Sample records for acinetobacter calcoaceticus adp1

  1. First report of Oxa-72-producing Acinetobacter calcoaceticus in Lebanon

    PubMed Central

    Al Atrouni, A.; Kempf, M.; Eveillard, M.; Rafei, R.; Hamze, M.; Joly-Guillou, M.-L.


    Emergence of carbapenem-resistant Acinetobacter spp. has been increasingly reported worldwide. We report here the first detection of an Acinetobacter calcoaceticus isolate from vegetables in Lebanon carrying the blaOxa-72 gene. These findings show that the Lebanese environment may constitute a potential reservoir for this antibiotic resistance gene. PMID:26858838

  2. 21 CFR 866.3010 - Acinetobacter calcoaceticus serological reagents.

    Code of Federal Regulations, 2010 CFR


    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Acinetobacter calcoaceticus serological reagents. 866.3010 Section 866.3010 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents §...

  3. 21 CFR 866.3010 - Acinetobacter calcoaceticus serological reagents.

    Code of Federal Regulations, 2014 CFR


    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Acinetobacter calcoaceticus serological reagents. 866.3010 Section 866.3010 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents §...

  4. 21 CFR 866.3010 - Acinetobacter calcoaceticus serological reagents.

    Code of Federal Regulations, 2013 CFR


    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Acinetobacter calcoaceticus serological reagents. 866.3010 Section 866.3010 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents §...

  5. 21 CFR 866.3010 - Acinetobacter calcoaceticus serological reagents.

    Code of Federal Regulations, 2012 CFR


    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Acinetobacter calcoaceticus serological reagents. 866.3010 Section 866.3010 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents §...

  6. 21 CFR 866.3010 - Acinetobacter calcoaceticus serological reagents.

    Code of Federal Regulations, 2011 CFR


    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Acinetobacter calcoaceticus serological reagents. 866.3010 Section 866.3010 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents §...

  7. Surface activity of Acinetobacter calcoaceticus sp. 2CA2

    SciTech Connect

    Neufeld, R.J.; Zajic, J.E.


    The hydrocarbon metabolizing Acinetobacter calcoaceticus sp. 2CA2 reduces the surface tension of the culture broth during growth on liquid hydrocarbons. This activity, which is not evident during growth on soluble substrates, is associated with the whole cells. Removing the cells from the culture broth increases the surface tension of the liquid phase. The cells when resuspended in water result in a dramatic lowering of the surface tension. Acinetobacter sp. 2CA2 tends to partition between the two liquid phases during growth on hydrocarbons. Both the hydrocarbon bound and nonadhering cells are equally surface active. The whole cells are also able to form and stabilize kerosene-water emulsions. This ability is not related to the lowering of the liquid surface or interfacial tension, since both surface active and nonsurface active cells demonstrated the same emulsifying properties. An extracellular lipopeptide produced during growth on hydrocarbons is not surface active but effectively forms and stabilizes kerosene-water emulsions. The cells and extracellular lipopeptide are also effective in de-emulsifying surfactant stabilized test emulsions. The cells and extracellular lipopeptide are also effective in de-emulsifying surfactant stabilized test emulsions. The lipopeptide product reduced the half-life of a Tween-Span (TS) stabilized kerosene-water emulsion from 650 to 0.4 h at product concentrations of less than 1% (w/v).

  8. Genome Instability Mediates the Loss of Key Traits by Acinetobacter baylyi ADP1 during Laboratory Evolution

    PubMed Central

    Renda, Brian A.; Dasgupta, Aurko; Leon, Dacia


    Acinetobacter baylyi ADP1 has the potential to be a versatile bacterial host for synthetic biology because it is naturally transformable. To examine the genetic reliability of this desirable trait and to understand the potential stability of other engineered capabilities, we propagated ADP1 for 1,000 generations of growth in rich nutrient broth and analyzed the genetic changes that evolved by whole-genome sequencing. Substantially reduced transformability and increased cellular aggregation evolved during the experiment. New insertions of IS1236 transposable elements and IS1236-mediated deletions led to these phenotypes in most cases and were common overall among the selected mutations. We also observed a 49-kb deletion of a prophage region that removed an integration site, which has been used for genome engineering, from every evolved genome. The comparatively low rates of these three classes of mutations in lineages that were propagated with reduced selection for 7,500 generations indicate that they increase ADP1 fitness under common laboratory growth conditions. Our results suggest that eliminating transposable elements and other genetic failure modes that affect key organismal traits is essential for improving the reliability of metabolic engineering and genome editing in undomesticated microbial hosts, such as Acinetobacter baylyi ADP1. PMID:25512307

  9. Thio Wax Ester Biosynthesis Utilizing the Unspecific Bifunctional Wax Ester Synthase/Acyl Coenzyme A:Diacylglycerol Acyltransferase of Acinetobacter sp. Strain ADP1

    PubMed Central

    Uthoff, Stefan; Stöveken, Tim; Weber, Nikolaus; Vosmann, Klaus; Klein, Erika; Kalscheuer, Rainer; Steinbüchel, Alexander


    The bifunctional wax ester synthase/acyl coenzyme A (acyl-CoA):diacylglycerol acyltransferase (WS/DGAT) from Acinetobacter sp. strain ADP1 (formerly Acinetobacter calcoaceticus ADP1) mediating the biosyntheses of wax esters and triacylglycerols was used for the in vivo and in vitro biosynthesis of thio wax esters and dithio wax esters. For in vitro biosynthesis, 5′His6WS/DGAT comprising an N-terminal His6 tag was purified from the soluble protein fraction of Escherichia coli Rosetta(DE3)pLysS (pET23a::5′His6atf). By employing SP-Sepharose high-pressure and Ni-nitrilotriacetic acid fast-protein liquid chromatographies, a 19-fold enrichment with a final specific activity of 165.2 nmol mg of protein−1 min−1 was achieved by using 1-hexadecanol and palmitoyl-CoA as substrates. Incubation of purified 5′His6WS/DGAT with 1-hexadecanethiol and palmitoyl-CoA as substrates resulted in the formation of palmitic acid hexadecyl thio ester (10.4% relative specific activity of a 1-hexadecanol control). Utilization of 1,8-octanedithiol and palmitoyl-CoA as substrates led to the formation of 1-S-monopalmitoyloctanedithiol and minor amounts of 1,8-S-dipalmitoyloctanedithiol (59.3% relative specific activity of a 1-hexadecanol control). The latter dithio wax ester was efficiently produced when 1-S-monopalmitoyloctanedithiol and palmitoyl-CoA were used as substrates (13.4% specific activity relative to that of a 1-hexadecanol control). For the in vivo biosynthesis of thio wax esters, the knockout mutant Acinetobacter sp. strain ADP1acr1ΩKm, which is unable to produce fatty alcohols, was used. Cultivation of Acinetobacter sp. strain ADP1acr1ΩKm in the presence of gluconate, 1-hexadecanethiol, and oleic acid in nitrogen-limited mineral salts medium resulted in the accumulation of unusual thio wax esters that accounted for around 1.19% (wt/wt) of the cellular dry weight and consisted mainly of oleic acid hexadecyl thioester as revealed by gas chromatography-mass spectrometry

  10. Types and Prevalence of Carbapenem-Resistant Acinetobacter calcoaceticus-Acinetobacter baumannii Complex in Northern Taiwan

    PubMed Central

    Hsieh, Wen-Shyang; Wang, Nai-Yu; Feng, Jou-An; Weng, Li-Chuan


    The frequency of the carbapenem-resistant Acinetobacter calcoaceticus-Acinetobacter baumannii (CRACB) complex increases annually in our hospitals. However, the types and prevalence of carbapenemases among isolates still remain unclear. In this study, we identified and collected 672 carbapenem-resistant isolates from a medical center in Northern Taiwan between April and December of 2010. There were 577 genospecies 2 (Acinetobacter baumannii), 79 genospecies 13TU, and 16 genospecies 3 isolates. The isolates had an acquired blaOXA-24-like gene, which was confirmed by sequencing for the encoded OXA-72 carbapenemase, and were often associated with high-level carbapenem resistance. These CRACB complex isolates remained susceptible to colistin (100%). The genotyping of isolates was conducted using pulsed-field gel electrophoresis with ApaI digestion. In most clonally related groups, patients were from both branch hospitals. The results indicate that interhospital dissemination of clones occurred. This study provides updated data on the types and prevalence of the CRACB complex. In addition, it presents a warning on the emergence and spread of CRACB complex harboring blaOXA-24-like genes in northern Taiwan. PMID:24145535

  11. Unique features revealed by the genome sequence of Acinetobacter sp. ADP1, a versatile and naturally transformation competent bacterium

    PubMed Central

    Barbe, Valérie; Vallenet, David; Fonknechten, Nuria; Kreimeyer, Annett; Oztas, Sophie; Labarre, Laurent; Cruveiller, Stéphane; Robert, Catherine; Duprat, Simone; Wincker, Patrick; Ornston, L. Nicholas; Weissenbach, Jean; Marlière, Philippe; Cohen, Georges N.; Médigue, Claudine


    Acinetobacter sp. strain ADP1 is a nutritionally versatile soil bacterium closely related to representatives of the well-characterized Pseudomonas aeruginosa and Pseudomonas putida. Unlike these bacteria, the Acinetobacter ADP1 is highly competent for natural transformation which affords extraordinary convenience for genetic manipulation. The circular chromosome of the Acinetobacter ADP1, presented here, encodes 3325 predicted coding sequences, of which 60% have been classified based on sequence similarity to other documented proteins. The close evolutionary proximity of Acinetobacter and Pseudomonas species, as judged by the sequences of their 16S RNA genes and by the highest level of bidirectional best hits, contrasts with the extensive divergence in the GC content of their DNA (40 versus 62%). The chromosomes also differ significantly in size, with the Acinetobacter ADP1 chromosome <60% of the length of the Pseudomonas counterparts. Genome analysis of the Acinetobacter ADP1 revealed genes for metabolic pathways involved in utilization of a large variety of compounds. Almost all of these genes, with orthologs that are scattered in other species, are located in five major ‘islands of catabolic diversity’, now an apparent ‘archipelago of catabolic diversity’, within one-quarter of the overall genome. Acinetobacter ADP1 displays many features of other aerobic soil bacteria with metabolism oriented toward the degradation of organic compounds found in their natural habitat. A distinguishing feature of this genome is the absence of a gene corresponding to pyruvate kinase, the enzyme that generally catalyzes the terminal step in conversion of carbohydrates to pyruvate for respiration by the citric acid cycle. This finding supports the view that the cycle itself is centrally geared to the catabolic capabilities of this exceptionally versatile organism. PMID:15514110

  12. A complete collection of single-gene deletion mutants of Acinetobacter baylyi ADP1

    PubMed Central

    de Berardinis, Véronique; Vallenet, David; Castelli, Vanina; Besnard, Marielle; Pinet, Agnès; Cruaud, Corinne; Samair, Sumitta; Lechaplais, Christophe; Gyapay, Gabor; Richez, Céline; Durot, Maxime; Kreimeyer, Annett; Le Fèvre, François; Schächter, Vincent; Pezo, Valérie; Döring, Volker; Scarpelli, Claude; Médigue, Claudine; Cohen, Georges N; Marlière, Philippe; Salanoubat, Marcel; Weissenbach, Jean


    We have constructed a collection of single-gene deletion mutants for all dispensable genes of the soil bacterium Acinetobacter baylyi ADP1. A total of 2594 deletion mutants were obtained, whereas 499 (16%) were not, and are therefore candidate essential genes for life on minimal medium. This essentiality data set is 88% consistent with the Escherichia coli data set inferred from the Keio mutant collection profiled for growth on minimal medium, while 80% of the orthologous genes described as essential in Pseudomonas aeruginosa are also essential in ADP1. Several strategies were undertaken to investigate ADP1 metabolism by (1) searching for discrepancies between our essentiality data and current metabolic knowledge, (2) comparing this essentiality data set to those from other organisms, (3) systematic phenotyping of the mutant collection on a variety of carbon sources (quinate, 2-3 butanediol, glucose, etc.). This collection provides a new resource for the study of gene function by forward and reverse genetic approaches and constitutes a robust experimental data source for systems biology approaches. PMID:18319726

  13. Natural transformation and availability of transforming DNA to Acinetobacter calcoaceticus in soil microcosms.

    PubMed Central

    Nielsen, K M; van Weerelt, M D; Berg, T N; Bones, A M; Hagler, A N; van Elsas, J D


    A small microcosm, based on optimized in vitro transformation conditions, was used to study the ecological factors affecting the transformation of Acinetobacter calcoaceticus BD413 in soil. The transforming DNA used was A. calcoaceticus homologous chromosomal DNA with an inserted gene cassette containing a kanamycin resistance gene, nptII. The effects of soil type (silt loam or loamy sand), bacterial cell density, time of residence of A. calcoaceticus or of DNA in soil before transformation, transformation period, and nutrient input were investigated. There were clear inhibitory effects of the soil matrix on transformation and DNA availability. A. calcoaceticus cells reached stationary phase and lost the ability to be transformed shortly after introduction into sterile soil. The use of an initially small number of A. calcoaceticus cells and nutrients, resulting in bacterial growth, enhanced transformation frequencies within a limited period. The availability of introduced DNA for transformation of A. calcoaceticus cells disappeared within a few hours in soil. Differences in transformation frequencies between soils were found; A. calcoaceticus cells were transformed at a higher rate and for a longer period in a silt loam than in a loamy sand. Physical separation of DNA and A. calcoaceticus cells had a negative effect on transformation. Transformation was also detected in nonsterile soil microcosms, albeit only in the presence of added nutrients and at a reduced frequency. These results suggest that chromosomal DNA released into soil rapidly becomes unavailable for transformation of A. calcoaceticus. In addition, strain BD413 quickly loses the ability to receive, stabilize, and/or express exogenous DNA after introduction into soil. PMID:9143126

  14. Acinetobacter seifertii sp. nov., a member of the Acinetobacter calcoaceticus-Acinetobacter baumannii complex isolated from human clinical specimens.


    Nemec, Alexandr; Krizova, Lenka; Maixnerova, Martina; Sedo, Ondrej; Brisse, Sylvain; Higgins, Paul G


    This study aimed to define the taxonomic status of a phenetically distinct group of 16 strains that corresponds to Acinetobacter genomic species 'close to 13TU', a provisional genomic species of the Acinetobacter calcoaceticus-Acinetobacter baumannii (ACB) complex recognized by Gerner-Smidt and Tjernberg in 1993. These strains have been isolated in different countries since the early 1990s and were mostly recovered from human clinical specimens. They were compared with 45 reference strains representing the known taxa of the ACB complex using taxonomic methods relevant to the genus Acinetobacter. Based on sequence analysis of the concatenated partial sequences (2976 bp) of seven housekeeping genes, the 16 strains formed a tight and well-supported cluster (intracluster sequence identity of ≥98.4 %) that was clearly separated from the other members of the ACB complex (≤94.7 %). The species status of the group was supported by average nucleotide identity values of ≤91.7 % between the whole genome sequence of representative strain NIPH 973(T) (NCBI accession no. APOO00000000) and those of the other species. In addition, whole-cell matrix-assisted laser desorption ionization-time-of-flight (MALDI-TOF) MS analyses indicated the distinctness of the group at the protein level. Metabolic and physiological tests revealed several typical features of the group, although they did not allow its reliable differentiation from the other members of the ACB complex. We conclude that the 16 strains represent a distinct novel species, for which we propose the name Acinetobacter seifertii sp. nov. The type strain is NIPH 973(T) ( = CIP 110471(T) = CCUG 34785(T) = CCM 8535(T)). PMID:25563912

  15. Biosurfactants from Acinetobacter calcoaceticus BU03 enhance the solubility and biodegradation of phenanthrene.


    Zhao, Zhenyong; Wong, Jonathan W C


    A thermophilic bacterial strain, Acinetobacter calcoaceticus BU03, with a biosurfactant-producing capability, was isolated from petroleum-contaminated soil with an improved procedure which employed the solubilization of polycyclic aromatic hydrocarbons (PAHs), i.e. naphthalene in agar plate, as a selection criterion. Crude biosurfactant was recovered from the culture of BU03 by extraction with n-hexane, and its properties were investigated. Biosurfactants from A. calcoaceticus BU03 constitute a thermo-stable mixture, composed of different agents with surface activities. At their critical micelle concentration (CMC) of 152.4 mg L(-1), the crude biosurfactants produced from A. calcoaceticus BU03 decreased the air-water surface tension to 38.4 mN m(-1). In thermophilic conditions, the emulsifying activity is 2.8 times that of Tween 80. The effects of the biosurfactants produced by A. calcoaceticus on the solubility and biodegradation of PAHs were investigated in batch systems. Biosurfactants produced by A. calcoaceticus BU03 at 25 times their CMC significantly increased the apparent aqueous solubility of phenanthrene (PHE), pyrene (PYR) and benzo(a)pyrene (B[a]P) to 54.3, 6.33 and 2.08 mg L(-1), respectively. In aqueous system, the biosurfactants at concentrations of 0.5 CMC and 1 CMC slightly enhanced the biodegradation of PHE by a consortium of PAH-degrading microrganisms. Results indicate that biosurfactants from A. calcoaceticus BU03 have potential to enhance the removal of PAHs from contaminated sites. PMID:19438062

  16. Isolation and Characterization of Fipronil Degrading Acinetobacter calcoaceticus and Acinetobacter oleivorans from Rhizospheric Zone of Zea mays.


    Uniyal, Shivani; Paliwal, Rashmi; Verma, Megha; Sharma, R K; Rai, J P N


    An enrichment culture technique was used for the isolation of bacteria capable of utilizing fipronil as a sole source of carbon and energy. Based on morphological, biochemical characteristics and phylogenetic analysis of 16S rRNA sequence, the bacterial strains were identified as Acinetobacter calcoaceticus and Acinetobacter oleivorans. Biodegradation experiments were conducted in loamy sand soil samples fortified with fipronil (50 µg kg(-1)) and inoculated with Acinetobacter sp. cells (45 × 10(7) CFU mL(-1)) for 90 days. Soil samples were periodically analyzed by gas liquid chromatography equipped with electron capture detector. Biodegradation of fipronil fitted well with the pseudo first-order kinetics, with rate constant value between 0.041 and 0.051 days(-1). In pot experiments, fipronil and its metabolites fipronil sulfide, fipronil sulfone and fipronil amide were found below quantifiable limit in soil and root, shoot and leaves of Zea mays. These results demonstrated that A. calcoaceticus and A. oleivorans may serve as promising strains in the bioremediation of fipronil-contaminated soils. PMID:27084098

  17. Biodegradation of Phenol by Bacteria Strain Acinetobacter Calcoaceticus PA Isolated from Phenolic Wastewater

    PubMed Central

    Liu, Zhenghui; Xie, Wenyu; Li, Dehao; Peng, Yang; Li, Zesheng; Liu, Shusi


    A phenol-degrading bacterium strain PA was successfully isolated from the effluent of petrochemical wastewater. Based on its morphological, physiological and biochemical characteristics, the strain PA was characterized as a Gram-negative, strictly aerobic, nonmotile and short rod-shaped bacterium that utilizes phenol as a sole carbon and energy source. 16S rDNA sequence analysis revealed that this strain is affiliated to Acinetobacter calcoaceticus in the group of Gammaproteobacteria. The strain was efficient in removing 91.6% of the initial 800 mg∙L−1 phenol within 48 h, and had a tolerance of phenol concentration as high as 1700 mg∙L−1. These results indicated that A. calcoaceticus possesses a promising potential in treating phenolic wastewater. PMID:27005648

  18. Role for emulsan in growth of Acinetobacter calcoaceticus RAG-1 on crude oil

    SciTech Connect

    Pines, O.; Gutnick, D.


    When Acinetobacter calcoaceticus RAG-1 was grown together with an emulsan-deficient mutant on crude oil, only the emulsan-producing RAG-1 was found to grow, regardless of whether the medium was supplemented with emulsan. The results suggested that the cell-associated form of the bioemulsifier is the biologically active species required for growth on crude oil. A revertant of an emulsan-deficient strain was isolated which simultaneously regained the ability to produce both cell-associated and cell-free emulsan as well as the ability to grow on crude oil.

  19. RT-PCR and statistical analyses of adeABC expression in clinical isolates of Acinetobacter calcoaceticus-Acinetobacter baumannii complex.


    Ruzin, Alexey; Immermann, Frederick W; Bradford, Patricia A


    The relationship between expression of adeABC and minimal inhibitory concentration (MIC) of tigecycline was investigated by RT-PCR and statistical analyses in a population of 106 clinical isolates (MIC range, 0.0313-16 microg/ml) of Acinetobacter calcoaceticus-Acinetobacter baumannii complex. There was a statistically significant linear relationship (p < 0.0001) between log-transformed expression values and log-transformed MIC values, indicating that overexpression of AdeABC efflux pump is a prevalent mechanism for decreased susceptibility to tigecycline in A. calcoaceticus-A. baumannii complex. PMID:20438348

  20. Characterization of affinity-purified isoforms of Acinetobacter calcoaceticus Y1 glutathione transferases.


    Chee, Chin-Soon; Tan, Irene Kit-Ping; Alias, Zazali


    Glutathione transferases (GST) were purified from locally isolated bacteria, Acinetobacter calcoaceticus Y1, by glutathione-affinity chromatography and anion exchange, and their substrate specificities were investigated. SDS-polyacrylamide gel electrophoresis revealed that the purified GST resolved into a single band with a molecular weight (MW) of 23 kDa. 2-dimensional (2-D) gel electrophoresis showed the presence of two isoforms, GST1 (pI 4.5) and GST2 (pI 6.2) with identical MW. GST1 was reactive towards ethacrynic acid, hydrogen peroxide, 1-chloro-2,4-dinitrobenzene, and trans,trans-hepta-2,4-dienal while GST2 was active towards all substrates except hydrogen peroxide. This demonstrated that GST1 possessed peroxidase activity which was absent in GST2. This study also showed that only GST2 was able to conjugate GSH to isoproturon, a herbicide. GST1 and GST2 were suggested to be similar to F0KLY9 (putative glutathione S-transferase) and F0KKB0 (glutathione S-transferase III) of Acinetobacter calcoaceticus strain PHEA-2, respectively. PMID:24892084

  1. Characterization of Affinity-Purified Isoforms of Acinetobacter calcoaceticus Y1 Glutathione Transferases

    PubMed Central

    Chee, Chin-Soon; Tan, Irene Kit-Ping; Alias, Zazali


    Glutathione transferases (GST) were purified from locally isolated bacteria, Acinetobacter calcoaceticus Y1, by glutathione-affinity chromatography and anion exchange, and their substrate specificities were investigated. SDS-polyacrylamide gel electrophoresis revealed that the purified GST resolved into a single band with a molecular weight (MW) of 23 kDa. 2-dimensional (2-D) gel electrophoresis showed the presence of two isoforms, GST1 (pI 4.5) and GST2 (pI 6.2) with identical MW. GST1 was reactive towards ethacrynic acid, hydrogen peroxide, 1-chloro-2,4-dinitrobenzene, and trans,trans-hepta-2,4-dienal while GST2 was active towards all substrates except hydrogen peroxide. This demonstrated that GST1 possessed peroxidase activity which was absent in GST2. This study also showed that only GST2 was able to conjugate GSH to isoproturon, a herbicide. GST1 and GST2 were suggested to be similar to F0KLY9 (putative glutathione S-transferase) and F0KKB0 (glutathione S-transferase III) of Acinetobacter calcoaceticus strain PHEA-2, respectively. PMID:24892084

  2. Draft Genome Sequence of Acinetobacter calcoaceticus Strain P23, a Plant Growth-Promoting Bacterium of Duckweed

    PubMed Central

    Hosoyama, Akira; Yamazoe, Atsushi; Morikawa, Masaaki


    Acinetobacter calcoaceticus strain P23 is a plant growth-promoting bacterium, which was isolated from the surface of duckweed. We report here the draft genome sequence of strain P23. The genome data will serve as a valuable reference for understanding the molecular mechanism of plant growth promotion in aquatic plants. PMID:25720680

  3. Draft Genome Sequence of Acinetobacter calcoaceticus Strain P23, a Plant Growth-Promoting Bacterium of Duckweed.


    Sugawara, Masayuki; Hosoyama, Akira; Yamazoe, Atsushi; Morikawa, Masaaki


    Acinetobacter calcoaceticus strain P23 is a plant growth-promoting bacterium, which was isolated from the surface of duckweed. We report here the draft genome sequence of strain P23. The genome data will serve as a valuable reference for understanding the molecular mechanism of plant growth promotion in aquatic plants. PMID:25720680


    Technology Transfer Automated Retrieval System (TEKTRAN)

    We evaluated the utility of Bacti-Swab NPG Modified Stuart's medium (Remel)in maintaining viable Gram negative (Acinetobacter calcoaceticus) and Gram positive bacteria (Streptococcus iniae and S. agalactiae) for up to 10 days. In the first experiment, qualitative assessment of the viability of S. i...

  5. Utilization of short chain monocarboxylic acids in an effluent of petrochemical industry by Acinetobacter calcoaceticus

    SciTech Connect

    Du Preez, J.C.; Toerien, D.F.


    The aqueous effluent generated by the Fischer-Tropsch process, containing a total of 13 g/L C/sub 2/-C/sub 5/ monocarboxylic acids, was investigated as a potential substrate for the production of single-cell protein (SCP). A bacterial isolate, Acinetobacter calcoaceticus, could utilize all the acids in the effluent simultaneously in chemostat cultures, and no residual acids were detected in the culture below a dilution rate of 0.78 h/sup -1/. The critical dilution rate was 1.04 h/sup -1/. The maintenance energy requirement of the cells growing on the monocarboxylic acid mixture was considerably lower than that of cells growing on acetate as the sole carbon source. Enrichment of the effluent with ethanol to increase the biomass concentration was successful and still allowed the simultaneous and efficient utilization of all the carbon sources, but resulted in a decrease of the critical dilution rate by ca. 20%.

  6. Specific binding of a bacteriophage at a hydrocarbon-water interface. [Acinetobacter calcoaceticus

    SciTech Connect

    Pines, O.; Gutnick, D.


    Emulsan, the extracellular polyanionic emulsifying agent produced by Acinetobacter calcoaceticus RAG-1, has been implicated as a receptor for a specific virulent RAG-1 bacteriophage, ap3. Aqueous solutions of emulsan did not interfere with phage ap3 adsorption to RAG-1 cells. However, binding of phage ap3 occurred at the interfaces of hexadecane-in-water emulsions specifically stabilized by emulsan polymers. Binding of ap3 to emulsions was inhibited either in the presence of anti-emulsan antibodies or in the presence of a specific emulsan depolymerase. Moreover, when the phage was first bound to emulsan-stabilized emulsions and the emulsions subsequently treated with emulsan depolymerase, viable phage was released, indicating that phage ap3 DNA ejection was not triggered by binding. The results indicate that emulsan functions as the ap3 receptor and suggest that to function as a receptor, emulsan assumes a specific conformation conferred on it by its specific interaction with hydrophobic surfaces.

  7. Acinetobacter strains IH9 and OCI1, two rhizospheric phosphate solubilizing isolates able to promote plant growth, constitute a new genomovar of Acinetobacter calcoaceticus.


    Peix, Alvaro; Lang, Elke; Verbarg, Susanne; Spröer, Cathrin; Rivas, Raúl; Santa-Regina, Ignacio; Mateos, Pedro F; Martínez-Molina, Eustoquio; Rodríguez-Barrueco, Claudino; Velázquez, Encarna


    During a screening of phosphate solubilizing bacteria (PSB) in agricultural soils, two strains, IH9 and OCI1, were isolated from the rhizosphere of grasses in Spain, and they showed a high ability to solubilize phosphate in vitro. Inoculation experiments in chickpea and barley were conducted with both strains and the results demonstrated their ability to promote plant growth. The 16S rRNA gene sequences of these strains were nearly identical to each other and to those of Acinetobacter calcoaceticus DSM 30006(T), as well as the strain CIP 70.29 representing genomospecies 3. Their phenotypic characteristics also coincided with those of strains forming the A. calcoaceticus-baumannii complex. They differed from A. calcoaceticus in the utilization of l-tartrate as a carbon source and from genomospecies 3 in the use of d-asparagine as a carbon source. The 16S-23S intergenic spacer (ITS) sequences of the two isolates showed nearly 98% identities to those of A. calcoaceticus, confirming that they belong to this phylogenetic group. However, the isolates appeared as a separate branch from the A. calcoaceticus sequences, indicating their molecular separation from other A. calcoaceticus strains. The analysis of three housekeeping genes, recA, rpoD and gyrB, confirmed that IH9 and OCI1 form a distinct lineage within A. calcoaceticus. These results were congruent with those from DNA-DNA hybridization, indicating that strains IH9 and OCI1 constitute a new genomovar for which we propose the name A. calcoaceticus genomovar rhizosphaerae. PMID:19467815

  8. Role of Thin Fimbriae in Adherence and Growth of Acinetobacter calcoaceticus RAG-1 on Hexadecane.


    Rosenberg, M; Bayer, E A; Delarea, J; Rosenberg, E


    Acinetobacter calcoaceticus RAG-1, a hydrocarbon-degrading bacterium which adheres avidly to hydrocarbons and other hydrophobic surfaces, possesses numerous thin fimbriae (ca. 3.5-nm diameter) on the cell surface. MR-481, a nonadherent mutant of RAG-1 which is unable to grow on hexadecane under conditions of limited emulsification and low initial cell density, lacks these fimbriae. Prolonged incubation of MR-481 in hexadecane medium enriched for partial adherence revertants. The reappearance of thin fimbriae was observed in all such revertant strains. RAG-1 cells and partial revertant strains were agglutinated in the presence of antibody, whereas MR-481 cells were not. Another mutant, AB15, which was previously isolated on the basis of its nonagglutinability in the presence of antibody, also lacked thin fimbriae and was conditionally nonadherent. Furthermore, strain AB15 was unable to grow on hexadecane medium. Adherence of RAG-1 cells to hexadecane was considerably reduced after shearing treatment. The material removed from the cell surface by shearing of RAG-1 and the partial revertant strains yielded a single antigenic band in RAG-1 and partial revertant strains, as observed by crossed immunoelectrophoresis. This band was absent in both fimbriae-less mutants, MR-481 and AB15. The data demonstrate that the thin fimbriae of RAG-1 (i) are a major factor in adherence to polystyrene and hydrocarbon, (ii) may be crucial in enabling growth of cells on hexadecane, and (iii) constitute the major cell surface agglutinogen. PMID:16346118

  9. Immunochemical identification of the major cell surface agglutinogen of Acinetobacter calcoaceticus RAG-92.


    Bayer, E A; Skutelsky, E; Goldman, S; Rosenberg, E; Gutnick, D L


    The immunochemical and immunocytochemical characteristics of three Acinetobacter calcoaceticus RAG strains were compared in order to clarify the relationship between antibody-induced agglutination and the production of polyanionic extracellular emulsifier (termed emulsan). In addition to the parent, RAG-92, two mutant strains were examined: (1) a non-agglutinating emulsan-producer (AB15), and (2) an agglutinating mutant (16TLU) defective in the production of emulsan. A combined genetic-immunochemical approach was employed. This included the comparison of crossed immunoelectrophoresis patterns of parent and mutant supernates and the effect of absorption of anti-whole cell antiserum with mutant cells. In addition, agglutinability and competition studies were performed as well as electron microscopic cytochemistry. The results demonstrated that three major antigenic components were associated with the cell surface and the supernate. Mutant cells were altered both in their cell surface properties and in their extracellular products. One antigenic component, termed component C3, was the major cell surface agglutinogen; this component was absent in non-agglutinating mutants. Component C3 may be identical with or attached to the 300 nm projections on the parent cell surface, but it is not directly related to the presence of emulsan. It appears that emulsan plays little or no role in the phenomenon of antibody-induced agglutination of this organism. PMID:6688443

  10. Role of Thin Fimbriae in Adherence and Growth of Acinetobacter calcoaceticus RAG-1 on Hexadecane

    PubMed Central

    Rosenberg, Mel; Bayer, Edward A.; Delarea, Jacob; Rosenberg, Eugene


    Acinetobacter calcoaceticus RAG-1, a hydrocarbon-degrading bacterium which adheres avidly to hydrocarbons and other hydrophobic surfaces, possesses numerous thin fimbriae (ca. 3.5-nm diameter) on the cell surface. MR-481, a nonadherent mutant of RAG-1 which is unable to grow on hexadecane under conditions of limited emulsification and low initial cell density, lacks these fimbriae. Prolonged incubation of MR-481 in hexadecane medium enriched for partial adherence revertants. The reappearance of thin fimbriae was observed in all such revertant strains. RAG-1 cells and partial revertant strains were agglutinated in the presence of antibody, whereas MR-481 cells were not. Another mutant, AB15, which was previously isolated on the basis of its nonagglutinability in the presence of antibody, also lacked thin fimbriae and was conditionally nonadherent. Furthermore, strain AB15 was unable to grow on hexadecane medium. Adherence of RAG-1 cells to hexadecane was considerably reduced after shearing treatment. The material removed from the cell surface by shearing of RAG-1 and the partial revertant strains yielded a single antigenic band in RAG-1 and partial revertant strains, as observed by crossed immunoelectrophoresis. This band was absent in both fimbriae-less mutants, MR-481 and AB15. The data demonstrate that the thin fimbriae of RAG-1 (i) are a major factor in adherence to polystyrene and hydrocarbon, (ii) may be crucial in enabling growth of cells on hexadecane, and (iii) constitute the major cell surface agglutinogen. Images PMID:16346118

  11. Production and Secretion of the Polysaccharide Biodispersan of Acinetobacter calcoaceticus A2 in Protein Secretion Mutants.


    Elkeles, A; Rosenberg, E; Ron, E Z


    Biodispersan is an extracellular anionic polysaccharide produced by Acinetobacter calcoaceticus A2 that changes the surface properties of limestone and acts both as a dispersant and as a grinding aid (E. Rosenberg, C. Rubinovitz, A. Gottlieb, S. Rosenhak, and E. Z. Ron, Appl. Environ. Microbiol. 54:317-322, 1988; E. Rosenberg, C. Rubinovitz, R. Legmann, and E. Z. Ron, Appl. Environ. Microbiol. 54:323-326, 1988; E. Rosenberg, Z. Schwartz, A. Tenenbaum, C. Rubinovitz, R. Legmann, and E. Z. Ron, J. Dispersion Sci. Technol. 10:241-250, 1989). Extracellular fluid also contains a high concentration of secreted proteins that create problems in the purification and application of biodispersan. In order to obtain preparations of biodispersan that contained smaller amounts of protein, we selected mutants of strain A2 that were defective in protein secretion. These mutants produced equal, or even higher, levels of total biodispersan compared with those of the parental strain. Moreover, although there was a significant drop in the concentration of extracellular proteins in the medium, the secretion of biodispersan was unaffected. These results suggest that secretion mutants are potentially useful for the production of extracellular polysaccharides. PMID:16349473

  12. Autoantibodies to Brain Components and Antibodies to Acinetobacter calcoaceticus Are Present in Bovine Spongiform Encephalopathy

    PubMed Central

    Tiwana, Harmale; Wilson, Clyde; Pirt, John; Cartmell, William; Ebringer, Alan


    Bovine spongiform encephalopathy (BSE) is a neurological disorder, predominantly of British cattle, which belongs to the group of transmissible spongiform encephalopathies together with Creutzfeldt-Jakob disease (CJD), kuru, and scrapie. Autoantibodies to brain neurofilaments have been previously described in patients with CJD and kuru and in sheep affected by scrapie. Spongiform-like changes have also been observed in chronic experimental allergic encephalomyelitis, at least in rabbits and guinea pigs, and in these conditions autoantibodies to myelin occur. We report here that animals with BSE have elevated levels of immunoglobulin A autoantibodies to brain components, i.e., neurofilaments (P < 0.001) and myelin (P < 0.001), as well as to Acinetobacter calcoaceticus (P < 0.001), saprophytic microbes found in soil which have sequences cross-reacting with bovine neurofilaments and myelin, but there were no antibody elevations against Agrobacterium tumefaciens or Escherichia coli. The relevance of such mucosal autoantibodies or antibacterial antibodies to the pathology of BSE and its possible link to prions requires further evaluation. PMID:10569779

  13. Purification and properties of L-mandelate dehydrogenase and comparison with other membrane-bound dehydrogenases from Acinetobacter calcoaceticus.


    Hoey, M E; Allison, N; Scott, A J; Fewson, C A


    L-Mandelate dehydrogenase was purified from Acinetobacter calcoaceticus by Triton X-100 extraction from a 'wall + membrane' fraction, ion-exchange chromatography on DEAE-Sephacel, (NH4)2SO4 fractionation and gel filtration followed by further ion-exchange chromatography. The purified enzyme was partially characterized with respect to its subunit Mr (44,000), pH optimum (7.5), pI value (4.2), substrate specificity and susceptibility to various potential inhibitors including thiol-blocking reagents. FMN was identified as the non-covalently bound cofactor. The properties of L-mandelate dehydrogenase are compared with those of D-mandelate dehydrogenase, D-lactate dehydrogenase and L-lactate dehydrogenase from A. calcoaceticus. PMID:3325042

  14. Purification and properties of L-mandelate dehydrogenase and comparison with other membrane-bound dehydrogenases from Acinetobacter calcoaceticus.

    PubMed Central

    Hoey, M E; Allison, N; Scott, A J; Fewson, C A


    L-Mandelate dehydrogenase was purified from Acinetobacter calcoaceticus by Triton X-100 extraction from a 'wall + membrane' fraction, ion-exchange chromatography on DEAE-Sephacel, (NH4)2SO4 fractionation and gel filtration followed by further ion-exchange chromatography. The purified enzyme was partially characterized with respect to its subunit Mr (44,000), pH optimum (7.5), pI value (4.2), substrate specificity and susceptibility to various potential inhibitors including thiol-blocking reagents. FMN was identified as the non-covalently bound cofactor. The properties of L-mandelate dehydrogenase are compared with those of D-mandelate dehydrogenase, D-lactate dehydrogenase and L-lactate dehydrogenase from A. calcoaceticus. PMID:3325042

  15. Expression, purification and reconstitution of the 4-hydroxybenzoate transporter PcaK from Acinetobacter sp. ADP1

    PubMed Central

    Pernstich, Christian; Senior, Laura; MacInnes, Katherine A.; Forsaith, Marc; Curnow, Paul


    The aromatic acid:H+ symporter family of integral membrane proteins play an important role in the microbial metabolism of aromatic compounds. Here, we show that the 4-hydroxybenzoate transporter from Acinetobacter sp. ADP1, PcaK, can be successfully overexpressed in Escherichia coli and purified by affinity chromatography. Affinity-purified PcaK is a stable, monodisperse homotrimer in the detergent n-dodecyl-β-d-maltopyranoside supplemented with cholesteryl hemisuccinate. The purified protein has α-helical secondary structure and can be reconstituted to a functional state in synthetic proteoliposomes. Asymmetric substrate transport was observed when proteoliposomes were energized by applying an electrochemical proton gradient (Δμ‾H+) or a membrane potential (ΔΨ) but not by ΔpH alone. PcaK was selective in transporting 4-hydroxybenzoate and 3,4-dihydroxybenzoate over closely related compounds, confirming previous reports on substrate specificity. However, PcaK also showed an unexpected preference for transporting 2-hydroxybenzoates. These results provide the basis for further detailed studies of the structure and function of this family of transporters. PMID:24907408

  16. Genotypic and Phenotypic Correlations of Multidrug-Resistant Acinetobacter baumannii-A. calcoaceticus Complex Strains Isolated from Patients at the National Naval Medical Center

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Acinetobacter baumannii-calcoaceticus complex (ABC) infections have complicated the care of U.S. combat casualties. In this study, 102 ABC isolates from wounded soldiers treated at National Naval Medical Center (NNMC) were characterized by phenotype and genotype to identify clones in this population...

  17. Characterization of carbapenem-resistant Acinetobacter calcoaceticus-baumannii complex isolates from nosocomial bloodstream infections in southern Iran.


    Pourabbas, Bahman; Firouzi, Roya; Pouladfar, Gholamreza


    Acinetobacter baumannii is an important opportunistic bacterial pathogen responsible for serious infections in hospitalized patients. From a total of 78 consecutive non-repetitive Acinetobacter spp. isolates from patients with blood infections, 61 were carbapenem resistant, which were positive for blaOXA-51-like (96.7%), blaOXA-23-like (77 %), blaOXA-58-like (8.1%) and blaOXA-40-like genes (32.8%) by multiplex PCR. The isolates were identified as A. baumannii (n = 59) and Acinetobacter nosocomialis (n = 2). Also, we found a case of Acinetobacter junii, causing bacteraemia, that possessed the IMP gene. High levels of resistance were observed to fluoroquinolones, aminoglycosides, tigecycline and to the beta-lactam antibiotics, including piperacillin/tazobactam and ampicillin/sulbactam. ISAba1 was present in 96.7% of all Acinetobacter calcoaceticus-baumannii complex (Acb) isolates. Also, 33 (54.1%) and 23 (37.7%) isolates harboured ISAba1 upstream of blaOXA-23-like and blaOXA-51-like genes, respectively, though this was not observed in A. nosocomialis isolates. No relationship was observed between the presence of ISAba1 upstream of oxacillinase genes and the level of carbapenem resistance in all Acb isolates. Only two genes encoding metallo-beta-lactamase (VIM, SPM) were detected in all Acb isolates. This suggests that carbapenem resistance in blood-isolate Acb is mostly due to the presence of acquired carbapenemases. This is the first report from Iran on the identification of A. nosocomialis isolates that possess multiple oxacillinase genes and lack upstream ISAba1. PMID:26747061

  18. Evolution of regulatory genes governing biodegradation in acinetobacter calcoaceticus. Final report, 15 July 1991-31 December 1994

    SciTech Connect

    Ornston, L.N.


    The Acinetobacter calcoaceticus pca-qui-pob supraoperonic gene cluster encodes bacterial enzymes that metabolize aromatic and hydroaromatic compounds in the environment. Our investigation is directed to understanding how mutation, gene rearrangement and selection contributed to evolution of the transcriptional controls exercised over genes in the cluster. The complete nucleotide sequence of the 18 kbp gene cluster has been determined, and genetic manipulations have been used to explore mechanisms contributing to expression of the genes. The results reveal that structural gene expression is governed by complex interactions between the products of different regulatory genes some of which share common ancestry. Additional controls appear to be exercised by compartmentation of some catabolic enzymes outside the inner cell membrane. Recombination appears to have made a major contribution to the evolution of existing control mechanisms, and their maintenance may be influence by continuing recombination. Contributions of recombination to mutation and repair are under investigation as are specific molecular mechanisms underlying transcriptional controls.

  19. Epidemiological Characteristics of blaNDM-1 in Enterobacteriaceae and the Acinetobacter calcoaceticus-Acinetobacter baumannii Complex in China from 2011 to 2012

    PubMed Central

    Ou, Weimei; Cui, Lanqing; Li, Yun; Zheng, Bo; Lv, Yuan


    Objectives The study aimed to investigate the prevalence and epidemiological characteristics of blaNDM-1 (encoding New Delhi metallo-β-lactamase 1) in Enterobacteriaceae and the Acinetobacter calcoaceticus-Acinetobacter baumannii complex (ABC) in China from July 2011 to June 2012. Methods PCR was used to screen for the presence of blaNDM-1 in all organisms studied. For blaNDM-1-positive strains, 16S rRNA analysis and Analytical Profile Index (API) strips were used to identify the bacterial genus and species. The ABCs were reconfirmed by PCR detection of blaOXA-51-like. Antibiotic susceptibilities of the bacteria were assessed by determining minimum inhibitory concentration (MIC) of them using two-fold agar dilution test, as recommended by the Clinical and Laboratory Standards Institute (CLSI). Molecular typing was performed using pulsed-field gel electrophoresis (PFGE). S1 nuclease-pulsed-field gel electrophoresis (S1-PFGE) and Southern blot hybridization were conducted to ascertain the gene location of blaNDM-1. Conjugation experiments were conducted to determine the transmission of blaNDM-1-positive strains. Results Among 2,170 Enterobacteriaceae and 600 ABCs, seven Enterobacteriaceae strains and two A. calcoaceticus isolates from five different cities carried the blaNDM-1 gene. The seven Enterobacteriaceae strains comprised four Klebsiella pneumoniae, one Enterobacter cloacae, one Enterobacter aerogen and one Citrobacter freundii. All seven were non-susceptible to imipenem, meropenem or ertapenem. Two A. calcoaceticus species were resistant to imipenem and meropenem. Three K. pneumoniae showed the same PFGE profiles. The blaNDM-1 genes of eight strains were localized on plasmids, while one was chromosomal. Conclusions Compared with previous reports, the numbers and species containing the blaNDM-1 in Enterobacteriaceae have significantly increased in China. Most of them are able to disseminate the gene, which is cause for concern. Consecutive surveillance should

  20. Molecular Epidemiology and Clinical Impact of Acinetobacter calcoaceticus-baumannii Complex in a Belgian Burn Wound Center.


    De Vos, Daniel; Pirnay, Jean-Paul; Bilocq, Florence; Jennes, Serge; Verbeken, Gilbert; Rose, Thomas; Keersebilck, Elkana; Bosmans, Petra; Pieters, Thierry; Hing, Mony; Heuninckx, Walter; De Pauw, Frank; Soentjens, Patrick; Merabishvili, Maia; Deschaght, Pieter; Vaneechoutte, Mario; Bogaerts, Pierre; Glupczynski, Youri; Pot, Bruno; van der Reijden, Tanny J; Dijkshoorn, Lenie


    Multidrug resistant Acinetobacter baumannii and its closely related species A. pittii and A. nosocomialis, all members of the Acinetobacter calcoaceticus-baumannii (Acb) complex, are a major cause of hospital acquired infection. In the burn wound center of the Queen Astrid military hospital in Brussels, 48 patients were colonized or infected with Acb complex over a 52-month period. We report the molecular epidemiology of these organisms, their clinical impact and infection control measures taken. A representative set of 157 Acb complex isolates was analyzed using repetitive sequence-based PCR (rep-PCR) (DiversiLab) and a multiplex PCR targeting OXA-51-like and OXA-23-like genes. We identified 31 rep-PCR genotypes (strains). Representatives of each rep-type were identified to species by rpoB sequence analysis: 13 types to A. baumannii, 10 to A. pittii, and 3 to A. nosocomialis. It was assumed that isolates that belonged to the same rep-type also belonged to the same species. Thus, 83.4% of all isolates were identified to A. baumannii, 9.6% to A. pittii and 4.5% to A. nosocomialis. We observed 12 extensively drug resistant Acb strains (10 A. baumannii and 2 A. nosocomialis), all carbapenem-non-susceptible/colistin-susceptible and imported into the burn wound center through patients injured in North Africa. The two most prevalent rep-types 12 and 13 harbored an OXA-23-like gene. Multilocus sequence typing allocated them to clonal complex 1 corresponding to EU (international) clone I. Both strains caused consecutive outbreaks, interspersed with periods of apparent eradication. Patients infected with carbapenem resistant A. baumannii were successfully treated with colistin/rifampicin. Extensive infection control measures were required to eradicate the organisms. Acinetobacter infection and colonization was not associated with increased attributable mortality. PMID:27223476

  1. Molecular Epidemiology and Clinical Impact of Acinetobacter calcoaceticus-baumannii Complex in a Belgian Burn Wound Center

    PubMed Central

    Bilocq, Florence; Jennes, Serge; Verbeken, Gilbert; Rose, Thomas; Keersebilck, Elkana; Bosmans, Petra; Pieters, Thierry; Hing, Mony; Heuninckx, Walter; De Pauw, Frank; Soentjens, Patrick; Merabishvili, Maia; Deschaght, Pieter; Vaneechoutte, Mario; Bogaerts, Pierre; Glupczynski, Youri; Pot, Bruno; van der Reijden, Tanny J.; Dijkshoorn, Lenie


    Multidrug resistant Acinetobacter baumannii and its closely related species A. pittii and A. nosocomialis, all members of the Acinetobacter calcoaceticus-baumannii (Acb) complex, are a major cause of hospital acquired infection. In the burn wound center of the Queen Astrid military hospital in Brussels, 48 patients were colonized or infected with Acb complex over a 52-month period. We report the molecular epidemiology of these organisms, their clinical impact and infection control measures taken. A representative set of 157 Acb complex isolates was analyzed using repetitive sequence-based PCR (rep-PCR) (DiversiLab) and a multiplex PCR targeting OXA-51-like and OXA-23-like genes. We identified 31 rep-PCR genotypes (strains). Representatives of each rep-type were identified to species by rpoB sequence analysis: 13 types to A. baumannii, 10 to A. pittii, and 3 to A. nosocomialis. It was assumed that isolates that belonged to the same rep-type also belonged to the same species. Thus, 83.4% of all isolates were identified to A. baumannii, 9.6% to A. pittii and 4.5% to A. nosocomialis. We observed 12 extensively drug resistant Acb strains (10 A. baumannii and 2 A. nosocomialis), all carbapenem-non-susceptible/colistin-susceptible and imported into the burn wound center through patients injured in North Africa. The two most prevalent rep-types 12 and 13 harbored an OXA-23-like gene. Multilocus sequence typing allocated them to clonal complex 1 corresponding to EU (international) clone I. Both strains caused consecutive outbreaks, interspersed with periods of apparent eradication. Patients infected with carbapenem resistant A. baumannii were successfully treated with colistin/rifampicin. Extensive infection control measures were required to eradicate the organisms. Acinetobacter infection and colonization was not associated with increased attributable mortality. PMID:27223476

  2. The Wax Ester Synthase/Acyl Coenzyme A:Diacylglycerol Acyltransferase from Acinetobacter sp. Strain ADP1: Characterization of a Novel Type of Acyltransferase

    PubMed Central

    Stöveken, Tim; Kalscheuer, Rainer; Malkus, Ursula; Reichelt, Rudolf; Steinbüchel, Alexander


    The wax ester synthase/acyl coenzyme A (acyl-CoA):diacylglycerol acyltransferase (WS/DGAT) catalyzes the final steps in triacylglycerol (TAG) and wax ester (WE) biosynthesis in the gram-negative bacterium Acinetobacter sp. strain ADP1. It constitutes a novel class of acyltransferases which is fundamentally different from acyltransferases involved in TAG and WE synthesis in eukaryotes. The enzyme was purified by a three-step purification protocol to apparent homogeneity from the soluble fraction of recombinant Escherichia coli Rosetta (DE3)pLysS (pET23a::atfA). Purified WS/DGAT revealed a remarkably low substrate specificity, accepting a broad range of various substances as alternative acceptor molecules. Besides having DGAT and WS activity, the enzyme possesses acyl-CoA:monoacylglycerol acyltransferase (MGAT) activity. The sn-1 and sn-3 positions of acylglycerols are accepted with higher specificity than the sn-2 position. Linear alcohols ranging from ethanol to triacontanol are efficiently acylated by the enzyme, which exhibits highest specificities towards medium-chain-length alcohols. The acylation of cyclic and aromatic alcohols, such as cyclohexanol or phenylethanol, further underlines the unspecific character of this enzyme. The broad range of possible substrates may lead to biotechnological production of interesting wax ester derivatives. Determination of the native molecular weight revealed organization as a homodimer. The large number of WS/DGAT-homologous genes identified in pathogenic mycobacteria and their possible importance for the pathogenesis and latency of these bacteria makes the purified WS/DGAT from Acinetobacter sp. strain ADP1 a valuable model for studying this group of proteins in pathogenic mycobacteria. PMID:15687201

  3. Similarities between the antABC-Encoded Anthranilate Dioxygenase and the benABC-Encoded Benzoate Dioxygenase of Acinetobacter sp. Strain ADP1

    PubMed Central

    Bundy, Becky M.; Campbell, Alan L.; Neidle, Ellen L.


    Acinetobacter sp. strain ADP1 can use benzoate or anthranilate as a sole carbon source. These structurally similar compounds are independently converted to catechol, allowing further degradation to proceed via the β-ketoadipate pathway. In this study, the first step in anthranilate catabolism was characterized. A mutant unable to grow on anthranilate, ACN26, was selected. The sequence of a wild-type DNA fragment that restored growth revealed the antABC genes, encoding 54-, 19-, and 39-kDa proteins, respectively. The deduced AntABC sequences were homologous to those of class IB multicomponent aromatic ring-dihydroxylating enzymes, including the dioxygenase that initiates benzoate catabolism. Expression of antABC in Escherichia coli, a bacterium that normally does not degrade anthranilate, enabled the conversion of anthranilate to catechol. Unlike benzoate dioxygenase (BenABC), anthranilate dioxygenase (AntABC) catalyzed catechol formation without requiring a dehydrogenase. In Acinetobacter mutants, benC substituted for antC during growth on anthranilate, suggesting relatively broad substrate specificity of the BenC reductase, which transfers electrons from NADH to the terminal oxygenase. In contrast, the benAB genes did not substitute for antAB. An antA point mutation in ACN26 prevented anthranilate degradation, and this mutation was independent of a mucK mutation in the same strain that prevented exogenous muconate degradation. Anthranilate induced expression of antA, although no associated transcriptional regulators were identified. Disruption of three open reading frames in the immediate vicinity of antABC did not prevent the use of anthranilate as a sole carbon source. The antABC genes were mapped on the ADP1 chromosome and were not linked to the two known supraoperonic gene clusters involved in aromatic compound degradation. PMID:9721284

  4. Involvement of a plasmid in growth on and dispersion of crude oil by Acinetobacter calcoaceticus RA57

    SciTech Connect

    Rusansky, S.; Avigad, R.; Michaeli, S.; Gutnick, D.L.


    A crude-oil-degrading Acinetobacter species, Acinetobacter calcoaceticus RA57, was isolated by standard enrichment culture techniques on the basis of its ability to utilize the oily sludge found in the vicinity of a local gas station. Strain RA57 was found to contain four plasmids: pSR1, pSR2, pSR3, and pSR4. Both supercoiled and open circular forms of the first three plasmids were identified by two-dimensional gel electrophoresis. Restriction endonuclease analysis of pSR4 demonstrated that the plasmid contained a circular map. Colonies were isolated at random after growth in the presence of acridine orange and found to fall into two categories: (i) those which had lost the ability to grow on and disperse crude oil in liquid culture and concurrently were cured of pSR4 and (ii) those which retained the ability to both grow on and disperse crude oil and which contained pSR4. Strains from the first class continued to grow on hydrocarbon vapors, indicating that the defect associated with the curing of pSR4 was related to the physical interaction of the cells with the hydrocarbon substrate, rather than to its metabolism. No differences in either adherence to hydrocarbons or production of extracellular emulsifying activity were found between the two classes of mutants. In growth experiments on crude oil in mixed culture with strains which either contained or lacked pSR4, no sparing of the growth defect was observed. The results are consistent with the possibility that pSR4 encodes a factor(s) which is tightly associated with the cell surface.

  5. [Effect of univalent cations on synthesis of surfactants by Acinetobacter calcoaceticus IMV B-7241].


    Pirog, T P; Shevchuk, T A; Antoniuk, S I; Kravchenko, E Iu; Iutinskaia, G A


    The effect of univalent cations on activity of key enzymes of C2-metabolism has been investigated in the producer of biosurfactants, Acinetibacter calcoaceticus IMV B-7241 grown on ethanol. It was established that potassium cations are inhibitors of pyroquinolinequinone-dependent alcohol- and acetaldehyde dehydrogenases, the enzymes of biosynthesis of surface-active aminolipids (NADP-dependent glutamate dehydrogenase) and glycolipids (phosphoenopyruvate (PhEP)-carboxikinase), while ammonium cations are activators of these enzymes and PhEP-carboxylase. A decrease of potassium cations concentration in the cultivation medium to 1 mM and increase of the content of amine nitrogen to 10 mM as a result of potassium nitrate substitution by equimolar, as to nitrogen, urea concentration were accompanied by the increase of activity of enzymes of ethanol metabolism and SAS biosynthesis, as well as by the 2-fold increase of conditional concentration of the biosurfactants. PMID:23720959

  6. Characterization of lipase-deficient mutants of Acinetobacter calcoaceticus BD413: identification of a periplasmic lipase chaperone essential for the production of extracellular lipase.

    PubMed Central

    Kok, R G; van Thor, J J; Nugteren-Roodzant, I M; Vosman, B; Hellingwerf, K J


    Acinetobacter calcoaceticus BD413 produces an extracellular lipase, which is encoded by the lipA gene. Five lipase-deficient mutants have been generated via random insertion mutagenesis. Phenotypic characterization of these mutants revealed the presence of as many as four lipolytic enzymes in A. calcoaceticus. Biochemical evidence classified four of the mutants as export mutants, which presumably are defective in translocation of the lipase across the outer membrane. The additional mutant, designated AAC302, displays a LipA- phenotype, and yet the mutation in this strain was localized 0.84 kbp upstream of lipA. Sequence analysis of this region revealed an open reading frame, designated lipB, that is disrupted in AAC302. The protein encoded by this open reading frame shows extensive similarity to a chaperone-like helper protein of several pseudomonads, required for the production of extracellular lipase. Via complementation of AAC302 with a functional extrachromosomal copy of lipA, it could be determined that LipB is essential for lipase production. As shown by the use of a translational LipB-PhoA fusion construct, the C-terminal part of LipB of A. calcoaceticus BD413 is located outside the cytoplasm. Sequence analysis further strongly suggests that A. calcoaceticus LipB is N terminally anchored in the cytoplasmic membrane. Therefore, analogous to the situation in Pseudomonas species, however, lipB in A. calcoaceticus is located upstream of the structural lipase gene. lipB and lipA form a bicistronic operon, and the two genes are cotranscribed from an Escherichia coli sigma 70-type promoter. The reversed order of genes, in comparison with the situation in Pseudomonas species, suggests that LipA and LipB are produced in equimolar amounts. Therefore, the helper protein presumably does not only have a catalytic function, e.g., in folding of the lipase, but is also likely to act as a lipase-specific chaperone. A detailed model of the export route of the lipase of A

  7. Characterization of lipase-deficient mutants of Acinetobacter calcoaceticus BD413: identification of a periplasmic lipase chaperone essential for the production of extracellular lipase.


    Kok, R G; van Thor, J J; Nugteren-Roodzant, I M; Vosman, B; Hellingwerf, K J


    Acinetobacter calcoaceticus BD413 produces an extracellular lipase, which is encoded by the lipA gene. Five lipase-deficient mutants have been generated via random insertion mutagenesis. Phenotypic characterization of these mutants revealed the presence of as many as four lipolytic enzymes in A. calcoaceticus. Biochemical evidence classified four of the mutants as export mutants, which presumably are defective in translocation of the lipase across the outer membrane. The additional mutant, designated AAC302, displays a LipA- phenotype, and yet the mutation in this strain was localized 0.84 kbp upstream of lipA. Sequence analysis of this region revealed an open reading frame, designated lipB, that is disrupted in AAC302. The protein encoded by this open reading frame shows extensive similarity to a chaperone-like helper protein of several pseudomonads, required for the production of extracellular lipase. Via complementation of AAC302 with a functional extrachromosomal copy of lipA, it could be determined that LipB is essential for lipase production. As shown by the use of a translational LipB-PhoA fusion construct, the C-terminal part of LipB of A. calcoaceticus BD413 is located outside the cytoplasm. Sequence analysis further strongly suggests that A. calcoaceticus LipB is N terminally anchored in the cytoplasmic membrane. Therefore, analogous to the situation in Pseudomonas species, however, lipB in A. calcoaceticus is located upstream of the structural lipase gene. lipB and lipA form a bicistronic operon, and the two genes are cotranscribed from an Escherichia coli sigma 70-type promoter. The reversed order of genes, in comparison with the situation in Pseudomonas species, suggests that LipA and LipB are produced in equimolar amounts. Therefore, the helper protein presumably does not only have a catalytic function, e.g., in folding of the lipase, but is also likely to act as a lipase-specific chaperone. A detailed model of the export route of the lipase of A

  8. Inducer responses of BenM, a LysR-type transcriptional regulator from Acinetobacter baylyi ADP1

    SciTech Connect

    Craven, Sarah H.; Ezezika, Obidimma C.; Haddad, Sandra; Hall, Ruth A.; Momany, Cory; Neidle, Ellen L.; Georgia


    BenM and CatM control transcription of a complex regulon for aromatic compound degradation. These Acinetobacter baylyi paralogues belong to the largest family of prokaryotic transcriptional regulators, the LysR-type proteins. Whereas BenM activates transcription synergistically in response to two effectors, benzoate and cis,cis-muconate, CatM responds only to cis,cis-muconate. Here, site-directed mutagenesis was used to determine the physiological significance of an unexpected benzoate-binding pocket in BenM discovered during structural studies. Residues in BenM were changed to match those of CatM in this hydrophobic pocket. Two BenM residues, R160 and Y293, were found to mediate the response to benzoate. Additionally, alteration of these residues caused benzoate to inhibit activation by cis,cis-muconate, positioned in a separate primary effector-binding site of BenM. The location of the primary site, in an interdomain cleft, is conserved in diverse LysR-type regulators. To improve understanding of this important family, additional regulatory mutants were analysed. The atomic-level structures were characterized of the effector-binding domains of variants that do not require inducers for activation, CatM(R156H) and BenM(R156H,T157S). These structures clearly resemble those of the wild-type proteins in their activated muconate-bound complexes. Amino acid replacements that enable activation without effectors reside at protein interfaces that may impact transcription through effects on oligomerization.

  9. Iterative reconstruction of a global metabolic model of Acinetobacter baylyi ADP1 using high-throughput growth phenotype and gene essentiality data

    PubMed Central

    Durot, Maxime; Le Fèvre, François; de Berardinis, Véronique; Kreimeyer, Annett; Vallenet, David; Combe, Cyril; Smidtas, Serge; Salanoubat, Marcel; Weissenbach, Jean; Schachter, Vincent


    Background Genome-scale metabolic models are powerful tools to study global properties of metabolic networks. They provide a way to integrate various types of biological information in a single framework, providing a structured representation of available knowledge on the metabolism of the respective species. Results We reconstructed a constraint-based metabolic model of Acinetobacter baylyi ADP1, a soil bacterium of interest for environmental and biotechnological applications with large-spectrum biodegradation capabilities. Following initial reconstruction from genome annotation and the literature, we iteratively refined the model by comparing its predictions with the results of large-scale experiments: (1) high-throughput growth phenotypes of the wild-type strain on 190 distinct environments, (2) genome-wide gene essentialities from a knockout mutant library, and (3) large-scale growth phenotypes of all mutant strains on 8 minimal media. Out of 1412 predictions, 1262 were initially consistent with our experimental observations. Inconsistencies were systematically examined, leading in 65 cases to model corrections. The predictions of the final version of the model, which included three rounds of refinements, are consistent with the experimental results for (1) 91% of the wild-type growth phenotypes, (2) 94% of the gene essentiality results, and (3) 94% of the mutant growth phenotypes. To facilitate the exploitation of the metabolic model, we provide a web interface allowing online predictions and visualization of results on metabolic maps. Conclusion The iterative reconstruction procedure led to significant model improvements, showing that genome-wide mutant phenotypes on several media can significantly facilitate the transition from genome annotation to a high-quality model. PMID:18840283

  10. Plant growth-promoting bacterium Acinetobacter calcoaceticus P23 increases the chlorophyll content of the monocot Lemna minor (duckweed) and the dicot Lactuca sativa (lettuce).


    Suzuki, Wakako; Sugawara, Masayuki; Miwa, Kyoko; Morikawa, Masaaki


    Acinetobacter calcoaceticus P23 is a plant growth-promoting bacterium that was isolated from the surface of duckweed (Lemna aoukikusa). The bacterium was observed to colonize on the plant surfaces and increase the chlorophyll content of not only the monocotyledon Lemna minor but also the dicotyledon Lactuca sativa in a hydroponic culture. This effect on the Lactuca sativa was significant in nutrient-poor (×1/100 dilution of H2 medium) and not nutrient-rich (×1 or ×1/10 dilutions of H2 medium) conditions. Strain P23 has the potential to play a part in the future development of fertilizers and energy-saving hydroponic agricultural technologies. PMID:24468072

  11. [Synthesis of surfactants by Rhodococcus erythropolis IMV Ac-5017, Acinetobacter calcoaceticus IMV B-7241 and Nocardia vaccinii IMV B-7405 on industrial waste].


    Pirog, T P; Sofilkanich, A P; Pokora, K A; Shevchuk, T A; Iutinskaia, G A


    The synthesis of surfactants by Rhodococcus erythropolis IMV Ac-5017, Acinetobacter calcoaceticus IMV B-7241 and Nocardia vaccinii IMV B-7405 on industrial waste (food and oil-processing industry, production of biodiesel) was investigated. The possibility of replacing the expensive substrates (n-hexadecane and ethanol) by industrial waste (oil and fat industry, fried sunflower oil, glycerol, liquid paraffin) for the surfactant biosynthesis was established. The conditional concentration of surfactants was maximal on oil containing substrates and exceeded those on n-hexadecane and ethanol 2-3 times. The highest rates of surfactants synthesis were observed on fried sunflower oil with the use of inoculum grown on carbohydrate substrates (glucose, molasses). It was established that the addition of glucose (0.1%) was accompanied by 2-4-fold intensification of surfactants synthesis by R. erythropolis IMV Ac-5017 and N. vaccinii IMV B-7405 on fried sunflower oil (2%). PMID:25000725

  12. Acinetobacter calcoaceticus genes involved in biosynthesis of the coenzyme pyrrolo-quinoline-quinone: nucleotide sequence and expression in Escherichia coli K-12.

    PubMed Central

    Goosen, N; Horsman, H P; Huinen, R G; van de Putte, P


    Synthesis of the coenzyme pyrrolo-quinoline-quinone (PQQ) from Acinetobacter calcoaceticus requires the products of at least four different genes. In this paper we present the nucleotide sequence of a 5,085-base-pair DNA fragment containing these four genes. Within the DNA fragment three reading frames are present, coding for proteins of Mr 10,800, 29,700, and 43,600 and corresponding to three of the PQQ genes. In the DNA region where the fourth PQQ gene was mapped the largest possible reading frame encodes for a polypeptide of only 24 amino acids. Still, the expression of this region is essential for the biosynthesis of PQQ. A possible role for this DNA region is discussed. Sandwiched between two PQQ genes an additional reading frame is present, coding for a protein of Mr 33,600. This gene, which is probably transcribed in the same operon as three of the PQQ genes, seems not required for PQQ synthesis. Expression of the PQQ genes in Acinetobacter lwoffi and Escherichia coli K-12 led to the synthesis of the coenzyme in these organisms. Images PMID:2536663

  13. Insertions or Deletions (Indels) in the rrn 16S-23S rRNA Gene Internal Transcribed Spacer Region (ITS) Compromise the Typing and Identification of Strains within the Acinetobacter calcoaceticus-baumannii (Acb) Complex and Closely Related Members

    PubMed Central

    Maslunka, Christopher; Gifford, Bianca; Tucci, Joseph; Gürtler, Volker; Seviour, Robert J.


    To determine whether ITS sequences in the rrn operon are suitable for identifying individual Acinetobacter Acb complex members, we analysed length and sequence differences between multiple ITS copies within the genomes of individual strains. Length differences in ITS reported previously between A. nosocomialis BCRC15417T (615 bp) and other strains (607 bp) can be explained by presence of an insertion (indel 13i/1) in the longer ITS variant. The same Indel 13i/1 was also found in ITS sequences of ten strains of A. calcoaceticus, all 639 bp long, and the 628 bp ITS of Acinetobacter strain BENAB127. Four additional indels (13i/2–13i/5) were detected in Acinetobacter strain c/t13TU 10090 ITS length variants (608, 609, 620, 621 and 630 bp). These ITS variants appear to have resulted from horizontal gene transfer involving other Acinetobacter species or in some cases unrelated bacteria. Although some ITS copies in strain c/t13TU 10090 are of the same length (620 bp) as those in Acinetobacter strains b/n1&3, A. pittii (10 strains), A. calcoaceticus and A. oleivorans (not currently acknowledged as an Acb member), their individual ITS sequences differ. Thus ITS length by itself can not by itself be used to identify Acb complex strains. A shared indel in ITS copies in two separate Acinetobacter species compromises the specificity of ITS targeted probes, as shown with the Aun-3 probe designed to target the ITS in A. pitti. The presence of indel 13i/5 in the ITS of Acinetobacter strain c/t13TU means it too responded positively to this probe. Thus, neither ITS sequencing nor the currently available ITS targeted probes can distinguish reliably between Acb member species. PMID:25141005

  14. [Destruction of oil in the presence of Cu2+ and surfactants of Acinetobacter calcoaceticus IMV B-7241, Rhodococcus erythropolis IMV Ac-5017 and Nocardia vaccinii IMV B-7405].


    Pirog, T P; Konon, A D; Sofilkanich, A P; Shevchuk, T A; Iutinska, G O


    The effect of copper cations (0.01-1.0 mM) and surface-active agents (surfactants) of Acinetobacter calcoaceticus IMV B-7241, Rhodococcus erythropolis IMV Alc-5017 and Nocardia vaccinii IMV B-7405 in the form of culture liquid on the destruction of oil in water (3.0-6.0 g/L) and soil (20 g/kg), including in the presence of Cd2+ and Pb2+ (0.01-0.5 mM), was investigated. It was shown that the degree of oil degradation in water and soil after 20 days in the presence of low concentrations of Cu2+ (0.01-0.05 mM) and culture liquid of strains IMV B-7241, IMV Ac-5017, and IMV B-7405 was 15 - 25% higher than without copper cations. The activating effect of Cu2+ on the decomposition of complex oil and Cd2+ and Pb2+ pollution was established: after treatment with surfactant of A. calcoacelicus IMV B-7241 and R. erythropolis IMV Ac-5017 destruction of oil in water and soil was 85-95%, and after removal of the copper cations decreased to 45-70%. Intensification of oil destruction in the presence of copper cations may be due to their stimulating effect on the activity of alkane hydroxylases as in surfactant-producing strains, and natural (autochthonous) oxidizing microbiota. PMID:26036026

  15. Novel Regulator MphX Represses Activation of Phenol Hydroxylase Genes Caused by a XylR/DmpR-Type Regulator MphR in Acinetobacter calcoaceticus

    PubMed Central

    Zhan, Yuhua; Wang, Jin; Yan, Yongliang; Chen, Ming; Lu, Wei; Ping, Shuzhen; Zhang, Wei; Zhao, Zhonglin; Li, Shuying; Takeo, Masahiro; Lin, Min


    Acinetobacter calcoaceticus PHEA-2 utilizes phenol as its sole carbon and energy source and has a multi-component phenol hydroxylase-encoding gene operon (mphKLMNOP) for phenol degradation. Two additional genes, mphR and mphX, were found upstream and downstream of mphKLMNOP, respectively. The mphR gene encodes a XylR/DmpR-type regulator-like protein and is transcribed in the opposite direction to mphKLMNOP. The mphX gene is transcribed in the same direction as mphKLMNOP and encodes a protein with 293 amino acid residues showing weak identity with some unknown proteins encoded in the meta-cleavage pathway gene clusters for aromatic compound degradation. Disruption of mphR by homologous recombination resulted in the loss of phenol degradation while disruption of mphX caused significantly faster phenol degradation than in the wild type strain. Transcriptional assays for mphK, mphR, and mphX revealed that mphR activated mphKLMNOP transcription in the presence of phenol, but mphX partially repressed this activation. Gel mobility-shift assay demonstrated a direct interaction of MphR with the mphK promoter region. These results indicate the involvement of a novel repressor protein MphX in transcriptional regulation of phenol hydroxylase genes caused by a XylR/DmpR-type regulator MphR. PMID:21455294

  16. Screening and characterization of a novel alkaline lipase from Acinetobacter calcoaceticus 1-7 Isolated from bohai bay in china for detergent formulation.


    Wang, Haikuan; Zhong, Shaojiong; Ma, Huijing; Zhang, Jie; Qi, Wei


    A novel alkaline lipase-producing strain 1-7 identified as Acinetobacter calcoaceticus was isolated from soil samples collected from Bohai Bay, China, using an olive oil alkaline plate, which contained olive oil as the sole carbon source. The lipase from strain 1-7 showed the maximum activity at pH 9.0 under 40 °C. One interesting feature of this enzyme is that it exhibits lipase activity over a broad range of temperatures and good stability. It is also stable at a broad range of pHs from 4.0 to 10.0 for 24 h. Its catalytic activity was highly enhanced in the presence of Ca(2+), Mg(2+) and K(+), but partially inhibited by Cu(2+), Al(3+), Fe(3+), Ba(2+)and Zn(2+). The fact that it displays marked stability and activity in the presence of TritonX-100, Tween-20, Tween-80, SDS, Hydrogen peroxide, Sodium perborate, Sodium hypochlorite, Sodium citrate, Sodium taurocholate, Glycerine and NaCl suggests that this lipase is suitable as an additive in detergent formulations. PMID:24031813

  17. An endophytic bacterium Acinetobacter calcoaceticus Sasm3-enhanced phytoremediation of nitrate-cadmium compound polluted soil by intercropping Sedum alfredii with oilseed rape.


    Chen, Bao; Ma, Xiaoxiao; Liu, Guiqing; Xu, Xiaomeng; Pan, Fengshan; Zhang, Jie; Tian, Shengke; Feng, Ying; Yang, Xiaoe


    Intensive agricultural system with high input of fertilizer results in high agricultural output. However, excessive fertilization in intensive agricultural system has great potential to cause nitrate and heavy metal accumulation in soil, which is adverse to human health. The main objective of the present study was to observe the effects of intercropping and inoculation of endophytic bacterium Acinetobacter calcoaceticus Sasm3 on phytoremediation of combined contaminated soil in oilseed rape (Brassica napus L.). The results showed that with Sasm3 inoculation, the biomass of rape was increased by 10-20% for shoot, 64% for root, and 23-29% for seeds while the nitrate accumulation in rape was decreased by 14% in root and by 12% in shoot. The cadmium concentration in rape increased significantly with mono-inoculating treatment, whereas it decreased significantly after intercropping treatment. By denaturing gradient gel electrophoresis (DGGE) and real-time quantitative PCR analysis, the diversity of bacterial community and the number of nirS and nirK gene copies increased significantly with inoculation or/and intercropping treatment. In conclusion, the endophytic bacterium Sasm3-inoculated intercropping system not only improved the efficiency of clearing cadmium from soil without obstructing crop production, but also improved the quality of crop. PMID:26146371

  18. Nucleotide sequences of the Acinetobacter calcoaceticus benABC genes for benzoate 1,2-dioxygenase reveal evolutionary relationships among multicomponent oxygenases.

    PubMed Central

    Neidle, E L; Hartnett, C; Ornston, L N; Bairoch, A; Rekik, M; Harayama, S


    The nucleotide sequences of the Acinetobacter calcoaceticus benABC genes encoding a multicomponent oxygenase for the conversion of benzoate to a nonaromatic cis-diol were determined. The enzyme, benzoate 1,2-dioxygenase, is composed of a hydroxylase component, encoded by benAB, and an electron transfer component, encoded by benC. Comparison of the deduced amino acid sequences of BenABC with related sequences, including those for the multicomponent toluate, toluene, benzene, and naphthalene 1,2-dioxygenases, indicated that the similarly sized subunits of the hydroxylase components were derived from a common ancestor. Conserved cysteine and histidine residues may bind a [2Fe-2S] Rieske-type cluster to the alpha-subunits of all the hydroxylases. Conserved histidines and tyrosines may coordinate a mononuclear Fe(II) ion. The less conserved beta-subunits of the hydroxylases may be responsible for determining substrate specificity. Each dioxygenase had either one or two electron transfer proteins. The electron transfer component of benzoate dioxygenase, encoded by benC, and the corresponding protein of the toluate 1,2-dioxygenase, encoded by xylZ, were each found to have an N-terminal region which resembled chloroplast-type ferredoxins and a C-terminal region which resembled several oxidoreductases. These BenC and XylZ proteins had regions similar to certain monooxygenase components but did not appear to be evolutionarily related to the two-protein electron transfer systems of the benzene, toluene, and naphthalene 1,2-dioxygenases. Regions of possible NAD and flavin adenine dinucleotide binding were identified. PMID:1885518

  19. Potential DNA slippage structures acquired during evolutionary divergence of Acinetobacter calcoaceticus chromosomal benABC and Pseudomonas putida TOL pWW0 plasmid xylXYZ, genes encoding benzoate dioxygenases.

    PubMed Central

    Harayama, S; Rekik, M; Bairoch, A; Neidle, E L; Ornston, L N


    The xylXYZ DNA region is carried on the TOL pWW0 plasmid in Pseudomonas putida and encodes a benzoate dioxygenase with broad substrate specificity. The DNA sequence of the region is presented and compared with benABC, the chromosomal region encoding the benzoate dioxygenase of Acinetobacter calcoaceticus. Corresponding genes from the two biological sources share common ancestry: comparison of aligned XylX-BenA, XylY-BenB, and XylZ-BenC amino acid sequences revealed respective identities of 58.3, 61.3, and 53%. The aligned genes have diverged to assume G+C contents that differ by 14.0 to 14.9%. Usage of the unusual arginine codons AGA and AGG appears to have been selected in the P. putida xylX gene as it diverged from the ancestor it shared with A. calcoaceticus benA. Homologous A. calcoaceticus and P. putida genes exhibit different patterns of DNA sequence repetition, and analysis of one such pattern suggests that mutations creating different DNA slippage structures made a significant contribution to the evolutionary divergence of xylX. PMID:1938949

  20. Validation of use of whole-cell repetitive extragenic palindromic sequence-based PCR (REP-PCR) for typing strains belonging to the Acinetobacter calcoaceticus-Acinetobacter baumannii complex and application of the method to the investigation of a hospital outbreak.

    PubMed Central

    Snelling, A M; Gerner-Smidt, P; Hawkey, P M; Heritage, J; Parnell, P; Porter, C; Bodenham, A R; Inglis, T


    Acinetobacter spp. are being reported with increasing frequency as causes of nosocomial infection. In order to identify reservoirs of infection as quickly as possible, a rapid typing method that can differentiate epidemic strains from environmental and nonepidemic strains is needed. In 1993, a cluster of Acinetobacter baumannii isolates from five patients in the adult intensive therapy unit of our tertiary-care teaching hospital led us to develop and optimize a rapid repetitive extragenic palindromic sequence-based PCR (REP-PCR) typing protocol for members of the Acinetobacter calcoaceticus-A. baumannii complex that uses boiled colonies and consensus primers aimed at repetitive extragenic palindromic sequences. Four of the five patient isolates gave the same REP-PCR typing pattern as isolates of A. baumannii obtained from the temperature probe of a Bennett humidifier; the fifth isolate had a unique profile. Disinfection of the probe with 70% ethanol, as recommended by the manufacturer, proved ineffective, as A. baumannii with the same REP-PCR pattern was isolated from it 10 days after cleaning, necessitating a change in our decontamination procedure. Results obtained with REP-PCR were subsequently confirmed by ribotyping. To evaluate the discriminatory power (D) of REP-PCR for typing members of the A. calcoaceticus-A. baumannii complex, compared with that of ribotyping, we have applied both methods to a collection of 85 strains that included representatives of six DNA groups within the complex. Ribotyping using EcoRI digests yielded 53 patterns (D = 0.98), whereas 68 different REP-PCR patterns were observed (D = 0.99). By computer-assisted analysis of gel images, 74 patterns were observed with REP-PCR (D = 1.0). Overall, REP-PCR typing proved to be slightly more discriminatory than ribotyping. Our results indicate that REP-PCR typing used boiled colonies is a simple, rapid, and effective means of typing members of the A. calcoaceticus-A. baumannii complex. PMID

  1. Physiological factors affecting production of extracellular lipase (LipA) in Acinetobacter calcoaceticus BD413: fatty acid repression of lipA expression and degradation of LipA.

    PubMed Central

    Kok, R G; Nudel, C B; Gonzalez, R H; Nugteren-Roodzant, I M; Hellingwerf, K J


    The extracellular lipase (LipA) produced by Acinetobacter calcoaceticus BD413 is required for growth of the organism on triolein, since mutant strains that lack an active lipase fail to grow with triolein as the sole carbon source. Surprisingly, extracellular lipase activity and expression of the structural lipase gene (lipA), the latter measured through lacZ as a transcriptional reporter, are extremely low in triolein cultures of LipA+ strains. The explanation for this interesting paradox lies in the effect of fatty acids on the expression of lipA. We found that long-chain fatty acids, especially, strongly repress the expression of lipA, thereby negatively influencing the production of lipase. We propose the involvement of a fatty acyl-responsive DNA-binding protein in regulation of expression of the A. calcoaceticus lipBA operon. The potential biological significance of the observed physiological competition between expression and repression of lipA in the triolein medium is discussed. Activity of the extracellular lipase is also negatively affected by proteolytic degradation, as shown in in vitro stability experiments and by Western blotting (immunoblotting) of concentrated supernatants of stationary-phase cultures. In fact, the relatively high levels of extracellular lipase produced in the early stationary phase in media which contain hexadecane are due only to enhanced stability of the extracellular enzyme under those conditions. The rapid extracellular degradation of LipA of A. calcoaceticus BD413 by an endogenous protease is remarkable and suggests that proteolytic degradation of the enzyme is another important factor in regulating the level of active extracellular lipase. PMID:8830702

  2. Staring at the Cold Sun: Blue Light Regulation Is Distributed within the Genus Acinetobacter

    PubMed Central

    Golic, Adrián; Vaneechoutte, Mario; Nemec, Alexandr; Viale, Alejandro M.; Actis, Luis A.; Mussi, María Alejandra


    We previously showed that the opportunistic nosocomial pathogen Acinetobacter baumannii is able to sense and respond to light via BlsA, a BLUF (Blue-Light-sensing Using FAD)-domain photoreceptor protein. Here, we extend our previous studies showing that light regulation is not restricted to A. baumannii, but rather widespread within the genus Acinetobacter. First, we found that blue light modulates motility and biofilm formation in many species of the genus, including members of the Acinetobacter calcoaceticus-A. baumannii complex. In many of these species blue light acts as a key factor guiding the decision between motility or sessility at 24°C, whereas in A. baumannii, light inhibits both motility and biofilm formation. We also show that light regulation of motility occurred not only at 24°C but also at 37°C in non-A. baumannii species, contrasting the situation of A. baumannii which only shows photoregulation at 24°C. Second, we show that Acinetobacter baylyi (strain ADP1) BLUF-photoreceptors can functionally replace in vivo the A. baumannii 17978 BlsA protein and that the pathways leading to biofilm formation are inversely regulated at 24°C between these two microorganisms. Finally, we found the presence of predicted genes coding BLUF-containing proteins in all Acinetobacter sequenced genomes, even though the copy number is variable among them. Phylogenetic analysis suggests a common origin for all BLUF domains present in members of this genus, and could distinguish well-differentiated clusters that group together BLUF homologs from different species, a situation particularly clear for members of the ACB complex. Despite a role played by these BLUF domain-containing proteins in the photoregulation observed in the members of the genus Acinetobacter is a likely scenario given our findings in A. baumannii and A. baylyi, further research will contribute to confirm this possibility. PMID:23358859

  3. Enrichment of Acinetobacter spp. from food samples.


    Carvalheira, Ana; Ferreira, Vânia; Silva, Joana; Teixeira, Paula


    Relatively little is known about the role of foods in the chain of transmission of acinetobacters and the occurrence of different Acinetobacter spp. in foods. Currently, there is no standard procedure to recover acinetobacters from food in order to gain insight into the food-related ecology and epidemiology of acinetobacters. This study aimed to assess whether enrichment in Dijkshoorn enrichment medium followed by plating in CHROMagar™ Acinetobacter medium is a useful method for the isolation of Acinetobacter spp. from foods. Recovery of six Acinetobacter species from food spiked with these organisms was compared for two selective enrichment media (Baumann's enrichment and Dijkshoorn's enrichment). Significantly (p < 0.01) higher cell counts were obtained in Dijkshoorn's enrichment. Next, the Dijkshoorn's enrichment followed by direct plating on CHROMagar™ Acinetobacter was applied to detect Acinetobacter spp. in different foods. Fourteen different presumptive acinetobacters were recovered and assumed to represent nine different strains on the basis of REP-PCR typing. Eight of these strains were identified by rpoB gene analysis as belonging to the species Acinetobacter johnsonii, Acinetobacter calcoaceticus, Acinetobacter guillouiae and Acinetobacter gandensis. It was not possible to identify the species level of one strain which may suggests that it represents a distinct species. PMID:26742623


    EPA Science Inventory

    'Acinetobacter calcoaceticus', frequently found in drinking waters and implicated in nosocomial infections, was presumptively identified by its tiny, blue colonial appearance on Levine eosin methylene blue agar. All of the 33 isolates from drinking water showing this distinctive ...

  5. [Application of Whole-cell Biosensor ADP1_pWHlux for Acute Toxicity Detection in Water Environment].


    Tang, Hui; Song, Yi-zhi; Jiang, Bo; Chen, Guang-yu; Jia, Jian-li; Zhang, Xu; Li, Guang-he


    A whole-cell biosensor acinetobacter ADP1_pWHlux was constructed by genetic engineering for detecting acute toxicity, so as to overcome the harsh application conditions when detecting acute toxicity using natural luminescent bacteria or whole-cell biosensor constructed by model microorganisms as the host cell. Detection methods, detection sensitivity and detection range of acinetobacter ADP1_pWHlux were studied. The results showed that the luminescence of ADP1_pWHlux was inhibited by acute poison, poison dose and inhibition of luminescence exhibit dose-response relationship. ADPL_pWHlux was respond to 4 mg x L(-1) HgCl2 within 5 min. The detection limit for HgCl2 was 0.04 mg x L(-1). The detectable effects for indicators of Be2+, Ba2+, Cu2+, Ni2+ in standards for drinking water quality were obvious. The detection range of Be2+, Ba2+, Cu2+ were 0.025-250 mg x L(-1), the detection range of Ni2+, was 0.0025-250 mg x L(-1), the detection limit of Pb2+, BrO3(-) , ClO2(-) were 0.002 5 mg x L(-1), the detection limit of ClO3(-) was 0.025 mg x L(-1). The whole-cell biosensor ADPl_pWHlux detection method has been applied to evaluate acute toxicity in water environment of Qinghe river in Beijing, indicating the established method can be used to detect contaminated water samples. PMID:26841625

  6. [Problem of treatment for pyo-inflammatory complications caused by Acinetobacter].


    Bogomolova, N S; Bol'shakov, L V; Kuznetsova, S M


    The article deals with analysis of a detection frequency and antibacterial treatment resistance of Acinetobacter spp.of different species affiliation. Strains of bacteria detected in patients with pyo-inflammatory complications after surgeries (period from 2010 to 2012) were involved in the study 137 strains of Acinetobacter spp. were detected and studied Fraction of Acinetobacter spp. in 2010, 2011 and 2012 was 2.3, 3 and 3.4% respectively. Fraction of P. aeruginosain all non-fermentative Gram-negative bacteria (NFGNB) decreased by 120% and fraction of Acinetobacter spp. increased by 200-250%. Acinetobacter spp. detection frequency was not significantly changed in the period from 2006 to 2012. However the fraction of Acinetobacter spp. in NFGNB increased by 150% and was 29% in 2012. Detection frequency of A. baumanii sharply increased in 2012. A study of antibacterial treatment resistance of Acinetobacter spp. (10 antibacterial medicines) showed that Polymyxin B and E (Colistin) was the most effective medicine for A. baumanii and A. calcoaceticus infection. 85-95% of Acinetobacter spp.strains kept sensitivity to this antibacterial medicine. 66-88.9% of A. baumanii strains, 66.7-81.8% of A. alcoaceticus and 66.6% of other Acinetobacter spp. were sensitive to Tigecycline. Dioxidine effectiveness was close to Tigecycline in 66.7-80% of A. baumanii strains. 85-100% of A. calcoaceticus strains were sensitive to Dioxidine. There is a trend of decreasing of A. baumanii sensitivity to Carbapenems by 200%. Fraction of strains sensitive to Meropenem and Imipenem in 2012 was 21.4% and 16.7% respectively. All studied strains of A. lwoffi and A. haemolyticus kept sensitivity to Carbapenems. In 2012 23.8% of A. baumanii and 50% of A. calcoaceticus strains were sensitivity to Amikacin, meanwhile A. lwoffi and A. haemolyticus were not sensitive to this medicine. 31.3% of A. baumanii and 50% of A. calcoaceticus strains were sensitive to Ceftazidime/Sulbactam. 5.3% of A. baumanii

  7. Acinetobacter seifertii Isolated from China

    PubMed Central

    Yang, Yunxing; Wang, Jianfeng; Fu, Ying; Ruan, Zhi; Yu, Yunsong


    Abstract Clinical infections caused by Acinetobacter spp. have increasing public health concerns because of their global occurrence and ability to acquire multidrug resistance. Acinetobacter calcoaceticus–Acinetobacter baumannii (ACB) complex encompasses A. calcoaceticus, A. baumannii, A. pittii (formerly genomic species 3), and A nosocomial (formerly genomic species 13TU), which are predominantly responsible for clinical pathogenesis in the Acinetobacter genus. In our previous study, a putative novel species isolated from 385 non-A. baumannii spp. strains based on the rpoB gene phylogenetic tree was reported. Here, the putative novel species was identified as A. seifertii based on the whole-genome phylogenetic tree. A. seifertii was recognized as a novel member of the ACB complex and close to A. baumannii and A. nosocomials. Furthermore, we studied the characteristics of 10 A. seifertii isolates, which were distributed widely in 6 provinces in China and mainly caused infections in the elderly or children. To define the taxonomic status and characteristics, the biochemical reactions, antimicrobial susceptibility testing, pulsed field gel electrophoresis (PFGE), multilocus sequence typing (MLST), and whole-genome sequence analysis were performed. The phenotypic characteristics failed to distinguish A. serfertii from other species in the ACB complex. Most of the A. seifertii isolates were susceptible to antibiotics commonly used for nosocomial Acinetobacter spp. infections, but one isolate (strain A362) was resistant to ampicillin/sulbactam, ceftazidime and amikacin. The different patterns of MLST and PFGE suggested that the 10 isolates were not identical and lacked clonal relatedness. Our study reported for the first time the molecular epidemiological and genomic features of widely disseminated A. seifertii in China. These observations could enrich the knowledge of infections caused by non-A. baumannii and may provide a scientific basis for future clinical

  8. Prevalence and in-vitro antimicrobial susceptibility patterns of Acinetobacter strains isolated from patients in intensive care units.


    Aktas, O; Ozbek, A


    Fifty-six Acinetobacter species strains (49 Acinetobacter baumanii, 5 Acinetobacter calcoaceticus, 2 Acinetobacter iwoffii) were detected using both conventional methods and gas chromatography of bacterial fatty acids with the MIDI Sherlock Microbial Identification System. The susceptibilities of these strains to 16 antimicrobial agents were investigated by the disc-diffusion method according to the National Committee for Clinical Laboratory Standards. The production of extended-spectrum beta-lactamases (ESBLs) and inducible beta-lactamases (IBLs) by the strains were investigated by the double-disc-synergy and disc-approximation methods, respectively. Imipenem was the most effective agent for Acinetobacter baumanii strains (95.9% of strains were sensitive), while meropenem and netilmicin showed moderate activity (87.7% and 79.6% of strains, respectively, responded). Acinetobacter baumanii strains were less sensitive to cefoperazone-sulbactam (53.1%), ofloxacin (51.0%), ciprofloxacin (42.8%), and amikacin (36.7%). Acinetobacter calcoaceticus and Acinetobacter iwoffii strains were sensitive to imipenem, meropenem and netilmicin. IBLs and ESBLs were produced, respectively, by 8.9% and 7.1% of all bacterial strains. The strains isolated were sufficiently sensitive to imipenem, but not to ofloxacin or ciprofloxacin, and were very resistant to amikacin. PMID:12964502

  9. A cluster of Acinetobacter Pneumonia in foundry workers

    SciTech Connect

    Cordes, L.G.; Brink, E.W.; Checko, P.J.; Lentnek, A.; Lyons, R.W.; Hayes, P.S.; Wu, T.C.; Tharr, D.G.; Fraser, D.W.


    In a 3-month period, three men who had worked for 5 to 19 years as welders or grinders of steel castings in a foundry acquired pneumonia caused by Acinetobacter calcoaceticus variety anitratus serotype 7J. Two of the men died, and postmortem examination showed mixed-dust pneumoconiosis with iron particles in the lungs. A calcoaceticus variety anitratus serotype 7J was isolated from the air in the foundry but the source was not found. The prevalence of antibody titers of 64 or greater to the 7J strain was significantly higher among foundry workers (15%) than among community controls (2%) (p less than 0.01). Sampling showed that the concentrations of total and metallic particles (especially iron) and of free silica in air inhaled by welders and grinders at the foundry frequently exceeded acceptable levels. These findings suggest that chronic exposure to such particles may increase susceptibility to infection by this organism, which rarely affects healthy people.

  10. Identification of 50 Class D β-Lactamases and 65 Acinetobacter-Derived Cephalosporinases in Acinetobacter spp.

    PubMed Central

    Périchon, Bruno; Goussard, Sylvie; Walewski, Violaine; Krizova, Lenka; Cerqueira, Gustavo; Murphy, Cheryl; Feldgarden, Michael; Wortman, Jennifer; Clermont, Dominique


    Whole-genome sequencing of a collection of 103 Acinetobacter strains belonging to 22 validly named species and another 16 putative species allowed detection of genes for 50 new class D β-lactamases and 65 new Acinetobacter-derived cephalosporinases (ADC). All oxacillinases (OXA) contained the three typical motifs of class D β-lactamases, STFK, (F/Y)GN, and K(S/T)G. The phylogenetic tree drawn from the OXA sequences led to an increase in the number of OXA groups from 7 to 18. The topologies of the OXA and RpoB phylogenetic trees were similar, supporting the ancient acquisition of blaOXA genes by Acinetobacter species. The class D β-lactamase genes appeared to be intrinsic to several species, such as Acinetobacter baumannii, Acinetobacter pittii, Acinetobacter calcoaceticus, and Acinetobacter lwoffii. Neither blaOXA-40/143- nor blaOXA-58-like genes were detected, and their origin remains therefore unknown. The phylogenetic tree analysis based on the alignment of the sequences deduced from blaADC revealed five main clusters, one containing ADC belonging to species closely related to A. baumannii and the others composed of cephalosporinases from the remaining species. No indication of blaOXA or blaADC transfer was observed between distantly related species, except for blaOXA-279, possibly transferred from Acinetobacter genomic species 6 to Acinetobacter parvus. Analysis of β-lactam susceptibility of seven strains harboring new oxacillinases and cloning of the corresponding genes in Escherichia coli and in a susceptible A. baumannii strain indicated very weak hydrolysis of carbapenems. Overall, this study reveals a large pool of β-lactamases in different Acinetobacter spp., potentially transferable to pathogenic strains of the genus. PMID:24277043

  11. The Success of Acinetobacter Species; Genetic, Metabolic and Virulence Attributes

    PubMed Central

    Peleg, Anton Y.; de Breij, Anna; Adams, Mark D.; Cerqueira, Gustavo M.; Mocali, Stefano; Galardini, Marco; Nibbering, Peter H.; Earl, Ashlee M.; Ward, Doyle V.; Paterson, David L.; Seifert, Harald; Dijkshoorn, Lenie


    An understanding of why certain Acinetobacter species are more successful in causing nosocomial infections, transmission and epidemic spread in healthcare institutions compared with other species is lacking. We used genomic, phenotypic and virulence studies to identify differences between Acinetobacter species. Fourteen strains representing nine species were examined. Genomic analysis of six strains showed that the A. baumannii core genome contains many genes important for diverse metabolism and survival in the host. Most of the A. baumannii core genes were also present in one or more of the less clinically successful species. In contrast, when the accessory genome of an individual A. baumannii strain was compared to a strain of a less successful species (A. calcoaceticus RUH2202), many operons with putative virulence function were found to be present only in the A. baumannii strain, including the csu operon, the acinetobactin chromosomal cluster, and bacterial defence mechanisms. Phenotype microarray analysis showed that compared to A. calcoaceticus (RUH2202), A. baumannii ATCC 19606T was able to utilise nitrogen sources more effectively and was more tolerant to pH, osmotic and antimicrobial stress. Virulence differences were also observed, with A. baumannii ATCC 19606T, A. pittii SH024, and A. nosocomialis RUH2624 persisting and forming larger biofilms on human skin than A. calcoaceticus. A. baumannii ATCC 19606T and A. pittii SH024 were also able to survive in a murine thigh infection model, whereas the other two species were eradicated. The current study provides important insights into the elucidation of differences in clinical relevance among Acinetobacter species. PMID:23144699

  12. Monitoring Precursor 16S rRNAs of Acinetobacter spp. in Activated Sludge Wastewater Treatment Systems

    PubMed Central

    Oerther, Daniel B.; Pernthaler, Jakob; Schramm, Andreas; Amann, Rudolf; Raskin, Lutgarde


    Recently, Cangelosi and Brabant used oligonucleotide probes targeting the precursor 16S rRNA of Escherichia coli to demonstrate that the levels of precursor rRNA were more sensitive to changes in growth phase than the levels of total rRNA (G. A. Cangelosi and W. H. Brabant, J. Bacteriol. 179:4457–4463, 1997). In order to measure changes in the levels of precursor rRNA in activated sludge systems, we designed oligonucleotide probes targeting the 3′ region of the precursor 16S rRNA of Acinetobacter spp. We used these probes to monitor changes in the level of precursor 16S rRNA during batch growth of Acinetobacter spp. in Luria-Bertani (LB) medium, filtered wastewater, and in lab- and full-scale wastewater treatment systems. Consistent with the previous reports for E. coli, results obtained with membrane hybridizations and fluorescence in situ hybridizations with Acinetobacter calcoaceticus grown in LB medium showed a more substantial and faster increase in precursor 16S rRNA levels compared to the increase in total 16S rRNA levels during exponential growth. Diluting an overnight culture of A. calcoaceticus grown in LB medium with filtered wastewater resulted in a pattern of precursor 16S rRNA levels that appeared to follow diauxic growth. In addition, fluorescence in situ hybridizations with oligonucleotide probes targeting total 16S rRNA and precursor 16S rRNA showed that individual cells of A. calcoaceticus expressed highly variable levels of precursor 16S rRNA when adapting from LB medium to filtered sewage. Precursor 16S rRNA levels of Acinetobacter spp. transiently increased when activated sludge was mixed with influent wastewater in lab- and full-scale wastewater treatment systems. These results suggest that Acinetobacter spp. experience a change in growth activity within wastewater treatment systems. PMID:10788395

  13. Acinetobacter baumannii

    PubMed Central

    Howard, Aoife; O’Donoghue, Michael; Feeney, Audrey; Sleator, Roy D.


    Acinetobacter baumannii is an opportunistic bacterial pathogen primarily associated with hospital-acquired infections. The recent increase in incidence, largely associated with infected combat troops returning from conflict zones, coupled with a dramatic increase in the incidence of multidrug-resistant (MDR) strains, has significantly raised the profile of this emerging opportunistic pathogen. Herein, we provide an overview of the pathogen, discuss some of the major factors that have led to its clinical prominence and outline some of the novel therapeutic strategies currently in development. PMID:22546906

  14. Blood stream infections caused by Acinetobacter baumannii group in Japan - Epidemiological and clinical investigation.


    Fujikura, Yuji; Yuki, Atsushi; Hamamoto, Takaaki; Kawana, Akihiko; Ohkusu, Kiyofumi; Matsumoto, Tetsuya


    Acinetobacter calcoaceticus-Acinetobacter baumannii complex, especially A. baumannii, Acinetobacter pittii and Acinetobacter nosocomialis, constitutes an important group of nosocomial pathogens; however, epidemiological or clinical characteristics and prognosis is limited in Japan. From 2009 to 2013, 47 blood stream infection cases resulting from A. baumannii group were reviewed at the National Defense Medical College, an 800-bed tertiary hospital. To determine the genospecies, further comparative nucleotide sequence analyses of the RNA polymerase b-subunit (rpoB) gene were performed. Sequence analysis of rpoB gene showed that 25 (49.0%), 17 (33.3%) and 5 (9.8%) cases were caused by A. baumannii, A. pittii and A. nosocomialis, respectively. The 30-day and in-hospital mortality rates of A. baumannii were 8.5% and 25.5%, respectively, and there were no significant differences between Acinetobacter species. Clinical characteristics were statistically insignificant. Multidrug-resistant Acinetobacter species were detected in 3 cases (5.9%) with same pulsed-field gel electrophoresis (PFGE) pattern and A. baumannii was less susceptible to amikacin and levofloxacin. In this study, the mortality and clinical characteristics were similar among A. baumannii group isolate cases despite some showing drug resistance. However, identification of Acinetobacter species helps to initiate appropriate antibiotic therapy in earlier treatment phase, because A. baumannii shows some drug resistance. PMID:26993173

  15. High levels of multiple metal resistance and its correlation to antibiotic resistance in environmental isolates of Acinetobacter.


    Dhakephalkar, P K; Chopade, B A


    Forty strains of Acinetobacter were isolated from different environmental sources. All the strains were classified into four genospecies, i.e., A. baumannii (33 isolates), A. calcoaceticus (three isolates), A. junii (three isolates) and A. genospecies3 (one isolate). Susceptibility of these 40 strains to salts of 20 heavy metals and 18 antibiotics was tested by the agar dilution method. All environmental isolates of Acinetobacter were resistant to multiple metal ions (minimum 13 metal ions) while all but one of the strains were resistant to multiple antibiotics (minimum four antibiotics). The maximum number of strains were found to be sensitive to mercury (60% strains) while all strains were resistant to copper, lead, boron and tungsten even at 10 mM concentration. Salts of these four metal ions may be added to the growth medium to facilitate selective isolation of Acinetobacter. Rifampicin and nalidixic acid were the most toxic antibiotics, inhibiting 94.5 and 89.5% of the acinetobacters, respectively. A. genospecies3 was found to be the most resistant species, tolerating high concentrations of all the 20 metal ions and also to a greater number of antibiotics than any other species of Acinetobacter tested. An inhibitory concentration (10 mM) of Ni(2+) and Zn(2+) was observed to inhibit the growth of all of the clinical isolates but allowed the growth of the environmental isolates, facilitating the differentiation between pathogenic and non-pathogenic acinetobacters. PMID:8118175

  16. Numerical classification and identification of Acinetobacter genomic species.


    Kämpfer, P; Tjernberg, I; Ursing, J


    A total of 211 Acinetobacter strains (representing all currently recognized genomic species) were tested for 329 biochemical characters. Overall similarities of all strains were determined for 145 characters by numerical taxonomic techniques, the UPGMA algorithm and the S(SM)) and the S(J) coefficients as measures of similarity. Seven clusters (two or more strains) and three unclustered strains were recovered at a similarity level of 80.0% (S(SM). At this level a complete correspondence between phenotypic cluster and genomic species was found only for genomic species 12 (Ac. radioresistens). At higher similarity levels (84.0% to 84.6% (S(SM)), however, several subclusters were found, each representing a single genomic species. An exception were the strains belonging to the genetically closely related species of the Acinetobacter calcoaceticus-baumannii complex. These were recovered scattered in several subclusters. The degree of genomic relatedness between some DNA groups correlated with phenotypic similarities, especially for DNA group 8 (Ac. Iwoffii) and 15 of Tjernberg and Ursing, and for DNA group 4 (Ac. haemolyticus) and 6. For the majority of genomic species, two identification matrices were constructed consisting of 22 and 10 diagnostic characters, respectively. The correct identification rates for the matrices were 98.0% (22 tests) and 90.8% (10 tests) taking a Willcox probability > 0.9. For unambiguous identification of some genomic species, however, additional methods (preferably DNA-DNA hybridization or ribotyping) should be used. PMID:8244904

  17. Acinetobacter Pneumonia: A Review

    PubMed Central

    Hartzell, Joshua D.; Kim, Andrew S.; Kortepeter, Mark G.; Moran, Kimberly A.


    Acinetobacter species are becoming a major cause of nosocomial infections, including hospital-acquired and ventilator-associated pneumonia. Acinetobacter species have become increasingly resistant to antibiotics over the past several years and currently present a significant challenge in treating these infections. Physicians now rely on older agents, such as polymyxins (colistin), for treatment. This paper reviews the epidemiology, treatment, and prevention of this emerging pathogen. PMID:18092011

  18. Reliability of phenotypic tests for identification of Acinetobacter species.

    PubMed Central

    Gerner-Smidt, P; Tjernberg, I; Ursing, J


    A numerical approach was used for identification of 198 Acinetobacter strains assigned to DNA groups according to the classification of Tjernberg and Ursing (I. Tjernberg and J. Ursing, APMIS 97:595-605, 1989). The matrix used was constructed from data published by Bouvet and Grimont (P.J.M. Bouvet and P.A.D. Grimont, Int. J. Syst. Bacteriol. 36:228-240, 1986) and Bouvet and Jeanjean (P.J.M. Bouvet and S. Jeanjean, Res. Microbiol. 140:291-299, 1989). The tests chosen were those of the simplified identification scheme for Acinetobacter species devised by Bouvet and Grimont (P.J.M. Bouvet and P.A.D. Grimont, Ann. Inst. Pasteur/Microbiol. 138:569-578, 1987), namely, growth at 37, 41, and 44 degrees C, oxidation of glucose, gelatin hydrolysis, and assimilation of 14 carbon sources. Of the strains tested, 181 represented 12 DNA groups in the matrix; at a probability level of greater than or equal to 0.95, 78% of them were correctly identified, 2.2% were misidentified, and 19.8% were not identified. Seventeen strains represented two DNA groups not included in the matrix; nine of them were incorrectly assigned to a DNA group by these phenotypic tests. Because of problems of separating strains belonging to DNA groups 1, 2, 3, and 13 by using the phenotypic tests proposed by Bouvet and Grimont (Ann. Inst. Pasteur/Microbiol.), we suggest that these groups should be referred to as the Acinetobacter calcoaceticus-A. baumannii complex. PMID:2007635

  19. Multidrug Resistant Acinetobacter

    PubMed Central

    Manchanda, Vikas; Sanchaita, Sinha; Singh, NP


    Emergence and spread of Acinetobacter species, resistant to most of the available antimicrobial agents, is an area of great concern. It is now being frequently associated with healthcare associated infections. Literature was searched at PUBMED, Google Scholar, and Cochrane Library, using the terms ‘Acinetobacter Resistance, multidrug resistant (MDR), Antimicrobial Therapy, Outbreak, Colistin, Tigecycline, AmpC enzymes, and carbapenemases in various combinations. The terms such as MDR, Extensively Drug Resistant (XDR), and Pan Drug Resistant (PDR) have been used in published literature with varied definitions, leading to confusion in the correlation of data from various studies. In this review various mechanisms of resistance in the Acinetobacter species have been discussed. The review also probes upon the current therapeutic options, including combination therapies available to treat infections due to resistant Acinetobacter species in adults as well as children. There is an urgent need to enforce infection control measures and antimicrobial stewardship programs to prevent the further spread of these resistant Acinetobacter species and to delay the emergence of increased resistance in the bacteria. PMID:20927292

  20. Radiation resistance of clinical Acinetobacter spp. : A need for concern

    SciTech Connect

    Christensen, E.A.; Gerner-Smidt, P.; Kristensen, H. )


    As part of an epidemiological investigation of hospital infections caused by Acinetobacter spp. the radiation resistance of 15 clinical isolates and four reference strains was assessed. The radiation resistance (in D-6 values, viz. the dose necessary for reducing the initial number of colony forming units by a factor of 10(6)) was, in general, higher in the isolates of A. radioresistens than in the isolates of the A. calcoaceticus-A. baumannii complex and of A. lwoffi. However, the least resistant isolates of A. radioresistens had a D-6 value equal to or lower than the most resistant isolates of the other groups. The lowest D-6 values found were for two of the reference strains. The highest D-6 value was 35 kGy. Three isolates of A. johnsonii could not survive long enough in a dried preparation to make an assessment of the D-6 values possible. The radiation resistance of the 15 clinical isolates in the present study was higher than the resistance found in a study of similar isolates in 1970.

  1. Utility of Whole-Genome Sequencing in Characterizing Acinetobacter Epidemiology and Analyzing Hospital Outbreaks

    PubMed Central

    Fitzpatrick, Margaret A.; Hauser, Alan R.


    Acinetobacter baumannii frequently causes nosocomial infections and outbreaks. Whole-genome sequencing (WGS) is a promising technique for strain typing and outbreak investigations. We compared the performance of conventional methods with WGS for strain typing clinical Acinetobacter isolates and analyzing a carbapenem-resistant A. baumannii (CRAB) outbreak. We performed two band-based typing techniques (pulsed-field gel electrophoresis and repetitive extragenic palindromic-PCR), multilocus sequence type (MLST) analysis, and WGS on 148 Acinetobacter calcoaceticus-A. baumannii complex bloodstream isolates collected from a single hospital from 2005 to 2012. Phylogenetic trees inferred from core-genome single nucleotide polymorphisms (SNPs) confirmed three Acinetobacter species within this collection. Four major A. baumannii clonal lineages (as defined by MLST) circulated during the study, three of which are globally distributed and one of which is novel. WGS indicated that a threshold of 2,500 core SNPs accurately distinguished A. baumannii isolates from different clonal lineages. The band-based techniques performed poorly in assigning isolates to clonal lineages and exhibited little agreement with sequence-based techniques. After applying WGS to a CRAB outbreak that occurred during the study, we identified a threshold of 2.5 core SNPs that distinguished nonoutbreak from outbreak strains. WGS was more discriminatory than the band-based techniques and was used to construct a more accurate transmission map that resolved many of the plausible transmission routes suggested by epidemiologic links. Our study demonstrates that WGS is superior to conventional techniques for A. baumannii strain typing and outbreak analysis. These findings support the incorporation of WGS into health care infection prevention efforts. PMID:26699703

  2. Real-Time Fluorescence Loop Mediated Isothermal Amplification for the Detection of Acinetobacter baumannii

    PubMed Central

    Wang, Qinqin; Zhou, Yanbin; Li, Shaoli; Zhuo, Chao; Xu, Siqi; Huang, Lixia; Yang, Ling; Liao, Kang


    Background Detection of Acinetobacter baumannii has been relying primarily on bacterial culture that often fails to return useful results in time. Although DNA-based assays are more sensitive than bacterial culture in detecting the pathogen, the molecular results are often inconsistent and challenged by doubts on false positives, such as those due to system- and environment-derived contaminations. In addition, these molecular tools require expensive laboratory instruments. Therefore, establishing molecular tools for field use require simpler molecular platforms. The loop-mediated isothermal amplification method is relatively simple and can be improved for better use in a routine clinical bacteriology laboratory. A simple and portable device capable of performing both the amplification and detection (by fluorescence) of LAMP in the same platform has been developed in recent years. This method is referred to as real-time loop-mediated isothermal amplification. In this study, we attempted to utilize this method for rapid detection of A. baumannii. Methodology and Significant Findings Species-specific primers were designed to test the utility of this method. Clinical samples of A. baumannii were used to determine the sensitivity and specificity of this system compared to bacterial culture and a polymerase chain reaction method. All positive samples isolated from sputum were confirmed to be the species of Acinetobacter by 16S rRNA gene sequencing. The RealAmp method was found to be simpler and allowed real-time detection of DNA amplification, and could distinguish A. baumannii from Acinetobacter calcoaceticus and Acinetobacter genomic species 3. DNA was extracted by simple boiling method. Compared to bacterial culture, the sensitivity and specificity of RealAmp in detecting A. baumannii was 98.9% and 75.0%, respectively. Conclusion The RealAmp assay only requires a single unit, and the assay positivity can be verified by visual inspection. Therefore, this assay has

  3. Comparative studies of the Acinetobacter genus and the species identification method based on the recA sequences.


    Krawczyk, B; Lewandowski, K; Kur, J


    The recA gene is indispensable for a maintaining and diversification of the bacterial genetic material. Given its important role in ensuring cell viability, it is not surprising that the RecA protein is both ubiquitous and well conserved among a range of prokaryotes. Previously, we reported Acinetobacter genomic species identification method based on PCR amplification of an internal fragment of the recA gene with subsequent restriction analysis (RFLP) with HinfI and MboI enzymes. In present study, the PCR products containing the internal fragment of the recA gene, for 25 Acinetobacter strains belonging to all genomic species, were sequenced. Based on the nucleotide sequences the restriction maps and phylogenetic tree were prepared. The restriction maps revealed that Tsp509I restriction enzyme is the most discriminating for RFLP. To verify the computer analysis, the amplified DNAs from all reference genomic species available (43 strains) and 34 clinical strains were digested with each of the three restriction endonucleases mentioned. The results of digestion confirmed the computer analysis. The reconstructed phylogenetic tree showed linkages between genomic species 1 (Acinetobacter calcoaceticus), 2 (Acinetobacter baumannii), 3, 'between 1 and 3', TU13 and 'close to TU13'; genomic species 4, 6, BJ13, BJ14, BJ15, BJ16 and BJ17; genomic species 7 (Acinetobacter johnsonii) and TU14; genomic species 10 and 11; genomic species 8 (Acinetobacter Iwoffii), 9, 12 (Acinetobacter radioresistens) and TU15; and genomic species 5 (Acinetobacter junii). It is interesting that one branch in the phylogenetic tree contains haemolytic species-genomic species 4 (A. haemolyticus), BJ13, BJ14, BJ15, BJ16 and BJ17. The proposed genotypic method clearly revealed that the RFLP profiles obtained with Tsp509I enzyme might be useful for species identification of Acinetobacter strains. In this context, recA/RFLP genotypic method should be seen as an ideal preliminary screening method for large

  4. Urban riverine environment is a source of multidrug-resistant and ESBL-producing clinically important Acinetobacter spp.


    Maravić, Ana; Skočibušić, Mirjana; Fredotović, Željana; Šamanić, Ivica; Cvjetan, Svjetlana; Knezović, Mia; Puizina, Jasna


    Some Acinetobacter species have emerged as very important opportunistic pathogens in humans. We investigated Acinetobacter spp. from the polluted urban riverine environment in Croatia in regard to species affiliation, antibiotic resistance pattern, and resistance mechanisms. Considerable number of isolates produced acquired extended-spectrum β-lactamase(s) (ESBLs), CTX-M-15 solely or with TEM-116. By Southern blot hybridization, bla TEM-116 was identified on plasmids ca. 10, 3, and 1.2 kb in Acinetobacter junii, A. gandensis, and A. johnsonii. The bla TEM-116-carrying plasmid in A. gandensis was successfully transferred by conjugation to azide-resistant Escherichia coli J53. A. radioresistens isolate also carried an intrinsic carbapenemase gene bla OXA-133 with ISAba1 insertion sequence present upstream to promote its expression. Majority of ESBL-producing isolates harbored integrases intI1 and/or intI2 and the sulfamethoxazole resistance gene sul1. Almost all isolates had overexpressed resistance-nodulation-cell division (RND) efflux system, indicating that this mechanism may have contributed to multidrug resistance phenotypes. This is the first report of environmental CTX-M-15-producing Acinetobacter spp. and the first identification of CTX-M-15 in A. johnsonii, A. junii, A. calcoaceticus, A. gandensis, A. haemolyticus, and A. radioresistens worldwide. We identified, also for the first time, the environmental Acinetobacter-producing TEM ESBLs, highlighting the potential risk for human health, and the role of these bacteria in maintenance and dissemination of clinically important antibiotic resistance genes in community through riverine environments. PMID:26490931

  5. Comparison of the Virulence Potential of Acinetobacter Strains from Clinical and Environmental Sources

    PubMed Central

    Tayabali, Azam F.; Nguyen, Kathy C.; Shwed, Philip S.; Crosthwait, Jennifer; Coleman, Gordon; Seligy, Verner L.


    Several Acinetobacter strains have utility for biotechnology applications, yet some are opportunistic pathogens. We compared strains of seven Acinetobacter species (baumannii, Ab; calcoaceticus, Ac; guillouiae, Ag; haemolyticus, Ah; lwoffii, Al; junii, Aj; and venetianus, Av-RAG-1) for their potential virulence attributes, including proliferation in mammalian cell conditions, haemolytic/cytolytic activity, ability to elicit inflammatory signals, and antibiotic susceptibility. Only Ah grew at 102 and 104 bacteria/well in mammalian cell culture medium at 37°C. However, co-culture with colonic epithelial cells (HT29) improved growth of all bacterial strains, except Av-RAG-1. Cytotoxicity of Ab and Ah toward HT29 was at least double that of other test bacteria. These effects included bacterial adherence, loss of metabolism, substrate detachment, and cytolysis. Only Ab and Ah exhibited resistance to killing by macrophage-like J774A.1 cells. Haemolytic activity of Ah and Av-RAG-1 was strong, but undetectable for other strains. When killed with an antibiotic, Ab, Ah, Aj and Av-RAG-1 induced 3 to 9-fold elevated HT29 interleukin (IL)-8 levels. However, none of the strains altered levels of J774A.1 pro-inflammatory cytokines (IL-1β, IL-6 and tumor necrosis factor-α). Antibiotic susceptibility profiling showed that Ab, Ag and Aj were viable at low concentrations of some antibiotics. All strains were positive for virulence factor genes ompA and epsA, and negative for mutations in gyrA and parC genes that convey fluoroquinolone resistance. The data demonstrate that Av-RAG-1, Ag and Al lack some potentially harmful characteristics compared to other Acinetobacter strains tested, but the biotechnology candidate Av-RAG-1 should be scrutinized further prior to widespread use. PMID:22655033

  6. Carbapenem Resistance in Acinetobacter baumannii and Other Acinetobacter spp. Causing Neonatal Sepsis: Focus on NDM-1 and Its Linkage to ISAba125

    PubMed Central

    Chatterjee, Somdatta; Datta, Saswati; Roy, Subhasree; Ramanan, Lavanya; Saha, Anindya; Viswanathan, Rajlakshmi; Som, Tapas; Basu, Sulagna


    Carbapenem-resistant determinants and their surrounding genetic structure were studied in Acinetobacter spp. from neonatal sepsis cases collected over 7 years at a tertiary care hospital. Acinetobacter spp. (n = 68) were identified by ARDRA followed by susceptibility tests. Oxacillinases, metallo-β-lactamases (MBLs), extended-spectrum β-lactamases and AmpCs, were detected phenotypically and/or by PCR followed by DNA sequencing. Transconjugants possessing the blaNDM−1(New Delhi metallo-β-lactamase) underwent further analysis for plasmids, integrons and associated genes. Genetic environment of the carbapenemases were studied by PCR mapping and DNA sequencing. Multivariate logistic regression was used to identify risk factors for sepsis caused by NDM-1-harboring organisms. A. baumannii (72%) was the predominant species followed by A. calcoaceticus (10%), A. lwoffii (6%), A. nosocomialis (3%), A. junni (3%), A. variabilis (3%), A. haemolyticus (2%), and 14TU (2%). Fifty six percent of the isolates were meropenem-resistant. Oxacillinases present were OXA-23-like, OXA-58-like and OXA-51-like, predominately in A. baumannii. NDM-1 was the dominant MBL (22%) across different Acinetobacter spp. Isolates harboring NDM-1 also possessed bla(VIM−2, PER−1, VEB−2, CTX−M−15), armA, aac(6′)Ib, aac(6′)Ib-cr genes. blaNDM−1was organized in a composite transposon between two copies of ISAba125 in the isolates irrespective of the species. Further, OXA-23-like gene and OXA-58-like genes were linked with ISAba1 and ISAba3 respectively. Isolates were clonally diverse. Integrons were variable in sequence but not associated with carbapenem resistance. Most commonly found genes in the 5′ and 3′conserved segment were aminoglycoside resistance genes (aadB, aadA2, aac4′), non-enzymatic chloramphenicol resistance gene (cmlA1g) and ADP-ribosylation genes (arr2, arr3). Outborn neonates had a significantly higher incidence of sepsis due to NDM-1 harboring isolates than

  7. Molecular Methods for Identification of Acinetobacter Species by Partial Sequencing of the rpoB and 16S rRNA Genes

    PubMed Central

    Khosravi, Azar Dokht; Shahraki, Abdolrazagh Hashemi; Heidarieh, Parvin; Sheikhi, Nasrin


    Background Acinetobacter spp. is a diverse group of Gram-negative bacteria which are ubiquitous in soil and water, and an important cause of nosocomial infections. The purpose of this study was to identify a collection of Acinetobacter spp. clinical isolates accurately and to investigate their antibiotic susceptibility patterns. Materials and Methods A total of 197 non-duplicate clinical isolates of Acinetobacter spp. isolates identified using conventional biochemical tests. The molecular technique of PCR-RFLP and sequence analysis of rpoB and 16S rRNA genes was applied for species identification. Antimicrobial susceptibility test was performed with a disk diffusion assay. Results Based on 16S rRNA and rpoB genes analysis separately, most of clinical isolates can be identified with high bootstrap values. However, the identity of the isolate 555T was uncertain due to high similarity of A. grimontii and A. junii. Identification by concatenation of 16S rRNA and rpoB confirmed the identity of clinical isolates of Acenitobacer to species level confidently. Accordingly, the isolate 555T assigned as A. grimontii due to 100% similarity to A. grimontii. Moreover, this isolate showed 98.64% to A. junii. Besides, the identity of the isolates 218T and 364T was confirmed as Genomic species 3 and A. calcoaceticus respectively. So, the majority of Acinetobacter spp. isolates, were identified as: A. baumannii (131 isolates, 66%), A. calcoaceticus (9 isolates, 4.5%), and A. genomosp 16 (8 isolates, 4%). The rest of identified species showed the lower frequencies. In susceptibility test, 105 isolates (53%), presented high antibiotic resistance of 90% to ceftriaxone, piperacillin, piperacillin tazobactam, amikacin, and 81% to ciprofloxacin. Conclusion Sequence analysis of the 16S rRNA and rpoB spacer simultaneously was able to do identification of Acinetobacter spp. to species level. A.baumannii was identified as the most prevalent species with high antibiotic resistance. Other

  8. Clinical impact and pathogenicity of Acinetobacter.


    Joly-Guillou, M-L


    Members of the genus Acinetobacter have been implicated in a wide spectrum of infectious diseases. Although this organism is associated primarily with nosocomial infections, it has also been involved in cases of community-acquired infection. Before the 1970s, Acinetobacter infections were mostly post-surgical urinary tract infections in patients hospitalised in surgical units. The significant improvement in resuscitation techniques during the last 30 years has changed the types of infection caused by Acinetobacter. Since the 1980s, Acinetobacter has spread rapidly among patients in intensive care units. Today, Acinetobacter accounts for c. 9% of nosocomial infections, with most Acinetobacter infections involving the respiratory tract. Transmission via the hands of hospital staff has become the most important contributory factor in patient colonisation. Acinetobacter baumannii is the species that is involved most frequently in infections of humans, but a natural reservoir for A. baumannii outside the hospital environment has not yet been identified. Community-acquired infection and infections acquired following war or natural disasters (e.g., earthquakes) have been described. Acinetobacter causes mild-to-severe illness, but can be fatal. The severity of Acinetobacter infection depends upon the site of infection and the patient's susceptibility to infection as a result of underlying disease. The circumstances that allow Acinetobacter to assume a pathogenic role are not really well-understood. As this organism is a low-grade pathogen, the pathogenesis of Acinetobacter infections probably involves numerous factors, including virulence determinants, which have yet to be investigated. PMID:16216100

  9. Laboratory Maintenance of Acinetobacter baumannii.


    Jacobs, Anna C; Zurawski, Daniel V


    Acinetobacter baumannii has recently drawn great interest in the microbiology research community due to the increase in clinical antibiotic resistance of this organism, and persistence of this bacterial species in the hospital environment. This unit outlines protocols for the growth and maintenance of A. baumannii in the laboratory. PMID:25367273

  10. Determination of synergy between sulbactam, meropenem and colistin in carbapenem-resistant Klebsiella pneumoniae and Acinetobacter baumannii isolates and correlation with the molecular mechanism of resistance.


    Laishram, Shakti; Anandan, Shalini; Devi, Bakthavatchalam Yamuna; Elakkiya, Munusamy; Priyanka, Babu; Bhuvaneshwari, Thukkaram; Peter, John Victor; Subramani, Kandasmy; Balaji, Veeraraghavan


    Treatment of infections with carbapenem-resistant Gram negative organism is a major challenge especially among intensive care patients. Combinations of sulbactam, meropenem and colistin was studied for its synergistic activity against 100 invasive isolates of carbapenem-resistant Klebsiella pneumoniae and Acinetobacter baumannii-calcoaceticus complex by checkerboard assay and time kill assay (TKA). In addition, presence of carbapenemase production was determined by multiplex PCR. Time kill assay detected more synergy than checkerboard assay. Good bactericidal activity of 70-100% was noted with the combinations tested. Among K. pneumoniae, isolates producing NDM carbapenemase alone showed significantly more synergy than isolates producing OXA-48-like carbapenemases. In treatment of infection with carbapenem-resistant organisms, the site of infection and the type of carbapenemase produced may help to determine the most effective combination of antimicrobials. PMID:27461479

  11. Reservoirs of Non-baumannii Acinetobacter Species.


    Al Atrouni, Ahmad; Joly-Guillou, Marie-Laure; Hamze, Monzer; Kempf, Marie


    Acinetobacter spp. are ubiquitous gram negative and non-fermenting coccobacilli that have the ability to occupy several ecological niches including environment, animals and human. Among the different species, Acinetobacter baumannii has evolved as global pathogen causing wide range of infection. Since the implementation of molecular techniques, the habitat and the role of non-baumannii Acinetobacter in human infection have been elucidated. In addition, several new species have been described. In the present review, we summarize the recent data about the natural reservoir of non-baumannii Acinetobacter including the novel species that have been described for the first time from environmental sources and reported during the last years. PMID:26870013

  12. Reservoirs of Non-baumannii Acinetobacter Species

    PubMed Central

    Al Atrouni, Ahmad; Joly-Guillou, Marie-Laure; Hamze, Monzer; Kempf, Marie


    Acinetobacter spp. are ubiquitous gram negative and non-fermenting coccobacilli that have the ability to occupy several ecological niches including environment, animals and human. Among the different species, Acinetobacter baumannii has evolved as global pathogen causing wide range of infection. Since the implementation of molecular techniques, the habitat and the role of non-baumannii Acinetobacter in human infection have been elucidated. In addition, several new species have been described. In the present review, we summarize the recent data about the natural reservoir of non-baumannii Acinetobacter including the novel species that have been described for the first time from environmental sources and reported during the last years. PMID:26870013

  13. Multicenter study using standardized protocols and reagents for evaluation of reproducibility of PCR-based fingerprinting of Acinetobacter spp.

    PubMed Central

    Grundmann, H J; Towner, K J; Dijkshoorn, L; Gerner-Smidt, P; Maher, M; Seifert, H; Vaneechoutte, M


    Seven laboratories in six European countries examined 40 isolates belonging to the Acinetobacter calcoaceticus-Acinetobacter baumannii complex to investigate whether standardized protocols and quality-controlled reagents could produce reliable, discriminatory, and reproducible PCR-based fingerprinting results. Four PCR protocols with different primers (primers DAF4, ERIC-2, M13, and REP1 + REP2) were used. The epidemiological conclusions reached by the participating laboratories were substantially correct, with 96.4% of the total isolate grouping allocations agreeing with the consensus view. All laboratories identified the main epidemiological clusters, and each laboratory also identified two non-outbreak-related isolates. There were no significant differences between the isolate grouping results obtained by the different protocols and with the different primers. Visual comparison indicated that the standardized protocols and reagents yielded reproducible fingerprint patterns, but with some variations in particular band intensities. Minor variations in fingerprint profiles were detected, but computer-assisted analysis of PCR fingerprints obtained on agarose gels demonstrated that 88.3 to 91.6% (depending on the source of DNA) of the patterns clustered correctly, while 96.4 to 98.9% of the patterns clustered correctly following automated high-resolution laser fluorescence analysis. Correlation of the patterns for isogenic isolates ranged from 83.3 to 86.6% but was slightly better (mean correlation, 87.1%) for centrally prepared DNA extracts than for DNA extracts prepared by individual laboratories (mean correlation, 84.7%). It was concluded that independently produced PCR fingerprint patterns can be obtained reproducibly for Acinetobacter spp. at the practical level if (i) quality-controlled reagents, (ii) standardized extraction of DNA, and (iii) standardized amplification conditions are used. PMID:9399496

  14. Substitutions of Ser83Leu in GyrA and Ser80Leu in ParC Associated with Quinolone Resistance in Acinetobacter pittii.


    Gu, Dan-xia; Hu, Yun-jian; Zhou, Hong-wei; Zhang, Rong; Chen, Gong-xiang


    To investigate the prevalence and the mechanism of quinolone-resistant Acinetobacter pittii, 634 Acinetobacter calcoaceticus-Acinetobacter baumannii complex isolates were collected throughout Zhejiang Province. Identification of isolates was conducted by matrix-assisted laser desorption ionization/time of flight mass spectrometry (MALDI-TOF MS), blaOXA-51-like gene, and partial RNA polymerase β-subunit (rpoB) amplification. Twenty-seven isolates of A. pittii were identified. Among the 634 isolates, A. baumannii, A. pittii, Acinetobacter nosocomialis, and A. calcoaceticus counted for 87.22%, 4.26%, 8.20%, and 0.32%, respectively. Antimicrobial susceptibility of nalidixic acid, ofloxacin, enoxacin, ciprofloxacin, lomefloxacin, levofloxacin, sparfloxacin, moxifloxacin, and gatifloxacin for 27 A. pittii were determined by the agar dilution method. Detection of quinolone-resistant determining regions of gyrA, gyrB, parC, and parE was performed for the A. pittii isolates. In addition, plasmid-mediated quinolone resistance (PMQR) determinants (qnrA, qnrB, qnrS, qnrC, qnrD, aac(6')-Ib-cr, qepA, oqxA, and oqxB) were investigated. All the 27 isolates demonstrated a higher minimum inhibitory concentration (MIC) to old quinolones than the new fluoroquinolones. No mutation in gyrA, gyrB, parC, or parE was detected in 20 ciprofloxacin-susceptible isolates. Seven ciprofloxacin-resistant A. pittii were identified with a Ser83Leu mutation in GyrA. Among them, six isolates with simultaneous Ser83Leu amino acid substitution in GyrA and Ser80Leu in ParC displayed higher MIC values against ciprofloxacin. Additionally, three were identified with a Met370Ile substitution in ParE, and two were detected with a Tyr317His mutation in ParE, which were reported for the first time. No PMQR determinants were identified in the 27 A. pittii isolates. In conclusion, mutations in chromosome play a major role in quinolone resistance in A. pittii, while resistance mechanisms mediated by plasmid have

  15. Prophage induction and differential RecA and UmuDAb transcriptome regulation in the DNA damage responses of Acinetobacter baumannii and Acinetobacter baylyi.


    Hare, Janelle M; Ferrell, Joshua C; Witkowski, Travis A; Grice, Alison N


    The SOS response to DNA damage that induces up to 10% of the prokaryotic genome requires RecA action to relieve LexA transcriptional repression. In Acinetobacter species, which lack LexA, the error-prone polymerase accessory UmuDAb is instead required for ddrR induction after DNA damage, suggesting it might be a LexA analog. RNA-Seq experiments defined the DNA damage transcriptome (mitomycin C-induced) of wild type, recA and umuDAb mutant strains of both A. baylyi ADP1 and A. baumannii ATCC 17978. Of the typical SOS response genes, few were differentially regulated in these species; many were repressed or absent. A striking 38.4% of all ADP1 genes, and 11.4% of all 17978 genes, were repressed under these conditions. In A. baylyi ADP1, 66 genes (2.0% of the genome), including a CRISPR/Cas system, were DNA damage-induced, and belonged to four regulons defined by differential use of recA and umuDAb. In A. baumannii ATCC 17978, however, induction of 99% of the 152 mitomycin C-induced genes depended on recA, and only 28 of these genes required umuDAb for their induction. 90% of the induced A. baumannii genes were clustered in three prophage regions, and bacteriophage particles were observed after mitomycin C treatment. These prophages encoded esvI, esvK1, and esvK2, ethanol-stimulated virulence genes previously identified in a Caenorhabditis elegans model, as well as error-prone polymerase alleles. The induction of all 17978 error-prone polymerase alleles, whether prophage-encoded or not, was recA dependent, but only these DNA polymerase V-related genes were de-repressed in the umuDAb mutant in the absence of DNA damage. These results suggest that both species possess a robust and complex DNA damage response involving both recA-dependent and recA-independent regulons, and further demonstrates that although umuDAb has a specialized role in repressing error-prone polymerases, additional regulators likely participate in these species' transcriptional response to DNA damage

  16. Prophage Induction and Differential RecA and UmuDAb Transcriptome Regulation in the DNA Damage Responses of Acinetobacter baumannii and Acinetobacter baylyi

    PubMed Central

    Hare, Janelle M.; Ferrell, Joshua C.; Witkowski, Travis A.; Grice, Alison N.


    The SOS response to DNA damage that induces up to 10% of the prokaryotic genome requires RecA action to relieve LexA transcriptional repression. In Acinetobacter species, which lack LexA, the error-prone polymerase accessory UmuDAb is instead required for ddrR induction after DNA damage, suggesting it might be a LexA analog. RNA-Seq experiments defined the DNA damage transcriptome (mitomycin C-induced) of wild type, recA and umuDAb mutant strains of both A. baylyi ADP1 and A. baumannii ATCC 17978. Of the typical SOS response genes, few were differentially regulated in these species; many were repressed or absent. A striking 38.4% of all ADP1 genes, and 11.4% of all 17978 genes, were repressed under these conditions. In A. baylyi ADP1, 66 genes (2.0% of the genome), including a CRISPR/Cas system, were DNA damage-induced, and belonged to four regulons defined by differential use of recA and umuDAb. In A. baumannii ATCC 17978, however, induction of 99% of the 152 mitomycin C-induced genes depended on recA, and only 28 of these genes required umuDAb for their induction. 90% of the induced A. baumannii genes were clustered in three prophage regions, and bacteriophage particles were observed after mitomycin C treatment. These prophages encoded esvI, esvK1, and esvK2, ethanol-stimulated virulence genes previously identified in a Caenorhabditis elegans model, as well as error-prone polymerase alleles. The induction of all 17978 error-prone polymerase alleles, whether prophage-encoded or not, was recA dependent, but only these DNA polymerase V-related genes were de-repressed in the umuDAb mutant in the absence of DNA damage. These results suggest that both species possess a robust and complex DNA damage response involving both recA-dependent and recA-independent regulons, and further demonstrates that although umuDAb has a specialized role in repressing error-prone polymerases, additional regulators likely participate in these species' transcriptional response to DNA damage

  17. Community-acquired Acinetobacter meningitis in adults.


    Chang, W N; Lu, C H; Huang, C R; Chuang, Y C


    Community-acquired Acinetobacter meningitis in adults is an extremely rare infection of the central nervous system (CNS). Here we report one adult case of this rare CNS infection and review the clinical data of another seven cases reported in the English language literature. In total, eight patients (six men and two women) aged between 19 and 63 years were studied. The causative pathogen in our patient was Acinetobacter baumannii; in the other reported cases they were most likely Acinetobacter Iwoffii, Acinetobacter johnsonii, Acinetobacter junii, a genomic species 3 or 6. No underlying disease was found in seven of the eight cases and six of the eight patients acquired the infections before the age of 30 years. Fever and consciousness disturbance were the most common clinical manifestations. Waterhouse-Friderichsen syndrome (WFS) was found in two cases. Unlike the Acinetobacter strains found in nosocomial infections, the strain of Acinetobacter meningitis in the community-acquired case did not show multiple antibiotic resistance. Most adult patients with community-acquired Acinetobacter meningitis can be saved by timely therapy with appropriate antibiotics before deterioration of the systemic condition and impairment of consciousness. PMID:11139162

  18. Radiation resistance of acinetobacter spp.

    NASA Astrophysics Data System (ADS)

    Whitby, James L.


    The radiation resistance of 78 different strains of Acinetobacter sp. 42 from clinical isolates and 36 from other sources were compared with 15 clinical isolates and 12 other strains from Denmark. None of the Canadian strains was as resistant as resistant-enhanced Danish strains. Four strains had D 10 values of 3.1-3.6 kGy. Irradiated and unirradiated cells from all strains grew well, when cultured in Trypticase-Soy Broth at 30°C. Most cultures grew after overnight incubation. It was concluded that there would be no difficulty in detecting these strains, using ISO methodology for establishing the radiation sterilization dose for devices.

  19. High prevalence of blaOXA-23 in Acinetobacter spp. and detection of blaNDM-1 in A. soli in Cuba: report from National Surveillance Program (2010–2012)

    PubMed Central

    Quiñones, D.; Carvajal, I.; Perez, Y.; Hart, M.; Perez, J.; Garcia, S.; Salazar, D.; Ghosh, S.; Kawaguchiya, M.; Aung, M.S.; Kobayashi, N.


    As a first national surveillance of Acinetobacter in Cuba, a total of 500 Acinetobacter spp. isolates recovered from 30 hospitals between 2010 and 2012 were studied. Acinetobacter baumannii–calcoaceticus complex accounted for 96.4% of all the Acinetobacter isolates, while other species were detected at low frequency (A. junii 1.6%, A. lwoffii 1%, A. haemolyticus 0.8%, A. soli 0.2%). Resistance rates of isolates were 34–61% to third-generation cephalosporins, 49–50% to β-lactams/inhibitor combinations, 42–47% to aminoglycosides, 42–44% to carbapenems and 55% to ciprofloxacin. However, resistance rates to colistin, doxycycline, tetracycline and rifampin were less than 5%. Among carbapenem-resistant isolates, 75% harboured different blaOXA genes (OXA-23, 73%; OXA-24, 18%; OXA-58, 3%). The blaNDM-1 gene was identified in an A. soli strain, of which the species was confirmed by sequence analysis of 16S rRNA gene, rpoB, rpoB–rpoC and rpoL–rpoB intergenic spacer regions and gyrB. The sequences of blaNDM-1 and its surrounding genes were identical to those reported for plasmids of A. baumannii and A. lwoffi strains. This is the first report of blaNDM-1 in A. soli, together with a high prevalence of OXA-23 carbapenemase for carbapenem resistance in Acinetobacter spp. in Cuba. PMID:26236494

  20. AtaA, a New Member of the Trimeric Autotransporter Adhesins from Acinetobacter sp. Tol 5 Mediating High Adhesiveness to Various Abiotic Surfaces

    PubMed Central

    Ishikawa, Masahito; Nakatani, Hajime; Hori, Katsutoshi


    Acinetobacter sp. Tol 5 exhibits an autoagglutinating nature and noteworthy adhesiveness to various abiotic surfaces from hydrophobic plastics to hydrophilic glass and stainless steel. Although previous studies have suggested that bacterionanofibers on Tol 5 cells are involved in the adhesive phenotype of Tol 5, the fiber that directly mediates Tol 5 adhesion has remained unknown. Here, we present a new member of trimeric autotransporter adhesins designated AtaA, which we discovered by analyzing a less adhesive mutant of Tol 5, T1, obtained by transposon mutagenesis. AtaA forms thinner and shorter nanofibers than fimbriae on Tol 5 cells. We performed target disruption of ataA by allelic marker exchange, and the resulting ΔataA strain was complemented with ataA on the Escherichia coli-Acinetobacter shuttle vector, which was newly constructed. These results proved that AtaA is essential for Tol 5’s autoagglutinating nature and high adhesiveness to surfaces of various materials. In addition, the adhesiveness to solid surfaces mediated by AtaA is notably higher than that mediated by YadA of Yersinia enterocolitica WA-314. Moreover, and importantly, these characteristics can be conferred to the non-adhesive, non-agglutinating bacterium Acinetobacter sp. ADP1 in trans by transformation with ataA, with expected applications to microbial immobilization. PMID:23155410

  1. Acinetobacter and similar organisms in ear infections.


    Dadswell, J V


    Fifty-seven strains of acinetobacter-like organisms were isolated over a period of 26 months from the ears of 55 patients with acute or chronic otitis media, or otitis externa, and one strain was isolated in a survey of 50 normal ears. After comparison with eight reference strains, 32 of the isolates were identified as Acinetobacter anitratus, 22 as Acinetobacter Iwoffii, three as Moraxella spp. and one as Achromobacter sp. Analysis of the clinical findings suggests that although most of these organisms played little part in the disease process, a few strains were probably pathogenic in this situation. PMID:957420

  2. Acinetobacter kookii sp. nov., isolated from soil.


    Choi, Ji Young; Ko, Gwangpyo; Jheong, Weonghwa; Huys, Geert; Seifert, Harald; Dijkshoorn, Lenie; Ko, Kwan Soo


    Two Gram-stain-negative, non-fermentative bacterial strains, designated 11-0202(T) and 11-0607, were isolated from soil in South Korea, and four others, LUH 13522, LUH 8638, LUH 10268 and LUH 10288, were isolated from a beet field in Germany, soil in the Netherlands, and sediment of integrated fish farms in Malaysia and Thailand, respectively. Based on 16S rRNA, rpoB and gyrB gene sequences, they are considered to represent a novel species of the genus Acinetobacter. Their 16S rRNA gene sequences showed greatest pairwise similarity to Acinetobacter beijerinckii NIPH 838(T) (97.9-98.4 %). They shared highest rpoB and gyrB gene sequence similarity with Acinetobacter johnsonii DSM 6963(T) and Acinetobacter bouvetii 4B02(T) (85.4-87.6 and 78.1-82.7 %, respectively). Strain 11-0202(T) displayed low DNA-DNA reassociation values (<40 %) with the most closely related species of the genus Acinetobacter. The six strains utilized azelate, 2,3-butanediol, ethanol and dl-lactate as sole carbon sources. Cellular fatty acid analyses showed similarities to profiles of related species of the genus Acinetobacter: summed feature 3 (C16 : 1ω7c, C16 : 1ω6c; 24.3-27.2 %), C18 : 1ω9c (19.9-22.1 %), C16 : 0 (15.2-22.0 %) and C12 : 0 (9.2-14.2 %). On the basis of the current findings, it is concluded that the six strains represent a novel species, for which the name Acinetobacter kookii sp. nov. is proposed. The type strain is 11-0202(T) ( = KCTC 32033(T) = JCM 18512(T)). PMID:23950148

  3. Gene cloning and characterization of a cold-adapted esterase from Acinetobacter venetianus V28.


    Kim, Young-Ok; Heo, Yu Li; Kim, Hyung-Kwoun; Nam, Bo-Hye; Kong, Hee Jeong; Kim, Dong-Gyun; Kim, Woo-Jin; Kim, Bong-Seok; Jee, Young-Ju; Lee, Sang-Jun


    Acinetobacter venetians V28 was isolated from the intestine of righteye flounder, Poecilopsetta plinthus caught in Vietnam seawater, and the esterase gene was cloned using a shotgun method. The amino acid sequence deduced from the nucleotide sequence (1,017 bp) corresponded to a protein of 338 amino acid residues with a molecular weight of 37,186. The esterase had 87% and 72% identities with the lipases of A. junii SH205 and A. calcoaceticus RUH2202, respectively. The esterase contained a putative leader sequence, as well as the conserved catalytic triad (Ser, His, Asp), consensus pentapeptide GXSXG, and oxyanion hole sequence (HG). The protein from the strain V28 was produced in both a soluble and an insoluble form when the Escherichia coli cells harboring the gene were cultured at 18 degrees C. The maximal activity of the purified enzyme was observed at a temperature of 40 degrees C and pH 9.0 using p-NP-caprylate as substrate; however, relative activity still reached to 70% even at 5 degrees C with an activation energy of 3.36 kcal/mol, which indicated that it was a cold-adapted enzyme. The enzyme was a nonmetalloprotein and was active against p-nitrophenyl esters of C4, C8, and C14. Remarkably, this enzyme retained much of its activity in the presence of commercial detergents and organic solvents. This cold-adapted esterase will be applicable as catalysts for reaction in the presence of organic solvents and detergents. PMID:22814499

  4. Pyogenic Liver Abscess Caused by Acinetobacter lwoffii: A Case Report.


    Singh, N Pal; Sagar, Tanu; Nirmal, Kirti; Kaur, I Rajender


    Acinetobacter lwoffii is a gram negative aerobic non-fermenter bacilli. It is considered as an important emerging pathogen after Acinetobacter baumannii in patients with impaired immune system and in nosocomial infections. Here, we present a case of community acquired pyogenic liver Abscess caused by Acinetobacter lwoffii in a diabetic patient. PMID:27504286

  5. Pyogenic Liver Abscess Caused by Acinetobacter lwoffii: A Case Report

    PubMed Central

    Singh, N. Pal; Nirmal, Kirti; Kaur, I. Rajender


    Acinetobacter lwoffii is a gram negative aerobic non-fermenter bacilli. It is considered as an important emerging pathogen after Acinetobacter baumannii in patients with impaired immune system and in nosocomial infections. Here, we present a case of community acquired pyogenic liver Abscess caused by Acinetobacter lwoffii in a diabetic patient. PMID:27504286

  6. Identification of an osmo-dependent and an osmo-independent choline transporter in Acinetobacter baylyi: implications in osmostress protection and metabolic adaptation.


    Sand, Miriam; Stahl, Julia; Waclawska, Izabela; Ziegler, Christine; Averhoff, Beate


    Members of the genus Acinetobacter are well known for their metabolic versatility that allows them to adapt to different ecological niches. In previous studies, we have demonstrated that Acinetobacter baylyi ADP1 can cope with high salinities by uptake and accumulation of the well-known compatible solute glycine betaine. Here, we demonstrate that addition of choline restores growth at high salinities. We further show that choline was actively taken up by the cells and converted to glycine betaine. Uptake of choline was induced by high salinity and the presence of choline in the growth medium. At high salinities, glycine betaine was accumulated in the cells whereas in the absence of osmotic stress it was exported. Inspection of the genome sequence followed by mutant studies led to the identification of two genes encoding secondary transporters (BetT1 and BetT2) of the betaine-choline-carnitine transporter (BCCT) family. The BetT1 transporter lacks an extended C-terminal domain usually found in osmoregulated choline BCCTs. BetT1 was found to facilitate osmolarity-independent choline transport most likely by a uniport mechanism. We propose that BetT1 does not primarily function in osmoadaptation but might play a role in metabolic adaptation to choline-rich environments. PMID:23889709

  7. Phosphate uptake kinetics by Acinetobacter isolates.


    Pauli, A S; Kaitala, S


    Acinetobacter isolates from activated sludge treatment plants of forest industry were used as model organisms for polyphosphate accumulating bacteria to study excess phosphate uptake by the overplus phenomenon as well as luxury uptake of phosphate during growth. The initial, rapid phosphate uptake by the phosphorus-starved Acinetobacter isolates (the overplus phenomenon) followed the Michaelis-Menten model (maximum initial phosphate uptake rate 29 mg P g(-1) dry mass (DM) h(-1), half-saturation constant for excess phosphate uptake 17 mg P L(-1)). During the rapid uptake no growth was observed, but most cells contained polyphosphate granules. Also growth and luxury uptake of phosphate could be modeled with the Michaelis-Menten equation (maximum phosphate uptake rate 3.7-12 mg P g(-1) DM h(-1), half-saturation constant for growth 0.47-6.0 mg P L(-1), maximum specific growth rate 0.15-0.55 h(-1)). PMID:18633985

  8. Engineering an Acinetobacter regulon for biosensing and high-throughput enzyme screening in E. coli via flow cytometry

    PubMed Central

    Jha, Ramesh K.; Kern, Theresa L.; Fox, David T.; M. Strauss, Charlie E.


    We created a single cell sorting system to screen for enzyme activity in Escherichia coli producing 3,4 dihydroxy benzoate (34DHB). To do so, we engineered a transcription factor regulon controlling the expression of green fluorescent protein (GFP) for induction by 34DHB. An autoregulated transcription factor, pcaU, was borrowed from Acinetobacter sp ADP1 to E. coli and its promoter region adapted for activity in E. Coli. The engineered pcaU regulon was inducible at >5 μM exogenous 34DHB, making it a sensitive biosensor for this industrially significant nylon precursor. Addition of a second plasmid provided IPTG inducible expression of dehydroshikimate dehydratase enzyme (AsbF), which converts endogenous dehydroshikimate to 34DHB. This system produced GFP fluorescence in an IPTG dose-dependent manner, and was easily detected in single cell on flow cytometer despite a moderate catalytic efficiency of AsbF. Using fluorescence-activated cell sorting (FACS), individual cells carrying the active AsbF could be isolated even when diluted into a decoy population of cells carrying a mutant (inactivated) AsbF variant at one part in a million. The same biosensor was also effective for further optimization of itself. FACS on E. coli carrying randomized loci in the promoter showed several variants with enhanced response to 34DHB. PMID:24861620

  9. Identification of NDM-1 in a Putatively Novel Acinetobacter Species (“NB14”) Closely Related to Acinetobacter pittii

    PubMed Central

    Espinal, Paula; Mosqueda, Noraida; Telli, Murat; van der Reijden, Tanny; Rolo, Dora; Fernández-Orth, Dietmar; Dijkshoorn, Lenie; Vila, Jordi


    In this study, we describe the molecular characterization of a plasmid-located blaNDM-1 harbored by an Acinetobacter clinical isolate recovered from a patient in Turkey that putatively constitutes a novel Acinetobacter species, as shown by its distinct ARDRA (amplified 16S ribosomal DNA restriction analysis) profile and molecular sequencing techniques. blaNDM-1 was carried by a conjugative plasmid widespread among non-baumannii Acinetobacter isolates, suggesting its potential for dissemination before reaching more clinically relevant Acinetobacter species. PMID:26259796

  10. Emerging therapies for multidrug resistant Acinetobacter baumannii.


    García-Quintanilla, Meritxell; Pulido, Marina R; López-Rojas, Rafael; Pachón, Jerónimo; McConnell, Michael J


    The global emergence of multidrug resistant Acinetobacter baumannii has reduced the number of clinically available antibiotics that retain activity against this pathogen. For this reason, the development of novel prevention and treatment strategies for infections caused by A. baumannii is necessary. Several studies have begun to characterize nonantibiotic approaches that utilize novel mechanisms of action to achieve antibacterial activity. Recent advances in phage therapy, iron chelation therapy, antimicrobial peptides, prophylactic vaccination, photodynamic therapy, and nitric oxide (NO)-based therapies have all been shown to have activity against A. baumannii. However, before these approaches can be used clinically there are still limitations and remaining questions that must be addressed. PMID:23317680

  11. Management of meningitis due to antibiotic-resistant Acinetobacter species

    PubMed Central

    Kim, Baek-Nam; Peleg, Anton Y; Lodise, Thomas P; Lipman, Jeffrey; Li, Jian; Nation, Roger; Paterson, David L


    Acinetobacter meningitis is becoming an increasingly common clinical entity, especially in the postneurosurgical setting, with mortality from this infection exceeding 15%. Infectious Diseases Society of America guidelines for therapy of postneurosurgical meningitis recommend either ceftazidime or cefepime as empirical coverage against Gram-negative pathogens. However, assessment of the pharmacodynamics of these cephalosporins in cerebrospinal fluid suggests that recommended doses will achieve pharmacodynamic targets against fewer than 10% of contemporary acinetobacter isolates. Thus, these antibiotics are poor options for suspected acinetobacter meningitis. From in vitro and pharmacodynamic perspectives, intravenous meropenem plus intraventricular administration of an aminoglycoside may represent a superior, albeit imperfect, regimen for suspected acinetobacter meningitis. For cases of meningitis due to carbapenem-resistant acinetobacter, use of tigecycline is not recommended on pharmacodynamic grounds. The greatest clinical experience rests with use of polymyxins, although an intravenous polymyxin alone is inadvisable. Combination with an intraventricularly administered antibiotic plus removal of infected neurosurgical hardware appears the therapeutic strategy most likely to succeed in this situation. Unfortunately, limited development of new antibiotics plus the growing threat of multidrug-resistant acinetobacter is likely to increase the problems posed by acinetobacter meningitis in the future. PMID:19324297

  12. Draft Genome Sequences of Acinetobacter parvus CM11, Acinetobacter radioresistens CM38, and Stenotrophomonas maltophilia BR12, Isolated from Murine Proximal Colonic Tissue

    PubMed Central

    Saffarian, Azadeh; Mulet, Céline; Naito, Tomoaki; Bouchier, Christiane; Tichit, Magali; Ma, Laurence; Grompone, Gianfranco


    Here, we report three genome sequences of bacteria isolated from murine proximal colonic tissue and identified as Acinetobacter parvus CM11, Acinetobacter radioresistens CM38, and Stenotrophomonas maltophilia BR12. PMID:26472823

  13. Draft Genome Sequences of Acinetobacter parvus CM11, Acinetobacter radioresistens CM38, and Stenotrophomonas maltophilia BR12, Isolated from Murine Proximal Colonic Tissue.


    Saffarian, Azadeh; Mulet, Céline; Naito, Tomoaki; Bouchier, Christiane; Tichit, Magali; Ma, Laurence; Grompone, Gianfranco; Sansonetti, Philippe J; Pédron, Thierry


    Here, we report three genome sequences of bacteria isolated from murine proximal colonic tissue and identified as Acinetobacter parvus CM11, Acinetobacter radioresistens CM38, and Stenotrophomonas maltophilia BR12. PMID:26472823

  14. Acinetobacter junii as an aetiological agent of corneal ulcer.


    Broniek, G; Langwińska-Wośko, E; Szaflik, J; Wróblewska, M


    Rods of the Acinetobacter genus are present mainly in the external environment (e.g. water, soil) and in animals, while in humans they may comprise physiological flora. The main pathogenic species is Acinetobacter baumannii complex, which constitutes a common cause of nosocomial infections, particularly in patients with underlying diseases and risk factors (e.g. prior broad-spectrum antibiotic therapy, malignancy, central venous catheter, mechanical ventilation); however, infections of the eye caused by strains of Acinetobacter spp. are very rare. We report a unique case of community-acquired corneal ulcer caused by Acinetobacter non-baumannii (possibly A. junii), in a patient with no risk factors identified. The case highlights the need for obtaining a sample from the cornea for bacteriological culture in the case of suspected ophthalmic infection as identification of the pathogen, and assessment of its susceptibility profile enables proper antibiotic therapy, improves the outcome and may constitute an eyesight-saving management. PMID:25056128

  15. Acinetobacter baumannii: Emergence of a Successful Pathogen

    PubMed Central

    Peleg, Anton Y.; Seifert, Harald; Paterson, David L.


    Acinetobacter baumannii has emerged as a highly troublesome pathogen for many institutions globally. As a consequence of its immense ability to acquire or upregulate antibiotic drug resistance determinants, it has justifiably been propelled to the forefront of scientific attention. Apart from its predilection for the seriously ill within intensive care units, A. baumannii has more recently caused a range of infectious syndromes in military personnel injured in the Iraq and Afghanistan conflicts. This review details the significant advances that have been made in our understanding of this remarkable organism over the last 10 years, including current taxonomy and species identification, issues with susceptibility testing, mechanisms of antibiotic resistance, global epidemiology, clinical impact of infection, host-pathogen interactions, and infection control and therapeutic considerations. PMID:18625687

  16. Multidrug-Resistant Acinetobacter spp.: Increasingly Problematic Nosocomial Pathogens

    PubMed Central

    Lee, Kyungwon; Yong, Dongeun; Jeong, Seok Hoon


    Pathogenic bacteria have increasingly been resisting to antimicrobial therapy. Recently, resistance problem has been relatively much worsened in Gram-negative bacilli. Acinetobacter spp. are typical nosocomial pathogens causing infections and high mortality, almost exclusively in compromised hospital patients. Acinetobacter spp. are intrinsically less susceptible to antibiotics than Enterobacteriaceae, and have propensity to acquire resistance. A surveillance study in Korea in 2009 showed that resistance rates of Acinetobacter spp. were very high: to fluoroquinolone 67%, to amikacin 48%, to ceftazidime 66% and to imipenem 51%. Carbapenem resistance was mostly due to OXA type carbapenemase production in A. baumannii isolates, whereas it was due to metallo-β-lactamase production in non-baumannii Acinetobacter isolates. Colistin-resistant isolates were rare but started to be isolated in Korea. Currently, the infection caused by multidrug-resistant A. baumannii is among the most difficult ones to treat. Analysis at tertiary care hospital in 2010 showed that among the 1,085 isolates of Acinetobacter spp., 14.9% and 41.8% were resistant to seven, and to all eight antimicrobial agents tested, respectively. It is known to be difficult to prevent Acinetobacter spp. infection in hospitalized patients, because the organisms are ubiquitous in hospital environment. Efforts to control resistant bacteria in Korea by hospitals, relevant scientific societies and government agencies have only partially been successful. We need concerted multidisciplinary efforts to preserve the efficacy of currently available antimicrobial agents, by following the principles of antimicrobial stewardship. PMID:22028150

  17. Extrahuman Epidemiology of Acinetobacter baumannii in Lebanon

    PubMed Central

    Rafei, Rayane; Hamze, Monzer; Pailhoriès, Hélène; Eveillard, Matthieu; Marsollier, Laurent; Joly-Guillou, Marie-Laure; Dabboussi, Fouad


    The presence of Acinetobacter baumannii outside hospitals is still a controversial issue. The objective of our study was to explore the extrahospital epidemiology of A. baumannii in Lebanon. From February 2012 to October 2013, a total of 73 water samples, 51 soil samples, 37 raw cow milk samples, 50 cow meat samples, 7 raw cheese samples, and 379 animal samples were analyzed by cultural methods for the presence of A. baumannii. Species identification was performed by rpoB gene sequencing. Antibiotic susceptibility was investigated, and the A. baumannii population was studied by two genotyping approaches: multilocus sequence typing (MLST) and blaOXA-51 sequence-based typing (SBT). A. baumannii was detected in 6.9% of water samples, 2.7% of milk samples, 8.0% of meat samples, 14.3% of cheese samples, and 7.7% of animal samples. All isolates showed a susceptible phenotype against most of the antibiotics tested and lacked carbapenemase-encoding genes, except one that harbored a blaOXA-143 gene. MLST analysis revealed the presence of 36 sequence types (STs), among which 24 were novel STs reported for the first time in this study. blaOXA-51 SBT showed the presence of 34 variants, among which 21 were novel and all were isolated from animal origins. Finally, 30 isolates had new partial rpoB sequences and were considered putative new Acinetobacter species. In conclusion, animals can be a potential reservoir for A. baumannii and the dissemination of new emerging carbapenemases. The roles of the novel animal clones identified in community-acquired infections should be investigated. PMID:25616788

  18. Clinical and economic outcomes of Acinetobacter vis a vis non-Acinetobacter infections in an Indian teaching hospital

    PubMed Central

    Asim, Priyendu; Naik, Nagappa Anantha; Muralidhar, Varma; Vandana, K. Eshwara; Varsha, A. Prabhu


    Context: Acinetobacter infections are a major nosocomial infection causing epidemics of infection in the Intensive Care Units (ICU). Aims: This study estimates the clinical and economic outcomes of Acinetobacter infections and compares them with those of non-Acinetobacter bacterial infections. Settings and Design: Prospective cross-sectional observational study carried out for 6 months in the medicine ICU of a tertiary care hospital. Materials and Methods: Patients were divided in two groups, one group with Acinetobacter infections and the other with non-Acinetobacter infections. The data was collected for infection, length of stay (LOS), mortality and cost along with patient demographics from the hospital records for analysis. Statistical Analysis Used: The data was analyzed using Statistical Package for the Social Sciences Version 15.0. The LOS and cost of treatment (COT) for the two groups were compared using the nonparametric Mann–Whitney U-test. Results: A total of 220 patients were studied out of which 91 had Acinetobacter infections. The median LOS was 20 days in Group-A and 12 days in Group-B (P < 0.0001). The median COT was INR 125,862 in Group-A and INR 68,228 in the Group-B (P < 0.0001). Mortality in Group-A and Group-B was 32.97 and 32.56 (P = 0.949) respectively. Conclusion: The burden of Acinetobacter infections in ICUs is increasing with the increase in LOS and COT for the patients. The infection control team has to play a major role in reducing the rate of nosocomial infections. PMID:26955573

  19. Modified CHROMagar Acinetobacter Medium for Direct Detection of Multidrug-Resistant Acinetobacter Strains in Nasal and Rectal Swab Samples

    PubMed Central

    Lee, Jacob; Kim, Taek-Kyung; Park, Min-Jeong; Kim, Han-Sung; Kim, Jae-Seok


    This study aimed to investigate whether CHROMagar Acinetobacter medium (CHROMagar, France) in combination with an antimicrobial supplement (modified CHROMagar Acinetobacter; CHROMagar, France) can be used for detecting and isolating multidrug-resistant Acinetobacter species (MRA) in nasal and rectal surveillance cultures. Nasal and rectal swab samples were collected from patients in an intensive care unit at a teaching hospital. The samples were used to inoculate modified CHROMagar Acinetobacter plates, which were examined after 24 and 48 hr of incubation at 37℃. Their susceptibility against the antimicrobial agents meropenem, imipenem, ciprofloxacin, and amikacin was analyzed using the Etest (bioMerieux, France). A total of 406 paired samples (406 nasal swabs and 406 rectal swabs) were obtained from 226 patients, and 120 samples (28 nasal and 28 rectal cultures, 47 nasal cultures only, and 17 rectal cultures only) yielded MRA. Seventy-five MRA isolates (18.5%) were recovered from the 406 nasal samples, and 45 MRA isolates (11.1%) were recovered from the 406 rectal samples. Of the 120 MRA isolates, 3 (2.5%) were detected only after 48 hr of incubation. The use of modified CHROMagar Acinetobacter together with nasal and rectal swabs and 1-day incubation is an effective surveillance tool for detecting MRA colonization. PMID:23667846

  20. Antibacterial sensitivity of Acinetobacter strains isolated from nosocomial infections.


    Karsligil, T; Balci, I; Zer, Y


    Acinetobacter species can cause many types of hospital-acquired infection and play an important role in nosocomial pneumonia in intensive care units, skin and wound infections, and meningitis. They are of increasing importance because of their ability to rapidly develop resistance to the major groups of antibiotics. We aimed to determine the antibiotic sensitivity of Acinetobacter strains isolated from, and determined to be the cause of, hospital-acquired infections. A total of 156 cultures of Acinetobacter (strains of A. baumannii [136; 87.2%] and A. iwoffii [20; 12.8%]), were isolated from clinical samples taken from patients in different units of our hospital. Conventional bacterial identification methods and the Sceptor system were used. In the antibiotic sensitivity tests, A. baumannii was susceptible to imipenem (90.4%), norfloxacin (84.5%) and ciprofloxacin (65.4%), and A. iwoffii to amikacin (80.0%), ticarcillin/clavulanic acid (70.0%) and imipenem (60.0%). PMID:15303777

  1. A case of community-acquired Acinetobacter junii-johnsonii cellulitis.


    Henao-Martínez, Andrés F; González-Fontal, Guido R; Johnson, Steven


    Acinetobacter skin and soft tissue infection outside of the traumatic wound setting are rare occurrences. The majority of cases occur in the presence of significant comorbilities and by Acinetobacter baumanii. Herein a case is reported of community-onset, health-care-associated, non-traumatic cellulitis caused by Acinetobacter, species junii-johnsonii with bacteremia. This is the first reported case of Acinetobacter junii-johnsonii skin and soft tissue infection. Hemorrhagic bullae might be one of the clinical features of Acinetobacter cellulitis. PMID:23242290

  2. Acinetobacter Peritoneal Dialysis Peritonitis: A Changing Landscape over Time

    PubMed Central

    Chao, Chia-Ter; Lee, Szu-Ying; Yang, Wei-Shun; Chen, Huei-Wen; Fang, Cheng-Chung; Yen, Chung-Jen; Chiang, Chih-Kang; Hung, Kuan-Yu; Huang, Jenq-Wen


    Background Acinetobacter species are assuming an increasingly important role in modern medicine, with their persistent presence in health-care settings and antibiotic resistance. However, clinical reports addressing this issue in patients with peritoneal dialysis (PD) peritonitis are rare. Methods All PD peritonitis episodes caused by Acinetobacter that occurred between 1985 and 2012 at a single centre were retrospectively reviewed. Clinical features, microbiological data, and outcomes were analysed, with stratifications based upon temporal periods (before and after 2000). Results Acinetobacter species were responsible for 26 PD peritonitis episodes (3.5% of all episodes) in 25 patients. A. baumannii was the most common pathogen (54%), followed by A. iwoffii (35%), with the former being predominant after 2000. Significantly more episodes resulted from breaks in exchange sterility after 2000, while those from exit site infections decreased (P = 0.01). The interval between the last and current peritonitis episodes lengthened significantly after 2000 (5 vs. 13.6 months; P = 0.05). All the isolates were susceptible to cefepime, fluoroquinolone, and aminoglycosides, with a low ceftazidime resistance rate (16%). Nearly half of the patients (46%) required hospitalisation for their Acinetobacter PD-associated peritonitis, and 27% required an antibiotic switch. The overall outcome was fair, with no mortality and a 12% technique failure rate, without obvious interval differences. Conclusions The temporal change in the microbiology and origin of Acinetobacter PD-associated peritonitis in our cohort suggested an important evolutional trend. Appropriate measures, including technique re-education and sterility maintenance, should be taken to decrease the Acinetobacter peritonitis incidence in PD patients. PMID:25314341

  3. Molecular screening for alkane hydroxylase genes in Gram-negative and Gram-positive strains.


    Smits, T H; Röthlisberger, M; Witholt, B; van Beilen, J B


    We have developed highly degenerate oligonucleotides for polymerase chain reaction (PCR) amplification of genes related to the Pseudomonas oleovorans GPo1 and Acinetobacter sp. ADP1 alkane hydroxylases, based on a number of highly conserved sequence motifs. In all Gram-negative and in two out of three Gram-positive strains able to grow on medium- (C6-C11) or long-chain n-alkanes (C12-C16), PCR products of the expected size were obtained. The PCR fragments were cloned and sequenced and found to encode peptides with 43.2-93.8% sequence identity to the corresponding fragment of the P. oleovorans GPo1 alkane hydroxylase. Strains that were unable to grow on n-alkanes did not yield PCR products with homology to alkane hydroxylase genes. The alkane hydroxylase genes of Acinetobacter calcoaceticus EB104 and Pseudomonas putida P1 were cloned using the PCR products as probes. The two genes allow an alkane hydroxylase-negative mutant of Acinetobacter sp. ADP1 and an Escherichia coli recombinant containing all P. oleovorans alk genes except alkB, respectively, to grow on n-alkanes, showing that the cloned genes do indeed encode alkane hydroxylases. PMID:11207749

  4. Multidrug-Resistant Acinetobacter baumannii in Veterinary Clinics, Germany

    PubMed Central

    Prenger-Berninghoff, Ellen; Weiss, Reinhard; van der Reijden, Tanny; van den Broek, Peterhans; Baljer, Georg; Dijkshoorn, Lenie


    An increase in prevalence of multidrug-resistant Acinetobacter spp. in hospitalized animals was observed at the Justus-Liebig-University (Germany). Genotypic analysis of 56 isolates during 2000–2008 showed 3 clusters that corresponded to European clones I–III. Results indicate spread of genotypically related strains within and among veterinary clinics in Germany. PMID:21888812

  5. Geographical Patterns in Antimicrobial Resistance of Acinetobacter in Clinical Isolates

    PubMed Central

    Sehgal, Sonal; Prakash, S. Krishna


    Objectives: Acinetobacter spp. has emerged as a threat to the healthcare workers throughout the globe, owing to its property of multidrug resistance. The aim of the present study was to evaluate the antimicrobial resistance patterns of Acinetobacter spp. among indoor and out patients in our hospital and compare the resistance patterns in India and abroad. Materials and Methods: In this retrospective study, which was carried out between Over a period of one year, a total of 5593 clinical specimens of pus and purulent fluids were examined and antimicrobial resistance pattern for Acinetobacter spp. using Modified Stoke’s were evaluated. Also a comparison was done with the other similar studies. Statistical Analysis: Using the proportions of sensitive and resistant, the statistical analysis was done. The total, mean and percentage were calculated by using SPSS. Results: A high level of antimicrobial multidrug-resistance was found in almost all the clinical isolate. Our study was also found to be concordant with the results of other studies. Conclusion: There is an emerging need for identification of the genes and mechanisms for multidrug resistance among Acinetobacter spp. PMID:24959441

  6. Acinetobacter plantarum sp. nov. isolated from wheat seedlings plant.


    Du, Juan; Singh, Hina; Yu, Hongshan; Jin, Feng-Xie; Yi, Tae-Hoo


    Strain THG-SQM11(T), a Gram-negative, aerobic, non-motile, coccus-shaped bacterium, was isolated from wheat seedlings plant in P. R. China. Strain THG-SQM11(T) was closely related to members of the genus Acinetobacter and showed the highest 16S rRNA sequence similarities with Acinetobacter junii (97.9 %) and Acinetobacter kookii (96.1 %). DNA-DNA hybridization showed 41.3 ± 2.4 % DNA reassociation with A. junii KCTC 12416(T). Chemotaxonomic data revealed that strain THG-SQM11(T) possesses ubiquinone-9 as the predominant respiratory quinone, C18:1 ω9c, summed feature 3 (C16:1 ω7c and/or C16:1 ω6c), and C16:0 as the major fatty acids. The major polar lipids were found to be diphosphatidylglycerol, phosphatidylethanolamine, phosphatidylglycerol, and phosphatidylcholine. The DNA G+C content was 41.7 mol %. These data, together with phenotypic characterization, suggest that the isolate represents a novel species, for which the name Acinetobacter plantarum sp. nov. is proposed, with THG-SQM11(T) as the type strain (=CCTCC AB 2015123(T) =KCTC 42611(T)). PMID:26869166

  7. Characterization of Acinetobacter baumannii biofilm associated components

    NASA Astrophysics Data System (ADS)

    Brossard, Kari A.

    Acinetobacter baumannii is a Gram-negative aerobic coccobaccillus that is a major cause of nosocomial infections worldwide. Infected individuals may develop pneumonia, urinary tract, wound, and other infections that are associated with the use of indwelling medical devices such as catheters and mechanical ventilation. Treatment is difficult because many A. baumannii isolates have developed multi-drug resistance and the bacterium can persist on abiotic surfaces. Persistence and resistance may be due to formation of biofilms, which leads to long-term colonization, evasion of the host immune system and resistance to treatment with antibiotics and disinfectants. While biofilms are complex multifaceted structures, two bacterial components that have been shown to be important in formation and stability are exopolysaccharides (EPS) and the biofilm-associated protein (Bap). An EPS, poly-beta-1,6-N-acetylglucosamine, PNAG, has been described for E. coli and S. epidermidis. PNAG acts as an intercellular adhesin. Production of this adhesin is dependent on the pga/icaABCD locus. We have identified a homologous locus in A. baumannii 307-0294 that is involved in production of an exopolysaccharide, recognized by an anti-PNAG antibody. We hypothesized that the A. baumannii pgaABCD locus plays a role in biofilm formation, and protection against host innate defenses and disinfectants suggesting that PNAG is a possible virulence factor for the organism. The first aim of this thesis will define the pgaABCD locus. We have previously identified Bap, a protein with similarity to those described for S. aureus and we have demonstrated that this protein is involved in maintaining the stability of biofilms on glass. We hypothesized that A. baumannii Bap plays a role in persistence and pathogenesis and is regulated by quorum sensing. In our second aim we will examine the role of Bap in attachment and biofilm formation on medically relevant surfaces and also determine if Bap is involved in

  8. Evaluation of CHROMagar Acinetobacter for Detection of Enteric Carriage of Multidrug-Resistant Acinetobacter baumannii in Samples from Critically Ill Patients▿

    PubMed Central

    Gordon, N. C.; Wareham, D. W.


    CHROMagar Acinetobacter was used to screen stool and perineal swabs for enteric carriage of multidrug-resistant Acinetobacter baumannii in samples from critically ill patients. Results were compared with a molecular assay resulting in sensitivity and specificity of culture compared to PCR of 91.7% and 89.6%, respectively. PMID:19439546

  9. Taxonomy of haemolytic and/or proteolytic strains of the genus Acinetobacter with the proposal of Acinetobacter courvalinii sp. nov. (genomic species 14 sensu Bouvet & Jeanjean), Acinetobacter dispersus sp. nov. (genomic species 17), Acinetobacter modestus sp. nov., Acinetobacter proteolyticus sp. nov. and Acinetobacter vivianii sp. nov.


    Nemec, Alexandr; Radolfova-Krizova, Lenka; Maixnerova, Martina; Vrestiakova, Eliska; Jezek, Petr; Sedo, Ondrej


    We aimed to define the taxonomic status of 40 haemolytic and/or proteolytic strains of the genus Acinetobacter which were previously classified into five putative species termed as genomic species 14BJ (n = 9), genomic species 17 (n = 9), taxon 18 (n = 7), taxon 19 (n = 6) and taxon 20 (n = 9). The strains were recovered mostly from human clinical specimens or soil and water ecosystems and were highly diverse in geographical origin and time of isolation. Comparative analysis of the rpoB and gyrB gene sequences of all strains, and the whole-genome sequences of selected strains, showed that these putative species formed five respective, well-supported clusters within a distinct clade of the genus Acinetobacter which typically, although not exclusively, encompasses strains with strong haemolytic activity. The whole-genome-based average nucleotide identity (ANIb) values supported the species status of each of these clusters. Moreover, the distinctness and coherence of the clusters were supported by whole-cell profiling based on MALDI-TOF MS. Congruent with these findings were the results of metabolic and physiological testing. We conclude that the five putative taxa represent respective novel species, for which the names Acinetobacter courvalinii sp. nov. (type strain ANC 3623T = CCUG 67960T = CIP 110480T = CCM 8635T), Acinetobacter dispersus sp. nov. (type strain ANC 4105T = CCUG 67961T = CIP 110500T = CCM 8636T), Acinetobacter modestus sp. nov. (type strain NIPH 236T = CCUG 67964T = CIP 110444T = CCM 8639T), Acinetobacter proteolyticus sp. nov. (type strain NIPH 809T = CCUG 67965T = CIP 110482T = CCM 8640T) and Acinetobacter vivianii sp. nov. (type strain NIPH 2168T = CCUG 67967T = CIP 110483T = CCM 8642T) are proposed. PMID:26822020

  10. Acinetobacter lipases: molecular biology, biochemical properties and biotechnological potential.


    Snellman, Erick A; Colwell, Rita R


    Lipases (EC have received increased attention recently, evidenced by the increasing amount of information about lipases in the current literature. The renewed interest in this enzyme class is due primarily to investigations of their role in pathogenesis and their increasing use in biotechnological applications. Also, many microbial lipases are available as commercial products, the majority of which are used in detergents, cosmetic production, food flavoring, and organic synthesis. Lipases are valued biocatalysts because they act under mild conditions, are highly stable in organic solvents, show broad substrate specificity, and usually show high regio- and/or stereo-selectivity in catalysis. A number of lipolytic strains of Acinetobacter have been isolated from a variety of sources and their lipases possess many biochemical properties similar to those that have been developed for biotechnological applications. This review discusses the biology of lipase expression in Acinetobacter, with emphasis on those aspects relevant to potential biotechnology applications. PMID:15378387

  11. Membrane proteomes of Pseudomonas aeruginosa and Acinetobacter baumannii.


    Dé, E; Cosette, P; Coquet, L; Siroy, A; Alexandre, S; Duncan, A; Naudin, B; Rihouey, C; Schaumann, A; Junter, G A; Jouenne, T


    Acinetobacter baumannii and Pseudomonas aeruginosa are known for their intrinsic resistance to antibiotics. Between mechanisms involved in this resistance, diminished expression of outer membrane proteins and up-regulation of efflux pumps play an important role. The characterization of membrane proteins is consequently necessary because of their importance in the antibiotic resistance but also in virulence. This review presents proteomic investigations aiming to describe the protein content of the membranes of these two bacterial species. PMID:19942379

  12. First report of OXA-72 producing Acinetobacter baumannii in Romania.


    Georgescu, M; Gheorghe, I; Dudu, A; Czobor, I; Costache, M; Cristea, V-C; Lazăr, V; Chifiriuc, M C


    This is the first report of an OXA-72-producing Acinetobacter baumannii strain in Romania, isolated from chronic leg ulcer samples. Identification of the strain was performed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. Presence of carbapenem resistance genes was investigated by PCR and sequencing. Our data support the spread of the bla OXA-72 gene in Eastern Europe. PMID:27547405

  13. Tigecycline Efflux as a Mechanism for Nonsusceptibility in Acinetobacter baumannii.


    Peleg, Anton Y; Adams, Jennifer; Paterson, David L


    Tigecycline has an extended spectrum of in vitro antimicrobial activities, including that against multidrug-resistant Acinetobacter. After identifying bloodstream isolates of Acinetobacter with reduced susceptibilities to tigecycline, we performed a study to assess tigecycline efflux mediated by the resistance-nodulation-division-type transporter AdeABC. After exposure of two tigecycline-nonsusceptible isolates to the efflux pump inhibitor phenyl-arginine-beta-naphthylamide (PABN), a fourfold reduction in the tigecycline MIC was observed. Both tigecycline-susceptible and -nonsusceptible isolates were found to carry the gene coding for the transmembrane component of the AdeABC pump, adeB, and the two-component regulatory system comprising adeS and adeR. Previously unreported point mutations were identified in the regulatory system in tigecycline-nonsusceptible isolates. Real-time PCR identified 40-fold and 54-fold increases in adeB expression in the two tigecycline-nonsusceptible isolates compared to that in a tigecycline-susceptible isolate. In vitro exposure of a tigecycline-susceptible clinical strain to tigecycline caused a rapid rise in the MIC of tigecycline from 2 microg/ml to 24 microg/ml, which was reversible with PABN. A 25-fold increase in adeB expression was observed in a comparison between this tigecycline-susceptible isolate and its isogenic tigecycline-nonsusceptible mutant. These results indicate that an efflux-based mechanism plays a role in reduced tigecycline susceptibility in Acinetobacter. PMID:17420217

  14. Tigecycline Efflux as a Mechanism for Nonsusceptibility in Acinetobacter baumannii▿

    PubMed Central

    Peleg, Anton Y.; Adams, Jennifer; Paterson, David L.


    Tigecycline has an extended spectrum of in vitro antimicrobial activities, including that against multidrug-resistant Acinetobacter. After identifying bloodstream isolates of Acinetobacter with reduced susceptibilities to tigecycline, we performed a study to assess tigecycline efflux mediated by the resistance-nodulation-division-type transporter AdeABC. After exposure of two tigecycline-nonsusceptible isolates to the efflux pump inhibitor phenyl-arginine-β-naphthylamide (PABN), a fourfold reduction in the tigecycline MIC was observed. Both tigecycline-susceptible and -nonsusceptible isolates were found to carry the gene coding for the transmembrane component of the AdeABC pump, adeB, and the two-component regulatory system comprising adeS and adeR. Previously unreported point mutations were identified in the regulatory system in tigecycline-nonsusceptible isolates. Real-time PCR identified 40-fold and 54-fold increases in adeB expression in the two tigecycline-nonsusceptible isolates compared to that in a tigecycline-susceptible isolate. In vitro exposure of a tigecycline-susceptible clinical strain to tigecycline caused a rapid rise in the MIC of tigecycline from 2 μg/ml to 24 μg/ml, which was reversible with PABN. A 25-fold increase in adeB expression was observed in a comparison between this tigecycline-susceptible isolate and its isogenic tigecycline-nonsusceptible mutant. These results indicate that an efflux-based mechanism plays a role in reduced tigecycline susceptibility in Acinetobacter. PMID:17420217

  15. Acinetobacter community-acquired pneumonia in a healthy child.


    Moreira Silva, G; Morais, L; Marques, L; Senra, V


    Acinetobacter is involved in a variety of infectious diseases primarily associated with healthcare. Recently there has been increasing evidence of the important role these pathogens play in community acquired infections. We report on the case of a previously healthy child, aged 28 months, admitted for fever, cough and pain on the left side of the chest, which on radiographic examination corresponded to a lower lobe necrotizing pneumonia. After detailed diagnostic work-up, community acquired Acinetobacter lwoffii pneumonia was diagnosed. The child had frequently shared respiratory equipment with elderly relatives with chronic obstructive pulmonary disease. As there were no other apparent risk factors, it could be assumed that the sharing of the equipment was the source of infection. The authors wish to draw attention to this possibility, that a necrotising community-acquired pneumonia due to Acinetobacter lwoffii can occur in a previously healthy child and to the dangers of inappropriate use and poor sterilisation of nebulisers. This case is a warning of the dangers that these bacteria may pose in the future in a community setting. PMID:21963110

  16. Genome Sequence of Jumbo Phage vB_AbaM_ME3 of Acinetobacter baumanni

    PubMed Central

    Buttimer, Colin; O’Sullivan, Lisa; Elbreki, Mohamed; Neve, Horst; McAuliffe, Olivia; Ross, R. Paul; Hill, Colin; O’Mahony, Jim


    Bacteriophage (phage) vB_AbaM_ME3 was previously isolated from wastewater effluent using the propagating host Acinetobacter baumannii DSM 30007. The full genome was sequenced, revealing it to be the largest Acinetobacter bacteriophage sequenced to date with a size of 234,900 bp and containing 326 open reading frames (ORFs). PMID:27563033

  17. Genome Sequence of Jumbo Phage vB_AbaM_ME3 of Acinetobacter baumanni.


    Buttimer, Colin; O'Sullivan, Lisa; Elbreki, Mohamed; Neve, Horst; McAuliffe, Olivia; Ross, R Paul; Hill, Colin; O'Mahony, Jim; Coffey, Aidan


    Bacteriophage (phage) vB_AbaM_ME3 was previously isolated from wastewater effluent using the propagating host Acinetobacter baumannii DSM 30007. The full genome was sequenced, revealing it to be the largest Acinetobacter bacteriophage sequenced to date with a size of 234,900 bp and containing 326 open reading frames (ORFs). PMID:27563033

  18. Emergence of NDM-1 and OXA-72 producing Acinetobacter pittii clinical isolates in Lebanon.


    Al Atrouni, A; Joly-Guillou, M-L; Hamze, M; Kempf, M


    Acinetobacter spp. have emerged as global opportunistic pathogen causing a wide range of infections. Emergence of carbapenem resistance in these organisms is a matter of great concern. We report here the first detection of Acinetobacter pittii clinical isolates in Lebanon carrying either the bla NDM-1 or the bla OXA-72 gene. PMID:27222717

  19. Molecular analysis of imipenem-resistant Acinetobacter baumannii isolated from US service members wounded in Iraq, 2003–2008

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Clonal spread and global dissemination of imipenem resistant (IR) A. baumannii-A. calcoaceticus complex (ABC) have been reported in recent years. However, the epidemiological features of the IR-ABCs in military treatment facilities (MTFs) have not been systematically studied. In this study, 298 ABC...

  20. Molecular characteristics of Multidrug Resistant Acinetobacter baumannii Isolates from US soldiers from Iraq at the National Naval Medical Center

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background: Infections with A. baumannii-calcoaceticus complex (ABC) have complicated the care of combat casualties. The majority of A. baumannii isolates cultured from injured personnel from OIF and OEF have been multi drug resistant (MDR). Therefore, the genes causing MDR and genotypes related to ...

  1. Molecular characteristics of Multidrug Resistant Acinetobacter baumannii Isolates from US soldiers from Iraq at the National Naval Medical Center

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background: Infections with A. baumannii-calcoaceticus complex (ABC) have complicated the care of combat casualties, and the spread and global dissemination of imipenem resistant (IR) clones of ABC have been reported in recent years. However, the epidemiological features of the IR-ABCs in military t...

  2. Acinetobacter sp. isolates from emergency departments in two hospitals of South Korea.


    Choi, Ji-Young; Ko, Eun Ah; Kwon, Ki Tae; Lee, Shinwon; Kang, Choel In; Chung, Doo-Ryeon; Peck, Kyong Ran; Song, Jae-Hoon; Ko, Kwan Soo


    A total of 114 Acinetobacter sp. isolates were collected from patients in the emergency departments (EDs) of two Korean hospitals. Most isolates belonged to the Acinetobacter baumannii complex (105 isolates, 92.1 %). Imipenem resistance was found in 39 isolates (34.2 %) of the Acinetobacter sp. isolates, and 6 colistin-resistant isolates were also identified. Species distribution and antimicrobial-resistance rates were different between the two hospitals. In addition, two main clones were identified in the imipenem-resistant A. baumannii isolates from hospital B, but very diverse and novel genotypes were found in those from hospital A. Many Acinetobacter sp. isolates, including the imipenem-resistant A. baumannii, are considered to be associated with the community. The evidence of high antimicrobial resistance and different features in these Acinetobacter sp. isolates between the two EDs suggests the need for continuous testing to monitor changes in epidemiology. PMID:25062943

  3. Coculture degradation of selected PCB congeners by two Acinetobacter sp

    SciTech Connect

    Adriaens, P.


    Polychlorinated biphenyls (PCBs) have been introduced in the environment for nearly six decades and are considered to be refractile to microbial attack, since PCBs have to be degraded via cometabolic processes, which occur in the obligate presence of an alternative growth substrate. However, cometabolism of PCBs has been demonstrated to accumulate chlorobenzoates as the main intermediates. Therefore, the complete mineralization of PCBs can only be obtained by coculturing at least a PCB cometabolizing and a chlorobenzoate utilizing microorganism, or by constructing a recombinant strain harboring the complementary pathways of both strains. Therefore, coculture mineralization of PCBs in suspended culture was obtained by providing biphenyl or 4-chlorobiphenyl as the growth substrate for Acinetobacter sp. strain P6, a PCB cometabolizer, while the chlorobenzoates were used as growth substrates by Acinetobacter sp. strain 4-CB1, which was isolated on 4-chlorobenzoate. 4-Chlorobenzoate (4-CB) was metabolized after hydrolytic dehalogenation to 4-hydroxybenzoate (4-HB) via the protocatechuate pathway. Acinetobacter sp. strain 4-CB1 has the metabolic ability to carry out the degradation of 3,4-DCB. Although this strain does not grow on this compound, it cometabolizes 3,4-DCB to 3-chloro-4-hydroxybenzoate (3-C-4-OHB), which is used as a growth substrate and further metabolized via 4-carboxy-1,2-benzoquinone. This degradation process was termed cryptic cometabolism. 3,4-DCB has shown to be a substrate inhibitor (Ki = 1,840 {mu}M) and an uncompetitive inhibitor for 4-CB metabolism. Additionally, 3-C-4-OHB was a competitive inhibitor (Ki = 12 {mu}M) for the 4-HB monooxygenase, while the quinone uncompetitively inhibited 4-CB metabolism (Ki = 50 {mu}M).

  4. Proliferation of spacecraft-associated Acinetobacter on alcohol solvents

    NASA Astrophysics Data System (ADS)

    Mogul, Rakesh; Cepeda, Ivonne; Brasali, Hania; Gornick, Trevor; Jain, Chirag; Kim, Eun Jin; Nguyen, Vinh Bao; Oei, Alex; Rodriguez, Joseph; Walker, Jillian; Savla, Gautam

    The Acinetobacter are the most abundant Gram-negative and non-spore forming bacteria found in the cleanroom facilities for Mars spacecraft. The spacecraft-associated Acinetobacter are extremotolerant towards hydrogen peroxide and have been shown to increase in abundance as a result of the spacecraft assembly process. To better understand the oligotrophic growth in the cleanroom environments, we have measured the growth of several Acinetobacter strains against ethanol and isopropanol, which are cleaning solvents used in the spacecraft assembly process. Our studies show that A. radioresistens 50v1, which was isolated from Mars Odyssey orbiter, optimally proliferates on 300 mM ethanol under minimal conditions at a growth rate that is 2-fold higher than that of the A. radioresistens type strain (strain 43998 (T) ). The impact of transition metals on the growth rates followed the trend of Fe (2+) > Mn (2+) > Zn (2+) , where Zn (2+) was inhibitory. In contrast, no growth on ethanol was observed for the novel species A. phoenicis 2P01AA, which was isolated from the facilities for the Mars Phoenix lander. Alcohol dehydrogenase activities measured in rich and minimal media paralleled these observations with the 50v1 strain possessing higher specific activities than the type strain, and the 2P01AA strain displaying no measurable activity in rich media. Preliminary studies indicate that isopropanol is insufficient as an energy source when in culture. The significance of these results as well as the observed differences between the Odyssey and Phoenix-associated strains will be discussed.

  5. Efflux-Mediated Antibiotic Resistance in Acinetobacter spp. ▿

    PubMed Central

    Coyne, Sébastien; Courvalin, Patrice; Périchon, Bruno


    Among Acinetobacter spp., A. baumannii is the most frequently implicated in nosocomial infections, in particular in intensive care units. It was initially thought that multidrug resistance (MDR) in this species was due mainly to horizontal acquisition of resistance genes. However, it has recently become obvious that increased expression of chromosomal genes for efflux systems plays a major role in MDR. Among the five superfamilies of pumps, resistance-nodulation-division (RND) systems are the most prevalent in multiply resistant A. baumannii. RND pumps typically exhibit a wide substrate range that can include antibiotics, dyes, biocides, detergents, and antiseptics. Overexpression of AdeABC, secondary to mutations in the adeRS genes encoding a two-component regulatory system, constitutes a major mechanism of multiresistance in A. baumannii. AdeIJK, intrinsic to this species, is responsible for natural resistance, but since overexpression above a certain threshold is toxic for the host, its contribution to acquired resistance is minimal. The recently described AdeFGH, probably regulated by a LysR-type transcriptional regulator, also confers multidrug resistance when overexpressed. Non-RND efflux systems, such as CraA, AmvA, AbeM, and AbeS, have also been characterized for A. baumannii, as have AdeXYZ and AdeDE for other Acinetobacter spp. Finally, acquired narrow-spectrum efflux pumps, such as the major facilitator superfamily (MFS) members TetA, TetB, CmlA, and FloR and the small multidrug resistance (SMR) member QacE in Acinetobacter spp., have been detected and are mainly encoded by mobile genetic elements. PMID:21173183

  6. Modifying enzymes related aminoglycoside: analyses of resistant Acinetobacter isolates

    PubMed Central

    Atasoy, Ali Riza; Ciftci, Ihsan Hakki; Petek, Mustafa


    Enzymatic modification of aminoglycosides by nucleotidyltransferases, acetyltransferases and/or phosphotransferases accounts for the majority of aminoglycoside-resistant Acinetobacter isolates. In this study, we investigated the relationship between aminoglycoside resistance and the presence of aminoglycoside-modifying enzymes in Acinetobacter baumannii clinical isolate groups with different resistance profiles. Thirty-two clinical A. baumannii isolates were included in this study. Acinetobacter isolates were divided into 4 groups according to results of susceptibility testing. The presence of genes encoding the following aminoglycoside-modifying enzymes; aph (3’)-V1, aph (3’)-Ia, aac (3)-Ia, aac (3) IIa, aac (6’)-Ih, aac (6’)-Ib and ant (2’)-Ia responsible for resistance was investigated by PCR in all strains. The acetyltransferase (aac (6’)-Ib, aac (3)-Ia) and phosphotransferase (aph (3’)-Ia) gene regions were identified in the first group, which comprised nine imipenem, meropenem, and gentamicin-resistant isolates. The acetyltransferase (aac (6’)-Ib, aac (3)-Ia), phosphotransferase (aph (3’)-VI) and nucleotidyltransferase (ant2-Ia) gene regions were identified in the second group, which was composed of nine imipenem-resistant, meropenem-resistant and gentamicin-sensitive isolates. The acetyltransferase (aac (3)-Ia) and phosphotransferase (aph (3’)-Ia) regions were identified in the fourth group, which comprised eight imipenem-sensitive, meropenem-sensitive and gentamicin-resistant isolates. Modifying enzyme gene regions were not detected in the third group, which was composed of six imipenem, meropenem and gentamicin-sensitive isolates. Our data are consistent with previous reports, with the exception of four isolates. Both acetyltransferases and phosphotransferases were widespread in A. baumannii clinical isolates in our study. However, the presence of the enzyme alone is insufficient to explain the resistance rates. Therefore, the

  7. Prevalence of Aminoglycoside Resistance Genes in Acinetobacter baumannii Isolates

    PubMed Central

    Aliakbarzade, Katayun; Farajnia, Safar; Karimi Nik, Ashraf; Zarei, Farzaneh; Tanomand, Asghar


    Background: Acinetobacter baumannii is one of the major causes of nosocomial infections and is resistant to most available antibiotics. Aminoglycosides remain as drugs of choice for treatment of Acinetobacter infections yet resistance to aminoglycosides has increased in the recent years. Objectives: The present study investigated the prevalence of genes encoding aminoglycoside-modifying enzymes in A. baumannii strains isolated from patients of Tabriz city, northwest of Iran. Materials and Methods: A total of 103 Acinetobacter isolates were collected from Imam Reza Hospital of Tabriz University of medical sciences. Antimicrobial susceptibility patterns of the isolates to different antimicrobial agents including cephalosporins, gentamicin, amikacin, tobramycin, colistin and polymyxin, were evaluated by the disc diffusion method. The frequency of aminoglycoside modifying enzymes encoding genes aacC1, aphA6, aadA1 and aadB was analyzed by the PCR method. Results: Antimicrobial susceptibility analysis showed that the highest resistance was towards beta−lactam antibiotics including cephalosporins whereas the highest sensitivity was observed towards colistin (77%) and polymyxin (84%). The resistance rate to aminoglycosides was 81%, 86% and 63% for amikacin, gentamicin and tobramycin, respectively. The PCR results showed that among the 103 A. baumannii isolates, 56 (65.11 %) were positive for aacC1, 52 (60.46 %) for aphA6, 24 (27.9 %) for aadA1 and 16 (18.6 %) for aadB resistant genes. Conclusions: The results of this study indicated that the genes encoding aminoglycoside-modifying enzymes are prevalent in A. baumannii isolates in the study region, which highlighted the necessity of considering preventive measures to control dissemination of these resistance genes. PMID:25632323

  8. Antimicrobial susceptibilities of clinical isolates of Acinetobacter baumannii from Singapore.


    Kuah, B G; Kumarasinghe, G; Doran, J; Chang, H R


    The in vitro activities of 17 antimicrobial agents alone or in combination against 70 clinical isolates of Acinetobacter baumannii from Singapore were determined by broth microdilution. The MICs of amoxicillin, ampicillin, ceftazidime, ceftriaxone, gentamicin, and piperacillin for 90% of the strains were > or = 128 micrograms/ml. Addition of sulbactam to ampicillin produced improved activity, whereas adding tazobactam to piperacillin did not. The MICs of amikacin, ciprofloxacin, and imipenem for 90% of the strains were 32, 32, and 16 micrograms/ml, respectively. PMID:7840598

  9. Acinetobacter infection is associated with acquired glucose intolerance in burn patients.


    Furniss, Dominic; Gore, Sinclair; Azadian, Berge; Myers, Simon R


    Infection with antibiotic-resistant Acinetobacter spp. is an increasing problem in critical care environments worldwide. Acinetobacter spp. are known to produce an insulin-cleaving protease. We hypothesized that infection with Acinetobacter spp. was associated with the acquisition of glucose intolerance in burn patients. Data were collected prospectively on all 473 patients admitted to the Burns Centre between January 2002 and March 2003. A total of 3.4% of patients acquired glucose intolerance during admission. Patients with Acinetobacter spp. infection were 9.8 times more likely to develop glucose intolerance than those without the infection (P < .0001). The association persisted after controlling for TBSA (P < .001). In patients with deep Acinetobacter spp. infection, 47% had glucose intolerance, compared with 12% in those with infection of the burn only (P = .03). In patients with pre-existing diabetes mellitus, 27% developed Acinetobacter spp. infection compared with only 8.5% of patients without diabetes (P = .04). This study demonstrates a clear association between Acinetobacter spp. infection and glucose intolerance in burns patients. PMID:16151285

  10. Successful Eradication of Multidrug Resistant Acinetobacter in the Helsinki Burn Centre.


    Lindford, Andrew; Kiuru, Valtteri; Anttila, Veli-Jukka; Vuola, Jyrki


    Multidrug-resistant (MDR) Acinetobacter is an important pathogen implicated in nosocomial infections in healthcare environments. Virulence factors, resistance mechanisms, and limited therapeutic options make this pathogen a major problem currently facing burn intensive care units (ICUs) worldwide. The purpose of this study was to assess the effect of infection control measures taken in Helsinki Burn Centre in 2001 on MDR Acinetobacter prevalence in ICU burn patients. Data were retrospectively collected from patient files from 1998 to 2012. ICU burn patients were defined as those with either over 30% of total body surface area burnt or requiring mechanical ventilation. Inclusion criteria consisted of patients who tested positive for Acinetobacter sp. in routine bacterial cultures or cultures taken because of a clinically suspected infection. Infection control interventions performed in 2001 consisted of various shower room renovations and changes in hospital hygiene and burn treatment regimes. Between 1998 and 2012, 75 patients were diagnosed with Acinetobacter sp. colonization. Following the infection control interventions the incidence of Acinetobacter sp. radically declined. Between 1998 and 2001, there were 31 cases of MDR Acinetobacter colonizations diagnosed, but from 2002 to 2012 no MDR strains were found. Changes to hospital hygiene and wound treatment protocols as well as structural changes to the hospital environment can have a major impact on preventing and treating Acinetobacter outbreaks in burn centers. PMID:25501783

  11. Treatment for patients with multidrug resistant Acinetobacter baumannii pulmonary infection

    PubMed Central



    Bacterial infections are common but have become increasingly resistant to drugs. The aim of the present study was to examine the combined treatment of traditional Chinese and Western medicine in 30 cases of pulmonary infection with multidrug resistant Acinetobacter baumannii. Patients were divided into groups A and B according to drug treatments. Cefoperazone or sulbactam and tanreqing were administered in group A, and cefoperazone or sulbactam in group B. The curative effect and prognosis of the two groups were recorded and the remaining treatments were performed routinely in the clinic. For the combined therapy group, which was administered sulperazone and tanreqing, 8 patients were recovered, 6 patients had significant effects, 3 patients exhibited some improvement and 1 patient had no response. One of the patients did not survive after 28 days. By contrast, there were 4 patients that were successfully treated, 3 patients with significant effects, 2 patients with some improvement and 2 patients had no response in the sulperazone group, and 4 patients did not survive after 28 days. In conclusion, the combined therapy of cefoperazone or sulbactam supplemented with tanreqing was identified to be more effective than cefoperazone or sulbactam as monotherapy, for treating multidrug resistant Acinetobacter baumannii. PMID:27073447

  12. Antimicrobial active herbal compounds against Acinetobacter baumannii and other pathogens.


    Tiwari, Vishvanath; Roy, Ranita; Tiwari, Monalisa


    Bacterial pathogens cause a number of lethal diseases. Opportunistic bacterial pathogens grouped into ESKAPE pathogens that are linked to the high degree of morbidity, mortality and increased costs as described by Infectious Disease Society of America. Acinetobacter baumannii is one of the ESKAPE pathogens which cause respiratory infection, pneumonia and urinary tract infections. The prevalence of this pathogen increases gradually in the clinical setup where it can grow on artificial surfaces, utilize ethanol as a carbon source and resists desiccation. Carbapenems, a β-lactam, are the most commonly prescribed drugs against A. baumannii. The high level of acquired and intrinsic carbapenem resistance mechanisms acquired by these bacteria makes their eradication difficult. The pharmaceutical industry has no solution to this problem. Hence, it is an urgent requirement to find a suitable alternative to carbapenem, a commonly prescribed drug for Acinetobacter infection. In order to do this, here we have made an effort to review the active compounds of plants that have potent antibacterial activity against many bacteria including carbapenem resistant strain of A. baumannii. We have also briefly highlighted the separation and identification methods used for these active compounds. This review will help researchers involved in the screening of herbal active compounds that might act as a replacement for carbapenem. PMID:26150810

  13. Antimicrobial active herbal compounds against Acinetobacter baumannii and other pathogens

    PubMed Central

    Tiwari, Vishvanath; Roy, Ranita; Tiwari, Monalisa


    Bacterial pathogens cause a number of lethal diseases. Opportunistic bacterial pathogens grouped into ESKAPE pathogens that are linked to the high degree of morbidity, mortality and increased costs as described by Infectious Disease Society of America. Acinetobacter baumannii is one of the ESKAPE pathogens which cause respiratory infection, pneumonia and urinary tract infections. The prevalence of this pathogen increases gradually in the clinical setup where it can grow on artificial surfaces, utilize ethanol as a carbon source and resists desiccation. Carbapenems, a β-lactam, are the most commonly prescribed drugs against A. baumannii. The high level of acquired and intrinsic carbapenem resistance mechanisms acquired by these bacteria makes their eradication difficult. The pharmaceutical industry has no solution to this problem. Hence, it is an urgent requirement to find a suitable alternative to carbapenem, a commonly prescribed drug for Acinetobacter infection. In order to do this, here we have made an effort to review the active compounds of plants that have potent antibacterial activity against many bacteria including carbapenem resistant strain of A. baumannii. We have also briefly highlighted the separation and identification methods used for these active compounds. This review will help researchers involved in the screening of herbal active compounds that might act as a replacement for carbapenem. PMID:26150810

  14. Acinetobacter baumannii in Localised Cutaneous Mycobacteriosis in Falcons.


    Muller, Margit Gabriele; George, Ancy Rajeev; Walochnik, Julia


    Between May 2007 and April 2009, 29 falcons with identically localized, yellowish discolored cutaneous lesions in the thigh and lateral body wall region were presented at Abu Dhabi Falcon Hospital. Out of 18 falcons integrated in this study, 16 tested positive to Mycobacterium. avium complex. The 2 negative falcons tested positive in the Mycobacterium genus PCR. Moreover, 1 falcon tested positive to M. avium. paratuberculosis in tissue samples by PCR. In all cases, blood and fecal samples tested negative. In the acid-fast stain, all samples showed the for mycobacteriosis typical rods. Moreover, in 13 samples Acinetobacter baumannii was detected by PCR and proven by DNA sequencing. Clinical features included highly elevated WBCs, heterophilia, lymphocytopenia, monocytosis, severe anemia and weight loss. A. baumannii, a gram-negative bacillus with the ability to integrate foreign DNA, has emerged as one of the major multidrug resistant bacteria. In veterinary medicine, it has so far been detected in dogs, cats, horses and wild birds. To the authors' knowledge, this is the first report of an A. baumannii infection in falcons and of a veterinary Mycobacterium-Acinetobacter coinfection. PMID:20871867

  15. Occurrence of High Catalase-containing Acinetobacter in Spacecraft Assembly Facilities

    NASA Astrophysics Data System (ADS)

    McCoy, K. B.; Derecho, I.; La Duc, M. T.; Vaishampayan, P.; Venkateswaran, K. J.; Mogul, R.


    In summary, the measurement of high catalase specific activity values for spacecraft-associated Acinetobacter strains is potentially the result of adaptation towards the harsh conditions of the clean rooms and assembly process.

  16. Antibiotic susceptibility of Acinetobacter species in intensive care unit in Montenegro.


    Mijovic, Gordana; Pejakov, Ljubica; Vujosevic, Danijela


    The global increase in multidrug resistance of Acinetobacter has created widespread problems in the treatment of patients in intensive care units (ICUs). The aim of this study was to assess the current level of antimicrobial susceptibility of Acinetobacter species in ICU of Clinical Centre of Montenegro and determine their epidemiology. Antibiotic susceptibility was tested in 70 isolates of Acinetobacter collected from non-repeating samples taken from 40 patients. The first nine isolates were genotyped by repetitive sequence-based PCR (rep-PCR). Tigecycline was found to be the most active antimicrobial agent with 80.6% of susceptibility. All the isolates were multidrug resistant with fully resistance to cefalosporinas, piperacillin and piperacillin/tazobactam. More than half of them (58.5%) were probably extensively resistant. Seven out of nine examined strains were clonally related by rep-PCR. Our results showed extremely high rate of multidrug resistance (MDR) of Acinetobacter isolates and high percentage of its clonally spreading. PMID:25979577

  17. The first cases of human bacteremia caused by Acinetobacter seifertii in Japan.


    Kishii, Kozue; Kikuchi, Ken; Tomida, Junko; Kawamura, Yoshiaki; Yoshida, Atsushi; Okuzumi, Katsuko; Moriya, Kyoji


    Acinetobacter seifertii, a novel species of Acinetobacter, was first reported in 2015. A. seifertii strains were isolated from human clinical specimens (blood, respiratory tract, and ulcer) and hospital environments. Here, we report the first cases of bacteremia caused by A. seifertii in patients with catheter-related bloodstream infection in Japan. The patients favorably recovered, without any complications, after removal of the peripheral intravenous catheters and administration of antibiotics. The pathogens were initially identified as Acinetobacter baumannii, using phenotypic methods and the MicroScan Walkaway System; however, rpoB gene sequence analysis indicated 99.54% similarity to A. seifertii. Moreover, antimicrobial susceptibility testing revealed that one of the strains was not susceptible to gentamicin and ceftazidime. Our report shows that Acinetobacter species other than A. baumannii can also cause nosocomial infections and that accurate methods for the identification of causative agents should be developed. PMID:26778251

  18. Contamination of Ambient Air with Acinetobacter baumannii on Consecutive Inpatient Days.


    Shimose, Luis A; Doi, Yohei; Bonomo, Robert A; De Pascale, Dennise; Viau, Roberto A; Cleary, Timothy; Namias, Nicholas; Kett, Daniel H; Munoz-Price, L Silvia


    Acinetobacter-positive patients had their ambient air tested for up to 10 consecutive days. The air was Acinetobacter positive for an average of 21% of the days; the rate of contamination was higher among patients colonized in the rectum than in the airways (relative risk [RR], 2.35; P = 0.006). Of the 6 air/clinical isolate pairs available, 4 pairs were closely related according to rep-PCR results. PMID:25926496

  19. Draft Genome Sequences of Acinetobacter baumannii Isolates from Wounded Military Personnel.


    Arivett, Brock A; Ream, Dave C; Fiester, Steven E; Kidane, Destaalem; Actis, Luis A


    Acinetobacter baumannii is a Gram-negative bacterium capable of causing hospital-acquired infections that has been grouped with Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter species as ESKAPE pathogens because of their extensive drug resistance phenotypes and increasing risk to human health. Twenty-four multidrug-resistant A. baumannii strains isolated from wounded military personnel were sequenced and annotated. PMID:27563036

  20. Characterization and identification of newly isolated Acinetobacter baumannii strain serdang 1 for phenol removal

    NASA Astrophysics Data System (ADS)

    Yadzir, Z. H. M.; Shukor, M. Y.; Nazir, M. S.; Abdullah, M. A.


    A new indigenous bacterial strain from Malaysian soil contaminated with petroleum waste had been successfully isolated, characterized and identified for phenol removal. The gram negative bacteria showed 98% identity with Acinetobacter baumannii based on Biolog{trade mark, serif} Identification System and the determination of a partial 16S ribosomal RNA (rRNA) sequence. The isolate clustered with species belonging to Acinetobacter clade in a 16S rDNA-based neighbour-joining phylogenetic tree.

  1. Draft Genome Sequences of Acinetobacter baumannii Isolates from Wounded Military Personnel

    PubMed Central

    Arivett, Brock A.; Ream, Dave C.; Fiester, Steven E.; Kidane, Destaalem


    Acinetobacter baumannii is a Gram-negative bacterium capable of causing hospital-acquired infections that has been grouped with Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter species as ESKAPE pathogens because of their extensive drug resistance phenotypes and increasing risk to human health. Twenty-four multidrug-resistant A. baumannii strains isolated from wounded military personnel were sequenced and annotated. PMID:27563036

  2. Update on the Epidemiology, Treatment, and Outcomes of Carbapenem-resistant Acinetobacter infections

    PubMed Central

    Kim, Uh Jin; Kim, Hee Kyung; An, Joon Hwan; Cho, Soo Kyung; Park, Kyung-Hwa


    Carbapenem-resistant Acinetobacter species are increasingly recognized as major nosocomial pathogens, especially in patients with critical illnesses or in intensive care. The ability of these organisms to accumulate diverse mechanisms of resistance limits the available therapeutic agents, makes the infection difficult to treat, and is associated with a greater risk of death. In this review, we provide an update on the epidemiology, resistance mechanisms, infection control measures, treatment, and outcomes of carbapenem-resistant Acinetobacter infections. PMID:25229014

  3. Study of the resistance of Acinetobacter sp. to mercuric chloride

    SciTech Connect

    Lomovskaya, O.L.; Mindlin, S.Z.; Khesin, R.B.


    In addition to large plasmids (approx 60 kb) a small plasmid (almost 7.5 kb), plasmid PKL1, has been found in HgCl/sub 2/-resistant strains of Acinetobacter sp. isolated from soil in the vicinity of the Khaidarkan mercury deposit. With the aid of conjugation and transformation studies it was established that plasmid pKL1 is a mobilized plasmid with a broad host range and that this plasmid carries the Hg/sup r/-determinant. A restriction map of plasmid pKL1 was constructed, and the site of the Hg/sup r/-determinant and the regions essential for replication were localized. By comparing the results of the present study and previously-obtained data it was proposed that in a given microbiocoenosis the Hg/sup r/-determinants may occur in plasmids which differ markedly in structure and properties.

  4. Stress responses in the opportunistic pathogen Acinetobacter baumannii

    PubMed Central

    Fiester, Steven E; Actis, Luis A


    Acinetobacter baumannii causes a wide range of severe infections among compromised and injured patients worldwide. The relevance of these infections are, in part, due to the ability of this pathogen to sense and react to environmental and host stress signals, allowing it to persist and disseminate in medical settings and the human host. This review summarizes current knowledge on the roles that environmental and cellular stressors play in the ability of A. baumannii to resist nutrient deprivation, oxidative and nitrosative injury, and even the presence of the commonly used antiseptic ethanol, which could serve as a nutrient- and virulence-enhancing signal rather than just being a convenient disinfectant. Emerging experimental evidence supports the role of some of these responses in the pathogenesis of the infections A. baumannii causes in humans and its capacity to resist antibiotics and host response effectors. PMID:23464372

  5. Acinetobacter baumannii Infection and IL-17 Mediated Immunity

    PubMed Central

    Yan, Zihe; Yang, Junjun; Hu, Renjing; Hu, Xichi; Chen, Kong


    Acinetobacter baumannii is a significant cause of severe hospital-acquired infections with a recent rise in multidrug-resistant infections involving traumatic wounds of military personnel. The interleukin-17 (IL-17) pathway is essential for neutrophil recruitment in response to a variety of pathogens, while the control of A. baumannii infection is known to be dependent on neutrophils. This suggests that IL-17 may play an important role in A. baumannii infection; however, this has yet to be studied. Here, we summarize the recent advances in understanding the host-pathogen interaction of A. baumannii and propose a potential role of the IL-17 pathway in generating a protective immune response. PMID:26977122

  6. Acinetobacter cyclohexanone monooxygenase: gene cloning and sequence determination.

    PubMed Central

    Chen, Y C; Peoples, O P; Walsh, C T


    The gene coding for cyclohexanone monooxygenase from Acinetobacter sp. strain NCIB 9871 was isolated by immunological screening methods. We located and determined the nucleotide sequence of the gene. The structural gene is 1,626 nucleotides long and codes for a polypeptide of 542 amino acids; 389 nucleotides 5' and 108 nucleotides 3' of the coding region are also reported. The complete amino acid sequence of the enzyme was derived by translation of the nucleotide sequence. From a comparison of the amino acid sequence with consensus sequences of nucleotide-binding folds, we identified a potential flavin-binding site at the NH2 terminus of the enzyme (residues 6 to 18) and a potential nicotinamide-binding site extending from residue 176 to residue 208 of the protein. An overproduction system for the gene to facilitate genetic manipulations was also constructed by using the tac promoter vector pKK223-3 in Escherichia coli. Images PMID:3338974

  7. Genetic Determinants of Intrinsic Colistin Tolerance in Acinetobacter baumannii

    PubMed Central

    Hood, M. Indriati; Becker, Kyle W.; Roux, Christelle M.; Dunman, Paul M.


    Acinetobacter baumannii is a leading cause of multidrug-resistant infections worldwide. This organism poses a particular challenge due to its ability to acquire resistance to new antibiotics through adaptation or mutation. This study was undertaken to determine the mechanisms governing the adaptability of A. baumannii to the antibiotic colistin. Screening of a transposon mutant library identified over 30 genes involved in inducible colistin resistance in A. baumannii. One of the genes identified was lpsB, which encodes a glycosyltransferase involved in lipopolysaccharide (LPS) synthesis. We demonstrate that loss of LpsB function results in increased sensitivity to both colistin and cationic antimicrobial peptides of the innate immune system. Moreover, LpsB is critical for pathogenesis in a pulmonary model of infection. Taken together, these data define bacterial processes required for intrinsic colistin tolerance in A. baumannii and underscore the importance of outer membrane structure in both antibiotic resistance and the pathogenesis of A. baumannii. PMID:23230287

  8. Herellea (Acinetobacter) and Pseudomonas ovalis (P. putida) from Frozen Foods

    PubMed Central

    Eller, Charles


    Seventeen strains of Herellea vaginicola (Acinetobacter antitratus) and 8 of Pseudomonas ovalis (P. putida), isolated from 23 (6.3%) of 364 samples of frozen, foil-pack foods, were identified and characterized morphologically and biochemically. Herellea was isolated from 17 foods (4.7%), P. ovalis from 6 (1.6%). No Mima were found. The food samples included precooked frozen meats, precooked and uncooked frozen vegetables, and uncooked frozen desserts. The bacteria were detected in the food with a procedure used generally for the detection of salmonellae. The pseudomonad simulated the characteristics of Herellea on Sellers differential agar, except for the fact that it fluoresced. From consideration of the habitat and pathogenicity of Herellea and Mima, it is concluded that, although the presence of these bacteria may not be desirable, their significance in food remains unanswered. PMID:4886860

  9. Antimicrobial susceptibility of clinical isolates of Acinetobacter baumannii.


    Shi, Z Y; Liu, P Y; Lau, Y; Lin, Y; Hu, B S; Shir J-M


    The in-vitro activity of 18 antimicrobial agents alone or in combination against 248 clinical isolates of Acinetobacter baumannii from Taiwan were tested by agar dilution. The MIC90S of ampicillin, amoxicillin, piperacillin, cefuroxime, cefotaxime, ceftriaxone, gentamicin, and amikacin were at least 128 mu g/ml. Ceftazidime, cefepime, sulbactam, clavulanic acid, and tazobactam presented moderate activity with MIC90S of 32, 16, 16, 32, and 32 mu g/ml, respectively. The increased activity of ampicillin/sulbactam, amoxicillin/clavulanic acid, and piperacillin/tazobactam was due to the intrinsic effect of sulbactam, clavulanic acid, and tazobactam, respectively. Imipenem, meropenem, and ciprofloxacin were the most active antimicrobial agents with MIC90S of 1, 1, and 0.5 mu g/ml, respectively. Nineteen isolates (7.7%) were resistant to all aminoglycosides and beta-lactam antibiotics, except carbapenems and ciprofloxacin. We are concerned about the multidrug resistance of A. baumannii in this study. PMID:9147913

  10. A Case of Acinetobacter Septic Pulmonary Embolism in an Infant

    PubMed Central

    Ananthan, Anitha; David, Jane; Ghildiyal, Radha


    Case Characteristics. An 11-month-old girl presented with fever and breathlessness for 5 days. Patient had respiratory distress with bilateral coarse crepitations. Chest radiograph revealed diffuse infiltrations in the right lung with thick walled cavities in mid and lower zone. Computed tomography showed multiple cystic spaces and emboli. Blood culture grew Acinetobacter species. Intervention. Patient was treated with Meropenem and Vancomycin. Outcome. Complete clinical and radiological recovery was seen in child. Message. Blood cultures and CT of the chest are invaluable in the evaluation of a patient with suspected septic pulmonary embolism. With early diagnosis and appropriate antimicrobial therapy, complete recovery can be expected in patients with septic pulmonary embolism. PMID:27529040

  11. The Response of Acinetobacter baumannii to Zinc Starvation.


    Nairn, Brittany L; Lonergan, Zachery R; Wang, Jiefei; Braymer, Joseph J; Zhang, Yaofang; Calcutt, M Wade; Lisher, John P; Gilston, Benjamin A; Chazin, Walter J; de Crécy-Lagard, Valerie; Giedroc, David P; Skaar, Eric P


    Zinc (Zn) is an essential metal that vertebrates sequester from pathogens to protect against infection. Investigating the opportunistic pathogen Acinetobacter baumannii's response to Zn starvation, we identified a putative Zn metallochaperone, ZigA, which binds Zn and is required for bacterial growth under Zn-limiting conditions and for disseminated infection in mice. ZigA is encoded adjacent to the histidine (His) utilization (Hut) system. The His ammonia-lyase HutH binds Zn very tightly only in the presence of high His and makes Zn bioavailable through His catabolism. The released Zn enables A. baumannii to combat host-imposed Zn starvation. These results demonstrate that A. baumannii employs several mechanisms to ensure bioavailability of Zn during infection, with ZigA functioning predominately during Zn starvation, but HutH operating in both Zn-deplete and -replete conditions to mobilize a labile His-Zn pool. PMID:27281572

  12. Community-acquired Acinetobacter baumannii: clinical characteristics, epidemiology and pathogenesis.


    Dexter, Carina; Murray, Gerald L; Paulsen, Ian T; Peleg, Anton Y


    Community-acquired Acinetobacter baumannii (CA-Ab) is a rare but serious cause of community-acquired pneumonia in tropical regions of the world. CA-Ab infections predominantly affect individuals with risk factors, which include excess alcohol consumption, diabetes mellitus, smoking and chronic lung disease. CA-Ab pneumonia presents as a surprisingly fulminant course and is characterized by a rapid onset of fever, severe respiratory symptoms and multi-organ dysfunction, with a mortality rate reported as high as 64%. It is unclear whether the distinct clinical syndrome caused by CA-Ab is because of host predisposing factors or unique bacterial characteristics, or a combination of both. Deepening our understanding of the drivers of overwhelming CA-Ab infection will provide important insights into preventative and therapeutic strategies. PMID:25850806

  13. Analysis of drug resistance in 1,861 strains of Acinetobacter baumannii

    PubMed Central



    Acinetobacter baumannii is an emerging human pathogen that causes hospital-acquired infections. The trend in increased antimicrobial resistance limits the choice of effective antimicrobial agents. The present study reports the resistance to Acinetobacter baumannii and analyzes the associations between antibiotic use and resistance rates at a general hospital between 2010 and 2014. A total of 1,861 isolates were obtained from clinical cultures, accounting for 10.33% of all detected bacteria (1,861/18,016). The strains were mainly from respiratory samples (1,628 isolates, 87.5%) and the intensive care unit (696 isolates, 37.4%). The resistance rates of Acinetobacter baumannii to the majority of antibiotics were >50%, particularly the resistance rate to cefoperazone/sulbactam increased from 47.37 in 2011 to 89.25% in 2014. However, the rates of imipenem and cilastatin sodium decreased from 81.03 to 69.44% due to the antibiotic policy. There were Pearson significant associations between the use of three antibiotics and resistance in Acinetobacter baumannii to this drug, piperacillin/tazobactam (r=0.976, P<0.01), gentamicin (r=0.870, P<0.01) and cefoxitin (r=0.741, P<0.05). Therefore, a combination of drugs should be adopted to treat Acinetobacter baumannii infections. Microbiology laboratory support and surveillance policies are essential to control the emergence of multidrug-resistance Acinetobacter baumannii. PMID:27073633

  14. Impact of empirical antimicrobial therapy on the outcome of critically ill patients with Acinetobacter bacteremia

    PubMed Central

    Al-Dorzi, Hasan M.; Asiri, Abdulaziz M.; Shimemri, Abdullah; Tamim, Hani M.; Al Johani, Sameera M.; Al Dabbagh, Tarek; Arabi, Yaseen M.


    RATIONALE: Empirical antimicrobial therapy (EAT) for Acinetobacter infections may not be appropriate as it tends to be multidrug-resistant. This study evaluated the relationship between appropriate EAT and the outcomes of Intensive Care Unit (ICU) patients with Acinetobacter bacteremia. METHODS: This is a retrospective study of patients admitted to a medical-surgical ICU (2005-2010) and developed Acinetobacter bacteremia during the stay. Patients were categorized according to EAT appropriateness, defined as administration of at least one antimicrobial agent to which the Acinetobacter was susceptible before susceptibility results were known. The relation between EAT appropriateness and outcomes was evaluated. RESULTS: Sixty patients developed Acinetobacter bacteremia in the 6-year period (age = 50 ± 19 years; 62% males; Acute Physiology and Chronic Health Evaluation II score = 28 ± 9; 98.3% with central lines; 67% in shock and 59% mechanically ventilated) on average on day 23 of ICU and day 38 of hospital stay. All isolates were resistant to at least three of the tested antimicrobials. Appropriate EAT was administered to 60% of patients, mostly as intravenous colistin. Appropriate EAT was associated with lower ICU mortality risk (odds ratio: 0.15; 95% confidence interval: 0.03-0.96) on multivariate analysis. CONCLUSIONS: In this 6-year cohort, Acinetobacter bacteremia was related to multidrug-resistant strains. Appropriate EAT was associated with decreased ICU mortality risk. PMID:26664563

  15. Identification of Ata, a Multifunctional Trimeric Autotransporter of Acinetobacter baumannii

    PubMed Central

    Bentancor, Leticia V.; Camacho-Peiro, Ana; Bozkurt-Guzel, Cagla; Pier, Gerald B.


    Acinetobacter baumannii has recently emerged as a highly troublesome nosocomial pathogen, especially in patients in intensive care units and in those undergoing mechanical ventilation. We have identified a surface protein adhesin of A. baumannii, designated the Acinetobacter trimeric autotransporter (Ata), that contains all of the typical features of trimeric autotransporters (TA), including a long signal peptide followed by an N-terminal, surface-exposed passenger domain and a C-terminal domain encoding 4 β-strands. To demonstrate that Ata encoded a TA, we created a fusion protein in which we replaced the entire passenger domain of Ata with the epitope tag V5, which can be tracked with specific monoclonal antibodies, and demonstrated that the C-terminal 101 amino acids of Ata were capable of exporting the heterologous V5 tag to the surface of A. baumannii in a trimeric form. We found that Ata played a role in biofilm formation and bound to various extracellular matrix/basal membrane (ECM/BM) components, including collagen types I, III, IV, and V and laminin. Moreover, Ata mediated the adhesion of whole A. baumannii cells to immobilized collagen type IV and played a role in the survival of A. baumannii in a lethal model of systemic infection in immunocompetent mice. Taken together, these results reveal that Ata is a TA of A. baumannii involved in virulence, including biofilm formation, binding to ECM/BM proteins, mediating the adhesion of A. baumannii cells to collagen type IV, and contributing to the survival of A. baumannii in a mouse model of lethal infection. PMID:22609912

  16. Epidemiological Monitoring of Nosocomial Infections Caused by Acinetobacter Baumannii

    PubMed Central

    Custovic, Amer; Smajlovic, Jasmina; Tihic, Nijaz; Hadzic, Sadeta; Ahmetagic, Sead; Hadzagic, Haris


    Introduction: Acinetobacter baumannii is a frequent cause of infections in hospitals around the world, which is very difficult to control and treat. It is particularly prevalent in intensive care wards. Aim: The main objective of the research was to establish the application of epidemiological monitoring of nosocomial infections (NIs) caused by A. baumannii in order to determine: the type and distribution of NIs, and to investigate antimicrobial drug resistance of A. baumannii. Material and Methods: 855 patients treated at the Clinic of Anesthesiology and Reanimation, University Clinical Center Tuzla during 2013 were followed prospectively for the development of NIs. Infections caused by A. baumannii were characterized by the anatomical site and antibiotics resistance profile. Results: NIs were registered in 105 patients (12.3%; 855/105). The predominant cause of infection was A. baumannii with an incidence of 51.4% (54/105), followed by ESBL-producing Klebsiella pneumoniae with 15.2% (16/105) of cases, methicillin-resistant Staphylococcus aureus with 8.6% (9/105), and ESBL-producing Proteus mirabilis with 7.6% (8/105). According to the anatomical site, and type of NIs caused by A. baumannii, the most frequent were respiratory infections (74.1%; 40/54). Infections of surgical sites were registered in 11.1% (6/54) of cases, while bloodstream infections in 9.2% (5/54). A. baumannii isolates tested resistant against most antibiotics examined, but showed a high degree of susceptibility to tobramycin (87%; 47/54) and colistin (100%; 54/54). Conclusion: The increasing incidence of multi- and extensively drug-resistant Acinetobacter spp. emphasizes the importance of administration of an adequate antibiotic strategy and the implementation of strict monitoring of the measures for controlling nosocomial infections. PMID:25648217

  17. Extremotolerant survival and proteomics of Acinetobacter isolated from spacecraft assembly facilities

    NASA Astrophysics Data System (ADS)

    Mogul, Rakesh; Vaishampayan, Parag; Venkateswaran, Kasthuri; McCoy, Kelly; Derecho, Ivy; Dallal, Freida


    Herein, we report on the extreme hydrogen peroxide resistance of Acinetobacter isolated from the assembly facilities for the Mars Odyssey orbiter and Phoenix lander. Specific activity experiments on 10 different spacecraft-associated Acinetobacter strains show that the catalase contents are 15-250-fold greater than that of E. coli. Among this group, the highest and lowest catalase-containing strains, which were Acinetobacter nov. sp. 2P01AA and Acinetobacter radioresistens 50v1, demonstrated no significant and 2-log reductions in survivability upon exposure to 100 mM hydrogen peroxide (1 hr), respectively. These survivals are among the highest reported for non-spore forming Gram-negative bacteria. Comparative proteomics on these strains reveals that alkyl hydroperoxide reductase, ATP synthase, dihydrolipoamide dehydrogenase, and peptidyl-tRNA hydrolase also contribute to the hydrogen peroxide extremotolerance. Together, the survival and metabolic features of the spacecraft-associated Acinetobacter indicate that survival in the dry and low-nutrient environments of clean rooms is supported by factors such as oxidant degradation, energy management, and protein biosynthesis.

  18. Comparative genomic analysis of novel Acinetobacter symbionts: A combined systems biology and genomics approach.


    Gupta, Vipin; Haider, Shazia; Sood, Utkarsh; Gilbert, Jack A; Ramjee, Meenakshi; Forbes, Ken; Singh, Yogendra; Lopes, Bruno S; Lal, Rup


    The increasing trend of antibiotic resistance in Acinetobacter drastically limits the range of therapeutic agents required to treat multidrug resistant (MDR) infections. This study focused on analysis of novel Acinetobacter strains using a genomics and systems biology approach. Here we used a network theory method for pathogenic and non-pathogenic Acinetobacter spp. to identify the key regulatory proteins (hubs) in each strain. We identified nine key regulatory proteins, guaA, guaB, rpsB, rpsI, rpsL, rpsE, rpsC, rplM and trmD, which have functional roles as hubs in a hierarchical scale-free fractal protein-protein interaction network. Two key hubs (guaA and guaB) were important for insect-associated strains, and comparative analysis identified guaA as more important than guaB due to its role in effective module regulation. rpsI played a significant role in all the novel strains, while rplM was unique to sheep-associated strains. rpsM, rpsB and rpsI were involved in the regulation of overall network topology across all Acinetobacter strains analyzed in this study. Future analysis will investigate whether these hubs are useful as drug targets for treating Acinetobacter infections. PMID:27378055

  19. Resistance mechanism of Acinetobacter spp. strains resistant to DW-116, a new quinolone.


    Choi, K H; Baek, M C; Kim, B K; Choi, E C


    DW-116 is a new fluoroquinolone antimicrobial agent with a broad spectrum. In order to elucidate the resistance mechanism to DW-116 in Acinetobacter spp. bacteria, total chromosomal DNA was isolated from 10 strains of Acinetobacter spp. resistant to DW-116. Quinolone resistance determinant region (QRDR) of DNA gyrase gene was amplified by PCR. The 345 bp nucleotide fragment yielded was inserted into pKF 3 which was used as the vector. Comparisons of the DNA sequences of 8 strains with that of the wild type strain revealed a Ser-83 to Leu mutation in mutants and all ten strains contained one silent mutation(T-->G) in QRDR. From Acinetobacter MB4-8 strain, DNA gyrase was isolated and purified, through no-vobiocin-sepharose, heparin-sepharose affinity column chromatography. The enzyme was composed of two subunits and the molecular mass of subunits A and B were 75.6 and 51.9 kDa, respectively. The supercoiling activity of the reconstituted DNA gyrase composed of subunit A from Acinetobacter MB4-8 and subunit B from E. coli was not inhibited by 128 micrograms/ml of ciprofloxacin. It might be said that one of the resistance mechanisms to DW-116 in A-cinetobacter MB4-8 was subunit A alteration of DNA gyrase. PMID:9875449

  20. Comparative genomic analysis of novel Acinetobacter symbionts: A combined systems biology and genomics approach

    PubMed Central

    Gupta, Vipin; Haider, Shazia; Sood, Utkarsh; Gilbert, Jack A.; Ramjee, Meenakshi; Forbes, Ken; Singh, Yogendra; Lopes, Bruno S.; Lal, Rup


    The increasing trend of antibiotic resistance in Acinetobacter drastically limits the range of therapeutic agents required to treat multidrug resistant (MDR) infections. This study focused on analysis of novel Acinetobacter strains using a genomics and systems biology approach. Here we used a network theory method for pathogenic and non-pathogenic Acinetobacter spp. to identify the key regulatory proteins (hubs) in each strain. We identified nine key regulatory proteins, guaA, guaB, rpsB, rpsI, rpsL, rpsE, rpsC, rplM and trmD, which have functional roles as hubs in a hierarchical scale-free fractal protein-protein interaction network. Two key hubs (guaA and guaB) were important for insect-associated strains, and comparative analysis identified guaA as more important than guaB due to its role in effective module regulation. rpsI played a significant role in all the novel strains, while rplM was unique to sheep-associated strains. rpsM, rpsB and rpsI were involved in the regulation of overall network topology across all Acinetobacter strains analyzed in this study. Future analysis will investigate whether these hubs are useful as drug targets for treating Acinetobacter infections. PMID:27378055

  1. CarbAcineto NP Test for Rapid Detection of Carbapenemase-Producing Acinetobacter spp.

    PubMed Central

    Dortet, Laurent; Poirel, Laurent; Errera, Caroline


    Multidrug-resistant Acinetobacter baumannii isolates, particularly those that produce carbapenemases, are increasingly reported worldwide. The biochemically based Carba NP test, extensively validated for the detection of carbapenemase producers among Enterobacteriaceae and Pseudomonas spp., has been modified to detect carbapenemase production in Acinetobacter spp. A collection of 151 carbapenemase-producing and 69 non-carbapenemase-producing Acinetobacter spp. were tested using the Carba NP test and a modified Carba NP protocol (the CarbAcineto NP test) in this study. The CarbAcineto NP test requires modified lysis conditions and an increased bacterial inoculum compared to those of the original Carba NP test. The Carba NP test detects metallo-β-lactamase producers but failed to detect the production of other carbapenemase types among Acinetobacter spp. In contrast, the newly designed CarbAcineto NP test, which is rapid and reproducible, detects all types of carbapenemases with a sensitivity of 94.7% and a specificity of 100%. This cost-effective technique offers a reliable and affordable technique for identifying carbapenemase production in Acinetobacter spp., which is a marker of multidrug resistance in those species. Its use will facilitate the recognition of these carbapenemases and prevent their spread. PMID:24759709

  2. Place of Colistin-Rifampicin Association in the Treatment of Multidrug-Resistant Acinetobacter Baumannii Meningitis: A Case Study

    PubMed Central

    Souhail, Dahraoui; Bouchra, Belefquih; Belarj, Badia; Laila, Rar; Mohammed, Frikh; Nassirou, Oumarou Mamane; Azeddine, Ibrahimi; Haimeur, Charki; Lemnouer, Abdelhay; Elouennass, Mostafa


    Treatment of Acinetobacter baumannii meningitis is an important challenge due to the accumulation of resistance of this bacteria and low meningeal diffusion of several antimicrobial requiring use of an antimicrobial effective combination to eradicate these species. We report a case of Acinetobacter baumannii multidrug-resistant nosocomial meningitis which was successfully treated with intravenous and intrathecal colistin associated with rifampicin. PMID:27064923

  3. Draft Genome Sequence of Acinetobacter sp. Strain VT-511 Isolated from the Stomach of a Patient with Gastric Cancer

    PubMed Central

    Tetz, Victor


    We report the draft genome sequence of Acinetobacter sp. strain VT-511, which was obtained from the stomach of a patient with gastric cancer. The genome of Acinetobacter sp. VT-511 is composed of approximately 3,416,321 bp and includes 3,214 predicted protein-coding genes. PMID:26472843

  4. Antimicrobial resistance in Acinetobacter baumannii: From bench to bedside

    PubMed Central

    Lin, Ming-Feng; Lan, Chung-Yu


    Acinetobacter baumannii (A. baumannii) is undoubtedly one of the most successful pathogens in the modern healthcare system. With invasive procedures, antibiotic use and immunocompromised hosts increasing in recent years, A. baumannii has become endemic in hospitals due to its versatile genetic machinery, which allows it to quickly evolve resistance factors, and to its remarkable ability to tolerate harsh environments. Infections and outbreaks caused by multidrug-resistant A. baumannii (MDRAB) are prevalent and have been reported worldwide over the past twenty or more years. To address this problem effectively, knowledge of species identification, typing methods, clinical manifestations, risk factors, and virulence factors is essential. The global epidemiology of MDRAB is monitored by persistent surveillance programs. Because few effective antibiotics are available, clinicians often face serious challenges when treating patients with MDRAB. Therefore, a deep understanding of the resistance mechanisms used by MDRAB can shed light on two possible strategies to combat the dissemination of antimicrobial resistance: stringent infection control and antibiotic treatments, of which colistin-based combination therapy is the mainstream strategy. However, due to the current unsatisfying therapeutic outcomes, there is a great need to develop and evaluate the efficacy of new antibiotics and to understand the role of other potential alternatives, such as antimicrobial peptides, in the treatment of MDRAB infections. PMID:25516853

  5. Global evolution of multidrug-resistant Acinetobacter baumannii clonal lineages.


    Zarrilli, Raffaele; Pournaras, Spyros; Giannouli, Maria; Tsakris, Athanassios


    The rapid expansion of Acinetobacter baumannii clinical isolates exhibiting resistance to carbapenems and most or all available antibiotics during the last decade is a worrying evolution. The apparent predominance of a few successful multidrug-resistant lineages worldwide underlines the importance of elucidating the mode of spread and the epidemiology of A. baumannii isolates in single hospitals, at a country-wide level and on a global scale. The evolutionary advantage of the dominant clonal lineages relies on the capability of the A. baumannii pangenome to incorporate resistance determinants. In particular, the simultaneous presence of divergent strains of the international clone II and their increasing prevalence in international hospitals further support the ongoing adaptation of this lineage to the hospital environment. Indeed, genomic and genetic studies have elucidated the role of mobile genetic elements in the transfer of antibiotic resistance genes and substantiate the rate of genetic alterations associated with acquisition in A. baumannii of various resistance genes, including OXA- and metallo-β-lactamase-type carbapenemase genes. The significance of single nucleotide polymorphisms and transposon mutagenesis in the evolution of A. baumannii has been also documented. Establishment of a network of reference laboratories in different countries would generate a more complete picture and a fuller understanding of the importance of high-risk A. baumannii clones in the international dissemination of antibiotic resistance. PMID:23127486

  6. The structure of alanine racemase from Acinetobacter baumannii

    PubMed Central

    Davis, Emily; Scaletti-Hutchinson, Emma; Opel-Reading, Helen; Nakatani, Yoshio; Krause, Kurt L.


    Acinetobacter baumannii is an opportunistic Gram-negative bacterium which is a common cause of hospital-acquired infections. Numerous antibiotic-resistant strains exist, emphasizing the need for the development of new antimicrobials. Alanine racemase (Alr) is a pyridoxal 5′-phosphate dependent enzyme that is responsible for racemization between enantiomers of alanine. As d-alanine is an essential component of the bacterial cell wall, its inhibition is lethal to prokaryotes, making it an excellent antibiotic drug target. The crystal structure of A. baumannii alanine racemase (AlrAba) from the highly antibiotic-resistant NCTC13302 strain has been solved to 1.9 Å resolution. Comparison of AlrAba with alanine racemases from closely related bacteria demonstrates a conserved overall fold. The substrate entryway and active site of the enzymes were shown to be highly conserved. The structure of AlrAba will provide the template required for future structure-based drug-design studies. PMID:25195891

  7. [Emerging Acinetobacter baumannii infections and factors favouring their occurrence].


    Eveillard, M; Joly-Guillou, M-L


    During the last decade, Acinetobacter baumannii (AB) has been increasingly responsible for infections occurring in three particular contexts (in terms of patients and environment). Community AB pneumonia is severe infections, mainly described around the Indian Ocean, and which mainly concern patients with major co-morbidities. AB is also responsible for infections occurring among soldiers wounded in action during operations conducted in Iraq or Afghanistan. Lastly, this bacterium is responsible for infections occurring among casualties from natural disasters like earthquakes and tsunamis. Those infections are often due to multidrug-resistant strains, which can be implicated in nosocomial outbreaks when patients are hospitalized in a local casualty department or during their repatriation thereafter. The source of the contaminations which lead to AB infections following injuries (warfare or natural disasters) is still poorly known. Three hypotheses are usually considered: a contamination of wounds with environmental bacteria, a wound contamination from a previous cutaneous or oropharyngeal endogenous reservoir, or hospital acquisition. The implication of telluric or agricultural primary reservoirs in human AB infections is a common hypothesis which remains to be demonstrated by further specifically designed studies. PMID:21963271

  8. Stress Conditions Induced by Carvacrol and Cinnamaldehyde on Acinetobacter baumannii.


    Montagu, Angélique; Joly-Guillou, Marie-Laure; Rossines, Elisabeth; Cayon, Jérome; Kempf, Marie; Saulnier, Patrick


    Acinetobacter baumannii has emerged as a major cause of nosocomial infections. The ability of A. baumannii to display various resistance mechanisms against antibiotics has transformed it into a successful nosocomial pathogen. The limited number of antibiotics in development and the disengagement of the pharmaceutical industry have prompted the development of innovative strategies. One of these strategies is the use of essential oils, especially aromatic compounds that are potent antibacterial molecules. Among them, the combination of carvacrol and cinnamaldehyde has already demonstrated antibacterial efficacy against A. baumannii. The aim of this study was to determine the biological effects of these two compounds in A. baumannii, describing their effect on the rRNA and gene regulation under environmental stress conditions. Results demonstrated rRNA degradation by the carvacrol/cinnamaldehyde mixture, and this effect was due to carvacrol. Degradation was conserved after encapsulation of the mixture in lipid nanocapsules. Results showed an upregulation of the genes coding for heat shock proteins, such as groES, groEL, dnaK, clpB, and the catalase katE, after exposure to carvacrol/cinnamaldehyde mixture. The catalase was upregulated after carvacrol exposure wich is related to an oxidative stress. The combination of thiourea (hydroxyl radical scavenger) and carvacrol demonstrated a potent bactericidal effect. These results underline the development of defense strategies of the bacteria by synthesis of reactive oxygen species in response to environmental stress conditions, such as carvacrol. PMID:27486453

  9. Stress Conditions Induced by Carvacrol and Cinnamaldehyde on Acinetobacter baumannii

    PubMed Central

    Montagu, Angélique; Joly-Guillou, Marie-Laure; Rossines, Elisabeth; Cayon, Jérome; Kempf, Marie; Saulnier, Patrick


    Acinetobacter baumannii has emerged as a major cause of nosocomial infections. The ability of A. baumannii to display various resistance mechanisms against antibiotics has transformed it into a successful nosocomial pathogen. The limited number of antibiotics in development and the disengagement of the pharmaceutical industry have prompted the development of innovative strategies. One of these strategies is the use of essential oils, especially aromatic compounds that are potent antibacterial molecules. Among them, the combination of carvacrol and cinnamaldehyde has already demonstrated antibacterial efficacy against A. baumannii. The aim of this study was to determine the biological effects of these two compounds in A. baumannii, describing their effect on the rRNA and gene regulation under environmental stress conditions. Results demonstrated rRNA degradation by the carvacrol/cinnamaldehyde mixture, and this effect was due to carvacrol. Degradation was conserved after encapsulation of the mixture in lipid nanocapsules. Results showed an upregulation of the genes coding for heat shock proteins, such as groES, groEL, dnaK, clpB, and the catalase katE, after exposure to carvacrol/cinnamaldehyde mixture. The catalase was upregulated after carvacrol exposure wich is related to an oxidative stress. The combination of thiourea (hydroxyl radical scavenger) and carvacrol demonstrated a potent bactericidal effect. These results underline the development of defense strategies of the bacteria by synthesis of reactive oxygen species in response to environmental stress conditions, such as carvacrol. PMID:27486453

  10. Host resistance to intranasal Acinetobacter baumannii reinfection in mice.


    Qiu, Hongyu; Li, Zack; KuoLee, Rhonda; Harris, Greg; Gao, Xiaoling; Yan, Hongbin; Xu, H Howard; Chen, Wangxue


    Acinetobacter baumannii is a major causative agent of healthcare-associated infection and develops multidrug resistance rapidly. However, little is known in the host defense mechanisms against this infection. In this study, we examined if mice recovered from a previous intranasal A. baumannii infection (recovered mice) are fully protected against a subsequent reinfection. We found that, despite the presence of specific serum IgG and mucosal IgA responses prior to the reinfection, the recovered mice were only marginally better protected against intranasal challenge with low doses of homologous or heterologous A. baumannii strains than the naïve mice. Post-challenge immune and inflammatory (cells and cytokines) responses were generally comparable between recovered and naïve mice although the recovered mice produced significantly higher amounts of IFN-γ and IL-17 and had higher percentages and numbers of resident lung CD44(hi)CD62L(-)CD4(+) and CD19(+) B lymphocytes. Taken together, our results suggest that mice recovered from a previous A. baumannii infection remain susceptible to reinfection, indicating the complexity of immune protection mechanism for this Gram-negative, multidrug-resistant emerging pathogen. PMID:27194730

  11. Pregnancy and Perinatal Outcomes Associated with Acinetobacter baumannii Infection.


    He, Mai; Kostadinov, Stefan; Gundogan, Fusun; Struminsky, Judith; Pinar, Halit; Sung, C James


    Objective To determine perinatal and pregnancy outcomes of Acinetobacter baumannii infection using clinicopathologic material from pregnant women, neonates, and perinatal postmortem examinations with positive cultures. Study Design This is a retrospective record review with placental and postmortem examination. Results During a 5-year period, 40 positive cultures were found. Three pregnancies with positive cultures close in the peripartum period were all associated with adverse outcomes including spontaneous abortion, preterm labor, and one full-term birth with histological chorioamnionitis. Two positive cultures were found in preterm neonates in the neonatal intensive care unit. Two of three cases of perinatal death grew pure cultures from blood and/or fetal tissue with placental or fetal examination demonstrating evidence of infection/inflammation with fetal inflammatory response. Conclusion This is the first case series report of A. baumannii-positive cultures in maternal, fetal, and neonatal specimen, with histopathologic evidence of infection. The results suggest a significant role of A. baumannii infection in adverse pregnancy and perinatal outcomes. PMID:23943711

  12. Pregnancy and Perinatal Outcomes Associated with Acinetobacter baumannii Infection

    PubMed Central

    He, Mai; Kostadinov, Stefan; Gundogan, Fusun; Struminsky, Judith; Pinar, Halit; Sung, C. James


    Objective To determine perinatal and pregnancy outcomes of Acinetobacter baumannii infection using clinicopathologic material from pregnant women, neonates, and perinatal postmortem examinations with positive cultures. Study Design This is a retrospective record review with placental and postmortem examination. Results During a 5-year period, 40 positive cultures were found. Three pregnancies with positive cultures close in the peripartum period were all associated with adverse outcomes including spontaneous abortion, preterm labor, and one full-term birth with histological chorioamnionitis. Two positive cultures were found in preterm neonates in the neonatal intensive care unit. Two of three cases of perinatal death grew pure cultures from blood and/or fetal tissue with placental or fetal examination demonstrating evidence of infection/inflammation with fetal inflammatory response. Conclusion This is the first case series report of A. baumannii-positive cultures in maternal, fetal, and neonatal specimen, with histopathologic evidence of infection. The results suggest a significant role of A. baumannii infection in adverse pregnancy and perinatal outcomes. PMID:23943711

  13. Acinetobacter baumannii: evolution of antimicrobial resistance-treatment options.


    Doi, Yohei; Murray, Gerald L; Peleg, Anton Y


    The first decade of the 20th century witnessed a surge in the incidence of infections due to several highly antimicrobial-resistant bacteria in hospitals worldwide. Acinetobacter baumannii is one such organism that turned from an occasional respiratory pathogen into a major nosocomial pathogen. An increasing number of A. baumannii genome sequences have broadened our understanding of the genetic makeup of these bacteria and highlighted the extent of horizontal transfer of DNA. Animal models of disease combined with bacterial mutagenesis have provided some valuable insights into mechanisms of A. baumannii pathogenesis. Bacterial factors known to be important for disease include outer membrane porins, surface structures including capsule and lipopolysaccharide, enzymes such as phospholipase D, iron acquisition systems, and regulatory proteins. A. baumannii has a propensity to accumulate resistance to various groups of antimicrobial agents. In particular, carbapenem resistance has become commonplace, accounting for the majority of A. baumannii strains in many hospitals today. Carbapenem-resistant strains are often resistant to all other routinely tested agents. Treatment of carbapenem-resistant A. baumannii infection therefore involves the use of combinations of last resort agents such as colistin and tigecycline, but the efficacy and safety of these approaches are yet to be defined. Antimicrobial-resistant A. baumannii has high potential to spread among ill patients in intensive care units. Early recognition and timely implementation of appropriate infection control measures is crucial in preventing outbreaks. PMID:25643273

  14. Genomic and phenotypic characterization of the species Acinetobacter venetianus.


    Fondi, Marco; Maida, Isabel; Perrin, Elena; Orlandini, Valerio; La Torre, Laura; Bosi, Emanuele; Negroni, Andrea; Zanaroli, Giulio; Fava, Fabio; Decorosi, Francesca; Giovannetti, Luciana; Viti, Carlo; Vaneechoutte, Mario; Dijkshoorn, Lenie; Fani, Renato


    Crude oil is a complex mixture of hydrocarbons and other organic compounds that can produce serious environmental problems and whose removal is highly demanding in terms of human and technological resources. The potential use of microbes as bioremediation agents is one of the most promising fields in this area. Members of the species Acinetobacter venetianus have been previously characterized for their capability to degrade n-alkanes and thus may represent interesting model systems to implement this process. Although a preliminary experimental characterization of the overall hydrocarbon degradation capability has been performed for five of them, to date, the genetic/genomic features underlying such molecular processes have not been identified. Here we have integrated genomic and phenotypic information for six A. venetianus strains, i.e. VE-C3, RAG-1(T), LUH 13518, LUH 7437, LUH 5627 and LUH 8758. Besides providing a thorough description of the A. venetianus species, these data were exploited to infer the genetic features (presence/absence patterns of genes) and the short-term evolutionary events possibly responsible for the variability in n-alkane degradation efficiency of these strains, including the mechanisms of interaction with the fuel droplet and the subsequent catabolism of this pollutant. PMID:26902269

  15. Genomic and phenotypic characterization of the species Acinetobacter venetianus

    PubMed Central

    Fondi, Marco; Maida, Isabel; Perrin, Elena; Orlandini, Valerio; La Torre, Laura; Bosi, Emanuele; Negroni, Andrea; Zanaroli, Giulio; Fava, Fabio; Decorosi, Francesca; Giovannetti, Luciana; Viti, Carlo; Vaneechoutte, Mario; Dijkshoorn, Lenie; Fani, Renato


    Crude oil is a complex mixture of hydrocarbons and other organic compounds that can produce serious environmental problems and whose removal is highly demanding in terms of human and technological resources. The potential use of microbes as bioremediation agents is one of the most promising fields in this area. Members of the species Acinetobacter venetianus have been previously characterized for their capability to degrade n-alkanes and thus may represent interesting model systems to implement this process. Although a preliminary experimental characterization of the overall hydrocarbon degradation capability has been performed for five of them, to date, the genetic/genomic features underlying such molecular processes have not been identified. Here we have integrated genomic and phenotypic information for six A. venetianus strains, i.e. VE-C3, RAG-1T, LUH 13518, LUH 7437, LUH 5627 and LUH 8758. Besides providing a thorough description of the A. venetianus species, these data were exploited to infer the genetic features (presence/absence patterns of genes) and the short-term evolutionary events possibly responsible for the variability in n-alkane degradation efficiency of these strains, including the mechanisms of interaction with the fuel droplet and the subsequent catabolism of this pollutant. PMID:26902269

  16. Acinetobacter baumannii: Evolution of Antimicrobial Resistance—Treatment Options

    PubMed Central

    Doi, Yohei; Murray, Gerald L.; Peleg, Anton Y.


    The first decade of the 20th century witnessed a surge in the incidence of infections due to several highly antimicrobial-resistant bacteria in hospitals worldwide. Acinetobacter baumannii is one such organism that turned from an occasional respiratory pathogen into a major nosocomial pathogen. An increasing number of A. baumannii genome sequences have broadened our understanding of the genetic makeup of these bacteria and highlighted the extent of horizontal transfer of DNA. Animal models of disease combined with bacterial mutagenesis have provided some valuable insights into mechanisms of A. baumannii pathogenesis. Bacterial factors known to be important for disease include outer membrane porins, surface structures including capsule and lipopolysaccharide, enzymes such as phospholipase D, iron acquisition systems, and regulatory proteins. A. baumannii has a propensity to accumulate resistance to various groups of antimicrobial agents. In particular, carbapenem resistance has become commonplace, accounting for the majority of A. baumannii strains in many hospitals today. Carbapenem-resistant strains are often resistant to all other routinely tested agents. Treatment of carbapenem-resistant A. baumannii infection therefore involves the use of combinations of last resort agents such as colistin and tigecycline, but the efficacy and safety of these approaches are yet to be defined. Antimicrobial-resistant A. baumannii has high potential to spread among ill patients in intensive care units. Early recognition and timely implementation of appropriate infection control measures is crucial in preventing outbreaks. PMID:25643273

  17. Evaluation of Parameters for High Efficiency Transformation of Acinetobacter baumannii

    PubMed Central

    Yildirim, Suleyman; Thompson, Mitchell G.; Jacobs, Anna C.; Zurawski, Daniel V.; Kirkup, Benjamin C.


    Acinetobacter baumannii is an emerging, nosocomial pathogen that is poorly characterized due to a paucity of genetic tools and methods. While whole genome sequence data from several epidemic and environmental strains have recently become available, the functional characterization of genes is significantly lagging. Efficient transformation is one of the first steps to develop molecular tools that can be used to address these shortcomings. Here we report parameters allowing high efficiency transformation of A. baumannii. Using a multi-factorial experimental design we found that growth phase, voltage, and resistance all significantly contribute to transformation efficiency. The highest efficiency (4.3 × 108 Transformants/μg DNA) was obtained at the stationary growth phase of the bacterium (OD 6.0) using 25 ng of plasmid DNA under 100 Ohms resistance and 1.7 kV/cm voltage. The optimized electroporation parameters reported here provide a useful tool for genetic manipulation of A. baumannii. PMID:26911658

  18. [Susceptibility to antibiotics and biochemical activity of strains of Acinetobacter sp. isolated from various sources].


    Gospodarek, E


    The study was performed on 576 Acinetobacter strains isolated from clinical material, objects from hospital, environment, soil, water and from animals. Applying API 20NE system identification was following: A. baumanii (61.1%), A. junii (19.4%), A. haemolyticus (4.3%), A. lwoffii (3.3%), A. johnsonii (0.52%) and not belonging to above genus strains (11.3%). Over 47% strains of Acinetobacter were isolated from clinical material as the only bacteria (mainly from samples received from intensive care units and surgical and urological wards). Out of 23 antibiotics and antimicrobials used for investigation of 535 strains of Acinetobacter, most active were imipenem (99%) of susceptible strains, ofloxacin and ciprofloxacin (95%) and netilmicin (88%). Multiple resistant strains were isolated more frequently from hospital environment than from other sources--these were mostly A. baumanii and A. junii. PMID:8189806

  19. Detection of aac(6')-I genes in amikacin-resistant Acinetobacter spp. by PCR.

    PubMed Central

    Ploy, M C; Giamarellou, H; Bourlioux, P; Courvalin, P; Lambert, T


    The distribution of aac(6')-I genes in 62 strains of Acinetobacter spp. resistant to amikacin, netilmicin, and tobramycin and susceptible to gentamicin, a phenotype compatible with synthesis of an AAC(6')-I enzyme, was studied by PCR and by DNA hybridization. Both methods gave similar results. Among the 51 Acinetobacter baumannii strains, aac(6')-Ib was found in 19 isolates and aac(6')-Ih was found in the remaining strains. The aac(6')-Ig gene was present in all 10 A. haemolyticus strains studied and was detected only in this species. A pair of degenerate oligonucleotides complementary to conserved regions of aac(6')-Ic, -Id, -If, -Ig, and -Ih enabled detection of these genes and also of aac(6')-Ij, recently recognized in Acinetobacter sp. strain 13. Images PMID:7695286

  20. Acinetobacter Infections and Outcomes at an Academic Medical Center: A Disease of Long-Term Care

    PubMed Central

    Townsend, Jennifer; Park, An Na; Gander, Rita; Orr, Kathleen; Arocha, Doramarie; Zhang, Song; Greenberg, David E.


    Background. Our study aims to describe the epidemiology, microbial resistance patterns, and clinical outcomes of Acinetobacter infections at an academic university hospital. This retrospective study analyzed all inpatient clinical isolates of Acinetobacter collected at an academic medical center over 4 years. The data were obtained from an Academic tertiary referral center between January 2008 and December 2011. All consecutive inpatients during the study period who had a clinical culture positive for Acinetobacter were included in the study. Patients without medical records available for review or less than 18 years of age were excluded. Methods. Records were reviewed to determine source of isolation, risk factors for acquisition, drug resistance patterns, and clinical outcomes. Repetitive sequence-based polymerase chain reaction of selected banked isolates was used to determine patterns of clonal spread in and among institutions during periods of higher infection rates. Results. Four hundred eighty-seven clinical isolates of Acinetobacter were found in 212 patients (in 252 admissions). Patients with Acinetobacter infections were frequently admitted from healthcare facilities (HCFs) (59%). One hundred eighty-three of 248 (76%) initial isolates tested were resistant to meropenem. One hundred ninety-eight of 249 (79.5%) initial isolates were multidrug resistant (MDR). Factors associated with mortality included bacteremia (odds ratio [OR] = 1.93, P = .024), concomitant steroid use (OR = 2.87, P < .001), admission from a HCF (OR = 6.34, P = .004), and chronic obstructive pulmonary disease (OR = 3.17, P < .001). Conclusions. Acinetobacter isolates at our institution are frequently MDR and are more common among those who reside in HCFs. Our findings underline the need for new strategies to prevent and treat this pathogen, including stewardship efforts in long-term care settings. PMID:26034772

  1. Analysis on distribution features and drug resistance of clinically isolated Acinetobacter baumannii

    PubMed Central

    Ren, Guangming; Zhou, Min; Ding, Ning; Zhou, Ning; Li, Qingling


    The aim of the present study was to examine the clinical distribution and drug resistance of Acinetobacter baumannii infection, and provide evidence of clinical medication as well as the prophylaxis for the treatment of drug resistance bacteria. In total, 306 Acinetobacter baumanniis selected from routine culture were collected between January 2012 and December 2013, to analyze the distributions among clinical specimens and wards and their drug resistance state. Of the 306 Acinetobacter baumanniis, the main distribution of specimens was sputum, accounting for 77.78%. The distribution of administrative office was dominated by intensive care unit with a proportion of 40.0% in 2012, which rapidly increased to 60.9% in 2013, followed by neurosurgery, respiration medicine and orthopedics with proportions of 23, 12 and 9.0% in 2012 and 9.71, 8.74 and 3.88% in 2013, respectively. The Acinetobacter baumannii's drug resistance rate of Tazobactam and Piperacillin was increased from 68.0% in 2012 to 71.36% in 2013. At the same time, the drug resistance rate of imipenem was enhanced from 66.0% in 2012 to 72.81% in 2013. By 2013, the drug resistance rates of penbritin, ceftizoxime, cefotetan and macrodantin reached ≤100%. In conclusion, Acinetobacter baumannii mainly causes respiratory tract infection with severe drug resistance. The drug resistance of Acinetobacter baumannii was mainly manifested as multidrug resistance or even pan-drug resistance with an obvious increasing trend of tolerance. Thus, it is necessary to prevent and treat nosocomial infection, to minimize usage of antibiotics and to standardize medical operating, to reduce the increase in persistence. PMID:27602085

  2. Prognostic differences between VAP from Acinetobacter baumanii and VAP from other microorganisms.


    Di Bonito, Marianna; Caiazzo, Simona; Iannazzone, Marta; Miccichè, Viviana; De Marco, Giuseppe; De Robertis, Edoardo; Tufano, Rosalba; Piazza, Ornella


    Nosocomial infection, in particular pneumonia, is an important risk factor for hospital mortality and morbidity. Acinetobacter baumanii is a common multi-resistant microorganism responsible of Ventilator Associated Pneumonia (VAP). Currently Colistin is a rescue therapy for this pathogen. The purpose of this retrospective study is to compare the outcome of VAP caused by Acinetobacter baumanii and VAP from other microorganisms in critical patients. Comorbidity, prognostic scores, mortality and eradication frequency did not turn out significantly different between the two study groups. Colistin safety was tested. PMID:23905048

  3. Prognostic differences between VAP from Acinetobacter baumanii and VAP from other microorganisms

    PubMed Central

    Di Bonito, Marianna; Caiazzo, Simona; Iannazzone, Marta; Miccichè, Viviana; De Marco, Giuseppe; De Robertis, Edoardo; Tufano, Rosalba; Piazza, Ornella


    Nosocomial infection, in particular pneumonia, is an important risk factor for hospital mortality and morbidity. Acinetobacter baumanii is a common multi-resistant microorganism responsible of Ventilator Associated Pneumonia (VAP). Currently Colistin is a rescue therapy for this pathogen. The purpose of this retrospective study is to compare the outcome of VAP caused by Acinetobacter baumanii and VAP from other microorganisms in critical patients. Comorbidity, prognostic scores, mortality and eradication frequency did not turn out significantly different between the two study groups. Colistin safety was tested. PMID:23905048

  4. Comparative Genomics of Multidrug Resistance in Acinetobacter baumannii

    PubMed Central


    Acinetobacter baumannii is a species of nonfermentative gram-negative bacteria commonly found in water and soil. This organism was susceptible to most antibiotics in the 1970s. It has now become a major cause of hospital-acquired infections worldwide due to its remarkable propensity to rapidly acquire resistance determinants to a wide range of antibacterial agents. Here we use a comparative genomic approach to identify the complete repertoire of resistance genes exhibited by the multidrug-resistant A. baumannii strain AYE, which is epidemic in France, as well as to investigate the mechanisms of their acquisition by comparison with the fully susceptible A. baumannii strain SDF, which is associated with human body lice. The assembly of the whole shotgun genome sequences of the strains AYE and SDF gave an estimated size of 3.9 and 3.2 Mb, respectively. A. baumannii strain AYE exhibits an 86-kb genomic region termed a resistance island—the largest identified to date—in which 45 resistance genes are clustered. At the homologous location, the SDF strain exhibits a 20 kb-genomic island flanked by transposases but devoid of resistance markers. Such a switching genomic structure might be a hotspot that could explain the rapid acquisition of resistance markers under antimicrobial pressure. Sequence similarity and phylogenetic analyses confirm that most of the resistance genes found in the A. baumannii strain AYE have been recently acquired from bacteria of the genera Pseudomonas, Salmonella, or Escherichia. This study also resulted in the discovery of 19 new putative resistance genes. Whole-genome sequencing appears to be a fast and efficient approach to the exhaustive identification of resistance genes in epidemic infectious agents of clinical significance. PMID:16415984

  5. Photodynamic therapy for Acinetobacter baumannii burn infections in mice.


    Dai, Tianhong; Tegos, George P; Lu, Zongshun; Huang, Liyi; Zhiyentayev, Timur; Franklin, Michael J; Baer, David G; Hamblin, Michael R


    Multidrug-resistant Acinetobacter baumannii infections represent a growing problem, especially in traumatic wounds and burns suffered by military personnel injured in Middle Eastern conflicts. Effective treatment with traditional antibiotics can be extremely difficult, and new antimicrobial approaches are being investigated. One of these alternatives to antimicrobials could be the combination of nontoxic photosensitizers (PSs) and visible light, known as photodynamic therapy (PDT). We report on the establishment of a new mouse model of full-thickness thermal burns infected with a bioluminescent derivative of a clinical Iraqi isolate of A. baumannii and its PDT treatment by topical application of a PS produced by the covalent conjugation of chlorin(e6) to polyethylenimine, followed by illumination of the burn surface with red light. Application of 10(8) A. baumannii cells to the surface of 10-s burns made on the dorsal surface of shaved female BALB/c mice led to chronic infections that lasted, on average, 22 days and that were characterized by a remarkably stable bacterial bioluminescence. PDT carried out on day 0 soon after application of the bacteria gave over 3 log units of loss of bacterial luminescence in a light exposure-dependent manner, while PDT carried out on day 1 and day 2 gave an approximately 1.7-log reduction. The application of PS dissolved in 10% or 20% dimethyl sulfoxide without light gave only a modest reduction in the bacterial luminescence from mouse burns. Some bacterial regrowth in the treated burn was observed but was generally modest. It was also found that PDT did not lead to the inhibition of wound healing. The data suggest that PDT may be an effective new treatment for multidrug-resistant localized A. baumannii infections. PMID:19564369

  6. Inverse PCR for subtyping of Acinetobacter baumannii carrying ISAba1.


    Kim, Shukho; Park, Yun-Ju; Kim, Jungmin


    Acinetobacter baumannii has been prevalent in nosocomial infections, often causing outbreaks in intensive care units. ISAba1 is an insertion sequence that has been identified only in A. baumannii and its copy number varies among strains. It has been reported that ISAba1 provides a promoter for bla OXA-51-like, bla OXA-23-like, and bla ampC, which are associated with the resistance of A. baumannii to carbapenems and cephalosporins. The main purpose of this study was to develop a novel inverse PCR method capable of typing A. baumannii strains. The method involves three major steps: cutting of genomic DNA with a restriction enzyme, ligation, and PCR. In the first step, bacterial genomic DNA was digested with DpnI. In the second step, the digested genomic DNAs were ligated to form intramolecular circular DNAs. In the last step, the ligated circular DNAs were amplified by PCR with primers specific for ISAba1 and the amplified PCR products were electrophoresed. Twenty-two clinical isolates of A. baumannii were used for the evaluation of the inverse PCR (iPCR) typing method. Dendrogram analysis revealed two major clusters, similar to pulsed-field gel electrophoresis (PFGE) results. Three ISAba1-associated genes - bla ampC, bla OXA-66-like, and csuD - were amplified and detected in the clinical isolates. This novel iPCR typing method is comparable to PFGE in its ability to discriminate A. baumannii strains, and is a promising molecular epidemiological tool for investigating A. baumannii carrying ISAba1. PMID:27095456

  7. Virstatin inhibits biofilm formation and motility of Acinetobacter baumannii

    PubMed Central


    Background Acinetobacter baumannii has emerged as an opportunistic nosocomial pathogen causing infections worldwide. One reason for this emergence is due to its natural ability to survive in the hospital environment, which may be explained by its capacity to form biofilms. Cell surface appendages are important determinants of the A. baumannii biofilm formation and as such constitute interesting targets to prevent the development of biofilm-related infections. A chemical agent called virstatin was recently described to impair the virulence of Vibrio cholerae by preventing the expression of its virulence factor, the toxin coregulated pilus (type IV pilus). The objective of this work was to investigate the potential effect of virstatin on A. baumannii biofilms. Results After a dose–response experiment, we determined that 100 μM virstatin led to an important decrease (38%) of biofilms formed by A. baumannii ATCC17978 grown under static mode. We demonstrated that the production of biofilms grown under dynamic mode was also delayed and reduced. The biofilm susceptibility to virstatin was then tested for 40 clinical and reference A. baumannii strains. 70% of the strains were susceptible to virstatin (with a decrease of 10 to 65%) when biofilms grew in static mode, whereas 60% of strains respond to the treatment when their biofilms grew in dynamic mode. As expected, motility and atomic force microscopy experiments showed that virstatin acts on the A. baumannii pili biogenesis. Conclusions By its action on pili biogenesis, virstatin demonstrated a very promising antibiofilm activity affecting more than 70% of the A. baumannii clinical isolates. PMID:24621315

  8. Assessment of Minocycline and Polymyxin B Combination against Acinetobacter baumannii

    PubMed Central

    Bowers, Dana R.; Cao, Henry; Zhou, Jian; Ledesma, Kimberly R.; Sun, Dongxu; Lomovskaya, Olga


    Antimicrobial resistance among Acinetobacter baumannii is increasing worldwide, often necessitating combination therapy. The clinical utility of using minocycline with polymyxin B is not well established. In this study, we investigated the activity of minocycline and polymyxin B against 1 laboratory isolate and 3 clinical isolates of A. baumannii. Minocycline susceptibility testing was performed with and without an efflux pump inhibitor, phenylalanine-arginine β-naphthylamide (PAβN). The intracellular minocycline concentration was determined with and without polymyxin B (0.5 μg/ml). Time-kill studies were performed over 24 h using approximately 106 CFU/ml of each strain with clinically relevant minocycline concentrations (2 μg/ml and 8 μg/ml), with and without polymyxin B (0.5 μg/ml). The in vivo efficacy of the combination was assessed in a neutropenic murine pneumonia model. Infected animals were administered minocycline (50 mg/kg), polymyxin B (10 mg/kg), or both to achieve clinically equivalent exposures in humans. A reduction in the minocycline MIC (≥4×) was observed in the presence of PAβN. The intracellular concentration and in vitro bactericidal effect of minocycline were both enhanced by polymyxin B. With 2 minocycline-susceptible strains, the bacterial burden in lung tissue at 24 h was considerably reduced by the combination compared to monotherapy with minocycline or polymyxin B. In addition, the combination prolonged survival of animals infected with a minocycline-susceptible strain. Polymyxin B increased the intracellular concentration of minocycline in bacterial cells and enhanced the bactericidal activity of minocycline, presumably due to efflux pump disruption. The clinical utility of this combination should be further investigated. PMID:25712362

  9. Prevalence of hypermutators among clinical Acinetobacter baumannii isolates

    PubMed Central

    Komp Lindgren, Patricia; Higgins, Paul G.; Seifert, Harald; Cars, Otto


    Objectives The objectives of this study were to study the presence of mutators in a set of Acinetobacter baumannii isolates and to explore whether there is a correlation between mutation rates and antibiotic resistance. Methods The variation in mutation rate was evaluated for 237 clinical A. baumannii isolates by determining the frequency of their mutation to rifampicin resistance. For each isolate, the antibiotic resistance profile was determined by disc diffusion and/or Etest. Isolates were divided into susceptible, resistant and MDR groups according to their resistance to five groups of different antibiotics. A comparison between differences in mutation frequency (f) and strain-specific factors was performed. Results Of the 237 isolates 32%, 18% and 50% were classified as susceptible, resistant and MDR, respectively. The f of rifampicin resistance varied between 2.2 × 10−10 and 1.2 × 10−6. Of the strains under investigation, 16% had an ≥2.5- to 166-fold higher f. The presence of mutators (definition ≥2.5-fold increase in f compared with ATCC 19606) in the MDR group (22%) was significantly higher (P < 0.05) than that in the susceptible and resistant groups (11% and 7%, respectively). Furthermore, f was significantly higher in the MDR group compared with that in the susceptible and resistant groups. Conclusions The facts that 26 of 37 mutator isolates (70%) in the population were MDR and that there was a significantly higher general f in isolates exhibiting an MDR profile suggest that hypermutability can be of advantage for the organism in a selective environment with extensive exposure to antimicrobials. PMID:26660878

  10. The rise of carbapenem-resistant Acinetobacter baumannii.


    Evans, Benjamin A; Hamouda, Ahmed; Amyes, Sebastian G B


    Acinetobacter spp. are Gram-negative bacteria that have become one of the most difficult pathogens to treat. The species A. baumannii, largely unknown 30 years ago, has risen to prominence particularly because of its ability to cause infections in immunocompromised patients. It is now a predominant pathogen in many hospitals as it has acquired resistance genes to virtually all antibiotics capable of treating Gram-negative bacteria, including the fluoroquinolones and the cephalosporins. Some members of the species have accumulated these resistance genes in large resistance islands, located in a "hot-spot" within the bacterial chromosome. The only conventional remaining treatment options were the carbapenems. However, A. baumannii possesses an inherent class D β-lactamase gene (blaOXA-51-like) that can have the ability to confer carbapenem resistance. Additionally, mechanisms of carbapenem resistance have emerged that derive from the importation of the distantly related class D β-lactamase genes blaOXA-23 and blaOXA-58. Although not inducible, the expression of these genes is controlled by mobile promoters carried on ISAba elements. It has also been found that other resistance genes including the chromosomal class C β-lactamase genes conferring cephalosporin resistance are controlled in the same manner. Colistin is now considered to be the final drug capable of treating infections caused by carbapenem-resistant A. baumannii; however, strains are now being isolated that are resistant to this antibiotic as well. The increasing inability to treat infections caused by A. baumannii ensures that this pathogen more than ranks with MRSA or Clostridium difficile as a threat to modern medicine. PMID:22894617

  11. Epidemiologic and Clinical Impact of Acinetobacter baumannii Colonization and Infection

    PubMed Central

    Villar, Macarena; Cano, María E.; Gato, Eva; Garnacho-Montero, José; Miguel Cisneros, José; Ruíz de Alegría, Carlos; Fernández-Cuenca, Felipe; Martínez-Martínez, Luis; Vila, Jordi; Pascual, Alvaro; Tomás, María; Bou, Germán; Rodríguez-Baño, Jesús


    Abstract Acinetobacter baumannii is one of the most important antibiotic-resistant nosocomial bacteria. We investigated changes in the clinical and molecular epidemiology of A. baumannii over a 10-year period. We compared the data from 2 prospective multicenter cohort studies in Spain, one performed in 2000 (183 patients) and one in 2010 (246 patients), which included consecutive patients infected or colonized by A. baumannii. Molecular typing was performed by repetitive extragenic palindromic polymerase chain reaction (REP-PCR), pulsed-field gel electrophoresis (PFGE), and multilocus sequence typing (MLST). The incidence density of A. baumannii colonization or infection increased significantly from 0.14 in 2000 to 0.52 in 2010 in medical services (p < 0.001). The number of non-nosocomial health care-associated cases increased from 1.2% to 14.2%, respectively (p < 0.001). Previous exposure to carbapenems increased in 2010 (16.9% in 2000 vs 27.3% in 2010, p = 0.03). The drugs most frequently used for definitive treatment of patients with infections were carbapenems in 2000 (45%) and colistin in 2010 (50.3%). There was molecular-typing evidence of an increase in the frequency of A. baumannii acquisition in non-intensive care unit wards in 2010 (7.6% in 2000 vs 19.2% in 2010, p = 0.01). By MSLT, the ST2 clonal group predominated and increased in 2010. This epidemic clonal group was more frequently resistant to imipenem and was associated with an increased risk of sepsis, although not with severe sepsis or mortality. Some significant changes were noted in the epidemiology of A. baumannii, which is increasingly affecting patients admitted to conventional wards and is also the cause of non-nosocomial health care-associated infections. Epidemic clones seem to combine antimicrobial resistance and the ability to spread, while maintaining their clinical virulence. PMID:25181313

  12. Rapid identification of Acinetobacter spp. by fluorescence in situ hybridization (FISH) from colony and blood culture material

    PubMed Central

    Essig, A.; Hagen, R. M.; Riecker, M.; Jerke, K.; Ellison, D.; Poppert, S.


    Multi-drug-resistant strains of the Acinetobacter baumannii complex cause nosocomial infections. Rapid identification of Acinetobacter spp. is desirable in order to facilitate therapeutic or hygiene decisions. We evaluated a newly designed DNA probe that can be used under standard conditions in both a microwave oven and a slide chamber for the rapid identification of Acinetobacter spp. by fluorescence in situ hybridization (FISH). Using FISH, the new probe correctly identified 81/81 Acinetobacter spp. isolates and excluded 109/109 tested non-target organisms from agar culture. Furthermore, the new probe correctly identified 7/7 Acinetobacter spp. in 214 blood cultures determined to contain Gram-negative bacteria by Gram staining. Using either the microwave oven or slide chamber technique, the new probe was able to identify Acinetobacter spp. in 100% of the samples tested. FISH used in conjunction with our newly designed probe provides an easy, cheap, precise, and rapid method for the preliminary identification of Acinetobacter spp., especially in laboratories where more sophisticated methods like matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF-MS) are not available. PMID:24516735

  13. Occurrence of an Environmental Acinetobacter baumannii Strain Similar to a Clinical Isolate in Paleosol from Croatia

    PubMed Central

    Durn, Goran; Goic-Barisic, Ivana; Kovacic, Ana


    Over the past decade, bacteria of the genus Acinetobacter have emerged as a leading cause of hospital-acquired infections. Outbreaks of Acinetobacter infections are considered to be caused exclusively by contamination and transmission in hospital environments. The natural habitats of clinically important multiresistant Acinetobacter spp. remain to be defined. In this paper, we report an incidental finding of a viable multidrug-resistant strain of Acinetobacter baumannii, related to clinical isolates, in acid paleosol from Croatia. The environmental isolate of A. baumannii showed 87% similarity to a clinical isolate originating from a hospital in this geographic area and was resistant to gentamicin, trimethoprim-sulfamethoxazole, ciprofloxacin, and levofloxacin. In paleosol, the isolate was able to survive a low pH (3.37), desiccation, and a high temperature (50°C). The probable source of A. baumannii in paleosol is illegally disposed waste of external origin situated in the abandoned quarry near the sampling site. The bacteria could have been leached from waste by storm water and thus infiltrated the paleosol. PMID:24584245

  14. First Genome Sequence of a Mexican Multidrug-Resistant Acinetobacter baumannii Isolate

    PubMed Central

    Graña-Miraglia, Lucía; Lozano, Luis; Castro-Jaimes, Semiramis; Cevallos, Miguel A.; Volkow, Patricia


    Acinetobacter baumannii has emerged as an important nosocomial pathogen worldwide. Here, we present the draft genome of the first multidrug-resistant A. baumannii isolate, sampled from a tertiary hospital in Mexico City. This genome will provide a starting point for studying the genomic diversity of this species in Mexico. PMID:27013043

  15. Is Aerosalization a Problem With Carbapenem-Resistant Acinetobacter baumannii in Thailand Hospital?

    PubMed Central

    Apisarnthanarak, Anucha; Tantajina, Ploenpit; Laovachirasuwan, Pornpimol; Weber, David J.; Singh, Nalini


    We evaluated the presence of air contamination with carbapenem-resistant Acinetobacter baumannii (CRAB) in medical units where patients with CRAB pneumonia were hospitalized, and in Obstetrics and Gynecology units with open-air ventilation in-patient settings. There was no evidence of CRAB contamination in either of the units. PMID:27419187

  16. Is Aerosalization a Problem With Carbapenem-Resistant Acinetobacter baumannii in Thailand Hospital?


    Apisarnthanarak, Anucha; Tantajina, Ploenpit; Laovachirasuwan, Pornpimol; Weber, David J; Singh, Nalini


    We evaluated the presence of air contamination with carbapenem-resistant Acinetobacter baumannii (CRAB) in medical units where patients with CRAB pneumonia were hospitalized, and in Obstetrics and Gynecology units with open-air ventilation in-patient settings. There was no evidence of CRAB contamination in either of the units. PMID:27419187

  17. Molecular epidemiology of Acinetobacter baumannii in central intensive care unit in Kosova Teaching Hospital.


    Raka, Lul; Kalenć, Smilja; Bosnjak, Zrinka; Budimir, Ana; Katić, Stjepan; Sijak, Dubravko; Mulliqi-Osmani, Gjyle; Zoutman, Dick; Jaka, Arbëresha


    Infections caused by bacteria of genus Acinetobacter pose a significant health care challenge worldwide. Information on molecular epidemiological investigation of outbreaks caused by Acinetobacter species in Kosova is lacking. The present investigation was carried out to enlight molecular epidemiology of Acinetobacter baumannii in the Central Intensive Care Unit (CICU) of a University hospital in Kosova using pulse field gel electrophoresis (PFGE). During March - July 2006, A. baumannii was isolated from 30 patients, of whom 22 were infected and 8 were colonised. Twenty patients had ventilator-associated pneumonia, one patient had meningitis, and two had coinfection with bloodstream infection and surgical site infection. The most common diagnoses upon admission to the ICU were politrauma and cerebral hemorrhage. Bacterial isolates were most frequently recovered from endotracheal aspirate (86.7%). First isolation occurred, on average, on day 8 following admission (range 1-26 days). Genotype analysis of A. baumannii isolates identified nine distinct PFGE patterns, with predominance of PFGE clone E represented by isolates from 9 patients. Eight strains were resistant to carbapenems. The genetic relatedness of Acinetobacter baumannii was high, indicating cross-transmission within the ICU setting. These results emphasize the need for measures to prevent nosocomial transmission of A. baumannii in ICU. PMID:20464330

  18. Draft Genome Sequence of Acinetobacter johnsonii MB44, Exhibiting Nematicidal Activity against Caenorhabditis elegans

    PubMed Central

    Tian, Shijing; Ali, Muhammad; Xie, Li


    Acinetobacter johnsonii MB44 was isolated from a frost-plant-tissue sample, which showed noteworthy nematicidal activity against the model organism Caenorhabditis elegans. Here, we report the 3.4 Mb draft genome of A. johnsonii MB44, which will help in understanding the molecular mechanism of its ability to infect nematodes. PMID:26893438

  19. First Identification of OXA-72 Carbapenemase from Acinetobacter pittii in Colombia

    PubMed Central

    Montealegre, Maria Camila; Maya, Juan José; Correa, Adriana; Espinal, Paula; Mojica, Maria F.; Ruiz, Sory J.; Rosso, Fernando; Vila, Jordi; Quinn, John P.


    OXA-72 has been reported in few countries around the world. We report the first case in Colombia in an Acinetobacter pittii clinical isolate. The arrival of a new OXA, into a country with high endemic resistance, poses a significant threat, especially because the potential for widespread dissemination is considerable. PMID:22508295

  20. Whole-Genome Sequence of a Multidrug-Resistant Clinical Isolate of Acinetobacter lwoffii▿

    PubMed Central

    Hu, Yongfei; Zhang, Wei; Liang, Hui; Liu, Liping; Peng, Guojun; Pan, Yuanlong; Yang, Xi; Zheng, Beiwen; Gao, George F.; Zhu, Baoli; Hu, Hongyan


    Acinetobacter lwoffii has been considered an opportunistic pathogen that can cause nosocomial infections in humans. Here, we present the genome sequence of A. lwoffii WJ10621, a multidrug-resistant clinical isolate that carries a plasmid with the NDM-1 resistance gene. PMID:21742884

  1. Whole-Genome Sequencing Elucidates Epidemiology of Nosocomial Clusters of Acinetobacter baumannii.


    Willems, Stefanie; Kampmeier, Stefanie; Bletz, Stefan; Kossow, Annelene; Köck, Robin; Kipp, Frank; Mellmann, Alexander


    We characterized two epidemiologically similar Acinetobacter baumannii clusters from two separate intensive care units (ICU) using core genome multilocus sequence typing. Clonal spread was confirmed in ICU-1 (12 of 14 isolates shared genotypes); in ICU-2, all genotypes (13 isolates) were diverse, thus excluding transmissions and enabling adequate infection control measures. PMID:27358465

  2. Diversity and antibiotic resistance of Acinetobacter spp. in water from the source to the tap.


    Narciso-da-Rocha, Carlos; Vaz-Moreira, Ivone; Svensson-Stadler, Liselott; Moore, Edward R B; Manaia, Célia M


    Acinetobacter spp. are ubiquitous bacteria in the environment. Acinetobacter spp. isolated from a municipal drinking water treatment plant and from connected tap water were identified to the species level on the basis of rpoB gene partial sequence analysis. Intraspecies variation was assessed based on the analysis of partial sequences of housekeeping genes (rpoB, gyrB, and recA). Antibiotic resistance was characterized using the disk diffusion method and isolates were classified as wild or non-wild type (non-WT), according to the observed phenotype. The strains of Acinetobacter spp. were related to 11 different validly published species, although three groups of isolates, presenting low rpoB sequence similarities with previously described species, may represent new species. Most of the isolates were related to the species A. johnsonii and A. lwoffii. These two groups, as well as others related to the species A. parvus and A. tjernbergiae, were detected in the water treatment plant and in tap water. Other strains, related to the species A. pittii and A. beijerinckii, were isolated only from tap water. Most of the isolates (80 %) demonstrated wild type (WT) to all of the 12 antibiotics tested. Non-WT for tetracycline, meropenem, and ceftazidime, among others, were observed in water treatment plant or in tap water samples. Although, in general, this study suggests a low prevalence of acquired antibiotic resistance in water Acinetobacter spp., the potential of some species to acquire and disseminate resistance via drinking water is suggested. PMID:22669636

  3. A Taxonomically Unique Acinetobacter Strain with Proteolytic and Hemolytic Activities Recovered from a Patient with a Soft Tissue Injury

    PubMed Central

    Almuzara, Marisa; Traglia, German Matías; Krizova, Lenka; Barberis, Claudia; Montaña, Sabrina; Bakai, Romina; Tuduri, Alicia; Vay, Carlos


    A taxonomically unique bacterial strain, Acinetobacter sp. A47, has been recovered from several soft tissue samples from a patient undergoing reconstructive surgery owing to a traumatic amputation. The results of 16S rRNA, rpoB, and gyrB gene comparative sequence analyses showed that A47 does not belong to any of the hitherto-known taxa and may represent an as-yet-unknown Acinetobacter species. The recognition of this novel organism contributes to our knowledge of the taxonomic complexity underlying infections caused by Acinetobacter. PMID:25392359

  4. [Identification and determination of sensitivity to antibiotics of 31 clinical strains of Acinetobacter other than A. baumannii].


    Freney, J; Bouvet, P J; Tixier, C


    Precise identification and determination of MICs of clinical isolates of Acinetobacter identified to other species than the hospital species A. baumannii were carried out. On 260 Acinetobacter strains isolated in an hospital over a 6 months period, 31 strains (12 p. cent) were identified to species other than A. baumannii. Among these 31 strains, A. Iwoffii sensu stricto (16 strains) and A. haemolyticus (6 strains) were mostly recovered. Eight glucose oxidizing strains were identified to A. haemolyticus (6 strains), Acinetobacter genospecies 3 (2 strains), and A. Iwoffii sensu stricto (1 strain). Antibiotic susceptibilities of these strains were greater than those commonly observed with A. baumannii strains. PMID:2930020

  5. Acinetobacter baumannii Genes Required for Bacterial Survival during Bloodstream Infection

    PubMed Central

    Subashchandrabose, Sargurunathan; Smith, Sara; DeOrnellas, Valerie; Crepin, Sebastien; Kole, Monica; Zahdeh, Carina


    ABSTRACT Acinetobacter baumannii is emerging as a leading global multiple-antibiotic-resistant nosocomial pathogen. The identity of genes essential for pathogenesis in a mammalian host remains largely unknown. Using transposon-directed insertion-site sequencing (TraDIS), we identified A. baumannii genes involved in bacterial survival in a leukopenic mouse model of bloodstream infection. Mice were inoculated with a pooled transposon mutant library derived from 109,000 mutants, and TraDIS was used to map transposon insertion sites in the genomes of bacteria in the inoculum and of bacteria recovered from mouse spleens. Unique transposon insertion sites were mapped and used to calculate a fitness factor for every insertion site based on its relative abundance in the inoculum and postinfection libraries. Eighty-nine transposon insertion mutants that were underrepresented after experimental infection in mice compared to their presence in the inocula were delineated as candidates for further evaluation. Genetically defined mutants lacking feoB (ferrous iron import), ddc (d-ala-d-ala-carboxypeptidase), and pntB (pyridine nucleotide transhydrogenase subunit) exhibited a fitness defect during systemic infection resulting from bacteremia. In vitro, these mutants, as well as a fepA (ferric enterobactin receptor) mutant, are defective in survival in human serum and within macrophages and are hypersensitive to killing by antimicrobial peptides compared to the survival of the parental strain under these conditions. Our data demonstrate that FepA is involved in the uptake of exogenous enterobactin in A. baumannii. Genetic complementation rescues the phenotypes of mutants in assays that emulate conditions encountered during infection. In summary, we have determined novel A. baumannii fitness genes involved in the pathogenesis of mammalian infection. IMPORTANCE A. baumannii is a significant cause of bacterial bloodstream infection in humans. Since multiple antibiotic resistance

  6. Acinetobacter variabilis sp. nov. (formerly DNA group 15 sensu Tjernberg & Ursing), isolated from humans and animals.


    Krizova, Lenka; McGinnis, Jana; Maixnerova, Martina; Nemec, Matej; Poirel, Laurent; Mingle, Lisa; Sedo, Ondrej; Wolfgang, William; Nemec, Alexandr


    We aimed to define the taxonomic status of 16 strains which were phenetically congruent with Acinetobacter DNA group 15 described by Tjernberg & Ursing in 1989. The strains were isolated from a variety of human and animal specimens in geographically distant places over the last three decades. Taxonomic analysis was based on an Acinetobacter-targeted, genus-wide approach that included the comparative sequence analysis of housekeeping, protein-coding genes, whole-cell profiling based on matrix-assisted laser desorption ionization-time-of-flight mass spectrometry (MALDI-TOF MS), an array of in-house physiological and metabolic tests, and whole-genome comparative analysis. Based on analyses of the rpoB and gyrB genes, the 16 strains formed respective, strongly supported clusters clearly separated from the other species of the genus Acinetobacter. The distinctness of the group at the species level was indicated by average nucleotide identity values of ≤82 % between the whole genome sequences of two of the 16 strains (NIPH 2171(T) and NIPH 899) and those of the known species. In addition, the coherence of the group was also supported by MALDI-TOF MS. All 16 strains were non-haemolytic and non-gelatinase-producing, grown at 41 °C and utilized a rather limited number of carbon sources. Virtually every strain displayed a unique combination of metabolic and physiological features. We conclude that the 16 strains represent a distinct species of the genus Acinetobacter, for which the name Acinetobacter variabilis sp. nov. is proposed to reflect its marked phenotypic heterogeneity. The type strain is NIPH 2171(T) ( = CIP 110486(T) = CCUG 26390(T) = CCM 8555(T)). PMID:25510976

  7. Acinetobacter variabilis sp. nov. (formerly DNA group 15 sensu Tjernberg & Ursing), isolated from humans and animals

    PubMed Central

    Krizova, Lenka; McGinnis, Jana; Maixnerova, Martina; Nemec, Matej; Poirel, Laurent; Mingle, Lisa; Sedo, Ondrej; Wolfgang, William


    We aimed to define the taxonomic status of 16 strains which were phenetically congruent with Acinetobacter DNA group 15 described by Tjernberg & Ursing in 1989. The strains were isolated from a variety of human and animal specimens in geographically distant places over the last three decades. Taxonomic analysis was based on an Acinetobacter-targeted, genus-wide approach that included the comparative sequence analysis of housekeeping, protein-coding genes, whole-cell profiling based on matrix-assisted laser desorption ionization-time-of-flight mass spectrometry (MALDI-TOF MS), an array of in-house physiological and metabolic tests, and whole-genome comparative analysis. Based on analyses of the rpoB and gyrB genes, the 16 strains formed respective, strongly supported clusters clearly separated from the other species of the genus Acinetobacter. The distinctness of the group at the species level was indicated by average nucleotide identity values of ≤82 % between the whole genome sequences of two of the 16 strains (NIPH 2171T and NIPH 899) and those of the known species. In addition, the coherence of the group was also supported by MALDI-TOF MS. All 16 strains were non-haemolytic and non-gelatinase-producing, grown at 41 °C and utilized a rather limited number of carbon sources. Virtually every strain displayed a unique combination of metabolic and physiological features. We conclude that the 16 strains represent a distinct species of the genus Acinetobacter, for which the name Acinetobacter variabilis sp. nov. is proposed to reflect its marked phenotypic heterogeneity. The type strain is NIPH 2171T ( = CIP 110486T = CCUG 26390T = CCM 8555T). PMID:25510976

  8. In vitro antimicrobial activity of ceftizoxime against glucose-nonfermentative gram-negative rods.


    Yabuuchi, E; Ito, T; Tanimura, E; Yamamoto, N; Ohyama, A


    Ceftizoxime, a new cephalosporin, was active against Pseudomonas cepacia, Flavobacterium meningosepticum, Alcaligenes faecalis, and Acinetobacter calcoaceticus and was more potent against Pseudomonas aeruginosa and Pseudomonas putida than was carbenicillin. PMID:6269480

  9. Colistin and tigecycline for management of external ventricular device-related ventriculitis due to multidrug-resistant Acinetobacter baumannii.


    Shrestha, Gentle Sunder; Tamang, Sushil; Paneru, Hem Raj; Shrestha, Pramesh Sunder; Keyal, Niraj; Acharya, Subhash Prasad; Marhatta, Moda Nath; Shilpakar, Sushil


    Acinetobacter baumannii is an important cause of nosocomial ventriculitis associated with external ventricular device (EVD). It is frequently multidrug resistant (MDR), carries a poor outcome, and is difficult to treat. We report a case of MDR Acinetobacter ventriculitis treated with intravenous and intraventricular colistin together with intravenous tigecycline. The patient developed nephrotoxicity and poor neurological outcome despite microbiological cure. Careful implementation of bundle of measures to minimize EVD-associated ventriculitis is valuable. PMID:27365967

  10. Colistin and tigecycline for management of external ventricular device-related ventriculitis due to multidrug-resistant Acinetobacter baumannii

    PubMed Central

    Shrestha, Gentle Sunder; Tamang, Sushil; Paneru, Hem Raj; Shrestha, Pramesh Sunder; Keyal, Niraj; Acharya, Subhash Prasad; Marhatta, Moda Nath; Shilpakar, Sushil


    Acinetobacter baumannii is an important cause of nosocomial ventriculitis associated with external ventricular device (EVD). It is frequently multidrug resistant (MDR), carries a poor outcome, and is difficult to treat. We report a case of MDR Acinetobacter ventriculitis treated with intravenous and intraventricular colistin together with intravenous tigecycline. The patient developed nephrotoxicity and poor neurological outcome despite microbiological cure. Careful implementation of bundle of measures to minimize EVD-associated ventriculitis is valuable. PMID:27365967

  11. Prevalence of Pseudomonas aeruginosa and Acinetobacter spp. in subgingival biofilm and saliva of subjects with chronic periodontal infection.


    Souto, Renata; Silva-Boghossian, Carina M; Colombo, Ana Paula Vieira


    P. aeruginosa and Acinetobacter spp. are important pathogens associated with late nosocomial pneumonia in hospitalized and institutionalized individuals. The oral cavity may be a major source of these respiratory pathogens, particularly in the presence of poor oral hygiene and periodontal infection. This study investigated the prevalence of P. aeruginosa and Acinetobacter spp. in subgingival biofilm and saliva of subjects with periodontal disease or health. Samples were obtained from 55 periodontally healthy (PH) and 169 chronic periodontitis (CP) patients. DNA was obtained from the samples and detection of P. aeruginosa and Acinetobacter spp. was carried out by multiplex and nested PCR. P. aeruginosa and Acinetobacter spp. were detected in 40% and 45% of all samples, respectively. No significant differences in the distribution of these microorganisms between men and women, subgingival biofilm and saliva samples, patients ≤ 35 and > 35 years of age, and smokers and non-smokers were observed regardless periodontal status (p > 0.05). In contrast, the frequencies of P. aeruginosa and Acinetobacter spp. in saliva and biofilm samples were significantly greater in CP than PH patients (p < 0.01). Smokers presenting P. aeruginosa and high frequencies of supragingival plaque were more likely to present CP than PH. P. aeruginosa and Acinetobacter spp. are frequently detected in the oral microbiota of CP. Poor oral hygiene, smoking and the presence of P. aeruginosa are strongly associated with periodontitis. PMID:25242933

  12. Sensitive, resistant and multi-drug resistant Acinetobacter baumanii at Saudi Arabia hospital eastern region.


    Ahmed, Mughis Uddin; Farooq, Reshma; Al-Hawashim, Nadia; Ahmed, Motasim; Yiannakou, Nearchos; Sayeed, Fatima; Sayed, Ali Rifat; Lutfullah, Sualiha


    Since the Physicians start use of antibiotics long ago with un-notice drug resistance. However actual problem was recognized about 85 years ago. Antibiotic resistant and Multi-drug resistant bacterial strains are at rise throughout the world. It is physicians and researchers to take scientific research based appropriate action to overcome this ever-spreading problem. This study is designed to find out sensitive (S), resistant (R) and multi-drug resistant (MDR) Acinetobacter baumanii strain along with other isolates in the resident patients of Eastern Region of Saudi Arabia. Pseudomonas aeruginosa is excluded from other gram-negative organisms isolated from different sites as it will be dealt separately. This study is based in was retrospective observations designed to collect data of different stains of Acinetobacter baumanii with reference to their Sensitivity (S), Resistance (R), Multi-Drug Resistance (MDR) along with other Gram negative isolated from different sites (from 1st January 2004 to 31st December 2011) at King Abdulaziz Hospital located Eastern Region of Kingdom of Saudi Arabia (KSA). All necessary techniques were used to culture and perform sensitivity of these isolates. There were 4532 isolates out of which 3018 (67%) were from patients. Out of Acinetobacter baumanii infected were 906 (20%) while other 3626 (80%) isolates were miscellaneous. Numbers of patients or cases were 480 (53%) out of 906 isolates and numbers of patients or cases in other organisms were 2538 (70%) out of 3626 isolates. Acinetobacter baumanii infected patients 221 (46%) were male and 259 (54%) were female and the male and female ratio of 1:1.2. In other organisms this male female ratio was almost same. There was steady rise in number of patients and the hence the isolates from 2004 to 2011. Majority of the bacterial strains were isolated as single organism but some were isolated as double or triple or quadruple or more organisms from different sites. Sensitive, Resistant and

  13. Bacteremia due to Acinetobacter ursingii in infants: Reports of two cases

    PubMed Central

    Yakut, Nurhayat; Kepenekli, Eda Kadayifci; Karaaslan, Ayse; Atici, Serkan; Akkoc, Gulsen; Demir, Sevliya Ocal; Soysal, Ahmet; Bakir, Mustafa


    Acinetobacter ursingii is an aerobic, gram-negative, opportunistic microorganism which is rarely isolated among Acinetobacter species. We present two immunocompetent infants who developed bacteremia due to A. ursingii. The first patient is a two -month- old boy who had been hospitalized in pediatric surgery unit for suspected tracheo-esophageal fistula because of recurrent aspiration pneumonia unresponsive to antibiotic therapy. The second patient is a fourteen -month- old boy with prolonged vomiting and diarrhea. A. ursingii was isolated from their blood cultures. They were successfully treated with ampicillin-sulbactam. Although A. ursingii has recently been isolated from a clinical specimen; reports of infection with A. ursingii in children are rare. A. ursingii should be kept in mind as an opportunistic microorganism in children. PMID:27347282

  14. Culturable populations of Acinetobacter can promptly respond to contamination by alkanes in mangrove sediments.


    Rocha, Lidianne L; Colares, Geórgia B; Angelim, Alysson L; Grangeiro, Thalles B; Melo, Vânia M M


    This study evaluated the potential of bacterial isolates from mangrove sediments to degrade hexadecane, an paraffin hydrocarbon that is a large constituent of diesel and automobile lubricants. From a total of 18 oil-degrading isolates obtained by an enrichment technique, four isolates showed a great potential to degrade hexadecane. The strain MSIC01, which was identified by 16S rRNA gene sequencing as Acinetobacter sp., showed the best performance in degrading this hydrocarbon, being capable of completely degrading 1% (v/v) hexadecane within 48 h without releasing biosurfactants. Its hydrophobic surface probably justifies its potential to degrade high concentrations of hexadecane. Thus, the sediments from the studied mangrove harbour bacterial communities that are able to use oil as a carbon source, which is a particularly interesting feature due to the risk of oil spills in coastal areas. Moreover, Acinetobacter sp. MSIC01 emerged as a promising candidate for applications in bioremediation of contaminated mangrove sediments. PMID:24050127

  15. Toll-Like Receptor 9 Contributes to Defense against Acinetobacter baumannii Infection

    PubMed Central

    Noto, Michael J.; Boyd, Kelli L.; Burns, William J.; Varga, Matthew G.; Peek, Richard M.


    Acinetobacter baumannii is a common nosocomial pathogen capable of causing severe diseases associated with significant morbidity and mortality in impaired hosts. Pattern recognition receptors, such as the Toll-like receptors (TLRs), play a key role in pathogen detection and function to alert the immune system to infection. Here, we examine the role for TLR9 signaling in response to A. baumannii infection. In a murine model of A. baumannii pneumonia, TLR9−/− mice exhibit significantly increased bacterial burdens in the lungs, increased extrapulmonary bacterial dissemination, and more severe lung pathology compared with those in wild-type mice. Following systemic A. baumannii infection, TLR9−/− mice have significantly increased bacterial burdens in the lungs, as well as decreased proinflammatory cytokine and chemokine production. These results demonstrate that TLR9-mediated pathogen detection is important for host defense against the opportunistic pathogen Acinetobacter baumannii. PMID:26238713

  16. Efficacy of Tigecycline for Secondary Acinetobacter Bacteremia and Factors Associated with Treatment Failure

    PubMed Central

    Liou, Bo-Huang; Lee, Yi-Tzu; Liu, Po-Yu; Fung, Chang-Phone


    We describe the clinical outcome of 17 patients with secondary Acinetobacter bacteremia whose isolates had a tigecycline MIC of ≤2 mg/liter and who received tigecycline within 2 days of bacteremia onset. The 14-day mortality rate of the tigecycline cohort was 41.2% (7/17), which was significantly higher than that of those receiving other appropriate antimicrobial agents (13.8%, 9/65; P = 0.018). However, the percentages of end-stage renal disease and congestive heart failure were higher in the tigecycline cohort. The efficacy of tigecycline was contingent upon the illness severity and bacterial species. Tigecycline should be applied cautiously for treatment of Acinetobacter bacteremia. PMID:25824230

  17. Detection of Multi-drug Resistant Acinetobacter Lwoffii Isolated from Soil of Mink Farm.


    Sun, Na; Wen, Yong Jun; Zhang, Shu Qin; Zhu, Hong Wei; Guo, Li; Wang, Feng Xue; Chen, Qiang; Ma, Hong Xia; Cheng, Shi Peng


    There were 4 Acinetobacter lwoffii obtained from soil samples. The antimicrobial susceptibility of the strains to 16 antimicrobial agents was investigated using K-B method. Three isolates showed the multi-drug resistance. The presence of resistance genes and integrons was determined using PCR. The aadA1, aac(3')-IIc, aph(3')-VII, aac(6')-Ib, sul2, cat2, floR, and tet(K) genes were detected, respectively. Three class 1 integrons were obtained. The arr-3-aacA4 and blaPSE-1 gene cassette, which cause resistance to aminoglycoside and beta-lactamase antibiotics. Our results reported the detection of multi-drug resistant and carried resistant genes Acinetobacter lwoffii from soil. The findings suggested that we should pay close attention to the prevalence of multi-drug resistant bacterial species of environment. PMID:27554122

  18. Post-neurosurgical meningitis caused by acinetobacter baumannii: case series and review of the literature

    PubMed Central

    Ni, Shunlan; Li, Shanshan; Yang, Naibin; Zhang, Sainan; Hu, Danping; Li, Qian; Lu, Mingqin


    Background: Acinetobacter baumannii (A. baumannii), a gram-negative bacterium, has now become an important hospital pathogen, which causes various serious nosocomial infections worldwide. Bacterial meningitis is a common complication after neurosurgical operation, and the percentage of A. baumannii meningitis is growing, especially the one resisting multiple drugs. Method: We retrospectively reviewed the cases with postoperative A. baumannii meningitis (PABM) in the First Affiliated Hospital of Wenzhou Medical University from January 2013 to October 2014. And we retrieved the PubMed for cases with PABM and reviewed them. Result: Five cases were included in our retrospective study. Two cases with sensitive A. baumannii and one with multidrug-resistant acinetobacter baumannii (MRAB) were cured, and other two with MRAB died. Conclusion: Intraventricular or intrathecal colistin could be a treatment to the MRAB. PMID:26885152

  19. Role of OmpA in the Multidrug Resistance Phenotype of Acinetobacter baumannii

    PubMed Central

    Fàbrega, Anna; Roca, Ignasi; Sánchez-Encinales, Viviana; Vila, Jordi; Pachón, Jerónimo


    Acinetobacter baumannii has emerged as a nosocomial pathogen with an increased prevalence of multidrug-resistant strains. The role of the outer membrane protein A (OmpA) in antimicrobial resistance remains poorly understood. In this report, disruption of the ompA gene led to decreased MICs of chloramphenicol, aztreonam, and nalidixic acid. We have characterized, for the first time, the contribution of OmpA in the antimicrobial resistance phenotype of A. baumannii. PMID:24379205

  20. Draft Genome Sequences of Two Extensively Drug-Resistant Acinetobacter baumannii Strains Isolated from Pus Samples

    PubMed Central

    Mahalingam, Niranjana; Manivannan, Bhavani; Jadhao, Sudhir; Mishra, Gayathri; Nilawe, Pravin


    We report the draft genomes of two extensively drug-resistant (XDR) Acinetobacter baumannii strains isolated from pus samples of two patients with surgical site infections at Sri Sathya Sai Institute of Higher Medical Sciences, Prasanthigram, India. The average genomic size and G+C content are 4 Mbp and 38.96% (AB28) and 4 Mbp and 38.94% (AB30), respectively. PMID:27013044

  1. Draft Genome Sequences of Two Extensively Drug-Resistant Acinetobacter baumannii Strains Isolated from Pus Samples.


    Mahalingam, Niranjana; Manivannan, Bhavani; Jadhao, Sudhir; Mishra, Gayathri; Nilawe, Pravin; Pradeep, Bulagonda Eswarappa


    We report the draft genomes of two extensively drug-resistant (XDR)Acinetobacter baumanniistrains isolated from pus samples of two patients with surgical site infections at Sri Sathya Sai Institute of Higher Medical Sciences, Prasanthigram, India. The average genomic size and G+C content are 4 Mbp and 38.96% (AB28) and 4 Mbp and 38.94% (AB30), respectively. PMID:27013044

  2. First report of NDM-1-producing Acinetobacter baumannii sequence type 25 in Brazil.


    Pillonetto, Marcelo; Arend, Lavinia; Vespero, Eliana Carolina; Pelisson, Marsileni; Chagas, Thiago Pavoni Gomes; Carvalho-Assef, Ana Paula D'Alincourt; Asensi, Marise Dutra


    New Delhi metallo-β-lactamase 1 (NDM-1) was first identified in Brazil in Enterobacter hormaechei and Providencia rettgeri in 2013. Here, we describe the first case of NDM-1-producing Acinetobacter baumannii sequence type 25 isolated from the urinary tract of a 71-year-old man who died of multiple complications, including A. baumannii infection. The NDM-1 gene was detected by quantitative PCR, and its sequence confirmed its presence in an ∼ 100-kb plasmid. PMID:25288087

  3. Isolation of Acinetobacter lwoffii from a lovebird (Agapornis roseicollis) with severe respiratory symptoms.


    Robino, P; Bert, E; Tramuta, C; Cerruti Sola, S; Nebbia, P


    Although Acinetobacter lwoffii is generally considered an ubiquitous and opportunistic bacterium, this germ has been isolated from the pulmonary and abdominal air sac swabs obtained from a Lovebird (Agapornis roseicollis), which died of a severe respiratory disease. Bacteriological tests (phenotypic and genotypic) led to the identification of A. lwoffii in pure culture. All the other parrots in the breeding centre were treated orally with oxytetracycline for 14 days and 3 months later no bird showed any signs of respiratory symptoms. PMID:15999637

  4. Severe Community-Acquired Bloodstream Infection with Acinetobacter ursingii in Person who Injects Drugs

    PubMed Central

    Salzer, Helmut J.F.; Rolling, Thierry; Schmiedel, Stefan; Klupp, Eva-Maria; Lange, Christoph


    We report a community-acquired bloodstream infection with Acinteobacter ursingii in an HIV-negative woman who injected drugs. The infection was successfully treated with meropenem. Species identification was performed by using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. Improved identification of Acinetobacter spp. by using this method will help identify clinical effects of this underdiagnosed pathogen. PMID:26689082

  5. Metabolism of spacecraft cleaning reagents by Mars Odyssey and Phoenix-associated Acinetobacter

    NASA Astrophysics Data System (ADS)

    Mogul, Rakesh; Barding, Gregory; Baki, Ryan; Perkins, Nicole; Lee, Sooji; Lalla, Sid; Campos, Alexa; Sripong, Kimberly; Madrid, Steve


    The metabolomic and proteomic properties that promote microbial survival in spacecraft assembly facilities are important aspects to planetary protection and astrobiology. In this presentation, we will provide molecular and biological evidence that the spacecraft-associated Acinetobacter metabolize/degrade spacecraft cleaning reagents such as ethanol, 2-propanol, and Kleenol-30. Gas chromatography-mass spectrometry (GC-MS) studies on A. radioresistens 50v1 (Mars Odyssey) show that the metabolome is dependent upon growth conditions and that ^{13}C-labeled ethanol is incorporated into metabolites such as TCA/glyoxylate cycle intermediates, amino acids, monosaccharides, and disaccharides (e.g., trehalose). In fact, plate count assays show that ethanol is a sole carbon source under minimal conditions for several Mars Phoenix and Odyssey-associated Acinetobacter strains, which may explain why the Acinetobacter are among the most abundant genera found in spacecraft assembly facilities. Biochemical analyses support the enzymatic oxidation of ethanol and 2-propanol by a membrane-bound and NAD+/PQQ-dependent alcohol dehydrogenase, with current kinetic data providing similar apparent K _{M} and maximum growth rate values of ˜5 and 8 mM ethanol, respectively. Preliminary GC-MS analysis also suggests that Kleenol-30 is degraded by A. radioresistens 50v1 when grown in ethanol mixtures. Under minimal conditions, A. radioresistens 50v1 (˜10 ^{8} cfu/mL) also displays a remarkable oxidative extremotolerance (˜2-log reduction in 10 mM hydrogen peroxide), which suggests crucial roles for metabolites associated with oxidative stress (e.g., trehalose) and the observed appreciable catalase specific activities. In conclusion, these results provide key insights into the survival strategies of spacecraft-associated Acinetobacter and emphasize the importance of characterizing the carbon metabolism of forward contaminants.

  6. Draft Genome Sequence of Ammonia-Producing Acinetobacter sp. Strain MCC2139 from Dairy Effluent

    PubMed Central

    Chatterjee, Debasmita; Thakur, Ashoke Ranjan


    We report the draft genome sequence of an ammonia-producing, esculin-hydrolyzing, catalase-positive, gram-negative bacterium, Acinetobacter sp. strain MCC2139. This bacterium, isolated from dairy sludge and with optimum growth at 37°C, has a genome size of 2,967,280 bp with a G+C content of 42.3%. PMID:23814111

  7. The Genomic Diversification of the Whole Acinetobacter Genus: Origins, Mechanisms, and Consequences

    PubMed Central

    Touchon, Marie; Cury, Jean; Yoon, Eun-Jeong; Krizova, Lenka; Cerqueira, Gustavo C.; Murphy, Cheryl; Feldgarden, Michael; Wortman, Jennifer; Clermont, Dominique; Lambert, Thierry; Grillot-Courvalin, Catherine; Nemec, Alexandr; Courvalin, Patrice; Rocha, Eduardo P.C.


    Bacterial genomics has greatly expanded our understanding of microdiversification patterns within a species, but analyses at higher taxonomical levels are necessary to understand and predict the independent rise of pathogens in a genus. We have sampled, sequenced, and assessed the diversity of genomes of validly named and tentative species of the Acinetobacter genus, a clade including major nosocomial pathogens and biotechnologically important species. We inferred a robust global phylogeny and delimited several new putative species. The genus is very ancient and extremely diverse: Genomes of highly divergent species share more orthologs than certain strains within a species. We systematically characterized elements and mechanisms driving genome diversification, such as conjugative elements, insertion sequences, and natural transformation. We found many error-prone polymerases that may play a role in resistance to toxins, antibiotics, and in the generation of genetic variation. Surprisingly, temperate phages, poorly studied in Acinetobacter, were found to account for a significant fraction of most genomes. Accordingly, many genomes encode clustered regularly interspaced short palindromic repeats (CRISPR)-Cas systems with some of the largest CRISPR-arrays found so far in bacteria. Integrons are strongly overrepresented in Acinetobacter baumannii, which correlates with its frequent resistance to antibiotics. Our data suggest that A. baumannii arose from an ancient population bottleneck followed by population expansion under strong purifying selection. The outstanding diversification of the species occurred largely by horizontal transfer, including some allelic recombination, at specific hotspots preferentially located close to the replication terminus. Our work sets a quantitative basis to understand the diversification of Acinetobacter into emerging resistant and versatile pathogens. PMID:25313016

  8. Continuous coculture degradation of selected polychlorinated biphenyl congeners by Acinetobacter spp. in an aerobic reactor system

    SciTech Connect

    Adriaens, P.; Focht, D.D. )


    A coculture of two Acinetobacter spp. was applied to degrade polychlorinated biphenyls during a 42-day incubation study in a continuous aerobic fixed-bed reactor system, filled with polyurethane foam boards as support for bacterial biofilm development. The reactor was supplied with mineral medium containing 500 ppm sodium benzoate as a growth (primary) substrate, while the incoming airstream was saturated with biphenyl vapors to induce for PCB cometabolism in Acinetobacter sp. strain P6. The chlorobenzoates thus generated from 4,4{prime}-dichlorobiphenyl (4,4{prime}-DCBP), 3,4-dichlorobiphenyl (3,4-DCBP), and 3,3{prime},4,4{prime}-tetrachlorobiphenyl were further metabolized by Acinetobacter sp. strain 4-CB1. The chlorobenzoate metabolites, as well as ring-fission product ({lambda}{sub max} = 442 nm) from the PCB congeners, accounted for the degradation of 63% (2.8 mM) of the 4,4{prime}-DCBP, 100% (0.5 mM) of the 3,4-DCBP, and 32% (0.12 mM) of the 3,3{prime},4,4{prime}-TCBP, the biofilm responded with a concurrent higher release of chlorobenzoates and chloride through cosubstrate utilization.

  9. Fatty aldehyde dehydrogenases in Acinetobacter sp. strain HO1-N: role in hexadecane and hexadecanol metabolism

    SciTech Connect

    Singer, M.E.; Finnerty, W.R.


    The role of fatty aldehyde dehydrogenases (FALDHs) in hexadecane and hexadecanol metabolism was studied in Acinetobacter sp. strain HO1-N. Two distinct FALDHs were demonstrated in Acinetobacter sp. strain HO1-N: (i) a membrane-bound, NADP-dependent FALDH activity induced 5-, 15-, and 9 fold by growth on hexadecanol, dodecyl aldehyde, and hexadecane, respectively, and (ii) a constitutive, NAD-dependent, membrane-localized FALDH. Dodecyl aldehyde-negative mutants were isolated and grouped into two phenotypic classes based on growth: class 1 mutants were hexadecane and hexadecanol negative and class 2 mutants were hexadecane and hexadecanol positive. Specific activity of NADP-dependent FALDH in Ald21 (class 1 mutant) was 85% lower than that of wild-type FALDH, while the specific activity of Ald24 (class 2 mutant) was 55% greater than that of wild-type FALDH. Ald21R, a dodecyl aldehyde-positive revertant able to grow on hexadecane, hexadecanol, and dodecyl aldehyde, exhibited a 100% increase in the specific activity of the NADP-dependent FALDH. This study provides genetic and physiological evidence for the role of fatty aldehyde as an essential metabolic intermediate and NADP-dependent FALDH as a key enzyme in the dissimilation of hexadecane, hexadecanol, and dodecyl aldehyde in Acinetobacter sp. strain HO1-N.

  10. Risk factors and outcomes of imipenem-resistant Acinetobacter bloodstream infection in North-eastern Malaysia

    PubMed Central

    Deris, Zakuan Zainy; Shafei, Mohd Nazri; Harun, Azian


    Objective To determine the risk factors and outcomes of imipenem-resistant Acinetobacter baumannii (IRAB) bloodstream infection (BSI) cases, since there is very little publication on Acinetobacter baumannii infections from Malaysia. Methods A cross sectional study of 41 cases (73.2%) of imipenem-sensitive Acinetobacter baumanii (ISAB) and 15 cases (26.8%) of IRAB was conducted in a teaching hospital which was located at North-Eastern state of Malaysia. Results There was no independent risk factor for IRAB BSI identified but IRAB BSI was significantly associated with longer bacteraemic days [OR 1.23 (95% CI 1.01, 1.50)]. Although prior use of carbepenems and cephalosporin were higher among IRAB than ISAB group, statistically they were not significant. There was no significant difference in term of outcomes between the two groups. Conclusions Although statistically not significant, this analysis compliments previous publication highlighting the importance of appropriate empiric antibiotic usage in hospital especially carbepenems and need further evaluation with bigger subjects. PMID:23569782

  11. Genome-sequence analysis of Acinetobacter johnsonii MB44 reveals potential nematode-virulent factors.


    Tian, Shijing; Ali, Muhammad; Xie, Li; Li, Lin


    Acinetobacter johnsonii is generally recognized as a nonpathogenic bacterium although it is often found in hospital environments. However, a newly identified isolate of this species from a frost-plant-tissue sample, namely, A. johnsonii MB44, showed significant nematicidal activity against the model organism Caenorhabditis elegans. To expand our understanding of this bacterial species, we generated a draft genome sequence of MB44 and analyzed its genomic features related to nematicidal attributes. The 3.36 Mb long genome contains 3636 predicted protein-coding genes and 95 RNA genes (including 14 rRNA genes), with a G + C content of 41.37 %. Genomic analysis of the prediction of nematicidal proteins using the software MP3 revealed a total of 108 potential virulence proteins. Some of these proteins were homologous to the known virulent proteins identified from Acinetobacter baumannii, a pathogenic species of the genus Acinetobacter. These virulent proteins included the outer membrane protein A, the phospholipase D, and penicillin-binding protein 7/8. Moreover, one siderophore biosynthesis gene cluster and one capsular polysaccharide gene cluster, which were predicted to be important virulence factors for C. elegans, were identified in the MB44 genome. The current study demonstrated that A. johnsonii MB44, with its nematicidal activity, could be an opportunistic pathogen to animals. PMID:27429894

  12. Biofilm may not be Necessary for the Epidemic Spread of Acinetobacter baumannii

    PubMed Central

    Hu, Yuan; He, Lihua; Tao, Xiaoxia; Meng, Fanliang; Zhang, Jianzhong


    Biofilm is recognized as a contributing factor to the capacity of Acinetobacter baumannii to persist and prosper in medical settings, but it is still unknown whether biofilms contribute to the spread of A. baumannii. In this study, the biofilm formation of 114 clinical A. baumannii isolates and 32 non-baumannii Acinetobacter isolates was investigated using a microtiter plate assay. The clonal relationships among A. baumannii isolates were assessed using pulsed-field gel electrophoresis and multilocus sequence typing, and one major outbreak clone and 5 other epidemic clones were identified. Compared with the epidemic or outbreak A. baumannii isolates, the sporadic isolates had significantly higher biofilm formation, but no significant difference was observed between the sporadic A. baumannii isolates and the non-baumannii Acinetobacter isolates, suggesting that biofilm is not important for the epidemic spread of A. baumannii. Of the multidrug-resistant (MDR) A. baumannii isolates in this study, 95.7% were assigned to international clone 2 (IC2) and showed significantly lower biofilm formations than the other isolates, suggesting that biofilm did not contribute to the high success of IC2. These findings have increased our understanding of the potential relationship between biofilm formation and the epidemic capacity of A. baumannii. PMID:27558010

  13. The Population Structure of Acinetobacter baumannii: Expanding Multiresistant Clones from an Ancestral Susceptible Genetic Pool

    PubMed Central

    Diancourt, Laure; Passet, Virginie; Nemec, Alexandr; Dijkshoorn, Lenie; Brisse, Sylvain


    Outbreaks of hospital infections caused by multidrug resistant Acinetobacter baumannii strains are of increasing concern worldwide. Although it has been reported that particular outbreak strains are geographically widespread, little is known about the diversity and phylogenetic relatedness of A. baumannii clonal groups. Sequencing of internal portions of seven housekeeping genes (total 2,976 nt) was performed in 154 A. baumannii strains covering the breadth of known diversity and including representatives of previously recognized international clones, and in 19 representatives of other Acinetobacter species. Restricted amounts of diversity and a star-like phylogeny reveal that A. baumannii is a genetically compact species that suffered a severe bottleneck in the recent past, possibly linked to a restricted ecological niche. A. baumannii is neatly demarcated from its closest relative (genomic species 13TU) and other Acinetobacter species. Multilocus sequence typing analysis demonstrated that the previously recognized international clones I to III correspond to three clonal complexes, each made of a central, predominant genotype and few single locus variants, a hallmark of recent clonal expansion. Whereas antimicrobial resistance was almost universal among isolates of these and a novel international clone (ST15), isolates of the other genotypes were mostly susceptible. This dichotomy indicates that antimicrobial resistance is a major selective advantage that drives the ongoing rapid clonal expansion of these highly problematic agents of nosocomial infections. PMID:20383326

  14. Biofilm may not be Necessary for the Epidemic Spread of Acinetobacter baumannii.


    Hu, Yuan; He, Lihua; Tao, Xiaoxia; Meng, Fanliang; Zhang, Jianzhong


    Biofilm is recognized as a contributing factor to the capacity of Acinetobacter baumannii to persist and prosper in medical settings, but it is still unknown whether biofilms contribute to the spread of A. baumannii. In this study, the biofilm formation of 114 clinical A. baumannii isolates and 32 non-baumannii Acinetobacter isolates was investigated using a microtiter plate assay. The clonal relationships among A. baumannii isolates were assessed using pulsed-field gel electrophoresis and multilocus sequence typing, and one major outbreak clone and 5 other epidemic clones were identified. Compared with the epidemic or outbreak A. baumannii isolates, the sporadic isolates had significantly higher biofilm formation, but no significant difference was observed between the sporadic A. baumannii isolates and the non-baumannii Acinetobacter isolates, suggesting that biofilm is not important for the epidemic spread of A. baumannii. Of the multidrug-resistant (MDR) A. baumannii isolates in this study, 95.7% were assigned to international clone 2 (IC2) and showed significantly lower biofilm formations than the other isolates, suggesting that biofilm did not contribute to the high success of IC2. These findings have increased our understanding of the potential relationship between biofilm formation and the epidemic capacity of A. baumannii. PMID:27558010

  15. Enrichment, isolation and characterization of pentachlorophenol degrading bacterium Acinetobacter sp. ISTPCP-3 from effluent discharge site.


    Sharma, Ashwani; Thakur, Indu Shekhar; Dureja, Prem


    Three pentachlorophenol (PCP) degrading bacterial strains were isolated from sediment core of pulp and paper mill effluent discharge site. The strains were continuously enriched in mineral salts medium supplemented with PCP as sole source of carbon and energy. One of the acclimated strains with relatively high PCP degradation capability was selected and characterized in this study. Based on morphology, biochemical tests, 16S rDNA sequence analysis and phylogenetic characteristics, the strains showed greatest similarity with Acinetobacter spp. The strain was identified as Acinetobacter sp. ISTPCP-3. The physiological characteristics and optimum growth conditions of the bacterial strain were investigated. The results of optimum growth temperature revealed that it was a mesophile. The optimum growth temperature for the strain was 30 degrees C. The preferential initial pH for the strain was ranging at 6.5-7.5, the optimum pH was 7. The bacterium was able to tolerate and degrade PCP up to a concentration of 200 mg/l. Increase in PCP concentration had a negative effect on biodegradation rate and PCP concentration above 250 mg/l was inhibitory to its growth. Acinetobacter sp. ISTPCP-3 was able to utilize PCP through an oxidative route with ortho ring-cleavage with the formation of 2,3,5,6-tetrachlorohydroquinone and 2-chloro-1,4-benzenediol, identified using gas chromatograph-mass spectrometric (GC-MS) analysis. The degradation pathway followed by isolated bacterium is different from previously characterized pathway. PMID:19214760

  16. Blood stream infections caused by Acinetobacter ursingii in an obstetrics ward.


    Horii, Toshinobu; Tamai, Kiyoko; Mitsui, Mayumi; Notake, Shigeyuki; Yanagisawa, Hideji


    The genus Acinetobacter is an important causative pathogen of nosocomial infections in the healthcare setting. The objectives of this study were to determine the species of causative pathogens and the sources of Acinetobacter blood stream infections that occurred in 2 immunocompetent pregnant women admitted to an obstetrics ward within a 2-month period. Phenotypic identification of the two isolates from blood stream infections was inconsistent among the ID test, the MicroScan WalkAway and the Vitek2 systems. In addition to the growth profile and detailed biochemical analysis, genotypic identification and phylogenetic tree analysis based on the almost complete 16S rRNA sequence and the partial rpoB gene sequence confirmed the identification of these isolates as A. ursingii. Environmental investigation of the obstetrics ward revealed A. ursingii and different strains of Acinetobacter junii in specimens obtained from the ward shower bath, although the source and route of transmission for the A. ursingii infections were not clarified. Our findings show that A. ursingii can inhabit the hospital environment. PMID:20969979

  17. Acinetobacter guangdongensis sp. nov., isolated from abandoned lead-zinc ore.


    Feng, Guang-Da; Yang, Song-Zhen; Wang, Yong-Hong; Deng, Ming-Rong; Zhu, Hong-Hui


    A Gram-stain-negative, non-motile bacterial strain designated 1NM-4(T) was isolated from an abandoned lead-zinc ore mine site in Mei County, Meizhou, Guangdong Province, southern China. The isolate was light yellow, strictly aerobic, oxidase-negative and catalase-positive. Phylogenetic analyses based on 16S rRNA, rpoB and gyrB gene sequences, together with DNA-DNA hybridization values less than 70%, revealed that strain 1NM-4(T) belongs to the genus Acinetobacter and may represent a novel species. The major respiratory quinone was ubiquinone 9 (Q-9) and the major cellular fatty acids consisted of C18:1ω9c, summed feature 3 (C16:1ω7c and/or C16:1ω6c), C16:0 and C12:0. The major polar lipids were diphosphatidylglycerol, phosphatidylethanolamine, phosphatidylglycerol, phosphatidylcholine, an unidentified aminolipid and two unidentified phospholipids. The genomic DNA G+C content of strain 1NM-4(T) was 47.17 ± 0.02 mol%. Based on phenotypic, phylogenetic and chemotaxonomic characteristics, strain 1NM-4(T) should be assigned to a novel species of the genus Acinetobacter, for which the name Acinetobacter guangdongensis sp. nov. is proposed. The type strain is 1NM-4(T) ( = GIMCC 1.656(T) = CCTCC AB 2014199(T) = KCTC 42012(T)). PMID:25015678

  18. Effect of Acinetobacter sp on metalaxyl degradation and metabolite profile of potato seedlings (Solanum tuberosum L.) alpha variety.


    Zuno-Floriano, Fabiola G; Miller, Marion G; Aldana-Madrid, Maria L; Hengel, Matt J; Gaikwad, Nilesh W; Tolstikov, Vladimir; Contreras-Cortés, Ana G


    One of the most serious diseases in potato cultivars is caused by the pathogen Phytophthora infestans, which affects leaves, stems and tubers. Metalaxyl is a fungicide that protects potato plants from Phytophthora infestans. In Mexico, farmers apply metalaxyl 35 times during the cycle of potato production and the last application is typically 15 days before harvest. There are no records related to the presence of metalaxyl in potato tubers in Mexico. In the present study, we evaluated the effect of Acinetobacter sp on metalaxyl degradation in potato seedlings. The effect of bacteria and metalaxyl on the growth of potato seedlings was also evaluated. A metabolite profile analysis was conducted to determine potential molecular biomarkers produced by potato seedlings in the presence of Acinetobacter sp and metalaxyl. Metalaxyl did not affect the growth of potato seedlings. However, Acinetobacter sp strongly affected the growth of inoculated seedlings, as confirmed by plant length and plant fresh weights which were lower in inoculated potato seedlings (40% and 27%, respectively) compared to the controls. Acinetobacter sp also affected root formation. Inoculated potato seedlings showed a decrease in root formation compared to the controls. LC-MS/MS analysis of metalaxyl residues in potato seedlings suggests that Acinetobacter sp did not degrade metalaxyl. GC-TOF-MS platform was used in metabolic profiling studies. Statistical data analysis and metabolic pathway analysis allowed suggesting the alteration of metabolic pathways by both Acinetobacter sp infection and metalaxyl treatment. Several hundred metabolites were detected, 137 metabolites were identified and 15 metabolic markers were suggested based on statistical change significance found with PLS-DA analysis. These results are important for better understanding the interactions of putative endophytic bacteria and pesticides on plants and their possible effects on plant metabolism. PMID:22363586

  19. Effect of Acinetobacter sp on Metalaxyl Degradation and Metabolite Profile of Potato Seedlings (Solanum tuberosum L.) Alpha Variety

    PubMed Central

    Zuno-Floriano, Fabiola G.; Miller, Marion G.; Aldana-Madrid, Maria L.; Hengel, Matt J.; Gaikwad, Nilesh W.; Tolstikov, Vladimir; Contreras-Cortés, Ana G.


    One of the most serious diseases in potato cultivars is caused by the pathogen Phytophthora infestans, which affects leaves, stems and tubers. Metalaxyl is a fungicide that protects potato plants from Phytophthora infestans. In Mexico, farmers apply metalaxyl 35 times during the cycle of potato production and the last application is typically 15 days before harvest. There are no records related to the presence of metalaxyl in potato tubers in Mexico. In the present study, we evaluated the effect of Acinetobacter sp on metalaxyl degradation in potato seedlings. The effect of bacteria and metalaxyl on the growth of potato seedlings was also evaluated. A metabolite profile analysis was conducted to determine potential molecular biomarkers produced by potato seedlings in the presence of Acinetobacter sp and metalaxyl. Metalaxyl did not affect the growth of potato seedlings. However, Acinetobacter sp strongly affected the growth of inoculated seedlings, as confirmed by plant length and plant fresh weights which were lower in inoculated potato seedlings (40% and 27%, respectively) compared to the controls. Acinetobacter sp also affected root formation. Inoculated potato seedlings showed a decrease in root formation compared to the controls. LC-MS/MS analysis of metalaxyl residues in potato seedlings suggests that Acinetobacter sp did not degrade metalaxyl. GC–TOF–MS platform was used in metabolic profiling studies. Statistical data analysis and metabolic pathway analysis allowed suggesting the alteration of metabolic pathways by both Acinetobacter sp infection and metalaxyl treatment. Several hundred metabolites were detected, 137 metabolites were identified and 15 metabolic markers were suggested based on statistical change significance found with PLS-DA analysis. These results are important for better understanding the interactions of putative endophytic bacteria and pesticides on plants and their possible effects on plant metabolism. PMID:22363586

  20. Detection of New Delhi metallo-β-lactamase (encoded by blaNDM-1) in Acinetobacter schindleri during routine surveillance.


    McGann, Patrick; Milillo, Michael; Clifford, Robert J; Snesrud, Erik; Stevenson, Lindsay; Backlund, Michael G; Viscount, Helen B; Quintero, Reyes; Kwak, Yoon I; Zapor, Michael J; Waterman, Paige E; Lesho, Emil P


    A carbapenem-resistant Alcaligenes faecalis strain was isolated from a surveillance swab of a service member injured in Afghanistan. The isolate was positive for bla(NDM) by real-time PCR. Species identification was reevaluated on three identification systems but was inconclusive. Genome sequencing indicated that the closest relative was Acinetobacter schindleri and that bla(NDM-1) was carried on a plasmid that shared >99% identity with one identified in an Acinetobacter lwoffii isolate. The isolate also carried a novel chromosomally encoded class D oxacillinase. PMID:23554204

  1. Characterizing In Vivo Pharmacodynamics of Carbapenems against Acinetobacter baumannii in a Murine Thigh Infection Model To Support Breakpoint Determinations

    PubMed Central

    MacVane, Shawn H.; Crandon, Jared L.


    Pharmacodynamic profiling data of carbapenems for Acinetobacter spp. are sparse. This study aimed to determine the pharmacodynamic targets of carbapenems for Acinetobacter baumannii based on a range of percentages of the dosing interval in which free drug concentrations remained above the MIC (fT>MIC) in the neutropenic murine thigh infection model. fT>MIC values of 23.7%, 32.8%, and 47.5% resulted in stasis, 1-log reductions, and 2-log reductions in bacterial density after 24 h, respectively. The pharmacodynamic targets of carbapenems for A. baumannii demonstrated in vivo are similar to those of other Gram-negative bacteria. PMID:24165174

  2. AdeIJK, a Resistance-Nodulation-Cell Division Pump Effluxing Multiple Antibiotics in Acinetobacter baumannii▿

    PubMed Central

    Damier-Piolle, Laurence; Magnet, Sophie; Brémont, Sylvie; Lambert, Thierry; Courvalin, Patrice


    We have identified a second resistance-nodulation-cell division (RND)-type efflux pump, AdeIJK, in clinical isolate Acinetobacter baumannii BM4454. The adeI, adeJ, and adeK genes encode, respectively, the membrane fusion, RND, and outer membrane components of the pump. AdeJ belongs to the AcrB protein family (57% identity with AcrB from Escherichia coli). mRNA analysis by Northern blotting and reverse transcription-PCR indicated that the genes were cotranscribed. Overexpression of the cloned adeIJK operon was toxic in both E. coli and Acinetobacter. The adeIJK genes were detected in all of the 60 strains of A. baumannii tested. The two latter observations suggest that the AdeIJK complex might contribute to intrinsic but not to acquired antibiotic resistance in Acinetobacter. To characterize the substrate specificity of the pump, we have constructed derivatives of BM4454 in which adeIJK (strain BM4579), adeABC (strain BM4561), or both groups of genes (strain BM4652) were inactivated by deletion-insertion. Determination of the antibiotic susceptibility of these strains and of BM4652 and BM4579, in which the adeIJK operon was provided in trans, indicated that the AdeIJK pump contributes to resistance to β-lactams, chloramphenicol, tetracycline, erythromycin, lincosamides, fluoroquinolones, fusidic acid, novobiocin, rifampin, trimethoprim, acridine, safranin, pyronine, and sodium dodecyl sulfate. The chemical structure of these molecules suggests that amphiphilic compounds are the preferred substrates. The AdeABC and AdeIJK efflux systems contributed in a more than additive fashion to tigecycline resistance. PMID:18086852

  3. Characterization of hydrogen peroxide-resistant Acinetobacter species isolated during the Mars Phoenix spacecraft assembly.


    Derecho, I; McCoy, K B; Vaishampayan, P; Venkateswaran, K; Mogul, R


    The microbiological inventory of spacecraft and the associated assembly facility surfaces represent the primary pool of forward contaminants that may impact the integrity of life-detection missions. Herein, we report on the characterization of several strains of hydrogen peroxide-resistant Acinetobacter, which were isolated during the Mars Phoenix lander assembly. All Phoenix-associated Acinetobacter strains possessed very high catalase specific activities, and the specific strain, A. gyllenbergii 2P01AA, displayed a survival against hydrogen peroxide (no loss in 100 mM H2O2 for 1 h) that is perhaps the highest known among Gram-negative and non-spore-forming bacteria. Proteomic characterizations reveal a survival mechanism inclusive of proteins coupled to peroxide degradation (catalase and alkyl hydroperoxide reductase), energy/redox management (dihydrolipoamide dehydrogenase), protein synthesis/folding (EF-G, EF-Ts, peptidyl-tRNA hydrolase, DnaK), membrane functions (OmpA-like protein and ABC transporter-related protein), and nucleotide metabolism (HIT family hydrolase). Together, these survivability and biochemical parameters support the hypothesis that oxidative tolerance and the related biochemical features are the measurable phenotypes or outcomes for microbial survival in the spacecraft assembly facilities, where the low-humidity (desiccation) and clean (low-nutrient) conditions may serve as selective pressures. Hence, the spacecraft-associated Acinetobacter, due to the conferred oxidative tolerances, may ultimately hinder efforts to reduce spacecraft bioburden when using chemical sterilants, thus suggesting that non-spore-forming bacteria may need to be included in the bioburden accounting for future life-detection missions. PMID:25243569

  4. Acinetobacter, Aeromonas, and Trichococcus populations dominate the microbial community within urban sewer infrastructure

    PubMed Central

    VandeWalle, J. L.; Goetz, G.W.; Huse, S.M.; Morrison, H. G.; Sogin, M.L.; Hoffmann, R.G.; Yan, K.; McLellan, S.L.


    We evaluated the population structure and temporal dynamics of the dominant community members within sewage influent from two wastewater treatment plants (WWTPs) in Milwaukee, WI. We generated >1.1M bacterial pyrotag sequences from the V6 hypervariable region of 16S rRNA genes from 38 influent samples and two samples taken upstream in the sanitary sewer system. Only a small fraction of pyrotags from influent samples (~15%) matched sequences from human fecal samples. The fecal components of the sewage samples included enriched pyrotag populations from Lactococcus and Enterobacteriaceae relative to their fractional representation in human fecal samples. In contrast to the large number of distinct pyrotags that represent fecal bacteria such as Lachnospiraceae and Bacteroides, only one or two unique V6 sequences represented Acinetobacter, Trichococcus and Aeromonas, which collectively account for nearly 35% of the total sewage community. Two dominant Acinetobacter V6 pyrotags (designated Acineto tag 1 and Acineto tag 2) fluctuated inversely with a seasonal pattern over a 3-year period, suggesting two distinct Acinetobacter populations respond differently to ecological forcings in the system. A single nucleotide change in the V6 pyrotags accounted for the difference in these populations and corresponded to two phylogenically distinct clades based on full-length sequences. Analysis of wavelet functions, derived from a mathematical model of temporal fluctuations, demonstrated that other abundant sewer associated populations including Trichococcus and Aeromonas had temporal patterns similar to either Acineto tag 1 or Acineto tag 2. Populations with related temporal fluctuations were found to significantly correlate with the same WWTP variables (5-day BOD, flow, ammonia, total phosphorous, and suspended solids). These findings illustrate that small differences in V6 sequences can represent phylogenetically and ecologically distinct taxa. This work provides insight into

  5. Escherichia coli Overexpressing a Baeyer-Villiger Monooxygenase from Acinetobacter radioresistens Becomes Resistant to Imipenem

    PubMed Central

    Minerdi, Daniela; Zgrablic, Ivan; Castrignanò, Silvia; Catucci, Gianluca; Medana, Claudio; Terlizzi, Maria Elena; Gribaudo, Giorgio; Gilardi, Gianfranco


    Antimicrobial resistance is a global issue currently resulting in the deaths of hundreds of thousands of people a year worldwide. Data present in the literature illustrate the emergence of many bacterial species that display resistance to known antibiotics; Acinetobacter spp. are a good example of this. We report here that Acinetobacter radioresistens has a Baeyer-Villiger monooxygenase (Ar-BVMO) with 100% amino acid sequence identity to the ethionamide monooxygenase of multidrug-resistant (MDR) Acinetobacter baumannii. Both enzymes are only distantly phylogenetically related to other canonical bacterial BVMO proteins. Ar-BVMO not only is capable of oxidizing two anticancer drugs metabolized by human FMO3, danusertib and tozasertib, but also can oxidize other synthetic drugs, such as imipenem. The latter is a member of the carbapenems, a clinically important antibiotic family used in the treatment of MDR bacterial infections. Susceptibility tests performed by the Kirby-Bauer disk diffusion method demonstrate that imipenem-sensitive Escherichia coli BL21 cells overexpressing Ar-BVMO become resistant to this antibiotic. An agar disk diffusion assay proved that when imipenem reacts with Ar-BVMO, it loses its antibiotic property. Moreover, an NADPH consumption assay with the purified Ar-BVMO demonstrates that this antibiotic is indeed a substrate, and its product is identified by liquid chromatography-mass spectrometry to be a Baeyer-Villiger (BV) oxidation product of the carbonyl moiety of the β-lactam ring. This is the first report of an antibiotic-inactivating BVMO enzyme that, while mediating its usual BV oxidation, also operates by an unprecedented mechanism of carbapenem resistance. PMID:26459905

  6. Gene-Silencing Antisense Oligomers Inhibit Acinetobacter Growth In Vitro and In Vivo

    PubMed Central

    Geller, Bruce L.; Marshall-Batty, Kimberly; Schnell, Frederick J.; McKnight, Mattie M.; Iversen, Patrick L.; Greenberg, David E.


    Background. Peptide-conjugated phosphorodiamidate morpholino oligomers (PPMOs) are synthetic DNA/RNA analogues that silence expression of specific genes. We studied whether PPMOs targeted to essential genes in Acinetobacter lwoffii and Acinetobacter baumannii are active in vitro and in vivo. Methods. PPMOs were evaluated in vitro using minimum inhibitory concentration (MIC) and viability assays, and in vivo using murine pulmonary infection models with intranasal PPMO treatment. Results. MICs of PPMOs ranged from 0.1 to 64 µM (approximately 0.6–38 µg/mL). The most effective PPMO tested was (RXR)4-AcpP, which is targeted to acpP. (RXR)4-AcpP reduced viability of A. lwoffii and A. baumannii by >103 colony-forming units/mL at 5–8 times MIC. Mice treated with ≥0.25 mg/kg of (RXR)4-AcpP survived longer and had less inflammation and bacterial lung burden than mice treated with a scrambled-sequence PPMO or phosphate-buffered saline. Treatment could be delayed after infection and still increase survival. Conclusions. PPMOs targeted to essential genes of A. lwoffii and A. baumannii were bactericidal and had MICs in a clinically relevant range. (RXR)4-AcpP increased survival of mice infected with A. lwoffii or A. baumannii, even when initial treatment was delayed after infection. PPMOs could be a viable therapeutic approach in dealing with multidrug-resistant Acinetobacter species. PMID:24130069

  7. Emergence of Acinetobacter baumannii international clone II in Brazil: reflection of a global expansion

    PubMed Central

    Martins, Natacha; Dalla-Costa, Libera; Uehara, Aline Almeida; Riley, Lee Woodland; Moreira, Beatriz Meurer


    The aim of this study was to investigate the occurrence of carbapenem-resistant Acinetobacter baumannii international clones (IC) in Curitiba, Brazil, using multilocus sequence typing and trilocus PCR-based typing schemes. IC2 was the first emerging clone. This IC was detected in an isolate from 2003 of a PFGE type spread in at least two hospitals since 1999. Subsequently, IC2 waned while IC1 and clonal complex 15/104 prevailed. This is the first description of IC2 in Brazil and Latin America. PMID:24121023

  8. Investigation of Metallo Beta Lactamases and Oxacilinases in Carbapenem Resistant Acinetobacter baumannii Strains Isolated from Inpatients

    PubMed Central

    Aksoy, M. Duygu; Çavuşlu, Şaban; Tuğrul, H. Murat


    Background: Resistance to beta-lactam antibiotics is widespread among Acinetobacter strains. Plasmid-mediated metallo beta lactamases (MBL) are responsible for carbapenem resistance, as are oxacillinases (OXA). In recent years, MBL producing carbapenem-resistant strains have been reported in the world and in Turkey in increasing rates. In our country, besides the OXA 51-like enzyme which is inherent in A. baumannii strains, OXA 58-like and OXA 23-like carbapenemases producing strains have also been widely detected. In addition, Verona Imipenemase (VIM) and (IMP)-type MBL have been reported in some centers. Aims: The aim of our study was to investigate the presence of carbapenemases in Acinetobacter strains isolated from hospitalized patients in Edirne. Study Design: Cross-sectional study. Methods: A total of 52 imipenem-resistant A. baumannii strains isolated between January and March 2013 were investigated. The presence of MBL was described phenotypically by the combined disk diffusion test (CDDT), double disk synergy test (DDST), MBL E-test (only performed in 28 strains) and modified Hodge test. blaIMP, blaVIM, blaGIM, blaSIM, blaSPM genes and blaOXA-23, blaOXA-51, blaOXA-40, blaOXA-58 genes were investigated by multiplex polymerase chain reaction (PCR). The blaNDM-1 gene was determined by PCR. Results: By modified Hodge test, 50 strains (96%) were found to be MBL positive. Positivity of MBL was 21% by both CDDT (0.1 M EDTA) and DDST. Twenty-four of 28 strains (85.7%) were positive by MBL E-test. OXA 23-like and OXA 51-like carbapenemases were detected in all strains, but OXA 58-like and OXA 40-like carbapenemases-producing A. baumannii were not detected. Also, MBL genes were not detected by genotypic methods. Conclusion: Only OXA 23-like carbapenemase was responsible for carbapenem resistance in carbapenem-resistant Acinetobacter strains in Edirne. The MBL-producing Acinetobacter strain is not yet a problem in our hospital. MBL resistance was found by

  9. Draft genome sequence of Acinetobacter baumannii strain NCTC 13423, a multidrug-resistant clinical isolate.


    Michiels, Joran E; Van den Bergh, Bram; Fauvart, Maarten; Michiels, Jan


    Acinetobacter baumannii is a pathogen that is becoming increasingly important and causes serious hospital-acquired infections. We sequenced the genome of A. baumannii NCTC 13423, a multidrug-resistant strain belonging to the international clone II group, isolated from a human infection in the United Kingdom in 2003. The 3,937,944 bp draft genome has a GC-content of 39.0 % and a total of 3672 predicted protein-coding sequences. The availability of genome sequences of multidrug-resistant A. baumannii isolates will fuel comparative genomic studies to help understand the worrying spread of multidrug resistance in this pathogen. PMID:27594976

  10. Clonal spread of blaOXA-72-carrying Acinetobacter baumannii sequence type 512 in Taiwan.


    Kuo, Han-Yueh; Hsu, Po-Jui; Chen, Jiann-Yuan; Liao, Po-Cheng; Lu, Chia-Wei; Chen, Chang-Hua; Liou, Ming-Li


    This is the first report to show an insidious outbreak of armA- and blaOXA-72-carrying Acinetobacter baumannii sequence type 512 (ST512) at a study hospital in northern Taiwan. Multilocus sequence typing revealed that this was a ST512 clone. All of the isolates with ST512 carried a novel 12,056-bp repGR2 in combination with a repGR12-type plasmid. This plasmid, designated pAB-ML, had one copy of the blaOXA-72 gene that was flanked by XerC/XerD-like sites and conferred resistance to carbapenems. PMID:27242318

  11. Colistin-Resistant Acinetobacter baumannii Clinical Strains with Deficient Biofilm Formation

    PubMed Central

    Dafopoulou, Konstantina; Xavier, Basil Britto; Hotterbeekx, An; Janssens, Lore; Lammens, Christine; Dé, Emmanuelle; Goossens, Herman; Tsakris, Athanasios; Malhotra-Kumar, Surbhi


    In two pairs of clinical colistin-susceptible/colistin-resistant (Csts/Cstr) Acinetobacter baumannii strains, the Cstr strains showed significantly decreased biofilm formation in static and dynamic assays (P < 0.001) and lower relative fitness (P < 0.05) compared with those of the Csts counterparts. The whole-genome sequencing comparison of strain pairs identified a mutation converting a stop codon to lysine (*241K) in LpsB (involved in lipopolysaccharide [LPS] synthesis) in one Cstr strain and a frameshift mutation in CarO and the loss of a 47,969-bp element containing multiple genes associated with biofilm production in the other. PMID:26666921

  12. Inhibition of LpxC Increases Antibiotic Susceptibility in Acinetobacter baumannii.


    García-Quintanilla, Meritxell; Caro-Vega, José M; Pulido, Marina R; Moreno-Martínez, Patricia; Pachón, Jerónimo; McConnell, Michael J


    LpxC inhibitors have generally shown poor in vitro activity against Acinetobacter baumannii We show that the LpxC inhibitor PF-5081090 inhibits lipid A biosynthesis, as determined by silver staining and measurements of endotoxin levels, and significantly increases cell permeability. The presence of PF-5081090 at 32 mg/liter increased susceptibility to rifampin, vancomycin, azithromycin, imipenem, and amikacin but had no effect on susceptibility to ciprofloxacin and tigecycline. Potentiating existing antibiotics with LpxC inhibitors may represent an alternative treatment strategy for multidrug-resistant A. baumannii. PMID:27270288

  13. Transferable amikacin resistance in Acinetobacter spp. due to a new type of 3'-aminoglycoside phosphotransferase.

    PubMed Central

    Lambert, T; Gerbaud, G; Courvalin, P


    Acinetobacter baumannii BM2580 resistant to kanamycin and structurally related antibiotics, including amikacin, was isolated from a clinical specimen. A phosphocellulose paper-binding assay and DNA annealing studies indicated that resistance to aminoglycosides in BM2580 was due to synthesis of a new type of 3'-aminoglycoside phosphotransferase. The gene conferring resistance to kanamycin-amikacin in this strain was carried by a 63-kilobase plasmid, pIP1841, self-transferable to A. baumannii, A. haemolyticus, and A. lwoffii but not to Escherichia coli. The aminoglycoside resistance gene of pIP1841 was cloned in E. coli, where it was expressed. Images PMID:2831812

  14. Tn125-Related Acquisition of blaNDM-Like Genes in Acinetobacter baumannii

    PubMed Central

    Poirel, Laurent; Bonnin, Rémy A.; Boulanger, Anne; Schrenzel, Jacques; Kaase, Martin


    A multidrug-resistant Acinetobacter baumannii isolate recovered from a patient hospitalized in Switzerland after a transfer from Serbia produced the NDM-1 carbapenemase. The blaNDM-1 gene was part of a chromosomally located Tn125 composite transposon bracketed by two copies of the same insertion sequence, ISAba125. This transposon was also associated with the acquisition and expression of the blaNDM-2 gene in an A. baumannii isolate in Germany. Tn125 appears to be the main vehicle for dissemination of blaNDM genes in that species. PMID:22143526

  15. Growth of Acinetobacter sp. strain HO1-N on n-hexadecanol: physiological and ultrastructural characteristics

    SciTech Connect

    Singer, M.E.; Tyler, S.M.; Finnerty, W.R.


    The growth of Acinetobacter sp. strain HO1-N on hexadecanol results in the formation of intracytoplasmic membranes and intracellular rectangular inclusions containing one of the end products of hexadecanol metabolism, hexadecyl palmitate. The intracellular inclusions were purified and characterized as wax ester inclusions consisting of 85.6% hexadecyl palmitate, 4.8% hexadecanol, and 9.6% phospholipid, with a phospholipid-to-protein ratio of 0.42 of lipid phosphate per mg of inclusion protein. The cellular lipids consisted of 69.8% hexadecyl palmitate, 22.8% phospholipid, 1.9% triglyceride, 4.7% mono- and diglyceride, 0.1% free fatty acid, and 0.8% hexadecanol, as compared with 98% hexadecyl palmitate and 1.9% triglyceride, which comprised the extracellular lipids. Cell-associated hexadecanol represented 0.05% of the exogenously supplied hexadecanol, with hexadecyl palmitate accounting for 14.7% of the total cellular dry weight. Acinetobacter sp. strain HO1-N possesses a mechanism for the intracellular packaging of hexadecyl palmitate in wax ester inclusions, which differ in structure and chemical composition from hydrocarbon inclusions isolated from hexadecane-grown cells.

  16. Characterization and application of a novel bioemulsifier in crude oil degradation by Acinetobacter beijerinckii ZRS.


    Zhao, Yi-He; Chen, Li-Yuan; Tian, Zi-Jing; Sun, Yue; Liu, Jin-Biao; Huang, Lei


    Bioemulsifiers can be applicated in a variety of areas such as bioremediation and microbial-enhanced oil recovery. The present study was aimed at bioemulsifier production, optimization, stability studies, and applications of the bioemulsifier produced by one of these strains, Acinetobacter beijerinckii ZRS. When Acinetobacter beijerinckii ZRS is cultured with hexadecane as a carbon source, it produces a novel extracellular emulsifying agent that does not cause remarkable reductions in surface tension. In order to enhance bioemulsifier production, response surface methodology was applied to optimize the culture medium. The bioemulsifier was subjected to thin-layer chromatography, Fourier transform infrared spectroscopy (FTIR), gel filtration chromatography, matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF), and nuclear magnetic resonance (NMR), which allowed for the identification of a novel polymeric bioemulsifier. The bioemulsifier retained its properties at a wide range of pH values, high temperatures and high salinities (up to 5% [w⁄v] Na(+) and 24% Ca(2+)). To deduce the role of this bioemulsifier in a coastal zone oil spill, the propagation of oil-degrading bacteria on oil-coated grains of gravel immersed in seawater was investigated in beach-simulating tanks. The bioemulsifier played a positive role in the degradation of these hydrocarbons and increasing the light crude oil degradation rate of the bacterial strain from 37.5 to 58.3% within 56 days. Therefore, this bioemulsifier shows strong potential to be used for bioremediation of oil pollution in marine environments. PMID:26576943

  17. Structure and context of Acinetobacter transposons carrying the oxa23 carbapenemase gene.


    Nigro, Steven J; Hall, Ruth M


    Theoxa23gene encoding the OXA-23 carbapenemase (and several minor variants of it) is widespread inAcinetobacter baumanniiclinical isolates and compromises treatment with carbapenem antibiotics. The gene is derived from the chromosome ofAcinetobacter radioresistenswhere it is an intrinsic gene, here designatedoxaAr InA. baumanniiand otherAcinetobacterspecies,oxa23is usually preceded by an IS, ISAba1, which supplies the strong promoter required for the gene to confer clinically relevant levels of resistance. TheoxaArgene appears to have been mobilized twice creating Tn2008and Tn2008B, both of which consist of a single ISAba1 and anA. radioresistens-derived fragment. Tn2006and Tn2009are clearly derived from Tn2008Band are each made up of Tn2008Bwith an additional segment of unknown origin and an additional ISAba1, creating a compound transposon. Tn2006, Tn2008and possibly Tn2008Bare globally disseminated, while Tn2009has as yet only been found in China. Of the four ISAba1-associated transposons, Tn2006has been most frequently observed worldwide and Tn2006in Tn6022, known as AbaR4, appears to contribute significantly to the dissemination ofoxa23 Moreover, AbaR4, Tn2006, Tn2008and Tn2009have each been found in conjugative plasmids, further facilitating their spread. PMID:26755496

  18. Resources for Genetic and Genomic Analysis of Emerging Pathogen Acinetobacter baumannii

    PubMed Central

    Ramage, Elizabeth; Weiss, Eli J.; Radey, Matthew; Hayden, Hillary S.; Held, Kiara G.; Huse, Holly K.; Zurawski, Daniel V.; Brittnacher, Mitchell J.; Manoil, Colin


    ABSTRACT Acinetobacter baumannii is a Gram-negative bacterial pathogen notorious for causing serious nosocomial infections that resist antibiotic therapy. Research to identify factors responsible for the pathogen's success has been limited by the resources available for genome-scale experimental studies. This report describes the development of several such resources for A. baumannii strain AB5075, a recently characterized wound isolate that is multidrug resistant and displays robust virulence in animal models. We report the completion and annotation of the genome sequence, the construction of a comprehensive ordered transposon mutant library, the extension of high-coverage transposon mutant pool sequencing (Tn-seq) to the strain, and the identification of the genes essential for growth on nutrient-rich agar. These resources should facilitate large-scale genetic analysis of virulence, resistance, and other clinically relevant traits that make A. baumannii a formidable public health threat. IMPORTANCE Acinetobacter baumannii is one of six bacterial pathogens primarily responsible for antibiotic-resistant infections that have become the scourge of health care facilities worldwide. Eliminating such infections requires a deeper understanding of the factors that enable the pathogen to persist in hospital environments, establish infections, and resist antibiotics. We present a set of resources that should accelerate genome-scale genetic characterization of these traits for a reference isolate of A. baumannii that is highly virulent and representative of current outbreak strains. PMID:25845845

  19. An alkaline lipase from organic solvent tolerant Acinetobacter sp. EH28: Application for ethyl caprylate synthesis.


    Ahmed, Eltayib Hassan; Raghavendra, Tripti; Madamwar, Datta


    A mesophilic bacterium producing a thermostable alkaline lipase was isolated from oil rich soil sample and identified as Acinetobacter sp. EH28. The lipase was partially purified by ammonium sulphate precipitation followed by hydrophobic interaction chromatography with 24.2-fold purification and 57.1U/ml specific activity. The partially purified enzyme exhibited maximum activity at pH 10.0 and at 50 degrees C and was highly stable at 50 degrees C retaining 100% of its activity up to 90min. It was highly stable and retained more than 80% of its initial activity upon exposure to various organic solvents. The EH28 lipase was used for synthesis of the flavor ester ethyl caprylate in organic solvents, thus providing a concept of application of Acinetobacter sp. lipase in non-aqueous catalysis. Reaction parameters best suited for this esterification reaction were 40 degrees C reaction temperature, 1.3:1 ratio of caprylic acid to ethanol and cyclohexane as the medium. PMID:20096565

  20. Comparative analysis of the lipids of Acinetobacter species grown on hexadecane.

    PubMed Central

    Makula, R A; Lockwood, P J; Finnerty, W R


    A comparative analysis of the cellular and extracellular lipids of Acinetobacter species HO1-N indicated basic physiological differences in hexadecane-grown cells. The cellular lipids obtained from hexadecane-grown cells were characterized by 3- and 18-fold increases in the phospholipid fraction and the mono- and diglyceride fraction, respectively, over that obtained from nutrient broth-yeast extract-grown cells. The cellular-associated pools of hexadecane were shown to comprise approximately 8% of the dry cell weight of hexadecane-grown cells. The extracellular lipids obtained from the culture broths of hexadecane-grown cells were comprised of triglyceride, mono- and diglyceride, free fatty acid, and wax ester. These lipids were either absent or present in minor concentrations in the culture broths of nutrient broth-yeast extract-grown cells. The exponential growth of Acinetobacter sp. on hexadecane was characterized by the significant accumulation of free fatty acid, monoglyceride, and diglyceride in the culture medium. Wax ester was shown to represent a minor portion of the extracellular lipids during the exponential growth phase, appearing in significant proportion only after the culture had entered the stationary phase of growth. PMID:1116989

  1. Chemical Analysis of the Outer Membrane and Other Layers of the Cell Envelope of Acinetobacter sp

    PubMed Central

    Thorne, Kareen J. I.; Thornley, Margaret J.; Glauert, Audrey M.


    Chemical analysis of fractions of the cell envelope of Acinetobacter sp. strain MJT/F5/199A, prepared by breakage in the French press and removal of plasma membranes, followed by sequential treatment with lysozyme and with papain, confirmed the existence of layers previously identified by electron microscopy. Outside the plasma membrane and periplasmic space, the envelope is composed of (i) a peptidoglycan-containing dense layer, (ii) an intermediate layer, (iii) a lipopolysaccharide-containing outer membrane, and (iv) an ordered array of protein subunits. A small amount of carbohydrate (3%) is found associated with protein in the fraction containing both the surface subunits and the intermediate layer. The papain-treated outer membranes contain 67% protein, 24% lipid, together with 11% lipopolysaccharide, and about 6% of non-lipopolysaccharide hexosamine. Lipid is located only in the papain-treated outer-membrane and is mainly phospholipid: 29% phosphatidyl glycerol, 30% phosphatidyl ethanolamine, and 40% cardiolipin. The principal fatty acid is C18:1. Significant amounts of alcohols16:1 and alcohols18:1, which are found in Acinetobacter waxes, were recovered from the outer membrane. Images PMID:4745422

  2. Antibiotic-Resistant Acinetobacter baumannii Increasing Success Remains a Challenge as a Nosocomial Pathogen

    PubMed Central

    Gonzalez-Villoria, Ana Maria; Valverde-Garduno, Veronica


    Antibiotic-resistant infectious bacteria currently imply a high risk and therefore constitute a strong challenge when treating patients in hospital settings. Characterization of these species and of particular strains is a priority for the establishment of diagnostic tests and preventive procedures. The relevance of Acinetobacter baumannii as a problematic microorganism in inpatient facilities, particularly intensive care units, has increased over time. This review aims to draw attention to (i) the historical emergence of carbapenem-resistant Acinetobacter baumannii, (ii) the current status of surveillance needs in Latin America, and (iii) recent data suggesting that A. baumannii continues to spread and evolve in hospital settings. First, we present synopsis of the series of events leading to the discovery and precise identification of this microorganism in hospital settings. Then key events in the acquisition of antibiotic-resistant genes by this microorganism are summarized, highlighting the race between new antibiotic generation and emergence of A. baumannii resistant strains. Here we review the historical development of this species as an infectious threat, the current state of its distribution, and antibiotic resistance characteristics, and we discuss future prospects for its control. PMID:26966582

  3. Screening of Herbal-Based Bioactive Extract Against Carbapenem-Resistant Strain of Acinetobacter baumannii.


    Tiwari, Monalisa; Roy, Ranita; Tiwari, Vishvanath


    Acinetobacter baumannii is grouped in the ESKAPE pathogens by Infectious Disease Society of America, which is linked to high degree of morbidity, mortality, and increased costs. The high level of acquired and intrinsic resistance mechanisms of these bacteria makes it an urgent requirement to find a suitable alternative to carbapenem, a commonly prescribed drug for Acinetobacter infection. In this study, methanolic extracts of six medicinal plants were subjected to phytochemical screening and their antimicrobial activity was tested against two strains of A. baumannii (ATCC 19606, carbapenem-sensitive strain, and RS 307, carbapenem-resistant strain). Synergistic effect of the plant extracts and antibiotics was also tested. Bael or Aegle marmelos contains tannin, phenol, terpenoids, glycoside, alkaloids, coumarine, steroid, and quinones. Flowers of madar or Calotropis procera possess tannin, phenol, terpenoids, glycoside, quinone, anthraquinone, anthocyanin, coumarin, and steroid. An inhibitory growth curve was seen for both the bacterial strains when treated with A. marmelos, Curcuma longa, and leaves and flowers of C. procera. Antibiotics alone showed a small zone of inhibition, but when used with herbal extracts they exhibited larger zone of inhibition. Synergistic effect of A. marmelos and imipenem was the best against both the strains of A. baumannii. From this study, it can be concluded that extracts from A. marmelos and leaves and flowers of C. procera exhibited the most effective antibacterial activity. These herbal extracts may be used to screen the bioactive compound against the carbapenem-resistant strain of A. baumannii. PMID:26910023

  4. Characterisation of Pellicles Formed by Acinetobacter baumannii at the Air-Liquid Interface

    PubMed Central

    Nait Chabane, Yassine; Marti, Sara; Rihouey, Christophe; Alexandre, Stéphane; Hardouin, Julie; Lesouhaitier, Olivier; Vila, Jordi; Kaplan, Jeffrey B.; Jouenne, Thierry; Dé, Emmanuelle


    The clinical importance of Acinetobacter baumannii is partly due to its natural ability to survive in the hospital environment. This persistence may be explained by its capacity to form biofilms and, interestingly, A. baumannii can form pellicles at the air-liquid interface more readily than other less pathogenic Acinetobacter species. Pellicles from twenty-six strains were morphologically classified into three groups: I) egg-shaped (27%); II) ball-shaped (50%); and III) irregular pellicles (23%). One strain representative of each group was further analysed by Brewster’s Angle Microscopy to follow pellicle development, demonstrating that their formation did not require anchoring to a solid surface. Total carbohydrate analysis of the matrix showed three main components: Glucose, GlcNAc and Kdo. Dispersin B, an enzyme that hydrolyzes poly-N-acetylglucosamine (PNAG) polysaccharide, inhibited A. baumannii pellicle formation, suggesting that this exopolysaccharide contributes to pellicle formation. Also associated with the pellicle matrix were three subunits of pili assembled by chaperon-usher systems: the major CsuA/B, A1S_1510 (presented 45% of identity with the main pilin F17-A from enterotoxigenic Escherichia coli pili) and A1S_2091. The presence of both PNAG polysaccharide and pili systems in matrix of pellicles might contribute to the virulence of this emerging pathogen. PMID:25360550

  5. Clonal diversity of Acinetobacter baumannii clinical isolates revealed by a snapshot study

    PubMed Central


    Background Acinetobacter baumannii is a notorious opportunistic pathogen mainly associated with hospital-acquired infections. Studies on the clonal relatedness of isolates could lay the foundation for effective infection control. A snapshot study was performed to investigate the clonal relatedness of A. baumannii clinical isolates in our local settings. Results Among 82 non-repetitive Acinetobacter spp. clinical isolates that were recovered during a period of four days in 13 hospitals in Sichuan, Southwest China, 67 isolates were identified as A. baumannii. Half of the 67 A. baumannii isolates were non-susceptible to carbapenems. blaOXA-23 was the only acquired carbapenemase gene detected, present in 40 isolates including five carbapenem-susceptible ones. The isolates belonged to 62 pulsotypes determined by PFGE and 31 sequence types (ST) by multi-locus sequence typing. Forty-three isolates belonged to the globally-disseminated clonal complex 92, among which ST75, ST92 and ST208 were the most common sequence types. Conclusions Clinical isolates of A. baumannii were diverse in clonality in this snapshot study. However, most of the isolates belonged to the globally-distributed clonal complex CC92. ST75, ST92 and ST208 were the most common types in our region. In particular, ST208 might be an emerging lineage carrying blaOXA-23. PMID:24144168

  6. Code blue: Acinetobacter baumannii, a nosocomial pathogen with a role in the oral cavity.


    Richards, A M; Abu Kwaik, Y; Lamont, R J


    Actinetobacter baumannii is an important nosocomial pathogen that can cause a wide range of serious conditions including pneumonia, meningitis, necrotizing fasciitis and sepsis. It is also a major cause of wound infections in military personnel injured during the conflicts in Afghanistan and Iraq, leading to its popular nickname of 'Iraqibacter'. Contributing to its success in clinical settings is resistance to environmental stresses such as desiccation and disinfectants. Moreover, in recent years there has been a dramatic increase in the number of A. baumannii strains with resistance to multiple antibiotic classes. Acinetobacter baumannii is an inhabitant of oral biofilms, which can act as a reservoir for pneumonia and chronic obstructive pulmonary disease. Subgingival colonization by A. baumannii increases the risk of refractory periodontitis. Pathogenesis of the organism involves adherence, biofilm formation and iron acquisition. In addition, A. baumannii can induce apoptotic cell death in epithelial cells and kill hyphal forms of Candida albicans. Virulence factors that have been identified include pili, the outer membrane protein OmpA, phospholipases and extracellular polysaccharide. Acinetobacter baumannii can sense blue light through a blue-light sensing using flavin (BLUF) domain protein, BlsA. The resulting conformational change in BlsA leads to changes in gene expression, including virulence genes. PMID:25052812

  7. Characterisation of pellicles formed by Acinetobacter baumannii at the air-liquid interface.


    Nait Chabane, Yassine; Marti, Sara; Rihouey, Christophe; Alexandre, Stéphane; Hardouin, Julie; Lesouhaitier, Olivier; Vila, Jordi; Kaplan, Jeffrey B; Jouenne, Thierry; Dé, Emmanuelle


    The clinical importance of Acinetobacter baumannii is partly due to its natural ability to survive in the hospital environment. This persistence may be explained by its capacity to form biofilms and, interestingly, A. baumannii can form pellicles at the air-liquid interface more readily than other less pathogenic Acinetobacter species. Pellicles from twenty-six strains were morphologically classified into three groups: I) egg-shaped (27%); II) ball-shaped (50%); and III) irregular pellicles (23%). One strain representative of each group was further analysed by Brewster's Angle Microscopy to follow pellicle development, demonstrating that their formation did not require anchoring to a solid surface. Total carbohydrate analysis of the matrix showed three main components: Glucose, GlcNAc and Kdo. Dispersin B, an enzyme that hydrolyzes poly-N-acetylglucosamine (PNAG) polysaccharide, inhibited A. baumannii pellicle formation, suggesting that this exopolysaccharide contributes to pellicle formation. Also associated with the pellicle matrix were three subunits of pili assembled by chaperon-usher systems: the major CsuA/B, A1S_1510 (presented 45% of identity with the main pilin F17-A from enterotoxigenic Escherichia coli pili) and A1S_2091. The presence of both PNAG polysaccharide and pili systems in matrix of pellicles might contribute to the virulence of this emerging pathogen. PMID:25360550

  8. Fatal skin and soft tissue infection of multidrug resistant Acinetobacter baumannii: A case report

    PubMed Central

    Ali, Aqsa; Botha, John; Tiruvoipati, Ravindranath


    INTRODUCTION Acinetobacter baumannii is usually associated with respiratory tract, urinary tract and bloodstream infections. Recent reports suggest that it is increasingly causing skin and soft tissue infections. It is also evolving as a multidrug resistant organism that can be difficult to treat. We present a fatal case of multidrug resistant A. baumannii soft tissue infection and review of relevant literature. PRESENTATION OF CASE A 41 year old morbidly obese man, with history of alcoholic liver disease presented with left superficial pre-tibial abrasions and cellulitis caused by multidrug resistant (MDR) A. baumannii. In spite of early antibiotic administration he developed extensive myositis and fat necrosis requiring extensive and multiple surgical debridements. He deteriorated despite appropriate antibiotic therapy and multiple surgical interventions with development of multi-organ failure and died. DISCUSSION Managing Acinetobacter infections remains difficult due to the array of resistance and the pathogens ability to develop new and ongoing resistance. The early diagnosis of necrotizing soft tissue infection may be challenging, but the key to successful management of patients with necrotizing soft tissue infection are early recognition and complete surgical debridement. CONCLUSION A. baumannii is emerging as an important cause of severe, life-threatening soft tissue infections. Multidrug resistant A. baumannii soft tissue infections may carry a high mortality in spite of early and aggressive treatment. Clinicians need to consider appropriate early empirical antibiotic coverage or the use of combination therapy to include MDR A. baumannii as a cause of skin and soft tissue infections. PMID:25016080

  9. Heterotrophic nitrogen removal by Acinetobacter sp. Y1 isolated from coke plant wastewater.


    Liu, YuXiang; Hu, Tingting; Song, Yujie; Chen, Hongping; Lv, YongKang


    A strain of Acinetobacter sp. Y1, which exhibited an amazing ability to remove ammonium, nitrite and nitrate, was isolated from the activated sludge of a coking wastewater treatment plant. The aim of this work was to study the ability, influence factors and possible pathway of nitrogen removal by Acinetobacter sp. Y1. Results showed that maximum removal rate of NH4(+)-N by the strain was 10.28 mg-N/L/h. Carbon source had significant influence on the growth and ammonium removal efficiencies of strain Y1. Pyruvate, citrate and acetate were favourable carbon sources for the strain. Temperature, pH value and shaking speed could affect the growth and nitrogen removal ability. Nitrate or nitrite could be used as a sole nitrogen source for the growth and removed efficiently by the strain. N2 levels increased to 53.74%, 50.21% and 55.13% within 36 h when 100 mg/L NH4(+)-N, NO2(-)-N or NO3(-) -N was used as sole nitrogen source in the gas detection experiment. The activities of hydroxylamine oxidoreductase (HAO), nitrate reductase (NR) and nitrite reductase (NiR), which are key enzymes in heterotrophic nitrification and aerobic denitrification, were all detectable in the strain. Consequently, a possible pathway for ammonium removal by the strain was also suggested. PMID:25910961

  10. Complete Genome Sequence of a Multidrug-Resistant Acinetobacter baumannii Isolate Obtained from a Mexican Hospital (Sequence Type 422).


    Castro-Jaimes, Semiramis; Salgado-Camargo, Abraham David; Graña-Miraglia, Lucía; Lozano, Luis; Bocanegra-Ibarias, Paola; Volkow-Fernández, Patricia; Silva-Sanchez, Jesus; Castillo-Ramírez, Santiago; Cevallos, Miguel A


    Acinetobacter baumannii has emerged as a dangerous nosocomial pathogen, particularly for severely ill patients in intensive care units and patients with hematologic malignancies. Here, we present the complete genome sequence of a multidrug-resistant A. baumannii isolate, recovered from a Mexican hospital and classified as sequence type 422 according to the multilocus sequence typing Pasteur scheme. PMID:27340065

  11. Draft Genome Sequence and Complete Plasmid Sequence of Acinetobacter lwoffii F78, an Isolate with Strong Allergy-Protective Properties.


    Fritzenwanker, Moritz; Hain, Torsten; Kesper, Dörthe A; Harb, Hani; Renz, Harald; Domann, Eugen


    The hygiene hypothesis states that the tremendous increase in atopic diseases correlates significantly with less contact to microbes in childhood. Here, we report the draft genome sequence of Acinetobacter lwoffii F78, a rural cowshed isolate with strong allergy-protective properties that contains an 8,579-bp plasmid. PMID:27445377

  12. Draft Genome Sequence and Complete Plasmid Sequence of Acinetobacter lwoffii F78, an Isolate with Strong Allergy-Protective Properties

    PubMed Central

    Fritzenwanker, Moritz; Hain, Torsten; Kesper, Dörthe A.; Harb, Hani; Renz, Harald


    The hygiene hypothesis states that the tremendous increase in atopic diseases correlates significantly with less contact to microbes in childhood. Here, we report the draft genome sequence of Acinetobacter lwoffii F78, a rural cowshed isolate with strong allergy-protective properties that contains an 8,579-bp plasmid. PMID:27445377

  13. Draft Genome Sequences of Seven Multidrug-Resistant Acinetobacter baumannii Strains, Isolated from Respiratory Samples in Spain

    PubMed Central

    Labrador-Herrera, Gema; Álvarez, Rocío; López-Rojas, Rafael; Smani, Younes; Cebrero-Cangueiro, Tania; Rueda, Antonio; Pérez Florido, Javier; Pachón-Ibáñez, María Eugenia


    The draft genome sequences of seven multidrug-resistant Acinetobacter baumannii clinical strains belonging to sequence types ST-208 and ST-218 are reported in this study. They were isolated from tracheobronchial aspirate of mechanically ventilated adult patients admitted to the intensive care unit of a Spanish tertiary hospital during 2010 to 2011. PMID:27034482

  14. Comparison between phenotypic and PCR for detection of OXA-23 type and metallo-beta-lactamases producer Acinetobacter spp.

    PubMed Central

    Azimi, Leila; Lari, Abdolaziz Rastegar; Talebi, Malihe; Namvar, Amirmorteza Ebrahimzadeh; Jabbari, Mosadegh


    Background: Resistance to carbapenems is developing around the world and can cause many problems for treatment of patients. Production of metallo-beta-lactamase (MBL) is one of the main mechanism for this type of resistance. So, detection of MBL-producer microorganisms can prevent the spread of this type of resistance. Materials and methods: In this study 94 Acinetobacter spp. were investigated. Resistance to imipenem was conducted after purification and identification. Combination disc (CD) and Double Disc Synergy Test (DDST) were performed for phenotypic detection of MBL and the molecular PCR method was done for vim-1, vim-2, imp-1 and OXA-23 genes. Results: According to TSI, SIM and oxidation-fermentation (OF) test and PCR assay 93 Acinetobacter baumannii and one strain Acinetobacter lwoffii were identified. 85% of them were resistant to imipenem. 34% of them have a positive combination disc test (CD) while Double Disc Synergy Test (DDST) was negative for all of them. The vim-1, vim-2 and imp-1 genes were not detected in PCR molecular method, however in 74% of strains with positive results in combination disc, were positive for the OXA-23 gene after PCR test. This study shows that the blaOXA-23 resistance determinant may become an emerging therapeutic problem. Discussion: According to the results, it seems that combination disc does not have enough specificity for detection of MBL-producer Acinetobacter and using Double Disc Synergy Test (DDST) can be more convenient. PMID:24327942

  15. Draft Genome Sequence of Extensively Drug-Resistant Acinetobacter baumannii Strain CUAB1 from a Patient in Hong Kong, China

    PubMed Central

    Leung, Alden King-Yung; Lau, Hiuus Hiu-Yu; Chan, Ting-Fung; Ip, Margaret


    We report the draft genome sequence of an extensively drug-resistant strain of Acinetobacter baumannii, CUAB1, isolated from a patient in a local Hong Kong hospital. MIC testing was performed, and genes previously associated with drug resistance were located. PMID:25977429

  16. Complete Genome Sequence of a Multidrug-Resistant Acinetobacter baumannii Isolate Obtained from a Mexican Hospital (Sequence Type 422)

    PubMed Central

    Castro-Jaimes, Semiramis; Salgado-Camargo, Abraham David; Graña-Miraglia, Lucía; Lozano, Luis; Bocanegra-Ibarias, Paola; Volkow-Fernández, Patricia; Silva-Sanchez, Jesus; Castillo-Ramírez, Santiago


    Acinetobacter baumannii has emerged as a dangerous nosocomial pathogen, particularly for severely ill patients in intensive care units and patients with hematologic malignancies. Here, we present the complete genome sequence of a multidrug-resistant A. baumannii isolate, recovered from a Mexican hospital and classified as sequence type 422 according to the multilocus sequence typing Pasteur scheme. PMID:27340065

  17. Genome sequence of Acinetobacter sp. strain HA, isolated from the gut of the polyphagous insect pest Helicoverpa armigera.


    Malhotra, Jaya; Dua, Ankita; Saxena, Anjali; Sangwan, Naseer; Mukherjee, Udita; Pandey, Neeti; Rajagopal, Raman; Khurana, Paramjit; Khurana, Jitendra P; Lal, Rup


    In this study, Acinetobacter sp. strain HA was isolated from the midgut of a fifth-instar larva of Helicoverpa armigera. Here, we report the draft genome sequence (3,125,085 bp) of this strain that consists of 102 contigs, 2,911 predicted coding sequences, and a G+C content of 41%. PMID:22933775

  18. Genome Sequence of Acinetobacter sp. Strain HA, Isolated from the Gut of the Polyphagous Insect Pest Helicoverpa armigera

    PubMed Central

    Malhotra, Jaya; Dua, Ankita; Saxena, Anjali; Sangwan, Naseer; Mukherjee, Udita; Pandey, Neeti; Rajagopal, Raman; Khurana, Paramjit; Khurana, Jitendra P.


    In this study, Acinetobacter sp. strain HA was isolated from the midgut of a fifth-instar larva of Helicoverpa armigera. Here, we report the draft genome sequence (3,125,085 bp) of this strain that consists of 102 contigs, 2,911 predicted coding sequences, and a G+C content of 41%. PMID:22933775

  19. [Candida peritonitis and sepsis due to Acinetobacter baumannii in peritoneal dialysis: an association with prognosis not always unfavourable].


    Rapisarda, Francesco; Aliotta, Roberta; Pocorobba, Barbara; Portale, Grazia; Ferrario, Silvia; Zanoli, Luca; Fatuzzo, Pasquale


    Fungal infections have a high incidence in patients receiving peritoneal dialysis. (1)
Peritoneal dialysis is often complicated by peritonitis which has only minimally mycotic etiology, but nonetheless it is associated with 15-45% mortality (8).
 The opportunistic pathogens such as Candida can cause infection in immunocompromised conditions. Even the Acinetobacter tends to infect immunocompromised individuals and it has the same risk factors for infection as Candida: immunosuppression, malignancy, HIV positivity and all the other conditions of immunosuppression, central venous catheterization, mechanical ventilation and prolonged antibiotic therapy. The sepsis by Acinetobacter predicts a negative prognosis with the mortality rate between 20 to 60% (12), especially in cases of isolation of multi-resistant germs.
 We present a case report of a CKD patient undergoing peritoneal dialysis therapy who was hospitalized for acute pancreatitis, later complicated by the development of pancreatic pseudocysts, C. albicans peritonitis with hematologic spread of the fungus, superimposed Acinetobacter baumannii sepsis and pneumonia. She has been subjected to percutaneous drainage of pseudocysts, to switch from peritoneal dialysis to hemodialysis, to various evacuative thoracentesis, and to polymicrobial therapy (meropenem, teicoplanina, tigeciclina, linezolid, colimicina, fluconazolo, etc.) that allowed the resolution of sepsis. The peculiarity of this case is represented by the numerous morbidity that the patient developed simultaneously, with the genesis of a complex clinical picture, by the combination of infections due to Candida albicans and Acinetobacter baumannii. Successful treatment strategies allowed to fight and cure a medical condition associated with a high mortality rate. PMID:26845211

  20. Complete Genome Sequence of a Dimethyl Sulfide-Utilizing Bacterium, Acinetobacter guillouiae Strain 20B (NBRC 110550)

    PubMed Central

    Yee, LiiMien; Hosoyama, Akira; Ohji, Shoko; Tsuchikane, Keiko; Shimodaira, Jun; Yamazoe, Atsushi; Fujita, Nobuyuki; Suzuki-Minakuchi, Chiho


    Acinetobacter guillouiae strain 20B can utilize dimethyl sulfide (DMS) as the sole sulfur source and degrade chloroethylenes. We report here the complete 4,648,418-bp genome sequence for this strain, which contains 4,367 predicted coding sequences (CDSs), including a well-characterized DMS degradative operon. PMID:25323718

  1. Biodegradation of 4-nitroaniline by plant-growth promoting Acinetobacter sp. AVLB2 and toxicological analysis of its biodegradation metabolites.


    Silambarasan, Sivagnanam; Vangnai, Alisa S


    4-nitroaniline (4-NA) is one of the major priority pollutants generated from industrial productions and pesticide transformation; however very limited biodegradation details have been reported. This work is the first to report 4-NA biodegradation kinetics and toxicity reduction using a newly isolated plant-growth promoting bacterium, Acinetobacter sp. AVLB2. The 4-NA-dependent growth kinetics parameters: μmax, Ks and Ki, were determined to be 0.039 h(-1), 6.623 mg L(-1) and 25.57 mg L(-1), respectively using Haldane inhibition model, while the maximum biodegradation rate (Vmax) of 4-NA was at 0.541 mg L(-1) h(-1) and 0.551 mg L(-1) h(-1), following Michaelis-Menten and Hanes-Woolf models, respectively. Biodegradation pathway of 4-NA by Acinetobacter sp. AVLB2 was proposed, and successfully led to the reduction of 4-NA toxicity according to the following toxicity assessments: microbial toxicity using Escherichia coli DH5α, phytotoxicity with Vigna radiata and Crotalaria juncea, and cytogenotoxicity with Allium cepa root-tip cells. In addition, Acinetobacter sp. AVLB2 possess important plant-growth promoting traits, both in the presence and absence of 4-NA. This study has provided a new insight into 4-NA biodegradation ability and concurrent plant-growth promoting activities of Acinetobacter sp. AVLB2, which may indicate its potential role for rhizoremediation, while sustaining crop production even under 4-NA stressed environment. PMID:26489917

  2. Evaluation of Vitek2 and BD Phoenix in antimicrobial susceptibility testing of Acinetobacter baumannii and Pseudomonas aeruginosa.


    Jekarl, Dong Wook; Han, Sang Bong; Kim, Yoon Joo; Shin, Sang Hyun; Park, Kang Gyun; Park, Jung Jun; Han, Kyungja; Park, Yeon-Joon


    The accuracy of antimicrobial susceptibility testing of Vitek2 and BD Phoenix against Acinetobacter baumannii and Pseudomonas aeruginosa was evaluated. Both systems showed overall categoric agreement of < or =90% for cefepime and ceftazidime against A. baumannii and imipenem and cefepime (and ceftazidime with Vitek2) against P. aeruginosa because of high minor error rates. PMID:20638609

  3. Acinetobacter infections prevalence and frequency of the antibiotics resistance: comparative study of intensive care units versus other hospital units

    PubMed Central

    Uwingabiye, Jean; Frikh, Mohammed; Lemnouer, Abdelhay; Bssaibis, Fatna; Belefquih, Bouchra; Maleb, Adil; Dahraoui, Souhail; Belyamani, Lahcen; Bait, Abdelouahed; Haimeur, Charki; Louzi, Lhoussain; Ibrahimi, Azeddine; Elouennass, Mostafa


    Introduction This study aims to determine the Acinetobacter sp clinical isolates frequency and its antibiotic susceptibility pattern by comparing results obtained from the Intensive Care Units (ICUs) to that of other units at the Mohammed V Military Teaching Hospital in Rabat. Methods This is a retrospective study over a 2-years period where we collected all clinical isolates of Acinetobacter sp obtained from samples for infection diagnosis performed on hospitalized patients between 2012 to 2014. Results During the study period, 441 clinical and non-repetitive isolates of Acinetobacter sp were collected representing 6.94% of all bacterial clinical isolates (n = 6352) and 9.6% of Gram negative rods (n = 4569). More than a half of the isolates were from the ICUs and were obtained from 293 infected patients of which 65, 2% (191 cases) were males (sex ratio = 1.9) and the median age was 56 years (interquartile range: 42-68 years). Acinetobacter clinical isolates were obtained from respiratory samples (44.67%) followed by blood cultures (14.51%). The resistance to ciprofloxacin, ceftazidime, piperacillin / tazobactam, imipenem, amikacin, tobramycin, netilmicin, rifampicin and colistin was respectively 87%, 86%, 79%, 76%; 52%, 43%, 33% 32% and 1.7%. The difference in resistance between the ICUs and the other units was statistically significant (p <0.05) except for colistin, tetracycline and rifampicin. Conclusion This paper shows that solving the problem of prevalence and high rate of multidrug resistant Acinetobacter infection which represents a therapeutic impasse, requires the control of the hospital environment and optimizing hands hygiene and antibiotics use in the hospital. PMID:27347280

  4. Biochemical and Structural Analysis of Inhibitors Targeting the ADC-7 Cephalosporinase of Acinetobacter baumannii

    PubMed Central


    β-Lactam resistance in Acinetobacter baumannii presents one of the greatest challenges to contemporary antimicrobial chemotherapy. Much of this resistance to cephalosporins derives from the expression of the class C β-lactamase enzymes, known as Acinetobacter-derived cephalosporinases (ADCs). Currently, β-lactamase inhibitors are structurally similar to β-lactam substrates and are not effective inactivators of this class C cephalosporinase. Herein, two boronic acid transition state inhibitors (BATSIs S02030 and SM23) that are chemically distinct from β-lactams were designed and tested for inhibition of ADC enzymes. BATSIs SM23 and S02030 bind with high affinity to ADC-7, a chromosomal cephalosporinase from Acinetobacter baumannii (Ki = 21.1 ± 1.9 nM and 44.5 ± 2.2 nM, respectively). The X-ray crystal structures of ADC-7 were determined in both the apo form (1.73 Å resolution) and in complex with S02030 (2.0 Å resolution). In the complex, S02030 makes several canonical interactions: the O1 oxygen of S02030 is bound in the oxyanion hole, and the R1 amide group makes key interactions with conserved residues Asn152 and Gln120. In addition, the carboxylate group of the inhibitor is meant to mimic the C3/C4 carboxylate found in β-lactams. The C3/C4 carboxylate recognition site in class C enzymes is comprised of Asn346 and Arg349 (AmpC numbering), and these residues are conserved in ADC-7. Interestingly, in the ADC-7/S02030 complex, the inhibitor carboxylate group is observed to interact with Arg340, a residue that distinguishes ADC-7 from the related class C enzyme AmpC. A thermodynamic analysis suggests that ΔH driven compounds may be optimized to generate new lead agents. The ADC-7/BATSI complex provides insight into recognition of non-β-lactam inhibitors by ADC enzymes and offers a starting point for the structure-based optimization of this class of novel β-lactamase inhibitors against a key resistance target. PMID:25380506

  5. Evaluation of the Bruker Biotyper Matrix-Assisted Laser Desorption Ionization–Time of Flight Mass Spectrometry System for Identification of Blood Isolates of Acinetobacter Species

    PubMed Central

    Hsueh, Po-Ren; Kuo, Lu-Cheng; Chang, Tsung-Chain; Lee, Tai-Fen; Teng, Shih-Hua; Chuang, Yu-Chung; Teng, Lee-Jene


    Matrix-assisted laser desorption ionization–time of flight mass spectrometry (MALDI-TOF MS) (Bruker Biotyper) was able to accurately identify 98.6% (142/144) of Acinetobacter baumannii isolates, 72.4% (63/87) of A. nosocomialis isolates, and 97.6% (41/42) of A. pittii isolates. All Acinetobacter junii, A. ursingii, A. johnsonii, and A. radioresistens isolates (n = 28) could also be identified correctly by Bruker Biotyper. PMID:24899038

  6. Complete Genome Sequence of the Multiresistant Acinetobacter baumannii Strain AbH12O-A2, Isolated during a Large Outbreak in Spain.


    Merino, M; Alvarez-Fraga, L; Gómez, M J; Aransay, A M; Lavín, J L; Chaves, F; Bou, G; Poza, M


    We report the complete genome sequence of Acinetobacter baumannii strain AbH12O-A2, isolated during a large outbreak in Spain. The genome has 3,875,775 bp and 3,526 coding sequences, with 39.4% G+C content. The availability of this genome will facilitate the study of the pathogenicity of the Acinetobacter species. PMID:25395646

  7. Complete Genome Sequence of the Multiresistant Acinetobacter baumannii Strain AbH12O-A2, Isolated during a Large Outbreak in Spain

    PubMed Central

    Merino, M.; Alvarez-Fraga, L.; Gómez, M. J.; Aransay, A. M.; Lavín, J. L.; Chaves, F.


    We report the complete genome sequence of Acinetobacter baumannii strain AbH12O-A2, isolated during a large outbreak in Spain. The genome has 3,875,775 bp and 3,526 coding sequences, with 39.4% G+C content. The availability of this genome will facilitate the study of the pathogenicity of the Acinetobacter species. PMID:25395646

  8. Isolation and characterization of diesel degrading bacteria, Sphingomonas sp. and Acinetobacter junii from petroleum contaminated soil

    NASA Astrophysics Data System (ADS)

    Zhang, Qiuzhuo; Wang, Duanchao; Li, Mengmeng; Xiang, Wei-Ning; Achal, Varenyam


    Two indigenous bacteria of petroleum contaminated soil were characterized to utilize diesel fuel as the sole carbon and energy sources in this work. 16S rRNA gene sequence analysis identified these bacteria as Sphingomonas sp. and Acinetobacter junii. The ability to degrade diesel fuel has been demonstrated for the first time by these isolates. The results of IR analyses showed that Sphingomonas sp. VA1 and A. junii VA2 degraded up to 82.6% and 75.8% of applied diesel over 15 days, respectively. In addition, Sphingomonas sp. VA1 possessed the higher cellular hydrophobicities of 94% for diesel compared to 81% by A. junii VA2. The isolates Sphingomonas sp. VA1 and A. junii VA2 exhibited 24% and 18%, respectively emulsification activity. This study reports two new diesel degrading bacterial species, which can be effectively used for bioremediation of petroleum contaminated sites.

  9. Factors affecting inactivation of Moraxell-Acinetobacter cells in an irradiation process. [/sup 137/Cs

    SciTech Connect

    Firstenberg-Eden, R.; Rowley, D.B.; Shattuck, G.E.


    The effect of various stages of the irradiation processing of beef on the injury and inactivation of radiation-resistant Moraxella-Acinetobactor cells was studied. Moraxella-Acinetobacter cells were more resistant to heat inactivation and injury when heated in meat with salts (0.75% NaCl and 0.375% sodium tripolyphosphate) than in meat without salts. These salts had no effect on radiation resistance. Heated cells were more sensitive to radiation inactivation and injury than unheated cells. After repair, the cells regained their resistance to both NaCl and irradiation. Freezing and storage at -40/sup 0/C for 14 days had only a slight effect on either unstressed or heat-stressed cells.

  10. Preferential carriage of class 2 integrons in Acinetobacter baumannii CC113 and novel singletons.


    Ramírez, M S; Montaña, S; Cassini, M; Centrón, D


    Our understanding of the distribution of integrons associated with multidrug resistance in Acinetobacter baumannii isolates around the world remains incomplete. The association between the class 1 and 2 integron A. baumannii-positive isolates (n = 60), recovered since 1982 from 11 Argentinean hospitals, and the circulating lineages, was investigated. While class 2 integrons were highly significantly associated with clonal lineage CC113B/CC79P (P = 0·009) and novel singletons (P = 0·001), class 1 integrons were found not to be associated with CC109B/CC1P or other lineages. The study reveals a differential distribution of class 2 integrons in lineages, and suggests that the prevalence of intI2 in Argentina is related to the emergence of novel singletons in recent years and to the abundance of CC113B/CC79P, which has been the local dominant lineage for several decades. PMID:25697643

  11. Distribution of AdeABC efflux system genes in genotypically diverse strains of clinical Acinetobacter baumannii.


    Wieczorek, Piotr; Sacha, Paweł; Czaban, Sławomir; Hauschild, Tomasz; Ojdana, Dominika; Kowalczuk, Oksana; Milewski, Robert; Poniatowski, Bogusław; Nikliński, Jacek; Tryniszewska, Elżbieta


    Acinetobacter baumannii has emerged as a highly problematic hospital-associated pathogen. Different mechanisms contribute to the formation of multidrug resistance in A. baumannii, including the AdeABC efflux system. Distribution of the structural and regulatory genes encoding the AdeABC efflux system among genetically diverse clinical A. baumannii strains was achieved by using PCR and pulsed-field gel electrophoresis techniques. The distribution of adeABRS genes is extremely high among our A. baumannii strains, except the adeC gene. We have observed a large proportion of strains presenting multidrug-resistance phenotype for several years. The efflux pump could be an important mechanism in these strains in resistance to antibiotics. PMID:23886790

  12. Emerging broad-spectrum resistance in Pseudomonas aeruginosa and Acinetobacter baumannii: Mechanisms and epidemiology.


    Potron, Anaïs; Poirel, Laurent; Nordmann, Patrice


    Multidrug resistance is quite common among non-fermenting Gram-negative rods, in particular among clinically relevant species including Pseudomonas aeruginosa and Acinetobacter baumannii. These bacterial species, which are mainly nosocomial pathogens, possess a diversity of resistance mechanisms that may lead to multidrug or even pandrug resistance. Extended-spectrum β-lactamases (ESBLs) conferring resistance to broad-spectrum cephalosporins, carbapenemases conferring resistance to carbapenems, and 16S rRNA methylases conferring resistance to all clinically relevant aminoglycosides are the most important causes of concern. Concomitant resistance to fluoroquinolones, polymyxins (colistin) and tigecycline may lead to pandrug resistance. The most important mechanisms of resistance in P. aeruginosa and A. baumannii and their most recent dissemination worldwide are detailed here. PMID:25857949

  13. Biofilm Formation and Motility Depend on the Nature of the Acinetobacter baumannii Clinical Isolates

    PubMed Central

    Vijayakumar, Saranya; Rajenderan, Sangeetha; Laishram, Shakti; Anandan, Shalini; Balaji, Veeraraghavan; Biswas, Indranil


    Acinetobacter baumannii is a nosocomial pathogen involved in various infections ranging from minor soft-tissue infections to more severe infections such as ventilator-associated pneumonia and bacteremia. The severity and the type of infections depend on the genetic and phenotypic variations of the strains. In this study, we compared the extent of biofilm formation and motility displayed by 60 multidrug-resistant A. baumannii clinical strains isolated from blood and sputum samples from patients from Southern India. Our results showed that isolates from the sputum samples formed significantly more robust biofilm compared to the blood isolates. On the other hand, we observed that the blood isolates were more motile than the sputum isolates. To the best of our knowledge, this is the first study that systematically evaluated the correlation between these two phenotypic traits and the nature of the isolates. PMID:27252939

  14. VEB-1 Extended-Spectrum β-lactamase–producing Acinetobacter baumannii, France1

    PubMed Central

    Coignard, Bruno; Carbonne, Anne; Blanckaert, Karine; Bajolet, Odile; Bernet, Claude; Verdeil, Xavier; Astagneau, Pascal; Desenclos, Jean-Claude; Nordmann, Patrice


    VEB-1 extended-spectrum β-lactamase–producing Acinetobacter baumannii was responsible for an outbreak in hospitals in France. A national alert was triggered in September 2003 when 4 hospitals reported clusters of A. baumannii infection with similar susceptibility profiles. Case definitions and laboratory guidelines were disseminated, and prospective surveillance was implemented; strains were sent to a single laboratory for characterization and typing. From April 2003 through June 2004, 53 hospitals reported 290 cases of A. baumannii infection or colonization; 275 isolates were blaVEB-1-positive and clonally related. Cases were first reported in 5 districts of northern France, then in 10 other districts in 4 regions. Within a region, interhospital spread was associated with patient transfer. In northern France, investigation and control measures led to a reduction of reported cases after January 2004. The national alert enabled early control of new clusters, demonstrating the usefulness of early warning about antimicrobial drug resistance. PMID:16965700

  15. Kinetic analysis of simultaneous denitrification and biomineralization of novel Acinetobacter sp. CN86.


    Su, Jun-Feng; Shi, Jing-Xin; Huang, Ting-Lin; Ma, Fang


    A novel aerobic denitrification and biomineralization strain CN86 was isolated from the Qu Jiang artificial lake. Based on phylogenetic characteristics, the isolated strain was identified as Acinetobacter species. Strain CN86 was confirmed to have the ability to perform simultaneous denitrification and biomineralization. Exponential decay equation was used for the matching of kinetic processes on denitrification and biomineralization. A highest nitrate removal rate was achieved at the pH7.0, organic concentration of 1.5g/L and temperature of 30°C. An optimal hardness removal rate was obtained at the pH9.0, organic concentration of 2.0g/L and temperature of 30°C. Strain CN86 is a suitable candidate for the simultaneous removal of nitrate and hardness in groundwater treatment. PMID:27287863

  16. Donor platelet plasma components inactivate sensitive and multidrug resistant Acinetobacter baumannii isolates.


    Edelblute, Chelsea M; Pakhomova, Olga N; Li, Fanying; Hargrave, Barbara Y; Heller, Loree C


    Acinetobacter baumannii is an environmentally resilient healthcare-associated opportunistic pathogen responsible for infections at many body sites. In the last 10 years, clinical strains resistant to many or all commonly used antibiotics have emerged globally. With few antimicrobial agents in the pharmaceutical pipeline, new and alternative agents are essential. Platelets secrete a large number of proteins, including proteins with antimicrobial activity. In a previous study, we demonstrated that donor platelet supernatants and plasma significantly inhibited the growth of a reference strain of A. baumannii in broth and on skin. This inhibition appeared to be unrelated to the platelet activation state. In this study, we demonstrate that this growth inhibition extends to clinical multidrug resistant isolates. We also demonstrate that there is no relationship between this activity and selected platelet-derived antimicrobial proteins. Instead, the donor plasma components complement and alpha-2 macroglobulin are implicated. PMID:26500225

  17. Genes Involved in the Biosynthesis and Transport of Acinetobactin in Acinetobacter baumannii

    PubMed Central

    Hasan, Tarik; Choi, Chul Hee


    Pathogenic bacteria survive in iron-limited host environments by using several iron acquisition mechanisms. Acinetobacter baumannii, causing serious infections in compromised patients, produces an iron-chelating molecule, called acinetobactin, which is composed of equimolar quantities of 2,3-dihydroxybenzoic acid (DHBA), L-threonine, and N-hydroxyhistamine, to compete with host cells for iron. Genes that are involved in the production and transport of acinetobactin are clustered within the genome of A. baumannii. A recent study showed that entA, located outside of the acinetobactin gene cluster, plays important roles in the biosynthesis of the acinetobactin precursor DHBA and in bacterial pathogenesis. Therefore, understanding the genes that are associated with the biosynthesis and transport of acinetobactin in the bacterial genome is required. This review is intended to provide a general overview of the genes in the genome of A. baumannii that are required for acinetobactin biosynthesis and transport. PMID:25873846

  18. Biofilm Formation and Motility Depend on the Nature of the Acinetobacter baumannii Clinical Isolates.


    Vijayakumar, Saranya; Rajenderan, Sangeetha; Laishram, Shakti; Anandan, Shalini; Balaji, Veeraraghavan; Biswas, Indranil


    Acinetobacter baumannii is a nosocomial pathogen involved in various infections ranging from minor soft-tissue infections to more severe infections such as ventilator-associated pneumonia and bacteremia. The severity and the type of infections depend on the genetic and phenotypic variations of the strains. In this study, we compared the extent of biofilm formation and motility displayed by 60 multidrug-resistant A. baumannii clinical strains isolated from blood and sputum samples from patients from Southern India. Our results showed that isolates from the sputum samples formed significantly more robust biofilm compared to the blood isolates. On the other hand, we observed that the blood isolates were more motile than the sputum isolates. To the best of our knowledge, this is the first study that systematically evaluated the correlation between these two phenotypic traits and the nature of the isolates. PMID:27252939

  19. Outbreak of extensively drug-resistant Acinetobacter baumannii indigo-pigmented strains.


    Vilacoba, Elisabet; Almuzara, Marisa; Gulone, Lucia; Rodriguez, Rocio; Pallone, Elida; Bakai, Romina; Centrón, Daniela; Ramírez, María Soledad


    Acinetobacter baumannii pigmented strains are not common in clinical settings. Here, we report an outbreak caused by indigo-pigmented A. baumannii strains isolated in an acute care hospital in Argentina from March to September 2012. Pan-PCR assays exposed a unique pattern belonging to the recently described regional CC113(B)/CC79(P) clonal complex that confirms the relevant relationships among the indigo-pigmented A. baumannii strains. All of them were extensively drug resistant and harbored different genetic elements associated with horizontal genetic transfer, such as the transposon Tn2006, class 2 integrons, AbaR-type islands, IS125, IS26, strA, strB, florR, and the small recombinase ISCR2 associated with the sul2 gene preceded by ISAba1. PMID:23985923

  20. Genome shuffling improves production of the low-temperature alkalophilic lipase by Acinetobacter johnsonii.


    Wang, HaiKuan; Zhang, Jie; Wang, XiaoJie; Qi, Wei; Dai, YuJie


    The production of a low-temperature alkalophilic lipase from Acinetobacter johnsonii was improved using genome shuffling. The starting populations, obtained by UV irradiation and diethyl sulfate mutagenesis, were subjected to recursive protoplast fusion. The optimal conditions for protoplast formation and regeneration were 0.15 mg lysozyme/ml for 45 min at 37°C. The protoplasts were inactivated under UV for 20 min or heated at 60°C for 60 min and a fusant probability of ~98% was observed. The positive colonies were created by fusing the inactivated protoplasts. After two rounds of genome shuffling, one strain, F22, with a lipase activity of 7 U/ml was obtained. PMID:21972140

  1. Brain abscess caused by multidrug-resistant Acinetobacter baumannii. Case report.


    Guinand Vives, Carlos H; Monsalve Duarte, Guillermo A; Beltrán, Sandra Valderrama; Pinzón, Johanna Osorio


    This 24-year-old soldier had a history of polytrauma caused by firearm missiles of a fragmentation weapon. He was referred to the Hospital Militar Central, where multiple shrapnel wounds in the head, face, thorax, and extremities were found. A brain abscess was documented and drained, and a culture grew a multidrug-resistant Acinetobacter baumannii. An appropriate antibiotic treatment was started but did not lead to a good response, and the patient died. The clinical course of the illness is presented, as is its treatment and the role of A baumannii as an etiological agent of a brain abscess. To the authors' knowledge, there have been no reported cases in the worldwide literature of brain abscess by this infectious agent. PMID:19061347

  2. Ultrafast Structural Dynamics of BlsA, a Photoreceptor from the Pathogenic Bacterium Acinetobacter baumannii

    PubMed Central


    Acinetobacter baumannii is an important human pathogen that can form biofilms and persist under harsh environmental conditions. Biofilm formation and virulence are modulated by blue light, which is thought to be regulated by a BLUF protein, BlsA. To understand the molecular mechanism of light sensing, we have used steady-state and ultrafast vibrational spectroscopy to compare the photoactivation mechanism of BlsA to the BLUF photosensor AppA from Rhodobacter sphaeroides. Although similar photocycles are observed, vibrational data together with homology modeling identify significant differences in the β5 strand in BlsA caused by photoactivation, which are proposed to be directly linked to downstream signaling. PMID:24723998

  3. [Management of a 4MRGN Acinetobacter baumanii outbreak in a burn unit].


    Siemers, F; Fanghänel, S; Bergmann, P A; Tamouridis, G; Stuttmann, R; Stolze, B; Hofmann, G O


    Patients with 4MRGN Acinetobacter baumanii infections in a burn unit represent great challenge. The structured management with 7 involved patients in such a situation is presented. After discovering the infectious trigger a management team is established. An immediate stop for further admissions was announced and all infected room areas and medical equipment were analysed for infection foci. The infected patients were transferred to regional hospitals or a rehabiltation hospital after finishing all surgical procedures. In one case, for whom further operations were needed, a transfer to a separated area of the intermediate care unit (IMC) within the hospital was arranged. The performed analysis of infection foci indicated a bronchoscopy tower to be the infection source. The outbreak was terminated after transferring all patients, final disinfection and subsequent nebulisation with 5-6% hydrogen peroxide within 18 days. PMID:25162239

  4. Membrane-permeabilizing activity of reverse-amide 2-aminoimidazole antibiofilm agents against Acinetobacter baumannii.


    Stowe, Sean D; Thompson, Richele J; Peng, Lingling; Su, Zhaoming; Blackledge, Meghan S; Draughn, G Logan; Coe, William H; Johannes, Eva; Lapham, Valerie K; Mackenzie, John; Melander, Christian; Cavanagh, John


    Acinetobacter baumannii has quickly become one of the most insidious and prevalent nosocomial infections. Recently, the reverse-amide class of 2-aminoimidazole compounds (RA-2AI) was found both to prevent A. baumannii biofilm formation and also to disperse preexisting formations, putatively through interactions with cytosolic response regulators. Here we focus on how this class of antibiofilm agent traverses cellular membranes. Following the discovery of dosage-dependent growth rate changes, the cellular effects of RA-2AI were investigated using a combination of molecular assays and microscopic techniques. It was found that RA-2AI exposure has measureable effects on the bacterial membranes, resulting in a period of increased permeability and visible structural aberrations. Based on these results, we propose a model that describes how the structure of RA-2AI allows it to insert itself into and disrupt the fluidity of the membrane, creating an opportunity for increased molecular permeability. PMID:25348099

  5. Acinetobactin Isomerization Enables Adaptive Iron Acquisition in Acinetobacter baumannii through pH-Triggered Siderophore Swapping.


    Shapiro, Justin A; Wencewicz, Timothy A


    Pathogenic strains of Acinetobacter baumannii excrete multiple siderophores that enhance iron scavenging from host sources. The oxazoline siderophore pre-acinetobactin undergoes an unusual non-enzymatic isomerization, producing the isoxazolidinone acinetobactin. In this study, we explored the kinetics, mechanism, and biological consequence of this siderophore swapping. Pre-acinetobactin is excreted to the extracellular space where the isomerization to acinetobactin occurs with a pH-rate profile consistent with 5-exo-tet cyclization at C5' with clean stereochemical inversion. Pre-acinetobactin persists at pH <6, and acinetobactin is rapidly formed at pH >7, matching each siderophore's pH preference for iron(III) chelation and A. baumannii growth promotion. Acinetobactin isomerization provides two siderophores for the price of one, enabling A. baumannii to sequester iron over a broad pH range likely to be encountered during the course of an infection. PMID:27624967

  6. Correlation of Ciprofloxacin Resistance with the AdeABC Efflux System in Acinetobacter baumannii Clinical Isolates

    PubMed Central

    Ardebili, Abdollah; Talebi, Malihe


    Background Acinetobacter baumannii is one of the most important pathogens capable of colonization in burn patients, leading to drug-resistant wound infections. This study evaluated the distribution of the AdeABC efflux system genes and their relationship to ciprofloxacin resistance in A. baumannii isolates collected from burn patients. Methods A total of 68 A. baumannii clinical strains were isolated from patients hospitalized in Motahari Burns Center in Tehran, Iran. Ciprofloxacin susceptibility was tested by the disk diffusion and agar dilution methods. PCR amplification of the adeRS-adeB drug efflux genes was performed for all resistant and susceptible isolates. To assess the role of the drug efflux pump in ciprofloxacin susceptibility, carbonyl cyanide 3-chlorophenylhydrazone (CCCP) was used as an efflux pump inhibitor (EPI). Results Approximately 95.6% of the Acinetobacter isolates were resistant to ciprofloxacin, with minimum inhibitory concentration (MIC) values ranging from 4 to ≥128 µg/mL. The susceptibility of 86.1% of the resistant isolates increased by factors of 2 to 64 in the presence of CCCP. All resistant isolates were positive for the adeRS-adeB genes, and 73.2% of them had mutations in the AdeRS regulatory system. Conclusions The results showed that AdeABC genes are common in A. baumannii, which might be associated with ciprofloxacin non-susceptibility, as indicated by the observed linkage to the presence of the genes essential for the activity of the AdeABC, several single mutations occurring in the adeRS regulatory system, and an increase of ciprofloxacin susceptibility in the presence of a CCCP EPI. PMID:25368818

  7. Variation in the Complex Carbohydrate Biosynthesis Loci of Acinetobacter baumannii Genomes

    PubMed Central

    Kenyon, Johanna J.; Hall, Ruth M.


    Extracellular polysaccharides are major immunogenic components of the bacterial cell envelope. However, little is known about their biosynthesis in the genus Acinetobacter, which includes A. baumannii, an important nosocomial pathogen. Whether Acinetobacter sp. produce a capsule or a lipopolysaccharide carrying an O antigen or both is not resolved. To explore these issues, genes involved in the synthesis of complex polysaccharides were located in 10 complete A. baumannii genome sequences, and the function of each of their products was predicted via comparison to enzymes with a known function. The absence of a gene encoding a WaaL ligase, required to link the carbohydrate polymer to the lipid A-core oligosaccharide (lipooligosaccharide) forming lipopolysaccharide, suggests that only a capsule is produced. Nine distinct arrangements of a large capsule biosynthesis locus, designated KL1 to KL9, were found in the genomes. Three forms of a second, smaller variable locus, likely to be required for synthesis of the outer core of the lipid A-core moiety, were designated OCL1 to OCL3 and also annotated. Each K locus includes genes for capsule export as well as genes for synthesis of activated sugar precursors, and for glycosyltransfer, glycan modification and oligosaccharide repeat-unit processing. The K loci all include the export genes at one end and genes for synthesis of common sugar precursors at the other, with a highly variable region that includes the remaining genes in between. Five different capsule loci, KL2, KL6, KL7, KL8 and KL9 were detected in multiply antibiotic resistant isolates belonging to global clone 2, and two other loci, KL1 and KL4, in global clone 1. This indicates that this region is being substituted repeatedly in multiply antibiotic resistant isolates from these clones. PMID:23614028

  8. Identification of Acinetobacter baumannii Serum-Associated Antibiotic Efflux Pump Inhibitors

    PubMed Central

    Blanchard, Catlyn; Barnett, Pamela; Perlmutter, Jessamyn


    Adaptive antibiotic resistance is a newly described phenomenon by which Acinetobacter baumannii induces efflux pump activity in response to host-associated environmental cues that may, in part, account for antibiotic treatment failures against clinically defined susceptible strains. To that end, during adaptation to growth in human serum, the organism induces approximately 22 putative efflux-associated genes and displays efflux-mediated minocycline tolerance at antibiotic concentrations corresponding to patient serum levels. Here, we show that in addition to minocycline, growth in human serum elicits A. baumannii efflux-mediated tolerance to the antibiotics ciprofloxacin, meropenem, tetracycline, and tigecycline. Moreover, using a whole-cell high-throughput screen and secondary assays, we identified novel serum-associated antibiotic efflux inhibitors that potentiated the activities of antibiotics toward serum-grown A. baumannii. Two compounds, Acinetobacter baumannii efflux pump inhibitor 1 (ABEPI1) [(E)-4-((4-chlorobenzylidene)amino)benezenesulfonamide] and ABEPI2 [N-tert-butyl-2-(1-tert-butyltetrazol-5-yl)sulfanylacetamide], were shown to lead to minocycline accumulation within A. baumannii during serum growth and inhibit the efflux potential of the organism. While both compounds also inhibited the antibiotic efflux properties of the bacterial pathogen Pseudomonas aeruginosa, they did not display significant cytotoxicity toward human cells or mammalian Ca2+ channel inhibitory effects, suggesting that ABEPI1 and ABEPI2 represent promising structural scaffolds for the development of new classes of bacterial antibiotic efflux pump inhibitors that can be used to potentiate the activities of current and future antibiotics for the therapeutic intervention of Gram-negative bacterial infections. PMID:25114126

  9. Structural and bioinformatic characterization of an Acinetobacter baumannii type II carrier protein

    SciTech Connect

    Allen, C. Leigh; Gulick, Andrew M.


    The high-resolution crystal structure of a free-standing carrier protein from Acinetobacter baumannii that belongs to a larger NRPS-containing operon, encoded by the ABBFA-003406–ABBFA-003399 genes of A. baumannii strain AB307-0294, that has been implicated in A. baumannii motility, quorum sensing and biofilm formation, is presented. Microorganisms produce a variety of natural products via secondary metabolic biosynthetic pathways. Two of these types of synthetic systems, the nonribosomal peptide synthetases (NRPSs) and polyketide synthases (PKSs), use large modular enzymes containing multiple catalytic domains in a single protein. These multidomain enzymes use an integrated carrier protein domain to transport the growing, covalently bound natural product to the neighboring catalytic domains for each step in the synthesis. Interestingly, some PKS and NRPS clusters contain free-standing domains that interact intermolecularly with other proteins. Being expressed outside the architecture of a multi-domain protein, these so-called type II proteins present challenges to understand the precise role they play. Additional structures of individual and multi-domain components of the NRPS enzymes will therefore provide a better understanding of the features that govern the domain interactions in these interesting enzyme systems. The high-resolution crystal structure of a free-standing carrier protein from Acinetobacter baumannii that belongs to a larger NRPS-containing operon, encoded by the ABBFA-003406–ABBFA-003399 genes of A. baumannii strain AB307-0294, that has been implicated in A. baumannii motility, quorum sensing and biofilm formation, is presented here. Comparison with the closest structural homologs of other carrier proteins identifies the requirements for a conserved glycine residue and additional important sequence and structural requirements within the regions that interact with partner proteins.

  10. Growth of Acinetobacter baumannii in Pellicle Enhanced the Expression of Potential Virulence Factors

    PubMed Central

    Alexandre, Stéphane; Coquet, Laurent; Vila, Jordi; Jouenne, Thierry; Dé, Emmanuelle


    Background Interestingly, Acinetobacter baumannii presents an enhanced capacity to form biofilms (also named pellicles) at the air-liquid interface as compared to the other Acinetobacter species. This characteristic questions the contribution of this phenotype to an increased risk of clinical infections by this pathogen. Methodology/Principal Findings By a proteomic approach using 2-D gel electrophoresis-LC-MS/MS mass spectrometry, we compared the membrane protein patterns of A. baumannii 77, a pellicle-forming clinical isolate, grown in planktonic and in sessile modes. We identified 52 proteins with a differential expression, including 32 up-regulated and 20 down-regulated in the pellicle state. Several proteins, differentially expressed during pellicle development, were of particular interest. We determined the over-expression of four siderophore iron uptake systems including the acinetobactin and enterobactin receptors and confirmed that the development of this type of biofilm is promoted by ferric ions. Two over-expressed proteins, CarO and an OprD-homologue, putative carbapenem-resistance associated porins, would be involved in the transport of specific compounds, like ornithine, a biosynthesis precursor of a siderophore from the hydroxamate family. We evidenced the overexpression of a lipase and a transporter of LCFA that may be involved in the recycling of lipids inside the pellicle matrix. Finally, we demonstrated both by proteomic and by AFM studies that this particular type of biofilm required multiple pili systems to maintain this cohesive structure at the air-liquid interface; two of these systems have never been described in A. baumannii. Conclusions/Significance Our study demonstrated that several proteins, overexpressed at a late state of pellicle development, could be potentially involved in virulence processes. Therefore, regarding the number of potential virulence factors that are over-expressed in this growth mode, the pellicle-forming clinical

  11. Biofilm-Related Genes: Analyses in Multi-Antibiotic Resistant Acinetobacter Baumannii Isolates From Mainland China

    PubMed Central

    Liu, Hui; Wu, Yong-Quan; Chen, Li-Ping; Gao, Xiang; Huang, Hao-Nan; Qiu, Fu-Lan; Wu, Ding-Chang


    Background Acinetobacter baumannii is an important nosocomial pathogen which shows a high level of mortality risk. Several papers have reported biofilm formation as a well-known pathogenic mechanism in A. baumannii infections and exceptional antibiotic resistance. The study aims to explore the potential relationships between biofilm-related genes and antimicrobial resistance. Material/Methods Samples from 122 patients with lower respiratory tract infections of A. baumannii were collected at Fujian Longyan First Hospital from January 2013 to September 2014. A. baumannii was isolated from sputum specimens. Biofilm-related genes including abaI, csuE, ompA, and bla-PER1 were analyzed by PCR. The minimum inhibitory concentration method was used to determine the sensitivity of each strain to antibiotics. Results The clinical manifestations of A. baumannii-induced lower respiratory tract infections lacked specificity. Infected patients were most commonly admitted to intensive care units (54.9%) and frequently had chronic obstructive pulmonary disease (27.0%). The detection rates of abaI and csuE were both 59.8%, and those of ompA and bla-PER1 were 100% and 0%, respectively. After genetic testing, antimicrobial resistance to amikacin, ampicillin/sulbactam, and 14 other types of antimicrobials was higher in abaI- and csuE-positive strains than in abaI- and csuE-negative strains (P<0.05). Conclusions The findings of our study suggest that abaI- and csuE-positive Acinetobacter baumannii strains are associated with a higher incidence of antibiotic resistance in 14 types of antimicrobials. PMID:27234982

  12. Biofilm-Related Genes: Analyses in Multi-Antibiotic Resistant Acinetobacter Baumannii Isolates From Mainland China.


    Liu, Hui; Wu, Yong-Quan; Chen, Li-Ping; Gao, Xiang; Huang, Hao-Nan; Qiu, Fu-Lan; Wu, Ding-Chang


    BACKGROUND Acinetobacter baumannii is an important nosocomial pathogen which shows a high level of mortality risk. Several papers have reported biofilm formation as a well-known pathogenic mechanism in A. baumannii infections and exceptional antibiotic resistance. The study aims to explore the potential relationships between biofilm-related genes and antimicrobial resistance. MATERIAL AND METHODS Samples from 122 patients with lower respiratory tract infections of A. baumannii were collected at Fujian Longyan First Hospital from January 2013 to September 2014. A. baumannii was isolated from sputum specimens. Biofilm-related genes including abaI, csuE, ompA, and bla-PER1 were analyzed by PCR. The minimum inhibitory concentration method was used to determine the sensitivity of each strain to antibiotics. RESULTS The clinical manifestations of A. baumannii-induced lower respiratory tract infections lacked specificity. Infected patients were most commonly admitted to intensive care units (54.9%) and frequently had chronic obstructive pulmonary disease (27.0%). The detection rates of abaI and csuE were both 59.8%, and those of ompA and bla-PER1 were 100% and 0%, respectively. After genetic testing, antimicrobial resistance to amikacin, ampicillin/sulbactam, and 14 other types of antimicrobials was higher in abaI- and csuE-positive strains than in abaI- and csuE-negative strains (P<0.05). CONCLUSIONS The findings of our study suggest that abaI- and csuE-positive Acinetobacter baumannii strains are associated with a higher incidence of antibiotic resistance in 14 types of antimicrobials. PMID:27234982

  13. Clinically Relevant Growth Conditions Alter Acinetobacter baumannii Antibiotic Susceptibility and Promote Identification of Novel Antibacterial Agents

    PubMed Central

    Colquhoun, Jennifer M.; Wozniak, Rachel A. F.; Dunman, Paul M.


    Biological processes that govern bacterial proliferation and survival in the host-environment(s) are likely to be vastly different from those that are required for viability in nutrient-rich laboratory media. Consequently, growth-based antimicrobial screens performed in conditions modeling aspects of bacterial disease states have the potential to identify new classes of antimicrobials that would be missed by screens performed in conventional laboratory media. Accordingly, we performed screens of the Selleck library of 853 FDA approved drugs for agents that exhibit antimicrobial activity toward the Gram-negative bacterial pathogen Acinetobacter baumannii during growth in human serum, lung surfactant, and/or the organism in the biofilm state and compared those results to that of conventional laboratory medium. Results revealed that a total of 90 compounds representing 73 antibiotics and 17 agents that were developed for alternative therapeutic indications displayed antimicrobial properties toward the test strain in at least one screening condition. Of the active library antibiotics only four agents, rifampin, rifaximin, ciprofloxacin and tetracycline, exhibited antimicrobial activity toward the organism during all screening conditions, whereas the remainder were inactive in ≥ 1 condition; 56 antibiotics were inactive during serum growth, 25 and 38 were inactive toward lung surfactant grown and biofilm-associated cells, respectively, suggesting that subsets of antibiotics may outperform others in differing infection settings. Moreover, 9 antibiotics that are predominantly used for the treatment Gram-positive pathogens and 10 non-antibiotics lacked detectable antimicrobial activity toward A. baumannii grown in conventional medium but were active during ≥ 1 alternative growth condition(s). Such agents may represent promising anti-Acinetobacter agents that would have likely been overlooked by antimicrobial whole cell screening assays performed in traditional

  14. Rapid detection of blaOXA in carbapenem-susceptible Acinetobacter radioresistens bacteremia leading to unnecessary antimicrobial administration.


    Brady, Adam C; Lewis, James S; Pfeiffer, Christopher D


    Rapid molecular techniques to identify resistant pathogens are revolutionizing antibiotic stewardship; however, it is important to recognize the limitations of these techniques. Herein we describe two cases of bacteremia that were both initially identified by genotypic testing as carbapenem-resistant Acinetobacter spp. and subsequently identified phenotypically as carbapenem-susceptible A. radioresistens. The genotypic results prompted unnecessary broad-spectrum antibiotic use and infection control concerns. PMID:27236714

  15. Novel Resistance-Nodulation-Cell Division Efflux System AdeDE in Acinetobacter Genomic DNA Group 3

    PubMed Central

    Chau, Sze-Lok; Chu, Yiu-Wai; Houang, Elizabeth T. S.


    Resistance-nodulation-cell division type efflux pump AdeDE was identified in acinetobacters belonging to genomic DNA group 3. Inactivation of adeE showed that it may be responsible for reduced susceptibility to amikacin, ceftazidime, chloramphenicol, ciprofloxacin, erythromycin, ethidium bromide, meropenem, rifampin, and tetracycline. However, unlike what was found for other similar efflux systems, the open reading frame for the outer membrane component was not found downstream of the adeDE gene cluster. PMID:15388479

  16. Emergence of Carbapenem-Resistant Acinetobacter baumannii in Nursing Homes With High Background Rates of MRSA Colonization.


    Cheng, Vincent C C; Chen, Jonathan H K; Ng, W C; Wong, Janet Y H; Chow, Denise M K; Law, T C; So, Simon Y C; Wong, Sally C Y; Chan, T C; Chan, Felix H W; Ho, P L; Yuen, K Y


    Carbapenem-resistant Acinetobacter baumannii (CRAB) with diverse multilocus sequence typing emerged among our nursing home residents (6.5%) with a high background rate of MRSA (32.2%). Rectal swabs yielded a higher rate of CRAB detection than axillary or nasal swabs. Bed-bound status, use of adult diapers, and nasogastric tube were risk factors for CRAB colonization. Infect Control Hosp Epidemiol 2016;37:983-986. PMID:27108526

  17. Identification of Novel Genes Involved in Long-Chain n-Alkane Degradation by Acinetobacter sp. Strain DSM 17874▿

    PubMed Central

    Throne-Holst, Mimmi; Wentzel, Alexander; Ellingsen, Trond E.; Kotlar, Hans-Kristian; Zotchev, Sergey B.


    Acinetobacter sp. strain DSM 17874 is capable of utilizing n-alkanes with chain lengths ranging from that of decane (C10H22) to that of tetracontane (C40H82) as a sole carbon source. Two genes encoding AlkB-type alkane hydroxylase homologues, designated alkMa and alkMb, have been shown to be involved in the degradation of n-alkanes with chain lengths of from 10 to 20 C atoms in this strain. Here, we describe a novel high-throughput screening method and the screening of a transposon mutant library to identify genes involved in the degradation of n-alkanes with C chain lengths longer than 20, which are solid at 30°C, the optimal growth temperature for Acinetobacter sp. strain DSM 17874. A library consisting of approximately 6,800 Acinetobacter sp. strain DSM 17874 transposon mutants was constructed and screened for mutants unable to grow on dotriacontane (C32H66) while simultaneously showing wild-type growth characteristics on shorter-chain n-alkanes. For 23 such mutants isolated, the genes inactivated by transposon insertion were identified. Targeted inactivation and complementation studies of one of these genes, designated almA and encoding a putative flavin-binding monooxygenase, confirmed its involvement in the strain's metabolism of long-chain n-alkanes. To our knowledge, almA represents the first cloned gene shown to be involved in the bacterial degradation of long-chain n-alkanes of 32 C's and longer. Genes encoding AlmA homologues were also identified in other long-chain n-alkane-degrading Acinetobacter strains. PMID:17400787

  18. Origin in Acinetobacter guillouiae and Dissemination of the Aminoglycoside-Modifying Enzyme Aph(3′)-VI

    PubMed Central

    Yoon, Eun-Jeong; Goussard, Sylvie; Touchon, Marie; Krizova, Lenka; Cerqueira, Gustavo; Murphy, Cheryl; Lambert, Thierry; Grillot-Courvalin, Catherine; Nemec, Alexandr


    ABSTRACT The amikacin resistance gene aphA6 was first detected in the nosocomial pathogen Acinetobacter baumannii and subsequently in other genera. Analysis of 133 whole-genome sequences covering the taxonomic diversity of Acinetobacter spp. detected aphA6 in the chromosome of 2 isolates of A. guillouiae, which is an environmental species, 1 of 8 A. parvus isolates, and 5 of 34 A. baumannii isolates. The gene was also present in 29 out of 36 A. guillouiae isolates screened by PCR, indicating that it is ancestral to this species. The Pnative promoter for aphA6 in A. guillouiae and A. parvus was replaced in A. baumannii by PaphA6, which was generated by use of the insertion sequence ISAba125, which brought a −35 sequence. Study of promoter strength in Escherichia coli and A. baumannii indicated that PaphA6 was four times more potent than Pnative. There was a good correlation between aminoglycoside MICs and aphA6 transcription in A. guillouiae isolates that remained susceptible to amikacin. The marked topology differences of the phylogenetic trees of aphA6 and of the hosts strongly support its recent direct transfer within Acinetobacter spp. and also to evolutionarily remote bacterial genera. Concomitant expression of aphA6 must have occurred because, contrary to the donors, it can confer resistance to the new hosts. Mobilization and expression of aphA6 via composite transposons and the upstream IS-generating hybrid PaphA6, followed by conjugation, seems the most plausible mechanism. This is in agreement with the observation that, in the recipients, aphA6 is carried by conjugative plasmids and flanked by IS that are common in Acinetobacter spp. Our data indicate that resistance genes can also be found in susceptible environmental bacteria.   PMID:25336457

  19. Investigation of the Distributions and Types of Multidrug-Resistant Acinetobacter baumannii in Different Departments in a General Hospital

    PubMed Central

    Qian, Yaner; Dong, Xuejun; Wang, Zongxin; Yang, Guocan; Liu, Qi


    Background: Acinetobacter baumannii is the most prevalent strain in hospitals and different clinical departments. Objectives: The current study aimed to investigate the genetic characteristics and resistance mechanisms of A. baumannii isolated from clinical samples in Shaoxing people’s hospital affiliated to Zhejiang University, Shaoxing, China. Patients and Methods: Acinetobacter baumannii strains were isolated from blood, phlegm and skin of the patients hospitalized in different departments as respiratory medicine, plastic surgery and intensive care unit (ICU). Multilocus sequence typing (MLST) was used to characterize the isolates. Kirby-Bauer test was used to evaluate antibiotic resistance of the bacteria. The expression of resistance inducing genes was detected by reverse transcription polymerase chain reaction (RT-PCR). The results were analyzed and compared. Results: Two bacterial types, ST208, and ST218, were identified in all 140 samples. The ST208 mainly came from ICU and department of respiratory medicine, while ST218 from department of plastic surgery; 70.21% of ST208 and 84.78% of ST218 were carbapenem-resistant Acinetobacter baumannii (CRAB) and carbapenem-susceptible Acinetobacter baumannii (CSAB), respectively. Multidrug-resistance genes in CRAB isolated from the hospital mainly included, oxa-23, oxa-5, intl 1 and qaceΔ1-sul 1. Besides, the highest and lowest antibiotic resistance was observed in the strains isolated from blood samples and wounds, respectively. Conclusions: The distribution of AB varies in different clinical departments and samples. In the hospital under study, the main types of AB were ST208 and ST218. The genes which affect the ability of antibiotic-resistance were oxa-23, oxa-51, intl 1 and qaceΔ1-sul 1. PMID:26487921

  20. Emergence and spread of plasmid-borne tet(B)::ISCR2 in minocycline-resistant Acinetobacter baumannii isolates.


    Vilacoba, Elisabet; Almuzara, Marisa; Gulone, Lucia; Traglia, German Matías; Figueroa, Silvia A; Sly, Gabriela; Fernández, Analia; Centrón, Daniela; Ramírez, María Soledad


    Resistance to minocycline has emerged in multidrug-resistant Acinetobacter baumannii isolates from Buenos Aires hospitals. Few reports about the description and dispersion of tet genes in this species have been published. We observed the presence of tet(B) in all minocycline-resistant isolates. This gene was found to be associated with the ISCR2 mobile element, which may, in part, explain its dispersion. PMID:23147737

  1. First report of an OXA-23 carbapenemase-producing Acinetobacter baumannii clinical isolate related to Tn2006 in Spain.


    Espinal, P; Macià, M D; Roca, I; Gato, E; Ruíz, E; Fernández-Cuenca, F; Oliver, A; Rodríguez-Baño, J; Bou, G; Tomás, M; Vila, J


    A carbapenem-resistant Acinetobacter baumannii clinical isolate belonging to European clone II and sequence type 2 was recovered from a patient in the Son Espases hospital in Mallorca, Spain. Genetic analysis showed the presence of the bla(OXA-23) gene in association with the widely disseminated transposon Tn2006. This is the first reported identification of A. baumannii carrying bla(OXA-23) in Spain. PMID:23070166

  2. Impaired Virulence and Fitness of a Colistin-Resistant Clinical Isolate of Acinetobacter baumannii in a Rat Model of Pneumonia

    PubMed Central

    Hraiech, Sami; Roch, Antoine; Lepidi, Hubert; Atieh, Thérèse; Audoly, Gilles; Rolain, Jean-Marc; Raoult, Didier; Brunel, Jean-Michel; Papazian, Laurent


    We compared the fitness and lung pathogenicity of two isogenic clinical isolates of Acinetobacter baumannii, one resistant (ABCR) and the other susceptible (ABCS) to colistin. In vitro, ABCR exhibited slower growth kinetics than ABCS. In a rat model of pneumonia, ABCR was associated with less pronounced signs of infection (lung bacterial count, systemic dissemination, and lung damage) and a better outcome (ABCR and ABCS mortality rates, 20 and 50%, respectively [P = 0.03]). PMID:23836181

  3. [Extended spectrum beta lactamases (ESBL) production in Acinetobacter baumannii strains isolated from Chilean hospitals belonging to VIII Region].


    Pino I, Carolina; Domínguez Y, Mariana; González R, Gerardo; Bello T, Helia; Sepúlveda A, Marcela; Mella M, Sergio; Zemelman M, Claudia; Zemelman Z, Raúl


    The resistance of Acinetobacter baumannii to ss-lactam antibiotics is mainly due to the synthesis of ss-lactamases. From a clinical point of view, this bacteria and others, grouped under the acronym SPACE (S: Serratia, P: Pseudomonas, A: Acinetobacter, C: Citrobacter, E: Enterobacter) are essentially Amp-C ss-lactamases producers. There is no local information about ESBL presence in Acinetobacter. We studied ESBL production using the Ho and col. technique modified by adding cloxacillin as chromosomal ss-lactamases inhibitor. From 69 isolates, with resistance to at least one third generation cephalosporin, only 7 showed positive synergy test. Four of these amplified for TEM family gene, and one of these amplified also for the OXA family. Our study found a low ESBL production percentage, which agrees with the premise of Amp-C as the main mechanism of resistance to ss-lactam antibiotics in A. baumannii. However, the ESBL description in these bacteria emphasizes the capacity of expressing multiple resistance mechanisms. PMID:17453072

  4. Characterization of carbapenem-resistant Acinetobacter baumannii clinical isolates in a tertiary care hospital in Saudi Arabia.


    Abdalhamid, Baha; Hassan, Hoda; Itbaileh, Ahmad; Shorman, Mahmoud


    This study characterized the occurrence of carbapenem resistance of Acinetobacter baumannii isolates in a tertiary care hospital in Saudi Arabia. From January 2010 until February 2012, Acinetobacter spp. isolates were collected from different wards and were identified using Vitek 2 system and 16S rRNA gene sequencing. Vitek 2 system and Etest were used for susceptibility testing. PCR and Pulse field gel electrophoresis (PFGE) were used for detecting and typing genes associated with carbapenem resistance. A total of 141 isolates were identified as A. baumannii. A total of 46 (32.6%) isolates were carbapenem-resistant Acinetobacter baumannii (CRAB) isolates and had wild diversity by PFGE. Metallo ?-lactamase confirmatory test was positive for 43 isolates with negative PCR for blaIMP and blaVIM. Among the 46 CRAB strains, 37 isolates harbored blaOXA-23 which was encoded downstream of ISAba1 and 1 isolate had ISAba1 encoded upstream blaOXA-51. These data reveal that the interhospital transmission of CRAB isolates was apparently insignificant. BlaOXA-23 adjacent to ISAba1 was the main mechanism of carbapenem resistance in these isolates. To our knowledge, this is the first molecular study characterizing carbapenem resistance in A. baumannii in the Eastern Province of Saudi Arabia. PMID:24531172

  5. Medically Relevant Acinetobacter Species Require a Type II Secretion System and Specific Membrane-Associated Chaperones for the Export of Multiple Substrates and Full Virulence

    PubMed Central

    Harding, Christian M.; Kinsella, Rachel L.; Palmer, Lauren D.; Skaar, Eric P.; Feldman, Mario F.


    Acinetobacter baumannii, A. nosocomialis, and A. pittii have recently emerged as opportunistic human pathogens capable of causing severe human disease; however, the molecular mechanisms employed by Acinetobacter to cause disease remain poorly understood. Many pathogenic members of the genus Acinetobacter contain genes predicted to encode proteins required for the biogenesis of a type II secretion system (T2SS), which have been shown to mediate virulence in many Gram-negative organisms. Here we demonstrate that Acinetobacter nosocomialis strain M2 produces a functional T2SS, which is required for full virulence in both the Galleria mellonella and murine pulmonary infection models. Importantly, this is the first bona fide secretion system shown to be required for virulence in Acinetobacter. Using bioinformatics, proteomics, and mutational analyses, we show that Acinetobacter employs its T2SS to export multiple substrates, including the lipases LipA and LipH as well as the protease CpaA. Furthermore, the Acinetobacter T2SS, which is found scattered amongst five distinct loci, does not contain a dedicated pseudopilin peptidase, but instead relies on the type IV prepilin peptidase, reinforcing the common ancestry of these two systems. Lastly, two of the three secreted proteins characterized in this study require specific chaperones for secretion. These chaperones contain an N-terminal transmembrane domain, are encoded adjacently to their cognate effector, and their disruption abolishes type II secretion of their cognate effector. Bioinformatic analysis identified putative chaperones located adjacent to multiple previously known type II effectors from several Gram-negative bacteria, which suggests that T2SS chaperones constitute a separate class of membrane-associated chaperones mediating type II secretion. PMID:26764912

  6. Antimicrobial susceptibility profiling and genomic diversity of Acinetobacter baumannii isolates: A study in western Iran

    PubMed Central

    Mohajeri, Parviz; Farahani, Abbas; Feizabadi, Mohammad Mehdi; Ketabi, Hosnieh; Abiri, Ramin; Najafi, Farid


    Background and Objective Acinetobacter baumannii is an aerobic non-motile Gram-negative bacterial pathogen that is resistant to most antibiotics. Carbapenems are the most common antibiotics for the treatment of infections caused by this pathogen. Mechanisms of antibiotic-resistance in A. baumannii are mainly mediated by efflux pumps-lactamases. The aim of this study was to determine antibiotic susceptibility, the possibility of existence of OXAs genes and fingerprinting by Pulsed-Field Gel Electrophoresis (PFGE) among clinical isolates of Acinetobacter collected from Kermanshah hospitals. Materials and Methods One hundred and four isolates were collected from patients attending Imam Reza, Taleghani and Imam Khomeini hospitals of Kermanshah (Iran). Isolates were identified by biochemical tests and API 20NE kit. The susceptibility to different antibiotics was assessed with Kirby-Bauer disk diffusion method. PCR was performed for detection of bla OXA-23, bla OXA-24, bla OXA-51 and bla OXA-58 beta-lactamase genes. Clonal relatedness was estimated by PFGE (with the restriction enzyme Apa I) and DNA patterns were analyzed by Gel compare II 6.5 software. Results All isolates showed high-level of resistance to imipenem, meropenem as well as to other antimicrobial agents, while no resistance to polymyxin B, colistin, tigecylcine and minocycline was observed. The bla OXA-23like and bla OXA-24 like were found among 77.9% and 19.2% of the isolates, respectively. All isolates were positive for bla OXA-51, but none produced any amplicon for bla OXA-58. PFGE genotype analysis suggested the existence of eight clones among the 104 strains [A (n = 35), B (n = 29), C (n = 19), D (n = 10), E (n = 4), F (n = 3), G (n = 3), H (n = 1)]. Clone A was the dominant clone in hospital settings particularly infection wards so that the isolates in this group, compared to the other clones, showed higher levels of resistance to antibiotics. Conclusion The bla OXA-51-like and bla OXA-23like were

  7. Paradoxical Effect of Polymyxin B: High Drug Exposure Amplifies Resistance in Acinetobacter baumannii.


    Tsuji, Brian T; Landersdorfer, Cornelia B; Lenhard, Justin R; Cheah, Soon-Ee; Thamlikitkul, Visanu; Rao, Gauri G; Holden, Patricia N; Forrest, Alan; Bulitta, Jürgen B; Nation, Roger L; Li, Jian


    Administering polymyxin antibiotics in a traditional fashion may be ineffective against Gram-negative ESKAPE (Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter species) pathogens. Here, we explored increasing the dose intensity of polymyxin B against two strains of Acinetobacter baumannii in the hollow-fiber infection model. The following dosage regimens were simulated for polymyxin B (t1/2 = 8 h): non-loading dose (1.43 mg/kg of body weight every 12 h [q12h]), loading dose (2.22 mg/kg q12h for 1 dose and then 1.43 mg/kg q12h), front-loading dose (3.33 mg/kg q12h for 1 dose followed by 1.43 mg/kg q12h), burst (5.53 mg/kg for 1 dose), and supraburst (18.4 mg/kg for 1 dose). Against both A. baumannii isolates, a rapid initial decline in the total population was observed within the first 6 h of polymyxin exposure, whereby greater polymyxin B exposure resulted in greater maximal killing of -1.25, -1.43, -2.84, -2.84, and -3.40 log10 CFU/ml within the first 6 h. Unexpectedly, we observed a paradoxical effect whereby higher polymyxin B exposures dramatically increased resistant subpopulations that grew on agar containing up to 10 mg/liter of polymyxin B over 336 h. High drug exposure also proliferated polymyxin-dependent growth. A cost-benefit pharmacokinetic/pharmacodynamic relationship between 24-h killing and 336-h resistance was explored. The intersecting point, where the benefit of bacterial killing was equal to the cost of resistance, was an fAUC0-24 (area under the concentration-time curve from 0 to 24 h for the free, unbound fraction of drug) of 38.5 mg · h/liter for polymyxin B. Increasing the dose intensity of polymyxin B resulted in amplification of resistance, highlighting the need to utilize polymyxins as part of a combination against high-bacterial-density A. baumannii infections. PMID:27067330

  8. Development of an rRNA-targeted oligonucleotide probe specific for the genus Acinetobacter and its application for in situ monitoring in activated sludge.

    PubMed Central

    Wagner, M; Erhart, R; Manz, W; Amann, R; Lemmer, H; Wedi, D; Schleifer, K H


    Enhanced biological phosphate removal in an anaerobic-aerobic activated sludge system has generally been ascribed to members of the genus Acinetobacter. A genus-specific 16S rRNA-targeted oligonucleotide probe was developed to investigate the role of Acinetobacter spp. in situ. Nonisotopic dot blot hybridization to 66 reference strains, including the seven described Acinetobacter spp., demonstrated the expected probe specificity. Fluorescent derivatives were used for in situ monitoring of Acinetobacter spp. in the anaerobic and aerobic compartments of a sewage treatment plant with enhanced biological phosphate removal. Microbial community structures were further analyzed with oligonucleotide probes specific for the alpha, beta, or gamma subclasses of the class Proteobacteria, for the Cytophaga-Flavobacterium cluster, for gram-positive bacteria with a high G + C DNA content, and for all bacteria. Total cell counts were determined by 4',6-diamidino-2-phenylindole staining. In both the anaerobic and the aerobic basins, the activated sludge samples were dominated by members of the class Proteobacteria belonging to the beta subclass and by gram-positive bacteria with a high G + C DNA content. Acinetobacter spp. constituted less than 10% of all bacteria. For both basins, the microbial community structures determined with molecular techniques were compared with the compositions of the heterotrophic saprophytic microbiota determined with agar plating techniques. Isolates on nutrient-rich medium were classified by whole-cell hybridization with rRNA-targeted probes and fatty acid analysis.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:7512807

  9. Genetic diversity of endophytic diazotrophs of the wild rice, Oryza alta and identification of the new diazotroph, Acinetobacter oryzae sp. nov.


    Chaudhary, Hassan Javed; Peng, Guixiang; Hu, Mei; He, Yumei; Yang, Lijuan; Luo, Yan; Tan, Zhiyuan


    Thirty-three endophytic diazotrophs were isolated from surface-sterilized leaves, stem, and roots of wild rice Oryza alta. The SDS-PAGE profile of total protein and insertion sequence-based polymerase chain reaction (IS-PCR) fingerprinting grouped the isolates into four clusters (I-IV). The 16S rRNA gene sequence homology of the representative strains B21, B31, B1, and B23 of clusters I, II, III, and IV were assigned to Pseudomonas oleovorans (99.2% similarity), Burkholderia fungorum (99.4% similarity), Enterobacter cloacae (98.9% similarity), and Acinetobacter johnsonii (98.4% similarity), respectively. The results showed wide genetic diversity of the putative diazotrophic strains of the wild rice, O. alta, and the strains of cluster IV are the first report of nitrogen-fixing Acinetobacter species. The cell size, phenotypic characters, total protein profile, genomic DNA fingerprinting, DNA-DNA hybridization, and antibiotic resistance differentiated strain B23(T) from its closest relatives A. johnsonii LMG999(T) and Acinetobacter haemolyticus LMG996(T). The DNA-DNA hybridization also distinguished the strain B23(T) from the closely related Acinetobacter species. Based on these data, a novel species, Acinetobacter oryzae sp. nov., and strain B23(T) (=LMG25575(T) = CGMCC1.10689(T)) as the type strain were proposed. PMID:22105517

  10. Outer membrane Protein A plays a role in pathogenesis of Acinetobacter nosocomialis.


    Kim, Sang Woo; Oh, Man Hwan; Jun, So Hyun; Jeon, Hyejin; Kim, Seung Il; Kim, Kwangho; Lee, Yoo Chul; Lee, Je Chul


    Acinetobacter nosocomialis is an important nosocomial pathogen that causes a variety of human infections. However, the specific virulence factors of this microorganism have not yet been determined. We investigated the role of outer membrane protein A (OmpA) in the pathogenesis of A. nosocomialis. A ΔompA mutant of the A. nosocomialis ATCC 17903(T) strain was constructed using markerless gene deletion. The ΔompA mutant displayed reduced biofilm formation in polystyrene tubes and reduced adherence to A549 cells in comparison to the wild-type strain. These virulence traits of the ΔompA mutant strain were restored when the ompA gene was complemented. Cytotoxicity was not significantly different between the wild-type strain and the ΔompA mutant when A549 cells were infected with bacteria or treated with outer membrane vesicles (OMVs). However, OMVs from the wild-type strain induced cytotoxicity in HEp-2 cells, whereas OMVs from the ΔompA mutant did not induce cytotoxicity. Proteomic analysis of OMVs revealed that OmpA influenced the distribution of envelope and periplasmic proteins. Overall, this study is the first report that links OmpA to A. nosocomialis pathogenesis, and highlights OmpA as a putative target to develop anti-virulence agents or vaccines against A. nosocomialis infection. PMID:26759990

  11. Isolation and characterization of antimicrobial compounds in plant extracts against multidrug-resistant Acinetobacter baumannii.


    Miyasaki, Yoko; Rabenstein, John D; Rhea, Joshua; Crouch, Marie-Laure; Mocek, Ulla M; Kittell, Patricia Emmett; Morgan, Margie A; Nichols, Wesley Stephen; Van Benschoten, M M; Hardy, William David; Liu, George Y


    The number of fully active antibiotic options that treat nosocomial infections due to multidrug-resistant Acinetobacter baumannii (A. baumannii) is extremely limited. Magnolia officinalis, Mahonia bealei, Rabdosia rubescens, Rosa rugosa, Rubus chingii, Scutellaria baicalensis, and Terminalia chebula plant extracts were previously shown to have growth inhibitory activity against a multidrug-resistant clinical strain of A. baumannii. In this study, the compounds responsible for their antimicrobial activity were identified by fractionating each plant extract using high performance liquid chromatography, and determining the antimicrobial activity of each fraction against A. baumannii. The chemical structures of the fractions inhibiting >40% of the bacterial growth were elucidated by liquid chromatography/mass spectrometry analysis and nuclear magnetic resonance spectroscopy. The six most active compounds were identified as: ellagic acid in Rosa rugosa; norwogonin in Scutellaria baicalensis; and chebulagic acid, chebulinic acid, corilagin, and terchebulin in Terminalia chebula. The most potent compound was identified as norwogonin with a minimum inhibitory concentration of 128 µg/mL, and minimum bactericidal concentration of 256 µg/mL against clinically relevant strains of A. baumannii. Combination studies of norwogonin with ten anti-Gram negative bacterial agents demonstrated that norwogonin did not enhance the antimicrobial activity of the synthetic antibiotics chosen for this study. In conclusion, of all identified antimicrobial compounds, norwogonin was the most potent against multidrug-resistant A. baumannii strains. Further studies are warranted to ascertain the prophylactic and therapeutic potential of norwogonin for infections due to multidrug-resistant A. baumannii. PMID:23630600

  12. Long-Term Diversity and Genome Adaptation of Acinetobacter baylyi in a Minimal-Medium Chemostat

    PubMed Central

    Jezequel, Nadia; Lagomarsino, Marco Cosentino; Heslot, Francois; Thomen, Philippe


    Laboratory-based evolution experiments on microorganisms that do not recombine frequently show two distinct phases: an initial rapid increase in fitness followed by a slower regime. To explore the population structure and the evolutionary tree in the later stages of adaptation, we evolved a very large population (∼3 × 10) of Acinetobacter baylyi bacteria for approximately 2,800 generations from a single clone. The population was maintained in a chemostat at a high dilution rate. Nitrate in limiting amount and as the sole nitrogen source was used as a selection pressure. Analysis via resequencing of genomes extracted from populations at different generations provides evidence that long-term diversity can be established in the chemostat in a very simple medium. To find out which biological parameters were targeted by adaptation, we measured the maximum growth rate, the nitrate uptake, and the resistance to starvation. Overall, we find that maximum growth rate could be a reasonably good proxy for fitness. The late slow adaptation is compatible with selection coefficients spanning a typical range of 10–10 per generation as estimated by resequencing, pointing to a possible subpopulations structuring. PMID:23254395

  13. Alcohol dehydrogenases in Acinetobacter sp. strain HO1-N: role in hexadecanse and hexadecanol metabolism

    SciTech Connect

    Singer, M.E.; Finnerty, W.R.


    Multiple alcohol dehydrogenases (ADH) were demonstrated in Acinetobacter sp. strain HO1-N. ADH-A and ADH-B were distinguished on the basis of electrophoretic mobility, pyridine nucleotide cofactor requirement, and substrate specificity. ADH-A is a soluble, NAD-linked, inducible ethanol dehydrogenase (EDH). An ethanol-negative mutant (Eth1) was isolated which contained 6.5% of wild-type EDH activity and was deficient in ADH-A. Eth1 exhibited normal growth on hexadecane and hexadecanol. A second ethanol-negative mutant (Eth3) was acetaldehyde dehydrogenase (ALDH) deficient, having 12.5% of wild-type ALDH activity. Eth3 had threefold-higher EDH activity than the wild-type strain. ALDH is a soluble, NAD-linked, ethanol-inducible enzyme. Eth3 exhibited normal growth on hexadecane, hexadecanol, and fatty aldehyde. ADH-B is soluble, constitutive, NADP-linked ADH which was active with medium-chain-length alcohols. Hexadecanol dehydrogenase (HDH), a soluble and membrane-bound, NAD-linked ADH, was induced 5- to 11-fold by growth on hexadecane or hexadecanol. HDH was distinct from ADH-A and ADH-B. NAD-linked HDH appears to possess a functional role in hexadecane and hexadecanol dissimilation.

  14. Biological remediation of polynuclear aromatic hydrocarbon contaminated soils using Acinetobacter sp.

    SciTech Connect

    Joshi, M.M.; Lee, S.


    Soils contaminated with polynuclear aromatic hydrocarbons (PAHs) pose a hazard to life. The remediation of such sites has been attempted using various methods such as solvent washing, air stripping, incineration, composting, electrokinetic remediation, and supercritical extraction. However, applicability of these physical, chemical, and biological treatment methods or their combination is critically dependent on soil characteristics, nature and level of contamination, site specifications, and economic feasibility, to name a few. Present research is aimed at studying the applicability of biological treatment for decontamination of industrial soil containing PAHs. The current preliminary study included soil analysis, contaminant characterization, and soil treatment using Acinetobacter sp. The soil treatment over a 5-week period, with minimal supplemental nutrient addition, showed removal efficiencies of 80% and more. The effect of initial microbial population in soil on the removal efficiency over a 5-week treatment period was studied. Experiments were designed to compare the removal efficiencies occurring in packed beds versus continuously-stirred tank reactor (CSTR)-type fermentation conditions. This also estimated a conservative range of decontamination efficiencies achievable using minimal control.

  15. Bacterial O-methylation of halogen-substituted phenols. [Rhodococcus; Acinetobacter

    SciTech Connect

    Allard, A.S.; Remberger, M.; Neilson, A.H.


    Two strains of bacteria capable of carrying out the O-methylation of phenolic compounds, one from the gram-positive genus Rhodococcus and one from the gram-negative genus Acinetobacter, were used to examine the O-methylation of phenols carrying fluoro-, chloro-, and bromo-substituents. Zero-order rates of O-methylation were calculated from data for the chloro- and bromophenols; there was no simple relationship between the rate of reaction and the structure of the substrates, and significant differences were observed in the responses of the two test organisms. For the gram-negative strain, the pattern of substitution was as important as the number of substituents. Hexachlorophene was resistant to O-methylation by both strains, and tetrabromobisphenol-A was O-methylated only by the gram-positive strain. It is suggested that in the natural environment, bacterial O-methylation of phenols carrying electron-attracting substituents might be a significant alternative to biodegradation.

  16. Construction of a 3-chlorobiphenyl-utilizing recombinant from an intergeneric mating. [Pseudomonas; Acinetobacter

    SciTech Connect

    Adams, R.H.; Huang, C.M.; Higson, F.K.; Brenner, V.; Focht, D.D. )


    Recombinant Pseudomonas sp. strain CB15, which grows on 3-chlorobiphenyl (3CB), was constructed from Pseudomonas sp. strain HF1, which grows on 3-chlorobenzoate, and from Acinetobacter sp. strain P6, which grows on biphenyl, by using a continuous amalgamated culture apparatus. DNA from strains CB15 and HF1 hybridized very strongly to each other, while hybridization between both parental strains, HF1 and P6, was negligible. However, DNA from the recombinant CB15 hybridized moderately to strongly with three specific fragments of parental strain P6. Strains HF1 and P6 did not grow on 3CB, but recombinant strain CB15 mineralized this compound and released inorganic chloride. When growing on 3CB, strain CB15 accumulated brown products, one of which was identified as 3-chloro-5-(2{prime}-hydroxy-3{prime}-chlorophenyl)-1,2-benzoquinone by mass spectrometry. At least three methods of inhibition from catecholic intermediates may account for slow growth on 3CB. In resting-cell assays, recombinant strain CB15 and strain P6 both metabolized 3CB faster than 3,3{prime}-dichlorobiphenyl. However, 3,3{prime}-dichlorobiphenyl could not be utilized as a growth substrate by strain CB15, nor did its presence have any effect on the rate of 3CB mineralization.

  17. Acinetobacter baumannii-Associated Skin and Soft Tissue Infections: Recognizing a Broadening Spectrum of Disease*

    PubMed Central

    Guerrero, Dubert M.; Perez, Federico; Conger, Nicholas G.; Solomkin, Joseph S.; Adams, Mark D.; Rather, Philip N.


    Abstract Background Acinetobacter baumannii is gaining importance as a cause of nosocomial infections, but its role in skin and soft tissue infection (SSTI) is not well defined. As a result of the outbreak of A. baumannii occurring in military personnel in Iraq and Afghanistan, reports of severe wound infections and SSTI caused by this pathogen are increasing in frequency. Methods We describe four cases of monomicrobial and polymicrobial A. baumannii–associated necrotizing SSTI accompanied by A. baumannii bacteremia and offer a review of similar experiences published in the literature. Results Our comparative analysis reveals four unique features associated with necrotizing SSTI associated with A. baumannii: i) Occurs in hosts with underlying comorbidities (e.g., trauma, cirrhosis); ii) is often accompanied by bacteremia; iii) multiple drug resistance and the presence of co-pathogens frequently complicated treatment (64% of cases); iv) the cases reported here and in our review required surgical debridement (84% of cases) and led to substantial mortality (∼30%). Conclusions As the prevalence of A. baumannii continues to increase in our health care system, SSTIs caused by this organism may become more common. Clinicians must be aware that the spectrum of disease caused by A. baumannii could include severe necrotizing SSTI and that vigilance for potential complications is necessary. PMID:19788383

  18. Identification and Characterization of a Glycosyltransferase Involved in Acinetobacter baumannii Lipopolysaccharide Core Biosynthesis▿

    PubMed Central

    Luke, Nicole R.; Sauberan, Shauna L.; Russo, Thomas A.; Beanan, Janet M.; Olson, Ruth; Loehfelm, Thomas W.; Cox, Andrew D.; St. Michael, Frank; Vinogradov, Evgeny V.; Campagnari, Anthony A.


    Although Acinetobacter baumannii has emerged as a significant cause of nosocomial infections worldwide, there have been few investigations describing the factors important for A. baumannii persistence and pathogenesis. This paper describes the first reported identification of a glycosyltransferase, LpsB, involved in lipopolysaccharide (LPS) biosynthesis in A. baumannii. Mutational, structural, and complementation analyses indicated that LpsB is a core oligosaccharide glycosyl transferase. Using a genetic approach, lpsB was compared with the lpsB homologues of several A. baumannii strains. These analyses indicated that LpsB is highly conserved among A. baumannii isolates. Furthermore, we developed a monoclonal antibody, monoclonal antibody 13C11, which reacts to an LPS core epitope expressed by approximately one-third of the A. baumannii clinical isolates evaluated to date. Previous studies describing the heterogeneity of A. baumannii LPS were limited primarily to structural analyses; therefore, studies evaluating the correlation between these surface glycolipids and pathogenesis were warranted. Our data from an evaluation of LpsB mutant 307::TN17, which expresses a deeply truncated LPS glycoform consisting of only two 3-deoxy-d-manno-octulosonic acid residues and lipid A, suggest that A. baumannii LPS is important for resistance to normal human serum and confers a competitive advantage for survival in vivo. These results have important implications for the role of LPS in A. baumannii infections. PMID:20194587

  19. Treatment Options for Carbapenem-Resistant and Extensively Drug-Resistant Acinetobacter baumannii Infections

    PubMed Central

    Viehman, J. Alexander; Nguyen, Minh-Hong; Doi, Yohei


    Acinetobacter baumannii is a leading cause of healthcare-associated infections worldwide. Due to various intrinsic and acquired mechanisms of resistance, most β-lactam agents are not effective against many strains, and carbapenems have played an important role in therapy. Recent trends show many infections are caused by carbapenem-resistant, or even extensively drug-resistant (XDR) strains, for which effective therapy is not well established. Evidence to date suggests that colistin constitutes the backbone of therapy, but the unique pharmacokinetic properties of colistin have led many to suggest the use of combination antimicrobial therapy. However, the combination of agents and dosing regimens that delivers the best clinical efficacy while minimizing toxicity is yet to be defined. Carbapenems, sulbactam, rifampin and tigecycline have been the most studied in the context of combination therapy. Most data regarding therapy for invasive, resistant A. baumannii infections come from uncontrolled case series and retrospective analyses, though some clinical trials have been completed and others are underway. Early institution of appropriate antimicrobial therapy is shown to consistently improve survival of patients with carbapenem-resistant and XDR A. baumannii infection, but the choice of empiric therapy in these infections remains an open question. This review summarizes the most current knowledge regarding the epidemiology, mechanisms of resistance, and treatment considerations of carbapenem-resistant and XDR A. baumannii. PMID:25091170

  20. Epidemiology of Carbapenemase-Producing Enterobacteriaceae and Acinetobacter baumannii in Mediterranean Countries

    PubMed Central

    Djahmi, Nassima; Dunyach-Remy, Catherine; Pantel, Alix; Dekhil, Mazouz; Sotto, Albert; Lavigne, Jean-Philippe


    The emergence and global spread of carbapenemase-producing Enterobacteriaceae and Acinetobacter baumannii are of great concern to health services worldwide. These β-lactamases hydrolyse almost all β-lactams, are plasmid-encoded, and are easily transferable among bacterial species. They are mostly of the KPC, VIM, IMP, NDM, and OXA-48 types. Their current extensive spread worldwide in Enterobacteriaceae is an important source of concern. Infections caused by these bacteria have limited treatment options and have been associated with high mortality rates. Carbapenemase producers are mainly identified among Klebsiella pneumoniae, Escherichia coli, and A. baumannii and still mostly in hospital settings and rarely in the community. The Mediterranean region is of interest due to a great diversity and population mixing. The prevalence of carbapenemases is particularly high, with this area constituting one of the most important reservoirs. The types of carbapenemase vary among countries, partially depending on the population exchange relationship between the regions and the possible reservoirs of each carbapenemase. This review described the epidemiology of carbapenemases produced by enterobacteria and A. baumannii in this part of the world highlighting the worrisome situation and the need to screen and detect these enzymes to prevent and control their dissemination. PMID:24955354

  1. Characterization of carbapenem-resistant Acinetobacter baumannii isolates in a Chinese teaching hospital

    PubMed Central

    Chang, Yaowen; Luan, Guangxin; Xu, Ying; Wang, Yanhong; Shen, Min; Zhang, Chi; Zheng, Wei; Huang, Jinwei; Yang, Jingni; Jia, Xu; Ling, Baodong


    Carbapenem-resistant Acinetobacter baumannii (CRAB) presents a serious therapeutic and infection control challenge. In this study, we investigated the epidemiological and molecular differences of CRAB and the threatening factors for contributing to increased CRAB infections at a hospital in western China. A total of 110 clinical isolates of A. baumannii, collected in a recent 2-year period, were tested for carbapenem antibiotic susceptibility, followed by a molecular analysis of carbapenemase genes. Genetic relatedness of the isolates was characterized by multilocus sequence typing. Sixty-seven of the 110 isolates (60.9%) were resistant to carbapenems, 80.60% (54/67) of which carried the blaOXA-23 gene. Most of these CRAB isolates (77.62%) were classified as clone complex 92 (CC92), and sequence type (ST) 92 was the most prevalent STs, followed by ST195, ST136, ST843, and ST75. One CRAB isolate of ST195 harbored plasmid pAB52 from a Chinese patient without travel history. This plasmid contains toxin–antitoxin elements related to adaptation for growth, which might have emerged as a common vehicle indirectly mediating the spread of OXA-23 in CRAB. Thus, CC92 A. baumannii carrying OXA-23 is a major drug-resistant strain spreading in China. Our findings indicate that rational application of antibiotics is indispensable for minimizing widespread of drug resistance. PMID:26388854

  2. Role of Fibronectin in the Adhesion of Acinetobacter baumannii to Host Cells

    PubMed Central

    Smani, Younes; McConnell, Michael J.; Pachón, Jerónimo


    Adhesion to host cells is an initial and important step in Acinetobacter baumannii pathogenesis. However, there is relatively little information on the mechanisms by which A. baumannii binds to and interacts with host cells. Adherence to extracellular matrix proteins, such as fibronectin, affords pathogens with a mechanism to invade epithelial cells. Here, we found that A. baumannii adheres more avidly to immobilized fibronectin than to control protein. Free fibronectin used as a competitor resulted in dose-dependent decreased binding of A. baumannii to fibronectin. Three outer membrane preparations (OMPs) were identified as fibronectin binding proteins (FBPs): OMPA, TonB-dependent copper receptor, and 34 kDa OMP. Moreover, we demonstrated that fibronectin inhibition and neutralization by specific antibody prevented significantly the adhesion of A. baumannii to human lung epithelial cells (A549 cells). Similarly, A. baumannii OMPA neutralization by specific antibody decreased significantly the adhesion of A. baumannii to A549 cells. These data indicate that FBPs are key adhesins that mediate binding of A. baumannii to human lung epithelial cells through interaction with fibronectin on the surface of these host cells. PMID:22514602

  3. Screening and Quantification of the Expression of Antibiotic Resistance Genes in Acinetobacter baumannii with a Microarray▿

    PubMed Central

    Coyne, Sébastien; Guigon, Ghislaine; Courvalin, Patrice; Périchon, Bruno


    An oligonucleotide-based DNA microarray was developed to evaluate expression of genes for efflux pumps in Acinetobacter baumannii and to detect acquired antibiotic resistance determinants. The microarray contained probes for 205 genes, including those for 47 efflux systems, 55 resistance determinants, and 35 housekeeping genes. The microarray was validated by comparative analysis of mutants overexpressing or deficient in the pumps relative to the parental strain. The performance of the microarray was also evaluated using in vitro single-step mutants obtained on various antibiotics. Overexpression, confirmed by quantitative reverse transcriptase PCR, of RND efflux pumps AdeABC, due to a G30D substitution in AdeS in a multidrug-resistant (MDR) strain obtained on gentamicin, and AdeIJK, in two mutants obtained on cefotaxime or tetracycline, was detected. A new efflux pump, AdeFGH, was found to be overexpressed in a mutant obtained on chloramphenicol. Study of MDR clinical isolates, including the AYE strain, whose entire sequence has been determined, indicated overexpression of AdeABC and of the chromosomally encoded cephalosporinase as well as the presence of several acquired resistance genes. The overexpressed and acquired determinants detected by the microarray could account for nearly the entire MDR phenotype of the isolates. The microarray is potentially useful for detection of resistance in A. baumannii and should allow detection of new efflux systems associated with antibiotic resistance. PMID:19884373

  4. Crystal structure of 5-enolpyruvylshikimate-3-phosphate (EPSP) synthase from the ESKAPE pathogen Acinetobacter baumannii.


    Sutton, Kristin A; Breen, Jennifer; Russo, Thomas A; Schultz, L Wayne; Umland, Timothy C


    The enzyme 5-enolpyruvylshikimate-3-phosphate (EPSP) synthase catalyzes the sixth step of the seven-step shikimate pathway. Chorismate, the product of the pathway, is a precursor for the biosynthesis of aromatic amino acids, siderophores and metabolites such as folate, ubiquinone and vitamin K. The shikimate pathway is present in bacteria, fungi, algae, plants and apicomplexan parasites, but is absent in humans. The EPSP synthase enzyme produces 5-enolpyruvylshikimate 3-phosphate and phosphate from phosphoenolpyruvate and shikimate 3-phosphate via a transferase reaction, and is the target of the herbicide glyphosate. The Acinetobacter baumannii gene encoding EPSP synthase, aroA, has previously been demonstrated to be essential during host infection for the growth and survival of this clinically important drug-resistant ESKAPE pathogen. Prephenate dehydrogenase is also encoded by the bifunctional A. baumannii aroA gene, but its activity is dependent upon EPSP synthase since it operates downstream of the shikimate pathway. As part of an effort to evaluate new antimicrobial targets, recombinant A. baumannii EPSP (AbEPSP) synthase, comprising residues Ala301-Gln756 of the aroA gene product, was overexpressed in Escherichia coli, purified and crystallized. The crystal structure, determined to 2.37 Å resolution, is described in the context of a potential antimicrobial target and in comparison to EPSP synthases that are resistant or sensitive to the herbicide glyphosate. PMID:26919521

  5. Wide Dissemination of GES-Type Carbapenemases in Acinetobacter baumannii Isolates in Kuwait

    PubMed Central

    Bonnin, Rémy A.; Rotimi, Vincent O.; Al Hubail, Mona; Gasiorowski, Elise; Al Sweih, Noura; Poirel, Laurent


    Acinetobacter baumannii is an opportunistic pathogen that is an important source of nosocomial infections. Production of extended-spectrum β-lactamases (ESBLs) of the GES type in A. baumannii has been increasingly reported, and some of these GES-type enzymes possess some carbapenemase activity. Our aim was to analyze the resistance determinants and the clonal relationships of carbapenem-nonsusceptible A. baumannii clinical isolates recovered from hospitals in Kuwait. A total of 63 isolates were analyzed, and all were found to be positive for blaGES-type genes. One isolate harbored the blaGES-14 gene encoding an ESBL with significant carbapenemase activity, whereas the other isolates harbored the blaGES-11 ESBL gene. Thirty-three isolates coharbored the blaOXA-23 and blaGES-11 genes. Analyses of the genetic locations indicated that the blaGES-11/-14 genes were plasmid located. It is noteworthy that the blaOXA-23 and blaGES-11 genes were colocated onto a single plasmid. Nine different pulsotypes were observed among the 63 isolates. This study showed the emergence of GES-type ESBLs in A. baumannii in Kuwait, further suggesting that the Middle East region might be a reservoir for carbapenemase-producing A. baumannii. PMID:23089751

  6. Phylogenetic and genomic diversity in isolates from the globally distributed Acinetobacter baumannii ST25 lineage

    PubMed Central

    Sahl, Jason W.; Del Franco, Mariateresa; Pournaras, Spyros; Colman, Rebecca E.; Karah, Nabil; Dijkshoorn, Lenie; Zarrilli, Raffaele


    Acinetobacter baumannii is a globally distributed nosocomial pathogen that has gained interest due to its resistance to most currently used antimicrobials. Whole genome sequencing (WGS) and phylogenetics has begun to reveal the global genetic diversity of this pathogen. The evolution of A. baumannii has largely been defined by recombination, punctuated by the emergence and proliferation of defined clonal lineages. In this study we sequenced seven genomes from the sequence type (ST)25 lineage and compared them to 12 ST25 genomes deposited in public databases. A recombination analysis identified multiple genomic regions that are homoplasious in the ST25 phylogeny, indicating active or historical recombination. Genes associated with antimicrobial resistance were differentially distributed between ST25 genomes, which matched our laboratory-based antimicrobial susceptibility typing. Differences were also observed in biofilm formation between ST25 isolates, which were demonstrated to produce significantly more extensive biofilm than an isolate from the ST1 clonal lineage. These results demonstrate that within A. baumannii, even a fairly recently derived monophyletic lineage can still exhibit significant genotypic and phenotypic diversity. These results have implications for associating outbreaks with sequence typing as well as understanding mechanisms behind the global propagation of successful A. baumannii lineages. PMID:26462752

  7. A fatal case of multidrug resistant acinetobacter necrotizing fasciitis: the changing scary face of nosocomial infection.


    Sinha, Nupur; Niazi, Masooma; Lvovsky, Dmitry


    Necrotizing fasciitis is an uncommon soft-tissue infection, associated with high morbidity and mortality. Early recognition and treatment are crucial for survival. Acinetobacter baumannii is rarely associated with necrotizing fasciitis. Wound infections due to A. baumannii have been described in association with severe trauma in soldiers. There are only sporadic reports of monomicrobial A. baumannii necrotizing fasciitis. We report a unique case of monomicrobial necrotizing fasciitis caused by multidrug resistant (MDR) A. baumannii, in absence of any preceding trauma, surgery, or any obvious breech in the continuity of skin or mucosa. A 48-year-old woman with history of HIV, asthma, hypertension, and tobacco and excocaine use presented with acute respiratory failure requiring mechanical ventilation. She was treated for pneumonia for 7 days and was successfully extubated. All septic work-up was negative. Two days later, she developed rapidly spreading nonblanching edema with bleb formation at the lateral aspect of right thigh. Emergent extensive debridement and fasciotomy were performed. Operative findings and histopathology were consistent with necrotizing fasciitis. Despite extensive debridement, she succumbed to septic shock in the next few hours. Blood, wound, and tissue cultures grew A. baumannii, sensitive only to amikacin and polymyxin. Histopathology was consistent with necrotizing fasciitis. PMID:25349748

  8. The Acinetobacter baumannii Oxymoron: Commensal Hospital Dweller Turned Pan-Drug-Resistant Menace

    PubMed Central

    Roca, Ignasi; Espinal, Paula; Vila-Farrés, Xavier; Vila, Jordi


    During the past few decades Acinetobacter baumannii has evolved from being a commensal dweller of health-care facilities to constitute one of the most annoying pathogens responsible for hospitalary outbreaks and it is currently considered one of the most important nosocomial pathogens. In a prevalence study of infections in intensive care units conducted among 75 countries of the five continents, this microorganism was found to be the fifth most common pathogen. Two main features contribute to the success of A. baumannii: (i) A. baumannii exhibits an outstanding ability to accumulate a great variety of resistance mechanisms acquired by different mechanisms, either mutations or acquisition of genetic elements such as plasmids, integrons, transposons, or resistant islands, making this microorganism multi- or pan-drug-resistant and (ii) The ability to survive in the environment during prolonged periods of time which, combined with its innate resistance to desiccation and disinfectants, makes A. baumannii almost impossible to eradicate from the clinical setting. In addition, its ability to produce biofilm greatly contributes to both persistence and resistance. In this review, the pathogenesis of the infections caused by this microorganism as well as the molecular bases of antibacterial resistance and clinical aspects such as treatment and potential future therapeutic strategies are discussed in depth. PMID:22536199

  9. CspE is Overproduced by Temperature Downshift in the Acinetobacter johnsonii DBP-3.


    Su, Dan; Hao, Linlin; Chen, Fuwang; Li, Siming; Abdelrahman, Ahmed Mohamed; Zhang, Yu; Yu, Hao; Liu, Songcai; Li, Mingtang


    The denitrifying bacterium Acinetobacter johnsonii strain DBP-3 which was capable of removing phosphate, nitrate, and ammoniacal salt is psychrotolerant, whereas, the cold shock response mechanisms or the cold shock proteins (Csps) was unclear. In this article, the optimal growth temperature (25 °C) and cold shock temperature (7.5 °C) were determined firstly by an Arrhenius plot of the growth of the strain DBP-3. Then, among the seven cold shock-like protein genes which were cloned and identified referenced by A. johnsonii SH046 genome, qRT-PCR and shotgun-LTQ mass spectrometry showed that Csp3 and Csp4 were overexpressed under cold shock condition. Furthermore, Western blotting confirmed the result with the antibodies against Csp3 and Csp4 prepared by ourselves. Finally, the phylogenetic analysis showed that the similarity percent between Csp3 and Csp4 was 76.85 %, and Csp3 and Csp4 belonged to CspE family. The results indicated that CspE is overproduced by temperature downshift and may play an important role in the psychrotolerant process of strain DBP-3. PMID:26794214

  10. Crystal Structure of Hcp from Acinetobacter baumannii: A Component of the Type VI Secretion System

    PubMed Central

    Ruiz, Federico M.; Santillana, Elena; Spínola-Amilibia, Mercedes; Torreira, Eva; Culebras, Esther; Romero, Antonio


    The type VI secretion system (T6SS) is a bacterial macromolecular machine widely distributed in Gram-negative bacteria, which transports effector proteins into eukaryotic host cells or other bacteria. Membrane complexes and a central tubular structure, which resembles the tail of contractile bacteriophages, compose the T6SS. One of the proteins forming this tube is the hemolysin co-regulated protein (Hcp), which acts as virulence factor, as transporter of effectors and as a chaperone. In this study, we present the structure of Hcp from Acinetobacter baumannii, together with functional and oligomerization studies. The structure of this protein exhibits a tight β barrel formed by two β sheets and flanked at one side by a short α-helix. Six Hcp molecules associate to form a donut-shaped hexamer, as observed in both the crystal structure and solution. These results emphasize the importance of this oligomerization state in this family of proteins, despite the low similarity of sequence among them. The structure presented in this study is the first one for a protein forming part of a functional T6SS from A. baumannii. These results will help us to understand the mechanism and function of this secretion system in this opportunistic nosocomial pathogen. PMID:26079269

  11. Anthelmintic closantel enhances bacterial killing of polymyxin B against multidrug-resistant Acinetobacter baumannii

    PubMed Central

    Tran, Thien B.; Cheah, Soon-Ee; Yu, Heidi H.; Bergen, Phillip J.; Nation, Roger L.; Creek, Darren J.; Purcell, Anthony; Forrest, Alan; Doi, Yohei; Song, Jiangning; Velkov, Tony; Li, Jian


    Polymyxins, an old class of antibiotics, are currently used as the last resort for the treatment of multidrug-resistant (MDR) Acinetobacter baumannii. However, recent pharmacokinetic and pharmacodynamic data indicate that monotherapy can lead to the development of resistance. Novel approaches are urgently needed to preserve and improve the efficacy of this last-line class of antibiotics. This study examined the antimicrobial activity of novel combination of polymyxin B with anthelmintic closantel against A. baumannii. Closantel monotherapy (16 mg/L) was ineffective against most tested A. baumannii isolates. However, closantel at 4–16 mg/L with a clinically achievable concentration of polymyxin B (2 mg/L) successfully inhibited the development of polymyxin resistance in polymyxin-susceptible isolates, and provided synergistic killing against polymyxin-resistant isolates (MIC ≥4 mg/L). Our findings suggest that the combination of polymyxin B with closantel could be potentially useful for the treatment of MDR, including polymyxin-resistant, A. baumannii infections. The re-positioning of non-antibiotic drugs to treat bacterial infections may significantly expedite discovery of new treatment options for bacterial ‘superbugs’. PMID:26669752

  12. Neutropenia exacerbates infection by Acinetobacter baumannii clinical isolates in a murine wound model

    PubMed Central

    Grguric-Smith, Laryssa M.; Lee, Hiu H.; Gandhi, Jay A.; Brennan, Melissa B.; DeLeon-Rodriguez, Carlos M.; Coelho, Carolina; Han, George; Martinez, Luis R.


    The Gram negative coccobacillus Acinetobacter baumannii has become an increasingly prevalent cause of hospital-acquired infections in recent years. The majority of clinical A. baumannii isolates display high-level resistance to antimicrobials, which severely compromises our capacity to care for patients with A. baumannii disease. Neutrophils are of major importance in the host defense against microbial infections. However, the contribution of these cells of innate immunity in host resistance to cutaneous A. baumannii infection has not been directly investigated. Hence, we hypothesized that depletion of neutrophils increases severity of bacterial disease in an experimental A. baumannii murine wound model. In this study, the Ly-6G-specific monoclonal antibody (mAb), 1A8, was used to generate neutropenic mice and the pathogenesis of several A. baumannii clinical isolates on wounded cutaneous tissue was investigated. We demonstrated that neutrophil depletion enhances bacterial burden using colony forming unit determinations. Also, mAb 1A8 reduces global measurements of wound healing in A. baumannii-infected animals. Interestingly, histological analysis of cutaneous tissue excised from A. baumannii-infected animals treated with mAb 1A8 displays enhanced collagen deposition. Furthermore, neutropenia and A. baumannii infection alter pro-inflammatory cytokine release leading to severe microbial disease. Our findings provide a better understanding of the impact of these innate immune cells in controlling A. baumannii skin infections. PMID:26528277

  13. Sensitivity of cultured pancreatic carcinoma cells to Acinetobacter glutaminase-asparaginase.


    Wu, M C; Arimura, G K; Holcenberg, J S; Yunis, A A


    Cultured human pancreatic carcinoma cells (MIA PaCa-2) have been shown previously to be very sensitive to E. coli L-asparaginase (EC II). The present studies have demonstrated that another enzyme, Acinetobacter glutaminase-asparaginase (AGA) is much more effective in inhibiting cell growth. At the concentration of 0.0025 U/ml of AGA activity the enzyme totally inhibited cell growth, whereas the EC II with the same concentration did not show any effect. The inhibition of cell growth correlated well with inhibition of protein and glycoprotein synthesis. The addition of L-glutamine at the concentration of 1 mM completely reversed the inhibition of protein synthesis. Similarly, the addition of L-glutamine at the concentration of 3 mM daily on 3 successive days after adding AGA resulted in significant reversal of growth inhibition. The results of this study indicate that the action of AGA on MIA PaCa-2 is, to a great extent, exerted through its L-glutaminase activity. PMID:7173949

  14. Differential protection from tobramycin by extracellular polymeric substances from Acinetobacter baumannii and Staphylococcus aureus biofilms.


    Davenport, Emily K; Call, Douglas R; Beyenal, Haluk


    We investigated biofilms of two pathogens, Acinetobacter baumannii and Staphylococcus aureus, to characterize mechanisms by which the extracellular polymeric substance (EPS) found in biofilms can protect bacteria against tobramycin exposure. To do so, it is critical to study EPS-antibiotic interactions in a homogeneous environment without mass transfer limitations. Consequently, we developed a method to grow biofilms, harvest EPS, and then augment planktonic cultures with isolated EPS and tobramycin. We demonstrated that planktonic cultures respond differently to being treated with different types of EPS (A. baumannii versus S. aureus) in the presence of tobramycin. By harvesting EPS from the biofilms, we found that A. baumannii EPS acts as a "universal protector" by inhibiting tobramycin activity against bacterial cells regardless of species; S. aureus EPS did not show any protective ability in cell cultures. Adding Mg(2+) or Ca(2+) reduced the protective effect of A. baumannii EPS. Finally, when we selectively digested the proteins or DNA of the EPS, we found that the protective ability did not change, suggesting that neither has a significant role in protection. To the best of our knowledge, this is the first study that demonstrates how EPS protects pathogens against antibiotics in a homogeneous system without mass transfer limitations. Our results suggest that EPS protects biofilm communities, in part, by adsorbing antibiotics near the surface. This may limit antibiotic diffusion to the bottom of the biofilms but is not likely to be the only mechanism of protection. PMID:24913166

  15. Differential Protection from Tobramycin by Extracellular Polymeric Substances from Acinetobacter baumannii and Staphylococcus aureus Biofilms

    PubMed Central

    Davenport, Emily K.; Call, Douglas R.


    We investigated biofilms of two pathogens, Acinetobacter baumannii and Staphylococcus aureus, to characterize mechanisms by which the extracellular polymeric substance (EPS) found in biofilms can protect bacteria against tobramycin exposure. To do so, it is critical to study EPS-antibiotic interactions in a homogeneous environment without mass transfer limitations. Consequently, we developed a method to grow biofilms, harvest EPS, and then augment planktonic cultures with isolated EPS and tobramycin. We demonstrated that planktonic cultures respond differently to being treated with different types of EPS (A. baumannii versus S. aureus) in the presence of tobramycin. By harvesting EPS from the biofilms, we found that A. baumannii EPS acts as a “universal protector” by inhibiting tobramycin activity against bacterial cells regardless of species; S. aureus EPS did not show any protective ability in cell cultures. Adding Mg2+ or Ca2+ reduced the protective effect of A. baumannii EPS. Finally, when we selectively digested the proteins or DNA of the EPS, we found that the protective ability did not change, suggesting that neither has a significant role in protection. To the best of our knowledge, this is the first study that demonstrates how EPS protects pathogens against antibiotics in a homogeneous system without mass transfer limitations. Our results suggest that EPS protects biofilm communities, in part, by adsorbing antibiotics near the surface. This may limit antibiotic diffusion to the bottom of the biofilms but is not likely to be the only mechanism of protection. PMID:24913166

  16. Clinical Use of Colistin Induces Cross-Resistance to Host Antimicrobials in Acinetobacter baumannii

    PubMed Central

    Napier, Brooke A.; Burd, Eileen M.; Satola, Sarah W.; Cagle, Stephanie M.; Ray, Susan M.; McGann, Patrick; Pohl, Jan; Lesho, Emil P.; Weiss, David S.


    ABSTRACT The alarming rise in antibiotic resistance has led to an increase in patient mortality and health care costs. This problem is compounded by the absence of new antibiotics close to regulatory approval. Acinetobacter baumannii is a human pathogen that causes infections primarily in patients in intensive care units (ICUs) and is highly antibiotic resistant. Colistin is one of the last-line antibiotics for treating A. baumannii infections; however, colistin-resistant strains are becoming increasingly common. This cationic antibiotic attacks negatively charged bacterial membranes in a manner similar to that seen with cationic antimicrobials of the innate immune system. We therefore set out to determine if the increasing use of colistin, and emergence of colistin-resistant strains, is concomitant with the generation of cross-resistance to host cationic antimicrobials. We found that there is indeed a positive correlation between resistance to colistin and resistance to the host antimicrobials LL-37 and lysozyme among clinical isolates. Importantly, isolates obtained before and after treatment of individual patients demonstrated that colistin use correlated with increased resistance to cationic host antimicrobials. These data reveal the overlooked risk of inducing cross-resistance to host antimicrobials when treating patients with colistin as a last-line antibiotic. PMID:23695834

  17. Purification and characterization of catalase from marine bacterium Acinetobacter sp. YS0810.


    Fu, Xinhua; Wang, Wei; Hao, Jianhua; Zhu, Xianglin; Sun, Mi


    The catalase from marine bacterium Acinetobacter sp. YS0810 (YS0810CAT) was purified and characterized. Consecutive steps were used to achieve the purified enzyme as follows: ethanol precipitation, DEAE Sepharose ion exchange, Superdex 200 gel filtration, and Resource Q ion exchange. The active enzyme consisted of four identical subunits of 57.256 kDa. It showed a Soret peak at 405 nm, indicating the presence of iron protoporphyrin IX. The catalase was not apparently reduced by sodium dithionite but was inhibited by 3-amino-1,2,4-triazole, hydroxylamine hydrochloride, and sodium azide. Peroxidase-like activity was not found with the substrate o-phenylenediamine. So the catalase was determined to be a monofunctional catalase. N-terminal amino acid of the catalase analysis gave the sequence SQDPKKCPVTHLTTE, which showed high degree of homology with those of known catalases from bacteria. The analysis of amino acid sequence of the purified catalase by matrix-assisted laser desorption ionization time-of-flight mass spectrometry showed that it was a new catalase, in spite of its high homology with those of known catalases from other bacteria. The catalase showed high alkali stability and thermostability. PMID:25045672

  18. Higher Isolation of NDM-1 Producing Acinetobacter baumannii from the Sewage of the Hospitals in Beijing

    PubMed Central

    Cui, Jiajun; Wang, Pan; Huang, Liuyu; Klena, John D.; Song, Hongbin


    Multidrug resistant microbes present in the environment are a potential public health risk. In this study, we investigate the presence of New Delhi metallo-β-lactamase 1 (NDM-1) producing bacteria in the 99 water samples in Beijing City, including river water, treated drinking water, raw water samples from the pools and sewage from 4 comprehensive hospitals. For the blaNDM-1 positive isolate, antimicrobial susceptibility testing was further analyzed, and Pulsed Field Gel Electrophoresis (PFGE) was performed to determine the genetic relationship among the NDM-1 producing isolates from sewage and human, as well as the clinical strains without NDM-1. The results indicate that there was a higher isolation of NDM-1 producing Acinetobacter baumannii from the sewage of the hospitals, while no NDM-1 producing isolates were recovered from samples obtained from the river, drinking, or fishpond water. Surprisingly, these isolates were markedly different from the clinical isolates in drug resistance and pulsed field gel electrophoresis profiles, suggesting different evolutionary relationships. Our results showed that the hospital sewage may be one of the diffusion reservoirs of NDM-1 producing bacteria. PMID:23755152

  19. Biotechnological tools to improve bioremediation of phenol by Acinetobacter sp. RTE1.4.


    Paisio, Cintia E; Talano, Melina A; González, Paola S; Magallanes-Noguera, Cynthia; Kurina-Sanz, Marcela; Agostini, Elizabeth


    The use of native bacteria is a useful strategy to decontaminate industrial effluents as well as the environment. Acinetobacter sp. RTE1.4 was previously isolated from polluted environments and constitutes a promising alternative for this purpose due to its capability to remove phenol from synthetic solutions and industrial effluents. In this work, this strain was identified at species level as A. tandoii RTE1.4. Phenol degradation pathway was studied and some reaction intermediates were detected, confirming that this strain degraded phenol through ortho-cleavage of the aromatic ring. Phenol removal assays were carried out in a stirred tank bioreactor and a complete degradation of the contaminant was achieved after only 7 h, at an aeration rate of 3 vvm and at agitation of 600 rpm. Moreover, this bacterium was immobilized into calcium alginate beads and an increase in phenol biodegradation with respect to free cells was observed. The immobilized cells were reused for four consecutive cycles and stored at 4°C for 9 months, during which phenol removal efficiency was maintained. Post-removal solutions were evaluated by Microtox® test, showing a toxicity reduction after bacterial treatment. These findings demonstrated that A. tandoii RTE1.4 might be considered as a useful biotechnological tool for an efficient treatment of different solutions contaminated with phenol in bioreactors, using either free or immobilized cells. PMID:26853946

  20. Isotherm kinetics of Cr(III) removal by non-viable cells of Acinetobacter haemolyticus.


    Yahya, Siti Khairunnisa; Zakaria, Zainul Akmar; Samin, Jefri; Raj, A S Santhana; Ahmad, Wan Azlina


    The potential use of non-viable biomass of a Gram negative bacterium i.e. Acinetobacter haemolyticus to remove Cr(III) species from aqueous environment was investigated. Highest Cr(III) removal of 198.80 mg g(-1) was obtained at pH 5, biomass dosage of 15 mg cell dry weight, initial Cr(III) of 100 mg L(-1) and 30 min of contact time. The Langmuir and Freundlich models fit the experimental data (R(2)>0.95) while the kinetic data was best described using the pseudo second-order kinetic model (R(2)>0.99). Cr(III) was successfully recovered from the bacterial biomass using either 1M of CH(3)COOH, HNO(3) or H(2)SO(4) with 90% recovery. TEM and FTIR suggested the involvement of amine, carboxyl, hydroxyl and phosphate groups during the biosorption of Cr(III) onto the cell surface of A. haemolyticus. A. haemolyticus was also capable to remove 79.87 mg g(-1) Cr(III) (around 22.75%) from raw leather tanning wastewater. This study demonstrates the potential of using A. haemolyticus as biosorbent to remove Cr(III) from both synthetic and industrial wastewater. PMID:22398363

  1. The Genetic Analysis of an Acinetobacter johnsonii Clinical Strain Evidenced the Presence of Horizontal Genetic Transfer

    PubMed Central

    Montaña, Sabrina; Schramm, Sareda T. J.; Traglia, German Matías; Chiem, Kevin; Parmeciano Di Noto, Gisela; Almuzara, Marisa; Barberis, Claudia; Vay, Carlos; Quiroga, Cecilia; Tolmasky, Marcelo E.; Iriarte, Andrés; Ramírez, María Soledad


    Acinetobacter johnsonii rarely causes human infections. While most A. johnsonii isolates are susceptible to virtually all antibiotics, strains harboring a variety of β-lactamases have recently been described. An A. johnsonii Aj2199 clinical strain recovered from a hospital in Buenos Aires produces PER-2 and OXA-58. We decided to delve into its genome by obtaining the whole genome sequence of the Aj2199 strain. Genome comparison studies on Aj2199 revealed 240 unique genes and a close relation to strain WJ10621, isolated from the urine of a patient in China. Genomic analysis showed evidence of horizontal genetic transfer (HGT) events. Forty-five insertion sequences and two intact prophages were found in addition to several resistance determinants such as blaPER-2, blaOXA-58, blaTEM-1, strA, strB, ereA, sul1, aacC2 and a new variant of blaOXA-211, called blaOXA-498. In particular, blaPER-2 and blaTEM-1 are present within the typical contexts previously described in the Enterobacteriaceae family. These results suggest that A. johnsonii actively acquires exogenous DNA from other bacterial species and concomitantly becomes a reservoir of resistance genes. PMID:27548264

  2. Screening of antibiotics resistance to Enterobacteriaceae, Pseudomonas aeruginosa, and Acinetobacter baumannii by an advanced expert system.


    Nakamura, Tatsuya; Takahashi, Hakuo


    The VITEK2 advanced expert system (AES) gives information about the antibiotics-resistance mechanisms based on the biological validation derived from the VITEK2 susceptibility result. In this study, we investigated whether or not this system correctly categorized the beta-lactamase resistance mechanism data derived from the VITEK2 susceptibility result using the testing card, AST-N025, with Enterobacteriaceae, Pseudomonas aeruginosa, and Acinetobacter baumannii. We used 131 strains, and their phenotypes were determined according to the biological and genetic screening. The AES analysis result matched the phenotype testing in 120 (91.6%) of the 131 strains. Incorrect findings were found in six strains, including three strains of Serratia marcescens. The resistance mechanism could not be determined in five strains, including three strains of Providencia rettgeri. The analysis of those phenotypes agreed in 34 (97.1%) among 35 strains with extended spectrum beta-lactamase (ESBL), and in 27 (96.4%) among 28 strains with high-level cephalosporinase. The agreement ratio in the phenotype was very high as we expected. The incorrect and nondeterminable samples were strains with relatively high cephalosporinase that has variation of outer membrane protein. The AES was able to detect the phenotype for carbapenemase. The AES is a clinically useful system that allows taking prompt measures to treat patients because it can provide information about the resistance mechanism in less than half a day after starting the analysis. PMID:16369735

  3. Acinetobacter baumannii Virulence Is Mediated by the Concerted Action of Three Phospholipases D

    PubMed Central

    Stahl, Julia; Bergmann, Holger; Göttig, Stephan; Ebersberger, Ingo; Averhoff, Beate


    Acinetobacter baumannii causes a broad range of opportunistic infections in humans. Its success as an emerging pathogen is due to a combination of increasing antibiotic resistance, environmental persistence and adaptation to the human host. To date very little is known about the molecular basis of the latter. Here we demonstrate that A. baumannii can use phosphatidylcholine, an integral part of human cell membranes, as sole carbon and energy source. We report on the identification of three phospholipases belonging to the PLD superfamily. PLD1 and PLD2 appear restricted to the bacteria and display the general features of bacterial phospholipases D. They possess two PLDc_2 PFAM domains each encompassing the HxKx4Dx6GS/GGxN (HKD) motif necessary for forming the catalytic core. The third candidate, PLD3, is found in bacteria as well as in eukaryotes and harbours only one PLDc_2 PFAM domain and one conserved HKD motif, which however do not overlap. Employing a markerless mutagenesis system for A. baumannii ATCC 19606T, we generated a full set of PLD knock-out mutants. Galleria mellonella infection studies as well as invasion experiments using A549 human lung epithelial cells revealed that the three PLDs act in a concerted manner as virulence factors and are playing an important role in host cell invasion. PMID:26379240

  4. The contribution of nutrient metal acquisition and metabolism to Acinetobacter baumannii survival within the host

    PubMed Central

    Mortensen, Brittany L.; Skaar, Eric P.


    Acinetobacter baumannii is a significant contributor to intensive care unit (ICU) mortality causing numerous types of infection in this susceptible ICU population, most notably ventilator-associated pneumonia. The substantial disease burden attributed to A. baumannii and the rapid acquisition of antibiotic resistance make this bacterium a serious health care threat. A. baumannii is equipped to tolerate the hostile host environment through modification of its metabolism and nutritional needs. Among these adaptations is the evolution of mechanisms to acquire nutrient metals that are sequestered by the host as a defense against infection. Although all bacteria require nutrient metals, there is diversity in the particular metal needs among species and within varying tissue types and bacterial lifecycles. A. baumannii is well-equipped with the metal homeostatic systems required for the colonization of a diverse array of tissues. Specifically, iron and zinc homeostasis is important for A. baumannii interactions with biotic surfaces and for growth within vertebrates. This review discusses what is currently known regarding the interaction of A. baumannii with vertebrate cells with a particular emphasis on the contributions of metal homeostasis systems. Overall, published research supports the utility of exploiting these systems as targets for the development of much-needed antimicrobials against this emerging infectious threat. PMID:24377089

  5. Joint Transcriptional Control of Virulence and Resistance to Antibiotic and Environmental Stress in Acinetobacter baumannii

    PubMed Central

    Gallagher, Larry A.; Jacobson, Rachael K.; Usacheva, Elena A.; Peterson, Lance R.; Zurawski, Daniel V.; Shuman, Howard A.


    ABSTRACT The increasing emergence of antibiotic-resistant bacterial pathogens represents a serious risk to human health and the entire health care system. Many currently circulating strains of Acinetobacter baumannii exhibit resistance to multiple antibiotics. A key limitation in combating A. baumannii is that our understanding of the molecular mechanisms underlying the pathogenesis of A. baumannii is lacking. To identify potential virulence determinants of a contemporary multidrug-resistant isolate of A. baumannii, we used transposon insertion sequencing (TnSeq) of strain AB5075. A collection of 250,000 A. baumannii transposon mutants was analyzed for growth within Galleria mellonella larvae, an insect-based infection model. The screen identified 300 genes that were specifically required for survival and/or growth of A. baumannii inside G. mellonella larvae. These genes encompass both known, established virulence factors and several novel genes. Among these were more than 30 transcription factors required for growth in G. mellonella. A subset of the transcription factors was also found to be required for resistance to antibiotics and environmental stress. This work thus establishes a novel connection between virulence and resistance to both antibiotics and environmental stress in A. baumannii. PMID:26556274

  6. Synergistic Effects and Antibiofilm Properties of Chimeric Peptides against Multidrug-Resistant Acinetobacter baumannii Strains

    PubMed Central

    Gopal, Ramamourthy; Kim, Young Gwon; Lee, Jun Ho; Lee, Seog Ki; Chae, Jeong Don; Son, Byoung Kwan; Seo, Chang Ho


    The increasing prevalence of drug-resistant pathogens highlights the need to identify novel antibiotics. Here we investigated the efficacies of four new antimicrobial peptides (AMPs) for potential drug development. The antibacterial activities, synergistic effects, and antibiofilm properties of the four chimeric AMPs were tested against Acinetobacter baumannii, an emerging Gram-negative, nosocomial, drug-resistant pathogen. Nineteen A. baumannii strains resistant to ampicillin, cefotaxime, ciprofloxacin, tobramycin, and erythromycin were isolated at a hospital from patients with cholelithiasis. All four peptides exhibited significant antibacterial effects (MIC = 3.12 to 12.5 μM) against all 19 strains, whereas five commercial antibiotics showed little or no activity against the same pathogens. An exception was polymyxin, which was effective against all of the strains tested. Each of the peptides showed synergy against one or more strains when administered in combination with cefotaxime, ciprofloxacin, or erythromycin. The peptides also exhibited an ability to prevent biofilm formation, which was not seen with cefotaxime, ciprofloxacin, or erythromycin, though polymyxin also inhibited biofilm formation. Indeed, when administered in combination with ciprofloxacin, the AMP HPMA exerted a potent synergistic effect against A. baumannii biofilm formation. Collectively, our findings indicate that the AMPs tested have no cytotoxicity but possess potent antibacterial and antibiofilm activities and may act synergistically with commercial antibiotics. PMID:24366740

  7. Treatment of multidrug-resistant Acinetobacter baumannii meningitis with ampicillin/sulbactam.


    Jiménez-Mejías, M E; Pachón, J; Becerril, B; Palomino-Nicás, J; Rodríguez-Cobacho, A; Revuelta, M


    The clinical features and the outcomes of eight cases of nosocomial Acinetobacter baumannii meningitis treated with ampicillin/sulbactam are reported. All the patients had fever, neck stiffness or meningeal signs, and a low consciousness level, and in their cerebrospinal fluid (CSF), pleocytosis, a low glucose level, and an elevated protein level were noted. For all CSF isolates of A. baumannii, the MIC of ampicillin/sulbactam was < or = 8/4 microg/mL. The MICs of sulbactam by microdilution in two cases were 4 microg/mL. All isolates were resistant to cefotaxime, ceftriaxone, ceftazidime, ureidopenicillins, ciprofloxacin, and gentamicin. Seven isolates were resistant to imipenem. A. baumannii was isolated from other samples in seven episodes. All patients were treated with ampicillin/sulbactam (seven with 2 g/l g every 6 hours and one with 2 g/l g every 8 hours). Six patients were cured and two patients died of meningitis. There were no side effects with the ampicillin/sulbactam treatment. In conclusion, ampicillin/sulbactam may be effective as therapy for meningitis caused by A. baumanii resistant to imipenem and other beta-lactam drugs. PMID:9142795

  8. Activity of Gallium Meso- and Protoporphyrin IX against Biofilms of Multidrug-Resistant Acinetobacter baumannii Isolates

    PubMed Central

    Chang, David; Garcia, Rebecca A.; Akers, Kevin S.; Mende, Katrin; Murray, Clinton K.; Wenke, Joseph C.; Sanchez, Carlos J.


    Acinetobacter baumannii is a challenging pathogen due to antimicrobial resistance and biofilm development. The role of iron in bacterial physiology has prompted the evaluation of iron-modulation as an antimicrobial strategy. The non-reducible iron analog gallium(III) nitrate, Ga(NO3)3, has been shown to inhibit A. baumannii planktonic growth; however, utilization of heme-iron by clinical isolates has been associated with development of tolerance. These observations prompted the evaluation of iron-heme sources on planktonic and biofilm growth, as well as antimicrobial activities of gallium meso- and protoporphyrin IX (Ga-MPIX and Ga-PPIX), metal heme derivatives against planktonic and biofilm bacteria of multidrug-resistant (MDR) clinical isolates of A. baumannii in vitro. Ga(NO3)3 was moderately effective at reducing planktonic bacteria (64 to 128 µM) with little activity against biofilms (≥512 µM). In contrast, Ga-MPIX and Ga-PPIX were highly active against planktonic bacteria (0.25 to 8 µM). Cytotoxic effects in human fibroblasts were observed following exposure to concentrations exceeding 128 µM of Ga-MPIX and Ga-PPIX. We observed that the gallium metal heme conjugates were more active against planktonic and biofilm bacteria, possibly due to utilization of heme-iron as demonstrated by the enhanced effects on bacterial growth and biofilm formation. PMID:26999163

  9. Combination therapy with polymyxin B and netropsin against clinical isolates of multidrug-resistant Acinetobacter baumannii.


    Chung, Joon-Hui; Bhat, Abhayprasad; Kim, Chang-Jin; Yong, Dongeun; Ryu, Choong-Min


    Polymyxins are last-resort antibiotics for treating infections of Gram-negative bacteria. The recent emergence of polymyxin-resistant bacteria, however, urgently demands clinical optimisation of polymyxin use to minimise further evolution of resistance. In this study we developed a novel combination therapy using minimal concentrations of polymyxin B. After large-scale screening of Streptomyces secondary metabolites, we identified a reliable polymixin synergist and confirmed as netropsin using high-pressure liquid chromatography, nuclear magnetic resonance, and mass spectrometry followed by in vitro assays using various Gram-negative pathogenic bacteria. To evaluate the effectiveness of combining polymixin B and netropsin in vivo, we performed survival analysis on greater wax moth Galleria mellonella infected with colistin-resistant clinical Acinetobacter baumannii isolates as well as Escherichia coli, Shigella flexineri, Salmonella typhimuruim, and Pseudomonas aeruginosa. The survival of infected G. mellonella was significantly higher when treated with polymyxin B and netropsin in combination than when treated with polymyxin B or netropsin alone. We propose a netropsin combination therapy that minimises the use of polymyxin B when treating infections with multidrug resistant Gram-negative bacteria. PMID:27306928

  10. Impact of Acinetobacter baumannii Superoxide Dismutase on Motility, Virulence, Oxidative Stress Resistance and Susceptibility to Antibiotics

    PubMed Central

    Heider, Christine; Skiebe, Evelyn; Wilharm, Gottfried


    Acinetobacter baumannii is a Gram-negative bacterium appearing as an opportunistic pathogen in hospital settings. Superoxide dismutase (SOD) contributes to virulence in several pathogenic bacteria by detoxifying reactive oxygen species released in the course of host defense reactions. However, the biological role of SODs in A. baumannii has not yet been elucidated. Here, we inactivated in A. baumannii ATCC 17978 gene A1S_2343, encoding a putative SOD of the Fe-Mn type by transposon insertion, resulting in mutant ATCC 17978 sod2343::Km. The mutation was also introduced in two naturally competent A. baumannii isolates by transformation with chromosomal DNA derived from mutant ATCC 17978 sod2343::Km. We demonstrate that inactivation of sod2343 leads to significant motility defects in all three A. baumannii strains. The mutant strains were more susceptible to oxidative stress compared to their parental strains. Susceptibility to colistin and tetracycline was increased in all mutant strains while susceptibility of the mutants to gentamicin, levofloxacin and imipenem was strain-dependent. In the Galleria mellonella infection model the mutant strains were significantly attenuated. In conclusion, sod2343 plays an important role in motility, resistance to oxidative stress, susceptibility to antibiotics and virulence in A. baumannii. PMID:25000585

  11. Enhanced Efficacy of Combinations of Pexiganan with Colistin Versus Acinetobacter Baumannii in Experimental Sepsis.


    Cirioni, Oscar; Simonetti, Oriana; Pierpaoli, Elisa; Barucca, Alessandra; Ghiselli, Roberto; Orlando, Fiorenza; Pelloni, Maria; Minardi, Daniele; Trombettoni, Maria Michela Cappelletti; Guerrieri, Mario; Offidani, Annamaria; Giacometti, Andrea; Provinciali, Mauro


    We investigated the efficacy of colistin combined with pexiganan in experimental mouse models of Acinetobacter baumannii infection.Adult male BALB/c mice received intraperitoneally 1 mL saline containing 2 × 10 CFU of susceptible and multiresistant A. baumannii. Two hours after bacterial challenge, animals received 1 mg/kg of colistin, 1 mg/kg of pexiganan, or 1 mg/kg of colistin plus 1 mg/kg of pexiganan.Blood culture positivity, the quantities of bacteria in the intra-abdominal fluid, the rate of lethality and immunological studies, such as immunophenotyping and NK cytotoxicity, were evaluated.In the in vitro study, A. baumannii showed susceptibility to colistin and pexiganan and a strong synergy was observed by testing colistin combined with pexiganan with fractionary inhibitory concentration index of 0.312 for both strains.In the in vivo study colistin or pexiganan alone showed a good antimicrobial efficacy. When colistin was combined with pexiganan, the positive interaction produced low bacterial counts that were statistically significant versus singly treated groups. For both strains the highest rate of survival was observed in combined-treated groups (90%).Pexiganan increased NK cytotoxic activity over the levels of infected and colistin-treated animals.In conclusion, pexiganan combined with colistin was found to be efficacious against A. baumannii infection. PMID:26849630

  12. Cloning and characterization of two catA genes in Acinetobacter lwoffii K24.


    Kim, S I; Leem, S H; Choi, J S; Chung, Y H; Kim, S; Park, Y M; Park, Y K; Lee, Y N; Ha, K S


    Two novel type I catechol 1,2-dioxygenases inducible on aniline media were isolated from Acinetobacter lwoffii K24. Although the two purified enzymes, CD I1 and CD I2, had similar intradiol cleavage activities, they showed different substrate specificities for catechol analogs, physicochemical properties, and amino acid sequences. Two catA genes, catA1 and catA2, encoding by CD I1 and CD I2, respectively, were isolated from the A. lwoffii K24 genomic library by using colony hybridization and PCR. Two DNA fragments containing the catA1 and catA2 genes were located on separate regions of the chromosome. They contained open reading frames encoding 33.4- and 30.4-kDa proteins. The amino acid sequences of the two proteins matched well with previously determined sequences. Interestingly, further analysis of the two DNA fragments revealed the locations of the catB and catC genes as well. Moreover, the DNA fragment containing catA1 had a cluster of genes in the order catB1-catC1-catA1 while the catB2-catA2-catC2 arrangement was found in the catA2 DNA fragment. These results may provide an explanation of the different substrate specificities and physicochemical properties of CD I1 and CD I2. PMID:9260969

  13. Outbreak of multiresistant OXA-24- and OXA-51-producing Acinetobacter baumannii in an internal medicine ward.


    Tena, Daniel; Martínez, Nora Mariela; Oteo, Jesús; Sáez, David; Vindel, Ana; Azañedo, María Luisa; Sánchez, Lorenzo; Espinosa, Alfredo; Cobos, Juan; Sánchez, Rosario; Otero, Ignacio; Bisquert, Julia


    Here we describe the clinical, microbiological, epidemiological, and molecular characterization of an outbreak of multidrug-resistant Acinetobacter baumannii (MRAB) involving 5 patients admitted to the internal medicine ward of our hospital. Over a 6-week period, 5 MRAB isolates were recovered from 5 patients, including 1 with fatal meningitis, 3 with skin and soft tissue infections, and 1 with respiratory colonization. One sample obtained during environmental monitoring in the ward was A. baumannii-positive. According to the pulsed-field gel electrophoresis typing results, the strains isolated from all patients and the environmental sample belonged to a single clone, identified as ST79 by multilocus sequence typing. The blaOXA-24 and blaOXA-51 carbapenemases were detected in all isolates. Four patients died, but only the death of the meningitis patient was probably related to the A. baumannii infection. The infection source was probably the hands of the healthcare workers because the outbreak strain was isolated from the surface of a serum container. The results of the present study revealed the importance of strict adherence to control measures by all healthcare workers because the consequences of noncompliance can be very serious. PMID:23883845

  14. Endogenous hydrogen peroxide increases biofilm formation by inducing exopolysaccharide production in Acinetobacter oleivorans DR1

    PubMed Central

    Jang, In-Ae; Kim, Jisun; Park, Woojun


    In this study, we investigated differentially expressed proteins in Acinetobacter oleivorans cells during planktonic and biofilm growth by using 2-dimensional gel electrophoresis combined with matrix-assisted laser desorption time-of-flight mass spectrometry. We focused on the role of oxidative stress resistance during biofilm formation using mutants defective in alkyl hydroperoxide reductase (AhpC) because its production in aged biofilms was enhanced compared to that in planktonic cells. Results obtained using an ahpC promoter-gfp reporter vector showed that aged biofilms expressed higher ahpC levels than planktonic cells at 48 h. However, at 24 h, ahpC expression was higher in planktonic cells than in biofilms. Deletion of ahpC led to a severe growth defect in rich media that was not observed in minimal media and promoted early biofilm formation through increased production of exopolysaccharide (EPS) and EPS gene expression. Increased endogenous H2O2 production in the ahpC mutant in rich media enhanced biofilm formation, and this enhancement was not observed in the presence of antioxidants. Exogenous addition of H2O2 promoted biofilm formation in wild type cells, which suggested that biofilm development is linked to defense against H2O2. Collectively, our data showed that EPS production caused by H2O2 stress enhances biofilm formation in A. oleivorans. PMID:26884212

  15. Emergence of multidrug-resistant Acinetobacter baumannii producing OXA-23 Carbapenemase in Qatar.


    Rolain, J-M; Loucif, L; Al-Maslamani, M; Elmagboul, E; Al-Ansari, N; Taj-Aldeen, S; Shaukat, A; Ahmedullah, H; Hamed, M


    The objective of our study was to describe the molecular support of carbapenem resistance from randomly selected clinical isolates of multidrug-resistant (MDR) Acinetobacter baumannii as a pilot study from the Hamad Medical Corporation (HMC), Qatar. Results of our report will be used to study carbapenemases using molecular techniques in all isolated MDR A. baumannii. Forty-eight MDR A. baumannii were randomly selected from isolates preserved at HMC. Identification of all isolates was confirmed by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. Antibiotic resistance was tested phenotypically by Phoenix and confirmed by Etest. The molecular support of carbapenemases (bla OXA-23, bla OXA-24, bla OXA-58, bla NDM) was investigated by real-time PCR. The epidemiologic relatedness of the isolates was verified by phylogenetic analysis based on partial sequences of CsuE and bla OXA-51 genes. All 48 isolates were identified as A. baumannii and were confirmed to be resistant to most antibiotics, especially meropenem, imipenems, ciprofloxacin, levofloxacin, amikacin, gentamicin and most of the β-lactams; they were sensitive to colistin. All the isolates were positive for bla OXA-23 and negative for the other tested carbapenemase genes. Clonality analysis demonstrated that different lineages were actually circulating in Qatar; and we suggest that an outbreak occurred in the medical intensive care unit of HMC between 2011 and 2012. Here we report the emergence of MDR A. baumannii producing the carbapenemase OXA-23 in Qatar. PMID:27054039

  16. Identification of novel vaccine candidates against Acinetobacter baumannii using reverse vaccinology

    PubMed Central

    Chiang, Ming-Hsien; Sung, Wang-Chou; Lien, Shu-Pei; Chen, Ying-Zih; Lo, Annie Fei-yun; Huang, Jui-Hsin; Kuo, Shu-Chen; Chong, Pele


    Acinetobacter baumannii (Ab) is a global emerging bacterium causing nosocomial infections such as pneumonia, meningitis, bacteremia and soft tissue infections especially in intensive care units. Since Ab is resistant to almost all conventional antibiotics, it is now one of the 6 top-priorities of the dangerous microorganisms listed by the Infectious Disease Society of America. The development of vaccine is one of the most promising and cost-effective strategies to prevent infections. In this study, we identified potential protective vaccine candidates using reverse vaccinology. We have analyzed 14 on-line available Ab genome sequences and found 2752 homologous core genes. Using information obtained from immuno-proteomic experiments, published proteomic information and the bioinformatics PSORTb v3.0 software to predict the location of extracellular and/or outer membrane proteins, 77 genes were identified and selected for further studies. After excluding those antigens have been used as vaccine candidates reported by the in silico search-engines of PubMed and Google Scholar, 13 proteins could potentially be vaccine candidates. We have selected and cloned the genes of 3 antigens that were further expressed and purified. These antigens were found to be highly immunogenic and conferred partial protection (60%) in a pneumonia animal model. The strategy described in the present study incorporates the advantages of reverse vaccinology, bioinformatics and immuno-proteomic platform technologies and is easy to perform to identify novel immunogens for multi-component vaccines development. PMID:25751377

  17. Efficacy of Artilysin Art-175 against Resistant and Persistent Acinetobacter baumannii.


    Defraine, Valerie; Schuermans, Joris; Grymonprez, Barbara; Govers, Sander K; Aertsen, Abram; Fauvart, Maarten; Michiels, Jan; Lavigne, Rob; Briers, Yves


    Bacteriophage-encoded endolysins have shown promise as a novel class of antibacterials with a unique mode of action, i.e., peptidoglycan degradation. However, Gram-negative pathogens are generally not susceptible due to their protective outer membrane. Artilysins overcome this barrier. Artilysins are optimized, engineered fusions of selected endolysins with specific outer membrane-destabilizing peptides. Artilysin Art-175 comprises a modified variant of endolysin KZ144 with an N-terminal fusion to SMAP-29. Previously, we have shown the high susceptibility of Pseudomonas aeruginosa to Art-175. Here, we report that Art-175 is highly bactericidal against stationary-phase cells of multidrug-resistant Acinetobacter baumannii, even resulting in a complete elimination of large inocula (≥10(8) CFU/ml). Besides actively dividing cells, Art-175 also kills persisters. Instantaneous killing of A. baumannii upon contact with Art-175 could be visualized after immobilization of the bacteria in a microfluidic flow cell. Effective killing of a cell takes place through osmotic lysis after peptidoglycan degradation. The killing rate is enhanced by the addition of 0.5 mM EDTA. No development of resistance to Art-175 under selection pressure and no cross-resistance with existing resistance mechanisms could be observed. In conclusion, Art-175 represents a highly active Artilysin against both A. baumannii and P. aeruginosa, two of the most life-threatening pathogens of the order Pseudomonadales. PMID:27021321

  18. The induction and identification of novel Colistin resistance mutations in Acinetobacter baumannii and their implications

    PubMed Central

    Thi Khanh Nhu, Nguyen; Riordan, David W.; Do Hoang Nhu, Tran; Thanh, Duy Pham; Thwaites, Guy; Huong Lan, Nguyen Phu; Wren, Brendan W.; Baker, Stephen; Stabler, Richard A


    Acinetobacter baumannii is a significant cause of opportunistic hospital acquired infection and has been identified as an important emerging infection due to its high levels of antimicrobial resistance. Multidrug resistant A. baumannii has risen rapidly in Vietnam, where colistin is becoming the drug of last resort for many infections. In this study we generated spontaneous colistin resistant progeny (up to >256 μg/μl) from four colistin susceptible Vietnamese isolates and one susceptible reference strain (MIC <1.5 μg/μl). Whole genome sequencing was used to identify single nucleotide mutations that could be attributed to the reduced colistin susceptibility. We identified six lpxACD and three pmrB mutations, the majority of which were novel. In addition, we identified further mutations in six A. baumannii genes (vacJ, pldA, ttg2C, pheS and conserved hypothetical protein) that we hypothesise have a role in reduced colistin susceptibility. This study has identified additional mutations that may be associated with colistin resistance through novel resistance mechanisms. Our work further demonstrates how rapidly A. baumannii can generate resistance to a last resort antimicrobial and highlights the need for improved surveillance to identified A. baumannii with an extensive drug resistance profile. PMID:27329501

  19. The First Outbreak Caused by Acinetobacter baumannii ST208 and ST195 in China

    PubMed Central

    Qu, Junyan; Du, Yu


    This study aimed to analyze the clinical characteristics of patients and molecular mechanisms of the first outbreak mainly caused by sequence types (STs) 208 multidrug resistant (MDR) Acinetobacter baumannii in China. A total of 10 clinical samples were collected from 5 patients who were involved in the outbreak. Bacterial identification and antibiotic sensitivity tests were performed by the VITEK-2 COMPACT automated system. MICs of tigecycline for clinical isolates were determined using broth microdilution. The clonal relatedness of A. baumannii clinical isolates in our local settings was determinated by pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing (MLST). A total of 7 A. baumannii strains were isolated and all were MDR strains; two of them were carbapenem-nonsusceptible strains. blaOXA-23 was the only acquired carbapenemase gene in the isolates. The isolates belonged to a single clonal pulsotype determined by PFGE and two sequences types (STs) determined by MLST. The isolates belonged to the globally disseminated clonal complex 92, among which ST195 and ST208 were the most common sequence types (71.43% and 28.57%). The outbreak was successfully controlled by stringent infection control measures, especially improving the hand hygiene compliance and enhancing antimicrobial stewardship. In conclusion, this is the first description of an outbreak caused mainly by A. baumannii of ST208 in China. Infection control measures should be strengthened when infection outbreaks in hospital. PMID:27144176

  20. Colistin Resistance in Acinetobacter baumannii Is Mediated by Complete Loss of Lipopolysaccharide Production ▿

    PubMed Central

    Moffatt, Jennifer H.; Harper, Marina; Harrison, Paul; Hale, John D. F.; Vinogradov, Evgeny; Seemann, Torsten; Henry, Rebekah; Crane, Bethany; St. Michael, Frank; Cox, Andrew D.; Adler, Ben; Nation, Roger L.; Li, Jian; Boyce, John D.


    Infections caused by multidrug-resistant (MDR) Gram-negative bacteria represent a major global health problem. Polymyxin antibiotics such as colistin have resurfaced as effective last-resort antimicrobials for use against MDR Gram-negative pathogens, including Acinetobacter baumannii. Here we show that A. baumannii can rapidly develop resistance to polymyxin antibiotics by complete loss of the initial binding target, the lipid A component of lipopolysaccharide (LPS), which has long been considered to be essential for the viability of Gram-negative bacteria. We characterized 13 independent colistin-resistant derivatives of A. baumannii type strain ATCC 19606 and showed that all contained mutations within one of the first three genes of the lipid A biosynthesis pathway: lpxA, lpxC, and lpxD. All of these mutations resulted in the complete loss of LPS production. Furthermore, we showed that loss of LPS occurs in a colistin-resistant clinical isolate of A. baumannii. This is the first report of a spontaneously occurring, lipopolysaccharide-deficient, Gram-negative bacterium. PMID:20855724

  1. Effect of carbonyl cyanide 3-chlorophenylhydrazone (CCCP) on killing Acinetobacter baumannii by colistin.


    Park, Young Kyoung; Ko, Kwan Soo


    We investigated the effect of cyanide 3-chlorophenylhydrazone (CCCP) and other efflux pump inhibitors (EPIs) on the colistin susceptibility in Acinetobacter baumannii. While minimum inhibitory concentrations (MICs) of colistin in all colistin-resistant strains decreased significantly with 25 μM of CCCP and 2,4-dinitrophenol (DNP), phenyl-arginine-β-naphthylamide (PAβN), and reserpine did not decrease the colistin MICs. However, CCCP and DNP as well as PAβN and reserpine did not have a significant effect on the MICs of the other agents. Efflux pump gene expressions in colistin-resistant strains were not increased compared with those in colistin-susceptible strains. When only 5X MIC of colistin (5 mg/L) was provided to a colistin-susceptible A. baumannii strain, the bacterial cell number was reduced by 9 h after exposure to colistin, but regrowth was observed. When CCCP was added to colistin, bacterial cells were completely killed after 24 to 48 h of incubation, which was not due to the toxicity of CCCP itself. Colistin resistance in A. baumannii may not be due to efflux pumps. Our present study suggests that bacterial cells with reduced metabolic activity by CCCP are more susceptible to colistin in A. baumannii. It may show the possibility that combined therapy with colistin and other antimicrobial agents could effective against A. baumannii infections. PMID:25557480

  2. Emergence and clonal dissemination of carbapenem-hydrolysing OXA-58-producing Acinetobacter baumannii isolates in Bolivia.


    Sevillano, Elena; Fernández, Elena; Bustamante, Zulema; Zabalaga, Silvia; Rosales, Ikerne; Umaran, Adelaida; Gallego, Lucía


    Acinetobacter baumannii is an emerging multidrug-resistant pathogen and very little information is available regarding its imipenem resistance in Latin American countries such as Bolivia. This study investigated the antimicrobial resistance profile of 46 clinical strains from different hospitals in Cochabamba, Bolivia, from March 2008 to July 2009, and the presence of carbapenemases as a mechanism of resistance to imipenem. Isolates were obtained from 46 patients (one isolate per patient; 30 males,16 females) with an age range of 1 day to 84 years, and were collected from different sample types, the majority from respiratory tract infections (17) and wounds (13). Resistance to imipenem was detected in 15 isolates collected from different hospitals of the city. These isolates grouped into the same genotype, named A, and were resistant to all antibiotics tested including imipenem, with susceptibility only to colistin. Experiments to detect carbapenemases revealed the presence of the OXA-58 carbapenemase. Further analysis revealed the location of the bla(OXA-58) gene on a 40 kb plasmid. To our knowledge, this is the first report of carbapenem resistance in A. baumannii isolates from Bolivia that is conferred by the OXA-58 carbapenemase. The presence of this gene in a multidrug-resistant clone and its location within a plasmid is of great concern with regard to the spread of carbapenem-resistant A. baumannii in the hospital environment in Bolivia. PMID:21873380

  3. Clonal diversity of Acinetobacter baumannii from diabetic patients in Saudi Arabian hospitals.


    Alsultan, Abdulrahman A; Aboulmagd, Elsayed; Evans, Benjamin A; Amyes, Sebastian G B


    Carbapenem-resistant Acinetobacter baumannii (CR-AB) represents a major health-care problem, causing high rates of morbidity and mortality. This study investigated the clonality of CR-AB isolated from diabetic patients from different regions in Saudi Arabia, as well as the relatedness of the β-lactamase genes. A total of 64 non-repetitive CR-AB clinical isolates were collected from 16 different regions in Saudi Arabia from intensive care patients. Isolates were identified phenotypically by the Vitek 2 compact system and genotypically by amplification of the blaOXA-51-like gene. The target sequences were amplified by PCR and the clonal diversity of the isolates was explored by PFGE. Resistance studies revealed that the prevalence of imipenem and meropenem resistance was 92% and 96%, respectively, while the vast majority of the isolates were susceptible to tigecycline and colistin. In addition, blaVIM and blaOXA-23 were the most prevalent genes in the isolates under investigation, while ISAba1 was the most dominant insertion sequence. PFGE results showed 13 clusters; clone H was dominant, comprising 20 isolates from four hospitals, followed by clones C and F, comprising 11 isolates each from three and six hospitals, respectively. Moreover, the current study signified the clonal diversity of CR-AB in Saudi Arabia and showed the ability of some clones to infect patients in many different cities. PMID:25106863

  4. Antimicrobial Resistance of Acinetobacter baumannii to Imipenem in Iran: A Systematic Review and Meta-Analysis

    PubMed Central

    Pourhajibagher, Maryam; Hashemi, Farhad B.; Pourakbari, Babak; Aziemzadeh, Masoud; Bahador, Abbas


    Imipenem-resistant multi-drug resistant (IR-MDR) Acinetobacter baumannii has been emerged as a morbidity successful nosocomial pathogen throughout the world.To address imipenem being yet the most effective antimicrobial agent against A. baumannii to control outbreaks and treat patients, a systematic review and meta-analysis was performed to evaluate the prevalence of IR-MDR A. baumannii. We systematically searched Web of Science, PubMed, MEDLINE, Science Direct, EMBASE, Scopus, Cochrane Library, Google Scholar, and Iranian databases to identify studies addressing the antibiotic resistance of A. baumannii to imipenem and the frequency of MDR strains in Iran. Out of 58 articles and after a secondary screening using inclusion and exclusion criteria and on the basis of title and abstract evaluation, 51 studies were selected for analysis. The meta-analysis revealed that 55% [95% confidence interval (CI), 53.0–56.5] of A. baumannii were resistant to imipenem and 74% (95% CI, 61.3–83.9) were MDR. The MDR A. baumannii population in Iran is rapidly changing toward a growing resistance to imipenem. Our findings highlight the critical need for a comprehensive monitoring and infection control policy as well as a national susceptibility review program that evaluates IR-MDR A. baumannii isolates from various parts of Iran. PMID:27099638

  5. Differential Role of the T6SS in Acinetobacter baumannii Virulence

    PubMed Central

    Foucault-Grunenwald, Marie-Laure; Borges, Vitor; Charpentier, Xavier; Limansky, Adriana S.; Gomes, João Paulo; Viale, Alejandro M.; Salcedo, Suzana P.


    Gram-negative bacteria, such as Acinetobacter baumannii, are an increasing burden in hospitals worldwide with an alarming spread of multi-drug resistant (MDR) strains. Herein, we compared a type strain (ATCC17978), a non-clinical isolate (DSM30011) and MDR strains of A. baumannii implicated in hospital outbreaks (Ab242, Ab244 and Ab825), revealing distinct patterns of type VI secretion system (T6SS) functionality. The T6SS genomic locus is present and was actively transcribed in all of the above strains. However, only the A. baumannii DSM30011 strain was capable of killing Escherichia coli in a T6SS-dependent manner, unlike the clinical isolates, which failed to display an active T6SS in vitro. In addition, DSM30011 was able to outcompete ATCC17978 as well as Pseudomonas aeruginosa and Klebsiella pneumoniae, bacterial pathogens relevant in mixed nosocomial infections. Finally, we found that the T6SS of DSM30011 is required for host colonization of the model organism Galleria mellonella suggesting that this system could play an important role in A. baumannii virulence in a strain-specific manner. PMID:26401654

  6. Identification and Characterization of Type II Toxin-Antitoxin Systems in the Opportunistic Pathogen Acinetobacter baumannii

    PubMed Central

    Jurėnaitė, Milda; Markuckas, Arvydas


    Acinetobacter baumannii is an opportunistic pathogen that causes nosocomial infections. Due to the ability to persist in the clinical environment and rapidly acquire antibiotic resistance, multidrug-resistant A. baumannii clones have spread in medical units in many countries in the last decade. The molecular basis of the emergence and spread of the successful multidrug-resistant A. baumannii clones is not understood. Bacterial toxin-antitoxin (TA) systems are abundant genetic loci harbored in low-copy-number plasmids and chromosomes and have been proposed to fulfill numerous functions, from plasmid stabilization to regulation of growth and death under stress conditions. In this study, we have performed a thorough bioinformatic search for type II TA systems in genomes of A. baumannii strains and estimated at least 15 possible TA gene pairs, 5 of which have been shown to be functional TA systems. Three of them were orthologs of bacterial and archaeal RelB/RelE, HicA/HicB, and HigB/HigA systems, and others were the unique SplT/SplA and CheT/CheA TA modules. The toxins of all five TA systems, when expressed in Escherichia coli, inhibited translation, causing RNA degradation. The HigB/HigA and SplT/SplA TA pairs of plasmid origin were highly prevalent in clinical multidrug-resistant A. baumannii isolates from Lithuanian hospitals belonging to the international clonal lineages known as European clone I (ECI) and ECII. PMID:23667234

  7. Identification of a DNA-Damage-Inducible Regulon in Acinetobacter baumannii

    PubMed Central

    Aranda, Jesús; Poza, Margarita; Shingu-Vázquez, Miguel; Cortés, Pilar; Boyce, John D.; Adler, Ben; Barbé, Jordi


    The transcriptional response of Acinetobacter baumannii, a major cause of nosocomial infections, to the DNA-damaging agent mitomycin C (MMC) was studied using DNA microarray technology. Most of the 39 genes induced by MMC were related to either prophages or encoded proteins involved in DNA repair. Electrophoretic mobility shift assays demonstrated that the product of the A. baumannii MMC-inducible umuD gene (umuDAb) specifically binds to the palindromic sequence TTGAAAATGTAACTTTTTCAA present in its promoter region. Mutations in this palindromic region abolished UmuDAb protein binding. A comparison of the promoter regions of all MMC-induced genes identified four additional transcriptional units with similar palindromic sequences recognized and specifically bound by UmuDAb. Therefore, the UmuDAb regulon consists of at least eight genes encoding seven predicted error-prone DNA polymerase V components and DddR, a protein of unknown function. Expression of these genes was not induced in the MMC-treated recA mutant. Furthermore, inactivation of the umuDAb gene resulted in the deregulation of all DNA-damage-induced genes containing the described palindromic DNA motif. Together, these findings suggest that UmuDAb is a direct regulator of the DNA damage response in A. baumannii. PMID:24123815

  8. Inactivation of Acinetobacter baumannii Biofilms on Polystyrene, Stainless Steel, and Urinary Catheters by Octenidine Dihydrochloride

    PubMed Central

    Narayanan, Amoolya; Nair, Meera S.; Karumathil, Deepti P.; Baskaran, Sangeetha A.; Venkitanarayanan, Kumar; Amalaradjou, Mary Anne Roshni


    Acinetobacter baumannii is a major nosocomial pathogen causing human infections with significant mortality rates. In most cases, infections are acquired through exposure to A. baumannii biofilms that persist on contaminated hospital equipment and surfaces. Thus, it is imperative to develop effective measures for controlling A. baumannii biofilms in nosocomial settings. This study investigated the efficacy of octenidine dihydrochloride (OH), a new generation disinfectant for reducing A. baumannii biofilms on polystyrene, stainless steel and catheters. OH at 0.3% (5 mM), 0.6% (10 mM), and 0.9% (15 mM) was effective in significantly inactivating A. baumannii biofilms on all tested surfaces (P < 0.05). Furthermore, OH was equally effective in inactivating biofilms of multidrug resistant and drug susceptible A. baumannii isolates. In addition, confocal imaging revealed the predominance of dead cells in the OH-treated samples in comparison to the control. Further, scanning electron microscopy of biofilms formed on catheters revealed that OH treatment significantly reduced A. baumannii biofilm populations in corroboration with our antibiofilm assay. These data underscore the efficacy of OH in inactivating A. baumannii biofilms, thereby suggesting its potential use as a disinfectant or a catheter lock solution to control A. baumannii infections. PMID:27375572

  9. Detoxification of Indole by an Indole-Induced Flavoprotein Oxygenase from Acinetobacter baumannii

    PubMed Central

    Lin, Guang-Huey; Chen, Hao-Ping; Shu, Hung-Yu


    Indole, a derivative of the amino acid tryptophan, is a toxic signaling molecule, which can inhibit bacterial growth. To overcome indole-induced toxicity, many bacteria have developed enzymatic defense systems to convert indole to non-toxic, water-insoluble indigo. We previously demonstrated that, like other aromatic compound-degrading bacteria, Acinetobacter baumannii can also convert indole to indigo. However, no work has been published investigating this mechanism. Here, we have shown that the growth of wild-type A. baumannii is severely inhibited in the presence of 3.5 mM indole. However, at lower concentrations, growth is stable, implying that the bacteria may be utilizing a survival mechanism to oxidize indole. To this end, we have identified a flavoprotein oxygenase encoded by the iifC gene of A. baumannii. Further, our results suggest that expressing this recombinant oxygenase protein in Escherichia coli can drive indole oxidation to indigo in vitro. Genome analysis shows that the iif operon is exclusively present in the genomes of A. baumannii and Pseudomonas syringae pv. actinidiae. Quantitative PCR and Western blot analysis also indicate that the iif operon is activated by indole through the AraC-like transcriptional regulator IifR. Taken together, these data suggest that this species of bacteria utilizes a novel indole-detoxification mechanism that is modulated by IifC, a protein that appears to be, at least to some extent, regulated by IifR. PMID:26390211

  10. Thai ethnomedicinal plants as resistant modifying agents for combating Acinetobacter baumannii infections

    PubMed Central


    Abstracts Background Acinetobacter baumannii is well-recognized as an important nosocomial pathogen, however, due to their intrinsic resistance to several antibiotics, treatment options are limited. Synergistic effects between antibiotics and medicinal plants, particularly their active components, have intensively been studied as alternative approaches. Methods Fifty-one ethanol extracts obtained from 44 different selected medicinal plant species were tested for resistance modifying agents (RMAs) of novobiocin against A. baumannii using growth inhibition assay. Results At 250 μg/ml, Holarrhena antidysenterica, Punica granatum, Quisqualis indica, Terminalia bellirica, Terminalia chebula, and Terminalia sp. that possessed low intrinsic antibacterial activity significantly enhanced the activity of novobiocin at 1 μg/ml (1/8xminimum inhibitory concentration) against this pathogen. Holarrhena antidysenterica at 7.8 μg/ml demonstrated remarkable resistant modifying ability against A. baumannii in combination with novobiocin. The phytochemical study revealed that constituents of this medicinal plant contain alkaloids, condensed tannins, and triterpenoids. Conclusion The use of Holarrhena antidysenterica in combination with novobiocin provides an effective alternative treatment for multidrug resistant A. baumannii infections. PMID:22536985

  11. Disinfection of Acinetobacter baumannii-contaminated surfaces relevant to medical treatment facilities with ultraviolet C light.


    Rastogi, Vipin K; Wallace, Lalena; Smith, Lisa S


    The efficacy of ultraviolet C (UVC) light (100-280 nm) in the decontamination of three hospital-related surfaces, namely, unpainted/painted aluminum (bed railings), stainless steel (operating tables), and scrubs (laboratory coats), was investigated. Acinetobacter baumannii cells were inoculated (10(5) or 10(3) cells) on small coupons and dried overnight in a class II biosafety cabinet. Drying resulted in < or =50% loss of viability. The UVC fluence of 90 J/m2 was observed to be very effective in the decontamination of cells from all metal coupon surfaces (complete killing). However, the same fluence was ineffective in the decontamination of scrubs. The effectiveness of two other common disinfection practices, that is, 15 minutes of boiling or spraying with 70% ethanol, was investigated for the scrubs. Although ethanol treatment was ineffective, the boiling treatment was very effective (complete killing). These results establish that metal surfaces can be decontaminated with UVC irradiation and boiling treatment is effective for scrub decontamination. PMID:18062390

  12. Effects of silver nanoparticles in combination with antibiotics on the resistant bacteria Acinetobacter baumannii.


    Wan, Guoqing; Ruan, Lingao; Yin, Yu; Yang, Tian; Ge, Mei; Cheng, Xiaodong


    Acinetobacter baumannii resistance to carbapenem antibiotics is a serious clinical challenge. As a newly developed technology, silver nanoparticles (AgNPs) show some excellent characteristics compared to older treatments, and are a candidate for combating A. baumannii infection. However, its mechanism of action remains unclear. In this study, we combined AgNPs with antibiotics to treat carbapenem-resistant A. baumannii (aba1604). Our results showed that single AgNPs completely inhibited A. baumannii growth at 2.5 μg/mL. AgNP treatment also showed synergistic effects with the antibiotics polymixin B and rifampicin, and an additive effect with tigecyline. In vivo, we found that AgNPs-antibiotic combinations led to better survival ratios in A. baumannii-infected mouse peritonitis models than that by single drug treatment. Finally, we employed different antisense RNA-targeted Escherichia coli strains to elucidate the synergistic mechanism involved in bacterial responses to AgNPs and antibiotics. PMID:27574420

  13. Translation Elongation Factor Tuf of Acinetobacter baumannii Is a Plasminogen-Binding Protein

    PubMed Central

    Koenigs, Arno; Zipfel, Peter F.; Kraiczy, Peter


    Acinetobacter baumannii is an important nosocomial pathogen, causing a variety of opportunistic infections of the skin, soft tissues and wounds, urinary tract infections, secondary meningitis, pneumonia and bacteremia. Over 63% of A. baumannii infections occurring in the United States are caused by multidrug resistant isolates, and pan-resistant isolates have begun to emerge that are resistant to all clinically relevant antibiotics. The complement system represents the first line of defense against invading pathogens. However, many A. baumannii isolates, especially those causing severe bacteremia are resistant to complement-mediated killing, though the underlying mechanisms remain poorly understood. Here we show for the first time that A. baumannii binds host-derived plasminogen and we identify the translation elongation factor Tuf as a moonlighting plasminogen-binding protein that is exposed on the outer surface of A. baumannii. Binding of plasminogen to Tuf is at least partly dependent on lysine residues and ionic interactions. Plasminogen, once bound to Tuf can be converted to active plasmin and proteolytically degrade fibrinogen as well as the key complement component C3b. Thus, Tuf acts as a multifunctional protein that may contribute to virulence of A. baumannii by aiding in dissemination and evasion of the complement system. PMID:26230848

  14. Demonstration of the interactions between aromatic compound-loaded lipid nanocapsules and Acinetobacter baumannii bacterial membrane.


    Montagu, A; Joly-Guillou, M-L; Guillet, C; Bejaud, J; Rossines, E; Saulnier, P


    Acinetobacter baumannii is an important nosocomial pathogen that is resistant to many commonly-used antibiotics. One strategy for treatment is the use of aromatic compounds (carvacrol, cinnamaldehyde) against A. baumannii. The aim of this study was to determine the interactions between bacteria and lipid nanocapsules (LNCs) over time based on the fluorescence of 3,3'-Dioctadecyloxacarbocyanine Perchlorate-LNCs (DiO-LNCs) and the properties of trypan blue to analyse the physicochemical mechanisms occurring at the level of the biological membrane. The results demonstrated the capacity of carvacrol-loaded LNCs to interact with and penetrate the bacterial membrane in comparison with cinnamaldehyde-loaded LNCs and unloaded LNCs. Modifications of carvacrol after substitution of hydroxyl functional groups by fatty acids demonstrated the crucial role of hydroxyl functions in antibacterial activity. Finally, after contact with the efflux pump inhibitor, carbonylcyanide-3-chlorophenyl hydrazine (CCCP), the results indicated the total synergistic antibacterial effect with Car-LNCs, showing that CCCP is associated with the action mechanism of carvacrol, especially at the level of the efflux pump mechanism. PMID:27039148

  15. Functional Exposed Amino Acids of BauA as Potential Immunogen Against Acinetobacter baumannii.


    Sefid, Fatemeh; Rasooli, Iraj; Jahangiri, Abolfazl; Bazmara, Hadise


    Multidrug-resistant Acinetobacter baumannii is recognized to be among the most difficult antimicrobial-resistant gram negative bacilli to control and treat. One of the major challenges that the pathogenic bacteria face in their host is the scarcity of freely available iron. To survive under such conditions, bacteria express new proteins on their outer membrane and also secrete iron chelators called siderophores. Antibodies directed against these proteins associated with iron uptake exert a bacteriostatic or bactericidal effect against A. baumanii in vitro, by blocking siderophore mediated iron uptake pathways. Attempts should be made to discover peptides that could mimic protein epitopes and possess the same immunogenicity as the whole protein. Subsequently, theoretical methods for epitope prediction have been developed leading to synthesis of such peptides that are important for development of immunodiagnostic tests and vaccines. The present study was designed to in silico resolving the major obstacles in the control or in prevention of the diseases caused by A. baumannii. We exploited bioinformatic tools to better understand and characterize the Baumannii acinetobactin utilization structure of A. baumannii and select appropriate regions as effective B cell epitopes. In conclusion, amino acids 26-191 of cork domain and 321-635 of part of the barrel domain including L4-L9, were selected as vaccine candidates. These two regions contain functional exposed amino acids with higher score of B cell epitopes properties. Majority of amino acids are hydrophilic, flexible, accessible, and favorable for B cells from secondary structure point of view. PMID:25840681

  16. Resistance and integron characterization of Acinetobacter baumannii in a teaching hospital in Chongqing, China

    PubMed Central

    Huang, C.; Long, Q.; Qian, K.; Fu, T.; Zhang, Z.; Liao, P.; Xie, J.


    A total of 189 Acinetobacter baumannii isolates were collected in 2011 from a teaching hospital in Chongqing, China. Susceptibility data showed strains carrying integrons were significantly more resistant to all tested antibiotics that strains lacking integrons. Five types of gene cassettes belonging to class I integrons were identified in this study, and for the first time two types of gene cassettes belonging to class II integrons are reported. Most of the cassettes belong to a class I integron (136/144) encoding arr3, aacA4, dfrA17, aadA5, aadB, cat, blaOXA10, aadA1, aadA2, dfrA and aacC1. Isolates contained a class I gene cassette; AadA2-HP-dfrA was the prevalent strain in this hospital. A class II integron was detected in eight strains, which contained the type IV fimbriae expression regulatory gene pilR and sulfate adenylyltransferase, suggesting a possible role in multidrug resistance. The major epidemic strains from intensive care unit patients belong to international clone 2. In conclusion, the presence of integrons was significantly associated with multiple drug resistance of A. baumannii in this hospital, and class I integron isolates bearing AadA2-HP-dfrA were the prevalent strain in this hospital. PMID:26649184

  17. Identification and characterization of a glycosyltransferase involved in Acinetobacter baumannii lipopolysaccharide core biosynthesis.


    Luke, Nicole R; Sauberan, Shauna L; Russo, Thomas A; Beanan, Janet M; Olson, Ruth; Loehfelm, Thomas W; Cox, Andrew D; St Michael, Frank; Vinogradov, Evgeny V; Campagnari, Anthony A


    Although Acinetobacter baumannii has emerged as a significant cause of nosocomial infections worldwide, there have been few investigations describing the factors important for A. baumannii persistence and pathogenesis. This paper describes the first reported identification of a glycosyltransferase, LpsB, involved in lipopolysaccharide (LPS) biosynthesis in A. baumannii. Mutational, structural, and complementation analyses indicated that LpsB is a core oligosaccharide glycosyl transferase. Using a genetic approach, lpsB was compared with the lpsB homologues of several A. baumannii strains. These analyses indicated that LpsB is highly conserved among A. baumannii isolates. Furthermore, we developed a monoclonal antibody, monoclonal antibody 13C11, which reacts to an LPS core epitope expressed by approximately one-third of the A. baumannii clinical isolates evaluated to date. Previous studies describing the heterogeneity of A. baumannii LPS were limited primarily to structural analyses; therefore, studies evaluating the correlation between these surface glycolipids and pathogenesis were warranted. Our data from an evaluation of LpsB mutant 307::TN17, which expresses a deeply truncated LPS glycoform consisting of only two 3-deoxy-d-manno-octulosonic acid residues and lipid A, suggest that A. baumannii LPS is important for resistance to normal human serum and confers a competitive advantage for survival in vivo. These results have important implications for the role of LPS in A. baumannii infections. PMID:20194587

  18. Effects of silver nanoparticles in combination with antibiotics on the resistant bacteria Acinetobacter baumannii

    PubMed Central

    Wan, Guoqing; Ruan, Lingao; Yin, Yu; Yang, Tian; Ge, Mei; Cheng, Xiaodong


    Acinetobacter baumannii resistance to carbapenem antibiotics is a serious clinical challenge. As a newly developed technology, silver nanoparticles (AgNPs) show some excellent characteristics compared to older treatments, and are a candidate for combating A. baumannii infection. However, its mechanism of action remains unclear. In this study, we combined AgNPs with antibiotics to treat carbapenem-resistant A. baumannii (aba1604). Our results showed that single AgNPs completely inhibited A. baumannii growth at 2.5 μg/mL. AgNP treatment also showed synergistic effects with the antibiotics polymixin B and rifampicin, and an additive effect with tigecyline. In vivo, we found that AgNPs–antibiotic combinations led to better survival ratios in A. baumannii-infected mouse peritonitis models than that by single drug treatment. Finally, we employed different antisense RNA-targeted Escherichia coli strains to elucidate the synergistic mechanism involved in bacterial responses to AgNPs and antibiotics. PMID:27574420

  19. Resistance patterns of multidrug resistant Acinetobacter baumannii in an ICU of a tertiary care hospital, Malaysia

    PubMed Central

    Janahiraman, Sivakami; Aziz, Muhammad Nazri; Hoo, Fan Kee; P’ng, Hon Shen; Boo, Yang Liang; Ramachandran, Vasudevan; Shamsuddin, Ahmad Fuad


    Backgrounds & Objective: Antimicrobial resistance is a major health problem worldwide in hospitals. The main contributing factors are exposures to broad-spectrum antimicrobials and cross-infections. Understanding the extent and type of antimicrobial use in tertiary care hospitals will aid in developing national antimicrobial stewardship priorities. Methods: In this study, we have analyzed the antimicrobial agents’ usage for acquisition of multidrug resistant using retrospective, cross-sectional, single-centre study in a multidisciplinary ICU at tertiary care hospital. Results: Acinetobacter baumannii (ACB) was isolated in various specimens from 662 patients. From these, 136 patients who were diagnosed with Ventilator-associated pneumonia (VAP) caused by ACB were included into the study. In our study, MDR strain accounts for 51% of all VAP cases caused by ACB. The development of ACB VAP were 10.5 + 6.4 days for MDR strains compared to susceptible organism (7.8 + 4.5 days) and had significantly longer ICU stay. Conclusion: The study concludes that prudent use of antimicrobial agents is important to reduce acquisition of MDR ACB. PMID:26870101

  20. Outbreak of septicaemic cases caused by Acinetobacter ursingii in a neonatal intensive care unit.


    Máder, Krisztina; Terhes, Gabriella; Hajdú, Edit; Urbán, Edit; Sóki, József; Magyar, Tibor; Márialigeti, Károly; Katona, Márta; Nagy, Elisabeth; Túri, Sándor


    Neonatal infections may be caused by various microorganisms, but as far as we are aware, Acinetobacter ursingii has not yet been reported in connection with nosocomial infections of premature infants. During 2 months, 3 premature babies were treated with nosocomial infection caused by A. ursingii at the same ward, and on the basis of molecular typing results the same strain was responsible for all of these cases. Traditional biochemical methods and automatic identification systems failed to identify this bacterium on the species level, and only 16S rDNA sequencing gave acceptable species identifications. The isolated strains proved to be susceptible to all of the tested antimicrobials, including ampicillin/sulbactam, doxycyclin, netilmicin, ciprofloxacin, piperacillin/tazobactam, ceftazidime, imipenem, meropenem, trimethoprim/sulfametoxazole, gentamicin, tobramycin, amikacin, and levofloxacin according to the CLSI standard. In spite of the environmental screening, the source of the infection could not be clarified. One of 3 neonates died, the others recovered and were discharged home after several months of hospitalization. PMID:19931486

  1. Carbapenem-resistant isolates of Acinetobacter baumannii in a municipal wastewater treatment plant, Croatia, 2014.


    Hrenovic, Jasna; Goic-Barisic, Ivana; Kazazic, Snjezana; Kovacic, Ana; Ganjto, Marin; Tonkic, Marija


    Acinetobacter baumannii is an emerging hospital pathogen. Whereas A. baumannii isolated from patients or hospitals has been reported, there are few data regarding propagation of viable A. baumannii in the natural environment. This study investigates the occurrence and antimicrobial susceptibility of viable A. baumannii in municipal wastewater and its persistence through the wastewater treatment process. A total of 21 A. baumannii isolates were recovered at a secondary type of municipal wastewater treatment plant in Zagreb, Croatia: 15 from raw influent wastewater and six from final effluent. All isolates were carbapenem- and multidrug-resistant. Among 14 isolates tested for blaOXA genes, all harboured the constitutive blaOXA-51-like gene, while the acquired blaOXA-23-like and blaOXA-40-like genes were found in 10 and three isolates respectively. Six A. baumannii isolates recovered from effluent wastewater multiplied and survived in sterilised effluent wastewater up to 50 days. These findings support the idea that multidrug-resistant A. baumannii can occur and have the ability to survive in the environment. PMID:27105318

  2. The Genetic Analysis of an Acinetobacter johnsonii Clinical Strain Evidenced the Presence of Horizontal Genetic Transfer.


    Montaña, Sabrina; Schramm, Sareda T J; Traglia, German Matías; Chiem, Kevin; Parmeciano Di Noto, Gisela; Almuzara, Marisa; Barberis, Claudia; Vay, Carlos; Quiroga, Cecilia; Tolmasky, Marcelo E; Iriarte, Andrés; Ramírez, María Soledad


    Acinetobacter johnsonii rarely causes human infections. While most A. johnsonii isolates are susceptible to virtually all antibiotics, strains harboring a variety of β-lactamases have recently been described. An A. johnsonii Aj2199 clinical strain recovered from a hospital in Buenos Aires produces PER-2 and OXA-58. We decided to delve into its genome by obtaining the whole genome sequence of the Aj2199 strain. Genome comparison studies on Aj2199 revealed 240 unique genes and a close relation to strain WJ10621, isolated from the urine of a patient in China. Genomic analysis showed evidence of horizontal genetic transfer (HGT) events. Forty-five insertion sequences and two intact prophages were found in addition to several resistance determinants such as blaPER-2, blaOXA-58, blaTEM-1, strA, strB, ereA, sul1, aacC2 and a new variant of blaOXA-211, called blaOXA-498. In particular, blaPER-2 and blaTEM-1 are present within the typical contexts previously described in the Enterobacteriaceae family. These results suggest that A. johnsonii actively acquires exogenous DNA from other bacterial species and concomitantly becomes a reservoir of resistance genes. PMID:27548264

  3. The induction and identification of novel Colistin resistance mutations in Acinetobacter baumannii and their implications.


    Thi Khanh Nhu, Nguyen; Riordan, David W; Do Hoang Nhu, Tran; Thanh, Duy Pham; Thwaites, Guy; Huong Lan, Nguyen Phu; Wren, Brendan W; Baker, Stephen; Stabler, Richard A


    Acinetobacter baumannii is a significant cause of opportunistic hospital acquired infection and has been identified as an important emerging infection due to its high levels of antimicrobial resistance. Multidrug resistant A. baumannii has risen rapidly in Vietnam, where colistin is becoming the drug of last resort for many infections. In this study we generated spontaneous colistin resistant progeny (up to >256 μg/μl) from four colistin susceptible Vietnamese isolates and one susceptible reference strain (MIC <1.5 μg/μl). Whole genome sequencing was used to identify single nucleotide mutations that could be attributed to the reduced colistin susceptibility. We identified six lpxACD and three pmrB mutations, the majority of which were novel. In addition, we identified further mutations in six A. baumannii genes (vacJ, pldA, ttg2C, pheS and conserved hypothetical protein) that we hypothesise have a role in reduced colistin susceptibility. This study has identified additional mutations that may be associated with colistin resistance through novel resistance mechanisms. Our work further demonstrates how rapidly A. baumannii can generate resistance to a last resort antimicrobial and highlights the need for improved surveillance to identified A. baumannii with an extensive drug resistance profile. PMID:27329501

  4. Antibacterial Activity of a Novel Peptide-Modified Lysin Against Acinetobacter baumannii and Pseudomonas aeruginosa

    PubMed Central

    Yang, Hang; Wang, Mengyue; Yu, Junping; Wei, Hongping


    The global emergence of multidrug-resistant (MDR) bacteria is a growing threat to public health worldwide. Natural bacteriophage lysins are promising alternatives in the treatment of infections caused by Gram-positive pathogens, but not Gram-negative ones, like Acinetobacter baumannii and Pseudomonas aeruginosa, due to the barriers posed by their outer membranes. Recently, modifying a natural lysin with an antimicrobial peptide was found able to break the barriers, and to kill Gram-negative pathogens. Herein, a new peptide-modified lysin (PlyA) was constructed by fusing the cecropin A peptide residues 1–8 (KWKLFKKI) with the OBPgp279 lysin and its antibacterial activity was studied. PlyA showed good and broad antibacterial activities against logarithmic phase A. baumannii and P. aeruginosa, but much reduced activities against the cells in stationary phase. Addition of outer membrane permeabilizers (EDTA and citric acid) could enhance the antibacterial activity of PlyA against stationary phase cells. Finally, no antibacterial activity of PlyA could be observed in some bio-matrices, such as culture media, milk, and sera. In conclusion, we reported here a novel peptide-modified lysin with significant antibacterial activity against both logarithmic (without OMPs) and stationary phase (with OMPs) A. baumannii and P. aeruginosa cells in buffer, but further optimization is needed to achieve broad activity in diverse bio-matrices. PMID:26733995

  5. Characterization of the anaerobic denitrification bacterium Acinetobacter sp. SZ28 and its application for groundwater treatment.


    Su, Jun feng; Zheng, Sheng Chen; Huang, Ting lin; Ma, Fang; Shao, Si Cheng; Yang, Shao Fei; Zhang, Li na


    Acinetobacter sp. SZ28 exhibited efficient autotrophic denitrification ability using Mn(2+) as an electron donor. Sequence amplification identified the presence of the nirS gene. Meteorological chromatography analysis showed that N2 was produced as an end product. Response surface methodology experiments showed that the maximum removal of nitrate occurred under the following conditions: Mn(2+) concentration of 143.56 mg/L, C/N ratio of 6.82, initial pH of 5.17, and temperature of 34.26 °C, where the initial Mn(2+) concentration produced the largest effect. In the groundwater experiment, nitrate levels decreased from 1.63 mg/L to 0 mg/L. Three-dimensional fluorescence analysis showed a decrease in the peak intensity of the original humus. Humus and the small-molecule amino acid tryptophan were detected. These results demonstrated that strain SZ28 is a suitable candidate for the simultaneous removal of nitrogen and Mn(2+) in groundwater treatment. PMID:26094190

  6. Detoxification of Indole by an Indole-Induced Flavoprotein Oxygenase from Acinetobacter baumannii.


    Lin, Guang-Huey; Chen, Hao-Ping; Shu, Hung-Yu


    Indole, a derivative of the amino acid tryptophan, is a toxic signaling molecule, which can inhibit bacterial growth. To overcome indole-induced toxicity, many bacteria have developed enzymatic defense systems to convert indole to non-toxic, water-insoluble indigo. We previously demonstrated that, like other aromatic compound-degrading bacteria, Acinetobacter baumannii can also convert indole to indigo. However, no work has been published investigating this mechanism. Here, we have shown that the growth of wild-type A. baumannii is severely inhibited in the presence of 3.5 mM indole. However, at lower concentrations, growth is stable, implying that the bacteria may be utilizing a survival mechanism to oxidize indole. To this end, we have identified a flavoprotein oxygenase encoded by the iifC gene of A. baumannii. Further, our results suggest that expressing this recombinant oxygenase protein in Escherichia coli can drive indole oxidation to indigo in vitro. Genome analysis shows that the iif operon is exclusively present in the genomes of A. baumannii and Pseudomonas syringae pv. actinidiae. Quantitative PCR and Western blot analysis also indicate that the iif operon is activated by indole through the AraC-like transcriptional regulator IifR. Taken together, these data suggest that this species of bacteria utilizes a novel indole-detoxification mechanism that is modulated by IifC, a protein that appears to be, at least to some extent, regulated by IifR. PMID:26390211

  7. Acinetobacter baumannii phenylacetic acid metabolism influences infection outcome through a direct effect on neutrophil chemotaxis.


    Bhuiyan, Md Saruar; Ellett, Felix; Murray, Gerald L; Kostoulias, Xenia; Cerqueira, Gustavo M; Schulze, Keith E; Mahamad Maifiah, Mohd Hafidz; Li, Jian; Creek, Darren J; Lieschke, Graham J; Peleg, Anton Y


    Innate cellular immune responses are a critical first-line defense against invading bacterial pathogens. Leukocyte migration from the bloodstream to a site of infection is mediated by chemotactic factors that are often host-derived. More recently, there has been a greater appreciation of the importance of bacterial factors driving neutrophil movement during infection. Here, we describe the development of a zebrafish infection model to study Acinetobacter baumannii pathogenesis. By using isogenic A. baumannii mutants lacking expression of virulence effector proteins, we demonstrated that bacterial drivers of disease severity are conserved between zebrafish and mammals. By using transgenic zebrafish with fluorescent phagocytes, we showed that a mutation of an established A. baumannii global virulence regulator led to marked changes in neutrophil behavior involving rapid neutrophil influx to a localized site of infection, followed by prolonged neutrophil dwelling. This neutrophilic response augmented bacterial clearance and was secondary to an impaired A. baumannii phenylacetic acid catabolism pathway, which led to accumulation of phenylacetate. Purified phenylacetate was confirmed to be a neutrophil chemoattractant. These data identify a previously unknown mechanism of bacterial-guided neutrophil chemotaxis in vivo, providing insight into the role of bacterial metabolism in host innate immune evasion. Furthermore, the work provides a potentially new therapeutic paradigm of targeting a bacterial metabolic pathway to augment host innate immune responses and attenuate disease. PMID:27506797

  8. The effect of silver or gallium doped titanium against the multidrug resistant Acinetobacter baumannii.


    Cochis, A; Azzimonti, B; Della Valle, C; De Giglio, E; Bloise, N; Visai, L; Cometa, S; Rimondini, L; Chiesa, R


    Implant-related infection of biomaterials is one of the main causes of arthroplasty and osteosynthesis failure. Bacteria, such as the rapidly-emerging Multi Drug Resistant (MDR) pathogen Acinetobacter Baumannii, initiate the infection by adhering to biomaterials and forming a biofilm. Since the implant surface plays a crucial role in early bacterial adhesion phases, titanium was electrochemically modified by an Anodic Spark Deposition (ASD) treatment, developed previously and thought to provide osseo-integrative properties. In this study, the treatment was modified to insert gallium or silver onto the titanium surface, to provide antibacterial properties. The material was characterized morphologically, chemically, and mechanically; biological properties were investigated by direct cytocompatibility assay, Alkaline Phosphatase (ALP) activity, Scanning Electron Microscopy (SEM), and Immunofluorescent (IF) analysis; antibacterial activity was determined by counting Colony Forming Units, and viability assay. The various ASD-treated surfaces showed similar morphology, micrometric pore size, and uniform pore distribution. Of the treatments studied, gallium-doped specimens showed the best ALP synthesis and antibacterial properties. This study demonstrates the possibility of successfully doping the surface of titanium with gallium or silver, using the ASD technique; this approach can provide antibacterial properties and maintain high osseo-integrative potential. PMID:26708086

  9. Combination therapy with polymyxin B and netropsin against clinical isolates of multidrug-resistant Acinetobacter baumannii

    PubMed Central

    Chung, Joon-hui; Bhat, Abhayprasad; Kim, Chang-Jin; Yong, Dongeun; Ryu, Choong-Min


    Polymyxins are last-resort antibiotics for treating infections of Gram-negative bacteria. The recent emergence of polymyxin-resistant bacteria, however, urgently demands clinical optimisation of polymyxin use to minimise further evolution of resistance. In this study we developed a novel combination therapy using minimal concentrations of polymyxin B. After large-scale screening of Streptomyces secondary metabolites, we identified a reliable polymixin synergist and confirmed as netropsin using high-pressure liquid chromatography, nuclear magnetic resonance, and mass spectrometry followed by in vitro assays using various Gram-negative pathogenic bacteria. To evaluate the effectiveness of combining polymixin B and netropsin in vivo, we performed survival analysis on greater wax moth Galleria mellonella infected with colistin-resistant clinical Acinetobacter baumannii isolates as well as Escherichia coli, Shigella flexineri, Salmonella typhimuruim, and Pseudomonas aeruginosa. The survival of infected G. mellonella was significantly higher when treated with polymyxin B and netropsin in combination than when treated with polymyxin B or netropsin alone. We propose a netropsin combination therapy that minimises the use of polymyxin B when treating infections with multidrug resistant Gram-negative bacteria. PMID:27306928

  10. Sheltering Effect and Indirect Pathogenesis of Carbapenem-Resistant Acinetobacter baumannii in Polymicrobial Infection

    PubMed Central

    Liao, Yu-Ting; Kuo, Shu-Chen; Lee, Yi-Tzu; Chen, Chien-Pei; Lin, Shu-Wen; Shen, Li-Jiuan; Fung, Chang-Phone


    The role of carbapenem-resistant Acinetobacter baumannii (CRAb) in polymicrobial infection remains elusive. Having observed the ability of CRAb to shelter other susceptible bacteria from carbapenem killing, we sought to determine the factors contributing to this sheltering effect by transforming different recombinant plasmids into recipient A. baumannii cells. The sheltering effects of CRAb were reproduced in recipient A. baumannii cells that highly expressed carbapenem-hydrolyzing class D β-lactamases (CHDLs) through their associated strong promoter. With the use of Western blot analysis and a bioassay, the highly expressed CHDLs were found to be extracellularly released and led to hydrolysis of carbapenem. The level of extracellular CHDLs increased after challenge with a higher concentration of CHDL substrates, such as carbapenem and ticarcillin. This increased CHDL may, in part, be attributed to cell lysis, as indicated by the presence of extracellular gyrase. In the planktonic condition, the sheltering effect for the cocultured susceptible bacteria might represent an indirect and passive effect of the CRAb self-defense mechanism, because coculture with the susceptible pathogen did not augment the amount of the extracellular CHDLs. Polymicrobial infection caused by CRAb and a susceptible counterpart exerted higher pathogenicity than monomicrobial infection caused by either pathogen alone in mice receiving carbapenem therapy. This study demonstrated that CHDL-producing CRAb appears to provide a sheltering effect for carbapenem-susceptible pathogens via the extracellular release of CHDLs and, by this mechanism, can enhance the pathogenesis of polymicrobial infection in the presence of carbapenem therapy. PMID:24798276

  11. A mouse model of Acinetobacter baumannii-associated pneumonia using a clinically isolated hypervirulent strain.


    Harris, Greg; Kuo Lee, Rhonda; Lam, Christopher K; Kanzaki, Gregory; Patel, Girishchandra B; Xu, H Howard; Chen, Wangxue


    Acinetobacter baumannii is an important emerging pathogen in health care-acquired infections and is responsible for severe nosocomial and community-acquired pneumonia. Currently available mouse models of A. baumannii pneumonia show poor colonization with little to no extrapulmonary dissemination. Here, we describe a mouse model of A. baumannii pneumonia using a clinical isolate (LAC-4 strain) that reliably reproduces the most relevant features of human pulmonary A. baumannii infection and pathology. Using this model, we have shown that LAC-4 infection induced rapid bacterial replication in the lungs, significant extrapulmonary dissemination, and severe bacteremia by 24 h postintranasal inoculation. Infected mice showed severe bronchopneumonia and dilatation and inflammatory cell infiltration in the perivascular space. More significantly, 100% of C57BL/6 and BALB/c mice succumbed to 10(8) CFU of LAC-4 inoculation within 48 h. When this model was used to assess the efficacy of antimicrobials, all mice treated with imipenem and tigecycline survived a lethal intranasal challenge, with minimal clinical signs and body weight loss. Moreover, intranasal immunization of mice with formalin-fixed LAC-4 protected 40% of mice from a lethal (100× 100% lethal dose) intraperitoneal challenge. Thus, this model offers a reproducible acute course of A. baumannii pneumonia without requiring additional manipulation of host immune status, which will facilitate the development of therapeutic agents and vaccines against A. baumannii pneumonia in humans. PMID:23689726

  12. DNA microarray for genotyping antibiotic resistance determinants in Acinetobacter baumannii clinical isolates.


    Dally, Simon; Lemuth, Karin; Kaase, Martin; Rupp, Steffen; Knabbe, Cornelius; Weile, Jan


    In recent decades, Acinetobacter baumannii has emerged as an organism of great concern due to its ability to accumulate antibiotic resistance. In order to improve the diagnosis of resistance determinants in A. baumannii in terms of lead time and accuracy, we developed a microarray that can be used to detect 91 target sequences associated with antibiotic resistance within 4 h from bacterial culture to result. The array was validated with 60 multidrug-resistant strains of A. baumannii in a blinded, prospective study. The results were compared to phenotype results determined by the automated susceptibility testing system VITEK2. Antibiotics considered were piperacillin-tazobactam, ceftazidime, imipenem, meropenem, trimethoprim-sulfamethoxazole, amikacin, gentamicin, tobramycin, ciprofloxacin, and tigecycline. The average positive predictive value, negative predictive value, sensitivity, and specificity were 98, 98, 99, and 94%, respectively. For carbapenemase genes, the array results were compared to singleplex PCR results provided by the German National Reference Center for Gram-Negative Pathogens, and results were in complete concordance. The presented array is able to detect all relevant resistance determinants of A. baumannii in parallel. The short handling time of 4 h from culture to result helps to provide fast results in order to initiate adequate anti-infective therapy for critically ill patients. Another application would be data acquisition for epidemiologic surveillance. PMID:23856783

  13. [In vitro activity of tigecycline against multiple resistant Acinetobacter baumannii and carbapenem resistant Klebsiella pneumoniae isolates].


    Arikan Akan, Ozay; Uysal, Sevil


    In order to detect the in vitro activity of tigecycline against multiple resistant gram-negative bacilli isolated in our hospital, tigecycline susceptibilities of clinical isolates of multiple and/or panresistant 100 Acinetobacter baumannii isolates, and 38 carbapenem resistant Klebsiella pneumoniae (17 of which were panresistant), obtained between January 2005 and August 2007, were evaluated by using E-test (AB Biodisc, Sweden). Carbapenem resistance rate was found to be 59% for A.baumannii, using Vitek2 Compact System (Bio-Merieux, France) which is present in our laboratory for routine use. Minimal inhibitory concentration (MIC) levels for tigecycline were < or =2 mcg/ml in 93% of the isolates while the MIC level was 3 mcg/ml for 7% of the isolates. Tigecycline MIC50 and MIC 90 values were 1.5 and 2 mcg/ml, respectively. Among K. pneumoniae the least resistance was detected against amikacin (52.6% resistant) while tigecycline MIC levels were between 0.13 mcg/ml and 2 mcg/ml. All of the K.pneumoniae strains were susceptible to tigecycline, and the MIC50 ve MIC90 values of these isolates were 1 mcg/ml and 1.5 mcg/ml, respectively. The in vitro susceptibility rates of tigecycline against multiple and/or panresistant A. baumannii and K. pneumoniae isolates are found to be promising for use in therapy. PMID:18697418

  14. Synergistic Effect of Oleanolic Acid on Aminoglycoside Antibiotics against Acinetobacter baumannii

    PubMed Central

    Shin, Bora; Park, Woojun


    Difficulties involved in treating drug-resistant pathogens have created a need for new therapies. In this study, we investigated the possibility of using oleanolic acid (OA), a natural pentacyclic triterpenoid, as a natural adjuvant for antibiotics against Acinetobacter baumannii. High concentrations of OA can kill cells, partly because it generates reactive oxygen species. Measurement of the fractional inhibitory concentration (FIC) for OA and time-kill experiments demonstrated that it only synergizes with aminoglycoside antibiotics (e.g., gentamicin, kanamycin). Other classes of antibiotics (e.g., ampicillin, rifampicin, norfloxacin, chloramphenicol, and tetracycline) have no interactions with OA. Microarray and quantitative reverse transcription-PCR analysis indicated that genes involved in ATP synthesis and cell membrane permeability, the gene encoding glycosyltransferase, peptidoglycan-related genes, phage-related genes, and DNA repair genes were upregulated under OA. OA highly induces the expression of adk, which encodes an adenylate kinase, and des6, which encodes a linoleoyl-CoA desaturase, and deletion of these genes increased FICs; these observations indicate that adk and des6 are involved in the synergism of OA with aminoglycosides. Data obtained using 8-anilino-1-naphthalenesulfonic acid, fluorescence-conjugated gentamicin, and membrane fatty acid analysis indicates that adk and des6 are involved in changes in membrane permeability. Proton-motive force and ATP synthesis tests show that those genes are also involved in energy metabolism. Taken together, our data show that OA boosts aminoglycoside uptake by changing membrane permeability and energy metabolism in A. baumannii. PMID:26360766

  15. Novel Engineered Peptides of a Phage Lysin as Effective Antimicrobials against Multidrug-Resistant Acinetobacter baumannii.


    Thandar, Mya; Lood, Rolf; Winer, Benjamin Y; Deutsch, Douglas R; Euler, Chad W; Fischetti, Vincent A


    Acinetobacter baumannii is a Gram-negative bacterial pathogen responsible for a range of nosocomial infections. The recent rise and spread of multidrug-resistant A. baumannii clones has fueled a search for alternative therapies, including bacteriophage endolysins with potent antibacterial activities. A common feature of these lysins is the presence of a highly positively charged C-terminal domain with a likely role in promoting outer membrane penetration. In the present study, we show that the C-terminal amino acids 108 to 138 of phage lysin PlyF307, named P307, alone were sufficient to kill A. baumannii (>3 logs). Furthermore, P307 could be engineered for improved activity, the most active derivative being P307SQ-8C (>5-log kill). Both P307 and P307SQ-8C showed high in vitro activity against A. baumannii in biofilms. Moreover, P307SQ-8C exhibited MICs comparable to those of levofloxacin and ceftazidime and acted synergistically with polymyxin B. Although the peptides were shown to kill by disrupting the bacterial cytoplasmic membrane, they did not lyse human red blood cells or B cells; however, serum was found to be inhibitory to lytic activity. In a murine model of A. baumannii skin infection, P307SQ-8C reduced the bacterial burden by ∼2 logs in 2 h. This study demonstrates the prospect of using peptide derivatives from bacteriophage lysins to treat topical infections and remove biofilms caused by Gram-negative pathogens. PMID:26856847

  16. [A urinary outbreak of Acinetobacter baumanii in a spinal cord injury unit].


    Pedraza, F; Andreu, A; Saune, M; Moreno, A; Ramírez, L; García, L


    From January 1990 to April 1992, 114 urinary strains of Acinetobacter baumanii were isolated in 57 patients with traumatic spinal cord [correction of medular] injury. The strains were characterized by having all of them the same biochemical identification, except for citrate, maltose and tryptophan-desaminase. Until December 1990, (5 strains) were resistant to all antibiotics, except to tobramicine, amikacine, cotrimoxazol and imipenem (6.3%, 33.9%, 26.7% and 0% of resistances, respectively); since January 1991, (99 strains) became resistant to all of them, except to imipenem. 39.5% of AB were isolated in pure cultures, 46% of them with pyuria. Between February 1991 and January 1992, we observed the highest number of affected patients, although without seasonal predominance. We observed as well a higher incidence among males (46 males, 11 females). 80% of them carried a permanent probe. Only 6 patients presented clinical signs directly related to AB. The environmental study could not demonstrate any source of contagion or transmission mechanism. PMID:8452972

  17. Extracellular Polymeric Substance Architecture Influences Natural Genetic Transformation of Acinetobacter baylyi in Biofilms

    PubMed Central

    Merod, Robin T.


    Genetic exchange by natural transformation is an important mechanism of horizontal gene transfer in biofilms. Thirty-two biofilm metrics were quantified in a heavily encapsulated Acinetobacter baylyi strain and a miniencapsulated mutant strain, accounting for cellular architecture, extracellular polymeric substances (EPS) architecture, and their combined biofilm architecture. In general, transformation location, abundance, and frequency were more closely correlated to EPS architecture than to cellular or combined architecture. Transformation frequency and transformant location had the greatest correlation with the EPS metric surface area-to-biovolume ratio. Transformation frequency peaked when EPS surface area-to-biovolume ratio was greater than 3 μm2/μm3 and less than 5 μm2/μm3. Transformant location shifted toward the biofilm-bulk fluid interface as the EPS surface area-to-biovolume ratio increased. Transformant biovolume was most closely correlated with EPS biovolume and peaked when transformation occurred in close proximity to the substratum. This study demonstrates that biofilm architecture influences A. baylyi transformation frequency and transformant location and abundance. The major role of EPS may be to facilitate the binding and stabilization of plasmid DNA for cellular uptake. PMID:25304505

  18. Molecular Epidemiology and Characterization of Genotypes of Acinetobacter baumannii Isolates from Regions of South China.


    Ying, Jun; Lu, Junwan; Zong, Li; Li, Ailing; Pan, Ruowang; Cheng, Cong; Li, Kunpeng; Chen, Liqiang; Ying, Jianchao; Tou, Huifen; Zhu, Chuanxin; Xu, Teng; Yi, Huiguang; Li, Jinsong; Ni, Liyan; Xu, Zuyuan; Bao, Qiyu; Li, Peizhen


    The aim of this study was to analyze the molecular epidemiologic characteristics of Acinetobacter baumannii. A total of 398 isolates were collected in 7 regions of South China from January to June of 2012. Drug sensitivity was tested toward 15 commonly used antibiotics; thus, 146 multi-drug-resistant strains (resistant to more than 7 drugs) were identified, representing 36.7% of all isolates. Pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing (MLST) were used for molecular subtyping. According to the PFGE results (with a cutoff of 70% similarity for the DNA electrophoretic bands), 146 strains were subdivided into 15 clusters, with cluster A being the largest (33.6%, distributed in all districts except Jiaxing). Cluster B was also widespread and included 14.4% of all strains. In addition, MLST results revealed 11 sequence types (ST), with ST208 being the most prevalent, followed by ST191 and ST729. Furthermore, 4 novel alleles and 6 novel STs were identified. Our results showed that multi-drug-resistant A. baumannii in South China shares the origin with other widespread strains in other countries. The nosocomial infections caused by A. baumannii have been severe in South China. Continuous monitoring and judicious antibiotic use are required. PMID:26166496

  19. Aptamer-nanobody based ELASA for specific detection of Acinetobacter baumannii isolates.


    Rasoulinejad, Samaneh; Gargari, Seyed Latif Mousavi


    Acinetobacter baumannii has turned into an important threat in nosocomial outbreak infections and multidrug resistance leading to high mortality rates in the 21st century. In recent years its mortality has increased by 15% which in part could be due to lack of a rapid and sensitive diagnostic test. In this work we introduced a new detection test for A. baumannii with two highly specific aptamer and nanobody molecules. High binding affinity DNA oligonucleotide aptamers toward A. baumannii were selected through 12 rounds of whole cell System Evolution of Ligands by EXponential enrichment process (SELEX). The SELEX procedures was monitored by flow cytometry. The dissociation constant and binding efficiency of the selected aptamer Aci49 was 7.547±1:353pM and 47.50%, respectively. A sandwich enzyme linked aptamer sorbent assay (ELASA) was designed with the biotinylated Aci49 aptamer and our previously developed nanobody against biofilm associated protein (Bap). The assay system was optimized with A. baumannii (ATCC 19606) and 47 clinical isolates of A. baumannii were tested. The threshold of detection in sandwich ELASA process was10(3) CFU/ml. The sensitivity of test toward the clinical isolates was 95.47%. Our results reveal that the sandwich ELASA is sensitive and specific enough for the rapid detection of A. baumannii from clinical isolates. PMID:27234880

  20. A metallo-keratinase from a newly isolated Acinetobacter sp. R-1 with low collagenase activity and its biotechnological application potential in leather industry.


    Zhang, Rong-Xian; Gong, Jin-Song; Zhang, Dan-Dan; Su, Chang; Hou, Ying-Shuo; Li, Heng; Shi, Jin-Song; Xu, Zheng-Hong


    Microbial keratinase is a well-recognized enzyme that can specifically degrade insoluble keratins. A keratinase-producing bacterium was isolated from a duck ranch soil and identified as Acinetobacter sp. R-1 based on the biochemical characteristics and 16S rDNA gene sequencing. It showed high keratinase activity and low collagenase activity. The keratinase was purified to electrophoretic homogeneity with 6.69% recovery, 2.68-fold purification and an estimated molecular weight of 25 kDa. Additionally, the keratinase showed optimal activity at 50 °C and pH11. Keratinase activity of Acinetobacter sp. significantly increased in the presence of Li(+), Na(+), and Ca(2+), while it was completely inhibited by EDTA, indicating it was a metallo-keratinase. Moreover, the crude keratinase from Acinetobacter sp. R-1 could thoroughly depilate goat skin and simultaneously modify the wool surface, which indicated its applicable potential in leather and textile industries. PMID:26589609

  1. Spread of carbapenem-resistant international clones of Acinetobacter baumannii in Turkey and Azerbaijan: a collaborative study.


    Ahmed, S S; Alp, E; Ulu-Kilic, A; Dinc, G; Aktas, Z; Ada, B; Bagirova, F; Baran, I; Ersoy, Y; Esen, S; Guven, T G; Hopman, J; Hosoglu, S; Koksal, F; Parlak, E; Yalcin, A N; Yilmaz, G; Voss, A; Melchers, W


    Epidemic clones of Acinetobacter baumannii, described as European clones I, II, and III, are associated with hospital epidemics throughout the world. We aimed to determine the molecular characteristics and genetic diversity between European clones I, II, and III from Turkey and Azerbaijan. In this study, a total of 112 bloodstream isolates of carbapenem-resistant Acinetobacter spp. were collected from 11 hospitals across Turkey and Azerbaijan. The identification of Acinetobacter spp. using conventional and sensitivity tests was performed by standard criteria. Multiplex polymerase chain reaction (PCR) was used to detect OXA carbapenemase-encoding genes (bla OXA-23-like, bla OXA-24-like, bla OXA-51-like, and bla OXA-58-like). Pulsed-field gel electrophoresis (PFGE) typing was used to investigate genetic diversity. The bla OXA-51-like gene was present in all 112 isolates, 75 (67 %) carried bla OXA-23-like, 7 (6.2 %) carried bla OXA-58-like genes, and 5 (4.5 %) carried bla OXA-24-like genes. With a 90 % similarity cut-off value, 15 clones and eight unique isolates were identified. The largest clone was cluster D, with six subtypes. Isolates from clusters D and I were widely spread in seven different geographical regions throughout Turkey. However, F cluster was found in the northern and eastern regions of Turkey. EU clone I was grouped within J cluster with three isolates found in Antalya, Istanbul, and Erzurum. EU clone II was grouped in the U cluster with 15 isolates and found in Kayseri and Diyarbakır. The bla OXA-24-like gene in carbapenemases was identified rarely in Turkey and has been reported for the first time from Azerbaijan. Furthermore, this is the first multicenter study in Turkey and Azerbaijan to identify several major clusters belonging to European clones I and II of A. baumannii. PMID:27259712

  2. Genomic and proteomic evidences unravel the UV-resistome of the poly-extremophile Acinetobacter sp. Ver3

    PubMed Central

    Kurth, Daniel; Belfiore, Carolina; Gorriti, Marta F.; Cortez, Néstor; Farias, María E.; Albarracín, Virginia H.


    Ultraviolet radiation can damage biomolecules, with detrimental or even lethal effects for life. Even though lower wavelengths are filtered by the ozone layer, a significant amount of harmful UV-B and UV-A radiation reach Earth’s surface, particularly in high altitude environments. high-altitude Andean lakes (HAALs) are a group of disperse shallow lakes and salterns, located at the Dry Central Andes region in South America at altitudes above 3,000 m. As it is considered one of the highest UV-exposed environments, HAAL microbes constitute model systems to study UV-resistance mechanisms in environmental bacteria at various complexity levels. Herein, we present the genome sequence of Acinetobacter sp. Ver3, a gammaproteobacterium isolated from Lake Verde (4,400 m), together with further experimental evidence supporting the phenomenological observations regarding this bacterium ability to cope with increased UV-induced DNA damage. Comparison with the genomes of other Acinetobacter strains highlighted a number of unique genes, such as a novel cryptochrome. Proteomic profiling of UV-exposed cells identified up-regulated proteins such as a specific cytoplasmic catalase, a putative regulator, and proteins associated to amino acid and protein synthesis. Down-regulated proteins were related to several energy-generating pathways such as glycolysis, beta-oxidation of fatty acids, and electronic respiratory chain. To the best of our knowledge, this is the first report on a genome from a polyextremophilic Acinetobacter strain. From the genomic and proteomic data, an “UV-resistome” was defined, encompassing the genes that would support the outstanding UV-resistance of this strain. PMID:25954258

  3. Genomic and proteomic evidences unravel the UV-resistome of the poly-extremophile Acinetobacter sp. Ver3.


    Kurth, Daniel; Belfiore, Carolina; Gorriti, Marta F; Cortez, Néstor; Farias, María E; Albarracín, Virginia H


    Ultraviolet radiation can damage biomolecules, with detrimental or even lethal effects for life. Even though lower wavelengths are filtered by the ozone layer, a significant amount of harmful UV-B and UV-A radiation reach Earth's surface, particularly in high altitude environments. high-altitude Andean lakes (HAALs) are a group of disperse shallow lakes and salterns, located at the Dry Central Andes region in South America at altitudes above 3,000 m. As it is considered one of the highest UV-exposed environments, HAAL microbes constitute model systems to study UV-resistance mechanisms in environmental bacteria at various complexity levels. Herein, we present the genome sequence of Acinetobacter sp. Ver3, a gammaproteobacterium isolated from Lake Verde (4,400 m), together with further experimental evidence supporting the phenomenological observations regarding this bacterium ability to cope with increased UV-induced DNA damage. Comparison with the genomes of other Acinetobacter strains highlighted a number of unique genes, such as a novel cryptochrome. Proteomic profiling of UV-exposed cells identified up-regulated proteins such as a specific cytoplasmic catalase, a putative regulator, and proteins associated to amino acid and protein synthesis. Down-regulated proteins were related to several energy-generating pathways such as glycolysis, beta-oxidation of fatty acids, and electronic respiratory chain. To the best of our knowledge, this is the first report on a genome from a polyextremophilic Acinetobacter strain. From the genomic and proteomic data, an "UV-resistome" was defined, encompassing the genes that would support the outstanding UV-resistance of this strain. PMID:25954258

  4. Risk factors and outcome for colistin-resistant Acinetobacter nosocomialis bacteraemia in patients without previous colistin exposure.


    Wang, Y-C; Lee, Y-T; Yang, Y-S; Chen, C-T; Chiu, C-H; Yin, T; Kuo, S-C; Chen, T-L; Lin, J-C; Wang, F-D; Fung, C-P; Chang, F-Y


    The clinical characteristics of patients with colistin-resistant Acinetobacter baumannii bacteraemia have been documented, but those of patients with bacteraemia caused by other Acinetobacter species remain unknown. Previous exposure to colistin has been shown to be associated with the emergence of colistin resistance, but may be not the only predisposing factor. In the current study, we highlight the risk and outcome of patients without previous exposure to colistin who acquired colistin-resistant Acinetobacter nosocomialis (ColRAN) bacteraemia. This 11-year single-centre retrospective study analysed 58 patients with ColRAN bacteraemia and 213 patients with colistin-susceptible A. nosocomialis (ColSAN) bacteraemia. Antimicrobial susceptibilities were determined with an agar dilution method. The clonal relationship of ColRAN isolates was determined with pulsed-field gel electrophoresis. A conjugation mating-out assay was conducted to delineate the potential transfer of colistin resistance genes. Multivariable analysis was performed to evaluate the risk factors for ColRAN bacteraemia. Chronic obstructive pulmonary disease (COPD) was independently associated with ColRAN bacteraemia (OR 3.04; 95% CI 1.45-6.37; p 0.003). Patients with ColRAN bacteraemia had higher APACHE II scores, but the two groups showed no significant differences in 14-day mortality (10.3% vs. 10.3%) or 28-day mortality (15.5% vs. 15.0%). ColRAN isolates had greater resistance than ColSAN isolates to all antimicrobial agents except for ciprofloxacin (0% vs. 6.6%). There were 16 different ColRAN pulsotypes, and two major clones were found. Colistin resistance did not transfer to colistin-susceptible A. baumannii or A. nosocomialis. These results show that COPD is an independent risk factor for acquisition of ColRAN bacteraemia. The mortality rates were similar between patients with ColRAN and ColSAN bacteraemia. PMID:25980356

  5. NDM-1-Producing Citrobacter freundii, Escherichia coli, and Acinetobacter baumannii Identified from a Single Patient in China

    PubMed Central

    Huang, Ying-Min; Zhong, Lan-lan; Zhang, Xue-Fei; Hu, Hang-tong; Li, Yu-qi; Yang, Xiao-rong; Feng, Lian-Qiang; Huang, Xi


    We identified New Delhi metallo-β-lactamase (NDM-1)-producing Citrobacter freundii GB032, Escherichia coli GB102, and Acinetobacter baumannii GB661 in urine and stool samples from a single patient in China. Plasmid profiling and Southern blotting indicated that blaNDM-1 from GB032 and that from GB102 were likely located on the same plasmid, while blaNDM-1 from GB661 was located on a very large (>400-kb) plasmid. This case underscores the broad host range of blaNDM-1 and its potential to spread between members of the family Enterobacteriaceae and A. baumannii. PMID:26055374

  6. First occurrence of blaOXA-58 in Acinetobacter baumannii isolated from a clinical sample in Southern Brazil

    PubMed Central

    de Souza Gusatti, Carolina; Bertholdo, Lauren Martins; Otton, Letícia Muner; Marchetti, Desirée Padilha; Ferreira, Alessandra Einsfeld; Corção, Gertrudes


    This is the first report of an Acinetobacter baumannii from clinical origin carrying the blaOXA-58 gene in Brazil. The isolate included in this study was from a patient during an outbreak in Porto Alegre, RS, Southern Brazil, in 2007. It was resistant to most of the beta-lactams tested, it has also the blaOXA-65 gene and the ISAbal sequence located upstream to both blaOXA genes detected and it has a MIC of imipenem of 64 μg/mL. PMID:24031824

  7. Potent in vitro antibacterial activity of DS-8587, a novel broad-spectrum quinolone, against Acinetobacter baumannii.


    Higuchi, Saito; Onodera, Yoshikuni; Chiba, Megumi; Hoshino, Kazuki; Gotoh, Naomasa


    We investigated the in vitro activity of DS-8587, a novel fluoroquinolone, against Acinetobacter baumannii. The MICs of DS-8587 against clinical isolates and its inhibitory activity against target enzymes were superior to those of ciprofloxacin and levofloxacin. Furthermore, the antibacterial activity of DS-8587 was less affected by adeA/adeB/adeC or abeM efflux pumps than was that of ciprofloxacin and the frequency of single-step mutations with DS-8587 was lower than that with ciprofloxacin. DS-8587 might be an effective agent against A. baumannii infection. PMID:23380726

  8. Potent In Vitro Antibacterial Activity of DS-8587, a Novel Broad-Spectrum Quinolone, against Acinetobacter baumannii

    PubMed Central

    Onodera, Yoshikuni; Chiba, Megumi; Hoshino, Kazuki; Gotoh, Naomasa


    We investigated the in vitro activity of DS-8587, a novel fluoroquinolone, against Acinetobacter baumannii. The MICs of DS-8587 against clinical isolates and its inhibitory activity against target enzymes were superior to those of ciprofloxacin and levofloxacin. Furthermore, the antibacterial activity of DS-8587 was less affected by adeA/adeB/adeC or abeM efflux pumps than was that of ciprofloxacin and the frequency of single-step mutations with DS-8587 was lower than that with ciprofloxacin. DS-8587 might be an effective agent against A. baumannii infection. PMID:23380726

  9. Effects of three different topical antibacterial dressings on Acinetobacter baumannii-contaminated full-thickness burns in rats.


    Uygur, Fatih; Oncül, Oral; Evinç, Rahmi; Diktas, Hüsrev; Acar, Ali; Ulkür, Ersin


    In this animal study, three topical antibacterial dressings, Acticoat, chlorhexidine acetate 0.5% and silver sulfadiazine 1%, were compared in the treatment of Acinetobacter baumannii contamination of burns. All treatments were effective and prevented the organism invading the muscle and causing systemic infection, so there were significant differences between the results of the treatment groups and the control group. Mean eschar concentrations did not differ significantly between the silver sulfadiazine and chlorhexidine acetate groups, but there were significant differences between these and the Acticoat group, indicating that Acticoat eliminated A. baumannii from the tissues more effectively. PMID:18789593

  10. Outbreak of carbapenem-resistant Acinetobacter baumannii in the intensive care unit: a multi-level strategic management approach.


    Molter, G; Seifert, H; Mandraka, F; Kasper, G; Weidmann, B; Hornei, B; Öhler, M; Schwimmbeck, P; Kröschel, P; Higgins, P G; Reuter, S


    An outbreak of carbapenem-resistant Acinetobacter baumannii (CRAb) occurred in an interdisciplinary intensive care unit, affecting 10 patients. Within hours of recognition of the spread of CRAb an intervention team was instituted for collection of available data, decision-making, communication and monitoring of all interventions performed, including cohorting, temporary stop of admissions, staff education, and enforcement of infection control measures. An area was defined for cohortation of patients colonized with CRAb, with a separate nursing team and a second set of mobile equipment. New transmissions were no longer observed after only four days into the institution of enhanced infection control measures. PMID:26778130

  11. Update on Acinetobacter species: mechanisms of antimicrobial resistance and contemporary in vitro activity of minocycline and other treatment options.


    Castanheira, Mariana; Mendes, Rodrigo E; Jones, Ronald N


    Among Acinetobacter species, A. baumannii and other closely related species are commonly implicated in nosocomial infections. These organisms are usually multidrug resistant (MDR), and therapeutic options to treat A. baumannii infections are very limited. Clinicians have been resorting to older antimicrobial agents to treat infections caused by MDR A. baumannii, and some of these agents have documented toxicity and/or are not optimized for the infection type to be treated. Recent clinical experience supported by antimicrobial susceptibility data suggests that minocycline has greater activity than other tetracyclines and glycylcyclines against various MDR pathogens that have limited therapeutic options available, including Acinetobacter species. An intravenous formulation of minocycline has recently become available for clinical use, and in contrast to most older tetracyclines, minocycline has high activity against Acinetobacter species. In this report, we summarized some of the characteristics of the tetracycline class, and quantified the minocycline activity against contemporary (2007-2011) isolates and its potential therapeutic role against a collection of 5477 A. baumannii and other relevant gram-negative organisms when compared directly with tetracycline, doxycycline, and other broad-spectrum antimicrobial agents. Acinetobacter baumannii strains were highly resistant to all agents tested, with the exception of minocycline (79.1% susceptible) and colistin (98.8% susceptible). Minocycline (minimum inhibitory concentration that inhibits 50% and 90% of the isolates [MIC(50/90)]: 1/8 µg/mL) displayed greater activity than doxycycline (MIC(50/90): 2/>8 µg/mL) and tetracycline hydrochloride (HCL) (only 30.2% susceptible) against A. baumannii isolates, and was significantly more active than other tetracyclines against Burkholderia cepacia, Escherichia coli, Serratia marcescens, and Stenotrophomonas maltophilia isolates. In vitro susceptibility testing using

  12. The Response Regulator BfmR Is a Potential Drug Target for Acinetobacter baumannii

    PubMed Central

    Manohar, Akshay; Beanan, Janet M.; Olson, Ruth; MacDonald, Ulrike; Graham, Jessica


    ABSTRACT Identification and validation is the first phase of target-based antimicrobial development. BfmR (RstA), a response regulator in a two-component signal transduction system (TCS) in Acinetobacter baumannii, is an intriguing potential antimicrobial target. A unique characteristic of BfmR is that its inhibition would have the dual benefit of significantly decreasing in vivo survival and increasing sensitivity to selected antimicrobials. Studies on the clinically relevant strain AB307-0294 have shown BfmR to be essential in vivo. Here, we demonstrate that this phenotype in strains AB307-0294 and AB908 is mediated, in part, by enabling growth in human ascites fluid and serum. Further, BfmR conferred resistance to complement-mediated bactericidal activity that was independent of capsular polysaccharide. Importantly, BfmR also increased resistance to the clinically important antimicrobials meropenem and colistin. BfmR was highly conserved among A. baumannii strains. The crystal structure of the receiver domain of BfmR was determined, lending insight into putative ligand binding sites. This enabled an in silico ligand binding analysis and a blind docking strategy to assess use as a potential druggable target. Predicted binding hot spots exist at the homodimer interface and the phosphorylation site. These data support pursuing the next step in the development process, which includes determining the degree of inhibition needed to impact growth/survival and the development a BfmR activity assay amenable to high-throughput screening for the identification of inhibitors. Such agents would represent a new class of antimicrobials active against A. baumannii which could be active against other Gram-negative bacilli that possess a TCS with shared homology. IMPORTANCE Increasing antibiotic resistance in bacteria, particularly Gram-negative bacilli, has significantly affected the ability of physicians to treat infections, with resultant increased morbidity, mortality, and

  13. [Distribution of blaOXA genes in Acinetobacter baumannii strains: a multicenter study].


    Ciftci, Ihsan Hakkı; Aşık, Gülşah; Karakeçe, Engin; Oksüz, Lütfiye; Yağcı, Server; Sesli Çetin, Emel; Ozdemir, Mehmet; Atasoy, Ali Rıza; Koçoğlu, Esra; Gül, Mustafa; Kurtoğlu, Muhammet Güzel; Köksal Çakırlar, Fatma; Seyrek, Adnan; Berktaş, Mustafa; Gültepe, Bilge; Ayyildiz, Ahmet


    Acinetobacter baumannii is the most important agent of nosocomial infections within the Acinetobacter genus. This gram-negative coccobacillus is intrinsically resistant to many antibiotics used in antimicrobial therapy, and capable of developing resistance including carbapenems. The objective of this study was to develop a multiplex real time polymerase chain reaction (qPCR) kit for OXA subgroups in A.baumannii, and to investigate the distribution of OXA subgroups in A.baumannii strains isolated from geographically different regions of Turkey. A total of 834 A.baumannii clinical isolates collected from different state and university medical centers in 13 provinces (Afyonkarahisar, Ankara, Bolu, Elazig, Erzurum, Isparta, Istanbul, Kahramanmaras, Konya, Sakarya, Van) between 2008-2011, were included in the study. The isolates were identified by conventional methods and automated systems [Vitek2 (bioMerieux, ABD) and Phoenix (BD Diagnostic, MD)]. The susceptibility profiles of the isolates were studied with automated systems and standard disc diffusion method. All samples were subjected to qPCR to detect blaOXA-51-like, blaOXA-23-like and blaOXA-58-like genes. A conventional PCR method was also used to detect blaOXA-24-like gene. The resistance rates observed during the study period were as follows: 96.8% for amoxicillin-clavulanate, 86.8% for ciprofloxacin, 74.7% for gentamicin, 71.7% for amikacin, 73.5% for cefaperozone-sulbactam, 72.1% for imipenem and 73% for meropenem. Six hundred and two (72.2 %) isolates were resistant to both imipenem and meropenem. Colistin was found to be the most effective antibiotic against A.baumannii isolates with 100% susceptibility rate. All isolates were positive for blaOXA-51-like, however blaOXA-24-like gene could not be demonstrated in any isolate. Total positivity rates of blaOXA-23-like and blaOXA-58-like genes were found as 53.7% and 12.5%, respectively, while these rates were 74.4% and 17.3% in carbapenem-resistant isolates

  14. The Response Regulator BfmR Is a Potential Drug Target for Acinetobacter baumannii.


    Russo, Thomas A; Manohar, Akshay; Beanan, Janet M; Olson, Ruth; MacDonald, Ulrike; Graham, Jessica; Umland, Timothy C


    Identification and validation is the first phase of target-based antimicrobial development. BfmR (RstA), a response regulator in a two-component signal transduction system (TCS) in Acinetobacter baumannii, is an intriguing potential antimicrobial target. A unique characteristic of BfmR is that its inhibition would have the dual benefit of significantly decreasing in vivo survival and increasing sensitivity to selected antimicrobials. Studies on the clinically relevant strain AB307-0294 have shown BfmR to be essential in vivo. Here, we demonstrate that this phenotype in strains AB307-0294 and AB908 is mediated, in part, by enabling growth in human ascites fluid and serum. Further, BfmR conferred resistance to complement-mediated bactericidal activity that was independent of capsular polysaccharide. Importantly, BfmR also increased resistance to the clinically important antimicrobials meropenem and colistin. BfmR was highly conserved among A. baumannii strains. The crystal structure of the receiver domain of BfmR was determined, lending insight into putative ligand binding sites. This enabled an in silico ligand binding analysis and a blind docking strategy to assess use as a potential druggable target. Predicted binding hot spots exist at the homodimer interface and the phosphorylation site. These data support pursuing the next step in the development process, which includes determining the degree of inhibition needed to impact growth/survival and the development a BfmR activity assay amenable to high-throughput screening for the identification of inhibitors. Such agents would represent a new class of antimicrobials active against A. baumannii which could be active against other Gram-negative bacilli that possess a TCS with shared homology. IMPORTANCE Increasing antibiotic resistance in bacteria, particularly Gram-negative bacilli, has significantly affected the ability of physicians to treat infections, with resultant increased morbidity, mortality, and health

  15. Identifying more epidemic clones during a hospital outbreak of multidrug-resistant Acinetobacter baumannii.


    Domenech de Cellès, Matthieu; Salomon, Jérôme; Marinier, Anne; Lawrence, Christine; Gaillard, Jean-Louis; Herrmann, Jean-Louis; Guillemot, Didier


    Infections caused by multidrug-resistant bacteria are a major concern in hospitals. Current infection-control practices legitimately focus on hygiene and appropriate use of antibiotics. However, little is known about the intrinsic abilities of some bacterial strains to cause outbreaks. They can be measured at a population level by the pathogen's transmission rate, i.e. the rate at which the pathogen is transmitted from colonized hosts to susceptible hosts, or its reproduction number, counting the number of secondary cases per infected/colonized host. We collected data covering a 20-month surveillance period for carriage of multidrug-resistant Acinetobacter baumannii (MDRAB) in a surgery ward. All isolates were subjected to molecular fingerprinting, and a cluster analysis of profiles was performed to identify clonal groups. We then applied stochastic transmission models to infer transmission rates of MDRAB and each MDRAB clone. Molecular fingerprinting indicated that 3 clonal complexes spread in the ward. A first model, not accounting for different clones, quantified the level of in-ward cross-transmission, with an estimated transmission rate of 0.03/day (95% credible interval [0.012-0.049]) and a single-admission reproduction number of 0.61 [0.30-1.02]. The second model, accounting for different clones, suggested an enhanced transmissibility of clone 3 (transmission rate 0.047/day [0.018-0.091], with a single-admission reproduction number of 0.81 [0.30-1.56]). Clones 1 and 2 had comparable transmission rates (respectively, 0.016 [0.001-0.045], 0.014 [0.001-0.045]). The method used is broadly applicable to other nosocomial pathogens, as long as surveillance data and genotyping information are available. Building on these results, more epidemic clones could be identified, and could lead to follow-up studies dissecting the functional basis for variation in transmissibility of MDRAB lineages. PMID:23029226

  16. Novel Approach To Optimize Synergistic Carbapenem-Aminoglycoside Combinations against Carbapenem-Resistant Acinetobacter baumannii

    PubMed Central

    Yadav, Rajbharan; Landersdorfer, Cornelia B.; Nation, Roger L.; Boyce, John D.


    Acinetobacter baumannii is among the most dangerous pathogens and emergence of resistance is highly problematic. Our objective was to identify and rationally optimize β-lactam-plus-aminoglycoside combinations via novel mechanism-based modeling that synergistically kill and prevent resistance of carbapenem-resistant A. baumannii. We studied combinations of 10 β-lactams and three aminoglycosides against four A. baumannii strains, including two imipenem-intermediate (MIC, 4 mg/liter) and one imipenem-resistant (MIC, 32 mg/liter) clinical isolate, using high-inoculum static-concentration time-kill studies. We present the first application of mechanism-based modeling for killing and resistance of A. baumannii using Monte Carlo simulations of human pharmacokinetics to rationally optimize combination dosage regimens for immunocompromised, critically ill patients. All monotherapies achieved limited killing (≤2.3 log10) of A. baumannii ATCC 19606 followed by extensive regrowth for aminoglycosides. Against this strain, imipenem-plus-aminoglycoside combinations yielded more rapid and extensive killing than other β-lactam-plus-aminoglycoside combinations. Imipenem at 8 mg/liter combined with an aminoglycoside yielded synergistic killing (>5 log10) and prevented regrowth of all four strains. Modeling demonstrated that imipenem likely killed the aminoglycoside-resistant population and vice versa and that aminoglycosides enhanced the target site penetration of imipenem. Against carbapenem-resistant A. baumannii (MIC, 32 mg/liter), optimized combination regimens (imipenem at 4 g/day as a continuous infusion plus tobramycin at 7 mg/kg of body weight every 24 h) were predicted to achieve >5 log10 killing without regrowth in 98.2% of patients. Bacterial killing and suppression of regrowth were best achieved for combination regimens with unbound imipenem steady-state concentrations of at least 8 mg/liter. Imipenem-plus-aminoglycoside combination regimens are highly promising and

  17. Predictors of mortality in patients with extensively drug-resistant Acinetobacter baumannii pneumonia receiving colistin therapy.


    Choi, Ik Sung; Lee, Yu Ji; Wi, Yu Mi; Kwan, Byung Soo; Jung, Kae Hwa; Hong, Woong Pyo; Kim, June Myong


    The ratio of the area under the free (unbound) concentration-time curve to minimum inhibitory concentration (fAUC/MIC) was proposed to be the pharmacokinetic/pharmacodynamic index most strongly linked to the antibacterial effect of colistin against Acinetobacter baumannii. A retrospective study of patients who received colistin to treat pneumonia caused by extensively drug-resistant (XDR) A. baumannii over a 4-year period was performed to assess the impact of the colistin MIC on mortality. A total of 227 patients were included in the analysis. The 7-day and 14-day mortality rates of patients with XDR A. baumannii pneumonia receiving colistin therapy were 15.0% and 23.8%, respectively. In the multivariate analysis, Acute Physiology and Chronic Health Evaluation (APACHE) II score, days from index culture to first dose of colistin, underlying tumour and septic shock at presentation were independent predictors of mortality in patients with XDR A. baumannii pneumonia receiving colistin therapy. In the univariate analysis, the colistin dose based on ideal body weight (IBW) correlated with patient outcome. Therefore, the use of IBW appeared to be more appropriate to calculate the colistin dosage. In addition, these results highlight the clinical significance of colistin MIC in patients with XDR A. baumannii pneumonia receiving colistin therapy. Although MICs were in the 'susceptible' range, patients infected with isolates with high colistin MICs showed a poorer clinical response rate than patients infected with isolates with low colistin MICs. Further clinical studies are needed to evaluate the roles of colistin MIC for predicting mortality in XDR A. baumannii pneumonia with a high colistin MIC. PMID:27423416

  18. Candida spp. airway colonization: A potential risk factor for Acinetobacter baumannii ventilator-associated pneumonia.


    Tan, Xiaojiang; Zhu, Song; Yan, Dongxing; Chen, Weiping; Chen, Ruilan; Zou, Jian; Yan, Jingdong; Zhang, Xiangdong; Farmakiotis, Dimitrios; Mylonakis, Eleftherios


    This retrospective study was conducted to identify potential risk factors for Acinetobacter baumannii (A. baumannii) ventilator-associated pneumonia (VAP) and evaluate the association between Candida spp. airway colonization and A. baumannii VAP. Intensive care unit (ICU) patients who were on mechanical ventilation (MV) for ≥48 hours were divided into the following groups: patients with and without Candida spp. airway colonization; colonized patients receiving antifungal treatment or not; patients with A. baumannii VAP and those without VAP. Logistic regression analysis and propensity score matching were used to identify factors independently associated with A. baumannii VAP. Among 618 eligible patients, 264 (43%) had Candida spp. airway colonization and 114 (18%) developed A. baumannii VAP. Along with MV for ≥7 days (adjusted odds ratio [aOR] 8.9, 95% confidence intervals [95% CI] 4.9-15.8) and presence of a central venous catheter (aOR 3.2, 95% CI 1.1-9), Candida spp. airway colonization (aOR 2.6, 95% CI 1.6-4.3) was identified as an independent risk factor for A. baumannii VAP. Patients with Candida spp. airway colonization were more likely to develop A. baumannii VAP than non-colonized patients (23% vs 15%, P=.01 and 34% vs. 15%, P<.001 in propensity score-matched subgroups). Administration of antifungal agents was not associated with A. baumannii VAP (29% vs. 21%, P=.153) but with higher in-hospital mortality (53% vs. 39%, P=.037). Candida spp. airway colonization (43%) and A. baumannii VAP (18%) were common in ICU patients who were on mechanical ventilation for at least 48 hours. Candida spp. airway colonization was an independent risk factor for subsequent A. baumannii VAP. PMID:27001670

  19. A new trilocus sequence-based multiplex-PCR to detect major Acinetobacter baumannii clones.


    Martins, Natacha; Picão, Renata Cristina; Cerqueira-Alves, Morgana; Uehara, Aline; Barbosa, Lívia Carvalho; Riley, Lee W; Moreira, Beatriz Meurer


    A collection of 163 Acinetobacter baumannii isolates detected in a large Brazilian hospital, was potentially related with the dissemination of four clonal complexes (CC): 113/79, 103/15, 109/1 and 110/25, defined by University of Oxford/Institut Pasteur multilocus sequence typing (MLST) schemes. The urge of a simple multiplex-PCR scheme to specify these clones has motivated the present study. The established trilocus sequence-based typing (3LST, for ompA, csuE and blaOXA-51-like genes) multiplex-PCR rapidly identifies international clones I (CC109/1), II (CC118/2) and III (CC187/3). Thus, the system detects only one (CC109/1) out of four main CC in Brazil. We aimed to develop an alternative multiplex-PCR scheme to detect these clones, known to be present additionally in Africa, Asia, Europe, USA and South America. MLST, performed in the present study to complement typing our whole collection of isolates, confirmed that all isolates belonged to the same four CC detected previously. When typed by 3LST-based multiplex-PCR, only 12% of the 163 isolates were classified into groups. By comparative sequence analysis of ompA, csuE and blaOXA-51-like genes, a set of eight primers was designed for an alternative multiplex-PCR to distinguish the five CC 113/79, 103/15, 109/1, 110/25 and 118/2. Study isolates and one CC118/2 isolate were blind-tested with the new alternative PCR scheme; all were correctly clustered in groups of the corresponding CC. The new multiplex-PCR, with the advantage of fitting in a single reaction, detects five leading A. baumannii clones and could help preventing the spread in healthcare settings. PMID:27125687

  20. Structures of the Class D Carbapenemase OXA-24 from Acinetobacter baumannii in Complex with Doripenem

    SciTech Connect

    Schneider, Kyle D.; Ortega, Caleb J.; Renck, Nicholas A.; Bonomo, Robert A.; Powers, Rachel A.; Leonard, David A.


    The emergence of class D {beta}-lactamases with carbapenemase activity presents an enormous challenge to health practitioners, particularly with regard to the treatment of infections caused by Gram-negative pathogens such as Acinetobacter baumannii. Unfortunately, class D {beta}-lactamases with carbapenemase activity are resistant to {beta}-lactamase inhibitors. To better understand the details of the how these enzymes bind and hydrolyze carbapenems, we have determined the structures of two deacylation-deficient variants (K84D and V130D) of the class D carbapenemase OXA-24 with doripenem bound as a covalent acyl-enzyme intermediate. Doripenem adopts essentially the same configuration in both OXA-24 variant structures, but varies significantly when compared to the non-carbapenemase class D member OXA-1/doripenem complex. The alcohol of the 6a hydroxyethyl moiety is directed away from the general base carboxy-K84, with implications for activation of the deacylating water. The tunnel formed by the Y112/M223 bridge in the apo form of OXA-24 is largely unchanged by the binding of doripenem. The presence of this bridge, however, causes the distal pyrrolidine/sulfonamide group to bind in a drastically different conformation compared to doripenem bound to OXA-1. The resulting difference in the position of the side-chain bridge sulfur of doripenem is consistent with the hypothesis that the tautomeric state of the pyrroline ring contributes to the different carbapenem hydrolysis rates of OXA-1 and OXA-24. These findings represent a snapshot of a key step in the catalytic mechanism of an important class D enzyme, and might be useful for the design of novel inhibitors.

  1. Antimicrobial photodynamic therapy in a mouse model of Acinetobacter baumannii burn infection

    NASA Astrophysics Data System (ADS)

    Dai, Tianhong; Tegos, George P.; Lu, Zongshun; Zhiyentayev, Timur; Huang, Liyi; Franklin, Michael J.; Baer, David G.; Hamblin, Michael R.


    Multi-drug resistant Acinetobacter baumanii infections represent a growing problem, especially in traumatic wounds and burns suffered by military personnel injured in Middle Eastern conflicts. Effective treatment using traditional antibiotics can be extremely difficult and new antimicrobial approaches are being investigated. One of these antimicrobial alternatives could be the combination of non-toxic photosensitizers (PS) and visible light known as photodynamic therapy (PDT). We report on the establishment of a new mouse model of full thickness thermal burns infected with a bioluminescent derivative of a clinical Iraqi isolate of A. baumannii and its PDT treatment by topical application of a PS produced by covalent conjugation chlorin(e6) to polyethylenimine followed by illumination of the burn surface with red light. Application of 108 A. baumannii cells to the surface of 10-second burns made on the dorsal surface of shaved female BALB/c mice led to chronic infections that lasted on average 22 days characterized by a remarkably stable bacterial bioluminescence. PDT carried out on day 0 soon after applying bacteria gave over three logs of loss of bacterial luminescence in a light exposure dependent manner, while PDT carried out on day 1 and day 2 gave approximately a 1.7-log reduction. Application of PS dissolved in 10% or 20% DMSO without light gave only modest reduction in bacterial luminescence from mouse burns. Some bacterial regrowth in the treated burn was observed but was generally modest. It was also found that PDT did not lead to inhibition of wound healing. The data suggest that PDT may be an effective new treatment for multi-drug resistant localized A. baumannii infections.

  2. Carbapenem-Resistant Acinetobacter baumannii: Concomitant Contamination of Air and Environmental Surfaces.


    Shimose, Luis A; Masuda, Eriko; Sfeir, Maroun; Berbel Caban, Ana; Bueno, Maria X; dePascale, Dennise; Spychala, Caressa N; Cleary, Timothy; Namias, Nicholas; Kett, Daniel H; Doi, Yohei; Munoz-Price, L Silvia


    OBJECTIVE To concomitantly determine the differential degrees of air and environmental contamination by Acinetobacter baumannii based on anatomic source of colonization and type of ICU layout (single-occupancy vs open layout). DESIGN Longitudinal prospective surveillance study of air and environmental surfaces in patient rooms. SETTING A 1,500-bed public teaching hospital in Miami, Florida. PATIENTS Consecutive A. baumannii-colonized patients admitted to our ICUs between October 2013 and February 2014. METHODS Air and environmental surfaces of the rooms of A. baumannii-colonized patients were sampled daily for up to 10 days. Pulsed-field gel electrophoresis (PFGE) was used to type and match the matching air, environmental, and clinical A. baumannii isolates. RESULTS A total of 25 A. baumannii-colonized patients were identified during the study period; 17 were colonized in the respiratory tract and 8 were colonized in the rectum. In rooms with rectally colonized patients, 38.3% of air samples were positive for A. baumannii; in rooms of patients with respiratory colonization, 13.1% of air samples were positive (P=.0001). In rooms with rectally colonized patients, 15.5% of environmental samples were positive for A. baumannii; in rooms of patients with respiratory colonization, 9.5% of environmental samples were positive (P=.02). The rates of air contamination in the open-layout and single-occupancy ICUs were 17.9% and 21.8%, respectively (P=.5). Environmental surfaces were positive in 9.5% of instances in open-layout ICUs versus 13.4% in single-occupancy ICUs (P=.09). CONCLUSIONS Air and environmental surface contaminations were significantly greater among rectally colonized patients; however, ICU layout did not influence the rate of contamination. Infect Control Hosp Epidemiol 2016;37:777-781. PMID:27045768

  3. Diversity of multi-drug resistant Acinetobacter baumannii population in a major hospital in Kuwait

    PubMed Central

    Vali, Leila; Dashti, Khadija; Opazo-Capurro, Andrés F.; Dashti, Ali A.; Al Obaid, Khaled; Evans, Benjamin A.


    Acinetobacter baumannii is one of the most important opportunistic pathogens that causes serious health care associated complications in critically ill patients. In the current study we report on the diversity of the clinical multi-drug resistant (MDR) A. baumannii in Kuwait by molecular characterization. One hundred A. baumannii were isolated from one of the largest governmental hospitals in Kuwait. Following the identification of the isolates by molecular methods, the amplified blaOXA-51-like gene product of one isolate (KO-12) recovered from blood showed the insertion of the ISAba19 at position 379 in blaOXA-78. Of the 33 MDR isolates, 28 (85%) contained blaOXA-23, 2 (6%) blaOXA-24 and 6 (18%) blaPER-1 gene. We did not detect blaOXA-58, blaVIM, blaIMP, blaGES, blaVEB, and blaNDM genes in any of the tested isolates. In three blaPER-1 positive isolates the genetic environment of blaPER-1 consisted of two copies of ISPa12 (tnpiA1) surrounding the blaPER-1 gene on a highly stable plasmid of ca. 140-kb. Multilocus-sequence typing (MLST) analysis of the 33 A. baumannii isolates identified 20 different STs, of which six (ST-607, ST-608, ST-609, ST-610, ST-611, and ST-612) were novel. Emerging STs such as ST15 (identified for the first time in the Middle East), ST78 and ST25 were also detected. The predominant clonal complex was CC2. Pulsed-field gel electrophoresis and MLST defined the MDR isolates as multi-clonal with diverse lineages. Our results lead us to believe that A. baumannii is diverse in clonal origins and/or is undergoing clonal expansion continuously while multiple lineages of MDR A. baumannii circulate in hospital ward simultaneously. PMID:26257720

  4. Emergence of multidrug-resistant Acinetobacter baumannii producing OXA-23 Carbapenemase in Qatar

    PubMed Central

    Rolain, J.-M.; Loucif, L.; Al-Maslamani, M.; Elmagboul, E.; Al-Ansari, N.; Taj-Aldeen, S.; Shaukat, A.; Ahmedullah, H.; Hamed, M.


    The objective of our study was to describe the molecular support of carbapenem resistance from randomly selected clinical isolates of multidrug-resistant (MDR) Acinetobacter baumannii as a pilot study from the Hamad Medical Corporation (HMC), Qatar. Results of our report will be used to study carbapenemases using molecular techniques in all isolated MDR A. baumannii. Forty-eight MDR A. baumannii were randomly selected from isolates preserved at HMC. Identification of all isolates was confirmed by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. Antibiotic resistance was tested phenotypically by Phoenix and confirmed by Etest. The molecular support of carbapenemases (blaOXA-23, blaOXA-24, blaOXA-58, blaNDM) was investigated by real-time PCR. The epidemiologic relatedness of the isolates was verified by phylogenetic analysis based on partial sequences of CsuE and blaOXA-51 genes. All 48 isolates were identified as A. baumannii and were confirmed to be resistant to most antibiotics, especially meropenem, imipenems, ciprofloxacin, levofloxacin, amikacin, gentamicin and most of the β-lactams; they were sensitive to colistin. All the isolates were positive for blaOXA-23 and negative for the other tested carbapenemase genes. Clonality analysis demonstrated that different lineages were actually circulating in Qatar; and we suggest that an outbreak occurred in the medical intensive care unit of HMC between 2011 and 2012. Here we report the emergence of MDR A. baumannii producing the carbapenemase OXA-23 in Qatar. PMID:27054039

  5. Carbapenem-Resistant Acinetobacter baumannii from Serbia: Revision of CarO Classification

    PubMed Central

    Novovic, Katarina; Mihajlovic, Sanja; Vasiljevic, Zorica; Filipic, Brankica; Begovic, Jelena; Jovcic, Branko


    Carbapenem-resistant A. baumannii present a significant therapeutic challenge for the treatment of nosocomial infections in many European countries. Although it is known that the gradient of A. baumannii prevalence increases from northern to southern Europe, this study provides the first data from Serbia. Twenty-eight carbapenem-resistant A. baumannii clinical isolates were collected at a Serbian pediatric hospital during a 2-year period. The majority of isolates (67.68%) belonged to the sequence type Group 1, European clonal complex II. All isolates harbored intrinsic OXA-51 and AmpC cephalosporinase. OXA-23 was detected in 16 isolates (57.14%), OXA-24 in 23 isolates (82.14%) and OXA-58 in 11 isolates (39.29%). Six of the isolates (21.43%) harbored all of the analyzed oxacillinases, except OXA-143 and OXA-235 that were not detected in this study. Production of oxacillinases was detected in different pulsotypes indicating the presence of horizontal gene transfer. NDM-1, VIM and IMP were not detected in analyzed clinical A. baumannii isolates. ISAba1 insertion sequence was present upstream of OXA-51 in one isolate, upstream of AmpC in 13 isolates and upstream of OXA-23 in 10 isolates. In silico analysis of carO sequences from analyzed A. baumannii isolates revealed the existence of two out of six highly polymorphic CarO variants. The phylogenetic analysis of CarO protein among Acinetobacter species revised the previous classification CarO variants into three groups based on strong bootstraps scores in the tree analysis. Group I comprises four variants (I-IV) while Groups II and III contain only one variant each. One half of the Serbian clinical isolates belong to Group I variant I, while the other half belongs to Group I variant III. PMID:25822626

  6. Characteristics of a novel Acinetobacter sp. and its kinetics in hexavalent chromium bioreduction.


    Narayani, M; Vidya Shetty, K


    Cr-B2, a Gram-negative hexavalent chromium [Cr(VI)] reducing bacteria, was isolated from the aerator water of an activated sludge process in the wastewater treatment facility of a dye and pigment based chemical industry. Cr- B2 exhibited a resistance for 1,100 mg/l Cr(VI) and, similarly, resistance against other heavy metal ions such as Ni2+ (800 mg/l), Cu2+ (600 mg/l), Pb2+ (1,100 mg/l), Cd2+ (350 mg/l), Zn2+ (700 mg/l), and Fe3+ (1,000 mg/l), and against selected antibiotics. Cr-B2 was observed to efficiently reduce 200 mg/l Cr(VI) completely in both nutrient and LB media, and could convert Cr(VI) to Cr(III) aerobically. Cr(VI) reduction kinetics followed allosteric enzyme kinetics. The Km values were found to be 43.11 mg/l for nutrient media and 38.05 mg/l for LB media. Vmax values of 13.17 mg/l/h and 12.53 mg/l/h were obtained for nutrient media and LB media, respectively, and the cooperativity coefficients (n) were found to be 8.47 and 3.49, respectively, indicating positive cooperativity in both cases. SEM analysis showed the formation of wrinkles and depressions in the cells when exposed to an 800 mg/l Cr(VI) concentration. The organism was seen to exhibit pleomorphic behavior. Cr-B2 was identified on the basis of morphological, biochemical, and partial 16S rRNA gene sequencing chracterizations and found to be Acinetobacter sp. PMID:22561865

  7. Resistance Markers and Genetic Diversity in Acinetobacter baumannii Strains Recovered from Nosocomial Bloodstream Infections

    PubMed Central

    Martins, Hanoch S. I.; Bomfim, Maria Rosa Q.; França, Rafaela O.; Farias, Luiz M.; Carvalho, Maria Auxiliadora R.; Serufo, José Carlos; Santos, Simone G.


    In this study, phenotypic and genotypic methods were used to detect metallo-β-lactamases, cephalosporinases and oxacillinases and to assess genetic diversity among 64 multiresistant Acinetobacter baumannii strains recovered from blood cultures in five different hospitals in Brazil from December 2008 to June 2009. High rates of resistance to imipenem (93.75%) and polymyxin B (39.06%) were observed using the disk diffusion (DD) method and by determining the minimum inhibitory concentration (MIC). Using the disk approximation method, thirty-nine strains (60.9%) were phenotypically positive for class D enzymes, and 51 strains (79.6%) were positive for cephalosporinase (AmpC). Using the E-test, 60 strains (93.75%) were positive for metallo-β-lactamases (MβLs). All strains were positive for at least one of the 10 studied genes; 59 (92.1%) contained blaVIM-1, 79.6% contained blaAmpC, 93.7% contained blaOXA23 and 84.3% contained blaOXA51. Enterobacteria Repetitive Intergenic Consensus (ERIC)-PCR analysis revealed a predominance of certain clones that differed from each other. However, the same band pattern was observed in samples from the different hospitals studied, demonstrating correlation between the genotypic and phenotypic results. Thus, ERIC-PCR is an appropriate method for rapidly clustering genetically related isolates. These results suggest that defined clonal clusters are circulating within the studied hospitals. These results also show that the prevalence of MDR A. baumannii may vary among clones disseminated in specific hospitals, and they emphasize the importance of adhering to appropriate infection control measures. PMID:24477210

  8. Intraspecies Transfer of the Chromosomal Acinetobacter baumannii blaNDM-1 Carbapenemase Gene.


    Krahn, Thomas; Wibberg, Daniel; Maus, Irena; Winkler, Anika; Bontron, Séverine; Sczyrba, Alexander; Nordmann, Patrice; Pühler, Alfred; Poirel, Laurent; Schlüter, Andreas


    The species Acinetobacter baumannii is one of the most important multidrug-resistant human pathogens. To determine its virulence and antibiotic resistance determinants, the genome of the nosocomial blaNDM-1-positive A. baumannii strain R2090 originating from Egypt was completely sequenced. Genome analysis revealed that strain R2090 is highly related to the community-acquired Australian A. baumannii strain D1279779. The two strains belong to sequence type 267 (ST267). Isolate R2090 harbored the chromosomally integrated transposon Tn125 carrying the carbapenemase gene blaNDM-1 that is not present in the D1279779 genome. To test the transferability of the metallo-β-lactamase (MBL) gene region, the clinical isolate R2090 was mated with the susceptible A. baumannii recipient CIP 70.10, and the carbapenem-resistant derivative R2091 was obtained. Genome sequencing of the R2091 derivative revealed that it had received an approximately 66-kb region comprising the transposon Tn125 embedding the blaNDM-1 gene. This region had integrated into the chromosome of the recipient strain CIP 70.10. From the four known mechanisms for horizontal gene transfer (conjugation, outer membrane vesicle-mediated transfer, transformation, and transduction), conjugation could be ruled out, since strain R2090 lacks any plasmid, and a type IV secretion system is not encoded in its chromosome. However, strain R2090 possesses three putative prophages, two of which were predicted to be complete and therefore functional. Accordingly, it was supposed that the transfer of the resistance gene region from the clinical isolate R2090 to the recipient occurred by general transduction facilitated by one of the prophages present in the R2090 genome. Hence, phage-mediated transduction has to be taken into account for the dissemination of antibiotic resistance genes within the species A. baumannii. PMID:26953198

  9. Investigation of the molecular epidemiology of Acinetobacter baumannii isolated from patients and environmental contamination.


    Ying, Chunmei; Li, Yongli; Wang, Yaping; Zheng, Bing; Yang, Chengde


    The objective of this work was to investigate correlations between Acinetobacter baumannii isolates from neurosurgical intensive care unit patients and its environment. This is a prospective, observational study. The minimal inhibitory concentrations of antimicrobial agents against 27 clinical and 28 environmental isolates were determined by the agar dilution method. Molecular genotyping was performed by enterobacterial repetitive intergenic consensus PCR (ERIC-PCR), pulsed-field gel electrophoresis (PFGE) and multi-locus sequence typing (MLST). The presence of carbapenemase and metallo-β-lactamase genes were analyzed by specific PCRs and DNA sequencing. From the clinical A. baumannii isolates, 25.9% were found resistant to minocycline, 51.9% to cefoperazone-sulbactam, 59.3% to imipenem and 70% resistant to other antimicrobial agents. Environmental isolates were more sensitive compared with clinical isolates (P<0.05). Twenty-seven clinical isolates comprised three ERIC-PCR genotypes, four major PFGE pulsotypes and five distinct MLST sequence types (STs) (ST208, ST368, ST191, ST195, ST540), all belonging to CC92 with only one locus (gpi) difference among them. Twenty-eight environmental isolates showed more diverse genetic types than clinical isolates and comprised six ERIC-PCR groups, nine PFGE groups and two main STs (ST208, ST229). Four clinical and 15 environmental isolates could not be identified by MLST and were assigned to non-clonal STs. We identified the presence of the blaOXA-23 carbapenemase encoding gene in most of the clinical (21/27) but fewer in the environmental isolates (3/28). The A. baumannii strains isolated from patients were genetically similar to the environmental strains, with CC92 members as the major fraction but with different antibiotic susceptibilities. PMID:25873322

  10. Antibiotic Resistance of Acinetobacter baumannii in Iran: A Systemic Review of the Published Literature

    PubMed Central

    Moradi, Jale; Hashemi, Farhad B.; Bahador, Abbas


    Objectives Acinetobacter baumannii is a bacterium responsible for health care-associated infections, and it frequently develops multiple drug resistance (MDR). The prevalence of antibiotic-resistant A. baumannii in Iran has increased, and this may cause significant clinical problems. Therefore, in order to elucidate the development of antibiotic resistance, we performed a systematic review of the literature published on antibiotic-resistant A. baumannii reported in Iran. Methods Thirty-six publications that met the criteria for inclusion were reviewed from an initial 87 papers. Selected papers published between 2008 and September 2014, were categorized on the basis of the sample collecting year been between 2001 and 2013. Results Analysis of data revealed that, in general, there was an increase in antimicrobial resistance. During the initial time point of these studies (2001–2007) there was a high rate of resistance to all antibiotics, with the exception of carbapenems, lipopeptides, and aminoglycosides that had a low resistance rate in comparison with the others. Also, the resistance rate was increased in one group of these three antimicrobial groups from 2010 to 2013. In particular, there was an increase in resistance to carbapenems (imipenem and meropenem) from 2010–2011 and 2012–2013, whereas no significant change in the resistance rate of the other two antimicrobial groups (lipopeptides and aminoglycosides) during the study time was observed, although we did observe certain trends in amikacin (aminoglycoside group antibiotic) between 2011–2012 and 2012–2013. Conclusion These findings indicate that antimicrobial resistance of A. baumannii in Iran has increased, which may very well affect the antimicrobial resistance of this organism worldwide. Based on these results, novel prevention and treatment strategies against A. baumannii infections are warranted. Furthermore, these data may assist in revising treatment guidelines and regional policies in care

  11. Protective Effect of a Synbiotic against Multidrug-Resistant Acinetobacter baumannii in a Murine Infection Model.


    Asahara, Takashi; Takahashi, Akira; Yuki, Norikatsu; Kaji, Rumi; Takahashi, Takuya; Nomoto, Koji


    This study investigated the ability of the probiotic Bifidobacterium breve strain Yakult (BbY) to protect against infection, as well as the potentiation of BbY activity by the synbiotic combination of BbY and prebiotic galactooligosaccharides (GOS). The study employed a mouse model of lethal intestinal multidrug-resistant Acinetobacter baumannii (MDRAb) infection. The endogenous intestinal microbiota was disrupted by the administration of multiple antibiotics, causing the loss of endogenous Bifidobacterium Oral infection of these mice with MDRAb resulted in marked growth of this organism. Additional treatment of the infected mice with a sublethal dose of 5-fluorouracil (5-FU) induced systemic invasion by MDRAb and subsequent animal death. The continuous oral administration of BbY increased the survival rate and inhibited the intestinal growth and invasion by MDRAb in the infection model. Disruptions of the intestinal environment and barrier function in the infected mice were attenuated by BbY. Protection against the MDRAb infection was markedly potentiated by a synbiotic combination of BbY and GOS, although GOS by itself did not provide protection. Negative correlations were observed between intestinal MDRAb and BbY counts or acetic acid levels; positive correlations were observed between acetic acid levels and intestinal epithelium expression of tight-junction-related genes. These results demonstrated that the probiotic and synbiotic markedly potentiated protection against fatal intestinal infection caused by a multidrug-resistant bacterium. Probiotics and synbiotics are presumed to provide protection by compensation for the disrupted indigenous populations, thereby maintaining the intestinal environments and barrier functions otherwise targeted during opportunistic infection by MDRAb. PMID:26953197

  12. Strategies for the treatment of polymyxin B-resistant Acinetobacter baumannii infections.


    Menegucci, Thatiany Cevallos; Albiero, James; Migliorini, Letícia Busato; Alves, Janio Leal Borges; Viana, Giselle Fukita; Mazucheli, Josmar; Carrara-Marroni, Floristher Elaine; Cardoso, Celso Luiz; Tognim, Maria Cristina Bronharo


    In this study, the activity of meropenem (MEM), fosfomycin (FOF) and polymyxin B (PMB), alone and in combination, was analysed. In addition, optimisation of the pharmacodynamic index of MEM and FOF against six isolates of OXA-23-producing Acinetobacter baumannii (including three resistant to PMB) that were not clonally related was assessed. Antimicrobial combinations were evaluated by chequerboard analysis and were considered synergistic when the fractional inhibitory concentration index (FICI) was ≤0.5. Pharmacodynamic analyses of the MEM and FOF dosing schemes were performed by Monte Carlo simulation. The target pharmacodynamic index (%ƒT>MIC) for MEM and FOF was ≥40% and ≥70%, respectively, and a probability of target attainment (PTA) ≥0.9 was considered adequate. Among the PMB-resistant isolates, combinations of PMB+MEM and PMB+FOF+MEM showed the highest synergistic activity (FICI ≤0.125); isolates that were previously PMB-resistant were included in the susceptible category using CLSI interpretive criteria. Pharmacodynamic evaluation found that for a FOF minimum inhibitory concentration (MIC) of ≤16μg/mL, treatment both by bolus dosing and prolonged infusion achieved adequate PTA, whilst for MIC=32μg/mL only infusion achieved adequate PTA. For a MEM MIC of 4μg/mL, only the bolus treatment scheme with 1.5g q6h and the infusion schemes with 1.0g q8h, 1.5g q6h and 2.0g q8h achieved PTA ≥0.9. Results of antimicrobial and pharmacodynamic analyses can assist in treating infections caused by multidrug-resistant A. baumannii. However, in vivo clinical studies are essential to evaluate the true role of these compounds, including intravenous antimicrobial FOF therapy. PMID:27068675

  13. Characterising the Transmission Dynamics of Acinetobacter baumannii in Intensive Care Units Using Hidden Markov Models.


    Doan, Tan N; Kong, David C M; Marshall, Caroline; Kirkpatrick, Carl M J; McBryde, Emma S


    Little is known about the transmission dynamics of Acinetobacter baumannii in hospitals, despite such information being critical for designing effective infection control measures. In the absence of comprehensive epidemiological data, mathematical modelling is an attractive approach to understanding transmission process. The statistical challenge in estimating transmission parameters from infection data arises from the fact that most patients are colonised asymptomatically and therefore the transmission process is not fully observed. Hidden Markov models (HMMs) can overcome this problem. We developed a continuous-time structured HMM to characterise the transmission dynamics, and to quantify the relative importance of different acquisition sources of A. baumannii in intensive care units (ICUs) in three hospitals in Melbourne, Australia. The hidden states were the total number of patients colonised with A. baumannii (both detected and undetected). The model input was monthly incidence data of the number of detected colonised patients (observations). A Bayesian framework with Markov chain Monte Carlo algorithm was used for parameter estimations. We estimated that 96-98% of acquisition in Hospital 1 and 3 was due to cross-transmission between patients; whereas most colonisation in Hospital 2 was due to other sources (sporadic acquisition). On average, it takes 20 and 31 days for each susceptible individual in Hospital 1 and Hospital 3 to become colonised as a result of cross-transmission, respectively; whereas it takes 17 days to observe one new colonisation from sporadic acquisition in Hospital 2. The basic reproduction ratio (R0) for Hospital 1, 2 and 3 was 1.5, 0.02 and 1.6, respectively. Our study is the first to characterise the transmission dynamics of A. baumannii using mathematical modelling. We showed that HMMs can be applied to sparse hospital infection data to estimate transmission parameters despite unobserved events and imperfect detection of the organism

  14. In vitro and in vivo antimicrobial activities of gallium nitrate against multidrug-resistant Acinetobacter baumannii.


    Antunes, Luísa C S; Imperi, Francesco; Minandri, Fabrizia; Visca, Paolo


    Multidrug-resistant Acinetobacter baumannii poses a tremendous challenge to traditional antibiotic therapy. Due to the crucial role of iron in bacterial physiology and pathogenicity, we investigated iron metabolism as a possible target for anti-A. baumannii chemotherapy using gallium as an iron mimetic. Due to chemical similarity, gallium competes with iron for binding to several redox enzymes, thereby interfering with a number of essential biological reactions. We found that Ga(NO(3))(3), the active component of an FDA-approved drug (Ganite), inhibits the growth of a collection of 58 A. baumannii strains in both chemically defined medium and human serum, at concentrations ranging from 2 to 80 μM and from 4 to 64 μM, respectively. Ga(NO(3))(3) delayed the entry of A. baumannii into the exponential phase and drastically reduced bacterial growth rates. Ga(NO(3))(3) activity was strongly dependent on iron availability in the culture medium, though the mechanism of growth inhibition was independent of dysregulation of gene expression controlled by the ferric uptake regulator Fur. Ga(NO(3))(3) also protected Galleria mellonella larvae from lethal A. baumannii infection, with survival rates of ≥75%. At therapeutic concentrations for humans (28 μM plasma levels), Ga(NO(3))(3) inhibited the growth in human serum of 76% of the multidrug-resistant A. baumannii isolates tested by ≥90%, raising expectations on the therapeutic potential of gallium for the treatment of A. baumannii bloodstream infections. Ga(NO(3))(3) also showed strong synergism with colistin, suggesting that a colistin-gallium combination holds promise as a last-resort therapy for infections caused by pan-resistant A. baumannii. PMID:22964249

  15. Ultraviolet C light for Acinetobacter baumannii wound infections in mice: Potential use for battlefield wound decontamination?

    PubMed Central

    Dai, Tianhong; Murray, Clinton K.; Vrahas, Mark S.; Baer, David G.; Tegos, George P.; Hamblin, Michael R.


    BACKGROUND Since the beginning of the conflicts in the Middle East, US Army physicians have noted a high rate of multidrug-resistant Acinetobacter baumannii infections among US soldiers wounded and initially treated in Iraq. In this study, we investigated the use of ultraviolet C (UVC) light for prevention of multidrug-resistant A. baumannii wound infections using mouse models. METHODS Partial-thickness skin abrasions and full-thickness burns in mice were infected with a multidrug-resistant A. baumannii isolate recovered from a wounded US soldier deployed to Iraq. The luxCDABE operon, which was contained in plasmid pMF 385, was cloned into the A. baumannii strain. This allowed real-time monitoring of the extent of infection in mice using bioluminescence imaging. UVC light was delivered to the mouse wounds at 30 minutes after the inoculation of A. baumannii. Groups of infected mouse wounds without being exposed to UVC served as the controls. RESULTS In vitro studies demonstrated that A. baumannii cells were inactivated at UVC exposures much lower than those needed for a similar effect on mammalian cells. It was observed in animal studies that UVC (3.24 J/cm2 for abrasions and 2.59 J/cm2 for burns) significantly reduced the bacterial burdens in UVC-treated wounds by approximately 10-fold compared with nontreated controls (p = 0.004 for abrasions, p = 0.019 for burns). DNA lesions were observed by immunofluorescence in mouse skin abrasions immediately after a UVC exposure of 3.24 J/cm2; however, the lesions were extensively repaired within 72 hours. CONCLUSION These results suggested that UVC may be useful in preventing combat-related wound infections. PMID:22929495

  16. Acinetobacter baumannii Response to Host-Mediated Zinc Limitation Requires the Transcriptional Regulator Zur

    PubMed Central

    Mortensen, Brittany L.; Rathi, Subodh; Chazin, Walter J.


    Acinetobacter baumannii is a leading cause of ventilator-associated pneumonia in intensive care units, and the increasing rates of antibiotic resistance make treating these infections challenging. Consequently, there is an urgent need to develop new antimicrobials to treat A. baumannii infections. One potential therapeutic option is to target bacterial systems involved in maintaining appropriate metal homeostasis, processes that are critical for the growth of pathogens within the host. The A. baumannii inner membrane zinc transporter ZnuABC is required for growth under low-zinc conditions and for A. baumannii pathogenesis. The expression of znuABC is regulated by the transcriptional repressor Zur. To investigate the role of Zur during the A. baumannii response to zinc limitation, a zur deletion mutant was generated, and transcriptional changes were analyzed using RNA sequencing. A number of Zur-regulated genes were identified that exhibit increased expression both when zur is absent and under low-zinc conditions, and Zur binds to predicted Zur box sequences of several genes affected by zinc levels or the zur mutation. Furthermore, the zur mutant is impaired for growth in the presence of both high and low zinc levels compared to wild-type A. baumannii. Finally, the zur mutant exhibits a defect in dissemination in a mouse model of A. baumannii pneumonia, establishing zinc sensing as a critical process during A. baumannii infection. These results define Zur-regulated genes within A. baumannii and demonstrate a requirement for Zur in the A. baumannii response to the various zinc levels experienced within the vertebrate host. PMID:24816603

  17. Relationship between Antibiotic Resistance, Biofilm Formation, and Biofilm-Specific Resistance in Acinetobacter baumannii.


    Qi, Lihua; Li, Hao; Zhang, Chuanfu; Liang, Beibei; Li, Jie; Wang, Ligui; Du, Xinying; Liu, Xuelin; Qiu, Shaofu; Song, Hongbin


    In this study, we aimed to examine the relationships between antibiotic resistance, biofilm formation, and biofilm-specific resistance in clinical isolates of Acinetobacter baumannii. The tested 272 isolates were collected from several hospitals in China during 2010-2013. Biofilm-forming capacities were evaluated using the crystal violet staining method. Antibiotic resistance/susceptibility profiles to 21 antibiotics were assessed using VITEK 2 system, broth microdilution method or the Kirby-Bauer disc diffusion method. The minimum inhibitory concentration (MIC) and minimum biofilm eradication concentration (MBEC) to cefotaxime, imipenem, and ciprofloxacin were evaluated using micro dilution assays. Genetic relatedness of the isolates was also analyzed by pulsed-field gel electrophoresis (PFGE) and plasmid profile. Among all the 272 isolates, 31 were multidrug-resistant (MDR), and 166 were extensively drug-resistant (XDR). PFGE typing revealed 167 pattern types and 103 clusters with a similarity of 80%. MDR and XDR isolates built up the main prevalent genotypes. Most of the non-MDR isolates were distributed in a scattered pattern. Additionally, 249 isolates exhibited biofilm formation, among which 63 were stronger biofilm formers than type strain ATCC19606. Population that exhibited more robust biofilm formation likely contained larger proportion of non-MDR isolates. Isolates with higher level of resistance tended to form weaker biofilms. The MBECs for cefotaxime, imipenem, and ciprofloxacin showed a positive correlation with corresponding MICs, while the enhancement in resistance occurred independent of the quantity of biofilm biomass produced. Results from this study imply that biofilm acts as a mechanism for bacteria to get a better survival, especially in isolates with resistance level not high enough. Moreover, even though biofilms formed by isolates with high level of resistance are always weak, they could still provide similar level of protection for the

  18. Isolation and characterization of a novel thermophilic-organic solvent stable lipase from Acinetobacter baylyi.


    Uttatree, Sasithorn; Winayanuwattikun, Pakorn; Charoenpanich, Jittima


    The benzene tolerant Acinetobacter baylyi isolated from marine sludge in Angsila, Thailand could constitutively secrete lipolytic enzymes. The enzyme was successfully purified 21.89-fold to homogeneity by ammonium sulfate precipitation and gel-permeable column chromatography with a relative molecular mass as 30 kDa. The enzyme expressed maximum activity at 60 degrees C and pH 8.0 with p-nitrophenyl palmitate as a substrate and found to be stable in pH and temperature ranging from 6.0-9.0 to 60-80 degrees C, respectively. A study on solvent stability revealed that the enzyme was highly resisted to many organic solvents especially benzene and isoamyl alcohol, but 40% inhibited by decane, hexane, acetonitrile, and short-chain alcohols. Lipase activity was completely inhibited in the presence of Fe(2+), Mn(2+), EDTA, SDS, and Triton X-100 while it was suffered detrimentally by Tween 80. The activity was enhanced by phenylmethylsulfonyl fluoride (PMSF), Na(+), and Mg(2+) and no significant effect was found in the presence of Ca(2+) and Li(+). Half of an activity was retained by Ba(2+), Ag(+), Hg(+), Ni(2+), Zn(2+), and DTT. The enzyme could hydrolyze a wide range of p-nitrophenyl esters, but preferentially medium length acyl chains (C(8)-C(12)). Among natural oils and fats, the enzyme 11-folds favorably catalyzed the hydrolysis of rice bran oil, corn oil, sesame oil, and coconut oil in comparison to palm oil. Moreover, the transesterification activity of palm oil to fatty acid methyl esters (FAMEs) revealed 31.64 +/- 1.58% after 48 h. The characteristics of novel A. baylyi lipase, as high temperature stability, organic solvent tolerance, and transesterification capacity from palm oil to FAMEs, indicate that it could be a vigorous biocatalyzer in the prospective fields as bioenergy industry or even in organic synthesis and pharmaceutical industry. PMID:20177822

  19. Photodynamic Inactivation of Acinetobacter baumannii Using Phenothiazinium Dyes: In Vitro and In Vivo Studies

    PubMed Central

    Ragàs, Xavier; Dai, Tianhong; Tegos, George P.; Agut, Montserrat; Nonell, Santi; Hamblin, Michael R.


    Background and Objective Phenothiazinium dyes have been reported to be effective photosensitizers inactivating a wide range of microorganisms in vitro after illumination with red light. However, their application in vivo has not extensively been explored. This study evaluates the bactericidal activity of phenothiazinium dyes against multidrug-resistant Acinetobacter baumannii both in vitro and in vivo. Study Design/Materials and Methods We report the investigation of toluidine blue O, methylene blue, 1,9-dimethylmethylene blue, and new methylene blue for photodynamic inactivation of multidrug-resistant A. baumannii in vitro. The most effective dye was selected to carry out in vivo studies using third-degree mouse burns infected with a bioluminescent A. baumannii strain, upon irradiation with a 652 nm noncoherent light source. The mice were imaged daily for 2 weeks to observe differences in the bioluminescence–time curve between the photodynamic therapy (PDT)-treated mice in comparison with untreated burns. Results All the dyes were effective in vitro against A. baumannii after 30 J/cm2 irradiation of 635 or 652 nm red light had been delivered, with more effective killing when the dye remained in solution. New methylene blue was the most effective of the four dyes, achieving a 3.2-log reduction of the bacterial luminescence during PDT in vivo after 360 J/cm2 and an 800 μM dye dose. Moreover, a statistically significant reduction of the area under the bioluminescence–time curve of PDT-treated mice was observed showing that the infection did not recur after PDT. Conclusions Phenothiazinium dyes, and especially new methylene blue, are potential photosensitizers for PDT to treat burns infected with multidrug-resistant A. baumannii in vivo. PMID:20583252

  20. Synergistic effects of sulbactam in multi-drug-resistant Acinetobacter baumannii.


    Temocin, Fatih; Erdinc, Fatma Sebnem; Tulek, Necla; Demirelli, Meryem; Ertem, Gunay; Kinikli, Sami; Koksal, Eda


    Acinetobacter baumannii is a frequently isolated etiologic agent of nosocomial infections, especially in intensive care units. With the increase in multi-drug resistance of A. baumannii isolates, finding appropriate treatment alternatives for infections caused by these bacteria has become more difficult, and available alternate treatments include the use of older antibiotics such as colistin or a combination of antibiotics. The current study aimed to evaluate the in vitro efficacy of various antibiotic combinations against multi-drug resistant A. baumannii strains. Thirty multi-drug and carbapenem resistant A. baumannii strains isolated at the Ankara Training and Research Hospital between June 2011 and June 2012 were used in the study. Antibiotic susceptibility tests and species-level identification were performed using conventional methods and the VITEK 2 system. The effects of meropenem, ciprofloxacin, amikacin, tigecycline, and colistin alone and in combination with sulbactam against the isolates were studied using Etest (bioMérieux) in Mueller-Hinton agar medium. Fractional inhibitory concentration index (FIC) was used to determine the efficacy of the various combinations. While all combinations showed a predominant indifferent effect, a synergistic effect was also observed in 4 of the 5 combinations. Synergy was demonstrated in 43% of the isolates with the meropenem-sulbactam combination, in 27% of the isolates with tigecycline-sulbactam, and in 17% of the isolates with colistin-sulbactam and amikacin-sulbactam. No synergy was detected with the sulbactam-ciprofloxacin combination and antagonism was detected only in the sulbactam-colistin combination (6.66% of the isolates). Antibiotic combinations can be used as an alternative treatment approach in multi-drug resistant A. baumannii infections. PMID:26691470

  1. Carbapenem-resistant Acinetobacter baumannii acquired before liver transplantation: Impact on recipient outcomes.


    Freire, Maristela Pinheiro; Pierrotti, Ligia Câmera; Oshiro, Isabel Cristina Villela Soares; Bonazzi, Patrícia Rodrigues; Oliveira, Larissa Marques de; Machado, Anna Silva; Van Der Heijden, Inneke Marie; Rossi, Flavia; Costa, Silvia Figueiredo; D'Albuquerque, Luiz Augusto Carneiro; Abdala, Edson


    Infection with carbapenem-resistant Acinetobacter baumannii (CRAB) after liver transplantation (LT) is associated with high mortality. This study aimed to identify risk factors for post-LT CRAB infection, as well as to evaluate the impact of pre-LT CRAB acquisition on the incidence of post-LT CRAB infection. This was a prospective cohort study of all patients undergoing LT at our facility between October 2009 and October 2011. Surveillance cultures (SCs) were collected immediately before LT and weekly thereafter, until discharge. We analyzed 196 patients who were submitted to 222 LTs. CRAB was identified in 105 (53.6%); 24 (22.9%) of these patients were found to have acquired CRAB before LT, and 85 (81.0%) tested positive on SCs. Post-LT CRAB infection occurred in 56 (28.6%), the most common site being the surgical wound. Multivariate analysis showed that the risk factors for developing CRAB infection were prolonged cold ischemia, post-LT dialysis, LT due to fulminant hepatitis, and pre-LT CRAB acquisition with pre-LT CRAB acquisition showing a considerable trend toward significance (P = 0.06). Among the recipients with CRAB infection, 60-day mortality was 46.4%, significantly higher than among those without (P < 0.001). Mortality risk factors were post-LT infection with multidrug-resistant bacteria, LT performed because of fulminant hepatitis, retransplantation, prolonged cold ischemia, longer LT surgical time, and pre-LT CRAB acquisition, the last showing a trend toward significance (P = 0.08). In conclusion, pre-LT CRAB acquisition appears to increase the risk of post-LT CRAB infection, which has a negative impact on recipient survival. Liver Transplantation 22 615-626 2016 AASLD. PMID:26684547

  2. OmpA Binding Mediates the Effect of Antimicrobial Peptide LL-37 on Acinetobacter baumannii

    PubMed Central

    Lin, Ming-Feng; Tsai, Pei-Wen; Chen, Jeng-Yi; Lin, Yun-You; Lan, Chung-Yu


    Multidrug-resistant Acinetobacter baumannii has recently emerged as an important pathogen in nosocomial infection; thus, effective antimicrobial regimens are urgently needed. Human antimicrobial peptides (AMPs) exhibit multiple functions and antimicrobial activities against bacteria and fungi and are proposed to be potential adjuvant therapeutic agents. This study examined the effect of the human cathelicidin-derived AMP LL-37 on A. baumannii and revealed the underlying mode of action. We found that LL-37 killed A. baumannii efficiently and reduced cell motility and adhesion. The bacteria-killing effect of LL-37 on A. baumannii was more efficient compared to other AMPs, including human ß–defensin 3 (hBD3) and histatin 5 (Hst5). Both flow cytometric analysis and immunofluorescence staining showed that LL-37 bound to A. baumannii cells. Moreover, far-western analysis demonstrated that LL-37 could bind to the A. baumannii OmpA (AbOmpA) protein. An ELISA assay indicated that biotin-labelled LL-37 (BA-LL37) bound to the AbOmpA74-84 peptide in a dose-dependent manner. Using BA-LL37 as a probe, the ~38 kDa OmpA signal was detected in the wild type but the ompA deletion strain did not show the protein, thereby validating the interaction. Finally, we found that the ompA deletion mutant was more sensitive to LL-37 and decreased cell adhesion by 32% compared to the wild type. However, ompA deletion mutant showed a greatly reduced adhesion defect after LL-37 treatment compared to the wild strain. Taken together, this study provides evidence that LL-37 affects A. baumannii through OmpA binding. PMID:26484669

  3. Simple Method for Markerless Gene Deletion in Multidrug-Resistant Acinetobacter baumannii.


    Oh, Man Hwan; Lee, Je Chul; Kim, Jungmin; Choi, Chul Hee; Han, Kyudong


    The traditional markerless gene deletion technique based on overlap extension PCR has been used for generating gene deletions in multidrug-resistant Acinetobacter baumannii. However, the method is time-consuming because it requires restriction digestion of the PCR products in DNA cloning and the construction of new vectors containing a suitable antibiotic resistance cassette for the selection of A. baumannii merodiploids. Moreover, the availability of restriction sites and the selection of recombinant bacteria harboring the desired chimeric plasmid are limited, making the construction of a chimeric plasmid more difficult. We describe a rapid and easy cloning method for markerless gene deletion in A. baumannii, which has no limitation in the availability of restriction sites and allows for easy selection of the clones carrying the desired chimeric plasmid. Notably, it is not necessary to construct new vectors in our method. This method utilizes direct cloning of blunt-end DNA fragments, in which upstream and downstream regions of the target gene are fused with an antibiotic resistance cassette via overlap extension PCR and are inserted into a blunt-end suicide vector developed for blunt-end cloning. Importantly, the antibiotic resistance cassette is placed outside the downstream region in order to enable easy selection of the recombinants carrying the desired plasmid, to eliminate the antibiotic resistance cassette via homologous recombination, and to avoid the necessity of constructing new vectors. This strategy was successfully applied to functional analysis of the genes associated with iron acquisition by A. baumannii ATCC 19606 and to ompA gene deletion in other A. baumannii strains. Consequently, the proposed method is invaluable for markerless gene deletion in multidrug-resistant A. baumannii. PMID:25746991

  4. The Complete Genome and Phenome of a Community-Acquired Acinetobacter baumannii

    PubMed Central

    Farrugia, Daniel N.; Elbourne, Liam D. H.; Hassan, Karl A.; Eijkelkamp, Bart A.; Tetu, Sasha G.; Brown, Melissa H.; Shah, Bhumika S.; Peleg, Anton Y.; Mabbutt, Bridget C.; Paulsen, Ian T.


    Many sequenced strains of Acinetobacter baumannii are established nosocomial pathogens capable of resistance to multiple antimicrobials. Community-acquired A. baumannii in contrast, comprise a minor proportion of all A. baumannii infections and are highly susceptible to antimicrobial treatment. However, these infections also present acute clinical manifestations associated with high reported rates of mortality. We report the complete 3.70 Mbp genome of A. baumannii D1279779, previously isolated from the bacteraemic infection of an Indigenous Australian; this strain represents the first community-acquired A. baumannii to be sequenced. Comparative analysis of currently published A. baumannii genomes identified twenty-four accessory gene clusters present in D1279779. These accessory elements were predicted to encode a range of functions including polysaccharide biosynthesis, type I DNA restriction-modification, and the metabolism of novel carbonaceous and nitrogenous compounds. Conversely, twenty genomic regions present in previously sequenced A. baumannii strains were absent in D1279779, including gene clusters involved in the catabolism of 4-hydroxybenzoate and glucarate, and the A. baumannii antibiotic resistance island, known to bestow resistance to multiple antimicrobials in nosocomial strains. Phenomic analysis utilising the Biolog Phenotype Microarray system indicated that A. baumannii D1279779 can utilise a broader range of carbon and nitrogen sources than international clone I and clone II nosocomial isolates. However, D1279779 was more sensitive to antimicrobial compounds, particularly beta-lactams, tetracyclines and sulphonamides. The combined genomic and phenomic analyses have provided insight into the features distinguishing A. baumannii isolated from community-acquired and nosocomial infections. PMID:23527001

  5. In vitro effects of sulbactam combinations with different antibiotic groups against clinical Acinetobacter baumannii isolates.


    Deveci, Aydin; Coban, Ahmet Yilmaz; Acicbe, Ozlem; Tanyel, Esra; Yaman, Gorkem; Durupinar, Belma


    Treatment of multidrug resistant (MDR) Acinetobacter baumannii infections causes some problems as a result of possessing various antibacterial resistance mechanisms against available antibiotics. Combination of antibiotics, acting by different mechanisms, is used for the treatment of MDR bacterial infections. It is an important factor to determine synergy or antagonism between agents in the combination for the constitution of effective therapy. The study aimed to determine In vitro interactions interpreted according to calculated fractional inhibitory concentration (FIC) index between sulbactam and ceftazidime, ceftriaxone, cefepime, ciprofloxacin, gentamicin, meropenem, tigecycline, and colistin. Ten clinical isolates of A. baumannii were tested for determination of synergistic effects of sulbactam with different antimicrobial combinations. Minimal inhibitory concentration (MIC) values of both sulbactam and combined antibiotics decreased 2- to 128-fold. Synergy and partial synergy were determined in combination of sulbactam with ceftazidime and gentamicin (FIC index: ≤ 0.5 or >0.5 to <1) and MIC values of both ceftazidime and gentamicin for five isolates fell down below the susceptibility break point. Similarly, MIC value of ciprofloxacin for six ciprofloxacin resistant isolates was determined as below the susceptibility break point in combination. However, all isolates were susceptible to colistin and tigecycline, MIC values of both were decreased in combination with sulbactam. Although synergistic and partial synergistic effects were observed in the combination of sulbactam and ceftriaxone, all isolates remained resistant to ceftriaxone. The effect of cefepime-sulbactam combination was synergy in five, partial synergy in one and indifferent in four isolates. Meropenem and sulbactam showed a partial synergistic effect (FIC index: >0.5 to <1) in three, an additive effect (FIC index: 1) in one and an indifferent effect (FIC index: >1-2) in six isolates

  6. Relationship between Antibiotic Resistance, Biofilm Formation, and Biofilm-Specific Resistance in Acinetobacter baumannii

    PubMed Central

    Qi, Lihua; Li, Hao; Zhang, Chuanfu; Liang, Beibei; Li, Jie; Wang, Ligui; Du, Xinying; Liu, Xuelin; Qiu, Shaofu; Song, Hongbin


    In this study, we aimed to examine the relationships between antibiotic resistance, biofilm formation, and biofilm-specific resistance in clinical isolates of Acinetobacter baumannii. The tested 272 isolates were collected from several hospitals in China during 2010–2013. Biofilm-forming capacities were evaluated using the crystal violet staining method. Antibiotic resistance/susceptibility profiles to 21 antibiotics were assessed using VITEK 2 system, broth microdilution method or the Kirby-Bauer disc diffusion method. The minimum inhibitory concentration (MIC) and minimum biofilm eradication concentration (MBEC) to cefotaxime, imipenem, and ciprofloxacin were evaluated using micro dilution assays. Genetic relatedness of the isolates was also analyzed by pulsed-field gel electrophoresis (PFGE) and plasmid profile. Among all the 272 isolates, 31 were multidrug-resistant (MDR), and 166 were extensively drug-resistant (XDR). PFGE typing revealed 167 pattern types and 103 clusters with a similarity of 80%. MDR and XDR isolates built up the main prevalent genotypes. Most of the non-MDR isolates were distributed in a scattered pattern. Additionally, 249 isolates exhibited biofilm formation, among which 63 were stronger biofilm formers than type strain ATCC19606. Population that exhibited more robust biofilm formation likely contained larger proportion of non-MDR isolates. Isolates with higher level of resistance tended to form weaker biofilms. The MBECs for cefotaxime, imipenem, and ciprofloxacin showed a positive correlation with corresponding MICs, while the enhancement in resistance occurred independent of the quantity of biofilm biomass produced. Results from this study imply that biofilm acts as a mechanism for bacteria to get a better survival, especially in isolates with resistance level not high enough. Moreover, even though biofilms formed by isolates with high level of resistance are always weak, they could still provide similar level of protection for the

  7. Antimicrobial Activity of Gallium Protoporphyrin IX against Acinetobacter baumannii Strains Displaying Different Antibiotic Resistance Phenotypes

    PubMed Central

    Arivett, Brock A.; Fiester, Steven E.; Ohneck, Emily J.; Penwell, William F.; Kaufman, Cynthia M.; Relich, Ryan F.


    A paucity of effective, currently available antibiotics and a lull in antibiotic development pose significant challenges for treatment of patients with multidrug-resistant (MDR) Acinetobacter baumannii infections. Thus, novel therapeutic strategies must be evaluated to meet the demands of treatment of these often life-threatening infections. Accordingly, we examined the antibiotic activity of gallium protoporphyrin IX (Ga-PPIX) against a collection of A. baumannii strains, including nonmilitary and military strains and strains representing different clonal lineages and isolates classified as susceptible or MDR. Susceptibility testing demonstrated that Ga-PPIX inhibits the growth of all tested strains when cultured in cation-adjusted Mueller-Hinton broth, with a MIC of 20 μg/ml. This concentration significantly reduced bacterial viability, while 40 μg/ml killed all cells of the A. baumannii ATCC 19606T and ACICU MDR isolate after 24-h incubation. Recovery of ATCC 19606T and ACICU strains from infected A549 human alveolar epithelial monolayers was also decreased when the medium was supplemented with Ga-PPIX, particularly at a 40-μg/ml concentration. Similarly, the coinjection of bacteria with Ga-PPIX increased the survival of Galleria mellonella larvae infected with ATCC 19606T or ACICU. Ga-PPIX was cytotoxic only when monolayers or larvae were exposed to concentrations 16-fold and 1,250-fold higher than those showing antibacterial activity, respectively. These results indicate that Ga-PPIX could be a viable therapeutic option for treatment of recalcitrant A. baumannii infections regardless of the resistance phenotype, clone lineage, time and site of isolation of strains causing these infections and their iron uptake phenotypes or the iron content of the media. PMID:26416873

  8. Clonal Diversity of Nosocomial Epidemic Acinetobacter baumannii Strains Isolated in Spain▿

    PubMed Central

    Villalón, Pilar; Valdezate, Sylvia; Medina-Pascual, Maria J.; Rubio, Virginia; Vindel, Ana; Saez-Nieto, Juan A.


    Acinetobacter baumannii is one of the major pathogens involved in nosocomial outbreaks. The clonal diversity of 729 epidemic strains isolated from 19 Spanish hospitals (mainly from intensive care units) was analyzed over an 11-year period. Pulsed-field gel electrophoresis (PFGE) identified 58 PFGE types that were subjected to susceptibility testing, rpoB gene sequencing, and multilocus sequence typing (MLST). All PFGE types were multidrug resistant; colistin was the only agent to which all pathogens were susceptible. The 58 PFGE types were grouped into 16 clones based on their genetic similarity (cutoff of 80%). These clones were distributed into one major cluster (cluster D), three medium clusters (clusters A, B, and C), and three minor clusters (clusters E, F, and G). The rpoB gene sequencing and MLST results reflected a clonal distribution, in agreement with the PFGE results. The MLST sequence types (STs) (and their percent distributions) were as follows: ST-2 (47.5%), ST-3 (5.1%), ST-15 (1.7%), ST-32 (1.7%), ST-79 (13.6%), ST-80 (20.3%), and ST-81 (10.2%). ST-79, ST-80, and ST-81 and the alleles cpn60-26 and recA29 are described for the first time. International clones I, II, and III were represented by ST-81, ST-2, and ST-3, respectively. ST-79 and ST-80 could be novel emerging clones. This work confirms PFGE and MLST to be complementary tools in clonality studies. Here PFGE was able to demonstrate the monoclonal pattern of most outbreaks, the inter- and intrahospital transmission of bacteria, and their endemic persistence in some wards. MLST allowed the temporal evolution and spatial distribution of Spanish clones to be monitored and permitted international comparisons to be made. PMID:21177889

  9. Immunization against Multidrug-Resistant Acinetobacter baumannii Effectively Protects Mice in both Pneumonia and Sepsis Models

    PubMed Central

    Huang, Weiwei; Yao, Yufeng; Long, Qiong; Yang, Xu; Sun, Wenjia; Liu, Cunbao; Jin, Xiaomei; li, Yang; Chu, Xiaojie; Chen, Bin; Ma, Yanbing


    Objective Acinetobacter baumannii is considered the prototypical example of a multi- or pan- drug-resistant bacterium. It has been increasingly implicated as a major cause of nosocomial and community-associated infections. This study proposed to evaluate the efficacy of immunological approaches to prevent and treat A. baumannii infections. Methods Mice were immunized with outer membrane vesicles (OMVs) prepared from a clinically isolated multidrug-resistant strain of A. baumannii. Pneumonia and sepsis models were used to evaluate the efficacy of active and passive immunization with OMVs. The probable effective mechanisms and the protective potential of clonally distinct clinical isolates were investigated in vitro using an opsonophagocytic assay. Results Intramuscular immunization with OMVs rapidly produced high levels of OMV-specific IgG antibodies, and subsequent intranasal challenge with A. baumannii elicited mucosal IgA and IgG responses. Both active and passive immunization protected the mice from challenges with homologue bacteria in a sepsis model. Bacterial burden in bronchoalveolar lavage fluids (BALF), lung, and spleen, inflammatory cell infiltration in BALF and lung, and inflammatory cytokine accumulation in BALF was significantly suppressed in the pneumonia model by both active and passive immunization strategies. The antisera from immunized mice presented with significant opsonophagocytic activities in a dose-dependent manner against not only homologous strains but also five of the other six clonally distinct clinical isolates. Conclusions Utilizing immunological characteristics of outer membrane proteins to elevate protective immunity and circumvent complex multidrug-resistance mechanisms might be a viable approach to effectively control A. baumannii infections. PMID:24956279

  10. Risk Factors and Clinical Outcomes for Patients With Acinetobacter baumannii Bacteremia

    PubMed Central

    Gu, Zhenyang; Han, Yuliang; Meng, Taojiang; Zhao, Shasha; Zhao, Xiaoli; Gao, Chunji; Huang, Wenrong


    Abstract Acinetobacter (A.) baumannii, an opportunistic nosocomial pathogen that can cause significant morbidity and mortality, has emerged as a worldwide problem. This study aimed to analyze the clinical features and outcomes of patients with A. baumannii bacteremia and determine the factors influencing survival by using 14-day mortality as the primary endpoint. A 6-year retrospective study of 122 cases with monomicrobial A. baumannii bacteremia was conducted in Chinese People's Liberation Army (PLA) General Hospital from January 2008 to April 2014. Predictors of 14-day mortality were identified by logistic regression analysis. The overall 14-day mortality rate was 40.2% (49 of 122 patients). Multivariable analysis revealed that independent predictors of 14-day mortality included severity of illness defined by Pitt Bacteremia Score (PBS) (odds ratio [OR], 0.46; 95% confidence interval [CI], 0.340–0.619; P < 0.001), neutropenia (OR, 18.02; 95% CI, 1.667–194.67; P = 0.017), and malignancy (OR, 4.63; 95% CI, 1.292–16.588; P = 0.019). The effect of malignancy was influenced by neutropenia (OR for interaction term, 1.60; 95% CI, 1.15–2.22; P = 0.005). A subgroup analysis revealed that 14-day mortality rate for patients with underlying hematological malignancies and solid tumors was 75% (12/16) and 40% (12/30), respectively. Survival analysis revealed that mortality in patients with hematological malignancies was higher than that in patients with solid tumors (P = 0.032). The outcomes of patients with A. baumannii bacteremia were related to PBS, neutropenia, and malignancy. Compared with solid tumors, patients with hematological malignancies had a higher mortality in the setting of A. baumannii bacteremia. PMID:26945403

  11. Wide distribution of carbapenem resistant Acinetobacter baumannii in burns patients in Iran

    PubMed Central

    Farshadzadeh, Zahra; Hashemi, Farhad B.; Rahimi, Sara; Pourakbari, Babak; Esmaeili, Davoud; Haghighi, Mohammad A.; Majidpour, Ali; Shojaa, Saeed; Rahmani, Maryam; Gharesi, Samira; Aziemzadeh, Masoud; Bahador, Abbas


    Antimicrobial resistance in carbapenem non-susceptible Acinetobacter baumannii (CNSAb) is a major public health concern globally. This study determined the antibiotic resistance and molecular epidemiology of CNSAb isolates from a referral burn center in Tehran, Iran. Sixty-nine CNSAb isolates were tested for susceptibility to antimicrobial agents using the E test methodology. Multiple locus variable number tandem repeat analysis (MLVA), Multilocus sequence typing (MLST) and multiplex PCR were performed. PCR assays tested for ambler classes A, B, and D β-lactamases. Detection of ISAba1, characterization of integrons, and biofilm formation were investigated. Fifty-three (77%) isolates revealed XDR phenotypes. High prevalence of blaOXA-23-like (88%) and blaPER-1 (54%) were detected. ISAba1 was detected upstream of blaADC, blaOXA-23-like and blaOXA51-like genes in, 97, 42, and 26% of isolates, respectively. Thirty-one (45%) isolates were assigned to international clone (IC) variants. MLVA identified 56 distinct types with six clusters and 53 singleton genotypes. Forty previously known MLST sequence types forming 5 clonal complexes were identified. The Class 1 integron (class 1 integrons) gene was identified in 84% of the isolates. The most prevalent (33%) cassette combination was aacA4-catB8-aadA1. The IC variants were predominant in the A. baumannii lineage with the ability to form strong biofilms. The XDR-CNSAb from burned patients in Iran is resistant to various antimicrobials, including tigecycline. This study shows wide genetic diversity in CNSAb. Integrating the new Iranian A. baumannii IC variants into the epidemiologic clonal and susceptibility profile databases can help effective global control measures against the XDR-CNSAb pandemic. PMID:26539176

  12. In Vitro activities of combinations of rifampin with other antimicrobials against multidrug-resistant Acinetobacter baumannii.


    Bai, Yan; Liu, Bin; Wang, Tianlin; Cai, Yun; Liang, Beibei; Wang, Rui; Liu, Youning; Wang, Jin


    The antimicrobial treatment of multidrug-resistant (MDR) Acinetobacter baumannii infections has become a great challenge for medical staff all over the world. Increasing numbers of MDR A. baumannii infections have been identified and reported, but effective clinical treatments for them are decreasing. The objective of this study was to investigate the in vitro activities of combinations of rifampin (an established antimicrobial) and other antimicrobials, including biapenem, colistin, and tigecycline, against 73 clinical isolates of MDR A. baumannii. In total, 73 clinical isolates of MDR A. baumannii were collected from two A-level general hospitals in Beijing, and the MICs of rifampin, biapenem, colistin, and tigecycline were determined. The checkerboard method was used to determine the fractional inhibitory concentration indices (FICIs), that is, whether the combinations acted synergistically against these isolates. The MIC50, MIC90, and MICrange of rifampin combined with biapenem, colistin, and tigecycline against the isolates were clearly lower than those for four antimicrobials (rifampin, biapenem, colistin, and tigecycline) that were used alone. Combinations of rifampin with biapenem, colistin, and tigecycline individually demonstrated the following interactions: synergistic interactions (FICI ≤ 0.5) for 31.51%, 34.25%, and 31.51% of the isolates, partially synergistic interactions (0.5 < FICI < 1) for 49.31%, 43.83%, and 47.94% of the isolates, and additive interactions (FICI = 1) for 19.18%, 21.92%, and 20.55% of the isolates, respectively. There were no indifferent (1 < FICI < 4) or antagonistic (FICI ≥ 4) interactions. Therefore, combinations of rifampin with biapenem, colistin, or tigecycline may be future therapeutic alternatives for the treatment of MDR A. baumannii infections. PMID:25534730

  13. In Vitro Activities of Combinations of Rifampin with Other Antimicrobials against Multidrug-Resistant Acinetobacter baumannii

    PubMed Central

    Bai, Yan; Liu, Bin; Wang, Tianlin; Cai, Yun; Liang, Beibei; Liu, Youning; Wang, Jin


    The antimicrobial treatment of multidrug-resistant (MDR) Acinetobacter baumannii infections has become a great challenge for medical staff all over the world. Increasing numbers of MDR A. baumannii infections have been identified and reported, but effective clinical treatments for them are decreasing. The objective of this study was to investigate the in vitro activities of combinations of rifampin (an established antimicrobial) and other antimicrobials, including biapenem, colistin, and tigecycline, against 73 clinical isolates of MDR A. baumannii. In total, 73 clinical isolates of MDR A. baumannii were collected from two A-level general hospitals in Beijing, and the MICs of rifampin, biapenem, colistin, and tigecycline were determined. The checkerboard method was used to determine the fractional inhibitory concentration indices (FICIs), that is, whether the combinations acted synergistically against these isolates. The MIC50, MIC90, and MICrange of rifampin combined with biapenem, colistin, and tigecycline against the isolates were clearly lower than those for four antimicrobials (rifampin, biapenem, colistin, and tigecycline) that were used alone. Combinations of rifampin with biapenem, colistin, and tigecycline individually demonstrated the following interactions: synergistic interactions (FICI ≤ 0.5) for 31.51%, 34.25%, and 31.51% of the isolates, partially synergistic interactions (0.5 < FICI < 1) for 49.31%, 43.83%, and 47.94% of the isolates, and additive interactions (FICI = 1) for 19.18%, 21.92%, and 20.55% of the isolates, respectively. There were no indifferent (1 < FICI < 4) or antagonistic (FICI ≥ 4) interactions. Therefore, combinations of rifampin with biapenem, colistin, or tigecycline may be future therapeutic alternatives for the treatment of MDR A. baumannii infections. PMID:25534730

  14. Deciphering the Function of the Outer Membrane Protein OprD Homologue of Acinetobacter baumannii

    PubMed Central

    Catel-Ferreira, Manuella; Nehmé, Rony; Molle, Virginie; Aranda, Jesús; Bouffartigues, Emeline; Chevalier, Sylvie; Bou, Germán; Jouenne, Thierry


    The increasing number of carbapenem-resistant Acinetobacter baumannii isolates is a major cause for concern which restricts therapeutic options to treat severe infections caused by this emerging pathogen. To identify the molecular mechanisms involved in carbapenem resistance, we studied the contribution of an outer membrane protein homologue of the Pseudomonas aeruginosa OprD porin. Suspected to be the preferred pathway of carbapenems in A. baumannii, the oprD homologue gene was inactivated in strain ATCC 17978. Comparison of wild-type and mutant strains did not confirm the expected increased resistance to any antibiotic tested. OprD homologue sequence analysis revealed that this protein actually belongs to an OprD subgroup but is closer to the P. aeruginosa OprQ protein, with which it could share some functions, e.g., allowing bacterial survival under low-iron or -magnesium growth conditions or under poor oxygenation. We thus overexpressed and purified a recombinant OprD homologue protein to further examine its functional properties. As a specific channel, this porin presented rather low single-channel conductance, i.e., 28 pS in 1 M KCl, and was partially closed by micro- and millimolar concentrations of Fe3+ and Mg2+, respectively, but not by imipenem and meropenem or basic amino acids. The A. baumannii OprD homologue is likely not involved in the carbapenem resistance mechanism, but as an OprQ-like protein, it could contribute to the adaptation of this bacterium to magnesium- and/or iron-depleted environments. PMID:22564848

  15. Modeling the impact of interventions against Acinetobacter baumannii transmission in intensive care units

    PubMed Central

    Doan, Tan N; Kong, David CM; Marshall, Caroline; Kirkpatrick, Carl MJ; McBryde, Emma S


    The efficacy of infection control interventions against Acinetobacter baumannii remains unclear, despite such information being critical for effective prevention of the transmission of this pathogen. Mathematical modeling offers an alternative to clinical trials, which may be prohibitively expensive, unfeasible or unethical, in predicting the impact of interventions. Furthermore, it allows the ability to ask key “what if” questions to evaluate which interventions have the most impact. We constructed a transmission dynamic model to quantify the effects of interventions on reducing A. baumannii prevalence and the basic reproduction ratio (R0) in intensive care units (ICUs). We distinguished between colonization and infection, and incorporated antibiotic exposure and transmission from free-living bacteria in the environment. Under the assumptions and parameterization in our model, 25% and 18% of patients are colonized and infected with A. baumannii, respectively; and R0 is 1.4. Improved compliance with hand hygiene (≥87%), enhanced environmental cleaning, reduced length of ICU stay of colonized patients (≤ 10 days), shorter durations of antibiotic treatment of A. baumannii (≤6 days), and isolation of infected patients combined with cleaning of isolation rooms are effective, reducing R0 to below unity. In contrast, expediting the recovery of the intestinal microbiota (e.g. use of probiotics) is not effective. This study represents a biologically realistic model of the transmission dynamics of A. baumannii, and the most comprehensive analysis of the effectiveness of interventions against this pathogen. Our study provides important data for designing effective infection control interventions. PMID:26252184

  16. Impact of a Cross-Kingdom Signaling Molecule of Candida albicans on Acinetobacter baumannii Physiology

    PubMed Central

    Kostoulias, Xenia; Murray, Gerald L.; Cerqueira, Gustavo M.; Kong, Jason B.; Bantun, Farkad; Mylonakis, Eleftherios; Khoo, Chen Ai


    Multidrug-resistant (MDR) Acinetobacter baumannii is an opportunistic human pathogen that has become highly problematic in the clinical environment. Novel therapies are desperately required. To assist in identifying new therapeutic targets, the antagonistic interactions between A. baumannii and the most common human fungal pathogen, Candida albicans, were studied. We have observed that the C. albicans quorum-sensing molecule, farnesol, has cross-kingdom interactions, affecting the viability of A. baumannii. To gain an understanding of its mechanism, the transcriptional profile of A. baumannii exposed to farnesol was examined. Farnesol caused dysregulation of a large number of genes involved in cell membrane biogenesis, multidrug efflux pumps (AcrAB-like and AdeIJK-like), and A. baumannii virulence traits such as biofilm formation (csuA, csuB, and ompA) and motility (pilZ and pilH). We also observed a strong induction in genes involved in cell division (minD, minE, ftsK, ftsB, and ftsL). These transcriptional data were supported by functional assays showing that farnesol disrupts A. baumannii cell membrane integrity, alters cell morphology, and impairs virulence characteristics such as biofilm formation and twitching motility. Moreover, we showed that A. baumannii uses efflux pumps as a defense mechanism against this eukaryotic signaling molecule. Owing to its effects on membrane integrity, farnesol was tested to see if it potentiated the activity of the membrane-acting polymyxin antibiotic colistin. When coadministered, farnesol increased sensitivity to colistin for otherwise resistant strains. These data provide mechanistic understanding of the antagonistic interactions between diverse pathogens and may provide important insights into novel therapeutic strategies. PMID:26482299

  17. Clinical epidemiology and resistance mechanisms of carbapenem-resistant Acinetobacter baumannii, French Guiana, 2008-2014.


    Mahamat, Aba; Bertrand, Xavier; Moreau, Brigitte; Hommel, Didier; Couppie, Pierre; Simonnet, Christine; Kallel, Hatem; Demar, Magalie; Djossou, Felix; Nacher, Mathieu


    This study investigated the clinical epidemiology and resistance mechanisms of Acinetobacter baumannii and characterised the clonal diversity of carbapenem-resistant A. baumannii (CRAB) during an ICU-associated outbreak at Cayenne Hospital, French Guiana. All non-duplicate A. baumannii isolates from 2008 to 2014 were tested for antibiotic susceptibility by disk diffusion. Multilocus sequence typing, pulsed-field gel electrophoresis (PFGE) and characterisation of carbapenemase-encoding genes were performed on CRAB. Of the 441 A. baumannii isolates, most were from males (54.0%) and were detected mainly from the ICU (30.8%) and medicine wards (21.8%). In the ICU, strains were mainly isolated from the respiratory tract (44.1%) and bloodstream (14.0%), whereas in medicine wards they mainly were from wound/drainage (36.5%) and bloodstream (25.0%). A. baumannii showed the greatest susceptibility to piperacillin/tazobactam (92.7%), imipenem (92.5%), colistin (95.6%) and amikacin (97.2%), being lower in the ICU and medicine wards compared with other wards. An outbreak of OXA-23-producing CRAB occurred in the 13-bed ICU in 2010. CRAB strains were more co-resistant to other antimicrobials compared with non-CRAB. Molecular genetics analysis revealed five sequence types [ST78, ST107 and ST642 and two new STs (ST830 and ST831)]. Analysis of PFGE profiles indicated cross-transmissions of CRAB within the ICU, between the ICU and one medicine ward during transfer of patients, and within that medicine ward. This study provides the first clinical and molecular data of A. baumannii from French Guiana and the Amazon basin. The ICU was the highest risk unit of this nosocomial outbreak of OXA-23-producing CRAB, which could subsequently disseminate within the hospital. PMID:27236843

  18. Distribution and resistance of pathogens in liver transplant recipients with Acinetobacter baumannii infection

    PubMed Central

    Gao, Fei; Ye, Qifa; Wan, Qiquan; Liu, Shan; Zhou, Jiandang


    Background Drug-resistant Acinetobacter baumannii has become a major problem in liver transplant recipients. The aim of this study was to investigate the clinical presentation, distribution, and drug susceptibility characteristics in liver recipients with A. baumannii infection. Methods We retrospectively investigated 17 liver recipients who developed A. baumannii infection between January 1, 2007 and December 31, 2014. The distribution of A. baumannii and drug susceptibility characteristics were reviewed. Results Infectious complications due to A. baumannii appeared in 17 liver recipients, with a total of 24 episodes. Approximately 63% (15/24) of A. baumannii infections occurred within 2 weeks after transplantation. The most common source of infection was multiple culture-positive sites (35.3%, n=6), followed by the intra-abdominal/biliary tract (23.5%, n=4) and lung (23.5%, n=4). Eight patients (47.1%) had a body temperature of 38°C or higher at the onset of A. baumannii infection. Nine, seven, and 12 recipients had a serum creatinine level of >1.5 mg/dL, a white blood cell count of >15,000/mm3, and a platelet count of <50,000/mm3, respectively. There were five (29.4%) cases of septic shock and eight (47.1%) deaths. The rate of antibiotic resistance of A. baumannii to ten of 12 antibiotics investigated was more than 60%. Among the 24 infections caused by A. baumannii, 75% were carbapenem-resistant. The rods were relatively sensitive to tigecycline and cefoperazone-sulbactam. Conclusion The clinical manifestations of A. baumannii infection included a high body temperature, a decreased platelet count, an elevated white blood cell count, and onset in the early period after transplantation as well as high mortality. The antibiotic resistance rate of A. baumannii was extremely high. Prevention measures and combination antibiotic therapy are needed to improve the outcomes of liver recipients with A. baumannii infections. PMID:25848296

  19. Distribution and expression of the Ade multidrug efflux systems in Acinetobacter baumannii clinical isolates.


    Pagdepanichkit, Sirawit; Tribuddharat, Chanwit; Chuanchuen, Rungtip


    One hundred Acinetobacter baumannii clinical isolates were examined for inhibitory effect of reserpine and carbonyl cyanide m-chlorophenylhydrazone (CCCP) on the antimicrobial susceptibility and expression of 4 resistant-nodulation-cell division (RND)-type multidrug efflux systems, including AdeABC, AdeDE, AdeIJK, and AdeFGH, using RT-PCR. Ten A. baumannii isolates expressing AdeABC, AdeIJK, or AdeFGH were randomly selected for determination of transcription level and regulatory mutations. While all the isolates were resistant to multiple drugs, the reserpine and CCCP experiment showed that the multidrug resistance phenotype in most A. baumannii isolates was associated with efflux pumps. Most isolates expressed at least one of the RND-type efflux pumps tested (97%). AdeIJK expression was most common (97%), but none of the isolates produced AdeDE. Fifty-two percent of the A. baumannii isolates simultaneously produced up to 3 RND-type efflux systems (i.e., AdeABC, AdeFGH, and AdeIJK). No good correlation between the expression of RND-type efflux pumps and the type of antimicrobial resistance was observed. Overexpression of AdeABC, AdeIJK, and AdeFGH was not always related to the presence of mutations in their corresponding regulatory genes. This study highlights (i) the universal presence of the RND-type efflux pumps with variable levels of expression level among the A. baumannii in this collection and (ii) the complexity of their regulation of expression. PMID:27332787

  20. Clinical predictors of Pseudomonas aeruginosa or Acinetobacter baumannii bacteremia in patients admitted to the ED.


    Kang, Cheol-In; Chung, Doo Ryeon; Peck, Kyong Ran; Song, Jae-Hoon


    The identification of clinical characteristics that could identify patients at high risk for Pseudomonas aeruginosa or Acinetobacter baumannii bacteremia would aid clinicians in the appropriate management of these life-threatening conditions, especially in patients admitted to the emergency department (ED) with community-onset infections. To determine clinical risk factors for P. aeruginosa or A. baumannii bacteremia in patients with community-onset gram-negative bacteremia (GNB), a post hoc analysis of a nationwide bacteremia surveillance database including patients with microbiologically documented GNB was performed. Ninety-six patients with P. aeruginosa or A. baumannii bacteremia were compared with 1230 patients with Escherichia coli or Klebsiella pneumoniae bacteremia. A solid tumor or hematologic malignancy was more likely to be associated with P. aeruginosa or A. baumannii bacteremia, whereas concurrent neurologic disease was less frequently seen. In regards to the site of infection, pneumonia was more common in P. aeruginosa or A. baumannii bacteremia, whereas a urinary tract infection was less frequently seen. Factors associated with P. aeruginosa or A. baumannii bacteremia in multivariate analysis included pneumonia (odds ratio [OR], 3.60; 95% confidence interval [CI], 1.86-6.99), hematologic malignancy (OR, 2.71; 95% CI, 1.26-5.84), male sex (OR, 2.17; 95% CI, 1.31-3.58), solid tumor (OR, 1.89; 95% CI, 1.15-3.12), and health-care-associated infection (OR, 1.88; 95% CI, 1.48-2.41). Our data suggest that an initial empirical antimicrobial coverage of P. aeruginosa or A. baumannii bacteremia should be seriously considered in patients with pneumonia, a hematologic malignancy, solid tumor, or health-care-associated infection, when GNB is suspected, even in community-onset infections. PMID:22030178