Sample records for acinetobacter baumannii bacteremia

  1. Host Fate is Rapidly Determined by Innate Effector-Microbial Interactions During Acinetobacter baumannii Bacteremia

    PubMed Central

    Bruhn, Kevin W.; Pantapalangkoor, Paul; Nielsen, Travis; Tan, Brandon; Junus, Justin; Hujer, Kristine M.; Wright, Meredith S.; Bonomo, Robert A.; Adams, Mark D.; Chen, Wangxue; Spellberg, Brad


    Background. Acinetobacter baumannii is one of the most antibiotic-resistant pathogens. Defining mechanisms driving pathogenesis is critical to enable new therapeutic approaches. Methods. We studied virulence differences across a diverse panel of A. baumannii clinical isolates during murine bacteremia to elucidate host-microbe interactions that drive outcome. Results. We identified hypervirulent strains that were lethal at low intravenous inocula and achieved very high early, and persistent, blood bacterial densities. Virulent strains were nonlethal at low inocula but lethal at 2.5-fold higher inocula. Finally, relatively avirulent (hypovirulent) strains were nonlethal at 20-fold higher inocula and were efficiently cleared by early time points. In vivo virulence correlated with in vitro resistance to complement and macrophage uptake. Depletion of complement, macrophages, and neutrophils each independently increased bacterial density of the hypovirulent strain but insufficiently to change lethality. However, disruption of all 3 effector mechanisms enabled early bacterial densities similar to hypervirulent strains, rendering infection 100% fatal. Conclusions. The lethality of A. baumannii strains depends on distinct stages. Strains resistant to early innate effectors are able to establish very high early bacterial blood density, and subsequent sustained bacteremia leads to Toll-like receptor 4–mediated hyperinflammation and lethality. These results have important implications for translational efforts to develop therapies that modulate host-microbe interactions. PMID:25378635

  2. Comparison of a Repetitive Extragenic Palindromic Sequence-Based PCR Method and Clinical and Microbiological Methods for Determining Strain Sources in Cases of Nosocomial Acinetobacter baumannii Bacteremia

    PubMed Central

    Martín-Lozano, David; Cisneros, José Miguel; Becerril, Berta; Cuberos, Lucila; Prados, Trinidad; Ortíz-Leyba, Carlos; Cañas, Elías; Pachón, Jerónimo


    Using a repetitive extragenic palindromic PCR (REP-PCR), we genotypically characterized strains causing nosocomial Acinetobacter baumannii infections and analyzed the source of bacteremia in 67 patients from an institution in which infections by this bacterium were endemic. Six different genotypes were found, including 21, 27, 3, 9, 3, and 4 strains. The probable source of bacteremia, according to clinical and/or microbiological criteria, was known in 42 patients (63%): respiratory tract (n = 19), surgical sites (n = 12), intravascular catheters (n = 5), burns (n = 3), and urinary tract (n = 3). The definite source of bacteremia, according to REP-PCR, could be established in 30 (71%) out of the 42 patients with strains from blood and other sites; in these cases clinical and microbiological criteria for the source of bacteremia were thus confirmed. In the remaining 12 patients (29%) the probable source was refuted by the REP-PCR method. The definite sources of bacteremia according to genotype were as follows: respiratory tract in 13 patients (31%), surgical sites in 8 (19%), intravascular catheters in 4 (9%), burns in 3 (7%), and urinary tract in 2 (5%). A comparison of strains from blood cultures and other sites with regard to their REP-PCR and antimicrobial resistance profiles was also made. Taking the REP-PCR as the “gold standard,” the positive predictive value of antibiotype was 77% and the negative predictive value was 42%. In summary, the utility of the diagnosis of the source of nosocomial A. baumannii bacteremia using clinical and/or microbiological criteria, including antibiotyping, is limited, as demonstrated by REP-PCR. PMID:12454154

  3. High frequency of Acinetobacter soli among Acinetobacter isolates causing bacteremia at a tertiary hospital in Japan.


    Endo, Shiro; Yano, Hisakazu; Kanamori, Hajime; Inomata, Shinya; Aoyagi, Tetsuji; Hatta, Masumitsu; Gu, Yoshiaki; Tokuda, Koichi; Kitagawa, Miho; Kaku, Mitsuo


    Acinetobacter baumannii is generally the most frequently isolated Acinetobacter species. Sequence analysis techniques allow reliable identification of Acinetobacter isolates at the species level. Forty-eight clinical isolates of Acinetobacter spp. were obtained from blood cultures at Tohoku University Hospital. These isolates were identified at the species level by partial sequencing of the RNA polymerase β-subunit (rpoB), 16S rRNA, and gyrB genes. Then further characterization was done by using the PCR for detection of OXA-type β-lactamase gene clusters, metallo-β-lactamases, and carO genes. Pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing were also performed. The most frequent isolate was Acinetobacter soli (27.1%). Six of the 13 A. soli isolates were carbapenem nonsusceptible, and all of these isolates produced IMP-1. PFGE revealed that the 13 A. soli isolates were divided into 8 clusters. This study demonstrated that A. soli accounted for a high proportion of Acinetobacter isolates causing bacteremia at a Japanese tertiary hospital. Non-A. baumannii species were identified more frequently than A. baumannii and carbapenem-nonsusceptible isolates were found among the non-A. baumannii strains. These results emphasize the importance of performing epidemiological investigations of Acinetobacter species.

  4. Reservoirs of Non-baumannii Acinetobacter Species

    PubMed Central

    Al Atrouni, Ahmad; Joly-Guillou, Marie-Laure; Hamze, Monzer; Kempf, Marie


    Acinetobacter spp. are ubiquitous gram negative and non-fermenting coccobacilli that have the ability to occupy several ecological niches including environment, animals and human. Among the different species, Acinetobacter baumannii has evolved as global pathogen causing wide range of infection. Since the implementation of molecular techniques, the habitat and the role of non-baumannii Acinetobacter in human infection have been elucidated. In addition, several new species have been described. In the present review, we summarize the recent data about the natural reservoir of non-baumannii Acinetobacter including the novel species that have been described for the first time from environmental sources and reported during the last years. PMID:26870013

  5. Clinical implications of glycoproteomics for Acinetobacter baumannii.


    Kinsella, Rachel L; Scott, Nichollas E; Feldman, Mario F


    The opportunistic human pathogen Acinetobacter baumannii persists in the healthcare setting because of its ability to survive exposure to various antimicrobial and sterilization agents. A. baumannii's ability to cause multiple infection types complicates diagnosis and treatment. Rapid detection of A. baumannii infections would likely improve treatment outcomes. Recently published Acinetobacter glycoproteomic data show the prevalence of O-linked glycoproteins, suggesting the possibility for an O-glycan-based detection technology. O-glycan biosynthesis is required for protein glycosylation and capsular polysaccharide production in A. baumannii. Recent publications demonstrate key roles for protein glycosylation and capsular polysaccharide in the pathogenicity of A. baumannii. Targeted antimicrobial development against O-glycan biosynthesis may produce new effective treatment options for A. baumannii infections. Here, we discuss how the data gathered through Acinetobacter glycoproteomics can be used to develop technologies for rapid diagnosis and reveal potential antimicrobial targets. In addition, we consider the efficacy of glycoconjugate vaccine development against A. baumannii.

  6. The first cases of human bacteremia caused by Acinetobacter seifertii in Japan.


    Kishii, Kozue; Kikuchi, Ken; Tomida, Junko; Kawamura, Yoshiaki; Yoshida, Atsushi; Okuzumi, Katsuko; Moriya, Kyoji


    Acinetobacter seifertii, a novel species of Acinetobacter, was first reported in 2015. A. seifertii strains were isolated from human clinical specimens (blood, respiratory tract, and ulcer) and hospital environments. Here, we report the first cases of bacteremia caused by A. seifertii in patients with catheter-related bloodstream infection in Japan. The patients favorably recovered, without any complications, after removal of the peripheral intravenous catheters and administration of antibiotics. The pathogens were initially identified as Acinetobacter baumannii, using phenotypic methods and the MicroScan Walkaway System; however, rpoB gene sequence analysis indicated 99.54% similarity to A. seifertii. Moreover, antimicrobial susceptibility testing revealed that one of the strains was not susceptible to gentamicin and ceftazidime. Our report shows that Acinetobacter species other than A. baumannii can also cause nosocomial infections and that accurate methods for the identification of causative agents should be developed.

  7. Genome organization of epidemic Acinetobacter baumannii strains

    PubMed Central


    Background Acinetobacter baumannii is an opportunistic pathogen responsible for hospital-acquired infections. A. baumannii epidemics described world-wide were caused by few genotypic clusters of strains. The occurrence of epidemics caused by multi-drug resistant strains assigned to novel genotypes have been reported over the last few years. Results In the present study, we compared whole genome sequences of three A. baumannii strains assigned to genotypes ST2, ST25 and ST78, representative of the most frequent genotypes responsible for epidemics in several Mediterranean hospitals, and four complete genome sequences of A. baumannii strains assigned to genotypes ST1, ST2 and ST77. Comparative genome analysis showed extensive synteny and identified 3068 coding regions which are conserved, at the same chromosomal position, in all A. baumannii genomes. Genome alignments also identified 63 DNA regions, ranging in size from 4 o 126 kb, all defined as genomic islands, which were present in some genomes, but were either missing or replaced by non-homologous DNA sequences in others. Some islands are involved in resistance to drugs and metals, others carry genes encoding surface proteins or enzymes involved in specific metabolic pathways, and others correspond to prophage-like elements. Accessory DNA regions encode 12 to 19% of the potential gene products of the analyzed strains. The analysis of a collection of epidemic A. baumannii strains showed that some islands were restricted to specific genotypes. Conclusion The definition of the genome components of A. baumannii provides a scaffold to rapidly evaluate the genomic organization of novel clinical A. baumannii isolates. Changes in island profiling will be useful in genomic epidemiology of A. baumannii population. PMID:21985032

  8. Quantitative proteomics to study carbapenem resistance in Acinetobacter baumannii

    PubMed Central

    Tiwari, Vishvanath; Tiwari, Monalisa


    Acinetobacter baumannii is an opportunistic pathogen causing pneumonia, respiratory infections and urinary tract infections. The prevalence of this lethal pathogen increases gradually in the clinical setup where it can grow on artificial surfaces, utilize ethanol as a carbon source. Moreover it resists desiccation. Carbapenems, a β-lactam, are the most commonly prescribed drugs against A. baumannii. Resistance against carbapenem has emerged in Acinetobacter baumannii which can create significant health problems and is responsible for high morbidity and mortality. With the development of quantitative proteomics, a considerable progress has been made in the study of carbapenem resistance of Acinetobacter baumannii. Recent updates showed that quantitative proteomics has now emerged as an important tool to understand the carbapenem resistance mechanism in Acinetobacter baumannii. Present review also highlights the complementary nature of different quantitative proteomic methods used to study carbapenem resistance and suggests to combine multiple proteomic methods for understanding the response to antibiotics by Acinetobacter baumannii. PMID:25309531

  9. Iron and Acinetobacter baumannii Biofilm Formation

    PubMed Central

    Gentile, Valentina; Frangipani, Emanuela; Bonchi, Carlo; Minandri, Fabrizia; Runci, Federica; Visca, Paolo


    Acinetobacter baumannii is an emerging nosocomial pathogen, responsible for infection outbreaks worldwide. The pathogenicity of this bacterium is mainly due to its multidrug-resistance and ability to form biofilm on abiotic surfaces, which facilitate long-term persistence in the hospital setting. Given the crucial role of iron in A. baumannii nutrition and pathogenicity, iron metabolism has been considered as a possible target for chelation-based antibacterial chemotherapy. In this study, we investigated the effect of iron restriction on A. baumannii growth and biofilm formation using different iron chelators and culture conditions. We report substantial inter-strain variability and growth medium-dependence for biofilm formation by A. baumannii isolates from veterinary and clinical sources. Neither planktonic nor biofilm growth of A. baumannii was affected by exogenous chelators. Biofilm formation was either stimulated by iron or not responsive to iron in the majority of isolates tested, indicating that iron starvation is not sensed as an overall biofilm-inducing stimulus by A. baumannii. The impressive iron withholding capacity of this bacterium should be taken into account for future development of chelation-based antimicrobial and anti-biofilm therapies. PMID:25438019

  10. Acinetobacter baumannii Genes Required for Bacterial Survival during Bloodstream Infection

    PubMed Central

    Subashchandrabose, Sargurunathan; Smith, Sara; DeOrnellas, Valerie; Crepin, Sebastien; Kole, Monica; Zahdeh, Carina


    ABSTRACT Acinetobacter baumannii is emerging as a leading global multiple-antibiotic-resistant nosocomial pathogen. The identity of genes essential for pathogenesis in a mammalian host remains largely unknown. Using transposon-directed insertion-site sequencing (TraDIS), we identified A. baumannii genes involved in bacterial survival in a leukopenic mouse model of bloodstream infection. Mice were inoculated with a pooled transposon mutant library derived from 109,000 mutants, and TraDIS was used to map transposon insertion sites in the genomes of bacteria in the inoculum and of bacteria recovered from mouse spleens. Unique transposon insertion sites were mapped and used to calculate a fitness factor for every insertion site based on its relative abundance in the inoculum and postinfection libraries. Eighty-nine transposon insertion mutants that were underrepresented after experimental infection in mice compared to their presence in the inocula were delineated as candidates for further evaluation. Genetically defined mutants lacking feoB (ferrous iron import), ddc (d-ala-d-ala-carboxypeptidase), and pntB (pyridine nucleotide transhydrogenase subunit) exhibited a fitness defect during systemic infection resulting from bacteremia. In vitro, these mutants, as well as a fepA (ferric enterobactin receptor) mutant, are defective in survival in human serum and within macrophages and are hypersensitive to killing by antimicrobial peptides compared to the survival of the parental strain under these conditions. Our data demonstrate that FepA is involved in the uptake of exogenous enterobactin in A. baumannii. Genetic complementation rescues the phenotypes of mutants in assays that emulate conditions encountered during infection. In summary, we have determined novel A. baumannii fitness genes involved in the pathogenesis of mammalian infection. IMPORTANCE A. baumannii is a significant cause of bacterial bloodstream infection in humans. Since multiple antibiotic resistance

  11. Extrahuman Epidemiology of Acinetobacter baumannii in Lebanon

    PubMed Central

    Rafei, Rayane; Hamze, Monzer; Pailhoriès, Hélène; Eveillard, Matthieu; Marsollier, Laurent; Joly-Guillou, Marie-Laure; Dabboussi, Fouad


    The presence of Acinetobacter baumannii outside hospitals is still a controversial issue. The objective of our study was to explore the extrahospital epidemiology of A. baumannii in Lebanon. From February 2012 to October 2013, a total of 73 water samples, 51 soil samples, 37 raw cow milk samples, 50 cow meat samples, 7 raw cheese samples, and 379 animal samples were analyzed by cultural methods for the presence of A. baumannii. Species identification was performed by rpoB gene sequencing. Antibiotic susceptibility was investigated, and the A. baumannii population was studied by two genotyping approaches: multilocus sequence typing (MLST) and blaOXA-51 sequence-based typing (SBT). A. baumannii was detected in 6.9% of water samples, 2.7% of milk samples, 8.0% of meat samples, 14.3% of cheese samples, and 7.7% of animal samples. All isolates showed a susceptible phenotype against most of the antibiotics tested and lacked carbapenemase-encoding genes, except one that harbored a blaOXA-143 gene. MLST analysis revealed the presence of 36 sequence types (STs), among which 24 were novel STs reported for the first time in this study. blaOXA-51 SBT showed the presence of 34 variants, among which 21 were novel and all were isolated from animal origins. Finally, 30 isolates had new partial rpoB sequences and were considered putative new Acinetobacter species. In conclusion, animals can be a potential reservoir for A. baumannii and the dissemination of new emerging carbapenemases. The roles of the novel animal clones identified in community-acquired infections should be investigated. PMID:25616788

  12. Species identification within Acinetobacter calcoaceticus-baumannii complex using MALDI-TOF MS.


    Toh, Benjamin E W; Paterson, David L; Kamolvit, Witchuda; Zowawi, Hosam; Kvaskoff, David; Sidjabat, Hanna; Wailan, Alexander; Peleg, Anton Y; Huber, Charlotte A


    Acinetobacter baumannii, one of the more clinically relevant species in the Acinetobacter genus is well known to be multi-drug resistant and associated with bacteremia, urinary tract infection, pneumonia, wound infection and meningitis. However, it cannot be differentiated from closely related species such as Acinetobacter calcoaceticus, Acinetobacter pittii and Acinetobacter nosocomialis by most phenotypic tests and can only be differentiated by specific, time consuming genotypic tests with very limited use in clinical microbiological laboratories. As a result, these species are grouped into the A. calcoaceticus-A. baumannii (Acb) complex. Herein we investigated the mass spectra of 73 Acinetobacter spp., representing ten different species, using an AB SCIEX 5800 MALDI-TOF MS to differentiate members of the Acinetobacter genus, including the species of the Acb complex. RpoB gene sequencing, 16S rRNA sequencing, and gyrB multiplex PCR were also evaluated as orthogonal methods to identify the organisms used in this study. We found that whilst 16S rRNA and rpoB gene sequencing could not differentiate A. pittii or A. calcoaceticus, they can be differentiated using gyrB multiplex PCR and MALDI-TOF MS. All ten Acinetobacter species investigated could be differentiated by their MALDI-TOF mass spectra.

  13. Acinetobacter baumannii: Emergence of a Successful Pathogen

    PubMed Central

    Peleg, Anton Y.; Seifert, Harald; Paterson, David L.


    Acinetobacter baumannii has emerged as a highly troublesome pathogen for many institutions globally. As a consequence of its immense ability to acquire or upregulate antibiotic drug resistance determinants, it has justifiably been propelled to the forefront of scientific attention. Apart from its predilection for the seriously ill within intensive care units, A. baumannii has more recently caused a range of infectious syndromes in military personnel injured in the Iraq and Afghanistan conflicts. This review details the significant advances that have been made in our understanding of this remarkable organism over the last 10 years, including current taxonomy and species identification, issues with susceptibility testing, mechanisms of antibiotic resistance, global epidemiology, clinical impact of infection, host-pathogen interactions, and infection control and therapeutic considerations. PMID:18625687

  14. Acinetobacter baumannii: an emerging opportunistic pathogen.


    Howard, Aoife; O'Donoghue, Michael; Feeney, Audrey; Sleator, Roy D


    Acinetobacter baumannii is an opportunistic bacterial pathogen primarily associated with hospital-acquired infections. The recent increase in incidence, largely associated with infected combat troops returning from conflict zones, coupled with a dramatic increase in the incidence of multidrug-resistant (MDR) strains, has significantly raised the profile of this emerging opportunistic pathogen. Herein, we provide an overview of the pathogen, discuss some of the major factors that have led to its clinical prominence and outline some of the novel therapeutic strategies currently in development.

  15. Translation Elongation Factor Tuf of Acinetobacter baumannii Is a Plasminogen-Binding Protein

    PubMed Central

    Koenigs, Arno; Zipfel, Peter F.; Kraiczy, Peter


    Acinetobacter baumannii is an important nosocomial pathogen, causing a variety of opportunistic infections of the skin, soft tissues and wounds, urinary tract infections, secondary meningitis, pneumonia and bacteremia. Over 63% of A. baumannii infections occurring in the United States are caused by multidrug resistant isolates, and pan-resistant isolates have begun to emerge that are resistant to all clinically relevant antibiotics. The complement system represents the first line of defense against invading pathogens. However, many A. baumannii isolates, especially those causing severe bacteremia are resistant to complement-mediated killing, though the underlying mechanisms remain poorly understood. Here we show for the first time that A. baumannii binds host-derived plasminogen and we identify the translation elongation factor Tuf as a moonlighting plasminogen-binding protein that is exposed on the outer surface of A. baumannii. Binding of plasminogen to Tuf is at least partly dependent on lysine residues and ionic interactions. Plasminogen, once bound to Tuf can be converted to active plasmin and proteolytically degrade fibrinogen as well as the key complement component C3b. Thus, Tuf acts as a multifunctional protein that may contribute to virulence of A. baumannii by aiding in dissemination and evasion of the complement system. PMID:26230848

  16. Rapid identification of Acinetobacter baumannii, Acinetobacter nosocomialis and Acinetobacter pittii with a multiplex PCR assay.


    Chen, Te-Li; Lee, Yi-Tzu; Kuo, Shu-Chen; Yang, Su-Pen; Fung, Chang-Phone; Lee, Shou-Dong


    Acinetobacter baumannii, Acinetobacter nosocomialis and Acinetobacter pittii are clinically relevant members of the Acinetobacter calcoaceticus-A. baumannii (Acb) complex and important nosocomial pathogens. These three species are genetically closely related and phenotypically similar; however, they differ in their epidemiology, antibiotic resistance and pathogenicity. In this study, we investigated the use of a multiplex PCR-based assay designed to detect internal fragments of the 16S-23S rRNA intergenic region and the gyrB and recA genes. The assay was capable of differentiating A. baumannii, A. nosocomialis and A. pittii in a reliable manner. In 23 different reference strains and 89 clinical isolates of Acinetobacter species, the assay accurately identified clinically relevant Acb complex species except those 'between 1 and 3' or 'close to 13TU'. None of the non-Acb complex species was misidentified. In an analysis of 1034 positive blood cultures, the assay had a sensitivity of 92.4 % and specificity of 98.2 % for Acb complex identification. Our results show that a single multiplex PCR assay can reliably differentiate clinically relevant Acb complex species. Thus, this method may be used to better understand the clinical differences between infections caused by these species.

  17. Characterization of Acinetobacter baumannii biofilm associated components

    NASA Astrophysics Data System (ADS)

    Brossard, Kari A.

    Acinetobacter baumannii is a Gram-negative aerobic coccobaccillus that is a major cause of nosocomial infections worldwide. Infected individuals may develop pneumonia, urinary tract, wound, and other infections that are associated with the use of indwelling medical devices such as catheters and mechanical ventilation. Treatment is difficult because many A. baumannii isolates have developed multi-drug resistance and the bacterium can persist on abiotic surfaces. Persistence and resistance may be due to formation of biofilms, which leads to long-term colonization, evasion of the host immune system and resistance to treatment with antibiotics and disinfectants. While biofilms are complex multifaceted structures, two bacterial components that have been shown to be important in formation and stability are exopolysaccharides (EPS) and the biofilm-associated protein (Bap). An EPS, poly-beta-1,6-N-acetylglucosamine, PNAG, has been described for E. coli and S. epidermidis. PNAG acts as an intercellular adhesin. Production of this adhesin is dependent on the pga/icaABCD locus. We have identified a homologous locus in A. baumannii 307-0294 that is involved in production of an exopolysaccharide, recognized by an anti-PNAG antibody. We hypothesized that the A. baumannii pgaABCD locus plays a role in biofilm formation, and protection against host innate defenses and disinfectants suggesting that PNAG is a possible virulence factor for the organism. The first aim of this thesis will define the pgaABCD locus. We have previously identified Bap, a protein with similarity to those described for S. aureus and we have demonstrated that this protein is involved in maintaining the stability of biofilms on glass. We hypothesized that A. baumannii Bap plays a role in persistence and pathogenesis and is regulated by quorum sensing. In our second aim we will examine the role of Bap in attachment and biofilm formation on medically relevant surfaces and also determine if Bap is involved in

  18. Polymicrobial Chronic Infection Including Acinetobacter Baumannii in a Plated Segmental Defect in the Rat Femur

    DTIC Science & Technology


    Including Acinetobacter baumannii in a Plated Segmental Defect in the Rat Femur PRINCIPAL INVESTIGATOR: Dean T. Tsukayama, MD...FEB 2007 - 31 DEC 2007 4. TITLE AND SUBTITLE Polymicrobial Chronic Infection Including Acinetobacter baumannii 5a. CONTRACT NUMBER in a Plated...bone isolate of Acinetobacter baumannii exhibited very little osteolytic involvement when used alone in the model. Qualitative cultures indicated very

  19. [In vitro tigecycline and carbapenem susceptibilities of clinical Acinetobacter baumannii isolates].


    Nayman Alpat, Saygın; Aybey, Aşkın Derya; Akşit, Filiz; Ozgüneş, Ilhan; Kiremitçi, Abdurrahman; Usluer, Gaye


    Acinetobacter baumannii is a frequent cause of nosocomial infections in most hospitals. Management of infections caused by these strains is difficult, as the strains often display multiple drug resistance, including carbapenem. Tigecycline which is a glycylcycline derivative has antimicrobial activity against many gram-positive and gram-negative organisms. In this study, in vitro activity of tigecycline and carbapenems against clinical isolates of A.baumannii strains were investigated. A total of 100 A.baumannii isolates were collected from hospitalized patients with documented nosocomial infections [pneumonia (n = 39), surgical wound infection (n = 32), bacteremia (n = 16), catheter infection (n = 6), urinary tract infection (n = 5), peritonitis (n = 1), eye infection (n = 1)] between October 2006 and June 2007. Only one isolate per patient was included to the study. Minimum inhibitory concentrations (MIC) of tigecycline were determined by E-test (AB Biodisk, Sweden). Carbapenem resistance of A.baumannii strains were determined by disk diffusion method. All of the 100 A.baumannii isolates (100%) were found susceptible to tigecycline (MIC values ≤ 2 µg/ml; MIC ranges: 0.032-1.5 µg/ml). Imipenem susceptibility test was performed for 95 strains, and 36 (37.9%) were found sensitive, 18 (18.9%) were intermediate sensitive, and 41 (43.2%) were resistant. Meropenem susceptibility test was performed for 87 strains, and 22 (25.3%) were found sensitive, 9 (10.3%) were intermediate sensitive, and 56 (64.4%) were resistant. Since tigecycline is found quite effective on nosocomial A.baumannii isolates, it may be considered as a treatment alternative in infections caused by carbapenem-resistant Acinetobacter spp.

  20. Inactivation of Phospholipase D Diminishes Acinetobacter baumannii Pathogenesis▿ †

    PubMed Central

    Jacobs, Anna C.; Hood, Indriati; Boyd, Kelli L.; Olson, Patrick D.; Morrison, John M.; Carson, Steven; Sayood, Khalid; Iwen, Peter C.; Skaar, Eric P.; Dunman, Paul M.


    Acinetobacter baumannii is an emerging bacterial pathogen of considerable health care concern. Nonetheless, relatively little is known about the organism's virulence factors or their regulatory networks. Septicemia and ventilator-associated pneumonia are two of the more severe forms of A. baumannii disease. To identify virulence factors that may contribute to these disease processes, genetically diverse A. baumannii clinical isolates were evaluated for the ability to proliferate in human serum. A transposon mutant library was created in a strain background that propagated well in serum and screened for members with decreased serum growth. The results revealed that disruption of A. baumannii phospholipase D (PLD) caused a reduction in the organism's ability to thrive in serum, a deficiency in epithelial cell invasion, and diminished pathogenesis in a murine model of pneumonia. Collectively, these results suggest that PLD is an A. baumannii virulence factor. PMID:20194595

  1. Deciphering the Multifactorial Nature of Acinetobacter baumannii Pathogenicity

    PubMed Central

    Antunes, Luísa C. S.; Imperi, Francesco; Carattoli, Alessandra; Visca, Paolo


    Background Acinetobacter baumannii is an emerging bacterial pathogen that causes a broad array of infections, particularly in hospitalized patients. Many studies have focused on the epidemiology and antibiotic resistance of A. baumannii, but little is currently known with respect to its virulence potential. Methodology/Principal Findings The aim of this work was to analyze a number of virulence-related traits of four A. baumannii strains of different origin and clinical impact for which complete genome sequences were available, in order to tentatively identify novel determinants of A. baumannii pathogenicity. Clinical strains showed comparable virulence in the Galleria mellonella model of infection, irrespective of their status as outbreak or sporadic strains, whereas a non-human isolate was avirulent. A combined approach of genomic and phenotypic analyses led to the identification of several virulence factors, including exoproducts with hemolytic, phospholipase, protease and iron-chelating activities, as well as a number of multifactorial phenotypes, such as biofilm formation, surface motility and stress resistance, which were differentially expressed and could play a role in A. baumannii pathogenicity. Conclusion/Significance This work provides evidence of the multifactorial nature of A. baumannii virulence. While A. baumannii clinical isolates could represent a selected population of strains adapted to infect the human host, subpopulations of highly genotypically and phenotypically diverse A. baumannii strains may exist outside the hospital environment, whose relevance and distribution deserve further investigation. PMID:21829642

  2. Characterization of blaOXA-143 variants in Acinetobacter baumannii and Acinetobacter pittii.


    Zander, Esther; Bonnin, Rémy A; Seifert, Harald; Higgins, Paul G


    The acquired carbapenem-hydrolyzing oxacillinase (OXA) OXA-143 has thus far been detected only in Acinetobacter baumannii isolates from Brazil. The aim of this study was to characterize three OXA-143 variants: OXA-231 and OXA-253 from carbapenem-resistant A. baumannii isolates and OXA-255 in a carbapenem-susceptible Acinetobacter pittii isolate originating from Brazil, Honduras, and the United States, respectively. The 5' rapid amplification of cDNA ends (RACE) technique identified the same transcription initiation site for all blaOXA-143-like genes and revealed differences in the putative promoter regions. However, all cloned OXA-143 variants conferred carbapenem resistance on A. baumannii ATCC 17978 and OXA-255 conferred carbapenem resistance on A. pittii SH024, which was correlated with blaOXA-255 gene expression. This is the first description of OXA-143-like outside A. baumannii. Detection of OXA-143-like in the United States and Honduras indicates its dissemination through the American continent.

  3. Acinetobacter baumannii Infection and IL-17 Mediated Immunity

    PubMed Central

    Yan, Zihe; Yang, Junjun; Hu, Renjing; Hu, Xichi; Chen, Kong


    Acinetobacter baumannii is a significant cause of severe hospital-acquired infections with a recent rise in multidrug-resistant infections involving traumatic wounds of military personnel. The interleukin-17 (IL-17) pathway is essential for neutrophil recruitment in response to a variety of pathogens, while the control of A. baumannii infection is known to be dependent on neutrophils. This suggests that IL-17 may play an important role in A. baumannii infection; however, this has yet to be studied. Here, we summarize the recent advances in understanding the host-pathogen interaction of A. baumannii and propose a potential role of the IL-17 pathway in generating a protective immune response. PMID:26977122

  4. Infections Caused by Acinetobacter baumannii in Recipients of Hematopoietic Stem Cell Transplantation

    PubMed Central

    Al-Anazi, Khalid Ahmed; Al-Jasser, Asma M.


    Acinetobacter baumannii (A. baumannii) is a Gram-negative, strictly aerobic, non-fermentative coccobacillus, which is widely distributed in nature. Recently, it has emerged as a major cause of health care-associated infections (HCAIs) in addition to its capacity to cause community-acquired infections. Risk factors for A. baumannii infections and bacteremia in recipients of hematopoietic stem cell transplantation include: severe underlying illness such as hematological malignancy, prolonged use of broad-spectrum antibiotics, invasive instrumentation such as central venous catheters or endotracheal intubation, colonization of respiratory, gastrointestinal, or urinary tracts in addition to severe immunosuppression caused by using corticosteroids for treating graft versus host disease. The organism causes a wide spectrum of clinical manifestations, but serious complications such as bacteremia, septic shock, ventilator-associated pneumonia, extensive soft tissue necrosis, and rapidly progressive systemic infections that ultimately lead to multi-organ failure and death are prone to occur in severely immunocompromised hosts. The organism is usually resistant to many antimicrobials including penicillins, cephalosporins, trimethoprim–sulfamethoxazole, almost all fluoroquinolones, and most of the aminoglycosides. The recently increasing resistance to carbapenems, colistin, and polymyxins is alarming. Additionally, there are geographic variations in the resistance patterns and several globally and regionally resistant strains have already been described. Successful management of A. baumannii infections depends upon appropriate utilization of antibiotics and strict application of preventive and infection control measures. In uncomplicated infections, the use of a single active beta-lactam may be justified, while definitive treatment of complicated infections in critically ill individuals may require drug combinations such as colistin and rifampicin or colistin and carbapenem

  5. Identification of Ata, a Multifunctional Trimeric Autotransporter of Acinetobacter baumannii

    PubMed Central

    Bentancor, Leticia V.; Camacho-Peiro, Ana; Bozkurt-Guzel, Cagla; Pier, Gerald B.


    Acinetobacter baumannii has recently emerged as a highly troublesome nosocomial pathogen, especially in patients in intensive care units and in those undergoing mechanical ventilation. We have identified a surface protein adhesin of A. baumannii, designated the Acinetobacter trimeric autotransporter (Ata), that contains all of the typical features of trimeric autotransporters (TA), including a long signal peptide followed by an N-terminal, surface-exposed passenger domain and a C-terminal domain encoding 4 β-strands. To demonstrate that Ata encoded a TA, we created a fusion protein in which we replaced the entire passenger domain of Ata with the epitope tag V5, which can be tracked with specific monoclonal antibodies, and demonstrated that the C-terminal 101 amino acids of Ata were capable of exporting the heterologous V5 tag to the surface of A. baumannii in a trimeric form. We found that Ata played a role in biofilm formation and bound to various extracellular matrix/basal membrane (ECM/BM) components, including collagen types I, III, IV, and V and laminin. Moreover, Ata mediated the adhesion of whole A. baumannii cells to immobilized collagen type IV and played a role in the survival of A. baumannii in a lethal model of systemic infection in immunocompetent mice. Taken together, these results reveal that Ata is a TA of A. baumannii involved in virulence, including biofilm formation, binding to ECM/BM proteins, mediating the adhesion of A. baumannii cells to collagen type IV, and contributing to the survival of A. baumannii in a mouse model of lethal infection. PMID:22609912

  6. Acinetobacter baumannii: Evolution of Antimicrobial Resistance—Treatment Options

    PubMed Central

    Doi, Yohei; Murray, Gerald L.; Peleg, Anton Y.


    The first decade of the 20th century witnessed a surge in the incidence of infections due to several highly antimicrobial-resistant bacteria in hospitals worldwide. Acinetobacter baumannii is one such organism that turned from an occasional respiratory pathogen into a major nosocomial pathogen. An increasing number of A. baumannii genome sequences have broadened our understanding of the genetic makeup of these bacteria and highlighted the extent of horizontal transfer of DNA. Animal models of disease combined with bacterial mutagenesis have provided some valuable insights into mechanisms of A. baumannii pathogenesis. Bacterial factors known to be important for disease include outer membrane porins, surface structures including capsule and lipopolysaccharide, enzymes such as phospholipase D, iron acquisition systems, and regulatory proteins. A. baumannii has a propensity to accumulate resistance to various groups of antimicrobial agents. In particular, carbapenem resistance has become commonplace, accounting for the majority of A. baumannii strains in many hospitals today. Carbapenem-resistant strains are often resistant to all other routinely tested agents. Treatment of carbapenem-resistant A. baumannii infection therefore involves the use of combinations of last resort agents such as colistin and tigecycline, but the efficacy and safety of these approaches are yet to be defined. Antimicrobial-resistant A. baumannii has high potential to spread among ill patients in intensive care units. Early recognition and timely implementation of appropriate infection control measures is crucial in preventing outbreaks. PMID:25643273

  7. Copper Resistance of the Emerging Pathogen Acinetobacter baumannii

    PubMed Central

    Williams, Caitlin L.; Neu, Heather M.; Gilbreath, Jeremy J.; Michel, Sarah L. J.; Zurawski, Daniel V.


    ABSTRACT Acinetobacter baumannii is an important emerging pathogen that is capable of causing many types of severe infection, especially in immunocompromised hosts. Since A. baumannii can rapidly acquire antibiotic resistance genes, many infections are on the verge of being untreatable, and novel therapies are desperately needed. To investigate the potential utility of copper-based antibacterial strategies against Acinetobacter infections, we characterized copper resistance in a panel of recent clinical A. baumannii isolates. Exposure to increasing concentrations of copper in liquid culture and on solid surfaces resulted in dose-dependent and strain-dependent effects; levels of copper resistance varied broadly across isolates, possibly resulting from identified genotypic variation among strains. Examination of the growth-phase-dependent effect of copper on A. baumannii revealed that resistance to copper increased dramatically in stationary phase. Moreover, A. baumannii biofilms were more resistant to copper than planktonic cells but were still susceptible to copper toxicity. Exposure of bacteria to subinhibitory concentrations of copper allowed them to better adapt to and grow in high concentrations of copper; this copper tolerance response is likely achieved via increased expression of copper resistance mechanisms. Indeed, genomic analysis revealed numerous putative copper resistance proteins that share amino acid homology to known proteins in Escherichia coli and Pseudomonas aeruginosa. Transcriptional analysis revealed significant upregulation of these putative copper resistance genes following brief copper exposure. Future characterization of copper resistance mechanisms may aid in the search for novel antibiotics against Acinetobacter and other highly antibiotic-resistant pathogens. IMPORTANCE Acinetobacter baumannii causes many types of severe nosocomial infections; unfortunately, some isolates have acquired resistance to almost every available antibiotic

  8. Acinetobacter baumannii: An Emerging and Important Pathogen

    PubMed Central

    Alsan, Marcella; Klompas, Michael


    Objective To review the clinical significance, management, and control of Acinetobacter infections. Methods Literature review. Results Acinetobacter infections have become a major cause of hospital-acquired infections worldwide. Acinetobacter is noted for its ability to survive for long periods on hospital surfaces and equipment, its predilection to develop resistance to multiple antibiotics, its affinity to cause serious infections in critically ill patients, and many well described outbreaks attributable to contamination of a common source. The crude ICU mortality is approximately 40%. Rigorous antibiotic stewardship and infection control measures are critical to prevent the spread of multidrug-resistant Acinetobacter infections. There is also a pressing need for new therapeutic options. Conclusion Acinetobacter is an emerging pathogen of increasing significance. PMID:26966345

  9. Epithelial Innate Immune Response to Acinetobacter baumannii Challenge

    PubMed Central

    Feng, Zhimin; Jia, Xun; Adams, Mark D.; Ghosh, Santosh K.; Bonomo, Robert A.


    Currently, Acinetobacter baumannii is recognized as one of the major pathogens seriously threatening our health care delivery system. Aspects of the innate immune response to A. baumannii infection are not yet well understood. Human β-defensins (hBDs) are epithelial cell-derived cationic antimicrobial peptides (AMPs) that also function to bridge the innate and adaptive immune system. We tested the induction of hBD-2 and -3 by A. baumannii on primary oral and skin epithelial cells and found that A. baumannii induces hBD-3 transcripts to a greater extent than it induces hBD-2 transcripts on both types of cells. In addition, we found that A. baumannii is susceptible to hBD-2 and -3 killing at submicromolar concentrations. Moreover, hBD-3 induction by A. baumannii was found to be dependent on epidermal growth factor receptor (EGFR) signaling. Inhibition of mitogen-activated protein kinase resulted in reduced expression of both hBD-2 and -3. Lastly, a disintegrin and metalloprotease 17 (ADAM17; also known as TACE) was found to be critical for hBD-3 induction, while ADAM10 and dual oxidase 1 (Duox1) were not required for hBD-3 induction. Induction of AMPs is an important component of innate sensing of pathogens and may play an important role in triggering systemic immune responses to A. baumannii infection. Further studies on the interactions between epithelial cells and A. baumannii will help us understand early stages of infection and may shed light on why some individuals are more vulnerable to A. baumannii infection. PMID:25114113

  10. Epithelial innate immune response to Acinetobacter baumannii challenge.


    Feng, Zhimin; Jia, Xun; Adams, Mark D; Ghosh, Santosh K; Bonomo, Robert A; Weinberg, Aaron


    Currently, Acinetobacter baumannii is recognized as one of the major pathogens seriously threatening our health care delivery system. Aspects of the innate immune response to A. baumannii infection are not yet well understood. Human β-defensins (hBDs) are epithelial cell-derived cationic antimicrobial peptides (AMPs) that also function to bridge the innate and adaptive immune system. We tested the induction of hBD-2 and -3 by A. baumannii on primary oral and skin epithelial cells and found that A. baumannii induces hBD-3 transcripts to a greater extent than it induces hBD-2 transcripts on both types of cells. In addition, we found that A. baumannii is susceptible to hBD-2 and -3 killing at submicromolar concentrations. Moreover, hBD-3 induction by A. baumannii was found to be dependent on epidermal growth factor receptor (EGFR) signaling. Inhibition of mitogen-activated protein kinase resulted in reduced expression of both hBD-2 and -3. Lastly, a disintegrin and metalloprotease 17 (ADAM17; also known as TACE) was found to be critical for hBD-3 induction, while ADAM10 and dual oxidase 1 (Duox1) were not required for hBD-3 induction. Induction of AMPs is an important component of innate sensing of pathogens and may play an important role in triggering systemic immune responses to A. baumannii infection. Further studies on the interactions between epithelial cells and A. baumannii will help us understand early stages of infection and may shed light on why some individuals are more vulnerable to A. baumannii infection.

  11. [Evolution of antimicrobial susceptibility of Acinetobacter baumannii clinical isolates].


    López-Hernández, S; Alarcón, T; López-Brea, M


    Acinetobacter baumannii is a microorganism frequently implicated in colonization and infection in hospitalized patients. An increase of resistance has been observed in recent years making these infections difficult to treat. The in vitro activity of 24 antibiotics, 15 betalactam agents and nine nonbetalactams, was studied in 156 A. baumannii clinical isolates. The strains were collected from different clinical samples obtained from inpatients (92%) and 8% were from outpatients. Evolution of susceptibility from January 1995 to December 1997 was studied. MIC of the following antibiotics was determined by the agar dilution method: ampicillin, ticarcillin, piperacillin, ampicillin-sulbactam, amoxicillin- clavulanic acid, ticarcillin-clavulanic acid, piperacillin-tazobactam, cefotaxime, ceftazidime, cefepime, imipenem, meropenem, clavulanic acid, sulbactam, tazobactam, amikacin, gentamicin, tobramycin, ofloxacin, doxycycline, fosfomycin, rifampin, azithromycin and colistin. Low antimicrobial susceptibility was observed in most A. baumannii strains. Colistin, imipenem, meropenem and ampicillin-sulbactam showed the greatest susceptibility (100, 88.4, 88.4 and 84.6%, respectively). A. baumannii strains from inpatients showed a lower antimicrobial susceptibility than strains from outpatients, who showed a high percentage of susceptibility to most antibiotics. Rifampin and azithromycin showed certain in vitro activity against the most susceptible A. baumannii strains. A progressive decrease in susceptibility to most antibiotics was observed during the period studied. Carbapenem-resistant A. baumannii emerged in 1996 and increased in 1997.

  12. [Ecological aspects and prophylaxis of Acinetobacter baumannii nosocomial infection].


    Boukadida, J


    Acinetobacter Baumannii is an aerobic strit gram negative bacteria cause of epidemic infection in intensive care units this bacteria is isolated from the patient and its environment. The detection of AB infection require the isolation of patients and decontamination of the material despite the virulence of the germ, these measures are necessary due to the rapid extension of epidemic in the absence of adequate means.

  13. First report of OXA-72 producing Acinetobacter baumannii in Romania.


    Georgescu, M; Gheorghe, I; Dudu, A; Czobor, I; Costache, M; Cristea, V-C; Lazăr, V; Chifiriuc, M C


    This is the first report of an OXA-72-producing Acinetobacter baumannii strain in Romania, isolated from chronic leg ulcer samples. Identification of the strain was performed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. Presence of carbapenem resistance genes was investigated by PCR and sequencing. Our data support the spread of the bla OXA-72 gene in Eastern Europe.

  14. Membrane proteomes of Pseudomonas aeruginosa and Acinetobacter baumannii.


    Dé, E; Cosette, P; Coquet, L; Siroy, A; Alexandre, S; Duncan, A; Naudin, B; Rihouey, C; Schaumann, A; Junter, G A; Jouenne, T


    Acinetobacter baumannii and Pseudomonas aeruginosa are known for their intrinsic resistance to antibiotics. Between mechanisms involved in this resistance, diminished expression of outer membrane proteins and up-regulation of efflux pumps play an important role. The characterization of membrane proteins is consequently necessary because of their importance in the antibiotic resistance but also in virulence. This review presents proteomic investigations aiming to describe the protein content of the membranes of these two bacterial species.

  15. Stress responses in the opportunistic pathogen Acinetobacter baumannii

    PubMed Central

    Fiester, Steven E; Actis, Luis A


    Acinetobacter baumannii causes a wide range of severe infections among compromised and injured patients worldwide. The relevance of these infections are, in part, due to the ability of this pathogen to sense and react to environmental and host stress signals, allowing it to persist and disseminate in medical settings and the human host. This review summarizes current knowledge on the roles that environmental and cellular stressors play in the ability of A. baumannii to resist nutrient deprivation, oxidative and nitrosative injury, and even the presence of the commonly used antiseptic ethanol, which could serve as a nutrient- and virulence-enhancing signal rather than just being a convenient disinfectant. Emerging experimental evidence supports the role of some of these responses in the pathogenesis of the infections A. baumannii causes in humans and its capacity to resist antibiotics and host response effectors. PMID:23464372

  16. Acinetobacter baumannii: biology and drug resistance - role of carbapenemases.


    Nowak, Pawel; Paluchowska, Paulina


    Acinetobacter baumannii is a Gram-negative, glucose-non-fermenting, oxidase-negative coccobacillus, most commonly associated with the hospital settings. The ability to survive in adverse environmental conditions as well as high level of natural and acquired antimicrobial resistance make A. baumannii one of the most important nosocomial pathogens. While carbapenems have long been considered as antimicrobials of last-resort, the rates of clinical A. baumannii strains resistant to these antibiotics are increasing worldwide. Carbapenem resistance among A. baumannii is conferred by coexisting mechanisms including: decrease in permeability of the outer membrane, efflux pumps, production of beta-lactamases, and modification of penicillin-binding proteins. The most prevalent mechanism of carbapenem resistance among A. baumannii is associated with carbapenem-hydro-lysing enzymes that belong to Ambler class D and B beta-lactamases. In addition, there have also been reports of resistance mediated by selected Ambler class A carbapenemases among A. baumannii strains. Resistance determinants in A. baumannii are located on chromosome and plasmids, while acquisition of new mechanisms can be mediated by insertion sequences, integrons, transposons, and plasmids. Clinical relevance of carbapen-em resistance among strains isolated from infected patients, carriers and hospital environment underlines the need for carbapenemase screening. Currently available methods vary in principle, accuracy and efficiency. The techniques that deserve particular attention belong to both easily accessible unsophisticated methods as well as advanced techniques based on mass spectrometry or molecular biology. While carbapenemases limit the therapeutic options in A. baumannii infections, studies concerning novel beta-lactamase inhibitors offer a new insight into effective therapy.

  17. Serum resistance, gallium nitrate tolerance and extrapulmonary dissemination are linked to heme consumption in a bacteremic strain of Acinetobacter baumannii.


    de Léséleuc, Louis; Harris, Greg; KuoLee, Rhonda; Xu, H Howard; Chen, Wangxue


    Bacteremia caused by Acinetobacter baumannii is a highly lethal complication of hospital-acquired pneumonia. In the present study, we investigated the serum resistance, gallium nitrate tolerance and heme consumption of A. baumannii strain LAC-4 which was recently reported to display high virulence in a mouse pneumonia model with extrapulmonary dissemination leading to fatal bacteremia. This strain showed enhanced growth in mouse and fetal bovine serum that was independent of complement and was not observed with regular growth media. The LAC-4 strain was found to possess a high tolerance to gallium nitrate (GaN), whereas serum synergized with GaN in inhibiting A. baumannii strain ATCC 17978. We found that LAC-4 contains a heme oxygenase gene and expresses a highly efficient heme consumption system. This system can be fully blocked in vitro and in vivo by gallium protoporphyrin IX (GaPPIX). Inhibition of heme consumption by GaPPIX completely abrogated the growth advantage of LAC-4 in serum as well as its tolerance to GaN. More importantly, GaPPIX treatment of mice intranasally infected with LAC-4 prevented extrapulmonary dissemination and death. Thus, we propose that heme provides an additional source of iron for LAC-4 to bypass iron restriction caused by serum transferrin, lactoferrin or free gallium salts. Heme consumption systems in A. baumannii may constitute major virulence factors for lethal bacteremic isolates.

  18. Control of hospital endemicity of multiple-drug-resistant Acinetobacter baumannii ST457 with directly observed hand hygiene.


    Cheng, V C C; Chen, J H K; Poon, R W S; Lee, W M; So, S Y C; Wong, S C Y; Chau, P H; Yip, C C Y; Wong, S S Y; Chan, J F W; Hung, I F N; Ho, P L; Yuen, K Y


    An increasing endemicity of multiple-drug-resistant Acinetobacter baumannii (MRAB) ST457 was noted in Hong Kong. The epidemiology, risk factors, and infection control measures to prevent nosocomial transmission of this epidemic clone were analyzed. A total of 5,058 patients cultured positive with A. baumannii between 1 January 2004 and 30 June 2014 were included, of which 297 (5.9 %) had bacteremia. The first case of MRAB bacteremia emerged in 2009, with an incidence that increased from 0.27 (one case) in 2009 to 1.86 (14 cases) per 100,000 patient-days in 2013 (p < 0.001). With the implementation of strict contact precautions and directly observed hand hygiene in conscious patients immediately before receiving meals and medications in July 2013, the incidence of MRAB bacteremia reduced from its peak to 0.77 (one case) per 100,000 patient-days in the first 6 months of 2014 (p < 0.001). Patients from long-term care facilities for the elderly [odds ratio (OR) 18.6, confidence interval (CI) 2.1-162.4, p = 0.008] and history of carbapenem (OR 7.0, CI 1.7-28.0, p = 0.006) and beta-lactam/beta-lactamase use (OR 5.6, CI 1.1-28.7, p = 0.038) 90 days prior to admission were independent risk factors for MRAB bacteremia by logistic regression when compared with carbapenem-susceptible A. baumannii bacteremia.

  19. Molecular Analysis of the Acinetobacter baumannii Biofilm-Associated Protein

    PubMed Central

    Goh, H. M. Sharon; Beatson, Scott A.; Totsika, Makrina; Moriel, Danilo G.; Phan, Minh-Duy; Szubert, Jan; Runnegar, Naomi; Sidjabat, Hanna E.; Paterson, David L.; Nimmo, Graeme R.; Lipman, Jeffrey


    Acinetobacter baumannii is a multidrug-resistant pathogen associated with hospital outbreaks of infection across the globe, particularly in the intensive care unit. The ability of A. baumannii to survive in the hospital environment for long periods is linked to antibiotic resistance and its capacity to form biofilms. Here we studied the prevalence, expression, and function of the A. baumannii biofilm-associated protein (Bap) in 24 carbapenem-resistant A. baumannii ST92 strains isolated from a single institution over a 10-year period. The bap gene was highly prevalent, with 22/24 strains being positive for bap by PCR. Partial sequencing of bap was performed on the index case strain MS1968 and revealed it to be a large and highly repetitive gene approximately 16 kb in size. Phylogenetic analysis employing a 1,948-amino-acid region corresponding to the C terminus of Bap showed that BapMS1968 clusters with Bap sequences from clonal complex 2 (CC2) strains ACICU, TCDC-AB0715, and 1656-2 and is distinct from Bap in CC1 strains. By using overlapping PCR, the bapMS1968 gene was cloned, and its expression in a recombinant Escherichia coli strain resulted in increased biofilm formation. A Bap-specific antibody was generated, and Western blot analysis showed that the majority of A. baumannii strains expressed an ∼200-kDa Bap protein. Further analysis of three Bap-positive A. baumannii strains demonstrated that Bap is expressed at the cell surface and is associated with biofilm formation. Finally, biofilm formation by these Bap-positive strains could be inhibited by affinity-purified Bap antibodies, demonstrating the direct contribution of Bap to biofilm growth by A. baumannii clinical isolates. PMID:23956398

  20. Inverse PCR for subtyping of Acinetobacter baumannii carrying ISAba1.


    Kim, Shukho; Park, Yun-Ju; Kim, Jungmin


    Acinetobacter baumannii has been prevalent in nosocomial infections, often causing outbreaks in intensive care units. ISAba1 is an insertion sequence that has been identified only in A. baumannii and its copy number varies among strains. It has been reported that ISAba1 provides a promoter for bla(OXA-51-like), bla(OXA-23-like), and bla(ampC), which are associated with the resistance of A. baumannii to carbapenems and cephalosporins. The main purpose of this study was to develop a novel inverse PCR method capable of typing A. baumannii strains. The method involves three major steps: cutting of genomic DNA with a restriction enzyme, ligation, and PCR. In the first step, bacterial genomic DNA was digested with DpnI. In the second step, the digested genomic DNAs were ligated to form intramolecular circular DNAs. In the last step, the ligated circular DNAs were amplified by PCR with primers specific for ISAba1 and the amplified PCR products were electrophoresed. Twenty-two clinical isolates of A. baumannii were used for the evaluation of the inverse PCR (iPCR) typing method. Dendrogram analysis revealed two major clusters, similar to pulsed-field gel electrophoresis (PFGE) results. Three ISAba1-associated genes--bla(ampC), bla(OXA-66-like), and csuD--were amplified and detected in the clinical isolates. This novel iPCR typing method is comparable to PFGE in its ability to discriminate A. baumannii strains, and is a promising molecular epidemiological tool for investigating A. baumannii carrying ISAba1.

  1. Complete Genome Sequence of Lytic Bacteriophage LZ35 Infecting Acinetobacter baumannii Isolates

    PubMed Central

    Guo, Zhonghe; Huang, Honglan; Wu, Xiaolin; Hao, Yuchong


    Acinetobacter baumannii is a Gram-negative opportunistic pathogen that is frequently associated with nosocomial infections. Bacteriophages infecting A. baumannii can be used as effective agents to control these infections. Here, we announce the complete genome sequence of the lytic bacteriophage LZ35 infecting A. baumannii isolates. PMID:27856573

  2. Draft Genome Sequences of Acinetobacter baumannii Isolates from Wounded Military Personnel.


    Arivett, Brock A; Ream, Dave C; Fiester, Steven E; Kidane, Destaalem; Actis, Luis A


    Acinetobacter baumannii is a Gram-negative bacterium capable of causing hospital-acquired infections that has been grouped with Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter species as ESKAPE pathogens because of their extensive drug resistance phenotypes and increasing risk to human health. Twenty-four multidrug-resistant A. baumannii strains isolated from wounded military personnel were sequenced and annotated.

  3. Antimicrobial active herbal compounds against Acinetobacter baumannii and other pathogens

    PubMed Central

    Tiwari, Vishvanath; Roy, Ranita; Tiwari, Monalisa


    Bacterial pathogens cause a number of lethal diseases. Opportunistic bacterial pathogens grouped into ESKAPE pathogens that are linked to the high degree of morbidity, mortality and increased costs as described by Infectious Disease Society of America. Acinetobacter baumannii is one of the ESKAPE pathogens which cause respiratory infection, pneumonia and urinary tract infections. The prevalence of this pathogen increases gradually in the clinical setup where it can grow on artificial surfaces, utilize ethanol as a carbon source and resists desiccation. Carbapenems, a β-lactam, are the most commonly prescribed drugs against A. baumannii. The high level of acquired and intrinsic carbapenem resistance mechanisms acquired by these bacteria makes their eradication difficult. The pharmaceutical industry has no solution to this problem. Hence, it is an urgent requirement to find a suitable alternative to carbapenem, a commonly prescribed drug for Acinetobacter infection. In order to do this, here we have made an effort to review the active compounds of plants that have potent antibacterial activity against many bacteria including carbapenem resistant strain of A. baumannii. We have also briefly highlighted the separation and identification methods used for these active compounds. This review will help researchers involved in the screening of herbal active compounds that might act as a replacement for carbapenem. PMID:26150810

  4. Blood stream infections caused by Acinetobacter baumannii group in Japan - Epidemiological and clinical investigation.


    Fujikura, Yuji; Yuki, Atsushi; Hamamoto, Takaaki; Kawana, Akihiko; Ohkusu, Kiyofumi; Matsumoto, Tetsuya


    Acinetobacter calcoaceticus-Acinetobacter baumannii complex, especially A. baumannii, Acinetobacter pittii and Acinetobacter nosocomialis, constitutes an important group of nosocomial pathogens; however, epidemiological or clinical characteristics and prognosis is limited in Japan. From 2009 to 2013, 47 blood stream infection cases resulting from A. baumannii group were reviewed at the National Defense Medical College, an 800-bed tertiary hospital. To determine the genospecies, further comparative nucleotide sequence analyses of the RNA polymerase b-subunit (rpoB) gene were performed. Sequence analysis of rpoB gene showed that 25 (49.0%), 17 (33.3%) and 5 (9.8%) cases were caused by A. baumannii, A. pittii and A. nosocomialis, respectively. The 30-day and in-hospital mortality rates of A. baumannii were 8.5% and 25.5%, respectively, and there were no significant differences between Acinetobacter species. Clinical characteristics were statistically insignificant. Multidrug-resistant Acinetobacter species were detected in 3 cases (5.9%) with same pulsed-field gel electrophoresis (PFGE) pattern and A. baumannii was less susceptible to amikacin and levofloxacin. In this study, the mortality and clinical characteristics were similar among A. baumannii group isolate cases despite some showing drug resistance. However, identification of Acinetobacter species helps to initiate appropriate antibiotic therapy in earlier treatment phase, because A. baumannii shows some drug resistance.

  5. Structure and biosynthesis of fimsbactins A-F, siderophores from Acinetobacter baumannii and Acinetobacter baylyi.


    Proschak, Anna; Lubuta, Patrice; Grün, Peter; Löhr, Frank; Wilharm, Gottfried; De Berardinis, Veronique; Bode, Helge B


    Novel chatechol/hydroxamate siderophores (named "fimsbactins") were identified in Acinetobacter baumannii ATCC 17978 and Acinetobacter baylyi ADP1. The major compound, fimsbactin A, was isolated from low-iron cultures of A. baylyi ADP1, and its chemical structure was elucidated by mass spectrometry, and detailed (1)H, (13)C and (15)N NMR spectroscopy. From inverse feeding experiments following HPLC-MS analysis, the structures of five additional derivatives were elucidated. The gene cluster encoding the fimsbactin synthetase (fbs) was identified in both genomes, and mutants in fbs genes in A. baylyi were analyzed, thus allowing prediction of the fimsbactin biosynthesis pathway.

  6. Epidemiologic and Clinical Impact of Acinetobacter baumannii Colonization and Infection

    PubMed Central

    Villar, Macarena; Cano, María E.; Gato, Eva; Garnacho-Montero, José; Miguel Cisneros, José; Ruíz de Alegría, Carlos; Fernández-Cuenca, Felipe; Martínez-Martínez, Luis; Vila, Jordi; Pascual, Alvaro; Tomás, María; Bou, Germán; Rodríguez-Baño, Jesús


    Abstract Acinetobacter baumannii is one of the most important antibiotic-resistant nosocomial bacteria. We investigated changes in the clinical and molecular epidemiology of A. baumannii over a 10-year period. We compared the data from 2 prospective multicenter cohort studies in Spain, one performed in 2000 (183 patients) and one in 2010 (246 patients), which included consecutive patients infected or colonized by A. baumannii. Molecular typing was performed by repetitive extragenic palindromic polymerase chain reaction (REP-PCR), pulsed-field gel electrophoresis (PFGE), and multilocus sequence typing (MLST). The incidence density of A. baumannii colonization or infection increased significantly from 0.14 in 2000 to 0.52 in 2010 in medical services (p < 0.001). The number of non-nosocomial health care-associated cases increased from 1.2% to 14.2%, respectively (p < 0.001). Previous exposure to carbapenems increased in 2010 (16.9% in 2000 vs 27.3% in 2010, p = 0.03). The drugs most frequently used for definitive treatment of patients with infections were carbapenems in 2000 (45%) and colistin in 2010 (50.3%). There was molecular-typing evidence of an increase in the frequency of A. baumannii acquisition in non-intensive care unit wards in 2010 (7.6% in 2000 vs 19.2% in 2010, p = 0.01). By MSLT, the ST2 clonal group predominated and increased in 2010. This epidemic clonal group was more frequently resistant to imipenem and was associated with an increased risk of sepsis, although not with severe sepsis or mortality. Some significant changes were noted in the epidemiology of A. baumannii, which is increasingly affecting patients admitted to conventional wards and is also the cause of non-nosocomial health care-associated infections. Epidemic clones seem to combine antimicrobial resistance and the ability to spread, while maintaining their clinical virulence. PMID:25181313

  7. Stress Conditions Induced by Carvacrol and Cinnamaldehyde on Acinetobacter baumannii.


    Montagu, Angélique; Joly-Guillou, Marie-Laure; Rossines, Elisabeth; Cayon, Jérome; Kempf, Marie; Saulnier, Patrick


    Acinetobacter baumannii has emerged as a major cause of nosocomial infections. The ability of A. baumannii to display various resistance mechanisms against antibiotics has transformed it into a successful nosocomial pathogen. The limited number of antibiotics in development and the disengagement of the pharmaceutical industry have prompted the development of innovative strategies. One of these strategies is the use of essential oils, especially aromatic compounds that are potent antibacterial molecules. Among them, the combination of carvacrol and cinnamaldehyde has already demonstrated antibacterial efficacy against A. baumannii. The aim of this study was to determine the biological effects of these two compounds in A. baumannii, describing their effect on the rRNA and gene regulation under environmental stress conditions. Results demonstrated rRNA degradation by the carvacrol/cinnamaldehyde mixture, and this effect was due to carvacrol. Degradation was conserved after encapsulation of the mixture in lipid nanocapsules. Results showed an upregulation of the genes coding for heat shock proteins, such as groES, groEL, dnaK, clpB, and the catalase katE, after exposure to carvacrol/cinnamaldehyde mixture. The catalase was upregulated after carvacrol exposure wich is related to an oxidative stress. The combination of thiourea (hydroxyl radical scavenger) and carvacrol demonstrated a potent bactericidal effect. These results underline the development of defense strategies of the bacteria by synthesis of reactive oxygen species in response to environmental stress conditions, such as carvacrol.

  8. Antimicrobial resistance in Acinetobacter baumannii: From bench to bedside

    PubMed Central

    Lin, Ming-Feng; Lan, Chung-Yu


    Acinetobacter baumannii (A. baumannii) is undoubtedly one of the most successful pathogens in the modern healthcare system. With invasive procedures, antibiotic use and immunocompromised hosts increasing in recent years, A. baumannii has become endemic in hospitals due to its versatile genetic machinery, which allows it to quickly evolve resistance factors, and to its remarkable ability to tolerate harsh environments. Infections and outbreaks caused by multidrug-resistant A. baumannii (MDRAB) are prevalent and have been reported worldwide over the past twenty or more years. To address this problem effectively, knowledge of species identification, typing methods, clinical manifestations, risk factors, and virulence factors is essential. The global epidemiology of MDRAB is monitored by persistent surveillance programs. Because few effective antibiotics are available, clinicians often face serious challenges when treating patients with MDRAB. Therefore, a deep understanding of the resistance mechanisms used by MDRAB can shed light on two possible strategies to combat the dissemination of antimicrobial resistance: stringent infection control and antibiotic treatments, of which colistin-based combination therapy is the mainstream strategy. However, due to the current unsatisfying therapeutic outcomes, there is a great need to develop and evaluate the efficacy of new antibiotics and to understand the role of other potential alternatives, such as antimicrobial peptides, in the treatment of MDRAB infections. PMID:25516853

  9. Stress Conditions Induced by Carvacrol and Cinnamaldehyde on Acinetobacter baumannii

    PubMed Central

    Montagu, Angélique; Joly-Guillou, Marie-Laure; Rossines, Elisabeth; Cayon, Jérome; Kempf, Marie; Saulnier, Patrick


    Acinetobacter baumannii has emerged as a major cause of nosocomial infections. The ability of A. baumannii to display various resistance mechanisms against antibiotics has transformed it into a successful nosocomial pathogen. The limited number of antibiotics in development and the disengagement of the pharmaceutical industry have prompted the development of innovative strategies. One of these strategies is the use of essential oils, especially aromatic compounds that are potent antibacterial molecules. Among them, the combination of carvacrol and cinnamaldehyde has already demonstrated antibacterial efficacy against A. baumannii. The aim of this study was to determine the biological effects of these two compounds in A. baumannii, describing their effect on the rRNA and gene regulation under environmental stress conditions. Results demonstrated rRNA degradation by the carvacrol/cinnamaldehyde mixture, and this effect was due to carvacrol. Degradation was conserved after encapsulation of the mixture in lipid nanocapsules. Results showed an upregulation of the genes coding for heat shock proteins, such as groES, groEL, dnaK, clpB, and the catalase katE, after exposure to carvacrol/cinnamaldehyde mixture. The catalase was upregulated after carvacrol exposure wich is related to an oxidative stress. The combination of thiourea (hydroxyl radical scavenger) and carvacrol demonstrated a potent bactericidal effect. These results underline the development of defense strategies of the bacteria by synthesis of reactive oxygen species in response to environmental stress conditions, such as carvacrol. PMID:27486453

  10. Characterization of newly isolated lytic bacteriophages active against Acinetobacter baumannii.


    Merabishvili, Maia; Vandenheuvel, Dieter; Kropinski, Andrew M; Mast, Jan; De Vos, Daniel; Verbeken, Gilbert; Noben, Jean-Paul; Lavigne, Rob; Vaneechoutte, Mario; Pirnay, Jean-Paul


    Based on genotyping and host range, two newly isolated lytic bacteriophages, myovirus vB_AbaM_Acibel004 and podovirus vB_AbaP_Acibel007, active against Acinetobacter baumannii clinical strains, were selected from a new phage library for further characterization. The complete genomes of the two phages were analyzed. Both phages are characterized by broad host range and essential features of potential therapeutic phages, such as short latent period (27 and 21 min, respectively), high burst size (125 and 145, respectively), stability of activity in liquid culture and low frequency of occurrence of phage-resistant mutant bacterial cells. Genomic analysis showed that while Acibel004 represents a novel bacteriophage with resemblance to some unclassified Pseudomonas aeruginosa phages, Acibel007 belongs to the well-characterized genus of the Phikmvlikevirus. The newly isolated phages can serve as potential candidates for phage cocktails to control A. baumannii infections.

  11. The structure of alanine racemase from Acinetobacter baumannii.


    Davis, Emily; Scaletti-Hutchinson, Emma; Opel-Reading, Helen; Nakatani, Yoshio; Krause, Kurt L


    Acinetobacter baumannii is an opportunistic Gram-negative bacterium which is a common cause of hospital-acquired infections. Numerous antibiotic-resistant strains exist, emphasizing the need for the development of new antimicrobials. Alanine racemase (Alr) is a pyridoxal 5'-phosphate dependent enzyme that is responsible for racemization between enantiomers of alanine. As D-alanine is an essential component of the bacterial cell wall, its inhibition is lethal to prokaryotes, making it an excellent antibiotic drug target. The crystal structure of A. baumannii alanine racemase (AlrAba) from the highly antibiotic-resistant NCTC13302 strain has been solved to 1.9 Å resolution. Comparison of AlrAba with alanine racemases from closely related bacteria demonstrates a conserved overall fold. The substrate entryway and active site of the enzymes were shown to be highly conserved. The structure of AlrAba will provide the template required for future structure-based drug-design studies.

  12. In vitro and in vivo biological activities of iron chelators and gallium nitrate against Acinetobacter baumannii.


    de Léséleuc, Louis; Harris, Greg; KuoLee, Rhonda; Chen, Wangxue


    We investigated the ability of compounds interfering with iron metabolism to inhibit the growth of Acinetobacter baumannii. Iron restriction with transferrin or 2,2-bipyridyl significantly inhibited A. baumannii growth in vitro. Gallium nitrate alone was moderately effective at reducing A. baumannii growth but became bacteriostatic in the presence of serum or transferrin. More importantly, gallium nitrate treatment reduced lung bacterial burdens in mice. The use of gallium-based therapies shows promise for the control of multidrug-resistant A. baumannii.

  13. Morphine, but not trauma, sensitizes to systemic Acinetobacter baumannii infection.


    Breslow, Jessica M; Monroy, M Alexandra; Daly, John M; Meissler, Joseph J; Gaughan, John; Adler, Martin W; Eisenstein, Toby K


    Acinetobacter baumannii is an important nosocomial pathogen in civilian intensive care units. Recently the incidence has increased in wounded military personnel. Morphine is documented in numerous animal studies to be immunosuppressive and to sensitize to infection. The hypotheses were tested that morphine, administered for analgesia in the battlefield, predisposes to Acinetobacter infection, and that the opioid may have an additive or synergistic effect with trauma. To test these hypotheses, an intraperitoneal infection model was established in mice using several Acinetobacter strains. Morphine administered for 48 h by implantation of a slow-release morphine pellet increased mortality compared to animals receiving a placebo pellet, an effect that was blocked by the mu-opioid receptor antagonist, naltrexone. Acinetobacter burdens in the blood, spleens, livers, and lungs of morphine-treated mice, were significantly higher than those in placebo-treated animals, confirming that mortality was due to potentiated growth of the bacteria. There were also elevated levels of pro-inflammatory cytokines in morphine-treated versus placebo-treated mice. Morphine caused a reduction in the total number of cells in the peritoneal cavity, a decrease in the percentage and total numbers of neutrophils, and a decrease in the total number of macrophages. Morphine treatment also suppressed levels of the neutrophil-inducing molecules, IL-17A and KC/CXCL1. However, IL-17A(-/-) mice given morphine were not sensitized to Acintobacter infection to a greater degree than similarly treated wild-type mice. Trauma alone did not sensitize to Acinetobacter infection, and there was no additive effect between morphine and trauma. These results support the hypothesis that morphine potentiates Acinetobacter infection.

  14. Molecular epidemiology of Acinetobacter baumannii and Acinetobacter nosocomialis in Germany over a 5-year period (2005-2009).


    Schleicher, X; Higgins, P G; Wisplinghoff, H; Körber-Irrgang, B; Kresken, M; Seifert, H


    To investigate the species distribution within the Acinetobacter calcoaceticus-Acinetobacter baumannii complex and the molecular epidemiology of A. baumannii and Acinetobacter nosocomialis, 376 Acinetobacter isolates were collected prospectively from hospitalized patients at 15 medical centres in Germany during three surveillance studies conducted over a 5-year period. Species identification was performed by molecular methods. Imipenem minimum inhibitory concentrations (MIC) were determined by broth microdilution. The prevalence of the most common carbapenemase-encoding genes was investigated by oxacillinase (OXA) -multiplex polymerase chain reaction (PCR). The molecular epidemiology was investigated by repetitive sequence-based PCR (rep-PCR; DiversiLab™). Acinetobacter pittii was the most prevalent Acinetobacter species (n = 193), followed by A. baumannii (n = 140), A. calcoaceticus (n = 10) and A. nosocomialis (n = 8). The majority of A. baumannii was represented by sporadic isolates (n = 70, 50%) that showed unique rep-PCR patterns, 25 isolates (18%) clustered with one or two other isolates, and only 45 isolates (32%) belonged to one of the previously described international clonal lineages. The most prevalent clonal lineage was international clone (IC) 2 (n = 34) and IC 1 (n = 6). According to CLSI, 25 A. baumannii isolates were non-susceptible to imipenem (MIC ≥ 8 mg/L), all of which produced an OXA-58-like or OXA-23-like carbapenemase. The rate of imipenem susceptibility among A. baumannii isolates decreased from 96% in 2005 to 76% in 2009. All other Acinetobacter isolates were susceptible to imipenem. The population structure of carbapenem-susceptible A. baumannii in Germany is highly diverse. Imipenem non-susceptibility was strongly associated with the clonal lineages IC 2 and IC 1. These data underscore the high clonality of carbapenem-resistant A. baumannii isolates.

  15. Imipenem: a potent inducer of multidrug resistance in Acinetobacter baumannii.


    Kuo, Han-Yueh; Chang, Kai-Chih; Kuo, Jai-Wei; Yueh, Hui-Wen; Liou, Ming-Li


    This study investigated the progression of multidrug resistance upon exposure to imipenem in Acinetobacter baumannii. Eighteen A. baumannii strains, including two reference strains (ATCC 19606 and ATCC 17978), four clinical strains (AB56, AB242, AB273 and AB279) and 12 antibiotic-selected mutant strains, were used in this study. Imipenem-selected mutants were generated from imipenem-susceptible strains (ATCC 19606, ATCC 17978 and AB242) by multistep selection resistance. Amikacin-, ciprofloxacin-, colistin-, meropenem- and ceftazidime-selected mutants were also generated from the two reference strains and were used for comparison. Antibiotic susceptibilities in the absence and presence of the efflux pump inhibitors carbonyl cyanide m-chlorophenylhydrazone (CCCP) and 1-(1-naphthylmethyl)-piperazine (NMP) were examined in the three imipenem-selected mutants and the three clinical multidrug-resistant (MDR) isolates. Expression profiles of the antimicrobial resistance genes in the imipenem-selected mutants and their parental strains were also determined. The results showed that imipenem was more likely, compared with the other antibiotics, to induce a MDR phenotype in the two reference strains. Differences in OXA-51-like carbapenemase, efflux pumps or/and AmpC β-lactamase expression were observed in the three imipenem-selected mutants. Moreover, a reduction in imipenem or amikacin resistance was observed when the imipenem-selected mutants and clinical isolates were exposed to NMP and CCCP. This study concluded that imipenem might be a potent inducer of multidrug resistance in A. baumannii strains. OXA-51-like carbapenemase combined with other resistance mechanisms may contribute to the development of multidrug resistance in A. baumannii. Monitoring the use of carbapenems is required to reduce the spread of MDR A. baumannii in hospitals.

  16. Genetic Regulation of Virulence and Antibiotic Resistance in Acinetobacter baumannii

    PubMed Central

    Kröger, Carsten; Kary, Stefani C.; Schauer, Kristina; Cameron, Andrew D. S.


    Multidrug resistant microorganisms are forecast to become the single biggest challenge to medical care in the 21st century. Over the last decades, members of the genus Acinetobacter have emerged as bacterial opportunistic pathogens, in particular as challenging nosocomial pathogens because of the rapid evolution of antimicrobial resistances. Although we lack fundamental biological insight into virulence mechanisms, an increasing number of researchers are working to identify virulence factors and to study antibiotic resistance. Here, we review current knowledge regarding the regulation of virulence genes and antibiotic resistance in Acinetobacter baumannii. A survey of the two-component systems AdeRS, BaeSR, GacSA and PmrAB explains how each contributes to antibiotic resistance and virulence gene expression, while BfmRS regulates cell envelope structures important for pathogen persistence. A. baumannii uses the transcription factors Fur and Zur to sense iron or zinc depletion and upregulate genes for metal scavenging as a critical survival tool in an animal host. Quorum sensing, nucleoid-associated proteins, and non-classical transcription factors such as AtfA and small regulatory RNAs are discussed in the context of virulence and antibiotic resistance. PMID:28036056

  17. Association of class 1 and 2 integrons with multidrug-resistant Acinetobacter baumannii international clones and Acinetobacter nosocomialis isolates.


    Martins, Natacha; Picão, Renata Cristina; Adams-Sapper, Sheila; Riley, Lee W; Moreira, Beatriz Meurer


    The Acinetobacter baumannii clonal complex 113/79 (CC113/79) and class 2 integrons predominate in Latin America; a relationship between these characteristics was explored. The presence of integrases was determined in successive hospital Acinetobacter isolates (163 A. baumannii isolates and 72 Acinetobacter nosocomialis isolates). Most isolates had integrons, but class 1 and 2 integrons were present significantly more often in CC109/1 and CC113/79, respectively. The high prevalence of CC113/79 in Latin America may account for the predominance of class 2 integrons.

  18. Evaluation of Parameters for High Efficiency Transformation of Acinetobacter baumannii

    PubMed Central

    Yildirim, Suleyman; Thompson, Mitchell G.; Jacobs, Anna C.; Zurawski, Daniel V.; Kirkup, Benjamin C.


    Acinetobacter baumannii is an emerging, nosocomial pathogen that is poorly characterized due to a paucity of genetic tools and methods. While whole genome sequence data from several epidemic and environmental strains have recently become available, the functional characterization of genes is significantly lagging. Efficient transformation is one of the first steps to develop molecular tools that can be used to address these shortcomings. Here we report parameters allowing high efficiency transformation of A. baumannii. Using a multi-factorial experimental design we found that growth phase, voltage, and resistance all significantly contribute to transformation efficiency. The highest efficiency (4.3 × 108 Transformants/μg DNA) was obtained at the stationary growth phase of the bacterium (OD 6.0) using 25 ng of plasmid DNA under 100 Ohms resistance and 1.7 kV/cm voltage. The optimized electroporation parameters reported here provide a useful tool for genetic manipulation of A. baumannii. PMID:26911658

  19. Characterization of surface antigen protein 1 (SurA1) from Acinetobacter baumannii and its role in virulence and fitness.


    Liu, Dong; Liu, Zeng-Shan; Hu, Pan; Cai, Ling; Fu, Bao-Quan; Li, Yan-Song; Lu, Shi-Ying; Liu, Nan-Nan; Ma, Xiao-Long; Chi, Dan; Chang, Jiang; Shui, Yi-Ming; Li, Zhao-Hui; Ahmad, Waqas; Zhou, Yu; Ren, Hong-Lin


    Acinetobacter baumannii is a Gram-negative bacillus that causes nosocomial infections, such as bacteremia, pneumonia, and meningitis and urinary tract and wound infections. In the present study, the surface antigen protein 1 (SurA1) gene of A. baumannii strain CCGGD201101 was identified, cloned and expressed, and then its roles in fitness and virulence were investigated. Virulence was observed in the human lung cancer cell lines A549 and HEp-2 at one week after treatment with recombinant SurA1. One isogenic SurA1 knock-out strain, GR0015, which was derived from the A. baumannii strain CCGGD201101 isolated from diseased chicks in a previous study, highlighted the effect of SurA1 on fitness and growth. Its growth rate in LB broth and killing activity in human sera were significantly decreased compared with strain CCGGD201101. In the Galleria mellonella insect model, the isogenic SurA1 knock-out strain exhibited a lower survival rate and decreased dissemination. These results suggest that SurA1 plays an important role in the fitness and virulence of A. baumannii.

  20. Regional differences and trends in antimicrobial susceptibility of Acinetobacter baumannii.


    Lob, Sibylle H; Hoban, Daryl J; Sahm, Daniel F; Badal, Robert E


    Acinetobacter baumannii, although representing a small percentage of Gram-negative bacilli isolates in intra-abdominal infections (IAIs) and urinary tract infections (UTIs), is frequently multidrug-resistant (MDR) and can pose difficult therapeutic challenges. From 2011 to 2014, 2337 A. baumannii were collected from IAIs and UTIs at 453 hospital sites in 48 countries as part of the SMART ongoing surveillance initiative. Current susceptibility and multidrug resistance, defined as resistance to at least three of the tested drug classes, were determined in a subset of 1011 isolates from 2013 to 2014. A. baumannii comprised 0.7-4.6% of all aerobic and facultative Gram-negative bacilli isolated in six global regions. MDR rates were lowest in North America (47%) and highest in Europe and the Middle East (>93%), with higher rates in ICUs than in non-ICU wards in almost all regions. Antimicrobial susceptibility profiles varied by region but resistance was high everywhere, with no drug inhibiting >70% of A. baumannii isolates in any region. Susceptibility to imipenem was highest in North America (64%) and lowest in Europe and the Middle East (≤11%). Amikacin overall was the most active of the studied agents, including against MDR isolates (of which 11-38% were susceptible). Trend analysis of only those countries that contributed isolates in each study year (2011-2014) demonstrated an increasing trend in MDR rates in the Middle East as well as decreasing susceptibility to several single antimicrobial agents in Africa, Europe and the Middle East. These patterns and trends can help direct antimicrobial therapy and infection control efforts.

  1. Towards the complete small RNome of Acinetobacter baumannii

    PubMed Central

    Weiss, Andy; Broach, William H.; Lee, Mackenzie C.


    In recent years, the Gram-negative bacterium Acinetobacter baumannii has garnered considerable attention for its unprecedented capacity to rapidly develop resistance to antibacterial therapeutics. This is coupled with the seemingly epidemic emergence of new hyper-virulent strains. Although strain-specific differences for A. baumannii isolates have been well described, these studies have primarily focused on proteinaceous factors. At present, only limited publications have investigated the presence and role of small regulatory RNA (sRNA) transcripts. Herein, we perform such an analysis, describing the RNA-seq-based identification of 78 A. baumannii sRNAs in the AB5075 background. Together with six previously identified elements, we include each of these in a new genome annotation file, which will serve as a tool to investigate regulatory events in this organism. Our work reveals that the sRNAs display high expression, accounting for >50 % of the 20 most strongly expressed genes. Through conservation analysis we identified six classes of similar sRNAs, with one found to be particularly abundant and homologous to regulatory, C4 antisense RNAs found in bacteriophages. These elements appear to be processed from larger transcripts in an analogous manner to the phage C4 molecule and are putatively controlled by two further sRNAs that are strongly antisense to them. Collectively, this study offers a detailed view of the sRNA content of A. baumannii, exposing sequence and structural conservation amongst these elements, and provides novel insight into the potential evolution, and role, of these understudied regulatory molecules. PMID:28348845

  2. Post Neurosurgical Meningitis due to Colistin Heteroresistant Acinetobacter baumannii

    PubMed Central

    Moosavian, Mojtaba; Shoja, Saeed; Nashibi, Roohangiz; Ebrahimi, Nasim; Tabatabaiefar, Mohammad Amin; Rostami, Soodabeh; Peymani, Amir


    Introduction: Recently Acinetobacter baumannii isolates have emerged as a problematic infectious agent that causes meningitis in neurosurgical patients. Colistin has been used successfully for the treatment of A. baumannii meningitis but colistin resistant isolates have been reported worldwide. Case Presentation: Two isolates of A. baumannii were cultured during a five-day period from cerebrospinal fluid (CSF) samples of a 20-year-old man with a gunshot trauma in the abdomen, which had exited from his back. Antimicrobial susceptibility tests of isolates were performed. Multiplex PCR was performed for detection of blaOXA-23-like, blaOXA-24-like and blaOXA-58-like genes. Metallo-β-lactamase genes such as: blaVIM, blaIMP, blaSPM and blaNDM were sought by singleplex PCR. In order to evaluate the genetic relationship, two isolates were examined by the repetitive extragenic palindromic-polymerase chain reaction (REP_PCR) method. Conclusions: E-test results showed that the isolates were sensitive to colistin and tigecycline with minimum inhibitory concentration of (MIC) 0.25 µg/mL and 1.5 µg/mL, respectively. Secondly the isolates were resistant to colistin with MIC > 256 µg/mL but remained sensitive to tigecycline with MIC 1.5 µg/mL. On the basis of the multiplex PCR, both of the isolates were positive for blaOXA-23-like. Other investigated genes such as blaOXA-24-like, blaOXA-58-like, blaVIM, blaIMP, blaSPM and blaNDM were negative. REP-PCR results showed that two isolates were derived from a single strain and both were the same. The results of our study revealed that the firs isolate of A. baumannii was colistin heteroresistant and was changed to completely resistant during therapy. Diagnosis and treatment of A. baumannii meningitis is very important and to avoid treatment failure we suggest that all A. baumannii isolates obtained from CSF should be evaluated properly for colistin heteroresistance. PMID:25632326

  3. Platelet-activating Factor Receptor Initiates Contact of Acinetobacter baumannii Expressing Phosphorylcholine with Host Cells

    PubMed Central

    Smani, Younes; Docobo-Pérez, Fernando; López-Rojas, Rafael; Domínguez-Herrera, Juan; Ibáñez-Martínez, José; Pachón, Jerónimo


    Adhesion is an initial and important step in Acinetobacter baumannii causing infections. However, the exact molecular mechanism of such a step between A. baumannii and the host cells remains unclear. Here, we demonstrated that the phosphorylcholine (ChoP)-containing outer membrane protein of A. baumannii binds to A549 cells through platelet-activating factor receptor (PAFR), resulting in activation of G protein and intracellular calcium. Upon A. baumannii expressing ChoP binding to PAFR, clathrin and β-arrestins, proteins involved in the direction of the vacuolar movement, are activated during invasion of A. baumannii. PAFR antagonism restricts the dissemination of A. baumannii in the pneumonia model. These results define a role for PAFR in A. baumannii interaction with host cells and suggest a mechanism for the entry of A. baumannii into the cytoplasm of host cells. PMID:22689572

  4. Epidemiological characterization of Acinetobacter baumannii bloodstream isolates from a Chinese Burn Institute: A three-year study.


    Huang, Guangtao; Yin, Supeng; Xiang, Lijuan; Gong, Yali; Sun, Kedai; Luo, Xiaoqiang; Zhang, Cheng; Yang, Zichen; Deng, Liuyang; Jiang, Bei; Jin, Shouguang; Chen, Jing; Peng, Yizhi


    Acinetobacter baumannii infection is a serious threat to burn patients. Bacteremia due to A. baumannii is becoming the most common cause of mortality following burn. However, the epidemiology of A. baumannii causing burn-related bloodstream infections has rarely been reported. We retrospectively collected 81 A. baumannii isolates from the bloodstream of burn patients over a three-year period. Antibiotic susceptibility tests, the prevalence of antibiotic-resistant genes and sequence typing (ST) were conducted to characterize these strains. Most of the isolates showed an extensive drug-resistant phenotype. The resistance frequencies to imipenem and meropenem were 94% and 91%, respectively. The blaOXA-23-like gene, AmpC, IS-AmpC, PER and SIM are the five most prevalent resistant genes, and their prevalence rates are 93% (75/81), 86% (70/81), 73% (59/81), 73% (59/81) and 52% (42/81), respectively. The 81 isolates were grouped into 10 known and 18 unknown ST types, with ST368 (38%) being the most prevalent. Except for ST457 and four new types (STn2, STn6, STn11 and STn14), the remaining 23 ST types belonged to one clonal complex 92, which is most common among clinical isolate in China. The above results indicated that ST368 isolates possessing both the blaOXA-23-like gene and ampC gene were the main culprits of the increasing nosocomial A. baumannii infection in this study. More attention should be paid to monitoring the molecular epidemiology of A. baumannii isolates from burn patients to prevent further distribution. Such information may help clinicians with therapeutic decisions and infection control in the Burns Institute.

  5. First Genome Sequence of a Mexican Multidrug-Resistant Acinetobacter baumannii Isolate

    PubMed Central

    Graña-Miraglia, Lucía; Lozano, Luis; Castro-Jaimes, Semiramis; Cevallos, Miguel A.; Volkow, Patricia


    Acinetobacter baumannii has emerged as an important nosocomial pathogen worldwide. Here, we present the draft genome of the first multidrug-resistant A. baumannii isolate, sampled from a tertiary hospital in Mexico City. This genome will provide a starting point for studying the genomic diversity of this species in Mexico. PMID:27013043

  6. Multidrug resistant Acinetobacter baumannii reaches a new frontier: prosthetic hip joint infection.


    Hischebeth, G T R; Wimmer, M D; Molitor, E; Seifert, H; Gravius, S; Bekeredjian-Ding, I


    Acinetobacter baumannii is an emerging nosocomial pathogen primarily in countries with a high prevalence of multidrug resistance. Here we report the detection of a bla OXA23 carbapenemase-producing A. baumannii strain in a German patient with prosthetic hip joint infection following several hip joint surgeries but no history of foreign travel.

  7. Prevalence of antibiotic resistance among Acinetobacter baumannii isolates from Aleppo, Syria.


    Hamzeh, Abdul Rezzak; Al Najjar, Mona; Mahfoud, Maysa


    This study describes and analyzes Acinetobacter baumannii antibiotic susceptibly profile in Aleppo, Syria, thus providing vital information for guiding treatment of A baumannii infections. Two hundred sixty nonrepetitive A baumannii isolates were studied over 3.5 years. Resistance rates are at the higher end of globally reported levels. Newer cephalosporins and β-lactamase-resistant agents are becoming practically ineffective. Better activity is limited to carbapenems and colistin, which elicited the highest susceptibility levels.

  8. Community-acquired Acinetobacter baumannii: clinical characteristics, epidemiology and pathogenesis.


    Dexter, Carina; Murray, Gerald L; Paulsen, Ian T; Peleg, Anton Y


    Community-acquired Acinetobacter baumannii (CA-Ab) is a rare but serious cause of community-acquired pneumonia in tropical regions of the world. CA-Ab infections predominantly affect individuals with risk factors, which include excess alcohol consumption, diabetes mellitus, smoking and chronic lung disease. CA-Ab pneumonia presents as a surprisingly fulminant course and is characterized by a rapid onset of fever, severe respiratory symptoms and multi-organ dysfunction, with a mortality rate reported as high as 64%. It is unclear whether the distinct clinical syndrome caused by CA-Ab is because of host predisposing factors or unique bacterial characteristics, or a combination of both. Deepening our understanding of the drivers of overwhelming CA-Ab infection will provide important insights into preventative and therapeutic strategies.

  9. Crystal Structure of Carbapenemase OXA-58 from Acinetobacter baumannii

    PubMed Central

    Antunes, Nuno Tiago; Toth, Marta


    Class D β-lactamases capable of hydrolyzing last-resort carbapenem antibiotics represent a major challenge for treatment of bacterial infections. Wide dissemination of these enzymes in Acinetobacter baumannii elevated this pathogen to the category of most deadly and difficult to treat. We present here the structure of the OXA-58 β-lactamase, a major class D carbapenemase of A. baumannii, determined to 1.30-Å resolution. Unlike two other Acinetobacter carbapenemases, OXA23 and OXA-24, the OXA-58 enzyme lacks the characteristic hydrophobic bridge over the active site, despite conservation of the residues which participate in its formation. The active-site residues in OXA-58 are spatially conserved in comparison to those in other class D β-lactamases. Lys86, which activates water molecules during the acylation and deacylation steps, is fully carboxylated in the OXA-58 structure. In the absence of a substrate, a water molecule is observed in the active site of the enzyme and is positioned in the pocket that is usually occupied by the 6α-hydroxyethyl moiety of carbapenems. A water molecule in this location would efficiently deacylate good substrates, such as the penicillins, but in the case of carbapenems, it would be expelled by the 6α-hydroxyethyl moiety of the antibiotics and a water from the surrounding medium would find its way to the vicinity of the carboxylated Lys86 to perform deacylation. Subtle differences in the position of this water in the acyl-enzyme complexes of class D β-lactamases could ultimately be responsible for differences in the catalytic efficiencies of these enzymes against last-resort carbapenem antibiotics. PMID:24468777

  10. Genome Sequence of an Acinetobacter baumannii Strain Carrying Three Acquired Carbapenemase Genes

    PubMed Central

    Oinuma, Ken-Ichi; Suzuki, Masato; Sato, Kanako; Nakaie, Kiyotaka; Niki, Makoto; Takizawa, Etsuko; Niki, Mamiko; Shibayama, Keigo; Yamada, Koichi; Kakeya, Hiroshi


    The emergence of multiple-carbapenemase-producing Acinetobacter strains has been a serious concern during the past decade. Here, we report the draft genome sequence of an Acinetobacter baumannii strain isolated from a Japanese patient with three acquired carbapenemase genes: blaNDM-1, blaTMB-1, and blaOXA-58. PMID:27856588

  11. Risk factors for and impact of carbapenem-resistant Acinetobacter baumannii colonization and infection: matched case-control study.


    Henig, O; Weber, G; Hoshen, M B; Paul, M; German, L; Neuberger, A; Gluzman, I; Berlin, A; Shapira, C; Balicer, R D


    The objective of this investigation was to identify risk factors for carbapenem-resistant Acinetobacter baumannii (CRAB) and its association with mortality. A population-based matched case-control study using the computerized database of Clalit Health Services (CHS) in the period between 2007 and 2012 was conducted. Hospitalized patients with CRAB colonization or infection were compared to hospitalized patients without evidence of A. baumannii, matched by age, ward of hospitalization, season, Charlson score, and length of hospitalization. Risk factors for CRAB isolation were searched for using multivariate analysis. Association of CRAB and other risk factors with mortality were assessed in the cohort. A total of 1190 patients with CRAB were matched to 1190 patients without CRAB. Low socioeconomic status was independently associated with CRAB isolation and CRAB bacteremia [odds ratio 2.18, 95% confidence interval (CI) 1.02-5]. Other risk factors were invasive procedures and bacteremia with other pathogens prior to CRAB isolation, and various comorbidities. Among all patients, CRAB isolation was independently associated with increased mortality (hazard ratio 2.33, 95% CI 2.08-2.6). Socioeconomic status is associated with health outcomes. Our population-based study revealed an almost doubled risk for CRAB in patients at lower socioeconomic status and an association with healthcare exposure. CRAB was associated with mortality and might become a risk indicator for complex morbidity and mortality.

  12. Insertion sequence transposition determines imipenem resistance in Acinetobacter baumannii.


    Kuo, Han-Yueh; Chang, Kai-Chih; Liu, Chih-Chin; Tang, Chuan Yi; Peng, Jhih-Hua; Lu, Chia-Wei; Tu, Chi-Chao; Liou, Ming-Li


    This study employed genomewide analysis to investigate potential resistance mechanisms in Acinetobacter baumannii following imipenem exposure. Imipenem-selected mutants were generated from the imipenem-susceptible strain ATCC 17978 by multistep selection resistance. Antibiotic susceptibilities were examined, and the selected mutants originated from the ATCC 17978 strain were confirmed by pulsed-field gel electrophoresis. The genomic sequence of a resistant mutant was analyzed using a next-generation sequencing platform, and genetic recombination was further confirmed by PCR. The result showed that phenotypic resistance was observed with carbapenem upon exposure to various concentrations of imipenem. Genomewide analysis showed that ISAba1 transposition was initiated by imipenem exposure at concentrations up to 0.5 mg/L. Transposition of ISAba1 upstream of blaOXA-95 was detected in all the selected mutants. The expression of blaOXA-95 was further analyzed by quantitative PCR, and the results demonstrated that a 200-fold increase in gene expression was required for resistance to imipenem. This study concluded that imipenem exposure at a concentration of 0.5 mg/L mediated the transposition of ISAba1 upstream of the blaOXA-95 gene and resulted in the overexpression of blaOXA-95 gene, which may play a major role in the resistance to imipenem in A. baumannii.

  13. Transcriptome Remodeling of Acinetobacter baumannii during Infection and Treatment

    PubMed Central

    Wright, Meredith S.; Jacobs, Michael R.; Bonomo, Robert A.


    ABSTRACT Acinetobacter baumannii is an increasingly common multidrug-resistant pathogen in health care settings. Although the genetic basis of antibiotic resistance mechanisms has been extensively studied, much less is known about how genetic variation contributes to other aspects of successful infections. Genetic changes that occur during host infection and treatment have the potential to remodel gene expression patterns related to resistance and pathogenesis. Longitudinal sets of multidrug-resistant A. baumannii isolates from eight patients were analyzed by RNA sequencing (RNA-seq) to identify differentially expressed genes and link them to genetic changes contributing to transcriptional variation at both within-patient and population levels. The number of differentially expressed genes among isolates from the same patient ranged from 26 (patient 588) to 145 (patient 475). Multiple patients had isolates with differential gene expression patterns related to mutations in the pmrAB and adeRS two-component regulatory system genes, as well as significant differences in genes related to antibiotic resistance, iron acquisition, amino acid metabolism, and surface-associated proteins. Population level analysis revealed 39 genetic regions with clade-specific differentially expressed genes, for which 19, 8, and 3 of these could be explained by insertion sequence mobilization, recombination-driven sequence variation, and intergenic mutations, respectively. Multiple types of mutations that arise during infection can significantly remodel the expression of genes that are known to be important in pathogenesis. PMID:28270585

  14. Antibiotic modulation of capsular exopolysaccharide and virulence in Acinetobacter baumannii.


    Geisinger, Edward; Isberg, Ralph R


    Acinetobacter baumannii is an opportunistic pathogen of increasing importance due to its propensity for intractable multidrug-resistant infections in hospitals. All clinical isolates examined contain a conserved gene cluster, the K locus, which determines the production of complex polysaccharides, including an exopolysaccharide capsule known to protect against killing by host serum and to increase virulence in animal models of infection. Whether the polysaccharides determined by the K locus contribute to intrinsic defenses against antibiotics is unknown. We demonstrate here that mutants deficient in the exopolysaccharide capsule have lowered intrinsic resistance to peptide antibiotics, while a mutation affecting sugar precursors involved in both capsule and lipopolysaccharide synthesis sensitizes the bacterium to multiple antibiotic classes. We observed that, when grown in the presence of certain antibiotics below their MIC, including the translation inhibitors chloramphenicol and erythromycin, A. baumannii increases production of the K locus exopolysaccharide. Hyperproduction of capsular exopolysaccharide is reversible and non-mutational, and occurs concomitantly with increased resistance to the inducing antibiotic that is independent of the presence of the K locus. Strikingly, antibiotic-enhanced capsular exopolysaccharide production confers increased resistance to killing by host complement and increases virulence in a mouse model of systemic infection. Finally, we show that augmented capsule production upon antibiotic exposure is facilitated by transcriptional increases in K locus gene expression that are dependent on a two-component regulatory system, bfmRS. These studies reveal that the synthesis of capsule, a major pathogenicity determinant, is regulated in response to antibiotic stress. Our data are consistent with a model in which gene expression changes triggered by ineffectual antibiotic treatment cause A. baumannii to transition between states of low

  15. Antibiotic Modulation of Capsular Exopolysaccharide and Virulence in Acinetobacter baumannii

    PubMed Central

    Geisinger, Edward; Isberg, Ralph R.


    Acinetobacter baumannii is an opportunistic pathogen of increasing importance due to its propensity for intractable multidrug-resistant infections in hospitals. All clinical isolates examined contain a conserved gene cluster, the K locus, which determines the production of complex polysaccharides, including an exopolysaccharide capsule known to protect against killing by host serum and to increase virulence in animal models of infection. Whether the polysaccharides determined by the K locus contribute to intrinsic defenses against antibiotics is unknown. We demonstrate here that mutants deficient in the exopolysaccharide capsule have lowered intrinsic resistance to peptide antibiotics, while a mutation affecting sugar precursors involved in both capsule and lipopolysaccharide synthesis sensitizes the bacterium to multiple antibiotic classes. We observed that, when grown in the presence of certain antibiotics below their MIC, including the translation inhibitors chloramphenicol and erythromycin, A. baumannii increases production of the K locus exopolysaccharide. Hyperproduction of capsular exopolysaccharide is reversible and non-mutational, and occurs concomitantly with increased resistance to the inducing antibiotic that is independent of the presence of the K locus. Strikingly, antibiotic-enhanced capsular exopolysaccharide production confers increased resistance to killing by host complement and increases virulence in a mouse model of systemic infection. Finally, we show that augmented capsule production upon antibiotic exposure is facilitated by transcriptional increases in K locus gene expression that are dependent on a two-component regulatory system, bfmRS. These studies reveal that the synthesis of capsule, a major pathogenicity determinant, is regulated in response to antibiotic stress. Our data are consistent with a model in which gene expression changes triggered by ineffectual antibiotic treatment cause A. baumannii to transition between states of low

  16. Genomic sequencing of a strain of Acinetobacter baumannii and potential mechanisms to antibiotics resistance.


    Zhao, Lei; Li, Hongru; Zhu, Ziwen; Wakefield, Mark R; Fang, Yujiang; Ye, Ying


    Acinetobacter baumannii has been becoming a great challenge to clinicians due to their resistance to almost all available antibiotics. In this study, we sequenced the genome from a multiple antibiotics resistant Acinetobacter baumannii stain which was named A. baumannii-1isolated from China by SMRT sequencing technology to explore its potential mechanisms to antibiotic resistance. We found that several mechanisms might contribute to the antibiotic resistance of Acinetobacter baumannii. Specifically, we found that SNP in genes associated with nucleotide excision repair and ABC transporter might contribute to its resistance to multiple antibiotics; we also found that specific genes associated with bacterial DNA integration and recombination, DNA-mediated transposition and response to antibiotics might contribute to its resistance to multiple antibiotics; Furthermore, specific genes associated with penicillin and cephalosporin biosynthetic pathway and specific genes associated with CHDL and MBL β-lactamase genes might contribute to its resistance to multiple antibiotics. Thus, the detailed mechanisms by which Acinetobacter baumannii show extensive resistance to multiple antibiotics are very complicated. Such a study might be helpful to develop new strategies to control Acinetobacter baumannii infection.

  17. Galleria mellonella as a model system to study Acinetobacter baumannii pathogenesis and therapeutics.


    Peleg, Anton Y; Jara, Sebastian; Monga, Divya; Eliopoulos, George M; Moellering, Robert C; Mylonakis, Eleftherios


    Nonmammalian model systems of infection such as Galleria mellonella (caterpillars of the greater wax moth) have significant logistical and ethical advantages over mammalian models. In this study, we utilize G. mellonella caterpillars to study host-pathogen interactions with the gram-negative organism Acinetobacter baumannii and determine the utility of this infection model to study antibacterial efficacy. After infecting G. mellonella caterpillars with a reference A. baumannii strain, we observed that the rate of G. mellonella killing was dependent on the infection inoculum and the incubation temperature postinfection, with greater killing at 37 degrees C than at 30 degrees C (P = 0.01). A. baumannii strains caused greater killing than the less-pathogenic species Acinetobacter baylyi and Acinetobacter lwoffii (P < 0.001). Community-acquired A. baumannii caused greater killing than a reference hospital-acquired strain (P < 0.01). Reduced levels of production of the quorum-sensing molecule 3-hydroxy-C(12)-homoserine lactone caused no change in A. baumannii virulence against G. mellonella. Treatment of a lethal A. baumannii infection with antibiotics that had in vitro activity against the infecting A. baumannii strain significantly prolonged the survival of G. mellonella caterpillars compared with treatment with antibiotics to which the bacteria were resistant. G. mellonella is a relatively simple, nonmammalian model system that can be used to facilitate the in vivo study of host-pathogen interactions in A. baumannii and the efficacy of antibacterial agents.

  18. Toll-Like Receptor 9 Contributes to Defense against Acinetobacter baumannii Infection

    PubMed Central

    Noto, Michael J.; Boyd, Kelli L.; Burns, William J.; Varga, Matthew G.; Peek, Richard M.


    Acinetobacter baumannii is a common nosocomial pathogen capable of causing severe diseases associated with significant morbidity and mortality in impaired hosts. Pattern recognition receptors, such as the Toll-like receptors (TLRs), play a key role in pathogen detection and function to alert the immune system to infection. Here, we examine the role for TLR9 signaling in response to A. baumannii infection. In a murine model of A. baumannii pneumonia, TLR9−/− mice exhibit significantly increased bacterial burdens in the lungs, increased extrapulmonary bacterial dissemination, and more severe lung pathology compared with those in wild-type mice. Following systemic A. baumannii infection, TLR9−/− mice have significantly increased bacterial burdens in the lungs, as well as decreased proinflammatory cytokine and chemokine production. These results demonstrate that TLR9-mediated pathogen detection is important for host defense against the opportunistic pathogen Acinetobacter baumannii. PMID:26238713

  19. Toll-Like Receptor 9 Contributes to Defense against Acinetobacter baumannii Infection.


    Noto, Michael J; Boyd, Kelli L; Burns, William J; Varga, Matthew G; Peek, Richard M; Skaar, Eric P


    Acinetobacter baumannii is a common nosocomial pathogen capable of causing severe diseases associated with significant morbidity and mortality in impaired hosts. Pattern recognition receptors, such as the Toll-like receptors (TLRs), play a key role in pathogen detection and function to alert the immune system to infection. Here, we examine the role for TLR9 signaling in response to A. baumannii infection. In a murine model of A. baumannii pneumonia, TLR9(-/-) mice exhibit significantly increased bacterial burdens in the lungs, increased extrapulmonary bacterial dissemination, and more severe lung pathology compared with those in wild-type mice. Following systemic A. baumannii infection, TLR9(-/-) mice have significantly increased bacterial burdens in the lungs, as well as decreased proinflammatory cytokine and chemokine production. These results demonstrate that TLR9-mediated pathogen detection is important for host defense against the opportunistic pathogen Acinetobacter baumannii.

  20. Worldwide dissemination of acquired carbapenem-hydrolysing class D β-lactamases in Acinetobacter spp. other than Acinetobacter baumannii.


    Zander, Esther; Fernández-González, Ana; Schleicher, Xenia; Dammhayn, Cathrin; Kamolvit, Witchuda; Seifert, Harald; Higgins, Paul G


    The aim of this study was to identify acquired OXA-type carbapenemases in Acinetobacter spp. other than Acinetobacter baumannii. From a total of 453 carbapenem-susceptible and -resistant Acinetobacter isolates collected worldwide, 23 were positive for blaOXA genes by multiplex PCR. These isolates were identified as Acinetobacter pittii (n=18), Acinetobacter nosocomialis (n=2), Acinetobacter junii (n=1) and Acinetobacter genomic species 14TU/13BJ (n=2). The blaOXA genes and associated insertion sequence (IS) elements were sequenced by primer walking. In 11 of these isolates, sequencing of the PCR products revealed that they were false-positive for blaOXA. The remaining 12 isolates, originating from Europe, Asia, South America, North America and South Africa, harboured OXA-23 (n=4), OXA-58 (n=5), OXA-40-like (n=1) and OXA-143-like (n=1); one A. pittii isolate harboured both OXA-23 and OXA-58. IS elements were associated with blaOXA in 10 isolates. OXA multiplex PCR showed a high degree of false-positive results (47.8%), indicating that detection of blaOXA in non-baumanniiAcinetobacter spp. should be confirmed using additional methods.

  1. Identification of novel vaccine candidates against Acinetobacter baumannii using reverse vaccinology

    PubMed Central

    Chiang, Ming-Hsien; Sung, Wang-Chou; Lien, Shu-Pei; Chen, Ying-Zih; Lo, Annie Fei-yun; Huang, Jui-Hsin; Kuo, Shu-Chen; Chong, Pele


    Acinetobacter baumannii (Ab) is a global emerging bacterium causing nosocomial infections such as pneumonia, meningitis, bacteremia and soft tissue infections especially in intensive care units. Since Ab is resistant to almost all conventional antibiotics, it is now one of the 6 top-priorities of the dangerous microorganisms listed by the Infectious Disease Society of America. The development of vaccine is one of the most promising and cost-effective strategies to prevent infections. In this study, we identified potential protective vaccine candidates using reverse vaccinology. We have analyzed 14 on-line available Ab genome sequences and found 2752 homologous core genes. Using information obtained from immuno-proteomic experiments, published proteomic information and the bioinformatics PSORTb v3.0 software to predict the location of extracellular and/or outer membrane proteins, 77 genes were identified and selected for further studies. After excluding those antigens have been used as vaccine candidates reported by the in silico search-engines of PubMed and Google Scholar, 13 proteins could potentially be vaccine candidates. We have selected and cloned the genes of 3 antigens that were further expressed and purified. These antigens were found to be highly immunogenic and conferred partial protection (60%) in a pneumonia animal model. The strategy described in the present study incorporates the advantages of reverse vaccinology, bioinformatics and immuno-proteomic platform technologies and is easy to perform to identify novel immunogens for multi-component vaccines development. PMID:25751377

  2. Longitudinal Characterization of Acinetobacter baumannii-calcoaceticus Complex, Klebsiella pneumoniae, and Methicillin-Resistant Staphylococcus aureus Colonizing and Infecting Combat Casualties

    DTIC Science & Technology


    Brief report Longitudinal characterization of Acinetobacter baumannii-calcoaceticus complex, Klebsiella pneumoniae , and methicillin-resistant...resistant Acinetobacter baumannii-calcoaceticus complex Klebsiella pneumoniae Methicillin-resistant Staphylococcus aureus MRSA Drug-resistant...Acinetobacter baumannii-calcoaceticus complex, Klebsiella pneumoniae , and methicillin- resistant Staphylococcus aureus colonize and infect combat casualties

  3. 5-Episinuleptolide Decreases the Expression of the Extracellular Matrix in Early Biofilm Formation of Multi-Drug Resistant Acinetobacter baumannii

    PubMed Central

    Tseng, Sung-Pin; Hung, Wei-Chun; Huang, Chiung-Yao; Lin, Yin-Shiou; Chan, Min-Yu; Lu, Po-Liang; Lin, Lin; Sheu, Jyh-Horng


    Nosocomial infections and increasing multi-drug resistance caused by Acinetobacter baumannii have been recognized as emerging problems worldwide. Moreover, A. baumannii is able to colonize various abiotic materials and medical devices, making it difficult to eradicate and leading to ventilator-associated pneumonia, and bacteremia. Development of novel molecules that inhibit bacterial biofilm formation may be an alternative prophylactic option for the treatment of biofilm-associated A. baumannii infections. Marine environments, which are unlike their terrestrial counterparts, harbor an abundant biodiversity of marine organisms that produce novel bioactive natural products with pharmaceutical potential. In this study, we identified 5-episinuleptolide, which was isolated from Sinularia leptoclados, as an inhibitor of biofilm formation in ATCC 19606 and three multi-drug resistant A. baumannii strains. In addition, the anti-biofilm activities of 5-episinuleptolide were observed for Gram-negative bacteria but not for Gram-positive bacteria, indicating that the inhibition mechanism of 5-episinuleptolide is effective against only Gram-negative bacteria. The mechanism of biofilm inhibition was demonstrated to correlate to decreased gene expression from the pgaABCD locus, which encodes the extracellular polysaccharide poly-β-(1,6)-N-acetylglucosamine (PNAG). Scanning electron microscopy (SEM) indicated that extracellular matrix of the biofilm was dramatically decreased by treatment with 5-episinuleptolide. Our study showed potentially synergistic activity of combination therapy with 5-episinuleptolide and levofloxacin against biofilm formation and biofilm cells. These data indicate that inhibition of biofilm formation via 5-episinuleptolide may represent another prophylactic option for solving the persistent problem of biofilm-associated A. baumannii infections. PMID:27483290

  4. Efficacy of the small molecule inhibitor of Lipid II BAS00127538 against Acinetobacter baumannii

    PubMed Central

    de Leeuw, Erik PH


    Objective To test the activity of a small molecule compound that targets Lipid II against Acinetobacter baumannii. Methods Susceptibility to small molecule Lipid II inhibitor BAS00127538 was assessed using carbapenem- and colistin-resistant clinical isolates of A. baumannii. In addition, synergy between colisitin and this compound was assessed. Results Small molecule Lipid II inhibitor BAS00127538 potently acts against A. baumannii and acts synergistically with colistin. Conclusion For the first time, a compound that targets Lipid II is described that acts against multi-drug resistant isolates of A. baumannii. The synergy with colistin warrants further lead development of BAS00127538. PMID:25143710

  5. Community-Acquired Bacteremic Acinetobacter Pneumonia in Tropical Australia Is Caused by Diverse Strains of Acinetobacter baumannii, with Carriage in the Throat in At-Risk Groups

    PubMed Central

    Anstey, Nicholas M.; Currie, Bart J.; Hassell, Marilyn; Palmer, Didier; Dwyer, Brian; Seifert, Harald


    Acinetobacter isolates from eight subjects with community-acquired Acinetobacter pneumonia (CAAP), a major cause of fatal community-acquired pneumonia in tropical Australia, were phenotypically and genotypically confirmed by pulsed-field gel electrophoresis analysis to be broadly diverse Acinetobacter baumannii strains. Wet-season throat carriage of A. baumannii was found in 10% of community residents with excess levels of alcohol consumption, the major at-risk group for CAAP. PMID:11825997

  6. Outbreak of multidrug-resistant Acinetobacter baumannii in an intensive care unit.


    Dettori, Marco; Piana, Andrea; Deriu, Maria Grazia; Lo Curto, Paola; Cossu, Andrea; Musumeci, Rosario; Cocuzza, Clementina; Astone, Vito; Contu, Maria Antonietta; Sotgiu, Giovanni


    Acinetobacter baumannii is a ubiquitous microrganism often able to colonize and survive in different environments. Currently it is one of the most common pathogens responsible for nosocomial infections, including outbreaks, especially in long-term care facilities. The aim of this study was to show the results of an environmental investigation and genotyping analysis of multidrug-resistant Acinetobacter baumannii associated with an outbreak in an intensive care unit of a tertiary hospital located in Northern Sardinia, Italy. Positive cultures of MDR Acinetobacter baumannii were reported during the month of June 2012, after the collection of biological samples from ten patients. Acinetobacter baumannii was isolated during the following environmental investigation from the headboard of two beds. All the strains were genotyped by performing multiplex PCR to identify the presence of genes encoding carbapenemases. The results showed specific bands of bla(OXA-51-like) gene and of the bla(OXA-23-like) gene. PFGE highlighted minimal differences in genomic fingerprints, while the cluster analysis grouped the isolated microorganisms into two closely related clusters, characterized by Dice's similarity coefficient equal to 95.1%. MLST showed that the strains belonged to ST31. The results of the study highlight the need, especially in high-risk areas, to adopt strict hygiene practices, particularly hand hygiene, and to ensure an appropriate turnover of personal protective equipment, which could be responsible for the spread of biological agents, such as MDR Acinetobacter baumannii.

  7. Acinetobacter seifertii sp. nov., a member of the Acinetobacter calcoaceticus-Acinetobacter baumannii complex isolated from human clinical specimens.


    Nemec, Alexandr; Krizova, Lenka; Maixnerova, Martina; Sedo, Ondrej; Brisse, Sylvain; Higgins, Paul G


    This study aimed to define the taxonomic status of a phenetically distinct group of 16 strains that corresponds to Acinetobacter genomic species 'close to 13TU', a provisional genomic species of the Acinetobacter calcoaceticus-Acinetobacter baumannii (ACB) complex recognized by Gerner-Smidt and Tjernberg in 1993. These strains have been isolated in different countries since the early 1990s and were mostly recovered from human clinical specimens. They were compared with 45 reference strains representing the known taxa of the ACB complex using taxonomic methods relevant to the genus Acinetobacter. Based on sequence analysis of the concatenated partial sequences (2976 bp) of seven housekeeping genes, the 16 strains formed a tight and well-supported cluster (intracluster sequence identity of ≥98.4 %) that was clearly separated from the other members of the ACB complex (≤94.7 %). The species status of the group was supported by average nucleotide identity values of ≤91.7 % between the whole genome sequence of representative strain NIPH 973(T) (NCBI accession no. APOO00000000) and those of the other species. In addition, whole-cell matrix-assisted laser desorption ionization-time-of-flight (MALDI-TOF) MS analyses indicated the distinctness of the group at the protein level. Metabolic and physiological tests revealed several typical features of the group, although they did not allow its reliable differentiation from the other members of the ACB complex. We conclude that the 16 strains represent a distinct novel species, for which we propose the name Acinetobacter seifertii sp. nov. The type strain is NIPH 973(T) ( = CIP 110471(T) = CCUG 34785(T) = CCM 8535(T)).

  8. Bacteremic nosocomial pneumonia caused by Acinetobacter baumannii and Acinetobacter nosocomialis: a single or two distinct clinical entities?


    Lee, Y-T; Kuo, S-C; Yang, S-P; Lin, Y-T; Chiang, D-H; Tseng, F-C; Chen, T-L; Fung, C-P


    The phenotypically indistinguishable Acinetobacter baumannii and Acinetobacter nosocomialis have become leading pathogens causing nosocomial pneumonia in critically ill patients. A. baumannii and A. nosocomialis nosocomial pneumonias were grouped as a single clinical entity previously. This study aimed to determine whether they are the same or a different clinical entity. A total of 121 patients with A. baumannii and 131 with A. nosocomialis bacteremic nosocomial pneumonia were included during an 8-year period. Despite the similar Charlson co-morbidity scores at admission, patients with A. baumannii pneumonia were more likely to have abnormal haematological findings, lobar pneumonia, significantly higher Acute Physiology and Chronic Health Evaluation II scores and higher frequency of shock at the onset of bacteraemia than those with A. nosocomialis pneumoni. A. baumannii isolates were resistant to more classes of antimicrobials, except colistin, and therefore the patients with A. baumannii pneumonia were more likely to receive inappropriate antimicrobial therapy. The 14-day mortality was significantly higher in patients with A. baumannii pneumonia (34.7% vs. 15.3%, p 0.001). A. baumannii was an independent risk factor for mortality (OR, 2.03; 95% CI, 1.05-3.90; p 0.035) in the overall cohort after adjustment for other risk factors for death, including inappropriate antimicrobial therapy. The results demonstrated the difference in clinical presentation, microbial characteristics and outcomes between A. baumannii and A. nosocomialis nosocomial pneumonia, and supported that they are two distinct clinical entities.

  9. Diverse responses to UV light exposure in Acinetobacter include the capacity for DNA damage-induced mutagenesis in the opportunistic pathogens Acinetobacter baumannii and Acinetobacter ursingii.


    Hare, Janelle M; Bradley, James A; Lin, Ching-li; Elam, Tyler J


    Error-prone and error-free DNA damage repair responses that are induced in most bacteria after exposure to various chemicals, antibiotics or radiation sources were surveyed across the genus Acinetobacter. The error-prone SOS mutagenesis response occurs when DNA damage induces a cell's umuDC- or dinP-encoded error-prone polymerases. The model strain Acinetobacter baylyi ADP1 possesses an unusual, regulatory umuD allele (umuDAb) with an extended 5' region and only incomplete fragments of umuC. Diverse Acinetobacter species were investigated for the presence of umuDC and their ability to conduct UV-induced mutagenesis. Unlike ADP1, most Acinetobacter strains possessed multiple umuDC loci containing either umuDAb or a umuD allele resembling that of Escherichia coli. The nearly omnipresent umuDAb allele was the ancestral umuD in Acinetobacter, with horizontal gene transfer accounting for over half of the umuDC operons. Despite multiple umuD(Ab)C operons in many strains, only three species conducted UV-induced mutagenesis: Acinetobacter baumannii, Acinetobacter ursingii and Acinetobacter beijerinckii. The type of umuDC locus or mutagenesis phenotype a strain possessed was not correlated with its error-free response of survival after UV exposure, but similar diversity was apparent. The survival of 30 Acinetobacter strains after UV treatment ranged over five orders of magnitude, with the Acinetobacter calcoaceticus-A. baumannii (Acb) complex and haemolytic strains having lower survival than non-Acb or non-haemolytic strains. These observations demonstrate that a genus can possess a range of DNA damage response mechanisms, and suggest that DNA damage-induced mutation could be an important part of the evolution of the emerging pathogens A. baumannii and A. ursingii.

  10. Early dissemination of OXA-72-producing Acinetobacter baumannii strain in Colombia: a case report.


    Saavedra, Sandra Yamile; Cayô, Rodrigo; Gales, Ana Cristina; Leal, Aura Lucia; Saavedra, Carlos Humberto


    Nosocomial infections caused by carbapenem-resistant Acinetobacter baumannii isolates have reached epidemic levels in past decades. Currently this microorganism is responsible for outbreaks of difficult eradication and with high mortality rates worldwide. We herein report a rare case of an OXA-72-producing A. baumannii isolate colonizing a 47-year-old male patient with peritonitis due to abdominal stab wound, four years earlier than the first report of this carbapenemase in Acinetobacter pittii in Colombia. Although OXA-72 presents a low prevalence compared with OXA-23, our study demonstrated that A. baumannii isolates carrying the blaOXA-72 gene were present in the hospital environment in Colombia and could act as a reservoir for further spread to other Acinetobacter species, like A. pittii, causing carbapenem-resistance.

  11. Critical role of bacterial isochorismatase in the autophagic process induced by Acinetobacter baumannii in mammalian cells

    PubMed Central

    Wang, Yang; Zhang, Kaiyu; Shi, Xiaochen; Wang, Chao; Wang, Feng; Fan, Junwen; Shen, Fengge; Xu, Jiancheng; Bao, Wanguo; Liu, Mingyuan; Yu, Lu


    A recent study reported that Acinetobacter baumannii could induce autophagy, but the recognition and clearance mechanism of intracytosolic A. baumannii in the autophagic process and the molecular mechanism of autophagy induced by the pathogen remains unknown. In this study, we first demonstrated that invading A. baumannii induced a complete, ubiquitin-mediated autophagic response that is dependent upon septins SEPT2 and SEPT9 in mammalian cells. We also demonstrated that autophagy induced by A. baumannii was Beclin-1 dependent via the AMPK/ERK/mammalian target of rapamycin pathway. Of interest, we found that the isochorismatase mutant strain had significantly decreased siderophore-mediated ferric iron acquisition ability and had a reduced the ability to induce autophagy. We verified that isochorismatase was required for the recognition of intracytosolic A. baumannii mediated by septin cages, ubiquitinated proteins, and ubiquitin-binding adaptor proteins p62 and NDP52 in autophagic response. We also confirmed that isochorismatase was required for the clearance of invading A. baumannii by autophagy in vitro and in the mouse model of infection. Together, these findings provide insight into the distinctive recognition and clearance of intracytosolic A. baumannii by autophagy in host cells, and that isochorismatase plays a critical role in the A. baumannii–induced autophagic process.—Wang, Y., Zhang, K., Shi, X., Wang, C., Wang, F., Fan, J., Shen, F., Xu, J., Bao, W., Liu, M., Yu, L. Critical role of bacterial isochorismatase in the autophagic process induced by Acinetobacter baumannii in mammalian cells. PMID:27432399

  12. [Emerging Acinetobacter baumannii infections and factors favouring their occurrence].


    Eveillard, M; Joly-Guillou, M-L


    During the last decade, Acinetobacter baumannii (AB) has been increasingly responsible for infections occurring in three particular contexts (in terms of patients and environment). Community AB pneumonia is severe infections, mainly described around the Indian Ocean, and which mainly concern patients with major co-morbidities. AB is also responsible for infections occurring among soldiers wounded in action during operations conducted in Iraq or Afghanistan. Lastly, this bacterium is responsible for infections occurring among casualties from natural disasters like earthquakes and tsunamis. Those infections are often due to multidrug-resistant strains, which can be implicated in nosocomial outbreaks when patients are hospitalized in a local casualty department or during their repatriation thereafter. The source of the contaminations which lead to AB infections following injuries (warfare or natural disasters) is still poorly known. Three hypotheses are usually considered: a contamination of wounds with environmental bacteria, a wound contamination from a previous cutaneous or oropharyngeal endogenous reservoir, or hospital acquisition. The implication of telluric or agricultural primary reservoirs in human AB infections is a common hypothesis which remains to be demonstrated by further specifically designed studies.

  13. Draft Genome Sequence of the Biofilm-Hyperproducing Acinetobacter baumannii Clinical Strain MAR002

    PubMed Central

    Álvarez-Fraga, Laura; López, María; Merino, María; Rumbo-Feal, Soraya; Tomás, María


    We report the draft genome sequence of Acinetobacter baumannii strain MAR002, a biofilm-hyperproducing clinical strain isolated during the study CP/09/0033 (GEIH/REIPI-Ab2010, Spain). The genome of A. baumannii MAR002 has an approximate length of 3,717,929 bp and 3,300 protein-coding sequences, with a C+G content of 39.09%. PMID:26205868

  14. Role of OmpA in the Multidrug Resistance Phenotype of Acinetobacter baumannii

    PubMed Central

    Fàbrega, Anna; Roca, Ignasi; Sánchez-Encinales, Viviana; Vila, Jordi; Pachón, Jerónimo


    Acinetobacter baumannii has emerged as a nosocomial pathogen with an increased prevalence of multidrug-resistant strains. The role of the outer membrane protein A (OmpA) in antimicrobial resistance remains poorly understood. In this report, disruption of the ompA gene led to decreased MICs of chloramphenicol, aztreonam, and nalidixic acid. We have characterized, for the first time, the contribution of OmpA in the antimicrobial resistance phenotype of A. baumannii. PMID:24379205

  15. First report of NDM-1-producing Acinetobacter baumannii sequence type 25 in Brazil.


    Pillonetto, Marcelo; Arend, Lavinia; Vespero, Eliana Carolina; Pelisson, Marsileni; Chagas, Thiago Pavoni Gomes; Carvalho-Assef, Ana Paula D'Alincourt; Asensi, Marise Dutra


    New Delhi metallo-β-lactamase 1 (NDM-1) was first identified in Brazil in Enterobacter hormaechei and Providencia rettgeri in 2013. Here, we describe the first case of NDM-1-producing Acinetobacter baumannii sequence type 25 isolated from the urinary tract of a 71-year-old man who died of multiple complications, including A. baumannii infection. The NDM-1 gene was detected by quantitative PCR, and its sequence confirmed its presence in an ∼ 100-kb plasmid.

  16. Iron acquisition functions expressed by the human pathogen Acinetobacter baumannii.


    Zimbler, Daniel L; Penwell, William F; Gaddy, Jennifer A; Menke, Sharon M; Tomaras, Andrew P; Connerly, Pamela L; Actis, Luis A


    Acinetobacter baumannii is a gram-negative bacterium that causes serious infections in compromised patients. More recently, it has emerged as the causative agent of severe infections in military personnel wounded in Iraq and Afghanistan. This pathogen grows under a wide range of conditions including iron-limiting conditions imposed by natural and synthetic iron chelators. Initial studies using the type strain 19606 showed that the iron proficiency of this pathogen depends on the expression of the acinetobactin-mediated iron acquisition system. More recently, we have observed that hemin but not human hemoglobin serves as an iron source when 19606 isogenic derivatives affected in acinetobactin transport and biosynthesis were cultured under iron-limiting conditions. This finding is in agreement with the observation that the genome of the strain 17978 has a gene cluster coding for putative hemin-acquisition functions, which include genes coding for putative hemin utilization functions and a TonBExbBD energy transducing system. This system restored enterobactin biosynthesis in an E. coli ExbBD deficient strain but not when introduced into a TonB mutant. PCR and Southern blot analyses showed that this hemin-utilization gene cluster is also present in the 19606 strain. Analysis of the 17978 genome also showed that this strain harbors genes required for acinetobactin synthesis and transport as well as a gene cluster that could code for additional iron acquisition functions. This hypothesis is in agreement with the fact that the inactivation of the basD acinetobactin biosynthetic gene did not affect the growth of A. baumannii 17978 cells under iron-chelated conditions. Interestingly, this second iron uptake gene cluster is flanked by perfect inverted repeats and includes transposase genes that are expressed transcriptionally. Also interesting is the observation that this additional cluster could not be detected in the type strain 19606, an observation that suggests some

  17. Acinetobacter baumannii and A. pittii clinical isolates lack adherence and cytotoxicity to lung epithelial cells in vitro.


    Lázaro-Díez, María; Navascués-Lejarza, Teresa; Remuzgo-Martínez, Sara; Navas, Jesús; Icardo, José Manuel; Acosta, Felix; Martínez-Martínez, Luis; Ramos-Vivas, José


    The molecular and genetic basis of Acinetobacter baumannii and Acinetobacter pittii virulence remains poorly understood, and there is still lack of knowledge in host cell response to these bacteria. In this study, we have used eleven clinical Acinetobacter strains (A. baumannii n = 5; A. pittii n = 6) to unravel bacterial adherence, invasion and cytotoxicity to human lung epithelial cells. Our results showed that adherence to epithelial cells by Acinetobacter strains is scarce and cellular invasion was not truly detected. In addition, all Acinetobacter strains failed to induce any cytotoxic effect on A549 cells.

  18. Characterization and identification of newly isolated Acinetobacter baumannii strain serdang 1 for phenol removal

    NASA Astrophysics Data System (ADS)

    Yadzir, Z. H. M.; Shukor, M. Y.; Nazir, M. S.; Abdullah, M. A.


    A new indigenous bacterial strain from Malaysian soil contaminated with petroleum waste had been successfully isolated, characterized and identified for phenol removal. The gram negative bacteria showed 98% identity with Acinetobacter baumannii based on Biolog{trade mark, serif} Identification System and the determination of a partial 16S ribosomal RNA (rRNA) sequence. The isolate clustered with species belonging to Acinetobacter clade in a 16S rDNA-based neighbour-joining phylogenetic tree.

  19. Biology of Acinetobacter baumannii: Pathogenesis, Antibiotic Resistance Mechanisms, and Prospective Treatment Options.


    Lee, Chang-Ro; Lee, Jung Hun; Park, Moonhee; Park, Kwang Seung; Bae, Il Kwon; Kim, Young Bae; Cha, Chang-Jun; Jeong, Byeong Chul; Lee, Sang Hee


    Acinetobacter baumannii is undoubtedly one of the most successful pathogens responsible for hospital-acquired nosocomial infections in the modern healthcare system. Due to the prevalence of infections and outbreaks caused by multi-drug resistant A. baumannii, few antibiotics are effective for treating infections caused by this pathogen. To overcome this problem, knowledge of the pathogenesis and antibiotic resistance mechanisms of A. baumannii is important. In this review, we summarize current studies on the virulence factors that contribute to A. baumannii pathogenesis, including porins, capsular polysaccharides, lipopolysaccharides, phospholipases, outer membrane vesicles, metal acquisition systems, and protein secretion systems. Mechanisms of antibiotic resistance of this organism, including acquirement of β-lactamases, up-regulation of multidrug efflux pumps, modification of aminoglycosides, permeability defects, and alteration of target sites, are also discussed. Lastly, novel prospective treatment options for infections caused by multi-drug resistant A. baumannii are summarized.

  20. Effects of silver nanoparticles in combination with antibiotics on the resistant bacteria Acinetobacter baumannii.


    Wan, Guoqing; Ruan, Lingao; Yin, Yu; Yang, Tian; Ge, Mei; Cheng, Xiaodong


    Acinetobacter baumannii resistance to carbapenem antibiotics is a serious clinical challenge. As a newly developed technology, silver nanoparticles (AgNPs) show some excellent characteristics compared to older treatments, and are a candidate for combating A. baumannii infection. However, its mechanism of action remains unclear. In this study, we combined AgNPs with antibiotics to treat carbapenem-resistant A. baumannii (aba1604). Our results showed that single AgNPs completely inhibited A. baumannii growth at 2.5 μg/mL. AgNP treatment also showed synergistic effects with the antibiotics polymixin B and rifampicin, and an additive effect with tigecyline. In vivo, we found that AgNPs-antibiotic combinations led to better survival ratios in A. baumannii-infected mouse peritonitis models than that by single drug treatment. Finally, we employed different antisense RNA-targeted Escherichia coli strains to elucidate the synergistic mechanism involved in bacterial responses to AgNPs and antibiotics.

  1. Biology of Acinetobacter baumannii: Pathogenesis, Antibiotic Resistance Mechanisms, and Prospective Treatment Options

    PubMed Central

    Lee, Chang-Ro; Lee, Jung Hun; Park, Moonhee; Park, Kwang Seung; Bae, Il Kwon; Kim, Young Bae; Cha, Chang-Jun; Jeong, Byeong Chul; Lee, Sang Hee


    Acinetobacter baumannii is undoubtedly one of the most successful pathogens responsible for hospital-acquired nosocomial infections in the modern healthcare system. Due to the prevalence of infections and outbreaks caused by multi-drug resistant A. baumannii, few antibiotics are effective for treating infections caused by this pathogen. To overcome this problem, knowledge of the pathogenesis and antibiotic resistance mechanisms of A. baumannii is important. In this review, we summarize current studies on the virulence factors that contribute to A. baumannii pathogenesis, including porins, capsular polysaccharides, lipopolysaccharides, phospholipases, outer membrane vesicles, metal acquisition systems, and protein secretion systems. Mechanisms of antibiotic resistance of this organism, including acquirement of β-lactamases, up-regulation of multidrug efflux pumps, modification of aminoglycosides, permeability defects, and alteration of target sites, are also discussed. Lastly, novel prospective treatment options for infections caused by multi-drug resistant A. baumannii are summarized. PMID:28348979

  2. Clinical and Epidemiological Significance of Carbapenem Resistance in Acinetobacter baumannii Infections

    PubMed Central

    Tal-Jasper, Ruthy; Katz, David E.; Amrami, Nadav; Ravid, Dor; Avivi, Dori; Zaidenstein, Ronit; Lazarovitch, Tsilia; Dadon, Mor; Kaye, Keith S.


    Carbapenems are considered the treatment of choice for Acinetobacter baumannii infections. Many facilities implement preventive measures toward only carbapenem-resistant A. baumannii (CRAB). However, the independent role of the carbapenem resistance determinant on patient outcomes remains controversial. In a 6-year analysis of adults with A. baumannii bloodstream infection (BSI), the outcomes of 149 CRAB isolates were compared to those of 91 patients with carbapenem-susceptible A. baumannii. In bivariable analyses, CRAB BSIs were significantly associated with worse outcomes and with a delay in the initiation of appropriate antimicrobial therapy (DAAT). However, in multivariable analyses, carbapenem resistance status was no longer associated with poor outcomes, while DAAT remained an independent predictor. The epidemiological significance of A. baumannii should not be determined by its resistance to carbapenems. PMID:26883694

  3. Identification and Characterization of a Glycosyltransferase Involved in Acinetobacter baumannii Lipopolysaccharide Core Biosynthesis▿

    PubMed Central

    Luke, Nicole R.; Sauberan, Shauna L.; Russo, Thomas A.; Beanan, Janet M.; Olson, Ruth; Loehfelm, Thomas W.; Cox, Andrew D.; St. Michael, Frank; Vinogradov, Evgeny V.; Campagnari, Anthony A.


    Although Acinetobacter baumannii has emerged as a significant cause of nosocomial infections worldwide, there have been few investigations describing the factors important for A. baumannii persistence and pathogenesis. This paper describes the first reported identification of a glycosyltransferase, LpsB, involved in lipopolysaccharide (LPS) biosynthesis in A. baumannii. Mutational, structural, and complementation analyses indicated that LpsB is a core oligosaccharide glycosyl transferase. Using a genetic approach, lpsB was compared with the lpsB homologues of several A. baumannii strains. These analyses indicated that LpsB is highly conserved among A. baumannii isolates. Furthermore, we developed a monoclonal antibody, monoclonal antibody 13C11, which reacts to an LPS core epitope expressed by approximately one-third of the A. baumannii clinical isolates evaluated to date. Previous studies describing the heterogeneity of A. baumannii LPS were limited primarily to structural analyses; therefore, studies evaluating the correlation between these surface glycolipids and pathogenesis were warranted. Our data from an evaluation of LpsB mutant 307::TN17, which expresses a deeply truncated LPS glycoform consisting of only two 3-deoxy-d-manno-octulosonic acid residues and lipid A, suggest that A. baumannii LPS is important for resistance to normal human serum and confers a competitive advantage for survival in vivo. These results have important implications for the role of LPS in A. baumannii infections. PMID:20194587

  4. Inactivation of Acinetobacter baumannii Biofilms on Polystyrene, Stainless Steel, and Urinary Catheters by Octenidine Dihydrochloride

    PubMed Central

    Narayanan, Amoolya; Nair, Meera S.; Karumathil, Deepti P.; Baskaran, Sangeetha A.; Venkitanarayanan, Kumar; Amalaradjou, Mary Anne Roshni


    Acinetobacter baumannii is a major nosocomial pathogen causing human infections with significant mortality rates. In most cases, infections are acquired through exposure to A. baumannii biofilms that persist on contaminated hospital equipment and surfaces. Thus, it is imperative to develop effective measures for controlling A. baumannii biofilms in nosocomial settings. This study investigated the efficacy of octenidine dihydrochloride (OH), a new generation disinfectant for reducing A. baumannii biofilms on polystyrene, stainless steel and catheters. OH at 0.3% (5 mM), 0.6% (10 mM), and 0.9% (15 mM) was effective in significantly inactivating A. baumannii biofilms on all tested surfaces (P < 0.05). Furthermore, OH was equally effective in inactivating biofilms of multidrug resistant and drug susceptible A. baumannii isolates. In addition, confocal imaging revealed the predominance of dead cells in the OH-treated samples in comparison to the control. Further, scanning electron microscopy of biofilms formed on catheters revealed that OH treatment significantly reduced A. baumannii biofilm populations in corroboration with our antibiofilm assay. These data underscore the efficacy of OH in inactivating A. baumannii biofilms, thereby suggesting its potential use as a disinfectant or a catheter lock solution to control A. baumannii infections. PMID:27375572

  5. Draft Genome Sequence of a Multidrug-Resistant Acinetobacter baumannii Strain from Chile.


    Opazo, Andrés; Lopes, Bruno S; García, Patricia; Domínguez Yévenes, Mariana; Lima, Celia; Bello-Toledo, Helia; González-Rocha, Gerardo; Amyes, Sebastian G B


    Acinetobacter baumannii strain Ab5 was isolated in the year 2007 in Chile, being one of the first multidrug-resistant (MDR) cases reported in the country. Here, we present the very first draft genome sequence of an MDR Chilean strain, which shows the presence of diverse resistance and acquired virulence genes.

  6. Draft Genome Sequence of a Multidrug-Resistant Acinetobacter baumannii Strain from Chile

    PubMed Central

    Lopes, Bruno S.; García, Patricia; Domínguez Yévenes, Mariana; Lima, Celia; Bello-Toledo, Helia; González-Rocha, Gerardo; Amyes, Sebastian G. B.


    Acinetobacter baumannii strain Ab5 was isolated in the year 2007 in Chile, being one of the first multidrug-resistant (MDR) cases reported in the country. Here, we present the very first draft genome sequence of an MDR Chilean strain, which shows the presence of diverse resistance and acquired virulence genes. PMID:26139713

  7. Draft Genome Sequences of Clinical Isolates of Multidrug-Resistant Acinetobacter baumannii

    PubMed Central

    Erickson, Keesha E.; Madinger, Nancy E.


    ABSTRACT We report here the draft genome sequences of two clinically isolated Acinetobacter baumannii strains. These samples were obtained from patients at the University of Colorado Hospital in 2007 and 2013 and encode an estimated 20 and 13 resistance genes, respectively. PMID:28153899

  8. The Impact of Antibiotic Consumption on Development of Acinetobacter Baumannii Resistance

    PubMed Central

    Granov, Djana; Ljubovic, Amela Dedeic; Zec, Svjetlana Loga; Granov, Nermir; Hukic, Mirsada


    Aim: The aim of this study was to examine the impact of antibiotic consumption on development of antimicrobial resistance in Acinetobacter baumannii. Material and Methods: The study was conducted in University Clinical Center of Sarajevo. In our retrospective study Acinetobacter baumannii isolated in period from July 1st 2009 to December 31st 2012. Isolates were detected from different clinical samples including urine, wound swab, blood, bronchial aspirate and other samples which were collected from patients situated on various hospital wards. Clinical isolates belonged to one per patient in a given period of time. Results: Antimicrobial resistance was interpreted according to CLSI breakpoints. Consumption of antibiotics was analyzed according to recommendations of the ESAC-Net and current Acinetobacter baumannii classification. Pearson’s correlation showed a positive correlation between gentamicin consumption and emerging of resistance (p = 0.023). Conclusion: Increase in the antimicrobial use was followed with an increase in resistance of Acinetobacter baumannii isolates. Monitoring of antibiotic resistance and consumption is of a great importance in order to reduce the emergence and spread of antimicrobial resistant organisms in the health care settings. PMID:28144198

  9. Colistin methanesulfonate against multidrug-resistant Acinetobacter baumannii in an in vitro pharmacodynamic model.


    Kroeger, Lisa A; Hovde, Laurie B; Mitropoulos, Isaac F; Schafer, Jeremy; Rotschafer, John C


    Using an in vitro pharmacodynamic model, a multidrug-resistant strain of Acinetobacter baumannii was exposed to colistin methanesulfonate alone and in combination with ceftazidime. Pre- and postexposure colistin sulfate MICs were determined. A single daily dose of colistin methanesulfonate combined with continuous-infusion ceftazidime prevented regrowth and postexposure MIC increases.

  10. Whole-Genome Sequencing Elucidates Epidemiology of Nosocomial Clusters of Acinetobacter baumannii

    PubMed Central

    Willems, Stefanie; Kampmeier, Stefanie; Bletz, Stefan; Kossow, Annelene; Köck, Robin; Kipp, Frank


    We characterized two epidemiologically similar Acinetobacter baumannii clusters from two separate intensive care units (ICU) using core genome multilocus sequence typing. Clonal spread was confirmed in ICU-1 (12 of 14 isolates shared genotypes); in ICU-2, all genotypes (13 isolates) were diverse, thus excluding transmissions and enabling adequate infection control measures. PMID:27358465

  11. Meta-analysis of colistin for the treatment of Acinetobacter baumannii infection.


    Chen, Zhijin; Chen, Yu; Fang, Yaogao; Wang, Xiaotian; Chen, Yanqing; Qi, Qingsong; Huang, Fang; Xiao, Xungang


    Multidrug resistant among Acinetobacter baumannii infection is associated with a high mortality rate and limits the therapeutic options. The aim of this study was to assess the safety and efficacy of colistin monotherapy vs. other single antibiotic therapy AND colistin-based combination therapy (with other antibiotics) vs. colistin alone for the treatment of Acinetobacter baumannii infection. Online electronic database were searched for studies evaluating colistin with or without other antibiotics in treatment of patients with drug-resistant Acinetobacter baumannii infection. Totally, twelve studies met the inclusion criteria. For colistin-based combination therapy, six articles including 668 patients were included. Our results showed that the overall clinical response did not differ significantly between colistin-based combination therapy and monotherapy (OR = 1.37, 95% CI = 0.86-2.19, P = 0.18). This insignificance was also detected in ICU mortality, length of stay and nephrotoxicity (P > 0.05). However, the colistin-based combination therapy was shown increasing the microbiological response (OR = 2.14, 95% CI = 1.48-3.07, P < 0.0001). For colistin monotherapy, six studies involving 491 patients were analyzed. The results were in concordance with the findings of the colistin-based combination therapy group. Our results suggest that colistin may be a promising therapy as safe and efficacious as standard antibiotics for the treatment of drug-resistant Acinetobacter baumannii infection.

  12. The Population Structure of Acinetobacter baumannii: Expanding Multiresistant Clones from an Ancestral Susceptible Genetic Pool

    PubMed Central

    Diancourt, Laure; Passet, Virginie; Nemec, Alexandr; Dijkshoorn, Lenie; Brisse, Sylvain


    Outbreaks of hospital infections caused by multidrug resistant Acinetobacter baumannii strains are of increasing concern worldwide. Although it has been reported that particular outbreak strains are geographically widespread, little is known about the diversity and phylogenetic relatedness of A. baumannii clonal groups. Sequencing of internal portions of seven housekeeping genes (total 2,976 nt) was performed in 154 A. baumannii strains covering the breadth of known diversity and including representatives of previously recognized international clones, and in 19 representatives of other Acinetobacter species. Restricted amounts of diversity and a star-like phylogeny reveal that A. baumannii is a genetically compact species that suffered a severe bottleneck in the recent past, possibly linked to a restricted ecological niche. A. baumannii is neatly demarcated from its closest relative (genomic species 13TU) and other Acinetobacter species. Multilocus sequence typing analysis demonstrated that the previously recognized international clones I to III correspond to three clonal complexes, each made of a central, predominant genotype and few single locus variants, a hallmark of recent clonal expansion. Whereas antimicrobial resistance was almost universal among isolates of these and a novel international clone (ST15), isolates of the other genotypes were mostly susceptible. This dichotomy indicates that antimicrobial resistance is a major selective advantage that drives the ongoing rapid clonal expansion of these highly problematic agents of nosocomial infections. PMID:20383326

  13. Multidrug resistant Acinetobacter baumannii in veterinary medicine--emergence of an underestimated pathogen?


    Müller, Stefanie; Janssen, Traute; Wieler, Lothar H


    The proportion of multidrug resistant bacteria causing infections in animals has continuously been increasing. While the relevance of ESBL (extended spectrum beta-lactamase)-producing Enterobacteriaceae spp. and MRSA (methicillin resistant Staphylococcus aureus) is unquestionable, knowledge about multidrug resistant Acinetobacter baumannii in veterinary medicine is scarce. This is a worrisome situation, as A. baumannii are isolated from veterinary clinical specimens with rising frequency. The remarkable ability of A. baumannii to develop multidrug resistance and the high risk of transmission are known in human medicine for years. Despite this, data regarding A. baumannii isolates of animal origin are missing. Due to the changing role of companion animals with closer contact between animal and owner, veterinary intensive care medicine is steadily developing. It can be assumed that the number of "high risk" patients with an enhanced risk for hospital acquired infections will be rising simultaneously. Thus, development and spread of multidrug resistant pathogens is envisioned to rise. It is possible, that A. baumannii will evolve into a veterinary nosocomial pathogen similar to ESBL-producing Enterobacteriaceae and MRSA. The lack of attention paid to A. baumannii in veterinary medicine is even more worrying, as first reports indicate a transmission between humans and animals. Essential questions regarding the role of livestock, especially as a potential source of multidrug resistant isolates, remain unanswered. This review summarizes the current knowledge on A. baumannii in veterinary medicine for the first time. It underlines the utmost significance of further investigations of A. baumannii animal isolates, particularly concerning epidemiology and resistance mechanisms.

  14. Evaluation of the trimeric autotransporter Ata as a vaccine candidate against Acinetobacter baumannii infections.


    Bentancor, Leticia V; Routray, Abhisek; Bozkurt-Guzel, Cagla; Camacho-Peiro, Ana; Pier, Gerald B; Maira-Litrán, Tomás


    Acinetobacter baumannii is a multidrug-resistant (MDR) nosocomial pathogen for which immunotherapeutic alternatives are needed. We previously identified a surface autotransporter of A. baumannii, Ata, that bound to various extracellular matrix/basal membrane proteins and was required for full virulence, biofilm formation, and the adhesion of A. baumannii to collagen type IV. We show here that Ata binding to collagen type IV was inhibited by antibodies to Ata. In addition, in the presence of complement and polymorphonuclear cells (PMNs), antibodies to Ata were highly opsonic against A. baumannii ATCC 17978 and showed low to moderate killing activity against four heterologous A. baumannii strains, whereas in the absence of PMNs, antibody to Ata efficiently promoted complement-dependent bactericidal killing of all of the tested A. baumannii isolates. Using a pneumonia model of infection in both immunocompetent and immunocompromised mice, we found that, compared to normal rabbit sera, antisera to Ata significantly reduced the levels of A. baumannii ATCC 17978 and two MDR strains in the lungs of infected mice. The ability of Ata to engender anti-adhesive, bactericidal, opsonophagocytic, and protective antibodies validates its potential use as an antigenic target against MDR A. baumannii infections.

  15. Evaluation of the Trimeric Autotransporter Ata as a Vaccine Candidate against Acinetobacter baumannii Infections

    PubMed Central

    Bentancor, Leticia V.; Routray, Abhisek; Bozkurt-Guzel, Cagla; Camacho-Peiro, Ana; Pier, Gerald B.


    Acinetobacter baumannii is a multidrug-resistant (MDR) nosocomial pathogen for which immunotherapeutic alternatives are needed. We previously identified a surface autotransporter of A. baumannii, Ata, that bound to various extracellular matrix/basal membrane proteins and was required for full virulence, biofilm formation, and the adhesion of A. baumannii to collagen type IV. We show here that Ata binding to collagen type IV was inhibited by antibodies to Ata. In addition, in the presence of complement and polymorphonuclear cells (PMNs), antibodies to Ata were highly opsonic against A. baumannii ATCC 17978 and showed low to moderate killing activity against four heterologous A. baumannii strains, whereas in the absence of PMNs, antibody to Ata efficiently promoted complement-dependent bactericidal killing of all of the tested A. baumannii isolates. Using a pneumonia model of infection in both immunocompetent and immunocompromised mice, we found that, compared to normal rabbit sera, antisera to Ata significantly reduced the levels of A. baumannii ATCC 17978 and two MDR strains in the lungs of infected mice. The ability of Ata to engender anti-adhesive, bactericidal, opsonophagocytic, and protective antibodies validates its potential use as an antigenic target against MDR A. baumannii infections. PMID:22825448

  16. Code blue: Acinetobacter baumannii, a nosocomial pathogen with a role in the oral cavity

    PubMed Central

    Richards, A.M.; Kwaik, Y. Abu; Lamont, R.J.


    SUMMARY Actinetobacter baumannii is an important nosocomial pathogen that can cause a wide range of serious conditions including pneumonia, meningitis, necrotizing fasciitis and sepsis. It is also a major cause of wound infections in military personnel injured during the conflicts in Afghanistan and Iraq, leading to its popular nickname of ‘Iraqibacter’. Contributing to its success in clinical settings is resistance to environmental stresses such as desiccation and disinfectants. Moreover, in recent years there has been a dramatic increase in the number of A. baumannii strains with resistance to multiple antibiotic classes. Acinetobacter baumannii is an inhabitant of oral biofilms, which can act as a reservoir for pneumonia and chronic obstructive pulmonary disease. Subgingival colonization by A. baumannii increases the risk of refractory periodontitis. Pathogenesis of the organism involves adherence, biofilm formation and iron acquisition. In addition, A. baumannii can induce apoptotic cell death in epithelial cells and kill hyphal forms of Candida albicans. Virulence factors that have been identified include pili, the outer membrane protein OmpA, phospholipases and extracellular polysaccharide. Acinetobacter baumannii can sense blue light through a blue-light sensing using flavin (BLUF) domain protein, BlsA. The resulting conformational change in BlsA leads to changes in gene expression, including virulence genes. PMID:25052812

  17. CpaA a novel protease from Acinetobacter baumannii clinical isolates deregulates blood coagulation.


    Tilley, Derek; Law, Robert; Warren, Sarah; Samis, John A; Kumar, Ayush


    Acinetobacter baumannii is an important nosocomial pathogen that displays high antibiotic resistance. It causes a variety of infections including pneumonias and sepsis which may result in disseminated intravascular coagulation. In this work, we identify and characterize a novel secreted, zinc-dependent, metallo-endopeptidase CpaA (coagulation targeting metallo-endopeptidase of Acinetobacter baumannii) which deregulates human blood coagulation in vitro and thus is likely to contribute to A. baumannii virulence. Three quarters of the clinical isolates tested (n = 16) had the cpaA gene; however, it was absent from two type strains, A. baumannii ATCC 17978 and A. baumannii ATCC 19606. The CpaA protein was purified from one clinical isolate and was able to cleave purified factor (F) V and fibrinogen and reduce the coagulation activity of FV in human plasma. CpaA-treated plasma showed reduced clotting activity in contact pathway-activated partial thromboplastin time (aPTT) assays, but increased clotting activity in tissue factor pathway prothrombin time (PT) assays. A significant portion of clinically relevant A. baumannii isolates secrete a protease which targets and deregulates the coagulation system.

  18. Improvement of MALDI-TOF MS profiling for the differentiation of species within the Acinetobacter calcoaceticus-Acinetobacter baumannii complex.


    Šedo, Ondrej; Nemec, Alexandr; Křížová, Lenka; Kačalová, Magdaléna; Zdráhal, Zbyněk


    MALDI-TOF MS is currently becoming the method of choice for rapid identification of bacterial species in routine diagnostics. Yet, this method suffers from the inability to differentiate reliably between some closely related bacterial species including those of the Acinetobacter calcoaceticus-Acinetobacter baumannii (ACB) complex, namely A. baumannii and Acinetobacter nosocomialis. In the present study, we evaluated a protocol which was different from that used in the Bruker Daltonics identification system (MALDI BioTyper) to improve species identification using a taxonomically precisely defined set of 105 strains representing the four validly named species of the ACB complex. The novel protocol is based on the change in matrix composition from alpha-cyano-4-hydroxycinnamic acid (saturated solution in water:acetonitrile:trifluoroacetic acid, 47.5:50:2.5, v/v) to ferulic acid (12.5mgml(-1) solution in water:acetonitrile:formic acid 50:33:17, v/v), while the other steps of sample processing remain unchanged. Compared to the standard protocol, the novel one extended the range of detected compounds towards higher molecular weight, produced signals with better mass resolution, and allowed the detection of species-specific signals. As a result, differentiation of A. nosocomialis and A. baumannii strains by cluster analysis was improved and 13 A. nosocomialis strains, assigned erroneously or ambiguously by using the standard protocol, were correctly identified.

  19. Candida spp. airway colonization: A potential risk factor for Acinetobacter baumannii ventilator-associated pneumonia.


    Tan, Xiaojiang; Zhu, Song; Yan, Dongxing; Chen, Weiping; Chen, Ruilan; Zou, Jian; Yan, Jingdong; Zhang, Xiangdong; Farmakiotis, Dimitrios; Mylonakis, Eleftherios


    This retrospective study was conducted to identify potential risk factors for Acinetobacter baumannii (A. baumannii) ventilator-associated pneumonia (VAP) and evaluate the association between Candida spp. airway colonization and A. baumannii VAP. Intensive care unit (ICU) patients who were on mechanical ventilation (MV) for ≥48 hours were divided into the following groups: patients with and without Candida spp. airway colonization; colonized patients receiving antifungal treatment or not; patients with A. baumannii VAP and those without VAP. Logistic regression analysis and propensity score matching were used to identify factors independently associated with A. baumannii VAP. Among 618 eligible patients, 264 (43%) had Candida spp. airway colonization and 114 (18%) developed A. baumannii VAP. Along with MV for ≥7 days (adjusted odds ratio [aOR] 8.9, 95% confidence intervals [95% CI] 4.9-15.8) and presence of a central venous catheter (aOR 3.2, 95% CI 1.1-9), Candida spp. airway colonization (aOR 2.6, 95% CI 1.6-4.3) was identified as an independent risk factor for A. baumannii VAP. Patients with Candida spp. airway colonization were more likely to develop A. baumannii VAP than non-colonized patients (23% vs 15%, P=.01 and 34% vs. 15%, P<.001 in propensity score-matched subgroups). Administration of antifungal agents was not associated with A. baumannii VAP (29% vs. 21%, P=.153) but with higher in-hospital mortality (53% vs. 39%, P=.037). Candida spp. airway colonization (43%) and A. baumannii VAP (18%) were common in ICU patients who were on mechanical ventilation for at least 48 hours. Candida spp. airway colonization was an independent risk factor for subsequent A. baumannii VAP.

  20. Evaluation of CHROMagar Acinetobacter for Detection of Enteric Carriage of Multidrug-Resistant Acinetobacter baumannii in Samples from Critically Ill Patients▿

    PubMed Central

    Gordon, N. C.; Wareham, D. W.


    CHROMagar Acinetobacter was used to screen stool and perineal swabs for enteric carriage of multidrug-resistant Acinetobacter baumannii in samples from critically ill patients. Results were compared with a molecular assay resulting in sensitivity and specificity of culture compared to PCR of 91.7% and 89.6%, respectively. PMID:19439546

  1. Screening and deciphering antibiotic resistance in Acinetobacter baumannii: a state of the art.


    Bonnin, Rémy A; Nordmann, Patrice; Poirel, Laurent


    Acinetobacter baumannii, recognized as a serious threat in healthcare facilities, has the ability to develop resistance to antibiotics quite easily. This resistance is related to either gene acquisition (horizontal gene transfer) or mutations in the genome, leading to gene disruption, over- or down-expression of genes. The clinically relevant antibiotic resistances in A. baumannii include resistance to aminoglycosides, broad-spectrum cephalosporins, carbapenems, tigecycline and colistin, which are the last resort antibiotics. The intrinsic and acquired resistance mechanisms of A. baumannii are presented here, with special focus on β-lactam resistance. The most up-to-date techniques for identification, including phenotypical and molecular tests, and screening of those emerging resistance traits are also highlighted. The implementation of early detection and identification of multidrug-resistant A. baumannii is crucial to control their spread.

  2. Distribution of AdeABC efflux system genes in genotypically diverse strains of clinical Acinetobacter baumannii.


    Wieczorek, Piotr; Sacha, Paweł; Czaban, Sławomir; Hauschild, Tomasz; Ojdana, Dominika; Kowalczuk, Oksana; Milewski, Robert; Poniatowski, Bogusław; Nikliński, Jacek; Tryniszewska, Elżbieta


    Acinetobacter baumannii has emerged as a highly problematic hospital-associated pathogen. Different mechanisms contribute to the formation of multidrug resistance in A. baumannii, including the AdeABC efflux system. Distribution of the structural and regulatory genes encoding the AdeABC efflux system among genetically diverse clinical A. baumannii strains was achieved by using PCR and pulsed-field gel electrophoresis techniques. The distribution of adeABRS genes is extremely high among our A. baumannii strains, except the adeC gene. We have observed a large proportion of strains presenting multidrug-resistance phenotype for several years. The efflux pump could be an important mechanism in these strains in resistance to antibiotics.

  3. Biofilm Formation and Colistin Susceptibility of Acinetobacter baumannii Isolated from Korean Nosocomial Samples.


    Kim, Hyun Ah; Ryu, Seong Yeol; Seo, Incheol; Suh, Seong-Il; Suh, Min-Ho; Baek, Won-Ki


    Biofilm formation, a virulence factor of Acinetobacter baumannii, is associated with long-term survival in hospital environments and provides resistance to antibiotics. Standard tests for antibiotic susceptibility involve analyzing bacteria in the planktonic state. However, the biofilm formation ability can influence antibiotic susceptibility. Therefore, here, the biofilm formation ability of A. baumannii clinical isolates from Korea was investigated and the susceptibility of biofilm and planktonic bacteria to colistin was compared. Of the 100 clinical isolates examined, 77% exhibited enhanced biofilm formation capacity relative to a standard A. baumannii strain (ATCC 19606). Differences between the minimal inhibitory concentrations and minimal biofilm-inhibitory concentrations of colistin were significantly greater in the group of A. baumannii that exhibited enhanced biofilm formation than the group that exhibited less ability for biofilm formation. Thus, the ability to form a biofilm may affect antibiotic susceptibility and clinical failure, even when the dose administered is in the susceptible range.

  4. First detection of OXA-24 carbapenemase-producing Acinetobacter baumannii isolates in Bulgaria.


    Todorova, Bozhana; Velinov, Tzvetan; Ivanov, Ivan; Dobreva, Elina; Kantardjiev, Todor


    This report describes the first identification of OXA-24 carbapenemase-producing Acinetobacter baumannii isolates from Bulgaria. According to national surveillance data A. baumannii along with Pseudomonas aeruginosa are the most troublesome microorganisms in hospital environment with high rates of acquired carbapenem resistance. In the present study real-time multiplex PCR was performed to identify the most common carbapenemase genes in 15 non-duplicate carbapenem-resistant A. baumannii isolates collected in 2012. The results showed lack of KPC, GES, VIM, IMP-type enzymes. Four A. baumannii isolates tested positive by PCR for the acquired OXA-24 together with the intrinsic OXA-51 carbapenemase. OXA-24 and OXA-23 were determined as co-existent in one isolate. Two isolates were identified with OXA-23 in addition to the OXA-51 carbapenemase.

  5. Phosphoproteomics as an emerging weapon to develop new antibiotics against carbapenem resistant strain of Acinetobacter baumannii.


    Tiwari, Vishvanath; Tiwari, Monalisa


    Acinetobacter baumannii causes pneumonia, bloodstream infections, urinary tract infections, respiratory infections and meningitis. A. baumannii has developed resistance against most of the antibiotics including carbapenem. Therefore, to battle carbapenem resistance, there is a need to develop antimicrobial drugs with new modes of action. Phosphoproteomics will help identify the differentially phosphorylated protein and its crucial phosphosites which facilitate the elucidation of molecular mechanism of signaling and regulation of carbapenem resistant strain of A. baumannii as compared to carbapenem sensitive strain. This understanding might be useful for the development of new antibiotics against kinases involved in the phosphorylation of identified phosphosites in carbapenem resistant strain of A. baumannii. The proposed antibiotics selectively inhibit carbapenem resistant strain which further avoids its excessive use against carbapenem sensitive strain and thereafter reduces emergence of resistance.

  6. The Complete Genome and Phenome of a Community-Acquired Acinetobacter baumannii

    PubMed Central

    Farrugia, Daniel N.; Elbourne, Liam D. H.; Hassan, Karl A.; Eijkelkamp, Bart A.; Tetu, Sasha G.; Brown, Melissa H.; Shah, Bhumika S.; Peleg, Anton Y.; Mabbutt, Bridget C.; Paulsen, Ian T.


    Many sequenced strains of Acinetobacter baumannii are established nosocomial pathogens capable of resistance to multiple antimicrobials. Community-acquired A. baumannii in contrast, comprise a minor proportion of all A. baumannii infections and are highly susceptible to antimicrobial treatment. However, these infections also present acute clinical manifestations associated with high reported rates of mortality. We report the complete 3.70 Mbp genome of A. baumannii D1279779, previously isolated from the bacteraemic infection of an Indigenous Australian; this strain represents the first community-acquired A. baumannii to be sequenced. Comparative analysis of currently published A. baumannii genomes identified twenty-four accessory gene clusters present in D1279779. These accessory elements were predicted to encode a range of functions including polysaccharide biosynthesis, type I DNA restriction-modification, and the metabolism of novel carbonaceous and nitrogenous compounds. Conversely, twenty genomic regions present in previously sequenced A. baumannii strains were absent in D1279779, including gene clusters involved in the catabolism of 4-hydroxybenzoate and glucarate, and the A. baumannii antibiotic resistance island, known to bestow resistance to multiple antimicrobials in nosocomial strains. Phenomic analysis utilising the Biolog Phenotype Microarray system indicated that A. baumannii D1279779 can utilise a broader range of carbon and nitrogen sources than international clone I and clone II nosocomial isolates. However, D1279779 was more sensitive to antimicrobial compounds, particularly beta-lactams, tetracyclines and sulphonamides. The combined genomic and phenomic analyses have provided insight into the features distinguishing A. baumannii isolated from community-acquired and nosocomial infections. PMID:23527001

  7. Acinetobacter baumannii Response to Host-Mediated Zinc Limitation Requires the Transcriptional Regulator Zur

    PubMed Central

    Mortensen, Brittany L.; Rathi, Subodh; Chazin, Walter J.


    Acinetobacter baumannii is a leading cause of ventilator-associated pneumonia in intensive care units, and the increasing rates of antibiotic resistance make treating these infections challenging. Consequently, there is an urgent need to develop new antimicrobials to treat A. baumannii infections. One potential therapeutic option is to target bacterial systems involved in maintaining appropriate metal homeostasis, processes that are critical for the growth of pathogens within the host. The A. baumannii inner membrane zinc transporter ZnuABC is required for growth under low-zinc conditions and for A. baumannii pathogenesis. The expression of znuABC is regulated by the transcriptional repressor Zur. To investigate the role of Zur during the A. baumannii response to zinc limitation, a zur deletion mutant was generated, and transcriptional changes were analyzed using RNA sequencing. A number of Zur-regulated genes were identified that exhibit increased expression both when zur is absent and under low-zinc conditions, and Zur binds to predicted Zur box sequences of several genes affected by zinc levels or the zur mutation. Furthermore, the zur mutant is impaired for growth in the presence of both high and low zinc levels compared to wild-type A. baumannii. Finally, the zur mutant exhibits a defect in dissemination in a mouse model of A. baumannii pneumonia, establishing zinc sensing as a critical process during A. baumannii infection. These results define Zur-regulated genes within A. baumannii and demonstrate a requirement for Zur in the A. baumannii response to the various zinc levels experienced within the vertebrate host. PMID:24816603

  8. Therapeutic efficacy of lysophosphatidylcholine in severe infections caused by Acinetobacter baumannii.


    Smani, Younes; Domínguez-Herrera, Juan; Ibáñez-Martínez, José; Pachón, Jerónimo


    Due to the significant increase in antimicrobial resistance of Acinetobacter baumannii, immune system stimulation to block infection progression may be a therapeutic adjuvant to antimicrobial treatment. Lysophosphatidylcholine (LPC), a major component of phospholipids in eukaryotic cells, is involved in immune cell recruitment and modulation. The aim of this study was to show if LPC could be useful for treating infections caused by A. baumannii. A. baumannii ATCC 17978 was used in this study. Levels of serum LPC and levels of the inflammatory cytokines tumor necrosis factor alpha (TNF-α), interleukin-6 (IL-6), IL-1β, and IL-10 were determined by spectrophotometric assay and enzyme-linked immunosorbent assay (ELISA), respectively, using a murine peritoneal sepsis model in which mice were inoculated with 5.3 log CFU/ml of A. baumannii. The therapeutic efficacy of LPC against A. baumannii in murine peritoneal sepsis and pneumonia models was assessed for 48 h after bacterial infection. At early time points in the murine model of peritoneal sepsis caused by A. baumannii, LPC was depleted and was associated with an increase of inflammatory cytokine release. Preemptive therapy with LPC in murine peritoneal sepsis and pneumonia models markedly enhanced spleen and lung bacterial clearance and reduced the numbers of positive blood cultures and the mouse mortality rates. Moreover, treatment with LPC reduced proinflammatory cytokine production. These data demonstrate that LPC is efficacious as a preemptive treatment in experimental models of peritoneal sepsis and pneumonia caused by A. baumannii.

  9. Acinetobacter baumannii Outer Membrane Vesicles Elicit a Potent Innate Immune Response via Membrane Proteins

    PubMed Central

    Jun, So Hyun; Lee, Jung Hwa; Kim, Bo Ra; Kim, Seung Il; Park, Tae In


    Acinetobacter baumannii is increasingly becoming a major nosocomial pathogen. This opportunistic pathogen secretes outer membrane vesicles (OMVs) that interact with host cells. The aim of this study was to investigate the ability of A. baumannii OMVs to elicit a pro-inflammatory response in vitro and the immunopathology in response to A. baumannii OMVs in vivo. OMVs derived from A. baumannii ATCC 19606T induced expression of pro-inflammatory cytokine genes, interleukin (IL)-1β and IL-6, and chemokine genes, IL-8, macrophage inflammatory protein-1α, and monocyte chemoattractant protein-1, in epithelial cells in a dose-dependent manner. Disintegration of OMV membrane with ethylenediaminetetraacetic acid resulted in low expression of pro-inflammatory cytokine genes, as compared with the response to intact OMVs. In addition, proteinase K-treated A. baumannii OMVs did not induce significant increase in expression of pro-inflammatory cytokine genes above the basal level, suggesting that the surface-exposed membrane proteins in intact OMVs are responsible for pro-inflammatory response. Early inflammatory processes, such as vacuolization and detachment of epithelial cells and neutrophilic infiltration, were clearly observed in lungs of mice injected with A. baumannii OMVs. Our data demonstrate that OMVs produced by A. baumannii elicit a potent innate immune response, which may contribute to immunopathology of the infected host. PMID:23977136

  10. Molecular detection of aminoglycoside-modifying enzyme genes in Acinetobacter baumannii clinical isolates.


    Heidary, Mohsen; Salimi Chirani, Alireza; Khoshnood, Saeed; Eslami, Gita; Atyabi, Seyyed Mohammad; Nazem, Habibollah; Fazilati, Mohammad; Hashemi, Ali; Soleimani, Saleh


    Acinetobacter baumannii is a major opportunistic pathogen in healthcare settings worldwide. In Iran, there are only few reports on the prevalence of aminoglycoside resistance genes among A. baumannii isolates. The aim of this study was to investigate the existence of aminoglycoside-modifying enzyme (AME) genes from A. baumannii strains collected at a university teaching hospital in Iran. One hundred A. baumannii strains were collected between 2014 and 2015 from hospitalized patients at Loghman Hakim Hospital, Tehran, Iran. Antimicrobial susceptibility was determined by disk diffusion method according to the Clinical and Laboratory Standards Institute recommendations. The DNA was extracted using a kit obtained from Bioneer Co. (Korea) and was used as a template for polymerase chain reaction. The most active antimicrobial agent against these strains was colistin. The rate of extended-spectrum cephalosporin resistance was 97%. The aadA1, aadB, aac(6')-Ib, and aac(3)-IIa genes were found in 85%, 77%, 72%, and 68% of A. baumannii isolates, respectively. This study showed a high prevalence rate of AME genes in A. baumannii. This prevalence rate has explained that further aminoglycoside resistance genes may have role in the resistance of clinical isolates of A. baumannii. Therefore, control and treatment of serious infections caused by this opportunistic pathogen should be given more consideration.

  11. Therapeutic Efficacy of Lysophosphatidylcholine in Severe Infections Caused by Acinetobacter baumannii

    PubMed Central

    Domínguez-Herrera, Juan; Ibáñez-Martínez, José; Pachón, Jerónimo


    Due to the significant increase in antimicrobial resistance of Acinetobacter baumannii, immune system stimulation to block infection progression may be a therapeutic adjuvant to antimicrobial treatment. Lysophosphatidylcholine (LPC), a major component of phospholipids in eukaryotic cells, is involved in immune cell recruitment and modulation. The aim of this study was to show if LPC could be useful for treating infections caused by A. baumannii. A. baumannii ATCC 17978 was used in this study. Levels of serum LPC and levels of the inflammatory cytokines tumor necrosis factor alpha (TNF-α), interleukin-6 (IL-6), IL-1β, and IL-10 were determined by spectrophotometric assay and enzyme-linked immunosorbent assay (ELISA), respectively, using a murine peritoneal sepsis model in which mice were inoculated with 5.3 log CFU/ml of A. baumannii. The therapeutic efficacy of LPC against A. baumannii in murine peritoneal sepsis and pneumonia models was assessed for 48 h after bacterial infection. At early time points in the murine model of peritoneal sepsis caused by A. baumannii, LPC was depleted and was associated with an increase of inflammatory cytokine release. Preemptive therapy with LPC in murine peritoneal sepsis and pneumonia models markedly enhanced spleen and lung bacterial clearance and reduced the numbers of positive blood cultures and the mouse mortality rates. Moreover, treatment with LPC reduced proinflammatory cytokine production. These data demonstrate that LPC is efficacious as a preemptive treatment in experimental models of peritoneal sepsis and pneumonia caused by A. baumannii. PMID:25896698

  12. Isolation and Characterization of Antimicrobial Compounds in Plant Extracts against Multidrug-Resistant Acinetobacter baumannii

    PubMed Central

    Miyasaki, Yoko; Rabenstein, John D.; Rhea, Joshua; Crouch, Marie-Laure; Mocek, Ulla M.; Kittell, Patricia Emmett; Morgan, Margie A.; Nichols, Wesley Stephen; Van Benschoten, M. M.; Hardy, William David; Liu, George Y.


    The number of fully active antibiotic options that treat nosocomial infections due to multidrug-resistant Acinetobacter baumannii (A. baumannii) is extremely limited. Magnolia officinalis, Mahonia bealei, Rabdosia rubescens, Rosa rugosa, Rubus chingii, Scutellaria baicalensis, and Terminalia chebula plant extracts were previously shown to have growth inhibitory activity against a multidrug-resistant clinical strain of A. baumannii. In this study, the compounds responsible for their antimicrobial activity were identified by fractionating each plant extract using high performance liquid chromatography, and determining the antimicrobial activity of each fraction against A. baumannii. The chemical structures of the fractions inhibiting >40% of the bacterial growth were elucidated by liquid chromatography/mass spectrometry analysis and nuclear magnetic resonance spectroscopy. The six most active compounds were identified as: ellagic acid in Rosa rugosa; norwogonin in Scutellaria baicalensis; and chebulagic acid, chebulinic acid, corilagin, and terchebulin in Terminalia chebula. The most potent compound was identified as norwogonin with a minimum inhibitory concentration of 128 µg/mL, and minimum bactericidal concentration of 256 µg/mL against clinically relevant strains of A. baumannii. Combination studies of norwogonin with ten anti-Gram negative bacterial agents demonstrated that norwogonin did not enhance the antimicrobial activity of the synthetic antibiotics chosen for this study. In conclusion, of all identified antimicrobial compounds, norwogonin was the most potent against multidrug-resistant A. baumannii strains. Further studies are warranted to ascertain the prophylactic and therapeutic potential of norwogonin for infections due to multidrug-resistant A. baumannii. PMID:23630600

  13. Joint Transcriptional Control of Virulence and Resistance to Antibiotic and Environmental Stress in Acinetobacter baumannii

    PubMed Central

    Gallagher, Larry A.; Jacobson, Rachael K.; Usacheva, Elena A.; Peterson, Lance R.; Zurawski, Daniel V.; Shuman, Howard A.


    ABSTRACT The increasing emergence of antibiotic-resistant bacterial pathogens represents a serious risk to human health and the entire health care system. Many currently circulating strains of Acinetobacter baumannii exhibit resistance to multiple antibiotics. A key limitation in combating A. baumannii is that our understanding of the molecular mechanisms underlying the pathogenesis of A. baumannii is lacking. To identify potential virulence determinants of a contemporary multidrug-resistant isolate of A. baumannii, we used transposon insertion sequencing (TnSeq) of strain AB5075. A collection of 250,000 A. baumannii transposon mutants was analyzed for growth within Galleria mellonella larvae, an insect-based infection model. The screen identified 300 genes that were specifically required for survival and/or growth of A. baumannii inside G. mellonella larvae. These genes encompass both known, established virulence factors and several novel genes. Among these were more than 30 transcription factors required for growth in G. mellonella. A subset of the transcription factors was also found to be required for resistance to antibiotics and environmental stress. This work thus establishes a novel connection between virulence and resistance to both antibiotics and environmental stress in A. baumannii. PMID:26556274

  14. Antimicrobial Resistance of Acinetobacter baumannii to Imipenem in Iran: A Systematic Review and Meta-Analysis.


    Pourhajibagher, Maryam; Hashemi, Farhad B; Pourakbari, Babak; Aziemzadeh, Masoud; Bahador, Abbas


    Imipenem-resistant multi-drug resistant (IR-MDR) Acinetobacter baumannii has been emerged as a morbidity successful nosocomial pathogen throughout the world.To address imipenem being yet the most effective antimicrobial agent against A. baumannii to control outbreaks and treat patients, a systematic review and meta-analysis was performed to evaluate the prevalence of IR-MDR A. baumannii. We systematically searched Web of Science, PubMed, MEDLINE, Science Direct, EMBASE, Scopus, Cochrane Library, Google Scholar, and Iranian databases to identify studies addressing the antibiotic resistance of A. baumannii to imipenem and the frequency of MDR strains in Iran. Out of 58 articles and after a secondary screening using inclusion and exclusion criteria and on the basis of title and abstract evaluation, 51 studies were selected for analysis. The meta-analysis revealed that 55% [95% confidence interval (CI), 53.0-56.5] of A. baumannii were resistant to imipenem and 74% (95% CI, 61.3-83.9) were MDR. The MDR A. baumannii population in Iran is rapidly changing toward a growing resistance to imipenem. Our findings highlight the critical need for a comprehensive monitoring and infection control policy as well as a national susceptibility review program that evaluates IR-MDR A. baumannii isolates from various parts of Iran.

  15. Complete Genome Sequence of a Multidrug-Resistant Acinetobacter baumannii Isolate Obtained from a Mexican Hospital (Sequence Type 422)

    PubMed Central

    Castro-Jaimes, Semiramis; Salgado-Camargo, Abraham David; Graña-Miraglia, Lucía; Lozano, Luis; Bocanegra-Ibarias, Paola; Volkow-Fernández, Patricia; Silva-Sanchez, Jesus; Castillo-Ramírez, Santiago


    Acinetobacter baumannii has emerged as a dangerous nosocomial pathogen, particularly for severely ill patients in intensive care units and patients with hematologic malignancies. Here, we present the complete genome sequence of a multidrug-resistant A. baumannii isolate, recovered from a Mexican hospital and classified as sequence type 422 according to the multilocus sequence typing Pasteur scheme. PMID:27340065

  16. Rapid discrimination of Acinetobacter baumannii international clone II lineage by pyrosequencing SNP analyses of bla(OXA-51-like) genes.


    Matsui, Mari; Suzuki, Satowa; Suzuki, Masato; Arakawa, Yoshichika; Shibayama, Keigo


    We found that Acinetobacter baumannii international clone II generally possesses unique GTA sequence at nucleotide positions 106-108 in the bla(OXA-51-like) genes. We exploited this to develop an easy and rapid method for discrimination of international clone II from other A. baumannii by employing pyrosequencing analyses of single nucleotide polymorphisms.

  17. Emergence of extensively drug-resistant OXA-72-producing Acinetobacter baumannii in Recife, Brazil: risk of clonal dissemination?


    de Sá Cavalcanti, Felipe Lira; Almeida, Anna Carolina Soares; Vilela, Marinalda Anselmo; de Morais Junior, Marcos Antonio; de Morais, Marcia Maria Camargo; Leal-Balbino, Tereza Cristina


    Two new examples of OXA-72-producing Acinetobacter baumannii isolate resistant to a broad spectrum of antimicrobials, but not polymyxin B, have been identified in Recife, Brazil. Molecular typing indicated a close genetic link with the OXA-72-producing A. baumannii previously isolated in São Paulo, suggesting the possibility of clonal dissemination within the country.

  18. Occurrence of an Environmental Acinetobacter baumannii Strain Similar to a Clinical Isolate in Paleosol from Croatia

    PubMed Central

    Durn, Goran; Goic-Barisic, Ivana; Kovacic, Ana


    Over the past decade, bacteria of the genus Acinetobacter have emerged as a leading cause of hospital-acquired infections. Outbreaks of Acinetobacter infections are considered to be caused exclusively by contamination and transmission in hospital environments. The natural habitats of clinically important multiresistant Acinetobacter spp. remain to be defined. In this paper, we report an incidental finding of a viable multidrug-resistant strain of Acinetobacter baumannii, related to clinical isolates, in acid paleosol from Croatia. The environmental isolate of A. baumannii showed 87% similarity to a clinical isolate originating from a hospital in this geographic area and was resistant to gentamicin, trimethoprim-sulfamethoxazole, ciprofloxacin, and levofloxacin. In paleosol, the isolate was able to survive a low pH (3.37), desiccation, and a high temperature (50°C). The probable source of A. baumannii in paleosol is illegally disposed waste of external origin situated in the abandoned quarry near the sampling site. The bacteria could have been leached from waste by storm water and thus infiltrated the paleosol. PMID:24584245

  19. Resources for Genetic and Genomic Analysis of Emerging Pathogen Acinetobacter baumannii

    PubMed Central

    Ramage, Elizabeth; Weiss, Eli J.; Radey, Matthew; Hayden, Hillary S.; Held, Kiara G.; Huse, Holly K.; Zurawski, Daniel V.; Brittnacher, Mitchell J.; Manoil, Colin


    ABSTRACT Acinetobacter baumannii is a Gram-negative bacterial pathogen notorious for causing serious nosocomial infections that resist antibiotic therapy. Research to identify factors responsible for the pathogen's success has been limited by the resources available for genome-scale experimental studies. This report describes the development of several such resources for A. baumannii strain AB5075, a recently characterized wound isolate that is multidrug resistant and displays robust virulence in animal models. We report the completion and annotation of the genome sequence, the construction of a comprehensive ordered transposon mutant library, the extension of high-coverage transposon mutant pool sequencing (Tn-seq) to the strain, and the identification of the genes essential for growth on nutrient-rich agar. These resources should facilitate large-scale genetic analysis of virulence, resistance, and other clinically relevant traits that make A. baumannii a formidable public health threat. IMPORTANCE Acinetobacter baumannii is one of six bacterial pathogens primarily responsible for antibiotic-resistant infections that have become the scourge of health care facilities worldwide. Eliminating such infections requires a deeper understanding of the factors that enable the pathogen to persist in hospital environments, establish infections, and resist antibiotics. We present a set of resources that should accelerate genome-scale genetic characterization of these traits for a reference isolate of A. baumannii that is highly virulent and representative of current outbreak strains. PMID:25845845

  20. In vitro and in vivo activities of E-101 solution against Acinetobacter baumannii isolates from U.S. military personnel.


    Denys, G A; Davis, J C; O'Hanley, P D; Stephens, J T


    We evaluated the in vitro and in vivo activity of a novel topical myeloperoxidase-mediated antimicrobial, E-101 solution, against 5 multidrug-resistant Acinetobacter baumannii isolates recovered from wounded American soldiers. Time-kill studies demonstrated rapid bactericidal activity against all A. baumannii strains tested in the presence of 3% blood. The in vitro bactericidal activity of E-101 solution against A. baumannii strains was confirmed in a full-thickness excision rat model. Additional in vivo studies appear warranted.

  1. Prevalence of digestive tract colonization of carbapenem-resistant Acinetobacter baumannii in hospitals in Saudi Arabia.


    Aljindan, Reem; Bukharie, Huda; Alomar, Amer; Abdalhamid, Baha


    Carbapenem-resistant Acinetobacter baumannii is a major health problem worldwide, especially in intensive care units (ICUs). This study aimed to detect the prevalence of A. baumannii colonization of the gastrointestinal tract of patients admitted to the ICU in two hospitals in Saudi Arabia. In addition, it aimed to characterize the molecular mechanisms of carbapenem resistance in these isolates. From January to June 2014, 565 rectal swab specimens were screened for Acinetobacer strains and carbapenem resistance using CHROMagar Acinetobacter and CHROMagar KPC agar plates, respectively. Organism identification and susceptibility were detected using the Vitek 2 system. A total of 47 Acinetobacter spp. were detected, and 35 were resistant to carbapenem, making the prevalence of Acinetobacter spp. 8.3% (47/565) and carbapenem resistance (6.2%, 35/565). The 47 strains showed remarkable clonal diversity as revealed by PFGE. Using PCR, OXA-51, a chromosomal marker for A. baumannii, was detected in 46 strains. OXA-23 β-lactamase was detected in all 35 carbapenem-resistant A. baumannii. No IMP, VIM, SPM, SIM, GIM, KPC or NDM β-lactamases were detected in these isolates. Thus, OXA-23 was the main mechanism of carbapenem resistance in these isolates. To the best of our knowledge, this is the first study to detect the prevalence of Acinetobacter colonization in the digestive tract of ICU patients in Saudi Arabia. This study revealed the importance of having well-established protocols for early identification of these multidrug-resistant organisms, optimizing infection-control strategies and having active surveillance studies to reduce morbidity, mortality and cost.

  2. The effect of terminal cleaning on environmental contamination rates of multidrug-resistant Acinetobacter baumannii.


    Strassle, Paula; Thom, Kerri A; Johnson, J Kristie; Johnsonm, J Kristie; Leekha, Surbhi; Lissauer, Matthew; Zhu, Jingkun; Harris, Anthony D


    We evaluated the prevalence of multidrug-resistant Acinetobacter baumannii environmental contamination before and after discharge cleaning in rooms of infected/colonized patients. 46.9% of rooms and 15.3% of sites were found contaminated precleaning, and 25% of rooms and 5.5% of sites were found contaminated postcleaning. Cleaning significantly decreased environmental contamination of A baumannii; however, persistent contamination represents a significant risk factor for transmission. Further studies on this and more effective cleaning methods are needed.

  3. High Frequency of OXA-253-Producing Acinetobacter baumannii in Different Hospitals in Recife, Brazil.


    de Sá Cavalcanti, Felipe Lira; Mendes-Marques, Carina Lucena; Vasconcelos, Crhisllane Rafaele Dos Santos; de Lima Campos, Túlio; Rezende, Antonio Mauro; Xavier, Danilo Elias; Leal, Nilma Cintra; de-Melo-Neto, Osvaldo Pompilio; de Morais, Marcia Maria Camargo; Leal-Balbino, Tereza Cristina


    Here, we report the isolation of 31 Acinetobacter baumannii strains producing OXA-253 in a single large Brazilian city. These strains belonged to five different sequence types (STs), including 4 STs not previously associated with blaOXA-253 In all strains, the blaOXA-253 gene was located in a plasmid within a genetic environment similar to what was found previously in Brazil and Italy. The reported data emphasize the successful transmission of the blaOXA-253 gene through a large area and the tendency for this resistance determinant to remain in the A. baumannii population.

  4. Inhibition of LpxC Increases Antibiotic Susceptibility in Acinetobacter baumannii

    PubMed Central

    García-Quintanilla, Meritxell; Caro-Vega, José M.; Pulido, Marina R.; Moreno-Martínez, Patricia; Pachón, Jerónimo


    LpxC inhibitors have generally shown poor in vitro activity against Acinetobacter baumannii. We show that the LpxC inhibitor PF-5081090 inhibits lipid A biosynthesis, as determined by silver staining and measurements of endotoxin levels, and significantly increases cell permeability. The presence of PF-5081090 at 32 mg/liter increased susceptibility to rifampin, vancomycin, azithromycin, imipenem, and amikacin but had no effect on susceptibility to ciprofloxacin and tigecycline. Potentiating existing antibiotics with LpxC inhibitors may represent an alternative treatment strategy for multidrug-resistant A. baumannii. PMID:27270288

  5. Acinetobacter baumannii Coordinates Urea Metabolism with Metal Import To Resist Host-Mediated Metal Limitation.


    Juttukonda, Lillian J; Chazin, Walter J; Skaar, Eric P


    During infection, bacterial pathogens must adapt to a nutrient metal-limited environment that is imposed by the host. The innate immune protein calprotectin inhibits bacterial growth in vitro by chelating the divalent metal ions zinc (Zn(2+), Zn) and manganese (Mn(2+), Mn), but pathogenic bacteria are able to cause disease in the presence of this antimicrobial protein in vivo. One such pathogen is Acinetobacter baumannii, a Gram-negative bacterium that causes pneumonia and bloodstream infections that can be complicated by resistance to multiple antibiotics. A. baumannii inhibition by calprotectin is dependent on calprotectin Mn binding, but the mechanisms employed by A. baumannii to overcome Mn limitation have not been identified. This work demonstrates that A. baumannii coordinates transcription of an NRAMP family Mn transporter and a urea carboxylase to resist the antimicrobial activities of calprotectin. This NRAMP family transporter facilitates Mn accumulation and growth of A. baumannii in the presence of calprotectin. A. baumannii is found to utilize urea as a sole nitrogen source, and urea utilization requires the urea carboxylase encoded in an operon with the NRAMP family transporter. Moreover, urea carboxylase activity is essential for calprotectin resistance in A. baumannii Finally, evidence is provided that this system combats calprotectin in vivo, as deletion of the transporter impairs A. baumannii fitness in a mouse model of pneumonia, and this fitness defect is modulated by the presence of calprotectin. These findings reveal that A. baumannii has evolved mechanisms to subvert host-mediated metal sequestration and they uncover a connection between metal starvation and metabolic stress.

  6. Role of macrophages in early host resistance to respiratory Acinetobacter baumannii infection.


    Qiu, Hongyu; KuoLee, Rhonda; Harris, Greg; Van Rooijen, Nico; Patel, Girishchandra B; Chen, Wangxue


    Acinetobacter baumannii is an emerging bacterial pathogen that causes nosocomial pneumonia and other infections. Although it is recognized as an increasing threat to immunocompromised patients, the mechanism of host defense against A. baumannii infection remains poorly understood. In this study, we examined the potential role of macrophages in host defense against A. baumannii infection using in vitro macrophage culture and the mouse model of intranasal (i.n.) infection. Large numbers of A. baumannii were taken up by alveolar macrophages in vivo as early as 4 h after i.n. inoculation. By 24 h, the infection induced significant recruitment and activation (enhanced expression of CD80, CD86 and MHC-II) of macrophages into bronchoalveolar spaces. In vitro cell culture studies showed that A. baumannii were phagocytosed by J774A.1 (J774) macrophage-like cells within 10 minutes of co-incubation, and this uptake was microfilament- and microtubule-dependent. Moreover, the viability of phagocytosed bacteria dropped significantly between 24 and 48 h after co-incubation. Infection of J774 cells by A. baumannii resulted in the production of large amounts of proinflammatory cytokines and chemokines, and moderate amounts of nitric oxide (NO). Prior treatment of J774 cells with NO inhibitors significantly suppressed their bactericidal efficacy (P<0.05). Most importantly, in vivo depletion of alveolar macrophages significantly enhanced the susceptibility of mice to i.n. A. baumannii challenge (P<0.01). These results indicate that macrophages may play an important role in early host defense against A. baumannii infection through the efficient phagocytosis and killing of A. baumannii to limit initial pathogen replication and the secretion of proinflammatory cytokines and chemokines for the rapid recruitment of other innate immune cells such as neutrophils.

  7. Acinetobacter baumannii Coordinates Urea Metabolism with Metal Import To Resist Host-Mediated Metal Limitation

    PubMed Central

    Juttukonda, Lillian J.; Chazin, Walter J.


    ABSTRACT During infection, bacterial pathogens must adapt to a nutrient metal-limited environment that is imposed by the host. The innate immune protein calprotectin inhibits bacterial growth in vitro by chelating the divalent metal ions zinc (Zn2+, Zn) and manganese (Mn2+, Mn), but pathogenic bacteria are able to cause disease in the presence of this antimicrobial protein in vivo. One such pathogen is Acinetobacter baumannii, a Gram-negative bacterium that causes pneumonia and bloodstream infections that can be complicated by resistance to multiple antibiotics. A. baumannii inhibition by calprotectin is dependent on calprotectin Mn binding, but the mechanisms employed by A. baumannii to overcome Mn limitation have not been identified. This work demonstrates that A. baumannii coordinates transcription of an NRAMP family Mn transporter and a urea carboxylase to resist the antimicrobial activities of calprotectin. This NRAMP family transporter facilitates Mn accumulation and growth of A. baumannii in the presence of calprotectin. A. baumannii is found to utilize urea as a sole nitrogen source, and urea utilization requires the urea carboxylase encoded in an operon with the NRAMP family transporter. Moreover, urea carboxylase activity is essential for calprotectin resistance in A. baumannii. Finally, evidence is provided that this system combats calprotectin in vivo, as deletion of the transporter impairs A. baumannii fitness in a mouse model of pneumonia, and this fitness defect is modulated by the presence of calprotectin. These findings reveal that A. baumannii has evolved mechanisms to subvert host-mediated metal sequestration and they uncover a connection between metal starvation and metabolic stress. PMID:27677795

  8. Bacteremia due to Acinetobacter ursingii in infants: Reports of two cases.


    Yakut, Nurhayat; Kepenekli, Eda Kadayifci; Karaaslan, Ayse; Atici, Serkan; Akkoc, Gulsen; Demir, Sevliya Ocal; Soysal, Ahmet; Bakir, Mustafa


    Acinetobacter ursingii is an aerobic, gram-negative, opportunistic microorganism which is rarely isolated among Acinetobacter species. We present two immunocompetent infants who developed bacteremia due to A. ursingii. The first patient is a two -month- old boy who had been hospitalized in pediatric surgery unit for suspected tracheo-esophageal fistula because of recurrent aspiration pneumonia unresponsive to antibiotic therapy. The second patient is a fourteen -month- old boy with prolonged vomiting and diarrhea. A. ursingii was isolated from their blood cultures. They were successfully treated with ampicillin-sulbactam. Although A. ursingii has recently been isolated from a clinical specimen; reports of infection with A. ursingii in children are rare. A. ursingii should be kept in mind as an opportunistic microorganism in children.

  9. Characterisation and genome sequence of the lytic Acinetobacter baumannii bacteriophage vB_AbaS_Loki.


    Turner, Dann; Wand, Matthew E; Briers, Yves; Lavigne, Rob; Sutton, J Mark; Reynolds, Darren M


    Acinetobacter baumannii has emerged as an important nosocomial pathogen in healthcare and community settings. While over 100 of Acinetobacter phages have been described in the literature, relatively few have been sequenced. This work describes the characterisation and genome annotation of a new lytic Acinetobacter siphovirus, vB_AbaS_Loki, isolated from activated sewage sludge. Sequencing revealed that Loki encapsulates a 41,308 bp genome, encoding 51 predicted open reading frames. Loki is most closely related to Acinetobacter phage IME_AB3 and more distantly related to Burkholderia phage KL1, Paracoccus phage vB_PmaS_IMEP1 and Pseudomonas phages vB_Pae_Kakheti25, vB_PaeS_SCH_Ab26 and PA73. Loki is characterised by a narrow host range, among the 40 Acinetobacter isolates tested, productive infection was only observed for the propagating host, A. baumannii ATCC 17978. Plaque formation was found to be dependent upon the presence of Ca2+ ions and adsorption to host cells was abolished upon incubation with a mutant of ATCC 17978 encoding a premature stop codon in lpxA. The complete genome sequence of vB_AbaS_Loki was deposited in the European Nucleotide Archive (ENA) under the accession number LN890663.

  10. Characterisation and genome sequence of the lytic Acinetobacter baumannii bacteriophage vB_AbaS_Loki

    PubMed Central

    Wand, Matthew E.; Briers, Yves; Lavigne, Rob; Sutton, J. Mark; Reynolds, Darren M.


    Acinetobacter baumannii has emerged as an important nosocomial pathogen in healthcare and community settings. While over 100 of Acinetobacter phages have been described in the literature, relatively few have been sequenced. This work describes the characterisation and genome annotation of a new lytic Acinetobacter siphovirus, vB_AbaS_Loki, isolated from activated sewage sludge. Sequencing revealed that Loki encapsulates a 41,308 bp genome, encoding 51 predicted open reading frames. Loki is most closely related to Acinetobacter phage IME_AB3 and more distantly related to Burkholderia phage KL1, Paracoccus phage vB_PmaS_IMEP1 and Pseudomonas phages vB_Pae_Kakheti25, vB_PaeS_SCH_Ab26 and PA73. Loki is characterised by a narrow host range, among the 40 Acinetobacter isolates tested, productive infection was only observed for the propagating host, A. baumannii ATCC 17978. Plaque formation was found to be dependent upon the presence of Ca2+ ions and adsorption to host cells was abolished upon incubation with a mutant of ATCC 17978 encoding a premature stop codon in lpxA. The complete genome sequence of vB_AbaS_Loki was deposited in the European Nucleotide Archive (ENA) under the accession number LN890663. PMID:28207864

  11. Impact of Acinetobacter baumannii superoxide dismutase on motility, virulence, oxidative stress resistance and susceptibility to antibiotics.


    Heindorf, Magdalena; Kadari, Mahendar; Heider, Christine; Skiebe, Evelyn; Wilharm, Gottfried


    Acinetobacter baumannii is a Gram-negative bacterium appearing as an opportunistic pathogen in hospital settings. Superoxide dismutase (SOD) contributes to virulence in several pathogenic bacteria by detoxifying reactive oxygen species released in the course of host defense reactions. However, the biological role of SODs in A. baumannii has not yet been elucidated. Here, we inactivated in A. baumannii ATCC 17978 gene A1S_2343, encoding a putative SOD of the Fe-Mn type by transposon insertion, resulting in mutant ATCC 17978 sod2343::Km. The mutation was also introduced in two naturally competent A. baumannii isolates by transformation with chromosomal DNA derived from mutant ATCC 17978 sod2343::Km. We demonstrate that inactivation of sod2343 leads to significant motility defects in all three A. baumannii strains. The mutant strains were more susceptible to oxidative stress compared to their parental strains. Susceptibility to colistin and tetracycline was increased in all mutant strains while susceptibility of the mutants to gentamicin, levofloxacin and imipenem was strain-dependent. In the Galleria mellonella infection model the mutant strains were significantly attenuated. In conclusion, sod2343 plays an important role in motility, resistance to oxidative stress, susceptibility to antibiotics and virulence in A. baumannii.

  12. Impact of Acinetobacter baumannii Superoxide Dismutase on Motility, Virulence, Oxidative Stress Resistance and Susceptibility to Antibiotics

    PubMed Central

    Heider, Christine; Skiebe, Evelyn; Wilharm, Gottfried


    Acinetobacter baumannii is a Gram-negative bacterium appearing as an opportunistic pathogen in hospital settings. Superoxide dismutase (SOD) contributes to virulence in several pathogenic bacteria by detoxifying reactive oxygen species released in the course of host defense reactions. However, the biological role of SODs in A. baumannii has not yet been elucidated. Here, we inactivated in A. baumannii ATCC 17978 gene A1S_2343, encoding a putative SOD of the Fe-Mn type by transposon insertion, resulting in mutant ATCC 17978 sod2343::Km. The mutation was also introduced in two naturally competent A. baumannii isolates by transformation with chromosomal DNA derived from mutant ATCC 17978 sod2343::Km. We demonstrate that inactivation of sod2343 leads to significant motility defects in all three A. baumannii strains. The mutant strains were more susceptible to oxidative stress compared to their parental strains. Susceptibility to colistin and tetracycline was increased in all mutant strains while susceptibility of the mutants to gentamicin, levofloxacin and imipenem was strain-dependent. In the Galleria mellonella infection model the mutant strains were significantly attenuated. In conclusion, sod2343 plays an important role in motility, resistance to oxidative stress, susceptibility to antibiotics and virulence in A. baumannii. PMID:25000585

  13. The contribution of nutrient metal acquisition and metabolism to Acinetobacter baumannii survival within the host

    PubMed Central

    Mortensen, Brittany L.; Skaar, Eric P.


    Acinetobacter baumannii is a significant contributor to intensive care unit (ICU) mortality causing numerous types of infection in this susceptible ICU population, most notably ventilator-associated pneumonia. The substantial disease burden attributed to A. baumannii and the rapid acquisition of antibiotic resistance make this bacterium a serious health care threat. A. baumannii is equipped to tolerate the hostile host environment through modification of its metabolism and nutritional needs. Among these adaptations is the evolution of mechanisms to acquire nutrient metals that are sequestered by the host as a defense against infection. Although all bacteria require nutrient metals, there is diversity in the particular metal needs among species and within varying tissue types and bacterial lifecycles. A. baumannii is well-equipped with the metal homeostatic systems required for the colonization of a diverse array of tissues. Specifically, iron and zinc homeostasis is important for A. baumannii interactions with biotic surfaces and for growth within vertebrates. This review discusses what is currently known regarding the interaction of A. baumannii with vertebrate cells with a particular emphasis on the contributions of metal homeostasis systems. Overall, published research supports the utility of exploiting these systems as targets for the development of much-needed antimicrobials against this emerging infectious threat. PMID:24377089

  14. OmpW is a potential target for eliciting protective immunity against Acinetobacter baumannii infections.


    Huang, Weiwei; Wang, Shijie; Yao, Yufeng; Xia, Ye; Yang, Xu; Long, Qiong; Sun, Wenjia; Liu, Cunbao; Li, Yang; Ma, Yanbing


    Acinetobacter baumannii (A. baumannii) is an important conditioned pathogen that causes nosocomial and community-associated infections. In this study, we sought to investigate whether outer membrane protein W (OmpW) is a potential target for eliciting protective immunity against A. baumannii infections. Mice immunized with the fusion protein thioredoxin-OmpW generated strong OmpW-specific IgG responses. In a sepsis model, both active and passive immunizations against OmpW effectively protected mice from A. baumannii infections. This protection was demonstrated by a significantly improved survival rate, reduced bacterial burdens within organs, and the suppressed accumulation of inflammatory cytokines and chemokines in sera. Opsonophagocytic assays with murine macrophage RAW264.7 cells indicated that the bactericidal effects of the antisera derived from the immunized mice are mediated synergistically by specific antibodies and complement components. The antisera presented significant opsonophagocytic activities against homologous strains and clonally distinct clinical isolates in vitro. Protein data analysis showed that the sequence of OmpW, which has a molecule length of 183 amino acids, is more than 91% conserved in reported A. baumannii strains. In conclusion, we identified OmpW as a highly immunogenic and conserved protein as a valuable antigen candidate for the development of an effective vaccine or the preparation of antisera to control A. baumannii infections.

  15. Aptamer-nanobody based ELASA for specific detection of Acinetobacter baumannii isolates.


    Rasoulinejad, Samaneh; Gargari, Seyed Latif Mousavi


    Acinetobacter baumannii has turned into an important threat in nosocomial outbreak infections and multidrug resistance leading to high mortality rates in the 21st century. In recent years its mortality has increased by 15% which in part could be due to lack of a rapid and sensitive diagnostic test. In this work we introduced a new detection test for A. baumannii with two highly specific aptamer and nanobody molecules. High binding affinity DNA oligonucleotide aptamers toward A. baumannii were selected through 12 rounds of whole cell System Evolution of Ligands by EXponential enrichment process (SELEX). The SELEX procedures was monitored by flow cytometry. The dissociation constant and binding efficiency of the selected aptamer Aci49 was 7.547±1:353pM and 47.50%, respectively. A sandwich enzyme linked aptamer sorbent assay (ELASA) was designed with the biotinylated Aci49 aptamer and our previously developed nanobody against biofilm associated protein (Bap). The assay system was optimized with A. baumannii (ATCC 19606) and 47 clinical isolates of A. baumannii were tested. The threshold of detection in sandwich ELASA process was10(3) CFU/ml. The sensitivity of test toward the clinical isolates was 95.47%. Our results reveal that the sandwich ELASA is sensitive and specific enough for the rapid detection of A. baumannii from clinical isolates.

  16. Carbapenem resistance in Pseudomonas aeruginosa and Acinetobacter baumannii in the nosocomial setting in Latin America.


    Labarca, Jaime A; Salles, Mauro José Costa; Seas, Carlos; Guzmán-Blanco, Manuel


    Increasing prevalence of carbapenem-resistant Pseudomonas aeruginosa and Acinetobacter baumannii strains in the nosocomial setting in Latin America represents an emerging challenge to public health, as the range of therapeutic agents active against these pathogens becomes increasingly constrained. We review published reports from 2002 to 2013, compiling data from throughout the region on prevalence, mechanisms of resistance and molecular epidemiology of carbapenem-resistant strains of P. aeruginosa and A. baumannii. We find rates of carbapenem resistance up to 66% for P. aeruginosa and as high as 90% for A. baumannii isolates across the different countries of Latin America, with the resistance rate of A. baumannii isolates greater than 50% in many countries. An outbreak of the SPM-1 carbapenemase is a chief cause of resistance in P. aeruginosa strains in Brazil. Elsewhere in Latin America, members of the VIM family are the most important carbapenemases among P. aeruginosa strains. Carbapenem resistance in A. baumannii in Latin America is predominantly due to the oxacillinases OXA-23, OXA-58 and (in Brazil) OXA-143. Susceptibility of P. aeruginosa and A. baumannii to colistin remains high, however, development of resistance has already been detected in some countries. Better epidemiological data are needed to design effective infection control interventions.

  17. Unique Structural Modifications Are Present in the Lipopolysaccharide from Colistin-Resistant Strains of Acinetobacter baumannii

    PubMed Central

    Pelletier, Mark R.; Casella, Leila G.; Jones, Jace W.; Adams, Mark D.; Zurawski, Daniel V.; Hazlett, Karsten R. O.; Doi, Yohei


    Acinetobacter baumannii is a nosocomial opportunistic pathogen that can cause severe infections, including hospital-acquired pneumonia, wound infections, and sepsis. Multidrug-resistant (MDR) strains are prevalent, further complicating patient treatment. Due to the increase in MDR strains, the cationic antimicrobial peptide colistin has been used to treat A. baumannii infections. Colistin-resistant strains of A. baumannii with alterations to the lipid A component of lipopolysaccharide (LPS) have been reported; specifically, the lipid A structure was shown to be hepta-acylated with a phosphoethanolamine (pEtN) modification present on one of the terminal phosphate residues. Using a tandem mass spectrometry platform, we provide definitive evidence that the lipid A isolated from colistin-resistant A. baumannii MAC204 LPS contains a novel structure corresponding to a diphosphoryl hepta-acylated lipid A structure with both pEtN and galactosamine (GalN) modifications. To correlate our structural studies with clinically relevant samples, we characterized colistin-susceptible and -resistant isolates obtained from patients. These results demonstrated that the clinical colistin-resistant isolate had the same pEtN and GalN modifications as those seen in the laboratory-adapted A. baumannii strain MAC204. In summary, this work has shown complete structure characterization including the accurate assignment of acylation, phosphorylation, and glycosylation of lipid A from A. baumannii, which are important for resistance to colistin. PMID:23877686

  18. Acinetobacter baumannii Is Dependent on the Type II Secretion System and Its Substrate LipA for Lipid Utilization and In Vivo Fitness

    PubMed Central

    Johnson, Tanya L.; Waack, Ursula; Smith, Sara; Mobley, Harry


    ABSTRACT Gram-negative bacteria express a number of sophisticated secretion systems to transport virulence factors across the cell envelope, including the type II secretion (T2S) system. Genes for the T2S components GspC through GspN and PilD are conserved among isolates of Acinetobacter baumannii, an increasingly common nosocomial pathogen that is developing multidrug resistance at an alarming rate. In contrast to most species, however, the T2S genes are dispersed throughout the genome rather than linked into one or two operons. Despite this unique genetic organization, we show here that the A. baumannii T2S system is functional. Deletion of gspD or gspE in A. baumannii ATCC 17978 results in loss of secretion of LipA, a lipase that breaks down long-chain fatty acids. Due to a lack of extracellular lipase, the gspD mutant, the gspE mutant, and a lipA deletion strain are incapable of growth on long-chain fatty acids as a sole source of carbon, while their growth characteristics are indistinguishable from those of the wild-type strain in nutrient-rich broth. Genetic inactivation of the T2S system and its substrate, LipA, also has a negative impact on in vivo fitness in a neutropenic murine model for bacteremia. Both the gspD and lipA mutants are outcompeted by the wild-type strain as judged by their reduced numbers in spleen and liver following intravenous coinoculation. Collectively, our findings suggest that the T2S system plays a hitherto-unrecognized role in in vivo survival of A. baumannii by transporting a lipase that may contribute to fatty acid metabolism. IMPORTANCE Infections by multidrug-resistant Acinetobacter baumannii are a growing health concern worldwide, underscoring the need for a better understanding of the molecular mechanisms by which this pathogen causes disease. In this study, we demonstrated that A. baumannii expresses a functional type II secretion (T2S) system that is responsible for secretion of LipA, an extracellular lipase required for

  19. Novobiocin Inhibits the Antimicrobial Resistance Acquired through DNA Damage-Induced Mutagenesis in Acinetobacter baumannii

    PubMed Central

    Jara, Luis M.; Pérez-Varela, María; Corral, Jordi; Arch, Marta; Cortés, Pilar; Bou, Germán; Barbé, Jordi


    Acinetobacter baumannii, a worldwide emerging nosocomial pathogen, acquires antimicrobial resistances in response to DNA-damaging agents, which increase the expression of multiple error-prone DNA polymerase components. Here we show that the aminocoumarin novobiocin, which inhibits the DNA damage response in Gram-positive bacteria, also inhibits the expression of error-prone DNA polymerases in this Gram-negative multidrug-resistant pathogen and, consequently, its potential acquisition of antimicrobial resistance through DNA damage-induced mutagenesis. PMID:26503651

  20. Factors associated with recovery of Acinetobacter baumannii in a combat support hospital.


    Griffith, Matthew E; Gonzalez, Russell S; Holcomb, John B; Hospenthal, Duane R; Wortmann, Glenn W; Murray, Clinton K


    A retrospective review of hospital records for Acinetobacter baumannii infection at a US Army combat support hospital revealed a monthly infection rate ranging from 20.5 to 0 cases per 1,000 patients admitted. The rate correlated with the mean census of host-nation patients in the intensive care unit, the mean census of host-nation patients on the wards, and length of stay in the intensive care unit.

  1. Synergistic activity of coriander oil and conventional antibiotics against Acinetobacter baumannii.


    Duarte, A; Ferreira, S; Silva, F; Domingues, F C


    In this study we investigated the existence of synergistic antibacterial effect between coriander (Coriandrum sativum L.) essential oil and six different antibacterial drugs (cefoperazone, chloramphenicol, ciprofloxacin, gentamicin, tetracycline and piperacillin). The antibacterial activity of coriander oil was assessed using microdilution susceptibility testing and synergistic interaction by checkerboard assays. The association of coriander essential oil with chloramphenicol, ciprofloxacin, gentamicin and tetracycline against Acinetobacter baumannii showed in vitro effectiveness, which is an indicator of a possible synergistic interaction against two reference strains of A. baumannii (LMG 1025 and LMG 1041) (FIC index from 0.047 to 0.375). However, when tested the involvement between coriander essential oil and piperacillin or cefoperazone, the isobolograms and FIC index showed an additive interaction. The in vitro interaction could improve the antimicrobial effectiveness of ciprofloxacin, gentamicin and tetracycline and may contribute to resensitize A. baumannii to the action of chloramphenicol.

  2. A milk pump as a source for spreading Acinetobacter baumannii in a neonatal intensive care unit.


    Engür, Defne; Çakmak, Bilin Çetinkaya; Türkmen, Münevver Kaynak; Telli, Murat; Eyigör, Mete; Güzünler, Melike


    Acinetobacter baumannii is a Gram-negative coccobacillus that has emerged as a troublesome pathogen causing institutional outbreaks. Environmental contamination is a distinctive characteristic of this microorganism, which brings a further difficulty in infection control. During A. baumannii outbreaks in intensive care units, a common contaminated object can be found as a reservoir. Finding out this source by epidemiological investigations is of particular importance in order to develop effective interventions. We describe an outbreak of A. baumannii and the results of epidemiological investigations in a neonatal intensive care unit. The outbreak strain was isolated from the outer surface of a breastmilk pump. We have successfully controlled the outbreak by careful reviewing of our milk collection process.

  3. Molecular Mechanisms of Sulbactam Antibacterial Activity and Resistance Determinants in Acinetobacter baumannii

    PubMed Central

    Penwell, William F.; Shapiro, Adam B.; Giacobbe, Robert A.; Gu, Rong-Fang; Gao, Ning; Thresher, Jason; McLaughlin, Robert E.; Huband, Michael D.; DeJonge, Boudewijn L. M.; Ehmann, David E.


    Sulbactam is a class A β-lactamase inhibitor with intrinsic whole-cell activity against certain bacterial species, including Acinetobacter baumannii. The clinical use of sulbactam for A. baumannii infections is of interest due to increasing multidrug resistance in this pathogen. However, the molecular drivers of its antibacterial activity and resistance determinants have yet to be precisely defined. Here we show that the antibacterial activities of sulbactam vary widely across contemporary A. baumannii clinical isolates and are mediated through inhibition of the penicillin-binding proteins (PBPs) PBP1 and PBP3, with very low frequency of resistance; the rare pbp3 mutants with high levels of resistance to sulbactam are attenuated in fitness. These results support further investigation of the potential clinical utility of sulbactam. PMID:25561334

  4. Molecular mechanisms of sulbactam antibacterial activity and resistance determinants in Acinetobacter baumannii.


    Penwell, William F; Shapiro, Adam B; Giacobbe, Robert A; Gu, Rong-Fang; Gao, Ning; Thresher, Jason; McLaughlin, Robert E; Huband, Michael D; DeJonge, Boudewijn L M; Ehmann, David E; Miller, Alita A


    Sulbactam is a class A β-lactamase inhibitor with intrinsic whole-cell activity against certain bacterial species, including Acinetobacter baumannii. The clinical use of sulbactam for A. baumannii infections is of interest due to increasing multidrug resistance in this pathogen. However, the molecular drivers of its antibacterial activity and resistance determinants have yet to be precisely defined. Here we show that the antibacterial activities of sulbactam vary widely across contemporary A. baumannii clinical isolates and are mediated through inhibition of the penicillin-binding proteins (PBPs) PBP1 and PBP3, with very low frequency of resistance; the rare pbp3 mutants with high levels of resistance to sulbactam are attenuated in fitness. These results support further investigation of the potential clinical utility of sulbactam.

  5. Outbreak of Extensively Drug-Resistant Acinetobacter baumannii Indigo-Pigmented Strains

    PubMed Central

    Vilacoba, Elisabet; Almuzara, Marisa; Gulone, Lucia; Rodriguez, Rocio; Pallone, Elida; Bakai, Romina; Centrón, Daniela


    Acinetobacter baumannii pigmented strains are not common in clinical settings. Here, we report an outbreak caused by indigo-pigmented A. baumannii strains isolated in an acute care hospital in Argentina from March to September 2012. Pan-PCR assays exposed a unique pattern belonging to the recently described regional CC113B/CC79P clonal complex that confirms the relevant relationships among the indigo-pigmented A. baumannii strains. All of them were extensively drug resistant and harbored different genetic elements associated with horizontal genetic transfer, such as the transposon Tn2006, class 2 integrons, AbaR-type islands, IS125, IS26, strA, strB, florR, and the small recombinase ISCR2 associated with the sul2 gene preceded by ISAba1. PMID:23985923

  6. VEB-1 Extended-Spectrum β-lactamase–producing Acinetobacter baumannii, France1

    PubMed Central

    Coignard, Bruno; Carbonne, Anne; Blanckaert, Karine; Bajolet, Odile; Bernet, Claude; Verdeil, Xavier; Astagneau, Pascal; Desenclos, Jean-Claude; Nordmann, Patrice


    VEB-1 extended-spectrum β-lactamase–producing Acinetobacter baumannii was responsible for an outbreak in hospitals in France. A national alert was triggered in September 2003 when 4 hospitals reported clusters of A. baumannii infection with similar susceptibility profiles. Case definitions and laboratory guidelines were disseminated, and prospective surveillance was implemented; strains were sent to a single laboratory for characterization and typing. From April 2003 through June 2004, 53 hospitals reported 290 cases of A. baumannii infection or colonization; 275 isolates were blaVEB-1-positive and clonally related. Cases were first reported in 5 districts of northern France, then in 10 other districts in 4 regions. Within a region, interhospital spread was associated with patient transfer. In northern France, investigation and control measures led to a reduction of reported cases after January 2004. The national alert enabled early control of new clusters, demonstrating the usefulness of early warning about antimicrobial drug resistance. PMID:16965700

  7. Genes Involved in the Biosynthesis and Transport of Acinetobactin in Acinetobacter baumannii

    PubMed Central

    Hasan, Tarik; Choi, Chul Hee


    Pathogenic bacteria survive in iron-limited host environments by using several iron acquisition mechanisms. Acinetobacter baumannii, causing serious infections in compromised patients, produces an iron-chelating molecule, called acinetobactin, which is composed of equimolar quantities of 2,3-dihydroxybenzoic acid (DHBA), L-threonine, and N-hydroxyhistamine, to compete with host cells for iron. Genes that are involved in the production and transport of acinetobactin are clustered within the genome of A. baumannii. A recent study showed that entA, located outside of the acinetobactin gene cluster, plays important roles in the biosynthesis of the acinetobactin precursor DHBA and in bacterial pathogenesis. Therefore, understanding the genes that are associated with the biosynthesis and transport of acinetobactin in the bacterial genome is required. This review is intended to provide a general overview of the genes in the genome of A. baumannii that are required for acinetobactin biosynthesis and transport. PMID:25873846

  8. Development of a real-time PCR assay for the rapid detection of Acinetobacter baumannii from whole blood samples.


    De Gregorio, Eliana; Roscetto, Emanuela; Iula, Vita Dora; Martinucci, Marianna; Zarrilli, Raffaele; Di Nocera, Pier Paolo; Catania, Maria Rosaria


    Acinetobacter baumannii is a multidrug-resistant pathogen associated with severe infections in hospitalized patients, including pneumonia, urinary and bloodstream infections. Rapid detection of A. baumannii infection is crucial for timely treatment of septicemic patients. The aim of the present study was to develop a specific marker for a quantitative polymerase chain reaction (PCR) assay for the detection of A. baumannii. The target gene chosen is the biofilm-associated protein (bap) gene, encoding a cell surface protein involved in biofilm formation. The assay is specific for A. baumannii, allowing its discrimination from different species of Acinetobacter and other clinically relevant bacterial pathogens. The assay is able to detect one genomic copy of A. baumannii, corresponding to 4 fg of purified DNA, and 20 colony-forming units/ml using DNA extracted from spiked whole blood samples.

  9. The crystal structure of the D-alanine-D-alanine ligase from Acinetobacter baumannii suggests a flexible conformational change in the central domain before nucleotide binding.


    Huynh, Kim-Hung; Hong, Myoung-ki; Lee, Clarice; Tran, Huyen-Thi; Lee, Sang Hee; Ahn, Yeh-Jin; Cha, Sun-Shin; Kang, Lin-Woo


    Acinetobacter baumannii, which is emerging as a multidrug-resistant nosocomial pathogen, causes a number of diseases, including pneumonia, bacteremia, meningitis, and skin infections. With ATP hydrolysis, the D-alanine-D-alanine ligase (DDL) catalyzes the synthesis of D-alanyl-D-alanine, which is an essential component of bacterial peptidoglycan. In this study, we determined the crystal structure of DDL from A. baumannii (AbDDL) at a resolution of 2.2 Å. The asymmetric unit contained six protomers of AbDDL. Five protomers had a closed conformation in the central domain, while one protomer had an open conformation in the central domain. The central domain with an open conformation did not interact with crystallographic symmetry-related protomers and the conformational change of the central domain was not due to crystal packing. The central domain of AbDDL can have an ensemble of the open and closed conformations before the binding of substrate ATP. The conformational change of the central domain is important for the catalytic activity and the detail information will be useful for the development of inhibitors against AbDDL and putative antibacterial agents against A. baumannii. The AbDDL structure was compared with that of other DDLs that were in complex with potent inhibitors and the catalytic activity of AbDDL was confirmed using enzyme kinetics assays.

  10. CipA of Acinetobacter baumannii Is a Novel Plasminogen Binding and Complement Inhibitory Protein.


    Koenigs, Arno; Stahl, Julia; Averhoff, Beate; Göttig, Stephan; Wichelhaus, Thomas A; Wallich, Reinhard; Zipfel, Peter F; Kraiczy, Peter


    Acinetobacter baumannii is an emerging opportunistic pathogen, responsible for up to 10% of gram-negative, nosocomial infections. The global increase of multidrug-resistant and pan-resistant Acinetobacter isolates presents clinicians with formidable challenges. To establish a persistent infection,A. baumannii must overcome the detrimental effects of complement as the first line of defense against invading microorganisms. However, the immune evasion principles underlying serum resistance inA. baumannii remain elusive. Here, we identified a novel plasminogen-binding protein, termed CipA. Bound plasminogen, upon conversion to active plasmin, degraded fibrinogen and complement C3b and contributed to serum resistance. Furthermore, CipA directly inhibited the alternative pathway of complement in vitro, irrespective of its ability to bind plasminogen. A CipA-deficient mutant was efficiently killed by human serum and showed a defect in the penetration of endothelial monolayers, demonstrating that CipA is a novel multifunctional protein that contributes to the pathogenesis ofA. baumannii.

  11. Antibiotic-Resistant Acinetobacter baumannii Increasing Success Remains a Challenge as a Nosocomial Pathogen.


    Gonzalez-Villoria, Ana Maria; Valverde-Garduno, Veronica


    Antibiotic-resistant infectious bacteria currently imply a high risk and therefore constitute a strong challenge when treating patients in hospital settings. Characterization of these species and of particular strains is a priority for the establishment of diagnostic tests and preventive procedures. The relevance of Acinetobacter baumannii as a problematic microorganism in inpatient facilities, particularly intensive care units, has increased over time. This review aims to draw attention to (i) the historical emergence of carbapenem-resistant Acinetobacter baumannii, (ii) the current status of surveillance needs in Latin America, and (iii) recent data suggesting that A. baumannii continues to spread and evolve in hospital settings. First, we present synopsis of the series of events leading to the discovery and precise identification of this microorganism in hospital settings. Then key events in the acquisition of antibiotic-resistant genes by this microorganism are summarized, highlighting the race between new antibiotic generation and emergence of A. baumannii resistant strains. Here we review the historical development of this species as an infectious threat, the current state of its distribution, and antibiotic resistance characteristics, and we discuss future prospects for its control.

  12. Antibiotic-Resistant Acinetobacter baumannii Increasing Success Remains a Challenge as a Nosocomial Pathogen

    PubMed Central

    Gonzalez-Villoria, Ana Maria; Valverde-Garduno, Veronica


    Antibiotic-resistant infectious bacteria currently imply a high risk and therefore constitute a strong challenge when treating patients in hospital settings. Characterization of these species and of particular strains is a priority for the establishment of diagnostic tests and preventive procedures. The relevance of Acinetobacter baumannii as a problematic microorganism in inpatient facilities, particularly intensive care units, has increased over time. This review aims to draw attention to (i) the historical emergence of carbapenem-resistant Acinetobacter baumannii, (ii) the current status of surveillance needs in Latin America, and (iii) recent data suggesting that A. baumannii continues to spread and evolve in hospital settings. First, we present synopsis of the series of events leading to the discovery and precise identification of this microorganism in hospital settings. Then key events in the acquisition of antibiotic-resistant genes by this microorganism are summarized, highlighting the race between new antibiotic generation and emergence of A. baumannii resistant strains. Here we review the historical development of this species as an infectious threat, the current state of its distribution, and antibiotic resistance characteristics, and we discuss future prospects for its control. PMID:26966582

  13. In Vitro and In Vivo Antimicrobial Activities of Gallium Nitrate against Multidrug-Resistant Acinetobacter baumannii

    PubMed Central

    Antunes, Luísa C. S.; Imperi, Francesco; Minandri, Fabrizia


    Multidrug-resistant Acinetobacter baumannii poses a tremendous challenge to traditional antibiotic therapy. Due to the crucial role of iron in bacterial physiology and pathogenicity, we investigated iron metabolism as a possible target for anti-A. baumannii chemotherapy using gallium as an iron mimetic. Due to chemical similarity, gallium competes with iron for binding to several redox enzymes, thereby interfering with a number of essential biological reactions. We found that Ga(NO3)3, the active component of an FDA-approved drug (Ganite), inhibits the growth of a collection of 58 A. baumannii strains in both chemically defined medium and human serum, at concentrations ranging from 2 to 80 μM and from 4 to 64 μM, respectively. Ga(NO3)3 delayed the entry of A. baumannii into the exponential phase and drastically reduced bacterial growth rates. Ga(NO3)3 activity was strongly dependent on iron availability in the culture medium, though the mechanism of growth inhibition was independent of dysregulation of gene expression controlled by the ferric uptake regulator Fur. Ga(NO3)3 also protected Galleria mellonella larvae from lethal A. baumannii infection, with survival rates of ≥75%. At therapeutic concentrations for humans (28 μM plasma levels), Ga(NO3)3 inhibited the growth in human serum of 76% of the multidrug-resistant A. baumannii isolates tested by ≥90%, raising expectations on the therapeutic potential of gallium for the treatment of A. baumannii bloodstream infections. Ga(NO3)3 also showed strong synergism with colistin, suggesting that a colistin-gallium combination holds promise as a last-resort therapy for infections caused by pan-resistant A. baumannii. PMID:22964249

  14. In vitro and in vivo antimicrobial activities of gallium nitrate against multidrug-resistant Acinetobacter baumannii.


    Antunes, Luísa C S; Imperi, Francesco; Minandri, Fabrizia; Visca, Paolo


    Multidrug-resistant Acinetobacter baumannii poses a tremendous challenge to traditional antibiotic therapy. Due to the crucial role of iron in bacterial physiology and pathogenicity, we investigated iron metabolism as a possible target for anti-A. baumannii chemotherapy using gallium as an iron mimetic. Due to chemical similarity, gallium competes with iron for binding to several redox enzymes, thereby interfering with a number of essential biological reactions. We found that Ga(NO(3))(3), the active component of an FDA-approved drug (Ganite), inhibits the growth of a collection of 58 A. baumannii strains in both chemically defined medium and human serum, at concentrations ranging from 2 to 80 μM and from 4 to 64 μM, respectively. Ga(NO(3))(3) delayed the entry of A. baumannii into the exponential phase and drastically reduced bacterial growth rates. Ga(NO(3))(3) activity was strongly dependent on iron availability in the culture medium, though the mechanism of growth inhibition was independent of dysregulation of gene expression controlled by the ferric uptake regulator Fur. Ga(NO(3))(3) also protected Galleria mellonella larvae from lethal A. baumannii infection, with survival rates of ≥75%. At therapeutic concentrations for humans (28 μM plasma levels), Ga(NO(3))(3) inhibited the growth in human serum of 76% of the multidrug-resistant A. baumannii isolates tested by ≥90%, raising expectations on the therapeutic potential of gallium for the treatment of A. baumannii bloodstream infections. Ga(NO(3))(3) also showed strong synergism with colistin, suggesting that a colistin-gallium combination holds promise as a last-resort therapy for infections caused by pan-resistant A. baumannii.

  15. Phase-Variable Control of Multiple Phenotypes in Acinetobacter baumannii Strain AB5075

    PubMed Central

    Tipton, Kyle A.; Dimitrova, Daniela


    ABSTRACT Acinetobacter baumannii strain AB5075 produces colonies with two opacity phenotypes, designated opaque and translucent. These phenotypes were unstable and opaque and translucent colony variants were observed to interconvert at high frequency, suggesting that a phase-variable mechanism was responsible. The frequency of phase variation both within colonies and in broth cultures increased in a cell density-dependent manner and was mediated by the accumulation of an extracellular factor. This factor was distinct from the known A. baumannii signaling molecule 3-OH C12-homoserine lactone. Opaque and translucent colony variants exhibited a number of phenotypic differences, including cell morphology, surface motility, biofilm formation, antibiotic resistance, and virulence in a Galleria mellonella model. Additional clinical isolates exhibited a similar phase-variable control of colony opacity, suggesting that this may be a common feature of A. baumannii. IMPORTANCE A novel phase-variable mechanism has been identified in Acinetobacter baumannii that results in an interconversion between opaque and translucent colony phenotypes. This phase variation also coordinately regulates motility, cell shape, biofilm formation, antibiotic resistance, and virulence. The frequency of phase variation is increased at high cell density via a diffusible extracellular signal. To our knowledge, this report presents the first example of phase variation in A. baumannii and also the first example of quorum sensing-mediated control of phase variation in a bacterium. The findings are important, as this phase-variable mechanism can be identified only via changes in colony opacity using oblique light; therefore, many researchers studying A. baumannii may unknowingly be working with different colony variants. PMID:26013481

  16. Structural and bioinformatic characterization of an Acinetobacter baumannii type II carrier protein

    SciTech Connect

    Allen, C. Leigh; Gulick, Andrew M.


    The high-resolution crystal structure of a free-standing carrier protein from Acinetobacter baumannii that belongs to a larger NRPS-containing operon, encoded by the ABBFA-003406–ABBFA-003399 genes of A. baumannii strain AB307-0294, that has been implicated in A. baumannii motility, quorum sensing and biofilm formation, is presented. Microorganisms produce a variety of natural products via secondary metabolic biosynthetic pathways. Two of these types of synthetic systems, the nonribosomal peptide synthetases (NRPSs) and polyketide synthases (PKSs), use large modular enzymes containing multiple catalytic domains in a single protein. These multidomain enzymes use an integrated carrier protein domain to transport the growing, covalently bound natural product to the neighboring catalytic domains for each step in the synthesis. Interestingly, some PKS and NRPS clusters contain free-standing domains that interact intermolecularly with other proteins. Being expressed outside the architecture of a multi-domain protein, these so-called type II proteins present challenges to understand the precise role they play. Additional structures of individual and multi-domain components of the NRPS enzymes will therefore provide a better understanding of the features that govern the domain interactions in these interesting enzyme systems. The high-resolution crystal structure of a free-standing carrier protein from Acinetobacter baumannii that belongs to a larger NRPS-containing operon, encoded by the ABBFA-003406–ABBFA-003399 genes of A. baumannii strain AB307-0294, that has been implicated in A. baumannii motility, quorum sensing and biofilm formation, is presented here. Comparison with the closest structural homologs of other carrier proteins identifies the requirements for a conserved glycine residue and additional important sequence and structural requirements within the regions that interact with partner proteins.

  17. Novel Engineered Peptides of a Phage Lysin as Effective Antimicrobials against Multidrug-Resistant Acinetobacter baumannii

    PubMed Central

    Thandar, Mya; Lood, Rolf; Winer, Benjamin Y.; Deutsch, Douglas R.; Euler, Chad W.


    Acinetobacter baumannii is a Gram-negative bacterial pathogen responsible for a range of nosocomial infections. The recent rise and spread of multidrug-resistant A. baumannii clones has fueled a search for alternative therapies, including bacteriophage endolysins with potent antibacterial activities. A common feature of these lysins is the presence of a highly positively charged C-terminal domain with a likely role in promoting outer membrane penetration. In the present study, we show that the C-terminal amino acids 108 to 138 of phage lysin PlyF307, named P307, alone were sufficient to kill A. baumannii (>3 logs). Furthermore, P307 could be engineered for improved activity, the most active derivative being P307SQ-8C (>5-log kill). Both P307 and P307SQ-8C showed high in vitro activity against A. baumannii in biofilms. Moreover, P307SQ-8C exhibited MICs comparable to those of levofloxacin and ceftazidime and acted synergistically with polymyxin B. Although the peptides were shown to kill by disrupting the bacterial cytoplasmic membrane, they did not lyse human red blood cells or B cells; however, serum was found to be inhibitory to lytic activity. In a murine model of A. baumannii skin infection, P307SQ-8C reduced the bacterial burden by ∼2 logs in 2 h. This study demonstrates the prospect of using peptide derivatives from bacteriophage lysins to treat topical infections and remove biofilms caused by Gram-negative pathogens. PMID:26856847

  18. Characterization of the Acinetobacter baumannii growth phase-dependent and serum responsive transcriptomes.


    Jacobs, Anna C; Sayood, Khalid; Olmsted, Stephen B; Blanchard, Catlyn E; Hinrichs, Steven; Russell, David; Dunman, Paul M


    Acinetobacter baumannii has emerged as a bacterial pathogen of considerable healthcare concern. Yet, little is known about the organism's basic biological processes and the regulatory networks that modulate expression of its virulence factors and antibiotic resistance. Using Affymetrix GeneChips , we comprehensively defined and compared the transcriptomes of two A. baumannii strains, ATCC 17978 and 98-37-09, during exponential and stationary phase growth in Luria-Bertani (LB) medium. Results revealed that in addition to expected growth phase-associated metabolic changes, several putative virulence factors were dramatically regulated in a growth phase-dependent manner. Because a common feature between the two most severe types of A. baumannii infection, pneumonia and septicemia, includes the organism's dissemination to visceral organs via the circulatory system, microarray studies were expanded to define the expression properties of A. baumannii during growth in human serum. Growth in serum significantly upregulated iron acquisition systems, genes associated with epithelial cell adherence and DNA uptake, as well as numerous putative drug efflux pumps. Antibiotic susceptibility testing verified that the organism exhibits increased antibiotic tolerance when cultured in human serum, as compared to LB medium. Collectively, these studies provide researchers with a comprehensive database of A. baumannii's expression properties in LB medium and serum and identify biological processes that may contribute to the organism's virulence and antibiotic resistance.

  19. A multidrug resistance plasmid contains the molecular switch for type VI secretion in Acinetobacter baumannii

    PubMed Central

    Weber, Brent S.; Ly, Pek Man; Irwin, Joshua N.; Pukatzki, Stefan; Feldman, Mario F.


    Infections with Acinetobacter baumannii, one of the most troublesome and least studied multidrug-resistant superbugs, are increasing at alarming rates. A. baumannii encodes a type VI secretion system (T6SS), an antibacterial apparatus of Gram-negative bacteria used to kill competitors. Expression of the T6SS varies among different strains of A. baumannii, for which the regulatory mechanisms are unknown. Here, we show that several multidrug-resistant strains of A. baumannii harbor a large, self-transmissible resistance plasmid that carries the negative regulators for T6SS. T6SS activity is silenced in plasmid-containing, antibiotic-resistant cells, while part of the population undergoes frequent plasmid loss and activation of the T6SS. This activation results in T6SS-mediated killing of competing bacteria but renders A. baumannii susceptible to antibiotics. Our data show that a plasmid that has evolved to harbor antibiotic resistance genes plays a role in the differentiation of cells specialized in the elimination of competing bacteria. PMID:26170289

  20. Rapid Killing of Acinetobacter baumannii by Polymyxins Is Mediated by a Hydroxyl Radical Death Pathway

    PubMed Central

    Sampson, Timothy R.; Liu, Xiang; Schroeder, Max R.; Kraft, Colleen S.; Burd, Eileen M.


    Acinetobacter baumannii is an opportunistic pathogen that is a cause of clinically significant nosocomial infections. Increasingly, clinical isolates of A. baumannii are extensively resistant to numerous antibiotics, and the use of polymyxin antibiotics against these infections is often the final treatment option. Historically, the polymyxins have been thought to kill bacteria through membrane lysis. Here, we present an alternative mechanism based on data demonstrating that polymyxins induce rapid cell death through hydroxyl radical production. Supporting this notion, we found that inhibition of radical production delays the ability of polymyxins to kill A. baumannii. Notably, we demonstrate that this mechanism of killing occurs in multidrug-resistant clinical isolates of A. baumannii and that this response is not induced in a polymyxin-resistant isolate. This study is the first to demonstrate that polymyxins induce rapid killing of A. baumannii and other Gram-negatives through hydroxyl radical production. This significantly augments our understanding of the mechanism of polymyxin action, which is critical knowledge toward the development of adjunctive therapies, particularly given the increasing necessity for treatment with these antibiotics in the clinical setting. PMID:22908157

  1. In Vitro Activity of Tigecycline Against Acinetobacter baumannii: Global Epidemiology and Resistance Mechanisms.


    Pournaras, Spyros; Koumaki, Vasiliki; Gennimata, Vasiliki; Kouskouni, Evangelia; Tsakris, Athanassios


    Acinetobacter baumannii is a pathogen of increasing concern, commonly causing outbreaks in the hospital environment. Of particular concern, A. baumannii strains exhibiting resistance to carbapenems, which were previously considered the treatment of choice for infected patients, have dramatically increased worldwide, leaving a few antibacterial choices. Tigecycline, a broad-spectrum modified minocycline derivative, isconsidered as a last resort drug against multidrug-resistant A. baumannii. Though, resistance to tigecycline has emerged and is growing notably following increasing tigecycline usage. Comparative evaluation of the tigecycline resistance rates reported worldwide is challenging due to the absence of official interpretative criteria for in vitro susceptibility testing and the discrepancies among the different susceptibility methodologies used, with broth microdilution being considered the reference method. Tigecycline resistance is mainly associated with resistance-nodulation-cell division (RND)-type transporters, mainly the AdeABC, AdeFGH and AdeIJK efflux pumps, but other resistance mechanisms have also been implicated. Tigecycline is still an attractive choice for A. baumannii, but further investigations are warranted so that treatment of MDR Α. baumannii could be guided by validated in vitro data.

  2. Contribution of EmrAB efflux pumps to colistin resistance in Acinetobacter baumannii.


    Lin, Ming-Feng; Lin, Yun-You; Lan, Chung-Yu


    Efflux pumps play an important role in antimicrobial resistance for Acinetobacter baumannii. However, the function of the Emr pump system and the relationship between Emr and drug resistance has not been characterized in A. baumannii. In this study, four possible groups of emr-like genes were found by searching a genome database. Among them, A1S_1772 (emrB) and A1S_1773 (emrA) were demonstrated to be co-transcribed as a single operon. Moreover, during osmotic stress, A1S_1772 showed the largest change in gene expression compared to the other emrB-like genes, and deletion of A1S_1772 (AB ΔemrB) significantly slowed cell growth in 20% sucrose. Using a phenotypic microarray analysis, the AB ΔemrB mutant was more susceptible to colistin and nafcillin, paromomycin, spiramycin, and D,L-serine hydroxmate than the wild type. The spot assay, time kill assay and minimal inhibition concentration determination also indicated that the wild type could tolerate colistin better than the AB ΔemrB mutant. Finally, the increased expression levels of all emrB-like genes, including A1S_0775, A1S_0909, A1S_1772, and A1S_1799, in colistin resistance-induced A. baumannii further supported the possible involvement of the emrB genes in A. baumannii colistin resistance. Together, the Emr pump systems in A. baumannii contribute to adaptation to osmotic stress and resistance to colistin.

  3. Colistin Resistance in Acinetobacter baumannii MDR-ZJ06 Revealed by a Multiomics Approach.


    Hua, Xiaoting; Liu, Lilin; Fang, Youhong; Shi, Qiucheng; Li, Xi; Chen, Qiong; Shi, Keren; Jiang, Yan; Zhou, Hua; Yu, Yunsong


    Acinetobacter baumannii has emerged as an important opportunistic pathogen due to its ability to acquire resistance to most currently available antibiotics. Colistin is often considered as the last line of therapy for infections caused by multidrug-resistant A. baumannii (MDRAB). However, colistin-resistant A. baumannii strain has recently been reported. To explore how multiple drug-resistant A. baumannii responded to colistin resistance, we compared the genomic, transcriptional and proteomic profile of A. baumannii MDR-ZJ06 to the induced colistin-resistant strain ZJ06-200P5-1. Genomic analysis showed that lpxC was inactivated by ISAba1 insertion, leading to LPS loss. Transcriptional analysis demonstrated that the colistin-resistant strain regulated its metabolism. Proteomic analysis suggested increased expression of the RND efflux pump system and down-regulation of FabZ and β-lactamase. These alterations were believed to be response to LPS loss. In summary, the lpxC mutation not only established colistin resistance but also altered global gene expression.

  4. Rapid killing of Acinetobacter baumannii by polymyxins is mediated by a hydroxyl radical death pathway.


    Sampson, Timothy R; Liu, Xiang; Schroeder, Max R; Kraft, Colleen S; Burd, Eileen M; Weiss, David S


    Acinetobacter baumannii is an opportunistic pathogen that is a cause of clinically significant nosocomial infections. Increasingly, clinical isolates of A. baumannii are extensively resistant to numerous antibiotics, and the use of polymyxin antibiotics against these infections is often the final treatment option. Historically, the polymyxins have been thought to kill bacteria through membrane lysis. Here, we present an alternative mechanism based on data demonstrating that polymyxins induce rapid cell death through hydroxyl radical production. Supporting this notion, we found that inhibition of radical production delays the ability of polymyxins to kill A. baumannii. Notably, we demonstrate that this mechanism of killing occurs in multidrug-resistant clinical isolates of A. baumannii and that this response is not induced in a polymyxin-resistant isolate. This study is the first to demonstrate that polymyxins induce rapid killing of A. baumannii and other Gram-negatives through hydroxyl radical production. This significantly augments our understanding of the mechanism of polymyxin action, which is critical knowledge toward the development of adjunctive therapies, particularly given the increasing necessity for treatment with these antibiotics in the clinical setting.

  5. Acinetobacter baumannii outer membrane protein A modulates the biogenesis of outer membrane vesicles.


    Moon, Dong Chan; Choi, Chul Hee; Lee, Jung Hwa; Choi, Chi-Won; Kim, Hye-Yeon; Park, Jeong Soon; Kim, Seung Il; Lee, Je Chul


    Acinetobacter baumannii secretes outer membrane vesicles (OMVs) during both in vitro and in vivo growth, but the biogenesis mechanism by which A. baumannii produces OMVs remains undefined. Outer membrane protein A of A. baumannii (AbOmpA) is a major protein in the outer membrane and the C-terminus of AbOmpA interacts with diaminopimelate of peptidoglycan. This study investigated the role of AbOmpA in the biogenesis of A. baumannii OMVs. Quantitative and qualitative approaches were used to analyze OMV biogenesis in A. baumannii ATCC 19606T and an isogenic ΔAbOmpA mutant. OMV production was significantly increased in the ΔAbOmpA mutant compared to wild-type bacteria as demonstrated by quantitation of proteins and lipopolysaccharides (LPS) packaged in OMVs. LPS profiles prepared from OMVs from wild-type bacteria and the ΔAbOmpA mutant had identical patterns, but proteomic analysis showed different protein constituents in OMVs from wild-type bacteria compared to the ΔAbOmpA mutant. In conclusion, AbOmpA influences OMV biogenesis by controlling OMV production and protein composition.

  6. Modeling the impact of interventions against Acinetobacter baumannii transmission in intensive care units.


    Doan, Tan N; Kong, David C M; Marshall, Caroline; Kirkpatrick, Carl M J; McBryde, Emma S


    The efficacy of infection control interventions against Acinetobacter baumannii remains unclear, despite such information being critical for effective prevention of the transmission of this pathogen. Mathematical modeling offers an alternative to clinical trials, which may be prohibitively expensive, unfeasible or unethical, in predicting the impact of interventions. Furthermore, it allows the ability to ask key "what if" questions to evaluate which interventions have the most impact. We constructed a transmission dynamic model to quantify the effects of interventions on reducing A. baumannii prevalence and the basic reproduction ratio (R0) in intensive care units (ICUs). We distinguished between colonization and infection, and incorporated antibiotic exposure and transmission from free-living bacteria in the environment. Under the assumptions and parameterization in our model, 25% and 18% of patients are colonized and infected with A. baumannii, respectively; and R0 is 1.4. Improved compliance with hand hygiene (≥87%), enhanced environmental cleaning, reduced length of ICU stay of colonized patients (≤ 10 days), shorter durations of antibiotic treatment of A. baumannii (≤6 days), and isolation of infected patients combined with cleaning of isolation rooms are effective, reducing R0 to below unity. In contrast, expediting the recovery of the intestinal microbiota (e.g. use of probiotics) is not effective. This study represents a biologically realistic model of the transmission dynamics of A. baumannii, and the most comprehensive analysis of the effectiveness of interventions against this pathogen. Our study provides important data for designing effective infection control interventions.

  7. Colistin Resistance in Acinetobacter baumannii MDR-ZJ06 Revealed by a Multiomics Approach

    PubMed Central

    Hua, Xiaoting; Liu, Lilin; Fang, Youhong; Shi, Qiucheng; Li, Xi; Chen, Qiong; Shi, Keren; Jiang, Yan; Zhou, Hua; Yu, Yunsong


    Acinetobacter baumannii has emerged as an important opportunistic pathogen due to its ability to acquire resistance to most currently available antibiotics. Colistin is often considered as the last line of therapy for infections caused by multidrug-resistant A. baumannii (MDRAB). However, colistin-resistant A. baumannii strain has recently been reported. To explore how multiple drug-resistant A. baumannii responded to colistin resistance, we compared the genomic, transcriptional and proteomic profile of A. baumannii MDR-ZJ06 to the induced colistin-resistant strain ZJ06-200P5-1. Genomic analysis showed that lpxC was inactivated by ISAba1 insertion, leading to LPS loss. Transcriptional analysis demonstrated that the colistin-resistant strain regulated its metabolism. Proteomic analysis suggested increased expression of the RND efflux pump system and down-regulation of FabZ and β-lactamase. These alterations were believed to be response to LPS loss. In summary, the lpxC mutation not only established colistin resistance but also altered global gene expression. PMID:28275586

  8. The induction and identification of novel Colistin resistance mutations in Acinetobacter baumannii and their implications

    PubMed Central

    Thi Khanh Nhu, Nguyen; Riordan, David W.; Do Hoang Nhu, Tran; Thanh, Duy Pham; Thwaites, Guy; Huong Lan, Nguyen Phu; Wren, Brendan W.; Baker, Stephen; Stabler, Richard A


    Acinetobacter baumannii is a significant cause of opportunistic hospital acquired infection and has been identified as an important emerging infection due to its high levels of antimicrobial resistance. Multidrug resistant A. baumannii has risen rapidly in Vietnam, where colistin is becoming the drug of last resort for many infections. In this study we generated spontaneous colistin resistant progeny (up to >256 μg/μl) from four colistin susceptible Vietnamese isolates and one susceptible reference strain (MIC <1.5 μg/μl). Whole genome sequencing was used to identify single nucleotide mutations that could be attributed to the reduced colistin susceptibility. We identified six lpxACD and three pmrB mutations, the majority of which were novel. In addition, we identified further mutations in six A. baumannii genes (vacJ, pldA, ttg2C, pheS and conserved hypothetical protein) that we hypothesise have a role in reduced colistin susceptibility. This study has identified additional mutations that may be associated with colistin resistance through novel resistance mechanisms. Our work further demonstrates how rapidly A. baumannii can generate resistance to a last resort antimicrobial and highlights the need for improved surveillance to identified A. baumannii with an extensive drug resistance profile. PMID:27329501

  9. Antibiotic Resistance Determinant-Focused Acinetobacter baumannii Vaccine Designed Using Reverse Vaccinology.


    Ni, Zhaohui; Chen, Yan; Ong, Edison; He, Yongqun


    As one of the most influential and troublesome human pathogens, Acinetobacter baumannii (A. baumannii) has emerged with many multidrug-resistant strains. After collecting 33 complete A. baumannii genomes and 84 representative antibiotic resistance determinants, we used the Vaxign reverse vaccinology approach to predict classical type vaccine candidates against A. baumannii infections and new type vaccine candidates against antibiotic resistance. Our genome analysis identified 35 outer membrane or extracellular adhesins that are conserved among all 33 genomes, have no human protein homology, and have less than 2 transmembrane helices. These 35 antigens include 11 TonB dependent receptors, 8 porins, 7 efflux pump proteins, and 2 fimbrial proteins (FilF and CAM87009.1). CAM86003.1 was predicted to be an adhesin outer membrane protein absent from 3 antibiotic-sensitive strains and conserved in 21 antibiotic-resistant strains. Feasible anti-resistance vaccine candidates also include one extracellular protein (QnrA), 3 RND type outer membrane efflux pump proteins, and 3 CTX-M type β-lactamases. Among 39 β-lactamases, A. baumannii CTX-M-2, -5, and -43 enzymes are predicted as adhesins and better vaccine candidates than other β-lactamases to induce preventive immunity and enhance antibiotic treatments. This report represents the first reverse vaccinology study to systematically predict vaccine antigen candidates against antibiotic resistance for a microbial pathogen.

  10. Class 2 Integrons Dissemination Among Multidrug Resistance (MDR) Clones of Acinetobacter baumannii

    PubMed Central

    Ramírez, María Soledad; Morales, Amanda; Vilacoba, Elisabet; Márquez, Carolina


    Acinetobacter baumannii has emerged as a serious problem in the hospital environment at a global scale. Previous results from our laboratory showed a high frequency of class 2 integrons in A. baumannii strains from Argentina regarding the low rate of this element in A. baumannii isolates from the rest of the world. To reveal the current epidemiology of class 2 integrons, a molecular surveillance analyzing 78 multidrug resistant (MDR) A. baumannii isolates from Argentina and Uruguay was performed, exposing the presence of class 2 integron in the 36.61% of the isolates. Class 2 integron characterization showed that the typical Tn7::In2-7 array was present in 26 out of 27 intI2 positive isolates. All intI2 positive isolates contained at least one of the Tn7 transposition genes. In addition, we identified that 18 intI2 positive isolates possessed the Tn7::In2-7 within the attTn7 site. The molecular typing evidenced that clones I and IV that do not belong to widespread European clones I and II were found among the intI2 positive isolates. Our results exposed the widely dissemination of class 2 integron among MDR A. baumannii isolates from Argentina and Uruguay, also showing the persistence of two novel clones in our region, which could explain in part the high frequency of class 2 integron found in our region. PMID:22198473

  11. Antibiotic Resistance Determinant-Focused Acinetobacter baumannii Vaccine Designed Using Reverse Vaccinology

    PubMed Central

    Ni, Zhaohui; Chen, Yan; Ong, Edison; He, Yongqun


    As one of the most influential and troublesome human pathogens, Acinetobacter baumannii (A. baumannii) has emerged with many multidrug-resistant strains. After collecting 33 complete A. baumannii genomes and 84 representative antibiotic resistance determinants, we used the Vaxign reverse vaccinology approach to predict classical type vaccine candidates against A. baumannii infections and new type vaccine candidates against antibiotic resistance. Our genome analysis identified 35 outer membrane or extracellular adhesins that are conserved among all 33 genomes, have no human protein homology, and have less than 2 transmembrane helices. These 35 antigens include 11 TonB dependent receptors, 8 porins, 7 efflux pump proteins, and 2 fimbrial proteins (FilF and CAM87009.1). CAM86003.1 was predicted to be an adhesin outer membrane protein absent from 3 antibiotic-sensitive strains and conserved in 21 antibiotic-resistant strains. Feasible anti-resistance vaccine candidates also include one extracellular protein (QnrA), 3 RND type outer membrane efflux pump proteins, and 3 CTX-M type β-lactamases. Among 39 β-lactamases, A. baumannii CTX-M-2, -5, and -43 enzymes are predicted as adhesins and better vaccine candidates than other β-lactamases to induce preventive immunity and enhance antibiotic treatments. This report represents the first reverse vaccinology study to systematically predict vaccine antigen candidates against antibiotic resistance for a microbial pathogen. PMID:28230771

  12. Effects of silver nanoparticles in combination with antibiotics on the resistant bacteria Acinetobacter baumannii

    PubMed Central

    Wan, Guoqing; Ruan, Lingao; Yin, Yu; Yang, Tian; Ge, Mei; Cheng, Xiaodong


    Acinetobacter baumannii resistance to carbapenem antibiotics is a serious clinical challenge. As a newly developed technology, silver nanoparticles (AgNPs) show some excellent characteristics compared to older treatments, and are a candidate for combating A. baumannii infection. However, its mechanism of action remains unclear. In this study, we combined AgNPs with antibiotics to treat carbapenem-resistant A. baumannii (aba1604). Our results showed that single AgNPs completely inhibited A. baumannii growth at 2.5 μg/mL. AgNP treatment also showed synergistic effects with the antibiotics polymixin B and rifampicin, and an additive effect with tigecyline. In vivo, we found that AgNPs–antibiotic combinations led to better survival ratios in A. baumannii-infected mouse peritonitis models than that by single drug treatment. Finally, we employed different antisense RNA-targeted Escherichia coli strains to elucidate the synergistic mechanism involved in bacterial responses to AgNPs and antibiotics. PMID:27574420

  13. Molecular Epidemiology of Multi-Drug Resistant Acinetobacter baumannii Isolated in Shandong, China

    PubMed Central

    Jiang, Meijie; Liu, Lijuan; Ma, Yunhua; Zhang, Zhijun; Li, Ning; Zhang, Fusen; Zhao, Shuping


    Acinetobacter baumannii is an emerging nosocomial pathogen prevalent in hospitals worldwide. In order to understand the molecular epidemiology of multi-drug resistant (MDR) A. baumannii, we investigated the genotypes of A. baumannii isolated from 10 hospitals in Shandong, China, from August 2013 to December 2013, by pulsed field gel electrophoresis (PFGE) and multilocus sequence typing (MLST). Antimicrobial resistance genes were analyzed by PCR and DNA sequencing. By PFGE analysis, we discovered 11 PFGE types in these 10 hospitals. By MLST, we assigned these isolates to 12 sequence types (STs), 10 of which belong to the cloning complex CC92, including the prevalent ST369, ST208, ST195, and ST368. Two new STs, namely ST794 and ST809, were detected only in one hospital. All isolates of the MDR A. baumannii were resistant to carbapenem, except 2 isolates, which did not express the blaOXA-23 carbapenemase gene, indicating blaOXA-23 is the major player for carbapenem resistance. We also discovered armA is likely to be responsible for amikacin resistance, and may play a role in gentamicin and tobramycin resistance. aac(3)-I is another gene responsible for gentamicin and tobramycin resistance. In summary, we discovered that the majority of the isolates in Shandong, China, were the STs belonging to the CC92. Besides, two new STs were detected in one hospital. These new STs should be further investigated for prevention of outbreaks caused by A. baumannii. PMID:27818659

  14. Widespread dispersion of the resistance element tet(B)::ISCR2 in XDR Acinetobacter baumannii isolates.


    Vilacoba, E; Almuzara, M; Gulone, L; Traglia, G M; Montaña, S; Rodríguez, H; Pasteran, F; Pennini, M; Sucari, A; Gómez, N; Fernández, A; Centrón, D; Ramírez, M S


    Acinetobacter baumannii is a significant nosocomial pathogen often associated with extreme drug resistance (XDR). In Argentina, isolates of A. baumannii resistant to tetracyclines have accounted for more than 40% of drug-resistant isolates in some hospitals. We have previously reported the dispersion of the tet(B) resistance element associated with the ISCR2 transposase in epidemiologically unrelated A. baumannii isolates recovered from 1983 to 2011. This study extends this surveillance to 77 recent (2009-2013) XDR A. baumannii isolates with different levels of minocycline susceptibility. Isolates were examined by a pan-PCR assay, which showed six different amplification patterns, and specific PCRs were used for the confirmation of the the ΔISCR2-tet(B)-tet(R)-ISCR2 element. The tet(B) gene was present in 66 isolates and the ISCR2 element in 68 isolates; the tet(B) gene was associated with ISCR2 in all tet(B)-positive isolates. We conclude that this element is widespread in XDR A. baumannii isolates from Argentina and could be responsible for the emergence of tetracycline resistance in recent years.

  15. Investigations on the genomic diversity of OXA from isolated Acinetobacter baumannii.


    Ma, Z; Zhou, L Q; Wang, H; Luo, L P


    We distinguished the four OXA-type carbapenemase subgroup alleles present in 120 strains of Acinetobacter baumannii by using polymerase chain reaction (PCR) and investigated the distributions of the OXA subgroups in clinically isolated samples. Amplification of the OXA genes blaOXA-23, blaOXA-24, blaOXA-51, and blaOXA-58 was performed by multiplex PCR. Antibiotics susceptibility test was conducted for determine the sensitivity of the A. baumannii to clinical common used antibiotics by Kirby-Bauer method. Results revealed that 46 (51.69%) of the samples were positive for only the blaOXA51 gene and 41 (46.07%) were positive for both the blaOXA51 and blaOXA58 genes in the 89 isolates of A. baumannii. Among these, 45 were carbapenem-resistant and 44 carbapenem-sensitive. Strains containing either blaOXA51 or blaOXA58 showed resistance or sensitivity to carbapenems, respectively. A. baumannii isolated from intensive care units showed significantly higher resistance rate to Cefepime, Piperacillin-tazobactam, Amikacin, Ceftazidime, Cefotaxime, Sulfamethoxazole-trimethoprim, and Gentamicin than those isolated from other departments (P < 0.05). In conclusion, we found that the presence of blaOXA-51 and blaOXA-58 appears to convey a mechanism of resistance or sensitivity to carbapenems, respectively, in A. baumannii clinical isolates.

  16. Emergence of multidrug-resistant Acinetobacter baumannii producing OXA-23 Carbapenemase in Qatar.


    Rolain, J-M; Loucif, L; Al-Maslamani, M; Elmagboul, E; Al-Ansari, N; Taj-Aldeen, S; Shaukat, A; Ahmedullah, H; Hamed, M


    The objective of our study was to describe the molecular support of carbapenem resistance from randomly selected clinical isolates of multidrug-resistant (MDR) Acinetobacter baumannii as a pilot study from the Hamad Medical Corporation (HMC), Qatar. Results of our report will be used to study carbapenemases using molecular techniques in all isolated MDR A. baumannii. Forty-eight MDR A. baumannii were randomly selected from isolates preserved at HMC. Identification of all isolates was confirmed by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. Antibiotic resistance was tested phenotypically by Phoenix and confirmed by Etest. The molecular support of carbapenemases (bla OXA-23, bla OXA-24, bla OXA-58, bla NDM) was investigated by real-time PCR. The epidemiologic relatedness of the isolates was verified by phylogenetic analysis based on partial sequences of CsuE and bla OXA-51 genes. All 48 isolates were identified as A. baumannii and were confirmed to be resistant to most antibiotics, especially meropenem, imipenems, ciprofloxacin, levofloxacin, amikacin, gentamicin and most of the β-lactams; they were sensitive to colistin. All the isolates were positive for bla OXA-23 and negative for the other tested carbapenemase genes. Clonality analysis demonstrated that different lineages were actually circulating in Qatar; and we suggest that an outbreak occurred in the medical intensive care unit of HMC between 2011 and 2012. Here we report the emergence of MDR A. baumannii producing the carbapenemase OXA-23 in Qatar.

  17. Prevalence of OXA-type β-lactamases among Acinetobacter baumannii isolates from Northwest of Iran.


    Sohrabi, Nasrollah; Farajnia, Safar; Akhi, Mohammad Taghi; Nahaei, Mohammad Reza; Naghili, Behrooz; Peymani, Amir; Amiri, Zohreh; Rezaee, Mohammad Ahangarzadeh; Saeedi, Nazli


    Carbapenems have been considered as last line antibiotics for treatment of multidrug-resistant (MDR) Acinetobacter baumannii but carbapenem resistant A. baumannii has been increased during the last decade in many parts of the world. OXA-type β-lactamase enzymes are the most common cause of carbapenem resistance in A. baumannii and presence of ISAba1 in upstream of these genes may increase the expression of these OXA genes. The aim of this study was to determine, for the first time, the antibiotic resistance pattern and prevalence of OXA type β-lactamases among nosocomial A. baumannii isolates from northwest of Iran. A total of 100 A. baumannii isolates were recovered from hospitalized patients in a university hospital in northwest of Iran. Sixty-two percent of isolates were resistant to imipenem. All isolates carried bla(OXA-51)-like gene. Among imipenem resistant isolates, 88.7% carried bla(OXA-23)-like, 1.6% carried bla(OXA-40)-like, and 3.2% had bla(OXA-58)-like resistance genes. Ninety percent of isolates contained ISAba1 element and in 74.2% of imipenem resistant isolates, ISAba1 was located in upstream of bla(OXA-23)-like. The results of this study demonstrated high prevalence of OXA-type carbapenemase among MDR A. bumanii in the Northwest of Iran.

  18. Genome-wide recombination drives diversification of epidemic strains of Acinetobacter baumannii.


    Snitkin, Evan S; Zelazny, Adrian M; Montero, Clemente I; Stock, Frida; Mijares, Lilia; Murray, Patrick R; Segre, Julie A


    Acinetobacter baumannii is an emerging human pathogen and a significant cause of nosocomial infections among hospital patients worldwide. The enormous increase in multidrug resistance among hospital isolates and the recent emergence of pan-drug-resistant strains underscores the urgency to understand how A. baumannii evolves in hospital environments. To this end, we undertook a genomic study of a polyclonal outbreak of multidrug-resistant A. baumannii at the research-based National Institutes of Health Clinical Center. Comparing the complete genome sequences of the three dominant outbreak strain types enabled us to conclude that, despite all belonging to the same epidemic lineage, the three strains diverged before their arrival at the National Institutes of Health. The simultaneous presence of three divergent strains from this lineage supports its increasing prevalence in international hospitals and suggests an ongoing adaptation to the hospital environment. Further genomic comparisons uncovered that much of the diversification that occurred since the divergence of the three outbreak strains was mediated by homologous recombination across 20% of their genomes. Inspection of recombinant regions revealed that several regions were associated with either the loss or swapping out of genes encoding proteins that are exposed to the cell surface or that synthesize cell-surface molecules. Extending our analysis to a larger set of international clinical isolates revealed a previously unappreciated ability of A. baumannii to vary surface molecules through horizontal gene transfer, with subsequent intraspecies dissemination by homologous recombination. These findings have immediate implications in surveillance, prevention, and treatment of A. baumannii infections.

  19. In vitro sensitivity of Acinetobacter baumannii and Pseudomonas aeruginosa to carbapenems among intensive care unit patients.


    Guzek, A; Korzeniewski, K; Nitsch-Osuch, Aneta; Rybicki, Z; Prokop, E


    Acinetobacter baumannii and Pseudomonas aeruginosa pathogens are the most common causes of fatal pneumonia among patients treated in Intensive Care Units (ICU). Carbapenems remain a group of antibiotics characterized by the highest effectiveness in treatment of heavy infections of the lower respiratory tract. This study compared in vitro sensitivity of A. baumannii and P. aeruginosa to three carbapenems: imipenem, meropenem and doripenem. The material was collected from 71 patients treated in the ICU from April 2009 to January 2010. Bronchial tree was the predominant source of samples. Fifty-four strains of A. baumannii and 17 strains of P. aeruginosa were analyzed. Sensitivity to carbapenems was interpreted in line with Clinical and Laboratory Standard Institute (CLSI) and European Committee for Antimicrobial Susceptibility Testing (EUCAST) criteria (imipenem and meropenem) or in compliance with the Food and Drug Administration (FDA) and CLSI guidelines (doripenem). We found that A. baumannii was significantly more often sensitive to imipenem than to doripenem and meropenem, but only according to the CLSI and FDA and not EUCAST criteria. The sensitivity of P. aeruginosa was higher to imipenem than to doripenem and meropenem, according to both CLSI and EUCAST criteria (64.7 %). We conclude that the EUCAST criteria demonstrate a higher rigor than those of CLSI and FDA in the determination of carbapenems sensitivity. Imipenem appears more effective than doripenem and meropenem in treatment of A. baumannii and P. aeruginosa infections.

  20. Ability of bacteriophage in resolving wound infection caused by multidrug-resistant Acinetobacter baumannii in uncontrolled diabetic rats.


    Shivaswamy, VinodKumar Chickmangalure; Kalasuramath, Suneeta Basavaraj; Sadanand, Chethan Kumar; Basavaraju, Abhishek Kilagere; Ginnavaram, Varsha; Bille, Sumanth; Ukken, Sanjay Saju; Pushparaj, Usha Nandini


    Acinetobacter baumannii, a substantial nosocomial pathogen, has developed resistance to almost all available antimicrobial drugs. Bacteriophage therapy is a possible alternative treatment for multidrug-resistant (MDR) bacterial infections. In this study, we have successfully isolated bacteriophage active against clinical strains of A. baumannii by enrichment from hospital sewage sludge using representatives of those strains. The bacteriophage isolated against A. baumannii formed plaques against beta-lactamases producing strains of A. baumannii. The utility of bacteriophage specific for A. baumannii to resolve wound infection in uncontrolled diabetic rats was evaluated. Five groups of uncontrolled diabetic rats were used. Group I was noninfected (Control), Group II was infected with MDR A. baumannii and challenged with bacteriophage, Group III was infected with MDR A. baumannii, Group IV was infected with MDR A. baumannii and challenged with antibiotic colistin, and Group V consisted of noninfected rats and sprayed with phage (Phage control). A significant decrease in infection, period of epithelization, and wound contraction was observed in the phage-challenged group when compared with antibiotic-treated uncontrolled diabetic rats and the control group. To conclude the study, new insights are provided into the biology of the broad host range of A. baumannii phage, demonstrating that A. baumannii phage has prospects for the treatment of infections caused by the MDR A. baumannii.

  1. OmpA Binding Mediates the Effect of Antimicrobial Peptide LL-37 on Acinetobacter baumannii

    PubMed Central

    Lin, Ming-Feng; Tsai, Pei-Wen; Chen, Jeng-Yi; Lin, Yun-You; Lan, Chung-Yu


    Multidrug-resistant Acinetobacter baumannii has recently emerged as an important pathogen in nosocomial infection; thus, effective antimicrobial regimens are urgently needed. Human antimicrobial peptides (AMPs) exhibit multiple functions and antimicrobial activities against bacteria and fungi and are proposed to be potential adjuvant therapeutic agents. This study examined the effect of the human cathelicidin-derived AMP LL-37 on A. baumannii and revealed the underlying mode of action. We found that LL-37 killed A. baumannii efficiently and reduced cell motility and adhesion. The bacteria-killing effect of LL-37 on A. baumannii was more efficient compared to other AMPs, including human ß–defensin 3 (hBD3) and histatin 5 (Hst5). Both flow cytometric analysis and immunofluorescence staining showed that LL-37 bound to A. baumannii cells. Moreover, far-western analysis demonstrated that LL-37 could bind to the A. baumannii OmpA (AbOmpA) protein. An ELISA assay indicated that biotin-labelled LL-37 (BA-LL37) bound to the AbOmpA74-84 peptide in a dose-dependent manner. Using BA-LL37 as a probe, the ~38 kDa OmpA signal was detected in the wild type but the ompA deletion strain did not show the protein, thereby validating the interaction. Finally, we found that the ompA deletion mutant was more sensitive to LL-37 and decreased cell adhesion by 32% compared to the wild type. However, ompA deletion mutant showed a greatly reduced adhesion defect after LL-37 treatment compared to the wild strain. Taken together, this study provides evidence that LL-37 affects A. baumannii through OmpA binding. PMID:26484669

  2. In Vivo Selection of Pan-Drug Resistant Acinetobacter baumannii during Antibiotic Treatment

    PubMed Central

    Kim, Yoonjung; Bae, Il Kwon; Yong, Dongeun; Lee, Kyungwon


    Purpose Colistin resistance in Acinetobacter baumannii (A. baumannii) is mediated by a complete loss of lipopolysaccharide production via mutations in lpxA, lpxC, and lpxD gene or lipid A modifications via mutations in the pmrA and pmrB genes. However, the exact mechanism of therapy-induced colistin resistance in A. baumannii is not well understood. Materials and Methods We investigated the genotypic and phenotypic changes that underlie pan-drug resistance mechanisms by determining differences between the alterations in extensively drug-resistant (XDR) A. baumannii (AB001 and AB002) isolates and a pan-drug resistant (PDR) counterpart (AB003) recovered from one patient before and after antibiotic treatment, respectively. Results All three clinical isolates shared an identical sequence type (ST138), belonging to the global epidemic clone, clonal complex 92, and all produced OXA-23 carbapenemase. The PDR AB003 showed two genetic differences, acquisition of armA gene and an amino acid substitution (Glu229Asp) in pmrB gene, relative to XDR isolates. No mutations were detected in the pmrA, pmrC, lpxA, lpxC, or lpxD genes in all three isolates. In matrix-assisted laser desorption ionization-time of flight analysis, the three isolates commonly showed two major peaks at 1728 m/z and 1912 m/z, but peaks at 2034 m/z, 2157 m/z, 2261 m/z, and 2384 m/z were detected only in the PDR A. baumannii AB003 isolate. Conclusion Our results show that changes in lipid A structure via a mutation in the pmrB gene and acquisition of armA gene might confer resistance to colistin and aminoglycosides to XDR A. baumannii strains, resulting in appearance of a PDR A. baumannii strain of ST138. PMID:26069113

  3. A rapid and simple method for constructing stable mutants of Acinetobacter baumannii

    PubMed Central


    Background Acinetobacter baumannii is a multidrug-resistant bacterium responsible for nosocomial infections in hospitals worldwide. Study of mutant phenotypes is fundamental for understanding gene function. The methodologies developed to inactivate A. baumannii genes are complicated and time-consuming; sometimes result in unstable mutants, and do not enable construction of double (or more) gene knockout mutant strains of A. baumannii. Results We describe here a rapid and simple method of obtaining A. baumannii mutants by gene replacement via double crossover recombination, by use of a PCR product that carries an antibiotic resistance cassette flanked by regions homologous to the target locus. To demonstrate the reproducibility of the approach, we produced mutants of three different chromosomal genes (omp33, oxyR, and soxR) by this method. In addition, we disrupted one of these genes (omp33) by integration of a plasmid into the chromosome by single crossover recombination, the most widely used method of obtaining A. baumannii mutants. Comparison of the different techniques revealed absolute stability when the gene was replaced by a double recombination event, whereas up to 40% of the population reverted to wild-type when the plasmid was disrupting the target gene after 10 passages in broth without selective pressure. Moreover, we demonstrate that the combination of both gene disruption and gene replacement techniques is an easy and useful procedure for obtaining double gene knockout mutants in A. baumannii. Conclusions This study provides a rapid and simple method of obtaining stable mutants of A. baumannii free of foreign plasmidic DNA, which does not require cloning steps, and enables construction of multiple gene knockout mutants. PMID:21062436

  4. Resistant mechanisms and molecular epidemiology of imipenem-resistant Acinetobacter baumannii

    PubMed Central

    Xiao, Shu-Zhen; Chu, Hai-Qing; Han, Li-Zhong; Zhang, Zhe-Min; Li, Bing; Zhao, Lan; Xu, Liyun


    The aim of the study was to investigate the resistant mechanisms and homology of imipenem-resistant Acinetobacter baumannii (A. baumannii). A total of 46 non-duplicate imipenem-resistant A. baumannii clinical isolates were collected from three tertiary hospitals between July, 2011 and June, 2012. The minimal inhibitory concentrations (MICs) of antimicrobial agents were determined using the agar dilution method. Phenylalanine-arginine β-naphthylamide was used to detect the presence of the efflux pump-mediated resistant mechanism. Polymerase chain reaction was employed to amplify genes associated with drug resistance, including β-lactamase genes, efflux pump genes and outer membrane protein gene CarO. A few amplicons were randomly selected and sequenced. Multilocus sequence analysis (MLST) was employed in typing A. baumanni. A. baumannii was resistant to imipenem, simultaneously showing resistance to several other antimicrobials. In addition, 13 A. baumannii were found to mediate drug resistance through operation of the efflux pump. Of the various drug resistance genes tested, blaOXA-51 was present in 46 isolates, blaOXA-23 gene was present in 44 isolates and blaNDM gene was found in only one strain. Other drug resistant-associated genes, including blaKPC, blaIMP, blaOXA-24, blaOXA-58, blaSHV, blaGIM and blaVIM were not detected. Mutation of adeS and outer membrane protein gene CarO were found in a few of the imipenem-resistant isolates. The MLST analysis revealed that all 46 clinical isolates were clustered into 11 genotypes and the most frequent genotype was ST208. In conclusion, β-lactamase genes, genes involved in efflux pump and mutation of outer membrane protein encoding gene may be important in mediating imipenem resistance in A. baumannii. Of the 11 different genotypes, ST11 was shared by the majority of A. baumannii, which may be due to horizontal transfer of patients from hospitals. PMID:27485638

  5. Impact of a Cross-Kingdom Signaling Molecule of Candida albicans on Acinetobacter baumannii Physiology

    PubMed Central

    Kostoulias, Xenia; Murray, Gerald L.; Cerqueira, Gustavo M.; Kong, Jason B.; Bantun, Farkad; Mylonakis, Eleftherios; Khoo, Chen Ai


    Multidrug-resistant (MDR) Acinetobacter baumannii is an opportunistic human pathogen that has become highly problematic in the clinical environment. Novel therapies are desperately required. To assist in identifying new therapeutic targets, the antagonistic interactions between A. baumannii and the most common human fungal pathogen, Candida albicans, were studied. We have observed that the C. albicans quorum-sensing molecule, farnesol, has cross-kingdom interactions, affecting the viability of A. baumannii. To gain an understanding of its mechanism, the transcriptional profile of A. baumannii exposed to farnesol was examined. Farnesol caused dysregulation of a large number of genes involved in cell membrane biogenesis, multidrug efflux pumps (AcrAB-like and AdeIJK-like), and A. baumannii virulence traits such as biofilm formation (csuA, csuB, and ompA) and motility (pilZ and pilH). We also observed a strong induction in genes involved in cell division (minD, minE, ftsK, ftsB, and ftsL). These transcriptional data were supported by functional assays showing that farnesol disrupts A. baumannii cell membrane integrity, alters cell morphology, and impairs virulence characteristics such as biofilm formation and twitching motility. Moreover, we showed that A. baumannii uses efflux pumps as a defense mechanism against this eukaryotic signaling molecule. Owing to its effects on membrane integrity, farnesol was tested to see if it potentiated the activity of the membrane-acting polymyxin antibiotic colistin. When coadministered, farnesol increased sensitivity to colistin for otherwise resistant strains. These data provide mechanistic understanding of the antagonistic interactions between diverse pathogens and may provide important insights into novel therapeutic strategies. PMID:26482299

  6. Use of Comparative Genomics To Characterize the Diversity of Acinetobacter baumannii Surveillance Isolates in a Health Care Institution.


    Wallace, Lalena; Daugherty, Sean C; Nagaraj, Sushma; Johnson, J Kristie; Harris, Anthony D; Rasko, David A


    Despite the increasing prevalence of the nosocomial pathogen Acinetobacter baumannii, little is known about which genomic components contribute to clinical presentation of this important pathogen. Most whole-genome comparisons of A. baumannii have focused on specific genomic regions associated with phenotypes in a limited number of genomes. In this work, we describe the results of a whole-genome comparative analysis of 254 surveillance isolates of Acinetobacter species, 203 of which were A. baumannii, isolated from perianal swabs and sputum samples collected as part of an infection control active surveillance program at the University of Maryland Medical Center. The collection of surveillance isolates includes both carbapenem-susceptible and -resistant isolates. Based on the whole-genome phylogeny, the A. baumannii isolates collected belong to two major phylogenomic lineages. Results from multilocus sequence typing indicated that one of the major phylogenetic groups of A. baumannii was comprised solely of strains from the international clonal lineage 2. The genomic content of the A. baumannii isolates was examined using large-scale BLAST score ratio analysis to identify genes that are associated with carbapenem-susceptible and -resistant isolates, as well as genes potentially associated with the source of isolation. This analysis revealed a number of genes that were exclusive or at greater frequency in each of these classifications. This study is the most comprehensive genomic comparison of Acinetobacter isolates from a surveillance study to date and provides important information that will contribute to our understanding of the success of A. baumannii as a human pathogen.

  7. Photodynamic Therapy for Acinetobacter baumannii Burn Infections in Mice

    DTIC Science & Technology


    rapidly expanding approach to the treatment of diseases because it eliminates unwanted cells, such as malig- nant cancer cells and infectious...of mouse models, and its long-lasting properties are probably due to the high biofilm -forming capac- ity of the A. baumannii strain (28). It appeared...results of previous studies (13, 22), the bacteria had penetrated deep into the burns and the infection became es- tablished by forming a biofilm ; as a

  8. RNA-mediated cis-regulation in Acinetobacter baumannii modulates stress-induced phenotypic variation.


    Ching, Carly; Gozzi, Kevin; Heinemann, Björn; Chai, Yunrong; Godoy, Veronica G


    In the nosocomial opportunistic pathogen Acinetobacter baumannii, RecA-dependent mutagenesis, which causes antibiotic resistance acquisition, is linked to the DNA damage response (DDR). Notably, unlike the Escherichia coli paradigm, recA and DDR gene expression in A. baumannii are bimodal. Namely, there is phenotypic variation upon DNA damage, which may provide a bet-hedging strategy for survival. Thus, understanding recA gene regulation is key to elucidate the yet unknown DDR regulation in A. baumannii Here, we identify a structured 5' Untranslated Region (5' UTR) in the recA transcript which serves as a cis-regulatory element. We show that a predicted stem-loop structure in this 5' UTR affects mRNA half-life and underlies bimodal gene expression and thus phenotypic variation in response to ciprofloxacin treatment. We furthermore show that the stem-loop structure of the recA 5' UTR influences intracellular RecA protein levels and, in vivo, impairing the formation of the stem-loop structure of the recA 5' UTR lowers cell survival to UV treatment and decreases rifampicin resistance acquisition from DNA damage-induced mutagenesis. We hypothesize that the 5' UTR allows for stable recA transcripts during stress, including antibiotic treatment, enabling cells to maintain suitable RecA levels for survival. This innovative strategy to regulate the DDR in A. baumannii may contribute to its success as a pathogen.ImportanceAcinetobacter baumannii is an opportunistic pathogen quickly gaining antibiotic resistances. Mutagenesis and antibiotic resistance acquisition are linked to the DNA damage response (DDR). However, how the DDR is regulated in A. baumannii remains unknown, since unlike most bacteria, A. baumannii does not follow the regulation of the Escherichia coli paradigm. Here, we have started to uncover the mechanisms regulating the novel A. baumannii DDR. We have found that a cis-acting 5' UTR regulates recA transcript stability, RecA protein levels, and DNA damage

  9. Identification of Acinetobacter baumannii serum-associated antibiotic efflux pump inhibitors.


    Blanchard, Catlyn; Barnett, Pamela; Perlmutter, Jessamyn; Dunman, Paul M


    Adaptive antibiotic resistance is a newly described phenomenon by which Acinetobacter baumannii induces efflux pump activity in response to host-associated environmental cues that may, in part, account for antibiotic treatment failures against clinically defined susceptible strains. To that end, during adaptation to growth in human serum, the organism induces approximately 22 putative efflux-associated genes and displays efflux-mediated minocycline tolerance at antibiotic concentrations corresponding to patient serum levels. Here, we show that in addition to minocycline, growth in human serum elicits A. baumannii efflux-mediated tolerance to the antibiotics ciprofloxacin, meropenem, tetracycline, and tigecycline. Moreover, using a whole-cell high-throughput screen and secondary assays, we identified novel serum-associated antibiotic efflux inhibitors that potentiated the activities of antibiotics toward serum-grown A. baumannii. Two compounds, Acinetobacter baumannii efflux pump inhibitor 1 (ABEPI1) [(E)-4-((4-chlorobenzylidene)amino)benezenesulfonamide] and ABEPI2 [N-tert-butyl-2-(1-tert-butyltetrazol-5-yl)sulfanylacetamide], were shown to lead to minocycline accumulation within A. baumannii during serum growth and inhibit the efflux potential of the organism. While both compounds also inhibited the antibiotic efflux properties of the bacterial pathogen Pseudomonas aeruginosa, they did not display significant cytotoxicity toward human cells or mammalian Ca(2+) channel inhibitory effects, suggesting that ABEPI1 and ABEPI2 represent promising structural scaffolds for the development of new classes of bacterial antibiotic efflux pump inhibitors that can be used to potentiate the activities of current and future antibiotics for the therapeutic intervention of Gram-negative bacterial infections.

  10. Identification of Acinetobacter baumannii Serum-Associated Antibiotic Efflux Pump Inhibitors

    PubMed Central

    Blanchard, Catlyn; Barnett, Pamela; Perlmutter, Jessamyn


    Adaptive antibiotic resistance is a newly described phenomenon by which Acinetobacter baumannii induces efflux pump activity in response to host-associated environmental cues that may, in part, account for antibiotic treatment failures against clinically defined susceptible strains. To that end, during adaptation to growth in human serum, the organism induces approximately 22 putative efflux-associated genes and displays efflux-mediated minocycline tolerance at antibiotic concentrations corresponding to patient serum levels. Here, we show that in addition to minocycline, growth in human serum elicits A. baumannii efflux-mediated tolerance to the antibiotics ciprofloxacin, meropenem, tetracycline, and tigecycline. Moreover, using a whole-cell high-throughput screen and secondary assays, we identified novel serum-associated antibiotic efflux inhibitors that potentiated the activities of antibiotics toward serum-grown A. baumannii. Two compounds, Acinetobacter baumannii efflux pump inhibitor 1 (ABEPI1) [(E)-4-((4-chlorobenzylidene)amino)benezenesulfonamide] and ABEPI2 [N-tert-butyl-2-(1-tert-butyltetrazol-5-yl)sulfanylacetamide], were shown to lead to minocycline accumulation within A. baumannii during serum growth and inhibit the efflux potential of the organism. While both compounds also inhibited the antibiotic efflux properties of the bacterial pathogen Pseudomonas aeruginosa, they did not display significant cytotoxicity toward human cells or mammalian Ca2+ channel inhibitory effects, suggesting that ABEPI1 and ABEPI2 represent promising structural scaffolds for the development of new classes of bacterial antibiotic efflux pump inhibitors that can be used to potentiate the activities of current and future antibiotics for the therapeutic intervention of Gram-negative bacterial infections. PMID:25114126

  11. The opportunistic human pathogen Acinetobacter baumannii senses and responds to light.


    Mussi, María A; Gaddy, Jennifer A; Cabruja, Matías; Arivett, Brock A; Viale, Alejandro M; Rasia, Rodolfo; Actis, Luis A


    Light is a ubiquitous environmental signal that many organisms sense and respond to by modulating their physiological responses accordingly. While this is an expected response among phototrophic microorganisms, the ability of chemotrophic prokaryotes to sense and react to light has become a puzzling and novel issue in bacterial physiology, particularly among bacterial pathogens. In this work, we show that the opportunistic pathogen Acinetobacter baumannii senses and responds to blue light. Motility and formation of biofilms and pellicles were observed only when bacterial cells were incubated in darkness. In contrast, the killing of Candida albicans filaments was enhanced when they were cocultured with bacteria under light. These bacterial responses depend on the expression of the A. baumannii ATCC 17978 A1S_2225 gene, which codes for an 18.6-kDa protein that contains an N-terminal blue-light-sensing-using flavin (BLUF) domain and lacks a detectable output domain(s). Spectral analyses of the purified recombinant protein showed its ability to sense light by a red shift upon illumination. Therefore, the A1S_2225 gene, which is present in several members of the Acinetobacter genus, was named blue-light-sensing A (blsA). Interestingly, temperature plays a role in the ability of A. baumannii to sense and respond to light via the BlsA photoreceptor protein.

  12. Characterisation of pellicles formed by Acinetobacter baumannii at the air-liquid interface.


    Nait Chabane, Yassine; Marti, Sara; Rihouey, Christophe; Alexandre, Stéphane; Hardouin, Julie; Lesouhaitier, Olivier; Vila, Jordi; Kaplan, Jeffrey B; Jouenne, Thierry; Dé, Emmanuelle


    The clinical importance of Acinetobacter baumannii is partly due to its natural ability to survive in the hospital environment. This persistence may be explained by its capacity to form biofilms and, interestingly, A. baumannii can form pellicles at the air-liquid interface more readily than other less pathogenic Acinetobacter species. Pellicles from twenty-six strains were morphologically classified into three groups: I) egg-shaped (27%); II) ball-shaped (50%); and III) irregular pellicles (23%). One strain representative of each group was further analysed by Brewster's Angle Microscopy to follow pellicle development, demonstrating that their formation did not require anchoring to a solid surface. Total carbohydrate analysis of the matrix showed three main components: Glucose, GlcNAc and Kdo. Dispersin B, an enzyme that hydrolyzes poly-N-acetylglucosamine (PNAG) polysaccharide, inhibited A. baumannii pellicle formation, suggesting that this exopolysaccharide contributes to pellicle formation. Also associated with the pellicle matrix were three subunits of pili assembled by chaperon-usher systems: the major CsuA/B, A1S_1510 (presented 45% of identity with the main pilin F17-A from enterotoxigenic Escherichia coli pili) and A1S_2091. The presence of both PNAG polysaccharide and pili systems in matrix of pellicles might contribute to the virulence of this emerging pathogen.

  13. Characterisation of Pellicles Formed by Acinetobacter baumannii at the Air-Liquid Interface

    PubMed Central

    Nait Chabane, Yassine; Marti, Sara; Rihouey, Christophe; Alexandre, Stéphane; Hardouin, Julie; Lesouhaitier, Olivier; Vila, Jordi; Kaplan, Jeffrey B.; Jouenne, Thierry; Dé, Emmanuelle


    The clinical importance of Acinetobacter baumannii is partly due to its natural ability to survive in the hospital environment. This persistence may be explained by its capacity to form biofilms and, interestingly, A. baumannii can form pellicles at the air-liquid interface more readily than other less pathogenic Acinetobacter species. Pellicles from twenty-six strains were morphologically classified into three groups: I) egg-shaped (27%); II) ball-shaped (50%); and III) irregular pellicles (23%). One strain representative of each group was further analysed by Brewster’s Angle Microscopy to follow pellicle development, demonstrating that their formation did not require anchoring to a solid surface. Total carbohydrate analysis of the matrix showed three main components: Glucose, GlcNAc and Kdo. Dispersin B, an enzyme that hydrolyzes poly-N-acetylglucosamine (PNAG) polysaccharide, inhibited A. baumannii pellicle formation, suggesting that this exopolysaccharide contributes to pellicle formation. Also associated with the pellicle matrix were three subunits of pili assembled by chaperon-usher systems: the major CsuA/B, A1S_1510 (presented 45% of identity with the main pilin F17-A from enterotoxigenic Escherichia coli pili) and A1S_2091. The presence of both PNAG polysaccharide and pili systems in matrix of pellicles might contribute to the virulence of this emerging pathogen. PMID:25360550

  14. Bioinformatic analysis of phage AB3, a phiKMV-like virus infecting Acinetobacter baumannii.


    Zhang, J; Liu, X; Li, X-J


    The phages of Acinetobacter baumannii has drawn increasing attention because of the multi-drug resistance of A. baumanni. The aim of this study was to sequence Acinetobacter baumannii phage AB3 and conduct bioinformatic analysis to lay a foundation for genome remodeling and phage therapy. We isolated and sequenced A. baumannii phage AB3 and attempted to annotate and analyze its genome. The results showed that the genome is a double-stranded DNA with a total length of 31,185 base pairs (bp) and 97 open reading frames greater than 100 bp. The genome includes 28 predicted genes, of which 24 are homologous to phage AB1. The entire coding sequence is located on the negative strand, representing 90.8% of the total length. The G+C mol% was 39.18%, without areas of high G+C content over 200 bp in length. No GC island, tRNA gene, or repeated sequence was identified. Gene lengths were 120-3099 bp, with an average of 1011 bp. Six genes were found to be greater than 2000 bp in length. Genomic alignment and phylogenetic analysis of the RNA polymerase gene showed that similar to phage AB1, phage AB3 is a phiKMV-like virus in the T7 phage family.

  15. [Toxigenic effect of Acinetobacter baumannii isolated from children with acute diarrhoea].


    Polanco, Nina; Manzi, Lorna


    Diarrheal diseases with diarrhea are the most frequent cause of morbidity and mortality in children; however the causative agent cannot be identified always, which suggests the presence of unknown enteropathogens inducing diarrhea. The isolation of Acinetobacter sp. from feces of children with acute diarrhea, unrelated to known enteropathogens motivated this investigation to detect a possible enterotoxigenic effect on HT-29 cells. The study population comprised 150 children with an age range from 0 to 5 years old; 120 were assisted in the "Hospital Materno Infantil del Este'' with gastrointestinal syndrome and 30 healthy controls who went to the center for routine analysis. In 25% of symptomatic patients were diagnosed parasites and bacteria, identified routinely. From four symptomatic patients were isolated three Acinetobacter baumannii strains and two A. calcoaceticus strains. The strains were cultured in brain-heart infusion for 24 and 48 hrs, at 35 degrees C, and the supernatants were obtained by centrifugation and filtration and their activity tested on HT-29 cell monolayers. The supernatants of the three strains of A. baumannii induced alterations of the cell monolayer, showed by detachments of cell monolayers, cell segregation, cell rounding and swelling. These effects were more intense with the 48 h culture exoproducts of the 016 strain, which were higher than the positive control. This toxigenic effect of A. baumannii, could represent a pathogenic mechanism whose definition requires more studies to determine the possible role in the pathogenicity of this bacillus.

  16. Presence of OXA-23-producing isolates of Acinetobacter baumannii in wastewater from hospitals in southern Brazil.


    Ferreira, Alessandra E; Marchetti, Desirée P; De Oliveira, Lyvia M; Gusatti, Carolina S; Fuentefria, Daiane B; Corção, Gertrudes


    The aim of the study was to evaluate the dissemination of multiresistant isolates of Acinetobacter baumannii carrying resistance genes, by samples of wastewater from hospitals in Porto Alegre, Rio Grande do Sul, Brazil. We obtained 303 bacterial isolates from the wastewater of three hospitals in Porto Alegre, Rio Grande do Sul. For each isolate, we determined the profile of susceptibility to antimicrobials and the presence of the genes bla(OXA-23), bla(OXA-24), bla(OXA-51), bla(OXA-58), bla(SPM-1), bla(IMP), and bla(VIM.) The bla(OXA-51) gene was found in 56% of the isolates, indicating the presence of A. baumannii in this environment. Of these, three multiresistant isolates were positive for the bla(OXA-23) gene, in wastewater from two of the hospitals. The results obtained in this study indicate that isolates of A. baumannii which are multiresistant and carry resistance genes such as bla(OXA-51) and bla(OXA-23) are being released into the environment in the wastewater from the hospitals analyzed. Multiresistant Acinetobacter junii, the newly emerging pathogen, were also found among the multiresistant isolates. Hospital wastewater may be crucial to the development and dispersal of multiresistant bacteria, making waterbodies reservoirs of bacterial resistance.

  17. Phenotypic characterization of Acinetobacter baumannii isolates from intensive care units at a tertiary-care hospital in Egypt.


    Nageeb, W; Kamel, M; Zakaria, S; Metwally, L


    Multi-drug resistant (MDR) strains of Acinetobacter baumannii are responsible for an increasing number of opportunistic infections in hospitals. This study determined the prevalence of MDR A. baumannii isolates from intensive care units in a large tertiary-care hospital in Ismailia, Egypt, and the occurrence of different beta-lactamases in these isolates. Biotyping and antimicrobial susceptibility profile was done for isolated strains. Respiratory, urine, burn wound and blood specimens were collected from 350 patients admitted to different units; 10 strains (2.9%) of A. baumannii were isolated. All isolates showed resistance to more than 3 classes of antibiotics. Among the isolates, 6 isolates were carbapenemase producers, 2 were AmpC beta-lactamase producers and no isolates were metallo-beta-lactamase producers. Despite the low prevalence of A. baumannii infection in this hospital, the antibiotic resistance profile suggests that prevention of health-care-associated transmission of MDR Acinetobacter spp. infection is essential.

  18. Bed rails and endotracheal tube connectors as possible sources for spreading Acinetobacter baumannii in ventilator-associated pneumonia patients.


    Chaladchalam, Suphawita; Diraphat, Pornphan; Utrarachkij, Fuangfa; Suthienkul, Orasa; Samakoses, Rudiwilai; Siripanichgon, Kanokrat


    This study aimed to determine molecular patterns of Acinetobacter baumannii using a PCR-based technique with REP-1, REP-2 and M13 primers to distinguish the patients' strains and the environmental strains (condensate, endotracheal tube connector, bed rail and nurses hands). There were 67 cases of ventilator-associated pneumonia (VAP) among 600 patients using mechanical ventilators in 10 wards from March to July 2006. The incidence of VAP was 11.2% or 8.9/1,000 ventilator days with a 54.5% fatality rate. Among 19 of 22 A. baumannii VAP patients, 68.4% (13/19) had their environmental samples contaminated with A. baumannii and the most common contaminated sites were bed rails and endotracheal tube connectors (36.8% each). Multidrug resistant (MDR) A. baumannii were involved in 77.3% of A. baumannii VAP. Molecular typing of 96 A. baumannii isolates was able to differentiate A. baumannii isolates into 7 types. Type 2 was the most common and found in 77.3% (17/22) of A. baumannii VAP patients admitted in 6 of 7 wards. Identical fingerprints were found in clinical isolates and their bed rails, endotracheal tube connectors and condensates of 5 patients. The results demonstrate that multiple clones of MDR A. baumannii were widely spread in the hospital. Bed rails and contaminated endotracheal tube connectors could be potential sources of A. baumannii spread.

  19. First report of an OXA-23 carbapenemase-producing Acinetobacter baumannii clinical isolate related to Tn2006 in Spain.


    Espinal, P; Macià, M D; Roca, I; Gato, E; Ruíz, E; Fernández-Cuenca, F; Oliver, A; Rodríguez-Baño, J; Bou, G; Tomás, M; Vila, J


    A carbapenem-resistant Acinetobacter baumannii clinical isolate belonging to European clone II and sequence type 2 was recovered from a patient in the Son Espases hospital in Mallorca, Spain. Genetic analysis showed the presence of the bla(OXA-23) gene in association with the widely disseminated transposon Tn2006. This is the first reported identification of A. baumannii carrying bla(OXA-23) in Spain.

  20. Simple Method for Markerless Gene Deletion in Multidrug-Resistant Acinetobacter baumannii

    PubMed Central

    Oh, Man Hwan; Lee, Je Chul; Kim, Jungmin


    The traditional markerless gene deletion technique based on overlap extension PCR has been used for generating gene deletions in multidrug-resistant Acinetobacter baumannii. However, the method is time-consuming because it requires restriction digestion of the PCR products in DNA cloning and the construction of new vectors containing a suitable antibiotic resistance cassette for the selection of A. baumannii merodiploids. Moreover, the availability of restriction sites and the selection of recombinant bacteria harboring the desired chimeric plasmid are limited, making the construction of a chimeric plasmid more difficult. We describe a rapid and easy cloning method for markerless gene deletion in A. baumannii, which has no limitation in the availability of restriction sites and allows for easy selection of the clones carrying the desired chimeric plasmid. Notably, it is not necessary to construct new vectors in our method. This method utilizes direct cloning of blunt-end DNA fragments, in which upstream and downstream regions of the target gene are fused with an antibiotic resistance cassette via overlap extension PCR and are inserted into a blunt-end suicide vector developed for blunt-end cloning. Importantly, the antibiotic resistance cassette is placed outside the downstream region in order to enable easy selection of the recombinants carrying the desired plasmid, to eliminate the antibiotic resistance cassette via homologous recombination, and to avoid the necessity of constructing new vectors. This strategy was successfully applied to functional analysis of the genes associated with iron acquisition by A. baumannii ATCC 19606 and to ompA gene deletion in other A. baumannii strains. Consequently, the proposed method is invaluable for markerless gene deletion in multidrug-resistant A. baumannii. PMID:25746991

  1. Association of biofilm production with colonization among clinical isolates of Acinetobacter baumannii

    PubMed Central

    Ryu, Seong Yeol; Baek, Won-Ki; Kim, Hyun Ah


    Background/Aims The pathogen Acinetobacter baumannii is increasingly causing healthcare-associated infections worldwide, particularly in intensive care units. Biofilm formation, a factor contributing to the virulence of A. baumannii, is associated with long-term persistence in hospital environments. The present study investigates the clinical impact of biofilm production on colonization and acquisition after patient admission. Methods Forty-nine A. baumannii isolates were obtained between August and November 2013 from Keimyung University Dongsan Medical Center, Daegu, Korea. All isolates were obtained from sputum samples of new patients infected or colonized by A. baumannii. The microtiter plate assay was used to determine biofilm formation. Results Twenty-four A. baumannii isolates (48%) demonstrated enhanced biofilm formation capacity than that of the standard A. baumannii strain (ATCC 19606). All isolates were resistant to carbapenem, 38 isolates (77%) were collected from patients in an intensive care unit, and 47 isolates (95%) were from patients who had been exposed to antibiotics in the previous month. The median duration of colonization was longer for biofilm-producing isolates than that of the biofilm non-biofilm producing isolates (18 days vs. 12 days, p < 0.05). Simultaneous colonization with other bacteria was more common for biofilm-producing isolates than that for the non-biofilm producing isolates. The most prevalent co-colonizing bacteria was Staphylococcus aureus. Conclusions Biofilm-producing isolates seem to colonize the respiratory tract for longer durations than the non-biofilm producing isolates. During colonization, biofilm producers promote co-colonization by other bacteria, particularly S. aureus. Additional research is required to determine possible links between biofilm formation and nosocomial infection. PMID:27653617

  2. Predictors of mortality in patients with extensively drug-resistant Acinetobacter baumannii pneumonia receiving colistin therapy.


    Choi, Ik Sung; Lee, Yu Ji; Wi, Yu Mi; Kwan, Byung Soo; Jung, Kae Hwa; Hong, Woong Pyo; Kim, June Myong


    The ratio of the area under the free (unbound) concentration-time curve to minimum inhibitory concentration (fAUC/MIC) was proposed to be the pharmacokinetic/pharmacodynamic index most strongly linked to the antibacterial effect of colistin against Acinetobacter baumannii. A retrospective study of patients who received colistin to treat pneumonia caused by extensively drug-resistant (XDR) A. baumannii over a 4-year period was performed to assess the impact of the colistin MIC on mortality. A total of 227 patients were included in the analysis. The 7-day and 14-day mortality rates of patients with XDR A. baumannii pneumonia receiving colistin therapy were 15.0% and 23.8%, respectively. In the multivariate analysis, Acute Physiology and Chronic Health Evaluation (APACHE) II score, days from index culture to first dose of colistin, underlying tumour and septic shock at presentation were independent predictors of mortality in patients with XDR A. baumannii pneumonia receiving colistin therapy. In the univariate analysis, the colistin dose based on ideal body weight (IBW) correlated with patient outcome. Therefore, the use of IBW appeared to be more appropriate to calculate the colistin dosage. In addition, these results highlight the clinical significance of colistin MIC in patients with XDR A. baumannii pneumonia receiving colistin therapy. Although MICs were in the 'susceptible' range, patients infected with isolates with high colistin MICs showed a poorer clinical response rate than patients infected with isolates with low colistin MICs. Further clinical studies are needed to evaluate the roles of colistin MIC for predicting mortality in XDR A. baumannii pneumonia with a high colistin MIC.

  3. Clinical epidemiology and resistance mechanisms of carbapenem-resistant Acinetobacter baumannii, French Guiana, 2008-2014.


    Mahamat, Aba; Bertrand, Xavier; Moreau, Brigitte; Hommel, Didier; Couppie, Pierre; Simonnet, Christine; Kallel, Hatem; Demar, Magalie; Djossou, Felix; Nacher, Mathieu


    This study investigated the clinical epidemiology and resistance mechanisms of Acinetobacter baumannii and characterised the clonal diversity of carbapenem-resistant A. baumannii (CRAB) during an ICU-associated outbreak at Cayenne Hospital, French Guiana. All non-duplicate A. baumannii isolates from 2008 to 2014 were tested for antibiotic susceptibility by disk diffusion. Multilocus sequence typing, pulsed-field gel electrophoresis (PFGE) and characterisation of carbapenemase-encoding genes were performed on CRAB. Of the 441 A. baumannii isolates, most were from males (54.0%) and were detected mainly from the ICU (30.8%) and medicine wards (21.8%). In the ICU, strains were mainly isolated from the respiratory tract (44.1%) and bloodstream (14.0%), whereas in medicine wards they mainly were from wound/drainage (36.5%) and bloodstream (25.0%). A. baumannii showed the greatest susceptibility to piperacillin/tazobactam (92.7%), imipenem (92.5%), colistin (95.6%) and amikacin (97.2%), being lower in the ICU and medicine wards compared with other wards. An outbreak of OXA-23-producing CRAB occurred in the 13-bed ICU in 2010. CRAB strains were more co-resistant to other antimicrobials compared with non-CRAB. Molecular genetics analysis revealed five sequence types [ST78, ST107 and ST642 and two new STs (ST830 and ST831)]. Analysis of PFGE profiles indicated cross-transmissions of CRAB within the ICU, between the ICU and one medicine ward during transfer of patients, and within that medicine ward. This study provides the first clinical and molecular data of A. baumannii from French Guiana and the Amazon basin. The ICU was the highest risk unit of this nosocomial outbreak of OXA-23-producing CRAB, which could subsequently disseminate within the hospital.

  4. Repurposing the anticancer drug mitomycin C for the treatment of persistent Acinetobacter baumannii infections.


    Cruz-Muñiz, Martha Yumiko; López-Jacome, Luis Esau; Hernández-Durán, Melissa; Franco-Cendejas, Rafael; Licona-Limón, Paula; Ramos-Balderas, Jose Luis; Martinéz-Vázquez, Mariano; Belmont-Díaz, Javier A; Wood, Thomas K; García-Contreras, Rodolfo


    Acinetobacter baumannii is an emergent opportunistic bacterial pathogen responsible for recalcitrant infections owing to its high intrinsic tolerance to most antibiotics; therefore, suitable strategies to treat these infections are needed. One plausible approach is the repurposing of drugs that are already in use. Among them, anticancer drugs may be especially useful due their cytotoxic activities and ample similarities between bacterial infections and growing tumours. In this work, the effectiveness of four anticancer drugs on the growth of A. baumannii ATTC BAA-747 was evaluated, including the antimetabolite 5-fluorouracil and three DNA crosslinkers, namely cisplatin, mitomycin C (MMC) and merphalan. MMC was the most effective drug, having a minimum inhibitory concentration for 50% of growth in Luria-Bertani medium at ca. 7 µg/mL and completely inhibiting growth at 25 µg/mL. Hence, MMC was tested against a panel of 21 clinical isolates, including 18 multidrug-resistant (MDR) isolates, 3 of which were sensitive only to colistin. The minimum inhibitory concentrations and minimum bactericidal concentrations of MMC in all tested strains were found to be similar to those of A. baumannii ATCC BAA-747, and MMC also effectively killed stationary-phase, persister and biofilm cells. Moreover, MMC was able to increase survival of the insect larvae Galleria mellonella against an otherwise lethal A. baumannii infection from 0% to ≥53% for the antibiotic-sensitive A. baumannii ATCC BAA-747 strain and the MDR strains A560 and A578. Therefore, MMC is highly effective at killing the emergent opportunistic pathogen A. baumannii.

  5. Repeated local emergence of carbapenem-resistant Acinetobacter baumannii in a single hospital ward

    PubMed Central

    Pham Thanh, Duy; Tran Do Hoan, Nhu; Wick, Ryan R.; Ingle, Danielle J.; Hawkey, Jane; Edwards, David J.; Kenyon, Johanna J.; Phu Huong Lan, Nguyen; Campbell, James I.; Thwaites, Guy; Thi Khanh Nhu, Nguyen; Hall, Ruth M.; Fournier-Level, Alexandre; Baker, Stephen; Holt, Kathryn E.


    We recently reported a dramatic increase in the prevalence of carbapenem-resistant Acinetobacter baumannii infections in the intensive care unit (ICU) of a Vietnamese hospital. This upsurge was associated with a specific oxa23-positive clone that was identified by multilocus VNTR analysis. Here, we used whole-genome sequence analysis to dissect the emergence of carbapenem-resistant A. baumannii causing ventilator-associated pneumonia (VAP) in the ICU during 2009–2012. To provide historical context and distinguish microevolution from strain introduction, we compared these genomes with those of A. baumannii asymptomatic carriage and VAP isolates from this same ICU collected during 2003–2007. We identified diverse lineages co-circulating over many years. Carbapenem resistance was associated with the presence of oxa23, oxa40, oxa58 and ndm1 genes in multiple lineages. The majority of resistant isolates were oxa23-positive global clone GC2; fine-scale phylogenomic analysis revealed five distinct GC2 sublineages within the ICU that had evolved locally via independent chromosomal insertions of oxa23 transposons. The increase in infections caused by carbapenem-resistant A. baumannii was associated with transposon-mediated transmission of a carbapenemase gene, rather than clonal expansion or spread of a carbapenemase-harbouring plasmid. Additionally, we found evidence of homologous recombination creating diversity within the local GC2 population, including several events resulting in replacement of the capsule locus. We identified likely donors of the imported capsule locus sequences amongst the A. baumannii isolated on the same ward, suggesting that diversification was largely facilitated via reassortment and sharing of genetic material within the localized A. baumannii population. PMID:28348846

  6. Diversity of multi-drug resistant Acinetobacter baumannii population in a major hospital in Kuwait

    PubMed Central

    Vali, Leila; Dashti, Khadija; Opazo-Capurro, Andrés F.; Dashti, Ali A.; Al Obaid, Khaled; Evans, Benjamin A.


    Acinetobacter baumannii is one of the most important opportunistic pathogens that causes serious health care associated complications in critically ill patients. In the current study we report on the diversity of the clinical multi-drug resistant (MDR) A. baumannii in Kuwait by molecular characterization. One hundred A. baumannii were isolated from one of the largest governmental hospitals in Kuwait. Following the identification of the isolates by molecular methods, the amplified blaOXA-51-like gene product of one isolate (KO-12) recovered from blood showed the insertion of the ISAba19 at position 379 in blaOXA-78. Of the 33 MDR isolates, 28 (85%) contained blaOXA-23, 2 (6%) blaOXA-24 and 6 (18%) blaPER-1 gene. We did not detect blaOXA-58, blaVIM, blaIMP, blaGES, blaVEB, and blaNDM genes in any of the tested isolates. In three blaPER-1 positive isolates the genetic environment of blaPER-1 consisted of two copies of ISPa12 (tnpiA1) surrounding the blaPER-1 gene on a highly stable plasmid of ca. 140-kb. Multilocus-sequence typing (MLST) analysis of the 33 A. baumannii isolates identified 20 different STs, of which six (ST-607, ST-608, ST-609, ST-610, ST-611, and ST-612) were novel. Emerging STs such as ST15 (identified for the first time in the Middle East), ST78 and ST25 were also detected. The predominant clonal complex was CC2. Pulsed-field gel electrophoresis and MLST defined the MDR isolates as multi-clonal with diverse lineages. Our results lead us to believe that A. baumannii is diverse in clonal origins and/or is undergoing clonal expansion continuously while multiple lineages of MDR A. baumannii circulate in hospital ward simultaneously. PMID:26257720

  7. Outbreak of resistant Acinetobacter baumannii- measures and proposal for prevention and control.


    Romanelli, Roberta Maia de Castro; Jesus, Lenize Adriana de; Clemente, Wanessa Trindade; Lima, Stella Sala Soares; Rezende, Edna Maria; Coutinho, Rosane Luiza; Moreira, Ricardo Luiz Fontes; Neves, Francelli Aparecida Cordeiro; Brás, Nelma de Jesus


    Acinetobacter baumannii colonization and infection, frequent in Intensive Care Unit (ICU) patients, is commonly associated with high morbimortality. Several outbreaks due to multidrug-resistant (MDR) A. baumanii have been reported but few of them in Brazil. This study aimed to identify risk factors associated with colonization and infection by MDR and carbapenem-resistant A. baumannii strains isolated from patients admitted to the adult ICU at HC/UFMG. A case-control study was performed from January 2007 to June 2008. Cases were defined as patients colonized or infected by MDR/carbapenem-resistant A. baumannii, and controls were patients without MDR/carbapenem-resistant A. baumannii isolation, in a 1:2 proportion. For statistical analysis, due to changes in infection control guidelines, infection criteria and the notification process, this study was divided into two periods. During the first period analyzed, from January to December 2007, colonization or infection by MDR/carbapenem-resistant A. baumannii was associated with prior infection, invasive device utilization, prior carbapenem use and clinical severity. In the multivariate analysis, prior infection and mechanical ventilation proved to be statistically significant risk factors. Carbapenem use showed a tendency towards a statistical association. During the second study period, from January to June 2008, variables with a significant association with MDR/carbapenem-resistant A. baumannii colonization/infection were catheter utilization, carbapenem and third-generation cephalosporin use, hepatic transplantation, and clinical severity. In the multivariate analysis, only CVC use showed a statistical difference. Carbapenem and third-generation cephalosporin use displayed a tendency to be risk factors. Risk factors must be focused on infection control and prevention measures considering A. baumanni dissemination.

  8. Iron-Regulated Phospholipase C Activity Contributes to the Cytolytic Activity and Virulence of Acinetobacter baumannii

    PubMed Central

    Fiester, Steven E.; Schmidt, Robert E.; Beckett, Amber C.; Ticak, Tomislav; Carrier, Mary V.; Ghosh, Rajarshi; Ohneck, Emily J.; Metz, Maeva L.; Sellin Jeffries, Marlo K.; Actis, Luis A.


    Acinetobacter baumannii is an opportunistic Gram-negative pathogen that causes a wide range of infections including pneumonia, septicemia, necrotizing fasciitis and severe wound and urinary tract infections. Analysis of A. baumannii representative strains grown in Chelex 100-treated medium for hemolytic activity demonstrated that this pathogen is increasingly hemolytic to sheep, human and horse erythrocytes, which interestingly contain increasing amounts of phosphatidylcholine in their membranes. Bioinformatic, genetic and functional analyses of 19 A. baumannii isolates showed that the genomes of each strain contained two phosphatidylcholine-specific phospholipase C (PC-PLC) genes, which were named plc1 and plc2. Accordingly, all of these strains were significantly hemolytic to horse erythrocytes and their culture supernatants tested positive for PC-PLC activity. Further analyses showed that the transcriptional expression of plc1 and plc2 and the production of phospholipase and thus hemolytic activity increased when bacteria were cultured under iron-chelation as compared to iron-rich conditions. Testing of the A. baumannii ATCC 19606T plc1::aph-FRT and plc2::aph isogenic insertion derivatives showed that these mutants had a significantly reduced PC-PLC activity as compared to the parental strain, while testing of plc1::ermAM/plc2::aph demonstrated that this double PC-PLC isogenic mutant expressed significantly reduced cytolytic and hemolytic activity. Interestingly, only plc1 was shown to contribute significantly to A. baumannii virulence using the Galleria mellonella infection model. Taken together, our data demonstrate that both PLC1 and PLC2, which have diverged from a common ancestor, play a concerted role in hemolytic and cytolytic activities; although PLC1 seems to play a more critical role in the virulence of A. baumannii when tested in an invertebrate model. These activities would provide access to intracellular iron stores this pathogen could use during

  9. Effect of carbapenem consumption patterns on the molecular epidemiology and carbapenem resistance of Acinetobacter baumannii.


    Mózes, Julianna; Ebrahimi, Fatemeh; Gorácz, Orsolya; Miszti, Cecília; Kardos, Gábor


    This study investigated the molecular epidemiology of Acinetobacter baumannii in the University of Debrecen in relation to antibiotic consumption. Overall and ward-specific antibiotic consumption was measured by the number of defined daily doses (DDD) per 100 bed-days between 2002 and 2012. Consumption was analysed against the number of A. baumannii positive patients per 100 bed-days, number of isolates per positive sample, and proportion of carbapenem resistant A. baumannii, using time-series analysis. Altogether 160 A. baumannii isolates from different wards were collected and analysed. Carbapenemase genes bla(OXA-23-like), bla(OXA-24-like), bla(OXA-48-like), bla(OXA-51-like), bla(OXA-58-like) and integrons were sought by PCR. Relatedness of isolates was assessed by PFGE. Prevalence and carbapenem resistance of A. baumannii were statistically associated with carbapenem consumption. Prevalence data followed carbapenem usage with three quarterly lags (r = 0.51-0.53, P<0.001), and meropenem and ertapenem, but not imipenem usage, affected prevalence. Colistin usage, in turn, lagged behind prevalence with one lag (r = 0.68-0.70, P<0.001). Six clusters were identified; the neurology ward with the lowest carbapenem consumption was associated with the carbapenem-susceptible cluster, as well as with the carbapenem-susceptible isolates in the cluster with variable susceptibility. Wards with high carbapenem usage almost exclusively harboured isolates from carbapenem-resistant clusters. All clusters were dominated by isolates of one or two wards, but most wards were represented in multiple clusters. Increases in prevalence and carbapenem resistance of A. baumannii were associated with usage of meropenem and ertapenem but not of imipenem, which led to the spread of multiple clones in the University.

  10. Epidemiologic and clinical impact of Acinetobacter baumannii colonization and infection: a reappraisal.


    Villar, Macarena; Cano, María E; Gato, Eva; Garnacho-Montero, José; Miguel Cisneros, José; Ruíz de Alegría, Carlos; Fernández-Cuenca, Felipe; Martínez-Martínez, Luis; Vila, Jordi; Pascual, Alvaro; Tomás, María; Bou, Germán; Rodríguez-Baño, Jesús


    Acinetobacter baumannii is one of the most important antibiotic-resistant nosocomial bacteria. We investigated changes in the clinical and molecular epidemiology of A. baumannii over a 10-year period. We compared the data from 2 prospective multicenter cohort studies in Spain, one performed in 2000 (183 patients) and one in 2010 (246 patients), which included consecutive patients infected or colonized by A. baumannii. Molecular typing was performed by repetitive extragenic palindromic polymerase chain reaction (REP-PCR), pulsed-field gel electrophoresis (PFGE), and multilocus sequence typing (MLST). The incidence density of A. baumannii colonization or infection increased significantly from 0.14 in 2000 to 0.52 in 2010 in medical services (p < 0.001). The number of non-nosocomial health care-associated cases increased from 1.2% to 14.2%, respectively (p < 0.001). Previous exposure to carbapenems increased in 2010 (16.9% in 2000 vs 27.3% in 2010, p = 0.03). The drugs most frequently used for definitive treatment of patients with infections were carbapenems in 2000 (45%) and colistin in 2010 (50.3%). There was molecular-typing evidence of an increase in the frequency of A. baumannii acquisition in non-intensive care unit wards in 2010 (7.6% in 2000 vs 19.2% in 2010, p = 0.01). By MSLT, the ST2 clonal group predominated and increased in 2010. This epidemic clonal group was more frequently resistant to imipenem and was associated with an increased risk of sepsis, although not with severe sepsis or mortality. Some significant changes were noted in the epidemiology of A. baumannii, which is increasingly affecting patients admitted to conventional wards and is also the cause of non-nosocomial health care-associated infections. Epidemic clones seem to combine antimicrobial resistance and the ability to spread, while maintaining their clinical virulence.

  11. Whole-Genome Sequence of a Colombian Acinetobacter baumannii Strain, a Coproducer of OXA-72 and OXA-255-Like Carbapenemases

    PubMed Central

    Saavedra, Sandra Yamile; Prada-Cardozo, Diego; Pérez-Cardona, Hermes; Hidalgo, Andrea Melissa; González, María Nilse; Reguero, María T.; Valenzuela de Silva, Emilia M.; Mantilla, José R.; Falquet, Laurent; Barreto-Hernández, Emiliano; Duarte, Carolina


    ABSTRACT Colombian Acinetobacter baumannii strain ST920 was isolated from the sputum of a 68-year-old male patient. This isolate possessed blaOXA-72 and blaOXA-255-like genes. The assembled genome contained 4,104,098 pb and 38.79% G+C content. This is the first case reported of the coproduction (blaOXA-72 and blaOXA-255-like) of carbapenem-hydrolyzing class D β-lactamases (CHDLs) in Acinetobacter baumannii. PMID:28209815

  12. Characterizing in vivo pharmacodynamics of carbapenems against Acinetobacter baumannii in a murine thigh infection model to support breakpoint determinations.


    Macvane, Shawn H; Crandon, Jared L; Nicolau, David P


    Pharmacodynamic profiling data of carbapenems for Acinetobacter spp. are sparse. This study aimed to determine the pharmacodynamic targets of carbapenems for Acinetobacter baumannii based on a range of percentages of the dosing interval in which free drug concentrations remained above the MIC (fT>MIC) in the neutropenic murine thigh infection model. fT>MIC values of 23.7%, 32.8%, and 47.5% resulted in stasis, 1-log reductions, and 2-log reductions in bacterial density after 24 h, respectively. The pharmacodynamic targets of carbapenems for A. baumannii demonstrated in vivo are similar to those of other Gram-negative bacteria.

  13. Invitro Apramycin Activity against multidrug-resistant Acinetobacter baumannii and Pseudomonas aeruginosa.


    Kang, Anthony D; Smith, Kenneth P; Eliopoulos, George M; Berg, Anders H; McCoy, Christopher; Kirby, James E


    The in vitro activity of apramycin was compared to that of amikacin, gentamicin, and tobramycin against multidrug-resistant, extensively drug-resistant, and pandrug-resistant Acinetobacter baumannii and Pseudomonas aeruginosa. Apramycin demonstrated an MIC50/MIC90 of 8/32μg/ml for A. baumannii and 16/32μg/ml for P. aeruginosa. Only 2% of A. baumannii and P. aeruginosa had an MIC greater than an epidemiological cutoff value of 64μg/ml. In contrast, the MIC50/MIC90 for amikacin, gentamicin, and tobramycin were ≥64/>256μg/ml for A. baumannii with 57%, 95%, and 74% of isolates demonstrating resistance, respectively, and the MIC50/MIC90 were ≥8/256μg/ml for P. aeruginosa with 27%, 50%, and 57% of strains demonstrating resistance, respectively. Apramycin appears to offer promising in vitro activity against highly resistant pathogens. It therefore may warrant further pre-clinical study to assess potential for repurposing as a human therapeutic and relevance as a scaffold for further medicinal chemistry exploration.

  14. Differential Role of the T6SS in Acinetobacter baumannii Virulence

    PubMed Central

    Foucault-Grunenwald, Marie-Laure; Borges, Vitor; Charpentier, Xavier; Limansky, Adriana S.; Gomes, João Paulo; Viale, Alejandro M.; Salcedo, Suzana P.


    Gram-negative bacteria, such as Acinetobacter baumannii, are an increasing burden in hospitals worldwide with an alarming spread of multi-drug resistant (MDR) strains. Herein, we compared a type strain (ATCC17978), a non-clinical isolate (DSM30011) and MDR strains of A. baumannii implicated in hospital outbreaks (Ab242, Ab244 and Ab825), revealing distinct patterns of type VI secretion system (T6SS) functionality. The T6SS genomic locus is present and was actively transcribed in all of the above strains. However, only the A. baumannii DSM30011 strain was capable of killing Escherichia coli in a T6SS-dependent manner, unlike the clinical isolates, which failed to display an active T6SS in vitro. In addition, DSM30011 was able to outcompete ATCC17978 as well as Pseudomonas aeruginosa and Klebsiella pneumoniae, bacterial pathogens relevant in mixed nosocomial infections. Finally, we found that the T6SS of DSM30011 is required for host colonization of the model organism Galleria mellonella suggesting that this system could play an important role in A. baumannii virulence in a strain-specific manner. PMID:26401654

  15. Association of the outer membrane protein Omp33 with fitness and virulence of Acinetobacter baumannii.


    Smani, Younes; Dominguez-Herrera, Juan; Pachón, Jerónimo


    Outer membrane protein 33 (Omp33) is an outer membrane porin of Acinetobacter baumannii associated with carbapenem resistance. However, the role of Omp33 in the fitness and virulence of A. baumannii remains unknown. In the present study, we investigated the role of Omp33 in fitness and virulence of A. baumannii by using an isogenic knockout strain deficient in the omp33 gene (JPAB02), derived from the ATCC 17978 wild-type (wt). Both in vitro and in vivo defect in the growth rate was found in the JPAB02 strain in competition with the ATCC 17978 wt, highlighting the effect of Omp33 on the metabolic fitness. A significant reduction was observed both in adherence and invasion of human lung epithelial cells and in cytotoxicity of these cells and macrophages with JPAB02. In a murine peritoneal sepsis model, the JPAB02 strain exhibited lower lethal dose 0 (LD0), LD50, and LD100, and dissemination in mice, with reduced bacterial concentration in spleen and lungs. From these data, we concluded that Omp33 plays an important role for fitness and virulence of A. baumannii.

  16. Screening of nuclear targeting proteins in Acinetobacter baumannii based on nuclear localization signals.


    Moon, Dong Chan; Gurung, Mamata; Lee, Jung Hwa; Lee, Yong Seok; Choi, Chi Won; Kim, Seung Il; Lee, Je Chul


    Nuclear targeting of bacterial proteins is an emerging pathogenic mechanism in bacteria. However, due to the absence of an appropriate screening system for nuclear targeting proteins, systematic approaches to nuclear targeting of bacterial proteins and subsequent host cell pathology are limited. In this study, we developed a screening system for nuclear targeting proteins in Acinetobacter baumannii using a combination of bioinformatic analysis based on nuclear localization signal (NLS) and the Gateway(®) recombinational cloning system. Among 3367 open reading frames of A. baumannii ATCC 17978, 34 functional or hypothetical proteins were predicted to carry the putative NLS sequences. Of the 29 clones generated by the Gateway(®) recombinational cloning system, 14 proteins tagged with green fluorescent protein (GFP) were targeted to nuclei of host cells. Among the 14 nuclear targeting proteins, S21, L20, and L32 ribosomal proteins and transposase carried putative nuclear export signal (NES) sequences, but only transposase harbored the functional NES. After translocation to nuclei of host cells, four A. baumannii proteins induced cytotoxicity. In conclusion, we have developed a screening system for nuclear targeting proteins in A. baumannii. This system may open the way to a new field of bacterial pathogenesis.

  17. The Effect of Colistin Resistance-Associated Mutations on the Fitness of Acinetobacter baumannii.


    Mu, Xinli; Wang, Nanfei; Li, Xi; Shi, Keren; Zhou, Zhihui; Yu, Yunsong; Hua, Xiaoting


    Acinetobacter baumannii had emerged as an important nosocomial and opportunistic pathogen worldwide. To assess the evolution of colistin resistance in A. baumannii and its effect on bacterial fitness, we exposed five independent colonies of A. baumannii ATCC 17978 to increasing concentrations of colistin in agar (4/5) and liquid media (1/5). Stable resistant isolates were analyzed using whole genome sequencing. All strains were colistin resistant after exposure to colistin. In addition to the previously reported lpxCAD and pmrAB mutations, we identified four novel putative colistin resistance genes: A1S_1983. hepA. A1S_3026, and rsfS. Lipopolysaccharide (LPS) loss mutants exhibited higher fitness costs than those of the pmrB mutant in nutrient-rich medium. The colistin-resistant mutants had a higher inhibition ratio in the serum growth experiment than that of the wild type strain in 100% serum. Minimum inhibitory concentration (MIC) results showed that the LPS-deficient but not the pmrB mutant had an altered antibiotic resistance profile. The compensatory mutations partially or completely rescued the LPS-deficient's fitness, suggesting that compensatory mutations play an important role in the emergence and spread of colistin resistance in A. baumannii.

  18. Detoxification of Indole by an Indole-Induced Flavoprotein Oxygenase from Acinetobacter baumannii

    PubMed Central

    Lin, Guang-Huey; Chen, Hao-Ping; Shu, Hung-Yu


    Indole, a derivative of the amino acid tryptophan, is a toxic signaling molecule, which can inhibit bacterial growth. To overcome indole-induced toxicity, many bacteria have developed enzymatic defense systems to convert indole to non-toxic, water-insoluble indigo. We previously demonstrated that, like other aromatic compound-degrading bacteria, Acinetobacter baumannii can also convert indole to indigo. However, no work has been published investigating this mechanism. Here, we have shown that the growth of wild-type A. baumannii is severely inhibited in the presence of 3.5 mM indole. However, at lower concentrations, growth is stable, implying that the bacteria may be utilizing a survival mechanism to oxidize indole. To this end, we have identified a flavoprotein oxygenase encoded by the iifC gene of A. baumannii. Further, our results suggest that expressing this recombinant oxygenase protein in Escherichia coli can drive indole oxidation to indigo in vitro. Genome analysis shows that the iif operon is exclusively present in the genomes of A. baumannii and Pseudomonas syringae pv. actinidiae. Quantitative PCR and Western blot analysis also indicate that the iif operon is activated by indole through the AraC-like transcriptional regulator IifR. Taken together, these data suggest that this species of bacteria utilizes a novel indole-detoxification mechanism that is modulated by IifC, a protein that appears to be, at least to some extent, regulated by IifR. PMID:26390211

  19. The Effect of Colistin Resistance-Associated Mutations on the Fitness of Acinetobacter baumannii

    PubMed Central

    Mu, Xinli; Wang, Nanfei; Li, Xi; Shi, Keren; Zhou, Zhihui; Yu, Yunsong; Hua, Xiaoting


    Acinetobacter baumannii had emerged as an important nosocomial and opportunistic pathogen worldwide. To assess the evolution of colistin resistance in A. baumannii and its effect on bacterial fitness, we exposed five independent colonies of A. baumannii ATCC 17978 to increasing concentrations of colistin in agar (4/5) and liquid media (1/5). Stable resistant isolates were analyzed using whole genome sequencing. All strains were colistin resistant after exposure to colistin. In addition to the previously reported lpxCAD and pmrAB mutations, we identified four novel putative colistin resistance genes: A1S_1983. hepA. A1S_3026, and rsfS. Lipopolysaccharide (LPS) loss mutants exhibited higher fitness costs than those of the pmrB mutant in nutrient-rich medium. The colistin-resistant mutants had a higher inhibition ratio in the serum growth experiment than that of the wild type strain in 100% serum. Minimum inhibitory concentration (MIC) results showed that the LPS-deficient but not the pmrB mutant had an altered antibiotic resistance profile. The compensatory mutations partially or completely rescued the LPS-deficient’s fitness, suggesting that compensatory mutations play an important role in the emergence and spread of colistin resistance in A. baumannii. PMID:27847502

  20. Identification and Characterization of an Acinetobacter baumannii Biofilm-Associated Protein▿

    PubMed Central

    Loehfelm, Thomas W.; Luke, Nicole R.; Campagnari, Anthony A.


    We have identified a homologue to the staphylococcal biofilm-associated protein (Bap) in a bloodstream isolate of Acinetobacter baumannii. The fully sequenced open reading frame is 25,863 bp and encodes a protein with a predicted molecular mass of 854 kDa. Analysis of the nucleotide sequence reveals a repetitive structure consistent with bacterial cell surface adhesins. Bap-specific monoclonal antibody (MAb) 6E3 was generated to an epitope conserved among 41% of A. baumannii strains isolated during a recent outbreak in the U.S. military health care system. Flow cytometry confirms that the MAb 6E3 epitope is surface exposed. Random transposon mutagenesis was used to generate A. baumannii bap1302::EZ-Tn5, a mutant negative for surface reactivity to MAb 6E3 in which the transposon disrupts the coding sequence of bap. Time course confocal laser scanning microscopy and three-dimensional image analysis of actively growing biofilms demonstrates that this mutant is unable to sustain biofilm thickness and volume, suggesting a role for Bap in supporting the development of the mature biofilm structure. This is the first identification of a specific cell surface protein directly involved in biofilm formation by A. baumannii and suggests that Bap is involved in intercellular adhesion within the mature biofilm. PMID:18024522

  1. Active and Passive Immunization Protects against Lethal, Extreme Drug Resistant-Acinetobacter baumannii Infection

    PubMed Central

    Luo, Guanpingshen; Lin, Lin; Ibrahim, Ashraf S.; Baquir, Beverlie; Pantapalangkoor, Paul; Bonomo, Robert A.; Doi, Yohei; Adams, Mark D.; Russo, Thomas A.; Spellberg, Brad


    Extreme-drug-resistant (XDR) Acinetobacter baumannii is a rapidly emerging pathogen causing infections with unacceptably high mortality rates due to inadequate available treatment. New methods to prevent and treat such infections are a critical unmet medical need. To conduct a rational vaccine discovery program, OmpA was identified as the primary target of humoral immune response after intravenous infection by A. baumannii in mice. OmpA was >99% conserved at the amino acid level across clinical isolates harvested between 1951 and 2009 from cerebrospinal fluid, blood, lung, and wound infections, including carbapenem-resistant isolates, and was ≥89% conserved among other sequenced strains, but had minimal homology to the human proteome. Vaccination of diabetic mice with recombinant OmpA (rOmpA) with aluminum hydroxide adjuvant markedly improved survival and reduced tissue bacterial burden in mice infected intravenously. Vaccination induced high titers of anti-OmpA antibodies, the levels of which correlated with survival in mice. Passive transfer with immune sera recapitulated protection. Immune sera did not enhance complement-mediated killing but did enhance opsonophagocytic killing of A. baumannii. These results define active and passive immunization strategies to prevent and treat highly lethal, XDR A. baumannii infections. PMID:22253723

  2. 2-DE analysis indicates that Acinetobacter baumannii displays a robust and versatile metabolism

    PubMed Central

    Soares, Nelson C; Cabral, Maria P; Parreira, José R; Gayoso, Carmen; Barba, Maria J; Bou, Germán


    Background Acinetobacter baumannii is a nosocomial pathogen that has been associated with outbreak infections in hospitals. Despite increasing awareness about this bacterium, its proteome remains poorly characterised, however recently the complete genome of A. baumannii reference strain ATCC 17978 has been sequenced. Here, we have used 2-DE and MALDI-TOF/TOF approach to characterise the proteome of this strain. Results The membrane and cytoplasmatic protein extracts were analysed separately, these analyses revealed the reproducible presence of 239 and 511 membrane and cytoplamatic protein spots, respectively. MALDI-TOF/TOF characterisation identified a total of 192 protein spots (37 membrane and 155 cytoplasmatic) and revealed that the identified membrane proteins were mainly transport-related proteins, whereas the cytoplasmatic proteins were of diverse nature, although mainly related to metabolic processes. Conclusion This work indicates that A. baumannii has a versatile and robust metabolism and also reveal a number of proteins that may play a key role in the mechanism of drug resistance and virulence. The data obtained complements earlier reports of A. baumannii proteome and provides new tools to increase our knowledge on the protein expression profile of this pathogen. PMID:19785748

  3. Comparative transcriptomics analyses of the different growth states of multidrug-resistant Acinetobacter baumannii.


    Li, Shuai; Li, Haitao; Qi, Tianjie; Yan, Xixin; Wang, Boli; Guan, Jitao; Li, Yu


    Multidrug-resistant (MDR) Acinetobacter baumannii is an important bacterial pathogen commonly associated with hospital acquired infections. A. baumannii can remain viable and hence virulent in the environment for a long period of time due primarily to its ability to form biofilms. A total of 459 cases of MDR A. baumannii our hospital collected from March 2014 to March 2015 were examined in this study, and a representative isolate selected for high-throughput mRNA sequencing and comparison of gene expression profiles under the biofilm and exponential growth conditions. Our study found that the same bacteria indeed exhibited differential mRNA expression under different conditions. Compared to the rapidly growing bacteria, biofilm bacteria had 106 genes upregulated and 92 genes downregulated. Bioinformatics analyses suggested that many of these genes are involved in the formation and maintenance of biofilms, whose expression also depends on the environment and specific signaling pathways and transcription factors that are absent in the log phase bacteria. These differentially expressed mRNAs might contribute to A. baumannii's unique pathogenicity and ability to inflict chronic and recurrent infections.

  4. Characterisation of successive Acinetobacter baumannii isolates from a deceased haemophagocytic lymphohistiocytosis patient.


    Choi, Hyeon Jin; Kil, Min Cheol; Choi, Ji-Young; Kim, Sun Ju; Park, Ki-Sup; Kim, Yae-Jean; Ko, Kwan Soo


    In this study, 38 Acinetobacter baumannii isolates successively isolated from blood, skin swabs and tracheal aspirates from a single patient who died from haemophagocytic lymphohistiocytosis were investigated. The isolates were collected between March 2012 and August 2012. A. baumannii genotypes were determined by multilocus sequence typing (MLST) and pulsed-field gel electrophoresis (PFGE). In vitro antimicrobial susceptibility testing was performed and colistin heteroresistance and persistence were evaluated. The structure of AbaR resistance islands was explored, and serum sensitivity was determined. Based on MLST analysis, all 38 A. baumannii isolates showed the same sequence type (ST138). However, PFGE analysis showed that isolates from blood samples belonged to different genotypes depending on the isolation time: whilst blood isolates obtained at the early stages showed restriction patterns similar to those of isolates from other sources, isolates obtained at later stages exhibited a distinct pattern. All isolates were resistant to imipenem, cefepime, ciprofloxacin and piperacillin/tazobactam. Five isolates from tracheal aspirates and one from a skin swab were resistant to polymyxins, and two isolates from skin swabs and one from another source were non-susceptible to tigecycline. All colistin-susceptible isolates showed heteroresistance to colistin, and four were persisters. Isolates from blood showed higher survival rates against human serum than those from other sources. This study shows that the patient was infected with more than one A. baumannii strain. Heteroresistance, persistence or evasion of the innate immune response may explain the failure of antimicrobial treatments in this patient.

  5. Thai ethnomedicinal plants as resistant modifying agents for combating Acinetobacter baumannii infections

    PubMed Central


    Abstracts Background Acinetobacter baumannii is well-recognized as an important nosocomial pathogen, however, due to their intrinsic resistance to several antibiotics, treatment options are limited. Synergistic effects between antibiotics and medicinal plants, particularly their active components, have intensively been studied as alternative approaches. Methods Fifty-one ethanol extracts obtained from 44 different selected medicinal plant species were tested for resistance modifying agents (RMAs) of novobiocin against A. baumannii using growth inhibition assay. Results At 250 μg/ml, Holarrhena antidysenterica, Punica granatum, Quisqualis indica, Terminalia bellirica, Terminalia chebula, and Terminalia sp. that possessed low intrinsic antibacterial activity significantly enhanced the activity of novobiocin at 1 μg/ml (1/8xminimum inhibitory concentration) against this pathogen. Holarrhena antidysenterica at 7.8 μg/ml demonstrated remarkable resistant modifying ability against A. baumannii in combination with novobiocin. The phytochemical study revealed that constituents of this medicinal plant contain alkaloids, condensed tannins, and triterpenoids. Conclusion The use of Holarrhena antidysenterica in combination with novobiocin provides an effective alternative treatment for multidrug resistant A. baumannii infections. PMID:22536985

  6. Differential Protection from Tobramycin by Extracellular Polymeric Substances from Acinetobacter baumannii and Staphylococcus aureus Biofilms

    PubMed Central

    Davenport, Emily K.; Call, Douglas R.


    We investigated biofilms of two pathogens, Acinetobacter baumannii and Staphylococcus aureus, to characterize mechanisms by which the extracellular polymeric substance (EPS) found in biofilms can protect bacteria against tobramycin exposure. To do so, it is critical to study EPS-antibiotic interactions in a homogeneous environment without mass transfer limitations. Consequently, we developed a method to grow biofilms, harvest EPS, and then augment planktonic cultures with isolated EPS and tobramycin. We demonstrated that planktonic cultures respond differently to being treated with different types of EPS (A. baumannii versus S. aureus) in the presence of tobramycin. By harvesting EPS from the biofilms, we found that A. baumannii EPS acts as a “universal protector” by inhibiting tobramycin activity against bacterial cells regardless of species; S. aureus EPS did not show any protective ability in cell cultures. Adding Mg2+ or Ca2+ reduced the protective effect of A. baumannii EPS. Finally, when we selectively digested the proteins or DNA of the EPS, we found that the protective ability did not change, suggesting that neither has a significant role in protection. To the best of our knowledge, this is the first study that demonstrates how EPS protects pathogens against antibiotics in a homogeneous system without mass transfer limitations. Our results suggest that EPS protects biofilm communities, in part, by adsorbing antibiotics near the surface. This may limit antibiotic diffusion to the bottom of the biofilms but is not likely to be the only mechanism of protection. PMID:24913166

  7. Serum Albumin and Ca2+ Are Natural Competence Inducers in the Human Pathogen Acinetobacter baumannii.


    Traglia, German Matias; Quinn, Brettni; Schramm, Sareda T J; Soler-Bistue, Alfonso; Ramirez, Maria Soledad


    The increasing frequency of bacteria showing antimicrobial resistance (AMR) raises the menace of entering into a postantibiotic era. Horizontal gene transfer (HGT) is one of the prime reasons for AMR acquisition. Acinetobacter baumannii is a nosocomial pathogen with outstanding abilities to survive in the hospital environment and to acquire resistance determinants. Its capacity to incorporate exogenous DNA is a major source of AMR genes; however, few studies have addressed this subject. The transformation machinery as well as the factors that induce natural competence in A. baumannii are unknown. In this study, we demonstrate that naturally competent strain A118 increases its natural transformation frequency upon the addition of Ca(2+)or albumin. We show that comEA and pilQ are involved in this process since their expression levels are increased upon the addition of these compounds. An unspecific protein, like casein, does not reproduce this effect, showing that albumin's effect is specific. Our work describes the first specific inducers of natural competence in A. baumannii Overall, our results suggest that the main protein in blood enhances HGT in A. baumannii, contributing to the increase of AMR in this threatening human pathogen.

  8. Insights on the Horizontal Gene Transfer of Carbapenemase Determinants in the Opportunistic Pathogen Acinetobacter baumannii

    PubMed Central

    Da Silva, Gabriela Jorge; Domingues, Sara


    Horizontal gene transfer (HGT) is a driving force to the evolution of bacteria. The fast emergence of antimicrobial resistance reflects the ability of genetic adaptation of pathogens. Acinetobacter baumannii has emerged in the last few decades as an important opportunistic nosocomial pathogen, in part due to its high capacity of acquiring resistance to diverse antibiotic families, including to the so-called last line drugs such as carbapenems. The rampant selective pressure and genetic exchange of resistance genes hinder the effective treatment of resistant infections. A. baumannii uses all the resistance mechanisms to survive against carbapenems but production of carbapenemases are the major mechanism, which may act in synergy with others. A. baumannii appears to use all the mechanisms of gene dissemination. Beyond conjugation, the mostly reported recent studies point to natural transformation, transduction and outer membrane vesicles-mediated transfer as mechanisms that may play a role in carbapenemase determinants spread. Understanding the genetic mobilization of carbapenemase genes is paramount in preventing their dissemination. Here we review the carbapenemases found in A. baumannii and present an overview of the current knowledge of contributions of the various HGT mechanisms to the molecular epidemiology of carbapenem resistance in this relevant opportunistic pathogen. PMID:27681923

  9. Serum Albumin and Ca2+ Are Natural Competence Inducers in the Human Pathogen Acinetobacter baumannii

    PubMed Central

    Traglia, German Matias; Quinn, Brettni; Schramm, Sareda T. J.; Soler-Bistue, Alfonso


    The increasing frequency of bacteria showing antimicrobial resistance (AMR) raises the menace of entering into a postantibiotic era. Horizontal gene transfer (HGT) is one of the prime reasons for AMR acquisition. Acinetobacter baumannii is a nosocomial pathogen with outstanding abilities to survive in the hospital environment and to acquire resistance determinants. Its capacity to incorporate exogenous DNA is a major source of AMR genes; however, few studies have addressed this subject. The transformation machinery as well as the factors that induce natural competence in A. baumannii are unknown. In this study, we demonstrate that naturally competent strain A118 increases its natural transformation frequency upon the addition of Ca2+or albumin. We show that comEA and pilQ are involved in this process since their expression levels are increased upon the addition of these compounds. An unspecific protein, like casein, does not reproduce this effect, showing that albumin's effect is specific. Our work describes the first specific inducers of natural competence in A. baumannii. Overall, our results suggest that the main protein in blood enhances HGT in A. baumannii, contributing to the increase of AMR in this threatening human pathogen. PMID:27270286

  10. Multidrug Resistance of Acinetobacter Baumannii in Ladoke Akintola University Teaching Hospital, Osogbo, Nigeria

    PubMed Central

    Odewale, G.; Adefioye, O. J.; Ojo, J.; Adewumi, F. A.; Olowe, O. A.


    Acinetobacter baumannii is a ubiquitous pathogen that has emerged as a major cause of healthcare-associated infections at Ladoke Akintola University Teaching Hospital. Isolates were assayed according to standard protocol. The isolates were subjected to molecular techniques to detect blaOXA, blaTEM, blaCTX-M, and blaSHV genes in strains of the A. baumannii isolates. The prevalence of A. baumannii was 8.5% and was most prevalent among patients in the age group 51–60 (36%); the male patients (63.6%) were more infected than their female counterparts. Patients (72.7%) in the intensive care unit (ICU) were most infected with this organism. The isolates showed 100% resistance to both amikacin and ciprofloxacin and 90.9% to both ceftriaxone and ceftazidime, while resistance to the other antibiotics used in this study were: piperacillin (81.8%), imipenem (72.7%), gentamycin (72.2%), and meropenem (63.6%). None of the isolates was, however, resistant to colistin. PCR results showed that blaOXA, blaTEM, and blaCTX-M genes were positive in some isolates, while blaSHV was not detected in any of the isolates. This study has revealed that the strains of A. baumannii isolated are multiple drug resistant. Regular monitoring, judicious prescription, and early detection of resistance to these antibiotics are, therefore, necessary to check further dissemination of the organism. PMID:27766173

  11. Acinetobacter baumannii phenylacetic acid metabolism influences infection outcome through a direct effect on neutrophil chemotaxis

    PubMed Central

    Bhuiyan, Md Saruar; Ellett, Felix; Murray, Gerald L.; Kostoulias, Xenia; Cerqueira, Gustavo M.; Schulze, Keith E.; Mahamad Maifiah, Mohd Hafidz; Li, Jian; Creek, Darren J.; Lieschke, Graham J.; Peleg, Anton Y.


    Innate cellular immune responses are a critical first-line defense against invading bacterial pathogens. Leukocyte migration from the bloodstream to a site of infection is mediated by chemotactic factors that are often host-derived. More recently, there has been a greater appreciation of the importance of bacterial factors driving neutrophil movement during infection. Here, we describe the development of a zebrafish infection model to study Acinetobacter baumannii pathogenesis. By using isogenic A. baumannii mutants lacking expression of virulence effector proteins, we demonstrated that bacterial drivers of disease severity are conserved between zebrafish and mammals. By using transgenic zebrafish with fluorescent phagocytes, we showed that a mutation of an established A. baumannii global virulence regulator led to marked changes in neutrophil behavior involving rapid neutrophil influx to a localized site of infection, followed by prolonged neutrophil dwelling. This neutrophilic response augmented bacterial clearance and was secondary to an impaired A. baumannii phenylacetic acid catabolism pathway, which led to accumulation of phenylacetate. Purified phenylacetate was confirmed to be a neutrophil chemoattractant. These data identify a previously unknown mechanism of bacterial-guided neutrophil chemotaxis in vivo, providing insight into the role of bacterial metabolism in host innate immune evasion. Furthermore, the work provides a potentially new therapeutic paradigm of targeting a bacterial metabolic pathway to augment host innate immune responses and attenuate disease. PMID:27506797

  12. A case of necrotizing fasciitis with septic shock in a cat caused by Acinetobacter baumannii.


    Brachelente, Chiara; Wiener, Dominique; Malik, Yasminda; Huessy, Daniela


    A 4-year-old, neutered female, domestic shorthair cat admitted to the animal hospital for recurrent constipation presumed to be due to post-traumatic injuries, went into shock with signs including fever and ataxia followed by stupor. On the fifth day of hospitalization, the cat developed severe, diffuse oedema of the ventral abdomen with multifocal to coalescing erythematous areas and small vesicle formation. The results of bacteriological cultures of liver, spleen and kidney specimens led to the diagnosis of Acinetobacter baumannii sepsis. Histopathological findings of skin samples taken during necropsy showed an extensive epidermal and dermal necrosis with septic vasculitis and numerous intralesional gram-negative bacteria. Detection of the bla(OXA-51-like) gene specific for A. baumannii by PCR, performed retrospectively on samples of the deep layers of the skin, confirmed the presence of A. baumannii also in the cutaneous lesions. To our knowledge this is the first report of a necrotizing fasciitis with septic shock in a cat caused by A. baumannii.

  13. Insights on the Horizontal Gene Transfer of Carbapenemase Determinants in the Opportunistic Pathogen Acinetobacter baumannii.


    Da Silva, Gabriela Jorge; Domingues, Sara


    Horizontal gene transfer (HGT) is a driving force to the evolution of bacteria. The fast emergence of antimicrobial resistance reflects the ability of genetic adaptation of pathogens. Acinetobacter baumannii has emerged in the last few decades as an important opportunistic nosocomial pathogen, in part due to its high capacity of acquiring resistance to diverse antibiotic families, including to the so-called last line drugs such as carbapenems. The rampant selective pressure and genetic exchange of resistance genes hinder the effective treatment of resistant infections. A. baumannii uses all the resistance mechanisms to survive against carbapenems but production of carbapenemases are the major mechanism, which may act in synergy with others. A. baumannii appears to use all the mechanisms of gene dissemination. Beyond conjugation, the mostly reported recent studies point to natural transformation, transduction and outer membrane vesicles-mediated transfer as mechanisms that may play a role in carbapenemase determinants spread. Understanding the genetic mobilization of carbapenemase genes is paramount in preventing their dissemination. Here we review the carbapenemases found in A. baumannii and present an overview of the current knowledge of contributions of the various HGT mechanisms to the molecular epidemiology of carbapenem resistance in this relevant opportunistic pathogen.

  14. Emergence of Acinetobacter baumannii ST730 carrying the blaOXA-72 gene in Brazil.


    Pagano, Mariana; Rozales, Franciéli P; Bertolini, Diego; Rocha, Lisiane; Sampaio, Jorge Lm; Barth, Afonso L; Martins, Andreza F


    Over the last decade, Acinetobacter baumannii resistant to carbapenems has emerged in many medical centres and has been commonly associated with high morbimortality. In Brazil, this resistance is mainly attributed to the spread of OXA-23-producing clones and, to a lesser extent, to OXA-143-producing clones. Here, we describe, for the first time, two OXA-72-producing A. baumannii isolates in southern Brazil to a broad spectrum of antibiotics, except polymyxin B and tigecycline. Molecular typing by multilocus sequence typing (MLST) demonstrated that both OXA-72-producing isolates belong to a new sequence type (ST), ST730, which was recently identified in OXA-23-producing A. baumannii isolates in São Paulo, Brazil. We demonstrate that the two A. baumannii ST730 isolates carrying blaOXA-72share a common ancestral origin with the blaOXA-23producers in Brazil. This observation reinforces the importance of strain-typing methods in order to clarify the dynamics of the emergence of new clones in a geographic region.

  15. Emergence of Acinetobacter baumannii ST730 carrying the bla OXA-72 gene in Brazil

    PubMed Central

    Pagano, Mariana; Rozales, Franciéli P; Bertolini, Diego; Rocha, Lisiane; Sampaio, Jorge LM; Barth, Afonso L; Martins, Andreza F


    Over the last decade, Acinetobacter baumannii resistant to carbapenems has emerged in many medical centres and has been commonly associated with high morbimortality. In Brazil, this resistance is mainly attributed to the spread of OXA-23-producing clones and, to a lesser extent, to OXA-143-producing clones. Here, we describe, for the first time, two OXA-72-producing A. baumannii isolates in southern Brazil to a broad spectrum of antibiotics, except polymyxin B and tigecycline. Molecular typing by multilocus sequence typing (MLST) demonstrated that both OXA-72-producing isolates belong to a new sequence type (ST), ST730, which was recently identified in OXA-23-producing A. baumannii isolates in São Paulo, Brazil. We demonstrate that the two A. baumannii ST730 isolates carrying blaOXA-72share a common ancestral origin with the blaOXA-23producers in Brazil. This observation reinforces the importance of strain-typing methods in order to clarify the dynamics of the emergence of new clones in a geographic region. PMID:27653364

  16. DNA Microarray for Genotyping Antibiotic Resistance Determinants in Acinetobacter baumannii Clinical Isolates

    PubMed Central

    Dally, Simon; Lemuth, Karin; Kaase, Martin; Rupp, Steffen; Knabbe, Cornelius


    In recent decades, Acinetobacter baumannii has emerged as an organism of great concern due to its ability to accumulate antibiotic resistance. In order to improve the diagnosis of resistance determinants in A. baumannii in terms of lead time and accuracy, we developed a microarray that can be used to detect 91 target sequences associated with antibiotic resistance within 4 h from bacterial culture to result. The array was validated with 60 multidrug-resistant strains of A. baumannii in a blinded, prospective study. The results were compared to phenotype results determined by the automated susceptibility testing system VITEK2. Antibiotics considered were piperacillin-tazobactam, ceftazidime, imipenem, meropenem, trimethoprim-sulfamethoxazole, amikacin, gentamicin, tobramycin, ciprofloxacin, and tigecycline. The average positive predictive value, negative predictive value, sensitivity, and specificity were 98, 98, 99, and 94%, respectively. For carbapenemase genes, the array results were compared to singleplex PCR results provided by the German National Reference Center for Gram-Negative Pathogens, and results were in complete concordance. The presented array is able to detect all relevant resistance determinants of A. baumannii in parallel. The short handling time of 4 h from culture to result helps to provide fast results in order to initiate adequate anti-infective therapy for critically ill patients. Another application would be data acquisition for epidemiologic surveillance. PMID:23856783

  17. The Acinetobacter baumannii Oxymoron: Commensal Hospital Dweller Turned Pan-Drug-Resistant Menace

    PubMed Central

    Roca, Ignasi; Espinal, Paula; Vila-Farrés, Xavier; Vila, Jordi


    During the past few decades Acinetobacter baumannii has evolved from being a commensal dweller of health-care facilities to constitute one of the most annoying pathogens responsible for hospitalary outbreaks and it is currently considered one of the most important nosocomial pathogens. In a prevalence study of infections in intensive care units conducted among 75 countries of the five continents, this microorganism was found to be the fifth most common pathogen. Two main features contribute to the success of A. baumannii: (i) A. baumannii exhibits an outstanding ability to accumulate a great variety of resistance mechanisms acquired by different mechanisms, either mutations or acquisition of genetic elements such as plasmids, integrons, transposons, or resistant islands, making this microorganism multi- or pan-drug-resistant and (ii) The ability to survive in the environment during prolonged periods of time which, combined with its innate resistance to desiccation and disinfectants, makes A. baumannii almost impossible to eradicate from the clinical setting. In addition, its ability to produce biofilm greatly contributes to both persistence and resistance. In this review, the pathogenesis of the infections caused by this microorganism as well as the molecular bases of antibacterial resistance and clinical aspects such as treatment and potential future therapeutic strategies are discussed in depth. PMID:22536199

  18. Differential protection from tobramycin by extracellular polymeric substances from Acinetobacter baumannii and Staphylococcus aureus biofilms.


    Davenport, Emily K; Call, Douglas R; Beyenal, Haluk


    We investigated biofilms of two pathogens, Acinetobacter baumannii and Staphylococcus aureus, to characterize mechanisms by which the extracellular polymeric substance (EPS) found in biofilms can protect bacteria against tobramycin exposure. To do so, it is critical to study EPS-antibiotic interactions in a homogeneous environment without mass transfer limitations. Consequently, we developed a method to grow biofilms, harvest EPS, and then augment planktonic cultures with isolated EPS and tobramycin. We demonstrated that planktonic cultures respond differently to being treated with different types of EPS (A. baumannii versus S. aureus) in the presence of tobramycin. By harvesting EPS from the biofilms, we found that A. baumannii EPS acts as a "universal protector" by inhibiting tobramycin activity against bacterial cells regardless of species; S. aureus EPS did not show any protective ability in cell cultures. Adding Mg(2+) or Ca(2+) reduced the protective effect of A. baumannii EPS. Finally, when we selectively digested the proteins or DNA of the EPS, we found that the protective ability did not change, suggesting that neither has a significant role in protection. To the best of our knowledge, this is the first study that demonstrates how EPS protects pathogens against antibiotics in a homogeneous system without mass transfer limitations. Our results suggest that EPS protects biofilm communities, in part, by adsorbing antibiotics near the surface. This may limit antibiotic diffusion to the bottom of the biofilms but is not likely to be the only mechanism of protection.

  19. Isolation and Characterization of Acinetobacter baumannii Recovered from Campylobacter Selective Medium

    PubMed Central

    Fernando, Dinesh M.; Khan, Izhar U. H.; Patidar, Rakesh; Lapen, David R.; Talbot, Guylaine; Topp, Edward; Kumar, Ayush


    Acinetobacter baumannii, a Gram-negative opportunistic pathogen, is known to cause multidrug resistant infections. This organism has primarily been isolated from clinical environments and its environmental reservoirs remain largely unknown. In the present study, we recovered seven isolates of A. baumannii growing under conditions selective for Campylobacter spp. (microaerophilic at 42°C and in the presence of antibiotics) from dairy cattle manure storage tank or surface water impacted by livestock effluents. Antibiotic susceptibility tests revealed that all of these isolates were less susceptible to at least two different clinically relevant antibiotics, compared to the type strain A. baumannii ATCC17978. Expression of resistance-nodulation-division efflux pumps, an important mechanism of intrinsic resistance in these organisms, was analyzed, and adeB was found to be overexpressed in one and adeJ was overexpressed in three isolates. Comparison of these isolates using genomic DNA Macro-Restriction Fragment Pattern Analysis (MRFPA) revealed relatively low relatedness among themselves or with some of the clinical isolates from previous studies. This study suggests that A. baumannii isolates are capable of growing under selective conditions for Campylobacter spp. and that this organism can be present in manure and water. PMID:27917170

  20. Variable number tandem repeat loci providing discrimination within widespread genotypes of Acinetobacter baumannii.


    Turton, J F; Matos, J; Kaufmann, M E; Pitt, T L


    Some genotypes of Acinetobacter baumannii, defined by pulsed-field gel electrophoresis (PFGE), have been found in many hospitals. Our aim was to find variable number tandem repeat (VNTR) loci capable of providing discrimination among isolates with highly similar or identical PFGE profiles, to gain insights into the epidemiology. Thirteen loci identified in A. baumannii ATCC 17978 were tested using a panel of isolates that included multiple representatives of genotypes belonging to the three European clonal lineages. Two loci, with repeat units of 9 and 6 bp respectively were selected. Repeat numbers varied between 3 and 29, and 9 and 26 respectively at the two loci. The repeat numbers of representatives of each genotype often differed between hospitals, providing a means of tracking patient transfers and possible transmissions between patients. The results suggest that this analysis accurately reflects the known epidemiological information, and provides a valuable tool for cross-infection studies.

  1. Antibiotic resistance determinants of a group of multidrug-resistant Acinetobacter baumannii in China.


    Xiao-Min, Xu; You-Fen, Fan; Wei-Yun, Feng; Zu-Huang, Mi; Xing-Bei, Weng


    A group of Acinetobacter baumannii confers multidrug resistance, but the molecular epidemiology and multidrug resistance mechanisms are poorly understood. Nineteen isolates were identified, and the antimicrobial susceptibility profile was determined using the disc diffusion method. Then, PCR of 78 kinds of resistance-associated genes were performed. A novel variant of blaADC gene: blaADC-67 gene (Genbank accession No. JX169789) was prevalent in all 19 isolates. Moreover, ISAba1 could also provide strong promoter to upregulate the expression of blaADC67 to confer resistance to beta-lactam. This is the first report of emergence of blaADC-67 in A. baumannii worldwide, which might confer resistance to beta-lactam.

  2. Discovery and Characterization of New Hydroxamate Siderophores, Baumannoferrin A and B, produced by Acinetobacter baumannii.


    Penwell, William F; DeGrace, Nancy; Tentarelli, Sharon; Gauthier, Lise; Gilbert, Catherine M; Arivett, Brock A; Miller, Alita A; Durand-Reville, Thomas F; Joubran, Camil; Actis, Luis A


    Acinetobacter baumannii AYE does not produce acinetobactin but grows under iron limitation. Accordingly, analyses of AYE iron-restricted culture supernatants resulted in the isolation of two fractions, which contained only hydroxamates and showed siderophore activity. Structural analyses identified baumannoferrin A and baumannoferrin B, which differ only by a double bond. These siderophores are composed of citrate, 1,3-diaminopropane, 2,4-diaminobutyrate, decenoic acid, and α-ketoglutarate. Analysis of the AYE genome showed the presence of a 12-gene cluster coding for proteins similar to those involved in the production and utilization of the hydroxamate siderophores acinetoferrin and achromobactin. As A. baumannii AYE does not produce acinetobactin and harbors only one gene cluster encoding the production and utilization of a siderophore, this strain's growth under iron limitation depends on baumannoferrin, a novel hydroxamate that could play a role in its virulence.

  3. Biotypes, serovars and antimicrobial resistance patterns of Acinetobacter baumannii clinical isolates.


    Oliveira, M G; Irino, K; Vaz, T M; Gonçalves, C R; Levy, C E


    255 Acinetobacter strains, from clinical specimens of inpatients and outpatients, were identified phenotypically according to the new taxonomy proposed by Bouvet and Grimont. A. baumannii was the most frequent species (80.8%). This species underwent biotyping and serotyping according to the scheme of Bouvet and Grimont, and that of Traub, respectively, 81.2% of samples belonged to biotypes 2, 6 and 9 with a predominance of biotype 2. 86.6% of the strains could be serotyped; 2 new serotypes were encountered. The new serotype 29, being the most frequently isolated, was related to biotype 2 (86.6%), whereas serotype 13 was related to biotype 6 (84.8%). These clones presented marked multiple resistance patterns and were widespread in different wards. No outbreak was reported during the period studied. These phenotypical methods proved to be useful in differentiating strains of A. baumannii and, if used together, they showed a high discriminatory power.

  4. Combined therapy for multi-drug-resistant Acinetobacter baumannii infection--is there evidence outside the laboratory?


    Tuon, Felipe F; Rocha, Jaime L; Merlini, Alexandre B


    Acinetobacter are among the most common bacteria isolated in hospital infections, especially in developing countries. Multi-drug, extended-drug or pan-drug resistance makes treatment a real medical challenge. In the present review, the authors describe clinical and experimental data in order to present different current and potential future strategies to treat infections caused by multi-drug-resistant Acinetobacter. The therapeutic options for carbapenem-resistant Acinetobacter are scarce, and the current options have poor pharmacokinetic aspects and several side effects. Combined therapy has been an alternative for multi-drug-resistant Acinetobacter. However, this issue is always controversial. In some studies combined therapy has shown superiority for some strains of Acinetobacter in animal models and in vitro studies. However, studies with humans are scarce and too poor quality to suggest the best approach for the treatment of infections caused by multi-drug-resistant Acinetobacter baumannii.

  5. Light modulates metabolic pathways and other novel physiological traits in the human pathogen Acinetobacter baumannii.


    Müller, Gabriela L; Tuttobene, Marisel; Altilio, Matías; Martinez Amezaga, Maitena; Nguyen, Meaghan; Pamela Cribb, P; Cybulski, Larisa E; Ramírez, María Soledad; Altabe, Silvia; Mussi, María Alejandra


    Light sensing in chemotrophic bacteria has been relatively recently ascertained. In the human pathogen Acinetobacter baumannii, light modulates motility, biofilm formation and virulence through the BLUF photoreceptor BlsA. In addition, light can induce reduction in susceptibility to certain antibiotics such as minocycline and tigecycline in a photoreceptor-independent manner. In this work we identified new traits whose expression are modulated by light in this pathogen, which comprise not only important determinants related to pathogenicity and antibiotic resistance, but also metabolic pathways, which represents a novel concept for chemotrophic bacteria. Indeed, the phenylacetic acid catabolic pathway as well as trehalose biosynthesis were modulated by light, responses that completely depend on BlsA. We further show that tolerance to some antibiotics as well as modulation of antioxidant enzyme levels are also influenced by light, likely contributing to bacterial persistence in adverse environments. Also, we present evidence indicating that surfactant production is modulated by light. Finally, the expression of whole pathways and gene clusters such as genes involved in lipid metabolism and genes encoding components of the type VI secretion system, as well as efflux pumps related to antibiotic resistance, were differentially induced by light. Overall, our results indicate that light modulates global features of A. baumannii lifestyle.Importance The discovery that non-phototrophic bacteria respond to light constituted a novel concept in microbiology. In this context, we demonstrated that light could modulate aspects related to bacterial virulence, persistence and resistance to antibiotics in the human pathogen Acinetobacter baumannii In this work, we present the novel finding that light directly regulates metabolism in this chemotrophic bacterium. Insights into the mechanism show the involvement of the photoreceptor BlsA. In addition, tolerance to antibiotics and

  6. Colistin and tigecycline for management of external ventricular device-related ventriculitis due to multidrug-resistant Acinetobacter baumannii

    PubMed Central

    Shrestha, Gentle Sunder; Tamang, Sushil; Paneru, Hem Raj; Shrestha, Pramesh Sunder; Keyal, Niraj; Acharya, Subhash Prasad; Marhatta, Moda Nath; Shilpakar, Sushil


    Acinetobacter baumannii is an important cause of nosocomial ventriculitis associated with external ventricular device (EVD). It is frequently multidrug resistant (MDR), carries a poor outcome, and is difficult to treat. We report a case of MDR Acinetobacter ventriculitis treated with intravenous and intraventricular colistin together with intravenous tigecycline. The patient developed nephrotoxicity and poor neurological outcome despite microbiological cure. Careful implementation of bundle of measures to minimize EVD-associated ventriculitis is valuable. PMID:27365967

  7. Clonal spread of blaOXA-72-carrying Acinetobacter baumannii sequence type 512 in Taiwan.


    Kuo, Han-Yueh; Hsu, Po-Jui; Chen, Jiann-Yuan; Liao, Po-Cheng; Lu, Chia-Wei; Chen, Chang-Hua; Liou, Ming-Li


    This is the first report to show an insidious outbreak of armA- and blaOXA-72-carrying Acinetobacter baumannii sequence type 512 (ST512) at a study hospital in northern Taiwan. Multilocus sequence typing revealed that this was a ST512 clone. All of the isolates with ST512 carried a novel 12,056-bp repGR2 in combination with a repGR12-type plasmid. This plasmid, designated pAB-ML, had one copy of the blaOXA-72 gene that was flanked by XerC/XerD-like sites and conferred resistance to carbapenems.

  8. In Vivo Fitness Adaptations of Colistin-Resistant Acinetobacter baumannii Isolates to Oxidative Stress

    PubMed Central

    Singh, Shweta S.; Alamneh, Yonas; Casella, Leila G.; Ernst, Robert K.; Lesho, Emil P.; Waterman, Paige E.; Zurawski, Daniel V.


    ABSTRACT The loss of fitness in colistin-resistant (CR) Acinetobacter baumannii was investigated using longitudinal isolates from the same patient. Early CR isolates were outcompeted by late CR isolates for growth in broth and survival in the lungs of mice. Fitness loss was associated with an increased susceptibility to oxidative stress since early CR strains had reduced in vitro survival in the presence of hydrogen peroxide and decreased catalase activity compared to that of late CR and colistin-susceptible (CS) strains. PMID:27993849

  9. Colistin-Resistant Acinetobacter baumannii Clinical Strains with Deficient Biofilm Formation

    PubMed Central

    Dafopoulou, Konstantina; Xavier, Basil Britto; Hotterbeekx, An; Janssens, Lore; Lammens, Christine; Dé, Emmanuelle; Goossens, Herman; Tsakris, Athanasios; Malhotra-Kumar, Surbhi


    In two pairs of clinical colistin-susceptible/colistin-resistant (Csts/Cstr) Acinetobacter baumannii strains, the Cstr strains showed significantly decreased biofilm formation in static and dynamic assays (P < 0.001) and lower relative fitness (P < 0.05) compared with those of the Csts counterparts. The whole-genome sequencing comparison of strain pairs identified a mutation converting a stop codon to lysine (*241K) in LpsB (involved in lipopolysaccharide [LPS] synthesis) in one Cstr strain and a frameshift mutation in CarO and the loss of a 47,969-bp element containing multiple genes associated with biofilm production in the other. PMID:26666921

  10. Diversity of polymyxin resistance mechanisms among Acinetobacter baumannii clinical isolates.


    Girardello, Raquel; Visconde, Marina; Cayô, Rodrigo; Figueiredo, Regina Célia Bressan Queiroz de; Mori, Marcelo Alves da Silva; Lincopan, Nilton; Gales, Ana Cristina


    Polymyxins have become drugs of last resort for treatment of multi-drug resistant (MDR) Gram-negative infections. However, the mechanisms of resistance to this compound have not been completely elucidated. In this study, we evaluated the mechanisms of resistance to this antimicrobial in two A. baumannii clinical isolates, respectively, susceptible (A027) and resistant (A009) to polymyxin B before and after polymyxin B exposure (A027(ind) and A009(ind)). The pmrAB and lpxACD were sequenced and their transcriptional levels were analyzed by qRT-PCR. The bacterial cell morphology was evaluated by transmission electronic microscopy (TEM) and the membrane potential was measured using Zeta-potential analyzer. The virulence of strains was studied using a Caenorhabditis elegans model. Both clinical isolates exhibited an elevation of the polymyxin B MIC after exposure to this compound. On the other hand, A027(ind) showed decreased values of MIC for β-lactams, aminoglycosides, vancomycin, teicoplanin, oxacillin and erythromycin. A027(ind) harbored two mutations in pmrB and the ISAba125 disrupting the lpxA. In contrast, A009(ind) strain exhibited increase of pmrB transcriptional level, after polymyxin B exposure, despite the absence of mutations in the pmrAB genes. The TEM images revealed a thicker and more electron-dense peptidoglycan layer for A009 than that of A027. The exposure to polymyxin B induced a strong condensation and darkening of intracellular material, mainly in A009(ind). In addition, the surface charge of A009 was significantly less negative than the one of A027. Using the C. elegans model, only A027(ind) strain showed a reduction on virulence. The diversity of polymyxin B resistance mechanisms among A. baumannii strains evaluated in this study confirms the complexity of these mechanisms, which may vary depending of the background of each strain.

  11. Clinical isolates of Acinetobacter baumannii from a Portuguese hospital: PFGE characterization, antibiotic susceptibility and biofilm-forming ability.


    Duarte, Andreia; Ferreira, Susana; Almeida, Sofia; Domingues, Fernanda C


    Acinetobacter baumannii is an emerging pathogen associated with nosocomial infections that in addition has shown an increasing resistance to antibiotics. In this work the genetic diversity of A. baumannii isolates from a Portuguese hospital, their antibiotic resistance profiles and ability to form biofilms was studied. Seventy-nine clinical A. baumannii isolates were characterized by pulsed-field gel electrophoresis (PFGE) with 9 different PFGE profiles being obtained. Concerning the antimicrobial susceptibility, all A. baumannii isolates were resistant to 12 of the 17 tested antibiotics and classified as multidrug-resistant (MDR). In addition, 74.7% of the isolates showed biofilm formation ability, however no statistical significance with antibiotic resistance was observed. In contrast, urine samples isolates were more likely to form biofilms than strains isolated from other sources. Our findings highlight the high number of MDR A. baumannii isolates and the importance of the formation of biofilms as a potential virulence factor.

  12. Use of a stainless steel washer platform to study Acinetobacter baumannii adhesion and biofilm formation on abiotic surfaces

    PubMed Central

    Orsinger-Jacobsen, Samantha J.; Patel, Shenan S.; Vellozzi, Ernestine M.; Gialanella, Phillip; Nimrichter, Leonardo; Miranda, Kildare


    Acinetobacter baumannii is a frequent cause of hospital-acquired pneumonia, and has recently increased in incidence as the causative agent of severe disease in troops wounded in Afghanistan and Iraq. Clinical approaches are limited since A. baumannii strains isolated from patients are extremely resistant to current antimicrobials. A. baumannii can survive desiccation and during outbreaks has been recovered from various sites in the patients’ environment. To better understand its prevalence in hospital settings, we used a stainless steel washer (SSW) platform to investigate A. baumannii biofilm formation on abiotic surfaces. Scanning electron microscopy demonstrated that A. baumannii forms strong biofilms on stainless steel surfaces. This platform was combined with a colorimetric 2,3-bis(2-methoxy-4-nitro-5-sulfophenyl)-5-[(phenylamino)carbonyl]-2H-tetrazolium hydroxide (XTT) reduction assay to observe the metabolic activity of bacterial cells, and to facilitate the manipulation and comparison of multiple A. baumannii clinical strains. A strong correlation between XTT and c.f.u. assays was demonstrated. To complement the cell viability assays, A. baumannii biofilm mass was measured by crystal violet staining. Furthermore, the effect of commonly used disinfectants and environmental stressors on A. baumannii biofilms and planktonic cells was compared and characterized. Biofilms on SSWs were significantly more resistant than their planktonic counterparts, providing additional evidence that may allow us to understand the high prevalence of this microbe in hospital settings. Our results validate that SSWs are a simple, versatile and innovative method to study A. baumannii biofilms in vitro. PMID:24025603

  13. Adjuvant role of Pseudomonas flagellin for Acinetobacter baumannii biofilm associated protein

    PubMed Central

    Sefidi, Mozhgan Derakhshan; Rasooli, Iraj; Owlia, Parviz; Talei, Daryush; Astaneh, Shakiba Darvish Alipour; Nazarian, Shahram


    AIM To study immunogenicity of Pseudomonas N terminal flagellin as an adjuvant for Acinetobacter baumannii (A. baumannii) biofilm associated protein (Bap). METHODS The N terminal flagellin gene was amplified. The pET28a (+) and polymerase chain reaction products were digested with HindIII and EcoR I. The ligation of N terminal flagellin into pET28a (‏+) was performed using T4 DNA ligase and was then transformed into Escherichia coli BL21 (DE3) as a suitable expression host. pET28a (‏+) vector harboring a conserved region of Bap from our previous work was used. The recombinant proteins were expressed, analyzed by SDS-PAGE method and was purified by affinity chromatography with His-Tag residues followed by confirmation with western blotting. Mice were immunized with recombinant N terminal flagellin and Bap subunits. The immunized animals were intranasally (i.n) challenged with A. baumannii and Pseudomonas aeruginosa (P. aeruginosa). RESULTS The flagellin enhanced the immunogenicity of Bap causing an increase in specific IgG titers in serum (P < 0.001). Internal organs, i.e., liver, lung and spleen of the Bap-Flagellin immunized group challenged with A. baumannii showed significantly lower bacterial load compared to the control group. The bacterial loads were studied in internal organs. A. baumannii infected immunized animals with Bap-Flagellin exhibited internal organs with minor bacterial load while P. aeruginosa PAO1 infected group showed heavy bacterial load of (4.3 ± 0.12) × 106, (1.1 ± 0.01) × 106 and (2.2 ± 0.22) × 106 per gram of lungs, liver and spleen respectively. Bacterial loads were detected per gram of lungs, liver and spleen of the mice group immunized with Bap were (1.2 ± 0.06) × 107, (11.1 ± 0.041) × 105 and (3.6 ± 0.42) × 106 respectively. In vivo neutralization assay indicated that all experimental mice groups, except for Flagellin administered group was significantly (P < 0.05) protected against A. baumannii. CONCLUSION These

  14. Tigecycline combination for ventilator-associated pneumonia caused by extensive drug-resistant Acinetobacter baumannii

    PubMed Central

    Zheng, Yali; Tang, Xiao; Wang, Rui; Tong, Zhaohui


    Background Extensive drug-resistant Acinetobacter baumannii (XDR A. baumannii) has emerged as an important pathogen in patients with ventilator-associated pneumonia (VAP) worldwide. This study determined whether or not combination tigecycline (TGC) treatment improved the short-term outcome of patients with XDR A. baumannii-induced VAP. Methods: Fifty-eight patients admitted to our intensive care unit (ICU) with confirmed XDR A. baumannii VAP between January 2011 and June 2013 were retrospectively studied. Fourteen patients were excluded. The included subjects were classified into two groups depending on treatment regimens with or without TGC (TGC group, n=20; non-TGC group, n=24). Thirty-day mortality rates, and clinical and microbiologic responses were reviewed and compared in detail. Results Microbiological eradication was observed in 3 patients (15.0%) in the TGC group and 7 patients (29.2%) in the non-TGC group (P=0.264). The mean time-to-eradication of XDR A. baumannii was 5.3±2.1 versus 7.6±4.0 days (P=0.395). Ten of 20 (50%) patients developed resistance to TGC after initiation of TGC therapy in the TGC group. Clinical cure were achieved in 50.0% of the patients (10/20) in the TGC group and 45.8% of the patients (7/24) in the non-TGC group (P=1.000). No differences existed in the 30-day mortality, length of ICU stay, length of hospital stay (LOS), and length of invasive mechanical ventilation (MV) between the two groups. The occurrence of septic shock was significantly lower in the TGC group (20.0% vs. 54.2%; P=0.030). Conclusions TGC combination therapy did not improve the clinical cure and microbiologic eradication in patients with XDR A. baumannii VAP. TGC combination therapy did not decrease all-cause mortality in patients with XDR A. baumannii VAP. TGC combination therapy reduced the incidence of septic shock in patients with XDR A. baumannii VAP, and might decrease the incidence of poly-microbial VAP. TGC combination therapy can only be recommended

  15. Rapid detection of Acinetobacter baumannii and molecular epidemiology of carbapenem-resistant A. baumannii in two comprehensive hospitals of Beijing, China

    PubMed Central

    Li, Puyuan; Niu, Wenkai; Li, Huan; Lei, Hong; Liu, Wei; Zhao, Xiangna; Guo, Leijing; Zou, Dayang; Yuan, Xin; Liu, Huiying; Yuan, Jing; Bai, Changqing


    Acinetobacter baumannii is an important opportunistic pathogen associated with a variety of nosocomial infections. A rapid and sensitive molecular detection in clinical isolates is quite needed for the appropriate therapy and outbreak control of A. baumannii. Group 2 carbapenems have been considered the agents of choice for the treatment of multiple drug-resistant A. baumannii. But the prevalence of carbapenem-resistant A. baumannii (CRAB) has been steadily increasing in recent years. Here, we developed a loop-mediated isothermal amplification (LAMP) assay for the rapid detection of A. baumannii in clinical samples by using high-specificity primers of the blaOXA-51 gene. Then we investigated the OXA-carbapenemases molecular epidemiology of A. baumannii isolates in two comprehensive hospitals in Beijing. The results showed that the LAMP assay could detect target DNA within 60 min at 65°C. The detection limit was 50 pg/μl, which was about 10-fold greater than that of PCR. Furthermore, this method could distinguish A. baumannii from the homologous A. nosocomialis and A. pittii. A total of 228 positive isolates were identified by this LAMP-based method for A. baumannii from 335 intensive care unit patients with clinically suspected multi-resistant infections in two hospitals in Beijing. The rates of CRAB are on the rise and are slowly becoming a routine phenotype for A. baumannii. Among the CRABs, 92.3% harbored both the blaOXA-23 and blaOXA-51 genes. Thirty-three pulsotypes were identified by pulsed-field gel electrophoresis, and the majority belonged to clone C. In conclusion, the LAMP method developed for detecting A. baumannii was faster and simpler than conventional PCR and has great potential for both point-of-care testing and basic research. We further demonstrated a high distribution of class D carbapenemase-encoding genes, mainly OXA-23, which presents an emerging threat in hospitals in China. PMID:26441924

  16. Intraspecies Transfer of the Chromosomal Acinetobacter baumannii blaNDM-1 Carbapenemase Gene

    PubMed Central

    Krahn, Thomas; Wibberg, Daniel; Maus, Irena; Winkler, Anika; Bontron, Séverine; Sczyrba, Alexander; Nordmann, Patrice; Pühler, Alfred; Poirel, Laurent


    The species Acinetobacter baumannii is one of the most important multidrug-resistant human pathogens. To determine its virulence and antibiotic resistance determinants, the genome of the nosocomial blaNDM-1-positive A. baumannii strain R2090 originating from Egypt was completely sequenced. Genome analysis revealed that strain R2090 is highly related to the community-acquired Australian A. baumannii strain D1279779. The two strains belong to sequence type 267 (ST267). Isolate R2090 harbored the chromosomally integrated transposon Tn125 carrying the carbapenemase gene blaNDM-1 that is not present in the D1279779 genome. To test the transferability of the metallo-β-lactamase (MBL) gene region, the clinical isolate R2090 was mated with the susceptible A. baumannii recipient CIP 70.10, and the carbapenem-resistant derivative R2091 was obtained. Genome sequencing of the R2091 derivative revealed that it had received an approximately 66-kb region comprising the transposon Tn125 embedding the blaNDM-1 gene. This region had integrated into the chromosome of the recipient strain CIP 70.10. From the four known mechanisms for horizontal gene transfer (conjugation, outer membrane vesicle-mediated transfer, transformation, and transduction), conjugation could be ruled out, since strain R2090 lacks any plasmid, and a type IV secretion system is not encoded in its chromosome. However, strain R2090 possesses three putative prophages, two of which were predicted to be complete and therefore functional. Accordingly, it was supposed that the transfer of the resistance gene region from the clinical isolate R2090 to the recipient occurred by general transduction facilitated by one of the prophages present in the R2090 genome. Hence, phage-mediated transduction has to be taken into account for the dissemination of antibiotic resistance genes within the species A. baumannii. PMID:26953198

  17. Distribution and expression of the Ade multidrug efflux systems in Acinetobacter baumannii clinical isolates.


    Pagdepanichkit, Sirawit; Tribuddharat, Chanwit; Chuanchuen, Rungtip


    One hundred Acinetobacter baumannii clinical isolates were examined for inhibitory effect of reserpine and carbonyl cyanide m-chlorophenylhydrazone (CCCP) on the antimicrobial susceptibility and expression of 4 resistant-nodulation-cell division (RND)-type multidrug efflux systems, including AdeABC, AdeDE, AdeIJK, and AdeFGH, using RT-PCR. Ten A. baumannii isolates expressing AdeABC, AdeIJK, or AdeFGH were randomly selected for determination of transcription level and regulatory mutations. While all the isolates were resistant to multiple drugs, the reserpine and CCCP experiment showed that the multidrug resistance phenotype in most A. baumannii isolates was associated with efflux pumps. Most isolates expressed at least one of the RND-type efflux pumps tested (97%). AdeIJK expression was most common (97%), but none of the isolates produced AdeDE. Fifty-two percent of the A. baumannii isolates simultaneously produced up to 3 RND-type efflux systems (i.e., AdeABC, AdeFGH, and AdeIJK). No good correlation between the expression of RND-type efflux pumps and the type of antimicrobial resistance was observed. Overexpression of AdeABC, AdeIJK, and AdeFGH was not always related to the presence of mutations in their corresponding regulatory genes. This study highlights (i) the universal presence of the RND-type efflux pumps with variable levels of expression level among the A. baumannii in this collection and (ii) the complexity of their regulation of expression.

  18. Photodynamic Inactivation of Acinetobacter baumannii Using Phenothiazinium Dyes: In Vitro and In Vivo Studies

    PubMed Central

    Ragàs, Xavier; Dai, Tianhong; Tegos, George P.; Agut, Montserrat; Nonell, Santi; Hamblin, Michael R.


    Background and Objective Phenothiazinium dyes have been reported to be effective photosensitizers inactivating a wide range of microorganisms in vitro after illumination with red light. However, their application in vivo has not extensively been explored. This study evaluates the bactericidal activity of phenothiazinium dyes against multidrug-resistant Acinetobacter baumannii both in vitro and in vivo. Study Design/Materials and Methods We report the investigation of toluidine blue O, methylene blue, 1,9-dimethylmethylene blue, and new methylene blue for photodynamic inactivation of multidrug-resistant A. baumannii in vitro. The most effective dye was selected to carry out in vivo studies using third-degree mouse burns infected with a bioluminescent A. baumannii strain, upon irradiation with a 652 nm noncoherent light source. The mice were imaged daily for 2 weeks to observe differences in the bioluminescence–time curve between the photodynamic therapy (PDT)-treated mice in comparison with untreated burns. Results All the dyes were effective in vitro against A. baumannii after 30 J/cm2 irradiation of 635 or 652 nm red light had been delivered, with more effective killing when the dye remained in solution. New methylene blue was the most effective of the four dyes, achieving a 3.2-log reduction of the bacterial luminescence during PDT in vivo after 360 J/cm2 and an 800 μM dye dose. Moreover, a statistically significant reduction of the area under the bioluminescence–time curve of PDT-treated mice was observed showing that the infection did not recur after PDT. Conclusions Phenothiazinium dyes, and especially new methylene blue, are potential photosensitizers for PDT to treat burns infected with multidrug-resistant A. baumannii in vivo. PMID:20583252

  19. Rapid detection of blaOXA in carbapenem-susceptible Acinetobacter radioresistens bacteremia leading to unnecessary antimicrobial administration.


    Brady, Adam C; Lewis, James S; Pfeiffer, Christopher D


    Rapid molecular techniques to identify resistant pathogens are revolutionizing antibiotic stewardship; however, it is important to recognize the limitations of these techniques. Herein we describe two cases of bacteremia that were both initially identified by genotypic testing as carbapenem-resistant Acinetobacter spp. and subsequently identified phenotypically as carbapenem-susceptible A. radioresistens. The genotypic results prompted unnecessary broad-spectrum antibiotic use and infection control concerns.

  20. Deciphering the iron response in Acinetobacter baumannii: a proteomics approach

    PubMed Central

    Nwugo, Chika; Gaddy, Jennifer A.; Zimbler, Daniel L.; Actis, Luis A.


    Iron is an essential nutrient that plays a role in bacterial differential gene expression and protein production. Accordingly, the comparative analysis of total lysate and outer membrane fractions isolated from A. baumannii ATCC 19606T cells cultured under iron-rich and -chelated conditions using 2-D gel electrophoresis-mass spectrometry resulted in the identification of 58 protein spots differentially produced. While 19 and 35 of them represent iron-repressed and iron-induced protein spots, respectively, four other spots represent a metal chelation response unrelated to iron. Most of the iron-repressed protein spots represent outer membrane siderophore receptors, some of which could be involved in the utilization of siderophores produced by other bacteria. The iron-induced protein spots represent a wide range of proteins including those involved in iron storage, such as Bfr, metabolic and energy processes, such as AcnA, AcnB, GlyA, SdhA, and SodB, as well as lipid biosynthesis. The detection of an iron-regulated Hfq ortholog indicates that iron regulation in this bacterium could be mediated by Fur and small RNAs as described in other bacteria. The iron-induced production of OmpA suggests this protein plays a role in iron metabolism as shown by the diminished ability of an OmpA isogenic deficient derivative to grow under iron-chelated conditions. PMID:20692388

  1. Genome Sequence of Acinetobacter baumannii Strain D36, an Antibiotic-Resistant Isolate from Lineage 2 of Global Clone 1

    PubMed Central

    Hamidian, Mohammad; Hawkey, Jane


    Multiply antibiotic-resistant Acinetobacter baumannii isolate D36 was recovered in Australia in 2008 and belongs to a distinct lineage of global clone 1 (GC1). Here, we present the complete 4.13 Mbp genome sequence (chromosome plus 4 plasmids), generated via long read sequencing (PacBio). PMID:26679588

  2. Draft Genome Sequences of Seven Multidrug-Resistant Acinetobacter baumannii Strains, Isolated from Respiratory Samples in Spain

    PubMed Central

    Labrador-Herrera, Gema; Álvarez, Rocío; López-Rojas, Rafael; Smani, Younes; Cebrero-Cangueiro, Tania; Rueda, Antonio; Pérez Florido, Javier; Pachón-Ibáñez, María Eugenia


    The draft genome sequences of seven multidrug-resistant Acinetobacter baumannii clinical strains belonging to sequence types ST-208 and ST-218 are reported in this study. They were isolated from tracheobronchial aspirate of mechanically ventilated adult patients admitted to the intensive care unit of a Spanish tertiary hospital during 2010 to 2011. PMID:27034482

  3. Genome Sequence of vB_AbaS_TRS1, a Viable Prophage Isolated from Acinetobacter baumannii Strain A118

    PubMed Central

    Turner, Dann; Wand, Matthew E.; Sutton, J. Mark; Centron, Daniela; Kropinski, Andrew M.


    A novel temperate phage, vB_AbaS_TRS1, was isolated from cultures of Acinetobacter baumannii strain A118 that had been exposed to mitomycin C. Phage TRS1 belongs to the Siphoviridae family of bacteriophages and encapsulates a 40,749-bp genome encoding 70 coding sequences and a single tRNA. PMID:27738026

  4. Genome Sequence of vB_AbaS_TRS1, a Viable Prophage Isolated from Acinetobacter baumannii Strain A118.


    Turner, Dann; Wand, Matthew E; Sutton, J Mark; Centron, Daniela; Kropinski, Andrew M; Reynolds, Darren M


    A novel temperate phage, vB_AbaS_TRS1, was isolated from cultures of Acinetobacter baumannii strain A118 that had been exposed to mitomycin C. Phage TRS1 belongs to the Siphoviridae family of bacteriophages and encapsulates a 40,749-bp genome encoding 70 coding sequences and a single tRNA.

  5. Surface-associated motility, a common trait of clinical isolates of Acinetobacter baumannii, depends on 1,3-diaminopropane.


    Skiebe, Evelyn; de Berardinis, Véronique; Morczinek, Peter; Kerrinnes, Tobias; Faber, Franziska; Lepka, Daniela; Hammer, Bettina; Zimmermann, Ortrud; Ziesing, Stefan; Wichelhaus, Thomas A; Hunfeld, Klaus-Peter; Borgmann, Stefan; Gröbner, Sabine; Higgins, Paul G; Seifert, Harald; Busse, Hans-Jürgen; Witte, Wolfgang; Pfeifer, Yvonne; Wilharm, Gottfried


    While flagella-independent motility has long been described in representatives of the genus Acinetobacter, the mechanism of motility remains ambiguous. Acinetobacter baumannii, a nosocomial pathogen appearing increasingly multidrug-resistant, may profit from motility during infection or while persisting in the hospital environment. However, data on the frequency of motility skills among clinical A. baumannii isolates is scarce. We have screened a collection of 83 clinical A. baumannii isolates of different origin and found that, with the exception of one isolate, all were motile on wet surfaces albeit to varying degrees and exhibiting differing morphologies. Screening a collection of transposon mutants of strain ATCC 17978 for motility defects, we identified 2 akinetic mutants carrying transposon insertions in the dat and ddc gene, respectively. These neighbouring genes contribute to synthesis of 1,3-diaminopropane (DAP), a polyamine ubiquitously produced in Acinetobacter. Supplementing semi-solid media with DAP cured the motility defect of both mutants. HPLC analyses confirmed that DAP synthesis was abolished in ddc and dat mutants of different A. baumannii isolates and was re-established after genetic complementation. Both, the dat and ddc mutant of ATCC 17978 were attenuated in the Galleria mellonella caterpillar infection model. Taken together, surface-associated motility is a common trait of clinical A. baumannii isolates that requires DAP and may play a role in its virulence.

  6. Efficacy of Lysophosphatidylcholine in Combination with Antimicrobial Agents against Acinetobacter baumannii in Experimental Murine Peritoneal Sepsis and Pneumonia Models

    PubMed Central

    Parra Millán, R.; Jiménez Mejías, M. E.; Sánchez Encinales, V.; Ayerbe Algaba, R.; Gutiérrez Valencia, A.; Pachón Ibáñez, M. E.; Díaz, C.; Pérez del Palacio, J.; López Cortés, L. F.; Smani, Y.


    Immune response stimulation to prevent infection progression may be an adjuvant to antimicrobial treatment. Lysophosphatidylcholine (LPC) is an immunomodulator involved in immune cell recruitment and activation. In this study, we aimed to evaluate the efficacy of LPC in combination with colistin, tigecycline, or imipenem in experimental murine models of peritoneal sepsis and pneumonia. We used Acinetobacter baumannii strain Ab9, which is susceptible to colistin, tigecycline, and imipenem, and multidrug-resistant strain Ab186, which is susceptible to colistin and resistant to tigecycline and imipenem. Pharmacokinetic and pharmacodynamic parameters for colistin, tigecycline, and imipenem and the 100% minimal lethal dose (MLD100) were determined for both strains. The therapeutic efficacies of LPC, colistin (60 mg/kg of body weight/day), tigecycline (10 mg/kg/day), and imipenem (180 mg/kg/day), alone or in combination, were assessed against Ab9 and Ab186 at the MLD100 in murine peritoneal sepsis and pneumonia models. The levels of pro- and anti-inflammatory cytokines, i.e., tumor necrosis factor alpha (TNF-α) and interleukin-10 (IL-10), were determined by enzyme-linked immunosorbent assay (ELISA) for the same experimental models after inoculating mice with the MLD of both strains. LPC in combination with colistin, tigecycline, or imipenem markedly enhanced the bacterial clearance of Ab9 and Ab186 from the spleen and lungs and reduced bacteremia and mouse mortality rates (P < 0.05) compared with those for colistin, tigecycline, and imipenem monotherapies. Moreover, at 4 h post-bacterial infection, Ab9 induced higher TNF-α and lower IL-10 levels than those with Ab186 (4 μg/ml versus 3 μg/ml [P < 0.05] and 2 μg/ml versus 3.4 μg/ml [P < 0.05], respectively). LPC treatment combined with colistin, tigecycline, or imipenem modestly reduced the severity of infection by A. baumannii strains with different resistance phenotypes compared to LPC monotherapy in both

  7. H-NS plays a role in expression of Acinetobacter baumannii virulence features.


    Eijkelkamp, Bart A; Stroeher, Uwe H; Hassan, Karl A; Elbourne, Liam D H; Paulsen, Ian T; Brown, Melissa H


    Acinetobacter baumannii has become a major problem in the clinical setting with the prevalence of infections caused by multidrug-resistant strains on the increase. Nevertheless, only a limited number of molecular mechanisms involved in the success of A. baumannii as a human pathogen have been described. In this study, we examined the virulence features of a hypermotile derivative of A. baumannii strain ATCC 17978, which was found to display enhanced adherence to human pneumocytes and elevated levels of lethality toward Caenorhabditis elegans nematodes. Analysis of cellular lipids revealed modifications to the fatty acid composition, providing a possible explanation for the observed changes in hydrophobicity and subsequent alteration in adherence and motility. Comparison of the genome sequences of the hypermotile variant and parental strain revealed that an insertion sequence had disrupted an hns-like gene in the variant. This gene encodes a homologue of the histone-like nucleoid structuring (H-NS) protein, a known global transcriptional repressor. Transcriptome analysis identified the global effects of this mutation on gene expression, with major changes seen in the autotransporter Ata, a type VI secretion system, and a type I pilus cluster. Interestingly, isolation and analysis of a second independent hypermotile ATCC 17978 variant revealed a mutation to a residue within the DNA binding region of H-NS. Taken together, these mutants indicate that the phenotypic and transcriptomic differences seen are due to loss of regulatory control effected by H-NS.

  8. Acinetobacter baumannii Virulence Is Mediated by the Concerted Action of Three Phospholipases D

    PubMed Central

    Stahl, Julia; Bergmann, Holger; Göttig, Stephan; Ebersberger, Ingo; Averhoff, Beate


    Acinetobacter baumannii causes a broad range of opportunistic infections in humans. Its success as an emerging pathogen is due to a combination of increasing antibiotic resistance, environmental persistence and adaptation to the human host. To date very little is known about the molecular basis of the latter. Here we demonstrate that A. baumannii can use phosphatidylcholine, an integral part of human cell membranes, as sole carbon and energy source. We report on the identification of three phospholipases belonging to the PLD superfamily. PLD1 and PLD2 appear restricted to the bacteria and display the general features of bacterial phospholipases D. They possess two PLDc_2 PFAM domains each encompassing the HxKx4Dx6GS/GGxN (HKD) motif necessary for forming the catalytic core. The third candidate, PLD3, is found in bacteria as well as in eukaryotes and harbours only one PLDc_2 PFAM domain and one conserved HKD motif, which however do not overlap. Employing a markerless mutagenesis system for A. baumannii ATCC 19606T, we generated a full set of PLD knock-out mutants. Galleria mellonella infection studies as well as invasion experiments using A549 human lung epithelial cells revealed that the three PLDs act in a concerted manner as virulence factors and are playing an important role in host cell invasion. PMID:26379240

  9. Molecular epidemiology of carbapenem non-susceptible Acinetobacter baumannii in France.


    Jeannot, Katy; Diancourt, Laure; Vaux, Sophie; Thouverez, Michelle; Ribeiro, Amandina; Coignard, Bruno; Courvalin, Patrice; Brisse, Sylvain


    Carbapenem-resistant Acinetobacter baumannii have emerged globally. The objective of this study was to investigate the epidemiology, clonal diversity and resistance mechanisms of imipenem non-susceptible A. baumannii isolates in France. Between December 2010 and August 2011, 132 notifications were collected, including 37 outbreaks corresponding to 242 cases (2 to 55 per cluster). Multilocus sequence typing, pulsed-field gel electrophoresis (PFGE) and characterisation of carbapenemase-encoding genes were performed on 110 non-repetitive isolates. Gene blaOXA-23 was the most frequently detected (82%), followed by blaOXA-24 (11%) and blaOXA-58 (7%). Eleven sequence types (ST) were distinguished, among which sequence types ST1, ST2 (64%), ST20, ST25, ST85 and ST107. Isolates from epidemiological clusters had the same ST and resistance genes, indicating probable transmission within centres. In contrast, PFGE types of isolates differed among centres, arguing against transmission among centers. This study provides the first epidemiological snapshot of the population of A. baumannii with reduced susceptibility to carbapenems from France, and further underlines the predominance of international clones.

  10. Molecular Epidemiology of Carbapenem Non-Susceptible Acinetobacter baumannii in France

    PubMed Central

    Jeannot, Katy; Diancourt, Laure; Vaux, Sophie; Thouverez, Michelle; Ribeiro, Amandina; Coignard, Bruno; Courvalin, Patrice; Brisse, Sylvain


    Carbapenem-resistant Acinetobacter baumannii have emerged globally. The objective of this study was to investigate the epidemiology, clonal diversity and resistance mechanisms of imipenem non-susceptible A. baumannii isolates in France. Between December 2010 and August 2011, 132 notifications were collected, including 37 outbreaks corresponding to 242 cases (2 to 55 per cluster). Multilocus sequence typing, pulsed-field gel electrophoresis (PFGE) and characterisation of carbapenemase-encoding genes were performed on 110 non-repetitive isolates. Gene blaOXA-23 was the most frequently detected (82%), followed by blaOXA-24 (11%) and blaOXA-58 (7%). Eleven sequence types (ST) were distinguished, among which sequence types ST1, ST2 (64%), ST20, ST25, ST85 and ST107. Isolates from epidemiological clusters had the same ST and resistance genes, indicating probable transmission within centres. In contrast, PFGE types of isolates differed among centres, arguing against transmission among centers. This study provides the first epidemiological snapshot of the population of A. baumannii with reduced susceptibility to carbapenems from France, and further underlines the predominance of international clones. PMID:25517732

  11. Molecular Epidemiology and Characterization of Genotypes of Acinetobacter baumannii Isolates from Regions of South China.


    Ying, Jun; Lu, Junwan; Zong, Li; Li, Ailing; Pan, Ruowang; Cheng, Cong; Li, Kunpeng; Chen, Liqiang; Ying, Jianchao; Tou, Huifen; Zhu, Chuanxin; Xu, Teng; Yi, Huiguang; Li, Jinsong; Ni, Liyan; Xu, Zuyuan; Bao, Qiyu; Li, Peizhen


    The aim of this study was to analyze the molecular epidemiologic characteristics of Acinetobacter baumannii. A total of 398 isolates were collected in 7 regions of South China from January to June of 2012. Drug sensitivity was tested toward 15 commonly used antibiotics; thus, 146 multi-drug-resistant strains (resistant to more than 7 drugs) were identified, representing 36.7% of all isolates. Pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing (MLST) were used for molecular subtyping. According to the PFGE results (with a cutoff of 70% similarity for the DNA electrophoretic bands), 146 strains were subdivided into 15 clusters, with cluster A being the largest (33.6%, distributed in all districts except Jiaxing). Cluster B was also widespread and included 14.4% of all strains. In addition, MLST results revealed 11 sequence types (ST), with ST208 being the most prevalent, followed by ST191 and ST729. Furthermore, 4 novel alleles and 6 novel STs were identified. Our results showed that multi-drug-resistant A. baumannii in South China shares the origin with other widespread strains in other countries. The nosocomial infections caused by A. baumannii have been severe in South China. Continuous monitoring and judicious antibiotic use are required.

  12. Characteristics of multidrug-resistant Acinetobacter baumannii strains isolated in Geneva during colonization or infection.


    Cherkaoui, Abdessalam; Emonet, Stéphane; Renzi, Gesuele; Schrenzel, Jacques


    This study determined the antibiotic susceptibility profile and genetic mechanisms of β-lactam resistance in 27 clinical strains of Acinetobacter baumannii isolated at the University Hospitals of Geneva, Switzerland. The antimicrobial susceptibility testing was performed using Etest and the disc diffusion method in accordance with CLSI guidelines. All of the strains were defined as multi-drug resistant (MDR) and were susceptible to colistin and moderately susceptible to tigecycline. Uniplex PCR assays were used to detect the following β-lactamase genes: four class D carbapenem-hydrolysing oxacillinases (blaOXA-51, blaOXA-23, blaOXA-24 and blaOXA-58), four class B metallo-β-lactamases genes (blaIMP, blaVIM, blaSPM and blaNDM) and two class A carbapenemases (blaKPC and blaGES). All of the strains were positive for blaOXA-51 (intrinsic resistance), 14/27 strains carried blaOXA-23, 2/27 strains carried a blaOXA-24-like gene, and 4/27 strains had a blaOXA-58 gene. blaGES-11 was found in three strains, and NDM-1-harbouring strains were identified in three patients. All of the A. baumannii isolates were typed by rep-PCR (DiversiLab) and excluded any clonality. Altogether, this analysis suggests a very high genetic diversity of imported MDR A. baumannii.

  13. Efficacy of Artilysin Art-175 against Resistant and Persistent Acinetobacter baumannii

    PubMed Central

    Defraine, Valerie; Schuermans, Joris; Grymonprez, Barbara; Govers, Sander K.; Aertsen, Abram; Fauvart, Maarten; Michiels, Jan; Lavigne, Rob


    Bacteriophage-encoded endolysins have shown promise as a novel class of antibacterials with a unique mode of action, i.e., peptidoglycan degradation. However, Gram-negative pathogens are generally not susceptible due to their protective outer membrane. Artilysins overcome this barrier. Artilysins are optimized, engineered fusions of selected endolysins with specific outer membrane-destabilizing peptides. Artilysin Art-175 comprises a modified variant of endolysin KZ144 with an N-terminal fusion to SMAP-29. Previously, we have shown the high susceptibility of Pseudomonas aeruginosa to Art-175. Here, we report that Art-175 is highly bactericidal against stationary-phase cells of multidrug-resistant Acinetobacter baumannii, even resulting in a complete elimination of large inocula (≥108 CFU/ml). Besides actively dividing cells, Art-175 also kills persisters. Instantaneous killing of A. baumannii upon contact with Art-175 could be visualized after immobilization of the bacteria in a microfluidic flow cell. Effective killing of a cell takes place through osmotic lysis after peptidoglycan degradation. The killing rate is enhanced by the addition of 0.5 mM EDTA. No development of resistance to Art-175 under selection pressure and no cross-resistance with existing resistance mechanisms could be observed. In conclusion, Art-175 represents a highly active Artilysin against both A. baumannii and P. aeruginosa, two of the most life-threatening pathogens of the order Pseudomonadales. PMID:27021321

  14. Spread of Amikacin Resistance in Acinetobacter baumannii Strains Isolated in Spain Due to an Epidemic Strain

    PubMed Central

    Vila, Jordi; Ruiz, Joaquim; Navia, Margarita; Becerril, Berta; Garcia, Isabel; Perea, Sofia; Lopez-Hernandez, Inmaculada; Alamo, Isabel; Ballester, Frederic; Planes, Anna M.; Martinez-Beltran, Jesus; De Anta, Teresa Jimenez


    Sixteen amikacin-resistant clinical Acinetobacter baumannii isolates from nine different hospitals in Spain were investigated to determine whether the high incidence of amikacin-resistant A. baumannii was due to the dissemination of an amikacin-resistant strain or to the spread of an amikacin resistance gene. The epidemiological relationship studied by repetitive extragenic palindromic PCR and low-frequency restriction analysis of chromosomal DNA showed that the same clone was isolated in eight of nine hospitals, although other clones were also found. The strains were studied for the presence of the aph(3′)-VIa and aac(6′)-I genes, which encode enzymes which inactivate amikacin, by PCR. All 16 clinical isolates had positive PCRs with primers specific for the amplification of the aph(3′)-VIa gene, whereas none had a positive reaction for the amplification of the aac(6′)-I gene. Therefore, the high incidence of amikacin resistance among clinical A. baumannii isolates in Spain was mainly due to an epidemic strain, although the spread of the aph(3′)-VI gene cannot be ruled out. PMID:9986846

  15. Intravesical colistin irrigation to treat multidrug-resistant Acinetobacter baumannii urinary tract infection: a case report

    PubMed Central


    Introduction Acinetobacter baumannii is a Gram-negative bacteria and a significant nosocomial pathogen in hospitals. Multidrug-resistant A. baumannii have emerged as a cause of nosocomial infections in critically ill patients. This microorganism has the ability to produce biofilms on different surfaces, which could explain their ability to persist in clinical environments and their role in device-related infections. Case presentation We present the case of a 33-year-old Hispanic man with local invasive retroperitoneal leiomyosarcoma and right kidney exclusion along with femoral venous thrombosis, who was admitted for tumor resection. He had been receiving multiple nephrotoxic antibiotics for a long time (including tigecycline and colistimethate sodium) and had a persistent urinary infection related to multidrug-resistant A. baumannii (with susceptibility to colistimethate). Colistimethate was administered through a three-lumen urinary device for continuous urinary irrigation over seven days. Our patient did not refer to any adverse effects. A urine culture control taken at the end of the irrigation and another taken 10 days later were negative. Conclusion Colistimethate sodium and other antimicrobials infused by urinary irrigation can be a good option in patients in whom parenteral administration could be toxic. PMID:23273314

  16. Identification of a DNA-Damage-Inducible Regulon in Acinetobacter baumannii

    PubMed Central

    Aranda, Jesús; Poza, Margarita; Shingu-Vázquez, Miguel; Cortés, Pilar; Boyce, John D.; Adler, Ben; Barbé, Jordi


    The transcriptional response of Acinetobacter baumannii, a major cause of nosocomial infections, to the DNA-damaging agent mitomycin C (MMC) was studied using DNA microarray technology. Most of the 39 genes induced by MMC were related to either prophages or encoded proteins involved in DNA repair. Electrophoretic mobility shift assays demonstrated that the product of the A. baumannii MMC-inducible umuD gene (umuDAb) specifically binds to the palindromic sequence TTGAAAATGTAACTTTTTCAA present in its promoter region. Mutations in this palindromic region abolished UmuDAb protein binding. A comparison of the promoter regions of all MMC-induced genes identified four additional transcriptional units with similar palindromic sequences recognized and specifically bound by UmuDAb. Therefore, the UmuDAb regulon consists of at least eight genes encoding seven predicted error-prone DNA polymerase V components and DddR, a protein of unknown function. Expression of these genes was not induced in the MMC-treated recA mutant. Furthermore, inactivation of the umuDAb gene resulted in the deregulation of all DNA-damage-induced genes containing the described palindromic DNA motif. Together, these findings suggest that UmuDAb is a direct regulator of the DNA damage response in A. baumannii. PMID:24123815

  17. Epidemiology of Carbapenemase-Producing Enterobacteriaceae and Acinetobacter baumannii in Mediterranean Countries

    PubMed Central

    Djahmi, Nassima; Dunyach-Remy, Catherine; Pantel, Alix; Dekhil, Mazouz; Sotto, Albert; Lavigne, Jean-Philippe


    The emergence and global spread of carbapenemase-producing Enterobacteriaceae and Acinetobacter baumannii are of great concern to health services worldwide. These β-lactamases hydrolyse almost all β-lactams, are plasmid-encoded, and are easily transferable among bacterial species. They are mostly of the KPC, VIM, IMP, NDM, and OXA-48 types. Their current extensive spread worldwide in Enterobacteriaceae is an important source of concern. Infections caused by these bacteria have limited treatment options and have been associated with high mortality rates. Carbapenemase producers are mainly identified among Klebsiella pneumoniae, Escherichia coli, and A. baumannii and still mostly in hospital settings and rarely in the community. The Mediterranean region is of interest due to a great diversity and population mixing. The prevalence of carbapenemases is particularly high, with this area constituting one of the most important reservoirs. The types of carbapenemase vary among countries, partially depending on the population exchange relationship between the regions and the possible reservoirs of each carbapenemase. This review described the epidemiology of carbapenemases produced by enterobacteria and A. baumannii in this part of the world highlighting the worrisome situation and the need to screen and detect these enzymes to prevent and control their dissemination. PMID:24955354

  18. Activity of Gallium Meso- and Protoporphyrin IX against Biofilms of Multidrug-Resistant Acinetobacter baumannii Isolates

    PubMed Central

    Chang, David; Garcia, Rebecca A.; Akers, Kevin S.; Mende, Katrin; Murray, Clinton K.; Wenke, Joseph C.; Sanchez, Carlos J.


    Acinetobacter baumannii is a challenging pathogen due to antimicrobial resistance and biofilm development. The role of iron in bacterial physiology has prompted the evaluation of iron-modulation as an antimicrobial strategy. The non-reducible iron analog gallium(III) nitrate, Ga(NO3)3, has been shown to inhibit A. baumannii planktonic growth; however, utilization of heme-iron by clinical isolates has been associated with development of tolerance. These observations prompted the evaluation of iron-heme sources on planktonic and biofilm growth, as well as antimicrobial activities of gallium meso- and protoporphyrin IX (Ga-MPIX and Ga-PPIX), metal heme derivatives against planktonic and biofilm bacteria of multidrug-resistant (MDR) clinical isolates of A. baumannii in vitro. Ga(NO3)3 was moderately effective at reducing planktonic bacteria (64 to 128 µM) with little activity against biofilms (≥512 µM). In contrast, Ga-MPIX and Ga-PPIX were highly active against planktonic bacteria (0.25 to 8 µM). Cytotoxic effects in human fibroblasts were observed following exposure to concentrations exceeding 128 µM of Ga-MPIX and Ga-PPIX. We observed that the gallium metal heme conjugates were more active against planktonic and biofilm bacteria, possibly due to utilization of heme-iron as demonstrated by the enhanced effects on bacterial growth and biofilm formation. PMID:26999163

  19. Antibacterial effects of Iranian fennel essential oil on isolates of Acinetobacter baumannii.


    Jazani, N H; Zartoshti, M; Babazadeh, H; Ali-daiee, N; Zarrin, S; Hosseini, S


    The aim of the present study was the evaluation of the antibacterial activity of Fennel essential oil on isolates of Acinetobacter baumannii. Forty eight isolates were collected from clinical specimens from burn wards of hospitals in Tehran, Iran between April and September, 2006. The susceptibility of isolates was determined using a broth microdilution method. Minimum Inhibitory Concentration (MIC) and Minimum Bactericidal Concentration (MBC) of isolates to Fennel essential oil were determined. The susceptibilities of isolates to different antibiotics were tested using agar disk diffusion method. The rates of resistance were determined to antibiotics as follows: cefazolin 100%, ciprofloxacin 100%, ofloxacin 95.8%, kanamycin 95.8%, carbenicillin 93.7%, ticarcillin 93.7%, piperacillin 88.9%, co-trimoxazole 79.1%, ceftizoxime 75%, gentamicin 70.8%, cefalotin 60.4%, amikacin 52% and imipenem 14.6%. Fennel essential oil possessed antibacterial effect against all isolates of A. baumannii. These results suggest the potential use of the Fennel essential oil for the control of multi-drug resistant A. baumannii infections. However, more adequate studies must be carried out to verify the possibility of using it for fighting bacterial infections in human.

  20. Synergistic Effects and Antibiofilm Properties of Chimeric Peptides against Multidrug-Resistant Acinetobacter baumannii Strains

    PubMed Central

    Gopal, Ramamourthy; Kim, Young Gwon; Lee, Jun Ho; Lee, Seog Ki; Chae, Jeong Don; Son, Byoung Kwan; Seo, Chang Ho


    The increasing prevalence of drug-resistant pathogens highlights the need to identify novel antibiotics. Here we investigated the efficacies of four new antimicrobial peptides (AMPs) for potential drug development. The antibacterial activities, synergistic effects, and antibiofilm properties of the four chimeric AMPs were tested against Acinetobacter baumannii, an emerging Gram-negative, nosocomial, drug-resistant pathogen. Nineteen A. baumannii strains resistant to ampicillin, cefotaxime, ciprofloxacin, tobramycin, and erythromycin were isolated at a hospital from patients with cholelithiasis. All four peptides exhibited significant antibacterial effects (MIC = 3.12 to 12.5 μM) against all 19 strains, whereas five commercial antibiotics showed little or no activity against the same pathogens. An exception was polymyxin, which was effective against all of the strains tested. Each of the peptides showed synergy against one or more strains when administered in combination with cefotaxime, ciprofloxacin, or erythromycin. The peptides also exhibited an ability to prevent biofilm formation, which was not seen with cefotaxime, ciprofloxacin, or erythromycin, though polymyxin also inhibited biofilm formation. Indeed, when administered in combination with ciprofloxacin, the AMP HPMA exerted a potent synergistic effect against A. baumannii biofilm formation. Collectively, our findings indicate that the AMPs tested have no cytotoxicity but possess potent antibacterial and antibiofilm activities and may act synergistically with commercial antibiotics. PMID:24366740

  1. Imipenem Treatment Induces Expression of Important Genes and Phenotypes in a Resistant Acinetobacter baumannii Isolate

    PubMed Central

    AbuBakar, Sazaly; Cerqueira, Gustavo Maia; Al-Haroni, Mohammed; Pang, Sui Ping


    Acinetobacter baumannii has emerged as a notorious multidrug-resistant pathogen, and development of novel control measures is of the utmost importance. Understanding the factors that play a role in drug resistance may contribute to the identification of novel therapeutic targets. Pili are essential for A. baumannii adherence to and biofilm formation on abiotic surfaces as well as virulence. In the present study, we found that biofilm formation was significantly induced in an imipenem-resistant (Impr) strain treated with a subinhibitory concentration of antibiotic compared to that in an untreated control and an imipenem-susceptible (Imps) isolate. Using microarray and quantitative PCR analyses, we observed that several genes responsible for the synthesis of type IV pili were significantly upregulated in the Impr but not in the Imps isolate. Notably, this finding is corroborated by an increase in the motility of the Impr strain. Our results suggest that the ability to overproduce colonization factors in response to imipenem treatment confers biological advantage to A. baumannii and may contribute to clinical success. PMID:26666943

  2. Characterization of a high-affinity iron transport system in Acinetobacter baumannii.

    PubMed Central

    Echenique, J R; Arienti, H; Tolmasky, M E; Read, R R; Staneloni, R J; Crosa, J H; Actis, L A


    Analysis of a clinical isolate of Acinetobacter baumannii showed that this bacterium was able to grow under iron-limiting conditions, using chemically defined growth media containing different iron chelators such as human transferrin, ethylenediaminedi-(o-hydroxyphenyl)acetic acid, nitrilotriacetic acid, and 2,2'-bipyridyl. This iron uptake-proficient phenotype was due to the synthesis and secretion of a catechol-type siderophore compound. Utilization bioassays using the Salmonella typhimurium iron uptake mutants enb-1 and enb-7 proved that this siderophore is different from enterobactin. This catechol siderophore was partially purified from culture supernatants by adsorption chromatography using an XAD-7 resin. The purified component exhibited a chromatographic behavior and a UV-visible light absorption spectrum different from those of 2,3-dihydroxybenzoic acid and other bacterial catechol siderophores. Furthermore, the siderophore activity of this extracellular catechol was confirmed by its ability to stimulate energy-dependent uptake of 55Fe(III) as well as to promote the growth of A. baumannii bacterial cells under iron-deficient conditions imposed by 60 microM human transferrin. Polyacrylamide gel electrophoresis analysis showed the presence of iron-regulated proteins in both inner and outer membranes of this clinical isolate of A. baumannii. Some of these membrane proteins may be involved in the recognition and internalization of the iron-siderophore complexes. Images PMID:1447137

  3. Sheltering effect and indirect pathogenesis of carbapenem-resistant Acinetobacter baumannii in polymicrobial infection.


    Liao, Yu-Ting; Kuo, Shu-Chen; Lee, Yi-Tzu; Chen, Chien-Pei; Lin, Shu-Wen; Shen, Li-Jiuan; Fung, Chang-Phone; Cho, Wen-Long; Chen, Te-Li


    The role of carbapenem-resistant Acinetobacter baumannii (CRAb) in polymicrobial infection remains elusive. Having observed the ability of CRAb to shelter other susceptible bacteria from carbapenem killing, we sought to determine the factors contributing to this sheltering effect by transforming different recombinant plasmids into recipient A. baumannii cells. The sheltering effects of CRAb were reproduced in recipient A. baumannii cells that highly expressed carbapenem-hydrolyzing class D β-lactamases (CHDLs) through their associated strong promoter. With the use of Western blot analysis and a bioassay, the highly expressed CHDLs were found to be extracellularly released and led to hydrolysis of carbapenem. The level of extracellular CHDLs increased after challenge with a higher concentration of CHDL substrates, such as carbapenem and ticarcillin. This increased CHDL may, in part, be attributed to cell lysis, as indicated by the presence of extracellular gyrase. In the planktonic condition, the sheltering effect for the cocultured susceptible bacteria might represent an indirect and passive effect of the CRAb self-defense mechanism, because coculture with the susceptible pathogen did not augment the amount of the extracellular CHDLs. Polymicrobial infection caused by CRAb and a susceptible counterpart exerted higher pathogenicity than monomicrobial infection caused by either pathogen alone in mice receiving carbapenem therapy. This study demonstrated that CHDL-producing CRAb appears to provide a sheltering effect for carbapenem-susceptible pathogens via the extracellular release of CHDLs and, by this mechanism, can enhance the pathogenesis of polymicrobial infection in the presence of carbapenem therapy.

  4. Activation of Phenotypic Subpopulations in Response to Ciprofloxacin Treatment in Acinetobacter baumannii

    PubMed Central

    MacGuire, Ashley E.; Ching, Meining Carly; Diamond, Brett H.; Kazakov, Alexey; Novichkov, Pavel; Godoy, Veronica G.


    Summary The multidrug-resistant, opportunistic pathogen, Acinetobacter baumannii, has spread swiftly through hospitals worldwide. Previously, we demonstrated that A. baumannii regulates the expression of various genes in response to DNA damage. Some of these regulated genes, especially those encoding the multiple error-prone DNA polymerases, can be implicated in induced mutagenesis, leading to antibiotic resistance. Here, we further explore the DNA damage-inducible system at the single cell level using chromosomal transcriptional reporters for selected DNA damage response genes. We found the genes examined respond in a bimodal fashion to ciprofloxacin treatment, forming two phenotypic subpopulations: induced and uninduced. This bimodal response to ciprofloxacin treatment in A. baumannii is unique and quite different than the Escherichia coli paradigm. The subpopulations are not genetically different, with each subpopulation returning to a starting state and differentiating with repeated treatment. We then identified a palindromic motif upstream of certain DNA damage response genes, and have shown alterations to this sequence to diminish the bimodal induction in response to DNA damaging treatment. Lastly, we are able to show a biological advantage for a bimodal response, finding that one subpopulation survives ciprofloxacin treatment better than the other. PMID:24612352

  5. Computational gene network study on antibiotic resistance genes of Acinetobacter baumannii.


    Anitha, P; Anbarasu, Anand; Ramaiah, Sudha


    Multi Drug Resistance (MDR) in Acinetobacter baumannii is one of the major threats for emerging nosocomial infections in hospital environment. Multidrug-resistance in A. baumannii may be due to the implementation of multi-combination resistance mechanisms such as β-lactamase synthesis, Penicillin-Binding Proteins (PBPs) changes, alteration in porin proteins and in efflux pumps against various existing classes of antibiotics. Multiple antibiotic resistance genes are involved in MDR. These resistance genes are transferred through plasmids, which are responsible for the dissemination of antibiotic resistance among Acinetobacter spp. In addition, these resistance genes may also have a tendency to interact with each other or with their gene products. Therefore, it becomes necessary to understand the impact of these interactions in antibiotic resistance mechanism. Hence, our study focuses on protein and gene network analysis on various resistance genes, to elucidate the role of the interacting proteins and to study their functional contribution towards antibiotic resistance. From the search tool for the retrieval of interacting gene/protein (STRING), a total of 168 functional partners for 15 resistance genes were extracted based on the confidence scoring system. The network study was then followed up with functional clustering of associated partners using molecular complex detection (MCODE). Later, we selected eight efficient clusters based on score. Interestingly, the associated protein we identified from the network possessed greater functional similarity with known resistance genes. This network-based approach on resistance genes of A. baumannii could help in identifying new genes/proteins and provide clues on their association in antibiotic resistance.

  6. Prevalence and analysis of microbiological factors associated with phenotypic heterogeneous resistance to carbapenems in Acinetobacter baumannii.


    Fernández Cuenca, Felipe; Sánchez, M del Carmen Gómez; Caballero-Moyano, Francisco Javier; Vila, Jordi; Martínez-Martínez, Luis; Bou, Germán; Baño, Jesús Rodríguez; Pascual, Alvaro


    The objectives of this study were to determine the prevalence of Acinetobacter baumannii with phenotypic heterogeneous resistance (PHR) to carbapenems (colonies inside the halo of inhibition) and to analyse its association with several microbiological variables. Acinetobacter baumannii isolates collected in Spain were used to analyse: (i) minimum inhibitory concentrations (MICs) of carbapenems; (ii) heteroresistance to carbapenems; (iii) genes encoding β-lactamases (bla genes); (iv) insertion sequences; and (v) inactivation of genes encoding porins (CarO, OprD and Omp33-36) and genes associated with the AdeABC efflux system (adeB, adeR and adeS). Polymerase chain reaction (PCR) amplification was used for gene detection. The rate of PHR was 20% to imipenem and 24% to meropenem. Susceptibility to imipenem was observed in 39% of PHR isolates. MICs of carbapenems for colonies were similar (± 1 log(2) dilution) to those of their parental isolates. These colonies growing inside the inhibition halo also reproduced the PHR to carbapenems. Differences observed between PHR isolates and non-PHR isolates were: bla(OXA-58-like), 57% vs. 0%; oprD-like, 96% vs. 56%; adeB, 89% vs. 94%; adeR, 82% vs. 94%; adeS, 82% vs. 94%; ISAba2, 61% vs. 31%; and ISAba3, 57% vs. 0%. No interruption of genes encoding porins or the efflux-related genes (adeB, adeR and adeS) was observed. In conclusion, A. baumannii strains with PHR to carbapenems are widespread in Spain. This phenotype is present in carbapenem-susceptible isolates as well as those that are not susceptible to carbapenems. Heteroresistance cannot explain the PHR to carbapenems, which appears to relate more to persistence or tolerance to carbapenems. bla(OXA-58-like), bla(OXA-51-like), ISAba2 and ISAba3 are associated with PHR to carbapenems. Inactivation of genes encoding porins or genes related to AdeABC is infrequent.

  7. Effect of Chlorine Exposure on the Survival and Antibiotic Gene Expression of Multidrug Resistant Acinetobacter baumannii in Water

    PubMed Central

    Karumathil, Deepti Prasad; Yin, Hsin-Bai; Kollanoor-Johny, Anup; Venkitanarayanan, Kumar


    Acinetobacter baumannii is a multidrug resistant pathogen capable of causing a wide spectrum of clinical conditions in humans. Acinetobacter spp. is ubiquitously found in different water sources. Chlorine being the most commonly used disinfectant in water, the study investigated the effect of chlorine on the survival of A. baumannii in water and transcription of genes conferring antibiotic resistance. Eight clinical isolates of A. baumannii, including a fatal meningitis isolate (ATCC 17978) (~108 CFU/mL) were separately exposed to free chlorine concentrations (0.2, 1, 2, 3 and 4 ppm) with a contact time of 30, 60, 90 and 120 second. The surviving pathogen counts at each specified contact time were determined using broth dilution assay. In addition, real-time quantitative PCR (RT-qPCR) analysis of the antibiotic resistance genes (efflux pump genes and those encoding resistance to specific antibiotics) of three selected A. baumannii strains following exposure to chlorine was performed. Results revealed that all eight A. baumannii isolates survived the tested chlorine levels during all exposure times (p > 0.05). Additionally, there was an up-regulation of all or some of the antibiotic resistance genes in A. baumannii, indicating a chlorine-associated induction of antibiotic resistance in the pathogen. PMID:24514427

  8. Effect of chlorine exposure on the survival and antibiotic gene expression of multidrug resistant Acinetobacter baumannii in water.


    Karumathil, Deepti Prasad; Yin, Hsin-Bai; Kollanoor-Johny, Anup; Venkitanarayanan, Kumar


    Acinetobacter baumannii is a multidrug resistant pathogen capable of causing a wide spectrum of clinical conditions in humans. Acinetobacter spp. is ubiquitously found in different water sources. Chlorine being the most commonly used disinfectant in water, the study investigated the effect of chlorine on the survival of A. baumannii in water and transcription of genes conferring antibiotic resistance. Eight clinical isolates of A. baumannii, including a fatal meningitis isolate (ATCC 17978) (~108 CFU/mL) were separately exposed to free chlorine concentrations (0.2, 1, 2, 3 and 4 ppm) with a contact time of 30, 60, 90 and 120 second. The surviving pathogen counts at each specified contact time were determined using broth dilution assay. In addition, real-time quantitative PCR (RT-qPCR) analysis of the antibiotic resistance genes (efflux pump genes and those encoding resistance to specific antibiotics) of three selected A. baumannii strains following exposure to chlorine was performed. Results revealed that all eight A. baumannii isolates survived the tested chlorine levels during all exposure times (p > 0.05). Additionally, there was an up-regulation of all or some of the antibiotic resistance genes in A. baumannii, indicating a chlorine-associated induction of antibiotic resistance in the pathogen.

  9. Reinforcing Lipid A Acylation on the Cell Surface of Acinetobacter baumannii Promotes Cationic Antimicrobial Peptide Resistance and Desiccation Survival

    PubMed Central

    Boll, Joseph M.; Tucker, Ashley T.; Klein, Dustin R.; Beltran, Alexander M.; Brodbelt, Jennifer S.; Davies, Bryan W.


    ABSTRACT Acinetobacter baumannii is an emerging Gram-negative pathogen found in hospitals and intensive care units. In order to persist in hospital environments, A. baumannii withstands desiccative conditions and can rapidly develop multidrug resistance to conventional antibiotics. Cationic antimicrobial peptides (CAMPs) have served as therapeutic alternatives because they target the conserved lipid A component of the Gram-negative outer membrane to lyse the bacterial cell. However, many Gram-negative pathogenic bacteria, including A. baumannii, fortify their outer membrane with hepta-acylated lipid A to protect the cell from CAMP-dependent cell lysis. Whereas in Escherichia coli and Salmonella, increased production of the outer membrane acyltransferase PagP results in formation of protective hepta-acylated lipid A, which reinforces the lipopolysaccharide portion of the outer membrane barrier, A. baumannii does not carry a gene that encodes a PagP homolog. Instead, A. baumannii has evolved a PagP-independent mechanism to synthesize protective hepta-acylated lipid A. Taking advantage of a recently adapted A. baumannii genetic recombineering system, we characterized two putative acyltransferases in A. baumannii designated LpxLAb (A. baumannii LpxL) and LpxMAb (A. baumannii LpxM), which transfer one and two lauroyl (C12:0) acyl chains, respectively, during lipid A biosynthesis. Hepta-acylation of A. baumannii lipid A promoted resistance to vertebrate and polymyxin CAMPs, which are prescribed as last-resort treatment options. Intriguingly, our analysis also showed that LpxMAb-dependent acylation of lipid A is essential for A. baumannii desiccation survival, a key resistance mechanism for survival in hospital environments. Compounds that inhibit LpxMAb-dependent hepta-acylation of lipid A could act synergistically with CAMPs to provide innovative transmission prevention strategies and treat multidrug-resistant infections. PMID:25991684

  10. [Distribution of blaOXA genes in Acinetobacter baumannii strains: a multicenter study].


    Ciftci, Ihsan Hakkı; Aşık, Gülşah; Karakeçe, Engin; Oksüz, Lütfiye; Yağcı, Server; Sesli Çetin, Emel; Ozdemir, Mehmet; Atasoy, Ali Rıza; Koçoğlu, Esra; Gül, Mustafa; Kurtoğlu, Muhammet Güzel; Köksal Çakırlar, Fatma; Seyrek, Adnan; Berktaş, Mustafa; Gültepe, Bilge; Ayyildiz, Ahmet


    Acinetobacter baumannii is the most important agent of nosocomial infections within the Acinetobacter genus. This gram-negative coccobacillus is intrinsically resistant to many antibiotics used in antimicrobial therapy, and capable of developing resistance including carbapenems. The objective of this study was to develop a multiplex real time polymerase chain reaction (qPCR) kit for OXA subgroups in A.baumannii, and to investigate the distribution of OXA subgroups in A.baumannii strains isolated from geographically different regions of Turkey. A total of 834 A.baumannii clinical isolates collected from different state and university medical centers in 13 provinces (Afyonkarahisar, Ankara, Bolu, Elazig, Erzurum, Isparta, Istanbul, Kahramanmaras, Konya, Sakarya, Van) between 2008-2011, were included in the study. The isolates were identified by conventional methods and automated systems [Vitek2 (bioMerieux, ABD) and Phoenix (BD Diagnostic, MD)]. The susceptibility profiles of the isolates were studied with automated systems and standard disc diffusion method. All samples were subjected to qPCR to detect blaOXA-51-like, blaOXA-23-like and blaOXA-58-like genes. A conventional PCR method was also used to detect blaOXA-24-like gene. The resistance rates observed during the study period were as follows: 96.8% for amoxicillin-clavulanate, 86.8% for ciprofloxacin, 74.7% for gentamicin, 71.7% for amikacin, 73.5% for cefaperozone-sulbactam, 72.1% for imipenem and 73% for meropenem. Six hundred and two (72.2 %) isolates were resistant to both imipenem and meropenem. Colistin was found to be the most effective antibiotic against A.baumannii isolates with 100% susceptibility rate. All isolates were positive for blaOXA-51-like, however blaOXA-24-like gene could not be demonstrated in any isolate. Total positivity rates of blaOXA-23-like and blaOXA-58-like genes were found as 53.7% and 12.5%, respectively, while these rates were 74.4% and 17.3% in carbapenem-resistant isolates

  11. Analysis of Genes Encoding Penicillin-Binding Proteins in Clinical Isolates of Acinetobacter baumannii ▿ †

    PubMed Central

    Cayô, Rodrigo; Rodríguez, María-Cruz; Espinal, Paula; Fernández-Cuenca, Felipe; Ocampo-Sosa, Alain A.; Pascual, Álvaro; Ayala, Juan A.; Vila, Jordi; Martínez-Martínez, Luis


    There is limited information on the role of penicillin-binding proteins (PBPs) in the resistance of Acinetobacter baumannii to β-lactams. This study presents an analysis of the allelic variations of PBP genes in A. baumannii isolates. Twenty-six A. baumannii clinical isolates (susceptible or resistant to carbapenems) from three teaching hospitals in Spain were included. The antimicrobial susceptibility profile, clonal pattern, and genomic species identification were also evaluated. Based on the six complete genomes of A. baumannii, the PBP genes were identified, and primers were designed for each gene. The nucleotide sequences of the genes identified that encode PBPs and the corresponding amino acid sequences were compared with those of ATCC 17978. Seven PBP genes and one monofunctional transglycosylase (MGT) gene were identified in the six genomes, encoding (i) four high-molecular-mass proteins (two of class A, PBP1a [ponA] and PBP1b [mrcB], and two of class B, PBP2 [pbpA or mrdA] and PBP3 [ftsI]), (ii) three low-molecular-mass proteins (two of type 5, PBP5/6 [dacC] and PBP6b [dacD], and one of type 7 (PBP7/8 [pbpG]), and (iii) a monofunctional enzyme (MtgA [mtgA]). Hot spot mutation regions were observed, although most of the allelic changes found translated into silent mutations. The amino acid consensus sequences corresponding to the PBP genes in the genomes and the clinical isolates were highly conserved. The changes found in amino acid sequences were associated with concrete clonal patterns but were not directly related to susceptibility or resistance to β-lactams. An insertion sequence disrupting the gene encoding PBP6b was identified in an endemic carbapenem-resistant clone in one of the participant hospitals. PMID:21947403

  12. Antimicrobial Activity of Gallium Protoporphyrin IX against Acinetobacter baumannii Strains Displaying Different Antibiotic Resistance Phenotypes

    PubMed Central

    Arivett, Brock A.; Fiester, Steven E.; Ohneck, Emily J.; Penwell, William F.; Kaufman, Cynthia M.; Relich, Ryan F.


    A paucity of effective, currently available antibiotics and a lull in antibiotic development pose significant challenges for treatment of patients with multidrug-resistant (MDR) Acinetobacter baumannii infections. Thus, novel therapeutic strategies must be evaluated to meet the demands of treatment of these often life-threatening infections. Accordingly, we examined the antibiotic activity of gallium protoporphyrin IX (Ga-PPIX) against a collection of A. baumannii strains, including nonmilitary and military strains and strains representing different clonal lineages and isolates classified as susceptible or MDR. Susceptibility testing demonstrated that Ga-PPIX inhibits the growth of all tested strains when cultured in cation-adjusted Mueller-Hinton broth, with a MIC of 20 μg/ml. This concentration significantly reduced bacterial viability, while 40 μg/ml killed all cells of the A. baumannii ATCC 19606T and ACICU MDR isolate after 24-h incubation. Recovery of ATCC 19606T and ACICU strains from infected A549 human alveolar epithelial monolayers was also decreased when the medium was supplemented with Ga-PPIX, particularly at a 40-μg/ml concentration. Similarly, the coinjection of bacteria with Ga-PPIX increased the survival of Galleria mellonella larvae infected with ATCC 19606T or ACICU. Ga-PPIX was cytotoxic only when monolayers or larvae were exposed to concentrations 16-fold and 1,250-fold higher than those showing antibacterial activity, respectively. These results indicate that Ga-PPIX could be a viable therapeutic option for treatment of recalcitrant A. baumannii infections regardless of the resistance phenotype, clone lineage, time and site of isolation of strains causing these infections and their iron uptake phenotypes or the iron content of the media. PMID:26416873

  13. Analysis of genes encoding penicillin-binding proteins in clinical isolates of Acinetobacter baumannii.


    Cayô, Rodrigo; Rodríguez, María-Cruz; Espinal, Paula; Fernández-Cuenca, Felipe; Ocampo-Sosa, Alain A; Pascual, Alvaro; Ayala, Juan A; Vila, Jordi; Martínez-Martínez, Luis


    There is limited information on the role of penicillin-binding proteins (PBPs) in the resistance of Acinetobacter baumannii to β-lactams. This study presents an analysis of the allelic variations of PBP genes in A. baumannii isolates. Twenty-six A. baumannii clinical isolates (susceptible or resistant to carbapenems) from three teaching hospitals in Spain were included. The antimicrobial susceptibility profile, clonal pattern, and genomic species identification were also evaluated. Based on the six complete genomes of A. baumannii, the PBP genes were identified, and primers were designed for each gene. The nucleotide sequences of the genes identified that encode PBPs and the corresponding amino acid sequences were compared with those of ATCC 17978. Seven PBP genes and one monofunctional transglycosylase (MGT) gene were identified in the six genomes, encoding (i) four high-molecular-mass proteins (two of class A, PBP1a [ponA] and PBP1b [mrcB], and two of class B, PBP2 [pbpA or mrdA] and PBP3 [ftsI]), (ii) three low-molecular-mass proteins (two of type 5, PBP5/6 [dacC] and PBP6b [dacD], and one of type 7 (PBP7/8 [pbpG]), and (iii) a monofunctional enzyme (MtgA [mtgA]). Hot spot mutation regions were observed, although most of the allelic changes found translated into silent mutations. The amino acid consensus sequences corresponding to the PBP genes in the genomes and the clinical isolates were highly conserved. The changes found in amino acid sequences were associated with concrete clonal patterns but were not directly related to susceptibility or resistance to β-lactams. An insertion sequence disrupting the gene encoding PBP6b was identified in an endemic carbapenem-resistant clone in one of the participant hospitals.

  14. Antimicrobial Activity of Gallium Protoporphyrin IX against Acinetobacter baumannii Strains Displaying Different Antibiotic Resistance Phenotypes.


    Arivett, Brock A; Fiester, Steven E; Ohneck, Emily J; Penwell, William F; Kaufman, Cynthia M; Relich, Ryan F; Actis, Luis A


    A paucity of effective, currently available antibiotics and a lull in antibiotic development pose significant challenges for treatment of patients with multidrug-resistant (MDR) Acinetobacter baumannii infections. Thus, novel therapeutic strategies must be evaluated to meet the demands of treatment of these often life-threatening infections. Accordingly, we examined the antibiotic activity of gallium protoporphyrin IX (Ga-PPIX) against a collection of A. baumannii strains, including nonmilitary and military strains and strains representing different clonal lineages and isolates classified as susceptible or MDR. Susceptibility testing demonstrated that Ga-PPIX inhibits the growth of all tested strains when cultured in cation-adjusted Mueller-Hinton broth, with a MIC of 20 μg/ml. This concentration significantly reduced bacterial viability, while 40 μg/ml killed all cells of the A. baumannii ATCC 19606(T) and ACICU MDR isolate after 24-h incubation. Recovery of ATCC 19606(T) and ACICU strains from infected A549 human alveolar epithelial monolayers was also decreased when the medium was supplemented with Ga-PPIX, particularly at a 40-μg/ml concentration. Similarly, the coinjection of bacteria with Ga-PPIX increased the survival of Galleria mellonella larvae infected with ATCC 19606(T) or ACICU. Ga-PPIX was cytotoxic only when monolayers or larvae were exposed to concentrations 16-fold and 1,250-fold higher than those showing antibacterial activity, respectively. These results indicate that Ga-PPIX could be a viable therapeutic option for treatment of recalcitrant A. baumannii infections regardless of the resistance phenotype, clone lineage, time and site of isolation of strains causing these infections and their iron uptake phenotypes or the iron content of the media.

  15. CRISPR-cas subtype I-Fb in Acinetobacter baumannii: evolution and utilization for strain subtyping.


    Karah, Nabil; Samuelsen, Ørjan; Zarrilli, Raffaele; Sahl, Jason W; Wai, Sun Nyunt; Uhlin, Bernt Eric


    Clustered regularly interspaced short palindromic repeats (CRISPR) are polymorphic elements found in the genome of some or all strains of particular bacterial species, providing them with a system of acquired immunity against invading bacteriophages and plasmids. Two CRISPR-Cas systems have been identified in Acinetobacter baumannii, an opportunistic pathogen with a remarkable capacity for clonal dissemination. In this study, we investigated the mode of evolution and diversity of spacers of the CRISPR-cas subtype I-Fb locus in a global collection of 76 isolates of A. baumannii obtained from 14 countries and 4 continents. The locus has basically evolved from a common ancestor following two main lineages and several pathways of vertical descent. However, this vertical passage has been interrupted by occasional events of horizontal transfer of the whole locus between distinct isolates. The isolates were assigned into 40 CRISPR-based sequence types (CST). CST1 and CST23-24 comprised 18 and 9 isolates, representing two main sub-clones of international clones CC1 and CC25, respectively. Epidemiological data showed that some of the CST1 isolates were acquired or imported from Iraq, where it has probably been endemic for more than one decade and occasionally been able to spread to USA, Canada, and Europe. CST23-24 has shown a remarkable ability to cause national outbreaks of infections in Sweden, Argentina, UAE, and USA. The three isolates of CST19 were independently imported from Thailand to Sweden and Norway, raising a concern about the prevalence of CST19 in Thailand. Our study highlights the dynamic nature of the CRISPR-cas subtype I-Fb locus in A. baumannii, and demonstrates the possibility of using a CRISPR-based approach for subtyping a significant part of the global population of A. baumannii.

  16. Colistin enhances therapeutic efficacy of daptomycin or teicoplanin in a murine model of multiresistant Acinetobacter baumannii sepsis.


    Cirioni, Oscar; Simonetti, Oriana; Pierpaoli, Elisa; Barucca, Alessandra; Ghiselli, Roberto; Orlando, Fiorenza; Pelloni, Maria; Trombettoni, Maria Michela Cappelletti; Guerrieri, Mario; Offidani, Annamaria; Giacometti, Andrea; Provinciali, Mauro


    We investigated the efficacy of colistin combined with teicoplanin or daptomycin in an experimental mouse model of multiresistant Acinetobacter baumannii infection. Animal received intraperitoneally 1ml saline containing 2×10(10)CFU of A. baumannii. Colistin, daptomycin, teicoplanin, and colistin plus daptomycin or teicoplanin were given by intraperitoneal administration 2h after bacterial challenge. A control group received sodium chloride solution. In the in vitro study A. baumannii showed to be susceptible only to colistin with MIC of 2mg/l. In the in vivo study, colistin alone showed a good antimicrobial efficacy. When combined with teicoplanin or daptomycin, colistin produced the lowest bacterial and the best survival rates. In immunological studies, when colistin was associated to daptomycin or teicoplanin, both the number and the cytotoxic activity of NK cells increased. In conclusion, colistin combined with teicoplanin or daptomycin may improve the therapy of multiresistant A. baumannii infection.

  17. No evidence of Bartonella quintana but detection of Acinetobacter baumannii in head lice from elementary schoolchildren in Paris.


    Bouvresse, Sophie; Socolovshi, Cristina; Berdjane, Zohra; Durand, Rémy; Izri, Arezki; Raoult, Didier; Chosidow, Olivier; Brouqui, Philippe


    The human body louse is the only known vector of Bartonella quintana. However, the presence of this bacterium has recently been detected in the head lice of homeless individuals and Nepalese slum children. Previous studies have reported the isolation of Acinetobacter baumannii from the body lice of homeless individuals. An epidemiological survey including 74 schools was conducted between 2008 and 2009 in Paris. After a first visual examination, the hair of children with suspected pediculosis was combed with a fine-tooth comb to collect live adult head lice. Molecular studies were performed on randomly selected DNA samples to detect B. quintana and A. baumannii by specific quantitative real-time PCR. Among a collection of 288 DNA samples, B. quintana was not detected, but A. baumannii was detected in 95 DNA samples (33%). Further study is needed to determine the significance of the finding of A. baumannii in head lice.

  18. Multi-omics approach to study global changes in a triclosan-resistant mutant strain of Acinetobacter baumannii ATCC 17978.


    Fernando, Dinesh M; Chong, Patrick; Singh, Manu; Spicer, Victor; Unger, Mark; Loewen, Peter C; Westmacott, Garrett; Kumar, Ayush


    Acinetobacter baumannii AB042, a triclosan-resistant mutant strain, was examined for modulated gene expression using whole-genome sequencing, transcriptomics and proteomics in order to understand the mechanism of triclosan resistance as well as its impact on A. baumannii. Data revealed modulated expression of the fatty acid metabolism pathway, co-factors known to play a role in the synthesis of fatty acids, as well as several transcriptional regulators. The membrane composition of the mutant revealed a decrease in C18 with a corresponding increase in C16 fatty acids compared with the parent strain A. baumannii ATCC 17978. These data indicate that A. baumannii responds to triclosan by altering the expression of genes involved in fatty acid metabolism, antibiotic resistance and amino acid metabolism.

  19. Detection of class 1 integron in Acinetobacter baumannii isolates collected from nine hospitals in Turkey

    PubMed Central

    ÇİÇek, Ayşegül Çopur; Düzgün, Azer Özad; Saral, Ayşegül; Kayman, Tuba; Çİzmecİ, Zeynep; Balcı, Pervin Özlem; Dal, Tuba; Fırat, Mehmet; Tosun, İsmail; Alıtntop, Yasemin Ay; Çalışkan, Ahmet; Yazıcı, Yelda; Sandallı, Cemal


    Objective To investigate the antibiotic resistance genes inserted into class 1 and class 2 integrons in Acinetobacter baumannii (A. baumannii) isolates obtained from nine different cities in Turkey. Methods A collection of 281 A. baumannii clinical isolates were collected from nine diferent state hospitals in Turkey and were confirmed as A. baumannii by conventional biochemical, API testing and bla-OXA-51 specific PCR. The isolates were examined by PCR for existence of class 1 and 2 integron gene cassettes. Results They were characterized by antimicrobial susceptibility testing and the highest resistance rates were determined for piperacillin (90.03%), ciprofloxacin (87.54%), cefepime and trimethoprim/sulfamethoxazole (81.13%). The lowest resistance rates was for cefotaxime (3.55%). class I integrons were detected in 6.4% (18/281) of A. baumannii strains and no class 2 integron was detected. The gene cassettes of class 1 integrons AacC1-AAC(3)I-aadA1, AacC1-aadA1, AAC(3)-I, AAC(3)-I -AAC(3)-I -aadA1, TEM-1, AAC(3)-I-aadA1 - AAC(3)-I -AAC(3)-I, AAC(3)-I -AAC(3)-I -AAC(3)-I -aadA1, AAC(3)-I - aadA1, AAC(3)-I-AAC(3)-I, AAC(3)-I-aadA1- AAC(3)-I-aadA1, AAC(3)-I- AAC(3)-I- aadA1-AAC(3)-I-aadA1 were detected in eighteen strains. The aac genes family were most frequently found integrated into the class 1 integrons and it was followed by aadA genes and TEM-1 genes. Conclusions This is an extensive study on the distribution of class 1 integron among A. baumannii in Turkey. In addition to these, two new alleles were observed. Their percentage rates of similarity to other cassettes are 95% aadA1 ( TKA18) and 89% aadA1 (ANKA3). PMID:23998017

  20. Whole-genome pyrosequencing of an epidemic multidrug-resistant Acinetobacter baumannii strain belonging to the European clone II group.


    Iacono, Michele; Villa, Laura; Fortini, Daniela; Bordoni, Roberta; Imperi, Francesco; Bonnal, Raoul J P; Sicheritz-Ponten, Thomas; De Bellis, Gianluca; Visca, Paolo; Cassone, Antonio; Carattoli, Alessandra


    The whole-genome sequence of an epidemic, multidrug-resistant Acinetobacter baumannii strain (strain ACICU) belonging to the European clone II group and carrying the plasmid-mediated bla(OXA)(-)(58) carbapenem resistance gene was determined. The A. baumannii ACICU genome was compared with the genomes of A. baumannii ATCC 17978 and Acinetobacter baylyi ADP1, with the aim of identifying novel genes related to virulence and drug resistance. A. baumannii ACICU has a single chromosome of 3,904,116 bp (which is predicted to contain 3,758 genes) and two plasmids, pACICU1 and pACICU2, of 28,279 and 64,366 bp, respectively. Genome comparison showed 86.4% synteny with A. baumannii ATCC 17978 and 14.8% synteny with A. baylyi ADP1. A conspicuous number of transporters belonging to different superfamilies was predicted for A. baumannii ACICU. The relative number of transporters was much higher in ACICU than in ATCC 17978 and ADP1 (76.2, 57.2, and 62.5 transporters per Mb of genome, respectively). An antibiotic resistance island, AbaR2, was identified in ACICU and had plausibly evolved by reductive evolution from the AbaR1 island previously described in multiresistant strain A. baumannii AYE. Moreover, 36 putative alien islands (pAs) were detected in the ACICU genome; 24 of these had previously been described in the ATCC 17978 genome, 4 are proposed here for the first time and are present in both ATCC 17978 and ACICU, and 8 are unique to the ACICU genome. Fifteen of the pAs in the ACICU genome encode genes related to drug resistance, including membrane transporters and ex novo acquired resistance genes. These findings provide novel insight into the genetic basis of A. baumannii resistance.

  1. Identification of an Acinetobacter baumannii Zinc Acquisition System that Facilitates Resistance to Calprotectin-mediated Zinc Sequestration

    PubMed Central

    Hood, M. Indriati; Mortensen, Brittany L.; Moore, Jessica L.; Zhang, Yaofang; Kehl-Fie, Thomas E.; Sugitani, Norie; Chazin, Walter J.; Caprioli, Richard M.; Skaar, Eric P.


    Acinetobacter baumannii is an important nosocomial pathogen that accounts for up to 20 percent of infections in intensive care units worldwide. Furthermore, A. baumannii strains have emerged that are resistant to all available antimicrobials. These facts highlight the dire need for new therapeutic strategies to combat this growing public health threat. Given the critical role for transition metals at the pathogen-host interface, interrogating the role for these metals in A. baumannii physiology and pathogenesis could elucidate novel therapeutic strategies. Toward this end, the role for calprotectin- (CP)-mediated chelation of manganese (Mn) and zinc (Zn) in defense against A. baumannii was investigated. These experiments revealed that CP inhibits A. baumannii growth in vitro through chelation of Mn and Zn. Consistent with these in vitro data, Imaging Mass Spectrometry revealed that CP accompanies neutrophil recruitment to the lung and accumulates at foci of infection in a murine model of A. baumannii pneumonia. CP contributes to host survival and control of bacterial replication in the lung and limits dissemination to secondary sites. Using CP as a probe identified an A. baumannii Zn acquisition system that contributes to Zn uptake, enabling this organism to resist CP-mediated metal chelation, which enhances pathogenesis. Moreover, evidence is provided that Zn uptake across the outer membrane is an energy-dependent process in A. baumannii. Finally, it is shown that Zn limitation reverses carbapenem resistance in multidrug resistant A. baumannii underscoring the clinical relevance of these findings. Taken together, these data establish Zn acquisition systems as viable therapeutic targets to combat multidrug resistant A. baumannii infections. PMID:23236280

  2. Paradoxical Effect of Polymyxin B: High Drug Exposure Amplifies Resistance in Acinetobacter baumannii

    PubMed Central

    Landersdorfer, Cornelia B.; Lenhard, Justin R.; Cheah, Soon-Ee; Thamlikitkul, Visanu; Rao, Gauri G.; Holden, Patricia N.; Forrest, Alan; Bulitta, Jürgen B.; Nation, Roger L.; Li, Jian


    Administering polymyxin antibiotics in a traditional fashion may be ineffective against Gram-negative ESKAPE (Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter species) pathogens. Here, we explored increasing the dose intensity of polymyxin B against two strains of Acinetobacter baumannii in the hollow-fiber infection model. The following dosage regimens were simulated for polymyxin B (t1/2 = 8 h): non-loading dose (1.43 mg/kg of body weight every 12 h [q12h]), loading dose (2.22 mg/kg q12h for 1 dose and then 1.43 mg/kg q12h), front-loading dose (3.33 mg/kg q12h for 1 dose followed by 1.43 mg/kg q12h), burst (5.53 mg/kg for 1 dose), and supraburst (18.4 mg/kg for 1 dose). Against both A. baumannii isolates, a rapid initial decline in the total population was observed within the first 6 h of polymyxin exposure, whereby greater polymyxin B exposure resulted in greater maximal killing of −1.25, −1.43, −2.84, −2.84, and −3.40 log10 CFU/ml within the first 6 h. Unexpectedly, we observed a paradoxical effect whereby higher polymyxin B exposures dramatically increased resistant subpopulations that grew on agar containing up to 10 mg/liter of polymyxin B over 336 h. High drug exposure also proliferated polymyxin-dependent growth. A cost-benefit pharmacokinetic/pharmacodynamic relationship between 24-h killing and 336-h resistance was explored. The intersecting point, where the benefit of bacterial killing was equal to the cost of resistance, was an fAUC0–24 (area under the concentration-time curve from 0 to 24 h for the free, unbound fraction of drug) of 38.5 mg · h/liter for polymyxin B. Increasing the dose intensity of polymyxin B resulted in amplification of resistance, highlighting the need to utilize polymyxins as part of a combination against high-bacterial-density A. baumannii infections. PMID:27067330

  3. Antimicrobial susceptibility profiling and genomic diversity of Acinetobacter baumannii isolates: A study in western Iran

    PubMed Central

    Mohajeri, Parviz; Farahani, Abbas; Feizabadi, Mohammad Mehdi; Ketabi, Hosnieh; Abiri, Ramin; Najafi, Farid


    Background and Objective Acinetobacter baumannii is an aerobic non-motile Gram-negative bacterial pathogen that is resistant to most antibiotics. Carbapenems are the most common antibiotics for the treatment of infections caused by this pathogen. Mechanisms of antibiotic-resistance in A. baumannii are mainly mediated by efflux pumps-lactamases. The aim of this study was to determine antibiotic susceptibility, the possibility of existence of OXAs genes and fingerprinting by Pulsed-Field Gel Electrophoresis (PFGE) among clinical isolates of Acinetobacter collected from Kermanshah hospitals. Materials and Methods One hundred and four isolates were collected from patients attending Imam Reza, Taleghani and Imam Khomeini hospitals of Kermanshah (Iran). Isolates were identified by biochemical tests and API 20NE kit. The susceptibility to different antibiotics was assessed with Kirby-Bauer disk diffusion method. PCR was performed for detection of bla OXA-23, bla OXA-24, bla OXA-51 and bla OXA-58 beta-lactamase genes. Clonal relatedness was estimated by PFGE (with the restriction enzyme Apa I) and DNA patterns were analyzed by Gel compare II 6.5 software. Results All isolates showed high-level of resistance to imipenem, meropenem as well as to other antimicrobial agents, while no resistance to polymyxin B, colistin, tigecylcine and minocycline was observed. The bla OXA-23like and bla OXA-24 like were found among 77.9% and 19.2% of the isolates, respectively. All isolates were positive for bla OXA-51, but none produced any amplicon for bla OXA-58. PFGE genotype analysis suggested the existence of eight clones among the 104 strains [A (n = 35), B (n = 29), C (n = 19), D (n = 10), E (n = 4), F (n = 3), G (n = 3), H (n = 1)]. Clone A was the dominant clone in hospital settings particularly infection wards so that the isolates in this group, compared to the other clones, showed higher levels of resistance to antibiotics. Conclusion The bla OXA-51-like and bla OXA-23like were

  4. Identification and characterisation of the putative phage-related endolysins through full genome sequence analysis in Acinetobacter baumannii ATCC 17978.


    Lai, Meng-Jiun; Soo, Po-Chi; Lin, Nien-Tsung; Hu, Anren; Chen, You-Jie; Chen, Li-Kuang; Chang, Kai-Chih


    Acinetobacter baumannii has recently emerged as a major cause of healthcare-associated infections owing to an increase in its antimicrobial resistance to virtually all available drugs. The ability of endolysins (lysozymes) to digest cell walls when applied exogenously to bacterial cells has enabled their use as novel antibacterials. In order to utilise endolysins as a therapeutic alternative to antibiotics, we surveyed the genome sequence of A. baumannii ATCC 17978 and successfully identified two phage-related endolysin genes, A1S_1600 and A1S_2016 (termed lysAB3 and lysAB4, respectively). Following cloning and expression/purification, various antibacterial activities of these two phage-related endolysins were determined in vitro. Zymographic assays showed that only purified LysAB3 could lyse the peptidoglycan of the A. baumannii cell wall. When applied exogenously, both LysAB3 and LysAB4 were active against most Acinetobacter spp. tested but had virtually no activity against other non-Acinetobacter spp. Scanning electron microscopy revealed that exposure to 100μg/mL LysAB3 and LysAB4 for up to 60min caused a remarkable modification of the cell shape of A. baumannii. These results indicate that the genes encoding phage-related endolysins can be readily isolated from the bacterial genome and have potential for the development of novel antimicrobial agents.

  5. Evaluate the frequency distribution of nonadhesive virulence factors in carbapenemase-producing Acinetobacter baumannii isolated from clinical samples in Kermanshah

    PubMed Central

    Mohajeri, Parviz; Sharbati, Saba; Farahani, Abbas; Rezaei, Zhaleh


    Background: Acinetobacter baumannii which is a Gram-negative bacterium can cause several different infections. The appearance of carbapenemase-producing A. baumannii in recent years has made the treatment process more difficult. The identification of virulence factors (VFs), such as nonadhesives in A. baumannii, helps to fight against related infections. Materials and Methods: A total of 104 samples from teaching hospitals in Kermanshah, Iran, were collected during a 24 months period (2011-2013). Sample identification was first carried out by biochemical tests, and then their susceptibility to carbapenems was determined using the Kirby–Bauer method. For confirmation of carbapenemase-producing A. baumannii, polymerase chain reaction (PCR) was done for carbapenemase-encoding genes. In addition, the frequency of nonadhesive VFs in carbapenemase-producing isolates was determined by PCR. Results: There were 50 isolates that were identified as carbapenemase-producing A. baumannii. The PCR results showed; 40 isolates (80%) for traT, 17 isolates (34%) for cvaC, and 8 isolates (16%) for iutA, and these encode serum resistance, colicin V and aerobactin, respectively. No significant correlation was observed between these three genes. Conclusions: The mechanism of A. baumannii virulence has always been in question. The role of VFs has also been recognized in other Gram-negative bacteria. According to the prevalence of traT, cvaC and iutA, as nonadhesive VFs, we can suggest that they could be the main mechanism of carbapenemase-producing A. baumannii pathogenesis. PMID:27003971

  6. Prevalence of antibiotics resistance and OXA carbapenemases genes in multidrug-resistant Acinetobacter baumannii isolates in central Taiwan.


    Yang, S-C; Chang, W-J; Chang, Y-H; Tsai, Y-S; Yang, T-P; Juan, C-W; Shiau, M-Y


    This study analyzed the prevalence of antibiotics resistance and the distribution of genes responsible for carbapenems resistance in Acinetobacter baumannii isolates. Clinical A. baumannii isolates were cultured, identified, and collected during the period from May 2007 to February 2009. Antibiotics resistance rates of the clinical isolates were analyzed by antimicrobial susceptibility testing. The distribution of carbapenemase alleles were investigated in the multidrug-resistant (MDR) A. baumannii isolates by multiplex polymerase chain reaction (PCR) techniques. A total of 1,265 independent A. baumannii isolates were identified. Approximately 70% of the clinical isolates were resistant to ampicillin/sulbactam, followed by imipenem, meropenem, cefepime, piperacillin/tazobactam, ceftazidime, and cefoperazone. Overall, 15.18% (192/1,265) of the isolates were characterized as MDR strains. All of the MDR A. baumannii isolates carried the bla (OXA51-like) allele. The detection rate of the bla (OXA23-like) and bla (OXA24-like) alleles was 96.35% (185/192) and 0.52% (1/192), respectively. Most of the isolates (185/192, 96.35%) carried genes which encode more than one carbapenemase. This report demonstrated that approximately 15% of A. baumannii clinical isolates in central Taiwan are MDR strains, with most of them harboring multiple carbapenemases. This study provides updated data regarding the prevalence of beta-lactam resistance and genotyping information of carbapenems resistance of A. baumannii in central Taiwan.

  7. Diversity and Clinical Impact of Acinetobacter baumannii Colonization and Infection at a Military Medical Center ▿

    PubMed Central

    Petersen, Kyle; Cannegieter, Suzanne C.; van der Reijden, Tanny J.; van Strijen, Beppie; You, David M.; Babel, Britta S.; Philip, Andrew I.; Dijkshoorn, Lenie


    The epidemiology of Acinetobacter baumannii emerging in combat casualties is poorly understood. We analyzed 65 (54 nonreplicate) Acinetobacter isolates from 48 patients (46 hospitalized and 2 outpatient trainees entering the military) from October 2004 to October 2005 for genotypic similarities, time-space relatedness, and antibiotic susceptibility. Clinical and surveillance cultures were compared by amplified fragment length polymorphism (AFLP) genomic fingerprinting to each other and to strains of a reference database. Antibiotic susceptibility was determined, and multiplex PCR was performed for OXA-23-like, -24-like, -51-like, and -58-like carbapenemases. Records were reviewed for overlapping hospital stays of the most frequent genotypes, and risk ratios were calculated for any association of genotype with severity of Acute Physiology and Chronic Health Evaluation II (APACHE II) score or injury severity score (ISS) and previous antibiotic use. Nineteen genotypes were identified; two predominated, one consistent with an emerging novel international clone and the other unique to our database. Both predominant genotypes were carbapenem resistant, were present at another hospital before patients' admission to our facility, and were associated with higher APACHE II scores, higher ISSs, and previous carbapenem antibiotics in comparison with other genotypes. One predominated in wound and respiratory isolates, and the other predominated in wound and skin surveillance samples. Several other genotypes were identified as European clones I to III. Acinetobacter genotypes from recruits upon entry to the military, unlike those in hospitalized patients, did not include carbapenem-resistant genotypes. Acinetobacter species isolated from battlefield casualties are diverse, including genotypes belonging to European clones I to III. Two carbapenem-resistant genotypes were epidemic, one of which appeared to belong to a novel international clone. PMID:21084513

  8. Diversity and clinical impact of Acinetobacter baumannii colonization and infection at a military medical center.


    Petersen, Kyle; Cannegieter, Suzanne C; van der Reijden, Tanny J; van Strijen, Beppie; You, David M; Babel, Britta S; Philip, Andrew I; Dijkshoorn, Lenie


    The epidemiology of Acinetobacter baumannii emerging in combat casualties is poorly understood. We analyzed 65 (54 nonreplicate) Acinetobacter isolates from 48 patients (46 hospitalized and 2 outpatient trainees entering the military) from October 2004 to October 2005 for genotypic similarities, time-space relatedness, and antibiotic susceptibility. Clinical and surveillance cultures were compared by amplified fragment length polymorphism (AFLP) genomic fingerprinting to each other and to strains of a reference database. Antibiotic susceptibility was determined, and multiplex PCR was performed for OXA-23-like, -24-like, -51-like, and -58-like carbapenemases. Records were reviewed for overlapping hospital stays of the most frequent genotypes, and risk ratios were calculated for any association of genotype with severity of Acute Physiology and Chronic Health Evaluation II (APACHE II) score or injury severity score (ISS) and previous antibiotic use. Nineteen genotypes were identified; two predominated, one consistent with an emerging novel international clone and the other unique to our database. Both predominant genotypes were carbapenem resistant, were present at another hospital before patients' admission to our facility, and were associated with higher APACHE II scores, higher ISSs, and previous carbapenem antibiotics in comparison with other genotypes. One predominated in wound and respiratory isolates, and the other predominated in wound and skin surveillance samples. Several other genotypes were identified as European clones I to III. Acinetobacter genotypes from recruits upon entry to the military, unlike those in hospitalized patients, did not include carbapenem-resistant genotypes. Acinetobacter species isolated from battlefield casualties are diverse, including genotypes belonging to European clones I to III. Two carbapenem-resistant genotypes were epidemic, one of which appeared to belong to a novel international clone.

  9. Genomic Evolution of Two Acinetobacter baumannii Clinical Strains from ST-2 Clones Isolated in 2000 and 2010 (ST-2_clon_2000 and ST-2_clon_2010).


    López, M; Rueda, A; Florido, J P; Blasco, L; Gato, E; Fernández-García, L; Martínez-Martínez, L; Fernández-Cuenca, F; Pachón, J; Cisneros, J M; Garnacho-Montero, J; Vila, J; Rodríguez-Baño, J; Pascual, A; Bou, G; Tomás, M


    Acinetobacter baumannii is a successful nosocomial pathogen due to its ability to persist in hospital environments by acquiring mobile elements such as transposons, plasmids, and phages. In this study, we compared two genomes of A. baumannii clinical strains isolated in 2000 (ST-2_clon_2000) and 2010 (ST-2_clon_2010) from GenBank project PRJNA308422.

  10. Genomic Evolution of Two Acinetobacter baumannii Clinical Strains from ST-2 Clones Isolated in 2000 and 2010 (ST-2_clon_2000 and ST-2_clon_2010)

    PubMed Central

    López, M.; Rueda, A.; Florido, J. P.; Blasco, L.; Gato, E.; Fernández-García, L.; Martínez-Martínez, L.; Fernández-Cuenca, F.; Pachón, J.; Cisneros, J. M.; Garnacho-Montero, J.; Vila, J.; Rodríguez-Baño, J.; Pascual, A.; Bou, G.


    Acinetobacter baumannii is a successful nosocomial pathogen due to its ability to persist in hospital environments by acquiring mobile elements such as transposons, plasmids, and phages. In this study, we compared two genomes of A. baumannii clinical strains isolated in 2000 (ST-2_clon_2000) and 2010 (ST-2_clon_2010) from GenBank project PRJNA308422. PMID:27795287

  11. Complete Genome Sequence of the Clinical Strain Acinetobacter baumannii R2090 Carrying the Chromosomally Encoded Metallo-β-Lactamase Gene blaNDM-1

    PubMed Central

    Krahn, Thomas; Wibberg, Daniel; Maus, Irena; Winkler, Anika; Nordmann, Patrice; Pühler, Alfred; Poirel, Laurent


    Acinetobacter baumannii is an emerging human pathogen causing nosocomial and community-acquired infections. Here, we present the complete genome sequence of the clinical A. baumannii strain R2090 carrying the metallo-β-lactamase gene blaNDM-1 in its chromosome within the transposon Tn125. PMID:26358593

  12. Investigation of a nosocomial outbreak of extended-spectrum beta-lactamase VEB-1-producing isolates of Acinetobacter baumannii in a hospital setting.


    Carbonne, A; Naas, T; Blanckaert, K; Couzigou, C; Cattoen, C; Chagnon, J-L; Nordmann, P; Astagneau, P


    A nosocomial outbreak of epidemiologically related VEB-1 extended-spectrum beta-lactamase-producing isolates of Acinetobacter baumannii occurred in 33 patients in an intensive care unit. A case-control study identified previous treatment with third-generation cephalosporins as the only risk factor for A. baumannii acquisition. Rationale for antibiotic use should be strengthened.

  13. A distinct alleles and genetic recombination of pmrCAB operon in species of Acinetobacter baumannii complex isolates.


    Kim, Dae Hun; Ko, Kwan Soo


    To investigate pmrCAB sequence divergence in 5 species of Acinetobacter baumannii complex, a total of 80 isolates from a Korean hospital were explored. We evaluated nucleotide and amino acid polymorphisms of pmrCAB operon, and phylogenetic trees were constructed for each gene of prmCAB operon. Colistin and polymyxin B susceptibility was determined for all isolates, and multilocus sequence typing was also performed for A. baumannii isolates. Our results showed that each species of A. baumannii complex has divergent pmrCAB operon sequences. We identified a distinct pmrCAB allele allied with Acinetobacter nosocomialis in gene trees. Different grouping in each gene tree suggests sporadic recombination or emergence of pmrCAB genes among Acinetobacter species. Sequence polymorphisms among Acinetobacter species might not be associated with colistin resistance. We revealed that a distinct pmrCAB allele may be widespread across the continents such as North America and Asia and that sporadic genetic recombination or emergence of pmrCAB genes might occur.

  14. A New Combination of a Pleuromutilin Derivative and Doxycycline for Treatment of Multidrug-Resistant Acinetobacter baumannii.


    Siricilla, Shajila; Mitachi, Katsuhiko; Yang, Junshu; Eslamimehr, Shakiba; Lemieux, Maddie R; Meibohm, Bernd; Ji, Yinduo; Kurosu, Michio


    Multidrug-resistant (MDR) Acinetobacter baumannii is one of the most difficult Gram-negative bacteria to treat and eradicate. In a cell-based screening of pleuromutilin derivatives against a drug sensitive A. baumannii strain, new molecules (2-4) exhibit bacteriostatic activity with 3.13 μg/mL concentration and 1 shows bactericidal activity with an MBC of 6.25 μg/mL. The pleuromutilin derivative 1 displays strong synergistic effects with doxycycline in a wide range of concentrations. A 35/1 ratio of 1 and doxycycline (1-Dox 35/1) kills drug susceptible A. baumannii with the MBC of 2.0 μg/mL and an MDR A. baumannii with the MBC of 3.13 μg/mL. In vitro anti-Acinetobacter activity of 1-Dox 35/1 is superior to that of clinical drugs such as tobramycin, tigecycline, and colistin. The efficacy of 1-Dox 35/1 is evaluated in a mouse septicemia model; treatment of the infected C57BL/6 mice with 1-Dox 35/1 protects from lethal infection of A. baumannii with an ED50 value of <2.0 mg/kg.

  15. Molecular Epidemiology and Clinical Impact of Acinetobacter calcoaceticus-baumannii Complex in a Belgian Burn Wound Center

    PubMed Central

    Bilocq, Florence; Jennes, Serge; Verbeken, Gilbert; Rose, Thomas; Keersebilck, Elkana; Bosmans, Petra; Pieters, Thierry; Hing, Mony; Heuninckx, Walter; De Pauw, Frank; Soentjens, Patrick; Merabishvili, Maia; Deschaght, Pieter; Vaneechoutte, Mario; Bogaerts, Pierre; Glupczynski, Youri; Pot, Bruno; van der Reijden, Tanny J.; Dijkshoorn, Lenie


    Multidrug resistant Acinetobacter baumannii and its closely related species A. pittii and A. nosocomialis, all members of the Acinetobacter calcoaceticus-baumannii (Acb) complex, are a major cause of hospital acquired infection. In the burn wound center of the Queen Astrid military hospital in Brussels, 48 patients were colonized or infected with Acb complex over a 52-month period. We report the molecular epidemiology of these organisms, their clinical impact and infection control measures taken. A representative set of 157 Acb complex isolates was analyzed using repetitive sequence-based PCR (rep-PCR) (DiversiLab) and a multiplex PCR targeting OXA-51-like and OXA-23-like genes. We identified 31 rep-PCR genotypes (strains). Representatives of each rep-type were identified to species by rpoB sequence analysis: 13 types to A. baumannii, 10 to A. pittii, and 3 to A. nosocomialis. It was assumed that isolates that belonged to the same rep-type also belonged to the same species. Thus, 83.4% of all isolates were identified to A. baumannii, 9.6% to A. pittii and 4.5% to A. nosocomialis. We observed 12 extensively drug resistant Acb strains (10 A. baumannii and 2 A. nosocomialis), all carbapenem-non-susceptible/colistin-susceptible and imported into the burn wound center through patients injured in North Africa. The two most prevalent rep-types 12 and 13 harbored an OXA-23-like gene. Multilocus sequence typing allocated them to clonal complex 1 corresponding to EU (international) clone I. Both strains caused consecutive outbreaks, interspersed with periods of apparent eradication. Patients infected with carbapenem resistant A. baumannii were successfully treated with colistin/rifampicin. Extensive infection control measures were required to eradicate the organisms. Acinetobacter infection and colonization was not associated with increased attributable mortality. PMID:27223476

  16. Alcohol impairs J774.16 macrophage-like cell antimicrobial functions in Acinetobacter baumannii infection

    PubMed Central

    Asplund, Melissa B; Coelho, Carolina; Cordero, Radames JB; Martinez, Luis R


    Acinetobacter baumannii (Ab) is a common cause of community-acquired pneumonia (CAP) in chronic alcoholics in tropical and sub-tropical climates and associated with a >50% mortality rate. We demonstrated that exposure of J774.16 macrophage-like cells to physiological alcohol (EtOH) concentrations decreased phagocytosis and killing of Ab. EtOH-mediated macrophage phagocytosis dysfunction may be associated with reduced expression of GTPase-RhoA, a key regulator of the actin polymerization signaling cascade. EtOH inhibited nitric oxide (NO) generation via inducible NO-synthase inactivation, which enhanced Ab survival within macrophages. Additionally, EtOH alters cytokine production resulting in a dysregulated immune response. This study is a proof of principle which establishes that EtOH might exacerbate Ab infection and be an important factor enhancing CAP in individuals at risk. PMID:23863607

  17. Alcohol impairs J774.16 macrophage-like cell antimicrobial functions in Acinetobacter baumannii infection.


    Asplund, Melissa B; Coelho, Carolina; Cordero, Radames J B; Martinez, Luis R


    Acinetobacter baumannii (Ab) is a common cause of community-acquired pneumonia (CAP) in chronic alcoholics in tropical and sub-tropical climates and associated with a > 50% mortality rate. We demonstrated that exposure of J774.16 macrophage-like cells to physiological alcohol (EtOH) concentrations decreased phagocytosis and killing of Ab. EtOH-mediated macrophage phagocytosis dysfunction may be associated with reduced expression of GTPase-RhoA, a key regulator of the actin polymerization signaling cascade. EtOH inhibited nitric oxide (NO) generation via inducible NO-synthase inactivation, which enhanced Ab survival within macrophages. Additionally, EtOH alters cytokine production resulting in a dysregulated immune response. This study is a proof of principle which establishes that EtOH might exacerbate Ab infection and be an important factor enhancing CAP in individuals at risk.

  18. Ultrafast Structural Dynamics of BlsA, a Photoreceptor from the Pathogenic Bacterium Acinetobacter baumannii

    PubMed Central


    Acinetobacter baumannii is an important human pathogen that can form biofilms and persist under harsh environmental conditions. Biofilm formation and virulence are modulated by blue light, which is thought to be regulated by a BLUF protein, BlsA. To understand the molecular mechanism of light sensing, we have used steady-state and ultrafast vibrational spectroscopy to compare the photoactivation mechanism of BlsA to the BLUF photosensor AppA from Rhodobacter sphaeroides. Although similar photocycles are observed, vibrational data together with homology modeling identify significant differences in the β5 strand in BlsA caused by photoactivation, which are proposed to be directly linked to downstream signaling. PMID:24723998

  19. Characterization of Acinetobacter baumannii from intensive care units and home care patients in Palermo, Italy.


    Mammina, C; Bonura, C; Aleo, A; Calà, C; Caputo, G; Cataldo, M C; Di Benedetto, A; Distefano, S; Fasciana, T; Labisi, M; Sodano, C; Palma, D M; Giammanco, A


    In this study 45 isolates of Acinetobacter baumannii identified from patients in intensive care units of three different hospitals and from pressure ulcers in home care patients in Palermo, Italy, during a 3-month period in 2010, were characterized. All isolates were resistant to at least three classes of antibiotics, but susceptible to colistin and tygecycline. Forty isolates were non-susceptible to carbapenems. Eighteen and two isolates, respectively, carried the bla(OXA-23-like) and the bla(OXA-58-like) genes. One strain carried the VIM-4 gene. Six major rep-PCR subtype clusters were defined, including isolates from different hospitals or home care patients. The sequence type/pulsed field gel electrophoresis group ST2/A included 33 isolates, and ST78/B the remaining 12. ST2 clone proved to be predominant, but a frequent involvement of the ST78 clone was evident.

  20. A PmrB-Regulated Deacetylase Required for Lipid A Modification and Polymyxin Resistance in Acinetobacter baumannii.


    Chin, Chui-Yoke; Gregg, Kelsey A; Napier, Brooke A; Ernst, Robert K; Weiss, David S


    Emerging resistance to "last-resort" polymyxin antibiotics in Gram-negative bacteria is a significant threat to public health. We identified the Acinetobacter baumannii NaxD deacetylase as a critical mediator of lipid A modification resulting in polymyxin resistance and demonstrated that naxD is regulated by the sensor kinase PmrB. This represents the first description of a specific PmrB-regulated gene contributing to polymyxin resistance in A. baumannii and highlights NaxD as a putative drug target to reverse polymyxin resistance.

  1. A PmrB-Regulated Deacetylase Required for Lipid A Modification and Polymyxin Resistance in Acinetobacter baumannii

    PubMed Central

    Chin, Chui-Yoke; Gregg, Kelsey A.; Napier, Brooke A.; Ernst, Robert K.


    Emerging resistance to “last-resort” polymyxin antibiotics in Gram-negative bacteria is a significant threat to public health. We identified the Acinetobacter baumannii NaxD deacetylase as a critical mediator of lipid A modification resulting in polymyxin resistance and demonstrated that naxD is regulated by the sensor kinase PmrB. This represents the first description of a specific PmrB-regulated gene contributing to polymyxin resistance in A. baumannii and highlights NaxD as a putative drug target to reverse polymyxin resistance. PMID:26459891

  2. NDM-1-Producing Citrobacter freundii, Escherichia coli, and Acinetobacter baumannii Identified from a Single Patient in China.


    Huang, Ying-Min; Zhong, Lan-Lan; Zhang, Xue-Fei; Hu, Hang-Tong; Li, Yu-Qi; Yang, Xiao-Rong; Feng, Lian-Qiang; Huang, Xi; Tian, Guo-Bao


    We identified New Delhi metallo-β-lactamase (NDM-1)-producing Citrobacter freundii GB032, Escherichia coli GB102, and Acinetobacter baumannii GB661 in urine and stool samples from a single patient in China. Plasmid profiling and Southern blotting indicated that blaNDM-1 from GB032 and that from GB102 were likely located on the same plasmid, while blaNDM-1 from GB661 was located on a very large (>400-kb) plasmid. This case underscores the broad host range of blaNDM-1 and its potential to spread between members of the family Enterobacteriaceae and A. baumannii.

  3. Transposons and integrons in colistin-resistant clones of Klebsiella pneumoniae and Acinetobacter baumannii with epidemic or sporadic behaviour.


    Arduino, Sonia M; Quiroga, María Paula; Ramírez, María Soledad; Merkier, Andrea Karina; Errecalde, Laura; Di Martino, Ana; Smayevsky, Jorgelina; Kaufman, Sara; Centrón, Daniela


    Multiple transposons, integrons and carbapenemases were found in Klebsiella pneumoniae colistin-resistant isolates as well as a genomic resistance island of the AbaR type in Acinetobacter baumannii colistin-resistant isolates from different hospitals from Buenos Aires City. PFGE analysis showed a polyclonal dissemination of antimicrobial resistance mechanisms among K. pneumoniae isolates, while in A. baumannii isolates the epidemic clone 1 from South America was found. Resistance determinants associated with horizontal gene transfer are contributing to the evolution to pandrug resistance in both epidemic and sporadic clones.

  4. NDM-1-Producing Citrobacter freundii, Escherichia coli, and Acinetobacter baumannii Identified from a Single Patient in China

    PubMed Central

    Huang, Ying-Min; Zhong, Lan-lan; Zhang, Xue-Fei; Hu, Hang-tong; Li, Yu-qi; Yang, Xiao-rong; Feng, Lian-Qiang; Huang, Xi


    We identified New Delhi metallo-β-lactamase (NDM-1)-producing Citrobacter freundii GB032, Escherichia coli GB102, and Acinetobacter baumannii GB661 in urine and stool samples from a single patient in China. Plasmid profiling and Southern blotting indicated that blaNDM-1 from GB032 and that from GB102 were likely located on the same plasmid, while blaNDM-1 from GB661 was located on a very large (>400-kb) plasmid. This case underscores the broad host range of blaNDM-1 and its potential to spread between members of the family Enterobacteriaceae and A. baumannii. PMID:26055374

  5. Acinetobacter baumannii Isolated from Lebanese Patients: Phenotypes and Genotypes of Resistance, Clonality, and Determinants of Pathogenicity

    PubMed Central

    Dahdouh, Elias; Hajjar, Micheline; Suarez, Monica; Daoud, Ziad


    Introduction: Acinetobacter baumannii is a nosocomial pathogen that usually affects critically ill patients. High mortality rates have been associated with MDR A. baumannii infections. Carbapenem resistance among these isolates is increasing worldwide and is associated with certain International Clones (ICs) and oxacillinases (OXAs). Moreover, this organism possesses a wide range of virulence factors, whose expression is not yet fully understood. In this study, clinical A. baumannii isolates are characterized in terms of antibiotic resistance, mechanisms of carbapenem resistance, clonality, and virulence. Materials and Methods: A. baumannii clinical isolates (n = 90) where obtained from a tertiary care center in Beirut, Lebanon. API 20NE strips in addition to the amplification of blaOXA−51−like were used for identification. Antibiotic susceptibility testing by disk diffusion was then performed in addition to PCRs for the detection of the most commonly disseminated carbapenemases. Clonality was determined by tri-locus PCR typing and doubling times were determined for isolates with varying susceptibility profiles. Biofilm formation, hemolysis, siderophore production, proteolytic activity, and surface motility was then determined for all the isolates. Statistical analysis was then performed for the determination of associations. Results and Discussion: 81 (90%) of the isolates were resistant to carbapenems. These high rates are similar to other multi-center studies in the country suggesting the need of intervention on a national level. 74 (91.3%) of the carbapenem resistant isolates harbored blaOXA−23−like including two that also harbored blaOXA−24−like. 88.9% of the A. baumannii isolates pertained to ICII and three other international clones were detected, showing the wide dissemination of clones into geographically distinct locations. Virulence profiles were highly diverse and no specific pattern was observed. Nevertheless, an association between

  6. Clinically Relevant Growth Conditions Alter Acinetobacter baumannii Antibiotic Susceptibility and Promote Identification of Novel Antibacterial Agents

    PubMed Central

    Colquhoun, Jennifer M.; Wozniak, Rachel A. F.; Dunman, Paul M.


    Biological processes that govern bacterial proliferation and survival in the host-environment(s) are likely to be vastly different from those that are required for viability in nutrient-rich laboratory media. Consequently, growth-based antimicrobial screens performed in conditions modeling aspects of bacterial disease states have the potential to identify new classes of antimicrobials that would be missed by screens performed in conventional laboratory media. Accordingly, we performed screens of the Selleck library of 853 FDA approved drugs for agents that exhibit antimicrobial activity toward the Gram-negative bacterial pathogen Acinetobacter baumannii during growth in human serum, lung surfactant, and/or the organism in the biofilm state and compared those results to that of conventional laboratory medium. Results revealed that a total of 90 compounds representing 73 antibiotics and 17 agents that were developed for alternative therapeutic indications displayed antimicrobial properties toward the test strain in at least one screening condition. Of the active library antibiotics only four agents, rifampin, rifaximin, ciprofloxacin and tetracycline, exhibited antimicrobial activity toward the organism during all screening conditions, whereas the remainder were inactive in ≥ 1 condition; 56 antibiotics were inactive during serum growth, 25 and 38 were inactive toward lung surfactant grown and biofilm-associated cells, respectively, suggesting that subsets of antibiotics may outperform others in differing infection settings. Moreover, 9 antibiotics that are predominantly used for the treatment Gram-positive pathogens and 10 non-antibiotics lacked detectable antimicrobial activity toward A. baumannii grown in conventional medium but were active during ≥ 1 alternative growth condition(s). Such agents may represent promising anti-Acinetobacter agents that would have likely been overlooked by antimicrobial whole cell screening assays performed in traditional

  7. Expression of Toll-like receptor 4 in lungs of immune-suppressed rat with Acinetobacter baumannii infection

    PubMed Central

    Wang, Yanmei; Zhang, Xiaohong; Feng, Xuanlin; Liu, Xiaoshu; Deng, Lei; Liang, Zong-An


    Toll-like receptor 4 (TLR4) is involved in the regulation of host responses to Acinetobacter baumannii (A. baumannii). The aim of the present study was to examine the function of TLR4 in lung inflammation in immune-suppressed rats with A. baumannii infection. A total of 72 Sprague-Dawley male rats were randomly divided into the control, A. baumannii infection and immune-suppressed infection groups. The immune-suppressed infection group was treated with 100 mg/kg hydrocortisone by subcutaneous injection every other day for 2 weeks prior to A. baumannii infection. Lung tissue was obtained on the 3rd and 7th day after tracheal inoculation with A. baumannii. The expression of TLR4 in bronchial and alveolar epithelial cells, and alveolar macrophage was examined using immunohistochemistry. The levels of interleukin (IL)-6, tumor necrosis factor (TNF)-α in bronchoalveolar lavage fluid were detected using ELISA. The results showed that in the control group, the expression of TLR4 was upregulated in the bronchial and alveolar epithelial, and alveolar macrophages, and the levels of IL-6 and TNF-α were increased in the early phase of A. baumannii infection. On the 7th day, no significant difference in the levels of IL-6 and TNF-α was observed between the A. baumannii infection and control groups. Conversely, the expression of TLR4 was downregulated in the immune-suppressed group, and the levels of IL-6 and TNF-α were reduced on the 3rd day after infection. In the subsequent observation period, the expression of TLR4 was upregulated and the levels of IL-6 and TNF-α were increased. In conclusion, the results show a critical role of TLR4 in mediating effective immune response in the lung of rat with A. baumannii infection. PMID:27703512

  8. Pharmacokinetic/pharmacodynamic evaluation of sulbactam against Acinetobacter baumannii in in vitro and murine thigh and lung infection models.


    Yokoyama, Yuta; Matsumoto, Kazuaki; Ikawa, Kazuro; Watanabe, Erika; Shigemi, Akari; Umezaki, Yasuhiro; Nakamura, Koyo; Ueno, Keiichiro; Morikawa, Norifumi; Takeda, Yasuo


    Acinetobacter baumannii is a pathogen that has become globally associated with nosocomial infections. Sulbactam, a potent inhibitor of β-lactamases, was previously shown to be active against A. baumannii strains in vitro and effective against A. baumannii infections. However, a pharmacokinetic/pharmacodynamic (PK/PD) analysis of sulbactam against A. baumannii infections has not yet been performed. This is necessary because optimisation of dosing regimens should be based on PK/PD analysis. Therefore, in vitro and in vivo PK/PD analyses of sulbactam were performed using murine thigh and lung infection models of A. baumannii to evaluate the pharmacokinetics and pharmacodynamics of sulbactam. Sulbactam showed time-dependent bactericidal activity in vitro against A. baumannii. The PK/PD index that best correlated with its in vivo effects was the time that the free drug concentration remained above the minimum inhibitory concentration (fT>MIC) both in the thigh (R(2)=0.95) and lung (R(2)=0.96) infection models. Values of fT>MIC for a static effect and 1, 2 and 3log10 kill, respectively, were 21.0%, 32.9%, 43.6% and 57.3% in the thigh infection model and 20.4%, 24.5%, 29.3% and 37.3% in the lung infection model. Here we report the in vitro and in vivo time-dependent activities of sulbactam against A. baumannii infection and demonstrate that sulbactam was sufficiently bactericidal when an fT>MIC of >60% against A. baumannii thigh infection and >40% against A. baumannii lung infection was achieved.

  9. Using Vitek MALDI-TOF mass spectrometry to identify species belonging to the Acinetobacter calcoaceticus-Acinetobacter baumannii complex: a relevant alternative to molecular biology?


    Pailhoriès, Hélène; Daure, Sophie; Eveillard, Matthieu; Joly-Guillou, Marie-Laure; Kempf, Marie


    Acinetobacter baumannii belongs to the Acinetobacter calcoaceticus-baumannii complex (Acb) containing 2 other pathogenic species: Acinetobacter pittii and Acinetobacter nosocomialis. Identification of these bacteria remains problematic despite the use of matrix-assisted laser ionization time-of-flight mass spectrometry (MALDI-TOF MS). Here, we enriched the SARAMIS™ database of the Vitek MS® plus mass spectrometer to improve the identification of species of the Acb complex. For each species, we incremented reference spectra. Then, a SuperSpectrum was created based on the selection of 40 specific masses. In a second step, we validated reference spectra and SuperSpectra with 100 isolates identified by rpoB gene sequencing. All the isolates were correctly identified by MALDI-TOF MS with the database we created as compared to the identifications obtained by rpoB sequencing. Our database enabled rapid and reliable identification of the pathogen species belonging to the Acb complex. Identification by MALDI-TOF MS with our database is a good alternative to molecular biology.

  10. Molecular Epidemiology and Characterization of Multiple-Drug Resistant (MDR) Clinical Isolates of Acinetobacter baumannii

    PubMed Central

    El-Shazly, Sherief; Dashti, Ali; Vali, Leila; Bolaris, Michael; Ibrahim, Ashraf S.


    Objectives We aimed to identify the genetic relatedness of multiple-drug resistance (MDR) in Acinetobacter baumannii clinical isolates recovered from a hospital in Los Angeles. Methods Twenty one MDR A. baumannii isolates were collected and their antibiotic susceptibility were determined according to the CLSI guidelines. Genes coding for antibiotic resistance were identified by PCR and their identities were confirmed by DNA sequencing. Clonal relationships were studied by pulsed-field gel electrophoresis (PFGE) and multi-locus sequence typing (MLST). Results MDR consistently correlated with the presence of oxacillinases, mostly in the form of plasmid-mediated OXA-23 enzyme which were detected in 12 (57.1%) isolates. GES-type carbapenemases were found in 20 (95.2%) strains, AAC in all 21 (100%) strains, PER in 7 (33.3%) strains and ISAba1 has been detected in 16 (76.2%) isolates. The association between ISAba1 and resistant genes confirms insertion elements as a source of β-lactamase production. Of the 21 clinical isolates, 5 were found to be related to sequence type-1 (ST1) and 16 to ST2 as analyzed by MLST. PFGE demonstrated that the majority of clinical isolates are highly related (>85%). Conclusions This study supports a more complete understanding of genotyping of antibiotic resistance for better assessment of MDR strains transmission. PMID:26518066

  11. Crystal Structure of Hcp from Acinetobacter baumannii: A Component of the Type VI Secretion System

    PubMed Central

    Ruiz, Federico M.; Santillana, Elena; Spínola-Amilibia, Mercedes; Torreira, Eva; Culebras, Esther; Romero, Antonio


    The type VI secretion system (T6SS) is a bacterial macromolecular machine widely distributed in Gram-negative bacteria, which transports effector proteins into eukaryotic host cells or other bacteria. Membrane complexes and a central tubular structure, which resembles the tail of contractile bacteriophages, compose the T6SS. One of the proteins forming this tube is the hemolysin co-regulated protein (Hcp), which acts as virulence factor, as transporter of effectors and as a chaperone. In this study, we present the structure of Hcp from Acinetobacter baumannii, together with functional and oligomerization studies. The structure of this protein exhibits a tight β barrel formed by two β sheets and flanked at one side by a short α-helix. Six Hcp molecules associate to form a donut-shaped hexamer, as observed in both the crystal structure and solution. These results emphasize the importance of this oligomerization state in this family of proteins, despite the low similarity of sequence among them. The structure presented in this study is the first one for a protein forming part of a functional T6SS from A. baumannii. These results will help us to understand the mechanism and function of this secretion system in this opportunistic nosocomial pathogen. PMID:26079269

  12. Crystal Structure of Hcp from Acinetobacter baumannii: A Component of the Type VI Secretion System.


    Ruiz, Federico M; Santillana, Elena; Spínola-Amilibia, Mercedes; Torreira, Eva; Culebras, Esther; Romero, Antonio


    The type VI secretion system (T6SS) is a bacterial macromolecular machine widely distributed in Gram-negative bacteria, which transports effector proteins into eukaryotic host cells or other bacteria. Membrane complexes and a central tubular structure, which resembles the tail of contractile bacteriophages, compose the T6SS. One of the proteins forming this tube is the hemolysin co-regulated protein (Hcp), which acts as virulence factor, as transporter of effectors and as a chaperone. In this study, we present the structure of Hcp from Acinetobacter baumannii, together with functional and oligomerization studies. The structure of this protein exhibits a tight β barrel formed by two β sheets and flanked at one side by a short α-helix. Six Hcp molecules associate to form a donut-shaped hexamer, as observed in both the crystal structure and solution. These results emphasize the importance of this oligomerization state in this family of proteins, despite the low similarity of sequence among them. The structure presented in this study is the first one for a protein forming part of a functional T6SS from A. baumannii. These results will help us to understand the mechanism and function of this secretion system in this opportunistic nosocomial pathogen.

  13. In vitro activities of antimicrobial agents, alone and in combination, against Acinetobacter baumannii isolated from blood.


    Chang, S C; Chen, Y C; Luh, K T; Hsieh, W C


    In vitro activities of 15 antimicrobial agents against 90 strains of Acinetobacter baumannii isolated from blood cultures from hospitalized patients were determined using the agar dilution method. Imipenem, ofloxacin, and ciprofloxacin had the best antimicrobial activity with minimum inhibitory concentrations (MIC50s) of 0.25 mu g/ml and MIC90s of 0.5-1 mu g/ml. beta-lactam antibiotics other than imipenem had poor activity, with MIC50s ranging from 8 to 64 mu g/ml and MIC90s from 32 to > or = 256 mu g/ml. The checkerboard titration method was used to study the effects of combination of two antimicrobial agents. Combinations of ceftazidime, aztreonam, imipenem, or ciprofloxacin with amikacin showed either synergistic effects or partial synergistic effects for 40.9%-86.4% of 22 tested strains. The best in vitro activity was observed with the combination of imipenem and amikacin. No antagonistic effects were observed with the combination of imipenem and amikacin. Synergistic effects were confirmed by time-kill curve studies. In conclusion, imipenem, ofloxacin, and ciprofloxacin were the three most active agents against human blood isolates of A. baumannii. The combination of a beta-lactam or ciprofloxacin with amikacin was synergistic for some of the isolates.

  14. Clinical Use of Colistin Induces Cross-Resistance to Host Antimicrobials in Acinetobacter baumannii

    PubMed Central

    Napier, Brooke A.; Burd, Eileen M.; Satola, Sarah W.; Cagle, Stephanie M.; Ray, Susan M.; McGann, Patrick; Pohl, Jan; Lesho, Emil P.; Weiss, David S.


    ABSTRACT The alarming rise in antibiotic resistance has led to an increase in patient mortality and health care costs. This problem is compounded by the absence of new antibiotics close to regulatory approval. Acinetobacter baumannii is a human pathogen that causes infections primarily in patients in intensive care units (ICUs) and is highly antibiotic resistant. Colistin is one of the last-line antibiotics for treating A. baumannii infections; however, colistin-resistant strains are becoming increasingly common. This cationic antibiotic attacks negatively charged bacterial membranes in a manner similar to that seen with cationic antimicrobials of the innate immune system. We therefore set out to determine if the increasing use of colistin, and emergence of colistin-resistant strains, is concomitant with the generation of cross-resistance to host cationic antimicrobials. We found that there is indeed a positive correlation between resistance to colistin and resistance to the host antimicrobials LL-37 and lysozyme among clinical isolates. Importantly, isolates obtained before and after treatment of individual patients demonstrated that colistin use correlated with increased resistance to cationic host antimicrobials. These data reveal the overlooked risk of inducing cross-resistance to host antimicrobials when treating patients with colistin as a last-line antibiotic. PMID:23695834

  15. Demonstration of the interactions between aromatic compound-loaded lipid nanocapsules and Acinetobacter baumannii bacterial membrane.


    Montagu, A; Joly-Guillou, M-L; Guillet, C; Bejaud, J; Rossines, E; Saulnier, P


    Acinetobacter baumannii is an important nosocomial pathogen that is resistant to many commonly-used antibiotics. One strategy for treatment is the use of aromatic compounds (carvacrol, cinnamaldehyde) against A. baumannii. The aim of this study was to determine the interactions between bacteria and lipid nanocapsules (LNCs) over time based on the fluorescence of 3,3'-Dioctadecyloxacarbocyanine Perchlorate-LNCs (DiO-LNCs) and the properties of trypan blue to analyse the physicochemical mechanisms occurring at the level of the biological membrane. The results demonstrated the capacity of carvacrol-loaded LNCs to interact with and penetrate the bacterial membrane in comparison with cinnamaldehyde-loaded LNCs and unloaded LNCs. Modifications of carvacrol after substitution of hydroxyl functional groups by fatty acids demonstrated the crucial role of hydroxyl functions in antibacterial activity. Finally, after contact with the efflux pump inhibitor, carbonylcyanide-3-chlorophenyl hydrazine (CCCP), the results indicated the total synergistic antibacterial effect with Car-LNCs, showing that CCCP is associated with the action mechanism of carvacrol, especially at the level of the efflux pump mechanism.

  16. Synergistic Effect of Oleanolic Acid on Aminoglycoside Antibiotics against Acinetobacter baumannii

    PubMed Central

    Shin, Bora; Park, Woojun


    Difficulties involved in treating drug-resistant pathogens have created a need for new therapies. In this study, we investigated the possibility of using oleanolic acid (OA), a natural pentacyclic triterpenoid, as a natural adjuvant for antibiotics against Acinetobacter baumannii. High concentrations of OA can kill cells, partly because it generates reactive oxygen species. Measurement of the fractional inhibitory concentration (FIC) for OA and time-kill experiments demonstrated that it only synergizes with aminoglycoside antibiotics (e.g., gentamicin, kanamycin). Other classes of antibiotics (e.g., ampicillin, rifampicin, norfloxacin, chloramphenicol, and tetracycline) have no interactions with OA. Microarray and quantitative reverse transcription-PCR analysis indicated that genes involved in ATP synthesis and cell membrane permeability, the gene encoding glycosyltransferase, peptidoglycan-related genes, phage-related genes, and DNA repair genes were upregulated under OA. OA highly induces the expression of adk, which encodes an adenylate kinase, and des6, which encodes a linoleoyl-CoA desaturase, and deletion of these genes increased FICs; these observations indicate that adk and des6 are involved in the synergism of OA with aminoglycosides. Data obtained using 8-anilino-1-naphthalenesulfonic acid, fluorescence-conjugated gentamicin, and membrane fatty acid analysis indicates that adk and des6 are involved in changes in membrane permeability. Proton-motive force and ATP synthesis tests show that those genes are also involved in energy metabolism. Taken together, our data show that OA boosts aminoglycoside uptake by changing membrane permeability and energy metabolism in A. baumannii. PMID:26360766

  17. Molecular epidemiology of carbapenem-resistant Acinetobacter baumannii in South America.


    Rodríguez, Carlos Hernán; Balderrama Yarhui, Norah; Nastro, Marcela; Nuñez Quezada, Tamara; Castro Cañarte, Glenda; Magne Ventura, Raquel; Ugarte Cuba, Tayita; Valenzuela, Natalia; Roach, Freddy; Mota, María Inés; Burger, Noelia; Velázquez Aguayo, Gladys; Ortellado-Canese, Juana; Bruni, Geni; Pandolfo, Cecilia; Bastyas, Nadya; Famiglietti, Angela


    One hundred and twenty-six epidemiologically sequential, unrelated, carbapenem-resistant Acinetobacter baumannii isolates from nine hospitals in six countries of South America were collected between July 2013 and June 2014. Genes coding for Ambler class D and B carbapenemases were sought by PCR. All isolates were typed using the 3-locus sequence typing and blaOXA-51-like sequence-based typing techniques. The blaOXA-23 gene was recovered in all the participating hospitals and in all the isolates of seven of nine medical centres. The blaOXA-72 gene was only recovered in the two medical centres from Guayaquil city, Ecuador. Trilocus sequence typing revealed the presence of sequence groups SG2, SG4 and SG5. blaOXA-51-like sequence-based typing revealed the presence of blaOXA-132, blaOXA-65, blaOXA-69 and blaOXA-64. Our results showed that the population of carbapenem-resistant A. baumannii in South America was principally associated with ST79, ST25 and ST15 (92 %) and harboured the blaOXA-23 gene mainly. CC2 was not detected.

  18. Characterisation and clonal dissemination of OXA-23-producing Acinetobacter baumannii in Tabriz, northwest Iran.


    Peymani, Amir; Higgins, Paul G; Nahaei, Mohammad-Reza; Farajnia, Safar; Seifert, Harald


    The characteristics and molecular epidemiology of carbapenemase genes amongst 68 imipenem-resistant Acinetobacter baumannii isolated from Imam Reza Hospital (Tabriz, Iran) during a 17-month period were studied. All 68 isolates were typed using sequence group-based multiplex polymerase chain reaction (PCR) to compare the clonal relationship of isolates with known international clonal lineages. Repetitive sequence-based PCR was further performed with representative isolates of each clone. PCR and sequencing were performed to detect OXA-type carbapenemases and class 1, 2 and 3 integron genes as well as to confirm the presence of insertion sequence ISAba1 upstream of bla(OXA-23) and bla(OXA-51-like) genes. Sixty-four isolates (94%) belonged to international clone (IC) II, two isolates (3%) belonged to IC I and two isolates (3%) did not belong to known international clones. All isolates carried bla(OXA-51-like), bla(OXA-23) and class 1 integron genes. No other acquired bla(OXA) genes or class 2 or 3 integron genes were detected. Sequence analysis confirmed the presence of bla(OXA-23) as well as the bla(OXA-51-like) variants bla(OXA-66), bla(OXA-69) and bla(OXA-88). ISAba1 was present upstream of the bla(OXA-23) gene in all of the isolates. Clonal spread of OXA-23-producing A. baumannii emphasises the need for appropriate infection control measures to prevent further spread of these multidrug-resistant organisms.

  19. Deciphering the function of the outer membrane protein OprD homologue of Acinetobacter baumannii.


    Catel-Ferreira, Manuella; Nehmé, Rony; Molle, Virginie; Aranda, Jesús; Bouffartigues, Emeline; Chevalier, Sylvie; Bou, Germán; Jouenne, Thierry; Dé, Emmanuelle


    The increasing number of carbapenem-resistant Acinetobacter baumannii isolates is a major cause for concern which restricts therapeutic options to treat severe infections caused by this emerging pathogen. To identify the molecular mechanisms involved in carbapenem resistance, we studied the contribution of an outer membrane protein homologue of the Pseudomonas aeruginosa OprD porin. Suspected to be the preferred pathway of carbapenems in A. baumannii, the oprD homologue gene was inactivated in strain ATCC 17978. Comparison of wild-type and mutant strains did not confirm the expected increased resistance to any antibiotic tested. OprD homologue sequence analysis revealed that this protein actually belongs to an OprD subgroup but is closer to the P. aeruginosa OprQ protein, with which it could share some functions, e.g., allowing bacterial survival under low-iron or -magnesium growth conditions or under poor oxygenation. We thus overexpressed and purified a recombinant OprD homologue protein to further examine its functional properties. As a specific channel, this porin presented rather low single-channel conductance, i.e., 28 pS in 1 M KCl, and was partially closed by micro- and millimolar concentrations of Fe(3+) and Mg(2+), respectively, but not by imipenem and meropenem or basic amino acids. The A. baumannii OprD homologue is likely not involved in the carbapenem resistance mechanism, but as an OprQ-like protein, it could contribute to the adaptation of this bacterium to magnesium- and/or iron-depleted environments.

  20. Variation in the OC Locus of Acinetobacter baumannii Genomes Predicts Extensive Structural Diversity in the Lipooligosaccharide

    PubMed Central

    Kenyon, Johanna J.; Nigro, Steven J.; Hall, Ruth M.


    Lipooligosaccharide (LOS) is a complex surface structure that is linked to many pathogenic properties of Acinetobacter baumannii. In A. baumannii, the genes responsible for the synthesis of the outer core (OC) component of the LOS are located between ilvE and aspS. The content of the OC locus is usually variable within a species, and examination of 6 complete and 227 draft A. baumannii genome sequences available in GenBank non-redundant and Whole Genome Shotgun databases revealed nine distinct new types, OCL4-OCL12, in addition to the three known ones. The twelve gene clusters fell into two distinct groups, designated Group A and Group B, based on similarities in the genes present. OCL6 (Group B) was unique in that it included genes for the synthesis of L-Rhamnosep. Genetic exchange of the different configurations between strains has occurred as some OC forms were found in several different sequence types (STs). OCL1 (Group A) was the most widely distributed being present in 18 STs, and OCL6 was found in 16 STs. Variation within clones was also observed, with more than one OC locus type found in the two globally disseminated clones, GC1 and GC2, that include the majority of multiply antibiotic resistant isolates. OCL1 was the most abundant gene cluster in both GC1 and GC2 genomes but GC1 isolates also carried OCL2, OCL3 or OCL5, and OCL3 was also present in GC2. As replacement of the OC locus in the major global clones indicates the presence of sub-lineages, a PCR typing scheme was developed to rapidly distinguish Group A and Group B types, and to distinguish the specific forms found in GC1 and GC2 isolates. PMID:25247305

  1. Personalized Therapeutic Cocktail of Wild Environmental Phages Rescues Mice from Acinetobacter baumannii Wound Infections

    PubMed Central

    Regeimbal, James M.; Jacobs, Anna C.; Corey, Brendan W.; Henry, Matthew S.; Thompson, Mitchell G.; Pavlicek, Rebecca L.; Quinones, Javier; Hannah, Ryan M.; Ghebremedhin, Meron; Crane, Nicole J.; Zurawski, Daniel V.; Teneza-Mora, Nimfa C.; Hall, Eric R.


    Multidrug-resistant bacterial pathogens are an increasing threat to public health, and lytic bacteriophages have reemerged as a potential therapeutic option. In this work, we isolated and assembled a five-member cocktail of wild phages against Acinetobacter baumannii and demonstrated therapeutic efficacy in a mouse full-thickness dorsal infected wound model. The cocktail lowers the bioburden in the wound, prevents the spread of infection and necrosis to surrounding tissue, and decreases infection-associated morbidity. Interestingly, this effective cocktail is composed of four phages that do not kill the parent strain of the infection and one phage that simply delays bacterial growth in vitro via a strong but incomplete selection event. The cocktail here appears to function in a combinatorial manner, as one constituent phage targets capsulated A. baumannii bacteria and selects for loss of receptor, shifting the population to an uncapsulated state that is then sensitized to the remaining four phages in the cocktail. Additionally, capsule is a known virulence factor for A. baumannii, and we demonstrated that the emergent uncapsulated bacteria are avirulent in a Galleria mellonella model. These results highlight the importance of anticipating population changes during phage therapy and designing intelligent cocktails to control emergent strains, as well as the benefits of using phages that target virulence factors. Because of the efficacy of this cocktail isolated from a limited environmental pool, we have established a pipeline for developing new phage therapeutics against additional clinically relevant multidrug-resistant pathogens by using environmental phages sourced from around the globe. PMID:27431214

  2. Antimicrobial photodynamic therapy in a mouse model of Acinetobacter baumannii burn infection

    NASA Astrophysics Data System (ADS)

    Dai, Tianhong; Tegos, George P.; Lu, Zongshun; Zhiyentayev, Timur; Huang, Liyi; Franklin, Michael J.; Baer, David G.; Hamblin, Michael R.


    Multi-drug resistant Acinetobacter baumanii infections represent a growing problem, especially in traumatic wounds and burns suffered by military personnel injured in Middle Eastern conflicts. Effective treatment using traditional antibiotics can be extremely difficult and new antimicrobial approaches are being investigated. One of these antimicrobial alternatives could be the combination of non-toxic photosensitizers (PS) and visible light known as photodynamic therapy (PDT). We report on the establishment of a new mouse model of full thickness thermal burns infected with a bioluminescent derivative of a clinical Iraqi isolate of A. baumannii and its PDT treatment by topical application of a PS produced by covalent conjugation chlorin(e6) to polyethylenimine followed by illumination of the burn surface with red light. Application of 108 A. baumannii cells to the surface of 10-second burns made on the dorsal surface of shaved female BALB/c mice led to chronic infections that lasted on average 22 days characterized by a remarkably stable bacterial bioluminescence. PDT carried out on day 0 soon after applying bacteria gave over three logs of loss of bacterial luminescence in a light exposure dependent manner, while PDT carried out on day 1 and day 2 gave approximately a 1.7-log reduction. Application of PS dissolved in 10% or 20% DMSO without light gave only modest reduction in bacterial luminescence from mouse burns. Some bacterial regrowth in the treated burn was observed but was generally modest. It was also found that PDT did not lead to inhibition of wound healing. The data suggest that PDT may be an effective new treatment for multi-drug resistant localized A. baumannii infections.

  3. Diversity of mechanisms conferring resistance to β-lactams among OXA-23-producing Acinetobacter baumannii clones.


    Cardoso, Juliana Provasi; Cayô, Rodrigo; Girardello, Raquel; Gales, Ana Cristina


    A total of 31 unrelated OXA-23-producing Acinetobacter baumannii strains isolated from 14 hospitals located in distinct Brazilian regions were evaluated in this study. These isolates were grouped into 12 different sequence types (STs), of which 7 had unique allelic sequences (ST188, ST189, ST190, ST191, ST192, ST228, and ST299). Most isolates belonged to the clonal complex CC79 followed by CC15 and CC1. Only polymyxin B and minocycline showed good activity against the OXA-23-producing A. baumannii clones. The ISAba1 upstream blaOXA-23, blaOXA-51-like, or ampC was found in 100%, 54.8%, and 77.4% of the isolates, respectively. High resistance rates to ceftazidime and cefotaxime were observed among those isolates possessing ISAba1 upstream ampC, in contrast to those isolates that did not carry this configuration. Moreover, a ≥2 Log2 decrease in the MICs of meropenem and ceftazidime was observed in the presence of phenyl-arginine-β-naphthylamide for 80.6% and 54.8% of isolates, respectively. Overexpression of the adeB was observed in 61.3% of isolates, particularly among those isolates belonging to the ST1 (CC1). It was also verified that ompW was down-regulated in all isolates belonging to the ST15 (CC15). On the other hand, carO and omp33-36 genes were overexpressed in 48.4% and 58.1% of the isolates, respectively. In this study, we show that overexpression of AdeABC system could significantly contribute for resistance to meropenem and ceftazidime among OXA-23-producing A. baumannii clones in Brazil, demonstrating the complexity involved in the β-lactam resistance in such isolates.

  4. Antimicrobial resistance determinants in Acinetobacter baumannii isolates taken from military treatment facilities.


    Taitt, Chris Rowe; Leski, Tomasz A; Stockelman, Michael G; Craft, David W; Zurawski, Daniel V; Kirkup, Benjamin C; Vora, Gary J


    Multidrug-resistant (MDR) Acinetobacter baumannii infections are of particular concern within medical treatment facilities, yet the gene assemblages that give rise to this phenotype remain poorly characterized. In this study, we tested 97 clinical A. baumannii isolates collected from military treatment facilities (MTFs) from 2003 to 2009 by using a molecular epidemiological approach that enabled for the simultaneous screening of 236 antimicrobial resistance genes. Overall, 80% of the isolates were found to be MDR, each strain harbored between one and 17 resistant determinants, and a total of 52 unique resistance determinants or gene families were detected which are known to confer resistance to β-lactam (e.g., blaGES-11, blaTEM, blaOXA-58), aminoglycoside (e.g., aphA1, aacC1, armA), macrolide (msrA, msrB), tetracycline [e.g., tet(A), tet(B), tet(39)], phenicol (e.g., cmlA4, catA1, cat4), quaternary amine (qacE, qacEΔ1), streptothricin (sat2), sulfonamide (sul1, sul2), and diaminopyrimidine (dfrA1, dfrA7, dfrA19) antimicrobial compounds. Importantly, 91% of the isolates harbored blaOXA-51-like carbapenemase genes (including six new variants), 40% harbored the blaOXA-23 carbapenemase gene, and 89% contained a variety of aminoglycoside resistance determinants with up to six unique determinants identified per strain. Many of the resistance determinants were found in potentially mobile gene cassettes; 45% and 7% of the isolates contained class 1 and class 2 integrons, respectively. Combined, the results demonstrate a facile approach that supports a more complete understanding of the genetic underpinnings of antimicrobial resistance to better assess the load, transmission, and evolution of MDR in MTF-associated A. baumannii.

  5. Optimisation of the Caenorhabditis elegans model for studying the pathogenesis of opportunistic Acinetobacter baumannii.


    Vallejo, J A; Beceiro, A; Rumbo-Feal, S; Rodríguez-Palero, M J; Russo, T A; Bou, G


    This study aimed to increase the sensitivity of Caenorhabditis elegans as an infection model for detection of minor differences in virulence or fitness between different Acinetobacter baumannii strains with known resistance and virulence mechanisms. Selected A. baumannii strains and mutants, comprising wild-type strains (ATCC 17978 and 19606), colistin-resistant strains (ATCC 19606 ΔlpxA and ATCC 19606 ΔlpxC), a clinical encapsulated isolate (AB307-0294), an imipenem-resistant strain (ATCC 17978 Δomp33-36) and an sRNA knock-out strain (ATCC 17978 Δ13573), were employed in developing killing and fertility assays in a C. elegans infection model. Because virulence levels of the strains were known, they could be used to assess assays in the nematode model for their ability to discriminate between degrees of virulence. The model was validated by microscopic analysis and in a murine sepsis infection model. The fertility assay, specifically utilising nematode growth medium, was able to detect virulence differences between the wild-type strains, ATCC 19606 ΔlpxA and isolate AB307-0294. Moreover, modification of an alternative culture medium by incremental changes in osmolarity facilitated detection of subtle virulence differences between isogenic mutants (ATCC 17978 Δomp33-36 and 17978 Δ13573). The success of the proposed fertility model depends on establishing a balance between optimal C. elegans reproduction and environmental stress leading to maximum pathogen-induced damage. This invertebrate model may reduce the need for mammalian in vivo studies of A. baumannii resistance and pathogenicity and may additionally be validated for the study of other low-virulence bacterial pathogens.

  6. Wide distribution of carbapenem resistant Acinetobacter baumannii in burns patients in Iran

    PubMed Central

    Farshadzadeh, Zahra; Hashemi, Farhad B.; Rahimi, Sara; Pourakbari, Babak; Esmaeili, Davoud; Haghighi, Mohammad A.; Majidpour, Ali; Shojaa, Saeed; Rahmani, Maryam; Gharesi, Samira; Aziemzadeh, Masoud; Bahador, Abbas


    Antimicrobial resistance in carbapenem non-susceptible Acinetobacter baumannii (CNSAb) is a major public health concern globally. This study determined the antibiotic resistance and molecular epidemiology of CNSAb isolates from a referral burn center in Tehran, Iran. Sixty-nine CNSAb isolates were tested for susceptibility to antimicrobial agents using the E test methodology. Multiple locus variable number tandem repeat analysis (MLVA), Multilocus sequence typing (MLST) and multiplex PCR were performed. PCR assays tested for ambler classes A, B, and D β-lactamases. Detection of ISAba1, characterization of integrons, and biofilm formation were investigated. Fifty-three (77%) isolates revealed XDR phenotypes. High prevalence of blaOXA-23-like (88%) and blaPER-1 (54%) were detected. ISAba1 was detected upstream of blaADC, blaOXA-23-like and blaOXA51-like genes in, 97, 42, and 26% of isolates, respectively. Thirty-one (45%) isolates were assigned to international clone (IC) variants. MLVA identified 56 distinct types with six clusters and 53 singleton genotypes. Forty previously known MLST sequence types forming 5 clonal complexes were identified. The Class 1 integron (class 1 integrons) gene was identified in 84% of the isolates. The most prevalent (33%) cassette combination was aacA4-catB8-aadA1. The IC variants were predominant in the A. baumannii lineage with the ability to form strong biofilms. The XDR-CNSAb from burned patients in Iran is resistant to various antimicrobials, including tigecycline. This study shows wide genetic diversity in CNSAb. Integrating the new Iranian A. baumannii IC variants into the epidemiologic clonal and susceptibility profile databases can help effective global control measures against the XDR-CNSAb pandemic. PMID:26539176

  7. More Than Just Light: Clinical Relevance of Light Perception in the Nosocomial Pathogen Acinetobacter baumannii and Other Members of the Genus Acinetobacter.


    Ramírez, María Soledad; Müller, Gabriela Leticia; Pérez, Jorgelina Fernanda; Golic, Adrián Ezequiel; Mussi, María Alejandra


    A summary of the major findings concerning light modulation in Acinetobacter baumannii, which governs aspects related to the success of this microorganism as a nosocomial pathogen, is presented. Particularly, the evidence shows that light modulates the ability of the bacteria to persist in the environment, its virulence against eukaryotic hosts and even susceptibility to certain antibiotics. The light signal is sensed through different mechanisms, in some cases involving specialized photoreceptors of the BLUF-type, whereas in others, directly by a photosensitizer molecule. We also provide new data concerning the genomic context of BLUF-domain containing proteins within the genus Acinetobacter, as well as further insights into the mechanism of light-mediated reduction in susceptibility to antibiotics. The overall information points toward light being a crucial stimulus in the lifestyle of members of the genus Acinetobacter as well as in other clinically relevant species, such as members of the ESKAPE group, playing therefore an important role in the clinical settings.

  8. Antimicrobial activity of novel 4H-4-oxoquinolizine compounds against extensively drug-resistant Acinetobacter baumannii strains.


    Na, Seok Hyeon; Jeon, Hyejin; Kim, Yoo Jeong; Kwon, Hyo Il; Selasi, Gati Noble; Nicholas, Asiimwe; Yun, Chang-Soo; Lee, Sang Ho; Lee, Je Chul


    The aim of this study was to screen lead compounds exhibiting potent in vitro antimicrobial activity against multidrug-resistant (MDR) Acinetobacter baumannii strains from a library of chemical compounds. In a high-throughput screening analysis of 7520 compounds representative of 340,000 small molecules, two 4H-4-oxoquinolizine compounds were the most active against A. baumannii ATCC 17978. Subsequent selection and analysis of 70 4H-4-oxoquinolizine compounds revealed that the top 7 compounds were extremely active against extensively drug-resistant (XDR) A. baumannii isolates. These compounds commonly carried a 1-cyclopropyl-7-fluoro-4-oxo-4H-quinolizine-3-carboxylic acid core structure but had different C-8 and/or C-9 moieties. Minimum inhibitory concentrations (MICs) of the seven compounds against fluoroquinolone-resistant A. baumannii isolates were found to be in the range of 0.02-1.70 µg/mL regardless of the mutation types in the quinolone resistance-determining region (QRDR) of GyrA and ParC. Cytotoxicity of the seven compounds was observed in HeLa and U937 cells at a concentration of 50 µg/mL, which was >32.5- to 119-fold higher than the MIC90 for A. baumannii isolates. In conclusion, novel 4H-4-oxoquinolizine compounds represent a promising scaffold on which to develop antimicrobial agents against drug-resistant A. baumannii strains.

  9. Early detection of metallo-β-lactamase NDM-1- and OXA-23 carbapenemase-producing Acinetobacter baumannii in Libyan hospitals.


    Mathlouthi, Najla; El Salabi, Allaaeddin Ali; Ben Jomàa-Jemili, Mariem; Bakour, Sofiane; Al-Bayssari, Charbel; Zorgani, Abdulaziz A; Kraiema, Abdulmajeed; Elahmer, Omar; Okdah, Liliane; Rolain, Jean-Marc; Chouchani, Chedly


    Acinetobacter baumannii is an opportunistic pathogen causing various nosocomial infections. The aim of this study was to characterise the molecular support of carbapenem-resistant A. baumannii clinical isolates recovered from two Libyan hospitals. Bacterial isolates were identified by matrix-assisted laser desorption/ionisation time-of-flight mass spectrometry (MALDI-TOF/MS). Antibiotic susceptibility testing was performed using disk diffusion and Etest methods, and carbapenem resistance determinants were studied by PCR amplification and sequencing. Multilocus sequence typing (MLST) was performed for typing of the isolates. All 36 imipenem-resistant isolates tested were identified as A. baumannii. The blaOXA-23 gene was detected in 29 strains (80.6%). The metallo-β-lactamase blaNDM-1 gene was detected in eight isolates (22.2%), showing dissemination of multidrug-resistant (MDR) A. baumannii in Tripoli Medical Center and Burn and Plastic Surgery Hospital in Libya, including one isolate that co-expressed the blaOXA-23 gene. MLST revealed several sequence types (STs). Imipenem-resistant A. baumannii ST2 was the predominant clone (16/36; 44.4%). This study shows that NDM-1 and OXA-23 contribute to antibiotic resistance in Libyan hospitals and represents the first incidence of the association of these two carbapenemases in an autochthonous MDR A. baumannii isolated from patients in Libya, indicating that there is a longstanding infection control problem in these hospitals.

  10. Structure of shikimate kinase, an in vivo essential metabolic enzyme in the nosocomial pathogen Acinetobacter baumannii, in complex with shikimate.


    Sutton, Kristin A; Breen, Jennifer; MacDonald, Ulrike; Beanan, Janet M; Olson, Ruth; Russo, Thomas A; Schultz, L Wayne; Umland, Timothy C


    Acinetobacter baumannii is an opportunistic Gram-negative pathogen that is an important cause of healthcare-associated infections exhibiting high mortality rates. Clinical isolates of multidrug-resistant (MDR) and extremely drug-resistant (XDR) A. baumannii strains are increasingly being observed. Compounding this concern is the dearth of new antibacterial agents in late-stage development that are effective against MDR and XDR A. baumannii. As part of an effort to address these concerns, two genes (aroA and aroC) of the shikimate pathway have previously been determined to be essential for the growth and survival of A. baumannii during host infection (i.e. to be essential in vivo). This study expands upon these results by demonstrating that the A. baumannii aroK gene, encoding shikimate kinase (SK), is also essential in vivo in a rat soft-tissue infection model. The crystal structure of A. baumannii SK in complex with the substrate shikimate and a sulfate ion that mimics the binding interactions expected for the β-phosphate of ATP was then determined to 1.91 Å resolution and the enzyme kinetics were characterized. The flexible shikimate-binding domain and LID region are compared with the analogous regions in other SK crystal structures. The impact of structural differences and sequence divergence between SKs from pathogenic bacteria that may influence antibiotic-development efforts is discussed.

  11. Global metabolic analyses identify key differences in metabolite levels between polymyxin-susceptible and polymyxin-resistant Acinetobacter baumannii.


    Maifiah, Mohd Hafidz Mahamad; Cheah, Soon-Ee; Johnson, Matthew D; Han, Mei-Ling; Boyce, John D; Thamlikitkul, Visanu; Forrest, Alan; Kaye, Keith S; Hertzog, Paul; Purcell, Anthony W; Song, Jiangning; Velkov, Tony; Creek, Darren J; Li, Jian


    Multidrug-resistant Acinetobacter baumannii presents a global medical crisis and polymyxins are used as the last-line therapy. This study aimed to identify metabolic differences between polymyxin-susceptible and polymyxin-resistant A. baumannii using untargeted metabolomics. The metabolome of each A. baumannii strain was measured using liquid chromatography-mass spectrometry. Multivariate and univariate statistics and pathway analyses were employed to elucidate metabolic differences between the polymyxin-susceptible and -resistant A. baumannii strains. Significant differences were identified between the metabolic profiles of the polymyxin-susceptible and -resistant A. baumannii strains. The lipopolysaccharide (LPS) deficient, polymyxin-resistant 19606R showed perturbation in specific amino acid and carbohydrate metabolites, particularly pentose phosphate pathway (PPP) and tricarboxylic acid (TCA) cycle intermediates. Levels of nucleotides were lower in the LPS-deficient 19606R. Furthermore, 19606R exhibited a shift in its glycerophospholipid profile towards increased abundance of short-chain lipids compared to the parent polymyxin-susceptible ATCC 19606. In contrast, in a pair of clinical isolates 03-149.1 (polymyxin-susceptible) and 03-149.2 (polymyxin-resistant, due to modification of lipid A), minor metabolic differences were identified. Notably, peptidoglycan biosynthesis metabolites were significantly depleted in both of the aforementioned polymyxin-resistant strains. This is the first comparative untargeted metabolomics study to show substantial differences in the metabolic profiles of the polymyxin-susceptible and -resistant A. baumannii.

  12. In vivo activity of daptomycin/colistin combination therapy in a Galleria mellonella model of Acinetobacter baumannii infection.


    Yang, Haifei; Chen, Guosheng; Hu, Lifen; Liu, Yanyan; Cheng, Jun; Li, Hongru; Ye, Ying; Li, Jiabin


    Antimicrobial treatment of multidrug-resistant Acinetobacter baumannii (MDR-AB) infections continues to pose significant challenges. With limited options, clinicians have been pushed towards using unorthodox combinations of licensed antibiotics. Although daptomycin/colistin combination appears to be a promising treatment option based on in vitro data, further preclinical work is needed. In this study, the A. baumannii-Galleria mellonella system was employed to study the in vivo efficacy of this combination in order to determine whether it should be explored further for the treatment of MDR-AB infections. The antimicrobial activity of colistin alone and in combination with daptomycin was assessed versus an A. baumannii type strain (ATCC 19606) and a MDR-AB clinical strain (GN2231) isolated in Anhui, China. Synergy studies were performed using the microtitre plate chequerboard assay and time-kill methodology. The in vivo activity of daptomycin/colistin combination was assessed using a G. mellonella larvae model. The combination of daptomycin and colistin was bactericidal against both strains tested. In chequerboard assays, daptomycin was highly active against A. baumannii when combined with colistin [fractional inhibitory concentration index (FICI) of <0.5]. Treatment of G. mellonella larvae infected with lethal doses of A. baumannii resulted in significantly enhanced survival rates when daptomycin was given with colistin compared with colistin treatment alone (P<0.05). This work suggests that daptomycin/colistin combination is highly active against A. baumannii both in vitro and in a simple invertebrate model of infection.

  13. Reservoirs of Acinetobacter baumannii outside the hospital and potential involvement in emerging human community-acquired infections.


    Eveillard, Matthieu; Kempf, Marie; Belmonte, Olivier; Pailhoriès, Hélène; Joly-Guillou, Marie-Laure


    The objective of the present report was to review briefly the potentially community-acquired Acinetobacter baumannii infections, to update information on the reservoirs of A. baumannii outside the hospital, and to consider their potential interactions with human infections. Most reports on potentially community-acquired A. baumannii have been published during the last 15 years. They concern community-acquired pneumonia, infections in survivors from natural disasters, and infected war wounds in troops from Iraq and Afghanistan. Although the existence of extra-hospital reservoirs of A. baumannii has long been disputed, the recent implementation of molecular methods has allowed the demonstration of the actual presence of this organism in various environmental locations, in human carriage, in pets, slaughter animals, and human lice. Although the origin of the A. baumannii infections in soldiers injured in Southwestern Asia is difficult to determine, there are some arguments to support the involvement of extra-hospital reservoirs in the occurrence of community-acquired infections. Overall, the emergence of community-acquired A. baumannii infections could be associated with interactions between animals, environment, and humans that are considered to be potentially involved in the emergence or re-emergence of some infectious diseases.

  14. Global metabolic analyses identify key differences in metabolite levels between polymyxin-susceptible and polymyxin-resistant Acinetobacter baumannii

    PubMed Central

    Mahamad Maifiah, Mohd Hafidz; Cheah, Soon-Ee; Johnson, Matthew D.; Han, Mei-Ling; Boyce, John D.; Thamlikitkul, Visanu; Forrest, Alan; Kaye, Keith S.; Hertzog, Paul; Purcell, Anthony W.; Song, Jiangning; Velkov, Tony; Creek, Darren J.; Li, Jian


    Multidrug-resistant Acinetobacter baumannii presents a global medical crisis and polymyxins are used as the last-line therapy. This study aimed to identify metabolic differences between polymyxin-susceptible and polymyxin-resistant A. baumannii using untargeted metabolomics. The metabolome of each A. baumannii strain was measured using liquid chromatography-mass spectrometry. Multivariate and univariate statistics and pathway analyses were employed to elucidate metabolic differences between the polymyxin-susceptible and -resistant A. baumannii strains. Significant differences were identified between the metabolic profiles of the polymyxin-susceptible and -resistant A. baumannii strains. The lipopolysaccharide (LPS) deficient, polymyxin-resistant 19606R showed perturbation in specific amino acid and carbohydrate metabolites, particularly pentose phosphate pathway (PPP) and tricarboxylic acid (TCA) cycle intermediates. Levels of nucleotides were lower in the LPS-deficient 19606R. Furthermore, 19606R exhibited a shift in its glycerophospholipid profile towards increased abundance of short-chain lipids compared to the parent polymyxin-susceptible ATCC 19606. In contrast, in a pair of clinical isolates 03–149.1 (polymyxin-susceptible) and 03–149.2 (polymyxin-resistant, due to modification of lipid A), minor metabolic differences were identified. Notably, peptidoglycan biosynthesis metabolites were significantly depleted in both of the aforementioned polymyxin-resistant strains. This is the first comparative untargeted metabolomics study to show substantial differences in the metabolic profiles of the polymyxin-susceptible and -resistant A. baumannii. PMID:26924392

  15. Whole-genome sequence analysis of the naturally competent Acinetobacter baumannii clinical isolate A118.


    Traglia, German M; Chua, Katherina; Centrón, Daniela; Tolmasky, Marcelo E; Ramírez, María Soledad


    Recent studies have demonstrated a high genomic plasticity in Acinetobacter baumannii, which may explain its high capacity to acquire multiple antibiotic resistance determinants and to survive in the hospital environment. Acinetobacter baumannii strain A118 (Ab A118) was isolated in the year 1995 from a blood culture of an intensive care unit patient. As this particular strain showed some peculiar characteristic such as being naturally competent and susceptible to numerous antibiotics, we performed whole-genome comparison (WGC) studies to gain insights into the nature and extent of the genomic differences. The Ab A118 genome is approximately 3,824 kb long with a 38.4% GC content and contains 3,520 coding sequences. WGC studies showed that the Ab A118 genome has 98% average nucleotide identity with that of A. baumannii ATCC 17978, and 96% average nucleotide identity with that of strains AYE and ACICU. At least 12 inversions, 275 insertions, and 626 deletions were identified when the Ab A118 genome was compared with those of strains ATCC 17978, AYE, and ACICU using MAUVE WGC. Multiple gene order arrangements were observed among the analyzed strains. MAUVE WGC analysis identified 19 conserved segments, known as locally colinear blocks. The number of single nucleotide polymorphisms found when comparing the Ab A118 genome with that of strains ATCC 17978, AYE, and ACICU was 43,784 (1.1496%), 44,130 (1.158%), and 43,914 (1.153%), respectively. Genes comEA, pilQ, pilD, pilF, comL, pilA, comEC, pilI, pilH, pilO, pilN, pilY1(comC), pilE, pilR, and comM, potentially involved in natural competence were found in the Ab A118 genome. In particular, unlike in most strains where comM is interrupted by an insertion of a resistance island (AbaR), in strain Ab A118 it is uninterrupted.

  16. Whole-Genome Sequence Analysis of the Naturally Competent Acinetobacter baumannii Clinical Isolate A118

    PubMed Central

    Traglia, German M.; Chua, Katherina; Centrón, Daniela; Tolmasky, Marcelo E.; Ramírez, María Soledad


    Recent studies have demonstrated a high genomic plasticity in Acinetobacter baumannii, which may explain its high capacity to acquire multiple antibiotic resistance determinants and to survive in the hospital environment. Acinetobacter baumannii strain A118 (Ab A118) was isolated in the year 1995 from a blood culture of an intensive care unit patient. As this particular strain showed some peculiar characteristic such as being naturally competent and susceptible to numerous antibiotics, we performed whole-genome comparison (WGC) studies to gain insights into the nature and extent of the genomic differences. The Ab A118 genome is approximately 3,824 kb long with a 38.4% GC content and contains 3,520 coding sequences. WGC studies showed that the Ab A118 genome has 98% average nucleotide identity with that of A. baumannii ATCC 17978, and 96% average nucleotide identity with that of strains AYE and ACICU. At least 12 inversions, 275 insertions, and 626 deletions were identified when the Ab A118 genome was compared with those of strains ATCC 17978, AYE, and ACICU using MAUVE WGC. Multiple gene order arrangements were observed among the analyzed strains. MAUVE WGC analysis identified 19 conserved segments, known as locally colinear blocks. The number of single nucleotide polymorphisms found when comparing the Ab A118 genome with that of strains ATCC 17978, AYE, and ACICU was 43,784 (1.1496%), 44,130 (1.158%), and 43,914 (1.153%), respectively. Genes comEA, pilQ, pilD, pilF, comL, pilA, comEC, pilI, pilH, pilO, pilN, pilY1(comC), pilE, pilR, and comM, potentially involved in natural competence were found in the Ab A118 genome. In particular, unlike in most strains where comM is interrupted by an insertion of a resistance island (AbaR), in strain Ab A118 it is uninterrupted. PMID:25164683

  17. Emergence and Spread of Plasmid-Borne tet(B)::ISCR2 in Minocycline-Resistant Acinetobacter baumannii Isolates

    PubMed Central

    Vilacoba, Elisabet; Almuzara, Marisa; Gulone, Lucia; Traglia, German Matías; Figueroa, Silvia A.; Sly, Gabriela; Fernández, Analia; Centrón, Daniela


    Resistance to minocycline has emerged in multidrug-resistant Acinetobacter baumannii isolates from Buenos Aires hospitals. Few reports about the description and dispersion of tet genes in this species have been published. We observed the presence of tet(B) in all minocycline-resistant isolates. This gene was found to be associated with the ISCR2 mobile element, which may, in part, explain its dispersion. PMID:23147737

  18. The Response Regulator BfmR Is a Potential Drug Target for Acinetobacter baumannii

    PubMed Central

    Manohar, Akshay; Beanan, Janet M.; Olson, Ruth; MacDonald, Ulrike; Graham, Jessica


    ABSTRACT Identification and validation is the first phase of target-based antimicrobial development. BfmR (RstA), a response regulator in a two-component signal transduction system (TCS) in Acinetobacter baumannii, is an intriguing potential antimicrobial target. A unique characteristic of BfmR is that its inhibition would have the dual benefit of significantly decreasing in vivo survival and increasing sensitivity to selected antimicrobials. Studies on the clinically relevant strain AB307-0294 have shown BfmR to be essential in vivo. Here, we demonstrate that this phenotype in strains AB307-0294 and AB908 is mediated, in part, by enabling growth in human ascites fluid and serum. Further, BfmR conferred resistance to complement-mediated bactericidal activity that was independent of capsular polysaccharide. Importantly, BfmR also increased resistance to the clinically important antimicrobials meropenem and colistin. BfmR was highly conserved among A. baumannii strains. The crystal structure of the receiver domain of BfmR was determined, lending insight into putative ligand binding sites. This enabled an in silico ligand binding analysis and a blind docking strategy to assess use as a potential druggable target. Predicted binding hot spots exist at the homodimer interface and the phosphorylation site. These data support pursuing the next step in the development process, which includes determining the degree of inhibition needed to impact growth/survival and the development a BfmR activity assay amenable to high-throughput screening for the identification of inhibitors. Such agents would represent a new class of antimicrobials active against A. baumannii which could be active against other Gram-negative bacilli that possess a TCS with shared homology. IMPORTANCE Increasing antibiotic resistance in bacteria, particularly Gram-negative bacilli, has significantly affected the ability of physicians to treat infections, with resultant increased morbidity, mortality, and

  19. Cloning, Nucleotide Sequencing, and Analysis of the Gene Encoding an AmpC β-Lactamase in Acinetobacter baumannii

    PubMed Central

    Bou, Germán; Martínez-Beltrán, Jesús


    A clinical strain of Acinetobacter baumannii (strain Ab RYC 52763/97) that was isolated during an outbreak in our hospital and that was resistant to all β-lactam antibiotics tested produced three β-lactamases: a TEM-1-type (pI, 5.4) plasmid-mediated β-lactamase, a chromosomally mediated OXA-derived (pI, 9.0) β-lactamase, and a presumptive chromosomal cephalosporinase (pI, 9.4). The nucleotide sequence of the chromosomal cephalosporinase gene shows for the first time the gene encoding an AmpC β-lactamase in A. baumannii. In addition, we report here the biochemical properties of this A. baumannii AmpC β-lactamase. PMID:10639377

  20. Clinical validation of a real-time polymerase chain reaction assay for rapid detection of Acinetobacter baumannii colonization.


    Blanco-Lobo, P; González-Galán, V; García-Quintanilla, M; Valencia, R; Cazalla, A; Martín, C; Alonso, I; Pérez-Romero, P; Cisneros, J M; Aznar, J; McConnell, M J


    Real-time polymerase chain reaction (PCR)-based approaches have not been assessed in terms of their ability to detect patients colonized by Acinetobacter baumannii during active surveillance. This prospective, double-blind study demonstrated that a real-time PCR assay had high sensitivity (100%) and specificity (91.2%) compared with conventional culture for detecting A. baumannii in 397 active surveillance samples, and provided results within 3h. Receiver-operator curve analyses demonstrated that the technique has diagnostic accuracy of 97.7% (95% confidence interval 96.0-99.3%). This method could facilitate the rapid implementation of infection control measures for preventing the transmission of A. baumannii.

  1. Fulminant endocarditis and disseminated infection caused by carbapenem-resistant Acinetobacter baumannii in a renal-pancreas transplant recipient

    PubMed Central

    Patel, G.; Perez, F.; Hujer, A.M.; Rudin, S.D.; Augustine, J.J.; Jacobs, G.H.; Jacobs, M.R.; Bonomo, R.A.


    Acinetobacter baumannii is an important cause of healthcare-associated infections, and is particularly problematic among patients who undergo organ transplantation. We describe a case of fulminant sepsis caused by carbapenem-resistant A. baumannii harboring the blaOXA-23 carbapenemase gene and belonging to international clone II. This isolate led to the death of a patient 6 days after simultaneous kidney-pancreas transplantation. Autopsy findings revealed acute mitral valve endocarditis, myocarditis, splenic and renal emboli, peritonitis, and pneumonia. This case highlights the severe nature of certain A. baumannii infections and the vulnerability of transplanted patients to the increasingly intractable ‘high-risk’ clones of multidrug-resistant organisms. PMID:25661804

  2. Dual Lower Respiratory Tract Infection by Burkholderia cepacia and Acinetobacter baumannii in A Neonate: A Case Report.


    Gade, Neeta; Negi, Sanjay Singh; Jindal, Atul; Gaikwad, Ujjwala; Das, Padma; Bhargava, Anudita


    Burkholderia cepacia (B.cepacia) and Acinetobacter baumannii (A.baumannii), the highly intrinsically resistant nonfermenters are known to cause frequent infections in immunocomproimsed or hospitalized patients with significant mortality rate. In this rare clinical presentation, both were simultaneously isolated from a case of neonatal sepsis with respiratory failure. The prompt early diagnosis and antibiogram of these nonfermenters were proved to be of tremendous help in the present case with successful treatment outcome of dual infection of B.cepacia and A.baumannii. The present case report strongly emphasises the clinical importance of early accurate diagnosis of these emerging potential fatal non-fermenters which could otherwise prove fatal in case of any slight delay or misidentification. Implementation of strict surveillance policy to monitor the growth of these non-fermenters and draconian infection control measure holds a key to success in significant reduction of the associated mortality and morbidity.

  3. Dual Lower Respiratory Tract Infection by Burkholderia cepacia and Acinetobacter baumannii in A Neonate: A Case Report

    PubMed Central

    Gade, Neeta; Jindal, Atul; Gaikwad, Ujjwala; Das, Padma; Bhargava, Anudita


    Burkholderia cepacia (B.cepacia) and Acinetobacter baumannii (A.baumannii), the highly intrinsically resistant nonfermenters are known to cause frequent infections in immunocomproimsed or hospitalized patients with significant mortality rate. In this rare clinical presentation, both were simultaneously isolated from a case of neonatal sepsis with respiratory failure. The prompt early diagnosis and antibiogram of these nonfermenters were proved to be of tremendous help in the present case with successful treatment outcome of dual infection of B.cepacia and A.baumannii. The present case report strongly emphasises the clinical importance of early accurate diagnosis of these emerging potential fatal non-fermenters which could otherwise prove fatal in case of any slight delay or misidentification. Implementation of strict surveillance policy to monitor the growth of these non-fermenters and draconian infection control measure holds a key to success in significant reduction of the associated mortality and morbidity. PMID:27891340

  4. Acinetobacter baumannii isolates from pets and horses in Switzerland: molecular characterization and clinical data

    PubMed Central

    Endimiani, Andrea; Hujer, Kristine M.; Hujer, Andrea M.; Bertschy, Isabelle; Rossano, Alexandra; Koch, Christoph; Gerber, Vinzenz; Francey, Thierry; Bonomo, Robert A.; Perreten, Vincent


    Objectives We investigated whether Acinetobacter baumannii isolates of veterinary origin shared common molecular characteristics with those described in humans. Methods Nineteen A. baumannii isolates collected in pets and horses were analysed. Clonality was studied using repetitive extragenic palindromic PCR (rep-PCR) and multilocus sequence typing (MLST). PCR and DNA sequencing for various β-lactamase, aminoglycoside-modifying enzyme, gyrA and parC, ISAba1 and IS1133, adeR and adeS of the AdeABC efflux pump, carO porin and class 1/2/3 integron genes were performed. Results Two main clones [A (n = 8) and B (n = 9)] were observed by rep-PCR. MLST indicated that clone A contained isolates of sequence type (ST) ST12 (international clone II) and clone B contained isolates of ST15 (international clone I). Two isolates of ST10 and ST20 were also noted. Seventeen isolates were resistant to gentamicin, 12 to ciprofloxacin and 3 to carbapenems. Isolates of ST12 carried blaOXA-66, blaADC-25, blaTEM-1, aacC2 and IS1133. Strains of ST15 possessed blaOXA-69, blaADC-11, blaTEM-1 and a class 1 integron carrying aacC1 and aadA1. ISAba1 was found upstream of blaADC (one ST10 and one ST12) and/or blaOXA-66 (seven ST12). Twelve isolates of different STs contained the substitutions Ser83Leu in GyrA and Ser80Leu or Glu84Lys in ParC. Significant disruptions of CarO porin and overexpressed efflux pumps were not observed. The majority of infections were hospital acquired and in animals with predisposing conditions for infection. Conclusions STs and the molecular background of resistance observed in our collection have been frequently described in A. baumannii detected in human patients. Animals should be considered as a potential reservoir of multidrug-resistant A. baumannii. PMID:21733964

  5. Risk factors for nosocomial burn wound infection caused by multidrug resistant Acinetobacter baumannii.


    Tekin, Recep; Dal, Tuba; Bozkurt, Fatma; Deveci, Ozcan; Palanc, Ylmaz; Arslan, Eyüp; Selçuk, Caferi Tayyar; Hoşoğlu, Salih


    Acinetobacter baumannii infections in burn patients may lead to delays in wound healing, graft losses, and development of sepsis. Determining the risk factors for multidrug resistant A. baumannii (MDR-AB) infections is essential for infection control. In the present study, the authors aimed to evaluate risk factors for wound infections caused by A. baumannii in burn patients. The study was conducted at Dicle University Hospital Burn Center, from April 2011 to July 2012, to investigate the risk factors for MDR-AB infections. The data of both the case and control group patients and the result of wound cultures were recorded on a daily basis, on individual forms given for each patient, and analyzed. A total of 30 cases infected with MDR-AB, and 60 uninfected control patients, were included in the study. The mean age (±SD) was 7.7 ± 15.4 years in infected patients and 11.4 ± 16.5 years in uninfected patients. The mean total burn surface area was 13.5 ± 10.9% in uninfected patients and 34.7 ± 16.2% in infected patients. The mean total burn surface area, the abbreviated burn severity index, acute physiological and chronic health evaluation II score, day of admission to hospital, length of hospital stay, first excision day, prior usage of third-generation cephalosporins, and stay in intensive care unit of the infected patients were significantly higher (P < .001) than those of patients without infection. Univariate analysis found that high acute physiological and chronic health evaluation II score, first excision time of wound, invasive device usage, admission day to hospital, and prior usage of broad-spectrum antibiotics were risk factors for nosocomial infections. This study showed that multiple factors contribute to multidrug resistance in A. baumannii. A combination of an early diagnosis of wound infections, appropriate antimicrobial treatments, surgical debridement, and early wound closure may be effective in the management.

  6. Sequence-activity relationship, and mechanism of action of mastoparan analogues against extended-drug resistant Acinetobacter baumannii.


    Vila-Farrés, Xavier; López-Rojas, Rafael; Pachón-Ibáñez, Maria Eugenia; Teixidó, Meritxell; Pachón, Jerónimo; Vila, Jordi; Giralt, Ernest


    The treatment of some infectious diseases can currently be very challenging since the spread of multi-, extended- or pan-resistant bacteria has considerably increased over time. On the other hand, the number of new antibiotics approved by the FDA has decreased drastically over the last 30 years. The main objective of this study was to investigate the activity of wasp peptides, specifically mastoparan and some of its derivatives against extended-resistant Acinetobacter baumannii. We optimized the stability of mastoparan in human serum since the specie obtained after the action of the enzymes present in human serum is not active. Thus, 10 derivatives of mastoparan were synthetized. Mastoparan analogues (guanidilated at the N-terminal, enantiomeric version and mastoparan with an extra positive charge at the C-terminal) showed the same activity against Acinetobacter baumannii as the original peptide (2.7 μM) and maintained their stability to more than 24 h in the presence of human serum compared to the original compound. The mechanism of action of all the peptides was carried out using a leakage assay. It was shown that mastoparan and the abovementioned analogues were those that released more carboxyfluorescein. In addition, the effect of mastoparan and its enantiomer against A. baumannii was studied using transmission electron microscopy (TEM). These results suggested that several analogues of mastoparan could be good candidates in the battle against highly resistant A. baumannii infections since they showed good activity and high stability.

  7. Acinetobacter baumannii RecA Protein in Repair of DNA Damage, Antimicrobial Resistance, General Stress Response, and Virulence ▿

    PubMed Central

    Aranda, Jesús; Bardina, Carlota; Beceiro, Alejandro; Rumbo, Soraya; Cabral, Maria P.; Barbé, Jordi; Bou, Germán


    RecA is the major enzyme involved in homologous recombination and plays a central role in SOS mutagenesis. In Acinetobacter spp., including Acinetobacter baumannii , a multidrug-resistant bacterium responsible for nosocomial infections worldwide, DNA repair responses differ in many ways from those of other bacterial species. In this work, the function of A. baumannii RecA was examined by constructing a recA mutant. Alteration of this single gene had a pleiotropic effect, showing the involvement of RecA in DNA damage repair and consequently in cellular protection against stresses induced by DNA damaging agents, several classes of antibiotics, and oxidative agents. In addition, the absence of RecA decreased survival in response to both heat shock and desiccation. Virulence assays in vitro (with macrophages) and in vivo (using a mouse model) similarly implicated RecA in the pathogenicity of A. baumannii . Thus, the data strongly suggest a protective role for RecA in the bacterium and indicate that inactivation of the protein can contribute to a combined therapeutic approach to controlling A. baumannii infections. PMID:21642465

  8. Molecular epidemiology and mechanisms of tigecycline resistance in clinical isolates of Acinetobacter baumannii from a Chinese university hospital.


    Deng, Mei; Zhu, Man-Hua; Li, Jun-Jie; Bi, Sheng; Sheng, Zi-Ke; Hu, Fei-Shu; Zhang, Jia-Jie; Chen, Wei; Xue, Xiao-Wei; Sheng, Ji-Fang; Li, Lan-Juan


    Because of its remarkable ability to acquire antibiotic resistance and to survive in nosocomial environments, Acinetobacter baumannii has become a significant nosocomial infectious agent worldwide. Tigecycline is one of the few therapeutic options for treating infections caused by A. baumannii isolates. However, tigecycline resistance has increasingly been reported. Our aim was to assess the prevalence and characteristics of efflux-based tigecycline resistance in clinical isolates of A. baumannii collected from a hospital in China. A total of 74 A. baumannii isolates, including 64 tigecycline-nonsusceptible A. baumannii (TNAB) and 10 tigecycline-susceptible A. baumannii (TSAB) isolates, were analyzed. The majority of them were determined to be positive for adeABC, adeRS, adeIJK, and abeM, while the adeE gene was found in only one TSAB isolate. Compared with the levels in TSAB isolates, the mean expression levels of adeB, adeJ, adeG, and abeM in TNAB isolates were observed to increase 29-, 3-, 0.7-, and 1-fold, respectively. The efflux pump inhibitors (EPIs) phenyl-arginine-β-naphthylamide (PAβN) and carbonyl cyanide 3-chlorophenylhydrazone (CCCP) could partially reverse the resistance pattern of tigecycline. Moreover, the tetX1 gene was detected in 12 (18.8%) TNAB isolates. To our knowledge, this is the first report of the tetX1 gene being detected in A. baumannii isolates. ST208 and ST191, which both clustered into clonal complex 92 (CC92), were the predominant sequence types (STs). This study showed that the active efflux pump AdeABC appeared to play important roles in the tigecycline resistance of A. baumannii. The dissemination of TNAB isolates in our hospital is attributable mainly to the spread of CC92.

  9. Antibiotic Resistance Profile and Distribution of Oxacillinase Genes Among Clinical Isolates of Acinetobacter baumannii in Shiraz Teaching Hospitals, 2012 - 2013

    PubMed Central

    Kooti, Sara; Motamedifar, Mohammad; Sarvari, Jamal


    Background: The emergence of multidrug-resistant Acinetobacter baumannii complicates the therapy of the related infections. Hospital isolates of A. baumannii are usually multidrug-resistant. The problem is compounded by increasing resistance to broad-spectrum antibiotics including carbapenems. Objectives: The aim of this study was to determine antimicrobial susceptibility patterns and distribution of blaOXA-type carbapenemases genes among A. baumannii isolates from hospitalized patients in Shiraz, Southwest Iran. Materials and Methods: Two hundred A. baumannii isolates were recovered from different clinical specimens in four Shiraz teaching hospitals. Isolates were detected as A. baumannii by Microgen kit and PCR with specific primers of blaOXA-51-like gene. Antimicrobial susceptibility testing was determined by disk diffusion method for all the isolates. Multiplex PCR assays were performed for detection of blaOXA-23-like, blaOXA-24-like and blaOXA-58-like genes. Results: All the isolates were susceptible to colistin and polymyxin B. Moreover, all of them were resistant to piperacillin, piperacillin-tazobactam, ampicillin, ceftazidime, cefoxitin and aztreonam. Eighty (40%) isolates had positive results for blaOXA-23-like, 14 (7%) for blaOXA-24-like and 1 (0.5%) isolate for blaOXA-58-like. The co-existence of studied genes was detected for blaOXA-23-like plus blaOXA-24-like in nine (4.5%) isolates. Conclusions: The prevalence of carbapenem resistant A. baumannii isolates in Shiraz hospitals is high. The blaOXA-23-like gene was the most frequent carbapenemase identified among resistant A. baumannii isolated in Shiraz hospitals. The increasing incidence of A. baumannii is a serious concern, therefore control of this pathogen and taking preventive measures are emphasized. PMID:26464764

  10. Epidemiological and clinical features associated with colonisation/infection by Acinetobacter baumannii with phenotypic heterogeneous resistance to carbapenems.


    Fernández-Cuenca, Felipe; Gómez-Sánchez, M; Rodríguez-Baño, Jesús; Martínez-Martínez, Luis; Vila, Jordi; Bou, Germán; Pascual, Alvaro


    The objective of this study was to identify risk factors for the acquisition of Acinetobacter baumannii with phenotypic heterogeneous resistance (PHR) to carbapenems and to determine whether these factors are similar to those associated with A. baumannii not showing this phenotype. Microbiological and clinical data from 211 patients included in the GEIH-Ab 2000 project were used. Isolates of A. baumannii were studied for their susceptibility to imipenem (IPM) by microdilution and for PHR to IPM as determined by the presence of colonies growing within the inhibition zone of IPM disks. Isolates were divided into three groups: (i) IPM-PHR isolates, i.e. susceptible and non-susceptible A. baumannii displaying PHR to IPM; (ii) non-IPM-PHR isolates, i.e. susceptible A. baumannii showing an inhibition halo but no colonies growing within it; and (iii) IPM-FR isolates, i.e. fully resistant A. baumannii displaying no halo of inhibition. IPM-PHR isolates of A. baumannii were more commonly isolated from respiratory tract samples and less commonly from urine, and were more frequently causes of infection than were IPM-FR isolates. Independent risk factors identified in patients with IPM-PHR isolates were Intensive Care Unit admission, surgery, and previous use of piperacillin/tazobactam or carbapenems, whilst risk factors for IPM-FR and IPM-PHR were previous use of cephalosporins and isolation from a urine sample. In conclusion, risk factors associated with colonisation/infection by isolates of A. baumannii with PHR to carbapenems are similar to those previously described for isolates resistant to carbapenems.

  11. Immunoprotective Efficacy of Acinetobacter baumannii Outer Membrane Protein, FilF, Predicted In silico as a Potential Vaccine Candidate

    PubMed Central

    Singh, Ravinder; Garg, Nisha; Shukla, Geeta; Capalash, Neena; Sharma, Prince


    Acinetobacter baumannii is emerging as a serious nosocomial pathogen with multidrug resistance that has made it difficult to cure and development of efficacious treatment against this pathogen is direly needed. This has led to investigate vaccine approach to prevent and treat A. baumannii infections. In this work, an outer membrane putative pilus assembly protein, FilF, was predicted as vaccine candidate by in silico analysis of A. baumannii proteome and was found to be conserved among the A. baumannii strains. It was cloned and expressed in E. coli BL21(DE3) and purified by Ni-NTA chromatography. Immunization with FilF generated high antibody titer (>64,000) and provided 50% protection against a standardized lethal dose (108 CFU) of A. baumannii in murine pneumonia model. FilF immunization reduced the bacterial load in lungs by 2 and 4 log cycles, 12 and 24 h post infection as compared to adjuvant control; reduced the levels of pro-inflammatory cytokines TNF-α, IL-6, IL-33, IFN-γ, and IL-1β significantly and histology of lung tissue supported the data by showing considerably reduced damage and infiltration of neutrophils in lungs. These results demonstrate the in vivo validation of immunoprotective efficacy of a protein predicted as a vaccine candidate by in silico proteomic analysis and open the possibilities for exploration of a large array of uncharacterized proteins. PMID:26904021

  12. OXA-235, a novel class D β-lactamase involved in resistance to carbapenems in Acinetobacter baumannii.


    Higgins, Paul G; Pérez-Llarena, Francisco J; Zander, Esther; Fernández, Ana; Bou, Germán; Seifert, Harald


    We investigated the mechanism of carbapenem resistance in 10 Acinetobacter baumannii strains isolated from the United States and Mexico between 2005 and 2009. The detection of known metallo-β-lactamase or carbapenem-hydrolyzing oxacillinase (OXA) genes by PCR was negative. The presence of plasmid-encoded carbapenem resistance genes was investigated by transformation of A. baumannii ATCC 17978. Shotgun cloning experiments and sequencing were performed, followed by the expression of a novel β-lactamase in A. baumannii. Three novel OXA enzymes were identified, OXA-235 in 8 isolates and the amino acid variants OXA-236 (Glu173-Val) and OXA-237 (Asp208-Gly) in 1 isolate each. The deduced amino acid sequences shared 85% identity with OXA-134, 54% to 57% identities with the acquired OXA-23, OXA-24, OXA-58, and OXA-143, and 56% identity with the intrinsic OXA-51 and, thus, represent a novel subclass of OXA. The expression of OXA-235 in A. baumannii led to reduced carbapenem susceptibility, while cephalosporin MICs were unaffected. Genetic analysis revealed that blaOXA-235, blaOXA-236, and blaOXA-237 were bracketed between two ISAba1 insertion sequences. In addition, the presence of these acquired β-lactamase genes might result from a transposition-mediated mechanism. This highlights the propensity of A. baumannii to acquire multiple carbapenem resistance determinants.

  13. Antibiotic resistance and OXA-type carbapenemases-encoding genes in airborne Acinetobacter baumannii isolated from burn wards.


    Gao, Jing; Zhao, Xiaonan; Bao, Ying; Ma, Ruihua; Zhou, Yufa; Li, Xinxian; Chai, Tongjie; Cai, Yumei


    The study was conducted to investigate drug resistance, OXA-type carbapenemases-encoding genes and genetic diversity in airborne Acinetobacter baumannii (A. baumannii) in burn wards. Airborne A. baumannii were collected in burn wards and their corridors using Andersen 6-stage air sampler from January to June 2011. The isolates susceptibility to 13 commonly used antibiotics was examined according to the CLSI guidelines; OXA-type carbapenemases-encoding genes and molecular diversity of isolates were analyzed, respectively. A total of 16 non-repetitive A. baumannii were isolated, with 10 strains having a resistance rate of greater than 50% against the 13 antibiotics. The resistance rate against ceftriaxone, cyclophosvnamide, ciprofloxacin, and imipenem was 93.75% (15/16), but no isolate observed to be resistant to cefoperazone/sulbactam. Resistance gene analyses showed that all 16 isolates carried OXA-51, and 15 isolates carried OXA-23 except No.15; but OXA-24 and OXA-58 resistance genes not detected. The isolates were classified into 13 genotypes (A-M) according to repetitive extragenic palindromic sequence PCR (REP-PCR) results and only six isolates had a homology ≥90%. In conclusion, airborne A. baumannii in the burn wards had multidrug resistance and complex molecular diversity, and OXA-23 and OXA-51 were dominant mechanisms for resisting carbapenems.

  14. Transmission Electron Microscopic Morphological Study and Flow Cytometric Viability Assessment of Acinetobacter baumannii Susceptible to Musca domestica cecropin

    PubMed Central

    Gui, Shuiqing; Li, Rongjiang; Feng, Yongwen; Wang, Sanming


    Multidrug-resistant (MDR) Acinetobacter baumannii infections are difficult to treat owing to the extremely limited armamentarium. Expectations about antimicrobial peptides' use as new powerful antibacterial agents have been raised on the basis of their unique mechanism of action. Musca domestica cecropin (Mdc), a novel antimicrobial peptide from the larvae of Housefly (Musca domestica), has potently active against Gram-positive and Gram-negative bacteria standard strain. Here we evaluated the antibacterial activity of Mdc against clinical isolates of MDR-A. baumannii and elucidate the related antibacterial mechanisms. The minimal inhibitory concentration (MIC) of Mdc was 4 μg/mL. Bactericidal kinetics of Mdc revealed rapid killing of A. baumannii (30 min). Flow cytometry using viability stain demonstrated that Mdc causes A. baumannii membrane permeabilization in a concentration- and time-dependent process, which correlates with the bactericidal action. Moreover, transmission electron microscopic (TEM) examination showed that Mdc is capable of disrupting the membrane of bacterial cells, resulting in efflux of essential cytoplasmic components. Overall, Mdc could be a promising antibacterial agent for MDR-A. baumannii infections. PMID:24883421

  15. Persistence of Multidrug-Resistant Acinetobacter baumannii Isolates Harboring blaOXA-23 and bap for 5 Years.


    Sung, Ji Youn; Koo, Sun Hoe; Kim, Semi; Kwon, Gye Cheol


    The emergence and dissemination of carbapenemase-producing Acinetobacter baumannii isolates have been reported worldwide, and A. baumannii isolates harboring blaOXA-23 are often resistant to various antimicrobial agents. Antimicrobial resistance can be particularly strong for biofilm-forming A. baumannii isolates. We investigated the genetic basis for carbapenem resistance and biofilm-forming ability of multidrug-resistant (MDR) clinical isolates. Ninety-two MDR A. baumannii isolates were collected from one university hospital located in the Chungcheong area of Korea over a 5-year period. Multiplex PCR and DNA sequencing were performed to characterize carbapenemase and bap genes. Clonal characteristics were analyzed using REP-PCR. In addition, imaging and quantification of biofilms were performed using a crystal violet assay. All 92 MDR A. baumannii isolates involved in our study contained the blaOXA-23 and bap genes. The average absorbance of biomass in Bap-producing strains was much greater than that in non-Bap-producing strains. In our study, only three REP-PCR types were found, and the isolates showing type A or type B were found more than 60 times among unique patients during the 5 years of surveillance. These results suggest that the isolates have persisted and colonized for 5 years, and biofilm formation ability has been responsible for their persistence and colonization.

  16. Biosynthesis of UDP-N,N′-Diacetylbacillosamine in Acinetobacter baumannii: Biochemical Characterization and Correlation to Existing Pathways†

    PubMed Central

    Morrison, Michael J.; Imperiali, Barbara


    The Gram-negative, opportunistic pathogen Acinetobacter baumannii has recently captured headlines due to its ability to circumvent current antibiotic therapies. Herein we show that the multi-drug resistant (MDR) AYE strain of A. baumannii contains a gene locus that encodes three enzymes responsible for the biosynthesis of the highly-modified bacterial nucleotide sugar, UDP-N,N -diacetylbacillosamine (UDP-diNAcBac). Previously, this UDP-sugar has been implicated in the pgl pathway of Campylobacter jejuni. Here we report the overexpression, purification, and biochemical characterization of the A. baumannii enzymes WeeK, WeeJ, and WeeI that are responsible for the production of UDP-diNAcBac. We also demonstrate the function of the phosphoglycosyltransferase (WeeH), which transfers the diNAcBac moiety to undecaprenyl-phosphate. UDP-diNAcBac biosynthesis in A. baumannii is also directly compared to the homologous pathways in the pathogens C. jejuni and Neisseria gonorrhoeae. This work demonstrates for the first time the ability of A. baumannii to generate the highly-modified, UDP-diNAcBac nucleotide sugar found previously in other bacteria adding to the growing list of pathogens that assemble glycoconjugates including bacillosamine. Additionally, characterization of these pathway enzymes highlights the opportunity for investigating the significance of highly-modified sugars in bacterial pathogenesis. PMID:23747578

  17. Multilocus Sequence Typing Analysis of Carbapenem-Resistant Acinetobacter baumannii in a Chinese Burns Institute

    PubMed Central

    Huang, Guangtao; Yin, Supeng; Gong, Yali; Zhao, Xia; Zou, Lingyun; Jiang, Bei; Dong, Zhiwei; Chen, Yu; Chen, Jing; Jin, Shouguang; Yuan, Zhiqiang; Peng, Yizhi


    Acinetobacter baumannii is a leading pathogen responsible for nosocomial infections. The emergence of carbapenem-resistant A. baumannii (CRAB) has left few effective antibiotics for clinicians to use. To investigate the temporal evolutionary relationships among CRAB strains, we collected 248 CRAB isolates from a Chinese burns institute over 3 years. The prevalence of the OXA-23 gene was detected by polymerase chain reaction. Multilocus sequence typing was used to type the CRAB strains and eBURST was used to analyze their evolutionary relationships. Wound surfaces (41%), sputa (24%), catheters (15%), and bloods (14%) were the four dominant isolation sources. Except for minocycline (33.5%) and sulbactam/cefoperazone (74.6%), these CRAB strains showed high resistance rates (>90%) to 16 tested antibiotics. The 248 isolates fall into 26 sequence types (STs), including nine known STs and 17 unknown STs. The majority (230/248) of these isolates belong to clonal complex 92 (CC92), including eight isolates belonging to seven unreported STs. A new CC containing 11 isolates grouped into four new STs was identified. The OXA-23 gene was detected at high prevalence among the CRAB isolates and the prevalence rate among the various STs differed. The majority of the isolates displayed a close evolutionary relationship, suggesting that serious nosocomial spreading and nosocomial infections of CRAB have occurred in the burn unit. In conclusion, the main CC for CRAB in this Chinese burn unit remained unchanged during the 3-year study period, and a new CC was identified. CC92 was the dominant complex, and more attention should be directed toward monitoring the new CC we have identified herein. PMID:27881972

  18. Mathematical Model To Quantify the Effects of Risk Factors on Carbapenem-Resistant Acinetobacter baumannii

    PubMed Central

    Tan, Michelle W.; Lye, David C.; Ng, Tat-Ming; Nikolaou, Michael


    Carbapenem-resistant Acinetobacter baumannii (CRAB) infections are increasing, and they are associated with an increased risk of mortality in hospitalized patients. Linear regression is commonly used to identify concurrent trends, but it cannot quantify the relationship between risk factors and resistance. We developed a model to quantify the impact of antibiotic consumption on the prevalence of CRAB over time. Data were collected from January 2007 to June 2013 from our institution. Quarterly antibiotic consumption was expressed as defined daily dose/1,000 inpatient days. Six-month prevalence of CRAB was expressed as a percentage of all nonrepeat A. baumannii isolates tested. Individual trends were identified using linear regression. Antibiotic consumption from 2007 to 2011 was input as a step function in a relationship with CRAB. Model fit was evaluated by visual inspection and the residual sum of squares. The final model was validated using the best-fit (95% confidence interval) parameter estimates and antibiotic consumption to predict CRAB prevalence from January 2012 to June 2013. Cefepime, ertapenem, and piperacillin-tazobactam consumption and CRAB prevalence increased significantly over time. CRAB prevalence was best correlated to ertapenem (use sensitive; r2 = 0.76), and accounting for additional concurrent antibiotic use did not significantly improve model fit. Prospective validation with ertapenem consumption correlated well with CRAB observations, suggesting good predicting ability of the model. Our model provided the quantitative impact of antibiotic consumption on CRAB. We plan to further refine this model to account for multiple risk factors. Interventions should focus on controlling risk factors with the highest impact on resistance. PMID:24957824

  19. A new trilocus sequence-based multiplex-PCR to detect major Acinetobacter baumannii clones.


    Martins, Natacha; Picão, Renata Cristina; Cerqueira-Alves, Morgana; Uehara, Aline; Barbosa, Lívia Carvalho; Riley, Lee W; Moreira, Beatriz Meurer


    A collection of 163 Acinetobacter baumannii isolates detected in a large Brazilian hospital, was potentially related with the dissemination of four clonal complexes (CC): 113/79, 103/15, 109/1 and 110/25, defined by University of Oxford/Institut Pasteur multilocus sequence typing (MLST) schemes. The urge of a simple multiplex-PCR scheme to specify these clones has motivated the present study. The established trilocus sequence-based typing (3LST, for ompA, csuE and blaOXA-51-like genes) multiplex-PCR rapidly identifies international clones I (CC109/1), II (CC118/2) and III (CC187/3). Thus, the system detects only one (CC109/1) out of four main CC in Brazil. We aimed to develop an alternative multiplex-PCR scheme to detect these clones, known to be present additionally in Africa, Asia, Europe, USA and South America. MLST, performed in the present study to complement typing our whole collection of isolates, confirmed that all isolates belonged to the same four CC detected previously. When typed by 3LST-based multiplex-PCR, only 12% of the 163 isolates were classified into groups. By comparative sequence analysis of ompA, csuE and blaOXA-51-like genes, a set of eight primers was designed for an alternative multiplex-PCR to distinguish the five CC 113/79, 103/15, 109/1, 110/25 and 118/2. Study isolates and one CC118/2 isolate were blind-tested with the new alternative PCR scheme; all were correctly clustered in groups of the corresponding CC. The new multiplex-PCR, with the advantage of fitting in a single reaction, detects five leading A. baumannii clones and could help preventing the spread in healthcare settings.

  20. In Vitro Activity of RX-P873 against Enterobacteriaceae, Pseudomonas aeruginosa, and Acinetobacter baumannii

    PubMed Central

    Rhomberg, Paul R.; Jones, Ronald N.; Farrell, David J.


    RX-P873 is a novel antibiotic from the pyrrolocytosine series which exhibits high binding affinity for the bacterial ribosome and broad-spectrum antibiotic properties. The pyrrolocytosines have shown in vitro activity against multidrug-resistant Gram-negative and Gram-positive strains of bacteria known to cause complicated urinary tract, skin, and lung infections, as well as sepsis. Enterobacteriaceae (657), Pseudomonas aeruginosa (200), and Acinetobacter baumannii (202) isolates from North America and Europe collected in 2012 as part of a worldwide surveillance program were tested in vitro by broth microdilution using Clinical and Laboratory Standards Institute (CLSI) methodology. RX-P873 (MIC90, 0.5 μg/ml) was >32-fold more active than ceftazidime and inhibited 97.1% and 99.5% of Enterobacteriaceae isolates at MIC values of ≤1 and ≤4 μg/ml, respectively. There were only three isolates with an MIC value of >4 μg/ml (all were indole-positive Protea). RX-P873 (MIC50/90, 2/4 μg/ml) was highly active against Pseudomonas aeruginosa isolates, including isolates which were nonsusceptible to ceftazidime or meropenem. RX-P873 was 2-fold less active against P. aeruginosa than tobramycin (MIC90, 2 μg/ml; 91.0% susceptible) and colistin (MIC90, 2 μg/ml; 99.5% susceptible) and 2-fold more potent than amikacin (MIC90, 8 μg/ml; 93.5% susceptible) and meropenem (MIC90, 8 μg/ml; 76.0% susceptible). RX-P873, the most active agent against Acinetobacter baumannii (MIC90, 1 μg/ml), was 2-fold more active than colistin (MIC90, 2 μg/ml; 97.0% susceptible) and 4-fold more active than tigecycline (MIC90, 4 μg/ml). This novel agent merits further exploration of its potential against multidrug-resistant Gram-negative bacteria. PMID:25645834

  1. In vitro antimicrobial synergy of colistin with rifampicin and carbapenems against colistin-resistant Acinetobacter baumannii clinical isolates.


    Hong, Duck Jin; Kim, Jung Ok; Lee, Hyukmin; Yoon, Eun-Jeong; Jeong, Seok Hoon; Yong, Dongeun; Lee, Kyungwon


    Increased use of colistin in a clinical setting had resulted in the emergence of colistin-resistant (CoR) Acinetobacter baumannii. Combination therapy has been studied as a new approach to treat infections caused by A. baumannii. Here, we investigated the in vitro antimicrobial synergistic activities of several antimicrobial agent combinations against CoR A. baumannii. A total of 41 non-duplicate clinical isolates of CoR A. baumannii from a tertiary care hospital in Korea were prospectively collected from April 2012 to December 2014. As a control group, 41 carbapenem-resistant but colistin-susceptible (CoS) A. baumannii strains were also evaluated. Minimum inhibitory concentrations (MICs) of antimicrobial agents were determined by Etest in triplicate, and in vitro synergy tests were performed by the Etest MIC:MIC ratio method. Synergistic activity was determined as the sum of each antimicrobial agent's fractional inhibitory concentration evaluated (ΣFIC): synergy, ≤0.5; indifference, >0.5-4; and antagonism, >4. Synergistic activities were more frequently observed in the CoR group than the CoS group for combinations of colistin-rifampicin (80.5% vs. 14.6%, P< 0.0001), colistin-meropenem (85.4% vs. 4.9%, P< 0.0001), and colistin-imipenem (46.3% vs. 2.4%, P< 0.0001). Combination with rifampicin or meropenem lowered colistin MICs against CoR A. baumannii clinical isolates to the susceptible range (≤ 2 μg/mL) more frequently (61.0%, 25/41, both) than combination with imipenem (29.3%, 12/41). Clinical trials are needed to prove the in vivo efficacy of those antimicrobial combinations that exhibited significant in vitro antimicrobial synergistic effects against CoR A. baumannii.

  2. Prevalence of and Risk Factors for Multidrug-Resistant Acinetobacter baumannii Colonization Among High-Risk Nursing Home Residents

    PubMed Central

    Mody, Lona; Gibson, Kristen E.; Horcher, Amanda; Prenovost, Katherine; McNamara, Sara E.; Foxman, Betsy; Kaye, Keith S.; Bradley, Suzanne


    OBJECTIVE To characterize the epidemiology of multidrug-resistant (MDR) Acinetobacter baumannii colonization in high-risk nursing home (NH) residents. DESIGN Nested case-control study within a multicenter prospective intervention trial. SETTING Four NHs in Southeast Michigan. PARTICIPANTS Case patients and control subjects were NH residents with an indwelling device (urinary catheter and/or feeding tube) selected from the control arm of the Targeted Infection Prevention study. Cases were residents colonized with MDR (resistant to ≥3 classes of antibiotics) A. baumannii; controls were never colonized with MDR A. baumannii. METHODS For active surveillance cultures, specimens from the nares, oropharynx, groin, perianal area, wounds, and device insertion site(s) were collected upon study enrollment, day 14, and monthly thereafter. A. baumannii strains and their susceptibilities were identified using standard microbiologic methods. RESULTS Of 168 NH residents, 25 (15%) were colonized with MDR A. baumannii. Compared with the 143 controls, cases were more functionally disabled (Physical Self-Maintenance Score >24; odds ratio, 5.1 [95% CI, 1.8–14.9]; P < .004), colonized with Proteus mirabilis (5.8 [1.9–17.9]; P < .003), and diabetic (3.4 [1.2–9.9]; P < .03). Most cases (22 [88%]) were colonized with multiple antibiotic-resistant organisms and 16 (64%) exhibited co-colonization with at least one other resistant gram-negative bacteria. CONCLUSION Functional disability, P. mirabilis colonization, and diabetes mellitus are important risk factors for colonization with MDR A. baumannii in high-risk NH residents. A. baumannii exhibits widespread antibiotic resistance and a preference to colonize with other antibiotic-resistant organisms, meriting enhanced attention and improved infection control practices in these residents. PMID:26072936

  3. An Inactivated Antibiotic-Exposed Whole-Cell Vaccine Enhances Bactericidal Activities Against Multidrug-Resistant Acinetobacter baumannii

    PubMed Central

    Shu, Meng-Hooi; MatRahim, NorAziyah; NorAmdan, NurAsyura; Pang, Sui-Ping; Hashim, Sharina H.; Phoon, Wai-Hong; AbuBakar, Sazaly


    Vaccination may be an alternative treatment for infection with multidrug-resistance (MDR) Acinetobacter baumannii. The study reported here evaluated the bactericidal antibody responses following immunization of mice using an inactivated whole-cell vaccine derived from antibiotic-exposed MDR A. baumannii (I-M28-47-114). Mice inoculated with I-M28-47 (non-antibiotic-exposed control) and I-M28-47-114 showed a high IgG antibody response by day 5 post-inoculation. Sera from mice inoculated with I-M28-47-114 collected on day 30 resulted in 80.7 ± 12.0% complement-mediated bacteriolysis in vitro of the test MDR A. baumannii treated with imipenem, which was a higher level of bacteriolysis over sera from mice inoculated with I-M28-47. Macrophage-like U937 cells eliminated 49.3 ± 11.6% of the test MDR A. baumannii treated with imipenem when opsonized with sera from mice inoculated with I-M28-47-114, which was a higher level of elimination than observed for test MDR A. baumannii opsonized with sera from mice inoculated with I-M28-47. These results suggest that vaccination with I-M28-47-114 stimulated antibody responses capable of mounting high bactericidal killing of MDR A. baumannii. Therefore, the inactivated antibiotic-exposed whole-cell vaccine (I-M28-47-114) has potential for development as a candidate vaccine for broad clearance and protection against MDR A. baumannii infections. PMID:26923424

  4. Impact of carbapenem resistance on clinical and economic outcomes among patients with Acinetobacter baumannii infection in Colombia.


    Lemos, E V; de la Hoz, F P; Alvis, N; Einarson, T R; Quevedo, E; Castañeda, C; Leon, Y; Amado, C; Cañon, O; Kawai, K


    Acinetobacter baumannii is a major cause of healthcare-associated infection, often affecting critically ill patients. The purpose of the study was to examine the associations of carbapenem resistance with mortality, length of hospital stay and hospital costs among patients infected with A. baumannii in intensive-care units (ICUs) in Colombia. A prospective, multicentre cohort study was conducted among 165 patients with A. baumannii infection admitted to ICUs between April 2006 and April 2010. Patients with carbapenem-resistant A. baumannii had higher risk of 30-day mortality than patients with carbapenem-susceptible A. baumannii in the univariate analysis (unadjusted hazard ratio = 2.12; 95% CI 1.14-3.95; p 0.018). However, carbapenem resistance was not significantly associated with risk of mortality (adjusted hazard ratio = 1.45; 95% CI 0.74-2.87; p 0.28) after adjusting for APACHE II score and other confounding factors. We did not find a significant difference in length of stay in ICU after the onset of infection between the two groups in the multivariate analysis (adjusted mean = 13.1 days versus 10.5 days; p 0.14). The average total cost of hospitalization among patients with carbapenem-resistant A. baumannii was significantly higher than that among patients with carbapenem-susceptible A. baumannii in the multivariate analysis (adjusted cost; US$ 11 359 versus US$ 7049; p <0.001). Carbapenem resistance was not significantly associated with mortality, though we are unable to rule out an increased risk due to the limited sample size. Carbapenem resistance was associated with an additional cost of hospitalization.

  5. In Vitro Activity of Tigecycline and Colistin against clinical isolates of Acinetobacter baumannii in Hospitals in Tehran and Bandar-Abbas, Iran

    PubMed Central

    peerayeh, Shahin najar; Karmostaji, Afsaneh; sarasiabi, Soraya sharifi; Javadpour, Sedigheh; Davoodian, Parivash; Moradi, Nahid


    Background: The Acinetobacter species, particularly A. baumannii, has emerged as one of the main causes of nosocomial infections in recent years. The high prevalence of drug resistance in A. baumannii limits the therapeutic options for treating infections caused by these bacteria. The objective of this study was to determine the in vitro activity of Tigecycline and Colistin against clinical isolates of A. baumannii in Tehran and Bandar Abbas, Iran. Methods: This study was conducted from March 2009 to November 2010 at three hospitals in Tehran and Bandar Abbas, Iran, using 165 Acinetobacter species isolated from clinical specimens. All isolates were subjected to PCR to detect blaOXA-51-like genes that are unique to Acinetobacter baumannii. Isolates that gave a band for the blaOXA-51-like genes were identified as A. baumannii. Anti-microbial susceptibility tests were performed for Tigecycline, Colistin, and other antibiotics. Results: Sensitivity rates to Colistin and Polymyxin-B were 100%. Resistance rates for Tigecycline were 4.2% in Tehran and 8.8% in Bandar-Abbas according to Jones criteria, whereas, according to U.S. FDA criteria, the resistance rates were 20.8% and 17.6%, respectively. Conclusions: New alternative drugs are needed for the treatment of drug resistant A. baumannii. Although Colistin appears to be a good choice, adverse reactions have limited its usage. Tigecycline is effective against A. baumannii isolates, and it shows promise for solving the problem. PMID:25763168

  6. Study of the major essential oil compounds of Coriandrum sativum against Acinetobacter baumannii and the effect of linalool on adhesion, biofilms and quorum sensing.


    Alves, Susana; Duarte, Andreia; Sousa, Sónia; Domingues, Fernanda C


    Acinetobacter baumannii is a pathogen that has the ability to adhere to surfaces in the hospital environment and to form biofilms which are increasingly resistant to antimicrobial agents. The aim of this work was to study the antimicrobial activity of the major oil compounds of Coriandrum sativum against A. baumannii. The effect of linalool on planktonic cells and biofilms of A. baumannii on different surfaces, as well as its effect on adhesion and quorum sensing was evaluated. From all the compounds evaluated, linalool was the compound with the best antibacterial activity, with minimum inhibitory concentration values between 2 and 8 μl ml(-1). Linalool also inhibited biofilm formation and dispersed established biofilms of A. baumannii, changed the adhesion of A. baumannii to surfaces and interfered with the quorum- sensing system. Thus, linalool could be a promising antimicrobial agent for controlling planktonic cells and biofilms of A. baumannii.

  7. Evaluation of carriage and environmental contamination by carbapenem-resistant Acinetobacter baumannii.


    Nutman, A; Lerner, A; Schwartz, D; Carmeli, Y


    We evaluated the sensitivity of surveillance cultures for carbapenem-resistant Acinetobacter baumannii (CRAB) in patients and in their environment. Patients with a CRAB-positive clinical culture were sampled within 7 days; the buccal mucosa and rectum were sampled using swabs, and skin was sampled using pre-moistened sterile sponges. Sponges were also used to sample the surrounding environment. Specimens were inoculated onto CHROMagar MDR Acinetobacter plates both directly and after overnight enrichment. CRAB load was scored semi-quantitatively and composite scores for patient colonization and environmental contamination were calculated. Thirty-four patients were included. Screening sensitivity was 28/34 (82%) for buccal mucosa, 30/34 (88%) for skin, and 25/34 (74%) for rectum. Combined sensitivity was 32/34 (94%). Among patients with CRAB-positive respiratory cultures, sensitivity for buccal mucosa was 20/20 (100%). Direct inoculation had excellent sensitivity: 25/28 (89%) for all three sites combined. In the subgroup of patients who did not have a respiratory source for CRAB, direct inoculation sensitivity was lower than among patients with CRAB-positive respiratory cultures: 5/8 (63%) versus 20/20 (100%). The environment of all patients was contaminated with CRAB. There was a positive correlation between the patient colonization score and the environmental contamination score (r = 0.63, p <0.001; r = 0.4, p 0.04 for buccal mucosa, r = 0.7, p <0.001 for skin, and r = 0.46, p 0.14 for rectum). In conclusion, screening for CRAB carriers can be performed by direct plating of skin and buccal mucosa samples. Environmental contamination is common and can be monitored. Implementing screening may facilitate infection control efforts to limit the spread of CRAB.

  8. Risk factors and outcomes for patients with bloodstream infection due to Acinetobacter baumannii-calcoaceticus complex.


    Chopra, Teena; Marchaim, Dror; Johnson, Paul C; Awali, Reda A; Doshi, Hardik; Chalana, Indu; Davis, Naomi; Zhao, Jing J; Pogue, Jason M; Parmar, Sapna; Kaye, Keith S


    Identifying patients at risk for bloodstream infection (BSI) due to Acinetobacter baumannii-Acinetobacter calcoaceticus complex (ABC) and providing early appropriate therapy are critical for improving patient outcomes. A retrospective matched case-control study was conducted to investigate the risk factors for BSI due to ABC in patients admitted to the Detroit Medical Center (DMC) between January 2006 and April 2009. The cases were patients with BSI due to ABC; the controls were patients not infected with ABC. Potential risk factors were collected 30 days prior to the ABC-positive culture date for the cases and 30 days prior to admission for the controls. A total of 245 case patients were matched with 245 control patients. Independent risk factors associated with BSI due to ABC included a Charlson's comorbidity score of ≥ 3 (odds ratio [OR], 2.34; P = 0.001), a direct admission from another health care facility (OR, 4.63; P < 0.0001), a prior hospitalization (OR, 3.11; P < 0.0001), the presence of an indwelling central venous line (OR, 2.75; P = 0.011), the receipt of total parenteral nutrition (OR, 21.2; P < 0.0001), the prior receipt of β-lactams (OR, 3.58; P < 0.0001), the prior receipt of carbapenems (OR, 3.18; P = 0.006), and the prior receipt of chemotherapy (OR, 15.42; P < 0.0001). The median time from the ABC-positive culture date to the initiation of the appropriate antimicrobial therapy was 2 days (interquartile range [IQR], 1 to 3 days). The in-hospital mortality rate was significantly higher among case patients than among control patients (OR, 3.40; P < 0.0001). BSIs due to ABC are more common among critically ill and debilitated institutionalized patients, who are heavily exposed to health care settings and invasive devices.

  9. GigA and GigB are Master Regulators of Antibiotic Resistance, Stress Responses and Virulence in Acinetobacter baumannii.


    Gebhardt, Michael J; Shuman, Howard A


    A critical component of bacterial pathogenesis is the ability of an invading organism to sense and adapt to the harsh environment imposed by the host's immune system. This is especially important for opportunistic pathogens, such as Acinetobacter baumannii, a nutritionally versatile, environmental organism that has recently gained attention as a life-threatening human pathogen. The emergence of A. baumannii is closely linked to antibiotic resistance and many contemporary isolates are multi-drug resistant (MDR). Unlike many other MDR pathogens, the molecular mechanisms underlying A. baumannii pathogenesis remain largely unknown. We report here the characterization of two recently identified virulence determinants, GigA and GigB, which comprise a signal transduction pathway required for surviving environmental stresses, causing infection and antibiotic resistance. Through transcriptome analysis we show that GigA and GigB coordinately regulate the expression of many genes and are required for generating an appropriate transcriptional response during antibiotic exposure. Genetic and biochemical data demonstrate a direct link between GigA and GigB and the nitrogen phosphotransferase system (PTS(Ntr)), establishing a novel connection between a novel stress response module and a well-conserved metabolic sensing pathway. Based on results presented here, we propose that GigA and GigB are master regulators of a global stress response in A. baumannii and coupling this pathway with the PTS(Ntr) allows A. baumannii to integrate cellular metabolic status with external environmental cues.IMPORTANCE Opportunistic pathogens, including Acinetobacter baumannii, encounter many harsh environments during the infection cycle, including antibiotic exposure and the hostile environment within a host. While development of antibiotic resistance in A. baumannii has been well studied, how this organism senses and responds to environmental cues remains largely unknown. Herein, we investigate two

  10. High prevalence of extensively drug-resistant and metallo beta-lactamase-producing clinical Acinetobacter baumannii in Iran.


    Maspi, Hossein; Mahmoodzadeh Hosseini, Hamideh; Amin, Mohsen; Imani Fooladi, Abbas Ali


    Acinetobacter species particularly Acinetobacter baumannii (A. baumannii) have been widely reported as broad-spectrum antibiotic resistant pathogens. Expression of various types of metallo beta-lactamases (MBL), classified as Ambler class B, has been associated with carbapenem resistance. Here, we attempted to assess the frequency of extensively drug-resistant (XDR) and MBL-producing A. baumannii among clinical isolates. 86 clinical A. baumannii strains were collected from 2014 to 2015 and their susceptibility to meropenem (10 μg), imipenem (10 μg), azteronem (30 μg), pipracillin (100 μg) tazobactam (110 μg), tobramycin (10 μg), fosfomycin (200 μg), rifampicin (5 μg), colistin (10 μg), tigecycline (15 μg), sulbactam/ampicillin (10 μg + 10 μg) and polymixin B (300 U) was evaluated using disk diffusion method. The MBL-producing isolates were screened using combined disc diffusion method. Furthermore, the presence of blaVIM, blaIMP, blaSPM, blaGIM, blaSIM and blaNDM was detected by PCR. 34.9% of isolates were recovered from bronchoalveolar lavage (BAL). 81 (94.2%) and 62 (71.2%) isolates were multidrug resistance (MDR) and XDR, respectively. 44 (51.2%) and 65 (75.6%) isolates were MBL-producing strains with resistance to imipenem and meropenem, respectively. 2 (2.3%), 13 (15.1%), 2 (2.3%), 4 (4.7%) and 2 (2.3%) isolates carried blaVIM, blaIMP, blaSPM, blaGIM and blaSIM genes, respectively. Our data showed that the rate of XDR and MBL A. baumannii is on the rise.

  11. Clonal relatedness and biofilm formation of OXA-23-producing carbapenem resistant Acinetobacter baumannii isolates from hospital environment.


    Aliramezani, Amir; Douraghi, Masoumeh; Hajihasani, Azade; Mohammadzadeh, Mona; Rahbar, Mohammad


    Carbapenem-resistant Acinetobacter baumannii (CRAB) is a serious threat for hospitalized patients and it can survive for long periods in hospital settings, particularly on inanimate surfaces. The environment occupied by these resistant and resilient isolates may act as a reservoir for cross-colonization and outbreaks. Here, we aimed to determine the distribution of CRAB in the hospital environment and to characterize their clonal relatedness, susceptibility profile, carriage of blaOXA genes, and biofilm formation. A total of 1080 samples were collected from various environmental surfaces and equipment of two referral hospitals in Tehran, Iran. The A. baumannii isolates were subjected to gyrB multiplex PCR, antibiotic susceptibility testing, biofilm formation assay, pulsed field gel electrophoresis (PFGE), and multiplex PCR for blaOXA-58, blaOXA-24, and blaOXA-23 genes. Eighteen Acinetobacter spp. were isolated; 8 were identified as A. baumannii and 10 as A. lwoffii. Five of A. baumannii isolates were CRAB and exhibited the multidrug-resistant (MDR) phenotype as well. All CRAB isolates produced biofilm, albeit with different levels. Four of CRAB isolates harbored the blaOXA-23. The CRAB isolates were clustered into 3 distinct pulsotypes (PTs). The CRAB isolates belonging to PT1 were detected in two geographically distinct hospitals whereas those belonging to PT3 were found in two different units of same hospital. This study revealed the presence of clonally related OXA-23-producing CRAB in high risk units of referral hospitals as inter- or intra-hospital dissemination. The distribution of multiresistant A. baumannii on several surfaces and areas may increase the risk of transmission of resistant isolates to vulnerable patients.

  12. Genetic basis of high level aminoglycoside resistance in Acinetobacter baumannii from Beijing, China

    PubMed Central

    Nie, Lu; Lv, Yuemeng; Yuan, Min; Hu, Xinxin; Nie, Tongying; Yang, Xinyi; Li, Guoqing; Pang, Jing; Zhang, Jingpu; Li, Congran; Wang, Xiukun; You, Xuefu


    The objective of this study was to investigate the genetic basis of high level aminoglycoside resistance in Acinetobacter baumannii clinical isolates from Beijing, China. 173 A. baumannii clinical isolates from hospitals in Beijing from 2006 to 2009 were first subjected to high level aminoglycoside resistance (HLAR, MIC to gentamicin and amikacin>512 µg/mL) phenotype selection by broth microdilution method. The strains were then subjected to genetic basis analysis by PCR detection of the aminoglycoside modifying enzyme genes (aac(3)-I, aac(3)-IIc, aac(6′)-Ib, aac(6′)-II, aph(4)-Ia, aph(3′)-I, aph(3′)-IIb, aph(3′)-IIIa, aph(3′)-VIa, aph(2″)-Ib, aph(2″)-Ic, aph(2″)-Id, ant(2″)-Ia, ant(3″)-I and ant(4′)-Ia) and the 16S rRNA methylase genes (armA, rmtB and rmtC). Correlation analysis between the presence of aminoglycoside resistance gene and HLAR phenotype were performed by SPSS. Totally 102 (58.96%) HLAR isolates were selected. The HLAR rates for year 2006, 2007, 2008 and 2009 were 52.63%, 65.22%, 51.11% and 70.83%, respectively. Five modifying enzyme genes (aac(3)-I, detection rate of 65.69%; aac(6′)-Ib, detection rate of 45.10%; aph(3′)-I, detection rate of 47.06%; aph(3′)-IIb, detection rate of 0.98%; ant(3″)-I, detection rate of 95.10%) and one methylase gene (armA, detection rate of 98.04%) were detected in the 102 A. baumannii with aac(3)-I+aac(6′)-Ib+ant(3″)-I+armA (detection rate of 25.49%), aac(3)-I+aph(3′)-I+ant(3″)-I+armA (detection rate of 21.57%) and ant(3″)-I+armA (detection rate of 12.75%) being the most prevalent gene profiles. The values of chi-square tests showed correlation of armA, ant(3″)-I, aac(3)-I, aph(3′)-I and aac(6′)-Ib with HLAR. armA had significant correlation (contingency coefficient 0.685) and good contingency with HLAR (kappa 0.940). The high rates of HLAR may cause a serious problem for combination therapy of aminoglycoside with β-lactams against A. baumannii infections. As armA was

  13. [Antimicrobial susceptibility and molecular characterization of multidrug-resistant Acinetobacter baumannii isolated in an university hospital].


    Direkel, Şahin; Çopur Çiçek, Ayşegül; Karagöz, Alper; Aydoğan Ejder, Nebahat; Oktay, Efdal; Delialioğlu, Nuran; Özgümüş, Osman Birol; Durmaz, Rıza


    Acinetobacter baumannii, an aerobic, non-motile, gram-negative bacterium is an important nosocomial pathogen which shows resistance to the most antibiotics. Carbapenems are the most commonly used antibiotics for the treatment of infections caused by this pathogen. However the emergence of resistance against carbapenems in an increasing rate generates serious problems for antimicrobial therapy. The aims of this study were to detect the antibiotic susceptibility, and the presence of blaOXA resistance genes of clinical A.baumannii isolates and to determine the clonal relationship between these isolates. A total of 79 A.baumannii strains isolated from various clinical specimens (37 respiratory tract samples, 11 wound, 10 blood, 8 catheters, 6 tissue, 5 urine, 2 abscess) of the patients admitted to Mersin University Medical School Hospital between May 2012-January 2013, were included in the study. The isolates were identified by conventional methods and Vitek®2 Compact automated system. Antibiotic susceptibilities of the isolates were determined by Kirby-Bauer disk diffusion method and evaluated according to CLSI criteria. The presence of blaOXA-51, blaOXA-23, blaOXA-24, blaOXA-48 and blaOXA-58 genes were detected by an in-house polymerase chain reaction (PCR), and the clonal relationship between the isolates were identified by pulsed-field gel electroforesis (PFGE) using the ApaI restriction enzyme. In our study, all of the isolates were susceptible to colistin, while the resistance rates against piperacillin-tazobactam, ciprofloxacin, imipenem, meropenem, cefoperazone/sulbactam, trimethoprim-sulfamethoxazole, ceftazidime, levofloxacin, gentamicin, tetracycline, ampicillin-sulbactam, amikacin, netilmicin and tigecycline were 97.5%, 96.2%, 94.9%, 94.9%, 93.6%, 91.1%, 88.6%, 86%, 83.6%, 77.2%, 69.6%, 55.7%, 27.8% and 3.8%, respectively. All the isolates were identified as A.baumannii with the OXA-specific PCR and OXA16S rDNA sequence analysis. All of the isolates (100

  14. The resistance and transmission mechanism of Acinetobacter baumannii isolates in a tertiary care hospital, China.


    Sun, Fengjun; Ou, Qianyi; Wang, Qian; Feng, Wei; Qiu, Xuewen; Chen, Jianhong; Liu, Yao; Xia, Peiyuan


    The aim of this study was to analyse the resistance and epidemiological data of 117 Acinetobacter baumannii isolates from Southwest Hospital, Chongqing, China. Except for polymyxin B, tigecycline, minocycline, cefoperazone/sulbactam, amikacin and levofloxacin, the resistance rates of other antimicrobial agents were above 90%. All the clinical isolates had the blaOXA-51 gene and 114 isolates had the blaOXA-23 gene. Forty-nine isolates were found to contain the blaIMP-4 gene. PFGE data showed that 117 isolates were divided into 25 groups. Sixty-three (53.85%) were found to carry the class 1 integron, and the sequence analysis of the class 1 integron internal variable regions - five types, one of which had the blaIMP-4 gene. For the blaIMP-4 positive strain without class 1 integron, we found the flanking sequence had the TnpA gene. The result suggested that the resistance gene was widely distributed in our hospital; moreover, the modes of presence and transmission are different and complicated. The results of our study can improve the infection empirical treatment method and infection control programme.

  15. The effect of silver or gallium doped titanium against the multidrug resistant Acinetobacter baumannii.


    Cochis, A; Azzimonti, B; Della Valle, C; De Giglio, E; Bloise, N; Visai, L; Cometa, S; Rimondini, L; Chiesa, R


    Implant-related infection of biomaterials is one of the main causes of arthroplasty and osteosynthesis failure. Bacteria, such as the rapidly-emerging Multi Drug Resistant (MDR) pathogen Acinetobacter Baumannii, initiate the infection by adhering to biomaterials and forming a biofilm. Since the implant surface plays a crucial role in early bacterial adhesion phases, titanium was electrochemically modified by an Anodic Spark Deposition (ASD) treatment, developed previously and thought to provide osseo-integrative properties. In this study, the treatment was modified to insert gallium or silver onto the titanium surface, to provide antibacterial properties. The material was characterized morphologically, chemically, and mechanically; biological properties were investigated by direct cytocompatibility assay, Alkaline Phosphatase (ALP) activity, Scanning Electron Microscopy (SEM), and Immunofluorescent (IF) analysis; antibacterial activity was determined by counting Colony Forming Units, and viability assay. The various ASD-treated surfaces showed similar morphology, micrometric pore size, and uniform pore distribution. Of the treatments studied, gallium-doped specimens showed the best ALP synthesis and antibacterial properties. This study demonstrates the possibility of successfully doping the surface of titanium with gallium or silver, using the ASD technique; this approach can provide antibacterial properties and maintain high osseo-integrative potential.

  16. Combination therapy with polymyxin B and netropsin against clinical isolates of multidrug-resistant Acinetobacter baumannii

    PubMed Central

    Chung, Joon-hui; Bhat, Abhayprasad; Kim, Chang-Jin; Yong, Dongeun; Ryu, Choong-Min


    Polymyxins are last-resort antibiotics for treating infections of Gram-negative bacteria. The recent emergence of polymyxin-resistant bacteria, however, urgently demands clinical optimisation of polymyxin use to minimise further evolution of resistance. In this study we developed a novel combination therapy using minimal concentrations of polymyxin B. After large-scale screening of Streptomyces secondary metabolites, we identified a reliable polymixin synergist and confirmed as netropsin using high-pressure liquid chromatography, nuclear magnetic resonance, and mass spectrometry followed by in vitro assays using various Gram-negative pathogenic bacteria. To evaluate the effectiveness of combining polymixin B and netropsin in vivo, we performed survival analysis on greater wax moth Galleria mellonella infected with colistin-resistant clinical Acinetobacter baumannii isolates as well as Escherichia coli, Shigella flexineri, Salmonella typhimuruim, and Pseudomonas aeruginosa. The survival of infected G. mellonella was significantly higher when treated with polymyxin B and netropsin in combination than when treated with polymyxin B or netropsin alone. We propose a netropsin combination therapy that minimises the use of polymyxin B when treating infections with multidrug resistant Gram-negative bacteria. PMID:27306928

  17. Imaging mass spectrometry for assessing temporal proteomics: Analysis of calprotectin in Acinetobacter baumannii pulmonary infection

    PubMed Central

    Nicklay, Joshua J.; Boyd, Kelli L.; Skaar, Eric P.; Caprioli, Richard M.


    Imaging MS is routinely used to show spatial localization of proteins within a tissue sample and can also be employed to study temporal protein dynamics. The antimicrobial S100 protein calprotectin, a heterodimer of subunits S100A8 and S100A9, is an abundant cytosolic component of neutrophils. Using imaging MS, calprotectin can be detected as a marker of the inflammatory response to bacterial challenge. In a murine model of Acinetobacter baumannii pneumonia, protein images of S100A8 and S100A9 collected at different time points throughout infection aid in visualization of the innate immune response to this pathogen. Calprotectin is detectable within 6 h of infection as immune cells respond to the invading pathogen. As the bacterial burden decreases, signals from the inflammatory proteins decrease. Calprotectin is no longer detectable 96–144 h post infection, correlating to a lack of detectable bacterial burden in lungs. These experiments provide a label-free, multiplexed approach to study host response to a bacterial threat and eventual clearance of the pathogen over time. PMID:23754577

  18. Screening of antibiotics resistance to Enterobacteriaceae, Pseudomonas aeruginosa, and Acinetobacter baumannii by an advanced expert system.


    Nakamura, Tatsuya; Takahashi, Hakuo


    The VITEK2 advanced expert system (AES) gives information about the antibiotics-resistance mechanisms based on the biological validation derived from the VITEK2 susceptibility result. In this study, we investigated whether or not this system correctly categorized the beta-lactamase resistance mechanism data derived from the VITEK2 susceptibility result using the testing card, AST-N025, with Enterobacteriaceae, Pseudomonas aeruginosa, and Acinetobacter baumannii. We used 131 strains, and their phenotypes were determined according to the biological and genetic screening. The AES analysis result matched the phenotype testing in 120 (91.6%) of the 131 strains. Incorrect findings were found in six strains, including three strains of Serratia marcescens. The resistance mechanism could not be determined in five strains, including three strains of Providencia rettgeri. The analysis of those phenotypes agreed in 34 (97.1%) among 35 strains with extended spectrum beta-lactamase (ESBL), and in 27 (96.4%) among 28 strains with high-level cephalosporinase. The agreement ratio in the phenotype was very high as we expected. The incorrect and nondeterminable samples were strains with relatively high cephalosporinase that has variation of outer membrane protein. The AES was able to detect the phenotype for carbapenemase. The AES is a clinically useful system that allows taking prompt measures to treat patients because it can provide information about the resistance mechanism in less than half a day after starting the analysis.

  19. Imaging mass spectrometry for assessing temporal proteomics: analysis of calprotectin in Acinetobacter baumannii pulmonary infection.


    Moore, Jessica L; Becker, Kyle W; Nicklay, Joshua J; Boyd, Kelli L; Skaar, Eric P; Caprioli, Richard M


    Imaging MS is routinely used to show spatial localization of proteins within a tissue sample and can also be employed to study temporal protein dynamics. The antimicrobial S100 protein calprotectin, a heterodimer of subunits S100A8 and S100A9, is an abundant cytosolic component of neutrophils. Using imaging MS, calprotectin can be detected as a marker of the inflammatory response to bacterial challenge. In a murine model of Acinetobacter baumannii pneumonia, protein images of S100A8 and S100A9 collected at different time points throughout infection aid in visualization of the innate immune response to this pathogen. Calprotectin is detectable within 6 h of infection as immune cells respond to the invading pathogen. As the bacterial burden decreases, signals from the inflammatory proteins decrease. Calprotectin is no longer detectable 96-144 h post infection, correlating to a lack of detectable bacterial burden in lungs. These experiments provide a label-free, multiplexed approach to study host response to a bacterial threat and eventual clearance of the pathogen over time.

  20. Carbapenem-Resistant Acinetobacter baumannii and Enterobacteriaceae in South and Southeast Asia.


    Hsu, Li-Yang; Apisarnthanarak, Anucha; Khan, Erum; Suwantarat, Nuntra; Ghafur, Abdul; Tambyah, Paul Anantharajah


    Carbapenem-resistant Gram-negative bacteria, in particular the Acinetobacter baumannii-calcoaceticus complex and Enterobacteriaceae, are escalating global public health threats. We review the epidemiology and prevalence of these carbapenem-resistant Gram-negative bacteria among countries in South and Southeast Asia, where the rates of resistance are some of the highest in the world. These countries house more than a third of the world's population, and several are also major medical tourism destinations. There are significant data gaps, and the almost universal lack of comprehensive surveillance programs that include molecular epidemiologic testing has made it difficult to understand the origins and extent of the problem in depth. A complex combination of factors such as inappropriate prescription of antibiotics, overstretched health systems, and international travel (including the phenomenon of medical tourism) probably led to the rapid rise and spread of these bacteria in hospitals in South and Southeast Asia. In India, Pakistan, and Vietnam, carbapenem-resistant Enterobacteriaceae have also been found in the environment and community, likely as a consequence of poor environmental hygiene and sanitation. Considerable political will and effort, including from countries outside these regions, are vital in order to reduce the prevalence of such bacteria in South and Southeast Asia and prevent their global spread.

  1. Antimicrobial blue light therapy for multidrug-resistant Acinetobacter baumannii infection in a mouse burn model: implications for prophylaxis and treatment of combat-related wound infections.


    Zhang, Yunsong; Zhu, Yingbo; Gupta, Asheesh; Huang, Yingying; Murray, Clinton K; Vrahas, Mark S; Sherwood, Margaret E; Baer, David G; Hamblin, Michael R; Dai, Tianhong


    In this study, we investigated the utility of antimicrobial blue light therapy for multidrug-resistant Acinetobacter baumannii infection in a mouse burn model. A bioluminescent clinical isolate of multidrug-resistant A. baumannii was obtained. The susceptibility of A. baumannii to blue light (415 nm)-inactivation was compared in vitro to that of human keratinocytes. Repeated cycles of sublethal inactivation of bacterial by blue light were performed to investigate the potential resistance development of A. baumannii to blue light. A mouse model of third degree burn infected with A. baumannii was developed. A single exposure of blue light was initiated 30 minutes after bacterial inoculation to inactivate A. baumannii in mouse burns. It was found that the multidrug-resistant A. baumannii strain was significantly more susceptible than keratinocytes to blue light inactivation. Transmission electron microscopy revealed blue light-induced ultrastructural damage in A. baumannii cells. Fluorescence spectroscopy suggested that endogenous porphyrins exist in A. baumannii cells. Blue light at an exposure of 55.8 J/cm(2) significantly reduced the bacterial burden in mouse burns. No resistance development to blue light inactivation was observed in A. baumannii after 10 cycles of sublethal inactivation of bacteria. No significant DNA damage was detected in mouse skin by means of a skin TUNEL assay after a blue light exposure of 195 J/cm(2).

  2. Evolution of Carbapenem-Resistant Acinetobacter baumannii Revealed through Whole-Genome Sequencing and Comparative Genomic Analysis

    PubMed Central

    Li, Henan; Liu, Fei; Zhang, Yawei; Wang, Xiaojuan; Zhao, Chunjiang; Chen, Hongbin; Zhang, Feifei; Zhu, Baoli


    Acinetobacter baumannii is a globally important nosocomial pathogen characterized by an evolving multidrug resistance. A total of 35 representative clinical A. baumannii strains isolated from 13 hospitals in nine cities in China from 1999 to 2011, including 32 carbapenem-resistant and 3 carbapenem-susceptible A. baumannii strains, were selected for whole-genome sequencing and comparative genomic analysis. Phylogenetic analysis revealed that the earliest strain, strain 1999BJAB11, and two strains isolated in Zhejiang Province in 2004 were the founder strains of carbapenem-resistant A. baumannii. Ten types of AbaR resistance islands were identified, and a previously unreported AbaR island, which comprised a two-component response regulator, resistance-related proteins, and RND efflux system proteins, was identified in two strains isolated in Zhejiang in 2004. Multiple transposons or insertion sequences (ISs) existed in each strain, and these gradually tended to diversify with evolution. Some of these IS elements or transposons were the first to be reported, and most of them were mainly found in strains from two provinces. Genome feature analysis illustrated diversified resistance genes, surface polysaccharides, and a restriction-modification system, even in strains that were phylogenetically and epidemiologically very closely related. IS-mediated deletions were identified in the type VI secretion system region, the csuE region, and core lipooligosaccharide (LOS) loci. Recombination occurred in the heme utilization region, and intrinsic resistance genes (blaADC and blaOXA-51-like variants) and three novel blaOXA-51-like variants (blaOXA-424, blaOXA-425, and blaOXA-426) were identified. Our results could improve the understanding of the evolutionary processes that contribute to the emergence of carbapenem-resistant A. baumannii strains and help elucidate the molecular evolutionary mechanism in A. baumannii. PMID:25487793

  3. Inhibition of LpxC Protects Mice from Resistant Acinetobacter baumannii by Modulating Inflammation and Enhancing Phagocytosis

    PubMed Central

    Lin, Lin; Tan, Brandon; Pantapalangkoor, Paul; Ho, Tiffany; Baquir, Beverlie; Tomaras, Andrew; Montgomery, Justin I.; Reilly, Usa; Barbacci, Elsa G.; Hujer, Kristine; Bonomo, Robert A.; Fernandez, Lucia; Hancock, Robert E. W.; Adams, Mark D.; French, Samuel W.; Buslon, Virgil S.; Spellberg, Brad


    ABSTRACT New treatments are needed for extensively drug-resistant (XDR) Gram-negative bacilli (GNB), such as Acinetobacter baumannii. Toll-like receptor 4 (TLR4) was previously reported to enhance bacterial clearance of GNB, including A. baumannii. However, here we have shown that 100% of wild-type mice versus 0% of TLR4-deficient mice died of septic shock due to A. baumannii infection, despite having similar tissue bacterial burdens. The strain lipopolysaccharide (LPS) content and TLR4 activation by extracted LPS did not correlate with in vivo virulence, nor did colistin resistance due to LPS phosphoethanolamine modification. However, more-virulent strains shed more LPS during growth than less-virulent strains, resulting in enhanced TLR4 activation. Due to the role of LPS in A. baumannii virulence, an LpxC inhibitor (which affects lipid A biosynthesis) antibiotic was tested. The LpxC inhibitor did not inhibit growth of the bacterium (MIC > 512 µg/ml) but suppressed A. baumannii LPS-mediated activation of TLR4. Treatment of infected mice with the LpxC inhibitor enhanced clearance of the bacteria by enhancing opsonophagocytic killing, reduced serum LPS concentrations and inflammation, and completely protected the mice from lethal infection. These results identify a previously unappreciated potential for the new class of LpxC inhibitor antibiotics to treat XDR A. baumannii infections. Furthermore, they have far-reaching implications for pathogenesis and treatment of infections caused by GNB and for the discovery of novel antibiotics not detected by standard in vitro screens. PMID:23033474

  4. OXA-23 and ISAba1-OXA-66 class D β-lactamases in Acinetobacter baumannii isolates from companion animals.


    Ewers, Christa; Klotz, Peter; Leidner, Ursula; Stamm, Ivonne; Prenger-Berninghoff, Ellen; Göttig, Stephan; Semmler, Torsten; Scheufen, Sandra


    Acinetobacter baumannii is recognised as a major pathogen of nosocomial infections that frequently show resistance to last-resort antimicrobials. To investigate whether A. baumannii from companion animals harbour carbapenem resistance mechanisms, 223 clinical isolates obtained from veterinary clinics between 2000 and 2013 in Germany were screened for carbapenem-non-susceptibility employing meropenem-containing Mueller-Hinton agar plates. Minimum inhibitory concentration (MIC) data were obtained using the VITEK(®)2 system. Assignment to international clones (ICs) was done by multiplex PCR or repetitive sequence-based PCR employing the DiversiLab system. Clonality was studied using pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing (MLST). Genes encoding carbapenemases and aminoglycoside-modifying enzymes were detected by PCR. In three samples from dogs, carbapenem-resistant A. baumannii carrying the blaOXA-23 gene on plasmids and located on transposon Tn2008 were identified. The isolates belonged to sequence type ST1(P) (clonal complex CC1/IC1/pulsotype II) and ST10(P) (CC10/IC8/pulsotype IV) according to the Pasteur MLST scheme, and to ST231(Ox) (CC109) and ST585(Ox) (CC447) following the Oxford scheme. Insertion sequence ISAba1 was identified upstream of blaOXA-66 in 58 A. baumannii isolates. MLST referred them to ST2(P) (CC2/IC2/pulsotypes I and III), ST208(Ox), ST350(Ox) and ST556(Ox) (all CC118), respectively. PFGE suggested nosocomial spread of these highly related strains, which frequently demonstrated a multidrug-resistant phenotype, in one veterinary clinic. These data show that A. baumannii from companion animals reveal resistance determinants and clonal lineages of strains globally emerging in humans. This suggests an interspecies transmission and warrants molecular surveillance of A. baumannii in veterinary clinics to mitigate its further spread.

  5. Immunization with lipopolysaccharide-deficient whole cells provides protective immunity in an experimental mouse model of Acinetobacter baumannii infection.


    García-Quintanilla, Meritxell; Pulido, Marina R; Pachón, Jerónimo; McConnell, Michael J


    The increasing clinical importance of infections caused by multidrug resistant Acinetobacter baumannii warrants the development of novel approaches for prevention and treatment. In this context, vaccination of certain patient populations may contribute to reducing the morbidity and mortality caused by this pathogen. Vaccines against Gram-negative bacteria based on inactivated bacterial cells are highly immunogenic and have been shown to produce protective immunity against a number of bacterial species. However, the high endotoxin levels present in these vaccines due to the presence of lipopolysaccharide complicates their use in human vaccination. In the present study, we used a laboratory-derived strain of A. baumannii that completely lacks lipopolysaccharide due to a mutation in the lpxD gene (IB010), one of the genes involved in the first steps of lipopolysaccharide biosynthesis, for vaccination. We demonstrate that IB010 has greatly reduced endotoxin content (<1.0 endotoxin unit/106 cells) compared to wild type cells. Immunization with formalin inactivated IB010 produced a robust antibody response consisting of both IgG1 and IgG2c subtypes. Mice immunized with IB010 had significantly lower post-infection tissue bacterial loads and significantly lower serum levels of the pro-inflammatory cytokines IL-1β, TNF-α and IL-6 compared to control mice in a mouse model of disseminated A. baumannii infection. Importantly, immunized mice were protected from infection with the ATCC 19606 strain and an A. baumannii clinical isolate. These data suggest that immunization with inactivated A. baumannii whole cells deficient in lipopolysaccharide could serve as the basis for a vaccine for the prevention of infection caused by A. baumannii.

  6. Molecular epidemiology and antimicrobial resistance phenotypes of Acinetobacter baumannii isolated from patients in three hospitals in southern Vietnam.


    Tuan Anh, Nguyen; Nga, Tran Vu Thieu; Tuan, Huynh Minh; Tuan, Nguyen Si; Y, Dao Minh; Vinh Chau, Nguyen Van; Baker, Stephen; Duong, Ho Huynh Thuy


    Multidrug resistance in the nosocomial pathogen Acinetobacter baumannii limits therapeutic options and impacts on clinical care. Resistance against carbapenems, a group of last-resort antimicrobials for treating multidrug-resistant (MDR) A. baumannii infections, is associated with the expression (and over-expression) of carbapenemases encoded by the blaOXA genes. The aim of this study was to determine the prevalence of antimicrobial-resistant A. baumannii associated with infection in three hospitals in southern Vietnam and to characterize the genetic determinants associated with resistance against carbapenems. We recovered a total of 160 A. baumannii isolates from clinical samples collected in three hospitals in southern Vietnam from 2012 to 2014. Antimicrobial resistance was common; 119/160 (74 %) of isolates were both MDR and extensively drug resistant (XDR). High-level imipenem resistance (>32 µg ml-1) was determined for 109/117 (91.6 %) of the XDR imipenem-nonsusceptible organisms, of which the majority (86.7 %) harboured the blaOXA-51 and blaOXA-23 genes associated with an ISAba1 element. Multiple-locus variable number tandem repeat analysis segregated the 160 A. baumannii into 107 different multiple-locus variable number tandem repeat analysis types, which described five major clusters. The biggest cluster was a clonal complex composed mainly of imipenem-resistant organisms that were isolated from all three of the study hospitals. Our study indicates a very high prevalence of MDR/XDR A. baumannii causing clinically significant infections in hospitals in southern Vietnam. These organisms commonly harboured the blaOXA-23 gene with ISAba1 and were carbapenem resistant; this resistance phenotype may explain their continued selection and ongoing transmission within the Vietnamese healthcare system.

  7. Crude oil degradation efficiency of a recombinant Acinetobacter baumannii strain and its survival in crude oil-contaminated soil microcosm.


    Mishra, Sanjeet; Sarma, Priyangshu M; Lal, Banwari


    A hydrocarbon degrading Acinetobacter baumannii S30 strain, isolated from crude oil-contaminated soil, was inserted with the lux gene from the luciferase gene cassette luxCDABE. Soil microcosms were designed to study the degradation efficacy for total petroleum hydrocarbon (TPH) of crude oil by lux-tagged A. baumannii S30 pJES. Bioaugmentation of a TPH-contaminated microcosm with A baumannii S30 pJES showed that TPH levels were reduced from 89.3 to 53.9 g/kg soil in 90 days. Biodegradation of TPH by A baumannii S30 pJES was also monitored in shake flask conditions, which showed a reduction of initial TPH levels by over 50% at the end of 120 h. A lux-PCR-based approach along with the standard dilution plating with selective antibiotics was successfully utilized to monitor the survivability of the lux-tagged strain A. baumannii S30 pJES in soil microcosms and stability of the lux insert in the host strain A. baumannii S30. The selective plating technique indicated the population of A. baumannii S30 pJES to be 6.5+/-0.13 x 10(8) CFU/g at day zero (just after bioaugmentation) and 2.09+/-0.08 x 10(8) CFU/g of soil after 90 days of incubation. lux-PCR confirmed the stability of the insert in all the randomly selected colonies of A. baumannii strains from the antibiotic plates. The lux insert was stable after 50 generations in Luria Bertini broth and storage at -70 degrees C as glycerol stocks for over a year. These results revealed that the lux insert was stable and lux-tagged A. baumannii S30 strain could survive in a TPH-contaminated soil microcosm and could degrade TPH in the soil microcosm conditions. It can be used as an effective marker to monitor the survival of augmented strains at a bioremediation site.

  8. Molecular epidemiology of multidrug-resistant Acinetobacter baumannii isolates in a university hospital in Nepal reveals the emergence of a novel epidemic clonal lineage.


    Shrestha, Shovita; Tada, Tatsuya; Miyoshi-Akiyama, Tohru; Ohara, Hiroshi; Shimada, Kayo; Satou, Kazuhito; Teruya, Kuniko; Nakano, Kazuma; Shiroma, Akino; Sherchand, Jeevan Bdr; Rijal, Basista Psd; Hirano, Takashi; Kirikae, Teruo; Pokhrel, Bharat Mani


    The emergence of multidrug-resistant (MDR) Acinetobacter baumannii has become a serious medical problem worldwide. To clarify the genetic and epidemiological properties of MDR A. baumannii strains isolated from a medical setting in Nepal, 246 Acinetobacter spp. isolates obtained from different patients were screened for MDR A. baumannii by antimicrobial disk susceptibility testing. Whole genomes of the MDR A. baumannii isolates were sequenced by MiSeq™ (Illumina), and the complete genome of one isolate (IOMTU433) was sequenced by PacBio RS II. Phylogenetic trees were constructed from single nucleotide polymorphism concatemers. Multilocus sequence types were deduced and drug resistance genes were identified. Of the 246 Acinetobacter spp. isolates, 122 (49.6%) were MDR A. baumannii, with the majority being resistant to aminoglycosides, carbapenems and fluoroquinolones but not to colistin and tigecycline. These isolates harboured the 16S rRNA methylase gene armA as well as bla(NDM-1), bla(OXA-23) or bla(OXA-58). MDR A. baumannii isolates belonging to clonal complex 1 (CC1) and CC2 as well as a novel clonal complex (CC149) have spread throughout a medical setting in Nepal. The MDR isolates harboured genes encoding carbapenemases (OXA and NDM-1) and a 16S rRNA methylase (ArmA).

  9. Enhanced Antibacterial Activity of Acinetobacter baumannii Bacteriophage ØABP-01 Endolysin (LysABP-01) in Combination with Colistin

    PubMed Central

    Thummeepak, Rapee; Kitti, Thawatchai; Kunthalert, Duangkamol; Sitthisak, Sutthirat


    Endolysins are lytic enzymes produced by bacteriophages with their ability to degrade the cell wall of bacterial hosts. Endolysin (LysABP-01) from Acinetobacter baumannii bacteriophage ØABP-01 was cloned, overexpressed and characterized. Endolysin LysABP-01 has a globular structure consisting of lysozyme-like (N-acetyl-β-D-muramidase) catalytic domain. It contains 185 amino acids which correspond to a 21.1 kDa protein. The lytic activity of the recombinant endolysin protein was determined by a plate lysis assay for its ability to lyse the autoclaved cell (crude cell wall) of the different bacterial species. LysABP-01 can degrade the crude cell wall of A. baumannii strains, Escherichia coli and Pseudomonas aeruginosa but not of Staphylococcus aureus. The antibacterial activity of LysABP-01 and its synergism with various antibiotics were tested. The results exhibited elevated antibacterial activity in a combination of the sub-MIC LysABP-01 and colistin. The checkerboard assay for measuring antibiotic synergy of LysABP-01 and colistin was performed. This combination was synergistic against various drug-resistant strains of A. baumannii (FIC index < 0.5). In summary, our study highlights the ability of LysABP-01 endolysin to hydrolyze the A. baumannii cell wall and its synergistic interaction with colistin. PMID:27656173

  10. Functional Characterization of AbeD, an RND-Type Membrane Transporter in Antimicrobial Resistance in Acinetobacter baumannii

    PubMed Central

    Srinivasan, Vijaya Bharathi; Venkataramaiah, Manjunath; Mondal, Amitabha; Rajamohan, Govindan


    Background Acinetobacter baumannii is becoming an increasing menace in health care settings especially in the intensive care units due to its ability to withstand adverse environmental conditions and exhibit innate resistance to different classes of antibiotics. Here we describe the biological contributions of abeD, a novel membrane transporter in bacterial stress response and antimicrobial resistance in A. baumannii. Results The abeD mutant displayed ~ 3.37 fold decreased survival and >5-fold reduced growth in hostile osmotic (0.25 M; NaCl) and oxidative (2.631 μM–6.574 μM; H2O2) stress conditions respectively. The abeD inactivated cells displayed increased susceptibility to ceftriaxone, gentamicin, rifampicin and tobramycin (~ 4.0 fold). The mutant displayed increased sensitivity to the hospital-based disinfectant benzalkonium chloride (~3.18-fold). In Caenorhabditis elegans model, the abeD mutant exhibited (P<0.01) lower virulence capability. Binding of SoxR on the regulatory fragments of abeD provide strong evidence for the involvement of SoxR system in regulating the expression of abeD in A. baumannii. Conclusion This study demonstrates the contributions of membrane transporter AbeD in bacterial physiology, stress response and antimicrobial resistance in A. baumannii for the first time. PMID:26496475

  11. Structure of the neutral capsular polysaccharide of Acinetobacter baumannii NIPH146 that carries the KL37 capsule gene cluster.


    Arbatsky, Nikolay P; Shneider, Mikhail M; Kenyon, Johanna J; Shashkov, Alexander S; Popova, Anastasiya V; Miroshnikov, Konstantin A; Volozhantsev, Nikolay V; Knirel, Yuriy A


    Capsular polysaccharide (CPS) was isolated from Acinetobacter baumannii NIPH146, and the following structure of branched pentasaccharide repeating unit was established by sugar analyses along with 1D and 2D NMR spectroscopy: In comparison to most other known capsular polysaccharides of A. baumannii, the CPS studied is neutral and lacks any specific monosaccharide component. The synthesis, assembly and export of this structure could be attributed to genes in a novel capsule biosynthesis gene cluster, designated KL37, which was found in the NIPH146 genome. The CPS of A. baumannii NIPH146 shares the α-d-Galp-(1→6)-β-d-Glcp-(1→3)-d-GalpNAc-(1→ trisaccharide fragment with the CPS units of several A. baumannii strains, including ATCC 17978 and LUH 5537 that carry the KL3 and KL22 gene clusters, respectively. KL37 contains two genes for glycosyltransferases that are related to two glycosyltransferase genes present in both KL3 and KL22, and the encoded proteins could be tentatively assigned to linkages between sugars in the CPS repeat.

  12. Structural basis for fragmenting the exopolysaccharide of Acinetobacter baumannii by bacteriophage ΦAB6 tailspike protein.


    Lee, I-Ming; Tu, I-Fan; Yang, Feng-Ling; Ko, Tzu-Ping; Liao, Jiahn-Haur; Lin, Nien-Tsung; Wu, Chung-Yi; Ren, Chien-Tai; Wang, Andrew H-J; Chang, Ching-Ming; Huang, Kai-Fa; Wu, Shih-Hsiung


    With an increase in antibiotic-resistant strains, the nosocomial pathogen Acinetobacter baumannii has become a serious threat to global health. Glycoconjugate vaccines containing fragments of bacterial exopolysaccharide (EPS) are an emerging therapeutic to combat bacterial infection. Herein, we characterize the bacteriophage ΦAB6 tailspike protein (TSP), which specifically hydrolyzed the EPS of A. baumannii strain 54149 (Ab-54149). Ab-54149 EPS exhibited the same chemical structure as two antibiotic-resistant A. baumannii strains. The ΦAB6 TSP-digested products comprised oligosaccharides of two repeat units, typically with stoichiometric pseudaminic acid (Pse). The 1.48-1.89-Å resolution crystal structures of an N-terminally-truncated ΦAB6 TSP and its complexes with the semi-hydrolyzed products revealed a trimeric β-helix architecture that bears intersubunit carbohydrate-binding grooves, with some features unusual to the TSP family. The structures suggest that Pse in the substrate is an important recognition site for ΦAB6 TSP. A region in the carbohydrate-binding groove is identified as the determinant of product specificity. The structures also elucidated a retaining mechanism, for which the catalytic residues were verified by site-directed mutagenesis. Our findings provide a structural basis for engineering the enzyme to produce desired oligosaccharides, which is useful for the development of glycoconjugate vaccines against A. baumannii infection.

  13. Identification and characteristics of imipenem-resistant Acinetobacter baumannii in surgical wards in a Chinese university hospital.


    Wang, Dalin; Ma, Linlin; Wu, Zhenyu; Li, Mingcheng; Li, Xiaohan; Zhang, Wei; Chen, Kun


    The aim of this study was to investigate the prevalence and characteristics of imipenem-resistant Acinetobacter baumanni isolated from surgical wards in a university hospital, China. A total of 143 non-duplicate A. baumannii were isolated from 517 inpatients in surgery intensive care units (ICUs), burn wards, and general surgery wards. Of these, 102 isolates of A. baumannii (71.3%) were resistant to imipenem. Among imipenem-resistant isolates, all isolates were resistant to almost all antimicrobial agents except polymyxin E, all isolates were positive for blaOXA-23 and blaOXA-51 in addition to ISAba1, 52 (51%) were positive for blaOXA-58, 8 (7.8%) contained blaVIM-2, which co-harbored with blaOXA-58. Molecular typing revealed the presence of three clones among imipenem-resistant isolates. This study confirmed that A. baumannii strains harboring OXA or VIM type β-lactamases are widely distributed throughout the surgery wards. The data demonstrate that there was a high prevalence of imipenem-resistant A. baumannii infection in the region.

  14. Structural basis for fragmenting the exopolysaccharide of Acinetobacter baumannii by bacteriophage ΦAB6 tailspike protein

    PubMed Central

    Lee, I-Ming; Tu, I-Fan; Yang, Feng-Ling; Ko, Tzu-Ping; Liao, Jiahn-Haur; Lin, Nien-Tsung; Wu, Chung-Yi; Ren, Chien-Tai; Wang, Andrew H.-J.; Chang, Ching-Ming; Huang, Kai-Fa; Wu, Shih-Hsiung


    With an increase in antibiotic-resistant strains, the nosocomial pathogen Acinetobacter baumannii has become a serious threat to global health. Glycoconjugate vaccines containing fragments of bacterial exopolysaccharide (EPS) are an emerging therapeutic to combat bacterial infection. Herein, we characterize the bacteriophage ΦAB6 tailspike protein (TSP), which specifically hydrolyzed the EPS of A. baumannii strain 54149 (Ab-54149). Ab-54149 EPS exhibited the same chemical structure as two antibiotic-resistant A. baumannii strains. The ΦAB6 TSP-digested products comprised oligosaccharides of two repeat units, typically with stoichiometric pseudaminic acid (Pse). The 1.48-1.89-Å resolution crystal structures of an N-terminally-truncated ΦAB6 TSP and its complexes with the semi-hydrolyzed products revealed a trimeric β-helix architecture that bears intersubunit carbohydrate-binding grooves, with some features unusual to the TSP family. The structures suggest that Pse in the substrate is an important recognition site for ΦAB6 TSP. A region in the carbohydrate-binding groove is identified as the determinant of product specificity. The structures also elucidated a retaining mechanism, for which the catalytic residues were verified by site-directed mutagenesis. Our findings provide a structural basis for engineering the enzyme to produce desired oligosaccharides, which is useful for the development of glycoconjugate vaccines against A. baumannii infection. PMID:28209973

  15. The role of filamentous hemagglutinin adhesin in adherence and biofilm formation in Acinetobacter baumannii ATCC19606(T).


    Darvish Alipour Astaneh, Shakiba; Rasooli, Iraj; Mousavi Gargari, Seyed Latif


    Filamentous hemagglutinin adhesins (FHA) are key factors for bacterial attachment and subsequent cell accumulation on substrates. Here an FHA-like Outer membrane (OM) adhesin of Acinetobacter baumannii ATCC19606(T) was displayed on Escherichia coli. The candidate autotransporter (AT) genes were identified in A. baumannii ATCC19606(T) genome. The exoprotein (FhaB1) and transporter (FhaC1) were produced independently within the same cell (FhaB1C1). The fhaC1 was mutated. In vitro adherence to epithelial cells of the recombinant FhaB1C1 and the mutant strains were compared with A. baumanni ATCC19606(T). A bivalent chimeric protein (K) composed of immunologically important portions of fhaB1 (B) and fhaC1 (C) was constructed. The mice vaccinated with chimeric protein were challenged with A. baumannii ATCC19606(T) and FhaB1C1 producing recombinant E. coli. Mutations in the fhaC1 resulted in the absence of FhaB1 in the OM. Expression of FhaB1C1 enhanced the adherence of recombinant bacteria to A546 bronchial cell line. The results revealed association of FhaB1 with bacterial adhesion and biofilm formation. Immunization with a combination of recombinant B and K proteins proved protective against A. baumanni ATCC19606(T). The findings may be applied in active and passive immunization strategies against A. baumannii.

  16. Xuebijing Protects Rats from Sepsis Challenged with Acinetobacter baumannii by Promoting Annexin A1 Expression and Inhibiting Proinflammatory Cytokines Secretion

    PubMed Central

    He, Xian-Di; Wang, Yan; Wu, Qiong; Wang, Hua-Xue; Chen, Zhen-Dong; Zheng, Rong-Sheng; Wang, Zi-Shu; Wang, Jun-Bin; Yang, Yan


    Xuebijing (XBJ) injection is a herbal medicine that has been widely used in the treatment of sepsis in China; however, its role in the development and progression of Acinetobacter baumannii sepsis and the underlying mechanisms remain uninvestigated. In the present study, fifty-four male Wistar rats were randomly assigned to normal-control group, sepsis-control group, and sepsis + XBJ group, each containing three subgroups of different treatment time periods (6, 12, and 24 hrs following injection, resp.). The sepsis model was established by intraperitoneal injection of A. baumannii ATCC 19606. For XBJ treatment, 4 mL/kg XBJ was administrated simultaneously by intravenous injection through caudal vein every 12 hrs. All animals demonstrated ill state, obvious intestinal dysfunction, histopathological lung damages, and overactive inflammatory responses after A. baumannii infection, and these events could be partially reversed by XBJ treatment from the beginning of infection. XBJ induced an increase in the expression of anti-inflammatory mediator annexin A1; however, two proinflammatory cytokines, interleukin-8 (IL-8) and tumor necrosis factor-α (TNF-α), were decreased at the each monitored time point. These findings suggested that XBJ via its cytokine-mediated anti-inflammatory effects might have a potential role in preventing the progression of A. baumannii infection to sepsis by early administration. PMID:24369483

  17. Preclinical advantages of intramuscularly administered peptide A3-APO over existing therapies in Acinetobacter baumannii wound infections

    PubMed Central

    Ostorhazi, Eszter; Rozgonyi, Ferenc; Sztodola, Andras; Harmos, Ferenc; Kovalszky, Ilona; Szabo, Dora; Knappe, Daniel; Hoffmann, Ralf; Cassone, Marco; Wade, John D.; Bonomo, Robert A.; Otvos, Laszlo


    Objectives The designer antibacterial peptide A3-APO is efficacious in mouse models of Escherichia coli and Acinetobacter baumannii systemic infections. Here we compare the efficacy of the peptide with that of imipenem and colistin in A. baumannii wound infections after burn injury. Methods CD-1 mice were inflicted with burn wounds and different inocula of A. baumannii, isolated from an injured soldier, were placed into the wound sites. The antibiotics were given intramuscularly (im) one to five times. Available free peptide in the blood and the systemic toxicity of colistin and A3-APO were studied in healthy mice. Results While toxicity of colistin was observed at 25 mg/kg bolus drug administration, the lowest toxic dose of A3-APO was 75 mg/kg. In the A. baumannii blast injury models, 5 mg/kg A3-APO improved survival and reduced bacterial counts in the blood as well as in the wounds and improved wound appearance significantly better than any other antibiotic treatment. The free peptide concentration in the blood did not reach 1 µg/mL. Conclusions Peptide A3-APO, with an intramuscular therapeutic index of 15, is more efficacious and less toxic than any existing burn injury infection therapy modality against multidrug-resistant Gram-negative pathogens. A3-APO administered by the im route probably binds to a biopolymer that promotes the peptide's biodistribution. PMID:20810424

  18. Synergistic effect of Myrtus communis L. essential oils and conventional antibiotics against multi-drug resistant Acinetobacter baumannii wound isolates.


    Aleksic, Verica; Mimica-Dukic, Neda; Simin, Natasa; Nedeljkovic, Natasa Stankovic; Knezevic, Petar


    Acinetobacter baumannii is a rapidly emerging, highly resistant clinical pathogen with increasing prevalence. In recent years, the limited number of antimicrobial agents available for treatment of infections with multi-drug resistant (MDR) strains reinforced tendency for discovery of novel antimicrobial agents or treatment strategies. The aim of the study was to determine antimicrobial effectiveness of three Myrtus communis L. essential oils, both alone and in combination with conventional antibiotics, against MDR A. baumannii wound isolates. The results obtained highlighted the occurrence of good antibacterial effect of myrtle oils when administered alone. Using checkerboard method, the combinations of subinhibitory concentrations of myrtle essential oils and conventional antibiotics, i.e. polymixin B and ciprofloxacine were examined. The results proved synergism among M. communis L. essential oils and both antibiotics against MDR A. baumannii wound isolates, with a FIC index under or equal 0.50. Combination of subinhibitory concentrations of essential oils and ciprofloxacin most frequently reduced bacterial growth in synergistic manner. The similar has been shown for combination with polymyxin B; furthermore, the myrtle essential oil resulted in re-sensitization of the MDR wound isolates, i.e. MICs used in combination were below the cut off for the sensitivity to the antibiotic. Time-kill curve method confirmed efficacy of myrtle essential oil and polymyxin B combination, with complete reduction of bacterial count after 6h. The detected synergy offers an opportunity for future development of treatment strategies for potentially lethal wound infections caused by MDR A. baumannii.

  19. Association between mutations in gyrA and parC genes of Acinetobacter baumannii clinical isolates and ciprofloxacin resistance

    PubMed Central

    Ardebili, Abdollah; Lari, Abdolaziz Rastegar; Beheshti, Maryam; Lari, Elnaz Rastegar


    Objective(s): We investigated the contribution of gyrA and parC mutational mechanism in decreased ciprofloxacin susceptibility of Acinetobacter baumannii isolated from burn wound infections. Materials and Methods: Ciprofloxacin susceptibility of 50 A. baumannii isolates was evaluated by disk diffusion and agar dilution methods. PCR and sequencing were performed for detection of mutation in gyrA and parC genes. Results: The 44 and 4 isolates of A. baumannii exhibited full and intermediate-resistant to ciprofloxacin, respectively. Overall, the 42 isolates with double mutations of gyrA and parC genes showed a higher level of ciprofloxacin resistance than the 3 isolates with single mutations of gyrA or parC. Conclusion: Simultaneous mutations in gyrA and parC genes are expected to play a major role in high-level fluoroquinolone resistance in A. baumannii; albeit a single mutation in DNA topoisomerase IV could occasionally be associated with intermediate-resistance to these antimicrobials. PMID:26221488

  20. Role of Acinetobacter baumannii UmuD homologs in antibiotic resistance acquired through DNA damage-induced mutagenesis.


    Aranda, Jesús; López, Mario; Leiva, Enoy; Magán, Andrés; Adler, Ben; Bou, Germán; Barbé, Jordi


    The role of Acinetobacter baumannii ATCC 17978 UmuDC homologs A1S_0636-A1S_0637, A1S_1174-A1S_1173, and A1S_1389 (UmuDAb) in antibiotic resistance acquired through UV-induced mutagenesis was evaluated. Neither the growth rate nor the UV-related survival of any of the three mutants was significantly different from that of the wild-type parental strain. However, all mutants, and especially the umuDAb mutant, were less able to acquire resistance to rifampin and streptomycin through the activities of their error-prone DNA polymerases. Furthermore, in the A. baumannii mutant defective in the umuDAb gene, the spectrum of mutations included a dramatic reduction in the frequency of transition mutations, the mutagenic signature of the DNA polymerase V encoded by umuDC.

  1. Differentiation of Acinetobacter baumannii biotypes by amplification of 16S-23S rRNA intergenic spacer sequences.


    Garcia, A; Montoya, R; Bello, H; Gonzalez, G; Dominguez, M; Zemelman, R


    Isolates of Acinetobacter baumannii (32 strains) from blood samples obtained from patients in five Chilean hospitals were identified and biotyped according to their phenotypic properties. They were also submitted to random amplified polymorphic DNA (RAPD) using eight randomly designed 10-mers and the core sequence of M13 phage (15-mers) as well as amplification of the spacer regions between 16S and 23S genes in the prokaryotic rRNA genetic loci. With some primers, RAPD discriminated between biotypes, whereas with others each isolate showed a particular profile. When amplification of spacer regions was performed, a clear correlation between patterns and biotypes was found. This last technique allowed correct biotyping of clinical isolates. Both genetic methods might be used for the identification of A. baumannii biotypes.

  2. [Successful treatment of a patient with multidrug resistant Acinetobacter baumannii meningitis with high dose ampicillin-sulbactam].


    Sayin Kutlu, Selda; Saçar, Suzan; Süzer, Tuncer; Cevahir, Nural; Okke, Demet; Dirgen Caylak, Selmin; Turgut, Hüseyin


    Acinetobacter baumannii is an important pathogen which causes severe nosocomial infections such as meningitis. Multidrug resistance is a growing problem throughout the world. In this report a case of multidrug resistant A.baumannii meningitis, treated with high dose of ampicillin-sulbactam (SAM) was presented. Rhinorrhea and confusion developed on the postoperative seventh day in a 67 years old male patient operated for macroadenoma of the hyphophysis gland. Since the cerebrospinal fluid (CSF) findings indicated a central nervous system infection, nosocomial meningitis was diagnosed and intravenous ceftazidime and vancomycin have started. Blood and CSF cultures of the patient revealed no growth and his general condition has improved. However, fever and confusion emerged again on the 21st day of therapy and the repeat CSF sample revealed increased pressure, purulent appearance, 510/mm3 leukocytes (90% PMNL), 58 mg/dl glucose (simultaneous blood glucose was 144 mg/dl) and 49 mg/dl protein. Direct microscopic examination of CSF revealed gram-negative coccobacilli and A.baumannii was identified in the culture. The isolate was resistant to piperacillin-tazobactam, third generation cephalosporins, aztreonam, ciprofloxacin, carbapenems and aminoglycosides, susceptible to sulbactam ampicillin and colistin. Ampicillin (12 gr) and sulbactam (6 gr) treatment was initiated and at the 72nd hour of the therapy the temperature and conciousness level of the patient returned to normal. Control CSF sample obtained on the 14th day of treatment revealed no leukocytes and no bacterial growth. The treatment was continued for 21 days and the patient recovered without any sequela. Since colistin which is one of the alternative antimicrobial treatment choices for resistant Acinetobacter infections, is not found in Turkey, sulbactam-ampicillin might be an effective and safe choice for the treatment of multi-resistant A. baumannii meningitis if the isolate was proven to be susceptible by

  3. Complete Genome Sequence of the Multiresistant Acinetobacter baumannii Strain AbH12O-A2, Isolated during a Large Outbreak in Spain

    PubMed Central

    Merino, M.; Alvarez-Fraga, L.; Gómez, M. J.; Aransay, A. M.; Lavín, J. L.; Chaves, F.


    We report the complete genome sequence of Acinetobacter baumannii strain AbH12O-A2, isolated during a large outbreak in Spain. The genome has 3,875,775 bp and 3,526 coding sequences, with 39.4% G+C content. The availability of this genome will facilitate the study of the pathogenicity of the Acinetobacter species. PMID:25395646

  4. Carbapenem Resistance in Acinetobacter baumannii and Other Acinetobacter spp. Causing Neonatal Sepsis: Focus on NDM-1 and Its Linkage to ISAba125.


    Chatterjee, Somdatta; Datta, Saswati; Roy, Subhasree; Ramanan, Lavanya; Saha, Anindya; Viswanathan, Rajlakshmi; Som, Tapas; Basu, Sulagna


    Carbapenem-resistant determinants and their surrounding genetic structure were studied in Acinetobacter spp. from neonatal sepsis cases collected over 7 years at a tertiary care hospital. Acinetobacter spp. (n = 68) were identified by ARDRA followed by susceptibility tests. Oxacillinases, metallo-β-lactamases (MBLs), extended-spectrum β-lactamases and AmpCs, were detected phenotypically and/or by PCR followed by DNA sequencing. Transconjugants possessing the bla NDM-1(New Delhi metallo-β-lactamase) underwent further analysis for plasmids, integrons and associated genes. Genetic environment of the carbapenemases were studied by PCR mapping and DNA sequencing. Multivariate logistic regression was used to identify risk factors for sepsis caused by NDM-1-harboring organisms. A. baumannii (72%) was the predominant species followed by A. calcoaceticus (10%), A. lwoffii (6%), A. nosocomialis (3%), A. junni (3%), A. variabilis (3%), A. haemolyticus (2%), and 14TU (2%). Fifty six percent of the isolates were meropenem-resistant. Oxacillinases present were OXA-23-like, OXA-58-like and OXA-51-like, predominately in A. baumannii. NDM-1 was the dominant MBL (22%) across different Acinetobacter spp. Isolates harboring NDM-1 also possessed bla (VIM-2, PER-1, VEB-2, CTX-M-15), armA, aac(6')Ib, aac(6')Ib-cr genes. bla NDM-1was organized in a composite transposon between two copies of ISAba125 in the isolates irrespective of the species. Further, OXA-23-like gene and OXA-58-like genes were linked with ISAba1 and ISAba3 respectively. Isolates were clonally diverse. Integrons were variable in sequence but not associated with carbapenem resistance. Most commonly found genes in the 5' and 3'conserved segment were aminoglycoside resistance genes (aadB, aadA2, aac4'), non-enzymatic chloramphenicol resistance gene (cmlA1g) and ADP-ribosylation genes (arr2, arr3). Outborn neonates had a significantly higher incidence of sepsis due to NDM-1 harboring isolates than their inborn

  5. Carbapenem Resistance in Acinetobacter baumannii and Other Acinetobacter spp. Causing Neonatal Sepsis: Focus on NDM-1 and Its Linkage to ISAba125

    PubMed Central

    Chatterjee, Somdatta; Datta, Saswati; Roy, Subhasree; Ramanan, Lavanya; Saha, Anindya; Viswanathan, Rajlakshmi; Som, Tapas; Basu, Sulagna


    Carbapenem-resistant determinants and their surrounding genetic structure were studied in Acinetobacter spp. from neonatal sepsis cases collected over 7 years at a tertiary care hospital. Acinetobacter spp. (n = 68) were identified by ARDRA followed by susceptibility tests. Oxacillinases, metallo-β-lactamases (MBLs), extended-spectrum β-lactamases and AmpCs, were detected phenotypically and/or by PCR followed by DNA sequencing. Transconjugants possessing the blaNDM−1(New Delhi metallo-β-lactamase) underwent further analysis for plasmids, integrons and associated genes. Genetic environment of the carbapenemases were studied by PCR mapping and DNA sequencing. Multivariate logistic regression was used to identify risk factors for sepsis caused by NDM-1-harboring organisms. A. baumannii (72%) was the predominant species followed by A. calcoaceticus (10%), A. lwoffii (6%), A. nosocomialis (3%), A. junni (3%), A. variabilis (3%), A. haemolyticus (2%), and 14TU (2%). Fifty six percent of the isolates were meropenem-resistant. Oxacillinases present were OXA-23-like, OXA-58-like and OXA-51-like, predominately in A. baumannii. NDM-1 was the dominant MBL (22%) across different Acinetobacter spp. Isolates harboring NDM-1 also possessed bla(VIM−2, PER−1, VEB−2, CTX−M−15), armA, aac(6′)Ib, aac(6′)Ib-cr genes. blaNDM−1was organized in a composite transposon between two copies of ISAba125 in the isolates irrespective of the species. Further, OXA-23-like gene and OXA-58-like genes were linked with ISAba1 and ISAba3 respectively. Isolates were clonally diverse. Integrons were variable in sequence but not associated with carbapenem resistance. Most commonly found genes in the 5′ and 3′conserved segment were aminoglycoside resistance genes (aadB, aadA2, aac4′), non-enzymatic chloramphenicol resistance gene (cmlA1g) and ADP-ribosylation genes (arr2, arr3). Outborn neonates had a significantly higher incidence of sepsis due to NDM-1 harboring isolates than

  6. The genome sequence of Acinetobacter baumannii isolated