Sample records for acinetobacter baumannii ab

  1. Acinetobacter baumannii

    PubMed Central

    Howard, Aoife; O’Donoghue, Michael; Feeney, Audrey; Sleator, Roy D.


    Acinetobacter baumannii is an opportunistic bacterial pathogen primarily associated with hospital-acquired infections. The recent increase in incidence, largely associated with infected combat troops returning from conflict zones, coupled with a dramatic increase in the incidence of multidrug-resistant (MDR) strains, has significantly raised the profile of this emerging opportunistic pathogen. Herein, we provide an overview of the pathogen, discuss some of the major factors that have led to its clinical prominence and outline some of the novel therapeutic strategies currently in development. PMID:22546906

  2. The Tail Associated Protein of Acinetobacter baumannii Phage ΦAB6 Is the Host Specificity Determinant Possessing Exopolysaccharide Depolymerase Activity

    PubMed Central

    Huang, Shiuan-Wen; Luo, Cheng-Hung; Chiou, Pei-Yu; Wu, Chao-Chuan; Lin, Nien-Tsung


    Acinetobacter baumannii is a non-fermenting, gram-negative bacterium. In recent years, the frequency of A. baumannii infections has continued to increase, and multidrug-resistant strains are emerging in hospitalized patients. Therefore, as therapeutic options become limited, the potential of phages as natural antimicrobial agents to control infections is worth reconsidering. In our previous study, we isolated ten virulent double-stranded DNA A. baumannii phages, ϕAB1–9 and ϕAB11, and found that each has a narrow host range. Many reports indicate that receptor-binding protein of phage mediates host recognition; however, understanding of the specific interactions between A. baumannii and phages remains very limited. In this study, host determinants of A. baumannii phages were investigated. Sequence comparison of ϕAB6 and ϕAB1 revealed high degrees of conservation among their genes except the tail fiber protein (ORF41 in ϕAB1 and ORF40 in ϕAB6). Furthermore, we found that ORF40ϕAB6 has polysaccharide depolymerase activity capable of hydrolyzing the A. baumannii exopolysaccharide and is a component of the phage tail apparatus determining host specificity. Thus, the lytic phages and their associated depolymerase not only have potential as alternative therapeutic agents for treating A. baumannii infections but also provide useful and highly specific tools for studying host strain exopolysaccharides and producing glycoconjugate vaccines. PMID:27077375

  3. The Tail Associated Protein of Acinetobacter baumannii Phage ΦAB6 Is the Host Specificity Determinant Possessing Exopolysaccharide Depolymerase Activity.


    Lai, Meng-Jiun; Chang, Kai-Chih; Huang, Shiuan-Wen; Luo, Cheng-Hung; Chiou, Pei-Yu; Wu, Chao-Chuan; Lin, Nien-Tsung


    Acinetobacter baumannii is a non-fermenting, gram-negative bacterium. In recent years, the frequency of A. baumannii infections has continued to increase, and multidrug-resistant strains are emerging in hospitalized patients. Therefore, as therapeutic options become limited, the potential of phages as natural antimicrobial agents to control infections is worth reconsidering. In our previous study, we isolated ten virulent double-stranded DNA A. baumannii phages, ϕAB1-9 and ϕAB11, and found that each has a narrow host range. Many reports indicate that receptor-binding protein of phage mediates host recognition; however, understanding of the specific interactions between A. baumannii and phages remains very limited. In this study, host determinants of A. baumannii phages were investigated. Sequence comparison of ϕAB6 and ϕAB1 revealed high degrees of conservation among their genes except the tail fiber protein (ORF41 in ϕAB1 and ORF40 in ϕAB6). Furthermore, we found that ORF40ϕAB6 has polysaccharide depolymerase activity capable of hydrolyzing the A. baumannii exopolysaccharide and is a component of the phage tail apparatus determining host specificity. Thus, the lytic phages and their associated depolymerase not only have potential as alternative therapeutic agents for treating A. baumannii infections but also provide useful and highly specific tools for studying host strain exopolysaccharides and producing glycoconjugate vaccines. PMID:27077375

  4. Complete Genome Sequence of the Multiresistant Acinetobacter baumannii Strain AbH12O-A2, Isolated during a Large Outbreak in Spain.


    Merino, M; Alvarez-Fraga, L; Gómez, M J; Aransay, A M; Lavín, J L; Chaves, F; Bou, G; Poza, M


    We report the complete genome sequence of Acinetobacter baumannii strain AbH12O-A2, isolated during a large outbreak in Spain. The genome has 3,875,775 bp and 3,526 coding sequences, with 39.4% G+C content. The availability of this genome will facilitate the study of the pathogenicity of the Acinetobacter species. PMID:25395646

  5. Complete Genome Sequence of the Multiresistant Acinetobacter baumannii Strain AbH12O-A2, Isolated during a Large Outbreak in Spain

    PubMed Central

    Merino, M.; Alvarez-Fraga, L.; Gómez, M. J.; Aransay, A. M.; Lavín, J. L.; Chaves, F.


    We report the complete genome sequence of Acinetobacter baumannii strain AbH12O-A2, isolated during a large outbreak in Spain. The genome has 3,875,775 bp and 3,526 coding sequences, with 39.4% G+C content. The availability of this genome will facilitate the study of the pathogenicity of the Acinetobacter species. PMID:25395646

  6. Laboratory Maintenance of Acinetobacter baumannii.


    Jacobs, Anna C; Zurawski, Daniel V


    Acinetobacter baumannii has recently drawn great interest in the microbiology research community due to the increase in clinical antibiotic resistance of this organism, and persistence of this bacterial species in the hospital environment. This unit outlines protocols for the growth and maintenance of A. baumannii in the laboratory. PMID:25367273

  7. Reservoirs of Non-baumannii Acinetobacter Species.


    Al Atrouni, Ahmad; Joly-Guillou, Marie-Laure; Hamze, Monzer; Kempf, Marie


    Acinetobacter spp. are ubiquitous gram negative and non-fermenting coccobacilli that have the ability to occupy several ecological niches including environment, animals and human. Among the different species, Acinetobacter baumannii has evolved as global pathogen causing wide range of infection. Since the implementation of molecular techniques, the habitat and the role of non-baumannii Acinetobacter in human infection have been elucidated. In addition, several new species have been described. In the present review, we summarize the recent data about the natural reservoir of non-baumannii Acinetobacter including the novel species that have been described for the first time from environmental sources and reported during the last years. PMID:26870013

  8. Reservoirs of Non-baumannii Acinetobacter Species

    PubMed Central

    Al Atrouni, Ahmad; Joly-Guillou, Marie-Laure; Hamze, Monzer; Kempf, Marie


    Acinetobacter spp. are ubiquitous gram negative and non-fermenting coccobacilli that have the ability to occupy several ecological niches including environment, animals and human. Among the different species, Acinetobacter baumannii has evolved as global pathogen causing wide range of infection. Since the implementation of molecular techniques, the habitat and the role of non-baumannii Acinetobacter in human infection have been elucidated. In addition, several new species have been described. In the present review, we summarize the recent data about the natural reservoir of non-baumannii Acinetobacter including the novel species that have been described for the first time from environmental sources and reported during the last years. PMID:26870013

  9. Properties of AdeABC and AdeIJK Efflux Systems of Acinetobacter baumannii Compared with Those of the AcrAB-TolC System of Escherichia coli

    PubMed Central

    Sugawara, Etsuko


    Acinetobacter baumannii contains RND-family efflux systems AdeABC and AdeIJK, which pump out a wide range of antimicrobial compounds, as judged from the MIC changes occurring upon deletion of the responsible genes. However, these studies may miss changes because of the high backgrounds generated by the remaining pumps and by β-lactamases, and it is unclear how the activities of these pumps compare quantitatively with those of the well-studied AcrAB-TolC system of Escherichia coli. We expressed adeABC and adeIJK of A. baumannii, as well as E. coli acrAB, in an E. coli host from which acrAB was deleted. The A. baumannii pumps were functional in E. coli, and the MIC changes that were observed largely confirmed the substrate range already reported, with important differences. Thus, the AdeABC system pumped out all β-lactams, an activity that was often missed in deletion studies. When the expression level of the pump genes was adjusted to a similar level for a comparison with AcrAB-TolC, we found that both A. baumannii efflux systems pumped out a wide range of compounds, but AdeABC was less effective than AcrAB-TolC in the extrusion of lipophilic β-lactams, novobiocin, and ethidium bromide, although it was more effective at tetracycline efflux. AdeIJK was remarkably more effective than a similar level of AcrAB-TolC in the efflux of β-lactams, novobiocin, and ethidium bromide, although it was less so in the efflux of erythromycin. These results thus allow us to compare these efflux systems on a quantitative basis, if we can assume that the heterologous systems are fully functional in the E. coli host. PMID:25246403

  10. Emerging therapies for multidrug resistant Acinetobacter baumannii.


    García-Quintanilla, Meritxell; Pulido, Marina R; López-Rojas, Rafael; Pachón, Jerónimo; McConnell, Michael J


    The global emergence of multidrug resistant Acinetobacter baumannii has reduced the number of clinically available antibiotics that retain activity against this pathogen. For this reason, the development of novel prevention and treatment strategies for infections caused by A. baumannii is necessary. Several studies have begun to characterize nonantibiotic approaches that utilize novel mechanisms of action to achieve antibacterial activity. Recent advances in phage therapy, iron chelation therapy, antimicrobial peptides, prophylactic vaccination, photodynamic therapy, and nitric oxide (NO)-based therapies have all been shown to have activity against A. baumannii. However, before these approaches can be used clinically there are still limitations and remaining questions that must be addressed. PMID:23317680

  11. Extrahuman Epidemiology of Acinetobacter baumannii in Lebanon

    PubMed Central

    Rafei, Rayane; Hamze, Monzer; Pailhoriès, Hélène; Eveillard, Matthieu; Marsollier, Laurent; Joly-Guillou, Marie-Laure; Dabboussi, Fouad


    The presence of Acinetobacter baumannii outside hospitals is still a controversial issue. The objective of our study was to explore the extrahospital epidemiology of A. baumannii in Lebanon. From February 2012 to October 2013, a total of 73 water samples, 51 soil samples, 37 raw cow milk samples, 50 cow meat samples, 7 raw cheese samples, and 379 animal samples were analyzed by cultural methods for the presence of A. baumannii. Species identification was performed by rpoB gene sequencing. Antibiotic susceptibility was investigated, and the A. baumannii population was studied by two genotyping approaches: multilocus sequence typing (MLST) and blaOXA-51 sequence-based typing (SBT). A. baumannii was detected in 6.9% of water samples, 2.7% of milk samples, 8.0% of meat samples, 14.3% of cheese samples, and 7.7% of animal samples. All isolates showed a susceptible phenotype against most of the antibiotics tested and lacked carbapenemase-encoding genes, except one that harbored a blaOXA-143 gene. MLST analysis revealed the presence of 36 sequence types (STs), among which 24 were novel STs reported for the first time in this study. blaOXA-51 SBT showed the presence of 34 variants, among which 21 were novel and all were isolated from animal origins. Finally, 30 isolates had new partial rpoB sequences and were considered putative new Acinetobacter species. In conclusion, animals can be a potential reservoir for A. baumannii and the dissemination of new emerging carbapenemases. The roles of the novel animal clones identified in community-acquired infections should be investigated. PMID:25616788

  12. Role of the BaeSR two-component system in the regulation of Acinetobacter baumannii adeAB genes and its correlation with tigecycline susceptibility

    PubMed Central


    Background Tigecycline resistance in Acinetobacter baumannii is primarily acquired through overexpression of the AdeABC efflux pump. Besides AdeRS, other two-component regulatory systems (TCSs) involving the regulation of this transporter have not been clarified. Results In this study, we found that the TCS genes baeR and baeS are co-transcribed and function as stress responders under high osmotic conditions. The baeSR and adeAB genes showed increased transcription in both the laboratory-induced and clinical tigecycline-resistant strains compared with the wild-type strain. The deletion of baeR in the ATCC 17978 strain led to 67–73% and 68% reduction in adeA and adeB expression, respectively, with a resultant 2-fold decrease in the tigecycline minimal inhibition concentration (MIC). In contrast, the overexpression of baeR resulted in a doubled tigecycline MIC, with a more than 2-fold increase in adeA and adeB expression. The influence of baeR knockout on adeAB gene expression can also be observed in the laboratory-induced tigecycline-resistant strain. A time-kill assay showed that the baeR deletion mutant showed an approximate 1-log10 reduction in colony forming units (CFUs) relative to the wild-type strain when the tigecycline concentration was 0.25 μg/mL throughout the assay period. The wild-type phenotype could be restored by trans-complementation with pWH1266-kan r -baeR. Increasing the tigecycline concentration to 0.5 μg/mL produced an even more marked 4.7-log10 reduction in CFUs of the baeR deletion mutant at 8 h, while only a 2.1-log10 reduction was observed for the wild-type strain. Conclusions Taken together, these data show for the first time that the BaeSR TCS influences the tigecycline susceptibility of A. baumannii through the positive regulation of the resistance-nodulation-division efflux pump genes adeA and adeB. PMID:24885279

  13. Community-acquired Acinetobacter baumannii: clinical characteristics, epidemiology and pathogenesis.


    Dexter, Carina; Murray, Gerald L; Paulsen, Ian T; Peleg, Anton Y


    Community-acquired Acinetobacter baumannii (CA-Ab) is a rare but serious cause of community-acquired pneumonia in tropical regions of the world. CA-Ab infections predominantly affect individuals with risk factors, which include excess alcohol consumption, diabetes mellitus, smoking and chronic lung disease. CA-Ab pneumonia presents as a surprisingly fulminant course and is characterized by a rapid onset of fever, severe respiratory symptoms and multi-organ dysfunction, with a mortality rate reported as high as 64%. It is unclear whether the distinct clinical syndrome caused by CA-Ab is because of host predisposing factors or unique bacterial characteristics, or a combination of both. Deepening our understanding of the drivers of overwhelming CA-Ab infection will provide important insights into preventative and therapeutic strategies. PMID:25850806

  14. Acinetobacter baumannii: Emergence of a Successful Pathogen

    PubMed Central

    Peleg, Anton Y.; Seifert, Harald; Paterson, David L.


    Acinetobacter baumannii has emerged as a highly troublesome pathogen for many institutions globally. As a consequence of its immense ability to acquire or upregulate antibiotic drug resistance determinants, it has justifiably been propelled to the forefront of scientific attention. Apart from its predilection for the seriously ill within intensive care units, A. baumannii has more recently caused a range of infectious syndromes in military personnel injured in the Iraq and Afghanistan conflicts. This review details the significant advances that have been made in our understanding of this remarkable organism over the last 10 years, including current taxonomy and species identification, issues with susceptibility testing, mechanisms of antibiotic resistance, global epidemiology, clinical impact of infection, host-pathogen interactions, and infection control and therapeutic considerations. PMID:18625687

  15. Neutropenia exacerbates infection by Acinetobacter baumannii clinical isolates in a murine wound model

    PubMed Central

    Grguric-Smith, Laryssa M.; Lee, Hiu H.; Gandhi, Jay A.; Brennan, Melissa B.; DeLeon-Rodriguez, Carlos M.; Coelho, Carolina; Han, George; Martinez, Luis R.


    The Gram negative coccobacillus Acinetobacter baumannii has become an increasingly prevalent cause of hospital-acquired infections in recent years. The majority of clinical A. baumannii isolates display high-level resistance to antimicrobials, which severely compromises our capacity to care for patients with A. baumannii disease. Neutrophils are of major importance in the host defense against microbial infections. However, the contribution of these cells of innate immunity in host resistance to cutaneous A. baumannii infection has not been directly investigated. Hence, we hypothesized that depletion of neutrophils increases severity of bacterial disease in an experimental A. baumannii murine wound model. In this study, the Ly-6G-specific monoclonal antibody (mAb), 1A8, was used to generate neutropenic mice and the pathogenesis of several A. baumannii clinical isolates on wounded cutaneous tissue was investigated. We demonstrated that neutrophil depletion enhances bacterial burden using colony forming unit determinations. Also, mAb 1A8 reduces global measurements of wound healing in A. baumannii-infected animals. Interestingly, histological analysis of cutaneous tissue excised from A. baumannii-infected animals treated with mAb 1A8 displays enhanced collagen deposition. Furthermore, neutropenia and A. baumannii infection alter pro-inflammatory cytokine release leading to severe microbial disease. Our findings provide a better understanding of the impact of these innate immune cells in controlling A. baumannii skin infections. PMID:26528277

  16. Characterization of Acinetobacter baumannii biofilm associated components

    NASA Astrophysics Data System (ADS)

    Brossard, Kari A.

    Acinetobacter baumannii is a Gram-negative aerobic coccobaccillus that is a major cause of nosocomial infections worldwide. Infected individuals may develop pneumonia, urinary tract, wound, and other infections that are associated with the use of indwelling medical devices such as catheters and mechanical ventilation. Treatment is difficult because many A. baumannii isolates have developed multi-drug resistance and the bacterium can persist on abiotic surfaces. Persistence and resistance may be due to formation of biofilms, which leads to long-term colonization, evasion of the host immune system and resistance to treatment with antibiotics and disinfectants. While biofilms are complex multifaceted structures, two bacterial components that have been shown to be important in formation and stability are exopolysaccharides (EPS) and the biofilm-associated protein (Bap). An EPS, poly-beta-1,6-N-acetylglucosamine, PNAG, has been described for E. coli and S. epidermidis. PNAG acts as an intercellular adhesin. Production of this adhesin is dependent on the pga/icaABCD locus. We have identified a homologous locus in A. baumannii 307-0294 that is involved in production of an exopolysaccharide, recognized by an anti-PNAG antibody. We hypothesized that the A. baumannii pgaABCD locus plays a role in biofilm formation, and protection against host innate defenses and disinfectants suggesting that PNAG is a possible virulence factor for the organism. The first aim of this thesis will define the pgaABCD locus. We have previously identified Bap, a protein with similarity to those described for S. aureus and we have demonstrated that this protein is involved in maintaining the stability of biofilms on glass. We hypothesized that A. baumannii Bap plays a role in persistence and pathogenesis and is regulated by quorum sensing. In our second aim we will examine the role of Bap in attachment and biofilm formation on medically relevant surfaces and also determine if Bap is involved in

  17. Draft Genome Sequences of Two Extensively Drug-Resistant Acinetobacter baumannii Strains Isolated from Pus Samples

    PubMed Central

    Mahalingam, Niranjana; Manivannan, Bhavani; Jadhao, Sudhir; Mishra, Gayathri; Nilawe, Pravin


    We report the draft genomes of two extensively drug-resistant (XDR) Acinetobacter baumannii strains isolated from pus samples of two patients with surgical site infections at Sri Sathya Sai Institute of Higher Medical Sciences, Prasanthigram, India. The average genomic size and G+C content are 4 Mbp and 38.96% (AB28) and 4 Mbp and 38.94% (AB30), respectively. PMID:27013044

  18. [Emerging Acinetobacter baumannii infections and factors favouring their occurrence].


    Eveillard, M; Joly-Guillou, M-L


    During the last decade, Acinetobacter baumannii (AB) has been increasingly responsible for infections occurring in three particular contexts (in terms of patients and environment). Community AB pneumonia is severe infections, mainly described around the Indian Ocean, and which mainly concern patients with major co-morbidities. AB is also responsible for infections occurring among soldiers wounded in action during operations conducted in Iraq or Afghanistan. Lastly, this bacterium is responsible for infections occurring among casualties from natural disasters like earthquakes and tsunamis. Those infections are often due to multidrug-resistant strains, which can be implicated in nosocomial outbreaks when patients are hospitalized in a local casualty department or during their repatriation thereafter. The source of the contaminations which lead to AB infections following injuries (warfare or natural disasters) is still poorly known. Three hypotheses are usually considered: a contamination of wounds with environmental bacteria, a wound contamination from a previous cutaneous or oropharyngeal endogenous reservoir, or hospital acquisition. The implication of telluric or agricultural primary reservoirs in human AB infections is a common hypothesis which remains to be demonstrated by further specifically designed studies. PMID:21963271

  19. Genetic Determinants of Intrinsic Colistin Tolerance in Acinetobacter baumannii

    PubMed Central

    Hood, M. Indriati; Becker, Kyle W.; Roux, Christelle M.; Dunman, Paul M.


    Acinetobacter baumannii is a leading cause of multidrug-resistant infections worldwide. This organism poses a particular challenge due to its ability to acquire resistance to new antibiotics through adaptation or mutation. This study was undertaken to determine the mechanisms governing the adaptability of A. baumannii to the antibiotic colistin. Screening of a transposon mutant library identified over 30 genes involved in inducible colistin resistance in A. baumannii. One of the genes identified was lpsB, which encodes a glycosyltransferase involved in lipopolysaccharide (LPS) synthesis. We demonstrate that loss of LpsB function results in increased sensitivity to both colistin and cationic antimicrobial peptides of the innate immune system. Moreover, LpsB is critical for pathogenesis in a pulmonary model of infection. Taken together, these data define bacterial processes required for intrinsic colistin tolerance in A. baumannii and underscore the importance of outer membrane structure in both antibiotic resistance and the pathogenesis of A. baumannii. PMID:23230287

  20. Joint Transcriptional Control of Virulence and Resistance to Antibiotic and Environmental Stress in Acinetobacter baumannii

    PubMed Central

    Gallagher, Larry A.; Jacobson, Rachael K.; Usacheva, Elena A.; Peterson, Lance R.; Zurawski, Daniel V.; Shuman, Howard A.


    ABSTRACT The increasing emergence of antibiotic-resistant bacterial pathogens represents a serious risk to human health and the entire health care system. Many currently circulating strains of Acinetobacter baumannii exhibit resistance to multiple antibiotics. A key limitation in combating A. baumannii is that our understanding of the molecular mechanisms underlying the pathogenesis of A. baumannii is lacking. To identify potential virulence determinants of a contemporary multidrug-resistant isolate of A. baumannii, we used transposon insertion sequencing (TnSeq) of strain AB5075. A collection of 250,000 A. baumannii transposon mutants was analyzed for growth within Galleria mellonella larvae, an insect-based infection model. The screen identified 300 genes that were specifically required for survival and/or growth of A. baumannii inside G. mellonella larvae. These genes encompass both known, established virulence factors and several novel genes. Among these were more than 30 transcription factors required for growth in G. mellonella. A subset of the transcription factors was also found to be required for resistance to antibiotics and environmental stress. This work thus establishes a novel connection between virulence and resistance to both antibiotics and environmental stress in A. baumannii. PMID:26556274

  1. In Vivo Selection of Pan-Drug Resistant Acinetobacter baumannii during Antibiotic Treatment

    PubMed Central

    Kim, Yoonjung; Bae, Il Kwon; Yong, Dongeun; Lee, Kyungwon


    Purpose Colistin resistance in Acinetobacter baumannii (A. baumannii) is mediated by a complete loss of lipopolysaccharide production via mutations in lpxA, lpxC, and lpxD gene or lipid A modifications via mutations in the pmrA and pmrB genes. However, the exact mechanism of therapy-induced colistin resistance in A. baumannii is not well understood. Materials and Methods We investigated the genotypic and phenotypic changes that underlie pan-drug resistance mechanisms by determining differences between the alterations in extensively drug-resistant (XDR) A. baumannii (AB001 and AB002) isolates and a pan-drug resistant (PDR) counterpart (AB003) recovered from one patient before and after antibiotic treatment, respectively. Results All three clinical isolates shared an identical sequence type (ST138), belonging to the global epidemic clone, clonal complex 92, and all produced OXA-23 carbapenemase. The PDR AB003 showed two genetic differences, acquisition of armA gene and an amino acid substitution (Glu229Asp) in pmrB gene, relative to XDR isolates. No mutations were detected in the pmrA, pmrC, lpxA, lpxC, or lpxD genes in all three isolates. In matrix-assisted laser desorption ionization-time of flight analysis, the three isolates commonly showed two major peaks at 1728 m/z and 1912 m/z, but peaks at 2034 m/z, 2157 m/z, 2261 m/z, and 2384 m/z were detected only in the PDR A. baumannii AB003 isolate. Conclusion Our results show that changes in lipid A structure via a mutation in the pmrB gene and acquisition of armA gene might confer resistance to colistin and aminoglycosides to XDR A. baumannii strains, resulting in appearance of a PDR A. baumannii strain of ST138. PMID:26069113

  2. Resources for Genetic and Genomic Analysis of Emerging Pathogen Acinetobacter baumannii

    PubMed Central

    Ramage, Elizabeth; Weiss, Eli J.; Radey, Matthew; Hayden, Hillary S.; Held, Kiara G.; Huse, Holly K.; Zurawski, Daniel V.; Brittnacher, Mitchell J.; Manoil, Colin


    ABSTRACT Acinetobacter baumannii is a Gram-negative bacterial pathogen notorious for causing serious nosocomial infections that resist antibiotic therapy. Research to identify factors responsible for the pathogen's success has been limited by the resources available for genome-scale experimental studies. This report describes the development of several such resources for A. baumannii strain AB5075, a recently characterized wound isolate that is multidrug resistant and displays robust virulence in animal models. We report the completion and annotation of the genome sequence, the construction of a comprehensive ordered transposon mutant library, the extension of high-coverage transposon mutant pool sequencing (Tn-seq) to the strain, and the identification of the genes essential for growth on nutrient-rich agar. These resources should facilitate large-scale genetic analysis of virulence, resistance, and other clinically relevant traits that make A. baumannii a formidable public health threat. IMPORTANCE Acinetobacter baumannii is one of six bacterial pathogens primarily responsible for antibiotic-resistant infections that have become the scourge of health care facilities worldwide. Eliminating such infections requires a deeper understanding of the factors that enable the pathogen to persist in hospital environments, establish infections, and resist antibiotics. We present a set of resources that should accelerate genome-scale genetic characterization of these traits for a reference isolate of A. baumannii that is highly virulent and representative of current outbreak strains. PMID:25845845

  3. Acinetobacter baumannii Infection and IL-17 Mediated Immunity

    PubMed Central

    Yan, Zihe; Yang, Junjun; Hu, Renjing; Hu, Xichi; Chen, Kong


    Acinetobacter baumannii is a significant cause of severe hospital-acquired infections with a recent rise in multidrug-resistant infections involving traumatic wounds of military personnel. The interleukin-17 (IL-17) pathway is essential for neutrophil recruitment in response to a variety of pathogens, while the control of A. baumannii infection is known to be dependent on neutrophils. This suggests that IL-17 may play an important role in A. baumannii infection; however, this has yet to be studied. Here, we summarize the recent advances in understanding the host-pathogen interaction of A. baumannii and propose a potential role of the IL-17 pathway in generating a protective immune response. PMID:26977122

  4. Identification of Ata, a Multifunctional Trimeric Autotransporter of Acinetobacter baumannii

    PubMed Central

    Bentancor, Leticia V.; Camacho-Peiro, Ana; Bozkurt-Guzel, Cagla; Pier, Gerald B.


    Acinetobacter baumannii has recently emerged as a highly troublesome nosocomial pathogen, especially in patients in intensive care units and in those undergoing mechanical ventilation. We have identified a surface protein adhesin of A. baumannii, designated the Acinetobacter trimeric autotransporter (Ata), that contains all of the typical features of trimeric autotransporters (TA), including a long signal peptide followed by an N-terminal, surface-exposed passenger domain and a C-terminal domain encoding 4 β-strands. To demonstrate that Ata encoded a TA, we created a fusion protein in which we replaced the entire passenger domain of Ata with the epitope tag V5, which can be tracked with specific monoclonal antibodies, and demonstrated that the C-terminal 101 amino acids of Ata were capable of exporting the heterologous V5 tag to the surface of A. baumannii in a trimeric form. We found that Ata played a role in biofilm formation and bound to various extracellular matrix/basal membrane (ECM/BM) components, including collagen types I, III, IV, and V and laminin. Moreover, Ata mediated the adhesion of whole A. baumannii cells to immobilized collagen type IV and played a role in the survival of A. baumannii in a lethal model of systemic infection in immunocompetent mice. Taken together, these results reveal that Ata is a TA of A. baumannii involved in virulence, including biofilm formation, binding to ECM/BM proteins, mediating the adhesion of A. baumannii cells to collagen type IV, and contributing to the survival of A. baumannii in a mouse model of lethal infection. PMID:22609912

  5. Acinetobacter baumannii: evolution of antimicrobial resistance-treatment options.


    Doi, Yohei; Murray, Gerald L; Peleg, Anton Y


    The first decade of the 20th century witnessed a surge in the incidence of infections due to several highly antimicrobial-resistant bacteria in hospitals worldwide. Acinetobacter baumannii is one such organism that turned from an occasional respiratory pathogen into a major nosocomial pathogen. An increasing number of A. baumannii genome sequences have broadened our understanding of the genetic makeup of these bacteria and highlighted the extent of horizontal transfer of DNA. Animal models of disease combined with bacterial mutagenesis have provided some valuable insights into mechanisms of A. baumannii pathogenesis. Bacterial factors known to be important for disease include outer membrane porins, surface structures including capsule and lipopolysaccharide, enzymes such as phospholipase D, iron acquisition systems, and regulatory proteins. A. baumannii has a propensity to accumulate resistance to various groups of antimicrobial agents. In particular, carbapenem resistance has become commonplace, accounting for the majority of A. baumannii strains in many hospitals today. Carbapenem-resistant strains are often resistant to all other routinely tested agents. Treatment of carbapenem-resistant A. baumannii infection therefore involves the use of combinations of last resort agents such as colistin and tigecycline, but the efficacy and safety of these approaches are yet to be defined. Antimicrobial-resistant A. baumannii has high potential to spread among ill patients in intensive care units. Early recognition and timely implementation of appropriate infection control measures is crucial in preventing outbreaks. PMID:25643273

  6. Acinetobacter baumannii: Evolution of Antimicrobial Resistance—Treatment Options

    PubMed Central

    Doi, Yohei; Murray, Gerald L.; Peleg, Anton Y.


    The first decade of the 20th century witnessed a surge in the incidence of infections due to several highly antimicrobial-resistant bacteria in hospitals worldwide. Acinetobacter baumannii is one such organism that turned from an occasional respiratory pathogen into a major nosocomial pathogen. An increasing number of A. baumannii genome sequences have broadened our understanding of the genetic makeup of these bacteria and highlighted the extent of horizontal transfer of DNA. Animal models of disease combined with bacterial mutagenesis have provided some valuable insights into mechanisms of A. baumannii pathogenesis. Bacterial factors known to be important for disease include outer membrane porins, surface structures including capsule and lipopolysaccharide, enzymes such as phospholipase D, iron acquisition systems, and regulatory proteins. A. baumannii has a propensity to accumulate resistance to various groups of antimicrobial agents. In particular, carbapenem resistance has become commonplace, accounting for the majority of A. baumannii strains in many hospitals today. Carbapenem-resistant strains are often resistant to all other routinely tested agents. Treatment of carbapenem-resistant A. baumannii infection therefore involves the use of combinations of last resort agents such as colistin and tigecycline, but the efficacy and safety of these approaches are yet to be defined. Antimicrobial-resistant A. baumannii has high potential to spread among ill patients in intensive care units. Early recognition and timely implementation of appropriate infection control measures is crucial in preventing outbreaks. PMID:25643273

  7. Structural and bioinformatic characterization of an Acinetobacter baumannii type II carrier protein

    SciTech Connect

    Allen, C. Leigh; Gulick, Andrew M.


    The high-resolution crystal structure of a free-standing carrier protein from Acinetobacter baumannii that belongs to a larger NRPS-containing operon, encoded by the ABBFA-003406–ABBFA-003399 genes of A. baumannii strain AB307-0294, that has been implicated in A. baumannii motility, quorum sensing and biofilm formation, is presented. Microorganisms produce a variety of natural products via secondary metabolic biosynthetic pathways. Two of these types of synthetic systems, the nonribosomal peptide synthetases (NRPSs) and polyketide synthases (PKSs), use large modular enzymes containing multiple catalytic domains in a single protein. These multidomain enzymes use an integrated carrier protein domain to transport the growing, covalently bound natural product to the neighboring catalytic domains for each step in the synthesis. Interestingly, some PKS and NRPS clusters contain free-standing domains that interact intermolecularly with other proteins. Being expressed outside the architecture of a multi-domain protein, these so-called type II proteins present challenges to understand the precise role they play. Additional structures of individual and multi-domain components of the NRPS enzymes will therefore provide a better understanding of the features that govern the domain interactions in these interesting enzyme systems. The high-resolution crystal structure of a free-standing carrier protein from Acinetobacter baumannii that belongs to a larger NRPS-containing operon, encoded by the ABBFA-003406–ABBFA-003399 genes of A. baumannii strain AB307-0294, that has been implicated in A. baumannii motility, quorum sensing and biofilm formation, is presented here. Comparison with the closest structural homologs of other carrier proteins identifies the requirements for a conserved glycine residue and additional important sequence and structural requirements within the regions that interact with partner proteins.

  8. Epidemiological Monitoring of Nosocomial Infections Caused by Acinetobacter Baumannii

    PubMed Central

    Custovic, Amer; Smajlovic, Jasmina; Tihic, Nijaz; Hadzic, Sadeta; Ahmetagic, Sead; Hadzagic, Haris


    Introduction: Acinetobacter baumannii is a frequent cause of infections in hospitals around the world, which is very difficult to control and treat. It is particularly prevalent in intensive care wards. Aim: The main objective of the research was to establish the application of epidemiological monitoring of nosocomial infections (NIs) caused by A. baumannii in order to determine: the type and distribution of NIs, and to investigate antimicrobial drug resistance of A. baumannii. Material and Methods: 855 patients treated at the Clinic of Anesthesiology and Reanimation, University Clinical Center Tuzla during 2013 were followed prospectively for the development of NIs. Infections caused by A. baumannii were characterized by the anatomical site and antibiotics resistance profile. Results: NIs were registered in 105 patients (12.3%; 855/105). The predominant cause of infection was A. baumannii with an incidence of 51.4% (54/105), followed by ESBL-producing Klebsiella pneumoniae with 15.2% (16/105) of cases, methicillin-resistant Staphylococcus aureus with 8.6% (9/105), and ESBL-producing Proteus mirabilis with 7.6% (8/105). According to the anatomical site, and type of NIs caused by A. baumannii, the most frequent were respiratory infections (74.1%; 40/54). Infections of surgical sites were registered in 11.1% (6/54) of cases, while bloodstream infections in 9.2% (5/54). A. baumannii isolates tested resistant against most antibiotics examined, but showed a high degree of susceptibility to tobramycin (87%; 47/54) and colistin (100%; 54/54). Conclusion: The increasing incidence of multi- and extensively drug-resistant Acinetobacter spp. emphasizes the importance of administration of an adequate antibiotic strategy and the implementation of strict monitoring of the measures for controlling nosocomial infections. PMID:25648217

  9. Global evolution of multidrug-resistant Acinetobacter baumannii clonal lineages.


    Zarrilli, Raffaele; Pournaras, Spyros; Giannouli, Maria; Tsakris, Athanassios


    The rapid expansion of Acinetobacter baumannii clinical isolates exhibiting resistance to carbapenems and most or all available antibiotics during the last decade is a worrying evolution. The apparent predominance of a few successful multidrug-resistant lineages worldwide underlines the importance of elucidating the mode of spread and the epidemiology of A. baumannii isolates in single hospitals, at a country-wide level and on a global scale. The evolutionary advantage of the dominant clonal lineages relies on the capability of the A. baumannii pangenome to incorporate resistance determinants. In particular, the simultaneous presence of divergent strains of the international clone II and their increasing prevalence in international hospitals further support the ongoing adaptation of this lineage to the hospital environment. Indeed, genomic and genetic studies have elucidated the role of mobile genetic elements in the transfer of antibiotic resistance genes and substantiate the rate of genetic alterations associated with acquisition in A. baumannii of various resistance genes, including OXA- and metallo-β-lactamase-type carbapenemase genes. The significance of single nucleotide polymorphisms and transposon mutagenesis in the evolution of A. baumannii has been also documented. Establishment of a network of reference laboratories in different countries would generate a more complete picture and a fuller understanding of the importance of high-risk A. baumannii clones in the international dissemination of antibiotic resistance. PMID:23127486

  10. Membrane proteomes of Pseudomonas aeruginosa and Acinetobacter baumannii.


    Dé, E; Cosette, P; Coquet, L; Siroy, A; Alexandre, S; Duncan, A; Naudin, B; Rihouey, C; Schaumann, A; Junter, G A; Jouenne, T


    Acinetobacter baumannii and Pseudomonas aeruginosa are known for their intrinsic resistance to antibiotics. Between mechanisms involved in this resistance, diminished expression of outer membrane proteins and up-regulation of efflux pumps play an important role. The characterization of membrane proteins is consequently necessary because of their importance in the antibiotic resistance but also in virulence. This review presents proteomic investigations aiming to describe the protein content of the membranes of these two bacterial species. PMID:19942379

  11. First report of OXA-72 producing Acinetobacter baumannii in Romania.


    Georgescu, M; Gheorghe, I; Dudu, A; Czobor, I; Costache, M; Cristea, V-C; Lazăr, V; Chifiriuc, M C


    This is the first report of an OXA-72-producing Acinetobacter baumannii strain in Romania, isolated from chronic leg ulcer samples. Identification of the strain was performed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. Presence of carbapenem resistance genes was investigated by PCR and sequencing. Our data support the spread of the bla OXA-72 gene in Eastern Europe. PMID:27547405

  12. Stress responses in the opportunistic pathogen Acinetobacter baumannii

    PubMed Central

    Fiester, Steven E; Actis, Luis A


    Acinetobacter baumannii causes a wide range of severe infections among compromised and injured patients worldwide. The relevance of these infections are, in part, due to the ability of this pathogen to sense and react to environmental and host stress signals, allowing it to persist and disseminate in medical settings and the human host. This review summarizes current knowledge on the roles that environmental and cellular stressors play in the ability of A. baumannii to resist nutrient deprivation, oxidative and nitrosative injury, and even the presence of the commonly used antiseptic ethanol, which could serve as a nutrient- and virulence-enhancing signal rather than just being a convenient disinfectant. Emerging experimental evidence supports the role of some of these responses in the pathogenesis of the infections A. baumannii causes in humans and its capacity to resist antibiotics and host response effectors. PMID:23464372

  13. The Response of Acinetobacter baumannii to Zinc Starvation.


    Nairn, Brittany L; Lonergan, Zachery R; Wang, Jiefei; Braymer, Joseph J; Zhang, Yaofang; Calcutt, M Wade; Lisher, John P; Gilston, Benjamin A; Chazin, Walter J; de Crécy-Lagard, Valerie; Giedroc, David P; Skaar, Eric P


    Zinc (Zn) is an essential metal that vertebrates sequester from pathogens to protect against infection. Investigating the opportunistic pathogen Acinetobacter baumannii's response to Zn starvation, we identified a putative Zn metallochaperone, ZigA, which binds Zn and is required for bacterial growth under Zn-limiting conditions and for disseminated infection in mice. ZigA is encoded adjacent to the histidine (His) utilization (Hut) system. The His ammonia-lyase HutH binds Zn very tightly only in the presence of high His and makes Zn bioavailable through His catabolism. The released Zn enables A. baumannii to combat host-imposed Zn starvation. These results demonstrate that A. baumannii employs several mechanisms to ensure bioavailability of Zn during infection, with ZigA functioning predominately during Zn starvation, but HutH operating in both Zn-deplete and -replete conditions to mobilize a labile His-Zn pool. PMID:27281572

  14. Differential Role of the T6SS in Acinetobacter baumannii Virulence

    PubMed Central

    Foucault-Grunenwald, Marie-Laure; Borges, Vitor; Charpentier, Xavier; Limansky, Adriana S.; Gomes, João Paulo; Viale, Alejandro M.; Salcedo, Suzana P.


    Gram-negative bacteria, such as Acinetobacter baumannii, are an increasing burden in hospitals worldwide with an alarming spread of multi-drug resistant (MDR) strains. Herein, we compared a type strain (ATCC17978), a non-clinical isolate (DSM30011) and MDR strains of A. baumannii implicated in hospital outbreaks (Ab242, Ab244 and Ab825), revealing distinct patterns of type VI secretion system (T6SS) functionality. The T6SS genomic locus is present and was actively transcribed in all of the above strains. However, only the A. baumannii DSM30011 strain was capable of killing Escherichia coli in a T6SS-dependent manner, unlike the clinical isolates, which failed to display an active T6SS in vitro. In addition, DSM30011 was able to outcompete ATCC17978 as well as Pseudomonas aeruginosa and Klebsiella pneumoniae, bacterial pathogens relevant in mixed nosocomial infections. Finally, we found that the T6SS of DSM30011 is required for host colonization of the model organism Galleria mellonella suggesting that this system could play an important role in A. baumannii virulence in a strain-specific manner. PMID:26401654

  15. OmpA Binding Mediates the Effect of Antimicrobial Peptide LL-37 on Acinetobacter baumannii

    PubMed Central

    Lin, Ming-Feng; Tsai, Pei-Wen; Chen, Jeng-Yi; Lin, Yun-You; Lan, Chung-Yu


    Multidrug-resistant Acinetobacter baumannii has recently emerged as an important pathogen in nosocomial infection; thus, effective antimicrobial regimens are urgently needed. Human antimicrobial peptides (AMPs) exhibit multiple functions and antimicrobial activities against bacteria and fungi and are proposed to be potential adjuvant therapeutic agents. This study examined the effect of the human cathelicidin-derived AMP LL-37 on A. baumannii and revealed the underlying mode of action. We found that LL-37 killed A. baumannii efficiently and reduced cell motility and adhesion. The bacteria-killing effect of LL-37 on A. baumannii was more efficient compared to other AMPs, including human ß–defensin 3 (hBD3) and histatin 5 (Hst5). Both flow cytometric analysis and immunofluorescence staining showed that LL-37 bound to A. baumannii cells. Moreover, far-western analysis demonstrated that LL-37 could bind to the A. baumannii OmpA (AbOmpA) protein. An ELISA assay indicated that biotin-labelled LL-37 (BA-LL37) bound to the AbOmpA74-84 peptide in a dose-dependent manner. Using BA-LL37 as a probe, the ~38 kDa OmpA signal was detected in the wild type but the ompA deletion strain did not show the protein, thereby validating the interaction. Finally, we found that the ompA deletion mutant was more sensitive to LL-37 and decreased cell adhesion by 32% compared to the wild type. However, ompA deletion mutant showed a greatly reduced adhesion defect after LL-37 treatment compared to the wild strain. Taken together, this study provides evidence that LL-37 affects A. baumannii through OmpA binding. PMID:26484669

  16. Inverse PCR for subtyping of Acinetobacter baumannii carrying ISAba1.


    Kim, Shukho; Park, Yun-Ju; Kim, Jungmin


    Acinetobacter baumannii has been prevalent in nosocomial infections, often causing outbreaks in intensive care units. ISAba1 is an insertion sequence that has been identified only in A. baumannii and its copy number varies among strains. It has been reported that ISAba1 provides a promoter for bla OXA-51-like, bla OXA-23-like, and bla ampC, which are associated with the resistance of A. baumannii to carbapenems and cephalosporins. The main purpose of this study was to develop a novel inverse PCR method capable of typing A. baumannii strains. The method involves three major steps: cutting of genomic DNA with a restriction enzyme, ligation, and PCR. In the first step, bacterial genomic DNA was digested with DpnI. In the second step, the digested genomic DNAs were ligated to form intramolecular circular DNAs. In the last step, the ligated circular DNAs were amplified by PCR with primers specific for ISAba1 and the amplified PCR products were electrophoresed. Twenty-two clinical isolates of A. baumannii were used for the evaluation of the inverse PCR (iPCR) typing method. Dendrogram analysis revealed two major clusters, similar to pulsed-field gel electrophoresis (PFGE) results. Three ISAba1-associated genes - bla ampC, bla OXA-66-like, and csuD - were amplified and detected in the clinical isolates. This novel iPCR typing method is comparable to PFGE in its ability to discriminate A. baumannii strains, and is a promising molecular epidemiological tool for investigating A. baumannii carrying ISAba1. PMID:27095456

  17. Virstatin inhibits biofilm formation and motility of Acinetobacter baumannii

    PubMed Central


    Background Acinetobacter baumannii has emerged as an opportunistic nosocomial pathogen causing infections worldwide. One reason for this emergence is due to its natural ability to survive in the hospital environment, which may be explained by its capacity to form biofilms. Cell surface appendages are important determinants of the A. baumannii biofilm formation and as such constitute interesting targets to prevent the development of biofilm-related infections. A chemical agent called virstatin was recently described to impair the virulence of Vibrio cholerae by preventing the expression of its virulence factor, the toxin coregulated pilus (type IV pilus). The objective of this work was to investigate the potential effect of virstatin on A. baumannii biofilms. Results After a dose–response experiment, we determined that 100 μM virstatin led to an important decrease (38%) of biofilms formed by A. baumannii ATCC17978 grown under static mode. We demonstrated that the production of biofilms grown under dynamic mode was also delayed and reduced. The biofilm susceptibility to virstatin was then tested for 40 clinical and reference A. baumannii strains. 70% of the strains were susceptible to virstatin (with a decrease of 10 to 65%) when biofilms grew in static mode, whereas 60% of strains respond to the treatment when their biofilms grew in dynamic mode. As expected, motility and atomic force microscopy experiments showed that virstatin acts on the A. baumannii pili biogenesis. Conclusions By its action on pili biogenesis, virstatin demonstrated a very promising antibiofilm activity affecting more than 70% of the A. baumannii clinical isolates. PMID:24621315

  18. Genome Sequence of a Clinical Strain of Acinetobacter baumannii Belonging to the ST79/PFGE-HUI-1 Clone Lacking the AdeABC (Resistance-Nodulation-Cell Division-Type) Efflux Pump.


    López, M; Álvarez-Fraga, L; Gato, E; Blasco, L; Poza, M; Fernández-García, L; Bou, G; Tomás, M


    Increased expression of chromosomal genes for resistance-nodulation-cell division-type efflux systems plays a major role in the multidrug resistance of Acinetobacter baumannii Little is known about the genetic characteristics of clinical strains of Acinetobacter baumannii lacking the AdeABC pump. In this study, we sequenced the genome of clinical strain Ab421 GEIH-2010 (belonging to clone ST79/PFGE-HUI-1 from the GEIH-REIPI Ab. 2010 project) which lacks this efflux pump. PMID:27609928

  19. Prevalence of Aminoglycoside Resistance Genes in Acinetobacter baumannii Isolates

    PubMed Central

    Aliakbarzade, Katayun; Farajnia, Safar; Karimi Nik, Ashraf; Zarei, Farzaneh; Tanomand, Asghar


    Background: Acinetobacter baumannii is one of the major causes of nosocomial infections and is resistant to most available antibiotics. Aminoglycosides remain as drugs of choice for treatment of Acinetobacter infections yet resistance to aminoglycosides has increased in the recent years. Objectives: The present study investigated the prevalence of genes encoding aminoglycoside-modifying enzymes in A. baumannii strains isolated from patients of Tabriz city, northwest of Iran. Materials and Methods: A total of 103 Acinetobacter isolates were collected from Imam Reza Hospital of Tabriz University of medical sciences. Antimicrobial susceptibility patterns of the isolates to different antimicrobial agents including cephalosporins, gentamicin, amikacin, tobramycin, colistin and polymyxin, were evaluated by the disc diffusion method. The frequency of aminoglycoside modifying enzymes encoding genes aacC1, aphA6, aadA1 and aadB was analyzed by the PCR method. Results: Antimicrobial susceptibility analysis showed that the highest resistance was towards beta−lactam antibiotics including cephalosporins whereas the highest sensitivity was observed towards colistin (77%) and polymyxin (84%). The resistance rate to aminoglycosides was 81%, 86% and 63% for amikacin, gentamicin and tobramycin, respectively. The PCR results showed that among the 103 A. baumannii isolates, 56 (65.11 %) were positive for aacC1, 52 (60.46 %) for aphA6, 24 (27.9 %) for aadA1 and 16 (18.6 %) for aadB resistant genes. Conclusions: The results of this study indicated that the genes encoding aminoglycoside-modifying enzymes are prevalent in A. baumannii isolates in the study region, which highlighted the necessity of considering preventive measures to control dissemination of these resistance genes. PMID:25632323

  20. Impact of a Cross-Kingdom Signaling Molecule of Candida albicans on Acinetobacter baumannii Physiology

    PubMed Central

    Kostoulias, Xenia; Murray, Gerald L.; Cerqueira, Gustavo M.; Kong, Jason B.; Bantun, Farkad; Mylonakis, Eleftherios; Khoo, Chen Ai


    Multidrug-resistant (MDR) Acinetobacter baumannii is an opportunistic human pathogen that has become highly problematic in the clinical environment. Novel therapies are desperately required. To assist in identifying new therapeutic targets, the antagonistic interactions between A. baumannii and the most common human fungal pathogen, Candida albicans, were studied. We have observed that the C. albicans quorum-sensing molecule, farnesol, has cross-kingdom interactions, affecting the viability of A. baumannii. To gain an understanding of its mechanism, the transcriptional profile of A. baumannii exposed to farnesol was examined. Farnesol caused dysregulation of a large number of genes involved in cell membrane biogenesis, multidrug efflux pumps (AcrAB-like and AdeIJK-like), and A. baumannii virulence traits such as biofilm formation (csuA, csuB, and ompA) and motility (pilZ and pilH). We also observed a strong induction in genes involved in cell division (minD, minE, ftsK, ftsB, and ftsL). These transcriptional data were supported by functional assays showing that farnesol disrupts A. baumannii cell membrane integrity, alters cell morphology, and impairs virulence characteristics such as biofilm formation and twitching motility. Moreover, we showed that A. baumannii uses efflux pumps as a defense mechanism against this eukaryotic signaling molecule. Owing to its effects on membrane integrity, farnesol was tested to see if it potentiated the activity of the membrane-acting polymyxin antibiotic colistin. When coadministered, farnesol increased sensitivity to colistin for otherwise resistant strains. These data provide mechanistic understanding of the antagonistic interactions between diverse pathogens and may provide important insights into novel therapeutic strategies. PMID:26482299

  1. Draft Genome Sequences of Acinetobacter baumannii Isolates from Wounded Military Personnel.


    Arivett, Brock A; Ream, Dave C; Fiester, Steven E; Kidane, Destaalem; Actis, Luis A


    Acinetobacter baumannii is a Gram-negative bacterium capable of causing hospital-acquired infections that has been grouped with Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter species as ESKAPE pathogens because of their extensive drug resistance phenotypes and increasing risk to human health. Twenty-four multidrug-resistant A. baumannii strains isolated from wounded military personnel were sequenced and annotated. PMID:27563036

  2. Draft Genome Sequences of Acinetobacter baumannii Isolates from Wounded Military Personnel

    PubMed Central

    Arivett, Brock A.; Ream, Dave C.; Fiester, Steven E.; Kidane, Destaalem


    Acinetobacter baumannii is a Gram-negative bacterium capable of causing hospital-acquired infections that has been grouped with Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter species as ESKAPE pathogens because of their extensive drug resistance phenotypes and increasing risk to human health. Twenty-four multidrug-resistant A. baumannii strains isolated from wounded military personnel were sequenced and annotated. PMID:27563036

  3. Clonal spread of blaOXA-72-carrying Acinetobacter baumannii sequence type 512 in Taiwan.


    Kuo, Han-Yueh; Hsu, Po-Jui; Chen, Jiann-Yuan; Liao, Po-Cheng; Lu, Chia-Wei; Chen, Chang-Hua; Liou, Ming-Li


    This is the first report to show an insidious outbreak of armA- and blaOXA-72-carrying Acinetobacter baumannii sequence type 512 (ST512) at a study hospital in northern Taiwan. Multilocus sequence typing revealed that this was a ST512 clone. All of the isolates with ST512 carried a novel 12,056-bp repGR2 in combination with a repGR12-type plasmid. This plasmid, designated pAB-ML, had one copy of the blaOXA-72 gene that was flanked by XerC/XerD-like sites and conferred resistance to carbapenems. PMID:27242318

  4. Antimicrobial active herbal compounds against Acinetobacter baumannii and other pathogens.


    Tiwari, Vishvanath; Roy, Ranita; Tiwari, Monalisa


    Bacterial pathogens cause a number of lethal diseases. Opportunistic bacterial pathogens grouped into ESKAPE pathogens that are linked to the high degree of morbidity, mortality and increased costs as described by Infectious Disease Society of America. Acinetobacter baumannii is one of the ESKAPE pathogens which cause respiratory infection, pneumonia and urinary tract infections. The prevalence of this pathogen increases gradually in the clinical setup where it can grow on artificial surfaces, utilize ethanol as a carbon source and resists desiccation. Carbapenems, a β-lactam, are the most commonly prescribed drugs against A. baumannii. The high level of acquired and intrinsic carbapenem resistance mechanisms acquired by these bacteria makes their eradication difficult. The pharmaceutical industry has no solution to this problem. Hence, it is an urgent requirement to find a suitable alternative to carbapenem, a commonly prescribed drug for Acinetobacter infection. In order to do this, here we have made an effort to review the active compounds of plants that have potent antibacterial activity against many bacteria including carbapenem resistant strain of A. baumannii. We have also briefly highlighted the separation and identification methods used for these active compounds. This review will help researchers involved in the screening of herbal active compounds that might act as a replacement for carbapenem. PMID:26150810

  5. Antimicrobial active herbal compounds against Acinetobacter baumannii and other pathogens

    PubMed Central

    Tiwari, Vishvanath; Roy, Ranita; Tiwari, Monalisa


    Bacterial pathogens cause a number of lethal diseases. Opportunistic bacterial pathogens grouped into ESKAPE pathogens that are linked to the high degree of morbidity, mortality and increased costs as described by Infectious Disease Society of America. Acinetobacter baumannii is one of the ESKAPE pathogens which cause respiratory infection, pneumonia and urinary tract infections. The prevalence of this pathogen increases gradually in the clinical setup where it can grow on artificial surfaces, utilize ethanol as a carbon source and resists desiccation. Carbapenems, a β-lactam, are the most commonly prescribed drugs against A. baumannii. The high level of acquired and intrinsic carbapenem resistance mechanisms acquired by these bacteria makes their eradication difficult. The pharmaceutical industry has no solution to this problem. Hence, it is an urgent requirement to find a suitable alternative to carbapenem, a commonly prescribed drug for Acinetobacter infection. In order to do this, here we have made an effort to review the active compounds of plants that have potent antibacterial activity against many bacteria including carbapenem resistant strain of A. baumannii. We have also briefly highlighted the separation and identification methods used for these active compounds. This review will help researchers involved in the screening of herbal active compounds that might act as a replacement for carbapenem. PMID:26150810

  6. Acinetobacter baumannii in Localised Cutaneous Mycobacteriosis in Falcons.


    Muller, Margit Gabriele; George, Ancy Rajeev; Walochnik, Julia


    Between May 2007 and April 2009, 29 falcons with identically localized, yellowish discolored cutaneous lesions in the thigh and lateral body wall region were presented at Abu Dhabi Falcon Hospital. Out of 18 falcons integrated in this study, 16 tested positive to Mycobacterium. avium complex. The 2 negative falcons tested positive in the Mycobacterium genus PCR. Moreover, 1 falcon tested positive to M. avium. paratuberculosis in tissue samples by PCR. In all cases, blood and fecal samples tested negative. In the acid-fast stain, all samples showed the for mycobacteriosis typical rods. Moreover, in 13 samples Acinetobacter baumannii was detected by PCR and proven by DNA sequencing. Clinical features included highly elevated WBCs, heterophilia, lymphocytopenia, monocytosis, severe anemia and weight loss. A. baumannii, a gram-negative bacillus with the ability to integrate foreign DNA, has emerged as one of the major multidrug resistant bacteria. In veterinary medicine, it has so far been detected in dogs, cats, horses and wild birds. To the authors' knowledge, this is the first report of an A. baumannii infection in falcons and of a veterinary Mycobacterium-Acinetobacter coinfection. PMID:20871867

  7. Blood stream infections caused by Acinetobacter baumannii group in Japan - Epidemiological and clinical investigation.


    Fujikura, Yuji; Yuki, Atsushi; Hamamoto, Takaaki; Kawana, Akihiko; Ohkusu, Kiyofumi; Matsumoto, Tetsuya


    Acinetobacter calcoaceticus-Acinetobacter baumannii complex, especially A. baumannii, Acinetobacter pittii and Acinetobacter nosocomialis, constitutes an important group of nosocomial pathogens; however, epidemiological or clinical characteristics and prognosis is limited in Japan. From 2009 to 2013, 47 blood stream infection cases resulting from A. baumannii group were reviewed at the National Defense Medical College, an 800-bed tertiary hospital. To determine the genospecies, further comparative nucleotide sequence analyses of the RNA polymerase b-subunit (rpoB) gene were performed. Sequence analysis of rpoB gene showed that 25 (49.0%), 17 (33.3%) and 5 (9.8%) cases were caused by A. baumannii, A. pittii and A. nosocomialis, respectively. The 30-day and in-hospital mortality rates of A. baumannii were 8.5% and 25.5%, respectively, and there were no significant differences between Acinetobacter species. Clinical characteristics were statistically insignificant. Multidrug-resistant Acinetobacter species were detected in 3 cases (5.9%) with same pulsed-field gel electrophoresis (PFGE) pattern and A. baumannii was less susceptible to amikacin and levofloxacin. In this study, the mortality and clinical characteristics were similar among A. baumannii group isolate cases despite some showing drug resistance. However, identification of Acinetobacter species helps to initiate appropriate antibiotic therapy in earlier treatment phase, because A. baumannii shows some drug resistance. PMID:26993173

  8. Epidemiologic and Clinical Impact of Acinetobacter baumannii Colonization and Infection

    PubMed Central

    Villar, Macarena; Cano, María E.; Gato, Eva; Garnacho-Montero, José; Miguel Cisneros, José; Ruíz de Alegría, Carlos; Fernández-Cuenca, Felipe; Martínez-Martínez, Luis; Vila, Jordi; Pascual, Alvaro; Tomás, María; Bou, Germán; Rodríguez-Baño, Jesús


    Abstract Acinetobacter baumannii is one of the most important antibiotic-resistant nosocomial bacteria. We investigated changes in the clinical and molecular epidemiology of A. baumannii over a 10-year period. We compared the data from 2 prospective multicenter cohort studies in Spain, one performed in 2000 (183 patients) and one in 2010 (246 patients), which included consecutive patients infected or colonized by A. baumannii. Molecular typing was performed by repetitive extragenic palindromic polymerase chain reaction (REP-PCR), pulsed-field gel electrophoresis (PFGE), and multilocus sequence typing (MLST). The incidence density of A. baumannii colonization or infection increased significantly from 0.14 in 2000 to 0.52 in 2010 in medical services (p < 0.001). The number of non-nosocomial health care-associated cases increased from 1.2% to 14.2%, respectively (p < 0.001). Previous exposure to carbapenems increased in 2010 (16.9% in 2000 vs 27.3% in 2010, p = 0.03). The drugs most frequently used for definitive treatment of patients with infections were carbapenems in 2000 (45%) and colistin in 2010 (50.3%). There was molecular-typing evidence of an increase in the frequency of A. baumannii acquisition in non-intensive care unit wards in 2010 (7.6% in 2000 vs 19.2% in 2010, p = 0.01). By MSLT, the ST2 clonal group predominated and increased in 2010. This epidemic clonal group was more frequently resistant to imipenem and was associated with an increased risk of sepsis, although not with severe sepsis or mortality. Some significant changes were noted in the epidemiology of A. baumannii, which is increasingly affecting patients admitted to conventional wards and is also the cause of non-nosocomial health care-associated infections. Epidemic clones seem to combine antimicrobial resistance and the ability to spread, while maintaining their clinical virulence. PMID:25181313

  9. Acinetobacter baumannii Genes Required for Bacterial Survival during Bloodstream Infection

    PubMed Central

    Subashchandrabose, Sargurunathan; Smith, Sara; DeOrnellas, Valerie; Crepin, Sebastien; Kole, Monica; Zahdeh, Carina


    ABSTRACT Acinetobacter baumannii is emerging as a leading global multiple-antibiotic-resistant nosocomial pathogen. The identity of genes essential for pathogenesis in a mammalian host remains largely unknown. Using transposon-directed insertion-site sequencing (TraDIS), we identified A. baumannii genes involved in bacterial survival in a leukopenic mouse model of bloodstream infection. Mice were inoculated with a pooled transposon mutant library derived from 109,000 mutants, and TraDIS was used to map transposon insertion sites in the genomes of bacteria in the inoculum and of bacteria recovered from mouse spleens. Unique transposon insertion sites were mapped and used to calculate a fitness factor for every insertion site based on its relative abundance in the inoculum and postinfection libraries. Eighty-nine transposon insertion mutants that were underrepresented after experimental infection in mice compared to their presence in the inocula were delineated as candidates for further evaluation. Genetically defined mutants lacking feoB (ferrous iron import), ddc (d-ala-d-ala-carboxypeptidase), and pntB (pyridine nucleotide transhydrogenase subunit) exhibited a fitness defect during systemic infection resulting from bacteremia. In vitro, these mutants, as well as a fepA (ferric enterobactin receptor) mutant, are defective in survival in human serum and within macrophages and are hypersensitive to killing by antimicrobial peptides compared to the survival of the parental strain under these conditions. Our data demonstrate that FepA is involved in the uptake of exogenous enterobactin in A. baumannii. Genetic complementation rescues the phenotypes of mutants in assays that emulate conditions encountered during infection. In summary, we have determined novel A. baumannii fitness genes involved in the pathogenesis of mammalian infection. IMPORTANCE A. baumannii is a significant cause of bacterial bloodstream infection in humans. Since multiple antibiotic resistance

  10. Antimicrobial resistance in Acinetobacter baumannii: From bench to bedside

    PubMed Central

    Lin, Ming-Feng; Lan, Chung-Yu


    Acinetobacter baumannii (A. baumannii) is undoubtedly one of the most successful pathogens in the modern healthcare system. With invasive procedures, antibiotic use and immunocompromised hosts increasing in recent years, A. baumannii has become endemic in hospitals due to its versatile genetic machinery, which allows it to quickly evolve resistance factors, and to its remarkable ability to tolerate harsh environments. Infections and outbreaks caused by multidrug-resistant A. baumannii (MDRAB) are prevalent and have been reported worldwide over the past twenty or more years. To address this problem effectively, knowledge of species identification, typing methods, clinical manifestations, risk factors, and virulence factors is essential. The global epidemiology of MDRAB is monitored by persistent surveillance programs. Because few effective antibiotics are available, clinicians often face serious challenges when treating patients with MDRAB. Therefore, a deep understanding of the resistance mechanisms used by MDRAB can shed light on two possible strategies to combat the dissemination of antimicrobial resistance: stringent infection control and antibiotic treatments, of which colistin-based combination therapy is the mainstream strategy. However, due to the current unsatisfying therapeutic outcomes, there is a great need to develop and evaluate the efficacy of new antibiotics and to understand the role of other potential alternatives, such as antimicrobial peptides, in the treatment of MDRAB infections. PMID:25516853

  11. Stress Conditions Induced by Carvacrol and Cinnamaldehyde on Acinetobacter baumannii.


    Montagu, Angélique; Joly-Guillou, Marie-Laure; Rossines, Elisabeth; Cayon, Jérome; Kempf, Marie; Saulnier, Patrick


    Acinetobacter baumannii has emerged as a major cause of nosocomial infections. The ability of A. baumannii to display various resistance mechanisms against antibiotics has transformed it into a successful nosocomial pathogen. The limited number of antibiotics in development and the disengagement of the pharmaceutical industry have prompted the development of innovative strategies. One of these strategies is the use of essential oils, especially aromatic compounds that are potent antibacterial molecules. Among them, the combination of carvacrol and cinnamaldehyde has already demonstrated antibacterial efficacy against A. baumannii. The aim of this study was to determine the biological effects of these two compounds in A. baumannii, describing their effect on the rRNA and gene regulation under environmental stress conditions. Results demonstrated rRNA degradation by the carvacrol/cinnamaldehyde mixture, and this effect was due to carvacrol. Degradation was conserved after encapsulation of the mixture in lipid nanocapsules. Results showed an upregulation of the genes coding for heat shock proteins, such as groES, groEL, dnaK, clpB, and the catalase katE, after exposure to carvacrol/cinnamaldehyde mixture. The catalase was upregulated after carvacrol exposure wich is related to an oxidative stress. The combination of thiourea (hydroxyl radical scavenger) and carvacrol demonstrated a potent bactericidal effect. These results underline the development of defense strategies of the bacteria by synthesis of reactive oxygen species in response to environmental stress conditions, such as carvacrol. PMID:27486453

  12. Stress Conditions Induced by Carvacrol and Cinnamaldehyde on Acinetobacter baumannii

    PubMed Central

    Montagu, Angélique; Joly-Guillou, Marie-Laure; Rossines, Elisabeth; Cayon, Jérome; Kempf, Marie; Saulnier, Patrick


    Acinetobacter baumannii has emerged as a major cause of nosocomial infections. The ability of A. baumannii to display various resistance mechanisms against antibiotics has transformed it into a successful nosocomial pathogen. The limited number of antibiotics in development and the disengagement of the pharmaceutical industry have prompted the development of innovative strategies. One of these strategies is the use of essential oils, especially aromatic compounds that are potent antibacterial molecules. Among them, the combination of carvacrol and cinnamaldehyde has already demonstrated antibacterial efficacy against A. baumannii. The aim of this study was to determine the biological effects of these two compounds in A. baumannii, describing their effect on the rRNA and gene regulation under environmental stress conditions. Results demonstrated rRNA degradation by the carvacrol/cinnamaldehyde mixture, and this effect was due to carvacrol. Degradation was conserved after encapsulation of the mixture in lipid nanocapsules. Results showed an upregulation of the genes coding for heat shock proteins, such as groES, groEL, dnaK, clpB, and the catalase katE, after exposure to carvacrol/cinnamaldehyde mixture. The catalase was upregulated after carvacrol exposure wich is related to an oxidative stress. The combination of thiourea (hydroxyl radical scavenger) and carvacrol demonstrated a potent bactericidal effect. These results underline the development of defense strategies of the bacteria by synthesis of reactive oxygen species in response to environmental stress conditions, such as carvacrol. PMID:27486453

  13. Host resistance to intranasal Acinetobacter baumannii reinfection in mice.


    Qiu, Hongyu; Li, Zack; KuoLee, Rhonda; Harris, Greg; Gao, Xiaoling; Yan, Hongbin; Xu, H Howard; Chen, Wangxue


    Acinetobacter baumannii is a major causative agent of healthcare-associated infection and develops multidrug resistance rapidly. However, little is known in the host defense mechanisms against this infection. In this study, we examined if mice recovered from a previous intranasal A. baumannii infection (recovered mice) are fully protected against a subsequent reinfection. We found that, despite the presence of specific serum IgG and mucosal IgA responses prior to the reinfection, the recovered mice were only marginally better protected against intranasal challenge with low doses of homologous or heterologous A. baumannii strains than the naïve mice. Post-challenge immune and inflammatory (cells and cytokines) responses were generally comparable between recovered and naïve mice although the recovered mice produced significantly higher amounts of IFN-γ and IL-17 and had higher percentages and numbers of resident lung CD44(hi)CD62L(-)CD4(+) and CD19(+) B lymphocytes. Taken together, our results suggest that mice recovered from a previous A. baumannii infection remain susceptible to reinfection, indicating the complexity of immune protection mechanism for this Gram-negative, multidrug-resistant emerging pathogen. PMID:27194730

  14. Antimicrobial susceptibility of clinical isolates of Acinetobacter baumannii.


    Shi, Z Y; Liu, P Y; Lau, Y; Lin, Y; Hu, B S; Shir J-M


    The in-vitro activity of 18 antimicrobial agents alone or in combination against 248 clinical isolates of Acinetobacter baumannii from Taiwan were tested by agar dilution. The MIC90S of ampicillin, amoxicillin, piperacillin, cefuroxime, cefotaxime, ceftriaxone, gentamicin, and amikacin were at least 128 mu g/ml. Ceftazidime, cefepime, sulbactam, clavulanic acid, and tazobactam presented moderate activity with MIC90S of 32, 16, 16, 32, and 32 mu g/ml, respectively. The increased activity of ampicillin/sulbactam, amoxicillin/clavulanic acid, and piperacillin/tazobactam was due to the intrinsic effect of sulbactam, clavulanic acid, and tazobactam, respectively. Imipenem, meropenem, and ciprofloxacin were the most active antimicrobial agents with MIC90S of 1, 1, and 0.5 mu g/ml, respectively. Nineteen isolates (7.7%) were resistant to all aminoglycosides and beta-lactam antibiotics, except carbapenems and ciprofloxacin. We are concerned about the multidrug resistance of A. baumannii in this study. PMID:9147913

  15. Antimicrobial susceptibilities of clinical isolates of Acinetobacter baumannii from Singapore.


    Kuah, B G; Kumarasinghe, G; Doran, J; Chang, H R


    The in vitro activities of 17 antimicrobial agents alone or in combination against 70 clinical isolates of Acinetobacter baumannii from Singapore were determined by broth microdilution. The MICs of amoxicillin, ampicillin, ceftazidime, ceftriaxone, gentamicin, and piperacillin for 90% of the strains were > or = 128 micrograms/ml. Addition of sulbactam to ampicillin produced improved activity, whereas adding tazobactam to piperacillin did not. The MICs of amikacin, ciprofloxacin, and imipenem for 90% of the strains were 32, 32, and 16 micrograms/ml, respectively. PMID:7840598

  16. Investigation of the Distributions and Types of Multidrug-Resistant Acinetobacter baumannii in Different Departments in a General Hospital

    PubMed Central

    Qian, Yaner; Dong, Xuejun; Wang, Zongxin; Yang, Guocan; Liu, Qi


    Background: Acinetobacter baumannii is the most prevalent strain in hospitals and different clinical departments. Objectives: The current study aimed to investigate the genetic characteristics and resistance mechanisms of A. baumannii isolated from clinical samples in Shaoxing people’s hospital affiliated to Zhejiang University, Shaoxing, China. Patients and Methods: Acinetobacter baumannii strains were isolated from blood, phlegm and skin of the patients hospitalized in different departments as respiratory medicine, plastic surgery and intensive care unit (ICU). Multilocus sequence typing (MLST) was used to characterize the isolates. Kirby-Bauer test was used to evaluate antibiotic resistance of the bacteria. The expression of resistance inducing genes was detected by reverse transcription polymerase chain reaction (RT-PCR). The results were analyzed and compared. Results: Two bacterial types, ST208, and ST218, were identified in all 140 samples. The ST208 mainly came from ICU and department of respiratory medicine, while ST218 from department of plastic surgery; 70.21% of ST208 and 84.78% of ST218 were carbapenem-resistant Acinetobacter baumannii (CRAB) and carbapenem-susceptible Acinetobacter baumannii (CSAB), respectively. Multidrug-resistance genes in CRAB isolated from the hospital mainly included, oxa-23, oxa-5, intl 1 and qaceΔ1-sul 1. Besides, the highest and lowest antibiotic resistance was observed in the strains isolated from blood samples and wounds, respectively. Conclusions: The distribution of AB varies in different clinical departments and samples. In the hospital under study, the main types of AB were ST208 and ST218. The genes which affect the ability of antibiotic-resistance were oxa-23, oxa-51, intl 1 and qaceΔ1-sul 1. PMID:26487921

  17. Comparative Genomics of Multidrug Resistance in Acinetobacter baumannii

    PubMed Central


    Acinetobacter baumannii is a species of nonfermentative gram-negative bacteria commonly found in water and soil. This organism was susceptible to most antibiotics in the 1970s. It has now become a major cause of hospital-acquired infections worldwide due to its remarkable propensity to rapidly acquire resistance determinants to a wide range of antibacterial agents. Here we use a comparative genomic approach to identify the complete repertoire of resistance genes exhibited by the multidrug-resistant A. baumannii strain AYE, which is epidemic in France, as well as to investigate the mechanisms of their acquisition by comparison with the fully susceptible A. baumannii strain SDF, which is associated with human body lice. The assembly of the whole shotgun genome sequences of the strains AYE and SDF gave an estimated size of 3.9 and 3.2 Mb, respectively. A. baumannii strain AYE exhibits an 86-kb genomic region termed a resistance island—the largest identified to date—in which 45 resistance genes are clustered. At the homologous location, the SDF strain exhibits a 20 kb-genomic island flanked by transposases but devoid of resistance markers. Such a switching genomic structure might be a hotspot that could explain the rapid acquisition of resistance markers under antimicrobial pressure. Sequence similarity and phylogenetic analyses confirm that most of the resistance genes found in the A. baumannii strain AYE have been recently acquired from bacteria of the genera Pseudomonas, Salmonella, or Escherichia. This study also resulted in the discovery of 19 new putative resistance genes. Whole-genome sequencing appears to be a fast and efficient approach to the exhaustive identification of resistance genes in epidemic infectious agents of clinical significance. PMID:16415984

  18. Biofilm may not be Necessary for the Epidemic Spread of Acinetobacter baumannii

    PubMed Central

    Hu, Yuan; He, Lihua; Tao, Xiaoxia; Meng, Fanliang; Zhang, Jianzhong


    Biofilm is recognized as a contributing factor to the capacity of Acinetobacter baumannii to persist and prosper in medical settings, but it is still unknown whether biofilms contribute to the spread of A. baumannii. In this study, the biofilm formation of 114 clinical A. baumannii isolates and 32 non-baumannii Acinetobacter isolates was investigated using a microtiter plate assay. The clonal relationships among A. baumannii isolates were assessed using pulsed-field gel electrophoresis and multilocus sequence typing, and one major outbreak clone and 5 other epidemic clones were identified. Compared with the epidemic or outbreak A. baumannii isolates, the sporadic isolates had significantly higher biofilm formation, but no significant difference was observed between the sporadic A. baumannii isolates and the non-baumannii Acinetobacter isolates, suggesting that biofilm is not important for the epidemic spread of A. baumannii. Of the multidrug-resistant (MDR) A. baumannii isolates in this study, 95.7% were assigned to international clone 2 (IC2) and showed significantly lower biofilm formations than the other isolates, suggesting that biofilm did not contribute to the high success of IC2. These findings have increased our understanding of the potential relationship between biofilm formation and the epidemic capacity of A. baumannii. PMID:27558010

  19. Biofilm may not be Necessary for the Epidemic Spread of Acinetobacter baumannii.


    Hu, Yuan; He, Lihua; Tao, Xiaoxia; Meng, Fanliang; Zhang, Jianzhong


    Biofilm is recognized as a contributing factor to the capacity of Acinetobacter baumannii to persist and prosper in medical settings, but it is still unknown whether biofilms contribute to the spread of A. baumannii. In this study, the biofilm formation of 114 clinical A. baumannii isolates and 32 non-baumannii Acinetobacter isolates was investigated using a microtiter plate assay. The clonal relationships among A. baumannii isolates were assessed using pulsed-field gel electrophoresis and multilocus sequence typing, and one major outbreak clone and 5 other epidemic clones were identified. Compared with the epidemic or outbreak A. baumannii isolates, the sporadic isolates had significantly higher biofilm formation, but no significant difference was observed between the sporadic A. baumannii isolates and the non-baumannii Acinetobacter isolates, suggesting that biofilm is not important for the epidemic spread of A. baumannii. Of the multidrug-resistant (MDR) A. baumannii isolates in this study, 95.7% were assigned to international clone 2 (IC2) and showed significantly lower biofilm formations than the other isolates, suggesting that biofilm did not contribute to the high success of IC2. These findings have increased our understanding of the potential relationship between biofilm formation and the epidemic capacity of A. baumannii. PMID:27558010

  20. Treatment for patients with multidrug resistant Acinetobacter baumannii pulmonary infection

    PubMed Central



    Bacterial infections are common but have become increasingly resistant to drugs. The aim of the present study was to examine the combined treatment of traditional Chinese and Western medicine in 30 cases of pulmonary infection with multidrug resistant Acinetobacter baumannii. Patients were divided into groups A and B according to drug treatments. Cefoperazone or sulbactam and tanreqing were administered in group A, and cefoperazone or sulbactam in group B. The curative effect and prognosis of the two groups were recorded and the remaining treatments were performed routinely in the clinic. For the combined therapy group, which was administered sulperazone and tanreqing, 8 patients were recovered, 6 patients had significant effects, 3 patients exhibited some improvement and 1 patient had no response. One of the patients did not survive after 28 days. By contrast, there were 4 patients that were successfully treated, 3 patients with significant effects, 2 patients with some improvement and 2 patients had no response in the sulperazone group, and 4 patients did not survive after 28 days. In conclusion, the combined therapy of cefoperazone or sulbactam supplemented with tanreqing was identified to be more effective than cefoperazone or sulbactam as monotherapy, for treating multidrug resistant Acinetobacter baumannii. PMID:27073447

  1. Pregnancy and Perinatal Outcomes Associated with Acinetobacter baumannii Infection.


    He, Mai; Kostadinov, Stefan; Gundogan, Fusun; Struminsky, Judith; Pinar, Halit; Sung, C James


    Objective To determine perinatal and pregnancy outcomes of Acinetobacter baumannii infection using clinicopathologic material from pregnant women, neonates, and perinatal postmortem examinations with positive cultures. Study Design This is a retrospective record review with placental and postmortem examination. Results During a 5-year period, 40 positive cultures were found. Three pregnancies with positive cultures close in the peripartum period were all associated with adverse outcomes including spontaneous abortion, preterm labor, and one full-term birth with histological chorioamnionitis. Two positive cultures were found in preterm neonates in the neonatal intensive care unit. Two of three cases of perinatal death grew pure cultures from blood and/or fetal tissue with placental or fetal examination demonstrating evidence of infection/inflammation with fetal inflammatory response. Conclusion This is the first case series report of A. baumannii-positive cultures in maternal, fetal, and neonatal specimen, with histopathologic evidence of infection. The results suggest a significant role of A. baumannii infection in adverse pregnancy and perinatal outcomes. PMID:23943711

  2. Pregnancy and Perinatal Outcomes Associated with Acinetobacter baumannii Infection

    PubMed Central

    He, Mai; Kostadinov, Stefan; Gundogan, Fusun; Struminsky, Judith; Pinar, Halit; Sung, C. James


    Objective To determine perinatal and pregnancy outcomes of Acinetobacter baumannii infection using clinicopathologic material from pregnant women, neonates, and perinatal postmortem examinations with positive cultures. Study Design This is a retrospective record review with placental and postmortem examination. Results During a 5-year period, 40 positive cultures were found. Three pregnancies with positive cultures close in the peripartum period were all associated with adverse outcomes including spontaneous abortion, preterm labor, and one full-term birth with histological chorioamnionitis. Two positive cultures were found in preterm neonates in the neonatal intensive care unit. Two of three cases of perinatal death grew pure cultures from blood and/or fetal tissue with placental or fetal examination demonstrating evidence of infection/inflammation with fetal inflammatory response. Conclusion This is the first case series report of A. baumannii-positive cultures in maternal, fetal, and neonatal specimen, with histopathologic evidence of infection. The results suggest a significant role of A. baumannii infection in adverse pregnancy and perinatal outcomes. PMID:23943711

  3. Evaluation of Parameters for High Efficiency Transformation of Acinetobacter baumannii

    PubMed Central

    Yildirim, Suleyman; Thompson, Mitchell G.; Jacobs, Anna C.; Zurawski, Daniel V.; Kirkup, Benjamin C.


    Acinetobacter baumannii is an emerging, nosocomial pathogen that is poorly characterized due to a paucity of genetic tools and methods. While whole genome sequence data from several epidemic and environmental strains have recently become available, the functional characterization of genes is significantly lagging. Efficient transformation is one of the first steps to develop molecular tools that can be used to address these shortcomings. Here we report parameters allowing high efficiency transformation of A. baumannii. Using a multi-factorial experimental design we found that growth phase, voltage, and resistance all significantly contribute to transformation efficiency. The highest efficiency (4.3 × 108 Transformants/μg DNA) was obtained at the stationary growth phase of the bacterium (OD 6.0) using 25 ng of plasmid DNA under 100 Ohms resistance and 1.7 kV/cm voltage. The optimized electroporation parameters reported here provide a useful tool for genetic manipulation of A. baumannii. PMID:26911658

  4. Photodynamic therapy for Acinetobacter baumannii burn infections in mice.


    Dai, Tianhong; Tegos, George P; Lu, Zongshun; Huang, Liyi; Zhiyentayev, Timur; Franklin, Michael J; Baer, David G; Hamblin, Michael R


    Multidrug-resistant Acinetobacter baumannii infections represent a growing problem, especially in traumatic wounds and burns suffered by military personnel injured in Middle Eastern conflicts. Effective treatment with traditional antibiotics can be extremely difficult, and new antimicrobial approaches are being investigated. One of these alternatives to antimicrobials could be the combination of nontoxic photosensitizers (PSs) and visible light, known as photodynamic therapy (PDT). We report on the establishment of a new mouse model of full-thickness thermal burns infected with a bioluminescent derivative of a clinical Iraqi isolate of A. baumannii and its PDT treatment by topical application of a PS produced by the covalent conjugation of chlorin(e6) to polyethylenimine, followed by illumination of the burn surface with red light. Application of 10(8) A. baumannii cells to the surface of 10-s burns made on the dorsal surface of shaved female BALB/c mice led to chronic infections that lasted, on average, 22 days and that were characterized by a remarkably stable bacterial bioluminescence. PDT carried out on day 0 soon after application of the bacteria gave over 3 log units of loss of bacterial luminescence in a light exposure-dependent manner, while PDT carried out on day 1 and day 2 gave an approximately 1.7-log reduction. The application of PS dissolved in 10% or 20% dimethyl sulfoxide without light gave only a modest reduction in the bacterial luminescence from mouse burns. Some bacterial regrowth in the treated burn was observed but was generally modest. It was also found that PDT did not lead to the inhibition of wound healing. The data suggest that PDT may be an effective new treatment for multidrug-resistant localized A. baumannii infections. PMID:19564369

  5. The rise of carbapenem-resistant Acinetobacter baumannii.


    Evans, Benjamin A; Hamouda, Ahmed; Amyes, Sebastian G B


    Acinetobacter spp. are Gram-negative bacteria that have become one of the most difficult pathogens to treat. The species A. baumannii, largely unknown 30 years ago, has risen to prominence particularly because of its ability to cause infections in immunocompromised patients. It is now a predominant pathogen in many hospitals as it has acquired resistance genes to virtually all antibiotics capable of treating Gram-negative bacteria, including the fluoroquinolones and the cephalosporins. Some members of the species have accumulated these resistance genes in large resistance islands, located in a "hot-spot" within the bacterial chromosome. The only conventional remaining treatment options were the carbapenems. However, A. baumannii possesses an inherent class D β-lactamase gene (blaOXA-51-like) that can have the ability to confer carbapenem resistance. Additionally, mechanisms of carbapenem resistance have emerged that derive from the importation of the distantly related class D β-lactamase genes blaOXA-23 and blaOXA-58. Although not inducible, the expression of these genes is controlled by mobile promoters carried on ISAba elements. It has also been found that other resistance genes including the chromosomal class C β-lactamase genes conferring cephalosporin resistance are controlled in the same manner. Colistin is now considered to be the final drug capable of treating infections caused by carbapenem-resistant A. baumannii; however, strains are now being isolated that are resistant to this antibiotic as well. The increasing inability to treat infections caused by A. baumannii ensures that this pathogen more than ranks with MRSA or Clostridium difficile as a threat to modern medicine. PMID:22894617

  6. Types and Prevalence of Carbapenem-Resistant Acinetobacter calcoaceticus-Acinetobacter baumannii Complex in Northern Taiwan

    PubMed Central

    Hsieh, Wen-Shyang; Wang, Nai-Yu; Feng, Jou-An; Weng, Li-Chuan


    The frequency of the carbapenem-resistant Acinetobacter calcoaceticus-Acinetobacter baumannii (CRACB) complex increases annually in our hospitals. However, the types and prevalence of carbapenemases among isolates still remain unclear. In this study, we identified and collected 672 carbapenem-resistant isolates from a medical center in Northern Taiwan between April and December of 2010. There were 577 genospecies 2 (Acinetobacter baumannii), 79 genospecies 13TU, and 16 genospecies 3 isolates. The isolates had an acquired blaOXA-24-like gene, which was confirmed by sequencing for the encoded OXA-72 carbapenemase, and were often associated with high-level carbapenem resistance. These CRACB complex isolates remained susceptible to colistin (100%). The genotyping of isolates was conducted using pulsed-field gel electrophoresis with ApaI digestion. In most clonally related groups, patients were from both branch hospitals. The results indicate that interhospital dissemination of clones occurred. This study provides updated data on the types and prevalence of the CRACB complex. In addition, it presents a warning on the emergence and spread of CRACB complex harboring blaOXA-24-like genes in northern Taiwan. PMID:24145535

  7. Post-neurosurgical meningitis caused by acinetobacter baumannii: case series and review of the literature

    PubMed Central

    Ni, Shunlan; Li, Shanshan; Yang, Naibin; Zhang, Sainan; Hu, Danping; Li, Qian; Lu, Mingqin


    Background: Acinetobacter baumannii (A. baumannii), a gram-negative bacterium, has now become an important hospital pathogen, which causes various serious nosocomial infections worldwide. Bacterial meningitis is a common complication after neurosurgical operation, and the percentage of A. baumannii meningitis is growing, especially the one resisting multiple drugs. Method: We retrospectively reviewed the cases with postoperative A. baumannii meningitis (PABM) in the First Affiliated Hospital of Wenzhou Medical University from January 2013 to October 2014. And we retrieved the PubMed for cases with PABM and reviewed them. Result: Five cases were included in our retrospective study. Two cases with sensitive A. baumannii and one with multidrug-resistant acinetobacter baumannii (MRAB) were cured, and other two with MRAB died. Conclusion: Intraventricular or intrathecal colistin could be a treatment to the MRAB. PMID:26885152

  8. Analysis of drug resistance in 1,861 strains of Acinetobacter baumannii

    PubMed Central



    Acinetobacter baumannii is an emerging human pathogen that causes hospital-acquired infections. The trend in increased antimicrobial resistance limits the choice of effective antimicrobial agents. The present study reports the resistance to Acinetobacter baumannii and analyzes the associations between antibiotic use and resistance rates at a general hospital between 2010 and 2014. A total of 1,861 isolates were obtained from clinical cultures, accounting for 10.33% of all detected bacteria (1,861/18,016). The strains were mainly from respiratory samples (1,628 isolates, 87.5%) and the intensive care unit (696 isolates, 37.4%). The resistance rates of Acinetobacter baumannii to the majority of antibiotics were >50%, particularly the resistance rate to cefoperazone/sulbactam increased from 47.37 in 2011 to 89.25% in 2014. However, the rates of imipenem and cilastatin sodium decreased from 81.03 to 69.44% due to the antibiotic policy. There were Pearson significant associations between the use of three antibiotics and resistance in Acinetobacter baumannii to this drug, piperacillin/tazobactam (r=0.976, P<0.01), gentamicin (r=0.870, P<0.01) and cefoxitin (r=0.741, P<0.05). Therefore, a combination of drugs should be adopted to treat Acinetobacter baumannii infections. Microbiology laboratory support and surveillance policies are essential to control the emergence of multidrug-resistance Acinetobacter baumannii. PMID:27073633

  9. First Genome Sequence of a Mexican Multidrug-Resistant Acinetobacter baumannii Isolate

    PubMed Central

    Graña-Miraglia, Lucía; Lozano, Luis; Castro-Jaimes, Semiramis; Cevallos, Miguel A.; Volkow, Patricia


    Acinetobacter baumannii has emerged as an important nosocomial pathogen worldwide. Here, we present the draft genome of the first multidrug-resistant A. baumannii isolate, sampled from a tertiary hospital in Mexico City. This genome will provide a starting point for studying the genomic diversity of this species in Mexico. PMID:27013043

  10. Characterization of carbapenem-resistant Acinetobacter baumannii isolates in a Chinese teaching hospital

    PubMed Central

    Chang, Yaowen; Luan, Guangxin; Xu, Ying; Wang, Yanhong; Shen, Min; Zhang, Chi; Zheng, Wei; Huang, Jinwei; Yang, Jingni; Jia, Xu; Ling, Baodong


    Carbapenem-resistant Acinetobacter baumannii (CRAB) presents a serious therapeutic and infection control challenge. In this study, we investigated the epidemiological and molecular differences of CRAB and the threatening factors for contributing to increased CRAB infections at a hospital in western China. A total of 110 clinical isolates of A. baumannii, collected in a recent 2-year period, were tested for carbapenem antibiotic susceptibility, followed by a molecular analysis of carbapenemase genes. Genetic relatedness of the isolates was characterized by multilocus sequence typing. Sixty-seven of the 110 isolates (60.9%) were resistant to carbapenems, 80.60% (54/67) of which carried the blaOXA-23 gene. Most of these CRAB isolates (77.62%) were classified as clone complex 92 (CC92), and sequence type (ST) 92 was the most prevalent STs, followed by ST195, ST136, ST843, and ST75. One CRAB isolate of ST195 harbored plasmid pAB52 from a Chinese patient without travel history. This plasmid contains toxin–antitoxin elements related to adaptation for growth, which might have emerged as a common vehicle indirectly mediating the spread of OXA-23 in CRAB. Thus, CC92 A. baumannii carrying OXA-23 is a major drug-resistant strain spreading in China. Our findings indicate that rational application of antibiotics is indispensable for minimizing widespread of drug resistance. PMID:26388854

  11. Crystal structure of 5-enolpyruvylshikimate-3-phosphate (EPSP) synthase from the ESKAPE pathogen Acinetobacter baumannii.


    Sutton, Kristin A; Breen, Jennifer; Russo, Thomas A; Schultz, L Wayne; Umland, Timothy C


    The enzyme 5-enolpyruvylshikimate-3-phosphate (EPSP) synthase catalyzes the sixth step of the seven-step shikimate pathway. Chorismate, the product of the pathway, is a precursor for the biosynthesis of aromatic amino acids, siderophores and metabolites such as folate, ubiquinone and vitamin K. The shikimate pathway is present in bacteria, fungi, algae, plants and apicomplexan parasites, but is absent in humans. The EPSP synthase enzyme produces 5-enolpyruvylshikimate 3-phosphate and phosphate from phosphoenolpyruvate and shikimate 3-phosphate via a transferase reaction, and is the target of the herbicide glyphosate. The Acinetobacter baumannii gene encoding EPSP synthase, aroA, has previously been demonstrated to be essential during host infection for the growth and survival of this clinically important drug-resistant ESKAPE pathogen. Prephenate dehydrogenase is also encoded by the bifunctional A. baumannii aroA gene, but its activity is dependent upon EPSP synthase since it operates downstream of the shikimate pathway. As part of an effort to evaluate new antimicrobial targets, recombinant A. baumannii EPSP (AbEPSP) synthase, comprising residues Ala301-Gln756 of the aroA gene product, was overexpressed in Escherichia coli, purified and crystallized. The crystal structure, determined to 2.37 Å resolution, is described in the context of a potential antimicrobial target and in comparison to EPSP synthases that are resistant or sensitive to the herbicide glyphosate. PMID:26919521

  12. [In vitro activity of tigecycline against multiple resistant Acinetobacter baumannii and carbapenem resistant Klebsiella pneumoniae isolates].


    Arikan Akan, Ozay; Uysal, Sevil


    In order to detect the in vitro activity of tigecycline against multiple resistant gram-negative bacilli isolated in our hospital, tigecycline susceptibilities of clinical isolates of multiple and/or panresistant 100 Acinetobacter baumannii isolates, and 38 carbapenem resistant Klebsiella pneumoniae (17 of which were panresistant), obtained between January 2005 and August 2007, were evaluated by using E-test (AB Biodisc, Sweden). Carbapenem resistance rate was found to be 59% for A.baumannii, using Vitek2 Compact System (Bio-Merieux, France) which is present in our laboratory for routine use. Minimal inhibitory concentration (MIC) levels for tigecycline were < or =2 mcg/ml in 93% of the isolates while the MIC level was 3 mcg/ml for 7% of the isolates. Tigecycline MIC50 and MIC 90 values were 1.5 and 2 mcg/ml, respectively. Among K. pneumoniae the least resistance was detected against amikacin (52.6% resistant) while tigecycline MIC levels were between 0.13 mcg/ml and 2 mcg/ml. All of the K.pneumoniae strains were susceptible to tigecycline, and the MIC50 ve MIC90 values of these isolates were 1 mcg/ml and 1.5 mcg/ml, respectively. The in vitro susceptibility rates of tigecycline against multiple and/or panresistant A. baumannii and K. pneumoniae isolates are found to be promising for use in therapy. PMID:18697418

  13. The structure of alanine racemase from Acinetobacter baumannii

    PubMed Central

    Davis, Emily; Scaletti-Hutchinson, Emma; Opel-Reading, Helen; Nakatani, Yoshio; Krause, Kurt L.


    Acinetobacter baumannii is an opportunistic Gram-negative bacterium which is a common cause of hospital-acquired infections. Numerous antibiotic-resistant strains exist, emphasizing the need for the development of new antimicrobials. Alanine racemase (Alr) is a pyridoxal 5′-phosphate dependent enzyme that is responsible for racemization between enantiomers of alanine. As d-alanine is an essential component of the bacterial cell wall, its inhibition is lethal to prokaryotes, making it an excellent antibiotic drug target. The crystal structure of A. baumannii alanine racemase (AlrAba) from the highly antibiotic-resistant NCTC13302 strain has been solved to 1.9 Å resolution. Comparison of AlrAba with alanine racemases from closely related bacteria demonstrates a conserved overall fold. The substrate entryway and active site of the enzymes were shown to be highly conserved. The structure of AlrAba will provide the template required for future structure-based drug-design studies. PMID:25195891

  14. Toll-Like Receptor 9 Contributes to Defense against Acinetobacter baumannii Infection

    PubMed Central

    Noto, Michael J.; Boyd, Kelli L.; Burns, William J.; Varga, Matthew G.; Peek, Richard M.


    Acinetobacter baumannii is a common nosocomial pathogen capable of causing severe diseases associated with significant morbidity and mortality in impaired hosts. Pattern recognition receptors, such as the Toll-like receptors (TLRs), play a key role in pathogen detection and function to alert the immune system to infection. Here, we examine the role for TLR9 signaling in response to A. baumannii infection. In a murine model of A. baumannii pneumonia, TLR9−/− mice exhibit significantly increased bacterial burdens in the lungs, increased extrapulmonary bacterial dissemination, and more severe lung pathology compared with those in wild-type mice. Following systemic A. baumannii infection, TLR9−/− mice have significantly increased bacterial burdens in the lungs, as well as decreased proinflammatory cytokine and chemokine production. These results demonstrate that TLR9-mediated pathogen detection is important for host defense against the opportunistic pathogen Acinetobacter baumannii. PMID:26238713

  15. Acinetobacter baumannii Infection in Prior ICU Bed Occupants Is an Independent Risk Factor for Subsequent Cases of Ventilator-Associated Pneumonia

    PubMed Central

    Tsakiridou, Eirini; Makris, Demosthenes; Daniil, Zoe; Manoulakas, Efstratios; Chatzipantazi, Vasiliki; Vlachos, Odysseas; Xidopoulos, Grigorios; Charalampidou, Olympia; Zakynthinos, Epaminondas


    Objective. We aimed to evaluate risk factors for ventilator-associated pneumonia (VAP) due to Acinetobacter baumannii (AbVAP) in critically ill patients. Methods. This was a prospective observational study conducted in an intensive care unit (ICU) of a district hospital (6 beds). Consecutive patients were eligible for enrolment if they required mechanical ventilation for >48 hours and hospitalization for >72 hours. Clinical, microbiological, and laboratory parameters were assessed as risk factors for AbVAP by univariate and multivariate analysis. Results. 193 patients were included in the study. Overall, VAP incidence was 23.8% and AbVAP, 11.4%. Previous hospitalization of another patient with Acinetobacter baumannii infection was the only independent risk factor for AbVAP (OR (95% CI) 12.016 (2.282–19.521) P < 0.001). ICU stay (25 ± 17 versus 12 ± 9  P < 0.001), the incidence of other infections (OR (95% CI) 9.485 (1.640–10.466) P = 0.002) (urinary tract infection, catheter related infection, and bacteremia), or sepsis (OR (95% CI) 10.400 (3.749–10.466) P < 0.001) were significantly increased in patients with AbVAP compared to patients without VAP; no difference was found with respect to ICU mortality. Conclusion. ICU admission or the hospitalization of patients infected by Acinetobacter baumannii increases the risk of AbVAP by subsequent patients. PMID:25101265

  16. Evaluation of Virulence Gene Expression Patterns in Acinetobacter baumannii Using Quantitative Real-Time Polymerase Chain Reaction Array.


    Lannan, Ford M; O'conor, Daniel K; Broderick, Joseph C; Tate, Jamison F; Scoggin, Jacob T; Moran, Nicholas A; Husson, Christopher M; Hegeman, Erik M; Ogrydziak, Cole E; Singh, Sneha A; Vafides, Andrew G; Brinkley, Carl C; Goodin, Jeremy L


    According to the Centers for Disease Control's recently devised National Strategy for Combating Antibiotic-Resistant Bacteria, Acinetobacter baumannii is a "serious" threat level pathogen. A. baumannii's notoriety stems from the fact that a large number of modern strains are multidrug resistant and persist in the hospital setting, thus causing numerous deaths per year. It is imperative that research focus on a more fundamental understanding of the factors responsible for the success of A. baumannii. Toward this end, our group investigated virulence gene expression patterns in a recently characterized wound isolate, AB5075, using quantitative real-time polymerase chain reaction array. Notably, several genes showed statistically significant upregulation at 37°C compared to 25°C; MviM, Wbbj, CarO, and certain genes of the Bas, Bar, and Csu operons. Additionally, we found that in vitro biofilm formation by Csu transposon insertion mutant strains is attenuated. These findings validate previous reports that suggest a link between the Csu operon and biofilm formation. More importantly, our results demonstrate a successful method for evaluating the significance of previously identified virulence factors in a modern and clinically relevant strain of A. baumannii, thereby providing a path toward a more fundamental understanding of the pathogenicity of A. baumannii. PMID:27612361

  17. Place of Colistin-Rifampicin Association in the Treatment of Multidrug-Resistant Acinetobacter Baumannii Meningitis: A Case Study

    PubMed Central

    Souhail, Dahraoui; Bouchra, Belefquih; Belarj, Badia; Laila, Rar; Mohammed, Frikh; Nassirou, Oumarou Mamane; Azeddine, Ibrahimi; Haimeur, Charki; Lemnouer, Abdelhay; Elouennass, Mostafa


    Treatment of Acinetobacter baumannii meningitis is an important challenge due to the accumulation of resistance of this bacteria and low meningeal diffusion of several antimicrobial requiring use of an antimicrobial effective combination to eradicate these species. We report a case of Acinetobacter baumannii multidrug-resistant nosocomial meningitis which was successfully treated with intravenous and intrathecal colistin associated with rifampicin. PMID:27064923

  18. Assessment of Minocycline and Polymyxin B Combination against Acinetobacter baumannii

    PubMed Central

    Bowers, Dana R.; Cao, Henry; Zhou, Jian; Ledesma, Kimberly R.; Sun, Dongxu; Lomovskaya, Olga


    Antimicrobial resistance among Acinetobacter baumannii is increasing worldwide, often necessitating combination therapy. The clinical utility of using minocycline with polymyxin B is not well established. In this study, we investigated the activity of minocycline and polymyxin B against 1 laboratory isolate and 3 clinical isolates of A. baumannii. Minocycline susceptibility testing was performed with and without an efflux pump inhibitor, phenylalanine-arginine β-naphthylamide (PAβN). The intracellular minocycline concentration was determined with and without polymyxin B (0.5 μg/ml). Time-kill studies were performed over 24 h using approximately 106 CFU/ml of each strain with clinically relevant minocycline concentrations (2 μg/ml and 8 μg/ml), with and without polymyxin B (0.5 μg/ml). The in vivo efficacy of the combination was assessed in a neutropenic murine pneumonia model. Infected animals were administered minocycline (50 mg/kg), polymyxin B (10 mg/kg), or both to achieve clinically equivalent exposures in humans. A reduction in the minocycline MIC (≥4×) was observed in the presence of PAβN. The intracellular concentration and in vitro bactericidal effect of minocycline were both enhanced by polymyxin B. With 2 minocycline-susceptible strains, the bacterial burden in lung tissue at 24 h was considerably reduced by the combination compared to monotherapy with minocycline or polymyxin B. In addition, the combination prolonged survival of animals infected with a minocycline-susceptible strain. Polymyxin B increased the intracellular concentration of minocycline in bacterial cells and enhanced the bactericidal activity of minocycline, presumably due to efflux pump disruption. The clinical utility of this combination should be further investigated. PMID:25712362

  19. Prevalence of hypermutators among clinical Acinetobacter baumannii isolates

    PubMed Central

    Komp Lindgren, Patricia; Higgins, Paul G.; Seifert, Harald; Cars, Otto


    Objectives The objectives of this study were to study the presence of mutators in a set of Acinetobacter baumannii isolates and to explore whether there is a correlation between mutation rates and antibiotic resistance. Methods The variation in mutation rate was evaluated for 237 clinical A. baumannii isolates by determining the frequency of their mutation to rifampicin resistance. For each isolate, the antibiotic resistance profile was determined by disc diffusion and/or Etest. Isolates were divided into susceptible, resistant and MDR groups according to their resistance to five groups of different antibiotics. A comparison between differences in mutation frequency (f) and strain-specific factors was performed. Results Of the 237 isolates 32%, 18% and 50% were classified as susceptible, resistant and MDR, respectively. The f of rifampicin resistance varied between 2.2 × 10−10 and 1.2 × 10−6. Of the strains under investigation, 16% had an ≥2.5- to 166-fold higher f. The presence of mutators (definition ≥2.5-fold increase in f compared with ATCC 19606) in the MDR group (22%) was significantly higher (P < 0.05) than that in the susceptible and resistant groups (11% and 7%, respectively). Furthermore, f was significantly higher in the MDR group compared with that in the susceptible and resistant groups. Conclusions The facts that 26 of 37 mutator isolates (70%) in the population were MDR and that there was a significantly higher general f in isolates exhibiting an MDR profile suggest that hypermutability can be of advantage for the organism in a selective environment with extensive exposure to antimicrobials. PMID:26660878

  20. Acinetobacter seifertii sp. nov., a member of the Acinetobacter calcoaceticus-Acinetobacter baumannii complex isolated from human clinical specimens.


    Nemec, Alexandr; Krizova, Lenka; Maixnerova, Martina; Sedo, Ondrej; Brisse, Sylvain; Higgins, Paul G


    This study aimed to define the taxonomic status of a phenetically distinct group of 16 strains that corresponds to Acinetobacter genomic species 'close to 13TU', a provisional genomic species of the Acinetobacter calcoaceticus-Acinetobacter baumannii (ACB) complex recognized by Gerner-Smidt and Tjernberg in 1993. These strains have been isolated in different countries since the early 1990s and were mostly recovered from human clinical specimens. They were compared with 45 reference strains representing the known taxa of the ACB complex using taxonomic methods relevant to the genus Acinetobacter. Based on sequence analysis of the concatenated partial sequences (2976 bp) of seven housekeeping genes, the 16 strains formed a tight and well-supported cluster (intracluster sequence identity of ≥98.4 %) that was clearly separated from the other members of the ACB complex (≤94.7 %). The species status of the group was supported by average nucleotide identity values of ≤91.7 % between the whole genome sequence of representative strain NIPH 973(T) (NCBI accession no. APOO00000000) and those of the other species. In addition, whole-cell matrix-assisted laser desorption ionization-time-of-flight (MALDI-TOF) MS analyses indicated the distinctness of the group at the protein level. Metabolic and physiological tests revealed several typical features of the group, although they did not allow its reliable differentiation from the other members of the ACB complex. We conclude that the 16 strains represent a distinct novel species, for which we propose the name Acinetobacter seifertii sp. nov. The type strain is NIPH 973(T) ( = CIP 110471(T) = CCUG 34785(T) = CCM 8535(T)). PMID:25563912

  1. Clonal diversity of Acinetobacter baumannii from diabetic patients in Saudi Arabian hospitals.


    Alsultan, Abdulrahman A; Aboulmagd, Elsayed; Evans, Benjamin A; Amyes, Sebastian G B


    Carbapenem-resistant Acinetobacter baumannii (CR-AB) represents a major health-care problem, causing high rates of morbidity and mortality. This study investigated the clonality of CR-AB isolated from diabetic patients from different regions in Saudi Arabia, as well as the relatedness of the β-lactamase genes. A total of 64 non-repetitive CR-AB clinical isolates were collected from 16 different regions in Saudi Arabia from intensive care patients. Isolates were identified phenotypically by the Vitek 2 compact system and genotypically by amplification of the blaOXA-51-like gene. The target sequences were amplified by PCR and the clonal diversity of the isolates was explored by PFGE. Resistance studies revealed that the prevalence of imipenem and meropenem resistance was 92% and 96%, respectively, while the vast majority of the isolates were susceptible to tigecycline and colistin. In addition, blaVIM and blaOXA-23 were the most prevalent genes in the isolates under investigation, while ISAba1 was the most dominant insertion sequence. PFGE results showed 13 clusters; clone H was dominant, comprising 20 isolates from four hospitals, followed by clones C and F, comprising 11 isolates each from three and six hospitals, respectively. Moreover, the current study signified the clonal diversity of CR-AB in Saudi Arabia and showed the ability of some clones to infect patients in many different cities. PMID:25106863

  2. Analysis on distribution features and drug resistance of clinically isolated Acinetobacter baumannii

    PubMed Central

    Ren, Guangming; Zhou, Min; Ding, Ning; Zhou, Ning; Li, Qingling


    The aim of the present study was to examine the clinical distribution and drug resistance of Acinetobacter baumannii infection, and provide evidence of clinical medication as well as the prophylaxis for the treatment of drug resistance bacteria. In total, 306 Acinetobacter baumanniis selected from routine culture were collected between January 2012 and December 2013, to analyze the distributions among clinical specimens and wards and their drug resistance state. Of the 306 Acinetobacter baumanniis, the main distribution of specimens was sputum, accounting for 77.78%. The distribution of administrative office was dominated by intensive care unit with a proportion of 40.0% in 2012, which rapidly increased to 60.9% in 2013, followed by neurosurgery, respiration medicine and orthopedics with proportions of 23, 12 and 9.0% in 2012 and 9.71, 8.74 and 3.88% in 2013, respectively. The Acinetobacter baumannii's drug resistance rate of Tazobactam and Piperacillin was increased from 68.0% in 2012 to 71.36% in 2013. At the same time, the drug resistance rate of imipenem was enhanced from 66.0% in 2012 to 72.81% in 2013. By 2013, the drug resistance rates of penbritin, ceftizoxime, cefotetan and macrodantin reached ≤100%. In conclusion, Acinetobacter baumannii mainly causes respiratory tract infection with severe drug resistance. The drug resistance of Acinetobacter baumannii was mainly manifested as multidrug resistance or even pan-drug resistance with an obvious increasing trend of tolerance. Thus, it is necessary to prevent and treat nosocomial infection, to minimize usage of antibiotics and to standardize medical operating, to reduce the increase in persistence. PMID:27602085

  3. Role of OmpA in the Multidrug Resistance Phenotype of Acinetobacter baumannii

    PubMed Central

    Fàbrega, Anna; Roca, Ignasi; Sánchez-Encinales, Viviana; Vila, Jordi; Pachón, Jerónimo


    Acinetobacter baumannii has emerged as a nosocomial pathogen with an increased prevalence of multidrug-resistant strains. The role of the outer membrane protein A (OmpA) in antimicrobial resistance remains poorly understood. In this report, disruption of the ompA gene led to decreased MICs of chloramphenicol, aztreonam, and nalidixic acid. We have characterized, for the first time, the contribution of OmpA in the antimicrobial resistance phenotype of A. baumannii. PMID:24379205

  4. First report of NDM-1-producing Acinetobacter baumannii sequence type 25 in Brazil.


    Pillonetto, Marcelo; Arend, Lavinia; Vespero, Eliana Carolina; Pelisson, Marsileni; Chagas, Thiago Pavoni Gomes; Carvalho-Assef, Ana Paula D'Alincourt; Asensi, Marise Dutra


    New Delhi metallo-β-lactamase 1 (NDM-1) was first identified in Brazil in Enterobacter hormaechei and Providencia rettgeri in 2013. Here, we describe the first case of NDM-1-producing Acinetobacter baumannii sequence type 25 isolated from the urinary tract of a 71-year-old man who died of multiple complications, including A. baumannii infection. The NDM-1 gene was detected by quantitative PCR, and its sequence confirmed its presence in an ∼ 100-kb plasmid. PMID:25288087

  5. Molecular epidemiology of Acinetobacter baumannii in central intensive care unit in Kosova Teaching Hospital.


    Raka, Lul; Kalenć, Smilja; Bosnjak, Zrinka; Budimir, Ana; Katić, Stjepan; Sijak, Dubravko; Mulliqi-Osmani, Gjyle; Zoutman, Dick; Jaka, Arbëresha


    Infections caused by bacteria of genus Acinetobacter pose a significant health care challenge worldwide. Information on molecular epidemiological investigation of outbreaks caused by Acinetobacter species in Kosova is lacking. The present investigation was carried out to enlight molecular epidemiology of Acinetobacter baumannii in the Central Intensive Care Unit (CICU) of a University hospital in Kosova using pulse field gel electrophoresis (PFGE). During March - July 2006, A. baumannii was isolated from 30 patients, of whom 22 were infected and 8 were colonised. Twenty patients had ventilator-associated pneumonia, one patient had meningitis, and two had coinfection with bloodstream infection and surgical site infection. The most common diagnoses upon admission to the ICU were politrauma and cerebral hemorrhage. Bacterial isolates were most frequently recovered from endotracheal aspirate (86.7%). First isolation occurred, on average, on day 8 following admission (range 1-26 days). Genotype analysis of A. baumannii isolates identified nine distinct PFGE patterns, with predominance of PFGE clone E represented by isolates from 9 patients. Eight strains were resistant to carbapenems. The genetic relatedness of Acinetobacter baumannii was high, indicating cross-transmission within the ICU setting. These results emphasize the need for measures to prevent nosocomial transmission of A. baumannii in ICU. PMID:20464330

  6. The Response Regulator BfmR Is a Potential Drug Target for Acinetobacter baumannii

    PubMed Central

    Manohar, Akshay; Beanan, Janet M.; Olson, Ruth; MacDonald, Ulrike; Graham, Jessica


    ABSTRACT Identification and validation is the first phase of target-based antimicrobial development. BfmR (RstA), a response regulator in a two-component signal transduction system (TCS) in Acinetobacter baumannii, is an intriguing potential antimicrobial target. A unique characteristic of BfmR is that its inhibition would have the dual benefit of significantly decreasing in vivo survival and increasing sensitivity to selected antimicrobials. Studies on the clinically relevant strain AB307-0294 have shown BfmR to be essential in vivo. Here, we demonstrate that this phenotype in strains AB307-0294 and AB908 is mediated, in part, by enabling growth in human ascites fluid and serum. Further, BfmR conferred resistance to complement-mediated bactericidal activity that was independent of capsular polysaccharide. Importantly, BfmR also increased resistance to the clinically important antimicrobials meropenem and colistin. BfmR was highly conserved among A. baumannii strains. The crystal structure of the receiver domain of BfmR was determined, lending insight into putative ligand binding sites. This enabled an in silico ligand binding analysis and a blind docking strategy to assess use as a potential druggable target. Predicted binding hot spots exist at the homodimer interface and the phosphorylation site. These data support pursuing the next step in the development process, which includes determining the degree of inhibition needed to impact growth/survival and the development a BfmR activity assay amenable to high-throughput screening for the identification of inhibitors. Such agents would represent a new class of antimicrobials active against A. baumannii which could be active against other Gram-negative bacilli that possess a TCS with shared homology. IMPORTANCE Increasing antibiotic resistance in bacteria, particularly Gram-negative bacilli, has significantly affected the ability of physicians to treat infections, with resultant increased morbidity, mortality, and

  7. The Response Regulator BfmR Is a Potential Drug Target for Acinetobacter baumannii.


    Russo, Thomas A; Manohar, Akshay; Beanan, Janet M; Olson, Ruth; MacDonald, Ulrike; Graham, Jessica; Umland, Timothy C


    Identification and validation is the first phase of target-based antimicrobial development. BfmR (RstA), a response regulator in a two-component signal transduction system (TCS) in Acinetobacter baumannii, is an intriguing potential antimicrobial target. A unique characteristic of BfmR is that its inhibition would have the dual benefit of significantly decreasing in vivo survival and increasing sensitivity to selected antimicrobials. Studies on the clinically relevant strain AB307-0294 have shown BfmR to be essential in vivo. Here, we demonstrate that this phenotype in strains AB307-0294 and AB908 is mediated, in part, by enabling growth in human ascites fluid and serum. Further, BfmR conferred resistance to complement-mediated bactericidal activity that was independent of capsular polysaccharide. Importantly, BfmR also increased resistance to the clinically important antimicrobials meropenem and colistin. BfmR was highly conserved among A. baumannii strains. The crystal structure of the receiver domain of BfmR was determined, lending insight into putative ligand binding sites. This enabled an in silico ligand binding analysis and a blind docking strategy to assess use as a potential druggable target. Predicted binding hot spots exist at the homodimer interface and the phosphorylation site. These data support pursuing the next step in the development process, which includes determining the degree of inhibition needed to impact growth/survival and the development a BfmR activity assay amenable to high-throughput screening for the identification of inhibitors. Such agents would represent a new class of antimicrobials active against A. baumannii which could be active against other Gram-negative bacilli that possess a TCS with shared homology. IMPORTANCE Increasing antibiotic resistance in bacteria, particularly Gram-negative bacilli, has significantly affected the ability of physicians to treat infections, with resultant increased morbidity, mortality, and health

  8. Candida albicans Airway Colonization Facilitates Subsequent Acinetobacter baumannii Pneumonia in a Rat Model.


    Tan, Xiaojiang; Chen, Ruilan; Zhu, Song; Wang, Huijun; Yan, Dongxing; Zhang, Xiangdong; Farmakiotis, Dimitrios; Mylonakis, Eleftherios


    The objective of the study was to determine the effects of Candida albicans respiratory tract colonization on Acinetobacter baumannii pneumonia in a rat model. Rats were colonized with C. albicans by instillation of 3 × 10(6) CFU into their airways, while sterile saline was instilled in the control group. The colonized rats were further divided into two groups: treated with amphotericin B or not. The rats were subsequently infected with A. baumannii (10(8) CFU by tracheobronchial instillation). A. baumannii lung CFU counts, cytokine lung levels, and rates of A. baumannii pneumonia were compared between groups. In vitro expression of A. baumannii virulence genes was measured by reverse transcription (RT)-PCR after 24-hour incubation with C. albicans or with Mueller-Hinton (MH) broth alone. Rats with Candida colonization developed A. baumannii pneumonia more frequently and had higher A. baumannii CFU burdens and heavier lungs than controls. After A. baumannii infection, lung interleukin 17 (IL-17) concentrations were lower and gamma interferon (IFN-γ) concentrations were higher in Candida-colonized rats than in controls. Candida-colonized rats treated with amphotericin B had a decreased rate of A. baumannii pneumonia and lower IFN-γ levels but higher IL-17 levels than untreated rats. Expression of basC, barB, bauA, ptk, plc2, and pld2 was induced while expression of ompA and abaI was suppressed in A. baumannii cultured in the presence of C. albicans C. albicans colonization facilitated the development of A. baumannii pneumonia in a rat model. Among Candida-colonized rats, antifungal treatment lowered the incidence of A. baumannii pneumonia. These findings could be due to modification of the host immune response and/or expression of A. baumannii virulence genes by Candida spp. PMID:27001817

  9. Identification of novel vaccine candidates against Acinetobacter baumannii using reverse vaccinology

    PubMed Central

    Chiang, Ming-Hsien; Sung, Wang-Chou; Lien, Shu-Pei; Chen, Ying-Zih; Lo, Annie Fei-yun; Huang, Jui-Hsin; Kuo, Shu-Chen; Chong, Pele


    Acinetobacter baumannii (Ab) is a global emerging bacterium causing nosocomial infections such as pneumonia, meningitis, bacteremia and soft tissue infections especially in intensive care units. Since Ab is resistant to almost all conventional antibiotics, it is now one of the 6 top-priorities of the dangerous microorganisms listed by the Infectious Disease Society of America. The development of vaccine is one of the most promising and cost-effective strategies to prevent infections. In this study, we identified potential protective vaccine candidates using reverse vaccinology. We have analyzed 14 on-line available Ab genome sequences and found 2752 homologous core genes. Using information obtained from immuno-proteomic experiments, published proteomic information and the bioinformatics PSORTb v3.0 software to predict the location of extracellular and/or outer membrane proteins, 77 genes were identified and selected for further studies. After excluding those antigens have been used as vaccine candidates reported by the in silico search-engines of PubMed and Google Scholar, 13 proteins could potentially be vaccine candidates. We have selected and cloned the genes of 3 antigens that were further expressed and purified. These antigens were found to be highly immunogenic and conferred partial protection (60%) in a pneumonia animal model. The strategy described in the present study incorporates the advantages of reverse vaccinology, bioinformatics and immuno-proteomic platform technologies and is easy to perform to identify novel immunogens for multi-component vaccines development. PMID:25751377

  10. Draft genome sequence of Acinetobacter baumannii strain NCTC 13423, a multidrug-resistant clinical isolate.


    Michiels, Joran E; Van den Bergh, Bram; Fauvart, Maarten; Michiels, Jan


    Acinetobacter baumannii is a pathogen that is becoming increasingly important and causes serious hospital-acquired infections. We sequenced the genome of A. baumannii NCTC 13423, a multidrug-resistant strain belonging to the international clone II group, isolated from a human infection in the United Kingdom in 2003. The 3,937,944 bp draft genome has a GC-content of 39.0 % and a total of 3672 predicted protein-coding sequences. The availability of genome sequences of multidrug-resistant A. baumannii isolates will fuel comparative genomic studies to help understand the worrying spread of multidrug resistance in this pathogen. PMID:27594976

  11. Characterization and identification of newly isolated Acinetobacter baumannii strain serdang 1 for phenol removal

    NASA Astrophysics Data System (ADS)

    Yadzir, Z. H. M.; Shukor, M. Y.; Nazir, M. S.; Abdullah, M. A.


    A new indigenous bacterial strain from Malaysian soil contaminated with petroleum waste had been successfully isolated, characterized and identified for phenol removal. The gram negative bacteria showed 98% identity with Acinetobacter baumannii based on Biolog{trade mark, serif} Identification System and the determination of a partial 16S ribosomal RNA (rRNA) sequence. The isolate clustered with species belonging to Acinetobacter clade in a 16S rDNA-based neighbour-joining phylogenetic tree.

  12. Identification and Characterization of a Glycosyltransferase Involved in Acinetobacter baumannii Lipopolysaccharide Core Biosynthesis▿

    PubMed Central

    Luke, Nicole R.; Sauberan, Shauna L.; Russo, Thomas A.; Beanan, Janet M.; Olson, Ruth; Loehfelm, Thomas W.; Cox, Andrew D.; St. Michael, Frank; Vinogradov, Evgeny V.; Campagnari, Anthony A.


    Although Acinetobacter baumannii has emerged as a significant cause of nosocomial infections worldwide, there have been few investigations describing the factors important for A. baumannii persistence and pathogenesis. This paper describes the first reported identification of a glycosyltransferase, LpsB, involved in lipopolysaccharide (LPS) biosynthesis in A. baumannii. Mutational, structural, and complementation analyses indicated that LpsB is a core oligosaccharide glycosyl transferase. Using a genetic approach, lpsB was compared with the lpsB homologues of several A. baumannii strains. These analyses indicated that LpsB is highly conserved among A. baumannii isolates. Furthermore, we developed a monoclonal antibody, monoclonal antibody 13C11, which reacts to an LPS core epitope expressed by approximately one-third of the A. baumannii clinical isolates evaluated to date. Previous studies describing the heterogeneity of A. baumannii LPS were limited primarily to structural analyses; therefore, studies evaluating the correlation between these surface glycolipids and pathogenesis were warranted. Our data from an evaluation of LpsB mutant 307::TN17, which expresses a deeply truncated LPS glycoform consisting of only two 3-deoxy-d-manno-octulosonic acid residues and lipid A, suggest that A. baumannii LPS is important for resistance to normal human serum and confers a competitive advantage for survival in vivo. These results have important implications for the role of LPS in A. baumannii infections. PMID:20194587

  13. Inactivation of Acinetobacter baumannii Biofilms on Polystyrene, Stainless Steel, and Urinary Catheters by Octenidine Dihydrochloride

    PubMed Central

    Narayanan, Amoolya; Nair, Meera S.; Karumathil, Deepti P.; Baskaran, Sangeetha A.; Venkitanarayanan, Kumar; Amalaradjou, Mary Anne Roshni


    Acinetobacter baumannii is a major nosocomial pathogen causing human infections with significant mortality rates. In most cases, infections are acquired through exposure to A. baumannii biofilms that persist on contaminated hospital equipment and surfaces. Thus, it is imperative to develop effective measures for controlling A. baumannii biofilms in nosocomial settings. This study investigated the efficacy of octenidine dihydrochloride (OH), a new generation disinfectant for reducing A. baumannii biofilms on polystyrene, stainless steel and catheters. OH at 0.3% (5 mM), 0.6% (10 mM), and 0.9% (15 mM) was effective in significantly inactivating A. baumannii biofilms on all tested surfaces (P < 0.05). Furthermore, OH was equally effective in inactivating biofilms of multidrug resistant and drug susceptible A. baumannii isolates. In addition, confocal imaging revealed the predominance of dead cells in the OH-treated samples in comparison to the control. Further, scanning electron microscopy of biofilms formed on catheters revealed that OH treatment significantly reduced A. baumannii biofilm populations in corroboration with our antibiofilm assay. These data underscore the efficacy of OH in inactivating A. baumannii biofilms, thereby suggesting its potential use as a disinfectant or a catheter lock solution to control A. baumannii infections. PMID:27375572

  14. Identification and characterization of a glycosyltransferase involved in Acinetobacter baumannii lipopolysaccharide core biosynthesis.


    Luke, Nicole R; Sauberan, Shauna L; Russo, Thomas A; Beanan, Janet M; Olson, Ruth; Loehfelm, Thomas W; Cox, Andrew D; St Michael, Frank; Vinogradov, Evgeny V; Campagnari, Anthony A


    Although Acinetobacter baumannii has emerged as a significant cause of nosocomial infections worldwide, there have been few investigations describing the factors important for A. baumannii persistence and pathogenesis. This paper describes the first reported identification of a glycosyltransferase, LpsB, involved in lipopolysaccharide (LPS) biosynthesis in A. baumannii. Mutational, structural, and complementation analyses indicated that LpsB is a core oligosaccharide glycosyl transferase. Using a genetic approach, lpsB was compared with the lpsB homologues of several A. baumannii strains. These analyses indicated that LpsB is highly conserved among A. baumannii isolates. Furthermore, we developed a monoclonal antibody, monoclonal antibody 13C11, which reacts to an LPS core epitope expressed by approximately one-third of the A. baumannii clinical isolates evaluated to date. Previous studies describing the heterogeneity of A. baumannii LPS were limited primarily to structural analyses; therefore, studies evaluating the correlation between these surface glycolipids and pathogenesis were warranted. Our data from an evaluation of LpsB mutant 307::TN17, which expresses a deeply truncated LPS glycoform consisting of only two 3-deoxy-d-manno-octulosonic acid residues and lipid A, suggest that A. baumannii LPS is important for resistance to normal human serum and confers a competitive advantage for survival in vivo. These results have important implications for the role of LPS in A. baumannii infections. PMID:20194587

  15. Genomic Analysis of the Multidrug-Resistant Acinetobacter baumannii Strain MDR-ZJ06 Widely Spread in China▿

    PubMed Central

    Zhou, Hua; Zhang, Tongwu; Yu, Dongliang; Pi, Borui; Yang, Qing; Zhou, Jianying; Hu, Songnian; Yu, Yunsong


    We previously reported that the multidrug-resistant (MDR) Acinetobacter baumannii strain MDR-ZJ06, belonging to European clone II, was widely spread in China. In this study, we report the whole-genome sequence of this clinically important strain. A 38.6-kb AbaR-type genomic resistance island (AbaR22) was identified in MDR-ZJ06. AbaR22 has a structure similar to those of the resistance islands found in A. baumannii strains AYE and AB0057, but it contained only a few antibiotic resistance genes. The region of resistant gene accumulation as previously described was not found in AbaR22. In the chromosome of the strain MDR-ZJ06, we identified the gene blaoxa-23 in a composite transposon (Tn2009). Tn2009 shared the backbone with other A. baumannii transponsons that harbor blaoxa-23, but it was bracketed by two ISAba1 elements which were transcribed in the same orientation. MDR-ZJ06 also expressed the armA gene on its plasmid pZJ06, and this gene has the same genetic environment as the armA gene of the Enterobacteriaceae. These results suggest variability of resistance acquisition even in closely related A. baumannii strains. PMID:21788470

  16. Distribution and resistance of pathogens in liver transplant recipients with Acinetobacter baumannii infection

    PubMed Central

    Gao, Fei; Ye, Qifa; Wan, Qiquan; Liu, Shan; Zhou, Jiandang


    Background Drug-resistant Acinetobacter baumannii has become a major problem in liver transplant recipients. The aim of this study was to investigate the clinical presentation, distribution, and drug susceptibility characteristics in liver recipients with A. baumannii infection. Methods We retrospectively investigated 17 liver recipients who developed A. baumannii infection between January 1, 2007 and December 31, 2014. The distribution of A. baumannii and drug susceptibility characteristics were reviewed. Results Infectious complications due to A. baumannii appeared in 17 liver recipients, with a total of 24 episodes. Approximately 63% (15/24) of A. baumannii infections occurred within 2 weeks after transplantation. The most common source of infection was multiple culture-positive sites (35.3%, n=6), followed by the intra-abdominal/biliary tract (23.5%, n=4) and lung (23.5%, n=4). Eight patients (47.1%) had a body temperature of 38°C or higher at the onset of A. baumannii infection. Nine, seven, and 12 recipients had a serum creatinine level of >1.5 mg/dL, a white blood cell count of >15,000/mm3, and a platelet count of <50,000/mm3, respectively. There were five (29.4%) cases of septic shock and eight (47.1%) deaths. The rate of antibiotic resistance of A. baumannii to ten of 12 antibiotics investigated was more than 60%. Among the 24 infections caused by A. baumannii, 75% were carbapenem-resistant. The rods were relatively sensitive to tigecycline and cefoperazone-sulbactam. Conclusion The clinical manifestations of A. baumannii infection included a high body temperature, a decreased platelet count, an elevated white blood cell count, and onset in the early period after transplantation as well as high mortality. The antibiotic resistance rate of A. baumannii was extremely high. Prevention measures and combination antibiotic therapy are needed to improve the outcomes of liver recipients with A. baumannii infections. PMID:25848296

  17. Growth Retardation, Reduced Invasiveness, and Impaired Colistin-Mediated Cell Death Associated with Colistin Resistance Development in Acinetobacter baumannii

    PubMed Central

    Poulou, Aggeliki; Dafopoulou, Konstantina; Chabane, Yassine Nait; Kristo, Ioulia; Makris, Demosthenes; Hardouin, Julie; Cosette, Pascal; Tsakris, Athanassios; Dé, Emmanuelle


    Two colistin-susceptible/colistin-resistant (Cols/Colr) pairs of Acinetobacter baumannii strains assigned to international clone 2, which is prevalent worldwide, were sequentially recovered from two patients after prolonged colistin administration. Compared with the respective Cols isolates (Ab248 and Ab299, both having a colistin MIC of 0.5 μg/ml), both Colr isolates (Ab249 and Ab347, with colistin MICs of 128 and 32 μg/ml, respectively) significantly overexpressed pmrCAB genes, had single-amino-acid shifts in the PmrB protein, and exhibited significantly slower growth. The Colr isolate Ab347, tested by proteomic analysis in comparison with its Cols counterpart Ab299, underexpressed the proteins CsuA/B and C from the csu operon (which is necessary for biofilm formation). This isolate also underexpressed aconitase B and different enzymes involved in the oxidative stress response (KatE catalase, superoxide dismutase, and alkyl hydroperoxide reductase), suggesting a reduced response to reactive oxygen species (ROS) and, consequently, impaired colistin-mediated cell death through hydroxyl radical production. Cols isolates that were indistinguishable by macrorestriction analysis from Ab299 caused six sequential bloodstream infections, and isolates indistinguishable from Ab248 caused severe soft tissue infection, while Colr isolates indistinguishable from Ab347 and Ab249 were mainly colonizers. In particular, a Cols isolate identical to Ab299 was still invading the bloodstream 90 days after the colonization of this patient by Colr isolates. These observations indicate considerably lower invasiveness of A. baumannii clinical isolates following the development of colistin resistance. PMID:24247145

  18. Growth retardation, reduced invasiveness, and impaired colistin-mediated cell death associated with colistin resistance development in Acinetobacter baumannii.


    Pournaras, Spyros; Poulou, Aggeliki; Dafopoulou, Konstantina; Chabane, Yassine Nait; Kristo, Ioulia; Makris, Demosthenes; Hardouin, Julie; Cosette, Pascal; Tsakris, Athanassios; Dé, Emmanuelle


    Two colistin-susceptible/colistin-resistant (Col(s)/Col(r)) pairs of Acinetobacter baumannii strains assigned to international clone 2, which is prevalent worldwide, were sequentially recovered from two patients after prolonged colistin administration. Compared with the respective Col(s) isolates (Ab248 and Ab299, both having a colistin MIC of 0.5 μg/ml), both Col(r) isolates (Ab249 and Ab347, with colistin MICs of 128 and 32 μg/ml, respectively) significantly overexpressed pmrCAB genes, had single-amino-acid shifts in the PmrB protein, and exhibited significantly slower growth. The Col(r) isolate Ab347, tested by proteomic analysis in comparison with its Col(s) counterpart Ab299, underexpressed the proteins CsuA/B and C from the csu operon (which is necessary for biofilm formation). This isolate also underexpressed aconitase B and different enzymes involved in the oxidative stress response (KatE catalase, superoxide dismutase, and alkyl hydroperoxide reductase), suggesting a reduced response to reactive oxygen species (ROS) and, consequently, impaired colistin-mediated cell death through hydroxyl radical production. Col(s) isolates that were indistinguishable by macrorestriction analysis from Ab299 caused six sequential bloodstream infections, and isolates indistinguishable from Ab248 caused severe soft tissue infection, while Col(r) isolates indistinguishable from Ab347 and Ab249 were mainly colonizers. In particular, a Col(s) isolate identical to Ab299 was still invading the bloodstream 90 days after the colonization of this patient by Col(r) isolates. These observations indicate considerably lower invasiveness of A. baumannii clinical isolates following the development of colistin resistance. PMID:24247145

  19. [Identification and determination of sensitivity to antibiotics of 31 clinical strains of Acinetobacter other than A. baumannii].


    Freney, J; Bouvet, P J; Tixier, C


    Precise identification and determination of MICs of clinical isolates of Acinetobacter identified to other species than the hospital species A. baumannii were carried out. On 260 Acinetobacter strains isolated in an hospital over a 6 months period, 31 strains (12 p. cent) were identified to species other than A. baumannii. Among these 31 strains, A. Iwoffii sensu stricto (16 strains) and A. haemolyticus (6 strains) were mostly recovered. Eight glucose oxidizing strains were identified to A. haemolyticus (6 strains), Acinetobacter genospecies 3 (2 strains), and A. Iwoffii sensu stricto (1 strain). Antibiotic susceptibilities of these strains were greater than those commonly observed with A. baumannii strains. PMID:2930020

  20. The Population Structure of Acinetobacter baumannii: Expanding Multiresistant Clones from an Ancestral Susceptible Genetic Pool

    PubMed Central

    Diancourt, Laure; Passet, Virginie; Nemec, Alexandr; Dijkshoorn, Lenie; Brisse, Sylvain


    Outbreaks of hospital infections caused by multidrug resistant Acinetobacter baumannii strains are of increasing concern worldwide. Although it has been reported that particular outbreak strains are geographically widespread, little is known about the diversity and phylogenetic relatedness of A. baumannii clonal groups. Sequencing of internal portions of seven housekeeping genes (total 2,976 nt) was performed in 154 A. baumannii strains covering the breadth of known diversity and including representatives of previously recognized international clones, and in 19 representatives of other Acinetobacter species. Restricted amounts of diversity and a star-like phylogeny reveal that A. baumannii is a genetically compact species that suffered a severe bottleneck in the recent past, possibly linked to a restricted ecological niche. A. baumannii is neatly demarcated from its closest relative (genomic species 13TU) and other Acinetobacter species. Multilocus sequence typing analysis demonstrated that the previously recognized international clones I to III correspond to three clonal complexes, each made of a central, predominant genotype and few single locus variants, a hallmark of recent clonal expansion. Whereas antimicrobial resistance was almost universal among isolates of these and a novel international clone (ST15), isolates of the other genotypes were mostly susceptible. This dichotomy indicates that antimicrobial resistance is a major selective advantage that drives the ongoing rapid clonal expansion of these highly problematic agents of nosocomial infections. PMID:20383326

  1. Is Aerosalization a Problem With Carbapenem-Resistant Acinetobacter baumannii in Thailand Hospital?

    PubMed Central

    Apisarnthanarak, Anucha; Tantajina, Ploenpit; Laovachirasuwan, Pornpimol; Weber, David J.; Singh, Nalini


    We evaluated the presence of air contamination with carbapenem-resistant Acinetobacter baumannii (CRAB) in medical units where patients with CRAB pneumonia were hospitalized, and in Obstetrics and Gynecology units with open-air ventilation in-patient settings. There was no evidence of CRAB contamination in either of the units. PMID:27419187

  2. Is Aerosalization a Problem With Carbapenem-Resistant Acinetobacter baumannii in Thailand Hospital?


    Apisarnthanarak, Anucha; Tantajina, Ploenpit; Laovachirasuwan, Pornpimol; Weber, David J; Singh, Nalini


    We evaluated the presence of air contamination with carbapenem-resistant Acinetobacter baumannii (CRAB) in medical units where patients with CRAB pneumonia were hospitalized, and in Obstetrics and Gynecology units with open-air ventilation in-patient settings. There was no evidence of CRAB contamination in either of the units. PMID:27419187

  3. Whole-Genome Sequencing Elucidates Epidemiology of Nosocomial Clusters of Acinetobacter baumannii.


    Willems, Stefanie; Kampmeier, Stefanie; Bletz, Stefan; Kossow, Annelene; Köck, Robin; Kipp, Frank; Mellmann, Alexander


    We characterized two epidemiologically similar Acinetobacter baumannii clusters from two separate intensive care units (ICU) using core genome multilocus sequence typing. Clonal spread was confirmed in ICU-1 (12 of 14 isolates shared genotypes); in ICU-2, all genotypes (13 isolates) were diverse, thus excluding transmissions and enabling adequate infection control measures. PMID:27358465

  4. Role of Fibronectin in the Adhesion of Acinetobacter baumannii to Host Cells

    PubMed Central

    Smani, Younes; McConnell, Michael J.; Pachón, Jerónimo


    Adhesion to host cells is an initial and important step in Acinetobacter baumannii pathogenesis. However, there is relatively little information on the mechanisms by which A. baumannii binds to and interacts with host cells. Adherence to extracellular matrix proteins, such as fibronectin, affords pathogens with a mechanism to invade epithelial cells. Here, we found that A. baumannii adheres more avidly to immobilized fibronectin than to control protein. Free fibronectin used as a competitor resulted in dose-dependent decreased binding of A. baumannii to fibronectin. Three outer membrane preparations (OMPs) were identified as fibronectin binding proteins (FBPs): OMPA, TonB-dependent copper receptor, and 34 kDa OMP. Moreover, we demonstrated that fibronectin inhibition and neutralization by specific antibody prevented significantly the adhesion of A. baumannii to human lung epithelial cells (A549 cells). Similarly, A. baumannii OMPA neutralization by specific antibody decreased significantly the adhesion of A. baumannii to A549 cells. These data indicate that FBPs are key adhesins that mediate binding of A. baumannii to human lung epithelial cells through interaction with fibronectin on the surface of these host cells. PMID:22514602

  5. Code blue: Acinetobacter baumannii, a nosocomial pathogen with a role in the oral cavity.


    Richards, A M; Abu Kwaik, Y; Lamont, R J


    Actinetobacter baumannii is an important nosocomial pathogen that can cause a wide range of serious conditions including pneumonia, meningitis, necrotizing fasciitis and sepsis. It is also a major cause of wound infections in military personnel injured during the conflicts in Afghanistan and Iraq, leading to its popular nickname of 'Iraqibacter'. Contributing to its success in clinical settings is resistance to environmental stresses such as desiccation and disinfectants. Moreover, in recent years there has been a dramatic increase in the number of A. baumannii strains with resistance to multiple antibiotic classes. Acinetobacter baumannii is an inhabitant of oral biofilms, which can act as a reservoir for pneumonia and chronic obstructive pulmonary disease. Subgingival colonization by A. baumannii increases the risk of refractory periodontitis. Pathogenesis of the organism involves adherence, biofilm formation and iron acquisition. In addition, A. baumannii can induce apoptotic cell death in epithelial cells and kill hyphal forms of Candida albicans. Virulence factors that have been identified include pili, the outer membrane protein OmpA, phospholipases and extracellular polysaccharide. Acinetobacter baumannii can sense blue light through a blue-light sensing using flavin (BLUF) domain protein, BlsA. The resulting conformational change in BlsA leads to changes in gene expression, including virulence genes. PMID:25052812

  6. Fatal skin and soft tissue infection of multidrug resistant Acinetobacter baumannii: A case report

    PubMed Central

    Ali, Aqsa; Botha, John; Tiruvoipati, Ravindranath


    INTRODUCTION Acinetobacter baumannii is usually associated with respiratory tract, urinary tract and bloodstream infections. Recent reports suggest that it is increasingly causing skin and soft tissue infections. It is also evolving as a multidrug resistant organism that can be difficult to treat. We present a fatal case of multidrug resistant A. baumannii soft tissue infection and review of relevant literature. PRESENTATION OF CASE A 41 year old morbidly obese man, with history of alcoholic liver disease presented with left superficial pre-tibial abrasions and cellulitis caused by multidrug resistant (MDR) A. baumannii. In spite of early antibiotic administration he developed extensive myositis and fat necrosis requiring extensive and multiple surgical debridements. He deteriorated despite appropriate antibiotic therapy and multiple surgical interventions with development of multi-organ failure and died. DISCUSSION Managing Acinetobacter infections remains difficult due to the array of resistance and the pathogens ability to develop new and ongoing resistance. The early diagnosis of necrotizing soft tissue infection may be challenging, but the key to successful management of patients with necrotizing soft tissue infection are early recognition and complete surgical debridement. CONCLUSION A. baumannii is emerging as an important cause of severe, life-threatening soft tissue infections. Multidrug resistant A. baumannii soft tissue infections may carry a high mortality in spite of early and aggressive treatment. Clinicians need to consider appropriate early empirical antibiotic coverage or the use of combination therapy to include MDR A. baumannii as a cause of skin and soft tissue infections. PMID:25016080

  7. Candida spp. airway colonization: A potential risk factor for Acinetobacter baumannii ventilator-associated pneumonia.


    Tan, Xiaojiang; Zhu, Song; Yan, Dongxing; Chen, Weiping; Chen, Ruilan; Zou, Jian; Yan, Jingdong; Zhang, Xiangdong; Farmakiotis, Dimitrios; Mylonakis, Eleftherios


    This retrospective study was conducted to identify potential risk factors for Acinetobacter baumannii (A. baumannii) ventilator-associated pneumonia (VAP) and evaluate the association between Candida spp. airway colonization and A. baumannii VAP. Intensive care unit (ICU) patients who were on mechanical ventilation (MV) for ≥48 hours were divided into the following groups: patients with and without Candida spp. airway colonization; colonized patients receiving antifungal treatment or not; patients with A. baumannii VAP and those without VAP. Logistic regression analysis and propensity score matching were used to identify factors independently associated with A. baumannii VAP. Among 618 eligible patients, 264 (43%) had Candida spp. airway colonization and 114 (18%) developed A. baumannii VAP. Along with MV for ≥7 days (adjusted odds ratio [aOR] 8.9, 95% confidence intervals [95% CI] 4.9-15.8) and presence of a central venous catheter (aOR 3.2, 95% CI 1.1-9), Candida spp. airway colonization (aOR 2.6, 95% CI 1.6-4.3) was identified as an independent risk factor for A. baumannii VAP. Patients with Candida spp. airway colonization were more likely to develop A. baumannii VAP than non-colonized patients (23% vs 15%, P=.01 and 34% vs. 15%, P<.001 in propensity score-matched subgroups). Administration of antifungal agents was not associated with A. baumannii VAP (29% vs. 21%, P=.153) but with higher in-hospital mortality (53% vs. 39%, P=.037). Candida spp. airway colonization (43%) and A. baumannii VAP (18%) were common in ICU patients who were on mechanical ventilation for at least 48 hours. Candida spp. airway colonization was an independent risk factor for subsequent A. baumannii VAP. PMID:27001670

  8. Real-Time Fluorescence Loop Mediated Isothermal Amplification for the Detection of Acinetobacter baumannii

    PubMed Central

    Wang, Qinqin; Zhou, Yanbin; Li, Shaoli; Zhuo, Chao; Xu, Siqi; Huang, Lixia; Yang, Ling; Liao, Kang


    Background Detection of Acinetobacter baumannii has been relying primarily on bacterial culture that often fails to return useful results in time. Although DNA-based assays are more sensitive than bacterial culture in detecting the pathogen, the molecular results are often inconsistent and challenged by doubts on false positives, such as those due to system- and environment-derived contaminations. In addition, these molecular tools require expensive laboratory instruments. Therefore, establishing molecular tools for field use require simpler molecular platforms. The loop-mediated isothermal amplification method is relatively simple and can be improved for better use in a routine clinical bacteriology laboratory. A simple and portable device capable of performing both the amplification and detection (by fluorescence) of LAMP in the same platform has been developed in recent years. This method is referred to as real-time loop-mediated isothermal amplification. In this study, we attempted to utilize this method for rapid detection of A. baumannii. Methodology and Significant Findings Species-specific primers were designed to test the utility of this method. Clinical samples of A. baumannii were used to determine the sensitivity and specificity of this system compared to bacterial culture and a polymerase chain reaction method. All positive samples isolated from sputum were confirmed to be the species of Acinetobacter by 16S rRNA gene sequencing. The RealAmp method was found to be simpler and allowed real-time detection of DNA amplification, and could distinguish A. baumannii from Acinetobacter calcoaceticus and Acinetobacter genomic species 3. DNA was extracted by simple boiling method. Compared to bacterial culture, the sensitivity and specificity of RealAmp in detecting A. baumannii was 98.9% and 75.0%, respectively. Conclusion The RealAmp assay only requires a single unit, and the assay positivity can be verified by visual inspection. Therefore, this assay has

  9. Distribution of AdeABC efflux system genes in genotypically diverse strains of clinical Acinetobacter baumannii.


    Wieczorek, Piotr; Sacha, Paweł; Czaban, Sławomir; Hauschild, Tomasz; Ojdana, Dominika; Kowalczuk, Oksana; Milewski, Robert; Poniatowski, Bogusław; Nikliński, Jacek; Tryniszewska, Elżbieta


    Acinetobacter baumannii has emerged as a highly problematic hospital-associated pathogen. Different mechanisms contribute to the formation of multidrug resistance in A. baumannii, including the AdeABC efflux system. Distribution of the structural and regulatory genes encoding the AdeABC efflux system among genetically diverse clinical A. baumannii strains was achieved by using PCR and pulsed-field gel electrophoresis techniques. The distribution of adeABRS genes is extremely high among our A. baumannii strains, except the adeC gene. We have observed a large proportion of strains presenting multidrug-resistance phenotype for several years. The efflux pump could be an important mechanism in these strains in resistance to antibiotics. PMID:23886790

  10. Predictors of mortality in solid-organ transplant recipients with infections caused by Acinetobacter baumannii.


    Liu, Hua; Ye, Qifa; Wan, Qiquan; Zhou, Jiandang


    Acinetobacter baumannii can cause a serious infection in solid-organ transplant (SOT) recipients, and more data on A. baumannii infection is needed. We sought to investigate the epidemiology and distribution of A. baumannii isolates in SOT recipients. We also investigated the risk factors for overall in-hospital mortality and infection-related 30-day mortality using multivariate logistic regression analysis. A double-center retrospective study of SOT recipients who were infected with A. baumannii between January 2003 and January 2015 was conducted. A total of 71 individuals developed 93 episodes of A. baumannii infection, with a mean age of 44.5 years (44.5±11.9 years). Ninety percent of recipients had nosocomial origin A. baumannii infection, with the bloodstream as the most common site of infection (32.4%). Septic shock developed in 23.9% (17 of 71) of all recipients with A. baumannii infection. Morbidity and mortality rates of A. baumannii infections were high in SOT recipients. The incidence rate of A. baumannii infection in SOT recipients was 3.9% (71 of 1,821). Overall in-hospital mortality and infection-related 30-day mortality were 53.5% (38 of 71) and 40.8% (29 of 71), respectively. Risk factors independently associated with overall in-hospital mortality were mechanical ventilation at onset of A. baumannii infection (odds ratio [OR] 6.29, 95% confidence interval [CI] 1.48-26.85; P=0.013), liver or liver-kidney transplantation (OR 15.33, 95% CI 1.82-129.18; P=0.012), and late-onset A. baumannii infection (OR 7.61, 95% CI 1.07-54.36; P=0.043). A platelet count <50,000/mm(3) (OR 12.76, 95% CI 1.28-126.81; P=0.030) and mechanical ventilation at onset of A. baumannii infection (OR 189.98, 95% CI 13.23-2,728.81; P<0.001) were identified as independent risk factors for infection-related 30-day mortality. In conclusion, the morbidity and mortality rates of A. baumannii infections were high in SOT recipients. Mechanical ventilation at onset of A. baumannii

  11. Evaluation of CHROMagar Acinetobacter for Detection of Enteric Carriage of Multidrug-Resistant Acinetobacter baumannii in Samples from Critically Ill Patients▿

    PubMed Central

    Gordon, N. C.; Wareham, D. W.


    CHROMagar Acinetobacter was used to screen stool and perineal swabs for enteric carriage of multidrug-resistant Acinetobacter baumannii in samples from critically ill patients. Results were compared with a molecular assay resulting in sensitivity and specificity of culture compared to PCR of 91.7% and 89.6%, respectively. PMID:19439546

  12. Biofilm Formation Caused by Clinical Acinetobacter baumannii Isolates Is Associated with Overexpression of the AdeFGH Efflux Pump

    PubMed Central

    He, Xinlong; Lu, Feng; Yuan, Fenglai; Jiang, Donglin; Zhao, Peng; Zhu, Jie; Cheng, Huali


    Chronic wound infections are associated with biofilm formation, which in turn has been correlated with drug resistance. However, the mechanism by which bacteria form biofilms in clinical environments is not clearly understood. This study was designed to investigate the biofilm formation potency of Acinetobacter baumannii and the potential association of biofilm formation with genes encoding efflux pumps, quorum-sensing regulators, and outer membrane proteins. A total of 48 clinically isolated A. baumannii strains, identified by enterobacterial repetitive intergenic consensus (ERIC)-PCR as types A-II, A-III, and A-IV, were analyzed. Three representative strains, which were designated A. baumannii ABR2, ABR11, and ABS17, were used to evaluate antimicrobial susceptibility, biofilm inducibility, and gene transcription (abaI, adeB, adeG, adeJ, carO, and ompA). A significant increase in the MICs of different classes of antibiotics was observed in the biofilm cells. The formation of a biofilm was significantly induced in all the representative strains exposed to levofloxacin. The levels of gene transcription varied between bacterial genotypes, antibiotics, and antibiotic concentrations. The upregulation of adeG correlated with biofilm induction. The consistent upregulation of adeG and abaI was detected in A-III-type A. baumannii in response to levofloxacin and meropenem (1/8 to 1/2× the MIC), conditions which resulted in the greatest extent of biofilm induction. This study demonstrates a potential role of the AdeFGH efflux pump in the synthesis and transport of autoinducer molecules during biofilm formation, suggesting a link between low-dose antimicrobial therapy and a high risk of biofilm infections caused by A. baumannii. This study provides useful information for the development of antibiofilm strategies. PMID:26033730

  13. Acinetobacter baumannii Response to Host-Mediated Zinc Limitation Requires the Transcriptional Regulator Zur

    PubMed Central

    Mortensen, Brittany L.; Rathi, Subodh; Chazin, Walter J.


    Acinetobacter baumannii is a leading cause of ventilator-associated pneumonia in intensive care units, and the increasing rates of antibiotic resistance make treating these infections challenging. Consequently, there is an urgent need to develop new antimicrobials to treat A. baumannii infections. One potential therapeutic option is to target bacterial systems involved in maintaining appropriate metal homeostasis, processes that are critical for the growth of pathogens within the host. The A. baumannii inner membrane zinc transporter ZnuABC is required for growth under low-zinc conditions and for A. baumannii pathogenesis. The expression of znuABC is regulated by the transcriptional repressor Zur. To investigate the role of Zur during the A. baumannii response to zinc limitation, a zur deletion mutant was generated, and transcriptional changes were analyzed using RNA sequencing. A number of Zur-regulated genes were identified that exhibit increased expression both when zur is absent and under low-zinc conditions, and Zur binds to predicted Zur box sequences of several genes affected by zinc levels or the zur mutation. Furthermore, the zur mutant is impaired for growth in the presence of both high and low zinc levels compared to wild-type A. baumannii. Finally, the zur mutant exhibits a defect in dissemination in a mouse model of A. baumannii pneumonia, establishing zinc sensing as a critical process during A. baumannii infection. These results define Zur-regulated genes within A. baumannii and demonstrate a requirement for Zur in the A. baumannii response to the various zinc levels experienced within the vertebrate host. PMID:24816603

  14. The Complete Genome and Phenome of a Community-Acquired Acinetobacter baumannii

    PubMed Central

    Farrugia, Daniel N.; Elbourne, Liam D. H.; Hassan, Karl A.; Eijkelkamp, Bart A.; Tetu, Sasha G.; Brown, Melissa H.; Shah, Bhumika S.; Peleg, Anton Y.; Mabbutt, Bridget C.; Paulsen, Ian T.


    Many sequenced strains of Acinetobacter baumannii are established nosocomial pathogens capable of resistance to multiple antimicrobials. Community-acquired A. baumannii in contrast, comprise a minor proportion of all A. baumannii infections and are highly susceptible to antimicrobial treatment. However, these infections also present acute clinical manifestations associated with high reported rates of mortality. We report the complete 3.70 Mbp genome of A. baumannii D1279779, previously isolated from the bacteraemic infection of an Indigenous Australian; this strain represents the first community-acquired A. baumannii to be sequenced. Comparative analysis of currently published A. baumannii genomes identified twenty-four accessory gene clusters present in D1279779. These accessory elements were predicted to encode a range of functions including polysaccharide biosynthesis, type I DNA restriction-modification, and the metabolism of novel carbonaceous and nitrogenous compounds. Conversely, twenty genomic regions present in previously sequenced A. baumannii strains were absent in D1279779, including gene clusters involved in the catabolism of 4-hydroxybenzoate and glucarate, and the A. baumannii antibiotic resistance island, known to bestow resistance to multiple antimicrobials in nosocomial strains. Phenomic analysis utilising the Biolog Phenotype Microarray system indicated that A. baumannii D1279779 can utilise a broader range of carbon and nitrogen sources than international clone I and clone II nosocomial isolates. However, D1279779 was more sensitive to antimicrobial compounds, particularly beta-lactams, tetracyclines and sulphonamides. The combined genomic and phenomic analyses have provided insight into the features distinguishing A. baumannii isolated from community-acquired and nosocomial infections. PMID:23527001

  15. Isolation and characterization of antimicrobial compounds in plant extracts against multidrug-resistant Acinetobacter baumannii.


    Miyasaki, Yoko; Rabenstein, John D; Rhea, Joshua; Crouch, Marie-Laure; Mocek, Ulla M; Kittell, Patricia Emmett; Morgan, Margie A; Nichols, Wesley Stephen; Van Benschoten, M M; Hardy, William David; Liu, George Y


    The number of fully active antibiotic options that treat nosocomial infections due to multidrug-resistant Acinetobacter baumannii (A. baumannii) is extremely limited. Magnolia officinalis, Mahonia bealei, Rabdosia rubescens, Rosa rugosa, Rubus chingii, Scutellaria baicalensis, and Terminalia chebula plant extracts were previously shown to have growth inhibitory activity against a multidrug-resistant clinical strain of A. baumannii. In this study, the compounds responsible for their antimicrobial activity were identified by fractionating each plant extract using high performance liquid chromatography, and determining the antimicrobial activity of each fraction against A. baumannii. The chemical structures of the fractions inhibiting >40% of the bacterial growth were elucidated by liquid chromatography/mass spectrometry analysis and nuclear magnetic resonance spectroscopy. The six most active compounds were identified as: ellagic acid in Rosa rugosa; norwogonin in Scutellaria baicalensis; and chebulagic acid, chebulinic acid, corilagin, and terchebulin in Terminalia chebula. The most potent compound was identified as norwogonin with a minimum inhibitory concentration of 128 µg/mL, and minimum bactericidal concentration of 256 µg/mL against clinically relevant strains of A. baumannii. Combination studies of norwogonin with ten anti-Gram negative bacterial agents demonstrated that norwogonin did not enhance the antimicrobial activity of the synthetic antibiotics chosen for this study. In conclusion, of all identified antimicrobial compounds, norwogonin was the most potent against multidrug-resistant A. baumannii strains. Further studies are warranted to ascertain the prophylactic and therapeutic potential of norwogonin for infections due to multidrug-resistant A. baumannii. PMID:23630600

  16. Antimicrobial Resistance of Acinetobacter baumannii to Imipenem in Iran: A Systematic Review and Meta-Analysis

    PubMed Central

    Pourhajibagher, Maryam; Hashemi, Farhad B.; Pourakbari, Babak; Aziemzadeh, Masoud; Bahador, Abbas


    Imipenem-resistant multi-drug resistant (IR-MDR) Acinetobacter baumannii has been emerged as a morbidity successful nosocomial pathogen throughout the world.To address imipenem being yet the most effective antimicrobial agent against A. baumannii to control outbreaks and treat patients, a systematic review and meta-analysis was performed to evaluate the prevalence of IR-MDR A. baumannii. We systematically searched Web of Science, PubMed, MEDLINE, Science Direct, EMBASE, Scopus, Cochrane Library, Google Scholar, and Iranian databases to identify studies addressing the antibiotic resistance of A. baumannii to imipenem and the frequency of MDR strains in Iran. Out of 58 articles and after a secondary screening using inclusion and exclusion criteria and on the basis of title and abstract evaluation, 51 studies were selected for analysis. The meta-analysis revealed that 55% [95% confidence interval (CI), 53.0–56.5] of A. baumannii were resistant to imipenem and 74% (95% CI, 61.3–83.9) were MDR. The MDR A. baumannii population in Iran is rapidly changing toward a growing resistance to imipenem. Our findings highlight the critical need for a comprehensive monitoring and infection control policy as well as a national susceptibility review program that evaluates IR-MDR A. baumannii isolates from various parts of Iran. PMID:27099638

  17. Carbapenem-resistant isolates of Acinetobacter baumannii in a municipal wastewater treatment plant, Croatia, 2014.


    Hrenovic, Jasna; Goic-Barisic, Ivana; Kazazic, Snjezana; Kovacic, Ana; Ganjto, Marin; Tonkic, Marija


    Acinetobacter baumannii is an emerging hospital pathogen. Whereas A. baumannii isolated from patients or hospitals has been reported, there are few data regarding propagation of viable A. baumannii in the natural environment. This study investigates the occurrence and antimicrobial susceptibility of viable A. baumannii in municipal wastewater and its persistence through the wastewater treatment process. A total of 21 A. baumannii isolates were recovered at a secondary type of municipal wastewater treatment plant in Zagreb, Croatia: 15 from raw influent wastewater and six from final effluent. All isolates were carbapenem- and multidrug-resistant. Among 14 isolates tested for blaOXA genes, all harboured the constitutive blaOXA-51-like gene, while the acquired blaOXA-23-like and blaOXA-40-like genes were found in 10 and three isolates respectively. Six A. baumannii isolates recovered from effluent wastewater multiplied and survived in sterilised effluent wastewater up to 50 days. These findings support the idea that multidrug-resistant A. baumannii can occur and have the ability to survive in the environment. PMID:27105318

  18. Complete Genome Sequence of a Multidrug-Resistant Acinetobacter baumannii Isolate Obtained from a Mexican Hospital (Sequence Type 422).


    Castro-Jaimes, Semiramis; Salgado-Camargo, Abraham David; Graña-Miraglia, Lucía; Lozano, Luis; Bocanegra-Ibarias, Paola; Volkow-Fernández, Patricia; Silva-Sanchez, Jesus; Castillo-Ramírez, Santiago; Cevallos, Miguel A


    Acinetobacter baumannii has emerged as a dangerous nosocomial pathogen, particularly for severely ill patients in intensive care units and patients with hematologic malignancies. Here, we present the complete genome sequence of a multidrug-resistant A. baumannii isolate, recovered from a Mexican hospital and classified as sequence type 422 according to the multilocus sequence typing Pasteur scheme. PMID:27340065

  19. Complete Genome Sequence of a Multidrug-Resistant Acinetobacter baumannii Isolate Obtained from a Mexican Hospital (Sequence Type 422)

    PubMed Central

    Castro-Jaimes, Semiramis; Salgado-Camargo, Abraham David; Graña-Miraglia, Lucía; Lozano, Luis; Bocanegra-Ibarias, Paola; Volkow-Fernández, Patricia; Silva-Sanchez, Jesus; Castillo-Ramírez, Santiago


    Acinetobacter baumannii has emerged as a dangerous nosocomial pathogen, particularly for severely ill patients in intensive care units and patients with hematologic malignancies. Here, we present the complete genome sequence of a multidrug-resistant A. baumannii isolate, recovered from a Mexican hospital and classified as sequence type 422 according to the multilocus sequence typing Pasteur scheme. PMID:27340065

  20. Evaluation of Vitek2 and BD Phoenix in antimicrobial susceptibility testing of Acinetobacter baumannii and Pseudomonas aeruginosa.


    Jekarl, Dong Wook; Han, Sang Bong; Kim, Yoon Joo; Shin, Sang Hyun; Park, Kang Gyun; Park, Jung Jun; Han, Kyungja; Park, Yeon-Joon


    The accuracy of antimicrobial susceptibility testing of Vitek2 and BD Phoenix against Acinetobacter baumannii and Pseudomonas aeruginosa was evaluated. Both systems showed overall categoric agreement of < or =90% for cefepime and ceftazidime against A. baumannii and imipenem and cefepime (and ceftazidime with Vitek2) against P. aeruginosa because of high minor error rates. PMID:20638609

  1. Clonal diversity of Acinetobacter baumannii clinical isolates revealed by a snapshot study

    PubMed Central


    Background Acinetobacter baumannii is a notorious opportunistic pathogen mainly associated with hospital-acquired infections. Studies on the clonal relatedness of isolates could lay the foundation for effective infection control. A snapshot study was performed to investigate the clonal relatedness of A. baumannii clinical isolates in our local settings. Results Among 82 non-repetitive Acinetobacter spp. clinical isolates that were recovered during a period of four days in 13 hospitals in Sichuan, Southwest China, 67 isolates were identified as A. baumannii. Half of the 67 A. baumannii isolates were non-susceptible to carbapenems. blaOXA-23 was the only acquired carbapenemase gene detected, present in 40 isolates including five carbapenem-susceptible ones. The isolates belonged to 62 pulsotypes determined by PFGE and 31 sequence types (ST) by multi-locus sequence typing. Forty-three isolates belonged to the globally-disseminated clonal complex 92, among which ST75, ST92 and ST208 were the most common sequence types. Conclusions Clinical isolates of A. baumannii were diverse in clonality in this snapshot study. However, most of the isolates belonged to the globally-distributed clonal complex CC92. ST75, ST92 and ST208 were the most common types in our region. In particular, ST208 might be an emerging lineage carrying blaOXA-23. PMID:24144168

  2. Occurrence of an Environmental Acinetobacter baumannii Strain Similar to a Clinical Isolate in Paleosol from Croatia

    PubMed Central

    Durn, Goran; Goic-Barisic, Ivana; Kovacic, Ana


    Over the past decade, bacteria of the genus Acinetobacter have emerged as a leading cause of hospital-acquired infections. Outbreaks of Acinetobacter infections are considered to be caused exclusively by contamination and transmission in hospital environments. The natural habitats of clinically important multiresistant Acinetobacter spp. remain to be defined. In this paper, we report an incidental finding of a viable multidrug-resistant strain of Acinetobacter baumannii, related to clinical isolates, in acid paleosol from Croatia. The environmental isolate of A. baumannii showed 87% similarity to a clinical isolate originating from a hospital in this geographic area and was resistant to gentamicin, trimethoprim-sulfamethoxazole, ciprofloxacin, and levofloxacin. In paleosol, the isolate was able to survive a low pH (3.37), desiccation, and a high temperature (50°C). The probable source of A. baumannii in paleosol is illegally disposed waste of external origin situated in the abandoned quarry near the sampling site. The bacteria could have been leached from waste by storm water and thus infiltrated the paleosol. PMID:24584245

  3. Inhibition of LpxC Increases Antibiotic Susceptibility in Acinetobacter baumannii.


    García-Quintanilla, Meritxell; Caro-Vega, José M; Pulido, Marina R; Moreno-Martínez, Patricia; Pachón, Jerónimo; McConnell, Michael J


    LpxC inhibitors have generally shown poor in vitro activity against Acinetobacter baumannii We show that the LpxC inhibitor PF-5081090 inhibits lipid A biosynthesis, as determined by silver staining and measurements of endotoxin levels, and significantly increases cell permeability. The presence of PF-5081090 at 32 mg/liter increased susceptibility to rifampin, vancomycin, azithromycin, imipenem, and amikacin but had no effect on susceptibility to ciprofloxacin and tigecycline. Potentiating existing antibiotics with LpxC inhibitors may represent an alternative treatment strategy for multidrug-resistant A. baumannii. PMID:27270288

  4. Tn125-Related Acquisition of blaNDM-Like Genes in Acinetobacter baumannii

    PubMed Central

    Poirel, Laurent; Bonnin, Rémy A.; Boulanger, Anne; Schrenzel, Jacques; Kaase, Martin


    A multidrug-resistant Acinetobacter baumannii isolate recovered from a patient hospitalized in Switzerland after a transfer from Serbia produced the NDM-1 carbapenemase. The blaNDM-1 gene was part of a chromosomally located Tn125 composite transposon bracketed by two copies of the same insertion sequence, ISAba125. This transposon was also associated with the acquisition and expression of the blaNDM-2 gene in an A. baumannii isolate in Germany. Tn125 appears to be the main vehicle for dissemination of blaNDM genes in that species. PMID:22143526

  5. The Role of the Two-Component System BaeSR in Disposing Chemicals through Regulating Transporter Systems in Acinetobacter baumannii.


    Lin, Ming-Feng; Lin, Yun-You; Lan, Chung-Yu


    Bacterial two-component regulatory systems (TCSs) facilitate changes in gene expression in response to environmental stimuli. TCS BaeR regulons influence tigecycline susceptibility in Acinetobacter baumannii through positively regulating the pump genes adeA and adeB. In this study, we demonstrate that an additional two transport systems, AdeIJK and MacAB-TolC, are also regulated by BaeSR. In the wild type and clinical tigecycline-resistant A. baumannii strains, gene expression of AdeIJK and MacAB-TolC increased after tigecycline induction, implicating their importance to tigecycline resistance in addition to AdeABC. Phenotypic microarray results showed that A. baumannii is vulnerable to certain chemicals, especially tannic acid, after deleting baeR, which was confirmed using the spot assay. The wild-type strain of A. baumannii also exhibited 1.6-fold and 4.4-fold increase in gene expression of adeJ and macB in the medium with 100 μg/mL tannic acid, but the increase was fully inhibited by baeR deletion. An electrophoretic motility shift assay based on an interaction between His-BaeR and the adeA, adeI and macA promoter regions did not demonstrate direct binding. In conclusion, A. baumannii can use the TCS BaeSR in disposing chemicals, such as tannic acid and tigecycline, through regulating the efflux pumps. PMID:26161744

  6. The Role of the Two-Component System BaeSR in Disposing Chemicals through Regulating Transporter Systems in Acinetobacter baumannii

    PubMed Central

    Lin, Ming-Feng; Lin, Yun-You; Lan, Chung-Yu


    Bacterial two-component regulatory systems (TCSs) facilitate changes in gene expression in response to environmental stimuli. TCS BaeR regulons influence tigecycline susceptibility in Acinetobacter baumannii through positively regulating the pump genes adeA and adeB. In this study, we demonstrate that an additional two transport systems, AdeIJK and MacAB-TolC, are also regulated by BaeSR. In the wild type and clinical tigecycline-resistant A. baumannii strains, gene expression of AdeIJK and MacAB-TolC increased after tigecycline induction, implicating their importance to tigecycline resistance in addition to AdeABC. Phenotypic microarray results showed that A. baumannii is vulnerable to certain chemicals, especially tannic acid, after deleting baeR, which was confirmed using the spot assay. The wild-type strain of A. baumannii also exhibited 1.6-fold and 4.4-fold increase in gene expression of adeJ and macB in the medium with 100 μg/mL tannic acid, but the increase was fully inhibited by baeR deletion. An electrophoretic motility shift assay based on an interaction between His-BaeR and the adeA, adeI and macA promoter regions did not demonstrate direct binding. In conclusion, A. baumannii can use the TCS BaeSR in disposing chemicals, such as tannic acid and tigecycline, through regulating the efflux pumps. PMID:26161744

  7. Acinetobacter baumannii-Associated Skin and Soft Tissue Infections: Recognizing a Broadening Spectrum of Disease*

    PubMed Central

    Guerrero, Dubert M.; Perez, Federico; Conger, Nicholas G.; Solomkin, Joseph S.; Adams, Mark D.; Rather, Philip N.


    Abstract Background Acinetobacter baumannii is gaining importance as a cause of nosocomial infections, but its role in skin and soft tissue infection (SSTI) is not well defined. As a result of the outbreak of A. baumannii occurring in military personnel in Iraq and Afghanistan, reports of severe wound infections and SSTI caused by this pathogen are increasing in frequency. Methods We describe four cases of monomicrobial and polymicrobial A. baumannii–associated necrotizing SSTI accompanied by A. baumannii bacteremia and offer a review of similar experiences published in the literature. Results Our comparative analysis reveals four unique features associated with necrotizing SSTI associated with A. baumannii: i) Occurs in hosts with underlying comorbidities (e.g., trauma, cirrhosis); ii) is often accompanied by bacteremia; iii) multiple drug resistance and the presence of co-pathogens frequently complicated treatment (64% of cases); iv) the cases reported here and in our review required surgical debridement (84% of cases) and led to substantial mortality (∼30%). Conclusions As the prevalence of A. baumannii continues to increase in our health care system, SSTIs caused by this organism may become more common. Clinicians must be aware that the spectrum of disease caused by A. baumannii could include severe necrotizing SSTI and that vigilance for potential complications is necessary. PMID:19788383

  8. The contribution of nutrient metal acquisition and metabolism to Acinetobacter baumannii survival within the host

    PubMed Central

    Mortensen, Brittany L.; Skaar, Eric P.


    Acinetobacter baumannii is a significant contributor to intensive care unit (ICU) mortality causing numerous types of infection in this susceptible ICU population, most notably ventilator-associated pneumonia. The substantial disease burden attributed to A. baumannii and the rapid acquisition of antibiotic resistance make this bacterium a serious health care threat. A. baumannii is equipped to tolerate the hostile host environment through modification of its metabolism and nutritional needs. Among these adaptations is the evolution of mechanisms to acquire nutrient metals that are sequestered by the host as a defense against infection. Although all bacteria require nutrient metals, there is diversity in the particular metal needs among species and within varying tissue types and bacterial lifecycles. A. baumannii is well-equipped with the metal homeostatic systems required for the colonization of a diverse array of tissues. Specifically, iron and zinc homeostasis is important for A. baumannii interactions with biotic surfaces and for growth within vertebrates. This review discusses what is currently known regarding the interaction of A. baumannii with vertebrate cells with a particular emphasis on the contributions of metal homeostasis systems. Overall, published research supports the utility of exploiting these systems as targets for the development of much-needed antimicrobials against this emerging infectious threat. PMID:24377089

  9. Impact of Acinetobacter baumannii Superoxide Dismutase on Motility, Virulence, Oxidative Stress Resistance and Susceptibility to Antibiotics

    PubMed Central

    Heider, Christine; Skiebe, Evelyn; Wilharm, Gottfried


    Acinetobacter baumannii is a Gram-negative bacterium appearing as an opportunistic pathogen in hospital settings. Superoxide dismutase (SOD) contributes to virulence in several pathogenic bacteria by detoxifying reactive oxygen species released in the course of host defense reactions. However, the biological role of SODs in A. baumannii has not yet been elucidated. Here, we inactivated in A. baumannii ATCC 17978 gene A1S_2343, encoding a putative SOD of the Fe-Mn type by transposon insertion, resulting in mutant ATCC 17978 sod2343::Km. The mutation was also introduced in two naturally competent A. baumannii isolates by transformation with chromosomal DNA derived from mutant ATCC 17978 sod2343::Km. We demonstrate that inactivation of sod2343 leads to significant motility defects in all three A. baumannii strains. The mutant strains were more susceptible to oxidative stress compared to their parental strains. Susceptibility to colistin and tetracycline was increased in all mutant strains while susceptibility of the mutants to gentamicin, levofloxacin and imipenem was strain-dependent. In the Galleria mellonella infection model the mutant strains were significantly attenuated. In conclusion, sod2343 plays an important role in motility, resistance to oxidative stress, susceptibility to antibiotics and virulence in A. baumannii. PMID:25000585

  10. Translation Elongation Factor Tuf of Acinetobacter baumannii Is a Plasminogen-Binding Protein

    PubMed Central

    Koenigs, Arno; Zipfel, Peter F.; Kraiczy, Peter


    Acinetobacter baumannii is an important nosocomial pathogen, causing a variety of opportunistic infections of the skin, soft tissues and wounds, urinary tract infections, secondary meningitis, pneumonia and bacteremia. Over 63% of A. baumannii infections occurring in the United States are caused by multidrug resistant isolates, and pan-resistant isolates have begun to emerge that are resistant to all clinically relevant antibiotics. The complement system represents the first line of defense against invading pathogens. However, many A. baumannii isolates, especially those causing severe bacteremia are resistant to complement-mediated killing, though the underlying mechanisms remain poorly understood. Here we show for the first time that A. baumannii binds host-derived plasminogen and we identify the translation elongation factor Tuf as a moonlighting plasminogen-binding protein that is exposed on the outer surface of A. baumannii. Binding of plasminogen to Tuf is at least partly dependent on lysine residues and ionic interactions. Plasminogen, once bound to Tuf can be converted to active plasmin and proteolytically degrade fibrinogen as well as the key complement component C3b. Thus, Tuf acts as a multifunctional protein that may contribute to virulence of A. baumannii by aiding in dissemination and evasion of the complement system. PMID:26230848

  11. A mouse model of Acinetobacter baumannii-associated pneumonia using a clinically isolated hypervirulent strain.


    Harris, Greg; Kuo Lee, Rhonda; Lam, Christopher K; Kanzaki, Gregory; Patel, Girishchandra B; Xu, H Howard; Chen, Wangxue


    Acinetobacter baumannii is an important emerging pathogen in health care-acquired infections and is responsible for severe nosocomial and community-acquired pneumonia. Currently available mouse models of A. baumannii pneumonia show poor colonization with little to no extrapulmonary dissemination. Here, we describe a mouse model of A. baumannii pneumonia using a clinical isolate (LAC-4 strain) that reliably reproduces the most relevant features of human pulmonary A. baumannii infection and pathology. Using this model, we have shown that LAC-4 infection induced rapid bacterial replication in the lungs, significant extrapulmonary dissemination, and severe bacteremia by 24 h postintranasal inoculation. Infected mice showed severe bronchopneumonia and dilatation and inflammatory cell infiltration in the perivascular space. More significantly, 100% of C57BL/6 and BALB/c mice succumbed to 10(8) CFU of LAC-4 inoculation within 48 h. When this model was used to assess the efficacy of antimicrobials, all mice treated with imipenem and tigecycline survived a lethal intranasal challenge, with minimal clinical signs and body weight loss. Moreover, intranasal immunization of mice with formalin-fixed LAC-4 protected 40% of mice from a lethal (100× 100% lethal dose) intraperitoneal challenge. Thus, this model offers a reproducible acute course of A. baumannii pneumonia without requiring additional manipulation of host immune status, which will facilitate the development of therapeutic agents and vaccines against A. baumannii pneumonia in humans. PMID:23689726

  12. Aptamer-nanobody based ELASA for specific detection of Acinetobacter baumannii isolates.


    Rasoulinejad, Samaneh; Gargari, Seyed Latif Mousavi


    Acinetobacter baumannii has turned into an important threat in nosocomial outbreak infections and multidrug resistance leading to high mortality rates in the 21st century. In recent years its mortality has increased by 15% which in part could be due to lack of a rapid and sensitive diagnostic test. In this work we introduced a new detection test for A. baumannii with two highly specific aptamer and nanobody molecules. High binding affinity DNA oligonucleotide aptamers toward A. baumannii were selected through 12 rounds of whole cell System Evolution of Ligands by EXponential enrichment process (SELEX). The SELEX procedures was monitored by flow cytometry. The dissociation constant and binding efficiency of the selected aptamer Aci49 was 7.547±1:353pM and 47.50%, respectively. A sandwich enzyme linked aptamer sorbent assay (ELASA) was designed with the biotinylated Aci49 aptamer and our previously developed nanobody against biofilm associated protein (Bap). The assay system was optimized with A. baumannii (ATCC 19606) and 47 clinical isolates of A. baumannii were tested. The threshold of detection in sandwich ELASA process was10(3) CFU/ml. The sensitivity of test toward the clinical isolates was 95.47%. Our results reveal that the sandwich ELASA is sensitive and specific enough for the rapid detection of A. baumannii from clinical isolates. PMID:27234880

  13. Triclosan Can Select for an AdeIJK-Overexpressing Mutant of Acinetobacter baumannii ATCC 17978 That Displays Reduced Susceptibility to Multiple Antibiotics

    PubMed Central

    Fernando, Dinesh M.; Xu, Wayne; Loewen, Peter C.; Zhanel, George G.


    In order to determine if triclosan can select for mutants of Acinetobacter baumannii ATCC 17978 that display reduced susceptibilities to antibiotics, we isolated a triclosan-resistant mutant, A. baumannii AB042, by serial passaging of A. baumannii ATCC 17978 in growth medium supplemented with triclosan. The antimicrobial susceptibility of AB042 was analyzed by the 2-fold serial dilution method. Expression of five different resistance-nodulation-division (RND) pump-encoding genes (adeB, adeG, adeJ, A1S_2818, and A1S_3217), two outer membrane porin-encoding genes (carO and oprD), and the MATE family pump-encoding gene abeM was analyzed using quantitative reverse transcriptase (qRT) PCR. A. baumannii AB042 exhibited elevated resistance to multiple antibiotics, including piperacillin-tazobactam, doxycycline, moxifloxacin, ceftriaxone, cefepime, meropenem, doripenem, ertapenem, ciprofloxacin, aztreonam, tigecycline, and trimethoprim-sulfamethoxazole, in addition to triclosan. Genome sequencing of A. baumannii AB042 revealed a 116G→V mutation in fabI, the gene encoding the target enzyme for triclosan. Expression analysis of efflux pumps showed overexpression of the AdeIJK pump, and sequencing of adeN, the gene that encodes the repressor of the adeIJK operon, revealed a 73-bp deletion which would cause a premature termination of translation, resulting in an inactive truncated AdeN protein. This work shows that triclosan can select for mutants of A. baumannii that display reduced susceptibilities to multiple antibiotics from chemically distinct classes in addition to triclosan resistance. This multidrug resistance can be explained by the overexpression of the AdeIJK efflux pump. PMID:25136007

  14. VEB-1 Extended-Spectrum β-lactamase–producing Acinetobacter baumannii, France1

    PubMed Central

    Coignard, Bruno; Carbonne, Anne; Blanckaert, Karine; Bajolet, Odile; Bernet, Claude; Verdeil, Xavier; Astagneau, Pascal; Desenclos, Jean-Claude; Nordmann, Patrice


    VEB-1 extended-spectrum β-lactamase–producing Acinetobacter baumannii was responsible for an outbreak in hospitals in France. A national alert was triggered in September 2003 when 4 hospitals reported clusters of A. baumannii infection with similar susceptibility profiles. Case definitions and laboratory guidelines were disseminated, and prospective surveillance was implemented; strains were sent to a single laboratory for characterization and typing. From April 2003 through June 2004, 53 hospitals reported 290 cases of A. baumannii infection or colonization; 275 isolates were blaVEB-1-positive and clonally related. Cases were first reported in 5 districts of northern France, then in 10 other districts in 4 regions. Within a region, interhospital spread was associated with patient transfer. In northern France, investigation and control measures led to a reduction of reported cases after January 2004. The national alert enabled early control of new clusters, demonstrating the usefulness of early warning about antimicrobial drug resistance. PMID:16965700

  15. Genes Involved in the Biosynthesis and Transport of Acinetobactin in Acinetobacter baumannii

    PubMed Central

    Hasan, Tarik; Choi, Chul Hee


    Pathogenic bacteria survive in iron-limited host environments by using several iron acquisition mechanisms. Acinetobacter baumannii, causing serious infections in compromised patients, produces an iron-chelating molecule, called acinetobactin, which is composed of equimolar quantities of 2,3-dihydroxybenzoic acid (DHBA), L-threonine, and N-hydroxyhistamine, to compete with host cells for iron. Genes that are involved in the production and transport of acinetobactin are clustered within the genome of A. baumannii. A recent study showed that entA, located outside of the acinetobactin gene cluster, plays important roles in the biosynthesis of the acinetobactin precursor DHBA and in bacterial pathogenesis. Therefore, understanding the genes that are associated with the biosynthesis and transport of acinetobactin in the bacterial genome is required. This review is intended to provide a general overview of the genes in the genome of A. baumannii that are required for acinetobactin biosynthesis and transport. PMID:25873846

  16. Outbreak of extensively drug-resistant Acinetobacter baumannii indigo-pigmented strains.


    Vilacoba, Elisabet; Almuzara, Marisa; Gulone, Lucia; Rodriguez, Rocio; Pallone, Elida; Bakai, Romina; Centrón, Daniela; Ramírez, María Soledad


    Acinetobacter baumannii pigmented strains are not common in clinical settings. Here, we report an outbreak caused by indigo-pigmented A. baumannii strains isolated in an acute care hospital in Argentina from March to September 2012. Pan-PCR assays exposed a unique pattern belonging to the recently described regional CC113(B)/CC79(P) clonal complex that confirms the relevant relationships among the indigo-pigmented A. baumannii strains. All of them were extensively drug resistant and harbored different genetic elements associated with horizontal genetic transfer, such as the transposon Tn2006, class 2 integrons, AbaR-type islands, IS125, IS26, strA, strB, florR, and the small recombinase ISCR2 associated with the sul2 gene preceded by ISAba1. PMID:23985923

  17. Acinetobactin Isomerization Enables Adaptive Iron Acquisition in Acinetobacter baumannii through pH-Triggered Siderophore Swapping.


    Shapiro, Justin A; Wencewicz, Timothy A


    Pathogenic strains of Acinetobacter baumannii excrete multiple siderophores that enhance iron scavenging from host sources. The oxazoline siderophore pre-acinetobactin undergoes an unusual non-enzymatic isomerization, producing the isoxazolidinone acinetobactin. In this study, we explored the kinetics, mechanism, and biological consequence of this siderophore swapping. Pre-acinetobactin is excreted to the extracellular space where the isomerization to acinetobactin occurs with a pH-rate profile consistent with 5-exo-tet cyclization at C5' with clean stereochemical inversion. Pre-acinetobactin persists at pH <6, and acinetobactin is rapidly formed at pH >7, matching each siderophore's pH preference for iron(III) chelation and A. baumannii growth promotion. Acinetobactin isomerization provides two siderophores for the price of one, enabling A. baumannii to sequester iron over a broad pH range likely to be encountered during the course of an infection. PMID:27624967

  18. In vitro and in vivo antimicrobial activities of gallium nitrate against multidrug-resistant Acinetobacter baumannii.


    Antunes, Luísa C S; Imperi, Francesco; Minandri, Fabrizia; Visca, Paolo


    Multidrug-resistant Acinetobacter baumannii poses a tremendous challenge to traditional antibiotic therapy. Due to the crucial role of iron in bacterial physiology and pathogenicity, we investigated iron metabolism as a possible target for anti-A. baumannii chemotherapy using gallium as an iron mimetic. Due to chemical similarity, gallium competes with iron for binding to several redox enzymes, thereby interfering with a number of essential biological reactions. We found that Ga(NO(3))(3), the active component of an FDA-approved drug (Ganite), inhibits the growth of a collection of 58 A. baumannii strains in both chemically defined medium and human serum, at concentrations ranging from 2 to 80 μM and from 4 to 64 μM, respectively. Ga(NO(3))(3) delayed the entry of A. baumannii into the exponential phase and drastically reduced bacterial growth rates. Ga(NO(3))(3) activity was strongly dependent on iron availability in the culture medium, though the mechanism of growth inhibition was independent of dysregulation of gene expression controlled by the ferric uptake regulator Fur. Ga(NO(3))(3) also protected Galleria mellonella larvae from lethal A. baumannii infection, with survival rates of ≥75%. At therapeutic concentrations for humans (28 μM plasma levels), Ga(NO(3))(3) inhibited the growth in human serum of 76% of the multidrug-resistant A. baumannii isolates tested by ≥90%, raising expectations on the therapeutic potential of gallium for the treatment of A. baumannii bloodstream infections. Ga(NO(3))(3) also showed strong synergism with colistin, suggesting that a colistin-gallium combination holds promise as a last-resort therapy for infections caused by pan-resistant A. baumannii. PMID:22964249

  19. Antibiotic-Resistant Acinetobacter baumannii Increasing Success Remains a Challenge as a Nosocomial Pathogen

    PubMed Central

    Gonzalez-Villoria, Ana Maria; Valverde-Garduno, Veronica


    Antibiotic-resistant infectious bacteria currently imply a high risk and therefore constitute a strong challenge when treating patients in hospital settings. Characterization of these species and of particular strains is a priority for the establishment of diagnostic tests and preventive procedures. The relevance of Acinetobacter baumannii as a problematic microorganism in inpatient facilities, particularly intensive care units, has increased over time. This review aims to draw attention to (i) the historical emergence of carbapenem-resistant Acinetobacter baumannii, (ii) the current status of surveillance needs in Latin America, and (iii) recent data suggesting that A. baumannii continues to spread and evolve in hospital settings. First, we present synopsis of the series of events leading to the discovery and precise identification of this microorganism in hospital settings. Then key events in the acquisition of antibiotic-resistant genes by this microorganism are summarized, highlighting the race between new antibiotic generation and emergence of A. baumannii resistant strains. Here we review the historical development of this species as an infectious threat, the current state of its distribution, and antibiotic resistance characteristics, and we discuss future prospects for its control. PMID:26966582

  20. Screening of Herbal-Based Bioactive Extract Against Carbapenem-Resistant Strain of Acinetobacter baumannii.


    Tiwari, Monalisa; Roy, Ranita; Tiwari, Vishvanath


    Acinetobacter baumannii is grouped in the ESKAPE pathogens by Infectious Disease Society of America, which is linked to high degree of morbidity, mortality, and increased costs. The high level of acquired and intrinsic resistance mechanisms of these bacteria makes it an urgent requirement to find a suitable alternative to carbapenem, a commonly prescribed drug for Acinetobacter infection. In this study, methanolic extracts of six medicinal plants were subjected to phytochemical screening and their antimicrobial activity was tested against two strains of A. baumannii (ATCC 19606, carbapenem-sensitive strain, and RS 307, carbapenem-resistant strain). Synergistic effect of the plant extracts and antibiotics was also tested. Bael or Aegle marmelos contains tannin, phenol, terpenoids, glycoside, alkaloids, coumarine, steroid, and quinones. Flowers of madar or Calotropis procera possess tannin, phenol, terpenoids, glycoside, quinone, anthraquinone, anthocyanin, coumarin, and steroid. An inhibitory growth curve was seen for both the bacterial strains when treated with A. marmelos, Curcuma longa, and leaves and flowers of C. procera. Antibiotics alone showed a small zone of inhibition, but when used with herbal extracts they exhibited larger zone of inhibition. Synergistic effect of A. marmelos and imipenem was the best against both the strains of A. baumannii. From this study, it can be concluded that extracts from A. marmelos and leaves and flowers of C. procera exhibited the most effective antibacterial activity. These herbal extracts may be used to screen the bioactive compound against the carbapenem-resistant strain of A. baumannii. PMID:26910023

  1. Biofilm-Related Genes: Analyses in Multi-Antibiotic Resistant Acinetobacter Baumannii Isolates From Mainland China

    PubMed Central

    Liu, Hui; Wu, Yong-Quan; Chen, Li-Ping; Gao, Xiang; Huang, Hao-Nan; Qiu, Fu-Lan; Wu, Ding-Chang


    Background Acinetobacter baumannii is an important nosocomial pathogen which shows a high level of mortality risk. Several papers have reported biofilm formation as a well-known pathogenic mechanism in A. baumannii infections and exceptional antibiotic resistance. The study aims to explore the potential relationships between biofilm-related genes and antimicrobial resistance. Material/Methods Samples from 122 patients with lower respiratory tract infections of A. baumannii were collected at Fujian Longyan First Hospital from January 2013 to September 2014. A. baumannii was isolated from sputum specimens. Biofilm-related genes including abaI, csuE, ompA, and bla-PER1 were analyzed by PCR. The minimum inhibitory concentration method was used to determine the sensitivity of each strain to antibiotics. Results The clinical manifestations of A. baumannii-induced lower respiratory tract infections lacked specificity. Infected patients were most commonly admitted to intensive care units (54.9%) and frequently had chronic obstructive pulmonary disease (27.0%). The detection rates of abaI and csuE were both 59.8%, and those of ompA and bla-PER1 were 100% and 0%, respectively. After genetic testing, antimicrobial resistance to amikacin, ampicillin/sulbactam, and 14 other types of antimicrobials was higher in abaI- and csuE-positive strains than in abaI- and csuE-negative strains (P<0.05). Conclusions The findings of our study suggest that abaI- and csuE-positive Acinetobacter baumannii strains are associated with a higher incidence of antibiotic resistance in 14 types of antimicrobials. PMID:27234982

  2. Biofilm-Related Genes: Analyses in Multi-Antibiotic Resistant Acinetobacter Baumannii Isolates From Mainland China.


    Liu, Hui; Wu, Yong-Quan; Chen, Li-Ping; Gao, Xiang; Huang, Hao-Nan; Qiu, Fu-Lan; Wu, Ding-Chang


    BACKGROUND Acinetobacter baumannii is an important nosocomial pathogen which shows a high level of mortality risk. Several papers have reported biofilm formation as a well-known pathogenic mechanism in A. baumannii infections and exceptional antibiotic resistance. The study aims to explore the potential relationships between biofilm-related genes and antimicrobial resistance. MATERIAL AND METHODS Samples from 122 patients with lower respiratory tract infections of A. baumannii were collected at Fujian Longyan First Hospital from January 2013 to September 2014. A. baumannii was isolated from sputum specimens. Biofilm-related genes including abaI, csuE, ompA, and bla-PER1 were analyzed by PCR. The minimum inhibitory concentration method was used to determine the sensitivity of each strain to antibiotics. RESULTS The clinical manifestations of A. baumannii-induced lower respiratory tract infections lacked specificity. Infected patients were most commonly admitted to intensive care units (54.9%) and frequently had chronic obstructive pulmonary disease (27.0%). The detection rates of abaI and csuE were both 59.8%, and those of ompA and bla-PER1 were 100% and 0%, respectively. After genetic testing, antimicrobial resistance to amikacin, ampicillin/sulbactam, and 14 other types of antimicrobials was higher in abaI- and csuE-positive strains than in abaI- and csuE-negative strains (P<0.05). CONCLUSIONS The findings of our study suggest that abaI- and csuE-positive Acinetobacter baumannii strains are associated with a higher incidence of antibiotic resistance in 14 types of antimicrobials. PMID:27234982

  3. Individual or Combined Effects of Meropenem, Imipenem, Sulbactam, Colistin, and Tigecycline on Biofilm-Embedded Acinetobacter baumannii and Biofilm Architecture.


    Wang, Yung-Chih; Kuo, Shu-Chen; Yang, Ya-Sung; Lee, Yi-Tzu; Chiu, Chun-Hsiang; Chuang, Ming-Fen; Lin, Jung-Chung; Chang, Feng-Yee; Chen, Te-Li


    Acinetobacter baumannii biofilms are difficult to eradicate. We investigated the effects of meropenem (2 mg/liter), imipenem (2 mg/liter), sulbactam (4 mg/liter), colistin (2 mg/liter), and tigecycline (2 mg/liter), alone or in combination, on biofilm-embedded carbapenem-resistant and carbapenem-susceptible A. baumannii (CRAb and CSAb, respectively) cells, as well as on the architecture of the biofilms. A. baumannii ATCC 15151 (Ab15151) and its OXA-82-overproducing transformant, along with two clinical CSAb and two clinical CRAb isolates of differing clonalities, were used. The minimal bactericidal concentrations for biofilm-embedded cells of the six tested isolates were >50-fold those of their planktonic cells. When used individually, meropenem exhibited a higher killing effect than the other four antimicrobials on biofilm-embedded CSAb cells in the colony biofilm assay. For two clinical CRAb isolates, meropenem plus sulbactam or sulbactam plus tigecycline showed >100-fold the bactericidal effect exhibited by these agents used alone after 48 h of treatment. The effect of antimicrobials on the architecture of Ab15151 biofilm emitting green fluorescence was determined by confocal laser scanning microscopy using COMSTAT software. Significant decreases in the maximum biofilm thickness were observed after exposure to meropenem and imipenem. Meropenem plus sulbactam significantly decreased the biomass and mean thickness and increased the roughness coefficient of biofilms, but sulbactam plus tigecycline only decreased the maximum and mean biofilm thickness compared to any of these agents used alone. Meropenem was active against biofilm-embedded CSAb, whereas meropenem plus sulbactam exhibited synergism against biofilm-embedded CRAb and caused significantly more damage to the biofilm architecture than did any of the agents used alone. PMID:27216052

  4. Novel Variants of AbaR Resistance Islands with a Common Backbone in Acinetobacter baumannii Isolates of European Clone II

    PubMed Central

    Povilonis, Justas; Sužiedėlienė, Edita


    In this study, the genetic organization of three novel genomic antibiotic resistance islands (AbaRs) in Acinetobacter baumannii isolates belonging to group of European clone II (EC II) comM integrated sequences of 18-, 21-, and 23-kb resistance islands were determined. These resistance islands carry the backbone of AbaR-type transposon structures, which are composed of the transposition module coding for potential transposition proteins and other genes coding for the intact universal stress protein (uspA), sulfate permease (sul), and proteins of unknown function. The antibiotic resistance genes strA, strB, tetB, and tetR and insertion sequence CR2 element were found to be inserted into the AbaR transposons. GenBank homology searches indicated that they are closely related to the AbaR sequences found integrated in comM in strains of EC II (A. baumannii strains 1656-2 and TCDC-AB0715) and AbaR4 integrated in another location of A. baumannii AB0057 (EC I). All of the AbaRs showed structural similarity to the previously described AbaR4 island and share a 12,008-bp backbone. AbaRs contain Tn1213, Tn2006, and the multiple fragments which could be derived from transposons Tn3, Tn10, Tn21, Tn1000, Tn5393, and Tn6020, the insertion sequences IS26, ISAba1, ISAba14, and ISCR2, and the class 1 integron. Moreover, chromosomal DNA was inserted into distinct regions of the AbaR backbone. Sequence analysis suggested that the AbaR-type transposons have evolved through insertions, deletions, and homologous recombination. AbaR islands, sharing the core structure similar to AbaR4, appeared to be distributed in isolates of EC I and EC II via integration into distinct genomic sites, i.e., pho and comM, respectively. PMID:22290980

  5. Wide Dissemination of GES-Type Carbapenemases in Acinetobacter baumannii Isolates in Kuwait

    PubMed Central

    Bonnin, Rémy A.; Rotimi, Vincent O.; Al Hubail, Mona; Gasiorowski, Elise; Al Sweih, Noura; Poirel, Laurent


    Acinetobacter baumannii is an opportunistic pathogen that is an important source of nosocomial infections. Production of extended-spectrum β-lactamases (ESBLs) of the GES type in A. baumannii has been increasingly reported, and some of these GES-type enzymes possess some carbapenemase activity. Our aim was to analyze the resistance determinants and the clonal relationships of carbapenem-nonsusceptible A. baumannii clinical isolates recovered from hospitals in Kuwait. A total of 63 isolates were analyzed, and all were found to be positive for blaGES-type genes. One isolate harbored the blaGES-14 gene encoding an ESBL with significant carbapenemase activity, whereas the other isolates harbored the blaGES-11 ESBL gene. Thirty-three isolates coharbored the blaOXA-23 and blaGES-11 genes. Analyses of the genetic locations indicated that the blaGES-11/-14 genes were plasmid located. It is noteworthy that the blaOXA-23 and blaGES-11 genes were colocated onto a single plasmid. Nine different pulsotypes were observed among the 63 isolates. This study showed the emergence of GES-type ESBLs in A. baumannii in Kuwait, further suggesting that the Middle East region might be a reservoir for carbapenemase-producing A. baumannii. PMID:23089751

  6. Emergence of multidrug-resistant Acinetobacter baumannii producing OXA-23 Carbapenemase in Qatar.


    Rolain, J-M; Loucif, L; Al-Maslamani, M; Elmagboul, E; Al-Ansari, N; Taj-Aldeen, S; Shaukat, A; Ahmedullah, H; Hamed, M


    The objective of our study was to describe the molecular support of carbapenem resistance from randomly selected clinical isolates of multidrug-resistant (MDR) Acinetobacter baumannii as a pilot study from the Hamad Medical Corporation (HMC), Qatar. Results of our report will be used to study carbapenemases using molecular techniques in all isolated MDR A. baumannii. Forty-eight MDR A. baumannii were randomly selected from isolates preserved at HMC. Identification of all isolates was confirmed by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. Antibiotic resistance was tested phenotypically by Phoenix and confirmed by Etest. The molecular support of carbapenemases (bla OXA-23, bla OXA-24, bla OXA-58, bla NDM) was investigated by real-time PCR. The epidemiologic relatedness of the isolates was verified by phylogenetic analysis based on partial sequences of CsuE and bla OXA-51 genes. All 48 isolates were identified as A. baumannii and were confirmed to be resistant to most antibiotics, especially meropenem, imipenems, ciprofloxacin, levofloxacin, amikacin, gentamicin and most of the β-lactams; they were sensitive to colistin. All the isolates were positive for bla OXA-23 and negative for the other tested carbapenemase genes. Clonality analysis demonstrated that different lineages were actually circulating in Qatar; and we suggest that an outbreak occurred in the medical intensive care unit of HMC between 2011 and 2012. Here we report the emergence of MDR A. baumannii producing the carbapenemase OXA-23 in Qatar. PMID:27054039

  7. The induction and identification of novel Colistin resistance mutations in Acinetobacter baumannii and their implications

    PubMed Central

    Thi Khanh Nhu, Nguyen; Riordan, David W.; Do Hoang Nhu, Tran; Thanh, Duy Pham; Thwaites, Guy; Huong Lan, Nguyen Phu; Wren, Brendan W.; Baker, Stephen; Stabler, Richard A


    Acinetobacter baumannii is a significant cause of opportunistic hospital acquired infection and has been identified as an important emerging infection due to its high levels of antimicrobial resistance. Multidrug resistant A. baumannii has risen rapidly in Vietnam, where colistin is becoming the drug of last resort for many infections. In this study we generated spontaneous colistin resistant progeny (up to >256 μg/μl) from four colistin susceptible Vietnamese isolates and one susceptible reference strain (MIC <1.5 μg/μl). Whole genome sequencing was used to identify single nucleotide mutations that could be attributed to the reduced colistin susceptibility. We identified six lpxACD and three pmrB mutations, the majority of which were novel. In addition, we identified further mutations in six A. baumannii genes (vacJ, pldA, ttg2C, pheS and conserved hypothetical protein) that we hypothesise have a role in reduced colistin susceptibility. This study has identified additional mutations that may be associated with colistin resistance through novel resistance mechanisms. Our work further demonstrates how rapidly A. baumannii can generate resistance to a last resort antimicrobial and highlights the need for improved surveillance to identified A. baumannii with an extensive drug resistance profile. PMID:27329501

  8. Effect of carbonyl cyanide 3-chlorophenylhydrazone (CCCP) on killing Acinetobacter baumannii by colistin.


    Park, Young Kyoung; Ko, Kwan Soo


    We investigated the effect of cyanide 3-chlorophenylhydrazone (CCCP) and other efflux pump inhibitors (EPIs) on the colistin susceptibility in Acinetobacter baumannii. While minimum inhibitory concentrations (MICs) of colistin in all colistin-resistant strains decreased significantly with 25 μM of CCCP and 2,4-dinitrophenol (DNP), phenyl-arginine-β-naphthylamide (PAβN), and reserpine did not decrease the colistin MICs. However, CCCP and DNP as well as PAβN and reserpine did not have a significant effect on the MICs of the other agents. Efflux pump gene expressions in colistin-resistant strains were not increased compared with those in colistin-susceptible strains. When only 5X MIC of colistin (5 mg/L) was provided to a colistin-susceptible A. baumannii strain, the bacterial cell number was reduced by 9 h after exposure to colistin, but regrowth was observed. When CCCP was added to colistin, bacterial cells were completely killed after 24 to 48 h of incubation, which was not due to the toxicity of CCCP itself. Colistin resistance in A. baumannii may not be due to efflux pumps. Our present study suggests that bacterial cells with reduced metabolic activity by CCCP are more susceptible to colistin in A. baumannii. It may show the possibility that combined therapy with colistin and other antimicrobial agents could effective against A. baumannii infections. PMID:25557480

  9. Identification and Characterization of Type II Toxin-Antitoxin Systems in the Opportunistic Pathogen Acinetobacter baumannii

    PubMed Central

    Jurėnaitė, Milda; Markuckas, Arvydas


    Acinetobacter baumannii is an opportunistic pathogen that causes nosocomial infections. Due to the ability to persist in the clinical environment and rapidly acquire antibiotic resistance, multidrug-resistant A. baumannii clones have spread in medical units in many countries in the last decade. The molecular basis of the emergence and spread of the successful multidrug-resistant A. baumannii clones is not understood. Bacterial toxin-antitoxin (TA) systems are abundant genetic loci harbored in low-copy-number plasmids and chromosomes and have been proposed to fulfill numerous functions, from plasmid stabilization to regulation of growth and death under stress conditions. In this study, we have performed a thorough bioinformatic search for type II TA systems in genomes of A. baumannii strains and estimated at least 15 possible TA gene pairs, 5 of which have been shown to be functional TA systems. Three of them were orthologs of bacterial and archaeal RelB/RelE, HicA/HicB, and HigB/HigA systems, and others were the unique SplT/SplA and CheT/CheA TA modules. The toxins of all five TA systems, when expressed in Escherichia coli, inhibited translation, causing RNA degradation. The HigB/HigA and SplT/SplA TA pairs of plasmid origin were highly prevalent in clinical multidrug-resistant A. baumannii isolates from Lithuanian hospitals belonging to the international clonal lineages known as European clone I (ECI) and ECII. PMID:23667234

  10. Effects of silver nanoparticles in combination with antibiotics on the resistant bacteria Acinetobacter baumannii.


    Wan, Guoqing; Ruan, Lingao; Yin, Yu; Yang, Tian; Ge, Mei; Cheng, Xiaodong


    Acinetobacter baumannii resistance to carbapenem antibiotics is a serious clinical challenge. As a newly developed technology, silver nanoparticles (AgNPs) show some excellent characteristics compared to older treatments, and are a candidate for combating A. baumannii infection. However, its mechanism of action remains unclear. In this study, we combined AgNPs with antibiotics to treat carbapenem-resistant A. baumannii (aba1604). Our results showed that single AgNPs completely inhibited A. baumannii growth at 2.5 μg/mL. AgNP treatment also showed synergistic effects with the antibiotics polymixin B and rifampicin, and an additive effect with tigecyline. In vivo, we found that AgNPs-antibiotic combinations led to better survival ratios in A. baumannii-infected mouse peritonitis models than that by single drug treatment. Finally, we employed different antisense RNA-targeted Escherichia coli strains to elucidate the synergistic mechanism involved in bacterial responses to AgNPs and antibiotics. PMID:27574420

  11. Effects of silver nanoparticles in combination with antibiotics on the resistant bacteria Acinetobacter baumannii

    PubMed Central

    Wan, Guoqing; Ruan, Lingao; Yin, Yu; Yang, Tian; Ge, Mei; Cheng, Xiaodong


    Acinetobacter baumannii resistance to carbapenem antibiotics is a serious clinical challenge. As a newly developed technology, silver nanoparticles (AgNPs) show some excellent characteristics compared to older treatments, and are a candidate for combating A. baumannii infection. However, its mechanism of action remains unclear. In this study, we combined AgNPs with antibiotics to treat carbapenem-resistant A. baumannii (aba1604). Our results showed that single AgNPs completely inhibited A. baumannii growth at 2.5 μg/mL. AgNP treatment also showed synergistic effects with the antibiotics polymixin B and rifampicin, and an additive effect with tigecyline. In vivo, we found that AgNPs–antibiotic combinations led to better survival ratios in A. baumannii-infected mouse peritonitis models than that by single drug treatment. Finally, we employed different antisense RNA-targeted Escherichia coli strains to elucidate the synergistic mechanism involved in bacterial responses to AgNPs and antibiotics. PMID:27574420

  12. The induction and identification of novel Colistin resistance mutations in Acinetobacter baumannii and their implications.


    Thi Khanh Nhu, Nguyen; Riordan, David W; Do Hoang Nhu, Tran; Thanh, Duy Pham; Thwaites, Guy; Huong Lan, Nguyen Phu; Wren, Brendan W; Baker, Stephen; Stabler, Richard A


    Acinetobacter baumannii is a significant cause of opportunistic hospital acquired infection and has been identified as an important emerging infection due to its high levels of antimicrobial resistance. Multidrug resistant A. baumannii has risen rapidly in Vietnam, where colistin is becoming the drug of last resort for many infections. In this study we generated spontaneous colistin resistant progeny (up to >256 μg/μl) from four colistin susceptible Vietnamese isolates and one susceptible reference strain (MIC <1.5 μg/μl). Whole genome sequencing was used to identify single nucleotide mutations that could be attributed to the reduced colistin susceptibility. We identified six lpxACD and three pmrB mutations, the majority of which were novel. In addition, we identified further mutations in six A. baumannii genes (vacJ, pldA, ttg2C, pheS and conserved hypothetical protein) that we hypothesise have a role in reduced colistin susceptibility. This study has identified additional mutations that may be associated with colistin resistance through novel resistance mechanisms. Our work further demonstrates how rapidly A. baumannii can generate resistance to a last resort antimicrobial and highlights the need for improved surveillance to identified A. baumannii with an extensive drug resistance profile. PMID:27329501

  13. Novel Engineered Peptides of a Phage Lysin as Effective Antimicrobials against Multidrug-Resistant Acinetobacter baumannii.


    Thandar, Mya; Lood, Rolf; Winer, Benjamin Y; Deutsch, Douglas R; Euler, Chad W; Fischetti, Vincent A


    Acinetobacter baumannii is a Gram-negative bacterial pathogen responsible for a range of nosocomial infections. The recent rise and spread of multidrug-resistant A. baumannii clones has fueled a search for alternative therapies, including bacteriophage endolysins with potent antibacterial activities. A common feature of these lysins is the presence of a highly positively charged C-terminal domain with a likely role in promoting outer membrane penetration. In the present study, we show that the C-terminal amino acids 108 to 138 of phage lysin PlyF307, named P307, alone were sufficient to kill A. baumannii (>3 logs). Furthermore, P307 could be engineered for improved activity, the most active derivative being P307SQ-8C (>5-log kill). Both P307 and P307SQ-8C showed high in vitro activity against A. baumannii in biofilms. Moreover, P307SQ-8C exhibited MICs comparable to those of levofloxacin and ceftazidime and acted synergistically with polymyxin B. Although the peptides were shown to kill by disrupting the bacterial cytoplasmic membrane, they did not lyse human red blood cells or B cells; however, serum was found to be inhibitory to lytic activity. In a murine model of A. baumannii skin infection, P307SQ-8C reduced the bacterial burden by ∼2 logs in 2 h. This study demonstrates the prospect of using peptide derivatives from bacteriophage lysins to treat topical infections and remove biofilms caused by Gram-negative pathogens. PMID:26856847

  14. Carbapenem-Resistant Acinetobacter baumannii: Concomitant Contamination of Air and Environmental Surfaces.


    Shimose, Luis A; Masuda, Eriko; Sfeir, Maroun; Berbel Caban, Ana; Bueno, Maria X; dePascale, Dennise; Spychala, Caressa N; Cleary, Timothy; Namias, Nicholas; Kett, Daniel H; Doi, Yohei; Munoz-Price, L Silvia


    OBJECTIVE To concomitantly determine the differential degrees of air and environmental contamination by Acinetobacter baumannii based on anatomic source of colonization and type of ICU layout (single-occupancy vs open layout). DESIGN Longitudinal prospective surveillance study of air and environmental surfaces in patient rooms. SETTING A 1,500-bed public teaching hospital in Miami, Florida. PATIENTS Consecutive A. baumannii-colonized patients admitted to our ICUs between October 2013 and February 2014. METHODS Air and environmental surfaces of the rooms of A. baumannii-colonized patients were sampled daily for up to 10 days. Pulsed-field gel electrophoresis (PFGE) was used to type and match the matching air, environmental, and clinical A. baumannii isolates. RESULTS A total of 25 A. baumannii-colonized patients were identified during the study period; 17 were colonized in the respiratory tract and 8 were colonized in the rectum. In rooms with rectally colonized patients, 38.3% of air samples were positive for A. baumannii; in rooms of patients with respiratory colonization, 13.1% of air samples were positive (P=.0001). In rooms with rectally colonized patients, 15.5% of environmental samples were positive for A. baumannii; in rooms of patients with respiratory colonization, 9.5% of environmental samples were positive (P=.02). The rates of air contamination in the open-layout and single-occupancy ICUs were 17.9% and 21.8%, respectively (P=.5). Environmental surfaces were positive in 9.5% of instances in open-layout ICUs versus 13.4% in single-occupancy ICUs (P=.09). CONCLUSIONS Air and environmental surface contaminations were significantly greater among rectally colonized patients; however, ICU layout did not influence the rate of contamination. Infect Control Hosp Epidemiol 2016;37:777-781. PMID:27045768

  15. Clinical predictors of Pseudomonas aeruginosa or Acinetobacter baumannii bacteremia in patients admitted to the ED.


    Kang, Cheol-In; Chung, Doo Ryeon; Peck, Kyong Ran; Song, Jae-Hoon


    The identification of clinical characteristics that could identify patients at high risk for Pseudomonas aeruginosa or Acinetobacter baumannii bacteremia would aid clinicians in the appropriate management of these life-threatening conditions, especially in patients admitted to the emergency department (ED) with community-onset infections. To determine clinical risk factors for P. aeruginosa or A. baumannii bacteremia in patients with community-onset gram-negative bacteremia (GNB), a post hoc analysis of a nationwide bacteremia surveillance database including patients with microbiologically documented GNB was performed. Ninety-six patients with P. aeruginosa or A. baumannii bacteremia were compared with 1230 patients with Escherichia coli or Klebsiella pneumoniae bacteremia. A solid tumor or hematologic malignancy was more likely to be associated with P. aeruginosa or A. baumannii bacteremia, whereas concurrent neurologic disease was less frequently seen. In regards to the site of infection, pneumonia was more common in P. aeruginosa or A. baumannii bacteremia, whereas a urinary tract infection was less frequently seen. Factors associated with P. aeruginosa or A. baumannii bacteremia in multivariate analysis included pneumonia (odds ratio [OR], 3.60; 95% confidence interval [CI], 1.86-6.99), hematologic malignancy (OR, 2.71; 95% CI, 1.26-5.84), male sex (OR, 2.17; 95% CI, 1.31-3.58), solid tumor (OR, 1.89; 95% CI, 1.15-3.12), and health-care-associated infection (OR, 1.88; 95% CI, 1.48-2.41). Our data suggest that an initial empirical antimicrobial coverage of P. aeruginosa or A. baumannii bacteremia should be seriously considered in patients with pneumonia, a hematologic malignancy, solid tumor, or health-care-associated infection, when GNB is suspected, even in community-onset infections. PMID:22030178

  16. RT-PCR and statistical analyses of adeABC expression in clinical isolates of Acinetobacter calcoaceticus-Acinetobacter baumannii complex.


    Ruzin, Alexey; Immermann, Frederick W; Bradford, Patricia A


    The relationship between expression of adeABC and minimal inhibitory concentration (MIC) of tigecycline was investigated by RT-PCR and statistical analyses in a population of 106 clinical isolates (MIC range, 0.0313-16 microg/ml) of Acinetobacter calcoaceticus-Acinetobacter baumannii complex. There was a statistically significant linear relationship (p < 0.0001) between log-transformed expression values and log-transformed MIC values, indicating that overexpression of AdeABC efflux pump is a prevalent mechanism for decreased susceptibility to tigecycline in A. calcoaceticus-A. baumannii complex. PMID:20438348

  17. Multidrug-Resistant Acinetobacter baumannii in Veterinary Clinics, Germany

    PubMed Central

    Prenger-Berninghoff, Ellen; Weiss, Reinhard; van der Reijden, Tanny; van den Broek, Peterhans; Baljer, Georg; Dijkshoorn, Lenie


    An increase in prevalence of multidrug-resistant Acinetobacter spp. in hospitalized animals was observed at the Justus-Liebig-University (Germany). Genotypic analysis of 56 isolates during 2000–2008 showed 3 clusters that corresponded to European clones I–III. Results indicate spread of genotypically related strains within and among veterinary clinics in Germany. PMID:21888812

  18. Identification of Acinetobacter baumannii Serum-Associated Antibiotic Efflux Pump Inhibitors

    PubMed Central

    Blanchard, Catlyn; Barnett, Pamela; Perlmutter, Jessamyn


    Adaptive antibiotic resistance is a newly described phenomenon by which Acinetobacter baumannii induces efflux pump activity in response to host-associated environmental cues that may, in part, account for antibiotic treatment failures against clinically defined susceptible strains. To that end, during adaptation to growth in human serum, the organism induces approximately 22 putative efflux-associated genes and displays efflux-mediated minocycline tolerance at antibiotic concentrations corresponding to patient serum levels. Here, we show that in addition to minocycline, growth in human serum elicits A. baumannii efflux-mediated tolerance to the antibiotics ciprofloxacin, meropenem, tetracycline, and tigecycline. Moreover, using a whole-cell high-throughput screen and secondary assays, we identified novel serum-associated antibiotic efflux inhibitors that potentiated the activities of antibiotics toward serum-grown A. baumannii. Two compounds, Acinetobacter baumannii efflux pump inhibitor 1 (ABEPI1) [(E)-4-((4-chlorobenzylidene)amino)benezenesulfonamide] and ABEPI2 [N-tert-butyl-2-(1-tert-butyltetrazol-5-yl)sulfanylacetamide], were shown to lead to minocycline accumulation within A. baumannii during serum growth and inhibit the efflux potential of the organism. While both compounds also inhibited the antibiotic efflux properties of the bacterial pathogen Pseudomonas aeruginosa, they did not display significant cytotoxicity toward human cells or mammalian Ca2+ channel inhibitory effects, suggesting that ABEPI1 and ABEPI2 represent promising structural scaffolds for the development of new classes of bacterial antibiotic efflux pump inhibitors that can be used to potentiate the activities of current and future antibiotics for the therapeutic intervention of Gram-negative bacterial infections. PMID:25114126

  19. Novel Aminoglycoside Resistance Transposons and Transposon-Derived Circular Forms Detected in Carbapenem-Resistant Acinetobacter baumannii Clinical Isolates.


    Karah, Nabil; Dwibedi, Chinmay Kumar; Sjöström, Karin; Edquist, Petra; Johansson, Anders; Wai, Sun Nyunt; Uhlin, Bernt Eric


    Acinetobacter baumannii has emerged as an important opportunistic pathogen equipped with a growing number of antibiotic resistance genes. Our study investigated the molecular epidemiology and antibiotic resistance features of 28 consecutive carbapenem-resistant clinical isolates of A. baumannii collected throughout Sweden in 2012 and 2013. The isolates mainly belonged to clonal complexes (CCs) with an extensive international distribution, such as CC2 (n = 16) and CC25 (n = 7). Resistance to carbapenems was related to blaOXA-23 (20 isolates), blaOXA-24/40-like (6 isolates), blaOXA-467 (1 isolate), and ISAba1-blaOXA-69 (1 isolate). Ceftazidime resistance was associated with blaPER-7 in the CC25 isolates. Two classical point mutations were responsible for resistance to quinolones in all the isolates. Isolates with high levels of resistance to aminoglycosides carried the 16S rRNA methylase armA gene. The isolates also carried a variety of genes encoding aminoglycoside-modifying enzymes. Several novel structures involved in aminoglycoside resistance were identified, including Tn6279, ΔTn6279, Ab-ST3-aadB, and different assemblies of Tn6020 and TnaphA6. Importantly, a number of circular forms related to the IS26 or ISAba125 composite transposons were detected. The frequent occurrence of these circular forms in the populations of several isolates indicates a potential role of these circular forms in the dissemination of antibiotic resistance genes. PMID:26824943

  20. Novel Aminoglycoside Resistance Transposons and Transposon-Derived Circular Forms Detected in Carbapenem-Resistant Acinetobacter baumannii Clinical Isolates

    PubMed Central

    Dwibedi, Chinmay Kumar; Sjöström, Karin; Edquist, Petra; Wai, Sun Nyunt; Uhlin, Bernt Eric


    Acinetobacter baumannii has emerged as an important opportunistic pathogen equipped with a growing number of antibiotic resistance genes. Our study investigated the molecular epidemiology and antibiotic resistance features of 28 consecutive carbapenem-resistant clinical isolates of A. baumannii collected throughout Sweden in 2012 and 2013. The isolates mainly belonged to clonal complexes (CCs) with an extensive international distribution, such as CC2 (n = 16) and CC25 (n = 7). Resistance to carbapenems was related to blaOXA-23 (20 isolates), blaOXA-24/40-like (6 isolates), blaOXA-467 (1 isolate), and ISAba1-blaOXA-69 (1 isolate). Ceftazidime resistance was associated with blaPER-7 in the CC25 isolates. Two classical point mutations were responsible for resistance to quinolones in all the isolates. Isolates with high levels of resistance to aminoglycosides carried the 16S rRNA methylase armA gene. The isolates also carried a variety of genes encoding aminoglycoside-modifying enzymes. Several novel structures involved in aminoglycoside resistance were identified, including Tn6279, ΔTn6279, Ab-ST3-aadB, and different assemblies of Tn6020 and TnaphA6. Importantly, a number of circular forms related to the IS26 or ISAba125 composite transposons were detected. The frequent occurrence of these circular forms in the populations of several isolates indicates a potential role of these circular forms in the dissemination of antibiotic resistance genes. PMID:26824943

  1. Characterisation of Pellicles Formed by Acinetobacter baumannii at the Air-Liquid Interface

    PubMed Central

    Nait Chabane, Yassine; Marti, Sara; Rihouey, Christophe; Alexandre, Stéphane; Hardouin, Julie; Lesouhaitier, Olivier; Vila, Jordi; Kaplan, Jeffrey B.; Jouenne, Thierry; Dé, Emmanuelle


    The clinical importance of Acinetobacter baumannii is partly due to its natural ability to survive in the hospital environment. This persistence may be explained by its capacity to form biofilms and, interestingly, A. baumannii can form pellicles at the air-liquid interface more readily than other less pathogenic Acinetobacter species. Pellicles from twenty-six strains were morphologically classified into three groups: I) egg-shaped (27%); II) ball-shaped (50%); and III) irregular pellicles (23%). One strain representative of each group was further analysed by Brewster’s Angle Microscopy to follow pellicle development, demonstrating that their formation did not require anchoring to a solid surface. Total carbohydrate analysis of the matrix showed three main components: Glucose, GlcNAc and Kdo. Dispersin B, an enzyme that hydrolyzes poly-N-acetylglucosamine (PNAG) polysaccharide, inhibited A. baumannii pellicle formation, suggesting that this exopolysaccharide contributes to pellicle formation. Also associated with the pellicle matrix were three subunits of pili assembled by chaperon-usher systems: the major CsuA/B, A1S_1510 (presented 45% of identity with the main pilin F17-A from enterotoxigenic Escherichia coli pili) and A1S_2091. The presence of both PNAG polysaccharide and pili systems in matrix of pellicles might contribute to the virulence of this emerging pathogen. PMID:25360550

  2. Characterisation of pellicles formed by Acinetobacter baumannii at the air-liquid interface.


    Nait Chabane, Yassine; Marti, Sara; Rihouey, Christophe; Alexandre, Stéphane; Hardouin, Julie; Lesouhaitier, Olivier; Vila, Jordi; Kaplan, Jeffrey B; Jouenne, Thierry; Dé, Emmanuelle


    The clinical importance of Acinetobacter baumannii is partly due to its natural ability to survive in the hospital environment. This persistence may be explained by its capacity to form biofilms and, interestingly, A. baumannii can form pellicles at the air-liquid interface more readily than other less pathogenic Acinetobacter species. Pellicles from twenty-six strains were morphologically classified into three groups: I) egg-shaped (27%); II) ball-shaped (50%); and III) irregular pellicles (23%). One strain representative of each group was further analysed by Brewster's Angle Microscopy to follow pellicle development, demonstrating that their formation did not require anchoring to a solid surface. Total carbohydrate analysis of the matrix showed three main components: Glucose, GlcNAc and Kdo. Dispersin B, an enzyme that hydrolyzes poly-N-acetylglucosamine (PNAG) polysaccharide, inhibited A. baumannii pellicle formation, suggesting that this exopolysaccharide contributes to pellicle formation. Also associated with the pellicle matrix were three subunits of pili assembled by chaperon-usher systems: the major CsuA/B, A1S_1510 (presented 45% of identity with the main pilin F17-A from enterotoxigenic Escherichia coli pili) and A1S_2091. The presence of both PNAG polysaccharide and pili systems in matrix of pellicles might contribute to the virulence of this emerging pathogen. PMID:25360550

  3. Tigecycline Efflux as a Mechanism for Nonsusceptibility in Acinetobacter baumannii.


    Peleg, Anton Y; Adams, Jennifer; Paterson, David L


    Tigecycline has an extended spectrum of in vitro antimicrobial activities, including that against multidrug-resistant Acinetobacter. After identifying bloodstream isolates of Acinetobacter with reduced susceptibilities to tigecycline, we performed a study to assess tigecycline efflux mediated by the resistance-nodulation-division-type transporter AdeABC. After exposure of two tigecycline-nonsusceptible isolates to the efflux pump inhibitor phenyl-arginine-beta-naphthylamide (PABN), a fourfold reduction in the tigecycline MIC was observed. Both tigecycline-susceptible and -nonsusceptible isolates were found to carry the gene coding for the transmembrane component of the AdeABC pump, adeB, and the two-component regulatory system comprising adeS and adeR. Previously unreported point mutations were identified in the regulatory system in tigecycline-nonsusceptible isolates. Real-time PCR identified 40-fold and 54-fold increases in adeB expression in the two tigecycline-nonsusceptible isolates compared to that in a tigecycline-susceptible isolate. In vitro exposure of a tigecycline-susceptible clinical strain to tigecycline caused a rapid rise in the MIC of tigecycline from 2 microg/ml to 24 microg/ml, which was reversible with PABN. A 25-fold increase in adeB expression was observed in a comparison between this tigecycline-susceptible isolate and its isogenic tigecycline-nonsusceptible mutant. These results indicate that an efflux-based mechanism plays a role in reduced tigecycline susceptibility in Acinetobacter. PMID:17420217

  4. Novel Approach To Optimize Synergistic Carbapenem-Aminoglycoside Combinations against Carbapenem-Resistant Acinetobacter baumannii

    PubMed Central

    Yadav, Rajbharan; Landersdorfer, Cornelia B.; Nation, Roger L.; Boyce, John D.


    Acinetobacter baumannii is among the most dangerous pathogens and emergence of resistance is highly problematic. Our objective was to identify and rationally optimize β-lactam-plus-aminoglycoside combinations via novel mechanism-based modeling that synergistically kill and prevent resistance of carbapenem-resistant A. baumannii. We studied combinations of 10 β-lactams and three aminoglycosides against four A. baumannii strains, including two imipenem-intermediate (MIC, 4 mg/liter) and one imipenem-resistant (MIC, 32 mg/liter) clinical isolate, using high-inoculum static-concentration time-kill studies. We present the first application of mechanism-based modeling for killing and resistance of A. baumannii using Monte Carlo simulations of human pharmacokinetics to rationally optimize combination dosage regimens for immunocompromised, critically ill patients. All monotherapies achieved limited killing (≤2.3 log10) of A. baumannii ATCC 19606 followed by extensive regrowth for aminoglycosides. Against this strain, imipenem-plus-aminoglycoside combinations yielded more rapid and extensive killing than other β-lactam-plus-aminoglycoside combinations. Imipenem at 8 mg/liter combined with an aminoglycoside yielded synergistic killing (>5 log10) and prevented regrowth of all four strains. Modeling demonstrated that imipenem likely killed the aminoglycoside-resistant population and vice versa and that aminoglycosides enhanced the target site penetration of imipenem. Against carbapenem-resistant A. baumannii (MIC, 32 mg/liter), optimized combination regimens (imipenem at 4 g/day as a continuous infusion plus tobramycin at 7 mg/kg of body weight every 24 h) were predicted to achieve >5 log10 killing without regrowth in 98.2% of patients. Bacterial killing and suppression of regrowth were best achieved for combination regimens with unbound imipenem steady-state concentrations of at least 8 mg/liter. Imipenem-plus-aminoglycoside combination regimens are highly promising and

  5. Predictors of mortality in patients with extensively drug-resistant Acinetobacter baumannii pneumonia receiving colistin therapy.


    Choi, Ik Sung; Lee, Yu Ji; Wi, Yu Mi; Kwan, Byung Soo; Jung, Kae Hwa; Hong, Woong Pyo; Kim, June Myong


    The ratio of the area under the free (unbound) concentration-time curve to minimum inhibitory concentration (fAUC/MIC) was proposed to be the pharmacokinetic/pharmacodynamic index most strongly linked to the antibacterial effect of colistin against Acinetobacter baumannii. A retrospective study of patients who received colistin to treat pneumonia caused by extensively drug-resistant (XDR) A. baumannii over a 4-year period was performed to assess the impact of the colistin MIC on mortality. A total of 227 patients were included in the analysis. The 7-day and 14-day mortality rates of patients with XDR A. baumannii pneumonia receiving colistin therapy were 15.0% and 23.8%, respectively. In the multivariate analysis, Acute Physiology and Chronic Health Evaluation (APACHE) II score, days from index culture to first dose of colistin, underlying tumour and septic shock at presentation were independent predictors of mortality in patients with XDR A. baumannii pneumonia receiving colistin therapy. In the univariate analysis, the colistin dose based on ideal body weight (IBW) correlated with patient outcome. Therefore, the use of IBW appeared to be more appropriate to calculate the colistin dosage. In addition, these results highlight the clinical significance of colistin MIC in patients with XDR A. baumannii pneumonia receiving colistin therapy. Although MICs were in the 'susceptible' range, patients infected with isolates with high colistin MICs showed a poorer clinical response rate than patients infected with isolates with low colistin MICs. Further clinical studies are needed to evaluate the roles of colistin MIC for predicting mortality in XDR A. baumannii pneumonia with a high colistin MIC. PMID:27423416

  6. Diversity of multi-drug resistant Acinetobacter baumannii population in a major hospital in Kuwait

    PubMed Central

    Vali, Leila; Dashti, Khadija; Opazo-Capurro, Andrés F.; Dashti, Ali A.; Al Obaid, Khaled; Evans, Benjamin A.


    Acinetobacter baumannii is one of the most important opportunistic pathogens that causes serious health care associated complications in critically ill patients. In the current study we report on the diversity of the clinical multi-drug resistant (MDR) A. baumannii in Kuwait by molecular characterization. One hundred A. baumannii were isolated from one of the largest governmental hospitals in Kuwait. Following the identification of the isolates by molecular methods, the amplified blaOXA-51-like gene product of one isolate (KO-12) recovered from blood showed the insertion of the ISAba19 at position 379 in blaOXA-78. Of the 33 MDR isolates, 28 (85%) contained blaOXA-23, 2 (6%) blaOXA-24 and 6 (18%) blaPER-1 gene. We did not detect blaOXA-58, blaVIM, blaIMP, blaGES, blaVEB, and blaNDM genes in any of the tested isolates. In three blaPER-1 positive isolates the genetic environment of blaPER-1 consisted of two copies of ISPa12 (tnpiA1) surrounding the blaPER-1 gene on a highly stable plasmid of ca. 140-kb. Multilocus-sequence typing (MLST) analysis of the 33 A. baumannii isolates identified 20 different STs, of which six (ST-607, ST-608, ST-609, ST-610, ST-611, and ST-612) were novel. Emerging STs such as ST15 (identified for the first time in the Middle East), ST78 and ST25 were also detected. The predominant clonal complex was CC2. Pulsed-field gel electrophoresis and MLST defined the MDR isolates as multi-clonal with diverse lineages. Our results lead us to believe that A. baumannii is diverse in clonal origins and/or is undergoing clonal expansion continuously while multiple lineages of MDR A. baumannii circulate in hospital ward simultaneously. PMID:26257720

  7. Ultraviolet C light for Acinetobacter baumannii wound infections in mice: Potential use for battlefield wound decontamination?

    PubMed Central

    Dai, Tianhong; Murray, Clinton K.; Vrahas, Mark S.; Baer, David G.; Tegos, George P.; Hamblin, Michael R.


    BACKGROUND Since the beginning of the conflicts in the Middle East, US Army physicians have noted a high rate of multidrug-resistant Acinetobacter baumannii infections among US soldiers wounded and initially treated in Iraq. In this study, we investigated the use of ultraviolet C (UVC) light for prevention of multidrug-resistant A. baumannii wound infections using mouse models. METHODS Partial-thickness skin abrasions and full-thickness burns in mice were infected with a multidrug-resistant A. baumannii isolate recovered from a wounded US soldier deployed to Iraq. The luxCDABE operon, which was contained in plasmid pMF 385, was cloned into the A. baumannii strain. This allowed real-time monitoring of the extent of infection in mice using bioluminescence imaging. UVC light was delivered to the mouse wounds at 30 minutes after the inoculation of A. baumannii. Groups of infected mouse wounds without being exposed to UVC served as the controls. RESULTS In vitro studies demonstrated that A. baumannii cells were inactivated at UVC exposures much lower than those needed for a similar effect on mammalian cells. It was observed in animal studies that UVC (3.24 J/cm2 for abrasions and 2.59 J/cm2 for burns) significantly reduced the bacterial burdens in UVC-treated wounds by approximately 10-fold compared with nontreated controls (p = 0.004 for abrasions, p = 0.019 for burns). DNA lesions were observed by immunofluorescence in mouse skin abrasions immediately after a UVC exposure of 3.24 J/cm2; however, the lesions were extensively repaired within 72 hours. CONCLUSION These results suggested that UVC may be useful in preventing combat-related wound infections. PMID:22929495

  8. Simple Method for Markerless Gene Deletion in Multidrug-Resistant Acinetobacter baumannii.


    Oh, Man Hwan; Lee, Je Chul; Kim, Jungmin; Choi, Chul Hee; Han, Kyudong


    The traditional markerless gene deletion technique based on overlap extension PCR has been used for generating gene deletions in multidrug-resistant Acinetobacter baumannii. However, the method is time-consuming because it requires restriction digestion of the PCR products in DNA cloning and the construction of new vectors containing a suitable antibiotic resistance cassette for the selection of A. baumannii merodiploids. Moreover, the availability of restriction sites and the selection of recombinant bacteria harboring the desired chimeric plasmid are limited, making the construction of a chimeric plasmid more difficult. We describe a rapid and easy cloning method for markerless gene deletion in A. baumannii, which has no limitation in the availability of restriction sites and allows for easy selection of the clones carrying the desired chimeric plasmid. Notably, it is not necessary to construct new vectors in our method. This method utilizes direct cloning of blunt-end DNA fragments, in which upstream and downstream regions of the target gene are fused with an antibiotic resistance cassette via overlap extension PCR and are inserted into a blunt-end suicide vector developed for blunt-end cloning. Importantly, the antibiotic resistance cassette is placed outside the downstream region in order to enable easy selection of the recombinants carrying the desired plasmid, to eliminate the antibiotic resistance cassette via homologous recombination, and to avoid the necessity of constructing new vectors. This strategy was successfully applied to functional analysis of the genes associated with iron acquisition by A. baumannii ATCC 19606 and to ompA gene deletion in other A. baumannii strains. Consequently, the proposed method is invaluable for markerless gene deletion in multidrug-resistant A. baumannii. PMID:25746991

  9. Clinical epidemiology and resistance mechanisms of carbapenem-resistant Acinetobacter baumannii, French Guiana, 2008-2014.


    Mahamat, Aba; Bertrand, Xavier; Moreau, Brigitte; Hommel, Didier; Couppie, Pierre; Simonnet, Christine; Kallel, Hatem; Demar, Magalie; Djossou, Felix; Nacher, Mathieu


    This study investigated the clinical epidemiology and resistance mechanisms of Acinetobacter baumannii and characterised the clonal diversity of carbapenem-resistant A. baumannii (CRAB) during an ICU-associated outbreak at Cayenne Hospital, French Guiana. All non-duplicate A. baumannii isolates from 2008 to 2014 were tested for antibiotic susceptibility by disk diffusion. Multilocus sequence typing, pulsed-field gel electrophoresis (PFGE) and characterisation of carbapenemase-encoding genes were performed on CRAB. Of the 441 A. baumannii isolates, most were from males (54.0%) and were detected mainly from the ICU (30.8%) and medicine wards (21.8%). In the ICU, strains were mainly isolated from the respiratory tract (44.1%) and bloodstream (14.0%), whereas in medicine wards they mainly were from wound/drainage (36.5%) and bloodstream (25.0%). A. baumannii showed the greatest susceptibility to piperacillin/tazobactam (92.7%), imipenem (92.5%), colistin (95.6%) and amikacin (97.2%), being lower in the ICU and medicine wards compared with other wards. An outbreak of OXA-23-producing CRAB occurred in the 13-bed ICU in 2010. CRAB strains were more co-resistant to other antimicrobials compared with non-CRAB. Molecular genetics analysis revealed five sequence types [ST78, ST107 and ST642 and two new STs (ST830 and ST831)]. Analysis of PFGE profiles indicated cross-transmissions of CRAB within the ICU, between the ICU and one medicine ward during transfer of patients, and within that medicine ward. This study provides the first clinical and molecular data of A. baumannii from French Guiana and the Amazon basin. The ICU was the highest risk unit of this nosocomial outbreak of OXA-23-producing CRAB, which could subsequently disseminate within the hospital. PMID:27236843

  10. Simple Method for Markerless Gene Deletion in Multidrug-Resistant Acinetobacter baumannii

    PubMed Central

    Oh, Man Hwan; Lee, Je Chul; Kim, Jungmin


    The traditional markerless gene deletion technique based on overlap extension PCR has been used for generating gene deletions in multidrug-resistant Acinetobacter baumannii. However, the method is time-consuming because it requires restriction digestion of the PCR products in DNA cloning and the construction of new vectors containing a suitable antibiotic resistance cassette for the selection of A. baumannii merodiploids. Moreover, the availability of restriction sites and the selection of recombinant bacteria harboring the desired chimeric plasmid are limited, making the construction of a chimeric plasmid more difficult. We describe a rapid and easy cloning method for markerless gene deletion in A. baumannii, which has no limitation in the availability of restriction sites and allows for easy selection of the clones carrying the desired chimeric plasmid. Notably, it is not necessary to construct new vectors in our method. This method utilizes direct cloning of blunt-end DNA fragments, in which upstream and downstream regions of the target gene are fused with an antibiotic resistance cassette via overlap extension PCR and are inserted into a blunt-end suicide vector developed for blunt-end cloning. Importantly, the antibiotic resistance cassette is placed outside the downstream region in order to enable easy selection of the recombinants carrying the desired plasmid, to eliminate the antibiotic resistance cassette via homologous recombination, and to avoid the necessity of constructing new vectors. This strategy was successfully applied to functional analysis of the genes associated with iron acquisition by A. baumannii ATCC 19606 and to ompA gene deletion in other A. baumannii strains. Consequently, the proposed method is invaluable for markerless gene deletion in multidrug-resistant A. baumannii. PMID:25746991

  11. Epidemiologic and clinical impact of Acinetobacter baumannii colonization and infection: a reappraisal.


    Villar, Macarena; Cano, María E; Gato, Eva; Garnacho-Montero, José; Miguel Cisneros, José; Ruíz de Alegría, Carlos; Fernández-Cuenca, Felipe; Martínez-Martínez, Luis; Vila, Jordi; Pascual, Alvaro; Tomás, María; Bou, Germán; Rodríguez-Baño, Jesús


    Acinetobacter baumannii is one of the most important antibiotic-resistant nosocomial bacteria. We investigated changes in the clinical and molecular epidemiology of A. baumannii over a 10-year period. We compared the data from 2 prospective multicenter cohort studies in Spain, one performed in 2000 (183 patients) and one in 2010 (246 patients), which included consecutive patients infected or colonized by A. baumannii. Molecular typing was performed by repetitive extragenic palindromic polymerase chain reaction (REP-PCR), pulsed-field gel electrophoresis (PFGE), and multilocus sequence typing (MLST). The incidence density of A. baumannii colonization or infection increased significantly from 0.14 in 2000 to 0.52 in 2010 in medical services (p < 0.001). The number of non-nosocomial health care-associated cases increased from 1.2% to 14.2%, respectively (p < 0.001). Previous exposure to carbapenems increased in 2010 (16.9% in 2000 vs 27.3% in 2010, p = 0.03). The drugs most frequently used for definitive treatment of patients with infections were carbapenems in 2000 (45%) and colistin in 2010 (50.3%). There was molecular-typing evidence of an increase in the frequency of A. baumannii acquisition in non-intensive care unit wards in 2010 (7.6% in 2000 vs 19.2% in 2010, p = 0.01). By MSLT, the ST2 clonal group predominated and increased in 2010. This epidemic clonal group was more frequently resistant to imipenem and was associated with an increased risk of sepsis, although not with severe sepsis or mortality. Some significant changes were noted in the epidemiology of A. baumannii, which is increasingly affecting patients admitted to conventional wards and is also the cause of non-nosocomial health care-associated infections. Epidemic clones seem to combine antimicrobial resistance and the ability to spread, while maintaining their clinical virulence. PMID:25181313

  12. First report of an OXA-23 carbapenemase-producing Acinetobacter baumannii clinical isolate related to Tn2006 in Spain.


    Espinal, P; Macià, M D; Roca, I; Gato, E; Ruíz, E; Fernández-Cuenca, F; Oliver, A; Rodríguez-Baño, J; Bou, G; Tomás, M; Vila, J


    A carbapenem-resistant Acinetobacter baumannii clinical isolate belonging to European clone II and sequence type 2 was recovered from a patient in the Son Espases hospital in Mallorca, Spain. Genetic analysis showed the presence of the bla(OXA-23) gene in association with the widely disseminated transposon Tn2006. This is the first reported identification of A. baumannii carrying bla(OXA-23) in Spain. PMID:23070166

  13. Purification, crystallization and preliminary X-ray crystallographic analysis of the UDP-N-acetylmuramoyl-tripeptide-D-alanyl-D-alanine ligase (MurF) from Acinetobacter baumannii.


    An, Young Jun; Jeong, Chang-Sook; Yu, Jeong Hee; Chung, Kyung Min; Cha, Sun-Shin


    The emergence and global spread of multidrug-resistant Acinetobacter baumannii strains are major threats to public health. Inhibition of peptidoglycan biosynthesis is an effective strategy for the development of antibiotics. The ATP-dependent UDP-N-acetylmuramoyl-tripeptide-D-alanyl-D-alanine ligase (MurF) that is responsible for the last step of peptidoglycan biosynthesis is a validated target for the development of antibiotics. Crystals of A. baumannii MurF in complex with ATP were grown by the microbatch crystallization method at 295 K. The crystals belonged to space group P322₁, with unit-cell parameters a=b=85.42, c=129.86 Å. Assuming the presence of one molecule in the asymmetric unit, the solvent content was estimated to be about 54.32%. PMID:25005102

  14. Treatment Options for Carbapenem-Resistant and Extensively Drug-Resistant Acinetobacter baumannii Infections

    PubMed Central

    Viehman, J. Alexander; Nguyen, Minh-Hong; Doi, Yohei


    Acinetobacter baumannii is a leading cause of healthcare-associated infections worldwide. Due to various intrinsic and acquired mechanisms of resistance, most β-lactam agents are not effective against many strains, and carbapenems have played an important role in therapy. Recent trends show many infections are caused by carbapenem-resistant, or even extensively drug-resistant (XDR) strains, for which effective therapy is not well established. Evidence to date suggests that colistin constitutes the backbone of therapy, but the unique pharmacokinetic properties of colistin have led many to suggest the use of combination antimicrobial therapy. However, the combination of agents and dosing regimens that delivers the best clinical efficacy while minimizing toxicity is yet to be defined. Carbapenems, sulbactam, rifampin and tigecycline have been the most studied in the context of combination therapy. Most data regarding therapy for invasive, resistant A. baumannii infections come from uncontrolled case series and retrospective analyses, though some clinical trials have been completed and others are underway. Early institution of appropriate antimicrobial therapy is shown to consistently improve survival of patients with carbapenem-resistant and XDR A. baumannii infection, but the choice of empiric therapy in these infections remains an open question. This review summarizes the most current knowledge regarding the epidemiology, mechanisms of resistance, and treatment considerations of carbapenem-resistant and XDR A. baumannii. PMID:25091170

  15. Phylogenetic and genomic diversity in isolates from the globally distributed Acinetobacter baumannii ST25 lineage

    PubMed Central

    Sahl, Jason W.; Del Franco, Mariateresa; Pournaras, Spyros; Colman, Rebecca E.; Karah, Nabil; Dijkshoorn, Lenie; Zarrilli, Raffaele


    Acinetobacter baumannii is a globally distributed nosocomial pathogen that has gained interest due to its resistance to most currently used antimicrobials. Whole genome sequencing (WGS) and phylogenetics has begun to reveal the global genetic diversity of this pathogen. The evolution of A. baumannii has largely been defined by recombination, punctuated by the emergence and proliferation of defined clonal lineages. In this study we sequenced seven genomes from the sequence type (ST)25 lineage and compared them to 12 ST25 genomes deposited in public databases. A recombination analysis identified multiple genomic regions that are homoplasious in the ST25 phylogeny, indicating active or historical recombination. Genes associated with antimicrobial resistance were differentially distributed between ST25 genomes, which matched our laboratory-based antimicrobial susceptibility typing. Differences were also observed in biofilm formation between ST25 isolates, which were demonstrated to produce significantly more extensive biofilm than an isolate from the ST1 clonal lineage. These results demonstrate that within A. baumannii, even a fairly recently derived monophyletic lineage can still exhibit significant genotypic and phenotypic diversity. These results have implications for associating outbreaks with sequence typing as well as understanding mechanisms behind the global propagation of successful A. baumannii lineages. PMID:26462752

  16. The Acinetobacter baumannii Oxymoron: Commensal Hospital Dweller Turned Pan-Drug-Resistant Menace

    PubMed Central

    Roca, Ignasi; Espinal, Paula; Vila-Farrés, Xavier; Vila, Jordi


    During the past few decades Acinetobacter baumannii has evolved from being a commensal dweller of health-care facilities to constitute one of the most annoying pathogens responsible for hospitalary outbreaks and it is currently considered one of the most important nosocomial pathogens. In a prevalence study of infections in intensive care units conducted among 75 countries of the five continents, this microorganism was found to be the fifth most common pathogen. Two main features contribute to the success of A. baumannii: (i) A. baumannii exhibits an outstanding ability to accumulate a great variety of resistance mechanisms acquired by different mechanisms, either mutations or acquisition of genetic elements such as plasmids, integrons, transposons, or resistant islands, making this microorganism multi- or pan-drug-resistant and (ii) The ability to survive in the environment during prolonged periods of time which, combined with its innate resistance to desiccation and disinfectants, makes A. baumannii almost impossible to eradicate from the clinical setting. In addition, its ability to produce biofilm greatly contributes to both persistence and resistance. In this review, the pathogenesis of the infections caused by this microorganism as well as the molecular bases of antibacterial resistance and clinical aspects such as treatment and potential future therapeutic strategies are discussed in depth. PMID:22536199

  17. Anthelmintic closantel enhances bacterial killing of polymyxin B against multidrug-resistant Acinetobacter baumannii

    PubMed Central

    Tran, Thien B.; Cheah, Soon-Ee; Yu, Heidi H.; Bergen, Phillip J.; Nation, Roger L.; Creek, Darren J.; Purcell, Anthony; Forrest, Alan; Doi, Yohei; Song, Jiangning; Velkov, Tony; Li, Jian


    Polymyxins, an old class of antibiotics, are currently used as the last resort for the treatment of multidrug-resistant (MDR) Acinetobacter baumannii. However, recent pharmacokinetic and pharmacodynamic data indicate that monotherapy can lead to the development of resistance. Novel approaches are urgently needed to preserve and improve the efficacy of this last-line class of antibiotics. This study examined the antimicrobial activity of novel combination of polymyxin B with anthelmintic closantel against A. baumannii. Closantel monotherapy (16 mg/L) was ineffective against most tested A. baumannii isolates. However, closantel at 4–16 mg/L with a clinically achievable concentration of polymyxin B (2 mg/L) successfully inhibited the development of polymyxin resistance in polymyxin-susceptible isolates, and provided synergistic killing against polymyxin-resistant isolates (MIC ≥4 mg/L). Our findings suggest that the combination of polymyxin B with closantel could be potentially useful for the treatment of MDR, including polymyxin-resistant, A. baumannii infections. The re-positioning of non-antibiotic drugs to treat bacterial infections may significantly expedite discovery of new treatment options for bacterial ‘superbugs’. PMID:26669752

  18. Differential protection from tobramycin by extracellular polymeric substances from Acinetobacter baumannii and Staphylococcus aureus biofilms.


    Davenport, Emily K; Call, Douglas R; Beyenal, Haluk


    We investigated biofilms of two pathogens, Acinetobacter baumannii and Staphylococcus aureus, to characterize mechanisms by which the extracellular polymeric substance (EPS) found in biofilms can protect bacteria against tobramycin exposure. To do so, it is critical to study EPS-antibiotic interactions in a homogeneous environment without mass transfer limitations. Consequently, we developed a method to grow biofilms, harvest EPS, and then augment planktonic cultures with isolated EPS and tobramycin. We demonstrated that planktonic cultures respond differently to being treated with different types of EPS (A. baumannii versus S. aureus) in the presence of tobramycin. By harvesting EPS from the biofilms, we found that A. baumannii EPS acts as a "universal protector" by inhibiting tobramycin activity against bacterial cells regardless of species; S. aureus EPS did not show any protective ability in cell cultures. Adding Mg(2+) or Ca(2+) reduced the protective effect of A. baumannii EPS. Finally, when we selectively digested the proteins or DNA of the EPS, we found that the protective ability did not change, suggesting that neither has a significant role in protection. To the best of our knowledge, this is the first study that demonstrates how EPS protects pathogens against antibiotics in a homogeneous system without mass transfer limitations. Our results suggest that EPS protects biofilm communities, in part, by adsorbing antibiotics near the surface. This may limit antibiotic diffusion to the bottom of the biofilms but is not likely to be the only mechanism of protection. PMID:24913166

  19. Differential Protection from Tobramycin by Extracellular Polymeric Substances from Acinetobacter baumannii and Staphylococcus aureus Biofilms

    PubMed Central

    Davenport, Emily K.; Call, Douglas R.


    We investigated biofilms of two pathogens, Acinetobacter baumannii and Staphylococcus aureus, to characterize mechanisms by which the extracellular polymeric substance (EPS) found in biofilms can protect bacteria against tobramycin exposure. To do so, it is critical to study EPS-antibiotic interactions in a homogeneous environment without mass transfer limitations. Consequently, we developed a method to grow biofilms, harvest EPS, and then augment planktonic cultures with isolated EPS and tobramycin. We demonstrated that planktonic cultures respond differently to being treated with different types of EPS (A. baumannii versus S. aureus) in the presence of tobramycin. By harvesting EPS from the biofilms, we found that A. baumannii EPS acts as a “universal protector” by inhibiting tobramycin activity against bacterial cells regardless of species; S. aureus EPS did not show any protective ability in cell cultures. Adding Mg2+ or Ca2+ reduced the protective effect of A. baumannii EPS. Finally, when we selectively digested the proteins or DNA of the EPS, we found that the protective ability did not change, suggesting that neither has a significant role in protection. To the best of our knowledge, this is the first study that demonstrates how EPS protects pathogens against antibiotics in a homogeneous system without mass transfer limitations. Our results suggest that EPS protects biofilm communities, in part, by adsorbing antibiotics near the surface. This may limit antibiotic diffusion to the bottom of the biofilms but is not likely to be the only mechanism of protection. PMID:24913166

  20. Enhanced Efficacy of Combinations of Pexiganan with Colistin Versus Acinetobacter Baumannii in Experimental Sepsis.


    Cirioni, Oscar; Simonetti, Oriana; Pierpaoli, Elisa; Barucca, Alessandra; Ghiselli, Roberto; Orlando, Fiorenza; Pelloni, Maria; Minardi, Daniele; Trombettoni, Maria Michela Cappelletti; Guerrieri, Mario; Offidani, Annamaria; Giacometti, Andrea; Provinciali, Mauro


    We investigated the efficacy of colistin combined with pexiganan in experimental mouse models of Acinetobacter baumannii infection.Adult male BALB/c mice received intraperitoneally 1 mL saline containing 2 × 10 CFU of susceptible and multiresistant A. baumannii. Two hours after bacterial challenge, animals received 1 mg/kg of colistin, 1 mg/kg of pexiganan, or 1 mg/kg of colistin plus 1 mg/kg of pexiganan.Blood culture positivity, the quantities of bacteria in the intra-abdominal fluid, the rate of lethality and immunological studies, such as immunophenotyping and NK cytotoxicity, were evaluated.In the in vitro study, A. baumannii showed susceptibility to colistin and pexiganan and a strong synergy was observed by testing colistin combined with pexiganan with fractionary inhibitory concentration index of 0.312 for both strains.In the in vivo study colistin or pexiganan alone showed a good antimicrobial efficacy. When colistin was combined with pexiganan, the positive interaction produced low bacterial counts that were statistically significant versus singly treated groups. For both strains the highest rate of survival was observed in combined-treated groups (90%).Pexiganan increased NK cytotoxic activity over the levels of infected and colistin-treated animals.In conclusion, pexiganan combined with colistin was found to be efficacious against A. baumannii infection. PMID:26849630

  1. The First Outbreak Caused by Acinetobacter baumannii ST208 and ST195 in China

    PubMed Central

    Qu, Junyan; Du, Yu


    This study aimed to analyze the clinical characteristics of patients and molecular mechanisms of the first outbreak mainly caused by sequence types (STs) 208 multidrug resistant (MDR) Acinetobacter baumannii in China. A total of 10 clinical samples were collected from 5 patients who were involved in the outbreak. Bacterial identification and antibiotic sensitivity tests were performed by the VITEK-2 COMPACT automated system. MICs of tigecycline for clinical isolates were determined using broth microdilution. The clonal relatedness of A. baumannii clinical isolates in our local settings was determinated by pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing (MLST). A total of 7 A. baumannii strains were isolated and all were MDR strains; two of them were carbapenem-nonsusceptible strains. blaOXA-23 was the only acquired carbapenemase gene in the isolates. The isolates belonged to a single clonal pulsotype determined by PFGE and two sequences types (STs) determined by MLST. The isolates belonged to the globally disseminated clonal complex 92, among which ST195 and ST208 were the most common sequence types (71.43% and 28.57%). The outbreak was successfully controlled by stringent infection control measures, especially improving the hand hygiene compliance and enhancing antimicrobial stewardship. In conclusion, this is the first description of an outbreak caused mainly by A. baumannii of ST208 in China. Infection control measures should be strengthened when infection outbreaks in hospital. PMID:27144176

  2. Colistin Resistance in Acinetobacter baumannii Is Mediated by Complete Loss of Lipopolysaccharide Production ▿

    PubMed Central

    Moffatt, Jennifer H.; Harper, Marina; Harrison, Paul; Hale, John D. F.; Vinogradov, Evgeny; Seemann, Torsten; Henry, Rebekah; Crane, Bethany; St. Michael, Frank; Cox, Andrew D.; Adler, Ben; Nation, Roger L.; Li, Jian; Boyce, John D.


    Infections caused by multidrug-resistant (MDR) Gram-negative bacteria represent a major global health problem. Polymyxin antibiotics such as colistin have resurfaced as effective last-resort antimicrobials for use against MDR Gram-negative pathogens, including Acinetobacter baumannii. Here we show that A. baumannii can rapidly develop resistance to polymyxin antibiotics by complete loss of the initial binding target, the lipid A component of lipopolysaccharide (LPS), which has long been considered to be essential for the viability of Gram-negative bacteria. We characterized 13 independent colistin-resistant derivatives of A. baumannii type strain ATCC 19606 and showed that all contained mutations within one of the first three genes of the lipid A biosynthesis pathway: lpxA, lpxC, and lpxD. All of these mutations resulted in the complete loss of LPS production. Furthermore, we showed that loss of LPS occurs in a colistin-resistant clinical isolate of A. baumannii. This is the first report of a spontaneously occurring, lipopolysaccharide-deficient, Gram-negative bacterium. PMID:20855724

  3. Detoxification of Indole by an Indole-Induced Flavoprotein Oxygenase from Acinetobacter baumannii

    PubMed Central

    Lin, Guang-Huey; Chen, Hao-Ping; Shu, Hung-Yu


    Indole, a derivative of the amino acid tryptophan, is a toxic signaling molecule, which can inhibit bacterial growth. To overcome indole-induced toxicity, many bacteria have developed enzymatic defense systems to convert indole to non-toxic, water-insoluble indigo. We previously demonstrated that, like other aromatic compound-degrading bacteria, Acinetobacter baumannii can also convert indole to indigo. However, no work has been published investigating this mechanism. Here, we have shown that the growth of wild-type A. baumannii is severely inhibited in the presence of 3.5 mM indole. However, at lower concentrations, growth is stable, implying that the bacteria may be utilizing a survival mechanism to oxidize indole. To this end, we have identified a flavoprotein oxygenase encoded by the iifC gene of A. baumannii. Further, our results suggest that expressing this recombinant oxygenase protein in Escherichia coli can drive indole oxidation to indigo in vitro. Genome analysis shows that the iif operon is exclusively present in the genomes of A. baumannii and Pseudomonas syringae pv. actinidiae. Quantitative PCR and Western blot analysis also indicate that the iif operon is activated by indole through the AraC-like transcriptional regulator IifR. Taken together, these data suggest that this species of bacteria utilizes a novel indole-detoxification mechanism that is modulated by IifC, a protein that appears to be, at least to some extent, regulated by IifR. PMID:26390211

  4. Thai ethnomedicinal plants as resistant modifying agents for combating Acinetobacter baumannii infections

    PubMed Central


    Abstracts Background Acinetobacter baumannii is well-recognized as an important nosocomial pathogen, however, due to their intrinsic resistance to several antibiotics, treatment options are limited. Synergistic effects between antibiotics and medicinal plants, particularly their active components, have intensively been studied as alternative approaches. Methods Fifty-one ethanol extracts obtained from 44 different selected medicinal plant species were tested for resistance modifying agents (RMAs) of novobiocin against A. baumannii using growth inhibition assay. Results At 250 μg/ml, Holarrhena antidysenterica, Punica granatum, Quisqualis indica, Terminalia bellirica, Terminalia chebula, and Terminalia sp. that possessed low intrinsic antibacterial activity significantly enhanced the activity of novobiocin at 1 μg/ml (1/8xminimum inhibitory concentration) against this pathogen. Holarrhena antidysenterica at 7.8 μg/ml demonstrated remarkable resistant modifying ability against A. baumannii in combination with novobiocin. The phytochemical study revealed that constituents of this medicinal plant contain alkaloids, condensed tannins, and triterpenoids. Conclusion The use of Holarrhena antidysenterica in combination with novobiocin provides an effective alternative treatment for multidrug resistant A. baumannii infections. PMID:22536985

  5. Functional Exposed Amino Acids of BauA as Potential Immunogen Against Acinetobacter baumannii.


    Sefid, Fatemeh; Rasooli, Iraj; Jahangiri, Abolfazl; Bazmara, Hadise


    Multidrug-resistant Acinetobacter baumannii is recognized to be among the most difficult antimicrobial-resistant gram negative bacilli to control and treat. One of the major challenges that the pathogenic bacteria face in their host is the scarcity of freely available iron. To survive under such conditions, bacteria express new proteins on their outer membrane and also secrete iron chelators called siderophores. Antibodies directed against these proteins associated with iron uptake exert a bacteriostatic or bactericidal effect against A. baumanii in vitro, by blocking siderophore mediated iron uptake pathways. Attempts should be made to discover peptides that could mimic protein epitopes and possess the same immunogenicity as the whole protein. Subsequently, theoretical methods for epitope prediction have been developed leading to synthesis of such peptides that are important for development of immunodiagnostic tests and vaccines. The present study was designed to in silico resolving the major obstacles in the control or in prevention of the diseases caused by A. baumannii. We exploited bioinformatic tools to better understand and characterize the Baumannii acinetobactin utilization structure of A. baumannii and select appropriate regions as effective B cell epitopes. In conclusion, amino acids 26-191 of cork domain and 321-635 of part of the barrel domain including L4-L9, were selected as vaccine candidates. These two regions contain functional exposed amino acids with higher score of B cell epitopes properties. Majority of amino acids are hydrophilic, flexible, accessible, and favorable for B cells from secondary structure point of view. PMID:25840681

  6. Detoxification of Indole by an Indole-Induced Flavoprotein Oxygenase from Acinetobacter baumannii.


    Lin, Guang-Huey; Chen, Hao-Ping; Shu, Hung-Yu


    Indole, a derivative of the amino acid tryptophan, is a toxic signaling molecule, which can inhibit bacterial growth. To overcome indole-induced toxicity, many bacteria have developed enzymatic defense systems to convert indole to non-toxic, water-insoluble indigo. We previously demonstrated that, like other aromatic compound-degrading bacteria, Acinetobacter baumannii can also convert indole to indigo. However, no work has been published investigating this mechanism. Here, we have shown that the growth of wild-type A. baumannii is severely inhibited in the presence of 3.5 mM indole. However, at lower concentrations, growth is stable, implying that the bacteria may be utilizing a survival mechanism to oxidize indole. To this end, we have identified a flavoprotein oxygenase encoded by the iifC gene of A. baumannii. Further, our results suggest that expressing this recombinant oxygenase protein in Escherichia coli can drive indole oxidation to indigo in vitro. Genome analysis shows that the iif operon is exclusively present in the genomes of A. baumannii and Pseudomonas syringae pv. actinidiae. Quantitative PCR and Western blot analysis also indicate that the iif operon is activated by indole through the AraC-like transcriptional regulator IifR. Taken together, these data suggest that this species of bacteria utilizes a novel indole-detoxification mechanism that is modulated by IifC, a protein that appears to be, at least to some extent, regulated by IifR. PMID:26390211

  7. Acinetobacter baumannii phenylacetic acid metabolism influences infection outcome through a direct effect on neutrophil chemotaxis.


    Bhuiyan, Md Saruar; Ellett, Felix; Murray, Gerald L; Kostoulias, Xenia; Cerqueira, Gustavo M; Schulze, Keith E; Mahamad Maifiah, Mohd Hafidz; Li, Jian; Creek, Darren J; Lieschke, Graham J; Peleg, Anton Y


    Innate cellular immune responses are a critical first-line defense against invading bacterial pathogens. Leukocyte migration from the bloodstream to a site of infection is mediated by chemotactic factors that are often host-derived. More recently, there has been a greater appreciation of the importance of bacterial factors driving neutrophil movement during infection. Here, we describe the development of a zebrafish infection model to study Acinetobacter baumannii pathogenesis. By using isogenic A. baumannii mutants lacking expression of virulence effector proteins, we demonstrated that bacterial drivers of disease severity are conserved between zebrafish and mammals. By using transgenic zebrafish with fluorescent phagocytes, we showed that a mutation of an established A. baumannii global virulence regulator led to marked changes in neutrophil behavior involving rapid neutrophil influx to a localized site of infection, followed by prolonged neutrophil dwelling. This neutrophilic response augmented bacterial clearance and was secondary to an impaired A. baumannii phenylacetic acid catabolism pathway, which led to accumulation of phenylacetate. Purified phenylacetate was confirmed to be a neutrophil chemoattractant. These data identify a previously unknown mechanism of bacterial-guided neutrophil chemotaxis in vivo, providing insight into the role of bacterial metabolism in host innate immune evasion. Furthermore, the work provides a potentially new therapeutic paradigm of targeting a bacterial metabolic pathway to augment host innate immune responses and attenuate disease. PMID:27506797

  8. DNA microarray for genotyping antibiotic resistance determinants in Acinetobacter baumannii clinical isolates.


    Dally, Simon; Lemuth, Karin; Kaase, Martin; Rupp, Steffen; Knabbe, Cornelius; Weile, Jan


    In recent decades, Acinetobacter baumannii has emerged as an organism of great concern due to its ability to accumulate antibiotic resistance. In order to improve the diagnosis of resistance determinants in A. baumannii in terms of lead time and accuracy, we developed a microarray that can be used to detect 91 target sequences associated with antibiotic resistance within 4 h from bacterial culture to result. The array was validated with 60 multidrug-resistant strains of A. baumannii in a blinded, prospective study. The results were compared to phenotype results determined by the automated susceptibility testing system VITEK2. Antibiotics considered were piperacillin-tazobactam, ceftazidime, imipenem, meropenem, trimethoprim-sulfamethoxazole, amikacin, gentamicin, tobramycin, ciprofloxacin, and tigecycline. The average positive predictive value, negative predictive value, sensitivity, and specificity were 98, 98, 99, and 94%, respectively. For carbapenemase genes, the array results were compared to singleplex PCR results provided by the German National Reference Center for Gram-Negative Pathogens, and results were in complete concordance. The presented array is able to detect all relevant resistance determinants of A. baumannii in parallel. The short handling time of 4 h from culture to result helps to provide fast results in order to initiate adequate anti-infective therapy for critically ill patients. Another application would be data acquisition for epidemiologic surveillance. PMID:23856783

  9. Characterizing In Vivo Pharmacodynamics of Carbapenems against Acinetobacter baumannii in a Murine Thigh Infection Model To Support Breakpoint Determinations

    PubMed Central

    MacVane, Shawn H.; Crandon, Jared L.


    Pharmacodynamic profiling data of carbapenems for Acinetobacter spp. are sparse. This study aimed to determine the pharmacodynamic targets of carbapenems for Acinetobacter baumannii based on a range of percentages of the dosing interval in which free drug concentrations remained above the MIC (fT>MIC) in the neutropenic murine thigh infection model. fT>MIC values of 23.7%, 32.8%, and 47.5% resulted in stasis, 1-log reductions, and 2-log reductions in bacterial density after 24 h, respectively. The pharmacodynamic targets of carbapenems for A. baumannii demonstrated in vivo are similar to those of other Gram-negative bacteria. PMID:24165174

  10. Preferential carriage of class 2 integrons in Acinetobacter baumannii CC113 and novel singletons.


    Ramírez, M S; Montaña, S; Cassini, M; Centrón, D


    Our understanding of the distribution of integrons associated with multidrug resistance in Acinetobacter baumannii isolates around the world remains incomplete. The association between the class 1 and 2 integron A. baumannii-positive isolates (n = 60), recovered since 1982 from 11 Argentinean hospitals, and the circulating lineages, was investigated. While class 2 integrons were highly significantly associated with clonal lineage CC113B/CC79P (P = 0·009) and novel singletons (P = 0·001), class 1 integrons were found not to be associated with CC109B/CC1P or other lineages. The study reveals a differential distribution of class 2 integrons in lineages, and suggests that the prevalence of intI2 in Argentina is related to the emergence of novel singletons in recent years and to the abundance of CC113B/CC79P, which has been the local dominant lineage for several decades. PMID:25697643

  11. Emerging broad-spectrum resistance in Pseudomonas aeruginosa and Acinetobacter baumannii: Mechanisms and epidemiology.


    Potron, Anaïs; Poirel, Laurent; Nordmann, Patrice


    Multidrug resistance is quite common among non-fermenting Gram-negative rods, in particular among clinically relevant species including Pseudomonas aeruginosa and Acinetobacter baumannii. These bacterial species, which are mainly nosocomial pathogens, possess a diversity of resistance mechanisms that may lead to multidrug or even pandrug resistance. Extended-spectrum β-lactamases (ESBLs) conferring resistance to broad-spectrum cephalosporins, carbapenemases conferring resistance to carbapenems, and 16S rRNA methylases conferring resistance to all clinically relevant aminoglycosides are the most important causes of concern. Concomitant resistance to fluoroquinolones, polymyxins (colistin) and tigecycline may lead to pandrug resistance. The most important mechanisms of resistance in P. aeruginosa and A. baumannii and their most recent dissemination worldwide are detailed here. PMID:25857949

  12. Biofilm Formation and Motility Depend on the Nature of the Acinetobacter baumannii Clinical Isolates

    PubMed Central

    Vijayakumar, Saranya; Rajenderan, Sangeetha; Laishram, Shakti; Anandan, Shalini; Balaji, Veeraraghavan; Biswas, Indranil


    Acinetobacter baumannii is a nosocomial pathogen involved in various infections ranging from minor soft-tissue infections to more severe infections such as ventilator-associated pneumonia and bacteremia. The severity and the type of infections depend on the genetic and phenotypic variations of the strains. In this study, we compared the extent of biofilm formation and motility displayed by 60 multidrug-resistant A. baumannii clinical strains isolated from blood and sputum samples from patients from Southern India. Our results showed that isolates from the sputum samples formed significantly more robust biofilm compared to the blood isolates. On the other hand, we observed that the blood isolates were more motile than the sputum isolates. To the best of our knowledge, this is the first study that systematically evaluated the correlation between these two phenotypic traits and the nature of the isolates. PMID:27252939

  13. Donor platelet plasma components inactivate sensitive and multidrug resistant Acinetobacter baumannii isolates.


    Edelblute, Chelsea M; Pakhomova, Olga N; Li, Fanying; Hargrave, Barbara Y; Heller, Loree C


    Acinetobacter baumannii is an environmentally resilient healthcare-associated opportunistic pathogen responsible for infections at many body sites. In the last 10 years, clinical strains resistant to many or all commonly used antibiotics have emerged globally. With few antimicrobial agents in the pharmaceutical pipeline, new and alternative agents are essential. Platelets secrete a large number of proteins, including proteins with antimicrobial activity. In a previous study, we demonstrated that donor platelet supernatants and plasma significantly inhibited the growth of a reference strain of A. baumannii in broth and on skin. This inhibition appeared to be unrelated to the platelet activation state. In this study, we demonstrate that this growth inhibition extends to clinical multidrug resistant isolates. We also demonstrate that there is no relationship between this activity and selected platelet-derived antimicrobial proteins. Instead, the donor plasma components complement and alpha-2 macroglobulin are implicated. PMID:26500225

  14. Biofilm Formation and Motility Depend on the Nature of the Acinetobacter baumannii Clinical Isolates.


    Vijayakumar, Saranya; Rajenderan, Sangeetha; Laishram, Shakti; Anandan, Shalini; Balaji, Veeraraghavan; Biswas, Indranil


    Acinetobacter baumannii is a nosocomial pathogen involved in various infections ranging from minor soft-tissue infections to more severe infections such as ventilator-associated pneumonia and bacteremia. The severity and the type of infections depend on the genetic and phenotypic variations of the strains. In this study, we compared the extent of biofilm formation and motility displayed by 60 multidrug-resistant A. baumannii clinical strains isolated from blood and sputum samples from patients from Southern India. Our results showed that isolates from the sputum samples formed significantly more robust biofilm compared to the blood isolates. On the other hand, we observed that the blood isolates were more motile than the sputum isolates. To the best of our knowledge, this is the first study that systematically evaluated the correlation between these two phenotypic traits and the nature of the isolates. PMID:27252939

  15. Brain abscess caused by multidrug-resistant Acinetobacter baumannii. Case report.


    Guinand Vives, Carlos H; Monsalve Duarte, Guillermo A; Beltrán, Sandra Valderrama; Pinzón, Johanna Osorio


    This 24-year-old soldier had a history of polytrauma caused by firearm missiles of a fragmentation weapon. He was referred to the Hospital Militar Central, where multiple shrapnel wounds in the head, face, thorax, and extremities were found. A brain abscess was documented and drained, and a culture grew a multidrug-resistant Acinetobacter baumannii. An appropriate antibiotic treatment was started but did not lead to a good response, and the patient died. The clinical course of the illness is presented, as is its treatment and the role of A baumannii as an etiological agent of a brain abscess. To the authors' knowledge, there have been no reported cases in the worldwide literature of brain abscess by this infectious agent. PMID:19061347

  16. Membrane-permeabilizing activity of reverse-amide 2-aminoimidazole antibiofilm agents against Acinetobacter baumannii.


    Stowe, Sean D; Thompson, Richele J; Peng, Lingling; Su, Zhaoming; Blackledge, Meghan S; Draughn, G Logan; Coe, William H; Johannes, Eva; Lapham, Valerie K; Mackenzie, John; Melander, Christian; Cavanagh, John


    Acinetobacter baumannii has quickly become one of the most insidious and prevalent nosocomial infections. Recently, the reverse-amide class of 2-aminoimidazole compounds (RA-2AI) was found both to prevent A. baumannii biofilm formation and also to disperse preexisting formations, putatively through interactions with cytosolic response regulators. Here we focus on how this class of antibiofilm agent traverses cellular membranes. Following the discovery of dosage-dependent growth rate changes, the cellular effects of RA-2AI were investigated using a combination of molecular assays and microscopic techniques. It was found that RA-2AI exposure has measureable effects on the bacterial membranes, resulting in a period of increased permeability and visible structural aberrations. Based on these results, we propose a model that describes how the structure of RA-2AI allows it to insert itself into and disrupt the fluidity of the membrane, creating an opportunity for increased molecular permeability. PMID:25348099

  17. The Nod1, Nod2, and Rip2 Axis Contributes to Host Immune Defense against Intracellular Acinetobacter baumannii Infection

    PubMed Central

    Bist, Pradeep; Dikshit, Neha; Koh, Tse Hsien; Mortellaro, Alessandra; Tan, Thuan Tong


    Acinetobacter baumannii is a major extensively drug-resistant lethal human nosocomial bacterium. However, the host innate immune mechanisms controlling A. baumannii are not well understood. Although viewed as an extracellular pathogen, A. baumannii can also invade and survive intracellularly. However, whether host innate immune pathways sensing intracellular bacteria contribute to immunity against A. baumannii is not known. Here, we provide evidence for the first time that intracellular antibacterial innate immune receptors Nod1 and Nod2, and their adaptor Rip2, play critical roles in the sensing and clearance of A. baumannii by human airway epithelial cells in vitro. A. baumannii infection upregulated Rip2 expression. Silencing of Nod1, Nod2, and Rip2 expression profoundly increased intracellular invasion and prolonged the multiplication and survival of A. baumannii in lung epithelial cells. Notably, the Nod1/2-Rip2 axis did not contribute to the control of A. baumannii infection of human macrophages, indicating that they play cell type-specific roles. The Nod1/2-Rip2 axis was needed for A. baumannii infection-induced activation of NF-κB but not mitogen-activated protein kinases. Moreover, the Nod1/2-Rip2 axis was critical to induce optimal cytokine and chemokine responses to A. baumannii infection. Mechanistic studies showed that the Nod1/2 pathway contributed to the innate control of A. baumannii infection through the production of β-defensin 2 by airway epithelial cells. This study revealed new insights into the immune control of A. baumannii and may contribute to the development of effective immune therapeutics and vaccines against A. baumannii. PMID:24366254

  18. Efficacy of Lysophosphatidylcholine in Combination with Antimicrobial Agents against Acinetobacter baumannii in Experimental Murine Peritoneal Sepsis and Pneumonia Models.


    Parra Millán, R; Jiménez Mejías, M E; Sánchez Encinales, V; Ayerbe Algaba, R; Gutiérrez Valencia, A; Pachón Ibáñez, M E; Díaz, C; Pérez Del Palacio, J; López Cortés, L F; Pachón, J; Smani, Y


    Immune response stimulation to prevent infection progression may be an adjuvant to antimicrobial treatment. Lysophosphatidylcholine (LPC) is an immunomodulator involved in immune cell recruitment and activation. In this study, we aimed to evaluate the efficacy of LPC in combination with colistin, tigecycline, or imipenem in experimental murine models of peritoneal sepsis and pneumonia. We used Acinetobacter baumannii strain Ab9, which is susceptible to colistin, tigecycline, and imipenem, and multidrug-resistant strain Ab186, which is susceptible to colistin and resistant to tigecycline and imipenem. Pharmacokinetic and pharmacodynamic parameters for colistin, tigecycline, and imipenem and the 100% minimal lethal dose (MLD100) were determined for both strains. The therapeutic efficacies of LPC, colistin (60 mg/kg of body weight/day), tigecycline (10 mg/kg/day), and imipenem (180 mg/kg/day), alone or in combination, were assessed against Ab9 and Ab186 at the MLD100 in murine peritoneal sepsis and pneumonia models. The levels of pro- and anti-inflammatory cytokines, i.e., tumor necrosis factor alpha (TNF-α) and interleukin-10 (IL-10), were determined by enzyme-linked immunosorbent assay (ELISA) for the same experimental models after inoculating mice with the MLD of both strains. LPC in combination with colistin, tigecycline, or imipenem markedly enhanced the bacterial clearance of Ab9 and Ab186 from the spleen and lungs and reduced bacteremia and mouse mortality rates (P < 0.05) compared with those for colistin, tigecycline, and imipenem monotherapies. Moreover, at 4 h post-bacterial infection, Ab9 induced higher TNF-α and lower IL-10 levels than those with Ab186 (4 μg/ml versus 3 μg/ml [P < 0.05] and 2 μg/ml versus 3.4 μg/ml [P < 0.05], respectively). LPC treatment combined with colistin, tigecycline, or imipenem modestly reduced the severity of infection by A. baumannii strains with different resistance phenotypes compared to LPC monotherapy in both

  19. Correlation of Ciprofloxacin Resistance with the AdeABC Efflux System in Acinetobacter baumannii Clinical Isolates

    PubMed Central

    Ardebili, Abdollah; Talebi, Malihe


    Background Acinetobacter baumannii is one of the most important pathogens capable of colonization in burn patients, leading to drug-resistant wound infections. This study evaluated the distribution of the AdeABC efflux system genes and their relationship to ciprofloxacin resistance in A. baumannii isolates collected from burn patients. Methods A total of 68 A. baumannii clinical strains were isolated from patients hospitalized in Motahari Burns Center in Tehran, Iran. Ciprofloxacin susceptibility was tested by the disk diffusion and agar dilution methods. PCR amplification of the adeRS-adeB drug efflux genes was performed for all resistant and susceptible isolates. To assess the role of the drug efflux pump in ciprofloxacin susceptibility, carbonyl cyanide 3-chlorophenylhydrazone (CCCP) was used as an efflux pump inhibitor (EPI). Results Approximately 95.6% of the Acinetobacter isolates were resistant to ciprofloxacin, with minimum inhibitory concentration (MIC) values ranging from 4 to ≥128 µg/mL. The susceptibility of 86.1% of the resistant isolates increased by factors of 2 to 64 in the presence of CCCP. All resistant isolates were positive for the adeRS-adeB genes, and 73.2% of them had mutations in the AdeRS regulatory system. Conclusions The results showed that AdeABC genes are common in A. baumannii, which might be associated with ciprofloxacin non-susceptibility, as indicated by the observed linkage to the presence of the genes essential for the activity of the AdeABC, several single mutations occurring in the adeRS regulatory system, and an increase of ciprofloxacin susceptibility in the presence of a CCCP EPI. PMID:25368818

  20. Insertion sequence disruption of adeR and ciprofloxacin resistance caused by efflux pumps and gyrA and parC mutations in Acinetobacter baumannii.


    Lopes, B S; Amyes, S G B


    Acinetobacter baumannii is a pathogenic bacterium responsible for a wide range of infections in immunocompromised patients. This study examined the role of insertional inactivation of the adeR gene and its effect on adeABC gene expression along with characterisation of the gyrA and parC mutations involved in ciprofloxacin resistance in three A. baumannii clinical isolates and their derivatives. Primers designed for the detection of adeSRABC detected the presence of ISAba16, which disrupted the adeR gene in strain Ab12M, and ISAba1, which disrupted the same gene in strains Ab18 and Ab209. A second copy of ISAba1 was detected upstream of the adeA gene in Ab209 leading to AdeABC pump expression. AdeIJK pump expression was seen in all of the isolates but was not as significant as AdeABC expression. Minimum inhibitory concentrations of ciprofloxacin were ≥256 mg/L for all of the isolates and a decrease of ≥8-fold was seen following addition of the efflux pump inhibitor 1-(1-naphthylmethyl)-piperazine. Fluorometric analysis also demonstrated active efflux, with upregulation of adeIJK and some genes of the adeABC operon in some strains. Sequencing of the quinolone resistance-determining region of the gyrA and parC genes revealed a Ser83→Leu change in the gyrA gene and a novel change of Ser80→Trp in the parC gene of Ab12, Ab12M and Ab209; in Ab18 there was a Ser80→Leu change in parC. This study shows the multifactorial contribution of different mechanisms in A. baumannii leading to ciprofloxacin resistance. PMID:23217848

  1. Colistin and tigecycline for management of external ventricular device-related ventriculitis due to multidrug-resistant Acinetobacter baumannii.


    Shrestha, Gentle Sunder; Tamang, Sushil; Paneru, Hem Raj; Shrestha, Pramesh Sunder; Keyal, Niraj; Acharya, Subhash Prasad; Marhatta, Moda Nath; Shilpakar, Sushil


    Acinetobacter baumannii is an important cause of nosocomial ventriculitis associated with external ventricular device (EVD). It is frequently multidrug resistant (MDR), carries a poor outcome, and is difficult to treat. We report a case of MDR Acinetobacter ventriculitis treated with intravenous and intraventricular colistin together with intravenous tigecycline. The patient developed nephrotoxicity and poor neurological outcome despite microbiological cure. Careful implementation of bundle of measures to minimize EVD-associated ventriculitis is valuable. PMID:27365967

  2. Colistin and tigecycline for management of external ventricular device-related ventriculitis due to multidrug-resistant Acinetobacter baumannii

    PubMed Central

    Shrestha, Gentle Sunder; Tamang, Sushil; Paneru, Hem Raj; Shrestha, Pramesh Sunder; Keyal, Niraj; Acharya, Subhash Prasad; Marhatta, Moda Nath; Shilpakar, Sushil


    Acinetobacter baumannii is an important cause of nosocomial ventriculitis associated with external ventricular device (EVD). It is frequently multidrug resistant (MDR), carries a poor outcome, and is difficult to treat. We report a case of MDR Acinetobacter ventriculitis treated with intravenous and intraventricular colistin together with intravenous tigecycline. The patient developed nephrotoxicity and poor neurological outcome despite microbiological cure. Careful implementation of bundle of measures to minimize EVD-associated ventriculitis is valuable. PMID:27365967

  3. Emergence of Acinetobacter baumannii international clone II in Brazil: reflection of a global expansion

    PubMed Central

    Martins, Natacha; Dalla-Costa, Libera; Uehara, Aline Almeida; Riley, Lee Woodland; Moreira, Beatriz Meurer


    The aim of this study was to investigate the occurrence of carbapenem-resistant Acinetobacter baumannii international clones (IC) in Curitiba, Brazil, using multilocus sequence typing and trilocus PCR-based typing schemes. IC2 was the first emerging clone. This IC was detected in an isolate from 2003 of a PFGE type spread in at least two hospitals since 1999. Subsequently, IC2 waned while IC1 and clonal complex 15/104 prevailed. This is the first description of IC2 in Brazil and Latin America. PMID:24121023

  4. Colistin-Resistant Acinetobacter baumannii Clinical Strains with Deficient Biofilm Formation

    PubMed Central

    Dafopoulou, Konstantina; Xavier, Basil Britto; Hotterbeekx, An; Janssens, Lore; Lammens, Christine; Dé, Emmanuelle; Goossens, Herman; Tsakris, Athanasios; Malhotra-Kumar, Surbhi


    In two pairs of clinical colistin-susceptible/colistin-resistant (Csts/Cstr) Acinetobacter baumannii strains, the Cstr strains showed significantly decreased biofilm formation in static and dynamic assays (P < 0.001) and lower relative fitness (P < 0.05) compared with those of the Csts counterparts. The whole-genome sequencing comparison of strain pairs identified a mutation converting a stop codon to lysine (*241K) in LpsB (involved in lipopolysaccharide [LPS] synthesis) in one Cstr strain and a frameshift mutation in CarO and the loss of a 47,969-bp element containing multiple genes associated with biofilm production in the other. PMID:26666921

  5. Detection of viable antibiotic-resistant/sensitive Acinetobacter baumannii in indoor air by propidium monoazide quantitative polymerase chain reaction.


    Tseng, C-C; Hsiao, P-K; Chang, K-C; Cheng, C-C; Yiin, L-M; Hsieh, C-J


    Acinetobacter baumannii represents a significant cause of nosocomial infections. Therefore, we combined real-time quantitative polymerase chain reaction (PCR) with the propidium monoazide (PMA-qPCR) to assess the feasibility of detecting viable, airborne A. baumannii. The biological collection efficiencies of three samplers for collecting airborne A. baumannii were evaluated by PMA-qPCR in a chamber study. After sampling, the effects of storage in collection fluid on A. baumannii were evaluated. The results showed that the culturable ratio of A. baumannii measured using the culture method was significantly correlated with the viable ratio measured using PMA-qPCR, but was not significantly correlated with the qPCR results. It was indicated that the AGI-30 impinger and the BioSampler were much more effective than the Nuclepore filter sampler for collecting airborne A. baumannii. The storage temperature was critical for aerosol samples, as the loss of viable A. baumannii was minimized when the PMA-bound DNA was stored at -20°C or if the collected cells were stored at 4°C and subsequently processed by PMA-qPCR within 1 month. The PMA-qPCR method was also to distinguish between colistin-sensitive and colistin-resistant A. baumannii, and no colistin-sensitive A. baumannii was detected by PMA-qPCR upon treatment of the BioSampler collection medium with 2 μg/ml colistin for 5 min. PMID:25283547

  6. Modulating Acinetobacter baumannii biofilm development with molecules containing 3,4,5-trimethoxy-N,N',N'-trimethylbenzohydrazide moiety.


    Sambanthamoorthy, Karthik; Hickman, Mark; Pattabiraman, Nagarajan; Palys, Thomas; Wagar, Eric J


    In recent years, Acinetobacter baumannii has emerged as a major cause of nosocomial infections, including infections of implanted medical devices. The treatment of infections caused by A. baumannii has been severely hampered due to their frequent resistance to currently available antibiotics, and most importantly the ability of A. baumannii to form biofilms, which plays a significant role in both persistence and antibiotic resistance. The inherent resistance of A. baumannii biofilms to host defenses and antimicrobial agents necessitates the search for novel approaches to deter biofilm formation. Here, we report our findings on nine compounds identified from structure-activity relationship (SAR) studies on an antibiofilm compound LP3134 that was reported earlier by Biofouling2014, 30, 17. Compounds were evaluated for antibiofilm and anti-adherence activities against A. baumannii. The ability of the compounds to prevent biofilm development on urinary catheters was studied. Growth curve experiments indicated that compounds did not affect the planktonic growth of A. baumannii. All compounds inhibited A. baumannii biofilm development as well as impacting early adhesion on abiotic surfaces. Seven compounds were able to deter biofilm development on silicone catheters. Due to the continued rise of emerging multidrug-resistant A. baumannii, results from this study provide foundation for further development of these molecules to treat A. baumannii infections in wounds and medical devices. PMID:25881818

  7. Rapid detection of Acinetobacter baumannii and molecular epidemiology of carbapenem-resistant A. baumannii in two comprehensive hospitals of Beijing, China

    PubMed Central

    Li, Puyuan; Niu, Wenkai; Li, Huan; Lei, Hong; Liu, Wei; Zhao, Xiangna; Guo, Leijing; Zou, Dayang; Yuan, Xin; Liu, Huiying; Yuan, Jing; Bai, Changqing


    Acinetobacter baumannii is an important opportunistic pathogen associated with a variety of nosocomial infections. A rapid and sensitive molecular detection in clinical isolates is quite needed for the appropriate therapy and outbreak control of A. baumannii. Group 2 carbapenems have been considered the agents of choice for the treatment of multiple drug-resistant A. baumannii. But the prevalence of carbapenem-resistant A. baumannii (CRAB) has been steadily increasing in recent years. Here, we developed a loop-mediated isothermal amplification (LAMP) assay for the rapid detection of A. baumannii in clinical samples by using high-specificity primers of the blaOXA-51 gene. Then we investigated the OXA-carbapenemases molecular epidemiology of A. baumannii isolates in two comprehensive hospitals in Beijing. The results showed that the LAMP assay could detect target DNA within 60 min at 65°C. The detection limit was 50 pg/μl, which was about 10-fold greater than that of PCR. Furthermore, this method could distinguish A. baumannii from the homologous A. nosocomialis and A. pittii. A total of 228 positive isolates were identified by this LAMP-based method for A. baumannii from 335 intensive care unit patients with clinically suspected multi-resistant infections in two hospitals in Beijing. The rates of CRAB are on the rise and are slowly becoming a routine phenotype for A. baumannii. Among the CRABs, 92.3% harbored both the blaOXA-23 and blaOXA-51 genes. Thirty-three pulsotypes were identified by pulsed-field gel electrophoresis, and the majority belonged to clone C. In conclusion, the LAMP method developed for detecting A. baumannii was faster and simpler than conventional PCR and has great potential for both point-of-care testing and basic research. We further demonstrated a high distribution of class D carbapenemase-encoding genes, mainly OXA-23, which presents an emerging threat in hospitals in China. PMID:26441924

  8. Nosocomial Infection by Sequence Type 357 Multidrug-Resistant Acinetobacter baumannii Isolates in a Neonatal Intensive Care Unit in Daejeon, Korea

    PubMed Central

    Sung, Ji Youn; Cho, Hye Hyun; Kwon, Kye Chul


    Acinetobacter baumannii is an important microorganism responsible for a number of nosocomial outbreaks, in particular, in intensive care units (ICUs). We investigated a nosocomial infection caused by multidrug-resistant (MDR) A. baumannii in a neonatal intensive care unit (NICU) in Korea. A. baumannii isolates were characterized using Etest (AB Biodisk, Sweden), two multiplex PCR assays, and multilocus sequence typing (MLST) scheme. PCR and PCR mapping experiments were performed for detecting and characterizing the determinants of antimicrobial resistance. Eight strains isolated from an NICU belonged to European (EU) clone II and revealed only one sequence type (ST), namely, ST357. All the isolates were susceptible to imipenem but were resistant to amikacin, gentamicin, ceftazidime, cefepime, and ciprofloxacin. To the best of our knowledge, this is the first report of a nosocomial infection in an NICU in Korea caused by ST357 MDR/carbapenem-susceptible A. baumannii strains. This result demonstrates that nosocomial outbreaks of MDR/carbapenem-susceptible strains as well as MDR/carbapenem-resistant isolates may occur in NICUs. PMID:23826565

  9. Emergence of multidrug-resistant Acinetobacter baumannii producing OXA-23 Carbapenemase in Qatar

    PubMed Central

    Rolain, J.-M.; Loucif, L.; Al-Maslamani, M.; Elmagboul, E.; Al-Ansari, N.; Taj-Aldeen, S.; Shaukat, A.; Ahmedullah, H.; Hamed, M.


    The objective of our study was to describe the molecular support of carbapenem resistance from randomly selected clinical isolates of multidrug-resistant (MDR) Acinetobacter baumannii as a pilot study from the Hamad Medical Corporation (HMC), Qatar. Results of our report will be used to study carbapenemases using molecular techniques in all isolated MDR A. baumannii. Forty-eight MDR A. baumannii were randomly selected from isolates preserved at HMC. Identification of all isolates was confirmed by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. Antibiotic resistance was tested phenotypically by Phoenix and confirmed by Etest. The molecular support of carbapenemases (blaOXA-23, blaOXA-24, blaOXA-58, blaNDM) was investigated by real-time PCR. The epidemiologic relatedness of the isolates was verified by phylogenetic analysis based on partial sequences of CsuE and blaOXA-51 genes. All 48 isolates were identified as A. baumannii and were confirmed to be resistant to most antibiotics, especially meropenem, imipenems, ciprofloxacin, levofloxacin, amikacin, gentamicin and most of the β-lactams; they were sensitive to colistin. All the isolates were positive for blaOXA-23 and negative for the other tested carbapenemase genes. Clonality analysis demonstrated that different lineages were actually circulating in Qatar; and we suggest that an outbreak occurred in the medical intensive care unit of HMC between 2011 and 2012. Here we report the emergence of MDR A. baumannii producing the carbapenemase OXA-23 in Qatar. PMID:27054039

  10. Carbapenem-Resistant Acinetobacter baumannii from Serbia: Revision of CarO Classification

    PubMed Central

    Novovic, Katarina; Mihajlovic, Sanja; Vasiljevic, Zorica; Filipic, Brankica; Begovic, Jelena; Jovcic, Branko


    Carbapenem-resistant A. baumannii present a significant therapeutic challenge for the treatment of nosocomial infections in many European countries. Although it is known that the gradient of A. baumannii prevalence increases from northern to southern Europe, this study provides the first data from Serbia. Twenty-eight carbapenem-resistant A. baumannii clinical isolates were collected at a Serbian pediatric hospital during a 2-year period. The majority of isolates (67.68%) belonged to the sequence type Group 1, European clonal complex II. All isolates harbored intrinsic OXA-51 and AmpC cephalosporinase. OXA-23 was detected in 16 isolates (57.14%), OXA-24 in 23 isolates (82.14%) and OXA-58 in 11 isolates (39.29%). Six of the isolates (21.43%) harbored all of the analyzed oxacillinases, except OXA-143 and OXA-235 that were not detected in this study. Production of oxacillinases was detected in different pulsotypes indicating the presence of horizontal gene transfer. NDM-1, VIM and IMP were not detected in analyzed clinical A. baumannii isolates. ISAba1 insertion sequence was present upstream of OXA-51 in one isolate, upstream of AmpC in 13 isolates and upstream of OXA-23 in 10 isolates. In silico analysis of carO sequences from analyzed A. baumannii isolates revealed the existence of two out of six highly polymorphic CarO variants. The phylogenetic analysis of CarO protein among Acinetobacter species revised the previous classification CarO variants into three groups based on strong bootstraps scores in the tree analysis. Group I comprises four variants (I-IV) while Groups II and III contain only one variant each. One half of the Serbian clinical isolates belong to Group I variant I, while the other half belongs to Group I variant III. PMID:25822626

  11. Intraspecies Transfer of the Chromosomal Acinetobacter baumannii blaNDM-1 Carbapenemase Gene.


    Krahn, Thomas; Wibberg, Daniel; Maus, Irena; Winkler, Anika; Bontron, Séverine; Sczyrba, Alexander; Nordmann, Patrice; Pühler, Alfred; Poirel, Laurent; Schlüter, Andreas


    The species Acinetobacter baumannii is one of the most important multidrug-resistant human pathogens. To determine its virulence and antibiotic resistance determinants, the genome of the nosocomial blaNDM-1-positive A. baumannii strain R2090 originating from Egypt was completely sequenced. Genome analysis revealed that strain R2090 is highly related to the community-acquired Australian A. baumannii strain D1279779. The two strains belong to sequence type 267 (ST267). Isolate R2090 harbored the chromosomally integrated transposon Tn125 carrying the carbapenemase gene blaNDM-1 that is not present in the D1279779 genome. To test the transferability of the metallo-β-lactamase (MBL) gene region, the clinical isolate R2090 was mated with the susceptible A. baumannii recipient CIP 70.10, and the carbapenem-resistant derivative R2091 was obtained. Genome sequencing of the R2091 derivative revealed that it had received an approximately 66-kb region comprising the transposon Tn125 embedding the blaNDM-1 gene. This region had integrated into the chromosome of the recipient strain CIP 70.10. From the four known mechanisms for horizontal gene transfer (conjugation, outer membrane vesicle-mediated transfer, transformation, and transduction), conjugation could be ruled out, since strain R2090 lacks any plasmid, and a type IV secretion system is not encoded in its chromosome. However, strain R2090 possesses three putative prophages, two of which were predicted to be complete and therefore functional. Accordingly, it was supposed that the transfer of the resistance gene region from the clinical isolate R2090 to the recipient occurred by general transduction facilitated by one of the prophages present in the R2090 genome. Hence, phage-mediated transduction has to be taken into account for the dissemination of antibiotic resistance genes within the species A. baumannii. PMID:26953198

  12. Antibiotic Resistance of Acinetobacter baumannii in Iran: A Systemic Review of the Published Literature

    PubMed Central

    Moradi, Jale; Hashemi, Farhad B.; Bahador, Abbas


    Objectives Acinetobacter baumannii is a bacterium responsible for health care-associated infections, and it frequently develops multiple drug resistance (MDR). The prevalence of antibiotic-resistant A. baumannii in Iran has increased, and this may cause significant clinical problems. Therefore, in order to elucidate the development of antibiotic resistance, we performed a systematic review of the literature published on antibiotic-resistant A. baumannii reported in Iran. Methods Thirty-six publications that met the criteria for inclusion were reviewed from an initial 87 papers. Selected papers published between 2008 and September 2014, were categorized on the basis of the sample collecting year been between 2001 and 2013. Results Analysis of data revealed that, in general, there was an increase in antimicrobial resistance. During the initial time point of these studies (2001–2007) there was a high rate of resistance to all antibiotics, with the exception of carbapenems, lipopeptides, and aminoglycosides that had a low resistance rate in comparison with the others. Also, the resistance rate was increased in one group of these three antimicrobial groups from 2010 to 2013. In particular, there was an increase in resistance to carbapenems (imipenem and meropenem) from 2010–2011 and 2012–2013, whereas no significant change in the resistance rate of the other two antimicrobial groups (lipopeptides and aminoglycosides) during the study time was observed, although we did observe certain trends in amikacin (aminoglycoside group antibiotic) between 2011–2012 and 2012–2013. Conclusion These findings indicate that antimicrobial resistance of A. baumannii in Iran has increased, which may very well affect the antimicrobial resistance of this organism worldwide. Based on these results, novel prevention and treatment strategies against A. baumannii infections are warranted. Furthermore, these data may assist in revising treatment guidelines and regional policies in care

  13. Photodynamic Inactivation of Acinetobacter baumannii Using Phenothiazinium Dyes: In Vitro and In Vivo Studies

    PubMed Central

    Ragàs, Xavier; Dai, Tianhong; Tegos, George P.; Agut, Montserrat; Nonell, Santi; Hamblin, Michael R.


    Background and Objective Phenothiazinium dyes have been reported to be effective photosensitizers inactivating a wide range of microorganisms in vitro after illumination with red light. However, their application in vivo has not extensively been explored. This study evaluates the bactericidal activity of phenothiazinium dyes against multidrug-resistant Acinetobacter baumannii both in vitro and in vivo. Study Design/Materials and Methods We report the investigation of toluidine blue O, methylene blue, 1,9-dimethylmethylene blue, and new methylene blue for photodynamic inactivation of multidrug-resistant A. baumannii in vitro. The most effective dye was selected to carry out in vivo studies using third-degree mouse burns infected with a bioluminescent A. baumannii strain, upon irradiation with a 652 nm noncoherent light source. The mice were imaged daily for 2 weeks to observe differences in the bioluminescence–time curve between the photodynamic therapy (PDT)-treated mice in comparison with untreated burns. Results All the dyes were effective in vitro against A. baumannii after 30 J/cm2 irradiation of 635 or 652 nm red light had been delivered, with more effective killing when the dye remained in solution. New methylene blue was the most effective of the four dyes, achieving a 3.2-log reduction of the bacterial luminescence during PDT in vivo after 360 J/cm2 and an 800 μM dye dose. Moreover, a statistically significant reduction of the area under the bioluminescence–time curve of PDT-treated mice was observed showing that the infection did not recur after PDT. Conclusions Phenothiazinium dyes, and especially new methylene blue, are potential photosensitizers for PDT to treat burns infected with multidrug-resistant A. baumannii in vivo. PMID:20583252

  14. Synergistic effects of sulbactam in multi-drug-resistant Acinetobacter baumannii.


    Temocin, Fatih; Erdinc, Fatma Sebnem; Tulek, Necla; Demirelli, Meryem; Ertem, Gunay; Kinikli, Sami; Koksal, Eda


    Acinetobacter baumannii is a frequently isolated etiologic agent of nosocomial infections, especially in intensive care units. With the increase in multi-drug resistance of A. baumannii isolates, finding appropriate treatment alternatives for infections caused by these bacteria has become more difficult, and available alternate treatments include the use of older antibiotics such as colistin or a combination of antibiotics. The current study aimed to evaluate the in vitro efficacy of various antibiotic combinations against multi-drug resistant A. baumannii strains. Thirty multi-drug and carbapenem resistant A. baumannii strains isolated at the Ankara Training and Research Hospital between June 2011 and June 2012 were used in the study. Antibiotic susceptibility tests and species-level identification were performed using conventional methods and the VITEK 2 system. The effects of meropenem, ciprofloxacin, amikacin, tigecycline, and colistin alone and in combination with sulbactam against the isolates were studied using Etest (bioMérieux) in Mueller-Hinton agar medium. Fractional inhibitory concentration index (FIC) was used to determine the efficacy of the various combinations. While all combinations showed a predominant indifferent effect, a synergistic effect was also observed in 4 of the 5 combinations. Synergy was demonstrated in 43% of the isolates with the meropenem-sulbactam combination, in 27% of the isolates with tigecycline-sulbactam, and in 17% of the isolates with colistin-sulbactam and amikacin-sulbactam. No synergy was detected with the sulbactam-ciprofloxacin combination and antagonism was detected only in the sulbactam-colistin combination (6.66% of the isolates). Antibiotic combinations can be used as an alternative treatment approach in multi-drug resistant A. baumannii infections. PMID:26691470

  15. Immunization against Multidrug-Resistant Acinetobacter baumannii Effectively Protects Mice in both Pneumonia and Sepsis Models

    PubMed Central

    Huang, Weiwei; Yao, Yufeng; Long, Qiong; Yang, Xu; Sun, Wenjia; Liu, Cunbao; Jin, Xiaomei; li, Yang; Chu, Xiaojie; Chen, Bin; Ma, Yanbing


    Objective Acinetobacter baumannii is considered the prototypical example of a multi- or pan- drug-resistant bacterium. It has been increasingly implicated as a major cause of nosocomial and community-associated infections. This study proposed to evaluate the efficacy of immunological approaches to prevent and treat A. baumannii infections. Methods Mice were immunized with outer membrane vesicles (OMVs) prepared from a clinically isolated multidrug-resistant strain of A. baumannii. Pneumonia and sepsis models were used to evaluate the efficacy of active and passive immunization with OMVs. The probable effective mechanisms and the protective potential of clonally distinct clinical isolates were investigated in vitro using an opsonophagocytic assay. Results Intramuscular immunization with OMVs rapidly produced high levels of OMV-specific IgG antibodies, and subsequent intranasal challenge with A. baumannii elicited mucosal IgA and IgG responses. Both active and passive immunization protected the mice from challenges with homologue bacteria in a sepsis model. Bacterial burden in bronchoalveolar lavage fluids (BALF), lung, and spleen, inflammatory cell infiltration in BALF and lung, and inflammatory cytokine accumulation in BALF was significantly suppressed in the pneumonia model by both active and passive immunization strategies. The antisera from immunized mice presented with significant opsonophagocytic activities in a dose-dependent manner against not only homologous strains but also five of the other six clonally distinct clinical isolates. Conclusions Utilizing immunological characteristics of outer membrane proteins to elevate protective immunity and circumvent complex multidrug-resistance mechanisms might be a viable approach to effectively control A. baumannii infections. PMID:24956279

  16. Risk Factors and Clinical Outcomes for Patients With Acinetobacter baumannii Bacteremia

    PubMed Central

    Gu, Zhenyang; Han, Yuliang; Meng, Taojiang; Zhao, Shasha; Zhao, Xiaoli; Gao, Chunji; Huang, Wenrong


    Abstract Acinetobacter (A.) baumannii, an opportunistic nosocomial pathogen that can cause significant morbidity and mortality, has emerged as a worldwide problem. This study aimed to analyze the clinical features and outcomes of patients with A. baumannii bacteremia and determine the factors influencing survival by using 14-day mortality as the primary endpoint. A 6-year retrospective study of 122 cases with monomicrobial A. baumannii bacteremia was conducted in Chinese People's Liberation Army (PLA) General Hospital from January 2008 to April 2014. Predictors of 14-day mortality were identified by logistic regression analysis. The overall 14-day mortality rate was 40.2% (49 of 122 patients). Multivariable analysis revealed that independent predictors of 14-day mortality included severity of illness defined by Pitt Bacteremia Score (PBS) (odds ratio [OR], 0.46; 95% confidence interval [CI], 0.340–0.619; P < 0.001), neutropenia (OR, 18.02; 95% CI, 1.667–194.67; P = 0.017), and malignancy (OR, 4.63; 95% CI, 1.292–16.588; P = 0.019). The effect of malignancy was influenced by neutropenia (OR for interaction term, 1.60; 95% CI, 1.15–2.22; P = 0.005). A subgroup analysis revealed that 14-day mortality rate for patients with underlying hematological malignancies and solid tumors was 75% (12/16) and 40% (12/30), respectively. Survival analysis revealed that mortality in patients with hematological malignancies was higher than that in patients with solid tumors (P = 0.032). The outcomes of patients with A. baumannii bacteremia were related to PBS, neutropenia, and malignancy. Compared with solid tumors, patients with hematological malignancies had a higher mortality in the setting of A. baumannii bacteremia. PMID:26945403

  17. In Vitro activities of combinations of rifampin with other antimicrobials against multidrug-resistant Acinetobacter baumannii.


    Bai, Yan; Liu, Bin; Wang, Tianlin; Cai, Yun; Liang, Beibei; Wang, Rui; Liu, Youning; Wang, Jin


    The antimicrobial treatment of multidrug-resistant (MDR) Acinetobacter baumannii infections has become a great challenge for medical staff all over the world. Increasing numbers of MDR A. baumannii infections have been identified and reported, but effective clinical treatments for them are decreasing. The objective of this study was to investigate the in vitro activities of combinations of rifampin (an established antimicrobial) and other antimicrobials, including biapenem, colistin, and tigecycline, against 73 clinical isolates of MDR A. baumannii. In total, 73 clinical isolates of MDR A. baumannii were collected from two A-level general hospitals in Beijing, and the MICs of rifampin, biapenem, colistin, and tigecycline were determined. The checkerboard method was used to determine the fractional inhibitory concentration indices (FICIs), that is, whether the combinations acted synergistically against these isolates. The MIC50, MIC90, and MICrange of rifampin combined with biapenem, colistin, and tigecycline against the isolates were clearly lower than those for four antimicrobials (rifampin, biapenem, colistin, and tigecycline) that were used alone. Combinations of rifampin with biapenem, colistin, and tigecycline individually demonstrated the following interactions: synergistic interactions (FICI ≤ 0.5) for 31.51%, 34.25%, and 31.51% of the isolates, partially synergistic interactions (0.5 < FICI < 1) for 49.31%, 43.83%, and 47.94% of the isolates, and additive interactions (FICI = 1) for 19.18%, 21.92%, and 20.55% of the isolates, respectively. There were no indifferent (1 < FICI < 4) or antagonistic (FICI ≥ 4) interactions. Therefore, combinations of rifampin with biapenem, colistin, or tigecycline may be future therapeutic alternatives for the treatment of MDR A. baumannii infections. PMID:25534730

  18. In Vitro Activities of Combinations of Rifampin with Other Antimicrobials against Multidrug-Resistant Acinetobacter baumannii

    PubMed Central

    Bai, Yan; Liu, Bin; Wang, Tianlin; Cai, Yun; Liang, Beibei; Liu, Youning; Wang, Jin


    The antimicrobial treatment of multidrug-resistant (MDR) Acinetobacter baumannii infections has become a great challenge for medical staff all over the world. Increasing numbers of MDR A. baumannii infections have been identified and reported, but effective clinical treatments for them are decreasing. The objective of this study was to investigate the in vitro activities of combinations of rifampin (an established antimicrobial) and other antimicrobials, including biapenem, colistin, and tigecycline, against 73 clinical isolates of MDR A. baumannii. In total, 73 clinical isolates of MDR A. baumannii were collected from two A-level general hospitals in Beijing, and the MICs of rifampin, biapenem, colistin, and tigecycline were determined. The checkerboard method was used to determine the fractional inhibitory concentration indices (FICIs), that is, whether the combinations acted synergistically against these isolates. The MIC50, MIC90, and MICrange of rifampin combined with biapenem, colistin, and tigecycline against the isolates were clearly lower than those for four antimicrobials (rifampin, biapenem, colistin, and tigecycline) that were used alone. Combinations of rifampin with biapenem, colistin, and tigecycline individually demonstrated the following interactions: synergistic interactions (FICI ≤ 0.5) for 31.51%, 34.25%, and 31.51% of the isolates, partially synergistic interactions (0.5 < FICI < 1) for 49.31%, 43.83%, and 47.94% of the isolates, and additive interactions (FICI = 1) for 19.18%, 21.92%, and 20.55% of the isolates, respectively. There were no indifferent (1 < FICI < 4) or antagonistic (FICI ≥ 4) interactions. Therefore, combinations of rifampin with biapenem, colistin, or tigecycline may be future therapeutic alternatives for the treatment of MDR A. baumannii infections. PMID:25534730

  19. Modeling the impact of interventions against Acinetobacter baumannii transmission in intensive care units

    PubMed Central

    Doan, Tan N; Kong, David CM; Marshall, Caroline; Kirkpatrick, Carl MJ; McBryde, Emma S


    The efficacy of infection control interventions against Acinetobacter baumannii remains unclear, despite such information being critical for effective prevention of the transmission of this pathogen. Mathematical modeling offers an alternative to clinical trials, which may be prohibitively expensive, unfeasible or unethical, in predicting the impact of interventions. Furthermore, it allows the ability to ask key “what if” questions to evaluate which interventions have the most impact. We constructed a transmission dynamic model to quantify the effects of interventions on reducing A. baumannii prevalence and the basic reproduction ratio (R0) in intensive care units (ICUs). We distinguished between colonization and infection, and incorporated antibiotic exposure and transmission from free-living bacteria in the environment. Under the assumptions and parameterization in our model, 25% and 18% of patients are colonized and infected with A. baumannii, respectively; and R0 is 1.4. Improved compliance with hand hygiene (≥87%), enhanced environmental cleaning, reduced length of ICU stay of colonized patients (≤ 10 days), shorter durations of antibiotic treatment of A. baumannii (≤6 days), and isolation of infected patients combined with cleaning of isolation rooms are effective, reducing R0 to below unity. In contrast, expediting the recovery of the intestinal microbiota (e.g. use of probiotics) is not effective. This study represents a biologically realistic model of the transmission dynamics of A. baumannii, and the most comprehensive analysis of the effectiveness of interventions against this pathogen. Our study provides important data for designing effective infection control interventions. PMID:26252184

  20. Distribution and expression of the Ade multidrug efflux systems in Acinetobacter baumannii clinical isolates.


    Pagdepanichkit, Sirawit; Tribuddharat, Chanwit; Chuanchuen, Rungtip


    One hundred Acinetobacter baumannii clinical isolates were examined for inhibitory effect of reserpine and carbonyl cyanide m-chlorophenylhydrazone (CCCP) on the antimicrobial susceptibility and expression of 4 resistant-nodulation-cell division (RND)-type multidrug efflux systems, including AdeABC, AdeDE, AdeIJK, and AdeFGH, using RT-PCR. Ten A. baumannii isolates expressing AdeABC, AdeIJK, or AdeFGH were randomly selected for determination of transcription level and regulatory mutations. While all the isolates were resistant to multiple drugs, the reserpine and CCCP experiment showed that the multidrug resistance phenotype in most A. baumannii isolates was associated with efflux pumps. Most isolates expressed at least one of the RND-type efflux pumps tested (97%). AdeIJK expression was most common (97%), but none of the isolates produced AdeDE. Fifty-two percent of the A. baumannii isolates simultaneously produced up to 3 RND-type efflux systems (i.e., AdeABC, AdeFGH, and AdeIJK). No good correlation between the expression of RND-type efflux pumps and the type of antimicrobial resistance was observed. Overexpression of AdeABC, AdeIJK, and AdeFGH was not always related to the presence of mutations in their corresponding regulatory genes. This study highlights (i) the universal presence of the RND-type efflux pumps with variable levels of expression level among the A. baumannii in this collection and (ii) the complexity of their regulation of expression. PMID:27332787

  1. Draft Genome Sequences of Seven Multidrug-Resistant Acinetobacter baumannii Strains, Isolated from Respiratory Samples in Spain

    PubMed Central

    Labrador-Herrera, Gema; Álvarez, Rocío; López-Rojas, Rafael; Smani, Younes; Cebrero-Cangueiro, Tania; Rueda, Antonio; Pérez Florido, Javier; Pachón-Ibáñez, María Eugenia


    The draft genome sequences of seven multidrug-resistant Acinetobacter baumannii clinical strains belonging to sequence types ST-208 and ST-218 are reported in this study. They were isolated from tracheobronchial aspirate of mechanically ventilated adult patients admitted to the intensive care unit of a Spanish tertiary hospital during 2010 to 2011. PMID:27034482

  2. Draft Genome Sequence of Extensively Drug-Resistant Acinetobacter baumannii Strain CUAB1 from a Patient in Hong Kong, China

    PubMed Central

    Leung, Alden King-Yung; Lau, Hiuus Hiu-Yu; Chan, Ting-Fung; Ip, Margaret


    We report the draft genome sequence of an extensively drug-resistant strain of Acinetobacter baumannii, CUAB1, isolated from a patient in a local Hong Kong hospital. MIC testing was performed, and genes previously associated with drug resistance were located. PMID:25977429

  3. Antibiotic resistance and phylogenetic characterization of Acinetobacter baumannii strains isolated from commercial raw meat in Switzerland.


    Lupo, Agnese; Vogt, Debora; Seiffert, Salome N; Endimiani, Andrea; Perreten, Vincent


    The spread of antibiotic-resistant bacteria through food has become a major public health concern because some important human pathogens may be transferred via the food chain. Acinetobacter baumannii is one of the most life-threatening gram-negative pathogens; multidrug-resistant (MDR) clones of A. baumannii are spreading worldwide, causing outbreaks in hospitals. However, the role of raw meat as a reservoir of A. baumannii remains unexplored. In this study, we describe for the first time the antibiotic susceptibility and fingerprint (repetitive extragenic palindromic PCR [rep-PCR] profile and sequence types [STs]) of A. baumannii strains found in raw meat retailed in Switzerland. Our results indicate that A. baumannii was present in 62 (25.0%) of 248 (CI 95%: 19.7 to 30.9%) meat samples analyzed between November 2012 and May 2013, with those derived from poultry being the most contaminated (48.0% [CI 95%: 37.8 to 58.3%]). Thirty-nine strains were further tested for antibiotic susceptibility and clonality. Strains were frequently not susceptible (intermediate and/or resistant) to third- and fourth-generation cephalosporins for human use (i.e., ceftriaxone [65%], cefotaxime [32%], ceftazidime [5%], and cefepime [2.5%]). Resistance to piperacillin-tazobactam, ciprofloxacin, colistin, and tetracycline was sporadically observed (2.5, 2.5, 5, and 5%, respectively), whereas resistance to carbapenems was not found. The strains were genetically very diverse from each other and belonged to 29 different STs, forming 12 singletons and 6 clonal complexes (CCs), of which 3 were new (CC277, CC360, and CC347). RepPCR analysis further distinguished some strains of the same ST. Moreover, some A. baumannii strains from meat belonged to the clonal complexes CC32 and CC79, similar to the MDR isolates responsible for human infections. In conclusion, our findings suggest that raw meat represents a reservoir of MDR A. baumannii and may serve as a vector for the spread of these pathogens

  4. Resistant mechanisms and molecular epidemiology of imipenem-resistant Acinetobacter baumannii.


    Xiao, Shu-Zhen; Chu, Hai-Qing; Han, Li-Zhong; Zhang, Zhe-Min; Li, Bing; Zhao, Lan; Xu, Liyun


    The aim of the study was to investigate the resistant mechanisms and homology of imipenem-resistant Acinetobacter baumannii (A. baumannii). A total of 46 non-duplicate imipenem‑resistant A. baumannii clinical isolates were collected from three tertiary hospitals between July, 2011 and June, 2012. The minimal inhibitory concentrations (MICs) of antimicrobial agents were determined using the agar dilution method. Phenylalanine‑arginine β-naphthylamide was used to detect the presence of the efflux pump-mediated resistant mechanism. Polymerase chain reaction was employed to amplify genes associated with drug resistance, including β‑lactamase genes, efflux pump genes and outer membrane protein gene CarO. A few amplicons were randomly selected and sequenced. Multilocus sequence analysis (MLST) was employed in typing A. baumanni. A. baumannii was resistant to imipenem, simultaneously showing resistance to several other antimicrobials. In addtition, 13 A. baumannii were found to mediate drug resistance through operation of the efflux pump. Of the various drug resistance genes tested, blaOXA‑51 was present in 46 isolates, blaOXA‑23 gene was present in 44 isolates and blaNDM gene was found in only one strain. Other drug resistant‑associated genes, including blaKPC, blaIMP, blaOXA-24, blaOXA‑58, blaSHV, blaGIM and blaVIM were not detected. Mutation of adeS and outer membrane protein gene CarO were found in a few of the imipenem‑resistant isolates. The MLST analysis revealed that all 46 clinical isolates were clustered into 11 genotypes and the most frequent genotype was ST208. In conclusion, β‑lactamase genes, genes involved in efflux pump and mutation of outer membrane protein encoding gene may be important in mediating imipenem resistance in A. baumannii. Of the 11 different genotypes, ST11 was shared by the majority of A. baumannii, which may be due to horizontal transfer of patients from hospitals. PMID:27485638

  5. Characterization of a highly virulent and antimicrobial-resistant Acinetobacter baumannii strain isolated from diseased chicks in China.


    Liu, Dong; Liu, Zeng-Shan; Hu, Pan; Hui, Qi; Fu, Bao-Quan; Lu, Shi-Ying; Li, Yan-Song; Zou, De-Ying; Li, Zhao-Hui; Yan, Dong-Ming; Ding, Yan-Xia; Zhang, Yuan-Yuan; Zhou, Yu; Liu, Nan-Nan; Ren, Hong-Lin


    Poultry husbandry is a very important aspect of the agricultural economy in China. However, chicks are often susceptible to infectious disease microorganisms, such as bacteria, viruses and parasites, causing large economic losses in recent years. In the present study, we isolated an Acinetobacter baumannii strain, CCGGD201101, from diseased chicks in the Jilin Province of China. Regression analyses of virulence and LD50 tests conducted using healthy chicks confirmed that A. baumannii CCGGD201101, with an LD50 of 1.81 (±0.11) × 10(4) CFU, was more virulent than A. baumannii ATCC17978, with an LD50 of 1.73 (±0.13) × 10(7) CFU. Moreover, TEM examination showed that the pili of A. baumannii CCGGD201101 were different from those of ATCC17978. Antibiotic sensitivity analyses showed that A. baumannii CCGGD201101 was sensitive to rifampicin but resistant to most other antibiotics. These results imply that A. baumannii strain CCGGD201101 had both virulence enhancement and antibiotic resistance characteristics, which are beneficial for A. baumannii survival under adverse conditions and enhance fitness and invasiveness in the host. A. baumannii CCGGD20101, with its high virulence and antimicrobial resistance, may be one of the pathogens causing death of diseased chicks. PMID:27399903

  6. Epidemiology of Carbapenemase-Producing Enterobacteriaceae and Acinetobacter baumannii in Mediterranean Countries

    PubMed Central

    Djahmi, Nassima; Dunyach-Remy, Catherine; Pantel, Alix; Dekhil, Mazouz; Sotto, Albert; Lavigne, Jean-Philippe


    The emergence and global spread of carbapenemase-producing Enterobacteriaceae and Acinetobacter baumannii are of great concern to health services worldwide. These β-lactamases hydrolyse almost all β-lactams, are plasmid-encoded, and are easily transferable among bacterial species. They are mostly of the KPC, VIM, IMP, NDM, and OXA-48 types. Their current extensive spread worldwide in Enterobacteriaceae is an important source of concern. Infections caused by these bacteria have limited treatment options and have been associated with high mortality rates. Carbapenemase producers are mainly identified among Klebsiella pneumoniae, Escherichia coli, and A. baumannii and still mostly in hospital settings and rarely in the community. The Mediterranean region is of interest due to a great diversity and population mixing. The prevalence of carbapenemases is particularly high, with this area constituting one of the most important reservoirs. The types of carbapenemase vary among countries, partially depending on the population exchange relationship between the regions and the possible reservoirs of each carbapenemase. This review described the epidemiology of carbapenemases produced by enterobacteria and A. baumannii in this part of the world highlighting the worrisome situation and the need to screen and detect these enzymes to prevent and control their dissemination. PMID:24955354

  7. Acinetobacter baumannii Virulence Is Mediated by the Concerted Action of Three Phospholipases D

    PubMed Central

    Stahl, Julia; Bergmann, Holger; Göttig, Stephan; Ebersberger, Ingo; Averhoff, Beate


    Acinetobacter baumannii causes a broad range of opportunistic infections in humans. Its success as an emerging pathogen is due to a combination of increasing antibiotic resistance, environmental persistence and adaptation to the human host. To date very little is known about the molecular basis of the latter. Here we demonstrate that A. baumannii can use phosphatidylcholine, an integral part of human cell membranes, as sole carbon and energy source. We report on the identification of three phospholipases belonging to the PLD superfamily. PLD1 and PLD2 appear restricted to the bacteria and display the general features of bacterial phospholipases D. They possess two PLDc_2 PFAM domains each encompassing the HxKx4Dx6GS/GGxN (HKD) motif necessary for forming the catalytic core. The third candidate, PLD3, is found in bacteria as well as in eukaryotes and harbours only one PLDc_2 PFAM domain and one conserved HKD motif, which however do not overlap. Employing a markerless mutagenesis system for A. baumannii ATCC 19606T, we generated a full set of PLD knock-out mutants. Galleria mellonella infection studies as well as invasion experiments using A549 human lung epithelial cells revealed that the three PLDs act in a concerted manner as virulence factors and are playing an important role in host cell invasion. PMID:26379240

  8. Synergistic Effects and Antibiofilm Properties of Chimeric Peptides against Multidrug-Resistant Acinetobacter baumannii Strains

    PubMed Central

    Gopal, Ramamourthy; Kim, Young Gwon; Lee, Jun Ho; Lee, Seog Ki; Chae, Jeong Don; Son, Byoung Kwan; Seo, Chang Ho


    The increasing prevalence of drug-resistant pathogens highlights the need to identify novel antibiotics. Here we investigated the efficacies of four new antimicrobial peptides (AMPs) for potential drug development. The antibacterial activities, synergistic effects, and antibiofilm properties of the four chimeric AMPs were tested against Acinetobacter baumannii, an emerging Gram-negative, nosocomial, drug-resistant pathogen. Nineteen A. baumannii strains resistant to ampicillin, cefotaxime, ciprofloxacin, tobramycin, and erythromycin were isolated at a hospital from patients with cholelithiasis. All four peptides exhibited significant antibacterial effects (MIC = 3.12 to 12.5 μM) against all 19 strains, whereas five commercial antibiotics showed little or no activity against the same pathogens. An exception was polymyxin, which was effective against all of the strains tested. Each of the peptides showed synergy against one or more strains when administered in combination with cefotaxime, ciprofloxacin, or erythromycin. The peptides also exhibited an ability to prevent biofilm formation, which was not seen with cefotaxime, ciprofloxacin, or erythromycin, though polymyxin also inhibited biofilm formation. Indeed, when administered in combination with ciprofloxacin, the AMP HPMA exerted a potent synergistic effect against A. baumannii biofilm formation. Collectively, our findings indicate that the AMPs tested have no cytotoxicity but possess potent antibacterial and antibiofilm activities and may act synergistically with commercial antibiotics. PMID:24366740

  9. Treatment of multidrug-resistant Acinetobacter baumannii meningitis with ampicillin/sulbactam.


    Jiménez-Mejías, M E; Pachón, J; Becerril, B; Palomino-Nicás, J; Rodríguez-Cobacho, A; Revuelta, M


    The clinical features and the outcomes of eight cases of nosocomial Acinetobacter baumannii meningitis treated with ampicillin/sulbactam are reported. All the patients had fever, neck stiffness or meningeal signs, and a low consciousness level, and in their cerebrospinal fluid (CSF), pleocytosis, a low glucose level, and an elevated protein level were noted. For all CSF isolates of A. baumannii, the MIC of ampicillin/sulbactam was < or = 8/4 microg/mL. The MICs of sulbactam by microdilution in two cases were 4 microg/mL. All isolates were resistant to cefotaxime, ceftriaxone, ceftazidime, ureidopenicillins, ciprofloxacin, and gentamicin. Seven isolates were resistant to imipenem. A. baumannii was isolated from other samples in seven episodes. All patients were treated with ampicillin/sulbactam (seven with 2 g/l g every 6 hours and one with 2 g/l g every 8 hours). Six patients were cured and two patients died of meningitis. There were no side effects with the ampicillin/sulbactam treatment. In conclusion, ampicillin/sulbactam may be effective as therapy for meningitis caused by A. baumanii resistant to imipenem and other beta-lactam drugs. PMID:9142795

  10. Activity of Gallium Meso- and Protoporphyrin IX against Biofilms of Multidrug-Resistant Acinetobacter baumannii Isolates

    PubMed Central

    Chang, David; Garcia, Rebecca A.; Akers, Kevin S.; Mende, Katrin; Murray, Clinton K.; Wenke, Joseph C.; Sanchez, Carlos J.


    Acinetobacter baumannii is a challenging pathogen due to antimicrobial resistance and biofilm development. The role of iron in bacterial physiology has prompted the evaluation of iron-modulation as an antimicrobial strategy. The non-reducible iron analog gallium(III) nitrate, Ga(NO3)3, has been shown to inhibit A. baumannii planktonic growth; however, utilization of heme-iron by clinical isolates has been associated with development of tolerance. These observations prompted the evaluation of iron-heme sources on planktonic and biofilm growth, as well as antimicrobial activities of gallium meso- and protoporphyrin IX (Ga-MPIX and Ga-PPIX), metal heme derivatives against planktonic and biofilm bacteria of multidrug-resistant (MDR) clinical isolates of A. baumannii in vitro. Ga(NO3)3 was moderately effective at reducing planktonic bacteria (64 to 128 µM) with little activity against biofilms (≥512 µM). In contrast, Ga-MPIX and Ga-PPIX were highly active against planktonic bacteria (0.25 to 8 µM). Cytotoxic effects in human fibroblasts were observed following exposure to concentrations exceeding 128 µM of Ga-MPIX and Ga-PPIX. We observed that the gallium metal heme conjugates were more active against planktonic and biofilm bacteria, possibly due to utilization of heme-iron as demonstrated by the enhanced effects on bacterial growth and biofilm formation. PMID:26999163

  11. Outbreak of multiresistant OXA-24- and OXA-51-producing Acinetobacter baumannii in an internal medicine ward.


    Tena, Daniel; Martínez, Nora Mariela; Oteo, Jesús; Sáez, David; Vindel, Ana; Azañedo, María Luisa; Sánchez, Lorenzo; Espinosa, Alfredo; Cobos, Juan; Sánchez, Rosario; Otero, Ignacio; Bisquert, Julia


    Here we describe the clinical, microbiological, epidemiological, and molecular characterization of an outbreak of multidrug-resistant Acinetobacter baumannii (MRAB) involving 5 patients admitted to the internal medicine ward of our hospital. Over a 6-week period, 5 MRAB isolates were recovered from 5 patients, including 1 with fatal meningitis, 3 with skin and soft tissue infections, and 1 with respiratory colonization. One sample obtained during environmental monitoring in the ward was A. baumannii-positive. According to the pulsed-field gel electrophoresis typing results, the strains isolated from all patients and the environmental sample belonged to a single clone, identified as ST79 by multilocus sequence typing. The blaOXA-24 and blaOXA-51 carbapenemases were detected in all isolates. Four patients died, but only the death of the meningitis patient was probably related to the A. baumannii infection. The infection source was probably the hands of the healthcare workers because the outbreak strain was isolated from the surface of a serum container. The results of the present study revealed the importance of strict adherence to control measures by all healthcare workers because the consequences of noncompliance can be very serious. PMID:23883845

  12. Efficacy of Artilysin Art-175 against Resistant and Persistent Acinetobacter baumannii.


    Defraine, Valerie; Schuermans, Joris; Grymonprez, Barbara; Govers, Sander K; Aertsen, Abram; Fauvart, Maarten; Michiels, Jan; Lavigne, Rob; Briers, Yves


    Bacteriophage-encoded endolysins have shown promise as a novel class of antibacterials with a unique mode of action, i.e., peptidoglycan degradation. However, Gram-negative pathogens are generally not susceptible due to their protective outer membrane. Artilysins overcome this barrier. Artilysins are optimized, engineered fusions of selected endolysins with specific outer membrane-destabilizing peptides. Artilysin Art-175 comprises a modified variant of endolysin KZ144 with an N-terminal fusion to SMAP-29. Previously, we have shown the high susceptibility of Pseudomonas aeruginosa to Art-175. Here, we report that Art-175 is highly bactericidal against stationary-phase cells of multidrug-resistant Acinetobacter baumannii, even resulting in a complete elimination of large inocula (≥10(8) CFU/ml). Besides actively dividing cells, Art-175 also kills persisters. Instantaneous killing of A. baumannii upon contact with Art-175 could be visualized after immobilization of the bacteria in a microfluidic flow cell. Effective killing of a cell takes place through osmotic lysis after peptidoglycan degradation. The killing rate is enhanced by the addition of 0.5 mM EDTA. No development of resistance to Art-175 under selection pressure and no cross-resistance with existing resistance mechanisms could be observed. In conclusion, Art-175 represents a highly active Artilysin against both A. baumannii and P. aeruginosa, two of the most life-threatening pathogens of the order Pseudomonadales. PMID:27021321

  13. Emergence and clonal dissemination of carbapenem-hydrolysing OXA-58-producing Acinetobacter baumannii isolates in Bolivia.


    Sevillano, Elena; Fernández, Elena; Bustamante, Zulema; Zabalaga, Silvia; Rosales, Ikerne; Umaran, Adelaida; Gallego, Lucía


    Acinetobacter baumannii is an emerging multidrug-resistant pathogen and very little information is available regarding its imipenem resistance in Latin American countries such as Bolivia. This study investigated the antimicrobial resistance profile of 46 clinical strains from different hospitals in Cochabamba, Bolivia, from March 2008 to July 2009, and the presence of carbapenemases as a mechanism of resistance to imipenem. Isolates were obtained from 46 patients (one isolate per patient; 30 males,16 females) with an age range of 1 day to 84 years, and were collected from different sample types, the majority from respiratory tract infections (17) and wounds (13). Resistance to imipenem was detected in 15 isolates collected from different hospitals of the city. These isolates grouped into the same genotype, named A, and were resistant to all antibiotics tested including imipenem, with susceptibility only to colistin. Experiments to detect carbapenemases revealed the presence of the OXA-58 carbapenemase. Further analysis revealed the location of the bla(OXA-58) gene on a 40 kb plasmid. To our knowledge, this is the first report of carbapenem resistance in A. baumannii isolates from Bolivia that is conferred by the OXA-58 carbapenemase. The presence of this gene in a multidrug-resistant clone and its location within a plasmid is of great concern with regard to the spread of carbapenem-resistant A. baumannii in the hospital environment in Bolivia. PMID:21873380

  14. Identification of a DNA-Damage-Inducible Regulon in Acinetobacter baumannii

    PubMed Central

    Aranda, Jesús; Poza, Margarita; Shingu-Vázquez, Miguel; Cortés, Pilar; Boyce, John D.; Adler, Ben; Barbé, Jordi


    The transcriptional response of Acinetobacter baumannii, a major cause of nosocomial infections, to the DNA-damaging agent mitomycin C (MMC) was studied using DNA microarray technology. Most of the 39 genes induced by MMC were related to either prophages or encoded proteins involved in DNA repair. Electrophoretic mobility shift assays demonstrated that the product of the A. baumannii MMC-inducible umuD gene (umuDAb) specifically binds to the palindromic sequence TTGAAAATGTAACTTTTTCAA present in its promoter region. Mutations in this palindromic region abolished UmuDAb protein binding. A comparison of the promoter regions of all MMC-induced genes identified four additional transcriptional units with similar palindromic sequences recognized and specifically bound by UmuDAb. Therefore, the UmuDAb regulon consists of at least eight genes encoding seven predicted error-prone DNA polymerase V components and DddR, a protein of unknown function. Expression of these genes was not induced in the MMC-treated recA mutant. Furthermore, inactivation of the umuDAb gene resulted in the deregulation of all DNA-damage-induced genes containing the described palindromic DNA motif. Together, these findings suggest that UmuDAb is a direct regulator of the DNA damage response in A. baumannii. PMID:24123815

  15. Antibacterial Activity of a Novel Peptide-Modified Lysin Against Acinetobacter baumannii and Pseudomonas aeruginosa

    PubMed Central

    Yang, Hang; Wang, Mengyue; Yu, Junping; Wei, Hongping


    The global emergence of multidrug-resistant (MDR) bacteria is a growing threat to public health worldwide. Natural bacteriophage lysins are promising alternatives in the treatment of infections caused by Gram-positive pathogens, but not Gram-negative ones, like Acinetobacter baumannii and Pseudomonas aeruginosa, due to the barriers posed by their outer membranes. Recently, modifying a natural lysin with an antimicrobial peptide was found able to break the barriers, and to kill Gram-negative pathogens. Herein, a new peptide-modified lysin (PlyA) was constructed by fusing the cecropin A peptide residues 1–8 (KWKLFKKI) with the OBPgp279 lysin and its antibacterial activity was studied. PlyA showed good and broad antibacterial activities against logarithmic phase A. baumannii and P. aeruginosa, but much reduced activities against the cells in stationary phase. Addition of outer membrane permeabilizers (EDTA and citric acid) could enhance the antibacterial activity of PlyA against stationary phase cells. Finally, no antibacterial activity of PlyA could be observed in some bio-matrices, such as culture media, milk, and sera. In conclusion, we reported here a novel peptide-modified lysin with significant antibacterial activity against both logarithmic (without OMPs) and stationary phase (with OMPs) A. baumannii and P. aeruginosa cells in buffer, but further optimization is needed to achieve broad activity in diverse bio-matrices. PMID:26733995

  16. Sheltering Effect and Indirect Pathogenesis of Carbapenem-Resistant Acinetobacter baumannii in Polymicrobial Infection

    PubMed Central

    Liao, Yu-Ting; Kuo, Shu-Chen; Lee, Yi-Tzu; Chen, Chien-Pei; Lin, Shu-Wen; Shen, Li-Jiuan; Fung, Chang-Phone


    The role of carbapenem-resistant Acinetobacter baumannii (CRAb) in polymicrobial infection remains elusive. Having observed the ability of CRAb to shelter other susceptible bacteria from carbapenem killing, we sought to determine the factors contributing to this sheltering effect by transforming different recombinant plasmids into recipient A. baumannii cells. The sheltering effects of CRAb were reproduced in recipient A. baumannii cells that highly expressed carbapenem-hydrolyzing class D β-lactamases (CHDLs) through their associated strong promoter. With the use of Western blot analysis and a bioassay, the highly expressed CHDLs were found to be extracellularly released and led to hydrolysis of carbapenem. The level of extracellular CHDLs increased after challenge with a higher concentration of CHDL substrates, such as carbapenem and ticarcillin. This increased CHDL may, in part, be attributed to cell lysis, as indicated by the presence of extracellular gyrase. In the planktonic condition, the sheltering effect for the cocultured susceptible bacteria might represent an indirect and passive effect of the CRAb self-defense mechanism, because coculture with the susceptible pathogen did not augment the amount of the extracellular CHDLs. Polymicrobial infection caused by CRAb and a susceptible counterpart exerted higher pathogenicity than monomicrobial infection caused by either pathogen alone in mice receiving carbapenem therapy. This study demonstrated that CHDL-producing CRAb appears to provide a sheltering effect for carbapenem-susceptible pathogens via the extracellular release of CHDLs and, by this mechanism, can enhance the pathogenesis of polymicrobial infection in the presence of carbapenem therapy. PMID:24798276

  17. Molecular Epidemiology and Characterization of Genotypes of Acinetobacter baumannii Isolates from Regions of South China.


    Ying, Jun; Lu, Junwan; Zong, Li; Li, Ailing; Pan, Ruowang; Cheng, Cong; Li, Kunpeng; Chen, Liqiang; Ying, Jianchao; Tou, Huifen; Zhu, Chuanxin; Xu, Teng; Yi, Huiguang; Li, Jinsong; Ni, Liyan; Xu, Zuyuan; Bao, Qiyu; Li, Peizhen


    The aim of this study was to analyze the molecular epidemiologic characteristics of Acinetobacter baumannii. A total of 398 isolates were collected in 7 regions of South China from January to June of 2012. Drug sensitivity was tested toward 15 commonly used antibiotics; thus, 146 multi-drug-resistant strains (resistant to more than 7 drugs) were identified, representing 36.7% of all isolates. Pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing (MLST) were used for molecular subtyping. According to the PFGE results (with a cutoff of 70% similarity for the DNA electrophoretic bands), 146 strains were subdivided into 15 clusters, with cluster A being the largest (33.6%, distributed in all districts except Jiaxing). Cluster B was also widespread and included 14.4% of all strains. In addition, MLST results revealed 11 sequence types (ST), with ST208 being the most prevalent, followed by ST191 and ST729. Furthermore, 4 novel alleles and 6 novel STs were identified. Our results showed that multi-drug-resistant A. baumannii in South China shares the origin with other widespread strains in other countries. The nosocomial infections caused by A. baumannii have been severe in South China. Continuous monitoring and judicious antibiotic use are required. PMID:26166496

  18. Investigation of Metallo Beta Lactamases and Oxacilinases in Carbapenem Resistant Acinetobacter baumannii Strains Isolated from Inpatients

    PubMed Central

    Aksoy, M. Duygu; Çavuşlu, Şaban; Tuğrul, H. Murat


    Background: Resistance to beta-lactam antibiotics is widespread among Acinetobacter strains. Plasmid-mediated metallo beta lactamases (MBL) are responsible for carbapenem resistance, as are oxacillinases (OXA). In recent years, MBL producing carbapenem-resistant strains have been reported in the world and in Turkey in increasing rates. In our country, besides the OXA 51-like enzyme which is inherent in A. baumannii strains, OXA 58-like and OXA 23-like carbapenemases producing strains have also been widely detected. In addition, Verona Imipenemase (VIM) and (IMP)-type MBL have been reported in some centers. Aims: The aim of our study was to investigate the presence of carbapenemases in Acinetobacter strains isolated from hospitalized patients in Edirne. Study Design: Cross-sectional study. Methods: A total of 52 imipenem-resistant A. baumannii strains isolated between January and March 2013 were investigated. The presence of MBL was described phenotypically by the combined disk diffusion test (CDDT), double disk synergy test (DDST), MBL E-test (only performed in 28 strains) and modified Hodge test. blaIMP, blaVIM, blaGIM, blaSIM, blaSPM genes and blaOXA-23, blaOXA-51, blaOXA-40, blaOXA-58 genes were investigated by multiplex polymerase chain reaction (PCR). The blaNDM-1 gene was determined by PCR. Results: By modified Hodge test, 50 strains (96%) were found to be MBL positive. Positivity of MBL was 21% by both CDDT (0.1 M EDTA) and DDST. Twenty-four of 28 strains (85.7%) were positive by MBL E-test. OXA 23-like and OXA 51-like carbapenemases were detected in all strains, but OXA 58-like and OXA 40-like carbapenemases-producing A. baumannii were not detected. Also, MBL genes were not detected by genotypic methods. Conclusion: Only OXA 23-like carbapenemase was responsible for carbapenem resistance in carbapenem-resistant Acinetobacter strains in Edirne. The MBL-producing Acinetobacter strain is not yet a problem in our hospital. MBL resistance was found by

  19. Effect of Chlorine Exposure on the Survival and Antibiotic Gene Expression of Multidrug Resistant Acinetobacter baumannii in Water

    PubMed Central

    Karumathil, Deepti Prasad; Yin, Hsin-Bai; Kollanoor-Johny, Anup; Venkitanarayanan, Kumar


    Acinetobacter baumannii is a multidrug resistant pathogen capable of causing a wide spectrum of clinical conditions in humans. Acinetobacter spp. is ubiquitously found in different water sources. Chlorine being the most commonly used disinfectant in water, the study investigated the effect of chlorine on the survival of A. baumannii in water and transcription of genes conferring antibiotic resistance. Eight clinical isolates of A. baumannii, including a fatal meningitis isolate (ATCC 17978) (~108 CFU/mL) were separately exposed to free chlorine concentrations (0.2, 1, 2, 3 and 4 ppm) with a contact time of 30, 60, 90 and 120 second. The surviving pathogen counts at each specified contact time were determined using broth dilution assay. In addition, real-time quantitative PCR (RT-qPCR) analysis of the antibiotic resistance genes (efflux pump genes and those encoding resistance to specific antibiotics) of three selected A. baumannii strains following exposure to chlorine was performed. Results revealed that all eight A. baumannii isolates survived the tested chlorine levels during all exposure times (p > 0.05). Additionally, there was an up-regulation of all or some of the antibiotic resistance genes in A. baumannii, indicating a chlorine-associated induction of antibiotic resistance in the pathogen. PMID:24514427

  20. Growth of Acinetobacter baumannii in Pellicle Enhanced the Expression of Potential Virulence Factors

    PubMed Central

    Alexandre, Stéphane; Coquet, Laurent; Vila, Jordi; Jouenne, Thierry; Dé, Emmanuelle


    Background Interestingly, Acinetobacter baumannii presents an enhanced capacity to form biofilms (also named pellicles) at the air-liquid interface as compared to the other Acinetobacter species. This characteristic questions the contribution of this phenotype to an increased risk of clinical infections by this pathogen. Methodology/Principal Findings By a proteomic approach using 2-D gel electrophoresis-LC-MS/MS mass spectrometry, we compared the membrane protein patterns of A. baumannii 77, a pellicle-forming clinical isolate, grown in planktonic and in sessile modes. We identified 52 proteins with a differential expression, including 32 up-regulated and 20 down-regulated in the pellicle state. Several proteins, differentially expressed during pellicle development, were of particular interest. We determined the over-expression of four siderophore iron uptake systems including the acinetobactin and enterobactin receptors and confirmed that the development of this type of biofilm is promoted by ferric ions. Two over-expressed proteins, CarO and an OprD-homologue, putative carbapenem-resistance associated porins, would be involved in the transport of specific compounds, like ornithine, a biosynthesis precursor of a siderophore from the hydroxamate family. We evidenced the overexpression of a lipase and a transporter of LCFA that may be involved in the recycling of lipids inside the pellicle matrix. Finally, we demonstrated both by proteomic and by AFM studies that this particular type of biofilm required multiple pili systems to maintain this cohesive structure at the air-liquid interface; two of these systems have never been described in A. baumannii. Conclusions/Significance Our study demonstrated that several proteins, overexpressed at a late state of pellicle development, could be potentially involved in virulence processes. Therefore, regarding the number of potential virulence factors that are over-expressed in this growth mode, the pellicle-forming clinical

  1. Reinforcing Lipid A Acylation on the Cell Surface of Acinetobacter baumannii Promotes Cationic Antimicrobial Peptide Resistance and Desiccation Survival

    PubMed Central

    Boll, Joseph M.; Tucker, Ashley T.; Klein, Dustin R.; Beltran, Alexander M.; Brodbelt, Jennifer S.; Davies, Bryan W.


    ABSTRACT Acinetobacter baumannii is an emerging Gram-negative pathogen found in hospitals and intensive care units. In order to persist in hospital environments, A. baumannii withstands desiccative conditions and can rapidly develop multidrug resistance to conventional antibiotics. Cationic antimicrobial peptides (CAMPs) have served as therapeutic alternatives because they target the conserved lipid A component of the Gram-negative outer membrane to lyse the bacterial cell. However, many Gram-negative pathogenic bacteria, including A. baumannii, fortify their outer membrane with hepta-acylated lipid A to protect the cell from CAMP-dependent cell lysis. Whereas in Escherichia coli and Salmonella, increased production of the outer membrane acyltransferase PagP results in formation of protective hepta-acylated lipid A, which reinforces the lipopolysaccharide portion of the outer membrane barrier, A. baumannii does not carry a gene that encodes a PagP homolog. Instead, A. baumannii has evolved a PagP-independent mechanism to synthesize protective hepta-acylated lipid A. Taking advantage of a recently adapted A. baumannii genetic recombineering system, we characterized two putative acyltransferases in A. baumannii designated LpxLAb (A. baumannii LpxL) and LpxMAb (A. baumannii LpxM), which transfer one and two lauroyl (C12:0) acyl chains, respectively, during lipid A biosynthesis. Hepta-acylation of A. baumannii lipid A promoted resistance to vertebrate and polymyxin CAMPs, which are prescribed as last-resort treatment options. Intriguingly, our analysis also showed that LpxMAb-dependent acylation of lipid A is essential for A. baumannii desiccation survival, a key resistance mechanism for survival in hospital environments. Compounds that inhibit LpxMAb-dependent hepta-acylation of lipid A could act synergistically with CAMPs to provide innovative transmission prevention strategies and treat multidrug-resistant infections. PMID:25991684

  2. Draft Genome Sequences of Two Extensively Drug-Resistant Acinetobacter baumannii Strains Isolated from Pus Samples.


    Mahalingam, Niranjana; Manivannan, Bhavani; Jadhao, Sudhir; Mishra, Gayathri; Nilawe, Pravin; Pradeep, Bulagonda Eswarappa


    We report the draft genomes of two extensively drug-resistant (XDR)Acinetobacter baumanniistrains isolated from pus samples of two patients with surgical site infections at Sri Sathya Sai Institute of Higher Medical Sciences, Prasanthigram, India. The average genomic size and G+C content are 4 Mbp and 38.96% (AB28) and 4 Mbp and 38.94% (AB30), respectively. PMID:27013044

  3. [Distribution of blaOXA genes in Acinetobacter baumannii strains: a multicenter study].


    Ciftci, Ihsan Hakkı; Aşık, Gülşah; Karakeçe, Engin; Oksüz, Lütfiye; Yağcı, Server; Sesli Çetin, Emel; Ozdemir, Mehmet; Atasoy, Ali Rıza; Koçoğlu, Esra; Gül, Mustafa; Kurtoğlu, Muhammet Güzel; Köksal Çakırlar, Fatma; Seyrek, Adnan; Berktaş, Mustafa; Gültepe, Bilge; Ayyildiz, Ahmet


    Acinetobacter baumannii is the most important agent of nosocomial infections within the Acinetobacter genus. This gram-negative coccobacillus is intrinsically resistant to many antibiotics used in antimicrobial therapy, and capable of developing resistance including carbapenems. The objective of this study was to develop a multiplex real time polymerase chain reaction (qPCR) kit for OXA subgroups in A.baumannii, and to investigate the distribution of OXA subgroups in A.baumannii strains isolated from geographically different regions of Turkey. A total of 834 A.baumannii clinical isolates collected from different state and university medical centers in 13 provinces (Afyonkarahisar, Ankara, Bolu, Elazig, Erzurum, Isparta, Istanbul, Kahramanmaras, Konya, Sakarya, Van) between 2008-2011, were included in the study. The isolates were identified by conventional methods and automated systems [Vitek2 (bioMerieux, ABD) and Phoenix (BD Diagnostic, MD)]. The susceptibility profiles of the isolates were studied with automated systems and standard disc diffusion method. All samples were subjected to qPCR to detect blaOXA-51-like, blaOXA-23-like and blaOXA-58-like genes. A conventional PCR method was also used to detect blaOXA-24-like gene. The resistance rates observed during the study period were as follows: 96.8% for amoxicillin-clavulanate, 86.8% for ciprofloxacin, 74.7% for gentamicin, 71.7% for amikacin, 73.5% for cefaperozone-sulbactam, 72.1% for imipenem and 73% for meropenem. Six hundred and two (72.2 %) isolates were resistant to both imipenem and meropenem. Colistin was found to be the most effective antibiotic against A.baumannii isolates with 100% susceptibility rate. All isolates were positive for blaOXA-51-like, however blaOXA-24-like gene could not be demonstrated in any isolate. Total positivity rates of blaOXA-23-like and blaOXA-58-like genes were found as 53.7% and 12.5%, respectively, while these rates were 74.4% and 17.3% in carbapenem-resistant isolates

  4. Comparative Genomics of Two ST 195 Carbapenem-Resistant Acinetobacter baumannii with Different Susceptibility to Polymyxin Revealed Underlying Resistance Mechanism

    PubMed Central

    Lean, Soo-Sum; Yeo, Chew Chieng; Suhaili, Zarizal; Thong, Kwai-Lin


    Acinetobacter baumannii is a Gram-negative nosocomial pathogen of importance due to its uncanny ability to acquire resistance to most antimicrobials. These include carbapenems, which are the drugs of choice for treating A. baumannii infections, and polymyxins, the drugs of last resort. Whole genome sequencing was performed on two clinical carbapenem-resistant A. baumannii AC29 and AC30 strains which had an indistinguishable ApaI pulsotype but different susceptibilities to polymyxin. Both genomes consisted of an approximately 3.8 Mbp circular chromosome each and several plasmids. AC29 (susceptible to polymyxin) and AC30 (resistant to polymyxin) belonged to the ST195 lineage and are phylogenetically clustered under the International Clone II (IC-II) group. An AbaR4-type resistance island (RI) interrupted the comM gene in the chromosomes of both strains and contained the blaOXA−23 carbapenemase gene and determinants for tetracycline and streptomycin resistance. AC29 harbored another copy of blaOXA−23 in a large (~74 kb) conjugative plasmid, pAC29b, but this gene was absent in a similar plasmid (pAC30c) found in AC30. A 7 kb Tn1548::armA RI which encodes determinants for aminoglycoside and macrolide resistance, is chromosomally-located in AC29 but found in a 16 kb plasmid in AC30, pAC30b. Analysis of known determinants for polymyxin resistance in AC30 showed mutations in the pmrA gene encoding the response regulator of the two-component pmrAB signal transduction system as well as in the lpxD, lpxC, and lpsB genes that encode enzymes involved in the biosynthesis of lipopolysaccharide (LPS). Experimental evidence indicated that impairment of LPS along with overexpression of pmrAB may have contributed to the development of polymyxin resistance in AC30. Cloning of a novel variant of the blaAmpC gene from AC29 and AC30, and its subsequent expression in E. coli also indicated its likely function as an extended-spectrum cephalosporinase. PMID:26779129

  5. Characterising the Transmission Dynamics of Acinetobacter baumannii in Intensive Care Units Using Hidden Markov Models.


    Doan, Tan N; Kong, David C M; Marshall, Caroline; Kirkpatrick, Carl M J; McBryde, Emma S


    Little is known about the transmission dynamics of Acinetobacter baumannii in hospitals, despite such information being critical for designing effective infection control measures. In the absence of comprehensive epidemiological data, mathematical modelling is an attractive approach to understanding transmission process. The statistical challenge in estimating transmission parameters from infection data arises from the fact that most patients are colonised asymptomatically and therefore the transmission process is not fully observed. Hidden Markov models (HMMs) can overcome this problem. We developed a continuous-time structured HMM to characterise the transmission dynamics, and to quantify the relative importance of different acquisition sources of A. baumannii in intensive care units (ICUs) in three hospitals in Melbourne, Australia. The hidden states were the total number of patients colonised with A. baumannii (both detected and undetected). The model input was monthly incidence data of the number of detected colonised patients (observations). A Bayesian framework with Markov chain Monte Carlo algorithm was used for parameter estimations. We estimated that 96-98% of acquisition in Hospital 1 and 3 was due to cross-transmission between patients; whereas most colonisation in Hospital 2 was due to other sources (sporadic acquisition). On average, it takes 20 and 31 days for each susceptible individual in Hospital 1 and Hospital 3 to become colonised as a result of cross-transmission, respectively; whereas it takes 17 days to observe one new colonisation from sporadic acquisition in Hospital 2. The basic reproduction ratio (R0) for Hospital 1, 2 and 3 was 1.5, 0.02 and 1.6, respectively. Our study is the first to characterise the transmission dynamics of A. baumannii using mathematical modelling. We showed that HMMs can be applied to sparse hospital infection data to estimate transmission parameters despite unobserved events and imperfect detection of the organism

  6. In vitro effects of sulbactam combinations with different antibiotic groups against clinical Acinetobacter baumannii isolates.


    Deveci, Aydin; Coban, Ahmet Yilmaz; Acicbe, Ozlem; Tanyel, Esra; Yaman, Gorkem; Durupinar, Belma


    Treatment of multidrug resistant (MDR) Acinetobacter baumannii infections causes some problems as a result of possessing various antibacterial resistance mechanisms against available antibiotics. Combination of antibiotics, acting by different mechanisms, is used for the treatment of MDR bacterial infections. It is an important factor to determine synergy or antagonism between agents in the combination for the constitution of effective therapy. The study aimed to determine In vitro interactions interpreted according to calculated fractional inhibitory concentration (FIC) index between sulbactam and ceftazidime, ceftriaxone, cefepime, ciprofloxacin, gentamicin, meropenem, tigecycline, and colistin. Ten clinical isolates of A. baumannii were tested for determination of synergistic effects of sulbactam with different antimicrobial combinations. Minimal inhibitory concentration (MIC) values of both sulbactam and combined antibiotics decreased 2- to 128-fold. Synergy and partial synergy were determined in combination of sulbactam with ceftazidime and gentamicin (FIC index: ≤ 0.5 or >0.5 to <1) and MIC values of both ceftazidime and gentamicin for five isolates fell down below the susceptibility break point. Similarly, MIC value of ciprofloxacin for six ciprofloxacin resistant isolates was determined as below the susceptibility break point in combination. However, all isolates were susceptible to colistin and tigecycline, MIC values of both were decreased in combination with sulbactam. Although synergistic and partial synergistic effects were observed in the combination of sulbactam and ceftriaxone, all isolates remained resistant to ceftriaxone. The effect of cefepime-sulbactam combination was synergy in five, partial synergy in one and indifferent in four isolates. Meropenem and sulbactam showed a partial synergistic effect (FIC index: >0.5 to <1) in three, an additive effect (FIC index: 1) in one and an indifferent effect (FIC index: >1-2) in six isolates

  7. Antimicrobial Activity of Gallium Protoporphyrin IX against Acinetobacter baumannii Strains Displaying Different Antibiotic Resistance Phenotypes

    PubMed Central

    Arivett, Brock A.; Fiester, Steven E.; Ohneck, Emily J.; Penwell, William F.; Kaufman, Cynthia M.; Relich, Ryan F.


    A paucity of effective, currently available antibiotics and a lull in antibiotic development pose significant challenges for treatment of patients with multidrug-resistant (MDR) Acinetobacter baumannii infections. Thus, novel therapeutic strategies must be evaluated to meet the demands of treatment of these often life-threatening infections. Accordingly, we examined the antibiotic activity of gallium protoporphyrin IX (Ga-PPIX) against a collection of A. baumannii strains, including nonmilitary and military strains and strains representing different clonal lineages and isolates classified as susceptible or MDR. Susceptibility testing demonstrated that Ga-PPIX inhibits the growth of all tested strains when cultured in cation-adjusted Mueller-Hinton broth, with a MIC of 20 μg/ml. This concentration significantly reduced bacterial viability, while 40 μg/ml killed all cells of the A. baumannii ATCC 19606T and ACICU MDR isolate after 24-h incubation. Recovery of ATCC 19606T and ACICU strains from infected A549 human alveolar epithelial monolayers was also decreased when the medium was supplemented with Ga-PPIX, particularly at a 40-μg/ml concentration. Similarly, the coinjection of bacteria with Ga-PPIX increased the survival of Galleria mellonella larvae infected with ATCC 19606T or ACICU. Ga-PPIX was cytotoxic only when monolayers or larvae were exposed to concentrations 16-fold and 1,250-fold higher than those showing antibacterial activity, respectively. These results indicate that Ga-PPIX could be a viable therapeutic option for treatment of recalcitrant A. baumannii infections regardless of the resistance phenotype, clone lineage, time and site of isolation of strains causing these infections and their iron uptake phenotypes or the iron content of the media. PMID:26416873

  8. Abrp, a new gene, confers reduced susceptibility to tetracycline, glycylcine, chloramphenicol and fosfomycin classes in Acinetobacter baumannii.


    Li, X; Quan, J; Yang, Y; Ji, J; Liu, L; Fu, Y; Hua, X; Chen, Y; Pi, B; Jiang, Y; Yu, Y


    Acinetobacter baumannii, a non-fermenting gram-negative coccobacillus, is a major pathogen responsible for a variety of healthcare-associated infections, including pneumonia, urinary tract and bloodstream infections. Moreover, A. baumannii is associated with alarming increases in drug resistance rates to almost all available antibiotics leaving limited treatment options. Here, we characterize the biological functions of a novel gene, abrp, which encodes a peptidase C13 family. We demonstrate that the abrp is associated with decreased susceptibility to tetracycline, minocycline, doxycycline, tigecycline, chloramphenicol and fosfomycin. Deletion of abrp was able to increase cell membrane permeability and display slower cell growth rate. Results from the present study show that abrp plays an important role in conferring reduced susceptibility to different classes of antibiotics and cell growth in A. baumannii. The change of antibiotic sensitivities may result from modifications to the cell membrane permeability of A. baumannii. PMID:27220329

  9. Antibiogram of multidrug resistant Acinetobacter baumannii isolated from clinical specimens at King Hussein Medical Centre, Jordan: a retrospective analysis.


    Batarseh, A; Al-Sarhan, A; Maayteh, M; Al-Khatirei, S; Alarmouti, M


    This study was conducted to determine the prevalence and the local antibiogram of multidrug-resistant Acinetobacter baumannii isolates in Al-Hussein Hospital at King Hussein Medical Centre in Amman, Jordan. In a retrospective study from January to December 2013, data on 116 non-repetitive positive clinical samples were retrieved from patients' laboratory records. The resistance rates of A. baumannii isolates were high for ceftriaxone, cefotaxime and ticarcillin (100%), ceftazidime, cefepime and piperacillin (98.3%), imipenem (97.4%), piperacillin/tazobactam (96.6%), quinolones (94.8%), ampicillin/sulbactam (89.7%), gentamicin, (87.9%), tobramycin and tetracycline (76.7%) and trimethoprim/sulfamethoxazole (75.9%), but lower for minocycline (26.7%) and colistin (1.7%). A. baumannii in our hospital were highly resistant to all antibiotics, including tigecycline, except for minocycline and colistin which are considered the last resort treatment for multidrug-resistant A. baumannii. PMID:26857720

  10. Acinetobacter baumannii Repeatedly Evolves a Hypermutator Phenotype in Response to Tigecycline That Effectively Surveys Evolutionary Trajectories to Resistance

    PubMed Central

    Hammerstrom, Troy G.; Beabout, Kathryn; Clements, Thomas P.; Saxer, Gerda; Shamoo, Yousif


    The evolution of hypermutators in response to antibiotic treatment in both clinical and laboratory settings provides a unique context for the study of adaptive evolution. With increased mutation rates, the number of hitchhiker mutations within an evolving hypermutator population is remarkably high and presents substantial challenges in determining which mutations are adaptive. Intriguingly however, hypermutators also provide an opportunity to explore deeply the accessible evolutionary trajectories that lead to increased organism fitness, in this case the evolution of antibiotic resistance to the clinically relevant antibiotic tigecycline by the hospital pathogen Acinetobacter baumannii. Using a continuous culture system, AB210M, a clinically derived strain of A. baumannii, was evolved to tigecycline resistance. Analysis of the adapted populations showed that nearly all the successful lineages became hypermutators via movement of a mobile element to inactivate mutS. In addition, metagenomic analysis of population samples revealed another 896 mutations that occurred at a frequency greater than 5% in the population, while 38 phenotypically distinct individual colonies harbored a total of 1712 mutations. These mutations were scattered throughout the genome and affected ~40% of the coding sequences. The most highly mutated gene was adeS, a known tigecycline-resistance gene; however, adeS was not solely responsible for the high level of TGC resistance. Sixteen other genes stood out as potentially relevant to increased resistance. The five most prominent candidate genes (adeS, rpsJ, rrf, msbA, and gna) consistently re-emerged in subsequent replicate population studies suggesting they are likely to play a role in adaptation to tigecycline. Interestingly, the repeated evolution of a hypermutator phenotype in response to antibiotic stress illustrates not only a highly adaptive strategy to resistance, but also a remarkably efficient survey of successful evolutionary

  11. Acinetobacter baumannii Repeatedly Evolves a Hypermutator Phenotype in Response to Tigecycline That Effectively Surveys Evolutionary Trajectories to Resistance.


    Hammerstrom, Troy G; Beabout, Kathryn; Clements, Thomas P; Saxer, Gerda; Shamoo, Yousif


    The evolution of hypermutators in response to antibiotic treatment in both clinical and laboratory settings provides a unique context for the study of adaptive evolution. With increased mutation rates, the number of hitchhiker mutations within an evolving hypermutator population is remarkably high and presents substantial challenges in determining which mutations are adaptive. Intriguingly however, hypermutators also provide an opportunity to explore deeply the accessible evolutionary trajectories that lead to increased organism fitness, in this case the evolution of antibiotic resistance to the clinically relevant antibiotic tigecycline by the hospital pathogen Acinetobacter baumannii. Using a continuous culture system, AB210M, a clinically derived strain of A. baumannii, was evolved to tigecycline resistance. Analysis of the adapted populations showed that nearly all the successful lineages became hypermutators via movement of a mobile element to inactivate mutS. In addition, metagenomic analysis of population samples revealed another 896 mutations that occurred at a frequency greater than 5% in the population, while 38 phenotypically distinct individual colonies harbored a total of 1712 mutations. These mutations were scattered throughout the genome and affected ~40% of the coding sequences. The most highly mutated gene was adeS, a known tigecycline-resistance gene; however, adeS was not solely responsible for the high level of TGC resistance. Sixteen other genes stood out as potentially relevant to increased resistance. The five most prominent candidate genes (adeS, rpsJ, rrf, msbA, and gna) consistently re-emerged in subsequent replicate population studies suggesting they are likely to play a role in adaptation to tigecycline. Interestingly, the repeated evolution of a hypermutator phenotype in response to antibiotic stress illustrates not only a highly adaptive strategy to resistance, but also a remarkably efficient survey of successful evolutionary

  12. Identification of an Acinetobacter baumannii Zinc Acquisition System that Facilitates Resistance to Calprotectin-mediated Zinc Sequestration

    PubMed Central

    Hood, M. Indriati; Mortensen, Brittany L.; Moore, Jessica L.; Zhang, Yaofang; Kehl-Fie, Thomas E.; Sugitani, Norie; Chazin, Walter J.; Caprioli, Richard M.; Skaar, Eric P.


    Acinetobacter baumannii is an important nosocomial pathogen that accounts for up to 20 percent of infections in intensive care units worldwide. Furthermore, A. baumannii strains have emerged that are resistant to all available antimicrobials. These facts highlight the dire need for new therapeutic strategies to combat this growing public health threat. Given the critical role for transition metals at the pathogen-host interface, interrogating the role for these metals in A. baumannii physiology and pathogenesis could elucidate novel therapeutic strategies. Toward this end, the role for calprotectin- (CP)-mediated chelation of manganese (Mn) and zinc (Zn) in defense against A. baumannii was investigated. These experiments revealed that CP inhibits A. baumannii growth in vitro through chelation of Mn and Zn. Consistent with these in vitro data, Imaging Mass Spectrometry revealed that CP accompanies neutrophil recruitment to the lung and accumulates at foci of infection in a murine model of A. baumannii pneumonia. CP contributes to host survival and control of bacterial replication in the lung and limits dissemination to secondary sites. Using CP as a probe identified an A. baumannii Zn acquisition system that contributes to Zn uptake, enabling this organism to resist CP-mediated metal chelation, which enhances pathogenesis. Moreover, evidence is provided that Zn uptake across the outer membrane is an energy-dependent process in A. baumannii. Finally, it is shown that Zn limitation reverses carbapenem resistance in multidrug resistant A. baumannii underscoring the clinical relevance of these findings. Taken together, these data establish Zn acquisition systems as viable therapeutic targets to combat multidrug resistant A. baumannii infections. PMID:23236280

  13. Evaluate the frequency distribution of nonadhesive virulence factors in carbapenemase-producing Acinetobacter baumannii isolated from clinical samples in Kermanshah

    PubMed Central

    Mohajeri, Parviz; Sharbati, Saba; Farahani, Abbas; Rezaei, Zhaleh


    Background: Acinetobacter baumannii which is a Gram-negative bacterium can cause several different infections. The appearance of carbapenemase-producing A. baumannii in recent years has made the treatment process more difficult. The identification of virulence factors (VFs), such as nonadhesives in A. baumannii, helps to fight against related infections. Materials and Methods: A total of 104 samples from teaching hospitals in Kermanshah, Iran, were collected during a 24 months period (2011-2013). Sample identification was first carried out by biochemical tests, and then their susceptibility to carbapenems was determined using the Kirby–Bauer method. For confirmation of carbapenemase-producing A. baumannii, polymerase chain reaction (PCR) was done for carbapenemase-encoding genes. In addition, the frequency of nonadhesive VFs in carbapenemase-producing isolates was determined by PCR. Results: There were 50 isolates that were identified as carbapenemase-producing A. baumannii. The PCR results showed; 40 isolates (80%) for traT, 17 isolates (34%) for cvaC, and 8 isolates (16%) for iutA, and these encode serum resistance, colicin V and aerobactin, respectively. No significant correlation was observed between these three genes. Conclusions: The mechanism of A. baumannii virulence has always been in question. The role of VFs has also been recognized in other Gram-negative bacteria. According to the prevalence of traT, cvaC and iutA, as nonadhesive VFs, we can suggest that they could be the main mechanism of carbapenemase-producing A. baumannii pathogenesis. PMID:27003971

  14. Mucosal immunization with purified OmpA elicited protective immunity against infections caused by multidrug-resistant Acinetobacter baumannii.


    Zhang, Xiaojiao; Yang, Tianxiang; Cao, Ju; Sun, Jide; Dai, Wei; Zhang, Liping


    Multidrug-resistant Acinetobacter baumannii (A. baumannii) is a rapidly emerging pathogen causing infections with high mortality rates due to inadequate medical treatment. New ways to prevent and treat such infections are of a critical medical need. In this study, intranasal vaccination with A. baumannii outer membrane protein A (OmpA) induced both systemic and mucosal antibodies. After challenge intraperitoneally by clinical strains of multidrug-resistant A. baumannii, mice immunized with OmpA had a significantly higher survival rate than control mice. The OmpA protein level tested positive by western blot in clinical strains of A. baumannii. Furthermore, characterization of human sera for anti-OmpA immunoglobulin G (IgG) antibody levels demonstrated that OmpA protein was immunogenic in healthy individuals and patients with A. baumannii invasive infections. In conclusion, to the best of our knowledge, this is the first study protective efficacy of mucosal immunization with OmpA as a protein antigen against multidrug-resistant A. Baumannii. PMID:27133268

  15. Antimicrobial susceptibility profiling and genomic diversity of Acinetobacter baumannii isolates: A study in western Iran

    PubMed Central

    Mohajeri, Parviz; Farahani, Abbas; Feizabadi, Mohammad Mehdi; Ketabi, Hosnieh; Abiri, Ramin; Najafi, Farid


    Background and Objective Acinetobacter baumannii is an aerobic non-motile Gram-negative bacterial pathogen that is resistant to most antibiotics. Carbapenems are the most common antibiotics for the treatment of infections caused by this pathogen. Mechanisms of antibiotic-resistance in A. baumannii are mainly mediated by efflux pumps-lactamases. The aim of this study was to determine antibiotic susceptibility, the possibility of existence of OXAs genes and fingerprinting by Pulsed-Field Gel Electrophoresis (PFGE) among clinical isolates of Acinetobacter collected from Kermanshah hospitals. Materials and Methods One hundred and four isolates were collected from patients attending Imam Reza, Taleghani and Imam Khomeini hospitals of Kermanshah (Iran). Isolates were identified by biochemical tests and API 20NE kit. The susceptibility to different antibiotics was assessed with Kirby-Bauer disk diffusion method. PCR was performed for detection of bla OXA-23, bla OXA-24, bla OXA-51 and bla OXA-58 beta-lactamase genes. Clonal relatedness was estimated by PFGE (with the restriction enzyme Apa I) and DNA patterns were analyzed by Gel compare II 6.5 software. Results All isolates showed high-level of resistance to imipenem, meropenem as well as to other antimicrobial agents, while no resistance to polymyxin B, colistin, tigecylcine and minocycline was observed. The bla OXA-23like and bla OXA-24 like were found among 77.9% and 19.2% of the isolates, respectively. All isolates were positive for bla OXA-51, but none produced any amplicon for bla OXA-58. PFGE genotype analysis suggested the existence of eight clones among the 104 strains [A (n = 35), B (n = 29), C (n = 19), D (n = 10), E (n = 4), F (n = 3), G (n = 3), H (n = 1)]. Clone A was the dominant clone in hospital settings particularly infection wards so that the isolates in this group, compared to the other clones, showed higher levels of resistance to antibiotics. Conclusion The bla OXA-51-like and bla OXA-23like were

  16. Paradoxical Effect of Polymyxin B: High Drug Exposure Amplifies Resistance in Acinetobacter baumannii.


    Tsuji, Brian T; Landersdorfer, Cornelia B; Lenhard, Justin R; Cheah, Soon-Ee; Thamlikitkul, Visanu; Rao, Gauri G; Holden, Patricia N; Forrest, Alan; Bulitta, Jürgen B; Nation, Roger L; Li, Jian


    Administering polymyxin antibiotics in a traditional fashion may be ineffective against Gram-negative ESKAPE (Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter species) pathogens. Here, we explored increasing the dose intensity of polymyxin B against two strains of Acinetobacter baumannii in the hollow-fiber infection model. The following dosage regimens were simulated for polymyxin B (t1/2 = 8 h): non-loading dose (1.43 mg/kg of body weight every 12 h [q12h]), loading dose (2.22 mg/kg q12h for 1 dose and then 1.43 mg/kg q12h), front-loading dose (3.33 mg/kg q12h for 1 dose followed by 1.43 mg/kg q12h), burst (5.53 mg/kg for 1 dose), and supraburst (18.4 mg/kg for 1 dose). Against both A. baumannii isolates, a rapid initial decline in the total population was observed within the first 6 h of polymyxin exposure, whereby greater polymyxin B exposure resulted in greater maximal killing of -1.25, -1.43, -2.84, -2.84, and -3.40 log10 CFU/ml within the first 6 h. Unexpectedly, we observed a paradoxical effect whereby higher polymyxin B exposures dramatically increased resistant subpopulations that grew on agar containing up to 10 mg/liter of polymyxin B over 336 h. High drug exposure also proliferated polymyxin-dependent growth. A cost-benefit pharmacokinetic/pharmacodynamic relationship between 24-h killing and 336-h resistance was explored. The intersecting point, where the benefit of bacterial killing was equal to the cost of resistance, was an fAUC0-24 (area under the concentration-time curve from 0 to 24 h for the free, unbound fraction of drug) of 38.5 mg · h/liter for polymyxin B. Increasing the dose intensity of polymyxin B resulted in amplification of resistance, highlighting the need to utilize polymyxins as part of a combination against high-bacterial-density A. baumannii infections. PMID:27067330

  17. [Antibiotic resistance of Acinetobacter baumannii strains isolated from clinical specimens in the "Marius Nasta" Pneumology Institute, Bucharest].


    Moisoiu, Adriana; Ionită, Monica; Sârbu, Lăcrămioara; Stoica, Corina; Grigoriu, Liliana


    Acinetobacter baumannii (A. baumannii) is one of the leading causes of morbidity and mortality in patients who are in critical condition in hospitals and especially in intensive care units (ICU). Long time considered a bacterium with low virulence, A. baumannii has more recently become a cause for major concern in clinical practice due to its high level of antimicrobial resistance. The extend of infections with Acinetobacter baumannii in ICU is caused by multiple factors, such as mechanical ventilation, invasive procedures, the use of a large number of broad spectrum antibiotics and transmission through the hands of medical staff In this study we evaluated the resistance to antibiotics of 213 non-duplicated strains of A. baumannii isolated in the bacteriology laboratory of the "Marius Nasta" lnstitute of Pneumophtisiology (IPMN) from January 2012 to December 2013. These strains originated from patients in medical wards (56), ICU (143) and surgery (14). Strains identification was performed by classical methods on multitest media and with API kits (Bio Merieux). The antibiotic sensitivity was performed on Mueller-Hinton media in accordance with CLSI2013. Analysis of the resistance to antibiotics was the following: carbenicilin (87.3%), ceftriaxone (87.3%), cefoperazone with sulbactam (84.9%), ceftazidime (79.3%), carbapenems (imipenem and/or meropenem--75.1%), fluoroquinolones (ciprofloxacin and/orlevofloxacin--73.7%), cefepime (66.6%), piperacilin with tazobactam (62.4%), amikacin (50.2%), netilmicin (45%), gentamicin (42.7%) and tobramycin (35.6%). In our study, we only found two strains of Acinetobacter baumannii with resistance to colistin and 70 (32.8%) strains sensitive only to colistin, but resistant to all other antibiotics tested. A. baumannii is a pathogen with rapid spread and extended resistance to even newer antimicrobial agents. Due to its ability to survive in the hospital environment, A. baumannii has the immense potential to cause nosocomial

  18. Characterization of carbapenem-resistant Acinetobacter baumannii clinical isolates in a tertiary care hospital in Saudi Arabia.


    Abdalhamid, Baha; Hassan, Hoda; Itbaileh, Ahmad; Shorman, Mahmoud


    This study characterized the occurrence of carbapenem resistance of Acinetobacter baumannii isolates in a tertiary care hospital in Saudi Arabia. From January 2010 until February 2012, Acinetobacter spp. isolates were collected from different wards and were identified using Vitek 2 system and 16S rRNA gene sequencing. Vitek 2 system and Etest were used for susceptibility testing. PCR and Pulse field gel electrophoresis (PFGE) were used for detecting and typing genes associated with carbapenem resistance. A total of 141 isolates were identified as A. baumannii. A total of 46 (32.6%) isolates were carbapenem-resistant Acinetobacter baumannii (CRAB) isolates and had wild diversity by PFGE. Metallo ?-lactamase confirmatory test was positive for 43 isolates with negative PCR for blaIMP and blaVIM. Among the 46 CRAB strains, 37 isolates harbored blaOXA-23 which was encoded downstream of ISAba1 and 1 isolate had ISAba1 encoded upstream blaOXA-51. These data reveal that the interhospital transmission of CRAB isolates was apparently insignificant. BlaOXA-23 adjacent to ISAba1 was the main mechanism of carbapenem resistance in these isolates. To our knowledge, this is the first molecular study characterizing carbapenem resistance in A. baumannii in the Eastern Province of Saudi Arabia. PMID:24531172

  19. Genotypic and Antimicrobial Susceptibility of Carbapenem-resistant Acinetobacter baumannii: Analysis of ISAba Elements and blaOXA-23-like Genes Including a New Variant

    PubMed Central

    Bahador, Abbas; Raoofian, Reza; Pourakbari, Babak; Taheri, Mohammad; Hashemizadeh, Zahra; Hashemi, Farhad B.


    Carbapenem-resistant Acinetobacter baumannii (CR-AB) causes serious nosocomial infections, especially in ICU wards of hospitals, worldwide. Expression of blaOXA genes is the chief mechanism of conferring carbapenem resistance among CR-AB. Although some blaOXA genes have been studied among CR-AB isolates from Iran, their blaOXA-23-like genes have not been investigated. We used a multiplex-PCR to detect Ambler class A, B, and D carbapenemases of 85 isolates, and determined that 34 harbored blaOXA-23-like genes. Amplified fragment length polymorphism (AFLP) genotyping, followed by DNA sequencing of blaOXA-23-like amplicons of CR-AB from each AFLP group was used to characterize their blaOXA-23-like genes. We also assessed the antimicrobial susceptibility pattern of CR-AB isolates, and tested whether they harbored insertion sequences ISAba1 and ISAba4. Sequence comparison with reference strain A. baumannii (NCTC12156) revealed five types of mutations in blaOXA-23-like genes; including one novel variant and four mutants that were already reported from China and the USA. All of the blaOXA-23-like genes mutations were associated with increased minimum inhibitory concentrations (MICs) against imipenem. ISAba1 and ISAba4 sequences were detected upstream of blaOXA-23 genes in 19 and 7% of isolates, respectively. The isolation of CR-AB with new blaOXA-23 mutations including some that have been reported from the USA and China highlights CR-AB pervasive distribution, which underscores the importance of concerted national and global efforts to control the spread of CR-AB isolates worldwide. PMID:26617588

  20. The Prevalence of ISAba1 and ISAba4 in Acinetobacter baumannii Species of Different International Clone Lineages Among Patients With Burning in Tehran, Iran

    PubMed Central

    Bahador, Abbas; Raoofian, Reza; Farshadzadeh, Zahra; Beitollahi, Leyli; Khaledi, Azad; Rahimi, Sara; Mokhtaran, Masoumeh; Mehrabi Tavana, Ali; Esmaeili, Davood


    Background: Multidrug resistant strains of Acinetobacter baumannii (MDR-AB) have emerged as alarming nosocomial pathogens among patients with burning. Objectives: The current study aimed to determine the susceptibility of A. baumannii species, carbapenems resistance patterns, and their association with ISAba1 and ISAba4 elements upstream of the blaOXA-like genes, and the distribution of international clone (IC) of A. baumannii isolates among patients with burning in Tehran, Iran. Materials and Methods: In the current study, 62 A. baumannii species isolates from patients with burning in Tehran, Iran, in 2012 were evaluated for the antimicrobial susceptibility, genetic relationships, ICs, carbapenemase encoding genes, and insertion elements ISAba upstream of blaOXA-like genes. Results: The highest rates of susceptibility were observed with colistin (88.7%) and tigecycline (82.2%). The extensively drug-resistance and pan drug-resistance were observed in 37.1% and 8.1% of the isolates, respectively. About 98.3% of 17 genotypes categorized into three distinct clusters. Thirty-six of the 62 isolates (58%) belonged to the IC II lineage. The most prevalent acquired OXA-type carbapenemase was blaOXA-23-like (62.9%). ISAba1 and ISAba4 were detected upstream of blaOXA-23-like genes in 45.1% and 12.9% of isolates, respectively. In 32.2% of all isolates, ISAba1 laid upstream of blaOXA-51-like genes. The PCR results were negative for carbapenemase genes of Ambler class A and B, except blaVIM-2. (1.6%). Conclusions: It was the first study that attempted to detect the insertion elements ISAba and IC lineages in MDR-AB species isolated from patients with burning in Iran. PMID:26396712

  1. Breath analysis for noninvasively differentiating Acinetobacter baumannii ventilator-associated pneumonia from its respiratory tract colonization of ventilated patients.


    Gao, Jianping; Zou, Yingchang; Wang, Yonggang; Wang, Feng; Lang, Lang; Wang, Ping; Zhou, Yong; Ying, Kejing


    A number of multiresistant pathogens including Acinetobacter baumannii (A. baumannii) place a heavy burden on ventilator-associated pneumonia (VAP) patients in intensive care units (ICU). It is critically important to differentiate between bacterial infection and colonization to avoid prescribing unnecessary antibiotics. Quantitative culture of lower respiratory tract (LRT) specimens, however, requires invasive procedures. Nowadays, volatile organic compounds (VOCs) have been studied in vitro and in vivo to identify pathogen-derived biomarkers. Therefore, an exploratory pilot study was conceived for a proof of concept that the appearance and level of A. baumannii-derived metabolites might be correlated with the presence of the pathogen and its ecological niche (i.e. the infection and colonization states) in ICU ventilated patients. Twenty patients with A. baumannii VAP (infection group), 20 ventilated patients with LRT A. baumannii colonization (colonization group) and 20 ventilated patients with neurological disorders, but without pneumonia or A. baumannii colonization (control group) were enrolled in the in vivo pilot study. A clinical isolate of A. baumannii strains was used for the in vitro culture experiment. The adsorptive preconcentration (solid-phase microextraction fiber and Tenax(®) TA) and analysis technique of gas chromatography-mass spectrometry were applied in the studies. Breath profiles could be visually differentiated between A. baumannii cultivation in vitro and culture medium, and among in vivo groups. In the in vitro experiment, nine compounds of interest (2,5-dimethyl-pyrazine, 1-undecene, isopentyl 3-methylbutanoate, decanal, 1,3-naphthalenediol, longifolene, tetradecane, iminodibenzyl and 3-methyl-indene) in the headspace were found to be possible A. baumannii derivations. While there were eight target VOCs (1-undecene, nonanal, decanal, 2,6,10-trimethyl-dodecane, 5-methyl-5-propyl-nonane, longifolene, tetradecane and 2-butyl-1-octanol

  2. Risk factors and outcomes of hospitalized patients with blood infections caused by multidrug-resistant Acinetobacter baumannii complex in a hospital of Northern China.


    Guo, Ninghui; Xue, Wencheng; Tang, Dahai; Ding, Jinya; Zhao, Bin


    The purpose of this study was to determine the risk factors and outcomes of bloodstream infections caused by multidrug-resistant (MDR) Acinetobacter baumannii complex in a hospital of Northern China. Risk factors associated with MDR A baumannii complex included older age, pneumonia, using drainage catheters, and intensive care unit stay. Multivariate analysis showed that multidrug resistance and mechanical ventilation were identified as independent risk factors for 30-day mortality in patients with A baumannii complex bacteremia. PMID:26804303

  3. Molecular Epidemiology and Clinical Impact of Acinetobacter calcoaceticus-baumannii Complex in a Belgian Burn Wound Center.


    De Vos, Daniel; Pirnay, Jean-Paul; Bilocq, Florence; Jennes, Serge; Verbeken, Gilbert; Rose, Thomas; Keersebilck, Elkana; Bosmans, Petra; Pieters, Thierry; Hing, Mony; Heuninckx, Walter; De Pauw, Frank; Soentjens, Patrick; Merabishvili, Maia; Deschaght, Pieter; Vaneechoutte, Mario; Bogaerts, Pierre; Glupczynski, Youri; Pot, Bruno; van der Reijden, Tanny J; Dijkshoorn, Lenie


    Multidrug resistant Acinetobacter baumannii and its closely related species A. pittii and A. nosocomialis, all members of the Acinetobacter calcoaceticus-baumannii (Acb) complex, are a major cause of hospital acquired infection. In the burn wound center of the Queen Astrid military hospital in Brussels, 48 patients were colonized or infected with Acb complex over a 52-month period. We report the molecular epidemiology of these organisms, their clinical impact and infection control measures taken. A representative set of 157 Acb complex isolates was analyzed using repetitive sequence-based PCR (rep-PCR) (DiversiLab) and a multiplex PCR targeting OXA-51-like and OXA-23-like genes. We identified 31 rep-PCR genotypes (strains). Representatives of each rep-type were identified to species by rpoB sequence analysis: 13 types to A. baumannii, 10 to A. pittii, and 3 to A. nosocomialis. It was assumed that isolates that belonged to the same rep-type also belonged to the same species. Thus, 83.4% of all isolates were identified to A. baumannii, 9.6% to A. pittii and 4.5% to A. nosocomialis. We observed 12 extensively drug resistant Acb strains (10 A. baumannii and 2 A. nosocomialis), all carbapenem-non-susceptible/colistin-susceptible and imported into the burn wound center through patients injured in North Africa. The two most prevalent rep-types 12 and 13 harbored an OXA-23-like gene. Multilocus sequence typing allocated them to clonal complex 1 corresponding to EU (international) clone I. Both strains caused consecutive outbreaks, interspersed with periods of apparent eradication. Patients infected with carbapenem resistant A. baumannii were successfully treated with colistin/rifampicin. Extensive infection control measures were required to eradicate the organisms. Acinetobacter infection and colonization was not associated with increased attributable mortality. PMID:27223476

  4. Molecular Epidemiology and Clinical Impact of Acinetobacter calcoaceticus-baumannii Complex in a Belgian Burn Wound Center

    PubMed Central

    Bilocq, Florence; Jennes, Serge; Verbeken, Gilbert; Rose, Thomas; Keersebilck, Elkana; Bosmans, Petra; Pieters, Thierry; Hing, Mony; Heuninckx, Walter; De Pauw, Frank; Soentjens, Patrick; Merabishvili, Maia; Deschaght, Pieter; Vaneechoutte, Mario; Bogaerts, Pierre; Glupczynski, Youri; Pot, Bruno; van der Reijden, Tanny J.; Dijkshoorn, Lenie


    Multidrug resistant Acinetobacter baumannii and its closely related species A. pittii and A. nosocomialis, all members of the Acinetobacter calcoaceticus-baumannii (Acb) complex, are a major cause of hospital acquired infection. In the burn wound center of the Queen Astrid military hospital in Brussels, 48 patients were colonized or infected with Acb complex over a 52-month period. We report the molecular epidemiology of these organisms, their clinical impact and infection control measures taken. A representative set of 157 Acb complex isolates was analyzed using repetitive sequence-based PCR (rep-PCR) (DiversiLab) and a multiplex PCR targeting OXA-51-like and OXA-23-like genes. We identified 31 rep-PCR genotypes (strains). Representatives of each rep-type were identified to species by rpoB sequence analysis: 13 types to A. baumannii, 10 to A. pittii, and 3 to A. nosocomialis. It was assumed that isolates that belonged to the same rep-type also belonged to the same species. Thus, 83.4% of all isolates were identified to A. baumannii, 9.6% to A. pittii and 4.5% to A. nosocomialis. We observed 12 extensively drug resistant Acb strains (10 A. baumannii and 2 A. nosocomialis), all carbapenem-non-susceptible/colistin-susceptible and imported into the burn wound center through patients injured in North Africa. The two most prevalent rep-types 12 and 13 harbored an OXA-23-like gene. Multilocus sequence typing allocated them to clonal complex 1 corresponding to EU (international) clone I. Both strains caused consecutive outbreaks, interspersed with periods of apparent eradication. Patients infected with carbapenem resistant A. baumannii were successfully treated with colistin/rifampicin. Extensive infection control measures were required to eradicate the organisms. Acinetobacter infection and colonization was not associated with increased attributable mortality. PMID:27223476

  5. An Amphipathic Undecapeptide with All d-Amino Acids Shows Promising Activity against Colistin-Resistant Strains of Acinetobacter baumannii and a Dual Mode of Action.


    Oddo, Alberto; Thomsen, Thomas T; Kjelstrup, Susanne; Gorey, Ciara; Franzyk, Henrik; Frimodt-Møller, Niels; Løbner-Olesen, Anders; Hansen, Paul R


    Multiple strains of Acinetobacter baumannii have developed multidrug resistance (MDR), leaving colistin as the only effective treatment. The cecropin-α-melittin hybrid BP100 (KKLFKKILKYL-NH2) and its analogs have previously shown activity against a wide array of plant and human pathogens. In this study, we investigated the in vitro antibacterial activities of 18 BP100 analogs (four known and 14 new) against the MDR A. baumannii strain ATCC BAA-1605, as well as against a number of other clinically relevant human pathogens. Selected peptides were further evaluated against strains of A. baumannii that acquired resistance to colistin due to mutations of the lpxC, lpxD, pmrA, and pmrB genes. The novel analogue BP214 showed antimicrobial activity at 1 to 2 μM and a hemolytic 50% effective concentration (EC50) of >150 μM. The lower activity of its enantiomer suggests a dual, specific and nonspecific mode of action. Interestingly, colistin behaved antagonistically to BP214 when pmrAB and lpxC mutants were challenged. PMID:26574005

  6. NDM-1-Producing Citrobacter freundii, Escherichia coli, and Acinetobacter baumannii Identified from a Single Patient in China

    PubMed Central

    Huang, Ying-Min; Zhong, Lan-lan; Zhang, Xue-Fei; Hu, Hang-tong; Li, Yu-qi; Yang, Xiao-rong; Feng, Lian-Qiang; Huang, Xi


    We identified New Delhi metallo-β-lactamase (NDM-1)-producing Citrobacter freundii GB032, Escherichia coli GB102, and Acinetobacter baumannii GB661 in urine and stool samples from a single patient in China. Plasmid profiling and Southern blotting indicated that blaNDM-1 from GB032 and that from GB102 were likely located on the same plasmid, while blaNDM-1 from GB661 was located on a very large (>400-kb) plasmid. This case underscores the broad host range of blaNDM-1 and its potential to spread between members of the family Enterobacteriaceae and A. baumannii. PMID:26055374

  7. Potent in vitro antibacterial activity of DS-8587, a novel broad-spectrum quinolone, against Acinetobacter baumannii.


    Higuchi, Saito; Onodera, Yoshikuni; Chiba, Megumi; Hoshino, Kazuki; Gotoh, Naomasa


    We investigated the in vitro activity of DS-8587, a novel fluoroquinolone, against Acinetobacter baumannii. The MICs of DS-8587 against clinical isolates and its inhibitory activity against target enzymes were superior to those of ciprofloxacin and levofloxacin. Furthermore, the antibacterial activity of DS-8587 was less affected by adeA/adeB/adeC or abeM efflux pumps than was that of ciprofloxacin and the frequency of single-step mutations with DS-8587 was lower than that with ciprofloxacin. DS-8587 might be an effective agent against A. baumannii infection. PMID:23380726

  8. Potent In Vitro Antibacterial Activity of DS-8587, a Novel Broad-Spectrum Quinolone, against Acinetobacter baumannii

    PubMed Central

    Onodera, Yoshikuni; Chiba, Megumi; Hoshino, Kazuki; Gotoh, Naomasa


    We investigated the in vitro activity of DS-8587, a novel fluoroquinolone, against Acinetobacter baumannii. The MICs of DS-8587 against clinical isolates and its inhibitory activity against target enzymes were superior to those of ciprofloxacin and levofloxacin. Furthermore, the antibacterial activity of DS-8587 was less affected by adeA/adeB/adeC or abeM efflux pumps than was that of ciprofloxacin and the frequency of single-step mutations with DS-8587 was lower than that with ciprofloxacin. DS-8587 might be an effective agent against A. baumannii infection. PMID:23380726

  9. Effects of three different topical antibacterial dressings on Acinetobacter baumannii-contaminated full-thickness burns in rats.


    Uygur, Fatih; Oncül, Oral; Evinç, Rahmi; Diktas, Hüsrev; Acar, Ali; Ulkür, Ersin


    In this animal study, three topical antibacterial dressings, Acticoat, chlorhexidine acetate 0.5% and silver sulfadiazine 1%, were compared in the treatment of Acinetobacter baumannii contamination of burns. All treatments were effective and prevented the organism invading the muscle and causing systemic infection, so there were significant differences between the results of the treatment groups and the control group. Mean eschar concentrations did not differ significantly between the silver sulfadiazine and chlorhexidine acetate groups, but there were significant differences between these and the Acticoat group, indicating that Acticoat eliminated A. baumannii from the tissues more effectively. PMID:18789593

  10. Ultrafast Structural Dynamics of BlsA, a Photoreceptor from the Pathogenic Bacterium Acinetobacter baumannii

    PubMed Central


    Acinetobacter baumannii is an important human pathogen that can form biofilms and persist under harsh environmental conditions. Biofilm formation and virulence are modulated by blue light, which is thought to be regulated by a BLUF protein, BlsA. To understand the molecular mechanism of light sensing, we have used steady-state and ultrafast vibrational spectroscopy to compare the photoactivation mechanism of BlsA to the BLUF photosensor AppA from Rhodobacter sphaeroides. Although similar photocycles are observed, vibrational data together with homology modeling identify significant differences in the β5 strand in BlsA caused by photoactivation, which are proposed to be directly linked to downstream signaling. PMID:24723998

  11. Infections Caused by Acinetobacter baumannii in Recipients of Hematopoietic Stem Cell Transplantation

    PubMed Central

    Al-Anazi, Khalid Ahmed; Al-Jasser, Asma M.


    Acinetobacter baumannii (A. baumannii) is a Gram-negative, strictly aerobic, non-fermentative coccobacillus, which is widely distributed in nature. Recently, it has emerged as a major cause of health care-associated infections (HCAIs) in addition to its capacity to cause community-acquired infections. Risk factors for A. baumannii infections and bacteremia in recipients of hematopoietic stem cell transplantation include: severe underlying illness such as hematological malignancy, prolonged use of broad-spectrum antibiotics, invasive instrumentation such as central venous catheters or endotracheal intubation, colonization of respiratory, gastrointestinal, or urinary tracts in addition to severe immunosuppression caused by using corticosteroids for treating graft versus host disease. The organism causes a wide spectrum of clinical manifestations, but serious complications such as bacteremia, septic shock, ventilator-associated pneumonia, extensive soft tissue necrosis, and rapidly progressive systemic infections that ultimately lead to multi-organ failure and death are prone to occur in severely immunocompromised hosts. The organism is usually resistant to many antimicrobials including penicillins, cephalosporins, trimethoprim–sulfamethoxazole, almost all fluoroquinolones, and most of the aminoglycosides. The recently increasing resistance to carbapenems, colistin, and polymyxins is alarming. Additionally, there are geographic variations in the resistance patterns and several globally and regionally resistant strains have already been described. Successful management of A. baumannii infections depends upon appropriate utilization of antibiotics and strict application of preventive and infection control measures. In uncomplicated infections, the use of a single active beta-lactam may be justified, while definitive treatment of complicated infections in critically ill individuals may require drug combinations such as colistin and rifampicin or colistin and carbapenem

  12. Variation in the Complex Carbohydrate Biosynthesis Loci of Acinetobacter baumannii Genomes

    PubMed Central

    Kenyon, Johanna J.; Hall, Ruth M.


    Extracellular polysaccharides are major immunogenic components of the bacterial cell envelope. However, little is known about their biosynthesis in the genus Acinetobacter, which includes A. baumannii, an important nosocomial pathogen. Whether Acinetobacter sp. produce a capsule or a lipopolysaccharide carrying an O antigen or both is not resolved. To explore these issues, genes involved in the synthesis of complex polysaccharides were located in 10 complete A. baumannii genome sequences, and the function of each of their products was predicted via comparison to enzymes with a known function. The absence of a gene encoding a WaaL ligase, required to link the carbohydrate polymer to the lipid A-core oligosaccharide (lipooligosaccharide) forming lipopolysaccharide, suggests that only a capsule is produced. Nine distinct arrangements of a large capsule biosynthesis locus, designated KL1 to KL9, were found in the genomes. Three forms of a second, smaller variable locus, likely to be required for synthesis of the outer core of the lipid A-core moiety, were designated OCL1 to OCL3 and also annotated. Each K locus includes genes for capsule export as well as genes for synthesis of activated sugar precursors, and for glycosyltransfer, glycan modification and oligosaccharide repeat-unit processing. The K loci all include the export genes at one end and genes for synthesis of common sugar precursors at the other, with a highly variable region that includes the remaining genes in between. Five different capsule loci, KL2, KL6, KL7, KL8 and KL9 were detected in multiply antibiotic resistant isolates belonging to global clone 2, and two other loci, KL1 and KL4, in global clone 1. This indicates that this region is being substituted repeatedly in multiply antibiotic resistant isolates from these clones. PMID:23614028

  13. Clinically Relevant Growth Conditions Alter Acinetobacter baumannii Antibiotic Susceptibility and Promote Identification of Novel Antibacterial Agents

    PubMed Central

    Colquhoun, Jennifer M.; Wozniak, Rachel A. F.; Dunman, Paul M.


    Biological processes that govern bacterial proliferation and survival in the host-environment(s) are likely to be vastly different from those that are required for viability in nutrient-rich laboratory media. Consequently, growth-based antimicrobial screens performed in conditions modeling aspects of bacterial disease states have the potential to identify new classes of antimicrobials that would be missed by screens performed in conventional laboratory media. Accordingly, we performed screens of the Selleck library of 853 FDA approved drugs for agents that exhibit antimicrobial activity toward the Gram-negative bacterial pathogen Acinetobacter baumannii during growth in human serum, lung surfactant, and/or the organism in the biofilm state and compared those results to that of conventional laboratory medium. Results revealed that a total of 90 compounds representing 73 antibiotics and 17 agents that were developed for alternative therapeutic indications displayed antimicrobial properties toward the test strain in at least one screening condition. Of the active library antibiotics only four agents, rifampin, rifaximin, ciprofloxacin and tetracycline, exhibited antimicrobial activity toward the organism during all screening conditions, whereas the remainder were inactive in ≥ 1 condition; 56 antibiotics were inactive during serum growth, 25 and 38 were inactive toward lung surfactant grown and biofilm-associated cells, respectively, suggesting that subsets of antibiotics may outperform others in differing infection settings. Moreover, 9 antibiotics that are predominantly used for the treatment Gram-positive pathogens and 10 non-antibiotics lacked detectable antimicrobial activity toward A. baumannii grown in conventional medium but were active during ≥ 1 alternative growth condition(s). Such agents may represent promising anti-Acinetobacter agents that would have likely been overlooked by antimicrobial whole cell screening assays performed in traditional

  14. Screening and Quantification of the Expression of Antibiotic Resistance Genes in Acinetobacter baumannii with a Microarray▿

    PubMed Central

    Coyne, Sébastien; Guigon, Ghislaine; Courvalin, Patrice; Périchon, Bruno


    An oligonucleotide-based DNA microarray was developed to evaluate expression of genes for efflux pumps in Acinetobacter baumannii and to detect acquired antibiotic resistance determinants. The microarray contained probes for 205 genes, including those for 47 efflux systems, 55 resistance determinants, and 35 housekeeping genes. The microarray was validated by comparative analysis of mutants overexpressing or deficient in the pumps relative to the parental strain. The performance of the microarray was also evaluated using in vitro single-step mutants obtained on various antibiotics. Overexpression, confirmed by quantitative reverse transcriptase PCR, of RND efflux pumps AdeABC, due to a G30D substitution in AdeS in a multidrug-resistant (MDR) strain obtained on gentamicin, and AdeIJK, in two mutants obtained on cefotaxime or tetracycline, was detected. A new efflux pump, AdeFGH, was found to be overexpressed in a mutant obtained on chloramphenicol. Study of MDR clinical isolates, including the AYE strain, whose entire sequence has been determined, indicated overexpression of AdeABC and of the chromosomally encoded cephalosporinase as well as the presence of several acquired resistance genes. The overexpressed and acquired determinants detected by the microarray could account for nearly the entire MDR phenotype of the isolates. The microarray is potentially useful for detection of resistance in A. baumannii and should allow detection of new efflux systems associated with antibiotic resistance. PMID:19884373

  15. Crystal Structure of Hcp from Acinetobacter baumannii: A Component of the Type VI Secretion System

    PubMed Central

    Ruiz, Federico M.; Santillana, Elena; Spínola-Amilibia, Mercedes; Torreira, Eva; Culebras, Esther; Romero, Antonio


    The type VI secretion system (T6SS) is a bacterial macromolecular machine widely distributed in Gram-negative bacteria, which transports effector proteins into eukaryotic host cells or other bacteria. Membrane complexes and a central tubular structure, which resembles the tail of contractile bacteriophages, compose the T6SS. One of the proteins forming this tube is the hemolysin co-regulated protein (Hcp), which acts as virulence factor, as transporter of effectors and as a chaperone. In this study, we present the structure of Hcp from Acinetobacter baumannii, together with functional and oligomerization studies. The structure of this protein exhibits a tight β barrel formed by two β sheets and flanked at one side by a short α-helix. Six Hcp molecules associate to form a donut-shaped hexamer, as observed in both the crystal structure and solution. These results emphasize the importance of this oligomerization state in this family of proteins, despite the low similarity of sequence among them. The structure presented in this study is the first one for a protein forming part of a functional T6SS from A. baumannii. These results will help us to understand the mechanism and function of this secretion system in this opportunistic nosocomial pathogen. PMID:26079269

  16. Clinical Use of Colistin Induces Cross-Resistance to Host Antimicrobials in Acinetobacter baumannii

    PubMed Central

    Napier, Brooke A.; Burd, Eileen M.; Satola, Sarah W.; Cagle, Stephanie M.; Ray, Susan M.; McGann, Patrick; Pohl, Jan; Lesho, Emil P.; Weiss, David S.


    ABSTRACT The alarming rise in antibiotic resistance has led to an increase in patient mortality and health care costs. This problem is compounded by the absence of new antibiotics close to regulatory approval. Acinetobacter baumannii is a human pathogen that causes infections primarily in patients in intensive care units (ICUs) and is highly antibiotic resistant. Colistin is one of the last-line antibiotics for treating A. baumannii infections; however, colistin-resistant strains are becoming increasingly common. This cationic antibiotic attacks negatively charged bacterial membranes in a manner similar to that seen with cationic antimicrobials of the innate immune system. We therefore set out to determine if the increasing use of colistin, and emergence of colistin-resistant strains, is concomitant with the generation of cross-resistance to host cationic antimicrobials. We found that there is indeed a positive correlation between resistance to colistin and resistance to the host antimicrobials LL-37 and lysozyme among clinical isolates. Importantly, isolates obtained before and after treatment of individual patients demonstrated that colistin use correlated with increased resistance to cationic host antimicrobials. These data reveal the overlooked risk of inducing cross-resistance to host antimicrobials when treating patients with colistin as a last-line antibiotic. PMID:23695834

  17. Demonstration of the interactions between aromatic compound-loaded lipid nanocapsules and Acinetobacter baumannii bacterial membrane.


    Montagu, A; Joly-Guillou, M-L; Guillet, C; Bejaud, J; Rossines, E; Saulnier, P


    Acinetobacter baumannii is an important nosocomial pathogen that is resistant to many commonly-used antibiotics. One strategy for treatment is the use of aromatic compounds (carvacrol, cinnamaldehyde) against A. baumannii. The aim of this study was to determine the interactions between bacteria and lipid nanocapsules (LNCs) over time based on the fluorescence of 3,3'-Dioctadecyloxacarbocyanine Perchlorate-LNCs (DiO-LNCs) and the properties of trypan blue to analyse the physicochemical mechanisms occurring at the level of the biological membrane. The results demonstrated the capacity of carvacrol-loaded LNCs to interact with and penetrate the bacterial membrane in comparison with cinnamaldehyde-loaded LNCs and unloaded LNCs. Modifications of carvacrol after substitution of hydroxyl functional groups by fatty acids demonstrated the crucial role of hydroxyl functions in antibacterial activity. Finally, after contact with the efflux pump inhibitor, carbonylcyanide-3-chlorophenyl hydrazine (CCCP), the results indicated the total synergistic antibacterial effect with Car-LNCs, showing that CCCP is associated with the action mechanism of carvacrol, especially at the level of the efflux pump mechanism. PMID:27039148

  18. Resistance and integron characterization of Acinetobacter baumannii in a teaching hospital in Chongqing, China

    PubMed Central

    Huang, C.; Long, Q.; Qian, K.; Fu, T.; Zhang, Z.; Liao, P.; Xie, J.


    A total of 189 Acinetobacter baumannii isolates were collected in 2011 from a teaching hospital in Chongqing, China. Susceptibility data showed strains carrying integrons were significantly more resistant to all tested antibiotics that strains lacking integrons. Five types of gene cassettes belonging to class I integrons were identified in this study, and for the first time two types of gene cassettes belonging to class II integrons are reported. Most of the cassettes belong to a class I integron (136/144) encoding arr3, aacA4, dfrA17, aadA5, aadB, cat, blaOXA10, aadA1, aadA2, dfrA and aacC1. Isolates contained a class I gene cassette; AadA2-HP-dfrA was the prevalent strain in this hospital. A class II integron was detected in eight strains, which contained the type IV fimbriae expression regulatory gene pilR and sulfate adenylyltransferase, suggesting a possible role in multidrug resistance. The major epidemic strains from intensive care unit patients belong to international clone 2. In conclusion, the presence of integrons was significantly associated with multiple drug resistance of A. baumannii in this hospital, and class I integron isolates bearing AadA2-HP-dfrA were the prevalent strain in this hospital. PMID:26649184

  19. Synergistic Effect of Oleanolic Acid on Aminoglycoside Antibiotics against Acinetobacter baumannii

    PubMed Central

    Shin, Bora; Park, Woojun


    Difficulties involved in treating drug-resistant pathogens have created a need for new therapies. In this study, we investigated the possibility of using oleanolic acid (OA), a natural pentacyclic triterpenoid, as a natural adjuvant for antibiotics against Acinetobacter baumannii. High concentrations of OA can kill cells, partly because it generates reactive oxygen species. Measurement of the fractional inhibitory concentration (FIC) for OA and time-kill experiments demonstrated that it only synergizes with aminoglycoside antibiotics (e.g., gentamicin, kanamycin). Other classes of antibiotics (e.g., ampicillin, rifampicin, norfloxacin, chloramphenicol, and tetracycline) have no interactions with OA. Microarray and quantitative reverse transcription-PCR analysis indicated that genes involved in ATP synthesis and cell membrane permeability, the gene encoding glycosyltransferase, peptidoglycan-related genes, phage-related genes, and DNA repair genes were upregulated under OA. OA highly induces the expression of adk, which encodes an adenylate kinase, and des6, which encodes a linoleoyl-CoA desaturase, and deletion of these genes increased FICs; these observations indicate that adk and des6 are involved in the synergism of OA with aminoglycosides. Data obtained using 8-anilino-1-naphthalenesulfonic acid, fluorescence-conjugated gentamicin, and membrane fatty acid analysis indicates that adk and des6 are involved in changes in membrane permeability. Proton-motive force and ATP synthesis tests show that those genes are also involved in energy metabolism. Taken together, our data show that OA boosts aminoglycoside uptake by changing membrane permeability and energy metabolism in A. baumannii. PMID:26360766

  20. Antimicrobial photodynamic therapy in a mouse model of Acinetobacter baumannii burn infection

    NASA Astrophysics Data System (ADS)

    Dai, Tianhong; Tegos, George P.; Lu, Zongshun; Zhiyentayev, Timur; Huang, Liyi; Franklin, Michael J.; Baer, David G.; Hamblin, Michael R.


    Multi-drug resistant Acinetobacter baumanii infections represent a growing problem, especially in traumatic wounds and burns suffered by military personnel injured in Middle Eastern conflicts. Effective treatment using traditional antibiotics can be extremely difficult and new antimicrobial approaches are being investigated. One of these antimicrobial alternatives could be the combination of non-toxic photosensitizers (PS) and visible light known as photodynamic therapy (PDT). We report on the establishment of a new mouse model of full thickness thermal burns infected with a bioluminescent derivative of a clinical Iraqi isolate of A. baumannii and its PDT treatment by topical application of a PS produced by covalent conjugation chlorin(e6) to polyethylenimine followed by illumination of the burn surface with red light. Application of 108 A. baumannii cells to the surface of 10-second burns made on the dorsal surface of shaved female BALB/c mice led to chronic infections that lasted on average 22 days characterized by a remarkably stable bacterial bioluminescence. PDT carried out on day 0 soon after applying bacteria gave over three logs of loss of bacterial luminescence in a light exposure dependent manner, while PDT carried out on day 1 and day 2 gave approximately a 1.7-log reduction. Application of PS dissolved in 10% or 20% DMSO without light gave only modest reduction in bacterial luminescence from mouse burns. Some bacterial regrowth in the treated burn was observed but was generally modest. It was also found that PDT did not lead to inhibition of wound healing. The data suggest that PDT may be an effective new treatment for multi-drug resistant localized A. baumannii infections.

  1. Investigation of the molecular epidemiology of Acinetobacter baumannii isolated from patients and environmental contamination.


    Ying, Chunmei; Li, Yongli; Wang, Yaping; Zheng, Bing; Yang, Chengde


    The objective of this work was to investigate correlations between Acinetobacter baumannii isolates from neurosurgical intensive care unit patients and its environment. This is a prospective, observational study. The minimal inhibitory concentrations of antimicrobial agents against 27 clinical and 28 environmental isolates were determined by the agar dilution method. Molecular genotyping was performed by enterobacterial repetitive intergenic consensus PCR (ERIC-PCR), pulsed-field gel electrophoresis (PFGE) and multi-locus sequence typing (MLST). The presence of carbapenemase and metallo-β-lactamase genes were analyzed by specific PCRs and DNA sequencing. From the clinical A. baumannii isolates, 25.9% were found resistant to minocycline, 51.9% to cefoperazone-sulbactam, 59.3% to imipenem and 70% resistant to other antimicrobial agents. Environmental isolates were more sensitive compared with clinical isolates (P<0.05). Twenty-seven clinical isolates comprised three ERIC-PCR genotypes, four major PFGE pulsotypes and five distinct MLST sequence types (STs) (ST208, ST368, ST191, ST195, ST540), all belonging to CC92 with only one locus (gpi) difference among them. Twenty-eight environmental isolates showed more diverse genetic types than clinical isolates and comprised six ERIC-PCR groups, nine PFGE groups and two main STs (ST208, ST229). Four clinical and 15 environmental isolates could not be identified by MLST and were assigned to non-clonal STs. We identified the presence of the blaOXA-23 carbapenemase encoding gene in most of the clinical (21/27) but fewer in the environmental isolates (3/28). The A. baumannii strains isolated from patients were genetically similar to the environmental strains, with CC92 members as the major fraction but with different antibiotic susceptibilities. PMID:25873322

  2. Wide distribution of carbapenem resistant Acinetobacter baumannii in burns patients in Iran

    PubMed Central

    Farshadzadeh, Zahra; Hashemi, Farhad B.; Rahimi, Sara; Pourakbari, Babak; Esmaeili, Davoud; Haghighi, Mohammad A.; Majidpour, Ali; Shojaa, Saeed; Rahmani, Maryam; Gharesi, Samira; Aziemzadeh, Masoud; Bahador, Abbas


    Antimicrobial resistance in carbapenem non-susceptible Acinetobacter baumannii (CNSAb) is a major public health concern globally. This study determined the antibiotic resistance and molecular epidemiology of CNSAb isolates from a referral burn center in Tehran, Iran. Sixty-nine CNSAb isolates were tested for susceptibility to antimicrobial agents using the E test methodology. Multiple locus variable number tandem repeat analysis (MLVA), Multilocus sequence typing (MLST) and multiplex PCR were performed. PCR assays tested for ambler classes A, B, and D β-lactamases. Detection of ISAba1, characterization of integrons, and biofilm formation were investigated. Fifty-three (77%) isolates revealed XDR phenotypes. High prevalence of blaOXA-23-like (88%) and blaPER-1 (54%) were detected. ISAba1 was detected upstream of blaADC, blaOXA-23-like and blaOXA51-like genes in, 97, 42, and 26% of isolates, respectively. Thirty-one (45%) isolates were assigned to international clone (IC) variants. MLVA identified 56 distinct types with six clusters and 53 singleton genotypes. Forty previously known MLST sequence types forming 5 clonal complexes were identified. The Class 1 integron (class 1 integrons) gene was identified in 84% of the isolates. The most prevalent (33%) cassette combination was aacA4-catB8-aadA1. The IC variants were predominant in the A. baumannii lineage with the ability to form strong biofilms. The XDR-CNSAb from burned patients in Iran is resistant to various antimicrobials, including tigecycline. This study shows wide genetic diversity in CNSAb. Integrating the new Iranian A. baumannii IC variants into the epidemiologic clonal and susceptibility profile databases can help effective global control measures against the XDR-CNSAb pandemic. PMID:26539176

  3. Deciphering the Function of the Outer Membrane Protein OprD Homologue of Acinetobacter baumannii

    PubMed Central

    Catel-Ferreira, Manuella; Nehmé, Rony; Molle, Virginie; Aranda, Jesús; Bouffartigues, Emeline; Chevalier, Sylvie; Bou, Germán; Jouenne, Thierry


    The increasing number of carbapenem-resistant Acinetobacter baumannii isolates is a major cause for concern which restricts therapeutic options to treat severe infections caused by this emerging pathogen. To identify the molecular mechanisms involved in carbapenem resistance, we studied the contribution of an outer membrane protein homologue of the Pseudomonas aeruginosa OprD porin. Suspected to be the preferred pathway of carbapenems in A. baumannii, the oprD homologue gene was inactivated in strain ATCC 17978. Comparison of wild-type and mutant strains did not confirm the expected increased resistance to any antibiotic tested. OprD homologue sequence analysis revealed that this protein actually belongs to an OprD subgroup but is closer to the P. aeruginosa OprQ protein, with which it could share some functions, e.g., allowing bacterial survival under low-iron or -magnesium growth conditions or under poor oxygenation. We thus overexpressed and purified a recombinant OprD homologue protein to further examine its functional properties. As a specific channel, this porin presented rather low single-channel conductance, i.e., 28 pS in 1 M KCl, and was partially closed by micro- and millimolar concentrations of Fe3+ and Mg2+, respectively, but not by imipenem and meropenem or basic amino acids. The A. baumannii OprD homologue is likely not involved in the carbapenem resistance mechanism, but as an OprQ-like protein, it could contribute to the adaptation of this bacterium to magnesium- and/or iron-depleted environments. PMID:22564848

  4. Association of doripenem resistance with OXA-type carbapenemases in Acinetobacter baumannii isolates

    PubMed Central

    Terzi, Huseyin-Agah; Atasoy, Ali-Rıza; Aykan, Sadiye-Berna; Karakece, Engin; Asık, Gulsah; Ciftci, Ihsan-Hakkı


    Objectives: To evaluate the in vitro activity of doripenem in Acinetobacter baumannii (A. baumannii) clinical isolates that possess different OXA-type carbapenemases, and to evaluate the roles of these enzymes in the development of carbapenem resistance. Methods: This retrospective study was conducted with 25 A. baumannii isolates at Sakarya University Training and Research Hospital, Sakarya, Turkey from June to October 2014. Antibiotic susceptibility testing was carried out using the Vitek-2 automated system (bioMérieux, Marcy l’Etoile, France). Minimum inhibitory concentrations (MICs) were determined using Etest strips (bioMérieux, Marcy l’Etoile, France). Quantitative polymerase chain reaction was performed in a Fluorion Instrument (Iontek, Istanbul, Turkey). Results: Isolates were divided into 5 groups based on their susceptibility profiles and OXA-type carbapenemase positivity. Group 2 isolates whose MIC of both meropenem and doripenem are in the range of 4-32 µg/mL were negative for both blaOXA-23 and blaOXA-58. Group 3 isolates whose MIC of meropenem and doripenem is in the range of 4-32 µg/mL, blaOXA-23 is positive, and blaOXA-58 is negative. Group 5 isolates whose MIC of meropenem is >32 µg/mL, and that of doripenem is in the range of 16-32 µg/mL were positive for both blaOXA-23 and blaOXA-58. Conclusion: The blaOXA-23 and blaOXA-58 gene combinations may confer resistance with a much greater MIC of both meropenem and doripenem. However, the presence of blaOXA-58 alone was not correlated with doripenem resistance. PMID:26739973

  5. Antimicrobial Resistance Determinants in Acinetobacter baumannii Isolates Taken from Military Treatment Facilities

    PubMed Central

    Leski, Tomasz A.; Stockelman, Michael G.; Craft, David W.; Zurawski, Daniel V.; Kirkup, Benjamin C.; Vora, Gary J.


    Multidrug-resistant (MDR) Acinetobacter baumannii infections are of particular concern within medical treatment facilities, yet the gene assemblages that give rise to this phenotype remain poorly characterized. In this study, we tested 97 clinical A. baumannii isolates collected from military treatment facilities (MTFs) from 2003 to 2009 by using a molecular epidemiological approach that enabled for the simultaneous screening of 236 antimicrobial resistance genes. Overall, 80% of the isolates were found to be MDR, each strain harbored between one and 17 resistant determinants, and a total of 52 unique resistance determinants or gene families were detected which are known to confer resistance to β-lactam (e.g., blaGES-11, blaTEM, blaOXA-58), aminoglycoside (e.g., aphA1, aacC1, armA), macrolide (msrA, msrB), tetracycline [e.g., tet(A), tet(B), tet(39)], phenicol (e.g., cmlA4, catA1, cat4), quaternary amine (qacE, qacEΔ1), streptothricin (sat2), sulfonamide (sul1, sul2), and diaminopyrimidine (dfrA1, dfrA7, dfrA19) antimicrobial compounds. Importantly, 91% of the isolates harbored blaOXA-51-like carbapenemase genes (including six new variants), 40% harbored the blaOXA-23 carbapenemase gene, and 89% contained a variety of aminoglycoside resistance determinants with up to six unique determinants identified per strain. Many of the resistance determinants were found in potentially mobile gene cassettes; 45% and 7% of the isolates contained class 1 and class 2 integrons, respectively. Combined, the results demonstrate a facile approach that supports a more complete understanding of the genetic underpinnings of antimicrobial resistance to better assess the load, transmission, and evolution of MDR in MTF-associated A. baumannii. PMID:24247131

  6. Global metabolic analyses identify key differences in metabolite levels between polymyxin-susceptible and polymyxin-resistant Acinetobacter baumannii.


    Mahamad Maifiah, Mohd Hafidz; Cheah, Soon-Ee; Johnson, Matthew D; Han, Mei-Ling; Boyce, John D; Thamlikitkul, Visanu; Forrest, Alan; Kaye, Keith S; Hertzog, Paul; Purcell, Anthony W; Song, Jiangning; Velkov, Tony; Creek, Darren J; Li, Jian


    Multidrug-resistant Acinetobacter baumannii presents a global medical crisis and polymyxins are used as the last-line therapy. This study aimed to identify metabolic differences between polymyxin-susceptible and polymyxin-resistant A. baumannii using untargeted metabolomics. The metabolome of each A. baumannii strain was measured using liquid chromatography-mass spectrometry. Multivariate and univariate statistics and pathway analyses were employed to elucidate metabolic differences between the polymyxin-susceptible and -resistant A. baumannii strains. Significant differences were identified between the metabolic profiles of the polymyxin-susceptible and -resistant A. baumannii strains. The lipopolysaccharide (LPS) deficient, polymyxin-resistant 19606R showed perturbation in specific amino acid and carbohydrate metabolites, particularly pentose phosphate pathway (PPP) and tricarboxylic acid (TCA) cycle intermediates. Levels of nucleotides were lower in the LPS-deficient 19606R. Furthermore, 19606R exhibited a shift in its glycerophospholipid profile towards increased abundance of short-chain lipids compared to the parent polymyxin-susceptible ATCC 19606. In contrast, in a pair of clinical isolates 03-149.1 (polymyxin-susceptible) and 03-149.2 (polymyxin-resistant, due to modification of lipid A), minor metabolic differences were identified. Notably, peptidoglycan biosynthesis metabolites were significantly depleted in both of the aforementioned polymyxin-resistant strains. This is the first comparative untargeted metabolomics study to show substantial differences in the metabolic profiles of the polymyxin-susceptible and -resistant A. baumannii. PMID:26924392

  7. Global metabolic analyses identify key differences in metabolite levels between polymyxin-susceptible and polymyxin-resistant Acinetobacter baumannii

    PubMed Central

    Mahamad Maifiah, Mohd Hafidz; Cheah, Soon-Ee; Johnson, Matthew D.; Han, Mei-Ling; Boyce, John D.; Thamlikitkul, Visanu; Forrest, Alan; Kaye, Keith S.; Hertzog, Paul; Purcell, Anthony W.; Song, Jiangning; Velkov, Tony; Creek, Darren J.; Li, Jian


    Multidrug-resistant Acinetobacter baumannii presents a global medical crisis and polymyxins are used as the last-line therapy. This study aimed to identify metabolic differences between polymyxin-susceptible and polymyxin-resistant A. baumannii using untargeted metabolomics. The metabolome of each A. baumannii strain was measured using liquid chromatography-mass spectrometry. Multivariate and univariate statistics and pathway analyses were employed to elucidate metabolic differences between the polymyxin-susceptible and -resistant A. baumannii strains. Significant differences were identified between the metabolic profiles of the polymyxin-susceptible and -resistant A. baumannii strains. The lipopolysaccharide (LPS) deficient, polymyxin-resistant 19606R showed perturbation in specific amino acid and carbohydrate metabolites, particularly pentose phosphate pathway (PPP) and tricarboxylic acid (TCA) cycle intermediates. Levels of nucleotides were lower in the LPS-deficient 19606R. Furthermore, 19606R exhibited a shift in its glycerophospholipid profile towards increased abundance of short-chain lipids compared to the parent polymyxin-susceptible ATCC 19606. In contrast, in a pair of clinical isolates 03–149.1 (polymyxin-susceptible) and 03–149.2 (polymyxin-resistant, due to modification of lipid A), minor metabolic differences were identified. Notably, peptidoglycan biosynthesis metabolites were significantly depleted in both of the aforementioned polymyxin-resistant strains. This is the first comparative untargeted metabolomics study to show substantial differences in the metabolic profiles of the polymyxin-susceptible and -resistant A. baumannii. PMID:26924392

  8. Early detection of metallo-β-lactamase NDM-1- and OXA-23 carbapenemase-producing Acinetobacter baumannii in Libyan hospitals.


    Mathlouthi, Najla; El Salabi, Allaaeddin Ali; Ben Jomàa-Jemili, Mariem; Bakour, Sofiane; Al-Bayssari, Charbel; Zorgani, Abdulaziz A; Kraiema, Abdulmajeed; Elahmer, Omar; Okdah, Liliane; Rolain, Jean-Marc; Chouchani, Chedly


    Acinetobacter baumannii is an opportunistic pathogen causing various nosocomial infections. The aim of this study was to characterise the molecular support of carbapenem-resistant A. baumannii clinical isolates recovered from two Libyan hospitals. Bacterial isolates were identified by matrix-assisted laser desorption/ionisation time-of-flight mass spectrometry (MALDI-TOF/MS). Antibiotic susceptibility testing was performed using disk diffusion and Etest methods, and carbapenem resistance determinants were studied by PCR amplification and sequencing. Multilocus sequence typing (MLST) was performed for typing of the isolates. All 36 imipenem-resistant isolates tested were identified as A. baumannii. The blaOXA-23 gene was detected in 29 strains (80.6%). The metallo-β-lactamase blaNDM-1 gene was detected in eight isolates (22.2%), showing dissemination of multidrug-resistant (MDR) A. baumannii in Tripoli Medical Center and Burn and Plastic Surgery Hospital in Libya, including one isolate that co-expressed the blaOXA-23 gene. MLST revealed several sequence types (STs). Imipenem-resistant A. baumannii ST2 was the predominant clone (16/36; 44.4%). This study shows that NDM-1 and OXA-23 contribute to antibiotic resistance in Libyan hospitals and represents the first incidence of the association of these two carbapenemases in an autochthonous MDR A. baumannii isolated from patients in Libya, indicating that there is a longstanding infection control problem in these hospitals. PMID:27216382

  9. Structure of the Acinetobacter baumannii Dithiol Oxidase DsbA Bound to Elongation Factor EF-Tu Reveals a Novel Protein Interaction Site

    PubMed Central

    Premkumar, Lakshmanane; Kurth, Fabian; Duprez, Wilko; Grøftehauge, Morten K.; King, Gordon J.; Halili, Maria A.; Heras, Begoña; Martin, Jennifer L.


    The multidrug resistant bacterium Acinetobacter baumannii is a significant cause of nosocomial infection. Biofilm formation, that requires both disulfide bond forming and chaperone-usher pathways, is a major virulence trait in this bacterium. Our biochemical characterizations show that the periplasmic A. baumannii DsbA (AbDsbA) enzyme has an oxidizing redox potential and dithiol oxidase activity. We found an unexpected non-covalent interaction between AbDsbA and the highly conserved prokaryotic elongation factor, EF-Tu. EF-Tu is a cytoplasmic protein but has been localized extracellularly in many bacterial pathogens. The crystal structure of this complex revealed that the EF-Tu switch I region binds to the non-catalytic surface of AbDsbA. Although the physiological and pathological significance of a DsbA/EF-Tu association is unknown, peptides derived from the EF-Tu switch I region bound to AbDsbA with submicromolar affinity. We also identified a seven-residue DsbB-derived peptide that bound to AbDsbA with low micromolar affinity. Further characterization confirmed that the EF-Tu- and DsbB-derived peptides bind at two distinct sites. These data point to the possibility that the non-catalytic surface of DsbA is a potential substrate or regulatory protein interaction site. The two peptides identified in this work together with the newly characterized interaction site provide a novel starting point for inhibitor design targeting AbDsbA. PMID:24860094

  10. Biochemical and Structural Analysis of Inhibitors Targeting the ADC-7 Cephalosporinase of Acinetobacter baumannii

    PubMed Central


    β-Lactam resistance in Acinetobacter baumannii presents one of the greatest challenges to contemporary antimicrobial chemotherapy. Much of this resistance to cephalosporins derives from the expression of the class C β-lactamase enzymes, known as Acinetobacter-derived cephalosporinases (ADCs). Currently, β-lactamase inhibitors are structurally similar to β-lactam substrates and are not effective inactivators of this class C cephalosporinase. Herein, two boronic acid transition state inhibitors (BATSIs S02030 and SM23) that are chemically distinct from β-lactams were designed and tested for inhibition of ADC enzymes. BATSIs SM23 and S02030 bind with high affinity to ADC-7, a chromosomal cephalosporinase from Acinetobacter baumannii (Ki = 21.1 ± 1.9 nM and 44.5 ± 2.2 nM, respectively). The X-ray crystal structures of ADC-7 were determined in both the apo form (1.73 Å resolution) and in complex with S02030 (2.0 Å resolution). In the complex, S02030 makes several canonical interactions: the O1 oxygen of S02030 is bound in the oxyanion hole, and the R1 amide group makes key interactions with conserved residues Asn152 and Gln120. In addition, the carboxylate group of the inhibitor is meant to mimic the C3/C4 carboxylate found in β-lactams. The C3/C4 carboxylate recognition site in class C enzymes is comprised of Asn346 and Arg349 (AmpC numbering), and these residues are conserved in ADC-7. Interestingly, in the ADC-7/S02030 complex, the inhibitor carboxylate group is observed to interact with Arg340, a residue that distinguishes ADC-7 from the related class C enzyme AmpC. A thermodynamic analysis suggests that ΔH driven compounds may be optimized to generate new lead agents. The ADC-7/BATSI complex provides insight into recognition of non-β-lactam inhibitors by ADC enzymes and offers a starting point for the structure-based optimization of this class of novel β-lactamase inhibitors against a key resistance target. PMID:25380506

  11. Emergence of Carbapenem-Resistant Acinetobacter baumannii in Nursing Homes With High Background Rates of MRSA Colonization.


    Cheng, Vincent C C; Chen, Jonathan H K; Ng, W C; Wong, Janet Y H; Chow, Denise M K; Law, T C; So, Simon Y C; Wong, Sally C Y; Chan, T C; Chan, Felix H W; Ho, P L; Yuen, K Y


    Carbapenem-resistant Acinetobacter baumannii (CRAB) with diverse multilocus sequence typing emerged among our nursing home residents (6.5%) with a high background rate of MRSA (32.2%). Rectal swabs yielded a higher rate of CRAB detection than axillary or nasal swabs. Bed-bound status, use of adult diapers, and nasogastric tube were risk factors for CRAB colonization. Infect Control Hosp Epidemiol 2016;37:983-986. PMID:27108526

  12. Emergence and spread of plasmid-borne tet(B)::ISCR2 in minocycline-resistant Acinetobacter baumannii isolates.


    Vilacoba, Elisabet; Almuzara, Marisa; Gulone, Lucia; Traglia, German Matías; Figueroa, Silvia A; Sly, Gabriela; Fernández, Analia; Centrón, Daniela; Ramírez, María Soledad


    Resistance to minocycline has emerged in multidrug-resistant Acinetobacter baumannii isolates from Buenos Aires hospitals. Few reports about the description and dispersion of tet genes in this species have been published. We observed the presence of tet(B) in all minocycline-resistant isolates. This gene was found to be associated with the ISCR2 mobile element, which may, in part, explain its dispersion. PMID:23147737

  13. Impaired Virulence and Fitness of a Colistin-Resistant Clinical Isolate of Acinetobacter baumannii in a Rat Model of Pneumonia

    PubMed Central

    Hraiech, Sami; Roch, Antoine; Lepidi, Hubert; Atieh, Thérèse; Audoly, Gilles; Rolain, Jean-Marc; Raoult, Didier; Brunel, Jean-Michel; Papazian, Laurent


    We compared the fitness and lung pathogenicity of two isogenic clinical isolates of Acinetobacter baumannii, one resistant (ABCR) and the other susceptible (ABCS) to colistin. In vitro, ABCR exhibited slower growth kinetics than ABCS. In a rat model of pneumonia, ABCR was associated with less pronounced signs of infection (lung bacterial count, systemic dissemination, and lung damage) and a better outcome (ABCR and ABCS mortality rates, 20 and 50%, respectively [P = 0.03]). PMID:23836181

  14. Clinical validation of a real-time polymerase chain reaction assay for rapid detection of Acinetobacter baumannii colonization.


    Blanco-Lobo, P; González-Galán, V; García-Quintanilla, M; Valencia, R; Cazalla, A; Martín, C; Alonso, I; Pérez-Romero, P; Cisneros, J M; Aznar, J; McConnell, M J


    Real-time polymerase chain reaction (PCR)-based approaches have not been assessed in terms of their ability to detect patients colonized by Acinetobacter baumannii during active surveillance. This prospective, double-blind study demonstrated that a real-time PCR assay had high sensitivity (100%) and specificity (91.2%) compared with conventional culture for detecting A. baumannii in 397 active surveillance samples, and provided results within 3h. Receiver-operator curve analyses demonstrated that the technique has diagnostic accuracy of 97.7% (95% confidence interval 96.0-99.3%). This method could facilitate the rapid implementation of infection control measures for preventing the transmission of A. baumannii. PMID:27206968

  15. Draft genome sequence of a multidrug-resistant blaOXA-23-producing Acinetobacter baumannii ST208 isolate from China.


    Chen, Yan; Wu, Liyan; Chen, Yu; Xu, Zhijun; Xu, Liqun


    Acinetobacter baumannii has emerged worldwide as an important opportunistic nosocomial pathogen and has become a major public health concern. In this study, the draft genome sequence of A. baumannii TCM331 (ST208/CC92), a multidrug-resistant (MDR) isolate harbouring the blaOXA-23 gene isolated in China, was determined. The genome of TCM331 was sequenced via Illumina HiSeq™ 2000, and bioinformatics analysis was performed. Important antimicrobial resistance determinants were observed in an estimated genome size of 4,058,691bp with 3838 predicted coding regions. In conclusion, these data might facilitate further understanding of the specific genomic features of MDR A. baumannii in China. PMID:27436391

  16. The outer membrane porin OmpW of Acinetobacter baumannii is involved in iron uptake and colistin binding.


    Catel-Ferreira, Manuella; Marti, Sara; Guillon, Laurent; Jara, Luis; Coadou, Gaël; Molle, Virginie; Bouffartigues, Emeline; Bou, German; Shalk, Isabelle; Jouenne, Thierry; Vila-Farrés, Xavier; Dé, Emmanuelle


    This study was undertaken to characterize functions of the outer membrane protein OmpW, which potentially contributes to the development of colistin- and imipenem-resistance in Acinetobacter baumannii. Reconstitution of OmpW in artificial lipid bilayers showed that it forms small channels (23 pS in 1 m KCl) and markedly interacts with iron and colistin, but not with imipenem. In vivo, (55) Fe uptake assays comparing the behaviours of ΔompW mutant and wild-type strains confirmed a role for OmpW in A. baumannii iron homeostasis. However, the loss of OmpW expression did not have an impact on A. baumannii susceptibilities to colistin or imipenem. PMID:26823169

  17. Molecular Epidemiology and Mechanisms of Tigecycline Resistance in Clinical Isolates of Acinetobacter baumannii from a Chinese University Hospital

    PubMed Central

    Deng, Mei; Zhu, Man-Hua; Li, Jun-Jie; Bi, Sheng; Sheng, Zi-Ke; Hu, Fei-Shu; Zhang, Jia-Jie; Chen, Wei; Xue, Xiao-Wei; Li, Lan-Juan


    Because of its remarkable ability to acquire antibiotic resistance and to survive in nosocomial environments, Acinetobacter baumannii has become a significant nosocomial infectious agent worldwide. Tigecycline is one of the few therapeutic options for treating infections caused by A. baumannii isolates. However, tigecycline resistance has increasingly been reported. Our aim was to assess the prevalence and characteristics of efflux-based tigecycline resistance in clinical isolates of A. baumannii collected from a hospital in China. A total of 74 A. baumannii isolates, including 64 tigecycline-nonsusceptible A. baumannii (TNAB) and 10 tigecycline-susceptible A. baumannii (TSAB) isolates, were analyzed. The majority of them were determined to be positive for adeABC, adeRS, adeIJK, and abeM, while the adeE gene was found in only one TSAB isolate. Compared with the levels in TSAB isolates, the mean expression levels of adeB, adeJ, adeG, and abeM in TNAB isolates were observed to increase 29-, 3-, 0.7-, and 1-fold, respectively. The efflux pump inhibitors (EPIs) phenyl-arginine-β-naphthylamide (PAβN) and carbonyl cyanide 3-chlorophenylhydrazone (CCCP) could partially reverse the resistance pattern of tigecycline. Moreover, the tetX1 gene was detected in 12 (18.8%) TNAB isolates. To our knowledge, this is the first report of the tetX1 gene being detected in A. baumannii isolates. ST208 and ST191, which both clustered into clonal complex 92 (CC92), were the predominant sequence types (STs). This study showed that the active efflux pump AdeABC appeared to play important roles in the tigecycline resistance of A. baumannii. The dissemination of TNAB isolates in our hospital is attributable mainly to the spread of CC92. PMID:24165187

  18. Pyocyanin Stimulates Quorum Sensing-Mediated Tolerance to Oxidative Stress and Increases Persister Cell Populations in Acinetobacter baumannii

    PubMed Central

    Bhargava, Nidhi; Sharma, Prince


    Acinetobacter baumannii and Pseudomonas aeruginosa are nosocomial pathogens with overlapping sites of infection. This work reports that the two can coexist stably in mixed-culture biofilms. In a study intended to improve our understanding of the mechanism of their coexistence, it was found that pyocyanin, produced by P. aeruginosa that generally eliminates competition from other pathogens, led to the generation of reactive oxygen species (ROS) in A. baumannii cells, which in response showed a significant (P ≤ 0.05) increase in production of enzymes, specifically, catalase and superoxide dismutase (SOD). This work shows for the first time that the expression of catalase and SOD is under the control of a quorum-sensing system in A. baumannii. In support of this observation, a quorum-sensing mutant of A. baumannii (abaI::Km) was found to be sensitive to pyocyanin compared to its wild type and showed significantly (P ≤ 0.001) lower levels of the antioxidant enzymes, which increased on addition of 5 μM N-(3-hydroxydodecanoyl)-l-homoserine lactone. Likewise, in wild-type A. baumannii, there was a significant (P < 0.01) decrease in the level of anti-oxidant enzymes in the presence of salicylic acid, a known quencher of quorum sensing. In the presence of amikacin and carbenicillin, A. baumannii formed 0.07 and 0.02% persister cells, which increased 4- and 3-fold, respectively, in the presence of pyocyanin. These findings show that pyocyanin induces a protective mechanism in A. baumannii against oxidative stress and also increases its persistence against antibiotics which could be of clinical significance in the case of coinfections with A. baumannii and P. aeruginosa. PMID:24891106

  19. Pyocyanin stimulates quorum sensing-mediated tolerance to oxidative stress and increases persister cell populations in Acinetobacter baumannii.


    Bhargava, Nidhi; Sharma, Prince; Capalash, Neena


    Acinetobacter baumannii and Pseudomonas aeruginosa are nosocomial pathogens with overlapping sites of infection. This work reports that the two can coexist stably in mixed-culture biofilms. In a study intended to improve our understanding of the mechanism of their coexistence, it was found that pyocyanin, produced by P. aeruginosa that generally eliminates competition from other pathogens, led to the generation of reactive oxygen species (ROS) in A. baumannii cells, which in response showed a significant (P ≤ 0.05) increase in production of enzymes, specifically, catalase and superoxide dismutase (SOD). This work shows for the first time that the expression of catalase and SOD is under the control of a quorum-sensing system in A. baumannii. In support of this observation, a quorum-sensing mutant of A. baumannii (abaI::Km) was found to be sensitive to pyocyanin compared to its wild type and showed significantly (P ≤ 0.001) lower levels of the antioxidant enzymes, which increased on addition of 5 μM N-(3-hydroxydodecanoyl)-l-homoserine lactone. Likewise, in wild-type A. baumannii, there was a significant (P < 0.01) decrease in the level of anti-oxidant enzymes in the presence of salicylic acid, a known quencher of quorum sensing. In the presence of amikacin and carbenicillin, A. baumannii formed 0.07 and 0.02% persister cells, which increased 4- and 3-fold, respectively, in the presence of pyocyanin. These findings show that pyocyanin induces a protective mechanism in A. baumannii against oxidative stress and also increases its persistence against antibiotics which could be of clinical significance in the case of coinfections with A. baumannii and P. aeruginosa. PMID:24891106

  20. Dissemination of 16S rRNA Methylase ArmA-Producing Acinetobacter baumannii and Emergence of OXA-72 Carbapenemase Coproducers in Japan

    PubMed Central

    Tada, Tatsuya; Miyoshi-Akiyama, Tohru; Shimada, Kayo; Shimojima, Masahiro


    Forty-nine clinical isolates of multidrug-resistant Acinetobacter baumannii were obtained from 12 hospitals in 7 prefectures throughout Japan. Molecular phylogenetic analysis revealed the clonal spread of A. baumannii sequence type 208 (ST208) and ST455 isolates harboring the armA gene and ST512 harboring the armA and blaOXA-72 genes. These findings show that A. baumannii isolates harboring armA are disseminated throughout Japan, and this is the first report to show that A. baumannii strains harboring blaOXA-72 and armA are emerging in hospitals in Japan. PMID:24550340

  1. Characterization of carbapenem-resistant Acinetobacter calcoaceticus-baumannii complex isolates from nosocomial bloodstream infections in southern Iran.


    Pourabbas, Bahman; Firouzi, Roya; Pouladfar, Gholamreza


    Acinetobacter baumannii is an important opportunistic bacterial pathogen responsible for serious infections in hospitalized patients. From a total of 78 consecutive non-repetitive Acinetobacter spp. isolates from patients with blood infections, 61 were carbapenem resistant, which were positive for blaOXA-51-like (96.7%), blaOXA-23-like (77 %), blaOXA-58-like (8.1%) and blaOXA-40-like genes (32.8%) by multiplex PCR. The isolates were identified as A. baumannii (n = 59) and Acinetobacter nosocomialis (n = 2). Also, we found a case of Acinetobacter junii, causing bacteraemia, that possessed the IMP gene. High levels of resistance were observed to fluoroquinolones, aminoglycosides, tigecycline and to the beta-lactam antibiotics, including piperacillin/tazobactam and ampicillin/sulbactam. ISAba1 was present in 96.7% of all Acinetobacter calcoaceticus-baumannii complex (Acb) isolates. Also, 33 (54.1%) and 23 (37.7%) isolates harboured ISAba1 upstream of blaOXA-23-like and blaOXA-51-like genes, respectively, though this was not observed in A. nosocomialis isolates. No relationship was observed between the presence of ISAba1 upstream of oxacillinase genes and the level of carbapenem resistance in all Acb isolates. Only two genes encoding metallo-beta-lactamase (VIM, SPM) were detected in all Acb isolates. This suggests that carbapenem resistance in blood-isolate Acb is mostly due to the presence of acquired carbapenemases. This is the first report from Iran on the identification of A. nosocomialis isolates that possess multiple oxacillinase genes and lack upstream ISAba1. PMID:26747061

  2. [Candida peritonitis and sepsis due to Acinetobacter baumannii in peritoneal dialysis: an association with prognosis not always unfavourable].


    Rapisarda, Francesco; Aliotta, Roberta; Pocorobba, Barbara; Portale, Grazia; Ferrario, Silvia; Zanoli, Luca; Fatuzzo, Pasquale


    Fungal infections have a high incidence in patients receiving peritoneal dialysis. (1)
Peritoneal dialysis is often complicated by peritonitis which has only minimally mycotic etiology, but nonetheless it is associated with 15-45% mortality (8).
 The opportunistic pathogens such as Candida can cause infection in immunocompromised conditions. Even the Acinetobacter tends to infect immunocompromised individuals and it has the same risk factors for infection as Candida: immunosuppression, malignancy, HIV positivity and all the other conditions of immunosuppression, central venous catheterization, mechanical ventilation and prolonged antibiotic therapy. The sepsis by Acinetobacter predicts a negative prognosis with the mortality rate between 20 to 60% (12), especially in cases of isolation of multi-resistant germs.
 We present a case report of a CKD patient undergoing peritoneal dialysis therapy who was hospitalized for acute pancreatitis, later complicated by the development of pancreatic pseudocysts, C. albicans peritonitis with hematologic spread of the fungus, superimposed Acinetobacter baumannii sepsis and pneumonia. She has been subjected to percutaneous drainage of pseudocysts, to switch from peritoneal dialysis to hemodialysis, to various evacuative thoracentesis, and to polymicrobial therapy (meropenem, teicoplanina, tigeciclina, linezolid, colimicina, fluconazolo, etc.) that allowed the resolution of sepsis. The peculiarity of this case is represented by the numerous morbidity that the patient developed simultaneously, with the genesis of a complex clinical picture, by the combination of infections due to Candida albicans and Acinetobacter baumannii. Successful treatment strategies allowed to fight and cure a medical condition associated with a high mortality rate. PMID:26845211

  3. Expression of the RND-type efflux pump AdeABC in Acinetobacter baumannii is regulated by the AdeRS two-component system.


    Marchand, Isabelle; Damier-Piolle, Laurence; Courvalin, Patrice; Lambert, Thierry


    The AdeABC pump of Acinetobacter baumannii BM4454, which confers resistance to various antibiotic classes including aminoglycosides, is composed of the AdeA, AdeB, and AdeC proteins; AdeB is a member of the RND superfamily. The adeA, adeB, and adeC genes are contiguous and adjacent to adeS and adeR, which are transcribed in the opposite direction and which specify proteins homologous to sensors and regulators of two-component systems, respectively (S. Magnet, P. Courvalin, and T. Lambert, Antimicrob. Agents Chemother. 45:3375-3380, 2001). Analysis by Northern hybridization indicated that the three genes were cotranscribed, although mRNAs corresponding to adeAB and adeC were also present. Cotranscription of the two regulatory genes was demonstrated by reverse transcription-PCR. Inactivation of adeS led to aminoglycoside susceptibility. Transcripts corresponding to adeAB were not detected in susceptible A. baumannii CIP 70-10 but were present in spontaneous gentamicin-resistant mutants obtained in vitro. Analysis of these mutants revealed the substitutions Thr153-->Met in AdeS downstream from the putative His-149 site of autophosphorylation, which is presumably responsible for the loss of phosphorylase activity by the sensor, and Pro116-->Leu in AdeR at the first residue of the alpha(5) helix of the receiver domain, which is involved in interactions that control the output domain of response regulators. These mutations led to constitutive expression of the pump and, thus, to antibiotic resistance. These data indicate that the AdeABC pump is cryptic in wild A. baumannii due to stringent control by the AdeRS two-component system. PMID:15328088

  4. Expression of the RND-Type Efflux Pump AdeABC in Acinetobacter baumannii Is Regulated by the AdeRS Two-Component System

    PubMed Central

    Marchand, Isabelle; Damier-Piolle, Laurence; Courvalin, Patrice; Lambert, Thierry


    The AdeABC pump of Acinetobacter baumannii BM4454, which confers resistance to various antibiotic classes including aminoglycosides, is composed of the AdeA, AdeB, and AdeC proteins; AdeB is a member of the RND superfamily. The adeA, adeB, and adeC genes are contiguous and adjacent to adeS and adeR, which are transcribed in the opposite direction and which specify proteins homologous to sensors and regulators of two-component systems, respectively (S. Magnet, P. Courvalin, and T. Lambert, Antimicrob. Agents Chemother. 45:3375-3380, 2001). Analysis by Northern hybridization indicated that the three genes were cotranscribed, although mRNAs corresponding to adeAB and adeC were also present. Cotranscription of the two regulatory genes was demonstrated by reverse transcription-PCR. Inactivation of adeS led to aminoglycoside susceptibility. Transcripts corresponding to adeAB were not detected in susceptible A. baumannii CIP 70-10 but were present in spontaneous gentamicin-resistant mutants obtained in vitro. Analysis of these mutants revealed the substitutions Thr153→Met in AdeS downstream from the putative His-149 site of autophosphorylation, which is presumably responsible for the loss of phosphorylase activity by the sensor, and Pro116→Leu in AdeR at the first residue of the α5 helix of the receiver domain, which is involved in interactions that control the output domain of response regulators. These mutations led to constitutive expression of the pump and, thus, to antibiotic resistance. These data indicate that the AdeABC pump is cryptic in wild A. baumannii due to stringent control by the AdeRS two-component system. PMID:15328088

  5. The first report on the outbreak of OXA-24/40-like carbapenemase-producing Acinetobacter baumannii in Turkey.


    Sarı, Ayşe Nur; Biçmen, Meral; Gülay, Zeynep


    Carbapenem resistance due to OXA-type carbapenemases seriously limits therapeutic options in nosocomial infections caused by Acinetobacter baumannii. Previous studies have shown the presence of OXA-51, OXA-58, and OXA-23 carbapenemases but not OXA-24/40 in A. baumannii in Turkey. In this study, we investigated carbapenem-hydrolyzing class D β-lactamases (CHDLs) in A. baumannii and the molecular epidemiology of CHDL producers at the Dokuz Eylul Hospital, Izmir Turkey, and detected blaOXA-24/40 in a clinical isolate from a patient in the medical intensive care unit (ICU). The specific enzyme type was OXA-72. Additional studies revealed 22 more isolates from 20 patients and that the OXA-72-producing strain caused an outbreak in the medical ICU from September 2012 to March 2013, which still continues. To our knowledge, this is the first report of OXA-24/40 carbapenemases in A. baumannii in Turkey. Emergency infection control should be implemented following the arrival of a new OXA at a hospital where A. baumannii is highly endemic. PMID:24047747

  6. Biosynthesis of UDP-N,N′-Diacetylbacillosamine in Acinetobacter baumannii: Biochemical Characterization and Correlation to Existing Pathways†

    PubMed Central

    Morrison, Michael J.; Imperiali, Barbara


    The Gram-negative, opportunistic pathogen Acinetobacter baumannii has recently captured headlines due to its ability to circumvent current antibiotic therapies. Herein we show that the multi-drug resistant (MDR) AYE strain of A. baumannii contains a gene locus that encodes three enzymes responsible for the biosynthesis of the highly-modified bacterial nucleotide sugar, UDP-N,N -diacetylbacillosamine (UDP-diNAcBac). Previously, this UDP-sugar has been implicated in the pgl pathway of Campylobacter jejuni. Here we report the overexpression, purification, and biochemical characterization of the A. baumannii enzymes WeeK, WeeJ, and WeeI that are responsible for the production of UDP-diNAcBac. We also demonstrate the function of the phosphoglycosyltransferase (WeeH), which transfers the diNAcBac moiety to undecaprenyl-phosphate. UDP-diNAcBac biosynthesis in A. baumannii is also directly compared to the homologous pathways in the pathogens C. jejuni and Neisseria gonorrhoeae. This work demonstrates for the first time the ability of A. baumannii to generate the highly-modified, UDP-diNAcBac nucleotide sugar found previously in other bacteria adding to the growing list of pathogens that assemble glycoconjugates including bacillosamine. Additionally, characterization of these pathway enzymes highlights the opportunity for investigating the significance of highly-modified sugars in bacterial pathogenesis. PMID:23747578

  7. Immunoprotective Efficacy of Acinetobacter baumannii Outer Membrane Protein, FilF, Predicted In silico as a Potential Vaccine Candidate

    PubMed Central

    Singh, Ravinder; Garg, Nisha; Shukla, Geeta; Capalash, Neena; Sharma, Prince


    Acinetobacter baumannii is emerging as a serious nosocomial pathogen with multidrug resistance that has made it difficult to cure and development of efficacious treatment against this pathogen is direly needed. This has led to investigate vaccine approach to prevent and treat A. baumannii infections. In this work, an outer membrane putative pilus assembly protein, FilF, was predicted as vaccine candidate by in silico analysis of A. baumannii proteome and was found to be conserved among the A. baumannii strains. It was cloned and expressed in E. coli BL21(DE3) and purified by Ni-NTA chromatography. Immunization with FilF generated high antibody titer (>64,000) and provided 50% protection against a standardized lethal dose (108 CFU) of A. baumannii in murine pneumonia model. FilF immunization reduced the bacterial load in lungs by 2 and 4 log cycles, 12 and 24 h post infection as compared to adjuvant control; reduced the levels of pro-inflammatory cytokines TNF-α, IL-6, IL-33, IFN-γ, and IL-1β significantly and histology of lung tissue supported the data by showing considerably reduced damage and infiltration of neutrophils in lungs. These results demonstrate the in vivo validation of immunoprotective efficacy of a protein predicted as a vaccine candidate by in silico proteomic analysis and open the possibilities for exploration of a large array of uncharacterized proteins. PMID:26904021

  8. Antibiotic resistance and OXA-type carbapenemases-encoding genes in airborne Acinetobacter baumannii isolated from burn wards.


    Gao, Jing; Zhao, Xiaonan; Bao, Ying; Ma, Ruihua; Zhou, Yufa; Li, Xinxian; Chai, Tongjie; Cai, Yumei


    The study was conducted to investigate drug resistance, OXA-type carbapenemases-encoding genes and genetic diversity in airborne Acinetobacter baumannii (A. baumannii) in burn wards. Airborne A. baumannii were collected in burn wards and their corridors using Andersen 6-stage air sampler from January to June 2011. The isolates susceptibility to 13 commonly used antibiotics was examined according to the CLSI guidelines; OXA-type carbapenemases-encoding genes and molecular diversity of isolates were analyzed, respectively. A total of 16 non-repetitive A. baumannii were isolated, with 10 strains having a resistance rate of greater than 50% against the 13 antibiotics. The resistance rate against ceftriaxone, cyclophosvnamide, ciprofloxacin, and imipenem was 93.75% (15/16), but no isolate observed to be resistant to cefoperazone/sulbactam. Resistance gene analyses showed that all 16 isolates carried OXA-51, and 15 isolates carried OXA-23 except No.15; but OXA-24 and OXA-58 resistance genes not detected. The isolates were classified into 13 genotypes (A-M) according to repetitive extragenic palindromic sequence PCR (REP-PCR) results and only six isolates had a homology ≥90%. In conclusion, airborne A. baumannii in the burn wards had multidrug resistance and complex molecular diversity, and OXA-23 and OXA-51 were dominant mechanisms for resisting carbapenems. PMID:23886986

  9. OXA-235, a Novel Class D β-Lactamase Involved in Resistance to Carbapenems in Acinetobacter baumannii

    PubMed Central

    Pérez-Llarena, Francisco J.; Zander, Esther; Fernández, Ana; Bou, Germán; Seifert, Harald


    We investigated the mechanism of carbapenem resistance in 10 Acinetobacter baumannii strains isolated from the United States and Mexico between 2005 and 2009. The detection of known metallo-β-lactamase or carbapenem-hydrolyzing oxacillinase (OXA) genes by PCR was negative. The presence of plasmid-encoded carbapenem resistance genes was investigated by transformation of A. baumannii ATCC 17978. Shotgun cloning experiments and sequencing were performed, followed by the expression of a novel β-lactamase in A. baumannii. Three novel OXA enzymes were identified, OXA-235 in 8 isolates and the amino acid variants OXA-236 (Glu173-Val) and OXA-237 (Asp208-Gly) in 1 isolate each. The deduced amino acid sequences shared 85% identity with OXA-134, 54% to 57% identities with the acquired OXA-23, OXA-24, OXA-58, and OXA-143, and 56% identity with the intrinsic OXA-51 and, thus, represent a novel subclass of OXA. The expression of OXA-235 in A. baumannii led to reduced carbapenem susceptibility, while cephalosporin MICs were unaffected. Genetic analysis revealed that blaOXA-235, blaOXA-236, and blaOXA-237 were bracketed between two ISAba1 insertion sequences. In addition, the presence of these acquired β-lactamase genes might result from a transposition-mediated mechanism. This highlights the propensity of A. baumannii to acquire multiple carbapenem resistance determinants. PMID:23439638

  10. A new trilocus sequence-based multiplex-PCR to detect major Acinetobacter baumannii clones.


    Martins, Natacha; Picão, Renata Cristina; Cerqueira-Alves, Morgana; Uehara, Aline; Barbosa, Lívia Carvalho; Riley, Lee W; Moreira, Beatriz Meurer


    A collection of 163 Acinetobacter baumannii isolates detected in a large Brazilian hospital, was potentially related with the dissemination of four clonal complexes (CC): 113/79, 103/15, 109/1 and 110/25, defined by University of Oxford/Institut Pasteur multilocus sequence typing (MLST) schemes. The urge of a simple multiplex-PCR scheme to specify these clones has motivated the present study. The established trilocus sequence-based typing (3LST, for ompA, csuE and blaOXA-51-like genes) multiplex-PCR rapidly identifies international clones I (CC109/1), II (CC118/2) and III (CC187/3). Thus, the system detects only one (CC109/1) out of four main CC in Brazil. We aimed to develop an alternative multiplex-PCR scheme to detect these clones, known to be present additionally in Africa, Asia, Europe, USA and South America. MLST, performed in the present study to complement typing our whole collection of isolates, confirmed that all isolates belonged to the same four CC detected previously. When typed by 3LST-based multiplex-PCR, only 12% of the 163 isolates were classified into groups. By comparative sequence analysis of ompA, csuE and blaOXA-51-like genes, a set of eight primers was designed for an alternative multiplex-PCR to distinguish the five CC 113/79, 103/15, 109/1, 110/25 and 118/2. Study isolates and one CC118/2 isolate were blind-tested with the new alternative PCR scheme; all were correctly clustered in groups of the corresponding CC. The new multiplex-PCR, with the advantage of fitting in a single reaction, detects five leading A. baumannii clones and could help preventing the spread in healthcare settings. PMID:27125687

  11. Resistance Markers and Genetic Diversity in Acinetobacter baumannii Strains Recovered from Nosocomial Bloodstream Infections

    PubMed Central

    Martins, Hanoch S. I.; Bomfim, Maria Rosa Q.; França, Rafaela O.; Farias, Luiz M.; Carvalho, Maria Auxiliadora R.; Serufo, José Carlos; Santos, Simone G.


    In this study, phenotypic and genotypic methods were used to detect metallo-β-lactamases, cephalosporinases and oxacillinases and to assess genetic diversity among 64 multiresistant Acinetobacter baumannii strains recovered from blood cultures in five different hospitals in Brazil from December 2008 to June 2009. High rates of resistance to imipenem (93.75%) and polymyxin B (39.06%) were observed using the disk diffusion (DD) method and by determining the minimum inhibitory concentration (MIC). Using the disk approximation method, thirty-nine strains (60.9%) were phenotypically positive for class D enzymes, and 51 strains (79.6%) were positive for cephalosporinase (AmpC). Using the E-test, 60 strains (93.75%) were positive for metallo-β-lactamases (MβLs). All strains were positive for at least one of the 10 studied genes; 59 (92.1%) contained blaVIM-1, 79.6% contained blaAmpC, 93.7% contained blaOXA23 and 84.3% contained blaOXA51. Enterobacteria Repetitive Intergenic Consensus (ERIC)-PCR analysis revealed a predominance of certain clones that differed from each other. However, the same band pattern was observed in samples from the different hospitals studied, demonstrating correlation between the genotypic and phenotypic results. Thus, ERIC-PCR is an appropriate method for rapidly clustering genetically related isolates. These results suggest that defined clonal clusters are circulating within the studied hospitals. These results also show that the prevalence of MDR A. baumannii may vary among clones disseminated in specific hospitals, and they emphasize the importance of adhering to appropriate infection control measures. PMID:24477210

  12. Strategies for the treatment of polymyxin B-resistant Acinetobacter baumannii infections.


    Menegucci, Thatiany Cevallos; Albiero, James; Migliorini, Letícia Busato; Alves, Janio Leal Borges; Viana, Giselle Fukita; Mazucheli, Josmar; Carrara-Marroni, Floristher Elaine; Cardoso, Celso Luiz; Tognim, Maria Cristina Bronharo


    In this study, the activity of meropenem (MEM), fosfomycin (FOF) and polymyxin B (PMB), alone and in combination, was analysed. In addition, optimisation of the pharmacodynamic index of MEM and FOF against six isolates of OXA-23-producing Acinetobacter baumannii (including three resistant to PMB) that were not clonally related was assessed. Antimicrobial combinations were evaluated by chequerboard analysis and were considered synergistic when the fractional inhibitory concentration index (FICI) was ≤0.5. Pharmacodynamic analyses of the MEM and FOF dosing schemes were performed by Monte Carlo simulation. The target pharmacodynamic index (%ƒT>MIC) for MEM and FOF was ≥40% and ≥70%, respectively, and a probability of target attainment (PTA) ≥0.9 was considered adequate. Among the PMB-resistant isolates, combinations of PMB+MEM and PMB+FOF+MEM showed the highest synergistic activity (FICI ≤0.125); isolates that were previously PMB-resistant were included in the susceptible category using CLSI interpretive criteria. Pharmacodynamic evaluation found that for a FOF minimum inhibitory concentration (MIC) of ≤16μg/mL, treatment both by bolus dosing and prolonged infusion achieved adequate PTA, whilst for MIC=32μg/mL only infusion achieved adequate PTA. For a MEM MIC of 4μg/mL, only the bolus treatment scheme with 1.5g q6h and the infusion schemes with 1.0g q8h, 1.5g q6h and 2.0g q8h achieved PTA ≥0.9. Results of antimicrobial and pharmacodynamic analyses can assist in treating infections caused by multidrug-resistant A. baumannii. However, in vivo clinical studies are essential to evaluate the true role of these compounds, including intravenous antimicrobial FOF therapy. PMID:27068675

  13. Relationship between Antibiotic Resistance, Biofilm Formation, and Biofilm-Specific Resistance in Acinetobacter baumannii.


    Qi, Lihua; Li, Hao; Zhang, Chuanfu; Liang, Beibei; Li, Jie; Wang, Ligui; Du, Xinying; Liu, Xuelin; Qiu, Shaofu; Song, Hongbin


    In this study, we aimed to examine the relationships between antibiotic resistance, biofilm formation, and biofilm-specific resistance in clinical isolates of Acinetobacter baumannii. The tested 272 isolates were collected from several hospitals in China during 2010-2013. Biofilm-forming capacities were evaluated using the crystal violet staining method. Antibiotic resistance/susceptibility profiles to 21 antibiotics were assessed using VITEK 2 system, broth microdilution method or the Kirby-Bauer disc diffusion method. The minimum inhibitory concentration (MIC) and minimum biofilm eradication concentration (MBEC) to cefotaxime, imipenem, and ciprofloxacin were evaluated using micro dilution assays. Genetic relatedness of the isolates was also analyzed by pulsed-field gel electrophoresis (PFGE) and plasmid profile. Among all the 272 isolates, 31 were multidrug-resistant (MDR), and 166 were extensively drug-resistant (XDR). PFGE typing revealed 167 pattern types and 103 clusters with a similarity of 80%. MDR and XDR isolates built up the main prevalent genotypes. Most of the non-MDR isolates were distributed in a scattered pattern. Additionally, 249 isolates exhibited biofilm formation, among which 63 were stronger biofilm formers than type strain ATCC19606. Population that exhibited more robust biofilm formation likely contained larger proportion of non-MDR isolates. Isolates with higher level of resistance tended to form weaker biofilms. The MBECs for cefotaxime, imipenem, and ciprofloxacin showed a positive correlation with corresponding MICs, while the enhancement in resistance occurred independent of the quantity of biofilm biomass produced. Results from this study imply that biofilm acts as a mechanism for bacteria to get a better survival, especially in isolates with resistance level not high enough. Moreover, even though biofilms formed by isolates with high level of resistance are always weak, they could still provide similar level of protection for the

  14. Relationship between Antibiotic Resistance, Biofilm Formation, and Biofilm-Specific Resistance in Acinetobacter baumannii

    PubMed Central

    Qi, Lihua; Li, Hao; Zhang, Chuanfu; Liang, Beibei; Li, Jie; Wang, Ligui; Du, Xinying; Liu, Xuelin; Qiu, Shaofu; Song, Hongbin


    In this study, we aimed to examine the relationships between antibiotic resistance, biofilm formation, and biofilm-specific resistance in clinical isolates of Acinetobacter baumannii. The tested 272 isolates were collected from several hospitals in China during 2010–2013. Biofilm-forming capacities were evaluated using the crystal violet staining method. Antibiotic resistance/susceptibility profiles to 21 antibiotics were assessed using VITEK 2 system, broth microdilution method or the Kirby-Bauer disc diffusion method. The minimum inhibitory concentration (MIC) and minimum biofilm eradication concentration (MBEC) to cefotaxime, imipenem, and ciprofloxacin were evaluated using micro dilution assays. Genetic relatedness of the isolates was also analyzed by pulsed-field gel electrophoresis (PFGE) and plasmid profile. Among all the 272 isolates, 31 were multidrug-resistant (MDR), and 166 were extensively drug-resistant (XDR). PFGE typing revealed 167 pattern types and 103 clusters with a similarity of 80%. MDR and XDR isolates built up the main prevalent genotypes. Most of the non-MDR isolates were distributed in a scattered pattern. Additionally, 249 isolates exhibited biofilm formation, among which 63 were stronger biofilm formers than type strain ATCC19606. Population that exhibited more robust biofilm formation likely contained larger proportion of non-MDR isolates. Isolates with higher level of resistance tended to form weaker biofilms. The MBECs for cefotaxime, imipenem, and ciprofloxacin showed a positive correlation with corresponding MICs, while the enhancement in resistance occurred independent of the quantity of biofilm biomass produced. Results from this study imply that biofilm acts as a mechanism for bacteria to get a better survival, especially in isolates with resistance level not high enough. Moreover, even though biofilms formed by isolates with high level of resistance are always weak, they could still provide similar level of protection for the

  15. An Inactivated Antibiotic-Exposed Whole-Cell Vaccine Enhances Bactericidal Activities Against Multidrug-Resistant Acinetobacter baumannii

    PubMed Central

    Shu, Meng-Hooi; MatRahim, NorAziyah; NorAmdan, NurAsyura; Pang, Sui-Ping; Hashim, Sharina H.; Phoon, Wai-Hong; AbuBakar, Sazaly


    Vaccination may be an alternative treatment for infection with multidrug-resistance (MDR) Acinetobacter baumannii. The study reported here evaluated the bactericidal antibody responses following immunization of mice using an inactivated whole-cell vaccine derived from antibiotic-exposed MDR A. baumannii (I-M28-47-114). Mice inoculated with I-M28-47 (non-antibiotic-exposed control) and I-M28-47-114 showed a high IgG antibody response by day 5 post-inoculation. Sera from mice inoculated with I-M28-47-114 collected on day 30 resulted in 80.7 ± 12.0% complement-mediated bacteriolysis in vitro of the test MDR A. baumannii treated with imipenem, which was a higher level of bacteriolysis over sera from mice inoculated with I-M28-47. Macrophage-like U937 cells eliminated 49.3 ± 11.6% of the test MDR A. baumannii treated with imipenem when opsonized with sera from mice inoculated with I-M28-47-114, which was a higher level of elimination than observed for test MDR A. baumannii opsonized with sera from mice inoculated with I-M28-47. These results suggest that vaccination with I-M28-47-114 stimulated antibody responses capable of mounting high bactericidal killing of MDR A. baumannii. Therefore, the inactivated antibiotic-exposed whole-cell vaccine (I-M28-47-114) has potential for development as a candidate vaccine for broad clearance and protection against MDR A. baumannii infections. PMID:26923424

  16. Emergence of Carbapenem-Resistant Pseudomonas aeruginosa and Acinetobacter baumannii Clinical Isolates Collected from Some Libyan Hospitals.


    Mathlouthi, Najla; Areig, Zaynab; Al Bayssari, Charbel; Bakour, Sofiane; Ali El Salabi, Allaaeddin; Ben Gwierif, Salha; Zorgani, Abdulaziz A; Ben Slama, Karim; Chouchani, Chedly; Rolain, Jean-Marc


    The aim of the present study was to investigate the molecular mechanism of carbapenem resistance in Pseudomonas aeruginosa and Acinetobacter baumannii clinical isolates recovered from Libyan hospitals between April 2013 and April 2014. In total, 49 strains (24 P. aeruginosa and 25 A. baumannii) were isolated, including 21 P. aeruginosa and 22 A. baumannii isolates (87.75%) resistant to imipenem (minimum inhibitory concentrations ≥16 μg/ml). The blaVIM-2 gene was detected in 19 P. aeruginosa isolates. All imipenem-resistant P. aeruginosa isolates showed the presence of OprD mutations. Acquired OXA-carbapenemase-encoding genes were present in all A. baumannii isolates: blaOXA-23 (n=19) and blaOXA-24 (n=3). Finally, a total of 13 and 17 different sequence types were assigned to the 21 P. aeruginosa and the 22 A. baumannii carbapenem-resistant isolates, respectively. This study is the first report describing imipenem-resistant P. aeruginosa and A. baumannii isolated from patients in Libya. We report the first case of co-occurrence of blaVIM-2 with oprD porin loss in identical isolates of P. aeruginosa in Libya and demonstrate that these oprD mutations can be used as a tool to study the clonality in P. aeruginosa isolates. We also report the first identification of multidrug-resistant A. baumannii isolates harboring blaOXA-23-like, blaOXA-24-like, and blaOXA-48-like genes in Libya. PMID:25587875

  17. An Inactivated Antibiotic-Exposed Whole-Cell Vaccine Enhances Bactericidal Activities Against Multidrug-Resistant Acinetobacter baumannii.


    Shu, Meng-Hooi; MatRahim, NorAziyah; NorAmdan, NurAsyura; Pang, Sui-Ping; Hashim, Sharina H; Phoon, Wai-Hong; AbuBakar, Sazaly


    Vaccination may be an alternative treatment for infection with multidrug-resistance (MDR) Acinetobacter baumannii. The study reported here evaluated the bactericidal antibody responses following immunization of mice using an inactivated whole-cell vaccine derived from antibiotic-exposed MDR A. baumannii (I-M28-47-114). Mice inoculated with I-M28-47 (non-antibiotic-exposed control) and I-M28-47-114 showed a high IgG antibody response by day 5 post-inoculation. Sera from mice inoculated with I-M28-47-114 collected on day 30 resulted in 80.7 ± 12.0% complement-mediated bacteriolysis in vitro of the test MDR A. baumannii treated with imipenem, which was a higher level of bacteriolysis over sera from mice inoculated with I-M28-47. Macrophage-like U937 cells eliminated 49.3 ± 11.6% of the test MDR A. baumannii treated with imipenem when opsonized with sera from mice inoculated with I-M28-47-114, which was a higher level of elimination than observed for test MDR A. baumannii opsonized with sera from mice inoculated with I-M28-47. These results suggest that vaccination with I-M28-47-114 stimulated antibody responses capable of mounting high bactericidal killing of MDR A. baumannii. Therefore, the inactivated antibiotic-exposed whole-cell vaccine (I-M28-47-114) has potential for development as a candidate vaccine for broad clearance and protection against MDR A. baumannii infections. PMID:26923424

  18. Insect-Derived Cecropins Display Activity against Acinetobacter baumannii in a Whole-Animal High-Throughput Caenorhabditis elegans Model

    PubMed Central

    Jayamani, Elamparithi; Rajamuthiah, Rajmohan; Larkins-Ford, Jonah; Fuchs, Beth Burgwyn; Conery, Annie L.; Vilcinskas, Andreas; Ausubel, Frederick M.


    The rise of multidrug-resistant Acinetobacter baumannii and a concomitant decrease in antibiotic treatment options warrants a search for new classes of antibacterial agents. We have found that A. baumannii is pathogenic and lethal to the model host organism Caenorhabditis elegans and have exploited this phenomenon to develop an automated, high-throughput, high-content screening assay in liquid culture that can be used to identify novel antibiotics effective against A. baumannii. The screening assay involves coincubating C. elegans with A. baumannii in 384-well plates containing potential antibacterial compounds. At the end of the incubation period, worms are stained with a dye that stains only dead animals, and images are acquired using automated microscopy and then analyzed using an automated image analysis program. This robust assay yields a Z′ factor consistently greater than 0.7. In a pilot experiment to test the efficacy of the assay, we screened a small custom library of synthetic antimicrobial peptides (AMPs) that were synthesized using publicly available sequence data and/or transcriptomic data from immune-challenged insects. We identified cecropin A and 14 other cecropin or cecropin-like peptides that were able to enhance C. elegans survival in the presence of A. baumannii. Interestingly, one particular hit, BR003-cecropin A, a cationic peptide synthesized by the mosquito Aedes aegypti, showed antibiotic activity against a panel of Gram-negative bacteria and exhibited a low MIC (5 μg/ml) against A. baumannii. BR003-cecropin A causes membrane permeability in A. baumannii, which could be the underlying mechanism of its lethality. PMID:25583713

  19. Controlling endemic multidrug-resistant Acinetobacter baumannii in Intensive Care Units using antimicrobial stewardship and infection control

    PubMed Central

    Cheon, Shinhye; Kim, Mi-Ja; Yun, Seon-Jin; Moon, Jae Young; Kim, Yeon-Sook


    Background/Aims: Nosocomial infections caused by multidrug-resistant (MDR) Acinetobacter baumannii have become public-health problem. However, few studies have evaluated the control of endemic MDR A. baumannii in Intensive Care Units (ICUs). Therefore, we investigated the effectiveness of antimicrobial stewardship and comprehensive intensified infection control measures for controlling endemic MDR A. baumannii in ICUs at a tertiary care center. Methods: Carbapenem use was strictly restricted through antimicrobial stewardship. Environmental cleaning and disinfection was performed at least 3 times per day in addition to basic infection control measures. Isolation using plastic curtains and contact precautions were applied to patients who were colonized or infected with MDR A. baumannii. The outcome was measured as the incidence density rate of hospital-onset MDR A. baumannii among patients in the ICUs. Results: The incidence density rate of hospital-onset MDR A. baumannii decreased from 22.82 cases per 1,000 patient-days to 2.68 cases per 1,000 patient-days after the interventions were implemented (odds ratio, 0.12; 95% confidence interval, 0.03 to 0.4; p < 0.001). The mean monthly use of carbapenems also decreased from 134.99 ± 82.26 defined daily doses per 1,000 patient-days to 94.85 ± 50.98 defined daily doses per 1,000 patient-days (p = 0.016). Conclusions: Concomitant implementation of strict antimicrobial stewardship and comprehensive infection control measures effectively controlled endemic MDR A. baumannii in our ICUs within 1 year. PMID:26874513

  20. Study of the major essential oil compounds of Coriandrum sativum against Acinetobacter baumannii and the effect of linalool on adhesion, biofilms and quorum sensing.


    Alves, Susana; Duarte, Andreia; Sousa, Sónia; Domingues, Fernanda C


    Acinetobacter baumannii is a pathogen that has the ability to adhere to surfaces in the hospital environment and to form biofilms which are increasingly resistant to antimicrobial agents. The aim of this work was to study the antimicrobial activity of the major oil compounds of Coriandrum sativum against A. baumannii. The effect of linalool on planktonic cells and biofilms of A. baumannii on different surfaces, as well as its effect on adhesion and quorum sensing was evaluated. From all the compounds evaluated, linalool was the compound with the best antibacterial activity, with minimum inhibitory concentration values between 2 and 8 μl ml(-1). Linalool also inhibited biofilm formation and dispersed established biofilms of A. baumannii, changed the adhesion of A. baumannii to surfaces and interfered with the quorum- sensing system. Thus, linalool could be a promising antimicrobial agent for controlling planktonic cells and biofilms of A. baumannii. PMID:26901586

  1. High prevalence of extensively drug-resistant and metallo beta-lactamase-producing clinical Acinetobacter baumannii in Iran.


    Maspi, Hossein; Mahmoodzadeh Hosseini, Hamideh; Amin, Mohsen; Imani Fooladi, Abbas Ali


    Acinetobacter species particularly Acinetobacter baumannii (A. baumannii) have been widely reported as broad-spectrum antibiotic resistant pathogens. Expression of various types of metallo beta-lactamases (MBL), classified as Ambler class B, has been associated with carbapenem resistance. Here, we attempted to assess the frequency of extensively drug-resistant (XDR) and MBL-producing A. baumannii among clinical isolates. 86 clinical A. baumannii strains were collected from 2014 to 2015 and their susceptibility to meropenem (10 μg), imipenem (10 μg), azteronem (30 μg), pipracillin (100 μg) tazobactam (110 μg), tobramycin (10 μg), fosfomycin (200 μg), rifampicin (5 μg), colistin (10 μg), tigecycline (15 μg), sulbactam/ampicillin (10 μg + 10 μg) and polymixin B (300 U) was evaluated using disk diffusion method. The MBL-producing isolates were screened using combined disc diffusion method. Furthermore, the presence of blaVIM, blaIMP, blaSPM, blaGIM, blaSIM and blaNDM was detected by PCR. 34.9% of isolates were recovered from bronchoalveolar lavage (BAL). 81 (94.2%) and 62 (71.2%) isolates were multidrug resistance (MDR) and XDR, respectively. 44 (51.2%) and 65 (75.6%) isolates were MBL-producing strains with resistance to imipenem and meropenem, respectively. 2 (2.3%), 13 (15.1%), 2 (2.3%), 4 (4.7%) and 2 (2.3%) isolates carried blaVIM, blaIMP, blaSPM, blaGIM and blaSIM genes, respectively. Our data showed that the rate of XDR and MBL A. baumannii is on the rise. PMID:27448835

  2. Genetic basis of high level aminoglycoside resistance in Acinetobacter baumannii from Beijing, China

    PubMed Central

    Nie, Lu; Lv, Yuemeng; Yuan, Min; Hu, Xinxin; Nie, Tongying; Yang, Xinyi; Li, Guoqing; Pang, Jing; Zhang, Jingpu; Li, Congran; Wang, Xiukun; You, Xuefu


    The objective of this study was to investigate the genetic basis of high level aminoglycoside resistance in Acinetobacter baumannii clinical isolates from Beijing, China. 173 A. baumannii clinical isolates from hospitals in Beijing from 2006 to 2009 were first subjected to high level aminoglycoside resistance (HLAR, MIC to gentamicin and amikacin>512 µg/mL) phenotype selection by broth microdilution method. The strains were then subjected to genetic basis analysis by PCR detection of the aminoglycoside modifying enzyme genes (aac(3)-I, aac(3)-IIc, aac(6′)-Ib, aac(6′)-II, aph(4)-Ia, aph(3′)-I, aph(3′)-IIb, aph(3′)-IIIa, aph(3′)-VIa, aph(2″)-Ib, aph(2″)-Ic, aph(2″)-Id, ant(2″)-Ia, ant(3″)-I and ant(4′)-Ia) and the 16S rRNA methylase genes (armA, rmtB and rmtC). Correlation analysis between the presence of aminoglycoside resistance gene and HLAR phenotype were performed by SPSS. Totally 102 (58.96%) HLAR isolates were selected. The HLAR rates for year 2006, 2007, 2008 and 2009 were 52.63%, 65.22%, 51.11% and 70.83%, respectively. Five modifying enzyme genes (aac(3)-I, detection rate of 65.69%; aac(6′)-Ib, detection rate of 45.10%; aph(3′)-I, detection rate of 47.06%; aph(3′)-IIb, detection rate of 0.98%; ant(3″)-I, detection rate of 95.10%) and one methylase gene (armA, detection rate of 98.04%) were detected in the 102 A. baumannii with aac(3)-I+aac(6′)-Ib+ant(3″)-I+armA (detection rate of 25.49%), aac(3)-I+aph(3′)-I+ant(3″)-I+armA (detection rate of 21.57%) and ant(3″)-I+armA (detection rate of 12.75%) being the most prevalent gene profiles. The values of chi-square tests showed correlation of armA, ant(3″)-I, aac(3)-I, aph(3′)-I and aac(6′)-Ib with HLAR. armA had significant correlation (contingency coefficient 0.685) and good contingency with HLAR (kappa 0.940). The high rates of HLAR may cause a serious problem for combination therapy of aminoglycoside with β-lactams against A. baumannii infections. As armA was

  3. [Evaluation of the efficacy of colistin/sulbactam combination on carbapenem-resistant Acinetobacter baumannii strains].


    Çetinkol, Yeliz; Telli, Murat; Altunçekiç Yıldırım, Arzu; Çalgın, Mustafa Kerem


    Acinetobacter baumannii strains, are opportunistic pathogens that cause severe nosocomial infections that are difficult to treat due to development of resistance to multiple antibiotics. As the antibiotic choices to be used in treatment are limited, combinations of a variety of antibiotics are used. The aims of this study were to identify the minimal inhibitory concentration (MIC) values of colistin and sulbactam against A.baumannii isolates and to determine the in vitro activity of colistin-sulbactam combination. A total of 50 A.baumannii strains isolated from different clinical specimens (32 tracheal aspirates, 10 blood, 6 urine and 2 wound samples) were included in the study. The identification of bacteria was performed by traditional methods and Vitek-2 (BioMerieux, France) automated system. Antibiotic susceptibilities were detected by Mueller-Hinton agar disk diffusion method and Vitek-2 automated system and the results were interpreted according to the CLSI standards. MIC values of colistin and sulbactam against A.baumannii strains and in vitro interactions of colistin-sulbactam combinations were determined with the E-test (BioMerieux, France). Fractional inhibitory concentration (FIC) index was used for the detection of efficacy of drug combinations. The presence of oxacillinase and metallo-beta-lactamase (MBL) genes that lead carbapenem resistance was investigated by polymerase chain reaction (PCR), and pulsed-field gel electrophoresis (PFGE) was performed for the determination of clonal relationship. In our study, all strains (100%) were detected as susceptible to colistin, 48 (96%) to trimethoprim/sulphamethoxazole and 18 to (36%) tigecyclin; however all of them were resistant to the other studied antibiotics, including sulbactam and carbapenem. When the colistin-sulbactam combination was assessed according to FIC index, all strains were found to have antagonistic effect. All of the carbapenem-resistant strains were positive for OXA-51 and OXA-23, and 3

  4. Higher Isolation of NDM-1 Producing Acinetobacter baumannii from the Sewage of the Hospitals in Beijing

    PubMed Central

    Cui, Jiajun; Wang, Pan; Huang, Liuyu; Klena, John D.; Song, Hongbin


    Multidrug resistant microbes present in the environment are a potential public health risk. In this study, we investigate the presence of New Delhi metallo-β-lactamase 1 (NDM-1) producing bacteria in the 99 water samples in Beijing City, including river water, treated drinking water, raw water samples from the pools and sewage from 4 comprehensive hospitals. For the blaNDM-1 positive isolate, antimicrobial susceptibility testing was further analyzed, and Pulsed Field Gel Electrophoresis (PFGE) was performed to determine the genetic relationship among the NDM-1 producing isolates from sewage and human, as well as the clinical strains without NDM-1. The results indicate that there was a higher isolation of NDM-1 producing Acinetobacter baumannii from the sewage of the hospitals, while no NDM-1 producing isolates were recovered from samples obtained from the river, drinking, or fishpond water. Surprisingly, these isolates were markedly different from the clinical isolates in drug resistance and pulsed field gel electrophoresis profiles, suggesting different evolutionary relationships. Our results showed that the hospital sewage may be one of the diffusion reservoirs of NDM-1 producing bacteria. PMID:23755152

  5. Screening of antibiotics resistance to Enterobacteriaceae, Pseudomonas aeruginosa, and Acinetobacter baumannii by an advanced expert system.


    Nakamura, Tatsuya; Takahashi, Hakuo


    The VITEK2 advanced expert system (AES) gives information about the antibiotics-resistance mechanisms based on the biological validation derived from the VITEK2 susceptibility result. In this study, we investigated whether or not this system correctly categorized the beta-lactamase resistance mechanism data derived from the VITEK2 susceptibility result using the testing card, AST-N025, with Enterobacteriaceae, Pseudomonas aeruginosa, and Acinetobacter baumannii. We used 131 strains, and their phenotypes were determined according to the biological and genetic screening. The AES analysis result matched the phenotype testing in 120 (91.6%) of the 131 strains. Incorrect findings were found in six strains, including three strains of Serratia marcescens. The resistance mechanism could not be determined in five strains, including three strains of Providencia rettgeri. The analysis of those phenotypes agreed in 34 (97.1%) among 35 strains with extended spectrum beta-lactamase (ESBL), and in 27 (96.4%) among 28 strains with high-level cephalosporinase. The agreement ratio in the phenotype was very high as we expected. The incorrect and nondeterminable samples were strains with relatively high cephalosporinase that has variation of outer membrane protein. The AES was able to detect the phenotype for carbapenemase. The AES is a clinically useful system that allows taking prompt measures to treat patients because it can provide information about the resistance mechanism in less than half a day after starting the analysis. PMID:16369735

  6. Combination therapy with polymyxin B and netropsin against clinical isolates of multidrug-resistant Acinetobacter baumannii.


    Chung, Joon-Hui; Bhat, Abhayprasad; Kim, Chang-Jin; Yong, Dongeun; Ryu, Choong-Min


    Polymyxins are last-resort antibiotics for treating infections of Gram-negative bacteria. The recent emergence of polymyxin-resistant bacteria, however, urgently demands clinical optimisation of polymyxin use to minimise further evolution of resistance. In this study we developed a novel combination therapy using minimal concentrations of polymyxin B. After large-scale screening of Streptomyces secondary metabolites, we identified a reliable polymixin synergist and confirmed as netropsin using high-pressure liquid chromatography, nuclear magnetic resonance, and mass spectrometry followed by in vitro assays using various Gram-negative pathogenic bacteria. To evaluate the effectiveness of combining polymixin B and netropsin in vivo, we performed survival analysis on greater wax moth Galleria mellonella infected with colistin-resistant clinical Acinetobacter baumannii isolates as well as Escherichia coli, Shigella flexineri, Salmonella typhimuruim, and Pseudomonas aeruginosa. The survival of infected G. mellonella was significantly higher when treated with polymyxin B and netropsin in combination than when treated with polymyxin B or netropsin alone. We propose a netropsin combination therapy that minimises the use of polymyxin B when treating infections with multidrug resistant Gram-negative bacteria. PMID:27306928

  7. Disinfection of Acinetobacter baumannii-contaminated surfaces relevant to medical treatment facilities with ultraviolet C light.


    Rastogi, Vipin K; Wallace, Lalena; Smith, Lisa S


    The efficacy of ultraviolet C (UVC) light (100-280 nm) in the decontamination of three hospital-related surfaces, namely, unpainted/painted aluminum (bed railings), stainless steel (operating tables), and scrubs (laboratory coats), was investigated. Acinetobacter baumannii cells were inoculated (10(5) or 10(3) cells) on small coupons and dried overnight in a class II biosafety cabinet. Drying resulted in < or =50% loss of viability. The UVC fluence of 90 J/m2 was observed to be very effective in the decontamination of cells from all metal coupon surfaces (complete killing). However, the same fluence was ineffective in the decontamination of scrubs. The effectiveness of two other common disinfection practices, that is, 15 minutes of boiling or spraying with 70% ethanol, was investigated for the scrubs. Although ethanol treatment was ineffective, the boiling treatment was very effective (complete killing). These results establish that metal surfaces can be decontaminated with UVC irradiation and boiling treatment is effective for scrub decontamination. PMID:18062390

  8. Resistance patterns of multidrug resistant Acinetobacter baumannii in an ICU of a tertiary care hospital, Malaysia

    PubMed Central

    Janahiraman, Sivakami; Aziz, Muhammad Nazri; Hoo, Fan Kee; P’ng, Hon Shen; Boo, Yang Liang; Ramachandran, Vasudevan; Shamsuddin, Ahmad Fuad


    Backgrounds & Objective: Antimicrobial resistance is a major health problem worldwide in hospitals. The main contributing factors are exposures to broad-spectrum antimicrobials and cross-infections. Understanding the extent and type of antimicrobial use in tertiary care hospitals will aid in developing national antimicrobial stewardship priorities. Methods: In this study, we have analyzed the antimicrobial agents’ usage for acquisition of multidrug resistant using retrospective, cross-sectional, single-centre study in a multidisciplinary ICU at tertiary care hospital. Results: Acinetobacter baumannii (ACB) was isolated in various specimens from 662 patients. From these, 136 patients who were diagnosed with Ventilator-associated pneumonia (VAP) caused by ACB were included into the study. In our study, MDR strain accounts for 51% of all VAP cases caused by ACB. The development of ACB VAP were 10.5 + 6.4 days for MDR strains compared to susceptible organism (7.8 + 4.5 days) and had significantly longer ICU stay. Conclusion: The study concludes that prudent use of antimicrobial agents is important to reduce acquisition of MDR ACB. PMID:26870101

  9. The effect of silver or gallium doped titanium against the multidrug resistant Acinetobacter baumannii.


    Cochis, A; Azzimonti, B; Della Valle, C; De Giglio, E; Bloise, N; Visai, L; Cometa, S; Rimondini, L; Chiesa, R


    Implant-related infection of biomaterials is one of the main causes of arthroplasty and osteosynthesis failure. Bacteria, such as the rapidly-emerging Multi Drug Resistant (MDR) pathogen Acinetobacter Baumannii, initiate the infection by adhering to biomaterials and forming a biofilm. Since the implant surface plays a crucial role in early bacterial adhesion phases, titanium was electrochemically modified by an Anodic Spark Deposition (ASD) treatment, developed previously and thought to provide osseo-integrative properties. In this study, the treatment was modified to insert gallium or silver onto the titanium surface, to provide antibacterial properties. The material was characterized morphologically, chemically, and mechanically; biological properties were investigated by direct cytocompatibility assay, Alkaline Phosphatase (ALP) activity, Scanning Electron Microscopy (SEM), and Immunofluorescent (IF) analysis; antibacterial activity was determined by counting Colony Forming Units, and viability assay. The various ASD-treated surfaces showed similar morphology, micrometric pore size, and uniform pore distribution. Of the treatments studied, gallium-doped specimens showed the best ALP synthesis and antibacterial properties. This study demonstrates the possibility of successfully doping the surface of titanium with gallium or silver, using the ASD technique; this approach can provide antibacterial properties and maintain high osseo-integrative potential. PMID:26708086

  10. Combination therapy with polymyxin B and netropsin against clinical isolates of multidrug-resistant Acinetobacter baumannii

    PubMed Central

    Chung, Joon-hui; Bhat, Abhayprasad; Kim, Chang-Jin; Yong, Dongeun; Ryu, Choong-Min


    Polymyxins are last-resort antibiotics for treating infections of Gram-negative bacteria. The recent emergence of polymyxin-resistant bacteria, however, urgently demands clinical optimisation of polymyxin use to minimise further evolution of resistance. In this study we developed a novel combination therapy using minimal concentrations of polymyxin B. After large-scale screening of Streptomyces secondary metabolites, we identified a reliable polymixin synergist and confirmed as netropsin using high-pressure liquid chromatography, nuclear magnetic resonance, and mass spectrometry followed by in vitro assays using various Gram-negative pathogenic bacteria. To evaluate the effectiveness of combining polymixin B and netropsin in vivo, we performed survival analysis on greater wax moth Galleria mellonella infected with colistin-resistant clinical Acinetobacter baumannii isolates as well as Escherichia coli, Shigella flexineri, Salmonella typhimuruim, and Pseudomonas aeruginosa. The survival of infected G. mellonella was significantly higher when treated with polymyxin B and netropsin in combination than when treated with polymyxin B or netropsin alone. We propose a netropsin combination therapy that minimises the use of polymyxin B when treating infections with multidrug resistant Gram-negative bacteria. PMID:27306928

  11. Antimicrobial Blue Light Therapy for Multidrug-Resistant Acinetobacter baumannii Infection in a Mouse Burn Model: Implications for Prophylaxis and Treatment of Combat-related Wound Infections

    PubMed Central

    Zhang, Yunsong; Zhu, Yingbo; Gupta, Asheesh; Huang, Yingying; Murray, Clinton K.; Vrahas, Mark S.; Sherwood, Margaret E.; Baer, David G.; Hamblin, Michael R.; Dai, Tianhong


    In this study, we investigated the utility of antimicrobial blue light therapy for multidrug-resistant Acinetobacter baumannii infection in a mouse burn model. A bioluminescent clinical isolate of multidrug-resistant A. baumannii was obtained. The susceptibility of A. baumannii to blue light (415 nm)–inactivation was compared in vitro to that of human keratinocytes. Repeated cycles of sublethal inactivation of bacterial by blue light were performed to investigate the potential resistance development of A. baumannii to blue light. A mouse model of third degree burn infected with A. baumannii was developed. A single exposure of blue light was initiated 30 minutes after bacterial inoculation to inactivate A. baumannii in mouse burns. It was found that the multidrug-resistant A. baumannii strain was significantly more susceptible than keratinocytes to blue light inactivation. Transmission electron microscopy revealed blue light–induced ultrastructural damage in A. baumannii cells. Fluorescence spectroscopy suggested that endogenous porphyrins exist in A. baumannii cells. Blue light at an exposure of 55.8 J/cm2 significantly reduced the bacterial burden in mouse burns. No resistance development to blue light inactivation was observed in A. baumannii after 10 cycles of sublethal inactivation of bacteria. No significant DNA damage was detected in mouse skin by means of a skin TUNEL assay after a blue light exposure of 195 J/cm2. PMID:24381206

  12. The pmrCAB Operon Mediates Polymyxin Resistance in Acinetobacter baumannii ATCC 17978 and Clinical Isolates through Phosphoethanolamine Modification of Lipid A▿

    PubMed Central

    Arroyo, Luis A.; Herrera, Carmen M.; Fernandez, Lucia; Hankins, Jessica V.; Trent, M. Stephen; Hancock, Robert E. W.


    The emergence of multidrug resistance among Acinetobacter baumannii is leading to an increasing dependence on the use of polymyxins as last-hope antibiotics. Here, we utilized genetic and biochemical methods to define the involvement of the pmrCAB operon in polymyxin resistance in this organism. Sequence analysis of 16 polymyxin B-resistant strains, including 6 spontaneous mutants derived from strain ATCC 17978 and 10 clinical isolates from diverse sources, revealed that they had independent mutations in the pmrB gene, encoding a sensor kinase, or in the response regulator PmrA. Knockout of the pmrB gene in two mutants and two clinical isolates led to a decrease in the polymyxin B susceptibility of these strains, which could be restored with the cloned pmrAB genes from the mutants but not from the wild type. Reverse transcription-quantitative PCR (RT-qPCR) analysis also showed a correlation between the expression of pmrC and polymyxin B resistance. Characterization of lipid A species from the mutant strains, by thin-layer chromatography and mass spectrometry, indicated that the addition of phosphoethanolamine to lipid A correlated with resistance. This addition is performed in Salmonella enterica serovar Typhimurium by the product of the pmrC gene, which is a homolog of the pmrC gene from Acinetobacter. Knockout of this gene in the mutant R2 [pmrB(T235I)] reversed resistance as well as phosphoethanolamine modification of lipid A. These results demonstrate that specific alterations in the sequence of the pmrCAB operon are responsible for resistance to polymyxins in A. baumannii. PMID:21646482

  13. [Extended spectrum beta lactamases (ESBL) production in Acinetobacter baumannii strains isolated from Chilean hospitals belonging to VIII Region].


    Pino I, Carolina; Domínguez Y, Mariana; González R, Gerardo; Bello T, Helia; Sepúlveda A, Marcela; Mella M, Sergio; Zemelman M, Claudia; Zemelman Z, Raúl


    The resistance of Acinetobacter baumannii to ss-lactam antibiotics is mainly due to the synthesis of ss-lactamases. From a clinical point of view, this bacteria and others, grouped under the acronym SPACE (S: Serratia, P: Pseudomonas, A: Acinetobacter, C: Citrobacter, E: Enterobacter) are essentially Amp-C ss-lactamases producers. There is no local information about ESBL presence in Acinetobacter. We studied ESBL production using the Ho and col. technique modified by adding cloxacillin as chromosomal ss-lactamases inhibitor. From 69 isolates, with resistance to at least one third generation cephalosporin, only 7 showed positive synergy test. Four of these amplified for TEM family gene, and one of these amplified also for the OXA family. Our study found a low ESBL production percentage, which agrees with the premise of Amp-C as the main mechanism of resistance to ss-lactam antibiotics in A. baumannii. However, the ESBL description in these bacteria emphasizes the capacity of expressing multiple resistance mechanisms. PMID:17453072

  14. Immunization with Lipopolysaccharide-Deficient Whole Cells Provides Protective Immunity in an Experimental Mouse Model of Acinetobacter baumannii Infection

    PubMed Central

    García-Quintanilla, Meritxell; Pulido, Marina R.; Pachón, Jerónimo; McConnell, Michael J.


    The increasing clinical importance of infections caused by multidrug resistant Acinetobacter baumannii warrants the development of novel approaches for prevention and treatment. In this context, vaccination of certain patient populations may contribute to reducing the morbidity and mortality caused by this pathogen. Vaccines against Gram-negative bacteria based on inactivated bacterial cells are highly immunogenic and have been shown to produce protective immunity against a number of bacterial species. However, the high endotoxin levels present in these vaccines due to the presence of lipopolysaccharide complicates their use in human vaccination. In the present study, we used a laboratory-derived strain of A. baumannii that completely lacks lipopolysaccharide due to a mutation in the lpxD gene (IB010), one of the genes involved in the first steps of lipopolysaccharide biosynthesis, for vaccination. We demonstrate that IB010 has greatly reduced endotoxin content (<1.0 endotoxin unit/106 cells) compared to wild type cells. Immunization with formalin inactivated IB010 produced a robust antibody response consisting of both IgG1 and IgG2c subtypes. Mice immunized with IB010 had significantly lower post-infection tissue bacterial loads and significantly lower serum levels of the pro-inflammatory cytokines IL-1β, TNF-α and IL-6 compared to control mice in a mouse model of disseminated A. baumannii infection. Importantly, immunized mice were protected from infection with the ATCC 19606 strain and an A. baumannii clinical isolate. These data suggest that immunization with inactivated A. baumannii whole cells deficient in lipopolysaccharide could serve as the basis for a vaccine for the prevention of infection caused by A. baumannii. PMID:25485716

  15. In vitro Comparison of Anti-Biofilm Effects against Carbapenem-Resistant Acinetobacter baumannii: Imipenem, Colistin, Tigecycline, Rifampicin and Combinations

    PubMed Central


    Background Multi-drug resistant (MDR) Acinetobacter baumannii has emerged as one of the most important nosocomial pathogens. In addition to the diverse resistance mechanisms, some A. baumannii strains are known to have biofilm-producing capacity, thereby decreasing antibiotic effectiveness. Materials and Methods This study was designed to assess biofilm-producing capacity of three different MDR A. baumannii strains with diverse resistance mechanisms (OXA-51, IMP-1 and VIM-2 type β-lactamases), and intended to compare the effect of each antibiotic regimen (rifampicin, colistin, imipenem, tigecycline, rifampicin-imipenem and rifampicin-colistin) on mature A. baumannii biofilms using in vitro polystyrene plate biofilm assay. Results Among three MDR A. baumannii strains, only VIM-2 strain produced strong biofilm compared to the controls (optical density, 8.04 ± 2.16 vs. 0.49 ± 0.26). Regarding VIM-2 strains, none of imipenem, colistin and rifampicin reduced biofilm formation alone at MIC of each antibiotic agent (inhibition of biofilm synthesis, less than 30%). In comparison, tigecyclin (0.76 ± 0.23), imipenem-rifampicin (1.07 ± 0.31) and colistin-rifampicin (1.47 ± 0.54) showed a significant inhibition of biofilm synthesis compared to the positive controls at 48 hours after incubation (P<0.01). Tigecycline inhibited biofilm formation even at the one fourth level of MIC (1.17 ± 0.21). Likewise, both imipenem and colistin were also effective even with the reduced concentrations when those were combined with rifampicin. Such biofilm-inhibiting effects with those antibiotic regimens sustained up to 96 hours after incubation. Conclusion Tigecycline, imipenem-rifampicin and colistin-rifampicin would be effective for the prevention or reduction of biofilm formation caused by A. baumannii strains. PMID:25844260

  16. Functional Characterization of AbeD, an RND-Type Membrane Transporter in Antimicrobial Resistance in Acinetobacter baumannii

    PubMed Central

    Srinivasan, Vijaya Bharathi; Venkataramaiah, Manjunath; Mondal, Amitabha; Rajamohan, Govindan


    Background Acinetobacter baumannii is becoming an increasing menace in health care settings especially in the intensive care units due to its ability to withstand adverse environmental conditions and exhibit innate resistance to different classes of antibiotics. Here we describe the biological contributions of abeD, a novel membrane transporter in bacterial stress response and antimicrobial resistance in A. baumannii. Results The abeD mutant displayed ~ 3.37 fold decreased survival and >5-fold reduced growth in hostile osmotic (0.25 M; NaCl) and oxidative (2.631 μM–6.574 μM; H2O2) stress conditions respectively. The abeD inactivated cells displayed increased susceptibility to ceftriaxone, gentamicin, rifampicin and tobramycin (~ 4.0 fold). The mutant displayed increased sensitivity to the hospital-based disinfectant benzalkonium chloride (~3.18-fold). In Caenorhabditis elegans model, the abeD mutant exhibited (P<0.01) lower virulence capability. Binding of SoxR on the regulatory fragments of abeD provide strong evidence for the involvement of SoxR system in regulating the expression of abeD in A. baumannii. Conclusion This study demonstrates the contributions of membrane transporter AbeD in bacterial physiology, stress response and antimicrobial resistance in A. baumannii for the first time. PMID:26496475

  17. A glimpse into evolution and dissemination of multidrug-resistant Acinetobacter baumannii isolates in East Asia: a comparative genomics study

    PubMed Central

    Feng, Ye; Ruan, Zhi; Shu, Jianfeng; Chen, Chyi-Liang; Chiu, Cheng-Hsun


    Clonal dissemination is characteristic of the important nosocomial pathogen Acinetobacter baumannii, as revealed by previous multi-locus sequence typing (MLST) studies. However, the disseminated phyletic unit is actually MLST sequence type instead of real bacterial clone. Here we sequenced the genomes of 13 multidrug-resistant (MDR) A. baumannii strains from Taiwan, and compared them with that of A. baumannii from other East Asian countries. Core-genome phylogenetic tree divided the analyzed strains into three major clades. Among them, one ST455 clade was a hybrid between the ST208 clade and the other ST455 clade. Several strains showed nearly identical genome sequence, but their isolation sources differed by over 2,500 km and 10 years apart, suggesting a wide dissemination of the phyletic units, which were much smaller than the sequence type. Frequent structural variation was detected even between the closely related strains in antimicrobial resistance elements such as AbaRI, class I integron, indicating strong selection pressure brought by antimicrobial use. In conclusion, wide clonal dissemination and frequent genomic variation simultaneously characterize the clinical MDR A. baumannii in East Asia. PMID:27072398

  18. A glimpse into evolution and dissemination of multidrug-resistant Acinetobacter baumannii isolates in East Asia: a comparative genomics study.


    Feng, Ye; Ruan, Zhi; Shu, Jianfeng; Chen, Chyi-Liang; Chiu, Cheng-Hsun


    Clonal dissemination is characteristic of the important nosocomial pathogen Acinetobacter baumannii, as revealed by previous multi-locus sequence typing (MLST) studies. However, the disseminated phyletic unit is actually MLST sequence type instead of real bacterial clone. Here we sequenced the genomes of 13 multidrug-resistant (MDR) A. baumannii strains from Taiwan, and compared them with that of A. baumannii from other East Asian countries. Core-genome phylogenetic tree divided the analyzed strains into three major clades. Among them, one ST455 clade was a hybrid between the ST208 clade and the other ST455 clade. Several strains showed nearly identical genome sequence, but their isolation sources differed by over 2,500 km and 10 years apart, suggesting a wide dissemination of the phyletic units, which were much smaller than the sequence type. Frequent structural variation was detected even between the closely related strains in antimicrobial resistance elements such as AbaRI, class I integron, indicating strong selection pressure brought by antimicrobial use. In conclusion, wide clonal dissemination and frequent genomic variation simultaneously characterize the clinical MDR A. baumannii in East Asia. PMID:27072398

  19. Novel cassette array in a class 1 integron in clinical isolates of Acinetobacter baumannii from central Iran.


    Japoni-Nejad, Alireza; Farshad, Shohreh; van Belkum, Alex; Ghaznavi-Rad, Ehsanollah


    Antibiotic resistance in Acinetobacter baumannii is a major problem in the hospital and outbreaks caused by this organism have been reported frequently. The present study aimed at determining the antibiotic susceptibility patterns, the prevalence of different classes of integrons and the characterization of integron class 1 gene cassettes in Iranian A. baumannii isolates. A total of 63 non-duplicate A. baumannii isolates were collected from clinical and environmental specimens in the Vali-Asr hospital in the central province of Iran (March to September, 2011). The antimicrobial susceptibility for 15 antibiotics which are used conventionally was determined by disk diffusion. The presence of different integron classes was investigated by PCR and the size of gene cassettes in class 1 integrons was then determined by PCR as well. Moreover, integron cassette arrays of isolates were delineated by RFLP and sequencing amplicons with different lengths. Of 63 isolates 62 (98.4%) carried a class 1 integron. The prevalence of IntI2 was 15.9% and the length of the amplicons ranged from 500 bp to 3 kb. Sequencing of integrons of class 1 revealed the presence of many resistance genes (aadA, aacA, aacC, dfrA, bla(GES) and bla(IMP)). We identified a completely new gene cassette which contained aacA7-qacF-aadA5-bla(IMP), this cassette has not been reported previously in A. baumannii. PMID:24161711

  20. Activity of Eravacycline against Enterobacteriaceae and Acinetobacter baumannii, Including Multidrug-Resistant Isolates, from New York City

    PubMed Central

    Abdallah, Marie; Olafisoye, Olawole; Cortes, Christopher; Urban, Carl; Landman, David


    Eravacycline demonstrated in vitro activity against a contemporary collection of more than 4,000 Gram-negative pathogens from New York City hospitals, with MIC50/MIC90 values, respectively, for Escherichia coli of 0.12/0.5 μg/ml, Klebsiella pneumoniae of 0.25/1 μg/ml, Enterobacter aerogenes of 0.25/1 μg/ml, Enterobacter cloacae 0.5/1 μg/ml, and Acinetobacter baumannii of 0.5/1 μg/ml. Activity was retained against multidrug-resistant isolates, including those expressing KPC and OXA carbapenemases. For A. baumannii, eravacycline MICs correlated with increased expression of the adeB gene. PMID:25534744

  1. Complete genome of the multidrug-resistant Acinetobacter baumannii strain KBN10P02143 isolated from Korea

    PubMed Central

    Lee, Yong-Woon; Choe, Hanna; Lee, Sang-Heon; Kim, Kyung Mo; Kam, Sin; Kim, Byung Kwon; Lee, Won-Kil


    Acinetobacter baumannii, a strictly aerobic, non-fermentative, Gram-negative coccobacillary rod-shaped bacterium, is an opportunistic pathogen in humans. We recently isolated a multidrug-resistant A. baumannii strain KBN10P02143 from the pus sample drawn from a surgical patient in South Korea. We report the complete genome of this strain, which consists of 4,139,396 bp (G + C content, 39.08%) with 3,868 protein-coding genes, 73 tRNAs and six rRNA operons. Identification of the genes related to multidrug resistance from this genome and the discovery of a novel conjugative plasmid will increase our understanding of the pathogenicity associated with this species. PMID:27143492

  2. Carbapenem Resistance in Acinetobacter baumannii and Other Acinetobacter spp. Causing Neonatal Sepsis: Focus on NDM-1 and Its Linkage to ISAba125

    PubMed Central

    Chatterjee, Somdatta; Datta, Saswati; Roy, Subhasree; Ramanan, Lavanya; Saha, Anindya; Viswanathan, Rajlakshmi; Som, Tapas; Basu, Sulagna


    Carbapenem-resistant determinants and their surrounding genetic structure were studied in Acinetobacter spp. from neonatal sepsis cases collected over 7 years at a tertiary care hospital. Acinetobacter spp. (n = 68) were identified by ARDRA followed by susceptibility tests. Oxacillinases, metallo-β-lactamases (MBLs), extended-spectrum β-lactamases and AmpCs, were detected phenotypically and/or by PCR followed by DNA sequencing. Transconjugants possessing the blaNDM−1(New Delhi metallo-β-lactamase) underwent further analysis for plasmids, integrons and associated genes. Genetic environment of the carbapenemases were studied by PCR mapping and DNA sequencing. Multivariate logistic regression was used to identify risk factors for sepsis caused by NDM-1-harboring organisms. A. baumannii (72%) was the predominant species followed by A. calcoaceticus (10%), A. lwoffii (6%), A. nosocomialis (3%), A. junni (3%), A. variabilis (3%), A. haemolyticus (2%), and 14TU (2%). Fifty six percent of the isolates were meropenem-resistant. Oxacillinases present were OXA-23-like, OXA-58-like and OXA-51-like, predominately in A. baumannii. NDM-1 was the dominant MBL (22%) across different Acinetobacter spp. Isolates harboring NDM-1 also possessed bla(VIM−2, PER−1, VEB−2, CTX−M−15), armA, aac(6′)Ib, aac(6′)Ib-cr genes. blaNDM−1was organized in a composite transposon between two copies of ISAba125 in the isolates irrespective of the species. Further, OXA-23-like gene and OXA-58-like genes were linked with ISAba1 and ISAba3 respectively. Isolates were clonally diverse. Integrons were variable in sequence but not associated with carbapenem resistance. Most commonly found genes in the 5′ and 3′conserved segment were aminoglycoside resistance genes (aadB, aadA2, aac4′), non-enzymatic chloramphenicol resistance gene (cmlA1g) and ADP-ribosylation genes (arr2, arr3). Outborn neonates had a significantly higher incidence of sepsis due to NDM-1 harboring isolates than

  3. First occurrence of blaOXA-58 in Acinetobacter baumannii isolated from a clinical sample in Southern Brazil

    PubMed Central

    de Souza Gusatti, Carolina; Bertholdo, Lauren Martins; Otton, Letícia Muner; Marchetti, Desirée Padilha; Ferreira, Alessandra Einsfeld; Corção, Gertrudes


    This is the first report of an Acinetobacter baumannii from clinical origin carrying the blaOXA-58 gene in Brazil. The isolate included in this study was from a patient during an outbreak in Porto Alegre, RS, Southern Brazil, in 2007. It was resistant to most of the beta-lactams tested, it has also the blaOXA-65 gene and the ISAbal sequence located upstream to both blaOXA genes detected and it has a MIC of imipenem of 64 μg/mL. PMID:24031824

  4. Outbreak of carbapenem-resistant Acinetobacter baumannii in the intensive care unit: a multi-level strategic management approach.


    Molter, G; Seifert, H; Mandraka, F; Kasper, G; Weidmann, B; Hornei, B; Öhler, M; Schwimmbeck, P; Kröschel, P; Higgins, P G; Reuter, S


    An outbreak of carbapenem-resistant Acinetobacter baumannii (CRAb) occurred in an interdisciplinary intensive care unit, affecting 10 patients. Within hours of recognition of the spread of CRAb an intervention team was instituted for collection of available data, decision-making, communication and monitoring of all interventions performed, including cohorting, temporary stop of admissions, staff education, and enforcement of infection control measures. An area was defined for cohortation of patients colonized with CRAb, with a separate nursing team and a second set of mobile equipment. New transmissions were no longer observed after only four days into the institution of enhanced infection control measures. PMID:26778130

  5. Complete genome sequence of Acinetobacter baumannii XH386 (ST208), a multi-drug resistant bacteria isolated from pediatric hospital in China

    PubMed Central

    Fang, Youhong; Quan, Jingjing; Hua, Xiaoting; Feng, Ye; Li, Xi; Wang, Jianfeng; Ruan, Zhi; Shang, Shiqiang; Yu, Yunsong


    Acinetobacter baumannii is an important bacterium that emerged as a significant nosocomial pathogen worldwide. The rise of A. baumannii was due to its multi-drug resistance (MDR), while it was difficult to treat multi-drug resistant A. baumannii with antibiotics, especially in pediatric patients for the therapeutic options with antibiotics were quite limited in pediatric patients. A. baumannii ST208 was identified as predominant sequence type of carbapenem resistant A. baumannii in the United States and China. As we knew, there was no complete genome sequence reproted for A. baumannii ST208, although several whole genome shotgun sequences had been reported. Here, we sequenced the 4087-kilobase (kb) chromosome and 112-kb plasmid of A. baumannii XH386 (ST208), which was isolated from a pediatric hospital in China. The genome of A. baumannii XH386 contained 3968 protein-coding genes and 94 RNA-only encoding genes. Genomic analysis and Minimum inhibitory concentration assay showed that A. baumannii XH386 was multi-drug resistant strain, which showed resistance to most of antibiotics, except for tigecycline. The data may be accessed via the GenBank accession number CP010779 and CP010780. PMID:26981403

  6. Whole-genome analysis of an extensively drug-resistant clinical isolate of Acinetobacter baumannii AC12: insights into the mechanisms of resistance of an ST195 clone from Malaysia.


    Lean, Soo-Sum; Yeo, Chew Chieng; Suhaili, Zarizal; Thong, Kwai-Lin


    Acinetobacter baumannii has emerged as an important nosocomial pathogen owing to its increasing resistance to most, if not all, antibiotics in clinical use. We recently reported the occurrence of extensively drug-resistant (XDR) A. baumannii isolates in a Malaysian tertiary hospital. The genome of one of these XDR isolates (A. baumannii AC12) was completely sequenced and comparative genome analyses were performed to elucidate the genetic basis of its antimicrobial resistance. The A. baumannii AC12 genome consists of a 3.8 Mbp circular chromosome and an 8731 bp cryptic plasmid, pAC12. It belongs to the ST195 lineage and is most closely related to A. baumannii BJAB0715 as well as other strains of the international clone III (IC-III) group. Two antibiotic resistance islands (RIs), designated AC12-RI1 and AC12-RI2, were found in the AC12 chromosome along with a 7 kb Tn1548::armA island conferring resistance to aminoglycosides and macrolides. The 22.8 kb AC12-RI1 interrupts the comM gene and harbours the carbapenem resistance gene blaOXA-23 flanked by ISAba1 within a Tn2006-like structure. AC12-RI1 also harbours resistance determinants for aminoglycosides, tetracyclines and sulphonamides. The 10.3 kb IS26-flanked AC12-RI2 is a derivative of AbGRI2-1, containing aphA1b and blaTEM genes (conferring aminoglycoside and β-lactam resistance, respectively). The presence of numerous genes mediating resistance to various antibiotics in novel RI structures as well as other genes encoding drug transporters and efflux pumps in A. baumannii AC12 most likely contributed to its XDR characteristics. PMID:25481460

  7. Identifying more epidemic clones during a hospital outbreak of multidrug-resistant Acinetobacter baumannii.


    Domenech de Cellès, Matthieu; Salomon, Jérôme; Marinier, Anne; Lawrence, Christine; Gaillard, Jean-Louis; Herrmann, Jean-Louis; Guillemot, Didier


    Infections caused by multidrug-resistant bacteria are a major concern in hospitals. Current infection-control practices legitimately focus on hygiene and appropriate use of antibiotics. However, little is known about the intrinsic abilities of some bacterial strains to cause outbreaks. They can be measured at a population level by the pathogen's transmission rate, i.e. the rate at which the pathogen is transmitted from colonized hosts to susceptible hosts, or its reproduction number, counting the number of secondary cases per infected/colonized host. We collected data covering a 20-month surveillance period for carriage of multidrug-resistant Acinetobacter baumannii (MDRAB) in a surgery ward. All isolates were subjected to molecular fingerprinting, and a cluster analysis of profiles was performed to identify clonal groups. We then applied stochastic transmission models to infer transmission rates of MDRAB and each MDRAB clone. Molecular fingerprinting indicated that 3 clonal complexes spread in the ward. A first model, not accounting for different clones, quantified the level of in-ward cross-transmission, with an estimated transmission rate of 0.03/day (95% credible interval [0.012-0.049]) and a single-admission reproduction number of 0.61 [0.30-1.02]. The second model, accounting for different clones, suggested an enhanced transmissibility of clone 3 (transmission rate 0.047/day [0.018-0.091], with a single-admission reproduction number of 0.81 [0.30-1.56]). Clones 1 and 2 had comparable transmission rates (respectively, 0.016 [0.001-0.045], 0.014 [0.001-0.045]). The method used is broadly applicable to other nosocomial pathogens, as long as surveillance data and genotyping information are available. Building on these results, more epidemic clones could be identified, and could lead to follow-up studies dissecting the functional basis for variation in transmissibility of MDRAB lineages. PMID:23029226

  8. Structures of the Class D Carbapenemase OXA-24 from Acinetobacter baumannii in Complex with Doripenem

    SciTech Connect

    Schneider, Kyle D.; Ortega, Caleb J.; Renck, Nicholas A.; Bonomo, Robert A.; Powers, Rachel A.; Leonard, David A.


    The emergence of class D {beta}-lactamases with carbapenemase activity presents an enormous challenge to health practitioners, particularly with regard to the treatment of infections caused by Gram-negative pathogens such as Acinetobacter baumannii. Unfortunately, class D {beta}-lactamases with carbapenemase activity are resistant to {beta}-lactamase inhibitors. To better understand the details of the how these enzymes bind and hydrolyze carbapenems, we have determined the structures of two deacylation-deficient variants (K84D and V130D) of the class D carbapenemase OXA-24 with doripenem bound as a covalent acyl-enzyme intermediate. Doripenem adopts essentially the same configuration in both OXA-24 variant structures, but varies significantly when compared to the non-carbapenemase class D member OXA-1/doripenem complex. The alcohol of the 6a hydroxyethyl moiety is directed away from the general base carboxy-K84, with implications for activation of the deacylating water. The tunnel formed by the Y112/M223 bridge in the apo form of OXA-24 is largely unchanged by the binding of doripenem. The presence of this bridge, however, causes the distal pyrrolidine/sulfonamide group to bind in a drastically different conformation compared to doripenem bound to OXA-1. The resulting difference in the position of the side-chain bridge sulfur of doripenem is consistent with the hypothesis that the tautomeric state of the pyrroline ring contributes to the different carbapenem hydrolysis rates of OXA-1 and OXA-24. These findings represent a snapshot of a key step in the catalytic mechanism of an important class D enzyme, and might be useful for the design of novel inhibitors.

  9. Protective Effect of a Synbiotic against Multidrug-Resistant Acinetobacter baumannii in a Murine Infection Model.


    Asahara, Takashi; Takahashi, Akira; Yuki, Norikatsu; Kaji, Rumi; Takahashi, Takuya; Nomoto, Koji


    This study investigated the ability of the probiotic Bifidobacterium breve strain Yakult (BbY) to protect against infection, as well as the potentiation of BbY activity by the synbiotic combination of BbY and prebiotic galactooligosaccharides (GOS). The study employed a mouse model of lethal intestinal multidrug-resistant Acinetobacter baumannii (MDRAb) infection. The endogenous intestinal microbiota was disrupted by the administration of multiple antibiotics, causing the loss of endogenous Bifidobacterium Oral infection of these mice with MDRAb resulted in marked growth of this organism. Additional treatment of the infected mice with a sublethal dose of 5-fluorouracil (5-FU) induced systemic invasion by MDRAb and subsequent animal death. The continuous oral administration of BbY increased the survival rate and inhibited the intestinal growth and invasion by MDRAb in the infection model. Disruptions of the intestinal environment and barrier function in the infected mice were attenuated by BbY. Protection against the MDRAb infection was markedly potentiated by a synbiotic combination of BbY and GOS, although GOS by itself did not provide protection. Negative correlations were observed between intestinal MDRAb and BbY counts or acetic acid levels; positive correlations were observed between acetic acid levels and intestinal epithelium expression of tight-junction-related genes. These results demonstrated that the probiotic and synbiotic markedly potentiated protection against fatal intestinal infection caused by a multidrug-resistant bacterium. Probiotics and synbiotics are presumed to provide protection by compensation for the disrupted indigenous populations, thereby maintaining the intestinal environments and barrier functions otherwise targeted during opportunistic infection by MDRAb. PMID:26953197

  10. Carbapenem-resistant Acinetobacter baumannii acquired before liver transplantation: Impact on recipient outcomes.


    Freire, Maristela Pinheiro; Pierrotti, Ligia Câmera; Oshiro, Isabel Cristina Villela Soares; Bonazzi, Patrícia Rodrigues; Oliveira, Larissa Marques de; Machado, Anna Silva; Van Der Heijden, Inneke Marie; Rossi, Flavia; Costa, Silvia Figueiredo; D'Albuquerque, Luiz Augusto Carneiro; Abdala, Edson


    Infection with carbapenem-resistant Acinetobacter baumannii (CRAB) after liver transplantation (LT) is associated with high mortality. This study aimed to identify risk factors for post-LT CRAB infection, as well as to evaluate the impact of pre-LT CRAB acquisition on the incidence of post-LT CRAB infection. This was a prospective cohort study of all patients undergoing LT at our facility between October 2009 and October 2011. Surveillance cultures (SCs) were collected immediately before LT and weekly thereafter, until discharge. We analyzed 196 patients who were submitted to 222 LTs. CRAB was identified in 105 (53.6%); 24 (22.9%) of these patients were found to have acquired CRAB before LT, and 85 (81.0%) tested positive on SCs. Post-LT CRAB infection occurred in 56 (28.6%), the most common site being the surgical wound. Multivariate analysis showed that the risk factors for developing CRAB infection were prolonged cold ischemia, post-LT dialysis, LT due to fulminant hepatitis, and pre-LT CRAB acquisition with pre-LT CRAB acquisition showing a considerable trend toward significance (P = 0.06). Among the recipients with CRAB infection, 60-day mortality was 46.4%, significantly higher than among those without (P < 0.001). Mortality risk factors were post-LT infection with multidrug-resistant bacteria, LT performed because of fulminant hepatitis, retransplantation, prolonged cold ischemia, longer LT surgical time, and pre-LT CRAB acquisition, the last showing a trend toward significance (P = 0.08). In conclusion, pre-LT CRAB acquisition appears to increase the risk of post-LT CRAB infection, which has a negative impact on recipient survival. Liver Transplantation 22 615-626 2016 AASLD. PMID:26684547

  11. Clonal Diversity of Nosocomial Epidemic Acinetobacter baumannii Strains Isolated in Spain▿

    PubMed Central

    Villalón, Pilar; Valdezate, Sylvia; Medina-Pascual, Maria J.; Rubio, Virginia; Vindel, Ana; Saez-Nieto, Juan A.


    Acinetobacter baumannii is one of the major pathogens involved in nosocomial outbreaks. The clonal diversity of 729 epidemic strains isolated from 19 Spanish hospitals (mainly from intensive care units) was analyzed over an 11-year period. Pulsed-field gel electrophoresis (PFGE) identified 58 PFGE types that were subjected to susceptibility testing, rpoB gene sequencing, and multilocus sequence typing (MLST). All PFGE types were multidrug resistant; colistin was the only agent to which all pathogens were susceptible. The 58 PFGE types were grouped into 16 clones based on their genetic similarity (cutoff of 80%). These clones were distributed into one major cluster (cluster D), three medium clusters (clusters A, B, and C), and three minor clusters (clusters E, F, and G). The rpoB gene sequencing and MLST results reflected a clonal distribution, in agreement with the PFGE results. The MLST sequence types (STs) (and their percent distributions) were as follows: ST-2 (47.5%), ST-3 (5.1%), ST-15 (1.7%), ST-32 (1.7%), ST-79 (13.6%), ST-80 (20.3%), and ST-81 (10.2%). ST-79, ST-80, and ST-81 and the alleles cpn60-26 and recA29 are described for the first time. International clones I, II, and III were represented by ST-81, ST-2, and ST-3, respectively. ST-79 and ST-80 could be novel emerging clones. This work confirms PFGE and MLST to be complementary tools in clonality studies. Here PFGE was able to demonstrate the monoclonal pattern of most outbreaks, the inter- and intrahospital transmission of bacteria, and their endemic persistence in some wards. MLST allowed the temporal evolution and spatial distribution of Spanish clones to be monitored and permitted international comparisons to be made. PMID:21177889

  12. Emergence of Multidrug Resistance and Metallo-beta-lactamase Producing Acinetobacter baumannii Isolated from Patients in Shiraz, Iran

    PubMed Central

    Moghadam, MN; Motamedifar, M; Sarvari, J; Sedigh, Ebrahim-Saraie H; Mousavi, Same M; Moghadam, FN


    Background: Metallo-beta-lactamase (MβL) enzymes production is one of the most important resistance mechanisms against carbapenems in some bacteria including Acinetobacter baumannii. Aims: This study was aimed to determine the antimicrobial susceptibility and the prevalence of MβL among carbapenem-resistant isolates of A. baumannii. Materials and Methods: In this cross-sectional study from October 2012 to April 2013, 98 isolates were identified as A. baumannii using Microgen™ kits and confirmed by molecular method. These isolates were tested for antimicrobial susceptibilities by disk diffusion method according to the Clinical and Laboratory Standards Institute guidelines. Carbapenem-resistant isolates were further detected phenotypically by MβL minimal inhibitory concentration (MIC)-test strips, and subsequently positive MβL isolates were confirmed by polymerase chain reaction (PCR). Results: Overall, 98% (96/98) of A. baumannii isolates were detected as carbapenem-resistant by MIC test. Highest sensitivity to the tested antibiotic with 42.9% (42/98) was observed to colistin. Of 96 carbapenem-resistant isolates, 43 were phenotypically positive for MβL; out of 43 isolates, 37 were confirmed for the presence of MβL genes by PCR. Conclusion: The frequency of drug resistance among the clinical samples of A. baumannii isolated in our study against most of the antibiotics was very high. Moreover, all MβL producing isolates were multidrug resistance. Therefore, systematic surveillance to detect MβL producing bacteria and rational prescription and use of carbapenems could be helpful to prevent the spread of carbapenem resistance. PMID:27398247

  13. Antibiotic susceptibility and molecular epidemiology of Acinetobacter calcoaceticus–baumannii complex strains isolated from a referral hospital in northern Vietnam

    PubMed Central

    Van, Trang Dinh; Dinh, Quynh-Dao; Vu, Phu Dinh; Nguyen, Trung Vu; Pham, Ca Van; Dao, Trinh Tuyet; Phung, Cam Dac; Hoang, Ha Thu Thi; Tang, Nga Thi; Do, Nga Thuy; Nguyen, Kinh Van; Wertheim, Heiman


    Acinetobacter calcoaceticus–baumannii complex is a common cause of hospital-acquired infections (HAIs) globally, remarkable for its high rate of antibiotic resistance, including to carbapenems. There are few data on the resistance of A. baumannii in Vietnam, which are essential for developing evidence-based treatment guidelines for HAIs. Antibiotic susceptibility testing was conducted by VITEK®2, and pulsed-field gel electrophoresis (PFGE) was performed on 66 clinical A. baumannii complex isolates recovered during 2009 at the National Hospital of Tropical Diseases (NHTD), a referral hospital in Hanoi, Vietnam. Basic demographic and clinical data were collected and analysed using descriptive statistics. Most isolates came from lower respiratory tract specimens (59; 89.4%) from intensive care unit (ICU) patients [64/65 (98.5%) with available data] who had been admitted to NHTD for ≥2 days [42/46 (91.3%) with available data]. More than 90% of the isolates were resistant to the tested β-lactamase/β-lactamase inhibitors, cephalosporins, carbapenems, fluoroquinolones and trimethoprim/sulfamethoxazole. Moreover, 25.4% (16/63) were resistant to all tested β-lactams, quinolones and aminoglycosides. All isolates remained sensitive to colistin and 58.7% were susceptible to tigecycline. Of the 66 isolates, 49 could be classified into eight PFGE types (A–H). Every PFGE type, except D, had cluster(s) of three or more isolates with a temporal relationship. In conclusion, these data suggest a significant rise in A. baumannii antibiotic resistance in Vietnam. Clustering within PFGE types supports cross-transmission of A. baumannii within the ICU at NHTD. Increased research and resources in optimising treatment, infection control and antibiotic stewardship are needed. PMID:25540720

  14. Amide side chain amphiphilic polymers disrupt surface established bacterial bio-films and protect mice from chronic Acinetobacter baumannii infection.


    Uppu, Divakara S S M; Samaddar, Sandip; Ghosh, Chandradhish; Paramanandham, Krishnamoorthy; Shome, Bibek R; Haldar, Jayanta


    Bacterial biofilms represent the root-cause of chronic or persistent infections in humans. Gram-negative bacterial infections due to nosocomial and opportunistic pathogens such as Acinetobacter baumannii are more difficult to treat because of their inherent and rapidly acquiring resistance to antibiotics. Due to biofilm formation, A. baumannii has been noted for its apparent ability to survive on artificial surfaces for an extended period of time, therefore allowing it to persist in the hospital environment. Here we report, maleic anhydride based novel cationic polymers appended with amide side chains that disrupt surface established multi-drug resistant A. baumannii biofilms. More importantly, these polymers significantly (p < 0.0001) decrease the bacterial burden in mice with chronic A. baumannii burn wound infection. The polymers also show potent antibacterial efficacy against methicillin resistant Staphylococcus aureus (MRSA), vancomycin resistant Enterococci (VRE) and multi-drug resistant clinical isolates of A. baumannii with minimal toxicity to mammalian cells. We observe that optimal hydrophobicity dependent on the side chain chemical structure of these polymers dictate the selective toxicity to bacteria. Polymers interact with the bacterial cell membranes by causing membrane depolarization, permeabilization and energy depletion. Bacteria develop rapid resistance to erythromycin and colistin whereas no detectable development of resistance occurs against these polymers even after several passages. These results suggest the potential use of these polymeric biomaterials in disinfecting biomedical device surfaces after the infection has become established and also for the topical treatment of chronic bacterial infections. PMID:26454051

  15. 5-Episinuleptolide Decreases the Expression of the Extracellular Matrix in Early Biofilm Formation of Multi-Drug Resistant Acinetobacter baumannii

    PubMed Central

    Tseng, Sung-Pin; Hung, Wei-Chun; Huang, Chiung-Yao; Lin, Yin-Shiou; Chan, Min-Yu; Lu, Po-Liang; Lin, Lin; Sheu, Jyh-Horng


    Nosocomial infections and increasing multi-drug resistance caused by Acinetobacter baumannii have been recognized as emerging problems worldwide. Moreover, A. baumannii is able to colonize various abiotic materials and medical devices, making it difficult to eradicate and leading to ventilator-associated pneumonia, and bacteremia. Development of novel molecules that inhibit bacterial biofilm formation may be an alternative prophylactic option for the treatment of biofilm-associated A. baumannii infections. Marine environments, which are unlike their terrestrial counterparts, harbor an abundant biodiversity of marine organisms that produce novel bioactive natural products with pharmaceutical potential. In this study, we identified 5-episinuleptolide, which was isolated from Sinularia leptoclados, as an inhibitor of biofilm formation in ATCC 19606 and three multi-drug resistant A. baumannii strains. In addition, the anti-biofilm activities of 5-episinuleptolide were observed for Gram-negative bacteria but not for Gram-positive bacteria, indicating that the inhibition mechanism of 5-episinuleptolide is effective against only Gram-negative bacteria. The mechanism of biofilm inhibition was demonstrated to correlate to decreased gene expression from the pgaABCD locus, which encodes the extracellular polysaccharide poly-β-(1,6)-N-acetylglucosamine (PNAG). Scanning electron microscopy (SEM) indicated that extracellular matrix of the biofilm was dramatically decreased by treatment with 5-episinuleptolide. Our study showed potentially synergistic activity of combination therapy with 5-episinuleptolide and levofloxacin against biofilm formation and biofilm cells. These data indicate that inhibition of biofilm formation via 5-episinuleptolide may represent another prophylactic option for solving the persistent problem of biofilm-associated A. baumannii infections. PMID:27483290

  16. In vitro activity of curcumin in combination with epigallocatechin gallate (EGCG) versus multidrug-resistant Acinetobacter baumannii

    PubMed Central


    Background Acinetobacter baumannii is an opportunistic human pathogen often associated with life-threatening infections in the immunocompromised and the critically ill. Strains are often multidrug-resistant (MDR) and due to the lack of new synthetic antimicrobials in development for treatment, attention is increasingly focused on natural compounds either as stand-alone or adjunctive agents. Curcumin (CCM) is a natural polyphenol found in turmeric and isolated from the plant, Curcuma longa. Curcumin has been found to possess many biological properties, including antibacterial activity. In this study the antimicrobial activity of CCM and synergistic effects with epigallocatechin gallate (EGCG) against multidrug-resistant strains of A. baumannii were investigated and assessed via checkerboard and time-kill assays. Results The MIC of CCM was >256 μg/mL against all strains of A. baumannii whilst those for EGCG ranged from 128-1024 μg/mL. In checkerboard studies synergy was observed against 5/9 isolates, with an additive effect noted in the remaining 4. The addition of EGCG reduced the MIC of CCM by 3- to 7-fold, with the greatest interaction resulting in a CCM MIC of 4 μg/mL. Time-kill curves indicated that a CCM-EGCG (1:8 and 1:4) combination was bactericidal with a 4 to 5-log reduction in viable counts after 24 h compared to the most effective polyphenol alone. Conclusions This study demonstrates that despite little antibacterial activity alone, CCM activity is greatly enhanced in the presence of EGCG resulting in antibacterial activity against MDR A. baumannii. The combination may have a potential use in medicine as a topical agent to prevent or treat A. baumannii infections. PMID:24969489

  17. Use of a new mouse model of Acinetobacter baumannii pneumonia to evaluate the postantibiotic effect of imipenem.

    PubMed Central

    Joly-Guillou, M L; Wolff, M; Pocidalo, J J; Walker, F; Carbon, C


    Acinetobacter baumannii is responsible for severe nosocomial pneumonia. To evaluate new therapeutic regimens for infections due to multiresistant strains and to study the pharmacodynamic properties of various antibiotics, we developed an experimental mouse model of acute A. baumannii pneumonia. C3H/HeN mice rendered transiently neutropenic were infected intratracheally with 5 x 10(6) CFU of A. baumannii. The mean log10 CFU/g of lung homogenate (+/- the standard deviation) were 9 +/- 0.9, 9.4 +/- 0.8, 8.6 +/- 1.2, and 7.7 +/- 1.4 on days 1, 2, 3, and 4 postinoculation. The lung pathology was characterized by pneumonitis with edema and a patchy distribution of hemorrhages in the peribronchovascular spaces of both lungs. Abscesses formed on days 3 and 4. Four days after inoculation, subacute pneumonitis characterized by alveolar macrophage proliferation and areas of fibrosis was observed. The cumulative mortality on day 4 was 85%. This new model was used to study the effects of 1, 2, or 3 50-mg/kg doses of imipenem. Imipenem concentrations in lungs were above the MIC for 2 h after the last dose. The in vivo postantibiotic effect (PAE) was determined during the 9-h period following the last dose; it decreased in duration with the number of doses: 9.6, 6.4, and 4 h after 1, 2, and 3 50-mg/kg doses, respectively. In contrast, no in vitro PAE was observed. This model offers a reproducible acute course of A. baumannii pneumonia. The presence of a prolonged in vivo PAE supports the currently recommended dosing intervals of imipenem for the treatment of human infections due to A. baumannii, i.e., 15 mg/kg three times a day. PMID:9021190

  18. 5-Episinuleptolide Decreases the Expression of the Extracellular Matrix in Early Biofilm Formation of Multi-Drug Resistant Acinetobacter baumannii.


    Tseng, Sung-Pin; Hung, Wei-Chun; Huang, Chiung-Yao; Lin, Yin-Shiou; Chan, Min-Yu; Lu, Po-Liang; Lin, Lin; Sheu, Jyh-Horng


    Nosocomial infections and increasing multi-drug resistance caused by Acinetobacter baumannii have been recognized as emerging problems worldwide. Moreover, A. baumannii is able to colonize various abiotic materials and medical devices, making it difficult to eradicate and leading to ventilator-associated pneumonia, and bacteremia. Development of novel molecules that inhibit bacterial biofilm formation may be an alternative prophylactic option for the treatment of biofilm-associated A. baumannii infections. Marine environments, which are unlike their terrestrial counterparts, harbor an abundant biodiversity of marine organisms that produce novel bioactive natural products with pharmaceutical potential. In this study, we identified 5-episinuleptolide, which was isolated from Sinularia leptoclados, as an inhibitor of biofilm formation in ATCC 19606 and three multi-drug resistant A. baumannii strains. In addition, the anti-biofilm activities of 5-episinuleptolide were observed for Gram-negative bacteria but not for Gram-positive bacteria, indicating that the inhibition mechanism of 5-episinuleptolide is effective against only Gram-negative bacteria. The mechanism of biofilm inhibition was demonstrated to correlate to decreased gene expression from the pgaABCD locus, which encodes the extracellular polysaccharide poly-β-(1,6)-N-acetylglucosamine (PNAG). Scanning electron microscopy (SEM) indicated that extracellular matrix of the biofilm was dramatically decreased by treatment with 5-episinuleptolide. Our study showed potentially synergistic activity of combination therapy with 5-episinuleptolide and levofloxacin against biofilm formation and biofilm cells. These data indicate that inhibition of biofilm formation via 5-episinuleptolide may represent another prophylactic option for solving the persistent problem of biofilm-associated A. baumannii infections. PMID:27483290

  19. Draft Genome Sequence of a Multidrug-Resistant Klebsiella pneumoniae Carbapenemase-Producing Acinetobacter baumannii Sequence Type 2 Isolate from Puerto Rico.


    Martínez, Teresa; Ropelewski, Alexander J; González-Mendez, Ricardo; Vázquez, Guillermo J; Robledo, Iraida E


    We report here the draft genome sequence of Acinetobacter baumannii strain M3AC14-8, sequence type 2 (ST2), carrying a chromosomally carried blaKPC-2 gene. The draft genome consists of a total length of 4.11 Mbp and a G+C content of 39.25%. PMID:27540056

  20. Draft Genome Sequence of a Multidrug-Resistant Klebsiella pneumoniae Carbapenemase-Producing Acinetobacter baumannii Sequence Type 2 Isolate from Puerto Rico

    PubMed Central

    Martínez, Teresa; Ropelewski, Alexander J.; González-Mendez, Ricardo; Vázquez, Guillermo J.


    We report here the draft genome sequence of Acinetobacter baumannii strain M3AC14-8, sequence type 2 (ST2), carrying a chromosomally carried blaKPC-2 gene. The draft genome consists of a total length of 4.11 Mbp and a G+C content of 39.25%. PMID:27540056

  1. Investigation and management of multidrug-resistant Acinetobacter baumannii spread in a French medical intensive care unit: one outbreak may hide another.


    Bourigault, Céline; Corvec, Stéphane; Bretonnière, Cédric; Guillouzouic, Aurélie; Crémet, Lise; Marraillac, Julie; Juvin, Marie-Emmanuelle; Bemer, Pascale; Le Gallou, Florence; Reynaud, Alain; Boutoille, David; Villers, Daniel; Lepelletier, Didier


    An outbreak in a medical intensive care unit was due to an OXA-23-producing Acinetobacter baumannii strain imported from a repatriate hospitalized in Singapore. This outbreak revealed another multidrug resistant epidemic strain that had been present in the hospital for 2 years. Both outbreaks were controlled after 9 months of an extensive infection control program. PMID:23266385

  2. Presence of high-risk clones of OXA-23-producing Acinetobacter baumannii (ST79) and SPM-1-producing Pseudomonas aeruginosa (ST277) in environmental water samples in Brazil.


    Turano, Helena; Gomes, Fernando; Medeiros, Micheli; Oliveira, Silvane; Fontes, Lívia C; Sato, Maria I Z; Lincopan, Nilton


    This study reports the presence of hospital-associated high-risk lineages of OXA-23-producing ST79 Acinetobacter baumannii and SPM-1-producing ST277 Pseudomonas aeruginosa in urban rivers in Brazil. These findings indicate that urban rivers can act as reservoirs of clinically important multidrug-resistant bacteria, which constitute a potential risk to human and animal health. PMID:27342783

  3. Genotypic and Phenotypic Correlations of Multidrug-Resistant Acinetobacter baumannii-A. calcoaceticus Complex Strains Isolated from Patients at the National Naval Medical Center

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Acinetobacter baumannii-calcoaceticus complex (ABC) infections have complicated the care of U.S. combat casualties. In this study, 102 ABC isolates from wounded soldiers treated at National Naval Medical Center (NNMC) were characterized by phenotype and genotype to identify clones in this population...

  4. Microbicides Alter the Expression and Function of RND-Type Efflux Pump AdeABC in Biofilm-Associated Cells of Acinetobacter baumannii Clinical Isolates.


    Krishnamoorthy, Suvarna; Shah, Bhavikkumar P; Lee, Hiu Ham; Martinez, Luis R


    Acinetobacter baumannii is a Gram-negative bacterium that causes nosocomial infections worldwide. This microbe's propensity to form biofilms allows it to persist and to survive on clinical abiotic surfaces for long periods. In fact, A. baumannii biofilm formation and its multidrug-resistant nature severely compromise our capacity to care for patients in hospital environments. In contrast, microbicides such as cetrimide (CT) and chlorhexidine (CHX) play important roles in the prevention and treatment of infections. We assessed the efficacy of CT and CHX, either alone or in combination, in eradicating A. baumannii biofilms formed by clinical isolates, by using stainless steel washers to mimic hard abiotic surfaces found in hospital settings. We demonstrated that increasing amounts of each microbicide, alone or in combination, were able to damage and to reduce the viability of A. baumannii biofilms efficaciously. Interestingly, the adeB gene of the resistance-nodulation-cell division (RND) family is predominantly associated with acquired resistance to antimicrobials in A. baumannii. We showed that CT and CHX adversely modified the expression and function of the RND-type efflux pump AdeABC in biofilm-associated A. baumannii cells. Furthermore, we established that these microbicides decreased the negative charges on A. baumannii cell membranes, causing dysregulation of the efflux pump and leading to cell death. Our findings suggest that CT and CHX, alone or in combination, can be used efficaciously for eradication of A. baumannii from hospital surfaces, in order to reduce infections caused by this nosocomial agent. PMID:26459900

  5. OXA-23 carbapenemase in multidrug-resistant Acinetobacter baumannii ST2 type: first identification in L'Aquila Hospital (Italy).


    Perilli, Mariagrazia; Sabatini, Alessia; Pontieri, Eugenio; Celenza, Giuseppe; Segatore, Bernardetta; Bottoni, Carlo; Bellio, Pierangelo; Mancini, Alisia; Marcoccia, Francesca; Brisdelli, Fabrizia; Amicosante, Gianfranco


    In this study 114 extensively drug-resistant Acinetobacter baumannii clinical isolates were characterized. The strains were collected at L'Aquila Hospital after the earthquake in L'Aquila city (central Italy) on the 6th of April 2009. The genes blaOXA-23 and blaOXA-51 were detected in all clinical isolates analyzed, whereas blaTEM-1 allele was detected in 56/114 isolates. The blaOXA-23 gene is located downstream the ISAba region and is under control of a strong promoter. On 42/80 A. baumannii the presence of two class 1 integrons was ascertained on chromosomal DNA. Variable regions show different gene array: (1) aadB and aadA2, (2) aacA4, aac(6')-Ib-cr, and aadA1. Macrorestriction analysis using ApaI restriction endonuclease identifies three clusters (A, B, and C) according to pulsed-field gel electrophoresis profiles. All isolates analyzed belong to the clone A. baumannii sequence type 2. PMID:25275951

  6. Holarrhena antidysenterica Extract and Its Steroidal Alkaloid, Conessine, as Resistance-Modifying Agents Against Extensively Drug-Resistant Acinetobacter baumannii.


    Siriyong, Thanyaluck; Chusri, Sasitorn; Srimanote, Potjanee; Tipmanee, Varomyalin; Voravuthikunchai, Supayang Piyawan


    Emergence and spread of antibiotic-resistant Acinetobacter baumannii have become a major public health concern. This study was designed to investigate the efficacy of Holarrhena antidysenterica extract and its major steroidal alkaloid conessine as resistance-modifying agents (RMAs) on the susceptibility of A. baumannii to novobiocin and rifampicin. A significant synergistic activity of both the extract and conessine in combination with either novobiocin or rifampicin with fractional inhibitory concentration index ≤0.5 was demonstrated. Fluorescent dyes and different efflux pump inhibitors were used to further investigate the synergism. Increase in the uptake of 1-N-phenylnaphthylamine in the bacterial cells treated with the extract and conessine was not observed indicating that both substances did not act as permeabilizers. With regard to efflux pump inhibition, no accumulation in ethidium bromide (EtBr) was noticed suggesting that the AdeABC pump was not involved. In contrast, accumulation in Pyronin Y was significantly increased (p < 0.05) demonstrating that the synergism was due to interference with the AdeIJK pump. Study on frequencies of the spontaneous mutational resistance to the extract in combination with antibiotics demonstrated attenuation in drug-resistant organisms. Thus, H. antidysenterica extract and conessine as RMAs may offer a combinatory therapy to restore antibiotic susceptibility in the extensively drug-resistant A. baumannii. PMID:26745443

  7. Dissemination of multiple carbapenem-resistant clones of Acinetobacter baumannii in the Eastern District of Saudi Arabia

    PubMed Central

    Al-Sultan, Abdulrahman A.; Evans, Benjamin A.; Aboulmagd, Elsayed; Al-Qahtani, Ahmed A.; Bohol, Marie Fe F.; Al-Ahdal, Mohammed N.; Opazo, Andres F.; Amyes, Sebastian G. B.


    It has previously been shown that carbapenem-resistant Acinetobacter baumannii are frequently detected in Saudi Arabia. The present study aimed to identify the epidemiology and distribution of antibiotic resistance determinants in these bacteria. A total of 83 A. baumannii isolates were typed by pulsed-field gel electrophoresis (PFGE), and screened by PCR for carbapenemase genes and insertion sequences. Antibiotic sensitivity to imipenem, meropenem, tigecycline, and colistin were determined. Eight different PFGE groups were identified, and were spread across multiple hospitals. Many of the PFGE groups contained isolates belonging to World-wide clone 2. Carbapenem resistance or intermediate resistance was detected in 69% of isolates. The blaVIM gene was detected in 94% of isolates, while blaOXA–23–like genes were detected in 58%. The data demonstrate the co-existence and wide distribution of a number of clones of carbapenem-resistant A. baumannii carrying multiple carbapenem-resistance determinants within hospitals in the Eastern Region of Saudi Arabia. PMID:26191044

  8. Mutations Decreasing Intrinsic β-Lactam Resistance Are Linked to Cell Division in the Nosocomial Pathogen Acinetobacter baumannii.


    Knight, Daniel; Dimitrova, Daniela D; Rudin, Susan D; Bonomo, Robert A; Rather, Philip N


    Transposon mutagenesis was used to identify novel determinants of intrinsic β-lactam resistance in Acinetobacter baumannii An EZ-Tn5 transposon insertion in a gene corresponding to the A1S_0225 sequence resulted in a 4-fold decrease in resistance to ampicillin, cefotaxime, imipenem, and ceftriaxone but did not alter resistance to other classes of antibiotics. Based on this phenotype, the gene was designated blhA (β-lactam hypersusceptibility). The blhA::EZ-Tn5 mutation conferred a similar phenotype in A. baumannii strain ATCC 17978. The wild-type blhA gene complemented the blhA::EZTn5 insertion and restored β-lactam resistance levels back to wild-type levels. The blhA mutation also increased β-lactam susceptibility in an adeB adeJ double mutant, indicating that the blhA mutation acted independently of these efflux systems to mediate susceptibility. In addition, mRNA levels for the blaOXA and blaADC β-lactamase genes were not altered by the blhA mutation. The blhA mutation resulted in a prominent cell division and morphological defect, with cells exhibiting a highly elongated phenotype, combined with large bulges in some cells. The blhA gene is unique to Acinetobacter and likely represents a novel gene involved in cell division. Three additional mutations, in zipA, zapA, and ftsK, each of which encode predicted cell division proteins, also conferred increased β-lactam susceptibility, indicating a common link between cell division and intrinsic β-lactam resistance in A. baumannii. PMID:27067318

  9. Diversity in the Major Polysaccharide Antigen of Acinetobacter Baumannii Assessed by DNA Sequencing, and Development of a Molecular Serotyping Scheme

    PubMed Central

    Dijkshoorn, Lenie; Wang, Lei; Reeves, Peter R.


    We have sequenced the gene clusters for type strains of the Acinetobacter baumannii serotyping scheme developed in the 1990s, and used the sequences to better understand diversity in surface polysaccharides of the genus. We obtained genome sequences for 27 available serovar type strains, and identified 25 polysaccharide gene cluster sequences. There are structures for 12 of these polysaccharides, and in general the genes present are appropriate to the structure where known. This greatly facilitates interpretation. We also find 53 different glycosyltransferase genes, and for 7 strains can provisionally allocate specific genes to all linkages. We identified primers that will distinguish the 25 sequence forms by PCR or microarray, or alternatively the genes can be used to determine serotype by “molecular serology”. We applied the latter to 190 Acinetobacter genome-derived gene-clusters, and found 76 that have one of the 25 gene-cluster forms. We also found novel gene clusters and added 52 new gene-cluster sequence forms with different wzy genes and different gene contents. Altogether, the strains that have one of the original 25 sequence forms include 98 A. baumannii (24 from our strains) and 5 A. nosocomialis (3 from our strains), whereas 32 genomes from 12 species other than A. baumannii or A. nosocomialis, all have new sequence forms. One of the 25 serovar type sequences is found to be in European clone I (EC I), 2 are in EC II but none in EC III. The public genome strains add an additional 52 new sequence forms, and also bring the number found in EC I to 5, in EC II to 9 and in EC III to 2. PMID:23922982

  10. Spread of carbapenem-resistant international clones of Acinetobacter baumannii in Turkey and Azerbaijan: a collaborative study.


    Ahmed, S S; Alp, E; Ulu-Kilic, A; Dinc, G; Aktas, Z; Ada, B; Bagirova, F; Baran, I; Ersoy, Y; Esen, S; Guven, T G; Hopman, J; Hosoglu, S; Koksal, F; Parlak, E; Yalcin, A N; Yilmaz, G; Voss, A; Melchers, W


    Epidemic clones of Acinetobacter baumannii, described as European clones I, II, and III, are associated with hospital epidemics throughout the world. We aimed to determine the molecular characteristics and genetic diversity between European clones I, II, and III from Turkey and Azerbaijan. In this study, a total of 112 bloodstream isolates of carbapenem-resistant Acinetobacter spp. were collected from 11 hospitals across Turkey and Azerbaijan. The identification of Acinetobacter spp. using conventional and sensitivity tests was performed by standard criteria. Multiplex polymerase chain reaction (PCR) was used to detect OXA carbapenemase-encoding genes (bla OXA-23-like, bla OXA-24-like, bla OXA-51-like, and bla OXA-58-like). Pulsed-field gel electrophoresis (PFGE) typing was used to investigate genetic diversity. The bla OXA-51-like gene was present in all 112 isolates, 75 (67 %) carried bla OXA-23-like, 7 (6.2 %) carried bla OXA-58-like genes, and 5 (4.5 %) carried bla OXA-24-like genes. With a 90 % similarity cut-off value, 15 clones and eight unique isolates were identified. The largest clone was cluster D, with six subtypes. Isolates from clusters D and I were widely spread in seven different geographical regions throughout Turkey. However, F cluster was found in the northern and eastern regions of Turkey. EU clone I was grouped within J cluster with three isolates found in Antalya, Istanbul, and Erzurum. EU clone II was grouped in the U cluster with 15 isolates and found in Kayseri and Diyarbakır. The bla OXA-24-like gene in carbapenemases was identified rarely in Turkey and has been reported for the first time from Azerbaijan. Furthermore, this is the first multicenter study in Turkey and Azerbaijan to identify several major clusters belonging to European clones I and II of A. baumannii. PMID:27259712

  11. Low-Frequency Ultrasound Enhances Antimicrobial Activity of Colistin-Vancomycin Combination against Pan-Resistant Biofilm of Acinetobacter baumannii.


    Liu, Xu; Yin, Hong; Weng, Chun-Xiao; Cai, Yun


    Acinetobacter baumannii biofilms in catheters are very difficult to treat. Low-frequency ultrasound (LFU) may improve bactericidal or bacteriostatic activity. However, no previous studies have been reported on its efficacy against pan-resistant biofilms of A. baumannii. This study was designed to investigate whether LFU can enhance the activity of colistin, vancomycin and colistin-vancomycin combinations against pan-resistant biofilms of A. baumannii. The efficacy of colistin combinations was determined using the fractional inhibitory concentration index (FICI). The antibacterial effect was determined from bacteria counts in biofilms and the establishment of 24-h time-kill curves. A significantly synergistic effect was detected between colistin and vancomycin (FICI <0.05). We found that although application of LFU (40 kHz, 600 mW/cm(2), 30 min, duty cycle 1:9) alone or in combination with a single agent failed to significantly reduce bacteria counts in biofilms, it apparently enhanced the antibacterial effectiveness of combinations of these agents. Moreover, higher concentrations of colistin in the combination treatments resulted in a better ultrasound-enhanced antibacterial effect. In 24-h time-kill curves, the combination of colistin (8 μg/mL) plus vancomycin (4 μg/mL) with LFU caused a significant reduction in bacteria counts in biofilms after 8 h and a continuing decline until 24 h. Bacterial counts were reduced by 3.77 log(CFU/mL) by LFU plus combinations, compared with combinations without LFU at 24 h. Our results indicate that LFU in combination with colistin plus vancomycin may be useful in treating pan-resistant A. baumannii infections. PMID:27131840

  12. Contribution of Efflux Pumps, Porins, and β-Lactamases to Multidrug Resistance in Clinical Isolates of Acinetobacter baumannii

    PubMed Central

    Rumbo, C.; Gato, E.; López, M.; Ruiz de Alegría, C.; Fernández-Cuenca, F.; Martínez-Martínez, L.; Vila, J.; Pachón, J.; Cisneros, J. M.; Rodríguez-Baño, J.; Pascual, A.


    We investigated the mechanisms of resistance to carbapenems, aminoglycosides, glycylcyclines, tetracyclines, and quinolones in 90 multiresistant clinical strains of Acinetobacter baumannii isolated from two genetically unrelated A. baumannii clones: clone PFGE-ROC-1 (53 strains producing the OXA-58 β-lactamase enzyme and 18 strains with the OXA-24 β-lactamase) and clone PFGE-HUI-1 (19 strains susceptible to carbapenems). We used real-time reverse transcriptase PCR to correlate antimicrobial resistance (MICs) with expression of genes encoding chromosomal β-lactamases (AmpC and OXA-51), porins (OmpA, CarO, Omp33, Dcap-like, OprB, Omp25, OprC, OprD, and OmpW), and proteins integral to six efflux systems (AdeABC, AdeIJK, AdeFGH, CraA, AbeM, and AmvA). Overexpression of the AdeABC system (level of expression relative to that by A. baumannii ATCC 17978, 30- to 45-fold) was significantly associated with resistance to tigecycline, minocycline, and gentamicin and other biological functions. However, hyperexpression of the AdeIJK efflux pump (level of expression relative to that by A. baumannii ATCC 17978, 8- to 10-fold) was significantly associated only with resistance to tigecycline and minocycline (to which the TetB efflux system also contributed). TetB and TetA(39) efflux pumps were detected in clinical strains and were associated with resistance to tetracyclines and doxycycline. The absence of the AdeABC system and the lack of expression of other mechanisms suggest that tigecycline-resistant strains of the PFGE-HUI-1 clone may be associated with a novel resistance-nodulation-cell efflux pump (decreased MICs in the presence of the inhibitor Phe-Arg β-naphthylamide dihydrochloride) and the TetA(39) system. PMID:23939894

  13. Effects of Saline, an Ambient Acidic Environment, and Sodium Salicylate on OXA-Mediated Carbapenem Resistance in Acinetobacter baumannii.


    Zander, Esther; Seifert, Harald; Higgins, Paul G


    Different physiological conditions, such as NaCl, low pH, and sodium salicylate, have been shown to affect antibiotic resistance determinants in Acinetobacter baumannii isolates. Therefore, the aim of this study was to investigate the effects of NaCl, sodium salicylate, and low pH on the susceptibility of A. baumannii to carbapenem. We cloned genes encoding oxacillinases (OXA) of different subclasses, with their associated promoters, from carbapenem-resistant A. baumannii isolates into the same vector and transferred them to the A. baumannii reference strains ATCC 19606 and ATCC 17978. Carbapenem MICs were determined at least in triplicate by agar dilution under standard conditions, as well as in the presence of 200 mM NaCl or 16 mM sodium salicylate, or at pH 5.8. OXA-58-like gene expression was determined by reverse transcription-quantitative PCR (qRT-PCR). Under some experimental conditions, significant MIC reductions were shown for some transformants but not for others. Only in one instance were all transformants harboring the same OXA affected by the same condition: at pH 5.8, the imipenem and meropenem MICs for strains expressing OXA-58-like enzymes decreased from a resistant level (32 to 64 mg/liter) to an intermediate-susceptible level (8 mg/liter). However, blaOXA-58-like gene expression remained the same. MICs for both wild-type reference strains were not affected by the conditions tested. Our results indicate that the effects of the experimental conditions tested on OXA in vivo are mostly strain dependent. MICs were not reduced to wild-type levels, suggesting that the conditions tested do not lead to complete OXA inhibition in the bacterial cell. PMID:27001819

  14. Rapid Determination of Colistin Resistance in Clinical Strains of Acinetobacter baumannii by Use of the Micromax Assay

    PubMed Central

    Tamayo, Maria; Santiso, Rebeca; Otero, Fátima; Bou, Germán; Lepe, José Antonio; McConnell, Michael J.; Cisneros, José Miguel; Gosálvez, Jaime


    Colistin is an old antibiotic which has been used as a therapeutic option for carbapenem- and multidrug-resistant Gram-negative bacteria, like Acinetobacter baumannii. This pathogen produces life-threatening infections, mainly in patients admitted to intensive care units. Rapid detection of resistance to colistin may improve patient outcomes and prevent the spread of resistance. For this purpose, Micromax technology was evaluated in four isogenic A. baumannii strains with known mechanisms of resistance to colistin and in 66 isolates (50 susceptible and 16 resistant). Two parameters were determined, DNA fragmentation and cell wall damage. To assess DNA fragmentation, cells trapped in a microgel were incubated with a lysing solution to remove the cell wall, and the released nucleoids were visualized under fluorescence microscopy. Fragmented DNA was observed as spots that diffuse from the nucleoid. To assess cell wall integrity, cells were incubated with a lysis solution which removes only weakened cell walls, resulting in nucleoid release exclusively in affected cells. A dose-response relationship was demonstrated between colistin concentrations and the percentages of bacteria with DNA fragmentation and cell wall damage, antibiotic effects that were delayed and less frequent in resistant strains. Receiver operating characteristic (ROC) curves demonstrated that both DNA fragmentation and cell wall damage were excellent parameters for identifying resistant strains. Obtaining ≤11% of bacteria with cell wall damage after incubation with 0.5 μg/ml colistin identified resistant strains of A. baumannii with 100% sensitivity and 96% specificity. Results were obtained in 3 h 30 min. This is a simple, rapid, and accurate assay for detecting colistin resistance in A. baumannii, with strong potential value in critical clinical situations. PMID:23985913

  15. Cloning and expression of quorum sensing N-acyl-homoserine synthase (LuxI) gene detected in Acinetobacter baumannii

    PubMed Central

    Modarresi, Farzan; Azizi, Omid; Shakibaie, Mohammad Reza; Motamedifar, Mohammad; Mansouri, Shahla


    Background and Objectives: In present study we aimed to clone the luxI gene encoding N-acyl-homoserine synthase detected in clinical isolates of Acinetobacter baumannii and study its expression in Escherichia coli transformants. Materials and Methods: Four A. baumannii hospital strains which demonstrated strong biofilm activity were selected in this investigation. The presence of luxI gene was detected using PCR technique. Purified PCR product DNA was initially cloned into pTG19 and transformed to E. coli DH5α. The gene was then recovered from agarose gel and ligated by T4 DNA ligase into pET28a expression vector using NdeI and XhoI enzymes. pET28a + luxI was transformed into E. coli BL21 (DE3). The luxI putative gene was further detected in the transformants by colony PCR. Expression of the luxI gene in the recombinant E. coli BL21 cells was studied by quantitative real time PCR (qRT-PCR) and the presence of N-acylhomoserine lactone (AHL) was checked by colorimetric assay and Fourier Transform Infra-Red (FT-IR) spectroscopy. Results: We successfully cloned AHL gene from A. baumannii strain 23 to pET28a expression vector. There was four fold increases in expression of luxI in the transformants (P ≤ 0.05). It was found that, strain 23 and the transformants showed highest amount of AHL activity (OD = 1.524). The FT-IR analysis indicated stretching C=O bond of the lactone ring and primary amides (N=H) at 1764.69 cm−1 and 1659.23 cm−1 respectively. Conclusion: From above results we concluded that, luxI in A. baumannii is indeed responsible for AHL production and not regulation and pET28a vector allows efficient AHL expression in E. coli BL21 transformants. PMID:27307980

  16. Effect of Ethanol on Differential Protein Production and Expression of Potential Virulence Functions in the Opportunistic Pathogen Acinetobacter baumannii

    PubMed Central

    Nwugo, Chika C.; Arivett, Brock A.; Zimbler, Daniel L.; Gaddy, Jennifer A.; Richards, Ashley M.; Actis, Luis A.


    Acinetobacter baumannii persists in the medical environment and causes severe human nosocomial infections. Previous studies showed that low-level ethanol exposure increases the virulence of A. baumannii ATCC 17978. To better understand the mechanisms involved in this response, 2-D gel electrophoresis combined with mass spectrometry was used to investigate differential protein production in bacteria cultured in the presence or absence of ethanol. This approach showed that the presence of ethanol significantly induces and represses the production of 22 and 12 proteins, respectively. Although over 25% of the ethanol-induced proteins were stress-response related, the overall bacterial viability was uncompromised when cultured under these conditions. Production of proteins involved in lipid and carbohydrate anabolism was increased in the presence of ethanol, a response that correlates with increased carbohydrate biofilm content, enhanced biofilm formation on abiotic surfaces and decrease bacterial motility on semi-solid surfaces. The presence of ethanol also induced the acidification of bacterial cultures and the production of indole-3-acetic acid (IAA), a ubiquitous plant hormone that signals bacterial stress-tolerance and promotes plant-bacteria interactions. These responses could be responsible for the significantly enhanced virulence of A. baumannii ATCC 17978 cells cultured in the presence of ethanol when tested with the Galleria mellonella experimental infection model. Taken together, these observations provide new insights into the effect of ethanol in bacterial virulence. This alcohol predisposes the human host to infections by A. baumannii and could favor the survival and adaptation of this pathogen to medical settings and adverse host environments. PMID:23284824

  17. Association of blaOXA-23 and bap with the persistence of Acinetobacter baumannii within a major healthcare system

    PubMed Central

    Luo, Ting L.; Rickard, Alexander H.; Srinivasan, Usha; Kaye, Keith S.; Foxman, Betsy


    Objectives: Acinetobacter baumannii is an emerging opportunistic nosocomial pathogen. Two factors that may enhance persistence in healthcare settings are antimicrobial resistance and biofilm-forming ability. The aim of this work was to determine whether A. baumannii isolates that persist in healthcare settings (endemic), can be differentiated from sporadic isolates based upon their ability to resist antibiotics and their biofilm-forming capability. Methods: Two hundred and ninety A. baumannii isolates were isolated over 17 months in the Detroit Medical Center (DMC). The isolates were genotyped using repetitive extragenic palindromic-PCR (REP-PCR). REP-types appearing greater than 10 times during active surveillance were considered endemic. The in vitro biofilm-forming ability and antibiotic resistance profile of each isolate were evaluated. Isolates were tested for the presence of two genetic markers—one implicated in biofilm formation (bap) and the other in antibiotic resistance (blaOXA-23). Results: Of the 290 isolates evaluated, 84% carried bap and 36% carried blaOXA-23. Five unique REP-PCR banding-types were detected >10 times (endemic) and constituted 58% of the 290 isolates. These five endemic REP-PCR types were 5.1 times more likely than sporadic isolates to carry both bap and blaOXA-23. Furthermore, endemic isolates were resistant to 3 more antibiotic classes, on average, than sporadic isolates and four of the five endemic REP-PCR types formed denser biofilms in vitro than sporadic isolates. Conclusions: Endemic A. baumannii isolates are more likely than sporadic isolates to possess factors that increase virulence and enhance survival within a large healthcare system. PMID:25814985

  18. Contribution of efflux pumps, porins, and β-lactamases to multidrug resistance in clinical isolates of Acinetobacter baumannii.


    Rumbo, C; Gato, E; López, M; Ruiz de Alegría, C; Fernández-Cuenca, F; Martínez-Martínez, L; Vila, J; Pachón, J; Cisneros, J M; Rodríguez-Baño, J; Pascual, A; Bou, G; Tomás, M


    We investigated the mechanisms of resistance to carbapenems, aminoglycosides, glycylcyclines, tetracyclines, and quinolones in 90 multiresistant clinical strains of Acinetobacter baumannii isolated from two genetically unrelated A. baumannii clones: clone PFGE-ROC-1 (53 strains producing the OXA-58 β-lactamase enzyme and 18 strains with the OXA-24 β-lactamase) and clone PFGE-HUI-1 (19 strains susceptible to carbapenems). We used real-time reverse transcriptase PCR to correlate antimicrobial resistance (MICs) with expression of genes encoding chromosomal β-lactamases (AmpC and OXA-51), porins (OmpA, CarO, Omp33, Dcap-like, OprB, Omp25, OprC, OprD, and OmpW), and proteins integral to six efflux systems (AdeABC, AdeIJK, AdeFGH, CraA, AbeM, and AmvA). Overexpression of the AdeABC system (level of expression relative to that by A. baumannii ATCC 17978, 30- to 45-fold) was significantly associated with resistance to tigecycline, minocycline, and gentamicin and other biological functions. However, hyperexpression of the AdeIJK efflux pump (level of expression relative to that by A. baumannii ATCC 17978, 8- to 10-fold) was significantly associated only with resistance to tigecycline and minocycline (to which the TetB efflux system also contributed). TetB and TetA(39) efflux pumps were detected in clinical strains and were associated with resistance to tetracyclines and doxycycline. The absence of the AdeABC system and the lack of expression of other mechanisms suggest that tigecycline-resistant strains of the PFGE-HUI-1 clone may be associated with a novel resistance-nodulation-cell efflux pump (decreased MICs in the presence of the inhibitor Phe-Arg β-naphthylamide dihydrochloride) and the TetA(39) system. PMID:23939894

  19. In Vivo and In Vitro Efficacy of Minocycline-Based Combination Therapy for Minocycline-Resistant Acinetobacter baumannii.


    Yang, Ya-Sung; Lee, Yi; Tseng, Kuo-Chuan; Huang, Wei-Cheng; Chuang, Ming-Fen; Kuo, Shu-Chen; Lauderdale, Tsai-Ling Yang; Chen, Te-Li


    Minocycline-based combination therapy has been suggested to be a possible choice for the treatment of infections caused by minocycline-susceptible Acinetobacter baumannii, but its use for the treatment of infections caused by minocycline-resistant A. baumannii is not well established. In this study, we compared the efficacy of minocycline-based combination therapy (with colistin, cefoperazone-sulbactam, or meropenem) to that of colistin in combination with meropenem for the treatment of minocycline-resistant A. baumannii infection. From 2006 to 2010, 191 (17.6%) of 1,083 A. baumannii complex isolates not susceptible to minocycline from the Taiwan Surveillance of Antimicrobial Resistance program were collected. Four representative A. baumannii isolates resistant to minocycline, amikacin, ampicillin-sulbactam, ceftazidime, ciprofloxacin, cefepime, gentamicin, imipenem, levofloxacin, meropenem, and piperacillin-tazobactam were selected on the basis of the diversity of their pulsotypes, collection years, health care setting origins, and geographic areas of origination. All four isolates had tetB and overexpressed adeABC, as revealed by quantitative reverse transcription-PCR. Among all minocycline-based regimens, only the combination with colistin produced a fractional inhibitory concentration index comparable to that achieved with meropenem combined with colistin. Minocycline (4 or 16 μg/ml) in combination with colistin (0.5 μg/ml) also synergistically killed minocycline-resistant isolates in time-kill studies. Minocycline (50 mg/kg of body weight) in combination with colistin (10 mg/kg) significantly improved the survival of mice and reduced the number of bacteria present in the lungs of mice compared to the results of monotherapy. However, minocycline (16 μg/ml)-based therapy was not effective at reducing biofilm-associated bacteria at 24 or 48 h when its effectiveness was compared to that of colistin (0.5 μg/ml) and meropenem (8 μg/ml). The clinical use of

  20. Molecular Analysis of Acinetobacter baumannii Strains Isolated in Lebanon Using Four Different Typing Methods

    PubMed Central

    Rafei, Rayane; Dabboussi, Fouad; Hamze, Monzer; Eveillard, Matthieu; Lemarié, Carole; Gaultier, Marie-Pierre; Mallat, Hassan; Moghnieh, Rima; Husni-Samaha, Rola; Joly-Guillou, Marie-Laure; Kempf, Marie


    This study analyzed 42 Acinetobacter baumannii strains collected between 2009–2012 from different hospitals in Beyrouth and North Lebanon to better understand the epidemiology and carbapenem resistance mechanisms in our collection and to compare the robustness of pulsed field gel electrophoresis (PFGE), multilocus sequence typing (MLST), repetitive sequence-based PCR (rep-PCR) and blaOXA-51 sequence-based typing (SBT). Among 31 carbapenem resistant strains, we have detected three carbapenem resistance genes: 28 carried the blaOXA-23 gene, 1 the blaOXA-24 gene and 2 strains the blaOXA-58 gene. This is the first detection of blaOXA-23 and blaOXA-24 in Lebanon. PFGE identified 11 types and was the most discriminating technique followed by rep-PCR (9 types), blaOXA-51 SBT (8 types) and MLST (7 types). The PFGE type A'/ST2 was the dominant genotype in our collection present in Beyrouth and North Lebanon. The clustering agreement between all techniques was measured by adjust Wallace coefficient. An overall agreement has been demonstrated. High values of adjust Wallace coefficient were found with followed combinations: PFGE to predict MLST types  = 100%, PFGE to predict blaOXA-51 SBT = 100%, blaOXA-51 SBT to predict MLST = 100%, MLST to predict blaOXA-51 SBT = 84.7%, rep-PCR to predict MLST = 81.5%, PFGE to predict rep-PCR = 69% and rep-PCR to predict blaOXA-51 SBT = 67.2%. PFGE and MLST are gold standard methods for outbreaks investigation and population structure studies respectively. Otherwise, these two techniques are technically, time and cost demanding. We recommend the use of blaOXA-51 SBT as first typing method to screen isolates and assign them to their corresponding clonal lineages. Repetitive sequence-based PCR is a rapid tool to access outbreaks but careful interpretation of results must be always performed. PMID:25541711

  1. [Characterization and determination of antibiotic resistance profiles of a single clone Acinetobacter baumannii strains isolated from blood cultures].


    Karagöz, Alper; Baran, Irmak; Aksu, Neriman; Acar, Sümeyra; Durmaz, Rıza


    Acinetobacter baumannii which is a significant cause of nosocomial infections, increases the rate of morbidity and mortality in health care settings especially in intensive care units (ICUs). The aim of this study was to determine the antibiotic resistance profiles of A.baumannii strains isolated from blood cultures of inpatients from different ICUs, wards and hospital environment and evaluate their clonal relationships and epidemiologic features. A total of 54 A.baumannii strains (47 from the blood cultures and 7 from the hospital environment), identified between 01 January 2012-28 December 2012 at the Clinical Microbiology Laboratory of Ankara Numune Training and Research Hospital, Turkey, were included in the study. Identification of A.baumannii isolates and their antimicrobial [sulbactam-ampicillin (SAM), piperacillin (PIP), piperacillin-tazobactam (TZP), ceftazidime (CFZ), cefoperazone-sulbactam (SCF), cefepime (CEF), imipenem (IMP), meropenem (MER), amikacin (AMK), gentamicin (GEN), netilmicin (NT), ciprofloxacin (CIP), levofloxacin (LVF), tetracycline (TET), tigecycline (TG), colistin (COL), trimethoprim-sulfamethoxazole (SXT)] susceptibility testing were performed by Vitek 2 (bioMérieux, France) system. The clonal relationship between the A.baumannii isolates was analysed by pulsed-field gel electrophoresis (PFGE). In our study colistin, tigecycline and netilmicin were found to be the most effective agents against A.baumannii isolates. All of the clinical isolates (n= 47) were found susceptible to COL, however all were resistant to SAM, PIP, TZP, CEF, IPM, CFZ, MER and CIP. While 1.85%, 14.8%, 14.8%, 16.6%, 59.2% and 22.2% of the isolates were susceptible to SCF, AMK, NT, GEN, TG and SXT, respectively; 1.85%, 1.85%, 9.2%, 16.6%, 38.8% and 27.7% of the isolates were intermediate to SCF, TET, AMK, NT, LVF and TG, respectively. Similarly, all of the environmental A.baumannii isolates (n= 7) were resistant to SAM, PIP, TZP, CFZ, CEF, IPM, MER and CIP, and all

  2. Isolation and genetic characterization of metallo-β-lactamase and carbapenamase producing strains of Acinetobacter baumannii from patients at Tehran hospitals

    PubMed Central

    Shahcheraghi, F; Abbasalipour, M; Feizabadi, MM; Ebrahimipour, GH; Akbari, N


    Background and Objective Carbapenems are therapeutic choice against infections caused by gram-negative bacilli including strains of Acinetobacter baumannii. Resistance to these antibiotics is mediated by efflux pumps, porins, PBPs and ß-lactamases. The aim of this study was to determine the possibility of existence of MBLs, OXAs and GES-1 betalactamase genes among clinical isolates of Acinetobacter collected from Tehran hospitals. Material and Methods Two hundred and three Acinetobacter isolates were collected from patient at Tehran hospitals. The isolates were identified using biochemical tests. The susceptibility to different antibiotics was evaluated by disk diffusion method and MICs of imipenem were determined using Micro broth dilution method (CLSI). PCR was performed for detection of bla VIM-2, bla SPM-1, bla IMP-2, bla GES-1, bla OXA-51, bla OXA-23 betalactamase genes. Clonal relatedness was estimated by PFGE with the restriction enzyme SmaI. Results and Conclusion Of 100 isolates of imipenem resistant Acinetobacter spp. collected from Tehran hospitals in 2009 and 2010, 6 isolates produced metallo-beta-lactamases and 94 isolates produced OXA-type carbapenemase. The bla SPM-1, bla GES-1, bla OXA-51, bla OXA-23 genes were detected by PCR among 6, 2, 94 and 84 isolates of A. baumannii, respectively. The MICs of isolates to imipenem were 8–128 µg/mL. PFGE analysis of 29 bla OXA-51 and bla OXA-23-positive A. baumannii isolates gave 6 different patterns. This is the first report of SPM-1 and GES-1 beta-lactamase producing A. baumannii. Production of the OXA-23, OXA-51, GES-1 and SPM-1 enzyme presents an emerging threat of carbapenem resistance among A. baumannii in Iran. PMID:22347585

  3. The long-term survival of Acinetobacter baumannii ATCC 19606(T) under nutrient-deprived conditions does not require the entry into the viable but non-culturable state.


    Bravo, Z; Orruño, M; Parada, C; Kaberdin, V R; Barcina, I; Arana, I


    Acinetobacter baumannii possesses a tremendous potential to thrive under hostile conditions. To learn more about its survival strategy and capacity to persist in the environment, we studied the effect of temperature, nutrient deprivation and dryness on the long-term survival of two A. baumannii strains (ATCC 19606(T) and a clinical isolate). Our results revealed that both strains show a great persistence under stress that appears to involve a bust-and-boom strategy. Bacterial survival was differentially affected by temperature and physical environment: Desiccation favored cell resistance to stress at 20 and 37 °C, while survival in aqueous environments was temperature dependent and led to changes in several cellular characteristics. In addition, we tested the ability of the A. baumannii ATCC 19606(T) strain to form biofilms by monitoring the expression of adhesion-/biofilm-related genes (ompA, bfmR and csuAB). The observed downregulation of these genes suggests that the potential difficulties to adhere to solid surfaces and form biofilms likely limit the capacity of starved cells to spread and colonize abiotic surfaces. PMID:26872882

  4. A Partially Purified Acinetobacter baumannii Phage Preparation Exhibits no Cytotoxicity in 3T3 Mouse Fibroblast Cells

    PubMed Central

    Henein, Alexandra E.; Hanlon, Geoffrey W.; Cooper, Callum J.; Denyer, Stephen P.; Maillard, Jean-Yves


    A surge in the level and scale of antibiotic resistance has prompted renewed interest in the application of bacteriophages to treat bacterial infections. However, concerns still exist over their efficacy and safety. Acinetobacter baumannii phage BS46, a member of the family Myoviridae, has previously been shown to be effective in murine models. The cytotoxic effect of this phage was evaluated in mouse fibroblast 3T3 cells using four different assays: trypan blue; staining with Hoechst and propidium iodide; lactate dehydrogenase release; and the MTS assay. The addition of phage concentrations up to 2 × 109 pfu/mL showed little to no impact on the viability of 3T3 cells after 24 h exposure using the different assays. This study demonstrates that phage BS46 is non-cytotoxic to 3T3 cells using four different assays and that appropriate quality assurance protocols for phage therapeutics are required. PMID:27536286

  5. Vitroprocines, new antibiotics against Acinetobacter baumannii, discovered from marine Vibrio sp. QWI-06 using mass-spectrometry-based metabolomics approach

    NASA Astrophysics Data System (ADS)

    Liaw, Chih-Chuang; Chen, Pei-Chin; Shih, Chao-Jen; Tseng, Sung-Pin; Lai, Ying-Mi; Hsu, Chi-Hsin; Dorrestein, Pieter C.; Yang, Yu-Liang


    A robust and convenient research strategy integrating state-of-the-art analytical techniques is needed to efficiently discover novel compounds from marine microbial resources. In this study, we identified a series of amino-polyketide derivatives, vitroprocines A-J, from the marine bacterium Vibrio sp. QWI-06 by an integrated approach using imaging mass spectroscopy and molecular networking, as well as conventional bioactivity-guided fractionation and isolation. The structure-activity relationship of vitroprocines against Acinetobacter baumannii is proposed. In addition, feeding experiments with 13C-labeled precursors indicated that a pyridoxal 5‧-phosphate-dependent mechanism is involved in the biosynthesis of vitroprocines. Elucidation of amino-polyketide derivatives from a species of marine bacteria for the first time demonstrates the potential of this integrated metabolomics approach to uncover marine bacterial biodiversity.

  6. Intra-Pleural Colistin Methanesulfonate Therapy for Pleural Infection caused by Carbapenem-Resistant Acinetobacter Baumannii: A Successful Case Report

    PubMed Central

    Rana, Muhammad Asim; Rahman, Basheer Abd El; Mady, Ahmed Fouad; Odat, Mohammed Al; AlHarthy, Abdurehman; Ramadan, Omar El Sayed; Mumtaz, Shahzad Ahmed; Omrani, Ali S.


    Infections caused by carbapenem-resistant, Gram-negative bacteria are an increasing clinical challenge, since the antimicrobial treatment options are often limited to colistin methanesulfonate. No data are available regarding the pharmacokinetics of colistin in pleural fluid. We report the case of a 92-year old man with ventilator-associated pneumonia and pleurisy caused by Acinetobacter baumannii and Escherichia coli, which were both multidrug-resistant. After an unsuccessful treatment with intravenous colistin methanesulfonate and imipen-em-cilastatin, the addition of intra-pleural colistin methanesulfonate to the intravenous treatment led to a prompt clinical, radiological and microbiological resolution. This is the first report of a successful use of intra-pleural colistin in the literature. The intra-pleural colistin therapy should be considered in selected cases of pleurisy caused by multi-resistant Gram-negative bacteria. PMID:25276329

  7. In vitro synergy of colistin combinations against extensively drug-resistant Acinetobacter baumannii producing OXA-23 carbapenemase.


    Wei, Wenjuan; Yang, Haifei; Liu, Yanyan; Ye, Ying; Li, Jiabin


    Fifty extensively drug-resistant Acinetobacter baumannii (XDRAB) were isolated from patients. The chequerboard microdilution method was used to determine the in vitro activities of five colistin (COL)-based combinations including COL+fosfomycin (FOS), COL+rifampicin (RIF), COL+imipenem (IMP), COL+sulbactam (SUP) and COL+levofloxacin (LVX). The synergistic activity was evaluated by the fractional inhibitory concentration index (FICI). According to our results, the combination of COL was synergistic with FOS, RIF, IMP, SUP and LVX with the ratios of 50, 72, 88, 92 and 64%, respectively. When combined with COL, the other five agents showed increased antimicrobial activities. In addition, two of the combinations, COL+RIF and COL+IMP, were more active than the combinations of COL+FOS, COL+SUP and COL+LVX. More importantly, these combination regimens could exert synergistic effects at the sub-minimum inhibitory concentration (MIC) levels against XDRAB strains. PMID:25978105

  8. A Partially Purified Acinetobacter baumannii Phage Preparation Exhibits no Cytotoxicity in 3T3 Mouse Fibroblast Cells.


    Henein, Alexandra E; Hanlon, Geoffrey W; Cooper, Callum J; Denyer, Stephen P; Maillard, Jean-Yves


    A surge in the level and scale of antibiotic resistance has prompted renewed interest in the application of bacteriophages to treat bacterial infections. However, concerns still exist over their efficacy and safety. Acinetobacter baumannii phage BS46, a member of the family Myoviridae, has previously been shown to be effective in murine models. The cytotoxic effect of this phage was evaluated in mouse fibroblast 3T3 cells using four different assays: trypan blue; staining with Hoechst and propidium iodide; lactate dehydrogenase release; and the MTS assay. The addition of phage concentrations up to 2 × 10(9) pfu/mL showed little to no impact on the viability of 3T3 cells after 24 h exposure using the different assays. This study demonstrates that phage BS46 is non-cytotoxic to 3T3 cells using four different assays and that appropriate quality assurance protocols for phage therapeutics are required. PMID:27536286

  9. Activity of Colistin in Combination with Meropenem, Tigecycline, Fosfomycin, Fusidic Acid, Rifampin or Sulbactam against Extensively Drug-Resistant Acinetobacter baumannii in a Murine Thigh-Infection Model

    PubMed Central

    Wang, Xiumei; Cong, Yulong


    Few effective therapeutic options are available for treating severe infections caused by extensively drug-resistant Acinetobacter baumannii (XDR-AB). Using a murine thigh-infection model, we examined the in vivo efficacy of colistin in combination with meropenem, tigecycline, fosfomycin, fusidic acid, rifampin, or sulbactam against 12 XDR-AB strains. Colistin, tigecycline, rifampin, and sulbactam monotherapy significantly decreased bacterial counts in murine thigh infections compared with those observed in control mice receiving no treatment. Colistin was the most effective agent tested, displaying bactericidal activity against 91.7% of strains at 48 h post-treatment. With strains showing a relatively low minimum inhibitory concentration (MIC) for meropenem (MIC ≤ 32 mg/L), combination therapy with colistin plus meropenem caused synergistic inhibition at both 24 h and 48 h post-treatment. However, when the meropenem MIC was ≥64 mg/L, meropenem did not significantly alter the efficacy of colistin. The addition of rifampin and fusidic acid significantly improved the efficacy of colistin, showing a synergistic effect in 100% and 58.3% of strains after 24 h of treatment, respectively, while the addition of tigecycline, fosfomycin, or sulbactam did not show obvious synergistic activity. No clear differences in activities were observed between colistin-rifampin and colistin-fusidic acid combination therapy with most strains. Overall, our in vivo study showed that administering colistin in combination with rifampin or fusidic acid is more efficacious in treating XDR-AB infections than other combinations. The colistin-meropenem combination may be another appropriate option if the MIC is ≤32 mg/L. Further clinical studies are urgently needed to confirm the relevance of these findings. PMID:27315107

  10. Analysis of tigecycline resistance development in clinical Acinetobacter baumannii isolates through a combined genomic and transcriptomic approach.


    Liu, Lin; Cui, Yujun; Zheng, Beiwen; Jiang, Saiping; Yu, Wei; Shen, Ping; Ji, Jinru; Li, Lanjuan; Qin, Nan; Xiao, Yonghong


    Tigecycline (Tgc) is considered a last-resort antibiotic for the treatment of multi-drug resistant bacteria. To study Tgc resistance development in the important nosocomial pathogen Acinetobacter baumannii, we adopted six clinical isolates from three patients undergoing antibiotic treatment, and bacterial genomic sequences and seven strand-specific transcriptomes were studied. Interestingly, the Tgc-intermediate 2015ZJAB1 only differed from Tgc-resistant 2015ZJAB2 in an SNP-clustered region including OprD, a sugar-type MFS permease, and a LuxR-type transcriptional regulator. Surprisingly, an almost identical region was found in 2015ZJAB3, which supports the possibility of a homologous recombination event that increased Tgc resistance. Furthermore, comparative transcriptomic analysis identified significantly regulated genes associated with Tgc resistance, which was verified using qRT-PCR. Three enriched COG categories included amino acid transport and metabolism, transcription, and inorganic ion transport and metabolism. KEGG analysis revealed common features under Tgc conditions, including up regulated benzoate degradation and a less active TCA cycle. This may be related to selective antimicrobial pressure in the environment and adaptation by lowering metabolism. This study provides the first report of an in vivo evolutionary process that included a putative homologous recombination event conferring Tgc resistance in clinical A. baumannii isolates in which transcriptome analysis revealed resistance-conferring genes and related metabolism characteristics. PMID:27240484

  11. Colistin and Fusidic Acid, a Novel Potent Synergistic Combination for Treatment of Multidrug-Resistant Acinetobacter baumannii Infections

    PubMed Central

    Betts, Jonathan W.; Bharathan, Binutha


    The spread of multidrug-resistant Acinetobacter baumannii (MDRAB) has led to the renaissance of colistin (COL), often the only agent to which MDRAB remains susceptible. Effective therapy with COL is beset with problems due to unpredictable pharmacokinetics, toxicity, and the rapid selection of resistance. Here, we describe a potent synergistic interaction when COL was combined with fusidic acid (FD) against A. baumannii. Synergy in vitro was assessed against 11 MDRAB isolates using disc diffusion, checkerboard methodology (fractional inhibitory concentration index [FICI] of ≤ 0.5, susceptibility breakpoint index [SBPI] of >2), and time-kill methodology (≥2 log10 CFU/ml reduction). The ability of FD to limit the emergence of COL resistance was assessed in the presence and absence of each drug alone and in combination. Synergy was demonstrated against all strains, with an average FICI and SBPI of 0.064 and 78.85, respectively. In time-kill assays, COL-FD was synergistic and rapidly bactericidal, including against COL-resistant strains. Fusidic acid prevented the emergence of COL resistance, which was readily selected with COL alone. This is the first description of a novel COL-FD regimen for the treatment of MDRAB. The combination was effective at low concentrations, which should be therapeutically achievable while limiting toxicity. Further studies are warranted to determine the mechanism underlying the interaction and the suitability of COL-FD as an unorthodox therapy for the treatment of multidrug-resistant Gram-negative infections. PMID:25987639

  12. Comparative Evaluation of Colistin Susceptibility Testing Methods among Carbapenem-Nonsusceptible Klebsiella pneumoniae and Acinetobacter baumannii Clinical Isolates.


    Dafopoulou, Konstantina; Zarkotou, Olympia; Dimitroulia, Evangelia; Hadjichristodoulou, Christos; Gennimata, Vasiliki; Pournaras, Spyros; Tsakris, Athanasios


    We compared six colistin susceptibility testing (ST) methods on 61 carbapenem-nonsusceptible Klebsiella pneumoniae (n = 41) and Acinetobacter baumannii (n = 20) clinical isolates with provisionally elevated colistin MICs by routine ST. Colistin MICs were determined by broth microdilution (BMD), BMD with 0.002% polysorbate 80 (P80) (BMD-P80), agar dilution (AD), Etest, Vitek2, and MIC test strip (MTS). BMD was used as the reference method for comparison. The EUCAST-recommended susceptible and resistant breakpoints of ≤2 and >2 μg/ml, respectively, were applied for both K. pneumoniae and A. baumannii. The proportions of colistin-resistant strains were 95.1, 77, 96.7, 57.4, 65.6, and 98.4% by BMD, BMD-P80, AD, Etest, MTS, and Vitek2, respectively. The Etest and MTS methods produced excessive rates of very major errors (VMEs) (39.3 and 31.1%, respectively), while BMD-P80 produced 18% VMEs, AD produced 3.3% VMEs, and Vitek2 produced no VMEs. Major errors (MEs) were rather limited by all tested methods. These data show that gradient diffusion methods may lead to inappropriate colistin therapy. Clinical laboratories should consider the use of automated systems, such as Vitek2, or dilution methods for colistin ST. PMID:26014928

  13. Comparative Evaluation of Colistin Susceptibility Testing Methods among Carbapenem-Nonsusceptible Klebsiella pneumoniae and Acinetobacter baumannii Clinical Isolates

    PubMed Central

    Dafopoulou, Konstantina; Zarkotou, Olympia; Dimitroulia, Evangelia; Hadjichristodoulou, Christos; Gennimata, Vasiliki; Tsakris, Athanasios


    We compared six colistin susceptibility testing (ST) methods on 61 carbapenem-nonsusceptible Klebsiella pneumoniae (n = 41) and Acinetobacter baumannii (n = 20) clinical isolates with provisionally elevated colistin MICs by routine ST. Colistin MICs were determined by broth microdilution (BMD), BMD with 0.002% polysorbate 80 (P80) (BMD-P80), agar dilution (AD), Etest, Vitek2, and MIC test strip (MTS). BMD was used as the reference method for comparison. The EUCAST-recommended susceptible and resistant breakpoints of ≤2 and >2 μg/ml, respectively, were applied for both K. pneumoniae and A. baumannii. The proportions of colistin-resistant strains were 95.1, 77, 96.7, 57.4, 65.6, and 98.4% by BMD, BMD-P80, AD, Etest, MTS, and Vitek2, respectively. The Etest and MTS methods produced excessive rates of very major errors (VMEs) (39.3 and 31.1%, respectively), while BMD-P80 produced 18% VMEs, AD produced 3.3% VMEs, and Vitek2 produced no VMEs. Major errors (MEs) were rather limited by all tested methods. These data show that gradient diffusion methods may lead to inappropriate colistin therapy. Clinical laboratories should consider the use of automated systems, such as Vitek2, or dilution methods for colistin ST. PMID:26014928

  14. Spread of carbapenem-resistant Acinetobacter baumannii global clone 2 in Asia and AbaR-type resistance islands.


    Kim, Dae Hun; Choi, Ji-Young; Kim, Hae Won; Kim, So Hyun; Chung, Doo Ryeon; Peck, Kyong Ran; Thamlikitkul, Visanu; So, Thomas Man-Kit; Yasin, Rohani M D; Hsueh, Po-Ren; Carlos, Celia C; Hsu, Li Yang; Buntaran, Latre; Lalitha, M K; Song, Jae-Hoon; Ko, Kwan Soo


    In this surveillance study, we identified the genotypes, carbapenem resistance determinants, and structural variations of AbaR-type resistance islands among carbapenem-resistant Acinetobacter baumannii (CRAB) isolates from nine Asian locales. Clonal complex 92 (CC92), corresponding to global clone 2 (GC2), was the most prevalent in most Asian locales (83/108 isolates; 76.9%). CC108, or GC1, was a predominant clone in India. OXA-23 oxacillinase was detected in CRAB isolates from most Asian locales except Taiwan. blaOXA-24 was found in CRAB isolates from Taiwan. AbaR4-type resistance islands, which were divided into six subtypes, were identified in most CRAB isolates investigated. Five isolates from India, Malaysia, Singapore, and Hong Kong contained AbaR3-type resistance islands. Of these, three isolates harbored both AbaR3- and AbaR4-type resistance islands simultaneously. In this study, GC2 was revealed as a prevalent clone in most Asian locales, with the AbaR4-type resistance island predominant, with diverse variants. The significance of this study lies in identifying the spread of global clones of carbapenem-resistant A. baumannii in Asia. PMID:23939892

  15. Antimicrobial action of zinc oxide nanoparticles in combination with ciprofloxacin and ceftazidime against multidrug-resistant Acinetobacter baumannii.


    Ghasemi, F; Jalal, R


    Acinetobacter baumannii is a serious concern amongst hospitalised patients worldwide and its resistance to antibiotics has emerged as a threat to public health in recent years. Metal oxide nanoparticles were found to be effective for overcoming bacterial resistance owing to their antibacterial activities. The aim of this study was to investigate the combined effects of zinc oxide nanoparticles (ZnO-NPs) and the conventional antibiotics ciprofloxacin and ceftazidime as well as their mechanisms of action against resistant A. baumannii. ZnO-NPs were prepared by the solvothermal method and were characterised by various methods. Broth microdilution and disk diffusion methods were used to determine the antibacterial activities of ciprofloxacin and ceftazidime antibiotics in the absence and presence of a subinhibitory concentration of ZnO-NPs. The mechanism of action of ZnO-NPs alone and in combination with these antibiotics was assessed by flow cytometry, DNA extraction, fluorescence and scanning electron microscopy. The results showed that the antibacterial activities of both antibiotics increased in the presence of a subinhibitory concentration of ZnO-NPs. Combination of ZnO-NPs with antibiotics increased the uptake of antibiotics and changed the bacterial cells from rod to cocci forms. Bacterial filamentation was also observed and exhibited no DNA fragmentation. In conclusion, the results of this study indicate that ZnO-NPs potentiate the antimicrobial action of ciprofloxacin and ceftazidime. A mechanism is proposed to explain this phenomenon. PMID:27530853

  16. Prevalence and Genetic Characterization of Carbapenem- and Polymyxin-Resistant Acinetobacter baumannii Isolated from a Tertiary Hospital in Terengganu, Malaysia

    PubMed Central

    Lean, Soo-Sum; Suhaili, Zarizal; Ismail, Salwani; Rahman, Nor Iza A.; Othman, Norlela; Abdullah, Fatimah Haslina; Thong, Kwai-Lin


    Nosocomial infection caused by Acinetobacter baumannii is of great concern due to its increasing resistance to most antimicrobials. In this study, 54 nonrepeat isolates of A. baumannii from the main tertiary hospital in Terengganu, Malaysia, were analyzed for their antibiograms and genotypes. Out of the 54 isolates, 39 (72.2%) were multidrug resistant (MDR) and resistant to carbapenems whereas 14 (25.9%) were categorized as extensive drug resistant (XDR) with additional resistance to polymyxin B, the drug of “last resort.” Pulsed-field gel electrophoresis analyses showed that the polymyxin-resistant isolates were genetically diverse while the carbapenem-resistant isolates were clonally related. The 14 XDR isolates were further investigated for mutations in genes known to mediate polymyxin resistance, namely, pmrCAB, and the lipopolysaccharide biosynthesis genes, lpxA, lpxC, lpxD, and lpsB. All 14 isolates had a P102H mutation in pmrA with no mutation detected in pmrC and pmrB. No mutation was detected in lpxA but each polymyxin-resistant isolate had 2–4 amino acid substitutions in lpxD and 1-2 substitutions in lpxC. Eight resistant isolates also displayed a unique H181Y mutation in lpsB. The extent of polymyxin resistance is of concern and the novel mutations discovered here warrant further investigations. PMID:25006521

  17. Colistin and Fusidic Acid, a Novel Potent Synergistic Combination for Treatment of Multidrug-Resistant Acinetobacter baumannii Infections.


    Phee, Lynette M; Betts, Jonathan W; Bharathan, Binutha; Wareham, David W


    The spread of multidrug-resistant Acinetobacter baumannii (MDRAB) has led to the renaissance of colistin (COL), often the only agent to which MDRAB remains susceptible. Effective therapy with COL is beset with problems due to unpredictable pharmacokinetics, toxicity, and the rapid selection of resistance. Here, we describe a potent synergistic interaction when COL was combined with fusidic acid (FD) against A. baumannii. Synergy in vitro was assessed against 11 MDRAB isolates using disc diffusion, checkerboard methodology (fractional inhibitory concentration index [FICI] of ≤ 0.5, susceptibility breakpoint index [SBPI] of >2), and time-kill methodology (≥2 log10 CFU/ml reduction). The ability of FD to limit the emergence of COL resistance was assessed in the presence and absence of each drug alone and in combination. Synergy was demonstrated against all strains, with an average FICI and SBPI of 0.064 and 78.85, respectively. In time-kill assays, COL-FD was synergistic and rapidly bactericidal, including against COL-resistant strains. Fusidic acid prevented the emergence of COL resistance, which was readily selected with COL alone. This is the first description of a novel COL-FD regimen for the treatment of MDRAB. The combination was effective at low concentrations, which should be therapeutically achievable while limiting toxicity. Further studies are warranted to determine the mechanism underlying the interaction and the suitability of COL-FD as an unorthodox therapy for the treatment of multidrug-resistant Gram-negative infections. PMID:25987639

  18. Nosocomial Outbreak of Carbapenem-Resistant Acinetobacter baumannii in Intensive Care Units and Successful Outbreak Control Program

    PubMed Central

    Choi, Won Suk; Kim, Su Hyun; Jeon, Eun Gyong; Son, Myeung Hee; Yoon, Young Kyung; Kim, Jung-Yeon; Kim, Mi Jeong; Sohn, Jang Wook; Kim, Min Ja


    Acinetobacter baumannii has been increasingly reported as a significant causative organism of various nosocomial infections. Here we describe an outbreak of carbapenem-resistant A. baumannii (CRAB) in the ICUs of a Korean university hospital, along with a successful outbreak control program. From October 2007 through July 2008, CRAB was isolated from 57 ICU patients. Nineteen patients were diagnosed as being truly infected with CRAB, four of whom were presumed to have died due to CRAB infection, producing a case-fatality rate of 21.1%. In surveillance of the environment and the healthcare workers (HCWs), CRAB was isolated from 24 (17.9%) of 135 environmental samples and seven (10.9%) of 65 HCWs. The pulsed field gel electrophoresis patterns showed that the isolates from patients, HCWs, and the environment were genetically related. Control of the outbreak was achieved by enforcing contact precautions, reducing environmental contamination through massive cleaning, and use of a closed-suctioning system. By August 2008 there were no new cases of CRAB in the ICUs. This study shows that the extensive spread of CRAB can happen through HCWs and the environmental contamination, and that proper strategies including strict contact precautions, massive environmental decontamination, and a closed-suctioning system can be effective for controlling CRAB outbreaks. PMID:20592889

  19. Analysis of tigecycline resistance development in clinical Acinetobacter baumannii isolates through a combined genomic and transcriptomic approach

    PubMed Central

    Liu, Lin; Cui, Yujun; Zheng, Beiwen; Jiang, Saiping; Yu, Wei; Shen, Ping; Ji, Jinru; Li, Lanjuan; Qin, Nan; Xiao, Yonghong


    Tigecycline (Tgc) is considered a last-resort antibiotic for the treatment of multi-drug resistant bacteria. To study Tgc resistance development in the important nosocomial pathogen Acinetobacter baumannii, we adopted six clinical isolates from three patients undergoing antibiotic treatment, and bacterial genomic sequences and seven strand-specific transcriptomes were studied. Interestingly, the Tgc-intermediate 2015ZJAB1 only differed from Tgc-resistant 2015ZJAB2 in an SNP-clustered region including OprD, a sugar-type MFS permease, and a LuxR-type transcriptional regulator. Surprisingly, an almost identical region was found in 2015ZJAB3, which supports the possibility of a homologous recombination event that increased Tgc resistance. Furthermore, comparative transcriptomic analysis identified significantly regulated genes associated with Tgc resistance, which was verified using qRT-PCR. Three enriched COG categories included amino acid transport and metabolism, transcription, and inorganic ion transport and metabolism. KEGG analysis revealed common features under Tgc conditions, including up regulated benzoate degradation and a less active TCA cycle. This may be related to selective antimicrobial pressure in the environment and adaptation by lowering metabolism. This study provides the first report of an in vivo evolutionary process that included a putative homologous recombination event conferring Tgc resistance in clinical A. baumannii isolates in which transcriptome analysis revealed resistance-conferring genes and related metabolism characteristics. PMID:27240484

  20. Analysis of Endothelial Adherence of Bartonella henselae and Acinetobacter baumannii Using a Dynamic Human Ex Vivo Infection Model

    PubMed Central

    Weidensdorfer, Marko; Chae, Ju Ik; Makobe, Celestine; Stahl, Julia; Averhoff, Beate; Müller, Volker; Schürmann, Christoph; Brandes, Ralf P.; Wilharm, Gottfried; Ballhorn, Wibke; Christ, Sara; Linke, Dirk; Fischer, Doris; Göttig, Stephan


    Bacterial adherence determines the virulence of many human-pathogenic bacteria. Experimental approaches elucidating this early infection event in greater detail have been performed using mainly methods of cellular microbiology. However, in vitro infections of cell monolayers reflect the in vivo situation only partially, and animal infection models are not available for many human-pathogenic bacteria. Therefore, ex vivo infection of human organs might represent an attractive method to overcome these limitations. We infected whole human umbilical cords ex vivo with Bartonella henselae or Acinetobacter baumannii under dynamic flow conditions mimicking the in vivo infection situation of human endothelium. For this purpose, methods for quantifying endothelium-adherent wild-type and trimeric autotransporter adhesin (TAA)-deficient bacteria were set up. Data revealed that (i) A. baumannii binds in a TAA-dependent manner to endothelial cells, (ii) this organ infection model led to highly reproducible adherence rates, and furthermore, (iii) this model allowed to dissect the biological function of TAAs in the natural course of human infections. These findings indicate that infection models using ex vivo human tissue samples (“organ microbiology”) might be a valuable tool in analyzing bacterial pathogenicity with the capacity to replace animal infection models at least partially. PMID:26712205

  1. Prediction of Putative Resistance Islands in a Carbapenem-Resistant Acinetobacter baumannii Global Clone 2 Clinical Isolate

    PubMed Central

    Lee, Yangsoon; D'Souza, Roshan; Lee, Kyungwon


    Background We investigated the whole genome sequence (WGS) of a carbapenem-resistant Acinetobacter baumannii isolate belonging to the global clone 2 (GC2) and predicted resistance islands using a software tool. Methods A. baumannii strain YU-R612 was isolated from the sputum of a 61-yr-old man with sepsis. The WGS of the YU-R612 strain was obtained by using the PacBio RS II Sequencing System (Pacific Biosciences Inc., USA). Antimicrobial resistance genes and resistance islands were analyzed by using ResFinder and Genomic Island Prediction software (GIPSy), respectively. Results The YU-R612 genome consisted of a circular chromosome (ca. 4,075 kb) and two plasmids (ca. 74 kb and 5 kb). Its sequence type (ST) under the Oxford scheme was ST191, consistent with assignment to GC2. ResFinder analysis showed that YU-R612 possessed the following resistance genes: four β-lactamase genes blaADC-30, blaOXA-66, blaOXA-23, and blaTEM-1; armA, aadA1, and aacA4 as aminoglycoside resistance-encoding genes; aac(6')Ib-cr for fluoroquinolone resistance; msr(E) for macrolide, lincosamide, and streptogramin B resistance; catB8 for phenicol resistance; and sul1 for sulfonamide resistance. By GIPSy analysis, six putative resistant islands (PRIs) were determined on the YU-R612 chromosome. Among them, PRI1 possessed two copies of Tn2009 carrying blaOXA-23, and PRI5 carried two copies of a class I integron carrying sul1 and armA genes. Conclusions By prediction of resistance islands in the carbapenem-resistant A. baumannii YU-R612 GC2 strain isolated in Korea, PRIs were detected on the chromosome that possessed Tn2009 and class I integrons. The prediction of resistance islands using software tools was useful for analysis of the WGS. PMID:27139604

  2. Contribution of the Ade Resistance-Nodulation-Cell Division-Type Efflux Pumps to Fitness and Pathogenesis of Acinetobacter baumannii

    PubMed Central

    Yoon, Eun-Jeong; Balloy, Viviane; Fiette, Laurence; Chignard, Michel; Courvalin, Patrice


    ABSTRACT Overexpression of chromosomal resistance-nodulation-cell division (RND)-type efflux systems with broad substrate specificity contributes to multidrug resistance (MDR) in Acinetobacter baumannii. We have shown that modulation of expression of the structural genes for the efflux systems AdeABC and AdeIJK confers MDR and results in numerous alterations of membrane-associated cellular functions, in particular biofilm formation. However, the contribution of these RND pumps to cell fitness and virulence has not yet been studied. The biological cost of an antibiotic resistance mechanism is a key parameter in determining its stability and dissemination. From an entirely sequenced susceptible clinical isolate, we have generated a set of isogenic derivatives having single point mutations resulting in overexpression of each efflux system or with every pump deleted by allelic replacement. We found that overproduction of the pumps results in a significant decrease in fitness of the bacterial host when measured by competition experiments in vitro. Fitness and virulence were also evaluated in vivo both in systemic and pulmonary infection models in immunocompetent mice. A diminished competitiveness of the AdeABC-overexpressing mutant was observed only after intraperitoneal inoculation, but not after intranasal inoculation, the latter mimicking the most frequent type of human A. baumannii infection. However, in mice infected intranasally, this mutant was more virulent and stimulated an enhanced neutrophil activation in the lungs. Altogether, these data account for the observation that adeABC overexpression is common in MDR A. baumannii frequently found in ventilator-associated pneumonia. PMID:27247231

  3. Dissemination of imipenem-resistant Acinetobacter baumannii with new plasmid-borne blaOXA-72 in Taiwan

    PubMed Central


    Background The systemic surveillance of imipenem-resistant Acinetobacter baumannii (IRAB) from multicenters in Taiwan revealed the emergence of isolates with blaOXA-72. This study described their genetic makeup, mechanism of spread, and contribution to carbapenem resistance. Methods Two hundred and ninety-one non-repetitive isolates of A. baumannii were collected from 10 teaching hospitals from different geographical regions in Taiwan from June 2007 to September 2007. Minimal inhibitory concentrations (MICs) were determined by agar dilution. Clonality was determined by pulsed-field gel electrophoresis. Plasmid was extracted and digested by restriction enzymes, and subsequently analyzed by electrophoresis and Southern blot for blaOXA-72. The flanking regions of blaOXA-72 were determined by inverse PCR. The contribution of blaOXA-72 to imipenem MIC was determined by transforming plasmids carrying blaOXA-72 into imipenem-susceptible A. baumannii. Results Among 142 IRAB in Taiwan, 27 harbored blaOXA-72; 22 originated from Southern Taiwan, 5 from Central Taiwan, and none from Northern Taiwan. There were two major clones. The blaOXA-72 was identified in the plasmids of all isolates. Two genetic structures flanking plasmid-borne blaOXA-72 were identified and shared identical sequences in certain regions; the one described in previous literature was present in only one isolate, and the new one was present in the remaining isolates. Introduction of blaOXA-72 resulted in an increase of imipenem MIC in the transformants. The overexpression of blaOXA-72 mRNA in response to imipenem further supported the contribution of blaOXA-72. Conclusions In conclusion, isolates with new plasmid-borne blaOXA-72 were found to be disseminated successfully in Southern Taiwan. The spread of the resistance gene depended on clonal spread and dissemination of a new plasmid. BlaOXA-72 in these isolates directly led to their imipenem-resistance. PMID:23849336

  4. Polyvinyl alcohol nanofiber formulation of the designer antimicrobial peptide APO sterilizes Acinetobacter baumannii-infected skin wounds in mice.


    Sebe, Istvan; Ostorhazi, Eszter; Fekete, Aron; Kovacs, Krisztian N; Zelko, Romana; Kovalszky, Ilona; Li, Wenyi; Wade, John D; Szabo, Dora; Otvos, Laszlo


    Native and designer cationic antimicrobial peptides are increasingly acknowledged as host defense molecules rather than true antimicrobials. Due to their ability to activate the innate immune system, these structures are used to treat uninfected and bacterially-infected wounds, including those harboring Acinetobacter baumannii. Previously we documented that when administered intramuscularly or topically in liquid formulations, the proline-rich host defense peptide dimer A3-APO accelerates uninfected wound re-epithelization and eliminates systemic and local A. baumannii, methicillin-resistant Staphylococcus aureus and other pathogen load from infected lesions better than conventional antibiotics. In the current study we sought to produce and characterize a novel delivery system, suitable for immediate and convenient application in non-hospital environments. The APO monomer was incorporated into polyvinyl alcohol nanofibers and the complex was polymerized into a solid patch dressing. Mice were subjected to skin abrasion where the wounds were either left uninfected or were inoculated with a near lethal dose of multidrug resistant A. baumannii strain. Analyzed after 3 days, APO monomer-containing patches improved wound appearance significantly better than polymer patches without antibiotics. When compared to colistin, the APO patches accelerated wound healing, and statistically significantly reduced wound size and wound bacterial load. The in vivo antimicrobial effect was more extensive than after intramuscular administration of the peptide drug, by using only one tenth of the active pharmaceutical ingredient. These data suggest that the APO monomer-impregnated nanofiber dressing can be developed as an economical first-line treatment option to skin injuries in general and battlefield burn and blast injuries in particular. PMID:26319645

  5. Evaluation of five susceptibility test methods for detection of tobramycin resistance in a cluster of epidemiologically related Acinetobacter baumannii isolates.


    Moodley, V Mischka; Oliver, Stephen P; Shankland, Iva; Elisha, B Gay


    Acinetobacter baumannii is a major nosocomial pathogen causing infections in critically ill patients. This organism has acquired the propensity to rapidly develop resistance to most antibiotics. At several hospitals within Cape Town, South Africa, tobramycin and colistin are frequently the only therapeutic options. Vitek2 automated susceptibility testing (AST) is used in the clinical laboratory to determine selected susceptibility profiles. The suspicion of a possible AST-related technical error when testing for susceptibility to tobramycin in A. baumannii precipitated this study. Thirty-nine A. baumannii strains isolated from clinical specimens (June to December 2006) were included in this prospective study. Tobramycin susceptibility testing results obtained by AST, disc diffusion, the epsilometer test (Etest), and agar dilution were compared to those for broth microdilution (BMD), the reference method. The tobramycin susceptibility results revealed errors in 25/39 (64%) isolates (10 very major and 15 minor errors) when AST was compared to BMD, 12/39 (31%) (2 very major and 10 minor errors) when Etest was compared to BMD, 16/39 (41%) (3 very major and 13 minor errors) when disc diffusion was compared to BMD, and 21/39 (54%) (10 very major and 11 minor errors) when agar dilution was compared to BMD. Using PCR, we detected aac(3)-IIa, which is associated with tobramycin resistance, in 21/25 of the discrepant isolates. Molecular typing (using pulsed-field gel electrophoresis and repetitive sequence-based PCR [rep-PCR]) showed that these isolates were genetically related. Clinical laboratories that routinely use the Vitek2 system should consider an alternative testing method for determining susceptibility to tobramycin. PMID:23698528

  6. Impaired growth under iron-limiting conditions associated with the acquisition of colistin resistance in Acinetobacter baumannii.


    López-Rojas, Rafael; García-Quintanilla, Meritxell; Labrador-Herrera, Gema; Pachón, Jerónimo; McConnell, Michael J


    Acquisition of colistin resistance in Acinetobacter baumannii has been associated with reduced bacterial fitness and virulence, although the mechanisms underlying this fitness loss have not been well characterised. In this study, the role played by environmental iron levels on the growth and survival of colistin-resistant strains of A. baumannii was assessed. Growth assays with the colistin-susceptible ATCC 19606 strain and its colistin-resistant derivative RC64 [colistin minimum inhibitory concentration (MIC) of 64 mg/L] demonstrated that the strains grew similarly in rich laboratory medium (Mueller-Hinton broth), whereas RC64 demonstrated impaired growth compared with ATCC 19606 in human serum (>100-fold at 24 h). Compared with RC64, ATCC 19606 grew in the presence of higher concentrations of the iron-specific chelator 2,2'-bipyridine and grew more readily under iron-limiting conditions in solid and liquid media. In addition, iron supplementation of human serum increased the growth of RC64 compared with unsupplemented human serum to a greater extent than ATCC 19606. The ability of 11 colistin-resistant clinical isolates with mutations in the pmrB gene to grow in iron-replete and iron-limiting conditions was assessed, demonstrating that eight of the strains showed reduced growth under iron limitation. Individual mutations in the pmrB gene did not directly correlate with a decreased capacity for growth under iron limitation, suggesting that mutations in pmrB may not directly produce this phenotype. Together these results indicate that acquisition of colistin resistance in A. baumannii can be associated with a decreased ability to grow in low-iron environments. PMID:27179817

  7. Homologs of the Acinetobacter baumannii AceI Transporter Represent a New Family of Bacterial Multidrug Efflux Systems

    PubMed Central

    Liu, Qi; Henderson, Peter J. F.


    ABSTRACT Multidrug efflux systems are a major cause of resistance to antimicrobials in bacteria, including those pathogenic to humans, animals, and plants. These proteins are ubiquitous in these pathogens, and five families of bacterial multidrug efflux systems have been identified to date. By using transcriptomic and biochemical analyses, we recently identified the novel AceI (Acinetobacter chlorhexidine efflux) protein from Acinetobacter baumannii that conferred resistance to the biocide chlorhexidine, via an active efflux mechanism. Proteins homologous to AceI are encoded in the genomes of many other bacterial species and are particularly prominent within proteobacterial lineages. In this study, we expressed 23 homologs of AceI and examined their resistance and/or transport profiles. MIC analyses demonstrated that, like AceI, many of the homologs conferred resistance to chlorhexidine. Many of the AceI homologs conferred resistance to additional biocides, including benzalkonium, dequalinium, proflavine, and acriflavine. We conducted fluorimetric transport assays using the AceI homolog from Vibrio parahaemolyticus and confirmed that resistance to both proflavine and acriflavine was mediated by an active efflux mechanism. These results show that this group of AceI homologs represent a new family of bacterial multidrug efflux pumps, which we have designated the proteobacterial antimicrobial compound efflux (PACE) family of transport proteins. PMID:25670776

  8. Draft Genome Sequence of Colistin-Resistant Acinetobacter baumannii Strain VB22595 Isolated from a Central Line-Associated Bloodstream Infection.


    Veeraraghavan, Balaji; Anandan, Shalini; Ragupathi, Naveen Kumar Devanga; Vijayakumar, Saranya; Sethuvel, Dhiviya Prabaa Muthuirulandi; Biswas, Indranil


    Acinetobacter baumannii is an important emerging pathogen that causes health care-associated infections. In this study, we determined the genome of a multidrug-resistant clinical strain, VB22595, isolated from a hospital in Southern India. The draft genome indicates that strain VB22595 encodes a genome of ~3.92 Mb in size and does not contain plasmid derived MCR-1 for colistin resistance. PMID:27516521

  9. Inhibition of aminoglycoside 6'-N-acetyltransferase type Ib by zinc: reversal of amikacin resistance in Acinetobacter baumannii and Escherichia coli by a zinc ionophore.


    Lin, David L; Tran, Tung; Alam, Jamal Y; Herron, Steven R; Ramirez, Maria Soledad; Tolmasky, Marcelo E


    In vitro activity of the aminoglycoside 6'-N-acetyltransferase type Ib [AAC(6')-Ib] was inhibited by ZnCl2 with a 50% inhibitory concentration (IC50) of 15 μM. Growth of Acinetobacter baumannii or Escherichia coli harboring aac(6')-Ib in cultures containing 8 μg/ml amikacin was significantly inhibited by the addition of 2 μM Zn(2+) in complex with the ionophore pyrithione (ZnPT). PMID:24820083

  10. New PCR-Based Open Reading Frame Typing Method for Easy, Rapid, and Reliable Identification of Acinetobacter baumannii International Epidemic Clones without Performing Multilocus Sequence Typing

    PubMed Central

    Suzuki, Masahiro; Hosoba, Eriko; Matsui, Mari


    Antimicrobial resistance issues have become a global health concern. The rapid identification of multidrug-resistant microbes, which depends on microbial genomic information, is essential for overcoming growing antimicrobial resistance challenges. However, genotyping methods, such as multilocus sequence typing (MLST), for identifying international epidemic clones of Acinetobacter baumannii are not easily performed as routine tests in ordinary clinical laboratories. In this study, we aimed to develop a novel genotyping method that can be performed in ordinary microbiology laboratories. Several open reading frames (ORFs) specific to certain bacterial genetic lineages or species, together with their unique distribution patterns on the chromosomes showing a good correlation with the results of MLST, were selected in A. baumannii and other Acinetobacter spp. by comparing their genomic data. The distribution patterns of the ORFs were visualized by agarose gel electrophoresis after multiplex PCR amplification and digitized. A. baumannii sequence types (STs) corresponding to international clones I and II were successfully discriminated from other STs and Acinetobacter species by detecting the distribution patterns of their ORFs using the multiplex PCR developed here. Since bacterial STs can be easily expressed as digitized numeric data with plus (+) expressed as 1 and minus (−) expressed as 0, the results of the method can be easily compared with those obtained by different tests or laboratories. This PCR-based ORF typing (POT) method can easily and rapidly identify international epidemic clones of A. baumannii and differentiate this microbe from other Acinetobacter spp. Since this POT method is easy enough to be performed even in ordinary clinical laboratories, it would also contribute to daily infection control measures and surveillance. PMID:24899031

  11. Draft Genome Sequence of Colistin-Resistant Acinetobacter baumannii Strain VB22595 Isolated from a Central Line-Associated Bloodstream Infection

    PubMed Central

    Veeraraghavan, Balaji; Anandan, Shalini; Ragupathi, Naveen Kumar Devanga; Vijayakumar, Saranya; Sethuvel, Dhiviya Prabaa Muthuirulandi


    Acinetobacter baumannii is an important emerging pathogen that causes health care-associated infections. In this study, we determined the genome of a multidrug-resistant clinical strain, VB22595, isolated from a hospital in Southern India. The draft genome indicates that strain VB22595 encodes a genome of ~3.92 Mb in size and does not contain plasmid derived MCR-1 for colistin resistance. PMID:27516521

  12. Polymyxin Resistance in Acinetobacter baumannii: Genetic Mutations and Transcriptomic Changes in Response to Clinically Relevant Dosage Regimens

    PubMed Central

    Cheah, Soon-Ee; Johnson, Matthew D.; Zhu, Yan; Tsuji, Brian T.; Forrest, Alan; Bulitta, Jurgen B.; Boyce, John D.; Nation, Roger L.; Li, Jian


    Polymyxins are often last-line therapeutic agents used to treat infections caused by multidrug-resistant A. baumannii. Recent reports of polymyxin-resistant A. baumannii highlight the urgent need for research into mechanisms of polymyxin resistance. This study employed genomic and transcriptomic analyses to investigate the mechanisms of polymyxin resistance in A. baumannii AB307-0294 using an in vitro dynamic model to mimic four different clinically relevant dosage regimens of polymyxin B and colistin over 96 h. Polymyxin B dosage regimens that achieved peak concentrations above 1 mg/L within 1 h caused significant bacterial killing (~5 log10CFU/mL), while the gradual accumulation of colistin resulted in no bacterial killing. Polymyxin resistance was observed across all dosage regimens; partial reversion to susceptibility was observed in 6 of 8 bacterial samples during drug-free passaging. Stable polymyxin-resistant samples contained a mutation in pmrB. The transcriptomes of stable and non-stable polymyxin-resistant samples were not substantially different and featured altered expression of genes associated with outer membrane structure and biogenesis. These findings were further supported via integrated analysis of previously published transcriptomics data from strain ATCC19606. Our results provide a foundation for understanding the mechanisms of polymyxin resistance following exposure to polymyxins and the need to explore effective combination therapies. PMID:27195897

  13. Polymyxin Resistance in Acinetobacter baumannii: Genetic Mutations and Transcriptomic Changes in Response to Clinically Relevant Dosage Regimens.


    Cheah, Soon-Ee; Johnson, Matthew D; Zhu, Yan; Tsuji, Brian T; Forrest, Alan; Bulitta, Jurgen B; Boyce, John D; Nation, Roger L; Li, Jian


    Polymyxins are often last-line therapeutic agents used to treat infections caused by multidrug-resistant A. baumannii. Recent reports of polymyxin-resistant A. baumannii highlight the urgent need for research into mechanisms of polymyxin resistance. This study employed genomic and transcriptomic analyses to investigate the mechanisms of polymyxin resistance in A. baumannii AB307-0294 using an in vitro dynamic model to mimic four different clinically relevant dosage regimens of polymyxin B and colistin over 96 h. Polymyxin B dosage regimens that achieved peak concentrations above 1 mg/L within 1 h caused significant bacterial killing (~5 log10CFU/mL), while the gradual accumulation of colistin resulted in no bacterial killing. Polymyxin resistance was observed across all dosage regimens; partial reversion to susceptibility was observed in 6 of 8 bacterial samples during drug-free passaging. Stable polymyxin-resistant samples contained a mutation in pmrB. The transcriptomes of stable and non-stable polymyxin-resistant samples were not substantially different and featured altered expression of genes associated with outer membrane structure and biogenesis. These findings were further supported via integrated analysis of previously published transcriptomics data from strain ATCC19606. Our results provide a foundation for understanding the mechanisms of polymyxin resistance following exposure to polymyxins and the need to explore effective combination therapies. PMID:27195897

  14. A combination of tigecycline, colistin, and meropenem against multidrug-resistant Acinetobacter baumannii bacteremia in a renal transplant recipient: pharmacodynamic and microbiological aspects.


    Candel, F J; Calvo, N; Head, J; Sánchez, A; Matesanz, M; Culebras, E; Barrientos, A; Picazo, J


    Acinetobacter baumannii are emerging as the causal agents of healthcare-associated infections. We describe arenal transplant recipient who developed bacteremia caused by multiresistant A. baumannii, which received a combination of tigecycline, colistin, and meropenem in continuous infusion. The clinical outcome was favorable. In this article we made a molecular study of this multiresistant strain. Our analysis reveals the presence of abla-OXA-72 gene,a class D of oxacillinase belonging to bla-OXA-40-like group,which constitutes the most disseminated familiy of carbapenemases in Spain. Thus, we found different susceptibility patterns of A. baumannii when we used different Mueller-Hinton agars with different manganese concentrations. Lastly, we explain the combination of these three antibiotics administered to increase microbiologic and pharmacodynamic yield. PMID:20559610

  15. Association between β-Lactamase-Encoding blaOXA-51 Variants and DiversiLab Rep-PCR-Based Typing of Acinetobacter baumannii Isolates

    PubMed Central

    Zander, Esther; Nemec, Alexandr; Seifert, Harald


    This study investigated the correlation between blaOXA-51 variants and Acinetobacter baumannii worldwide clonal lineages 1 to 8 (WW1 to -8). The blaOXA-51-like genes of 102 A. baumannii isolates were sequenced. Using DiversiLab repetitive-sequence-based PCR (rep-PCR) typing, 92 of these isolates had previously been assigned to WW1 to -8 and 10 were unclustered. Clustering of DNA sequences was performed using the neighbor-joining method and the Jukes-Cantor phylogenetic correction. blaOXA-51 variants were in good correlation with DiversiLab-defined clonal lineages. Sequence-based typing of blaOXA-51 variants has the potential to be applied for epidemiologic characterization of A. baumannii and to identify worldwide clonal lineages 1 to 8. PMID:22422849

  16. Prophage induction and differential RecA and UmuDAb transcriptome regulation in the DNA damage responses of Acinetobacter baumannii and Acinetobacter baylyi.


    Hare, Janelle M; Ferrell, Joshua C; Witkowski, Travis A; Grice, Alison N


    The SOS response to DNA damage that induces up to 10% of the prokaryotic genome requires RecA action to relieve LexA transcriptional repression. In Acinetobacter species, which lack LexA, the error-prone polymerase accessory UmuDAb is instead required for ddrR induction after DNA damage, suggesting it might be a LexA analog. RNA-Seq experiments defined the DNA damage transcriptome (mitomycin C-induced) of wild type, recA and umuDAb mutant strains of both A. baylyi ADP1 and A. baumannii ATCC 17978. Of the typical SOS response genes, few were differentially regulated in these species; many were repressed or absent. A striking 38.4% of all ADP1 genes, and 11.4% of all 17978 genes, were repressed under these conditions. In A. baylyi ADP1, 66 genes (2.0% of the genome), including a CRISPR/Cas system, were DNA damage-induced, and belonged to four regulons defined by differential use of recA and umuDAb. In A. baumannii ATCC 17978, however, induction of 99% of the 152 mitomycin C-induced genes depended on recA, and only 28 of these genes required umuDAb for their induction. 90% of the induced A. baumannii genes were clustered in three prophage regions, and bacteriophage particles were observed after mitomycin C treatment. These prophages encoded esvI, esvK1, and esvK2, ethanol-stimulated virulence genes previously identified in a Caenorhabditis elegans model, as well as error-prone polymerase alleles. The induction of all 17978 error-prone polymerase alleles, whether prophage-encoded or not, was recA dependent, but only these DNA polymerase V-related genes were de-repressed in the umuDAb mutant in the absence of DNA damage. These results suggest that both species possess a robust and complex DNA damage response involving both recA-dependent and recA-independent regulons, and further demonstrates that although umuDAb has a specialized role in repressing error-prone polymerases, additional regulators likely participate in these species' transcriptional response to DNA damage

  17. Prophage Induction and Differential RecA and UmuDAb Transcriptome Regulation in the DNA Damage Responses of Acinetobacter baumannii and Acinetobacter baylyi

    PubMed Central

    Hare, Janelle M.; Ferrell, Joshua C.; Witkowski, Travis A.; Grice, Alison N.


    The SOS response to DNA damage that induces up to 10% of the prokaryotic genome requires RecA action to relieve LexA transcriptional repression. In Acinetobacter species, which lack LexA, the error-prone polymerase accessory UmuDAb is instead required for ddrR induction after DNA damage, suggesting it might be a LexA analog. RNA-Seq experiments defined the DNA damage transcriptome (mitomycin C-induced) of wild type, recA and umuDAb mutant strains of both A. baylyi ADP1 and A. baumannii ATCC 17978. Of the typical SOS response genes, few were differentially regulated in these species; many were repressed or absent. A striking 38.4% of all ADP1 genes, and 11.4% of all 17978 genes, were repressed under these conditions. In A. baylyi ADP1, 66 genes (2.0% of the genome), including a CRISPR/Cas system, were DNA damage-induced, and belonged to four regulons defined by differential use of recA and umuDAb. In A. baumannii ATCC 17978, however, induction of 99% of the 152 mitomycin C-induced genes depended on recA, and only 28 of these genes required umuDAb for their induction. 90% of the induced A. baumannii genes were clustered in three prophage regions, and bacteriophage particles were observed after mitomycin C treatment. These prophages encoded esvI, esvK1, and esvK2, ethanol-stimulated virulence genes previously identified in a Caenorhabditis elegans model, as well as error-prone polymerase alleles. The induction of all 17978 error-prone polymerase alleles, whether prophage-encoded or not, was recA dependent, but only these DNA polymerase V-related genes were de-repressed in the umuDAb mutant in the absence of DNA damage. These results suggest that both species possess a robust and complex DNA damage response involving both recA-dependent and recA-independent regulons, and further demonstrates that although umuDAb has a specialized role in repressing error-prone polymerases, additional regulators likely participate in these species' transcriptional response to DNA damage

  18. In vitro activity of colistin in antimicrobial combination against carbapenem-resistant Acinetobacter baumannii isolated from patients with ventilator-associated pneumonia in Vietnam.


    Le Minh, Vien; Thi Khanh Nhu, Nguyen; Vinh Phat, Voong; Thompson, Corinne; Huong Lan, Nguyen Phu; Thieu Nga, Tran Vu; Thanh Tam, Pham Thi; Tuyen, Ha Thanh; Hoang Nhu, Tran Do; Van Hao, Nguyen; Thi Loan, Huynh; Minh Yen, Lam; Parry, Christopher M; Trung Nghia, Ho Dang; Campbell, James I; Hien, Tran Tinh; Thwaites, Louise; Thwaites, Guy; Van Vinh Chau, Nguyen; Baker, Stephen


    Acinetobacter baumannii has become one of the major infection threats in intensive care units (ICUs) globally. Since 2008, A. baumannii has been the leading cause of ventilator-associated pneumonia (VAP) in our ICU at an infectious disease hospital in southern Vietnam. The emergence of this pathogen in our setting is consistent with the persistence of a specific clone exhibiting resistance to carbapenems. Antimicrobial combinations may be a strategy to treat infections caused by these carbapenem-resistant A. baumannii. Therefore, we assessed potential antimicrobial combinations against local carbapenem-resistant A. baumannii by measuring in vitro interactions of colistin with four antimicrobials that are locally certified for treating VAP. We first performed antimicrobial susceptibility testing and multilocus variable number tandem repeat analysis (MLVA) genotyping on 74 A. baumannii isolated from quantitative tracheal aspirates from patients with VAP over an 18-month period. These 74 isolates could be subdivided into 21 main clusters by MLVA and >80 % were resistant to carbapenems. We selected 56 representative isolates for in vitro combination synergy testing. Synergy was observed in four (7 %), seven (13 %), 20 (36 %) and 38 (68 %) isolates with combinations of colistin with ceftazidime, ceftriaxone, imipenem and meropenem, respectively. Notably, more carbapenem-resistant A. baumannii isolates (36/43; 84 %) exhibited synergistic activity with a combination of colistin and meropenem than carbapenem-susceptible A. baumannii isolates (2/13; 15 %) (P = 0.023; Fisher's exact test). Our findings suggest that combinations of colistin and meropenem should be considered when treating carbapenem-resistant A. baumannii infections in Vietnam, and we advocate clinical trials investigating combination therapy for VAP. PMID:26297024

  19. In vitro activities of sitafloxacin tested alone and in combination with rifampin, colistin, sulbactam, and tigecycline against extensively drug-resistant Acinetobacter baumannii

    PubMed Central

    Dong, Xiaomeng; Chen, Fengzhe; Zhang, Yajun; Liu, Haihong; Liu, Yongjuan; Ma, Lixian


    Objectives: To detect the in vitro activities of sitafloxacin alone and in combination with rifampin, colistin, sulbactam, and tigecycline against extensively drug-resistant Acinetobacter baumannii (XDR-A. baumannii). Materials and methods: 24 XDR-A. baumannii strains were isolated from patients’ specimens. Broth microdilution assay was used to determine the minimum inhibitory concentration (MIC) for sitafloxacin, rifampin, colistin, sulbactam, and tigecycline against XDR-A. baumannii strains. The checkerboard microdilution method was used to determine the in vitro activities of sitafloxacin combined with the other four antimicrobial agents. Accordingly, the fractional inhibitory concentration (FIC) and FIC index (FICI) were calculated for each of the combinations. Results: According to our results, when tested alone, the rate of susceptibility for sitafloxacin was 91.67% against XDR-A. baumannii, followed by colistin 62.5%, and then tigecycline 54.17%, rifampin 41.67%. Sulbactam, with a 16.67% rate of susceptibility was the least effective one. On the other hand, when tested in combination, all those three combinations except tigecycline/sitafloxacin revealed remarkable synergistic effects. Colistin/sitafloxacin showed the highest indifference rate. These combination regimens could exert addictive or partially-synergistic effects at the sub-MIC levels against XDR-A. baumannii strains. Conclusion: Sitafloxacin has acceptable in vitro activity against XDR-A. baumannii strains as well as tigecycline, rifampin and colistin. Compared with single drugs, most of the combinations of these antimicrobial agents could exert synergistic and/or partially synergistic and/or addictive effects, which might provide a better alternative when treating XDR-A. baumannii infections. PMID:26221381

  20. GES-11-producing Acinetobacter baumannii clinical isolates from Tunisian hospitals: Long-term dissemination of GES-type carbapenemases in North Africa.


    Chihi, H; Bonnin, R A; Bourouis, A; Mahrouki, S; Besbes, S; Moussa, M Ben; Belhadj, O; Naas, T


    Acinetobacter baumannii is an emerging threat in healthcare facilities owing to its ability to be multidrug-resistant (MDR) and to be involved in outbreaks. GES-type extended-spectrum β-lactamases (ESBLs) have been increasingly identified in A. baumannii. In this study, clinical A. baumannii isolates were characterised using standard biochemical methods and antibiotic susceptibility testing. Antibiotic resistance genes were sought by PCR and sequencing. Genetic support was characterised using S1 nuclease pulsed-field gel electrophoresis (PFGE) mapping, conjugation and electroporation assays. The genetic environment was investigated by PCR, and genetic relatedness was investigated by PFGE. Two MDR A. baumannii clinical isolates susceptible only to colistin and rifampicin were isolated from a tracheal aspirate of a 49-year-old woman hospitalised in 2006 at the Military Hospital of Tunis, Tunisia, and from a tracheal aspirate of a 53-year-old man hospitalised in 2010 at the Institut Orthopédique Mohamed El Kassab of Tunis, Tunisia. PCR revealed that the two isolates harboured the acquired carbapenemase blaOXA-23 and ESBL blaGES-11 genes along with chromosomally-encoded blaOXA-51 and blaADC-like genes. PFGE revealed that these A. baumannii isolates were unrelated; nevertheless, plasmid analysis revealed a similar sized plasmid following electrophoresis of the isolates. In addition, A. baumannii CIP70.10 transformants displayed similar resistance patterns. blaGES-11 was integron-borne and the ISAbaI element was identified upstream of blaOXA-23 and blaADC-like. Here we described two unrelated clinical A. baumannii isolates producing GES-11 ESBL and OXA-23 carbapenemase from two Tunisian hospitals. This work further illustrates the emergence of GES-type β-lactamases in A. baumannii in North Africa as early as 2006. PMID:27436466

  1. Contamination of Ambient Air with Acinetobacter baumannii on Consecutive Inpatient Days.


    Shimose, Luis A; Doi, Yohei; Bonomo, Robert A; De Pascale, Dennise; Viau, Roberto A; Cleary, Timothy; Namias, Nicholas; Kett, Daniel H; Munoz-Price, L Silvia


    Acinetobacter-positive patients had their ambient air tested for up to 10 consecutive days. The air was Acinetobacter positive for an average of 21% of the days; the rate of contamination was higher among patients colonized in the rectum than in the airways (relative risk [RR], 2.35; P = 0.006). Of the 6 air/clinical isolate pairs available, 4 pairs were closely related according to rep-PCR results. PMID:25926496

  2. Rapid Molecular Characterization of Acinetobacter baumannii Clones with rep-PCR and Evaluation of Carbapenemase Genes by New Multiplex PCR in Hospital District of Helsinki and Uusimaa

    PubMed Central

    Pasanen, Tanja; Koskela, Suvi; Mero, Sointu; Tarkka, Eveliina; Tissari, Päivi; Vaara, Martti; Kirveskari, Juha


    Multidrug-resistant Acinetobacter baumannii (MDRAB) is an increasing problem worldwide. Prevalence of carbapenem resistance in Acinetobacter spp. due to acquired carbapenemase genes is not known in Finland. The purpose of this study was to examine prevalence and clonal spread of multiresistant A. baumannii group species, and their carbapenemase genes. A total of 55 Acinetobacter isolates were evaluated with repetitive PCR (DiversiLab) to analyse clonality of isolates, in conjunction with antimicrobial susceptibility profile for ampicillin/sulbactam, colistin, imipenem, meropenem, rifampicin and tigecycline. In addition, a new real-time PCR assay, detecting most clinically important carbapenemase genes just in two multiplex reactions, was developed. The assay detects genes for KPC, VIM, IMP, GES-1/-10, OXA-48, NDM, GIM-1, SPM-1, IMI/NMC-A, SME, CMY-10, SFC-1, SIM-1, OXA-23-like, OXA-24/40-like, OXA-58 and ISAbaI-OXA-51-like junction, and allows confident detection of isolates harbouring acquired carbapenemase genes. There was a time-dependent, clonal spread of multiresistant A. baumannii strongly correlating with carbapenamase gene profile, at least in this geographically restricted study material. The new carbapenemase screening assay was able to detect all the genes correctly suggesting it might be suitable for epidemiologic screening purposes in clinical laboratories. PMID:24465749

  3. Piscidin is Highly Active against Carbapenem-Resistant Acinetobacter baumannii and NDM-1-Producing Klebsiella pneumonia in a Systemic Septicaemia Infection Mouse Model

    PubMed Central

    Pan, Chieh-Yu; Chen, Jian-Chyi; Chen, Te-Li; Wu, Jen-Leih; Hui, Cho-Fat; Chen, Jyh-Yih


    This study was designed to investigate the antimicrobial activity of two synthetic antimicrobial peptides from an aquatic organism, tilapia piscidin 3 (TP3) and tilapia piscidin 4 (TP4), in vitro and in a murine sepsis model, as compared with ampicillin, tigecycline, and imipenem. Mice were infected with (NDM-1)-producing K. pneumonia and multi-drug resistant Acinetobacter baumannii, and subsequently treated with TP3, TP4, or antibiotics for different periods of time (up to 168 h). Mouse survival and bacterial colony forming units (CFU) in various organs were measured after each treatment. Toxicity was determined based on observation of behavior and measurement of biochemical parameters. TP3 and TP4 exhibited strong activity against K. pneumonia and A. baumannii in vitro. Administration of TP3 (150 μg/mouse) or TP4 (50 μg/mouse) 30 min after infection with K. pneumonia or A. baumannii significantly increased survival in mice. TP4 was more effective than tigecycline at reducing CFU counts in several organs. TP3 and TP4 were shown to be non-toxic, and did not affect mouse behavior. TP3 and TP4 are able at potentiate anti-Acinetobacter baumannii or anti-Klebsiella pneumonia drug activity, reduce bacterial load, and prevent drug resistance, indicating their potential for use in combating multidrug-resistant bacteria. PMID:25874924

  4. Prevalence of metallo-beta-lactamase among Pseudomonas aeruginosa and Acinetobacter baumannii in a Korean university hospital and comparison of screening methods for detecting metallo-beta-lactamase.


    Oh, Eun-Jee; Lee, Seungok; Park, Yeon-Joon; Park, Jung Jun; Park, Kanggyun; Kim, Sang-Il; Kang, Moon Won; Kim, Byung Kee


    To identify the metallo-beta-lactamases (MBLs) prevalent in Korea, a total of 130 clinical isolates of Pseudomonas aeruginosa and Acinetobacter baumannii (99 P. aeruginosa and 31 A. baumannii) with a reduced susceptibility to imipenem (IPM) and/or ceftazidime (CAZ) was subjected to PCR analyses with primers specific to bla(IMP-1), bla(VIM-1), and bla(VIM-2). In addition, inhibitor-potentiated disk diffusion methods (IPD) using two kinds of substrate-inhibitor combinations (ceftazidime-2-mercaptopropionic acid (2MPA) and imipenem-EDTA) were investigated. Thirty-three isolates (29 P. aeruginosa and 4 A. baumannii) carried bla(VIM-2) and two P. aeruginosa isolates harbored bla(IMP-1). The enterobacterial repetitive intergenic consensus PCR (ERIC-PCR) pattern revealed that many of the VIM-2-producing P. aeruginosa isolates were clonally related, whereas the A. baumannii isolates were diverse. The inhibitor-potentiated disk diffusion test using imipenem-EDTA was highly sensitive and specific for detecting the VIM-2 producer. These results suggest that VIM-2 is an important MBL in P. aeruginosa and A. baumannii in the Korean hospital of this study and that the IMP-1-producing P. aeruginosa has also emerged. Screening for MBLs and strict infection control for these isolates will contribute to prevent further spread of resistance. PMID:12842488

  5. Minocycline activity tested against Acinetobacter baumannii complex, Stenotrophomonas maltophilia, and Burkholderia cepacia species complex isolates from a global surveillance program (2013).


    Flamm, Robert K; Castanheira, Mariana; Streit, Jennifer M; Jones, Ronald N


    Clinical isolates of Acinetobacter baumannii complex (1312), Stenotrophomonas maltophilia (464), and Burkholderia cepacia species complex (30) were selected from medical centers in the United States (USA), Europe and the Mediterranean (EU-M) region, Latin America, and Asia Pacific. Only one isolate per infected patient episode was included and local identifications were confirmed by the monitoring laboratory. Susceptibility testing was performed at the monitoring laboratory using the reference broth microdilution method as described by Clinical and Laboratory Standards Institute (CLSI). A. baumannii complex were classified as MDR (multi-drug resistant [MDR]; nonsusceptible to ≥1 agent in ≥3 antimicrobial classes) and extensively drug-resistant (XDR; nonsusceptible to ≥1 agent in all but ≤2 antimicrobial classes). A total of 81.6% of A. baumannii complex were MDR. Colistin was the most active agent against MDR A. baumannii complex. Minocycline was the most active "tetracycline" against these organisms based on susceptibility. Against B. cepacia, trimethoprim-sulfamethoxazole (MIC90, 2 μg/mL; 100.0% susceptible) was the most active agent tested. Overall, minocycline was the most active tetracycline tested against A. baumannii complex and S. maltophilia isolates collected from patients throughout EU-M, USA, Latin America, and the Asia-Pacific. Minocycline, particularly the intravenous formulation, has activity against several ESKAPE pathogens and merits consideration in seriously ill patients where treatment options may be limited due to the presence of MDR bacteria. PMID:27112832

  6. Complete genome sequence of hypervirulent and outbreak-associated Acinetobacter baumannii strain LAC-4: epidemiology, resistance genetic determinants and potential virulence factors

    PubMed Central

    Ou, Hong-Yu; Kuang, Shan N.; He, Xinyi; Molgora, Brenda M.; Ewing, Peter J.; Deng, Zixin; Osby, Melanie; Chen, Wangxue; Xu, H. Howard


    Acinetobacter baumannii is an important human pathogen due to its multi-drug resistance. In this study, the genome of an ST10 outbreak A. baumannii isolate LAC-4 was completely sequenced to better understand its epidemiology, antibiotic resistance genetic determinants and potential virulence factors. Compared with 20 other complete genomes of A. baumannii, LAC-4 genome harbors at least 12 copies of five distinct insertion sequences. It contains 12 and 14 copies of two novel IS elements, ISAba25 and ISAba26, respectively. Additionally, three novel composite transposons were identified: Tn6250, Tn6251 and Tn6252, two of which contain resistance genes. The antibiotic resistance genetic determinants on the LAC-4 genome correlate well with observed antimicrobial susceptibility patterns. Moreover, twelve genomic islands (GI) were identified in LAC-4 genome. Among them, the 33.4-kb GI12 contains a large number of genes which constitute the K (capsule) locus. LAC-4 harbors several unique putative virulence factor loci. Furthermore, LAC-4 and all 19 other outbreak isolates were found to harbor a heme oxygenase gene (hemO)-containing gene cluster. The sequencing of the first complete genome of an ST10 A. baumannii clinical strain should accelerate our understanding of the epidemiology, mechanisms of resistance and virulence of A. baumannii. PMID:25728466

  7. Infection Control Programs and Antibiotic Control Programs to Limit Transmission of Multi-Drug Resistant Acinetobacter baumannii Infections: Evolution of Old Problems and New Challenges for Institutes

    PubMed Central

    Chen, Chang-Hua; Lin, Li-Chen; Chang, Yu-Jun; Chen, Yu-Min; Chang, Chin-Yen; Huang, Chieh-Chen


    Background: Acinetobacter baumannii complex (A. baumannii) has been isolated worldwide. The rapid spread of multidrug-resistant A. baumannii complex (MDRAB) in clinical settings has made choosing an appropriate antibiotic to treat these infections and executing contact precautions difficult for clinicians. Although controlling the transmission of MDRAB is a high priority for institutions, there is little information about MDRAB control. Therefore, this study evaluated infection control measures for A. baumannii infections, clusters and outbreaks in the literature. Methods: We performed a review of OVID Medline (from 1980 to 2015), and analyzed the literature. Results: We propose that both infection control programs and antibiotic control programs are essential for control of MDRAB. The first, effective control of MDRAB infections, requires compliance with a series of infection control methods including strict environmental cleaning, effective sterilization of reusable medical equipment, concentration on proper hand hygiene practices, and use of contact precautions, together with appropriate administrative guidance. The second strategy, effective antibiotic control programs to decrease A. baumannii, is also of paramount importance. Conclusion: We believe that both infection control programs and antibiotics stewardship programs are essential for control of MDRAB infections. PMID:26264006

  8. Contribution of Resistance-Nodulation-Cell Division Efflux Systems to Antibiotic Resistance and Biofilm Formation in Acinetobacter baumannii

    PubMed Central

    Yoon, Eun-Jeong; Nait Chabane, Yassine; Goussard, Sylvie; Snesrud, Erik; Courvalin, Patrice; Dé, Emmanuelle


    ABSTRACT Acinetobacter baumannii is a nosocomial pathogen of increasing importance due to its multiple resistance to antibiotics and ability to survive in the hospital environment linked to its capacity to form biofilms. To fully characterize the contribution of AdeABC, AdeFGH, and AdeIJK resistance-nodulation-cell division (RND)-type efflux systems to acquired and intrinsic resistance, we constructed, from an entirely sequenced susceptible A. baumannii strain, a set of isogenic mutants overexpressing each system following introduction of a point mutation in their cognate regulator or a deletion for the pump by allelic replacement. Pairwise comparison of every derivative with the parental strain indicated that AdeABC and AdeFGH are tightly regulated and contribute to acquisition of antibiotic resistance when overproduced. AdeABC had a broad substrate range, including β-lactams, fluoroquinolones, tetracyclines-tigecycline, macrolides-lincosamides, and chloramphenicol, and conferred clinical resistance to aminoglycosides. Importantly, when combined with enzymatic resistance to carbapenems and aminoglycosides, this pump contributed in a synergistic fashion to the level of resistance of the host. In contrast, AdeIJK was expressed constitutively and was responsible for intrinsic resistance to the same major drug classes as AdeABC as well as antifolates and fusidic acid. Surprisingly, overproduction of AdeABC and AdeIJK altered bacterial membrane composition, resulting in decreased biofilm formation but not motility. Natural transformation and plasmid transfer were diminished in recipients overproducing AdeABC. It thus appears that alteration in the expression of efflux systems leads to multiple changes in the relationship between the host and its environment, in addition to antibiotic resistance. PMID:25805730

  9. Epidemic Diffusion of OXA-23-Producing Acinetobacter baumannii Isolates in Italy: Results of the First Cross-Sectional Countrywide Survey

    PubMed Central

    Principe, Luigi; Piazza, Aurora; Giani, Tommaso; Bracco, Silvia; Caltagirone, Maria Sofia; Arena, Fabio; Nucleo, Elisabetta; Tammaro, Federica; Rossolini, Gian Maria; Pagani, Laura


    Carbapenem-resistant Acinetobacter baumannii (CRAb) is emerging worldwide as a public health problem in various settings. The aim of this study was to investigate the prevalence of CRAb isolates in Italy and to characterize their resistance mechanisms and genetic relatedness. A countrywide cross-sectional survey was carried out at 25 centers in mid-2011. CRAb isolates were reported from all participating centers, with overall proportions of 45.7% and 22.2% among consecutive nonreplicate clinical isolates of A. baumannii from inpatients (n = 508) and outpatients (n = 63), respectively. Most of them were resistant to multiple antibiotics, whereas all remained susceptible to colistin, with MIC50 and MIC90 values of ≤0.5 mg/liter. The genes coding for carbapenemase production were identified by PCR and sequencing. OXA-23 enzymes (found in all centers) were by far the most common carbapenemases (81.7%), followed by OXA-58 oxacillinases (4.5%), which were found in 7 of the 25 centers. In 6 cases, CRAb isolates carried both blaOXA-23-like and blaOXA-58-like genes. A repetitive extragenic palindromic (REP)-PCR technique, multiplex PCRs for group identification, and multilocus sequence typing (MLST) were used to determine the genetic relationships among representative isolates (n = 55). Two different clonal lineages were identified, including a dominant clone of sequence type 2 (ST2) related to the international clone II (sequence group 1 [SG1], SG4, and SG5) and a clone of ST78 (SG6) previously described in Italy. Overall, our results demonstrate that OXA-23 enzymes have become the most prevalent carbapenemases and are now endemic in Italy. In addition, molecular typing profiles showed the presence of international and national clonal lineages in Italy. PMID:24920776

  10. Toxic Accumulation of LPS Pathway Intermediates Underlies the Requirement of LpxH for Growth of Acinetobacter baumannii ATCC 19606.


    Richie, Daryl L; Takeoka, Kenneth T; Bojkovic, Jade; Metzger, Louis E; Rath, Christopher M; Sawyer, William S; Wei, Jun-Rong; Dean, Charles R


    The lipid A moiety of lipopolysaccharide (LPS) is the main constituent of the outer leaflet of the Gram-negative bacterial outer membrane (OM) and is essential in many Gram-negative pathogens. An exception is Acinetobacter baumannii ATCC 19606, where mutants lacking enzymes occurring early in lipid A biosynthesis (LpxA, LpxC or LpxD), and correspondingly lacking LPS, can grow. In contrast, we show here that LpxH, an enzyme that occurs downstream of LpxD in the lipid A biosynthetic pathway, is essential for growth in this strain. Multiple attempts to disrupt lpxH on the genome were unsuccessful, and when LpxH expression was controlled by an isopropyl β-d-1-thiogalactopyranoside (IPTG) inducible promoter, cell growth under typical laboratory conditions required IPTG induction. Mass spectrometry analysis of cells shifted from LpxH-induced to uninduced (and whose growth was correspondingly slowing as LpxH was depleted) showed a large cellular accumulation of UDP-2,3-diacyl-GlcN (substrate of LpxH), a C14:0(3-OH) acyl variant of the LpxD substrate (UDP-3-O-[(R)-3-OH-C14]-GlcN), and disaccharide 1-monophosphate (DSMP). Furthermore, the viable cell counts of the LpxH depleted cultures dropped modestly, and electron microscopy revealed clear defects at the cell (inner) membrane, suggesting lipid A intermediate accumulation was toxic. Consistent with this, blocking the synthesis of these intermediates by inhibition of the upstream LpxC enzyme using CHIR-090 abrogated the requirement for IPTG induction of LpxH. Taken together, these data indicate that LpxH is essential for growth in A. baumannii ATCC19606, because, unlike earlier pathway steps like LpxA or LpxC, blockage of LpxH causes accumulation of detergent-like pathway intermediates that prevents cell growth. PMID:27526195

  11. Frequency of Aminoglycoside-Modifying Enzymes and ArmA Among Different Sequence Groups of Acinetobacter baumannii in Iran.


    Hasani, Alka; Sheikhalizadeh, Vajihe; Ahangarzadeh Rezaee, Mohammad; Rahmati-Yamchi, Mohammad; Hasani, Akbar; Ghotaslou, Reza; Goli, Hamid Reza


    We evaluated aminoglycoside resistance in 87 Acinetobacter baumannii strains isolated from four hospitals located in the North West region of Iran and typed them in sequence groups (SGs) using trilocus sequence-based scheme to compare their clonal relationships with international clones. Resistance toward aminoglycosides was assayed by minimum inhibitory concentration (MIC) and presence of aminoglycoside-modifying enzymes (AMEs), and ArmA-encoding genes were evaluated in different SGs. The majority of isolates belonged to SG1 (39%), SG2 (33.3%), and SG3 (12.6%), whereas the remaining ones were assigned to six novel variants of SGs. MIC determination revealed netilmicin as the most and kanamycin as the least active aminoglycosides against all groups. Among the varied SGs, isolates of SG2 showed more susceptibility toward all tested aminoglycosides. APH(3'')-VIa-encoding gene was predominant in SG1 (47%), SG2 (62%), and SG6-9 (100%). However, AAC(3')-Ia (100%) and ANT(2')-Ia (90.9%) were the dominant AMEs in SG3. There was significant association between harboring of aminoglycoside resistance genes and specific aminoglycosides: gene encoded by APH(3')-VIa was allied to resistance against amikacin and kanamycin, whereas ANT(2')-Ia was related to the resistance toward gentamicin and tobramycin in SG2. In SG1, tobramycin resistance was correlated with harboring of AAC(6')-Ib. Screening of armA demonstrated the presence of this gene in SG1 (58.8%), SG2 (10.3%), as well as SG3 (9%). Our results revealed definite correlation between the phenotypes and genotypes of aminoglycoside resistance in different clonal lineages of A. baumannii. PMID:26779992

  12. Toxic Accumulation of LPS Pathway Intermediates Underlies the Requirement of LpxH for Growth of Acinetobacter baumannii ATCC 19606

    PubMed Central

    Richie, Daryl L.; Takeoka, Kenneth T.; Bojkovic, Jade; Metzger, Louis E.; Rath, Christopher M.; Sawyer, William S.; Wei, Jun-Rong; Dean, Charles R.


    The lipid A moiety of lipopolysaccharide (LPS) is the main constituent of the outer leaflet of the Gram-negative bacterial outer membrane (OM) and is essential in many Gram-negative pathogens. An exception is Acinetobacter baumannii ATCC 19606, where mutants lacking enzymes occurring early in lipid A biosynthesis (LpxA, LpxC or LpxD), and correspondingly lacking LPS, can grow. In contrast, we show here that LpxH, an enzyme that occurs downstream of LpxD in the lipid A biosynthetic pathway, is essential for growth in this strain. Multiple attempts to disrupt lpxH on the genome were unsuccessful, and when LpxH expression was controlled by an isopropyl β-d-1-thiogalactopyranoside (IPTG) inducible promoter, cell growth under typical laboratory conditions required IPTG induction. Mass spectrometry analysis of cells shifted from LpxH-induced to uninduced (and whose growth was correspondingly slowing as LpxH was depleted) showed a large cellular accumulation of UDP-2,3-diacyl-GlcN (substrate of LpxH), a C14:0(3-OH) acyl variant of the LpxD substrate (UDP-3-O-[(R)-3-OH-C14]-GlcN), and disaccharide 1-monophosphate (DSMP). Furthermore, the viable cell counts of the LpxH depleted cultures dropped modestly, and electron microscopy revealed clear defects at the cell (inner) membrane, suggesting lipid A intermediate accumulation was toxic. Consistent with this, blocking the synthesis of these intermediates by inhibition of the upstream LpxC enzyme using CHIR-090 abrogated the requirement for IPTG induction of LpxH. Taken together, these data indicate that LpxH is essential for growth in A. baumannii ATCC19606, because, unlike earlier pathway steps like LpxA or LpxC, blockage of LpxH causes accumulation of detergent-like pathway intermediates that prevents cell growth. PMID:27526195

  13. Carbapenem-resistant Acinetobacter baumannii from Brazil: role of carO alleles expression and blaOXA-23 gene

    PubMed Central


    Background Carbapenems are the antibiotics of choice to treat infections caused by Acinetobacter baumannii, and resistance to this class can be determined by loss of membrane permeability and enzymatic mechanisms. Here, we analyzed the basis of carbapenem resistance in clinical A. baumannii isolates from different Brazilian regions. Results The analyses addressed the carbapenemase activity of OXA-23, CarO expression and alterations in its primary structure. Susceptibility test revealed that the strains presented the COS (Colistin-Only-Sensitive) profile. PCR and sequencing showed the presence of the chromosomally-encoded blaOXA-51 in all isolates. The majority of strains (53%) carried the carbapenemase blaOXA-23 gene associated with ISAba1. The Hodge test indicated that these strains are carbapenemase producers. PFGE revealed 14 genotypes among strains from Rio de Janeiro and Maranhão. The influence of carO on imipenem resistance was evaluated considering two aspects: the composition of the primary amino acid sequence; and the expression level of this porin. Sequencing and in silico analyses showed the occurrence of CarOa, CarOb and undefined CarO types, and Real Time RT-PCR revealed basal and reduced carO transcription levels among isolates. Conclusions We concluded that, in general, for these Brazilian isolates, the major carbapenem resistance mechanism was due to OXA-23 carbapenemase activity and that loss of CarO porin plays a minor role in this phenotype. However, it was possible to associate the carO alleles and their expression with imipenem resistance. Therefore, these findings underline the complexity in addressing the role of different mechanisms in carbapenem resistance and highlight the possible influence of CarO type in this phenotype. PMID:24195496

  14. Colistin and Polymyxin B Dosage Regimens against Acinetobacter baumannii: Differences in Activity and the Emergence of Resistance.


    Cheah, Soon-Ee; Li, Jian; Tsuji, Brian T; Forrest, Alan; Bulitta, Jürgen B; Nation, Roger L


    Infections caused by multidrug-resistant Acinetobacter baumannii are a major public health problem, and polymyxins are often the last line of therapy for recalcitrant infections by such isolates. The pharmacokinetics of the two clinically used polymyxins, polymyxin B and colistin, differ considerably, since colistin is administered as an inactive prodrug that undergoes slow conversion to colistin. However, the impact of these substantial pharmacokinetic differences on bacterial killing and resistance emergence is poorly understood. We assessed clinically relevant polymyxin B and colistin dosage regimens against one reference and three clinical A. baumannii strains in a dynamic one-compartment in vitro model. A new mechanism-based pharmacodynamic model was developed to describe and predict the drug concentrations and viable counts of the total and resistant populations. Rapid attainment of target concentrations was shown to be critical for polymyxin-induced bacterial killing. All polymyxin B regimens achieved peak concentrations of at least 1 mg/liter within 1 h and caused ≥4 log10 killing at 1 h. In contrast, the slow rise of colistin concentrations to 3 mg/liter over 48 h resulted in markedly reduced bacterial killing. A significant (4 to 6 log10 CFU/ml) amplification of resistant bacterial populations was common to all dosage regimens. The developed mechanism-based model explained the observed bacterial killing, regrowth, and resistance. The model also implicated adaptive polymyxin resistance as a key driver of bacterial regrowth and predicted the amplification of preexisting, highly polymyxin-resistant bacterial populations following polymyxin treatment. Antibiotic combination therapies seem the most promising option for minimizing the emergence of polymyxin resistance. PMID:27067324

  15. In Vitro Interactions of Antibiotic Combinations of Colistin, Tigecycline, and Doripenem Against Extensively Drug-Resistant and Multidrug-Resistant Acinetobacter baumannii

    PubMed Central

    Park, Gyun Cheol; Choi, Ji Ae; Kim, Choon-Mee; Choi, In Sun; Kang, Seong Ho; Park, Geon; Moon, Dae Soo


    Background Acinetobacter baumannii infections are difficult to treat owing to the emergence of various antibiotic resistant isolates. Because treatment options are limited for multidrug-resistant (MDR) A. baumannii infection, the discovery of new therapies, including combination therapy, is required. We evaluated the synergistic activity of colistin, doripenem, and tigecycline combinations against extensively drug-resistant (XDR) A. baumannii and MDR A. baumannii. Methods Time-kill assays were performed for 41 XDR and 28 MDR clinical isolates of A. baumannii by using colistin, doripenem, and tigecycline combinations. Concentrations representative of clinically achievable levels (colistin 2 µg/mL, doripenem 8 µg/mL) and achievable tissue levels (tigecycline 2 µg/mL) for each antibiotic were used in this study. Results The colistin-doripenem combination displayed the highest rate of synergy (53.6%) and bactericidal activity (75.4%) in 69 clinical isolates of A. baumannii. Among them, thedoripenem-tigecycline combination showed the lowest rate of synergy (14.5%) and bacteri-cidal activity (24.6%). The doripenem-tigecycline combination showed a higher antagonistic interaction (5.8%) compared with the colistin-tigecycline (1.4%) combination. No antagonism was observed for the colistin-doripenem combination. Conclusions The colistin-doripenem combination is supported in vitro by the high rate of synergy and bactericidal activity and lack of antagonistic reaction in XDR and MDR A. baumannii. It seems to be necessary to perform synergy tests to determine the appropri-ate combination therapy considering the antagonistic reaction found in several isolates against the doripenem-tigecycline and colistin-tigecycline combinations. These findings should be further examined in clinical studies. PMID:26709259

  16. Epidemiology and resistance features of Acinetobacter baumannii isolates from the ward environment and patients in the burn ICU of a Chinese hospital.


    Gong, Yali; Shen, Xiaodong; Huang, Guangtao; Zhang, Cheng; Luo, Xiaoqiang; Yin, Supeng; Wang, Jing; Hu, Fuquan; Peng, Yizhi; Li, Ming


    Acinetobacter baumannii is an important opportunistic pathogen that causes severe nosocomial infections, especially in intensive care units (ICUs). Over the past decades, an everincreasing number of hospital outbreaks caused by A. baumannii have been reported worldwide. However, little attention has been directed toward the relationship between A. baumannii isolates from the ward environment and patients in the burn ICU. In this study, 88 A. baumannii isolates (26 from the ward environment and 62 from patients) were collected from the burn ICU of the Southwest Hospital in Chongqing, China, from July through December 2013. Antimicrobial susceptibility testing results showed that drug resistance was more severe in isolates from patients than from the ward environment, with all of the patient isolates being fully resistant to 10 out of 19 antimicrobials tested. Isolations from both the ward environment and patients possessed the β-lactamase genes bla OXA-51, bla OXA-23, bla AmpC, bla VIM, and bla PER. Using pulsed-field gel electrophoresis (PFGE) and multi-locus sequence typing (MLST), these isolates could be clustered into 4 major PFGE types and 4 main sequence types (ST368, ST369, ST195, and ST191) among which, ST368 was the dominant genotype. Epidemiologic and molecular typing data also revealed that a small-scale outbreak of A. baumannii infection was underway in the burn ICU of our hospital during the sampling period. These results suggest that dissemination of β-lactamase genes in the burn ICU might be closely associated with the high-level resistance of A. baumannii, and the ICU environment places these patients at a high risk for nosocomial infection. Cross-contamination should be an important concern in clinical activities to reduce hospitalacquired infections caused by A. baumannii. PMID:27480635

  17. Molecular Detection of Class-D OXA Carbapenemase Genes in Biofilm and Non-Biofilm Forming Clinical Isolates of Acinetobacter baumannii

    PubMed Central

    Azizi, Omid; Shakibaie, Mohammad Reza; Modarresi, Farzan; Shahcheraghi, Fereshteh


    Background: Emergence and spread of carbapenemase (blaOXA) genes in multidrug resistant Acinetobacter baumannii (MDR-AB) forming biofilm complicated treatment of the patients infected with this microorganism particularly in intensive care units (ICUs). Objectives: The current study aimed to determine the prevalence of molecular class-D OXA carbapenemase in biofilm and non-biofilm forming strains of MDR-AB. Materials and Methods: A total of 65 strains of MDR-AB were isolated from the patients hospitalized in the ICU of two hospitals in Kerman, Iran. The isolates were identified by conventional microbiological tests as well as API 20NE assay. Antibiotic susceptibility was carried out by disk diffusion method; minimum inhibitory concentration (MIC) of carbapenems was measured by E-test. The presence of blaOXA genes among the isolates were studied by duplex-polymerase chain reaction and application of appropriate primers. Biofilm formation was detected by microtiter plate method. Results: The isolates were highly resistant to ciprofloxacin, levofloxacin, piperacillin, nalidixic acid and third generation cephalosporins such as tigecycline (7%; n = 5) and colistin (13%; n = 8). Among the isolates, 77% (n = 50) exhibited high MIC (265μg/mL) for imipenem. Both the blaOXA-51 and blaOXA-23 like genes coexisted in all the isolates; while, blaOXA-24/40 like gene was only detected in 29 imipenem-resistant strains (P ≤ 0.05). The blaOXA-58 like gene was not detected among the isolated strains. Quantification of biofilm introduced 23 isolates (including blaOXA-24/40 strains) with efficient attachment to microtiter plate; while, those isolates without blaOXA-24/40, or imipenem-sensitive strains formed weak or no biofilm. Conclusions: Coexistence of the blaOXA-51, blaOXA-23 and blaOXA-24/40 like genes, along with formation of strong biofilm, in MDR-AB strains particularly with indiscriminate use of imipenem, complicated treatment of the patients infected with these bacteria in

  18. Antimicrobial Combinations against Pan-Resistant Acinetobacter baumannii Isolates with Different Resistance Mechanisms

    PubMed Central

    Leite, Gleice Cristina; Oliveira, Maura Salaroli; Perdigão-Neto, Lauro Vieira; Rocha, Cristiana Kamia Dias; Guimarães, Thais; Rizek, Camila; Levin, Anna Sara; Costa, Silvia Figueiredo


    The study investigated the effect of antibiotic combinations against 20 clinical isolates of A. baumannii (seven colistin-resistant and 13 colistin-susceptible) with different resistance mechanisms. Clinical data, treatment, and patient mortality were evaluated. The following methods were used: MIC, PCRs, and outer membrane protein (OMP) analysis. Synergy was investigated using the checkerboard and time-kill methods. Clonality was evaluated by PFGE. Based on clonality, the whole genome sequence of six A. baumannii isolates was analyzed. All isolates were resistant to meropenem, rifampicin, and fosfomycin. OXA-23 and OXA-143 were the most frequent carbapenemases found. Four isolates showed loss of a 43kDa OMP. The colistin-susceptible isolates belonged to different clones and showed the highest synergistic effect with fosfomycin-amikacin. Among colistin-resistant isolates, the highest synergistic effect was observed with the combinations of colistin-rifampicin followed by colistin-vancomycin. All colistin-resistant isolates harbored blaOXA-23-like and belonged to CC113. Clinical and demographic data were available for 18 of 20 patients. Fourteen received treatment and eight patients died during treatment. The most frequent site of infection was the blood in 13 of 14 patients. Seven patients received vancomycin plus an active drug against A. baumannii; however, mortality did not differ in this group. The synergistic effect was similar for colistin-susceptible isolates of distinct clonal origin presenting with the same resistance mechanism. Overall mortality and death during treatment was high, and despite the high synergism in vitro with vancomycin, death did not differ comparing the use or not of vancomycin plus an active drug against A. baumannii. PMID:26998609

  19. Iron limitation enhances acyl homoserine lactone (AHL) production and biofilm formation in clinical isolates of Acinetobacter baumannii

    PubMed Central

    Modarresi, Farzan; Azizi, Omid; Shakibaie, Mohammad Reza; Motamedifar, Mohammad; Mosadegh, Ellahe; Mansouri, Shahla


    Abstract Acinetobacter baumannii is an important source of infections in intensive care units (ICUs) of our hospitals in Kerman, Iran and the most frequently isolated strains produce biofilm. There is a little information about role of iron (Fe) levels on acyl homoserine lactone (AHL) production and biofilm formation in this microorganism. In the present study, we investigated the influence of iron-III limitation on AHL, siderophore, catechol and virulence factors in the biofilm forming clinical strains of A. baumannii. A total of 65 non-duplicated multidrug resistance (MDR) strains of A. baumannii were isolated from patients in ICUs of 2 hospitals in Kerman, Iran. Antibiotic susceptibility, siderophore and other iron chelators, hemolysis, cell twitching motility, capsule, gelatinase and DNase were studied. Presence of quorum sensing, LuxI and LuxR genes was detected by multiplex-PCR. AHL activity quantified by colorimetric method and the functional groups were determined by Fourier Transform Infra-Red Spectroscopy (FT-IR). Biofilm formation was detected by microtiter plate technique. All of the isolates were resistant to third generation of cephalosporins, ciprofloxacin, levofloxacin, tetracycline, whereas, 78% and 81% were resistant to amikacin and carbapenems, respectively. The siderophore activity was highest at 20 μM Fe3+ (70%); however, it decreased to 45% as concentration of Fe3+ increased to 80 μM. Furthermore, screening of the isolates for LuxI and LuxR genes showed that presence of both genes required in the isolates with high AHL activity. FT-IR analysis indicated C=O bond of the lactone ring and primary amides. Significantly, a higher amount of AHL (70%) was detected in the presence of low concentration of iron-III (20 μM); as iron concentration increased to 80 μM, the AHL activity was reduced to 40% (P ≤ 0.05). All the isolates exhibited twitching motility and had a capsule. No any gelatinase or DNase activity was detected. Quantification of

  20. Epidemiological Characteristics of blaNDM-1 in Enterobacteriaceae and the Acinetobacter calcoaceticus-Acinetobacter baumannii Complex in China from 2011 to 2012

    PubMed Central

    Ou, Weimei; Cui, Lanqing; Li, Yun; Zheng, Bo; Lv, Yuan


    Objectives The study aimed to investigate the prevalence and epidemiological characteristics of blaNDM-1 (encoding New Delhi metallo-β-lactamase 1) in Enterobacteriaceae and the Acinetobacter calcoaceticus-Acinetobacter baumannii complex (ABC) in China from July 2011 to June 2012. Methods PCR was used to screen for the presence of blaNDM-1 in all organisms studied. For blaNDM-1-positive strains, 16S rRNA analysis and Analytical Profile Index (API) strips were used to identify the bacterial genus and species. The ABCs were reconfirmed by PCR detection of blaOXA-51-like. Antibiotic susceptibilities of the bacteria were assessed by determining minimum inhibitory concentration (MIC) of them using two-fold agar dilution test, as recommended by the Clinical and Laboratory Standards Institute (CLSI). Molecular typing was performed using pulsed-field gel electrophoresis (PFGE). S1 nuclease-pulsed-field gel electrophoresis (S1-PFGE) and Southern blot hybridization were conducted to ascertain the gene location of blaNDM-1. Conjugation experiments were conducted to determine the transmission of blaNDM-1-positive strains. Results Among 2,170 Enterobacteriaceae and 600 ABCs, seven Enterobacteriaceae strains and two A. calcoaceticus isolates from five different cities carried the blaNDM-1 gene. The seven Enterobacteriaceae strains comprised four Klebsiella pneumoniae, one Enterobacter cloacae, one Enterobacter aerogen and one Citrobacter freundii. All seven were non-susceptible to imipenem, meropenem or ertapenem. Two A. calcoaceticus species were resistant to imipenem and meropenem. Three K. pneumoniae showed the same PFGE profiles. The blaNDM-1 genes of eight strains were localized on plasmids, while one was chromosomal. Conclusions Compared with previous reports, the numbers and species containing the blaNDM-1 in Enterobacteriaceae have significantly increased in China. Most of them are able to disseminate the gene, which is cause for concern. Consecutive surveillance should

  1. Zingiber officinale (ginger) compounds have tetracycline-resistance modifying effects against clinical extensively drug-resistant Acinetobacter baumannii.


    Wang, Hui-Min; Chen, Chung-Yi; Chen, Hsi-An; Huang, Wan-Chun; Lin, Wei-Ru; Chen, Tun-Chieh; Lin, Chun-Yu; Chien, Hsin-Ju; Lu, Po-Liang; Lin, Chiu-Mei; Chen, Yen-Hsu


    Extensively drug-resistant Acinetobacter baumannii (XDRAB) is a growing and serious nosocomial infection worldwide, such that developing new agents against it is critical. The antimicrobial activities of the rhizomes from Zingiber officinale, known as ginger, have not been proven in clinical bacterial isolates with extensive drug-resistance. This study aimed to investigate the effects of four known components of ginger, [6]-dehydrogingerdione, [10]-gingerol, [6]-shogaol and [6]-gingerol, against clinical XDRAB. All these compounds showed antibacterial effects against XDRAB. Combined with tetracycline, they showed good resistance modifying effects to modulate tetracycline resistance. Using the 1,1-diphenyl-2-picrylhydrazyl (DPPH) radical scavenging method, these four ginger compounds demonstrated antioxidant properties, which were inhibited by MnO₂, an oxidant without antibacterial effects. After the antioxidant property was blocked, their antimicrobial effects were abolished significantly. These results indicate that ginger compounds have antioxidant effects that partially contribute to their antimicrobial activity and are candidates for use in the treatment of infections with XDRAB. PMID:20564496

  2. Resistance-nodulation-cell division-type efflux pump involved in aminoglycoside resistance in Acinetobacter baumannii strain BM4454.


    Magnet, S; Courvalin, P; Lambert, T


    Multidrug-resistant strain Acinetobacter baumannii BM4454 was isolated from a patient with a urinary tract infection. The adeB gene, which encodes a resistance-nodulation-cell division (RND) protein, was detected in this strain by PCR with two degenerate oligodeoxynucleotides. Insertional inactivation of adeB in BM4454, which generated BM4454-1, showed that the corresponding protein was responsible for aminoglycoside resistance and was involved in the level of susceptibility to other drugs including fluoroquinolones, tetracyclines, chloramphenicol, erythromycin, trimethoprim, and ethidium bromide. Study of ethidium bromide accumulation in BM4454 and BM4454-1, in the presence or in the absence of carbonyl cyanide m-chlorophenylhydrazone, demonstrated that AdeB was responsible for the decrease in intracellular ethidium bromide levels in a proton motive force-dependent manner. The adeB gene was part of a cluster that included adeA and adeC which encodes proteins homologous to membrane fusion and outer membrane proteins of RND-type three-component efflux systems, respectively. The products of two upstream open reading frames encoding a putative two-component regulatory system might be involved in the regulation of expression of the adeABC gene cluster. PMID:11709311

  3. Resistance-Nodulation-Cell Division-Type Efflux Pump Involved in Aminoglycoside Resistance in Acinetobacter baumannii Strain BM4454

    PubMed Central

    Magnet, Sophie; Courvalin, Patrice; Lambert, Thierry


    Multidrug-resistant strain Acinetobacter baumannii BM4454 was isolated from a patient with a urinary tract infection. The adeB gene, which encodes a resistance-nodulation-cell division (RND) protein, was detected in this strain by PCR with two degenerate oligodeoxynucleotides. Insertional inactivation of adeB in BM4454, which generated BM4454-1, showed that the corresponding protein was responsible for aminoglycoside resistance and was involved in the level of susceptibility to other drugs including fluoroquinolones, tetracyclines, chloramphenicol, erythromycin, trimethoprim, and ethidium bromide. Study of ethidium bromide accumulation in BM4454 and BM4454-1, in the presence or in the absence of carbonyl cyanide m-chlorophenylhydrazone, demonstrated that AdeB was responsible for the decrease in intracellular ethidium bromide levels in a proton motive force-dependent manner. The adeB gene was part of a cluster that included adeA and adeC which encodes proteins homologous to membrane fusion and outer membrane proteins of RND-type three-component efflux systems, respectively. The products of two upstream open reading frames encoding a putative two-component regulatory system might be involved in the regulation of expression of the adeABC gene cluster. PMID:11709311

  4. Channel Formation by CarO, the Carbapenem Resistance-Associated Outer Membrane Protein of Acinetobacter baumannii

    PubMed Central

    Siroy, Axel; Molle, Virginie; Lemaître-Guillier, Christelle; Vallenet, David; Pestel-Caron, Martine; Cozzone, Alain J.; Jouenne, Thierry; Dé, Emmanuelle


    It has been recently shown that resistance to both imipenem and meropenem in multidrug-resistant clinical strains of Acinetobacter baumannii is associated with the loss of a heat-modifiable 25/29-kDa outer membrane protein, called CarO. This study aimed to investigate the channel-forming properties of CarO. Mass spectrometry analyses of this protein band detected another 25-kDa protein (called Omp25), together with CarO. Both proteins presented similar physicochemical parameters (Mw and pI). We overproduced and purified the two polypeptides as His-tagged recombinant proteins. Circular dichroism analyses demonstrated that the secondary structure of these proteins was mainly a β-strand conformation with spectra typical of porins. We studied the channel-forming properties of proteins by reconstitution into artificial lipid bilayers. In these conditions, CarO induced ion channels with a conductance value of 110 pS in 1 M KCl, whereas the Omp25 protein did not form any channels, despite its suggested porin function. The pores formed by CarO showed a slight cationic selectivity and no voltage closure. No specific imipenem binding site was found in CarO, and this protein would rather form unspecific monomeric channels. PMID:16304148

  5. Molecular Epidemiology of Carbapenem-Resistant Acinetobacter Baumannii Complex Isolates from Patients that were Injured During the Eastern Ukrainian Conflict.


    Granzer, Heike; Hagen, Ralf Matthias; Warnke, Philipp; Bock, Wolfgang; Baumann, Tobias; Schwarz, Norbert Georg; Podbielski, Andreas; Frickmann, Hagen; Koeller, Thomas


    This study addressed carbapenem-resistant Acinetobacter baumannii complex (ABC) isolates from patients that were injured during the military conflict in the Eastern Ukraine and treated at German Armed Forces Hospitals in 2014 and 2015. Clonal diversity of the strains and potential ways of transmission were analyzed. Patients with one or several isolation events of carbapenem-resistant ABC were included. Isolates were characterized by VITEK II-based identification and resistance testing, molecular screening for frequent carbapenemase genes, and DiversiLab rep-PCR-based typing. Available clinical information of the patients was assessed. From 21 young male Ukrainian patients with battle injuries, 32 carbapenem- and fluoroquinolone-resistant ABC strains were isolated. Four major clonal clusters were detected. From four patients (19%), ABC isolates from more than one clonal cluster were isolated. The composition of the clusters suggested transmission events prior to the admission to the German hospitals. The infection and colonization pressure in the conflict regions of the Eastern Ukraine with ABC of low clonal diversity is considerable. Respective infection risks have to be considered in case of battle-related injuries in these regions. The low number of local clones makes any molecular exclusion of transmission events difficult. PMID:27429793