Science.gov

Sample records for acinetobacter calcoaceticus rag-1

  1. Role for emulsan in growth of Acinetobacter calcoaceticus RAG-1 on crude oil

    SciTech Connect

    Pines, O.; Gutnick, D.

    1986-03-01

    When Acinetobacter calcoaceticus RAG-1 was grown together with an emulsan-deficient mutant on crude oil, only the emulsan-producing RAG-1 was found to grow, regardless of whether the medium was supplemented with emulsan. The results suggested that the cell-associated form of the bioemulsifier is the biologically active species required for growth on crude oil. A revertant of an emulsan-deficient strain was isolated which simultaneously regained the ability to produce both cell-associated and cell-free emulsan as well as the ability to grow on crude oil.

  2. Role of Thin Fimbriae in Adherence and Growth of Acinetobacter calcoaceticus RAG-1 on Hexadecane.

    PubMed

    Rosenberg, M; Bayer, E A; Delarea, J; Rosenberg, E

    1982-10-01

    Acinetobacter calcoaceticus RAG-1, a hydrocarbon-degrading bacterium which adheres avidly to hydrocarbons and other hydrophobic surfaces, possesses numerous thin fimbriae (ca. 3.5-nm diameter) on the cell surface. MR-481, a nonadherent mutant of RAG-1 which is unable to grow on hexadecane under conditions of limited emulsification and low initial cell density, lacks these fimbriae. Prolonged incubation of MR-481 in hexadecane medium enriched for partial adherence revertants. The reappearance of thin fimbriae was observed in all such revertant strains. RAG-1 cells and partial revertant strains were agglutinated in the presence of antibody, whereas MR-481 cells were not. Another mutant, AB15, which was previously isolated on the basis of its nonagglutinability in the presence of antibody, also lacked thin fimbriae and was conditionally nonadherent. Furthermore, strain AB15 was unable to grow on hexadecane medium. Adherence of RAG-1 cells to hexadecane was considerably reduced after shearing treatment. The material removed from the cell surface by shearing of RAG-1 and the partial revertant strains yielded a single antigenic band in RAG-1 and partial revertant strains, as observed by crossed immunoelectrophoresis. This band was absent in both fimbriae-less mutants, MR-481 and AB15. The data demonstrate that the thin fimbriae of RAG-1 (i) are a major factor in adherence to polystyrene and hydrocarbon, (ii) may be crucial in enabling growth of cells on hexadecane, and (iii) constitute the major cell surface agglutinogen. PMID:16346118

  3. Role of Thin Fimbriae in Adherence and Growth of Acinetobacter calcoaceticus RAG-1 on Hexadecane

    PubMed Central

    Rosenberg, Mel; Bayer, Edward A.; Delarea, Jacob; Rosenberg, Eugene

    1982-01-01

    Acinetobacter calcoaceticus RAG-1, a hydrocarbon-degrading bacterium which adheres avidly to hydrocarbons and other hydrophobic surfaces, possesses numerous thin fimbriae (ca. 3.5-nm diameter) on the cell surface. MR-481, a nonadherent mutant of RAG-1 which is unable to grow on hexadecane under conditions of limited emulsification and low initial cell density, lacks these fimbriae. Prolonged incubation of MR-481 in hexadecane medium enriched for partial adherence revertants. The reappearance of thin fimbriae was observed in all such revertant strains. RAG-1 cells and partial revertant strains were agglutinated in the presence of antibody, whereas MR-481 cells were not. Another mutant, AB15, which was previously isolated on the basis of its nonagglutinability in the presence of antibody, also lacked thin fimbriae and was conditionally nonadherent. Furthermore, strain AB15 was unable to grow on hexadecane medium. Adherence of RAG-1 cells to hexadecane was considerably reduced after shearing treatment. The material removed from the cell surface by shearing of RAG-1 and the partial revertant strains yielded a single antigenic band in RAG-1 and partial revertant strains, as observed by crossed immunoelectrophoresis. This band was absent in both fimbriae-less mutants, MR-481 and AB15. The data demonstrate that the thin fimbriae of RAG-1 (i) are a major factor in adherence to polystyrene and hydrocarbon, (ii) may be crucial in enabling growth of cells on hexadecane, and (iii) constitute the major cell surface agglutinogen. Images PMID:16346118

  4. Specific binding of a bacteriophage at a hydrocarbon-water interface. [Acinetobacter calcoaceticus

    SciTech Connect

    Pines, O.; Gutnick, D.

    1984-01-01

    Emulsan, the extracellular polyanionic emulsifying agent produced by Acinetobacter calcoaceticus RAG-1, has been implicated as a receptor for a specific virulent RAG-1 bacteriophage, ap3. Aqueous solutions of emulsan did not interfere with phage ap3 adsorption to RAG-1 cells. However, binding of phage ap3 occurred at the interfaces of hexadecane-in-water emulsions specifically stabilized by emulsan polymers. Binding of ap3 to emulsions was inhibited either in the presence of anti-emulsan antibodies or in the presence of a specific emulsan depolymerase. Moreover, when the phage was first bound to emulsan-stabilized emulsions and the emulsions subsequently treated with emulsan depolymerase, viable phage was released, indicating that phage ap3 DNA ejection was not triggered by binding. The results indicate that emulsan functions as the ap3 receptor and suggest that to function as a receptor, emulsan assumes a specific conformation conferred on it by its specific interaction with hydrophobic surfaces.

  5. First report of Oxa-72-producing Acinetobacter calcoaceticus in Lebanon

    PubMed Central

    Al Atrouni, A.; Kempf, M.; Eveillard, M.; Rafei, R.; Hamze, M.; Joly-Guillou, M.-L.

    2015-01-01

    Emergence of carbapenem-resistant Acinetobacter spp. has been increasingly reported worldwide. We report here the first detection of an Acinetobacter calcoaceticus isolate from vegetables in Lebanon carrying the blaOxa-72 gene. These findings show that the Lebanese environment may constitute a potential reservoir for this antibiotic resistance gene. PMID:26858838

  6. 21 CFR 866.3010 - Acinetobacter calcoaceticus serological reagents.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Acinetobacter calcoaceticus serological reagents. 866.3010 Section 866.3010 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents §...

  7. 21 CFR 866.3010 - Acinetobacter calcoaceticus serological reagents.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Acinetobacter calcoaceticus serological reagents. 866.3010 Section 866.3010 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents §...

  8. 21 CFR 866.3010 - Acinetobacter calcoaceticus serological reagents.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Acinetobacter calcoaceticus serological reagents. 866.3010 Section 866.3010 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents §...

  9. 21 CFR 866.3010 - Acinetobacter calcoaceticus serological reagents.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Acinetobacter calcoaceticus serological reagents. 866.3010 Section 866.3010 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents §...

  10. 21 CFR 866.3010 - Acinetobacter calcoaceticus serological reagents.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Acinetobacter calcoaceticus serological reagents. 866.3010 Section 866.3010 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents §...

  11. Surface activity of Acinetobacter calcoaceticus sp. 2CA2

    SciTech Connect

    Neufeld, R.J.; Zajic, J.E.

    1984-01-01

    The hydrocarbon metabolizing Acinetobacter calcoaceticus sp. 2CA2 reduces the surface tension of the culture broth during growth on liquid hydrocarbons. This activity, which is not evident during growth on soluble substrates, is associated with the whole cells. Removing the cells from the culture broth increases the surface tension of the liquid phase. The cells when resuspended in water result in a dramatic lowering of the surface tension. Acinetobacter sp. 2CA2 tends to partition between the two liquid phases during growth on hydrocarbons. Both the hydrocarbon bound and nonadhering cells are equally surface active. The whole cells are also able to form and stabilize kerosene-water emulsions. This ability is not related to the lowering of the liquid surface or interfacial tension, since both surface active and nonsurface active cells demonstrated the same emulsifying properties. An extracellular lipopeptide produced during growth on hydrocarbons is not surface active but effectively forms and stabilizes kerosene-water emulsions. The cells and extracellular lipopeptide are also effective in de-emulsifying surfactant stabilized test emulsions. The cells and extracellular lipopeptide are also effective in de-emulsifying surfactant stabilized test emulsions. The lipopeptide product reduced the half-life of a Tween-Span (TS) stabilized kerosene-water emulsion from 650 to 0.4 h at product concentrations of less than 1% (w/v).

  12. Types and Prevalence of Carbapenem-Resistant Acinetobacter calcoaceticus-Acinetobacter baumannii Complex in Northern Taiwan

    PubMed Central

    Hsieh, Wen-Shyang; Wang, Nai-Yu; Feng, Jou-An; Weng, Li-Chuan

    2014-01-01

    The frequency of the carbapenem-resistant Acinetobacter calcoaceticus-Acinetobacter baumannii (CRACB) complex increases annually in our hospitals. However, the types and prevalence of carbapenemases among isolates still remain unclear. In this study, we identified and collected 672 carbapenem-resistant isolates from a medical center in Northern Taiwan between April and December of 2010. There were 577 genospecies 2 (Acinetobacter baumannii), 79 genospecies 13TU, and 16 genospecies 3 isolates. The isolates had an acquired blaOXA-24-like gene, which was confirmed by sequencing for the encoded OXA-72 carbapenemase, and were often associated with high-level carbapenem resistance. These CRACB complex isolates remained susceptible to colistin (100%). The genotyping of isolates was conducted using pulsed-field gel electrophoresis with ApaI digestion. In most clonally related groups, patients were from both branch hospitals. The results indicate that interhospital dissemination of clones occurred. This study provides updated data on the types and prevalence of the CRACB complex. In addition, it presents a warning on the emergence and spread of CRACB complex harboring blaOXA-24-like genes in northern Taiwan. PMID:24145535

  13. Natural transformation and availability of transforming DNA to Acinetobacter calcoaceticus in soil microcosms.

    PubMed Central

    Nielsen, K M; van Weerelt, M D; Berg, T N; Bones, A M; Hagler, A N; van Elsas, J D

    1997-01-01

    A small microcosm, based on optimized in vitro transformation conditions, was used to study the ecological factors affecting the transformation of Acinetobacter calcoaceticus BD413 in soil. The transforming DNA used was A. calcoaceticus homologous chromosomal DNA with an inserted gene cassette containing a kanamycin resistance gene, nptII. The effects of soil type (silt loam or loamy sand), bacterial cell density, time of residence of A. calcoaceticus or of DNA in soil before transformation, transformation period, and nutrient input were investigated. There were clear inhibitory effects of the soil matrix on transformation and DNA availability. A. calcoaceticus cells reached stationary phase and lost the ability to be transformed shortly after introduction into sterile soil. The use of an initially small number of A. calcoaceticus cells and nutrients, resulting in bacterial growth, enhanced transformation frequencies within a limited period. The availability of introduced DNA for transformation of A. calcoaceticus cells disappeared within a few hours in soil. Differences in transformation frequencies between soils were found; A. calcoaceticus cells were transformed at a higher rate and for a longer period in a silt loam than in a loamy sand. Physical separation of DNA and A. calcoaceticus cells had a negative effect on transformation. Transformation was also detected in nonsterile soil microcosms, albeit only in the presence of added nutrients and at a reduced frequency. These results suggest that chromosomal DNA released into soil rapidly becomes unavailable for transformation of A. calcoaceticus. In addition, strain BD413 quickly loses the ability to receive, stabilize, and/or express exogenous DNA after introduction into soil. PMID:9143126

  14. Acinetobacter seifertii sp. nov., a member of the Acinetobacter calcoaceticus-Acinetobacter baumannii complex isolated from human clinical specimens.

    PubMed

    Nemec, Alexandr; Krizova, Lenka; Maixnerova, Martina; Sedo, Ondrej; Brisse, Sylvain; Higgins, Paul G

    2015-03-01

    This study aimed to define the taxonomic status of a phenetically distinct group of 16 strains that corresponds to Acinetobacter genomic species 'close to 13TU', a provisional genomic species of the Acinetobacter calcoaceticus-Acinetobacter baumannii (ACB) complex recognized by Gerner-Smidt and Tjernberg in 1993. These strains have been isolated in different countries since the early 1990s and were mostly recovered from human clinical specimens. They were compared with 45 reference strains representing the known taxa of the ACB complex using taxonomic methods relevant to the genus Acinetobacter. Based on sequence analysis of the concatenated partial sequences (2976 bp) of seven housekeeping genes, the 16 strains formed a tight and well-supported cluster (intracluster sequence identity of ≥98.4 %) that was clearly separated from the other members of the ACB complex (≤94.7 %). The species status of the group was supported by average nucleotide identity values of ≤91.7 % between the whole genome sequence of representative strain NIPH 973(T) (NCBI accession no. APOO00000000) and those of the other species. In addition, whole-cell matrix-assisted laser desorption ionization-time-of-flight (MALDI-TOF) MS analyses indicated the distinctness of the group at the protein level. Metabolic and physiological tests revealed several typical features of the group, although they did not allow its reliable differentiation from the other members of the ACB complex. We conclude that the 16 strains represent a distinct novel species, for which we propose the name Acinetobacter seifertii sp. nov. The type strain is NIPH 973(T) ( = CIP 110471(T) = CCUG 34785(T) = CCM 8535(T)). PMID:25563912

  15. Biosurfactants from Acinetobacter calcoaceticus BU03 enhance the solubility and biodegradation of phenanthrene.

    PubMed

    Zhao, Zhenyong; Wong, Jonathan W C

    2009-03-01

    A thermophilic bacterial strain, Acinetobacter calcoaceticus BU03, with a biosurfactant-producing capability, was isolated from petroleum-contaminated soil with an improved procedure which employed the solubilization of polycyclic aromatic hydrocarbons (PAHs), i.e. naphthalene in agar plate, as a selection criterion. Crude biosurfactant was recovered from the culture of BU03 by extraction with n-hexane, and its properties were investigated. Biosurfactants from A. calcoaceticus BU03 constitute a thermo-stable mixture, composed of different agents with surface activities. At their critical micelle concentration (CMC) of 152.4 mg L(-1), the crude biosurfactants produced from A. calcoaceticus BU03 decreased the air-water surface tension to 38.4 mN m(-1). In thermophilic conditions, the emulsifying activity is 2.8 times that of Tween 80. The effects of the biosurfactants produced by A. calcoaceticus on the solubility and biodegradation of PAHs were investigated in batch systems. Biosurfactants produced by A. calcoaceticus BU03 at 25 times their CMC significantly increased the apparent aqueous solubility of phenanthrene (PHE), pyrene (PYR) and benzo(a)pyrene (B[a]P) to 54.3, 6.33 and 2.08 mg L(-1), respectively. In aqueous system, the biosurfactants at concentrations of 0.5 CMC and 1 CMC slightly enhanced the biodegradation of PHE by a consortium of PAH-degrading microrganisms. Results indicate that biosurfactants from A. calcoaceticus BU03 have potential to enhance the removal of PAHs from contaminated sites. PMID:19438062

  16. Isolation and Characterization of Fipronil Degrading Acinetobacter calcoaceticus and Acinetobacter oleivorans from Rhizospheric Zone of Zea mays.

    PubMed

    Uniyal, Shivani; Paliwal, Rashmi; Verma, Megha; Sharma, R K; Rai, J P N

    2016-06-01

    An enrichment culture technique was used for the isolation of bacteria capable of utilizing fipronil as a sole source of carbon and energy. Based on morphological, biochemical characteristics and phylogenetic analysis of 16S rRNA sequence, the bacterial strains were identified as Acinetobacter calcoaceticus and Acinetobacter oleivorans. Biodegradation experiments were conducted in loamy sand soil samples fortified with fipronil (50 µg kg(-1)) and inoculated with Acinetobacter sp. cells (45 × 10(7) CFU mL(-1)) for 90 days. Soil samples were periodically analyzed by gas liquid chromatography equipped with electron capture detector. Biodegradation of fipronil fitted well with the pseudo first-order kinetics, with rate constant value between 0.041 and 0.051 days(-1). In pot experiments, fipronil and its metabolites fipronil sulfide, fipronil sulfone and fipronil amide were found below quantifiable limit in soil and root, shoot and leaves of Zea mays. These results demonstrated that A. calcoaceticus and A. oleivorans may serve as promising strains in the bioremediation of fipronil-contaminated soils. PMID:27084098

  17. Biodegradation of Phenol by Bacteria Strain Acinetobacter Calcoaceticus PA Isolated from Phenolic Wastewater

    PubMed Central

    Liu, Zhenghui; Xie, Wenyu; Li, Dehao; Peng, Yang; Li, Zesheng; Liu, Shusi

    2016-01-01

    A phenol-degrading bacterium strain PA was successfully isolated from the effluent of petrochemical wastewater. Based on its morphological, physiological and biochemical characteristics, the strain PA was characterized as a Gram-negative, strictly aerobic, nonmotile and short rod-shaped bacterium that utilizes phenol as a sole carbon and energy source. 16S rDNA sequence analysis revealed that this strain is affiliated to Acinetobacter calcoaceticus in the group of Gammaproteobacteria. The strain was efficient in removing 91.6% of the initial 800 mg∙L−1 phenol within 48 h, and had a tolerance of phenol concentration as high as 1700 mg∙L−1. These results indicated that A. calcoaceticus possesses a promising potential in treating phenolic wastewater. PMID:27005648

  18. RT-PCR and statistical analyses of adeABC expression in clinical isolates of Acinetobacter calcoaceticus-Acinetobacter baumannii complex.

    PubMed

    Ruzin, Alexey; Immermann, Frederick W; Bradford, Patricia A

    2010-06-01

    The relationship between expression of adeABC and minimal inhibitory concentration (MIC) of tigecycline was investigated by RT-PCR and statistical analyses in a population of 106 clinical isolates (MIC range, 0.0313-16 microg/ml) of Acinetobacter calcoaceticus-Acinetobacter baumannii complex. There was a statistically significant linear relationship (p < 0.0001) between log-transformed expression values and log-transformed MIC values, indicating that overexpression of AdeABC efflux pump is a prevalent mechanism for decreased susceptibility to tigecycline in A. calcoaceticus-A. baumannii complex. PMID:20438348

  19. Characterization of affinity-purified isoforms of Acinetobacter calcoaceticus Y1 glutathione transferases.

    PubMed

    Chee, Chin-Soon; Tan, Irene Kit-Ping; Alias, Zazali

    2014-01-01

    Glutathione transferases (GST) were purified from locally isolated bacteria, Acinetobacter calcoaceticus Y1, by glutathione-affinity chromatography and anion exchange, and their substrate specificities were investigated. SDS-polyacrylamide gel electrophoresis revealed that the purified GST resolved into a single band with a molecular weight (MW) of 23 kDa. 2-dimensional (2-D) gel electrophoresis showed the presence of two isoforms, GST1 (pI 4.5) and GST2 (pI 6.2) with identical MW. GST1 was reactive towards ethacrynic acid, hydrogen peroxide, 1-chloro-2,4-dinitrobenzene, and trans,trans-hepta-2,4-dienal while GST2 was active towards all substrates except hydrogen peroxide. This demonstrated that GST1 possessed peroxidase activity which was absent in GST2. This study also showed that only GST2 was able to conjugate GSH to isoproturon, a herbicide. GST1 and GST2 were suggested to be similar to F0KLY9 (putative glutathione S-transferase) and F0KKB0 (glutathione S-transferase III) of Acinetobacter calcoaceticus strain PHEA-2, respectively. PMID:24892084

  20. Characterization of Affinity-Purified Isoforms of Acinetobacter calcoaceticus Y1 Glutathione Transferases

    PubMed Central

    Chee, Chin-Soon; Tan, Irene Kit-Ping; Alias, Zazali

    2014-01-01

    Glutathione transferases (GST) were purified from locally isolated bacteria, Acinetobacter calcoaceticus Y1, by glutathione-affinity chromatography and anion exchange, and their substrate specificities were investigated. SDS-polyacrylamide gel electrophoresis revealed that the purified GST resolved into a single band with a molecular weight (MW) of 23 kDa. 2-dimensional (2-D) gel electrophoresis showed the presence of two isoforms, GST1 (pI 4.5) and GST2 (pI 6.2) with identical MW. GST1 was reactive towards ethacrynic acid, hydrogen peroxide, 1-chloro-2,4-dinitrobenzene, and trans,trans-hepta-2,4-dienal while GST2 was active towards all substrates except hydrogen peroxide. This demonstrated that GST1 possessed peroxidase activity which was absent in GST2. This study also showed that only GST2 was able to conjugate GSH to isoproturon, a herbicide. GST1 and GST2 were suggested to be similar to F0KLY9 (putative glutathione S-transferase) and F0KKB0 (glutathione S-transferase III) of Acinetobacter calcoaceticus strain PHEA-2, respectively. PMID:24892084

  1. Draft Genome Sequence of Acinetobacter calcoaceticus Strain P23, a Plant Growth-Promoting Bacterium of Duckweed

    PubMed Central

    Hosoyama, Akira; Yamazoe, Atsushi; Morikawa, Masaaki

    2015-01-01

    Acinetobacter calcoaceticus strain P23 is a plant growth-promoting bacterium, which was isolated from the surface of duckweed. We report here the draft genome sequence of strain P23. The genome data will serve as a valuable reference for understanding the molecular mechanism of plant growth promotion in aquatic plants. PMID:25720680

  2. Draft Genome Sequence of Acinetobacter calcoaceticus Strain P23, a Plant Growth-Promoting Bacterium of Duckweed.

    PubMed

    Sugawara, Masayuki; Hosoyama, Akira; Yamazoe, Atsushi; Morikawa, Masaaki

    2015-01-01

    Acinetobacter calcoaceticus strain P23 is a plant growth-promoting bacterium, which was isolated from the surface of duckweed. We report here the draft genome sequence of strain P23. The genome data will serve as a valuable reference for understanding the molecular mechanism of plant growth promotion in aquatic plants. PMID:25720680

  3. A TRANSPORT SYSTEM FOR THE MAINTENANCE OF VIABILITY OF ACINETOBACTER CALCOACETICUS, STREPTOCOCCUS INIAE, AND S. AGALACTIAE OVER VARYING TIME PERIODS

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We evaluated the utility of Bacti-Swab NPG Modified Stuart's medium (Remel)in maintaining viable Gram negative (Acinetobacter calcoaceticus) and Gram positive bacteria (Streptococcus iniae and S. agalactiae) for up to 10 days. In the first experiment, qualitative assessment of the viability of S. i...

  4. Utilization of short chain monocarboxylic acids in an effluent of petrochemical industry by Acinetobacter calcoaceticus

    SciTech Connect

    Du Preez, J.C.; Toerien, D.F.

    1985-02-01

    The aqueous effluent generated by the Fischer-Tropsch process, containing a total of 13 g/L C/sub 2/-C/sub 5/ monocarboxylic acids, was investigated as a potential substrate for the production of single-cell protein (SCP). A bacterial isolate, Acinetobacter calcoaceticus, could utilize all the acids in the effluent simultaneously in chemostat cultures, and no residual acids were detected in the culture below a dilution rate of 0.78 h/sup -1/. The critical dilution rate was 1.04 h/sup -1/. The maintenance energy requirement of the cells growing on the monocarboxylic acid mixture was considerably lower than that of cells growing on acetate as the sole carbon source. Enrichment of the effluent with ethanol to increase the biomass concentration was successful and still allowed the simultaneous and efficient utilization of all the carbon sources, but resulted in a decrease of the critical dilution rate by ca. 20%.

  5. Acinetobacter strains IH9 and OCI1, two rhizospheric phosphate solubilizing isolates able to promote plant growth, constitute a new genomovar of Acinetobacter calcoaceticus.

    PubMed

    Peix, Alvaro; Lang, Elke; Verbarg, Susanne; Spröer, Cathrin; Rivas, Raúl; Santa-Regina, Ignacio; Mateos, Pedro F; Martínez-Molina, Eustoquio; Rodríguez-Barrueco, Claudino; Velázquez, Encarna

    2009-08-01

    During a screening of phosphate solubilizing bacteria (PSB) in agricultural soils, two strains, IH9 and OCI1, were isolated from the rhizosphere of grasses in Spain, and they showed a high ability to solubilize phosphate in vitro. Inoculation experiments in chickpea and barley were conducted with both strains and the results demonstrated their ability to promote plant growth. The 16S rRNA gene sequences of these strains were nearly identical to each other and to those of Acinetobacter calcoaceticus DSM 30006(T), as well as the strain CIP 70.29 representing genomospecies 3. Their phenotypic characteristics also coincided with those of strains forming the A. calcoaceticus-baumannii complex. They differed from A. calcoaceticus in the utilization of l-tartrate as a carbon source and from genomospecies 3 in the use of d-asparagine as a carbon source. The 16S-23S intergenic spacer (ITS) sequences of the two isolates showed nearly 98% identities to those of A. calcoaceticus, confirming that they belong to this phylogenetic group. However, the isolates appeared as a separate branch from the A. calcoaceticus sequences, indicating their molecular separation from other A. calcoaceticus strains. The analysis of three housekeeping genes, recA, rpoD and gyrB, confirmed that IH9 and OCI1 form a distinct lineage within A. calcoaceticus. These results were congruent with those from DNA-DNA hybridization, indicating that strains IH9 and OCI1 constitute a new genomovar for which we propose the name A. calcoaceticus genomovar rhizosphaerae. PMID:19467815

  6. Immunochemical identification of the major cell surface agglutinogen of Acinetobacter calcoaceticus RAG-92.

    PubMed

    Bayer, E A; Skutelsky, E; Goldman, S; Rosenberg, E; Gutnick, D L

    1983-04-01

    The immunochemical and immunocytochemical characteristics of three Acinetobacter calcoaceticus RAG strains were compared in order to clarify the relationship between antibody-induced agglutination and the production of polyanionic extracellular emulsifier (termed emulsan). In addition to the parent, RAG-92, two mutant strains were examined: (1) a non-agglutinating emulsan-producer (AB15), and (2) an agglutinating mutant (16TLU) defective in the production of emulsan. A combined genetic-immunochemical approach was employed. This included the comparison of crossed immunoelectrophoresis patterns of parent and mutant supernates and the effect of absorption of anti-whole cell antiserum with mutant cells. In addition, agglutinability and competition studies were performed as well as electron microscopic cytochemistry. The results demonstrated that three major antigenic components were associated with the cell surface and the supernate. Mutant cells were altered both in their cell surface properties and in their extracellular products. One antigenic component, termed component C3, was the major cell surface agglutinogen; this component was absent in non-agglutinating mutants. Component C3 may be identical with or attached to the 300 nm projections on the parent cell surface, but it is not directly related to the presence of emulsan. It appears that emulsan plays little or no role in the phenomenon of antibody-induced agglutination of this organism. PMID:6688443

  7. Production and Secretion of the Polysaccharide Biodispersan of Acinetobacter calcoaceticus A2 in Protein Secretion Mutants.

    PubMed

    Elkeles, A; Rosenberg, E; Ron, E Z

    1994-12-01

    Biodispersan is an extracellular anionic polysaccharide produced by Acinetobacter calcoaceticus A2 that changes the surface properties of limestone and acts both as a dispersant and as a grinding aid (E. Rosenberg, C. Rubinovitz, A. Gottlieb, S. Rosenhak, and E. Z. Ron, Appl. Environ. Microbiol. 54:317-322, 1988; E. Rosenberg, C. Rubinovitz, R. Legmann, and E. Z. Ron, Appl. Environ. Microbiol. 54:323-326, 1988; E. Rosenberg, Z. Schwartz, A. Tenenbaum, C. Rubinovitz, R. Legmann, and E. Z. Ron, J. Dispersion Sci. Technol. 10:241-250, 1989). Extracellular fluid also contains a high concentration of secreted proteins that create problems in the purification and application of biodispersan. In order to obtain preparations of biodispersan that contained smaller amounts of protein, we selected mutants of strain A2 that were defective in protein secretion. These mutants produced equal, or even higher, levels of total biodispersan compared with those of the parental strain. Moreover, although there was a significant drop in the concentration of extracellular proteins in the medium, the secretion of biodispersan was unaffected. These results suggest that secretion mutants are potentially useful for the production of extracellular polysaccharides. PMID:16349473

  8. Autoantibodies to Brain Components and Antibodies to Acinetobacter calcoaceticus Are Present in Bovine Spongiform Encephalopathy

    PubMed Central

    Tiwana, Harmale; Wilson, Clyde; Pirt, John; Cartmell, William; Ebringer, Alan

    1999-01-01

    Bovine spongiform encephalopathy (BSE) is a neurological disorder, predominantly of British cattle, which belongs to the group of transmissible spongiform encephalopathies together with Creutzfeldt-Jakob disease (CJD), kuru, and scrapie. Autoantibodies to brain neurofilaments have been previously described in patients with CJD and kuru and in sheep affected by scrapie. Spongiform-like changes have also been observed in chronic experimental allergic encephalomyelitis, at least in rabbits and guinea pigs, and in these conditions autoantibodies to myelin occur. We report here that animals with BSE have elevated levels of immunoglobulin A autoantibodies to brain components, i.e., neurofilaments (P < 0.001) and myelin (P < 0.001), as well as to Acinetobacter calcoaceticus (P < 0.001), saprophytic microbes found in soil which have sequences cross-reacting with bovine neurofilaments and myelin, but there were no antibody elevations against Agrobacterium tumefaciens or Escherichia coli. The relevance of such mucosal autoantibodies or antibacterial antibodies to the pathology of BSE and its possible link to prions requires further evaluation. PMID:10569779

  9. Purification and properties of L-mandelate dehydrogenase and comparison with other membrane-bound dehydrogenases from Acinetobacter calcoaceticus.

    PubMed

    Hoey, M E; Allison, N; Scott, A J; Fewson, C A

    1987-12-15

    L-Mandelate dehydrogenase was purified from Acinetobacter calcoaceticus by Triton X-100 extraction from a 'wall + membrane' fraction, ion-exchange chromatography on DEAE-Sephacel, (NH4)2SO4 fractionation and gel filtration followed by further ion-exchange chromatography. The purified enzyme was partially characterized with respect to its subunit Mr (44,000), pH optimum (7.5), pI value (4.2), substrate specificity and susceptibility to various potential inhibitors including thiol-blocking reagents. FMN was identified as the non-covalently bound cofactor. The properties of L-mandelate dehydrogenase are compared with those of D-mandelate dehydrogenase, D-lactate dehydrogenase and L-lactate dehydrogenase from A. calcoaceticus. PMID:3325042

  10. Purification and properties of L-mandelate dehydrogenase and comparison with other membrane-bound dehydrogenases from Acinetobacter calcoaceticus.

    PubMed Central

    Hoey, M E; Allison, N; Scott, A J; Fewson, C A

    1987-01-01

    L-Mandelate dehydrogenase was purified from Acinetobacter calcoaceticus by Triton X-100 extraction from a 'wall + membrane' fraction, ion-exchange chromatography on DEAE-Sephacel, (NH4)2SO4 fractionation and gel filtration followed by further ion-exchange chromatography. The purified enzyme was partially characterized with respect to its subunit Mr (44,000), pH optimum (7.5), pI value (4.2), substrate specificity and susceptibility to various potential inhibitors including thiol-blocking reagents. FMN was identified as the non-covalently bound cofactor. The properties of L-mandelate dehydrogenase are compared with those of D-mandelate dehydrogenase, D-lactate dehydrogenase and L-lactate dehydrogenase from A. calcoaceticus. PMID:3325042

  11. Genotypic and Phenotypic Correlations of Multidrug-Resistant Acinetobacter baumannii-A. calcoaceticus Complex Strains Isolated from Patients at the National Naval Medical Center

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Acinetobacter baumannii-calcoaceticus complex (ABC) infections have complicated the care of U.S. combat casualties. In this study, 102 ABC isolates from wounded soldiers treated at National Naval Medical Center (NNMC) were characterized by phenotype and genotype to identify clones in this population...

  12. Characterization of carbapenem-resistant Acinetobacter calcoaceticus-baumannii complex isolates from nosocomial bloodstream infections in southern Iran.

    PubMed

    Pourabbas, Bahman; Firouzi, Roya; Pouladfar, Gholamreza

    2016-03-01

    Acinetobacter baumannii is an important opportunistic bacterial pathogen responsible for serious infections in hospitalized patients. From a total of 78 consecutive non-repetitive Acinetobacter spp. isolates from patients with blood infections, 61 were carbapenem resistant, which were positive for blaOXA-51-like (96.7%), blaOXA-23-like (77 %), blaOXA-58-like (8.1%) and blaOXA-40-like genes (32.8%) by multiplex PCR. The isolates were identified as A. baumannii (n = 59) and Acinetobacter nosocomialis (n = 2). Also, we found a case of Acinetobacter junii, causing bacteraemia, that possessed the IMP gene. High levels of resistance were observed to fluoroquinolones, aminoglycosides, tigecycline and to the beta-lactam antibiotics, including piperacillin/tazobactam and ampicillin/sulbactam. ISAba1 was present in 96.7% of all Acinetobacter calcoaceticus-baumannii complex (Acb) isolates. Also, 33 (54.1%) and 23 (37.7%) isolates harboured ISAba1 upstream of blaOXA-23-like and blaOXA-51-like genes, respectively, though this was not observed in A. nosocomialis isolates. No relationship was observed between the presence of ISAba1 upstream of oxacillinase genes and the level of carbapenem resistance in all Acb isolates. Only two genes encoding metallo-beta-lactamase (VIM, SPM) were detected in all Acb isolates. This suggests that carbapenem resistance in blood-isolate Acb is mostly due to the presence of acquired carbapenemases. This is the first report from Iran on the identification of A. nosocomialis isolates that possess multiple oxacillinase genes and lack upstream ISAba1. PMID:26747061

  13. Evolution of regulatory genes governing biodegradation in acinetobacter calcoaceticus. Final report, 15 July 1991-31 December 1994

    SciTech Connect

    Ornston, L.N.

    1995-02-22

    The Acinetobacter calcoaceticus pca-qui-pob supraoperonic gene cluster encodes bacterial enzymes that metabolize aromatic and hydroaromatic compounds in the environment. Our investigation is directed to understanding how mutation, gene rearrangement and selection contributed to evolution of the transcriptional controls exercised over genes in the cluster. The complete nucleotide sequence of the 18 kbp gene cluster has been determined, and genetic manipulations have been used to explore mechanisms contributing to expression of the genes. The results reveal that structural gene expression is governed by complex interactions between the products of different regulatory genes some of which share common ancestry. Additional controls appear to be exercised by compartmentation of some catabolic enzymes outside the inner cell membrane. Recombination appears to have made a major contribution to the evolution of existing control mechanisms, and their maintenance may be influence by continuing recombination. Contributions of recombination to mutation and repair are under investigation as are specific molecular mechanisms underlying transcriptional controls.

  14. Epidemiological Characteristics of blaNDM-1 in Enterobacteriaceae and the Acinetobacter calcoaceticus-Acinetobacter baumannii Complex in China from 2011 to 2012

    PubMed Central

    Ou, Weimei; Cui, Lanqing; Li, Yun; Zheng, Bo; Lv, Yuan

    2014-01-01

    Objectives The study aimed to investigate the prevalence and epidemiological characteristics of blaNDM-1 (encoding New Delhi metallo-β-lactamase 1) in Enterobacteriaceae and the Acinetobacter calcoaceticus-Acinetobacter baumannii complex (ABC) in China from July 2011 to June 2012. Methods PCR was used to screen for the presence of blaNDM-1 in all organisms studied. For blaNDM-1-positive strains, 16S rRNA analysis and Analytical Profile Index (API) strips were used to identify the bacterial genus and species. The ABCs were reconfirmed by PCR detection of blaOXA-51-like. Antibiotic susceptibilities of the bacteria were assessed by determining minimum inhibitory concentration (MIC) of them using two-fold agar dilution test, as recommended by the Clinical and Laboratory Standards Institute (CLSI). Molecular typing was performed using pulsed-field gel electrophoresis (PFGE). S1 nuclease-pulsed-field gel electrophoresis (S1-PFGE) and Southern blot hybridization were conducted to ascertain the gene location of blaNDM-1. Conjugation experiments were conducted to determine the transmission of blaNDM-1-positive strains. Results Among 2,170 Enterobacteriaceae and 600 ABCs, seven Enterobacteriaceae strains and two A. calcoaceticus isolates from five different cities carried the blaNDM-1 gene. The seven Enterobacteriaceae strains comprised four Klebsiella pneumoniae, one Enterobacter cloacae, one Enterobacter aerogen and one Citrobacter freundii. All seven were non-susceptible to imipenem, meropenem or ertapenem. Two A. calcoaceticus species were resistant to imipenem and meropenem. Three K. pneumoniae showed the same PFGE profiles. The blaNDM-1 genes of eight strains were localized on plasmids, while one was chromosomal. Conclusions Compared with previous reports, the numbers and species containing the blaNDM-1 in Enterobacteriaceae have significantly increased in China. Most of them are able to disseminate the gene, which is cause for concern. Consecutive surveillance should

  15. Molecular Epidemiology and Clinical Impact of Acinetobacter calcoaceticus-baumannii Complex in a Belgian Burn Wound Center.

    PubMed

    De Vos, Daniel; Pirnay, Jean-Paul; Bilocq, Florence; Jennes, Serge; Verbeken, Gilbert; Rose, Thomas; Keersebilck, Elkana; Bosmans, Petra; Pieters, Thierry; Hing, Mony; Heuninckx, Walter; De Pauw, Frank; Soentjens, Patrick; Merabishvili, Maia; Deschaght, Pieter; Vaneechoutte, Mario; Bogaerts, Pierre; Glupczynski, Youri; Pot, Bruno; van der Reijden, Tanny J; Dijkshoorn, Lenie

    2016-01-01

    Multidrug resistant Acinetobacter baumannii and its closely related species A. pittii and A. nosocomialis, all members of the Acinetobacter calcoaceticus-baumannii (Acb) complex, are a major cause of hospital acquired infection. In the burn wound center of the Queen Astrid military hospital in Brussels, 48 patients were colonized or infected with Acb complex over a 52-month period. We report the molecular epidemiology of these organisms, their clinical impact and infection control measures taken. A representative set of 157 Acb complex isolates was analyzed using repetitive sequence-based PCR (rep-PCR) (DiversiLab) and a multiplex PCR targeting OXA-51-like and OXA-23-like genes. We identified 31 rep-PCR genotypes (strains). Representatives of each rep-type were identified to species by rpoB sequence analysis: 13 types to A. baumannii, 10 to A. pittii, and 3 to A. nosocomialis. It was assumed that isolates that belonged to the same rep-type also belonged to the same species. Thus, 83.4% of all isolates were identified to A. baumannii, 9.6% to A. pittii and 4.5% to A. nosocomialis. We observed 12 extensively drug resistant Acb strains (10 A. baumannii and 2 A. nosocomialis), all carbapenem-non-susceptible/colistin-susceptible and imported into the burn wound center through patients injured in North Africa. The two most prevalent rep-types 12 and 13 harbored an OXA-23-like gene. Multilocus sequence typing allocated them to clonal complex 1 corresponding to EU (international) clone I. Both strains caused consecutive outbreaks, interspersed with periods of apparent eradication. Patients infected with carbapenem resistant A. baumannii were successfully treated with colistin/rifampicin. Extensive infection control measures were required to eradicate the organisms. Acinetobacter infection and colonization was not associated with increased attributable mortality. PMID:27223476

  16. Molecular Epidemiology and Clinical Impact of Acinetobacter calcoaceticus-baumannii Complex in a Belgian Burn Wound Center

    PubMed Central

    Bilocq, Florence; Jennes, Serge; Verbeken, Gilbert; Rose, Thomas; Keersebilck, Elkana; Bosmans, Petra; Pieters, Thierry; Hing, Mony; Heuninckx, Walter; De Pauw, Frank; Soentjens, Patrick; Merabishvili, Maia; Deschaght, Pieter; Vaneechoutte, Mario; Bogaerts, Pierre; Glupczynski, Youri; Pot, Bruno; van der Reijden, Tanny J.; Dijkshoorn, Lenie

    2016-01-01

    Multidrug resistant Acinetobacter baumannii and its closely related species A. pittii and A. nosocomialis, all members of the Acinetobacter calcoaceticus-baumannii (Acb) complex, are a major cause of hospital acquired infection. In the burn wound center of the Queen Astrid military hospital in Brussels, 48 patients were colonized or infected with Acb complex over a 52-month period. We report the molecular epidemiology of these organisms, their clinical impact and infection control measures taken. A representative set of 157 Acb complex isolates was analyzed using repetitive sequence-based PCR (rep-PCR) (DiversiLab) and a multiplex PCR targeting OXA-51-like and OXA-23-like genes. We identified 31 rep-PCR genotypes (strains). Representatives of each rep-type were identified to species by rpoB sequence analysis: 13 types to A. baumannii, 10 to A. pittii, and 3 to A. nosocomialis. It was assumed that isolates that belonged to the same rep-type also belonged to the same species. Thus, 83.4% of all isolates were identified to A. baumannii, 9.6% to A. pittii and 4.5% to A. nosocomialis. We observed 12 extensively drug resistant Acb strains (10 A. baumannii and 2 A. nosocomialis), all carbapenem-non-susceptible/colistin-susceptible and imported into the burn wound center through patients injured in North Africa. The two most prevalent rep-types 12 and 13 harbored an OXA-23-like gene. Multilocus sequence typing allocated them to clonal complex 1 corresponding to EU (international) clone I. Both strains caused consecutive outbreaks, interspersed with periods of apparent eradication. Patients infected with carbapenem resistant A. baumannii were successfully treated with colistin/rifampicin. Extensive infection control measures were required to eradicate the organisms. Acinetobacter infection and colonization was not associated with increased attributable mortality. PMID:27223476

  17. Involvement of a plasmid in growth on and dispersion of crude oil by Acinetobacter calcoaceticus RA57

    SciTech Connect

    Rusansky, S.; Avigad, R.; Michaeli, S.; Gutnick, D.L.

    1987-08-01

    A crude-oil-degrading Acinetobacter species, Acinetobacter calcoaceticus RA57, was isolated by standard enrichment culture techniques on the basis of its ability to utilize the oily sludge found in the vicinity of a local gas station. Strain RA57 was found to contain four plasmids: pSR1, pSR2, pSR3, and pSR4. Both supercoiled and open circular forms of the first three plasmids were identified by two-dimensional gel electrophoresis. Restriction endonuclease analysis of pSR4 demonstrated that the plasmid contained a circular map. Colonies were isolated at random after growth in the presence of acridine orange and found to fall into two categories: (i) those which had lost the ability to grow on and disperse crude oil in liquid culture and concurrently were cured of pSR4 and (ii) those which retained the ability to both grow on and disperse crude oil and which contained pSR4. Strains from the first class continued to grow on hydrocarbon vapors, indicating that the defect associated with the curing of pSR4 was related to the physical interaction of the cells with the hydrocarbon substrate, rather than to its metabolism. No differences in either adherence to hydrocarbons or production of extracellular emulsifying activity were found between the two classes of mutants. In growth experiments on crude oil in mixed culture with strains which either contained or lacked pSR4, no sparing of the growth defect was observed. The results are consistent with the possibility that pSR4 encodes a factor(s) which is tightly associated with the cell surface.

  18. [Effect of univalent cations on synthesis of surfactants by Acinetobacter calcoaceticus IMV B-7241].

    PubMed

    Pirog, T P; Shevchuk, T A; Antoniuk, S I; Kravchenko, E Iu; Iutinskaia, G A

    2013-01-01

    The effect of univalent cations on activity of key enzymes of C2-metabolism has been investigated in the producer of biosurfactants, Acinetibacter calcoaceticus IMV B-7241 grown on ethanol. It was established that potassium cations are inhibitors of pyroquinolinequinone-dependent alcohol- and acetaldehyde dehydrogenases, the enzymes of biosynthesis of surface-active aminolipids (NADP-dependent glutamate dehydrogenase) and glycolipids (phosphoenopyruvate (PhEP)-carboxikinase), while ammonium cations are activators of these enzymes and PhEP-carboxylase. A decrease of potassium cations concentration in the cultivation medium to 1 mM and increase of the content of amine nitrogen to 10 mM as a result of potassium nitrate substitution by equimolar, as to nitrogen, urea concentration were accompanied by the increase of activity of enzymes of ethanol metabolism and SAS biosynthesis, as well as by the 2-fold increase of conditional concentration of the biosurfactants. PMID:23720959

  19. Characterization of lipase-deficient mutants of Acinetobacter calcoaceticus BD413: identification of a periplasmic lipase chaperone essential for the production of extracellular lipase.

    PubMed Central

    Kok, R G; van Thor, J J; Nugteren-Roodzant, I M; Vosman, B; Hellingwerf, K J

    1995-01-01

    Acinetobacter calcoaceticus BD413 produces an extracellular lipase, which is encoded by the lipA gene. Five lipase-deficient mutants have been generated via random insertion mutagenesis. Phenotypic characterization of these mutants revealed the presence of as many as four lipolytic enzymes in A. calcoaceticus. Biochemical evidence classified four of the mutants as export mutants, which presumably are defective in translocation of the lipase across the outer membrane. The additional mutant, designated AAC302, displays a LipA- phenotype, and yet the mutation in this strain was localized 0.84 kbp upstream of lipA. Sequence analysis of this region revealed an open reading frame, designated lipB, that is disrupted in AAC302. The protein encoded by this open reading frame shows extensive similarity to a chaperone-like helper protein of several pseudomonads, required for the production of extracellular lipase. Via complementation of AAC302 with a functional extrachromosomal copy of lipA, it could be determined that LipB is essential for lipase production. As shown by the use of a translational LipB-PhoA fusion construct, the C-terminal part of LipB of A. calcoaceticus BD413 is located outside the cytoplasm. Sequence analysis further strongly suggests that A. calcoaceticus LipB is N terminally anchored in the cytoplasmic membrane. Therefore, analogous to the situation in Pseudomonas species, however, lipB in A. calcoaceticus is located upstream of the structural lipase gene. lipB and lipA form a bicistronic operon, and the two genes are cotranscribed from an Escherichia coli sigma 70-type promoter. The reversed order of genes, in comparison with the situation in Pseudomonas species, suggests that LipA and LipB are produced in equimolar amounts. Therefore, the helper protein presumably does not only have a catalytic function, e.g., in folding of the lipase, but is also likely to act as a lipase-specific chaperone. A detailed model of the export route of the lipase of A

  20. Characterization of lipase-deficient mutants of Acinetobacter calcoaceticus BD413: identification of a periplasmic lipase chaperone essential for the production of extracellular lipase.

    PubMed

    Kok, R G; van Thor, J J; Nugteren-Roodzant, I M; Vosman, B; Hellingwerf, K J

    1995-06-01

    Acinetobacter calcoaceticus BD413 produces an extracellular lipase, which is encoded by the lipA gene. Five lipase-deficient mutants have been generated via random insertion mutagenesis. Phenotypic characterization of these mutants revealed the presence of as many as four lipolytic enzymes in A. calcoaceticus. Biochemical evidence classified four of the mutants as export mutants, which presumably are defective in translocation of the lipase across the outer membrane. The additional mutant, designated AAC302, displays a LipA- phenotype, and yet the mutation in this strain was localized 0.84 kbp upstream of lipA. Sequence analysis of this region revealed an open reading frame, designated lipB, that is disrupted in AAC302. The protein encoded by this open reading frame shows extensive similarity to a chaperone-like helper protein of several pseudomonads, required for the production of extracellular lipase. Via complementation of AAC302 with a functional extrachromosomal copy of lipA, it could be determined that LipB is essential for lipase production. As shown by the use of a translational LipB-PhoA fusion construct, the C-terminal part of LipB of A. calcoaceticus BD413 is located outside the cytoplasm. Sequence analysis further strongly suggests that A. calcoaceticus LipB is N terminally anchored in the cytoplasmic membrane. Therefore, analogous to the situation in Pseudomonas species, however, lipB in A. calcoaceticus is located upstream of the structural lipase gene. lipB and lipA form a bicistronic operon, and the two genes are cotranscribed from an Escherichia coli sigma 70-type promoter. The reversed order of genes, in comparison with the situation in Pseudomonas species, suggests that LipA and LipB are produced in equimolar amounts. Therefore, the helper protein presumably does not only have a catalytic function, e.g., in folding of the lipase, but is also likely to act as a lipase-specific chaperone. A detailed model of the export route of the lipase of A

  1. Plant growth-promoting bacterium Acinetobacter calcoaceticus P23 increases the chlorophyll content of the monocot Lemna minor (duckweed) and the dicot Lactuca sativa (lettuce).

    PubMed

    Suzuki, Wakako; Sugawara, Masayuki; Miwa, Kyoko; Morikawa, Masaaki

    2014-07-01

    Acinetobacter calcoaceticus P23 is a plant growth-promoting bacterium that was isolated from the surface of duckweed (Lemna aoukikusa). The bacterium was observed to colonize on the plant surfaces and increase the chlorophyll content of not only the monocotyledon Lemna minor but also the dicotyledon Lactuca sativa in a hydroponic culture. This effect on the Lactuca sativa was significant in nutrient-poor (×1/100 dilution of H2 medium) and not nutrient-rich (×1 or ×1/10 dilutions of H2 medium) conditions. Strain P23 has the potential to play a part in the future development of fertilizers and energy-saving hydroponic agricultural technologies. PMID:24468072

  2. [Synthesis of surfactants by Rhodococcus erythropolis IMV Ac-5017, Acinetobacter calcoaceticus IMV B-7241 and Nocardia vaccinii IMV B-7405 on industrial waste].

    PubMed

    Pirog, T P; Sofilkanich, A P; Pokora, K A; Shevchuk, T A; Iutinskaia, G A

    2014-01-01

    The synthesis of surfactants by Rhodococcus erythropolis IMV Ac-5017, Acinetobacter calcoaceticus IMV B-7241 and Nocardia vaccinii IMV B-7405 on industrial waste (food and oil-processing industry, production of biodiesel) was investigated. The possibility of replacing the expensive substrates (n-hexadecane and ethanol) by industrial waste (oil and fat industry, fried sunflower oil, glycerol, liquid paraffin) for the surfactant biosynthesis was established. The conditional concentration of surfactants was maximal on oil containing substrates and exceeded those on n-hexadecane and ethanol 2-3 times. The highest rates of surfactants synthesis were observed on fried sunflower oil with the use of inoculum grown on carbohydrate substrates (glucose, molasses). It was established that the addition of glucose (0.1%) was accompanied by 2-4-fold intensification of surfactants synthesis by R. erythropolis IMV Ac-5017 and N. vaccinii IMV B-7405 on fried sunflower oil (2%). PMID:25000725

  3. Acinetobacter calcoaceticus genes involved in biosynthesis of the coenzyme pyrrolo-quinoline-quinone: nucleotide sequence and expression in Escherichia coli K-12.

    PubMed Central

    Goosen, N; Horsman, H P; Huinen, R G; van de Putte, P

    1989-01-01

    Synthesis of the coenzyme pyrrolo-quinoline-quinone (PQQ) from Acinetobacter calcoaceticus requires the products of at least four different genes. In this paper we present the nucleotide sequence of a 5,085-base-pair DNA fragment containing these four genes. Within the DNA fragment three reading frames are present, coding for proteins of Mr 10,800, 29,700, and 43,600 and corresponding to three of the PQQ genes. In the DNA region where the fourth PQQ gene was mapped the largest possible reading frame encodes for a polypeptide of only 24 amino acids. Still, the expression of this region is essential for the biosynthesis of PQQ. A possible role for this DNA region is discussed. Sandwiched between two PQQ genes an additional reading frame is present, coding for a protein of Mr 33,600. This gene, which is probably transcribed in the same operon as three of the PQQ genes, seems not required for PQQ synthesis. Expression of the PQQ genes in Acinetobacter lwoffi and Escherichia coli K-12 led to the synthesis of the coenzyme in these organisms. Images PMID:2536663

  4. Comparison of the Virulence Potential of Acinetobacter Strains from Clinical and Environmental Sources

    PubMed Central

    Tayabali, Azam F.; Nguyen, Kathy C.; Shwed, Philip S.; Crosthwait, Jennifer; Coleman, Gordon; Seligy, Verner L.

    2012-01-01

    Several Acinetobacter strains have utility for biotechnology applications, yet some are opportunistic pathogens. We compared strains of seven Acinetobacter species (baumannii, Ab; calcoaceticus, Ac; guillouiae, Ag; haemolyticus, Ah; lwoffii, Al; junii, Aj; and venetianus, Av-RAG-1) for their potential virulence attributes, including proliferation in mammalian cell conditions, haemolytic/cytolytic activity, ability to elicit inflammatory signals, and antibiotic susceptibility. Only Ah grew at 102 and 104 bacteria/well in mammalian cell culture medium at 37°C. However, co-culture with colonic epithelial cells (HT29) improved growth of all bacterial strains, except Av-RAG-1. Cytotoxicity of Ab and Ah toward HT29 was at least double that of other test bacteria. These effects included bacterial adherence, loss of metabolism, substrate detachment, and cytolysis. Only Ab and Ah exhibited resistance to killing by macrophage-like J774A.1 cells. Haemolytic activity of Ah and Av-RAG-1 was strong, but undetectable for other strains. When killed with an antibiotic, Ab, Ah, Aj and Av-RAG-1 induced 3 to 9-fold elevated HT29 interleukin (IL)-8 levels. However, none of the strains altered levels of J774A.1 pro-inflammatory cytokines (IL-1β, IL-6 and tumor necrosis factor-α). Antibiotic susceptibility profiling showed that Ab, Ag and Aj were viable at low concentrations of some antibiotics. All strains were positive for virulence factor genes ompA and epsA, and negative for mutations in gyrA and parC genes that convey fluoroquinolone resistance. The data demonstrate that Av-RAG-1, Ag and Al lack some potentially harmful characteristics compared to other Acinetobacter strains tested, but the biotechnology candidate Av-RAG-1 should be scrutinized further prior to widespread use. PMID:22655033

  5. Insertions or Deletions (Indels) in the rrn 16S-23S rRNA Gene Internal Transcribed Spacer Region (ITS) Compromise the Typing and Identification of Strains within the Acinetobacter calcoaceticus-baumannii (Acb) Complex and Closely Related Members

    PubMed Central

    Maslunka, Christopher; Gifford, Bianca; Tucci, Joseph; Gürtler, Volker; Seviour, Robert J.

    2014-01-01

    To determine whether ITS sequences in the rrn operon are suitable for identifying individual Acinetobacter Acb complex members, we analysed length and sequence differences between multiple ITS copies within the genomes of individual strains. Length differences in ITS reported previously between A. nosocomialis BCRC15417T (615 bp) and other strains (607 bp) can be explained by presence of an insertion (indel 13i/1) in the longer ITS variant. The same Indel 13i/1 was also found in ITS sequences of ten strains of A. calcoaceticus, all 639 bp long, and the 628 bp ITS of Acinetobacter strain BENAB127. Four additional indels (13i/2–13i/5) were detected in Acinetobacter strain c/t13TU 10090 ITS length variants (608, 609, 620, 621 and 630 bp). These ITS variants appear to have resulted from horizontal gene transfer involving other Acinetobacter species or in some cases unrelated bacteria. Although some ITS copies in strain c/t13TU 10090 are of the same length (620 bp) as those in Acinetobacter strains b/n1&3, A. pittii (10 strains), A. calcoaceticus and A. oleivorans (not currently acknowledged as an Acb member), their individual ITS sequences differ. Thus ITS length by itself can not by itself be used to identify Acb complex strains. A shared indel in ITS copies in two separate Acinetobacter species compromises the specificity of ITS targeted probes, as shown with the Aun-3 probe designed to target the ITS in A. pitti. The presence of indel 13i/5 in the ITS of Acinetobacter strain c/t13TU means it too responded positively to this probe. Thus, neither ITS sequencing nor the currently available ITS targeted probes can distinguish reliably between Acb member species. PMID:25141005

  6. [Destruction of oil in the presence of Cu2+ and surfactants of Acinetobacter calcoaceticus IMV B-7241, Rhodococcus erythropolis IMV Ac-5017 and Nocardia vaccinii IMV B-7405].

    PubMed

    Pirog, T P; Konon, A D; Sofilkanich, A P; Shevchuk, T A; Iutinska, G O

    2015-01-01

    The effect of copper cations (0.01-1.0 mM) and surface-active agents (surfactants) of Acinetobacter calcoaceticus IMV B-7241, Rhodococcus erythropolis IMV Alc-5017 and Nocardia vaccinii IMV B-7405 in the form of culture liquid on the destruction of oil in water (3.0-6.0 g/L) and soil (20 g/kg), including in the presence of Cd2+ and Pb2+ (0.01-0.5 mM), was investigated. It was shown that the degree of oil degradation in water and soil after 20 days in the presence of low concentrations of Cu2+ (0.01-0.05 mM) and culture liquid of strains IMV B-7241, IMV Ac-5017, and IMV B-7405 was 15 - 25% higher than without copper cations. The activating effect of Cu2+ on the decomposition of complex oil and Cd2+ and Pb2+ pollution was established: after treatment with surfactant of A. calcoacelicus IMV B-7241 and R. erythropolis IMV Ac-5017 destruction of oil in water and soil was 85-95%, and after removal of the copper cations decreased to 45-70%. Intensification of oil destruction in the presence of copper cations may be due to their stimulating effect on the activity of alkane hydroxylases as in surfactant-producing strains, and natural (autochthonous) oxidizing microbiota. PMID:26036026

  7. Novel Regulator MphX Represses Activation of Phenol Hydroxylase Genes Caused by a XylR/DmpR-Type Regulator MphR in Acinetobacter calcoaceticus

    PubMed Central

    Zhan, Yuhua; Wang, Jin; Yan, Yongliang; Chen, Ming; Lu, Wei; Ping, Shuzhen; Zhang, Wei; Zhao, Zhonglin; Li, Shuying; Takeo, Masahiro; Lin, Min

    2011-01-01

    Acinetobacter calcoaceticus PHEA-2 utilizes phenol as its sole carbon and energy source and has a multi-component phenol hydroxylase-encoding gene operon (mphKLMNOP) for phenol degradation. Two additional genes, mphR and mphX, were found upstream and downstream of mphKLMNOP, respectively. The mphR gene encodes a XylR/DmpR-type regulator-like protein and is transcribed in the opposite direction to mphKLMNOP. The mphX gene is transcribed in the same direction as mphKLMNOP and encodes a protein with 293 amino acid residues showing weak identity with some unknown proteins encoded in the meta-cleavage pathway gene clusters for aromatic compound degradation. Disruption of mphR by homologous recombination resulted in the loss of phenol degradation while disruption of mphX caused significantly faster phenol degradation than in the wild type strain. Transcriptional assays for mphK, mphR, and mphX revealed that mphR activated mphKLMNOP transcription in the presence of phenol, but mphX partially repressed this activation. Gel mobility-shift assay demonstrated a direct interaction of MphR with the mphK promoter region. These results indicate the involvement of a novel repressor protein MphX in transcriptional regulation of phenol hydroxylase genes caused by a XylR/DmpR-type regulator MphR. PMID:21455294

  8. Screening and characterization of a novel alkaline lipase from Acinetobacter calcoaceticus 1-7 Isolated from bohai bay in china for detergent formulation.

    PubMed

    Wang, Haikuan; Zhong, Shaojiong; Ma, Huijing; Zhang, Jie; Qi, Wei

    2012-01-01

    A novel alkaline lipase-producing strain 1-7 identified as Acinetobacter calcoaceticus was isolated from soil samples collected from Bohai Bay, China, using an olive oil alkaline plate, which contained olive oil as the sole carbon source. The lipase from strain 1-7 showed the maximum activity at pH 9.0 under 40 °C. One interesting feature of this enzyme is that it exhibits lipase activity over a broad range of temperatures and good stability. It is also stable at a broad range of pHs from 4.0 to 10.0 for 24 h. Its catalytic activity was highly enhanced in the presence of Ca(2+), Mg(2+) and K(+), but partially inhibited by Cu(2+), Al(3+), Fe(3+), Ba(2+)and Zn(2+). The fact that it displays marked stability and activity in the presence of TritonX-100, Tween-20, Tween-80, SDS, Hydrogen peroxide, Sodium perborate, Sodium hypochlorite, Sodium citrate, Sodium taurocholate, Glycerine and NaCl suggests that this lipase is suitable as an additive in detergent formulations. PMID:24031813

  9. An endophytic bacterium Acinetobacter calcoaceticus Sasm3-enhanced phytoremediation of nitrate-cadmium compound polluted soil by intercropping Sedum alfredii with oilseed rape.

    PubMed

    Chen, Bao; Ma, Xiaoxiao; Liu, Guiqing; Xu, Xiaomeng; Pan, Fengshan; Zhang, Jie; Tian, Shengke; Feng, Ying; Yang, Xiaoe

    2015-11-01

    Intensive agricultural system with high input of fertilizer results in high agricultural output. However, excessive fertilization in intensive agricultural system has great potential to cause nitrate and heavy metal accumulation in soil, which is adverse to human health. The main objective of the present study was to observe the effects of intercropping and inoculation of endophytic bacterium Acinetobacter calcoaceticus Sasm3 on phytoremediation of combined contaminated soil in oilseed rape (Brassica napus L.). The results showed that with Sasm3 inoculation, the biomass of rape was increased by 10-20% for shoot, 64% for root, and 23-29% for seeds while the nitrate accumulation in rape was decreased by 14% in root and by 12% in shoot. The cadmium concentration in rape increased significantly with mono-inoculating treatment, whereas it decreased significantly after intercropping treatment. By denaturing gradient gel electrophoresis (DGGE) and real-time quantitative PCR analysis, the diversity of bacterial community and the number of nirS and nirK gene copies increased significantly with inoculation or/and intercropping treatment. In conclusion, the endophytic bacterium Sasm3-inoculated intercropping system not only improved the efficiency of clearing cadmium from soil without obstructing crop production, but also improved the quality of crop. PMID:26146371

  10. Nucleotide sequences of the Acinetobacter calcoaceticus benABC genes for benzoate 1,2-dioxygenase reveal evolutionary relationships among multicomponent oxygenases.

    PubMed Central

    Neidle, E L; Hartnett, C; Ornston, L N; Bairoch, A; Rekik, M; Harayama, S

    1991-01-01

    The nucleotide sequences of the Acinetobacter calcoaceticus benABC genes encoding a multicomponent oxygenase for the conversion of benzoate to a nonaromatic cis-diol were determined. The enzyme, benzoate 1,2-dioxygenase, is composed of a hydroxylase component, encoded by benAB, and an electron transfer component, encoded by benC. Comparison of the deduced amino acid sequences of BenABC with related sequences, including those for the multicomponent toluate, toluene, benzene, and naphthalene 1,2-dioxygenases, indicated that the similarly sized subunits of the hydroxylase components were derived from a common ancestor. Conserved cysteine and histidine residues may bind a [2Fe-2S] Rieske-type cluster to the alpha-subunits of all the hydroxylases. Conserved histidines and tyrosines may coordinate a mononuclear Fe(II) ion. The less conserved beta-subunits of the hydroxylases may be responsible for determining substrate specificity. Each dioxygenase had either one or two electron transfer proteins. The electron transfer component of benzoate dioxygenase, encoded by benC, and the corresponding protein of the toluate 1,2-dioxygenase, encoded by xylZ, were each found to have an N-terminal region which resembled chloroplast-type ferredoxins and a C-terminal region which resembled several oxidoreductases. These BenC and XylZ proteins had regions similar to certain monooxygenase components but did not appear to be evolutionarily related to the two-protein electron transfer systems of the benzene, toluene, and naphthalene 1,2-dioxygenases. Regions of possible NAD and flavin adenine dinucleotide binding were identified. PMID:1885518

  11. Potential DNA slippage structures acquired during evolutionary divergence of Acinetobacter calcoaceticus chromosomal benABC and Pseudomonas putida TOL pWW0 plasmid xylXYZ, genes encoding benzoate dioxygenases.

    PubMed Central

    Harayama, S; Rekik, M; Bairoch, A; Neidle, E L; Ornston, L N

    1991-01-01

    The xylXYZ DNA region is carried on the TOL pWW0 plasmid in Pseudomonas putida and encodes a benzoate dioxygenase with broad substrate specificity. The DNA sequence of the region is presented and compared with benABC, the chromosomal region encoding the benzoate dioxygenase of Acinetobacter calcoaceticus. Corresponding genes from the two biological sources share common ancestry: comparison of aligned XylX-BenA, XylY-BenB, and XylZ-BenC amino acid sequences revealed respective identities of 58.3, 61.3, and 53%. The aligned genes have diverged to assume G+C contents that differ by 14.0 to 14.9%. Usage of the unusual arginine codons AGA and AGG appears to have been selected in the P. putida xylX gene as it diverged from the ancestor it shared with A. calcoaceticus benA. Homologous A. calcoaceticus and P. putida genes exhibit different patterns of DNA sequence repetition, and analysis of one such pattern suggests that mutations creating different DNA slippage structures made a significant contribution to the evolutionary divergence of xylX. PMID:1938949

  12. Validation of use of whole-cell repetitive extragenic palindromic sequence-based PCR (REP-PCR) for typing strains belonging to the Acinetobacter calcoaceticus-Acinetobacter baumannii complex and application of the method to the investigation of a hospital outbreak.

    PubMed Central

    Snelling, A M; Gerner-Smidt, P; Hawkey, P M; Heritage, J; Parnell, P; Porter, C; Bodenham, A R; Inglis, T

    1996-01-01

    Acinetobacter spp. are being reported with increasing frequency as causes of nosocomial infection. In order to identify reservoirs of infection as quickly as possible, a rapid typing method that can differentiate epidemic strains from environmental and nonepidemic strains is needed. In 1993, a cluster of Acinetobacter baumannii isolates from five patients in the adult intensive therapy unit of our tertiary-care teaching hospital led us to develop and optimize a rapid repetitive extragenic palindromic sequence-based PCR (REP-PCR) typing protocol for members of the Acinetobacter calcoaceticus-A. baumannii complex that uses boiled colonies and consensus primers aimed at repetitive extragenic palindromic sequences. Four of the five patient isolates gave the same REP-PCR typing pattern as isolates of A. baumannii obtained from the temperature probe of a Bennett humidifier; the fifth isolate had a unique profile. Disinfection of the probe with 70% ethanol, as recommended by the manufacturer, proved ineffective, as A. baumannii with the same REP-PCR pattern was isolated from it 10 days after cleaning, necessitating a change in our decontamination procedure. Results obtained with REP-PCR were subsequently confirmed by ribotyping. To evaluate the discriminatory power (D) of REP-PCR for typing members of the A. calcoaceticus-A. baumannii complex, compared with that of ribotyping, we have applied both methods to a collection of 85 strains that included representatives of six DNA groups within the complex. Ribotyping using EcoRI digests yielded 53 patterns (D = 0.98), whereas 68 different REP-PCR patterns were observed (D = 0.99). By computer-assisted analysis of gel images, 74 patterns were observed with REP-PCR (D = 1.0). Overall, REP-PCR typing proved to be slightly more discriminatory than ribotyping. Our results indicate that REP-PCR typing used boiled colonies is a simple, rapid, and effective means of typing members of the A. calcoaceticus-A. baumannii complex. PMID

  13. Physiological factors affecting production of extracellular lipase (LipA) in Acinetobacter calcoaceticus BD413: fatty acid repression of lipA expression and degradation of LipA.

    PubMed Central

    Kok, R G; Nudel, C B; Gonzalez, R H; Nugteren-Roodzant, I M; Hellingwerf, K J

    1996-01-01

    The extracellular lipase (LipA) produced by Acinetobacter calcoaceticus BD413 is required for growth of the organism on triolein, since mutant strains that lack an active lipase fail to grow with triolein as the sole carbon source. Surprisingly, extracellular lipase activity and expression of the structural lipase gene (lipA), the latter measured through lacZ as a transcriptional reporter, are extremely low in triolein cultures of LipA+ strains. The explanation for this interesting paradox lies in the effect of fatty acids on the expression of lipA. We found that long-chain fatty acids, especially, strongly repress the expression of lipA, thereby negatively influencing the production of lipase. We propose the involvement of a fatty acyl-responsive DNA-binding protein in regulation of expression of the A. calcoaceticus lipBA operon. The potential biological significance of the observed physiological competition between expression and repression of lipA in the triolein medium is discussed. Activity of the extracellular lipase is also negatively affected by proteolytic degradation, as shown in in vitro stability experiments and by Western blotting (immunoblotting) of concentrated supernatants of stationary-phase cultures. In fact, the relatively high levels of extracellular lipase produced in the early stationary phase in media which contain hexadecane are due only to enhanced stability of the extracellular enzyme under those conditions. The rapid extracellular degradation of LipA of A. calcoaceticus BD413 by an endogenous protease is remarkable and suggests that proteolytic degradation of the enzyme is another important factor in regulating the level of active extracellular lipase. PMID:8830702

  14. An amphioxus RAG1-like DNA fragment encodes a functional central domain of vertebrate core RAG1

    PubMed Central

    Zhang, Yanni; Xu, Ke; Deng, Anqi; Fu, Xing; Xu, Anlong; Liu, Xiaolong

    2014-01-01

    The highly diversified repertoire of antigen receptors in the vertebrate immune system is generated via proteins encoded by the recombination activating genes (RAGs) RAG1 and RAG2 by a process known as variable, diversity, and joining [V(D)J] gene recombination. Based on the study of vertebrate RAG proteins, many hypotheses have been proposed regarding the origin and evolution of RAG. This issue remains unresolved, leaving a significant gap in our understanding of the evolution of adaptive immunity. Here, we show that the amphioxus genome contains an ancient RAG1-like DNA fragment (bfRAG1L) that encodes a virus-related protein that is much shorter than vertebrate RAG1 and harbors a region homologous to the central domain of core RAG1 (cRAG1). bfRAG1L also contains an unexpected retroviral type II nuclease active site motif, DXN(D/E)XK, and is capable of degrading both DNA and RNA. Moreover, bfRAG1L shares important functional properties with the central domain of cRAG1, including interaction with RAG2 and localization to the nucleus. Remarkably, the reconstitution of bfRAG1L into a cRAG1-like protein yielded an enzyme capable of recognizing recombination signal sequences and performing V(D)J recombination in the presence of mouse RAG2. Moreover, this reconstituted cRAG1-like protein could mediate the assembly of antigen receptor genes in RAG1-deficient mice. Together, our results demonstrate that amphioxus bfRAG1L encodes a protein that is functionally equivalent to the central domain of cRAG1 and is well prepared for further evolution to mediate V(D)J recombination. Thus, our findings provide unique insights into the evolutionary origin of RAG1. PMID:24368847

  15. An amphioxus RAG1-like DNA fragment encodes a functional central domain of vertebrate core RAG1.

    PubMed

    Zhang, Yanni; Xu, Ke; Deng, Anqi; Fu, Xing; Xu, Anlong; Liu, Xiaolong

    2014-01-01

    The highly diversified repertoire of antigen receptors in the vertebrate immune system is generated via proteins encoded by the recombination activating genes (RAGs) RAG1 and RAG2 by a process known as variable, diversity, and joining [V(D)J] gene recombination. Based on the study of vertebrate RAG proteins, many hypotheses have been proposed regarding the origin and evolution of RAG. This issue remains unresolved, leaving a significant gap in our understanding of the evolution of adaptive immunity. Here, we show that the amphioxus genome contains an ancient RAG1-like DNA fragment (bfRAG1L) that encodes a virus-related protein that is much shorter than vertebrate RAG1 and harbors a region homologous to the central domain of core RAG1 (cRAG1). bfRAG1L also contains an unexpected retroviral type II nuclease active site motif, DXN(D/E)XK, and is capable of degrading both DNA and RNA. Moreover, bfRAG1L shares important functional properties with the central domain of cRAG1, including interaction with RAG2 and localization to the nucleus. Remarkably, the reconstitution of bfRAG1L into a cRAG1-like protein yielded an enzyme capable of recognizing recombination signal sequences and performing V(D)J recombination in the presence of mouse RAG2. Moreover, this reconstituted cRAG1-like protein could mediate the assembly of antigen receptor genes in RAG1-deficient mice. Together, our results demonstrate that amphioxus bfRAG1L encodes a protein that is functionally equivalent to the central domain of cRAG1 and is well prepared for further evolution to mediate V(D)J recombination. Thus, our findings provide unique insights into the evolutionary origin of RAG1. PMID:24368847

  16. Thermal dependency of RAG1 self-association properties

    PubMed Central

    De, Pallabi; Zhao, Shuying; Gwyn, Lori M; Godderz, LeAnn J; Peak, Mandy M; Rodgers, Karla K

    2008-01-01

    Background Functional immunoglobulin and T cell receptor genes are produced in developing lymphocytes by V(D)J recombination. The initial site-specific DNA cleavage steps in this process are catalyzed by the V(D)J recombinase, consisting of RAG1 and RAG2, which is directed to appropriate DNA cleavage sites by recognition of the conserved recombination signal sequence (RSS). RAG1 contains both the active site and the RSS binding domains, although RAG2 is also required for DNA cleavage activity. An understanding of the physicochemical properties of the RAG proteins, their association, and their interaction with the RSS is not yet well developed. Results Here, we further our investigations into the self-association properties of RAG1 by demonstrating that despite the presence of multiple RAG1 oligomers, only the dimeric form maintains the ability to interact with RAG2 and the RSS. However, facile aggregation of the dimeric form at physiological temperature may render this protein inactive in the absence of RAG2. Upon addition of RAG2 at 37°C, the preferentially stabilized V(D)J recombinase:RSS complex contains a single dimer of RAG1. Conclusion Together these results confirm that the functional form of RAG1 in V(D)J recombination is in the dimeric state, and that its stability under physiological conditions likely requires complex formation with RAG2. Additionally, in future structural and functional studies of RAG1, it will be important to take into account the temperature-dependent self-association properties of RAG1 described in this study. PMID:18234093

  17. RAG1/2 knockout pigs with severe combined immunodeficiency.

    PubMed

    Huang, Jiao; Guo, Xiaogang; Fan, Nana; Song, Jun; Zhao, Bentian; Ouyang, Zhen; Liu, Zhaoming; Zhao, Yu; Yan, Quanmei; Yi, Xiaoling; Schambach, Axel; Frampton, Jon; Esteban, Miguel A; Yang, Dongshan; Yang, Huaqiang; Lai, Liangxue

    2014-08-01

    Pigs share many physiological, biochemical, and anatomical similarities with humans and have emerged as valuable large animal models for biomedical research. Considering the advantages in immune system resemblance, suitable size, and longevity for clinical practical and monitoring purpose, SCID pigs bearing dysfunctional RAG could serve as important experimental tools for regenerative medicine, allograft and xenograft transplantation, and reconstitution experiments related to the immune system. In this study, we report the generation and phenotypic characterization of RAG1 and RAG2 knockout pigs using transcription activator-like effector nucleases. Porcine fetal fibroblasts were genetically engineered using transcription activator-like effector nucleases and then used to provide donor nuclei for somatic cell nuclear transfer. We obtained 27 live cloned piglets; among these piglets, 9 were targeted with biallelic mutations in RAG1, 3 were targeted with biallelic mutations in RAG2, and 10 were targeted with a monoallelic mutation in RAG2. Piglets with biallelic mutations in either RAG1 or RAG2 exhibited hypoplasia of immune organs, failed to perform V(D)J rearrangement, and lost mature B and T cells. These immunodeficient RAG1/2 knockout pigs are promising tools for biomedical and translational research. PMID:24973446

  18. Three faces of recombination activating gene 1 (RAG1) mutations.

    PubMed

    Patiroglu, Turkan; Akar, Himmet Haluk; Van Der Burg, Mirjam

    2015-12-01

    Severe combined immune deficiency (SCID) is a group of genetic disorder associated with development of T- and/or B-lymphocytes. Recombination-activating genes (RAG1/2) play a critical role on VDJ recombination process that leads to the production of a broad T-cell receptor (TCR) and B-cell receptor (BCR) repertoire in the development of T and B cells. RAG1/2 genes mutations result in various forms of primary immunodeficiency, ranging from classic SCID to Omenn syndrome (OS) to atypical SCID with such as granuloma formation and autoimmunity. Herein, we reported 4 patients with RAG1 deficiency: classic SCID was seen in two patients who presented with recurrent pneumonia and chronic diarrhoea, and failure to thrive. OS was observed in one patient who presented with chronic diarrhoea, skin rash, recurrent lower respiratory infections, and atypical SCID was seen in one patient who presented with Pyoderma gangrenosum (PG) and had novel RAG1 mutation. PMID:26689875

  19. Enrichment of Acinetobacter spp. from food samples.

    PubMed

    Carvalheira, Ana; Ferreira, Vânia; Silva, Joana; Teixeira, Paula

    2016-05-01

    Relatively little is known about the role of foods in the chain of transmission of acinetobacters and the occurrence of different Acinetobacter spp. in foods. Currently, there is no standard procedure to recover acinetobacters from food in order to gain insight into the food-related ecology and epidemiology of acinetobacters. This study aimed to assess whether enrichment in Dijkshoorn enrichment medium followed by plating in CHROMagar™ Acinetobacter medium is a useful method for the isolation of Acinetobacter spp. from foods. Recovery of six Acinetobacter species from food spiked with these organisms was compared for two selective enrichment media (Baumann's enrichment and Dijkshoorn's enrichment). Significantly (p < 0.01) higher cell counts were obtained in Dijkshoorn's enrichment. Next, the Dijkshoorn's enrichment followed by direct plating on CHROMagar™ Acinetobacter was applied to detect Acinetobacter spp. in different foods. Fourteen different presumptive acinetobacters were recovered and assumed to represent nine different strains on the basis of REP-PCR typing. Eight of these strains were identified by rpoB gene analysis as belonging to the species Acinetobacter johnsonii, Acinetobacter calcoaceticus, Acinetobacter guillouiae and Acinetobacter gandensis. It was not possible to identify the species level of one strain which may suggests that it represents a distinct species. PMID:26742623

  20. ACINETOBACTER SPP.: DISTINCT MORPHOLOGY ON EOSIN METHYLENE BLUE AGAR AS AN AID TO IDENTIFICATION IN DRINKING WATER

    EPA Science Inventory

    'Acinetobacter calcoaceticus', frequently found in drinking waters and implicated in nosocomial infections, was presumptively identified by its tiny, blue colonial appearance on Levine eosin methylene blue agar. All of the 33 isolates from drinking water showing this distinctive ...

  1. Identification of two catalytic residues in RAG1 that define a single active site within the RAG1/RAG2 protein complex.

    PubMed

    Fugmann, S D; Villey, I J; Ptaszek, L M; Schatz, D G

    2000-01-01

    During V(D)J recombination, the RAG1 and RAG2 proteins cooperate to catalyze a series of DNA bond breakage and strand transfer reactions. The structure, location, and number of active sites involved in RAG-mediated catalysis have as yet not been determined. Using protein secondary structure prediction algorithms, we have identified a region of RAG1 with possible structural similarities to the active site regions of transposases and retroviral integrases. Based on this information, we have identified two aspartic acid residues in RAG1 (D600 and D708) that function specifically in catalysis. The results support a model in which RAG1 contains a single, divalent metal ion binding active site structurally related to the active sites of transposases/integrases and responsible for all catalytic functions of the RAG protein complex. PMID:10678172

  2. Role of RAG1 autoubiquitination in V(D)J recombination

    PubMed Central

    Singh, Samarendra K.; Gellert, Martin

    2015-01-01

    The variable domains of Ig and T-cell receptor genes in vertebrates are assembled from gene fragments by the V(D)J recombination process. The RAG1–RAG2 recombinase (RAG1/2) initiates this recombination by cutting DNA at the borders of recombination signal sequences (RSS) and their neighboring gene segments. The RAG1 protein is also known to contain a ubiquitin E3 ligase activity, located in an N-terminal region that is not strictly required for the basic recombination reaction but helps to regulate recombination. The isolated E3 ligase domain was earlier shown to ubiquitinate one site in a neighboring RAG1 sequence. Here we show that autoubiquitination of full-length RAG1 at this specific residue (K233) results in a large increase of DNA cleavage by RAG1/2. A mutational block of the ubiquitination site abolishes this effect and inhibits recombination of a test substrate in mouse cells. Thus, ubiquitination of RAG1, which can be promoted by RAG1’s own ubiquitin ligase activity, plays a significant role in governing the level of V(D)J recombination activity. PMID:26124138

  3. Mapping and Quantitation of the Interaction between the Recombination Activating Gene Proteins RAG1 and RAG2.

    PubMed

    Zhang, Yu-Hang; Shetty, Keerthi; Surleac, Marius D; Petrescu, Andrei J; Schatz, David G

    2015-05-01

    The RAG endonuclease consists of RAG1, which contains the active site for DNA cleavage, and RAG2, an accessory factor whose interaction with RAG1 is critical for catalytic function. How RAG2 activates RAG1 is not understood. Here, we used biolayer interferometry and pulldown assays to identify regions of RAG1 necessary for interaction with RAG2 and to measure the RAG1-RAG2 binding affinity (KD ∼0.4 μM) (where RAG1 and RAG2 are recombination activating genes 1 or 2). Using the Hermes transposase as a guide, we constructed a 36-kDa "mini" RAG1 capable of interacting robustly with RAG2. Mini-RAG1 consists primarily of the catalytic center and the residues N-terminal to it, but it lacks a zinc finger region in RAG1 previously implicated in binding RAG2. The ability of Mini-RAG1 to interact with RAG2 depends on a predicted α-helix (amino acids 997-1008) near the RAG1 C terminus and a region of RAG1 from amino acids 479 to 559. Two adjacent acidic amino acids in this region (Asp-546 and Glu-547) are important for both the RAG1-RAG2 interaction and recombination activity, with Asp-546 of particular importance. Structural modeling of Mini-RAG1 suggests that Asp-546/Glu-547 lie near the predicted 997-1008 α-helix and components of the active site, raising the possibility that RAG2 binding alters the structure of the RAG1 active site. Quantitative Western blotting allowed us to estimate that mouse thymocytes contain on average ∼1,800 monomers of RAG1 and ∼15,000 molecules of RAG2, implying that nuclear concentrations of RAG1 and RAG2 are below the KD value for their interaction, which could help limit off-target RAG activity. PMID:25745109

  4. Mapping and Quantitation of the Interaction between the Recombination Activating Gene Proteins RAG1 and RAG2*♦

    PubMed Central

    Zhang, Yu-Hang; Shetty, Keerthi; Surleac, Marius D.; Petrescu, Andrei J.; Schatz, David G.

    2015-01-01

    The RAG endonuclease consists of RAG1, which contains the active site for DNA cleavage, and RAG2, an accessory factor whose interaction with RAG1 is critical for catalytic function. How RAG2 activates RAG1 is not understood. Here, we used biolayer interferometry and pulldown assays to identify regions of RAG1 necessary for interaction with RAG2 and to measure the RAG1-RAG2 binding affinity (KD ∼0.4 μm) (where RAG1 and RAG2 are recombination activating genes 1 or 2). Using the Hermes transposase as a guide, we constructed a 36-kDa “mini” RAG1 capable of interacting robustly with RAG2. Mini-RAG1 consists primarily of the catalytic center and the residues N-terminal to it, but it lacks a zinc finger region in RAG1 previously implicated in binding RAG2. The ability of Mini-RAG1 to interact with RAG2 depends on a predicted α-helix (amino acids 997–1008) near the RAG1 C terminus and a region of RAG1 from amino acids 479 to 559. Two adjacent acidic amino acids in this region (Asp-546 and Glu-547) are important for both the RAG1-RAG2 interaction and recombination activity, with Asp-546 of particular importance. Structural modeling of Mini-RAG1 suggests that Asp-546/Glu-547 lie near the predicted 997-1008 α-helix and components of the active site, raising the possibility that RAG2 binding alters the structure of the RAG1 active site. Quantitative Western blotting allowed us to estimate that mouse thymocytes contain on average ∼1,800 monomers of RAG1 and ∼15,000 molecules of RAG2, implying that nuclear concentrations of RAG1 and RAG2 are below the KD value for their interaction, which could help limit off-target RAG activity. PMID:25745109

  5. Expression and V(D)J recombination activity of mutated RAG-1 proteins.

    PubMed Central

    Sadofsky, M J; Hesse, J E; McBlane, J F; Gellert, M

    1993-01-01

    The products of the RAG-1 and RAG-2 genes are essential for the recombination of the DNA encoding the antigen receptors of the developing immune system. Little is known of the specific role these genes play. We have explored the sequences encoding mouse RAG-1 by deleting large parts of the gene and by introducing local sequence changes. We find that a RAG-1 gene with 40% of the coding region deleted still retains its recombination function. In addition, a series of small deletions within the strongly conserved remaining 60% of the coding region was tested. Nine out of ten of these prove unable to provide RAG-1 activity, but one is quite active. Certain peptide sequences were also specifically targeted for mutagenesis. The RAG-1 protein generated from this expression system is transported to the nucleus and is degraded with a 15 minute half-life. The fate of the proteins made by the deletion mutants were also assessed. Transport of RAG-1 protein to the nucleus was found even with the most extensive deletions studied. The functionality of the deleted proteins is discussed with relation to an alignment of RAG-1 sequences from five animal species. Images PMID:8284210

  6. An ancient evolutionary origin of the Rag1/2 gene locus.

    PubMed

    Fugmann, Sebastian D; Messier, Cynthia; Novack, Laura A; Cameron, R Andrew; Rast, Jonathan P

    2006-03-01

    The diversity of antigen receptors in the adaptive immune system of jawed vertebrates is generated by a unique process of somatic gene rearrangement known as V(D)J recombination. The Rag1 and Rag2 proteins are the key mediators of this process. They are encoded by a compact gene cluster that has exclusively been identified in animal species displaying V(D)J-mediated immunity, and no homologous gene pair has been identified in other organisms. This distinctly restricted phylogenetic distribution has led to the hypothesis that one or both of the Rag genes were coopted after horizontal gene transfer and assembled into a Rag1/2 gene cluster in a common jawed vertebrate ancestor. Here, we identify and characterize a closely linked pair of genes, SpRag1L and SpRag2L, from an invertebrate, the purple sea urchin (Strongylocentrotus purpuratus) with similarity in both sequence and genomic organization to the vertebrate Rag1 and Rag2 genes. They are coexpressed during development and in adult tissues, and recombinant versions of the proteins form a stable complex with each other as well as with Rag1 and Rag2 proteins from several vertebrate species. We thus conclude that SpRag1L and SpRag2L represent homologs of vertebrate Rag1 and Rag2. In combination with the apparent absence of V(D)J recombination in echinoderms, this finding strongly suggests that linked Rag1- and Rag2-like genes were already present and functioning in a different capacity in the common ancestor of living deuterostomes, and that their specific role in the adaptive immune system was acquired much later in an early jawed vertebrate. PMID:16505374

  7. Zinc-finger nuclease mediated disruption of Rag1 in the LEW/Ztm rat

    PubMed Central

    2012-01-01

    Background Engineered zinc-finger nucleases (ZFN) represented an innovative method for the genome manipulation in vertebrates. ZFN introduced targeted DNA double strand breaks (DSB) and initiated non-homologous end joining (NHEJ) after pronuclear or cytoplasmatic microinjection into zygotes. Resulting frame shift mutations led to functional gene ablations in zebra fish, mice, pigs and also in laboratory rats. Therefore, we targeted the rat Rag1 gene essential for the V(D)J recombination within the immunoglobulin production process and for the differentiation of mature B and T lymphocytes to generate an immunodeficient rat model in the LEW/Ztm strain. Results After microinjection of Rag1 specific ZFN mRNAs in 623 zygotes of inbred LEW/Ztm rats 59 offspring were born from which one carried a 4 bp deletion. This frame shift mutation led to a premature stop codon and a subsequently truncated Rag1 protein confirmed by the loss of the full-length protein in Western Blot analysis. Truncation of the Rag1 protein was characterized by the complete depletion of mature B cells. The remaining T cell population contained mature CD4+/CD3+/TCRαβ+ as well as CD8+/CD3+/TCRαβ+ positive lymphocytes accompanied by a compensatory increase of natural killer cells in the peripheral blood. Reduction of T cell development in Rag1 mutant rats was associated with a hypoplastic thymus that lacked follicular structures. Histological evaluation also revealed the near-complete absence of lymphocytes in spleen and lymph nodes in the immunodeficient Rag1 mutant rat. Conclusion The Rag1 mutant rat will serve as an important model for transplantation studies. Furthermore, it may be used as a model for reconstitution experiments related to the immune system, particularly with respect to different populations of human lymphocytes, natural killer cells and autoimmune phenomena. PMID:23136839

  8. Rearrangement of RAG-1 recombinase gene in radiation-sensitive ``wasted`` mice

    SciTech Connect

    Woloschak, G.E. |; Libertin, C.R.; Weaver, P.; Churchill, M.; Chang-Liu, C.M.

    1993-09-01

    Mice recessive for the autosomal gene ``wasted`` (wst) display a disease pattern which includes increased sensitivity to the killing effects of ionizing radiation, immunodeficiency, and neurologic dysfunction. The recent cloning and characterization of recombinase genes (RAG-1/RAG-2) expressed in lymphoid and possibly central nervous system tissues prompted us to examine expression of these genes in DNA repair-deficient/immunodeficient wasted mice. Our results revealed expression of RAG-1 mRNA in spinal cord (but not brain) of control mice; no expression of RAG-1 mRNA was detected in spinal cord or brain from wst/wst mice or their normal littermates (wst/{center_dot} mice). In thymus tissue, a small RAG-1 transcript (1.0 kb) was detected in wst/wst mice that was not evident in thymus from control mice. In wst/{center_dot} mice, a two-fold increase in RAG-1 MRNA was evident in thymus tissue. RAG-2 mRNA could only be detected in thymus tissue from wst/{center_dot} and not from wst/wst or parental control BCF{sub 1} mice. Southern blots revealed a rearrangement/deletion within the RAG-1 gene of affected wasted mice, not evident in known strain-specific parental or littermate controls. These results support the idea that the RAG-1 gene may map at or near the locus for the wasted mutation. In addition, they suggest the importance of recombinase function in normal immune and central nervous system development as well as the potential contribution of this gene family to the normal repair of radiation-induced DNA damage.

  9. Generation of Rag1-knockout immunodeficient rats and mice using engineered meganucleases.

    PubMed

    Ménoret, Séverine; Fontanière, Sandra; Jantz, Derek; Tesson, Laurent; Thinard, Reynald; Rémy, Séverine; Usal, Claire; Ouisse, Laure-Hélène; Fraichard, Alexandre; Anegon, Ignacio

    2013-02-01

    Despite the recent availability of gene-specific nucleases, such as zinc-finger nucleases (ZFNs) and transcription activator-like nucleases (TALENs), there is still a need for new tools to modify the genome of different species in an efficient, rapid, and less costly manner. One aim of this study was to apply, for the first time, engineered meganucleases to mutate an endogenous gene in animal zygotes. The second aim was to target the mouse and rat recombination activating gene 1 (Rag1) to describe, for the first time, Rag1 knockout immunodeficient rats. We microinjected a plasmid encoding a meganuclease for Rag1 into the pronucleus of mouse and rat zygotes. Mutant animals were detected by PCR sequencing of the targeted sequence. A homozygous RAG1-deficient rat line was generated and immunophenotyped. Meganucleases were efficient, because 3.4 and 0.6% of mouse and rat microinjected zygotes, respectively, generated mutated animals. RAG1-deficient rats showed significantly decreased proportions and numbers of immature and mature T and B lymphocytes and normal NK cells vs. littermate wild-type controls. In summary, we describe the use of engineered meganucleases to inactivate an endogenous gene with efficiencies comparable to those of ZFNs and TALENs. Moreover, we generated an immunodeficient rat line useful for studies in which there is a need for biological parameters to be analyzed in the absence of immune responses. PMID:23150522

  10. A non-sequence specific DNA binding mode of RAG1 is inhibited by RAG2

    PubMed Central

    Zhao, Shuying; Gwyn, Lori M.; De, Pallabi; Rodgers, Karla K.

    2009-01-01

    The RAG1 and RAG2 proteins catalyze the site-specific DNA cleavage reactions in V(D)J recombination, the process that assembles antigen receptor genes from component gene segments during lymphocyte development. The first step towards the DNA cleavage reaction is the sequence-specific association of the RAG proteins with the conserved recombination signal sequence (RSS), which flanks each gene segment in the antigen receptor loci. Questions remain as to the contribution of each RAG protein to recognition of the RSS. For example, while RAG1 alone is capable of recognizing the conserved elements of the RSS, it is not clear if or how RAG2 may enhance sequence-specific associations with the RSS. To shed light on this issue, we examined the association of RAG1, with and without RAG2, to consensus RSS versus non-RSS substrates using fluorescence anisotropy and gel mobility shift assays. The results indicate that while RAG1 can recognize the RSS, the sequence-specific interaction at physiological conditions is masked by a high affinity non-sequence specific DNA-binding mode. Significantly, addition of RAG2 effectively suppressed the association of RAG1 with non-sequence specific DNA, resulting in a large differential in binding affinity for the RSS versus non-RSS sites. We conclude that this represents a major means by which RAG2 contributes to the initial recognition of the RSS, and that therefore association of RAG1 with RAG2 is required for effective interactions with the RSS in developing lymphocytes. PMID:19232525

  11. Rearrangement of RAG-1 recombinase gene in DNA-repair deficient ``wasted`` mice

    SciTech Connect

    Woloschak, G.E.; Libertin, C.R.; Weaver, P.; Churchill, M.; Chang-Liu, C.M.

    1993-11-01

    Mice recessive for the autosomal gene ``wasted`` wst display a disease pattern which includes increased sensitivity to the killing effects of ionizing radiation, immunodeficiency, and neurologic dysfunction. The recent cloning and characterization of recombinase genes (RAG-l/RAG-2) expressed in lymphoid and possibly central nervous system tissues prompted us to examine expression of these genes in DNA repair-deficient/immunodeficient wasted mice. Our results revealed expression of RAG-1 mRNA in spinal cord (but not brain) of control mice; no expression of RAG-1 mRNA was detected in spinal cord or brain from wst/wst mice or their normal littermates (wst/{center_dot}mice). In thymus tissue, a small RAG-1 transcript (1.0 kb) was detected in wst/wst mice that was not evident in thymus from control mice. In wst/{center_dot}mice, a two-fold increase in RAG-1 mRNA was evident in thymus tissue. RAG-2 mRNA could only be detected in thymus tissue from wst/{center_dot} and not from wst/wst or parental control BCF{sub 1} mice. Southern blots revealed a rearrangement/deletion within the RAG-1 gene of affected wasted mice, not evident in known strain-specific parental or littermate controls. These results support the idea that the RAG-1 gene may map at or near the locus for the wasted mutation. In addition, they suggest the importance of recombinase function in normal immune and central nervous system development as well as the potential contribution of this gene family to the normal repair of radiation-induced DNA damage.

  12. Molecular basis of engineered meganuclease targeting of the endogenous human RAG1 locus

    PubMed Central

    Muñoz, Inés G.; Prieto, Jesús; Subramanian, Sunita; Coloma, Javier; Redondo, Pilar; Villate, Maider; Merino, Nekane; Marenchino, Marco; D'Abramo, Marco; Gervasio, Francesco L.; Grizot, Sylvestre; Daboussi, Fayza; Smith, Julianne; Chion-Sotinel, Isabelle; Pâques, Frédéric; Duchateau, Philippe; Alibés, Andreu; Stricher, François; Serrano, Luis; Blanco, Francisco J.; Montoya, Guillermo

    2011-01-01

    Homing endonucleases recognize long target DNA sequences generating an accurate double-strand break that promotes gene targeting through homologous recombination. We have modified the homodimeric I-CreI endonuclease through protein engineering to target a specific DNA sequence within the human RAG1 gene. Mutations in RAG1 produce severe combined immunodeficiency (SCID), a monogenic disease leading to defective immune response in the individuals, leaving them vulnerable to infectious diseases. The structures of two engineered heterodimeric variants and one single-chain variant of I-CreI, in complex with a 24-bp oligonucleotide of the human RAG1 gene sequence, show how the DNA binding is achieved through interactions in the major groove. In addition, the introduction of the G19S mutation in the neighborhood of the catalytic site lowers the reaction energy barrier for DNA cleavage without compromising DNA recognition. Gene-targeting experiments in human cell lines show that the designed single-chain molecule preserves its in vivo activity with higher specificity, further enhanced by the G19S mutation. This is the first time that an engineered meganuclease variant targets the human RAG1 locus by stimulating homologous recombination in human cell lines up to 265 bp away from the cleavage site. Our analysis illustrates the key features for à la carte procedure in protein–DNA recognition design, opening new possibilities for SCID patients whose illness can be treated ex vivo. PMID:20846960

  13. Fine Mapping the Soybean Aphid Resistance Gene Rag1 in Soybean

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The soybean aphid [Aphis glycines Matsumura] is an important soybean [Glycine max (L.) Merr.] pest in North America. The dominant aphid resistance gene Rag1 was previously mapped from the cultivar ‘Dowling’ to a 12 centiMorgan (cM) marker interval on soybean chromosome 7 [formerly linkage group (LG)...

  14. RUNX1-dependent RAG1 deposition instigates human TCR-δ locus rearrangement

    PubMed Central

    Cieslak, Agata; Le Noir, Sandrine; Trinquand, Amélie; Lhermitte, Ludovic; Franchini, Don-Marc; Villarese, Patrick; Gon, Stéphanie; Bond, Jonathan; Simonin, Mathieu; Vanhille, Laurent; Reimann, Christian; Verhoeyen, Els; Larghero, Jerome; Six, Emmanuelle; Spicuglia, Salvatore; André-Schmutz, Isabelle; Langerak, Anton; Nadel, Bertrand; Macintyre, Elizabeth

    2014-01-01

    V(D)J recombination of TCR loci is regulated by chromatin accessibility to RAG1/2 proteins, rendering RAG1/2 targeting a potentially important regulator of lymphoid differentiation. We show that within the human TCR-α/δ locus, Dδ2-Dδ3 rearrangements occur at a very immature thymic, CD34+/CD1a−/CD7+dim stage, before Dδ2(Dδ3)-Jδ1 rearrangements. These strictly ordered rearrangements are regulated by mechanisms acting beyond chromatin accessibility. Importantly, direct Dδ2-Jδ1 rearrangements are prohibited by a B12/23 restriction and ordered human TCR-δ gene assembly requires RUNX1 protein, which binds to the Dδ2-23RSS, interacts with RAG1, and enhances RAG1 deposition at this site. This RUNX1-mediated V(D)J recombinase targeting imposes the use of two Dδ gene segments in human TCR-δ chains. Absence of this RUNX1 binding site in the homologous mouse Dδ1-23RSS provides a molecular explanation for the lack of ordered TCR-δ gene assembly in mice and may underlie differences in early lymphoid differentiation between these species. PMID:25135298

  15. A zinc site in the C-terminal domain of RAG1 is essential for DNA cleavage activity

    PubMed Central

    Gwyn, Lori M.; Peak, Mandy M.; De, Pallabi; Rahman, Negar S.; Rodgers, Karla K.

    2009-01-01

    The recombination activating protein, RAG1, a key component of the V(D)J recombinase, binds multiple Zn2+ ions in its catalytically-required core region. However, the role of zinc in the DNA cleavage activity of RAG1 is not well-resolved. To address this issue, we determined the stoichiometry of Zn2+ ions bound to the catalytically active core region of RAG1 under various conditions. Using metal quantitation methods, we determined that core RAG1 can bind up to four Zn2+ ions. Stripping the full complement of bound Zn2+ ions to produce apo-protein abrogated DNA cleavage activity. Moreover, even partial removal of zinc-binding equivalents resulted in a significant diminishment of DNA cleavage activity, as compared to holo-Zn2+ core RAG1. Mutants of the intact core RAG1 and the isolated core RAG1 domains were studied to identify the location of zinc-binding sites. Significantly, the C-terminal domain in core RAG1 binds at least two Zn2+ ions, with one zinc-binding site containing C902 and C907 as ligands (termed the CC zinc site) and H937 and H942 coordinating a Zn2+ ion in a separate site (HH zinc site). The latter zinc-binding site is essential for DNA cleavage activity, given that the H937A and H942A mutants were defective in both in vitro DNA cleavage assays and cellular recombination assays. Furthermore, as mutation of the active site residue E962 reduces Zn2+ coordination, we propose that the HH zinc site is located in close proximity to the DDE active site. Overall, these results demonstrate that Zn2+ serves an important auxiliary role for RAG1 DNA cleavage activity. Furthermore, we propose that one of the zinc-binding sites is linked to the active site of core RAG1 directly or indirectly by E962. PMID:19500590

  16. Collaboration of RAG2 with RAG1-like proteins during the evolution of V(D)J recombination.

    PubMed

    Carmona, Lina Marcela; Fugmann, Sebastian D; Schatz, David G

    2016-04-15

    The recombination-activating gene 1 (RAG1) and RAG2 proteins initiate V(D)J recombination, the process that assembles the B- and T-lymphocyte antigen receptor genes of jawed vertebrates. RAG1 and RAG2 are thought to have arisen from a transposable element, but the origins of this element are not understood. We show that two ancestral RAG1 proteins, Transib transposase and purple sea urchin RAG1-like, have a latent ability to initiate V(D)J recombination when coexpressed with RAG2 and that in vitro transposition by Transib transposase is stimulated by RAG2. Conversely, we report low levels of V(D)J recombination by RAG1 in the absence of RAG2. Recombination by RAG1 alone differs from canonical V(D)J recombination in having lost the requirement for asymmetric DNA substrates, implicating RAG2 in the origins of the "12/23 rule," a fundamental regulatory feature of the reaction. We propose that evolution of RAG1/RAG2 began with a Transib transposon whose intrinsic recombination activity was enhanced by capture of an ancestral RAG2, allowing for the development of adaptive immunity. PMID:27056670

  17. [Problem of treatment for pyo-inflammatory complications caused by Acinetobacter].

    PubMed

    Bogomolova, N S; Bol'shakov, L V; Kuznetsova, S M

    2014-01-01

    The article deals with analysis of a detection frequency and antibacterial treatment resistance of Acinetobacter spp.of different species affiliation. Strains of bacteria detected in patients with pyo-inflammatory complications after surgeries (period from 2010 to 2012) were involved in the study 137 strains of Acinetobacter spp. were detected and studied Fraction of Acinetobacter spp. in 2010, 2011 and 2012 was 2.3, 3 and 3.4% respectively. Fraction of P. aeruginosain all non-fermentative Gram-negative bacteria (NFGNB) decreased by 120% and fraction of Acinetobacter spp. increased by 200-250%. Acinetobacter spp. detection frequency was not significantly changed in the period from 2006 to 2012. However the fraction of Acinetobacter spp. in NFGNB increased by 150% and was 29% in 2012. Detection frequency of A. baumanii sharply increased in 2012. A study of antibacterial treatment resistance of Acinetobacter spp. (10 antibacterial medicines) showed that Polymyxin B and E (Colistin) was the most effective medicine for A. baumanii and A. calcoaceticus infection. 85-95% of Acinetobacter spp.strains kept sensitivity to this antibacterial medicine. 66-88.9% of A. baumanii strains, 66.7-81.8% of A. alcoaceticus and 66.6% of other Acinetobacter spp. were sensitive to Tigecycline. Dioxidine effectiveness was close to Tigecycline in 66.7-80% of A. baumanii strains. 85-100% of A. calcoaceticus strains were sensitive to Dioxidine. There is a trend of decreasing of A. baumanii sensitivity to Carbapenems by 200%. Fraction of strains sensitive to Meropenem and Imipenem in 2012 was 21.4% and 16.7% respectively. All studied strains of A. lwoffi and A. haemolyticus kept sensitivity to Carbapenems. In 2012 23.8% of A. baumanii and 50% of A. calcoaceticus strains were sensitivity to Amikacin, meanwhile A. lwoffi and A. haemolyticus were not sensitive to this medicine. 31.3% of A. baumanii and 50% of A. calcoaceticus strains were sensitive to Ceftazidime/Sulbactam. 5.3% of A. baumanii

  18. RAG1 and RAG2 in V(D)J recombination and transposition.

    PubMed

    Fugmann, S D

    2001-01-01

    RAG1 and RAG2 are the key components of the V(D)J recombinase machinery that catalyses the somatic gene rearrangements of antigen receptor genes during lymphocyte development. In the first step of V(D)J recombination--DNA cleavage--the RAG proteins act together as an endonuclease to excise the DNA between two individual gene segments. They are also thought to be involved in the subsequent DNA joining step. In vitro, the RAG proteins catalyze the integration of the excised DNA element into target DNA completing a process similar to bacterial transposition. In vivo, this reaction is suppressed by an unknown mechanism. The individual roles of RAG1 and RAG2 in V(D)J recombination and transposition reactions are discussed based on mutation analyses and structure predictions. PMID:11417858

  19. Recombination-activating gene 1 and 2 (RAG1 and RAG2) in flounder (Paralichthys olivaceus).

    PubMed

    Wang, Xianlei; Tan, Xungang; Zhang, Pei-Jun; Zhang, Yuqing; Xu, Peng

    2014-12-01

    During the development of B and T lymphocytes, Ig and TCR variable region genes are assembled from germline V, D, and J gene segments by a site-specific recombination reaction known as V(D)J recombination. The process of somatic V(D)J recombination, mediated by the recombination-activating gene (RAG) products, is the most significant characteristic of adaptive immunity in jawed vertebrates. Flounder (Paralichthys olivaceus) RAG1 and RAG2 were isolated by Genome Walker and RT-PCR, and their expression patterns were analysed by RT-PCR and in situ hybridization on sections. RAG1 spans over 7.0 kb, containing 4 exons and 3 introns, and the full-length ORF is 3207 bp, encoding a peptide of 1068 amino acids. The first exon lies in the 5'-UTR, which is an alternative exon. RAG2 full-length ORF is 1062 bp, encodes a peptide of 533 amino acids, and lacks introns in the coding region. In 6-month old flounders, the expression of RAG1 and RAG2 was essentially restricted to the pronephros (head kidney) and mesonephros (truck kidney). Additionally, both of them were mainly expressed in the thymus. These results revealed that the thymus and kidney most likely serve as the primary lymphoid tissues in the flounder. PMID:25431413

  20. Rearrangement of Rag-1 recombinase gene in DNA-repair deficient/immunodeficient ``wasted`` mice

    SciTech Connect

    Woloschak, G.E.; Weaver, P.; Churchill, M.; Chang-Liu, C-M.; Libertin, C.R.

    1992-11-01

    Mice recessive for the autosomal gene ``wasted`` (wst) display a disease pattern which includes increased sensitivity to the killing effects of ionizing radiation, immunodeficiency, and neurologic dysfunction. The recent cloning and characterization of recombinase genes (Rag-l/Rag-2) expressed in lymphoid and possibly central nervous system tissues prompted us to examine expression of these genes in DNA repair-deficient/immunodeficient wasted mice. Our results revealed that in thymus tissue, a small Rag-I transcript (1.0 kb) was detected in wst/wst mice that was not evident in thymus from control mice. In wst/{sm_bullet} mice, a two-fold increase in Rag-1 mRNA was evident in thymus tissue. Rag-2 mRNA could only be detected in thymus tissue from wst/{sm_bullet} and not from wst/wst or parental control BCF, mice. Southern blots revealed a rearrangement or deletion within the Rag-1 gene of affected wasted mice that was not evident in known strain-specific parental or littermate controls. These results support the idea that the Rag-1 gene may map at or near the locus for the wasted mutation. In addition, they suggest the importance of recombinase function in normal immune and central nervous system development as well as the potential contribution of this gene family to the normal repair of radiation-induced DNA damage.

  1. Rearrangement of Rag-1 recombinase gene in DNA-repair deficient/immunodeficient wasted'' mice

    SciTech Connect

    Woloschak, G.E.; Weaver, P.; Churchill, M.; Chang-Liu, C-M. ); Libertin, C.R. )

    1992-01-01

    Mice recessive for the autosomal gene wasted'' (wst) display a disease pattern which includes increased sensitivity to the killing effects of ionizing radiation, immunodeficiency, and neurologic dysfunction. The recent cloning and characterization of recombinase genes (Rag-l/Rag-2) expressed in lymphoid and possibly central nervous system tissues prompted us to examine expression of these genes in DNA repair-deficient/immunodeficient wasted mice. Our results revealed that in thymus tissue, a small Rag-I transcript (1.0 kb) was detected in wst/wst mice that was not evident in thymus from control mice. In wst/[sm bullet] mice, a two-fold increase in Rag-1 mRNA was evident in thymus tissue. Rag-2 mRNA could only be detected in thymus tissue from wst/[sm bullet] and not from wst/wst or parental control BCF, mice. Southern blots revealed a rearrangement or deletion within the Rag-1 gene of affected wasted mice that was not evident in known strain-specific parental or littermate controls. These results support the idea that the Rag-1 gene may map at or near the locus for the wasted mutation. In addition, they suggest the importance of recombinase function in normal immune and central nervous system development as well as the potential contribution of this gene family to the normal repair of radiation-induced DNA damage.

  2. Acinetobacter seifertii Isolated from China

    PubMed Central

    Yang, Yunxing; Wang, Jianfeng; Fu, Ying; Ruan, Zhi; Yu, Yunsong

    2016-01-01

    Abstract Clinical infections caused by Acinetobacter spp. have increasing public health concerns because of their global occurrence and ability to acquire multidrug resistance. Acinetobacter calcoaceticus–Acinetobacter baumannii (ACB) complex encompasses A. calcoaceticus, A. baumannii, A. pittii (formerly genomic species 3), and A nosocomial (formerly genomic species 13TU), which are predominantly responsible for clinical pathogenesis in the Acinetobacter genus. In our previous study, a putative novel species isolated from 385 non-A. baumannii spp. strains based on the rpoB gene phylogenetic tree was reported. Here, the putative novel species was identified as A. seifertii based on the whole-genome phylogenetic tree. A. seifertii was recognized as a novel member of the ACB complex and close to A. baumannii and A. nosocomials. Furthermore, we studied the characteristics of 10 A. seifertii isolates, which were distributed widely in 6 provinces in China and mainly caused infections in the elderly or children. To define the taxonomic status and characteristics, the biochemical reactions, antimicrobial susceptibility testing, pulsed field gel electrophoresis (PFGE), multilocus sequence typing (MLST), and whole-genome sequence analysis were performed. The phenotypic characteristics failed to distinguish A. serfertii from other species in the ACB complex. Most of the A. seifertii isolates were susceptible to antibiotics commonly used for nosocomial Acinetobacter spp. infections, but one isolate (strain A362) was resistant to ampicillin/sulbactam, ceftazidime and amikacin. The different patterns of MLST and PFGE suggested that the 10 isolates were not identical and lacked clonal relatedness. Our study reported for the first time the molecular epidemiological and genomic features of widely disseminated A. seifertii in China. These observations could enrich the knowledge of infections caused by non-A. baumannii and may provide a scientific basis for future clinical

  3. Enolase and Glycolytic Flux Play a Role in the Regulation of the Glucose Permease Gene RAG1 of Kluyveromyces lactis

    PubMed Central

    Lemaire, Marc; Wésolowski-Louvel, Micheline

    2004-01-01

    We isolated a mutant, rag17, which is impaired in glucose induction of expression of the major glucose transporter gene RAG1. The RAG17 gene encodes a protein 87% identical to S. cerevisiae enolases (Eno1 and Eno2). The Kleno null mutant showed no detectable enolase enzymatic activity and has severe growth defects on glucose and gluconeogenic carbon sources, indicating that K. lactis has a single enolase gene. In addition to RAG1, the transcription of several glycolytic genes was also strongly reduced in the ΔKleno mutant. Moreover, the defect in RAG1 expression was observed in other mutants of the glycolytic pathway (hexokinase and phosphoglycerate kinase). Therefore, it seems that the enolase and a functional glycolytic flux are necessary for induction of expression of the Rag1 glucose permease in K. lactis. PMID:15514048

  4. Identification of basic residues in RAG2 critical for DNA binding by the RAG1-RAG2 complex.

    PubMed

    Fugmann, S D; Schatz, D G

    2001-10-01

    In V(D)J recombination, the RAG1 and RAG2 proteins are the essential components of the complex that catalyzes DNA cleavage. RAG1 has been shown to play a central role in DNA binding and catalysis. In contrast, the molecular roles of RAG2 in V(D)J recombination are unknown. To address this, we individually mutated 36 evolutionarily conserved basic and hydroxy group containing residues within RAG2. Biochemical analysis of the recombinant RAG2 proteins led to the identification of a number of basic residue mutants defective in catalysis in vitro and V(D)J recombination in vivo. Five of these were deficient in binding of the RAG1-RAG2 complex to its cognate DNA target sequence while interacting normally with RAG1. Our findings provide support for the direct involvement of RAG2 in DNA binding during all steps of the cleavage reaction. PMID:11684024

  5. Accumulation of B1-like B cells in transgenic mice over-expressing catalytically inactive RAG1 in the periphery

    PubMed Central

    Hassaballa, Ashraf E; Palmer, Victoria L; Anderson, Dirk K; Kassmeier, Michele D; Nganga, Vincent K; Parks, Kevin W; Volkmer, Dustin L; Perry, Greg A; Swanson, Patrick C

    2011-01-01

    During their development, B lymphocytes undergo V(D)J recombination events and selection processes that, if successfully completed, produce mature B cells expressing a non-self-reactive B-cell receptor (BCR). Primary V(D)J rearrangements yield self-reactive B cells at high frequency, triggering attempts to remove, silence, or reprogramme them through deletion, anergy induction, or secondary V(D)J recombination (receptor editing), respectively. In principle, expressing a catalytically inactive V(D)J recombinase during a developmental stage in which V(D)J rearrangement is initiated may impair this process. To test this idea, we generated transgenic mice expressing a RAG1 active site mutant (dnRAG1 mice); RAG1 transcript was elevated in splenic, but not bone marrow, B cells in dnRAG1 mice relative to wild-type mice. The dnRAG1 mice accumulate splenic B cells with a B1-like phenotype that exhibit defects in B-cell activation, and are clonally diverse, yet repertoire restricted with a bias toward Jκ1 gene segment usage. The dnRAG1 mice show evidence of impaired B-cell development at the immature-to-mature transition, immunoglobulin deficiency, and poorer immune responses to thymus-independent antigens. Interestingly, dnRAG1 mice expressing the anti-dsDNA 3H9H56R heavy chain fail to accumulate splenic B1-like cells, yet retain peritoneal B1 cells. Instead, these mice show an expanded marginal zone compartment, but no difference is detected in the frequency of heavy chain gene replacement. Taken together, these data suggest a model in which dnRAG1 expression impairs secondary V(D)J recombination. As a result, selection and/or differentiation processes are altered in a way that promotes expansion of B1-like B cells in the spleen. PMID:22044391

  6. An interdomain boundary in RAG1 facilitates cooperative binding to RAG2 in formation of the V(D)J recombinase complex

    PubMed Central

    Byrum, Jennifer N; Zhao, Shuying; Rahman, Negar S; Gwyn, Lori M; Rodgers, William; Rodgers, Karla K

    2015-01-01

    V(D)J recombination assembles functional antigen receptor genes during lymphocyte development. Formation of the recombination complex containing the recombination activating proteins, RAG1 and RAG2, is essential for the site-specific DNA cleavage steps in V(D)J recombination. However, little is known concerning how complex formation leads to a catalytically-active complex. Here, we combined limited proteolysis and mass spectrometry methods to identify regions of RAG1 that are sequestered upon association with RAG2. These results show that RAG2 bridges an interdomain boundary in the catalytic region of RAG1. In a second approach, mutation of RAG1 residues within the interdomain boundary were tested for disruption of RAG1:RAG2 complex formation using fluorescence-based pull down assays. The core RAG1 mutants demonstrated varying effects on complex formation with RAG2. Interestingly, two mutants showed opposing results for the ability to interact with core versus full length RAG2, indicating that the non-core region of RAG2 participates in binding to core RAG1. Significantly, all of the RAG1 interdomain mutants demonstrated altered stoichiometries of the RAG complexes, with an increased number of RAG2 per RAG1 subunit compared to the wild type complex. Based on our results, we propose that interaction of RAG2 with RAG1 induces cooperative interactions of multiple binding sites, induced through conformational changes at the RAG1 interdomain boundary, and resulting in formation of the DNA cleavage active site. PMID:25676158

  7. Altered Gut Microbiota Composition in Rag1-deficient Mice Contributes to Modulating Homeostasis of Hematopoietic Stem and Progenitor Cells

    PubMed Central

    Kwon, Ohseop; Lee, Seungwon; Kim, Ji-Hae; Kim, Hyekang

    2015-01-01

    Hematopoietic stem and progenitor cells (HSPCs) can produce all kind of blood lineage cells, and gut microbiota that consists of various species of microbe affects development and maturation of the host immune system including gut lymphoid cells and tissues. However, the effect of altered gut microbiota composition on homeostasis of HSPCs remains unclear. Here we show that compositional change of gut microbiota affects homeostasis of HSPCs using Rag1-/- mice which represent lymphopenic condition. The number and proportions of HSPCs in Rag1-/- mice are lower compared to those of wild types. However, the number and proportions of HSPCs in Rag1-/- mice are restored as the level of wild types through alteration of gut microbiota diversity via transferring feces from wild types. Gut microbiota composition of Rag1-/- mice treated with feces from wild types shows larger proportions of family Prevotellaceae and Helicobacterceae whereas lower proportions of family Lachnospiraceae compared to unmanipulated Rag1-/- mice. In conclusion, gut microbiota composition of lymphopenic Rag1-/- mice is different to that of wild type, which may lead to altered homeostasis of HSPCs. PMID:26557809

  8. Phylogeny of caecilian amphibians (Gymnophiona) based on complete mitochondrial genomes and nuclear RAG1.

    PubMed

    San Mauro, Diego; Gower, David J; Oommen, Oommen V; Wilkinson, Mark; Zardoya, Rafael

    2004-11-01

    We determined the complete nucleotide sequence of the mitochondrial (mt) genome of five individual caecilians (Amphibia: Gymnophiona) representing five of the six recognized families: Rhinatrema bivittatum (Rhinatrematidae), Ichthyophis glutinosus (Ichthyophiidae), Uraeotyphlus cf. oxyurus (Uraeotyphlidae), Scolecomorphus vittatus (Scolecomorphidae), and Gegeneophis ramaswamii (Caeciliidae). The organization and size of these newly determined mitogenomes are similar to those previously reported for the caecilian Typhlonectes natans (Typhlonectidae), and for other vertebrates. Nucleotide sequences of the nuclear RAG1 gene were also determined for these six species of caecilians, and the salamander Mertensiella luschani atifi. RAG1 (both at the amino acid and nucleotide level) shows slower rates of evolution than almost all mt protein-coding genes (at the amino acid level). The new mt and nuclear sequences were compared with data for other amphibians and subjected to separate and combined phylogenetic analyses (Maximum Parsimony, Minimum Evolution, Maximum Likelihood, and Bayesian Inference). All analyses strongly support the monophyly of the three amphibian Orders. The Batrachia hypothesis (Gymnophiona, (Anura, Caudata) receives moderate or good support depending on the method of analysis. Within Gymnophiona, the optimal tree (Rhinatrema, (Ichthyophis, Uraeotyphlus), (Scolecomorphus, (Gegeneophis Typhlonectes) agrees with the most recent morphological and molecular studies. The sister group relationship between Rhinatrematidae and all other caecilians, that between Ichthyophiidae and Uraeotyphlidae, and the monophyly of the higher caecilians Scolecomorphidae+Caeciliidae+Typhlonectidae, are strongly supported, whereas the relationships among the higher caecilians are less unambiguously resolved. Analysis of RAG1 is affected by a spurious local rooting problem and associated low support that is ameliorated when outgroups are excluded. Comparisons of trees using the

  9. The In Vivo Pattern of Binding of RAG1 and RAG2 to Antigen Receptor Loci

    PubMed Central

    Ji, Yanhong; Resch, Wolfgang; Corbett, Elizabeth; Yamane, Arito; Casellas, Rafael; Schatz, David G.

    2010-01-01

    Summary The critical initial step in V(D)J recombination, binding of RAG1 and RAG2 to recombination signal sequences flanking antigen receptor V, D, and J gene segments, has not previously been characterized in vivo. Here we demonstrate that RAG protein binding occurs in a highly focal manner to a small region of active chromatin encompassing Igκ and Tcrα J gene segments and Igh and Tcrβ J and J-proximal D gene segments. Formation of these small RAG-bound regions, which we refer to as recombination centers, occurs in a developmental stage- and lineage-specific manner. Each RAG protein is independently capable of specific binding within recombination centers. While RAG1 binding was detected only at regions containing recombination signal sequences, RAG2 binds at thousands of sites in the genome containing histone 3 trimethylated at lysine 4. We propose that recombination centers coordinate V(D)J recombination by providing discrete sites within which gene segments are captured for recombination. PMID:20398922

  10. Biochemical Characterization of Nonamer Binding Domain of RAG1 Reveals its Thymine Preference with Respect to Length and Position.

    PubMed

    Raveendran, Deepthi; Raghavan, Sathees C

    2016-01-01

    RAG complex consisting of RAG1 and RAG2 is a site-specific endonuclease responsible for the generation of antigen receptor diversity. It cleaves recombination signal sequence (RSS), comprising of conserved heptamer and nonamer. Nonamer binding domain (NBD) of RAG1 plays a central role in the recognition of RSS. To investigate the DNA binding properties of the domain, NBD of murine RAG1 was cloned, expressed and purified. Electrophoretic mobility shift assays showed that NBD binds with high affinity to nonamer in the context of 12/23 RSS or heteroduplex DNA. NBD binding was specific to thymines when single stranded DNA containing poly A, C, G or T were used. Biolayer interferometry studies showed that poly T binding to NBD was robust and comparable to that of 12RSS. More than 23 nt was essential for NBD binding at homothymidine stretches. On a double-stranded DNA, NBD could bind to A:T stretches, but not G:C or random sequences. Although NBD is indispensable for sequence specific activity of RAGs, external supplementation of purified nonamer binding domain to NBD deleted cRAG1/cRAG2 did not restore its activity, suggesting that the overall domain architecture of RAG1 is important. Therefore, we define the sequence requirements of NBD binding to DNA. PMID:26742581

  11. Biochemical Characterization of Nonamer Binding Domain of RAG1 Reveals its Thymine Preference with Respect to Length and Position

    PubMed Central

    Raveendran, Deepthi; Raghavan, Sathees C.

    2016-01-01

    RAG complex consisting of RAG1 and RAG2 is a site-specific endonuclease responsible for the generation of antigen receptor diversity. It cleaves recombination signal sequence (RSS), comprising of conserved heptamer and nonamer. Nonamer binding domain (NBD) of RAG1 plays a central role in the recognition of RSS. To investigate the DNA binding properties of the domain, NBD of murine RAG1 was cloned, expressed and purified. Electrophoretic mobility shift assays showed that NBD binds with high affinity to nonamer in the context of 12/23 RSS or heteroduplex DNA. NBD binding was specific to thymines when single stranded DNA containing poly A, C, G or T were used. Biolayer interferometry studies showed that poly T binding to NBD was robust and comparable to that of 12RSS. More than 23 nt was essential for NBD binding at homothymidine stretches. On a double-stranded DNA, NBD could bind to A:T stretches, but not G:C or random sequences. Although NBD is indispensable for sequence specific activity of RAGs, external supplementation of purified nonamer binding domain to NBD deleted cRAG1/cRAG2 did not restore its activity, suggesting that the overall domain architecture of RAG1 is important. Therefore, we define the sequence requirements of NBD binding to DNA. PMID:26742581

  12. Structure of the RAG1 Nonamer Binding Domain with DNA Reveals a Dimer that Mediates DNA Synapsis

    SciTech Connect

    Yin, F.; Bailey, S; Innis, C; Ciubotaru, M; Kamtekar, S; Steitz, T; Schatz, D

    2009-01-01

    The products of recombination-activating genes RAG1 and RAG2 mediate the assembly of antigen receptor genes during lymphocyte development in a process known as V(D)J recombination. Lack of structural information for the RAG proteins has hindered mechanistic studies of this reaction. We report here the crystal structure of an essential DNA binding domain of the RAG1 catalytic core bound to its nonamer DNA recognition motif. The RAG1 nonamer binding domain (NBD) forms a tightly interwoven dimer that binds and synapses two nonamer elements, with each NBD making contact with both DNA molecules. Biochemical and biophysical experiments confirm that the two nonamers are in close proximity in the RAG1/2-DNA synaptic complex and demonstrate the functional importance of the protein-DNA contacts revealed in the structure. These findings reveal a previously unsuspected function for the NBD in DNA synapsis and have implications for the regulation of DNA binding and cleavage by RAG1 and RAG2.

  13. Prevalence and in-vitro antimicrobial susceptibility patterns of Acinetobacter strains isolated from patients in intensive care units.

    PubMed

    Aktas, O; Ozbek, A

    2003-01-01

    Fifty-six Acinetobacter species strains (49 Acinetobacter baumanii, 5 Acinetobacter calcoaceticus, 2 Acinetobacter iwoffii) were detected using both conventional methods and gas chromatography of bacterial fatty acids with the MIDI Sherlock Microbial Identification System. The susceptibilities of these strains to 16 antimicrobial agents were investigated by the disc-diffusion method according to the National Committee for Clinical Laboratory Standards. The production of extended-spectrum beta-lactamases (ESBLs) and inducible beta-lactamases (IBLs) by the strains were investigated by the double-disc-synergy and disc-approximation methods, respectively. Imipenem was the most effective agent for Acinetobacter baumanii strains (95.9% of strains were sensitive), while meropenem and netilmicin showed moderate activity (87.7% and 79.6% of strains, respectively, responded). Acinetobacter baumanii strains were less sensitive to cefoperazone-sulbactam (53.1%), ofloxacin (51.0%), ciprofloxacin (42.8%), and amikacin (36.7%). Acinetobacter calcoaceticus and Acinetobacter iwoffii strains were sensitive to imipenem, meropenem and netilmicin. IBLs and ESBLs were produced, respectively, by 8.9% and 7.1% of all bacterial strains. The strains isolated were sufficiently sensitive to imipenem, but not to ofloxacin or ciprofloxacin, and were very resistant to amikacin. PMID:12964502

  14. A cluster of Acinetobacter Pneumonia in foundry workers

    SciTech Connect

    Cordes, L.G.; Brink, E.W.; Checko, P.J.; Lentnek, A.; Lyons, R.W.; Hayes, P.S.; Wu, T.C.; Tharr, D.G.; Fraser, D.W.

    1981-12-01

    In a 3-month period, three men who had worked for 5 to 19 years as welders or grinders of steel castings in a foundry acquired pneumonia caused by Acinetobacter calcoaceticus variety anitratus serotype 7J. Two of the men died, and postmortem examination showed mixed-dust pneumoconiosis with iron particles in the lungs. A calcoaceticus variety anitratus serotype 7J was isolated from the air in the foundry but the source was not found. The prevalence of antibody titers of 64 or greater to the 7J strain was significantly higher among foundry workers (15%) than among community controls (2%) (p less than 0.01). Sampling showed that the concentrations of total and metallic particles (especially iron) and of free silica in air inhaled by welders and grinders at the foundry frequently exceeded acceptable levels. These findings suggest that chronic exposure to such particles may increase susceptibility to infection by this organism, which rarely affects healthy people.

  15. Experimental design in caecilian systematics: phylogenetic information of mitochondrial genomes and nuclear rag1.

    PubMed

    San Mauro, Diego; Gower, David J; Massingham, Tim; Wilkinson, Mark; Zardoya, Rafael; Cotton, James A

    2009-08-01

    In molecular phylogenetic studies, a major aspect of experimental design concerns the choice of markers and taxa. Although previous studies have investigated the phylogenetic performance of different genes and the effectiveness of increasing taxon sampling, their conclusions are partly contradictory, probably because they are highly context specific and dependent on the group of organisms used in each study. Goldman introduced a method for experimental design in phylogenetics based on the expected information to be gained that has barely been used in practice. Here we use this method to explore the phylogenetic utility of mitochondrial (mt) genes, mt genomes, and nuclear rag1 for studies of the systematics of caecilian amphibians, as well as the effect of taxon addition on the stabilization of a controversial branch of the tree. Overall phylogenetic information estimates per gene, specific estimates per branch of the tree, estimates for combined (mitogenomic) data sets, and estimates as a hypothetical new taxon is added to different parts of the caecilian tree are calculated and compared. In general, the most informative data sets are those for mt transfer and ribosomal RNA genes. Our results also show at which positions in the caecilian tree the addition of taxa have the greatest potential to increase phylogenetic information with respect to the controversial relationships of Scolecomorphus, Boulengerula, and all other teresomatan caecilians. These positions are, as intuitively expected, mostly (but not all) adjacent to the controversial branch. Generating whole mitogenomic and rag1 data for additional taxa joining the Scolecomorphus branch may be a more efficient strategy than sequencing a similar amount of additional nucleotides spread across the current caecilian taxon sampling. The methodology employed in this study allows an a priori evaluation and testable predictions of the appropriateness of particular experimental designs to solve specific questions at

  16. Identification of 50 Class D β-Lactamases and 65 Acinetobacter-Derived Cephalosporinases in Acinetobacter spp.

    PubMed Central

    Périchon, Bruno; Goussard, Sylvie; Walewski, Violaine; Krizova, Lenka; Cerqueira, Gustavo; Murphy, Cheryl; Feldgarden, Michael; Wortman, Jennifer; Clermont, Dominique

    2014-01-01

    Whole-genome sequencing of a collection of 103 Acinetobacter strains belonging to 22 validly named species and another 16 putative species allowed detection of genes for 50 new class D β-lactamases and 65 new Acinetobacter-derived cephalosporinases (ADC). All oxacillinases (OXA) contained the three typical motifs of class D β-lactamases, STFK, (F/Y)GN, and K(S/T)G. The phylogenetic tree drawn from the OXA sequences led to an increase in the number of OXA groups from 7 to 18. The topologies of the OXA and RpoB phylogenetic trees were similar, supporting the ancient acquisition of blaOXA genes by Acinetobacter species. The class D β-lactamase genes appeared to be intrinsic to several species, such as Acinetobacter baumannii, Acinetobacter pittii, Acinetobacter calcoaceticus, and Acinetobacter lwoffii. Neither blaOXA-40/143- nor blaOXA-58-like genes were detected, and their origin remains therefore unknown. The phylogenetic tree analysis based on the alignment of the sequences deduced from blaADC revealed five main clusters, one containing ADC belonging to species closely related to A. baumannii and the others composed of cephalosporinases from the remaining species. No indication of blaOXA or blaADC transfer was observed between distantly related species, except for blaOXA-279, possibly transferred from Acinetobacter genomic species 6 to Acinetobacter parvus. Analysis of β-lactam susceptibility of seven strains harboring new oxacillinases and cloning of the corresponding genes in Escherichia coli and in a susceptible A. baumannii strain indicated very weak hydrolysis of carbapenems. Overall, this study reveals a large pool of β-lactamases in different Acinetobacter spp., potentially transferable to pathogenic strains of the genus. PMID:24277043

  17. Cloning and expression analysis of recombination activating genes (RAG1/2) in red snapper (Lutjanus sanguineus).

    PubMed

    Zhang, X L; Lu, Y S; Jian, J C; Wu, Z H

    2012-04-01

    Recombination activating genes (RAG1 and RAG2), involved in the V(D)J recombination of immunoglobulin and T-cell receptor genes play a crucial role in the adaptive immune response in vertebrates. The expression of these genes was required for the proper development and maturity of lymphocytes so that they can be used as useful markers to evaluate the development of lymphoid organ. In this paper, the cDNA of RAG1 and RAG2 in red snapper, Lutjanus sanguineus were cloned by homological cloning and rapid amplification of cDNA ends (RACE) methods. Results showed the full length of RAG1 cDNA was 3944 bp, containing a 5' untranslated region (UTR) of 200 bp, a 3'-UTR of 561 bp and an open reading frame of 3183 bp encoding 1060 amino acids. Three important structural motifs, a RING/U-box domain, a RING/FYVE/PHD-type domain and a RAG Nonamer-binding domain were detected in the deduced amino acid sequence of RAG1 by InterProScan analysis. The full length of RAG2 cDNA was 2200 bp, consisting of a 141 bp 5'-UTR, a 457 bp 3'-UTR and an open reading frame of 1602 bp encoding 533 amino acids. Two important structural motifs, a Galactose oxidase/kelch, beta-propeller domain and a kelch-type beta-propeller domain were detected in the deduced amino acid sequence of RAG2 by InterProScan analysis. BLAST analysis revealed that the RAG1 and RAG2 in red snapper shared a high homology with other known RAG1 and RAG2 genes, while the greatest degree of identity was observed with Hippoglossus hippoglossus RAG1 at 82% and Takifugu rubripes RAG2 at 87%, respectively. The differential expressions of RAG1 and RAG2 in various tissues of red snapper were analyzed by fluorescent quantitative real-time PCR. The overall expression pattern of the two genes was quite similar. In healthy red snappers, the RAGs transcripts were mainly detected in thymus, following head kidney, spleen, intestine, liver and brain. After vaccinated with inactivated Vibrio alginolyticus 48 h later, the RAGs m

  18. Data on the evolutionary history of the V(D)J recombination-activating protein 1 - RAG1 coupled with sequence and variant analyses.

    PubMed

    Kumar, Abhishek; Bhandari, Anita; Sarde, Sandeep J; Muppavarapu, Sekhar; Tandon, Ravi

    2016-09-01

    RAG1 protein is one of the key component of RAG complex regulating the V(D)J recombination. There are only few studies for RAG1 concerning evolutionary history, detailed sequence and mutational hotspots. Herein, we present out datasets used for the recent comprehensive study of RAG1 based on sequence, phylogenetic and genetic variant analyses (Kumar et al., 2015) [1]. Protein sequence alignment helped in characterizing the conserved domains and regions of RAG1. It also aided in unraveling ancestral RAG1 in the sea urchin. Human genetic variant analyses revealed 751 mutational hotspots, located both in the coding and the non-coding regions. For further analysis and discussion, see (Kumar et al., 2015) [1]. PMID:27284568

  19. The Success of Acinetobacter Species; Genetic, Metabolic and Virulence Attributes

    PubMed Central

    Peleg, Anton Y.; de Breij, Anna; Adams, Mark D.; Cerqueira, Gustavo M.; Mocali, Stefano; Galardini, Marco; Nibbering, Peter H.; Earl, Ashlee M.; Ward, Doyle V.; Paterson, David L.; Seifert, Harald; Dijkshoorn, Lenie

    2012-01-01

    An understanding of why certain Acinetobacter species are more successful in causing nosocomial infections, transmission and epidemic spread in healthcare institutions compared with other species is lacking. We used genomic, phenotypic and virulence studies to identify differences between Acinetobacter species. Fourteen strains representing nine species were examined. Genomic analysis of six strains showed that the A. baumannii core genome contains many genes important for diverse metabolism and survival in the host. Most of the A. baumannii core genes were also present in one or more of the less clinically successful species. In contrast, when the accessory genome of an individual A. baumannii strain was compared to a strain of a less successful species (A. calcoaceticus RUH2202), many operons with putative virulence function were found to be present only in the A. baumannii strain, including the csu operon, the acinetobactin chromosomal cluster, and bacterial defence mechanisms. Phenotype microarray analysis showed that compared to A. calcoaceticus (RUH2202), A. baumannii ATCC 19606T was able to utilise nitrogen sources more effectively and was more tolerant to pH, osmotic and antimicrobial stress. Virulence differences were also observed, with A. baumannii ATCC 19606T, A. pittii SH024, and A. nosocomialis RUH2624 persisting and forming larger biofilms on human skin than A. calcoaceticus. A. baumannii ATCC 19606T and A. pittii SH024 were also able to survive in a murine thigh infection model, whereas the other two species were eradicated. The current study provides important insights into the elucidation of differences in clinical relevance among Acinetobacter species. PMID:23144699

  20. Monitoring Precursor 16S rRNAs of Acinetobacter spp. in Activated Sludge Wastewater Treatment Systems

    PubMed Central

    Oerther, Daniel B.; Pernthaler, Jakob; Schramm, Andreas; Amann, Rudolf; Raskin, Lutgarde

    2000-01-01

    Recently, Cangelosi and Brabant used oligonucleotide probes targeting the precursor 16S rRNA of Escherichia coli to demonstrate that the levels of precursor rRNA were more sensitive to changes in growth phase than the levels of total rRNA (G. A. Cangelosi and W. H. Brabant, J. Bacteriol. 179:4457–4463, 1997). In order to measure changes in the levels of precursor rRNA in activated sludge systems, we designed oligonucleotide probes targeting the 3′ region of the precursor 16S rRNA of Acinetobacter spp. We used these probes to monitor changes in the level of precursor 16S rRNA during batch growth of Acinetobacter spp. in Luria-Bertani (LB) medium, filtered wastewater, and in lab- and full-scale wastewater treatment systems. Consistent with the previous reports for E. coli, results obtained with membrane hybridizations and fluorescence in situ hybridizations with Acinetobacter calcoaceticus grown in LB medium showed a more substantial and faster increase in precursor 16S rRNA levels compared to the increase in total 16S rRNA levels during exponential growth. Diluting an overnight culture of A. calcoaceticus grown in LB medium with filtered wastewater resulted in a pattern of precursor 16S rRNA levels that appeared to follow diauxic growth. In addition, fluorescence in situ hybridizations with oligonucleotide probes targeting total 16S rRNA and precursor 16S rRNA showed that individual cells of A. calcoaceticus expressed highly variable levels of precursor 16S rRNA when adapting from LB medium to filtered sewage. Precursor 16S rRNA levels of Acinetobacter spp. transiently increased when activated sludge was mixed with influent wastewater in lab- and full-scale wastewater treatment systems. These results suggest that Acinetobacter spp. experience a change in growth activity within wastewater treatment systems. PMID:10788395

  1. Impaired sense of smell and altered olfactory system in RAG-1−∕− immunodeficient mice

    PubMed Central

    Rattazzi, Lorenza; Cariboni, Anna; Poojara, Ridhika; Shoenfeld, Yehuda; D'Acquisto, Fulvio

    2015-01-01

    Immune deficiencies are often associated with a number of physical manifestations including loss of sense of smell and an increased level of anxiety. We have previously shown that T and B cell-deficient recombinase activating gene (RAG-1)−∕− knockout mice have an increased level of anxiety-like behavior and altered gene expression involved in olfaction. In this study, we expanded these findings by testing the structure and functional development of the olfactory system in RAG-1−∕− mice. Our results show that these mice have a reduced engagement in different types of odors and this phenotype is associated with disorganized architecture of glomerular tissue and atrophy of the main olfactory epithelium. Most intriguingly this defect manifests specifically in adult age and is not due to impairment in the patterning of the olfactory neuron staining at the embryo stage. Together these findings provide a formerly unreported biological evidence for an altered function of the olfactory system in RAG-1−∕− mice. PMID:26441494

  2. Rapid generation of novel models of RAG1 deficiency by CRISPR/Cas9-induced mutagenesis in murine zygotes

    PubMed Central

    de Bruin, Lisa Ott; Yang, Wei; Capuder, Kelly; Lee, Yu Nee; Antolini, Maddalena; Meyers, Robin; Gellert, Martin; Musunuru, Kiran; Manis, John; Notarangelo, Luigi

    2016-01-01

    Mutations in the Recombination Activating Gene 1 (RAG1) can cause a wide variety of clinical and immunological phenotypes in humans, ranging from absence of T and B lymphocytes to occurrence of autoimmune manifestations associated with expansion of oligoclonal T cells and production of autoantibodies. Although the mechanisms underlying this phenotypic heterogeneity remain poorly understood, some genotype-phenotype correlations can be made. Currently, mouse models of Rag deficiency are restricted to RAG1−/− mice and to knock-in models carrying severe missense mutations. The Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)/Cas9 system is a novel and powerful gene-editing strategy that permits targeted introduction of DNA double strand breaks with high efficiency through simultaneous delivery of the Cas9 endonuclease and a guide RNA (gRNA). Here, we report on CRISPR-based, single-step generation and characterization of mutant mouse models in which gene editing was attempted around residue 838 of RAG1, a region whose functional role had not been studied previously. PMID:26887046

  3. Rapid generation of novel models of RAG1 deficiency by CRISPR/Cas9-induced mutagenesis in murine zygotes.

    PubMed

    Ott de Bruin, Lisa; Yang, Wei; Capuder, Kelly; Lee, Yu Nee; Antolini, Maddalena; Meyers, Robin; Gellert, Martin; Musunuru, Kiran; Manis, John; Notarangelo, Luigi

    2016-03-15

    Mutations in the Recombination Activating Gene 1 (RAG1) can cause a wide variety of clinical and immunological phenotypes in humans, ranging from absence of T and B lymphocytes to occurrence of autoimmune manifestations associated with expansion of oligoclonal T cells and production of autoantibodies. Although the mechanisms underlying this phenotypic heterogeneity remain poorly understood, some genotype-phenotype correlations can be made. Currently, mouse models of Rag deficiency are restricted to RAG1-/- mice and to knock-in models carrying severe missense mutations. The Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)/Cas9 system is a novel and powerful gene-editing strategy that permits targeted introduction of DNA double strand breaks with high efficiency through simultaneous delivery of the Cas9 endonuclease and a guide RNA (gRNA). Here, we report on CRISPR-based, single-step generation and characterization of mutant mouse models in which gene editing was attempted around residue 838 of RAG1, a region whose functional role had not been studied previously. PMID:26887046

  4. HMG-box domain stimulation of RAG1/2 cleavage activity is metal ion dependent

    PubMed Central

    Kriatchko, Aleksei N; Bergeron, Serge; Swanson, Patrick C

    2008-01-01

    Background RAG1 and RAG2 initiate V(D)J recombination by assembling a synaptic complex with a pair of antigen receptor gene segments through interactions with their flanking recombination signal sequence (RSS), and then introducing a DNA double-strand break at each RSS, separating it from the adjacent coding segment. While the RAG proteins are sufficient to mediate RSS binding and cleavage in vitro, these activities are stimulated by the architectural DNA binding and bending factors HMGB1 and HMGB2. Two previous studies (Bergeron et al., 2005, and Dai et al., 2005) came to different conclusions regarding whether only one of the two DNA binding domains of HMGB1 is sufficient to stimulate RAG-mediated binding and cleavage of naked DNA in vitro. Here we test whether this apparent discrepancy is attributed to the choice of divalent metal ion and the concentration of HMGB1 used in the cleavage reaction. Results We show here that single HMG-box domains of HMGB1 stimulate RAG-mediated RSS cleavage in a concentration-dependent manner in the presence of Mn2+, but not Mg2+. Interestingly, the inability of a single HMG-box domain to stimulate RAG-mediated RSS cleavage in Mg2+ is overcome by the addition of partner RSS to promote synapsis. Furthermore, we show that mutant forms of HMGB1 which otherwise fail to stimulate RAG-mediated RSS cleavage in Mg2+ can be substantially rescued when Mg2+ is replaced with Mn2+. Conclusion The conflicting data published previously in two different laboratories can be substantially explained by the choice of divalent metal ion and abundance of HMGB1 in the cleavage reaction. The observation that single HMG-box domains can promote RAG-mediated 23-RSS cleavage in Mg2+ in the presence, but not absence, of partner RSS suggests that synaptic complex assembly in vitro is associated with conformational changes that alter how the RAG and/or HMGB1 proteins bind and bend DNA in a manner that functionally replaces the role of one of the HMG-box domains

  5. Acinetobacter baumannii

    PubMed Central

    Howard, Aoife; O’Donoghue, Michael; Feeney, Audrey; Sleator, Roy D.

    2012-01-01

    Acinetobacter baumannii is an opportunistic bacterial pathogen primarily associated with hospital-acquired infections. The recent increase in incidence, largely associated with infected combat troops returning from conflict zones, coupled with a dramatic increase in the incidence of multidrug-resistant (MDR) strains, has significantly raised the profile of this emerging opportunistic pathogen. Herein, we provide an overview of the pathogen, discuss some of the major factors that have led to its clinical prominence and outline some of the novel therapeutic strategies currently in development. PMID:22546906

  6. Blood stream infections caused by Acinetobacter baumannii group in Japan - Epidemiological and clinical investigation.

    PubMed

    Fujikura, Yuji; Yuki, Atsushi; Hamamoto, Takaaki; Kawana, Akihiko; Ohkusu, Kiyofumi; Matsumoto, Tetsuya

    2016-06-01

    Acinetobacter calcoaceticus-Acinetobacter baumannii complex, especially A. baumannii, Acinetobacter pittii and Acinetobacter nosocomialis, constitutes an important group of nosocomial pathogens; however, epidemiological or clinical characteristics and prognosis is limited in Japan. From 2009 to 2013, 47 blood stream infection cases resulting from A. baumannii group were reviewed at the National Defense Medical College, an 800-bed tertiary hospital. To determine the genospecies, further comparative nucleotide sequence analyses of the RNA polymerase b-subunit (rpoB) gene were performed. Sequence analysis of rpoB gene showed that 25 (49.0%), 17 (33.3%) and 5 (9.8%) cases were caused by A. baumannii, A. pittii and A. nosocomialis, respectively. The 30-day and in-hospital mortality rates of A. baumannii were 8.5% and 25.5%, respectively, and there were no significant differences between Acinetobacter species. Clinical characteristics were statistically insignificant. Multidrug-resistant Acinetobacter species were detected in 3 cases (5.9%) with same pulsed-field gel electrophoresis (PFGE) pattern and A. baumannii was less susceptible to amikacin and levofloxacin. In this study, the mortality and clinical characteristics were similar among A. baumannii group isolate cases despite some showing drug resistance. However, identification of Acinetobacter species helps to initiate appropriate antibiotic therapy in earlier treatment phase, because A. baumannii shows some drug resistance. PMID:26993173

  7. Modeling altered T-cell development with induced pluripotent stem cells from patients with RAG1-dependent immune deficiencies.

    PubMed

    Brauer, Patrick M; Pessach, Itai M; Clarke, Erik; Rowe, Jared H; Ott de Bruin, Lisa; Lee, Yu Nee; Dominguez-Brauer, Carmen; Comeau, Anne M; Awong, Geneve; Felgentreff, Kerstin; Zhang, Yuhang H; Bredemeyer, Andrea; Al-Herz, Waleed; Du, Likun; Ververs, Francesca; Kennedy, Marion; Giliani, Silvia; Keller, Gordon; Sleckman, Barry P; Schatz, David G; Bushman, Frederic D; Notarangelo, Luigi D; Zúñiga-Pflücker, Juan Carlos

    2016-08-11

    Primary immunodeficiency diseases comprise a group of heterogeneous genetic defects that affect immune system development and/or function. Here we use in vitro differentiation of human induced pluripotent stem cells (iPSCs) generated from patients with different recombination-activating gene 1 (RAG1) mutations to assess T-cell development and T-cell receptor (TCR) V(D)J recombination. RAG1-mutants from severe combined immunodeficient (SCID) patient cells showed a failure to sustain progression beyond the CD3(--)CD4(-)CD8(-)CD7(+)CD5(+)CD38(-)CD31(-/lo)CD45RA(+) stage of T-cell development to reach the CD3(-/+)CD4(+)CD8(+)CD7(+)CD5(+)CD38(+)CD31(+)CD45RA(-) stage. Despite residual mutant RAG1 recombination activity from an Omenn syndrome (OS) patient, similar impaired T-cell differentiation was observed, due to increased single-strand DNA breaks that likely occur due to heterodimers consisting of both an N-terminal truncated and a catalytically dead RAG1. Furthermore, deep-sequencing analysis of TCR-β (TRB) and TCR-α (TRA) rearrangements of CD3(-)CD4(+)CD8(-) immature single-positive and CD3(+)CD4(+)CD8(+) double-positive cells showed severe restriction of repertoire diversity with preferential usage of few Variable, Diversity, and Joining genes, and skewed length distribution of the TRB and TRA complementary determining region 3 sequences from SCID and OS iPSC-derived cells, whereas control iPSCs yielded T-cell progenitors with a broadly diversified repertoire. Finally, no TRA/δ excision circles (TRECs), a marker of TRA/δ locus rearrangements, were detected in SCID and OS-derived T-lineage cells, consistent with a pre-TCR block in T-cell development. This study compares human T-cell development of SCID vs OS patients, and elucidates important differences that help to explain the wide range of immunologic phenotypes that result from different mutations within the same gene of various patients. PMID:27301863

  8. Nuclear DNA phylogeny of the squirrels (Mammalia: Rodentia) and the evolution of arboreality from c-myc and RAG1.

    PubMed

    Steppan, Scott J; Storz, Brian L; Hoffmann, Robert S

    2004-03-01

    Although the family Sciuridae is large and well known, phylogenetic analyses are scarce. We report on a comprehensive molecular phylogeny for the family. Two nuclear genes (c-myc and RAG1) comprising approximately 4500 bp of data (most in exons) are applied for the first time to rodent phylogenetics. Parsimony, likelihood, and Bayesian analyses of the separate gene regions and combined data reveal five major lineages and refute the conventional elevation of the flying squirrels (Pteromyinae) to subfamily status. Instead, flying squirrels are derived from one of the tree squirrel lineages. C-myc indels corroborate the sequence-based topologies. The common ancestor of extant squirrels appears to have been arboreal, confirming the fossil evidence. The results also reveal an unexpected clade of mostly terrestrial squirrels with African and Holarctic centers of diversity. We present a revised classification of squirrels. Our results demonstrate the phylogenetic utility of relatively slowly evolving nuclear exonic data even for relatively recent clades. PMID:15012949

  9. A molecular test of alternative hypotheses of tetraodontiform (Acanthomorpha: Tetraodontiformes) sister group relationships using data from the RAG1 gene.

    PubMed

    Holcroft, Nancy I

    2004-09-01

    Two primary competing hypotheses regarding the identity of the sister group of the order Tetraodontiformes exist. The first hypothesis holds that some or all acanthuroid fishes represent the sister of Tetraodontiformes. The second, proposed in 1984 by Rosen, holds that the order Zeiformes is sister to Tetraodontiformes and that the family Caproidae is sister to this Zeiformes + Tetraodontiformes clade. These two hypotheses were tested using data from the single-copy nuclear gene RAG1. Representatives of most major orders of acanthomorph fishes were included to provide an appropriate context in which to place Tetraodontiformes and its hypothesized sister groups. The results of an unweighted parsimony analysis indicate that Zeiformes is not the sister group of Tetraodontiformes. In addition, Caproidae appears unrelated to Zeiformes. A monophyletic Tetraodontiformes was recovered as the sister group of the clade Ephippidae + Drepanidae and was more distantly related to the included zeiform and caproid representatives. PMID:15288052

  10. Initial Stages of V(D)J Recombination: the Organization of RAG1/2 and RSS DNA in the Post-cleavage Complex

    PubMed Central

    Grundy, Gabrielle J.; Ramón-Maiques, Santiago; Dimitriadis, Emilios K.; Kotova, Svetlana; Biertümpfel, Christian; Heymann, J. Bernard; Steven, Alasdair C.; Gellert, Martin; Yang, Wei

    2009-01-01

    SUMMARY To obtain structural information on the early stages of V(D)J recombination, we isolated a complex of the core RAG1 and RAG2 proteins with DNA containing a pair of cleaved recombination signal sequences (RSS). Stoichiometric and molecular mass analysis established that this signal end complex (SEC) contains two protomers each of RAG1 and RAG2. Visualization of the SEC by negative staining electron microscopy revealed an anchor-shaped particle with approximate two-fold symmetry. Consistent with a parallel arrangement of DNA and protein subunits, the N-termini of RAG1 and RAG2 are positioned at opposing ends of the complex, and the DNA chains beyond the RSS nonamer emerge from the same face of the complex, near to the RAG1 N-termini. These first images of the V(D)J recombinase in its post-cleavage state provide a framework for modeling RAG domains and their interactions with DNA. PMID:19647518

  11. An anti-silencer– and SATB1-dependent chromatin hub regulates Rag1 and Rag2 gene expression during thymocyte development

    PubMed Central

    Hao, Bingtao; Naik, Abani Kanta; Watanabe, Akiko; Tanaka, Hirokazu; Chen, Liang; Richards, Hunter W.; Kondo, Motonari; Taniuchi, Ichiro; Kohwi, Yoshinori; Kohwi-Shigematsu, Terumi

    2015-01-01

    Rag1 and Rag2 gene expression in CD4+CD8+ double-positive (DP) thymocytes depends on the activity of a distant anti-silencer element (ASE) that counteracts the activity of an intergenic silencer. However, the mechanistic basis for ASE activity is unknown. Here, we show that the ASE physically interacts with the distant Rag1 and Rag2 gene promoters in DP thymocytes, bringing the two promoters together to form an active chromatin hub. Moreover, we show that the ASE functions as a classical enhancer that can potently activate these promoters in the absence of the silencer or other locus elements. In thymocytes lacking the chromatin organizer SATB1, we identified a partial defect in Tcra gene rearrangement that was associated with reduced expression of Rag1 and Rag2 at the DP stage. SATB1 binds to the ASE and Rag promoters, facilitating inclusion of Rag2 in the chromatin hub and the loading of RNA polymerase II to both the Rag1 and Rag2 promoters. Our results provide a novel framework for understanding ASE function and demonstrate a novel role for SATB1 as a regulator of Rag locus organization and gene expression in DP thymocytes. PMID:25847946

  12. Microarray-Based Genetic Mapping Using Soybean Near-Isogenic Lines and Generation of SNP Markers in the Rag1 Aphid-Resistance Interval

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A strategy using near-isogenic lines (NILs) and Affymetrix Soybean GeneChip microarrays was employed to identify genetic markers closely linked to the soybean aphid [Aphis glycines Matsumura (Hemiptera: Aphididae)] resistance gene Rag1 in soybean [Glycine max (L.) Merr.]. Genomic DNA from the aphid ...

  13. Characterization of RAG1 and IgM (mu chain) marking development of the immune system in red-spotted grouper (Epinephelus akaara).

    PubMed

    Mao, Ming-Guang; Lei, Ji-Lin; Alex, Perálvarez-Marín; Hong, Wan-Shu; Wang, Ke-Jian

    2012-10-01

    In vertebrates, lymphoid-specific recombinase protein encoded by recombination-activating genes (RAG1/2) plays a key role in V(D)J recombination of the T-cell receptor and B-cell receptor. In this study, both RAG1 and the immunoglobulin M (IgM) mu chain were cloned to characterize their potential role in the immune defense at developmental stages of red-spotted grouper, Epinephelus akaara. The open reading frame (ORF) of E. akaara RAG1 included 2778 nucleotide residues encoding a putative protein of 925 amino acids, while the ORF of the IgM mu chain had 1734 nucleotide residues encoding 578 amino acids including variable (VH) and constant (CH1-CH2-CH3-CH4) regions. E. akaara RAG1 was composed of a zinc-binding dimerization domain (ZDD) with a RING finger and zinc finger A (ZFA) in the non-core region and a nonamer-binding region (NBR), with a zinc finger B (ZFB), the central and C-terminal domains in the core region. Tridimensional models of the ZDD and NBR of E. akaara RAG1 were constructed for the first time in fishes, while a 3D model of the E. akaara IgM mu chain was also clarified. The RAG1 mRNA was only detected in the thymus and kidney of 4-month and 1.5-year old groupers using qPCR, and the RAG1 protein was confirmed using western blotting and immunohistochemistry. The IgM mu mRNA was examined in most tissues except the gonad. RAG1 and IgM mu gene expression were observed at 15 dph (days post-hatching) and 23 dph respectively, and increased to a higher level at 37 dph. In addition, this was the first time that the morphology of the E. akaara thymus was characterized. The oval-shaped thymus of 4-month old fish was clearly seen and there were amounts of T lymphocytes present. The results suggested that the immune action of E. akaara was likely to start to develop around 15 dph to 29 dph. The transcript level of the RAG1 gene and the number of lymphocytes in the thymus between 4-month and 1.5-year old groupers indicated that age-related thymic

  14. HMGB1/2 can target DNA for illegitimate cleavage by the RAG1/2 complex

    PubMed Central

    Zhang, Ming; Swanson, Patrick C

    2009-01-01

    Background V(D)J recombination is initiated in antigen receptor loci by the pairwise cleavage of recombination signal sequences (RSSs) by the RAG1 and RAG2 proteins via a nick-hairpin mechanism. The RSS contains highly conserved heptamer (consensus: 5'-CACAGTG) and nonamer (consensus: 5'-ACAAAAACC) motifs separated by either 12- or 23-base pairs of poorly conserved sequence. The high mobility group proteins HMGB1 and HMGB2 (HMGB1/2) are highly abundant architectural DNA binding proteins known to promote RAG-mediated synapsis and cleavage of consensus recombination signals in vitro by facilitating RSS binding and bending by the RAG1/2 complex. HMGB1/2 are known to recognize distorted DNA structures such as four-way junctions, and damaged or modified DNA. Whether HMGB1/2 can promote RAG-mediated DNA cleavage at sites lacking a canonical RSS by targeting or stabilizing structural distortions is unclear, but is important for understanding the etiology of chromosomal translocations involving antigen receptor genes and proto-oncogene sequences that do not contain an obvious RSS-like element. Results Here we identify a novel DNA breakpoint site in the plasmid V(D)J recombination substrate pGG49 (bps6197) that is cleaved by the RAG proteins via a nick-hairpin mechanism. The bps6197 sequence lacks a recognizable heptamer at the breakpoint (5'-CCTGACG-3') but contains a nonamer-like element (5'-ACATTAACC-3') 30 base pairs from the cleavage site. We find that RAG-mediated bps6197 cleavage is promoted by HMGB1/2, requiring both HMG-box domains to be intact to facilitate RAG-mediated cleavage, and is stimulated by synapsis with a 12-RSS. A dyad-symmetric inverted repeat sequence lying 5' to the breakpoint is implicated as a target for HMGB1/2 activity. Conclusion We have identified a novel DNA sequence, called bps6197, that supports standard V(D)J-type cleavage despite the absence of an apparent heptamer motif. Efficient RAG-mediated bps6197 cleavage requires the presence of

  15. High levels of multiple metal resistance and its correlation to antibiotic resistance in environmental isolates of Acinetobacter.

    PubMed

    Dhakephalkar, P K; Chopade, B A

    1994-01-01

    Forty strains of Acinetobacter were isolated from different environmental sources. All the strains were classified into four genospecies, i.e., A. baumannii (33 isolates), A. calcoaceticus (three isolates), A. junii (three isolates) and A. genospecies3 (one isolate). Susceptibility of these 40 strains to salts of 20 heavy metals and 18 antibiotics was tested by the agar dilution method. All environmental isolates of Acinetobacter were resistant to multiple metal ions (minimum 13 metal ions) while all but one of the strains were resistant to multiple antibiotics (minimum four antibiotics). The maximum number of strains were found to be sensitive to mercury (60% strains) while all strains were resistant to copper, lead, boron and tungsten even at 10 mM concentration. Salts of these four metal ions may be added to the growth medium to facilitate selective isolation of Acinetobacter. Rifampicin and nalidixic acid were the most toxic antibiotics, inhibiting 94.5 and 89.5% of the acinetobacters, respectively. A. genospecies3 was found to be the most resistant species, tolerating high concentrations of all the 20 metal ions and also to a greater number of antibiotics than any other species of Acinetobacter tested. An inhibitory concentration (10 mM) of Ni(2+) and Zn(2+) was observed to inhibit the growth of all of the clinical isolates but allowed the growth of the environmental isolates, facilitating the differentiation between pathogenic and non-pathogenic acinetobacters. PMID:8118175

  16. Transcriptomic analysis and biomarkers (Rag1 and Igμ) for probing the immune system development in Pacific cod, Gadus macrocephalus.

    PubMed

    Mao, Ming-Guang; Li, Xing; Perálvarez-Marín, Alejandro; Jiang, Jie-Lan; Jiang, Zhi-Qiang; Wen, Shi-Hui; Lü, Hui-Qian

    2015-06-01

    Mortality (>90%) is a big concern in larval rearing facilities of Pacific cod, Gadus macrocephalus, limiting its culture presently still in the experimental stages. Understanding the immune system development of G. macrocephalus is crucial to optimize the aquaculture of this species, to improve the use of economic resources and to avoid abuse of antibiotics. For the transcriptome analysis, using an Illumina sequencing platform, 61,775,698 raw reads were acquired. After a de novo assembly, 77,561 unigenes were obtained. We have classified functionally these transcripts by Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG). 27 genes mainly related to hematopoietic or lymphoid organ development and somatic diversification of immune receptors have been reported for the first time in Pacific cod, and 14 Ig heavy chain (μ chain) locuses were assembled using Trinity. Based on our previous achievement, we have chosen Rag1 and Igμ as immune system development biomarkers. Full length cDNA of Rag1 and Igμ as biomarkers were obtained respectively using RACE PCR. Concerning Rag1, the deduced amino acid of Rag1 and protein immunodetection revealed a Rag1 isoform of 69 kDa, significantly different from other fish orthologs, such as Oncorhynchus mykiss (121 kDa). Phylogenetic analysis reveals a unique immune system for the Gadus genre, not exclusive for Atlantic cod, among vertebrates. Meanwhile, full length cDNA of Igμ included an ORF of 1710 bp and the deduced amino acid was composed of a leader peptide, a variable domain, CH1, CH2, Hinge, CH3, CH4 and C-terminus, which was in accordance with most teleost. Absolute quantification PCR revealed that significant expression of Rag1 appeared earlier than Igμ, 61 and 95 dph compared to 95 dph, respectively. Here we report the first transcriptomic analysis of G. macrocephalus as the starting point for genetic research on immune system development towards improving the Pacific cod aquaculture. PMID:25842179

  17. A novel missense RAG-1 mutation results in T−B−NK+ SCID in Athabascan-speaking Dine Indians from the Canadian Northwest Territories

    PubMed Central

    Xiao, Zheng; Yannone, Steven M; Dunn, Elizabeth; Cowan, Morton J

    2009-01-01

    DNA double-strand repair factors in the non-homologous end joining (NHEJ) pathway resolve DNA double-strand breaks introduced by the recombination-activating gene (RAG) proteins during V(D)J recombination of T and B lymphocyte receptor genes. Defective NHEJ and subsequent failure of V(D)J recombination leads to severe combined immunodeficiency disease (SCID). We originally linked T−B−NK+ SCID in Athabascan-speaking Native Americans in the Southwestern US and Northwest Territories of Canada to chromosome 10. However, despite a common ancestry, the null mutation in the Artemis gene that we found to be causal in the SCID among the Navajo and Apache Indians was not present in the Dine Indians in the Northwest Territories. We now report a novel homozygous missense mutation (R776W) in RAG-1 in three children with T−B−NK+ SCID from two related families of Athabascan-speaking Dine Indians in the Canadian Northwest Territories. As expected, we found no increased sensitivity to ionizing radiation in patient fibroblasts. The impaired activity of this RAG-1 mutant in V(D)J recombination was confirmed by the EGFP-based V(D)J recombination assays. Overexpression of wild type RAG-1 in patient fibroblasts complemented V(D)J recombination, with recovery of both coding and signal joint formation. Our results indicate that the novel R776W missense mutation in RAG-1 is causal in the T−B−NK+ SCID phenotype in Athabascan-speaking Dine Indians from the Canadian Northwest Territories. PMID:18701881

  18. Numerical classification and identification of Acinetobacter genomic species.

    PubMed

    Kämpfer, P; Tjernberg, I; Ursing, J

    1993-09-01

    A total of 211 Acinetobacter strains (representing all currently recognized genomic species) were tested for 329 biochemical characters. Overall similarities of all strains were determined for 145 characters by numerical taxonomic techniques, the UPGMA algorithm and the S(SM)) and the S(J) coefficients as measures of similarity. Seven clusters (two or more strains) and three unclustered strains were recovered at a similarity level of 80.0% (S(SM). At this level a complete correspondence between phenotypic cluster and genomic species was found only for genomic species 12 (Ac. radioresistens). At higher similarity levels (84.0% to 84.6% (S(SM)), however, several subclusters were found, each representing a single genomic species. An exception were the strains belonging to the genetically closely related species of the Acinetobacter calcoaceticus-baumannii complex. These were recovered scattered in several subclusters. The degree of genomic relatedness between some DNA groups correlated with phenotypic similarities, especially for DNA group 8 (Ac. Iwoffii) and 15 of Tjernberg and Ursing, and for DNA group 4 (Ac. haemolyticus) and 6. For the majority of genomic species, two identification matrices were constructed consisting of 22 and 10 diagnostic characters, respectively. The correct identification rates for the matrices were 98.0% (22 tests) and 90.8% (10 tests) taking a Willcox probability > 0.9. For unambiguous identification of some genomic species, however, additional methods (preferably DNA-DNA hybridization or ribotyping) should be used. PMID:8244904

  19. Acinetobacter Pneumonia: A Review

    PubMed Central

    Hartzell, Joshua D.; Kim, Andrew S.; Kortepeter, Mark G.; Moran, Kimberly A.

    2007-01-01

    Acinetobacter species are becoming a major cause of nosocomial infections, including hospital-acquired and ventilator-associated pneumonia. Acinetobacter species have become increasingly resistant to antibiotics over the past several years and currently present a significant challenge in treating these infections. Physicians now rely on older agents, such as polymyxins (colistin), for treatment. This paper reviews the epidemiology, treatment, and prevention of this emerging pathogen. PMID:18092011

  20. Staring at the Cold Sun: Blue Light Regulation Is Distributed within the Genus Acinetobacter

    PubMed Central

    Golic, Adrián; Vaneechoutte, Mario; Nemec, Alexandr; Viale, Alejandro M.; Actis, Luis A.; Mussi, María Alejandra

    2013-01-01

    We previously showed that the opportunistic nosocomial pathogen Acinetobacter baumannii is able to sense and respond to light via BlsA, a BLUF (Blue-Light-sensing Using FAD)-domain photoreceptor protein. Here, we extend our previous studies showing that light regulation is not restricted to A. baumannii, but rather widespread within the genus Acinetobacter. First, we found that blue light modulates motility and biofilm formation in many species of the genus, including members of the Acinetobacter calcoaceticus-A. baumannii complex. In many of these species blue light acts as a key factor guiding the decision between motility or sessility at 24°C, whereas in A. baumannii, light inhibits both motility and biofilm formation. We also show that light regulation of motility occurred not only at 24°C but also at 37°C in non-A. baumannii species, contrasting the situation of A. baumannii which only shows photoregulation at 24°C. Second, we show that Acinetobacter baylyi (strain ADP1) BLUF-photoreceptors can functionally replace in vivo the A. baumannii 17978 BlsA protein and that the pathways leading to biofilm formation are inversely regulated at 24°C between these two microorganisms. Finally, we found the presence of predicted genes coding BLUF-containing proteins in all Acinetobacter sequenced genomes, even though the copy number is variable among them. Phylogenetic analysis suggests a common origin for all BLUF domains present in members of this genus, and could distinguish well-differentiated clusters that group together BLUF homologs from different species, a situation particularly clear for members of the ACB complex. Despite a role played by these BLUF domain-containing proteins in the photoregulation observed in the members of the genus Acinetobacter is a likely scenario given our findings in A. baumannii and A. baylyi, further research will contribute to confirm this possibility. PMID:23358859

  1. Reliability of phenotypic tests for identification of Acinetobacter species.

    PubMed Central

    Gerner-Smidt, P; Tjernberg, I; Ursing, J

    1991-01-01

    A numerical approach was used for identification of 198 Acinetobacter strains assigned to DNA groups according to the classification of Tjernberg and Ursing (I. Tjernberg and J. Ursing, APMIS 97:595-605, 1989). The matrix used was constructed from data published by Bouvet and Grimont (P.J.M. Bouvet and P.A.D. Grimont, Int. J. Syst. Bacteriol. 36:228-240, 1986) and Bouvet and Jeanjean (P.J.M. Bouvet and S. Jeanjean, Res. Microbiol. 140:291-299, 1989). The tests chosen were those of the simplified identification scheme for Acinetobacter species devised by Bouvet and Grimont (P.J.M. Bouvet and P.A.D. Grimont, Ann. Inst. Pasteur/Microbiol. 138:569-578, 1987), namely, growth at 37, 41, and 44 degrees C, oxidation of glucose, gelatin hydrolysis, and assimilation of 14 carbon sources. Of the strains tested, 181 represented 12 DNA groups in the matrix; at a probability level of greater than or equal to 0.95, 78% of them were correctly identified, 2.2% were misidentified, and 19.8% were not identified. Seventeen strains represented two DNA groups not included in the matrix; nine of them were incorrectly assigned to a DNA group by these phenotypic tests. Because of problems of separating strains belonging to DNA groups 1, 2, 3, and 13 by using the phenotypic tests proposed by Bouvet and Grimont (Ann. Inst. Pasteur/Microbiol.), we suggest that these groups should be referred to as the Acinetobacter calcoaceticus-A. baumannii complex. PMID:2007635

  2. Effects of Medicated Diet to Eradicate Helicobacter spp. on Growth, Pathology, and Infection Status in Rag1–/– and Nude Mice

    PubMed Central

    Garrett, Caroline M; Muth, Dillon; Watson, Julie

    2014-01-01

    The use of a commercial 4-drug diet has been shown to eradicate Helicobacter spp. from immunocompetent mice and those with innate immunodeficiencies. However the efficacy of this diet has not been confirmed in mice with altered adaptive immunity. We hypothesized that an 8-wk treatment with medicated diet would eradicate H. hepaticus and H. typhlonius from young naturally infected nude and Rag1 mice lacking functional T cells (Foxn1nu) or T and B cells (B6.129S7-Rag1tm1Mom/J), respectively. We evaluated helicobacter status, body weight, and gross and histologic changes between medicated and control diet in groups of infected and uninfected mice throughout treatment and at 8 wk after treatment completion. Initial infection status was confirmed by fecal PCR at weaning and 3 wk later, with study initiation in 7-wk-old mice. PCR testing demonstrated that independent of strain and sex, all treated mice tested negative for Helicobacter spp. after 4 wk of treatment and remained negative for the duration of the study. Irrespective of infection status, nude and Rag1 mice fed 8 wk of medicated diet gained less weight than did their untreated controls. Both strains normalized body weight while on control diet for the 8 wk after treatment. Mice fed medicated diet developed severe gastroesophageal hyperkeratosis, suggestive of reduced feed consumption, and enlarged ceca. These conditions improved or resolved after the return to control diet. This report is the first to demonstrate the efficacy and physical effects of providing medicated diet for the eradication of Helicobacter spp. from mice with adaptive immune deficiencies. PMID:24827565

  3. Multidrug Resistant Acinetobacter

    PubMed Central

    Manchanda, Vikas; Sanchaita, Sinha; Singh, NP

    2010-01-01

    Emergence and spread of Acinetobacter species, resistant to most of the available antimicrobial agents, is an area of great concern. It is now being frequently associated with healthcare associated infections. Literature was searched at PUBMED, Google Scholar, and Cochrane Library, using the terms ‘Acinetobacter Resistance, multidrug resistant (MDR), Antimicrobial Therapy, Outbreak, Colistin, Tigecycline, AmpC enzymes, and carbapenemases in various combinations. The terms such as MDR, Extensively Drug Resistant (XDR), and Pan Drug Resistant (PDR) have been used in published literature with varied definitions, leading to confusion in the correlation of data from various studies. In this review various mechanisms of resistance in the Acinetobacter species have been discussed. The review also probes upon the current therapeutic options, including combination therapies available to treat infections due to resistant Acinetobacter species in adults as well as children. There is an urgent need to enforce infection control measures and antimicrobial stewardship programs to prevent the further spread of these resistant Acinetobacter species and to delay the emergence of increased resistance in the bacteria. PMID:20927292

  4. Mathematical model of self-cycling fermentation

    SciTech Connect

    Wincure, B.M.; Cooper, D.G.; Rey, A.

    1995-04-20

    This article presents a mathematical model for biomass, limiting substrate, and dissolved oxygen concentrations during stable operation of self-cycling fermentation (SCF). Laboratory experiments using the bacterium Acinetobacter calcoaceticus RAG-1 and ethanol as the limiting substrate were performed to validate the model. A computer simulation developed from the model successfully matched experimental SCF intracycle trends and end-of-cycle results and, most importantly, settled into an unimposed periodicity characteristic of stable SCF operation.

  5. Effect of the bioemulsifier emulsan on naphthalene mineralization from coal tar in aqueous systems

    SciTech Connect

    Skubal, K.L.; Luthy, R.G.

    1994-09-01

    Coal tar in aerobic aqueous systems was treated with purified emulsan, the anionic heteropolysaccharide bioemulsifier produced by Acinetobacter calcoaceticus RAG-1; with inocula of various concentrations of stationary phase RAG-1 cells; or with cell-free broth from stationary phase RAG-1 cultures. Naphthalene mineralization by a mixed PAH-degrading population was measured by recovering {sup 14}CO{sub 2} evolved during biotransformation of the [{sup 14}C]naphthalene-labeled coal tar. There was no evidence of naphthalene mineralization by RAG- 1 cells alone. The addition of emulsan, RAG-1 inocula, or cell-free broth to systems containing the PAH-degrading population did not significantly affect naphthalene mineralization in any of the systems tested. Coal tar in these experiments was present either as a free dense nonaqueous phase liquid (DNAPL), or as DNAPL imbibed into microporous silica particles. Emulsification of the tar was not observed in either case. The presence or absence of microporous silica did not affect the extent or rate of naphthalene mineralization, nor did the concentration of RAG-1 inocula or the amount of broth added. The addition of cell-free broth, emulsan, or RAG-1 cells late in the experiments did not yield significantly different results compared to initial addition of these substances. Thus, emulsan and related fractions from RAG-1 cultures were ineffective in altering naphthalene mineralization in this study.

  6. Genomic and phenotypic characterization of the species Acinetobacter venetianus.

    PubMed

    Fondi, Marco; Maida, Isabel; Perrin, Elena; Orlandini, Valerio; La Torre, Laura; Bosi, Emanuele; Negroni, Andrea; Zanaroli, Giulio; Fava, Fabio; Decorosi, Francesca; Giovannetti, Luciana; Viti, Carlo; Vaneechoutte, Mario; Dijkshoorn, Lenie; Fani, Renato

    2016-01-01

    Crude oil is a complex mixture of hydrocarbons and other organic compounds that can produce serious environmental problems and whose removal is highly demanding in terms of human and technological resources. The potential use of microbes as bioremediation agents is one of the most promising fields in this area. Members of the species Acinetobacter venetianus have been previously characterized for their capability to degrade n-alkanes and thus may represent interesting model systems to implement this process. Although a preliminary experimental characterization of the overall hydrocarbon degradation capability has been performed for five of them, to date, the genetic/genomic features underlying such molecular processes have not been identified. Here we have integrated genomic and phenotypic information for six A. venetianus strains, i.e. VE-C3, RAG-1(T), LUH 13518, LUH 7437, LUH 5627 and LUH 8758. Besides providing a thorough description of the A. venetianus species, these data were exploited to infer the genetic features (presence/absence patterns of genes) and the short-term evolutionary events possibly responsible for the variability in n-alkane degradation efficiency of these strains, including the mechanisms of interaction with the fuel droplet and the subsequent catabolism of this pollutant. PMID:26902269

  7. Genomic and phenotypic characterization of the species Acinetobacter venetianus

    PubMed Central

    Fondi, Marco; Maida, Isabel; Perrin, Elena; Orlandini, Valerio; La Torre, Laura; Bosi, Emanuele; Negroni, Andrea; Zanaroli, Giulio; Fava, Fabio; Decorosi, Francesca; Giovannetti, Luciana; Viti, Carlo; Vaneechoutte, Mario; Dijkshoorn, Lenie; Fani, Renato

    2016-01-01

    Crude oil is a complex mixture of hydrocarbons and other organic compounds that can produce serious environmental problems and whose removal is highly demanding in terms of human and technological resources. The potential use of microbes as bioremediation agents is one of the most promising fields in this area. Members of the species Acinetobacter venetianus have been previously characterized for their capability to degrade n-alkanes and thus may represent interesting model systems to implement this process. Although a preliminary experimental characterization of the overall hydrocarbon degradation capability has been performed for five of them, to date, the genetic/genomic features underlying such molecular processes have not been identified. Here we have integrated genomic and phenotypic information for six A. venetianus strains, i.e. VE-C3, RAG-1T, LUH 13518, LUH 7437, LUH 5627 and LUH 8758. Besides providing a thorough description of the A. venetianus species, these data were exploited to infer the genetic features (presence/absence patterns of genes) and the short-term evolutionary events possibly responsible for the variability in n-alkane degradation efficiency of these strains, including the mechanisms of interaction with the fuel droplet and the subsequent catabolism of this pollutant. PMID:26902269

  8. Radiation resistance of clinical Acinetobacter spp. : A need for concern

    SciTech Connect

    Christensen, E.A.; Gerner-Smidt, P.; Kristensen, H. )

    1991-06-01

    As part of an epidemiological investigation of hospital infections caused by Acinetobacter spp. the radiation resistance of 15 clinical isolates and four reference strains was assessed. The radiation resistance (in D-6 values, viz. the dose necessary for reducing the initial number of colony forming units by a factor of 10(6)) was, in general, higher in the isolates of A. radioresistens than in the isolates of the A. calcoaceticus-A. baumannii complex and of A. lwoffi. However, the least resistant isolates of A. radioresistens had a D-6 value equal to or lower than the most resistant isolates of the other groups. The lowest D-6 values found were for two of the reference strains. The highest D-6 value was 35 kGy. Three isolates of A. johnsonii could not survive long enough in a dried preparation to make an assessment of the D-6 values possible. The radiation resistance of the 15 clinical isolates in the present study was higher than the resistance found in a study of similar isolates in 1970.

  9. Utility of Whole-Genome Sequencing in Characterizing Acinetobacter Epidemiology and Analyzing Hospital Outbreaks

    PubMed Central

    Fitzpatrick, Margaret A.; Hauser, Alan R.

    2015-01-01

    Acinetobacter baumannii frequently causes nosocomial infections and outbreaks. Whole-genome sequencing (WGS) is a promising technique for strain typing and outbreak investigations. We compared the performance of conventional methods with WGS for strain typing clinical Acinetobacter isolates and analyzing a carbapenem-resistant A. baumannii (CRAB) outbreak. We performed two band-based typing techniques (pulsed-field gel electrophoresis and repetitive extragenic palindromic-PCR), multilocus sequence type (MLST) analysis, and WGS on 148 Acinetobacter calcoaceticus-A. baumannii complex bloodstream isolates collected from a single hospital from 2005 to 2012. Phylogenetic trees inferred from core-genome single nucleotide polymorphisms (SNPs) confirmed three Acinetobacter species within this collection. Four major A. baumannii clonal lineages (as defined by MLST) circulated during the study, three of which are globally distributed and one of which is novel. WGS indicated that a threshold of 2,500 core SNPs accurately distinguished A. baumannii isolates from different clonal lineages. The band-based techniques performed poorly in assigning isolates to clonal lineages and exhibited little agreement with sequence-based techniques. After applying WGS to a CRAB outbreak that occurred during the study, we identified a threshold of 2.5 core SNPs that distinguished nonoutbreak from outbreak strains. WGS was more discriminatory than the band-based techniques and was used to construct a more accurate transmission map that resolved many of the plausible transmission routes suggested by epidemiologic links. Our study demonstrates that WGS is superior to conventional techniques for A. baumannii strain typing and outbreak analysis. These findings support the incorporation of WGS into health care infection prevention efforts. PMID:26699703

  10. Real-Time Fluorescence Loop Mediated Isothermal Amplification for the Detection of Acinetobacter baumannii

    PubMed Central

    Wang, Qinqin; Zhou, Yanbin; Li, Shaoli; Zhuo, Chao; Xu, Siqi; Huang, Lixia; Yang, Ling; Liao, Kang

    2013-01-01

    Background Detection of Acinetobacter baumannii has been relying primarily on bacterial culture that often fails to return useful results in time. Although DNA-based assays are more sensitive than bacterial culture in detecting the pathogen, the molecular results are often inconsistent and challenged by doubts on false positives, such as those due to system- and environment-derived contaminations. In addition, these molecular tools require expensive laboratory instruments. Therefore, establishing molecular tools for field use require simpler molecular platforms. The loop-mediated isothermal amplification method is relatively simple and can be improved for better use in a routine clinical bacteriology laboratory. A simple and portable device capable of performing both the amplification and detection (by fluorescence) of LAMP in the same platform has been developed in recent years. This method is referred to as real-time loop-mediated isothermal amplification. In this study, we attempted to utilize this method for rapid detection of A. baumannii. Methodology and Significant Findings Species-specific primers were designed to test the utility of this method. Clinical samples of A. baumannii were used to determine the sensitivity and specificity of this system compared to bacterial culture and a polymerase chain reaction method. All positive samples isolated from sputum were confirmed to be the species of Acinetobacter by 16S rRNA gene sequencing. The RealAmp method was found to be simpler and allowed real-time detection of DNA amplification, and could distinguish A. baumannii from Acinetobacter calcoaceticus and Acinetobacter genomic species 3. DNA was extracted by simple boiling method. Compared to bacterial culture, the sensitivity and specificity of RealAmp in detecting A. baumannii was 98.9% and 75.0%, respectively. Conclusion The RealAmp assay only requires a single unit, and the assay positivity can be verified by visual inspection. Therefore, this assay has

  11. Comparative studies of the Acinetobacter genus and the species identification method based on the recA sequences.

    PubMed

    Krawczyk, B; Lewandowski, K; Kur, J

    2002-02-01

    The recA gene is indispensable for a maintaining and diversification of the bacterial genetic material. Given its important role in ensuring cell viability, it is not surprising that the RecA protein is both ubiquitous and well conserved among a range of prokaryotes. Previously, we reported Acinetobacter genomic species identification method based on PCR amplification of an internal fragment of the recA gene with subsequent restriction analysis (RFLP) with HinfI and MboI enzymes. In present study, the PCR products containing the internal fragment of the recA gene, for 25 Acinetobacter strains belonging to all genomic species, were sequenced. Based on the nucleotide sequences the restriction maps and phylogenetic tree were prepared. The restriction maps revealed that Tsp509I restriction enzyme is the most discriminating for RFLP. To verify the computer analysis, the amplified DNAs from all reference genomic species available (43 strains) and 34 clinical strains were digested with each of the three restriction endonucleases mentioned. The results of digestion confirmed the computer analysis. The reconstructed phylogenetic tree showed linkages between genomic species 1 (Acinetobacter calcoaceticus), 2 (Acinetobacter baumannii), 3, 'between 1 and 3', TU13 and 'close to TU13'; genomic species 4, 6, BJ13, BJ14, BJ15, BJ16 and BJ17; genomic species 7 (Acinetobacter johnsonii) and TU14; genomic species 10 and 11; genomic species 8 (Acinetobacter Iwoffii), 9, 12 (Acinetobacter radioresistens) and TU15; and genomic species 5 (Acinetobacter junii). It is interesting that one branch in the phylogenetic tree contains haemolytic species-genomic species 4 (A. haemolyticus), BJ13, BJ14, BJ15, BJ16 and BJ17. The proposed genotypic method clearly revealed that the RFLP profiles obtained with Tsp509I enzyme might be useful for species identification of Acinetobacter strains. In this context, recA/RFLP genotypic method should be seen as an ideal preliminary screening method for large

  12. Urban riverine environment is a source of multidrug-resistant and ESBL-producing clinically important Acinetobacter spp.

    PubMed

    Maravić, Ana; Skočibušić, Mirjana; Fredotović, Željana; Šamanić, Ivica; Cvjetan, Svjetlana; Knezović, Mia; Puizina, Jasna

    2016-02-01

    Some Acinetobacter species have emerged as very important opportunistic pathogens in humans. We investigated Acinetobacter spp. from the polluted urban riverine environment in Croatia in regard to species affiliation, antibiotic resistance pattern, and resistance mechanisms. Considerable number of isolates produced acquired extended-spectrum β-lactamase(s) (ESBLs), CTX-M-15 solely or with TEM-116. By Southern blot hybridization, bla TEM-116 was identified on plasmids ca. 10, 3, and 1.2 kb in Acinetobacter junii, A. gandensis, and A. johnsonii. The bla TEM-116-carrying plasmid in A. gandensis was successfully transferred by conjugation to azide-resistant Escherichia coli J53. A. radioresistens isolate also carried an intrinsic carbapenemase gene bla OXA-133 with ISAba1 insertion sequence present upstream to promote its expression. Majority of ESBL-producing isolates harbored integrases intI1 and/or intI2 and the sulfamethoxazole resistance gene sul1. Almost all isolates had overexpressed resistance-nodulation-cell division (RND) efflux system, indicating that this mechanism may have contributed to multidrug resistance phenotypes. This is the first report of environmental CTX-M-15-producing Acinetobacter spp. and the first identification of CTX-M-15 in A. johnsonii, A. junii, A. calcoaceticus, A. gandensis, A. haemolyticus, and A. radioresistens worldwide. We identified, also for the first time, the environmental Acinetobacter-producing TEM ESBLs, highlighting the potential risk for human health, and the role of these bacteria in maintenance and dissemination of clinically important antibiotic resistance genes in community through riverine environments. PMID:26490931

  13. Tracking human multiple myeloma xenografts in NOD-Rag-1/IL-2 receptor gamma chain-null mice with the novel biomarker AKAP-4

    PubMed Central

    2011-01-01

    Background Multiple myeloma (MM) is a fatal malignancy ranking second in prevalence among hematological tumors. Continuous efforts are being made to develop innovative and more effective treatments. The preclinical evaluation of new therapies relies on the use of murine models of the disease. Methods Here we describe a new MM animal model in NOD-Rag1null IL2rgnull (NRG) mice that supports the engraftment of cell lines and primary MM cells that can be tracked with the tumor antigen, AKAP-4. Results Human MM cell lines, U266 and H929, and primary MM cells were successfully engrafted in NRG mice after intravenous administration, and were found in the bone marrow, blood and spleen of tumor-challenged animals. The AKAP-4 expression pattern was similar to that of known MM markers, such as paraproteins, CD38 and CD45. Conclusions We developed for the first time a murine model allowing for the growth of both MM cell lines and primary cells in multifocal sites, thus mimicking the disease seen in patients. Additionally, we validated the use of AKAP-4 antigen to track tumor growth in vivo and to specifically identify MM cells in mouse tissues. We expect that our model will significantly improve the pre-clinical evaluation of new anti-myeloma therapies. PMID:21923911

  14. Oxygen-Dependent Transcriptional Regulator Hap1p Limits Glucose Uptake by Repressing the Expression of the Major Glucose Transporter Gene RAG1 in Kluyveromyces lactis▿

    PubMed Central

    Bao, Wei-Guo; Guiard, Bernard; Fang, Zi-An; Donnini, Claudia; Gervais, Michel; Passos, Flavia M. Lopes; Ferrero, Iliana; Fukuhara, Hiroshi; Bolotin-Fukuhara, Monique

    2008-01-01

    The HAP1 (CYP1) gene product of Saccharomyces cerevisiae is known to regulate the transcription of many genes in response to oxygen availability. This response varies according to yeast species, probably reflecting the specific nature of their oxidative metabolism. It is suspected that a difference in the interaction of Hap1p with its target genes may explain some of the species-related variation in oxygen responses. As opposed to the fermentative S. cerevisiae, Kluyveromyces lactis is an aerobic yeast species which shows different oxygen responses. We examined the role of the HAP1-equivalent gene (KlHAP1) in K. lactis. KlHap1p showed a number of sequence features and some gene targets (such as KlCYC1) in common with its S. cerevisiae counterpart, and KlHAP1 was capable of complementing the hap1 mutation. However, the KlHAP1 disruptant showed temperature-sensitive growth on glucose, especially at low glucose concentrations. At normal temperature, 28°C, the mutant grew well, the colony size being even greater than that of the wild type. The most striking observation was that KlHap1p repressed the expression of the major glucose transporter gene RAG1 and reduced the glucose uptake rate. This suggested an involvement of KlHap1p in the regulation of glycolytic flux through the glucose transport system. The ΔKlhap1 mutant showed an increased ability to produce ethanol during aerobic growth, indicating a possible transformation of its physiological property to Crabtree positivity or partial Crabtree positivity. Dual roles of KlHap1p in activating respiration and repressing fermentation may be seen as a basis of the Crabtree-negative physiology of K. lactis. PMID:18806211

  15. Carbapenem Resistance in Acinetobacter baumannii and Other Acinetobacter spp. Causing Neonatal Sepsis: Focus on NDM-1 and Its Linkage to ISAba125

    PubMed Central

    Chatterjee, Somdatta; Datta, Saswati; Roy, Subhasree; Ramanan, Lavanya; Saha, Anindya; Viswanathan, Rajlakshmi; Som, Tapas; Basu, Sulagna

    2016-01-01

    Carbapenem-resistant determinants and their surrounding genetic structure were studied in Acinetobacter spp. from neonatal sepsis cases collected over 7 years at a tertiary care hospital. Acinetobacter spp. (n = 68) were identified by ARDRA followed by susceptibility tests. Oxacillinases, metallo-β-lactamases (MBLs), extended-spectrum β-lactamases and AmpCs, were detected phenotypically and/or by PCR followed by DNA sequencing. Transconjugants possessing the blaNDM−1(New Delhi metallo-β-lactamase) underwent further analysis for plasmids, integrons and associated genes. Genetic environment of the carbapenemases were studied by PCR mapping and DNA sequencing. Multivariate logistic regression was used to identify risk factors for sepsis caused by NDM-1-harboring organisms. A. baumannii (72%) was the predominant species followed by A. calcoaceticus (10%), A. lwoffii (6%), A. nosocomialis (3%), A. junni (3%), A. variabilis (3%), A. haemolyticus (2%), and 14TU (2%). Fifty six percent of the isolates were meropenem-resistant. Oxacillinases present were OXA-23-like, OXA-58-like and OXA-51-like, predominately in A. baumannii. NDM-1 was the dominant MBL (22%) across different Acinetobacter spp. Isolates harboring NDM-1 also possessed bla(VIM−2, PER−1, VEB−2, CTX−M−15), armA, aac(6′)Ib, aac(6′)Ib-cr genes. blaNDM−1was organized in a composite transposon between two copies of ISAba125 in the isolates irrespective of the species. Further, OXA-23-like gene and OXA-58-like genes were linked with ISAba1 and ISAba3 respectively. Isolates were clonally diverse. Integrons were variable in sequence but not associated with carbapenem resistance. Most commonly found genes in the 5′ and 3′conserved segment were aminoglycoside resistance genes (aadB, aadA2, aac4′), non-enzymatic chloramphenicol resistance gene (cmlA1g) and ADP-ribosylation genes (arr2, arr3). Outborn neonates had a significantly higher incidence of sepsis due to NDM-1 harboring isolates than

  16. Molecular Methods for Identification of Acinetobacter Species by Partial Sequencing of the rpoB and 16S rRNA Genes

    PubMed Central

    Khosravi, Azar Dokht; Shahraki, Abdolrazagh Hashemi; Heidarieh, Parvin; Sheikhi, Nasrin

    2015-01-01

    Background Acinetobacter spp. is a diverse group of Gram-negative bacteria which are ubiquitous in soil and water, and an important cause of nosocomial infections. The purpose of this study was to identify a collection of Acinetobacter spp. clinical isolates accurately and to investigate their antibiotic susceptibility patterns. Materials and Methods A total of 197 non-duplicate clinical isolates of Acinetobacter spp. isolates identified using conventional biochemical tests. The molecular technique of PCR-RFLP and sequence analysis of rpoB and 16S rRNA genes was applied for species identification. Antimicrobial susceptibility test was performed with a disk diffusion assay. Results Based on 16S rRNA and rpoB genes analysis separately, most of clinical isolates can be identified with high bootstrap values. However, the identity of the isolate 555T was uncertain due to high similarity of A. grimontii and A. junii. Identification by concatenation of 16S rRNA and rpoB confirmed the identity of clinical isolates of Acenitobacer to species level confidently. Accordingly, the isolate 555T assigned as A. grimontii due to 100% similarity to A. grimontii. Moreover, this isolate showed 98.64% to A. junii. Besides, the identity of the isolates 218T and 364T was confirmed as Genomic species 3 and A. calcoaceticus respectively. So, the majority of Acinetobacter spp. isolates, were identified as: A. baumannii (131 isolates, 66%), A. calcoaceticus (9 isolates, 4.5%), and A. genomosp 16 (8 isolates, 4%). The rest of identified species showed the lower frequencies. In susceptibility test, 105 isolates (53%), presented high antibiotic resistance of 90% to ceftriaxone, piperacillin, piperacillin tazobactam, amikacin, and 81% to ciprofloxacin. Conclusion Sequence analysis of the 16S rRNA and rpoB spacer simultaneously was able to do identification of Acinetobacter spp. to species level. A.baumannii was identified as the most prevalent species with high antibiotic resistance. Other

  17. Clinical impact and pathogenicity of Acinetobacter.

    PubMed

    Joly-Guillou, M-L

    2005-11-01

    Members of the genus Acinetobacter have been implicated in a wide spectrum of infectious diseases. Although this organism is associated primarily with nosocomial infections, it has also been involved in cases of community-acquired infection. Before the 1970s, Acinetobacter infections were mostly post-surgical urinary tract infections in patients hospitalised in surgical units. The significant improvement in resuscitation techniques during the last 30 years has changed the types of infection caused by Acinetobacter. Since the 1980s, Acinetobacter has spread rapidly among patients in intensive care units. Today, Acinetobacter accounts for c. 9% of nosocomial infections, with most Acinetobacter infections involving the respiratory tract. Transmission via the hands of hospital staff has become the most important contributory factor in patient colonisation. Acinetobacter baumannii is the species that is involved most frequently in infections of humans, but a natural reservoir for A. baumannii outside the hospital environment has not yet been identified. Community-acquired infection and infections acquired following war or natural disasters (e.g., earthquakes) have been described. Acinetobacter causes mild-to-severe illness, but can be fatal. The severity of Acinetobacter infection depends upon the site of infection and the patient's susceptibility to infection as a result of underlying disease. The circumstances that allow Acinetobacter to assume a pathogenic role are not really well-understood. As this organism is a low-grade pathogen, the pathogenesis of Acinetobacter infections probably involves numerous factors, including virulence determinants, which have yet to be investigated. PMID:16216100

  18. Laboratory Maintenance of Acinetobacter baumannii.

    PubMed

    Jacobs, Anna C; Zurawski, Daniel V

    2014-01-01

    Acinetobacter baumannii has recently drawn great interest in the microbiology research community due to the increase in clinical antibiotic resistance of this organism, and persistence of this bacterial species in the hospital environment. This unit outlines protocols for the growth and maintenance of A. baumannii in the laboratory. PMID:25367273

  19. Determination of synergy between sulbactam, meropenem and colistin in carbapenem-resistant Klebsiella pneumoniae and Acinetobacter baumannii isolates and correlation with the molecular mechanism of resistance.

    PubMed

    Laishram, Shakti; Anandan, Shalini; Devi, Bakthavatchalam Yamuna; Elakkiya, Munusamy; Priyanka, Babu; Bhuvaneshwari, Thukkaram; Peter, John Victor; Subramani, Kandasmy; Balaji, Veeraraghavan

    2016-08-01

    Treatment of infections with carbapenem-resistant Gram negative organism is a major challenge especially among intensive care patients. Combinations of sulbactam, meropenem and colistin was studied for its synergistic activity against 100 invasive isolates of carbapenem-resistant Klebsiella pneumoniae and Acinetobacter baumannii-calcoaceticus complex by checkerboard assay and time kill assay (TKA). In addition, presence of carbapenemase production was determined by multiplex PCR. Time kill assay detected more synergy than checkerboard assay. Good bactericidal activity of 70-100% was noted with the combinations tested. Among K. pneumoniae, isolates producing NDM carbapenemase alone showed significantly more synergy than isolates producing OXA-48-like carbapenemases. In treatment of infection with carbapenem-resistant organisms, the site of infection and the type of carbapenemase produced may help to determine the most effective combination of antimicrobials. PMID:27461479

  20. Reservoirs of Non-baumannii Acinetobacter Species.

    PubMed

    Al Atrouni, Ahmad; Joly-Guillou, Marie-Laure; Hamze, Monzer; Kempf, Marie

    2016-01-01

    Acinetobacter spp. are ubiquitous gram negative and non-fermenting coccobacilli that have the ability to occupy several ecological niches including environment, animals and human. Among the different species, Acinetobacter baumannii has evolved as global pathogen causing wide range of infection. Since the implementation of molecular techniques, the habitat and the role of non-baumannii Acinetobacter in human infection have been elucidated. In addition, several new species have been described. In the present review, we summarize the recent data about the natural reservoir of non-baumannii Acinetobacter including the novel species that have been described for the first time from environmental sources and reported during the last years. PMID:26870013

  1. Reservoirs of Non-baumannii Acinetobacter Species

    PubMed Central

    Al Atrouni, Ahmad; Joly-Guillou, Marie-Laure; Hamze, Monzer; Kempf, Marie

    2016-01-01

    Acinetobacter spp. are ubiquitous gram negative and non-fermenting coccobacilli that have the ability to occupy several ecological niches including environment, animals and human. Among the different species, Acinetobacter baumannii has evolved as global pathogen causing wide range of infection. Since the implementation of molecular techniques, the habitat and the role of non-baumannii Acinetobacter in human infection have been elucidated. In addition, several new species have been described. In the present review, we summarize the recent data about the natural reservoir of non-baumannii Acinetobacter including the novel species that have been described for the first time from environmental sources and reported during the last years. PMID:26870013

  2. Multicenter study using standardized protocols and reagents for evaluation of reproducibility of PCR-based fingerprinting of Acinetobacter spp.

    PubMed Central

    Grundmann, H J; Towner, K J; Dijkshoorn, L; Gerner-Smidt, P; Maher, M; Seifert, H; Vaneechoutte, M

    1997-01-01

    Seven laboratories in six European countries examined 40 isolates belonging to the Acinetobacter calcoaceticus-Acinetobacter baumannii complex to investigate whether standardized protocols and quality-controlled reagents could produce reliable, discriminatory, and reproducible PCR-based fingerprinting results. Four PCR protocols with different primers (primers DAF4, ERIC-2, M13, and REP1 + REP2) were used. The epidemiological conclusions reached by the participating laboratories were substantially correct, with 96.4% of the total isolate grouping allocations agreeing with the consensus view. All laboratories identified the main epidemiological clusters, and each laboratory also identified two non-outbreak-related isolates. There were no significant differences between the isolate grouping results obtained by the different protocols and with the different primers. Visual comparison indicated that the standardized protocols and reagents yielded reproducible fingerprint patterns, but with some variations in particular band intensities. Minor variations in fingerprint profiles were detected, but computer-assisted analysis of PCR fingerprints obtained on agarose gels demonstrated that 88.3 to 91.6% (depending on the source of DNA) of the patterns clustered correctly, while 96.4 to 98.9% of the patterns clustered correctly following automated high-resolution laser fluorescence analysis. Correlation of the patterns for isogenic isolates ranged from 83.3 to 86.6% but was slightly better (mean correlation, 87.1%) for centrally prepared DNA extracts than for DNA extracts prepared by individual laboratories (mean correlation, 84.7%). It was concluded that independently produced PCR fingerprint patterns can be obtained reproducibly for Acinetobacter spp. at the practical level if (i) quality-controlled reagents, (ii) standardized extraction of DNA, and (iii) standardized amplification conditions are used. PMID:9399496

  3. Substitutions of Ser83Leu in GyrA and Ser80Leu in ParC Associated with Quinolone Resistance in Acinetobacter pittii.

    PubMed

    Gu, Dan-xia; Hu, Yun-jian; Zhou, Hong-wei; Zhang, Rong; Chen, Gong-xiang

    2015-06-01

    To investigate the prevalence and the mechanism of quinolone-resistant Acinetobacter pittii, 634 Acinetobacter calcoaceticus-Acinetobacter baumannii complex isolates were collected throughout Zhejiang Province. Identification of isolates was conducted by matrix-assisted laser desorption ionization/time of flight mass spectrometry (MALDI-TOF MS), blaOXA-51-like gene, and partial RNA polymerase β-subunit (rpoB) amplification. Twenty-seven isolates of A. pittii were identified. Among the 634 isolates, A. baumannii, A. pittii, Acinetobacter nosocomialis, and A. calcoaceticus counted for 87.22%, 4.26%, 8.20%, and 0.32%, respectively. Antimicrobial susceptibility of nalidixic acid, ofloxacin, enoxacin, ciprofloxacin, lomefloxacin, levofloxacin, sparfloxacin, moxifloxacin, and gatifloxacin for 27 A. pittii were determined by the agar dilution method. Detection of quinolone-resistant determining regions of gyrA, gyrB, parC, and parE was performed for the A. pittii isolates. In addition, plasmid-mediated quinolone resistance (PMQR) determinants (qnrA, qnrB, qnrS, qnrC, qnrD, aac(6')-Ib-cr, qepA, oqxA, and oqxB) were investigated. All the 27 isolates demonstrated a higher minimum inhibitory concentration (MIC) to old quinolones than the new fluoroquinolones. No mutation in gyrA, gyrB, parC, or parE was detected in 20 ciprofloxacin-susceptible isolates. Seven ciprofloxacin-resistant A. pittii were identified with a Ser83Leu mutation in GyrA. Among them, six isolates with simultaneous Ser83Leu amino acid substitution in GyrA and Ser80Leu in ParC displayed higher MIC values against ciprofloxacin. Additionally, three were identified with a Met370Ile substitution in ParE, and two were detected with a Tyr317His mutation in ParE, which were reported for the first time. No PMQR determinants were identified in the 27 A. pittii isolates. In conclusion, mutations in chromosome play a major role in quinolone resistance in A. pittii, while resistance mechanisms mediated by plasmid have

  4. Community-acquired Acinetobacter meningitis in adults.

    PubMed

    Chang, W N; Lu, C H; Huang, C R; Chuang, Y C

    2000-01-01

    Community-acquired Acinetobacter meningitis in adults is an extremely rare infection of the central nervous system (CNS). Here we report one adult case of this rare CNS infection and review the clinical data of another seven cases reported in the English language literature. In total, eight patients (six men and two women) aged between 19 and 63 years were studied. The causative pathogen in our patient was Acinetobacter baumannii; in the other reported cases they were most likely Acinetobacter Iwoffii, Acinetobacter johnsonii, Acinetobacter junii, a genomic species 3 or 6. No underlying disease was found in seven of the eight cases and six of the eight patients acquired the infections before the age of 30 years. Fever and consciousness disturbance were the most common clinical manifestations. Waterhouse-Friderichsen syndrome (WFS) was found in two cases. Unlike the Acinetobacter strains found in nosocomial infections, the strain of Acinetobacter meningitis in the community-acquired case did not show multiple antibiotic resistance. Most adult patients with community-acquired Acinetobacter meningitis can be saved by timely therapy with appropriate antibiotics before deterioration of the systemic condition and impairment of consciousness. PMID:11139162

  5. Radiation resistance of acinetobacter spp.

    NASA Astrophysics Data System (ADS)

    Whitby, James L.

    1995-02-01

    The radiation resistance of 78 different strains of Acinetobacter sp. 42 from clinical isolates and 36 from other sources were compared with 15 clinical isolates and 12 other strains from Denmark. None of the Canadian strains was as resistant as resistant-enhanced Danish strains. Four strains had D 10 values of 3.1-3.6 kGy. Irradiated and unirradiated cells from all strains grew well, when cultured in Trypticase-Soy Broth at 30°C. Most cultures grew after overnight incubation. It was concluded that there would be no difficulty in detecting these strains, using ISO methodology for establishing the radiation sterilization dose for devices.

  6. High prevalence of blaOXA-23 in Acinetobacter spp. and detection of blaNDM-1 in A. soli in Cuba: report from National Surveillance Program (2010–2012)

    PubMed Central

    Quiñones, D.; Carvajal, I.; Perez, Y.; Hart, M.; Perez, J.; Garcia, S.; Salazar, D.; Ghosh, S.; Kawaguchiya, M.; Aung, M.S.; Kobayashi, N.

    2015-01-01

    As a first national surveillance of Acinetobacter in Cuba, a total of 500 Acinetobacter spp. isolates recovered from 30 hospitals between 2010 and 2012 were studied. Acinetobacter baumannii–calcoaceticus complex accounted for 96.4% of all the Acinetobacter isolates, while other species were detected at low frequency (A. junii 1.6%, A. lwoffii 1%, A. haemolyticus 0.8%, A. soli 0.2%). Resistance rates of isolates were 34–61% to third-generation cephalosporins, 49–50% to β-lactams/inhibitor combinations, 42–47% to aminoglycosides, 42–44% to carbapenems and 55% to ciprofloxacin. However, resistance rates to colistin, doxycycline, tetracycline and rifampin were less than 5%. Among carbapenem-resistant isolates, 75% harboured different blaOXA genes (OXA-23, 73%; OXA-24, 18%; OXA-58, 3%). The blaNDM-1 gene was identified in an A. soli strain, of which the species was confirmed by sequence analysis of 16S rRNA gene, rpoB, rpoB–rpoC and rpoL–rpoB intergenic spacer regions and gyrB. The sequences of blaNDM-1 and its surrounding genes were identical to those reported for plasmids of A. baumannii and A. lwoffi strains. This is the first report of blaNDM-1 in A. soli, together with a high prevalence of OXA-23 carbapenemase for carbapenem resistance in Acinetobacter spp. in Cuba. PMID:26236494

  7. Acinetobacter and similar organisms in ear infections.

    PubMed

    Dadswell, J V

    1976-08-01

    Fifty-seven strains of acinetobacter-like organisms were isolated over a period of 26 months from the ears of 55 patients with acute or chronic otitis media, or otitis externa, and one strain was isolated in a survey of 50 normal ears. After comparison with eight reference strains, 32 of the isolates were identified as Acinetobacter anitratus, 22 as Acinetobacter Iwoffii, three as Moraxella spp. and one as Achromobacter sp. Analysis of the clinical findings suggests that although most of these organisms played little part in the disease process, a few strains were probably pathogenic in this situation. PMID:957420

  8. Acinetobacter kookii sp. nov., isolated from soil.

    PubMed

    Choi, Ji Young; Ko, Gwangpyo; Jheong, Weonghwa; Huys, Geert; Seifert, Harald; Dijkshoorn, Lenie; Ko, Kwan Soo

    2013-12-01

    Two Gram-stain-negative, non-fermentative bacterial strains, designated 11-0202(T) and 11-0607, were isolated from soil in South Korea, and four others, LUH 13522, LUH 8638, LUH 10268 and LUH 10288, were isolated from a beet field in Germany, soil in the Netherlands, and sediment of integrated fish farms in Malaysia and Thailand, respectively. Based on 16S rRNA, rpoB and gyrB gene sequences, they are considered to represent a novel species of the genus Acinetobacter. Their 16S rRNA gene sequences showed greatest pairwise similarity to Acinetobacter beijerinckii NIPH 838(T) (97.9-98.4 %). They shared highest rpoB and gyrB gene sequence similarity with Acinetobacter johnsonii DSM 6963(T) and Acinetobacter bouvetii 4B02(T) (85.4-87.6 and 78.1-82.7 %, respectively). Strain 11-0202(T) displayed low DNA-DNA reassociation values (<40 %) with the most closely related species of the genus Acinetobacter. The six strains utilized azelate, 2,3-butanediol, ethanol and dl-lactate as sole carbon sources. Cellular fatty acid analyses showed similarities to profiles of related species of the genus Acinetobacter: summed feature 3 (C16 : 1ω7c, C16 : 1ω6c; 24.3-27.2 %), C18 : 1ω9c (19.9-22.1 %), C16 : 0 (15.2-22.0 %) and C12 : 0 (9.2-14.2 %). On the basis of the current findings, it is concluded that the six strains represent a novel species, for which the name Acinetobacter kookii sp. nov. is proposed. The type strain is 11-0202(T) ( = KCTC 32033(T) = JCM 18512(T)). PMID:23950148

  9. Gene cloning and characterization of a cold-adapted esterase from Acinetobacter venetianus V28.

    PubMed

    Kim, Young-Ok; Heo, Yu Li; Kim, Hyung-Kwoun; Nam, Bo-Hye; Kong, Hee Jeong; Kim, Dong-Gyun; Kim, Woo-Jin; Kim, Bong-Seok; Jee, Young-Ju; Lee, Sang-Jun

    2012-09-01

    Acinetobacter venetians V28 was isolated from the intestine of righteye flounder, Poecilopsetta plinthus caught in Vietnam seawater, and the esterase gene was cloned using a shotgun method. The amino acid sequence deduced from the nucleotide sequence (1,017 bp) corresponded to a protein of 338 amino acid residues with a molecular weight of 37,186. The esterase had 87% and 72% identities with the lipases of A. junii SH205 and A. calcoaceticus RUH2202, respectively. The esterase contained a putative leader sequence, as well as the conserved catalytic triad (Ser, His, Asp), consensus pentapeptide GXSXG, and oxyanion hole sequence (HG). The protein from the strain V28 was produced in both a soluble and an insoluble form when the Escherichia coli cells harboring the gene were cultured at 18 degrees C. The maximal activity of the purified enzyme was observed at a temperature of 40 degrees C and pH 9.0 using p-NP-caprylate as substrate; however, relative activity still reached to 70% even at 5 degrees C with an activation energy of 3.36 kcal/mol, which indicated that it was a cold-adapted enzyme. The enzyme was a nonmetalloprotein and was active against p-nitrophenyl esters of C4, C8, and C14. Remarkably, this enzyme retained much of its activity in the presence of commercial detergents and organic solvents. This cold-adapted esterase will be applicable as catalysts for reaction in the presence of organic solvents and detergents. PMID:22814499

  10. Pyogenic Liver Abscess Caused by Acinetobacter lwoffii: A Case Report.

    PubMed

    Singh, N Pal; Sagar, Tanu; Nirmal, Kirti; Kaur, I Rajender

    2016-06-01

    Acinetobacter lwoffii is a gram negative aerobic non-fermenter bacilli. It is considered as an important emerging pathogen after Acinetobacter baumannii in patients with impaired immune system and in nosocomial infections. Here, we present a case of community acquired pyogenic liver Abscess caused by Acinetobacter lwoffii in a diabetic patient. PMID:27504286

  11. Pyogenic Liver Abscess Caused by Acinetobacter lwoffii: A Case Report

    PubMed Central

    Singh, N. Pal; Nirmal, Kirti; Kaur, I. Rajender

    2016-01-01

    Acinetobacter lwoffii is a gram negative aerobic non-fermenter bacilli. It is considered as an important emerging pathogen after Acinetobacter baumannii in patients with impaired immune system and in nosocomial infections. Here, we present a case of community acquired pyogenic liver Abscess caused by Acinetobacter lwoffii in a diabetic patient. PMID:27504286

  12. Mitochondrial COI and nuclear RAG1 DNA sequences and analyses of specimens of the three morphologically established species in the genus Trichopsis (Perciformes: Osphronemidae) reveal new/cryptic species

    PubMed Central

    Panijpan, Bhinyo; Laosinchai, Parames; Senapin, Saengchan; Kowasupat, Chanon; Ruenwongsa, Pintip; Kühne, Jens; Phiwsaiya, Kornsunee

    2015-01-01

    Air-breathing fish species of the genus Trichopsis have been reported in Cambodia, Lao PDR, Indonesia, Malaysia, Singapore, Thailand and Vietnam. It is only in Thailand that all three recognized species (Trichopsis vittata, Trichopsis schalleri and Trichopsis pumila), as judged by distinct external features, are found. Cambodia and Lao PDR harbor two species each. The present work involves first-time DNA sequencing and analysis based on mitochondrial (COI) and nuclear (RAG1) DNA of numerous specimens of these species and specimens of a controversial Phetchaburi (Thailand) fish population with a mixed outward appearance. In addition to confirming the morphologically clear-cut taxonomic division of the three fish species, our DNA results show that whereas the T. pumila populations form one single species, there are cryptic species in the T. vittata and T. schalleri populations and possibly a new one in the latter. Members of the putative Phetchaburi fish population have been proven to be hybrids between T. pumila and T. vittata. In addition, a new the phylogenetic tree indicating ancestral relationships is also presented. This study should generate further research to find new/cryptic species of the genus Trichopsis in all countries harboring the fish. PMID:25853058

  13. Mitochondrial COI and nuclear RAG1 DNA sequences and analyses of specimens of the three morphologically established species in the genus Trichopsis (Perciformes: Osphronemidae) reveal new/cryptic species.

    PubMed

    Panijpan, Bhinyo; Laosinchai, Parames; Senapin, Saengchan; Kowasupat, Chanon; Ruenwongsa, Pintip; Kühne, Jens; Phiwsaiya, Kornsunee

    2015-06-01

    Air-breathing fish species of the genus Trichopsis have been reported in Cambodia, Lao PDR, Indonesia, Malaysia, Singapore, Thailand and Vietnam. It is only in Thailand that all three recognized species (Trichopsis vittata, Trichopsis schalleri and Trichopsis pumila), as judged by distinct external features, are found. Cambodia and Lao PDR harbor two species each. The present work involves first-time DNA sequencing and analysis based on mitochondrial (COI) and nuclear (RAG1) DNA of numerous specimens of these species and specimens of a controversial Phetchaburi (Thailand) fish population with a mixed outward appearance. In addition to confirming the morphologically clear-cut taxonomic division of the three fish species, our DNA results show that whereas the T. pumila populations form one single species, there are cryptic species in the T. vittata and T. schalleri populations and possibly a new one in the latter. Members of the putative Phetchaburi fish population have been proven to be hybrids between T. pumila and T. vittata. In addition, a new the phylogenetic tree indicating ancestral relationships is also presented. This study should generate further research to find new/cryptic species of the genus Trichopsis in all countries harboring the fish. PMID:25853058

  14. Evaluating placental inter-ordinal phylogenies with novel sequences including RAG1, gamma-fibrinogen, ND6, and mt-tRNA, plus MCMC-driven nucleotide, amino acid, and codon models.

    PubMed

    Waddell, Peter J; Shelley, Shawn

    2003-08-01

    It is essential to test a priori scientific hypotheses with independent data, not least to partly negate factors such as gene-specific base composition biases misleading our models. Seven new gene segments and sequences plus Bayesian likelihood phylogenetic methods were used to compare and test five recent placental phylogenies. These five phylogenies are similar to each other, yet quite different from Fthose of previously proposed trees, and span Waddell et al. [Syst. Biol. 48 (1999) 1] to Murphy et al. [Science 294 (2001b) 2348]. Trees for RAG1, gamma-fibrinogen, ND6, mt-tRNA, mt-RNA, c-MYC, epsilon -globin, and GHR are significantly congruent with the four main groups of mammals common to the five phylogenies, i.e., Afrotheria, Laurasiatheria, Euarchontoglires, Xenarthra plus Boreoeutheria (Laurasiatheria plus Euarchontoglires). Where these five a priori phylogenies differ, remain areas generally hard to resolve with the new sequences. The root remains ambiguous and does not reject a basal Afrotheria (the Exafroplacentalia hypothesis), Afrotheria plus Xenarthra together with basal (Atlantogenata), or Epitheria (Xenarthra basal) convincingly. Good evidence is found that Eulipotyphla is monophyletic and is located at the base of Laurasiatheria. The shrew mole, Uropsilus, is found to cluster consistently with other moles, while Solenodon may be the sister taxa to all other eulipotyphlans. Support is found for a probable sister pairing of just hedgehogs/gymnures and shrews. Relationships within Afrotheria, except the Paenungulata clade, remain hard to resolve, although there is congruent support for Afroinsectiphillia (aardvark, elephant shrews, golden moles, and tenrecs). A first-time use is made of MCMC enacted general time-reversible (GTR) amino acid and codon-based models for general tree selection. Even with ND6, a GTR amino acid model provided resolution of fine features, such as the sister group relationship of walrus to Otatriidae, and with BRCA a more

  15. Preconditioning Therapy with Lentiviral Vector-Programmed Dendritic Cells Accelerates the Homeostatic Expansion of Antigen-Reactive Human T Cells in NOD.Rag1−/−.IL-2rγc−/− mice

    PubMed Central

    Salguero, Gustavo; Sundarasetty, Bala Sai; Borchers, Sylvia; Wedekind, Dirk; Eiz-Vesper, Britta; Velaga, Sarvari; Jirmo, Adan C.; Behrens, Georg; Warnecke, Gregor; Knöfel, Ann-Kathrin; Blasczyk, Rainer; Mischak-Weissinger, Eva; Ganser, Arnold

    2011-01-01

    Abstract Dendritic cell (DC)-based immunization is a potent strategy to direct prompt and durable immune responses against viral reactivations after transplantations. Here, we show that overnight lentiviral vector (LV) gene transfer into human monocytes co-expressing granulocyte-macrophage colony stimulating factor and interleukin (IL)-4 induced self-differentiated DCs (SMART-DCs) with stable DC immunophenotype over weeks in culture and secreted several inflammatory cytokines. SMART-DCs injected subcutaneously in immunodeficient NOD.Rag1−/−.IL2rγ−/− (NRG) mice 1 day after LV transduction were stable for a month in vivo. “Conventional” DCs (cDCs) and SMART-DCs were compared with regard to their potency to accelerate the expansion, biodistribution, and antigenic stimulation of autologous human T cells. Peripheral blood cells obtained from human cytomegalovirus (hCMV)-reactive donors and full-length hCMV pp65 antigenic protein or peptides were used. DCs loaded with pp65 were administered subcutaneously into NRG mice as a preconditioning treatment a week prior to intravenous infusion with T cells. Optical imaging analyses demonstrated that in mice preconditioned with SMART-DC-pp65, T cells were directly recruited to the immunization site and subsequently spread to the spleen and other organs. A dramatic expansion of both human CD8+ and CD4+ T cells could be observed within a few days after infusion, and this was associated with consistent measurable CD8+ effector memory T-cell responses against different pp65 epitopes. Thus, this mouse model demonstrates the proof-of-principle for SMART-DCs to accelerate expansion of human lymphocytes, resulting in poly-functional and antigen-specific immune responses against hCMV-pp65. PMID:21574869

  16. Thio Wax Ester Biosynthesis Utilizing the Unspecific Bifunctional Wax Ester Synthase/Acyl Coenzyme A:Diacylglycerol Acyltransferase of Acinetobacter sp. Strain ADP1

    PubMed Central

    Uthoff, Stefan; Stöveken, Tim; Weber, Nikolaus; Vosmann, Klaus; Klein, Erika; Kalscheuer, Rainer; Steinbüchel, Alexander

    2005-01-01

    The bifunctional wax ester synthase/acyl coenzyme A (acyl-CoA):diacylglycerol acyltransferase (WS/DGAT) from Acinetobacter sp. strain ADP1 (formerly Acinetobacter calcoaceticus ADP1) mediating the biosyntheses of wax esters and triacylglycerols was used for the in vivo and in vitro biosynthesis of thio wax esters and dithio wax esters. For in vitro biosynthesis, 5′His6WS/DGAT comprising an N-terminal His6 tag was purified from the soluble protein fraction of Escherichia coli Rosetta(DE3)pLysS (pET23a::5′His6atf). By employing SP-Sepharose high-pressure and Ni-nitrilotriacetic acid fast-protein liquid chromatographies, a 19-fold enrichment with a final specific activity of 165.2 nmol mg of protein−1 min−1 was achieved by using 1-hexadecanol and palmitoyl-CoA as substrates. Incubation of purified 5′His6WS/DGAT with 1-hexadecanethiol and palmitoyl-CoA as substrates resulted in the formation of palmitic acid hexadecyl thio ester (10.4% relative specific activity of a 1-hexadecanol control). Utilization of 1,8-octanedithiol and palmitoyl-CoA as substrates led to the formation of 1-S-monopalmitoyloctanedithiol and minor amounts of 1,8-S-dipalmitoyloctanedithiol (59.3% relative specific activity of a 1-hexadecanol control). The latter dithio wax ester was efficiently produced when 1-S-monopalmitoyloctanedithiol and palmitoyl-CoA were used as substrates (13.4% specific activity relative to that of a 1-hexadecanol control). For the in vivo biosynthesis of thio wax esters, the knockout mutant Acinetobacter sp. strain ADP1acr1ΩKm, which is unable to produce fatty alcohols, was used. Cultivation of Acinetobacter sp. strain ADP1acr1ΩKm in the presence of gluconate, 1-hexadecanethiol, and oleic acid in nitrogen-limited mineral salts medium resulted in the accumulation of unusual thio wax esters that accounted for around 1.19% (wt/wt) of the cellular dry weight and consisted mainly of oleic acid hexadecyl thioester as revealed by gas chromatography-mass spectrometry

  17. Phosphate uptake kinetics by Acinetobacter isolates.

    PubMed

    Pauli, A S; Kaitala, S

    1997-02-01

    Acinetobacter isolates from activated sludge treatment plants of forest industry were used as model organisms for polyphosphate accumulating bacteria to study excess phosphate uptake by the overplus phenomenon as well as luxury uptake of phosphate during growth. The initial, rapid phosphate uptake by the phosphorus-starved Acinetobacter isolates (the overplus phenomenon) followed the Michaelis-Menten model (maximum initial phosphate uptake rate 29 mg P g(-1) dry mass (DM) h(-1), half-saturation constant for excess phosphate uptake 17 mg P L(-1)). During the rapid uptake no growth was observed, but most cells contained polyphosphate granules. Also growth and luxury uptake of phosphate could be modeled with the Michaelis-Menten equation (maximum phosphate uptake rate 3.7-12 mg P g(-1) DM h(-1), half-saturation constant for growth 0.47-6.0 mg P L(-1), maximum specific growth rate 0.15-0.55 h(-1)). PMID:18633985

  18. Identification of NDM-1 in a Putatively Novel Acinetobacter Species (“NB14”) Closely Related to Acinetobacter pittii

    PubMed Central

    Espinal, Paula; Mosqueda, Noraida; Telli, Murat; van der Reijden, Tanny; Rolo, Dora; Fernández-Orth, Dietmar; Dijkshoorn, Lenie; Vila, Jordi

    2015-01-01

    In this study, we describe the molecular characterization of a plasmid-located blaNDM-1 harbored by an Acinetobacter clinical isolate recovered from a patient in Turkey that putatively constitutes a novel Acinetobacter species, as shown by its distinct ARDRA (amplified 16S ribosomal DNA restriction analysis) profile and molecular sequencing techniques. blaNDM-1 was carried by a conjugative plasmid widespread among non-baumannii Acinetobacter isolates, suggesting its potential for dissemination before reaching more clinically relevant Acinetobacter species. PMID:26259796

  19. Emerging therapies for multidrug resistant Acinetobacter baumannii.

    PubMed

    García-Quintanilla, Meritxell; Pulido, Marina R; López-Rojas, Rafael; Pachón, Jerónimo; McConnell, Michael J

    2013-03-01

    The global emergence of multidrug resistant Acinetobacter baumannii has reduced the number of clinically available antibiotics that retain activity against this pathogen. For this reason, the development of novel prevention and treatment strategies for infections caused by A. baumannii is necessary. Several studies have begun to characterize nonantibiotic approaches that utilize novel mechanisms of action to achieve antibacterial activity. Recent advances in phage therapy, iron chelation therapy, antimicrobial peptides, prophylactic vaccination, photodynamic therapy, and nitric oxide (NO)-based therapies have all been shown to have activity against A. baumannii. However, before these approaches can be used clinically there are still limitations and remaining questions that must be addressed. PMID:23317680

  20. Management of meningitis due to antibiotic-resistant Acinetobacter species

    PubMed Central

    Kim, Baek-Nam; Peleg, Anton Y; Lodise, Thomas P; Lipman, Jeffrey; Li, Jian; Nation, Roger; Paterson, David L

    2009-01-01

    Acinetobacter meningitis is becoming an increasingly common clinical entity, especially in the postneurosurgical setting, with mortality from this infection exceeding 15%. Infectious Diseases Society of America guidelines for therapy of postneurosurgical meningitis recommend either ceftazidime or cefepime as empirical coverage against Gram-negative pathogens. However, assessment of the pharmacodynamics of these cephalosporins in cerebrospinal fluid suggests that recommended doses will achieve pharmacodynamic targets against fewer than 10% of contemporary acinetobacter isolates. Thus, these antibiotics are poor options for suspected acinetobacter meningitis. From in vitro and pharmacodynamic perspectives, intravenous meropenem plus intraventricular administration of an aminoglycoside may represent a superior, albeit imperfect, regimen for suspected acinetobacter meningitis. For cases of meningitis due to carbapenem-resistant acinetobacter, use of tigecycline is not recommended on pharmacodynamic grounds. The greatest clinical experience rests with use of polymyxins, although an intravenous polymyxin alone is inadvisable. Combination with an intraventricularly administered antibiotic plus removal of infected neurosurgical hardware appears the therapeutic strategy most likely to succeed in this situation. Unfortunately, limited development of new antibiotics plus the growing threat of multidrug-resistant acinetobacter is likely to increase the problems posed by acinetobacter meningitis in the future. PMID:19324297

  1. Draft Genome Sequences of Acinetobacter parvus CM11, Acinetobacter radioresistens CM38, and Stenotrophomonas maltophilia BR12, Isolated from Murine Proximal Colonic Tissue

    PubMed Central

    Saffarian, Azadeh; Mulet, Céline; Naito, Tomoaki; Bouchier, Christiane; Tichit, Magali; Ma, Laurence; Grompone, Gianfranco

    2015-01-01

    Here, we report three genome sequences of bacteria isolated from murine proximal colonic tissue and identified as Acinetobacter parvus CM11, Acinetobacter radioresistens CM38, and Stenotrophomonas maltophilia BR12. PMID:26472823

  2. Draft Genome Sequences of Acinetobacter parvus CM11, Acinetobacter radioresistens CM38, and Stenotrophomonas maltophilia BR12, Isolated from Murine Proximal Colonic Tissue.

    PubMed

    Saffarian, Azadeh; Mulet, Céline; Naito, Tomoaki; Bouchier, Christiane; Tichit, Magali; Ma, Laurence; Grompone, Gianfranco; Sansonetti, Philippe J; Pédron, Thierry

    2015-01-01

    Here, we report three genome sequences of bacteria isolated from murine proximal colonic tissue and identified as Acinetobacter parvus CM11, Acinetobacter radioresistens CM38, and Stenotrophomonas maltophilia BR12. PMID:26472823

  3. Acinetobacter junii as an aetiological agent of corneal ulcer.

    PubMed

    Broniek, G; Langwińska-Wośko, E; Szaflik, J; Wróblewska, M

    2014-12-01

    Rods of the Acinetobacter genus are present mainly in the external environment (e.g. water, soil) and in animals, while in humans they may comprise physiological flora. The main pathogenic species is Acinetobacter baumannii complex, which constitutes a common cause of nosocomial infections, particularly in patients with underlying diseases and risk factors (e.g. prior broad-spectrum antibiotic therapy, malignancy, central venous catheter, mechanical ventilation); however, infections of the eye caused by strains of Acinetobacter spp. are very rare. We report a unique case of community-acquired corneal ulcer caused by Acinetobacter non-baumannii (possibly A. junii), in a patient with no risk factors identified. The case highlights the need for obtaining a sample from the cornea for bacteriological culture in the case of suspected ophthalmic infection as identification of the pathogen, and assessment of its susceptibility profile enables proper antibiotic therapy, improves the outcome and may constitute an eyesight-saving management. PMID:25056128

  4. Acinetobacter baumannii: Emergence of a Successful Pathogen

    PubMed Central

    Peleg, Anton Y.; Seifert, Harald; Paterson, David L.

    2008-01-01

    Acinetobacter baumannii has emerged as a highly troublesome pathogen for many institutions globally. As a consequence of its immense ability to acquire or upregulate antibiotic drug resistance determinants, it has justifiably been propelled to the forefront of scientific attention. Apart from its predilection for the seriously ill within intensive care units, A. baumannii has more recently caused a range of infectious syndromes in military personnel injured in the Iraq and Afghanistan conflicts. This review details the significant advances that have been made in our understanding of this remarkable organism over the last 10 years, including current taxonomy and species identification, issues with susceptibility testing, mechanisms of antibiotic resistance, global epidemiology, clinical impact of infection, host-pathogen interactions, and infection control and therapeutic considerations. PMID:18625687

  5. Multidrug-Resistant Acinetobacter spp.: Increasingly Problematic Nosocomial Pathogens

    PubMed Central

    Lee, Kyungwon; Yong, Dongeun; Jeong, Seok Hoon

    2011-01-01

    Pathogenic bacteria have increasingly been resisting to antimicrobial therapy. Recently, resistance problem has been relatively much worsened in Gram-negative bacilli. Acinetobacter spp. are typical nosocomial pathogens causing infections and high mortality, almost exclusively in compromised hospital patients. Acinetobacter spp. are intrinsically less susceptible to antibiotics than Enterobacteriaceae, and have propensity to acquire resistance. A surveillance study in Korea in 2009 showed that resistance rates of Acinetobacter spp. were very high: to fluoroquinolone 67%, to amikacin 48%, to ceftazidime 66% and to imipenem 51%. Carbapenem resistance was mostly due to OXA type carbapenemase production in A. baumannii isolates, whereas it was due to metallo-β-lactamase production in non-baumannii Acinetobacter isolates. Colistin-resistant isolates were rare but started to be isolated in Korea. Currently, the infection caused by multidrug-resistant A. baumannii is among the most difficult ones to treat. Analysis at tertiary care hospital in 2010 showed that among the 1,085 isolates of Acinetobacter spp., 14.9% and 41.8% were resistant to seven, and to all eight antimicrobial agents tested, respectively. It is known to be difficult to prevent Acinetobacter spp. infection in hospitalized patients, because the organisms are ubiquitous in hospital environment. Efforts to control resistant bacteria in Korea by hospitals, relevant scientific societies and government agencies have only partially been successful. We need concerted multidisciplinary efforts to preserve the efficacy of currently available antimicrobial agents, by following the principles of antimicrobial stewardship. PMID:22028150

  6. Extrahuman Epidemiology of Acinetobacter baumannii in Lebanon

    PubMed Central

    Rafei, Rayane; Hamze, Monzer; Pailhoriès, Hélène; Eveillard, Matthieu; Marsollier, Laurent; Joly-Guillou, Marie-Laure; Dabboussi, Fouad

    2015-01-01

    The presence of Acinetobacter baumannii outside hospitals is still a controversial issue. The objective of our study was to explore the extrahospital epidemiology of A. baumannii in Lebanon. From February 2012 to October 2013, a total of 73 water samples, 51 soil samples, 37 raw cow milk samples, 50 cow meat samples, 7 raw cheese samples, and 379 animal samples were analyzed by cultural methods for the presence of A. baumannii. Species identification was performed by rpoB gene sequencing. Antibiotic susceptibility was investigated, and the A. baumannii population was studied by two genotyping approaches: multilocus sequence typing (MLST) and blaOXA-51 sequence-based typing (SBT). A. baumannii was detected in 6.9% of water samples, 2.7% of milk samples, 8.0% of meat samples, 14.3% of cheese samples, and 7.7% of animal samples. All isolates showed a susceptible phenotype against most of the antibiotics tested and lacked carbapenemase-encoding genes, except one that harbored a blaOXA-143 gene. MLST analysis revealed the presence of 36 sequence types (STs), among which 24 were novel STs reported for the first time in this study. blaOXA-51 SBT showed the presence of 34 variants, among which 21 were novel and all were isolated from animal origins. Finally, 30 isolates had new partial rpoB sequences and were considered putative new Acinetobacter species. In conclusion, animals can be a potential reservoir for A. baumannii and the dissemination of new emerging carbapenemases. The roles of the novel animal clones identified in community-acquired infections should be investigated. PMID:25616788

  7. Effect of emulsan on biodegradation of crude oil by pure and mixed bacterial cultures

    SciTech Connect

    Foght, J.M.; Westlake, D.W.S. ); Gutnick, D.L. )

    1989-01-01

    Crude oil was treated with purified emulsan, the heteropolysaccharide bioemulsifier produced by Acinetobacter calcoaceticus RAG-1. A mixed bacterial population as well as nine different pure cultures isolated from various sources was tested for biodegradation of emulsan-treated and untreated crude oil. Biodegradation was measured both quantitatively and qualitatively. Recovery of {sup 14}CO{sub 2} from mineralized {sup 14}C-labeled substrates yielded quantitative data on degradation of specific compounds, and capillary gas chromatography of residual unlabeled oil yielded qualitative data on a broad spectrum of crude oil components. Biodegradation of linear alkanes and other saturated hydrocarbons, both by pure cultures and by the mixed population, was reduced some 50 to 90% after emulsan pretreatment. In addition, degradation of aromatic compounds by the mixed population was reduced some 90% in emulsan-treated oil. In sharp contrast, aromatic biodegradation by pure cultures was either unaffected or slightly stimulated by emulsification of the oil.

  8. Clinical and economic outcomes of Acinetobacter vis a vis non-Acinetobacter infections in an Indian teaching hospital

    PubMed Central

    Asim, Priyendu; Naik, Nagappa Anantha; Muralidhar, Varma; Vandana, K. Eshwara; Varsha, A. Prabhu

    2016-01-01

    Context: Acinetobacter infections are a major nosocomial infection causing epidemics of infection in the Intensive Care Units (ICU). Aims: This study estimates the clinical and economic outcomes of Acinetobacter infections and compares them with those of non-Acinetobacter bacterial infections. Settings and Design: Prospective cross-sectional observational study carried out for 6 months in the medicine ICU of a tertiary care hospital. Materials and Methods: Patients were divided in two groups, one group with Acinetobacter infections and the other with non-Acinetobacter infections. The data was collected for infection, length of stay (LOS), mortality and cost along with patient demographics from the hospital records for analysis. Statistical Analysis Used: The data was analyzed using Statistical Package for the Social Sciences Version 15.0. The LOS and cost of treatment (COT) for the two groups were compared using the nonparametric Mann–Whitney U-test. Results: A total of 220 patients were studied out of which 91 had Acinetobacter infections. The median LOS was 20 days in Group-A and 12 days in Group-B (P < 0.0001). The median COT was INR 125,862 in Group-A and INR 68,228 in the Group-B (P < 0.0001). Mortality in Group-A and Group-B was 32.97 and 32.56 (P = 0.949) respectively. Conclusion: The burden of Acinetobacter infections in ICUs is increasing with the increase in LOS and COT for the patients. The infection control team has to play a major role in reducing the rate of nosocomial infections. PMID:26955573

  9. Modified CHROMagar Acinetobacter Medium for Direct Detection of Multidrug-Resistant Acinetobacter Strains in Nasal and Rectal Swab Samples

    PubMed Central

    Lee, Jacob; Kim, Taek-Kyung; Park, Min-Jeong; Kim, Han-Sung; Kim, Jae-Seok

    2013-01-01

    This study aimed to investigate whether CHROMagar Acinetobacter medium (CHROMagar, France) in combination with an antimicrobial supplement (modified CHROMagar Acinetobacter; CHROMagar, France) can be used for detecting and isolating multidrug-resistant Acinetobacter species (MRA) in nasal and rectal surveillance cultures. Nasal and rectal swab samples were collected from patients in an intensive care unit at a teaching hospital. The samples were used to inoculate modified CHROMagar Acinetobacter plates, which were examined after 24 and 48 hr of incubation at 37℃. Their susceptibility against the antimicrobial agents meropenem, imipenem, ciprofloxacin, and amikacin was analyzed using the Etest (bioMerieux, France). A total of 406 paired samples (406 nasal swabs and 406 rectal swabs) were obtained from 226 patients, and 120 samples (28 nasal and 28 rectal cultures, 47 nasal cultures only, and 17 rectal cultures only) yielded MRA. Seventy-five MRA isolates (18.5%) were recovered from the 406 nasal samples, and 45 MRA isolates (11.1%) were recovered from the 406 rectal samples. Of the 120 MRA isolates, 3 (2.5%) were detected only after 48 hr of incubation. The use of modified CHROMagar Acinetobacter together with nasal and rectal swabs and 1-day incubation is an effective surveillance tool for detecting MRA colonization. PMID:23667846

  10. Antibacterial sensitivity of Acinetobacter strains isolated from nosocomial infections.

    PubMed

    Karsligil, T; Balci, I; Zer, Y

    2004-01-01

    Acinetobacter species can cause many types of hospital-acquired infection and play an important role in nosocomial pneumonia in intensive care units, skin and wound infections, and meningitis. They are of increasing importance because of their ability to rapidly develop resistance to the major groups of antibiotics. We aimed to determine the antibiotic sensitivity of Acinetobacter strains isolated from, and determined to be the cause of, hospital-acquired infections. A total of 156 cultures of Acinetobacter (strains of A. baumannii [136; 87.2%] and A. iwoffii [20; 12.8%]), were isolated from clinical samples taken from patients in different units of our hospital. Conventional bacterial identification methods and the Sceptor system were used. In the antibiotic sensitivity tests, A. baumannii was susceptible to imipenem (90.4%), norfloxacin (84.5%) and ciprofloxacin (65.4%), and A. iwoffii to amikacin (80.0%), ticarcillin/clavulanic acid (70.0%) and imipenem (60.0%). PMID:15303777

  11. A case of community-acquired Acinetobacter junii-johnsonii cellulitis.

    PubMed

    Henao-Martínez, Andrés F; González-Fontal, Guido R; Johnson, Steven

    2012-06-01

    Acinetobacter skin and soft tissue infection outside of the traumatic wound setting are rare occurrences. The majority of cases occur in the presence of significant comorbilities and by Acinetobacter baumanii. Herein a case is reported of community-onset, health-care-associated, non-traumatic cellulitis caused by Acinetobacter, species junii-johnsonii with bacteremia. This is the first reported case of Acinetobacter junii-johnsonii skin and soft tissue infection. Hemorrhagic bullae might be one of the clinical features of Acinetobacter cellulitis. PMID:23242290

  12. Acinetobacter Peritoneal Dialysis Peritonitis: A Changing Landscape over Time

    PubMed Central

    Chao, Chia-Ter; Lee, Szu-Ying; Yang, Wei-Shun; Chen, Huei-Wen; Fang, Cheng-Chung; Yen, Chung-Jen; Chiang, Chih-Kang; Hung, Kuan-Yu; Huang, Jenq-Wen

    2014-01-01

    Background Acinetobacter species are assuming an increasingly important role in modern medicine, with their persistent presence in health-care settings and antibiotic resistance. However, clinical reports addressing this issue in patients with peritoneal dialysis (PD) peritonitis are rare. Methods All PD peritonitis episodes caused by Acinetobacter that occurred between 1985 and 2012 at a single centre were retrospectively reviewed. Clinical features, microbiological data, and outcomes were analysed, with stratifications based upon temporal periods (before and after 2000). Results Acinetobacter species were responsible for 26 PD peritonitis episodes (3.5% of all episodes) in 25 patients. A. baumannii was the most common pathogen (54%), followed by A. iwoffii (35%), with the former being predominant after 2000. Significantly more episodes resulted from breaks in exchange sterility after 2000, while those from exit site infections decreased (P = 0.01). The interval between the last and current peritonitis episodes lengthened significantly after 2000 (5 vs. 13.6 months; P = 0.05). All the isolates were susceptible to cefepime, fluoroquinolone, and aminoglycosides, with a low ceftazidime resistance rate (16%). Nearly half of the patients (46%) required hospitalisation for their Acinetobacter PD-associated peritonitis, and 27% required an antibiotic switch. The overall outcome was fair, with no mortality and a 12% technique failure rate, without obvious interval differences. Conclusions The temporal change in the microbiology and origin of Acinetobacter PD-associated peritonitis in our cohort suggested an important evolutional trend. Appropriate measures, including technique re-education and sterility maintenance, should be taken to decrease the Acinetobacter peritonitis incidence in PD patients. PMID:25314341

  13. Multidrug-Resistant Acinetobacter baumannii in Veterinary Clinics, Germany

    PubMed Central

    Prenger-Berninghoff, Ellen; Weiss, Reinhard; van der Reijden, Tanny; van den Broek, Peterhans; Baljer, Georg; Dijkshoorn, Lenie

    2011-01-01

    An increase in prevalence of multidrug-resistant Acinetobacter spp. in hospitalized animals was observed at the Justus-Liebig-University (Germany). Genotypic analysis of 56 isolates during 2000–2008 showed 3 clusters that corresponded to European clones I–III. Results indicate spread of genotypically related strains within and among veterinary clinics in Germany. PMID:21888812

  14. Geographical Patterns in Antimicrobial Resistance of Acinetobacter in Clinical Isolates

    PubMed Central

    Sehgal, Sonal; Prakash, S. Krishna

    2014-01-01

    Objectives: Acinetobacter spp. has emerged as a threat to the healthcare workers throughout the globe, owing to its property of multidrug resistance. The aim of the present study was to evaluate the antimicrobial resistance patterns of Acinetobacter spp. among indoor and out patients in our hospital and compare the resistance patterns in India and abroad. Materials and Methods: In this retrospective study, which was carried out between Over a period of one year, a total of 5593 clinical specimens of pus and purulent fluids were examined and antimicrobial resistance pattern for Acinetobacter spp. using Modified Stoke’s were evaluated. Also a comparison was done with the other similar studies. Statistical Analysis: Using the proportions of sensitive and resistant, the statistical analysis was done. The total, mean and percentage were calculated by using SPSS. Results: A high level of antimicrobial multidrug-resistance was found in almost all the clinical isolate. Our study was also found to be concordant with the results of other studies. Conclusion: There is an emerging need for identification of the genes and mechanisms for multidrug resistance among Acinetobacter spp. PMID:24959441

  15. Acinetobacter plantarum sp. nov. isolated from wheat seedlings plant.

    PubMed

    Du, Juan; Singh, Hina; Yu, Hongshan; Jin, Feng-Xie; Yi, Tae-Hoo

    2016-07-01

    Strain THG-SQM11(T), a Gram-negative, aerobic, non-motile, coccus-shaped bacterium, was isolated from wheat seedlings plant in P. R. China. Strain THG-SQM11(T) was closely related to members of the genus Acinetobacter and showed the highest 16S rRNA sequence similarities with Acinetobacter junii (97.9 %) and Acinetobacter kookii (96.1 %). DNA-DNA hybridization showed 41.3 ± 2.4 % DNA reassociation with A. junii KCTC 12416(T). Chemotaxonomic data revealed that strain THG-SQM11(T) possesses ubiquinone-9 as the predominant respiratory quinone, C18:1 ω9c, summed feature 3 (C16:1 ω7c and/or C16:1 ω6c), and C16:0 as the major fatty acids. The major polar lipids were found to be diphosphatidylglycerol, phosphatidylethanolamine, phosphatidylglycerol, and phosphatidylcholine. The DNA G+C content was 41.7 mol %. These data, together with phenotypic characterization, suggest that the isolate represents a novel species, for which the name Acinetobacter plantarum sp. nov. is proposed, with THG-SQM11(T) as the type strain (=CCTCC AB 2015123(T) =KCTC 42611(T)). PMID:26869166

  16. Characterization of Acinetobacter baumannii biofilm associated components

    NASA Astrophysics Data System (ADS)

    Brossard, Kari A.

    Acinetobacter baumannii is a Gram-negative aerobic coccobaccillus that is a major cause of nosocomial infections worldwide. Infected individuals may develop pneumonia, urinary tract, wound, and other infections that are associated with the use of indwelling medical devices such as catheters and mechanical ventilation. Treatment is difficult because many A. baumannii isolates have developed multi-drug resistance and the bacterium can persist on abiotic surfaces. Persistence and resistance may be due to formation of biofilms, which leads to long-term colonization, evasion of the host immune system and resistance to treatment with antibiotics and disinfectants. While biofilms are complex multifaceted structures, two bacterial components that have been shown to be important in formation and stability are exopolysaccharides (EPS) and the biofilm-associated protein (Bap). An EPS, poly-beta-1,6-N-acetylglucosamine, PNAG, has been described for E. coli and S. epidermidis. PNAG acts as an intercellular adhesin. Production of this adhesin is dependent on the pga/icaABCD locus. We have identified a homologous locus in A. baumannii 307-0294 that is involved in production of an exopolysaccharide, recognized by an anti-PNAG antibody. We hypothesized that the A. baumannii pgaABCD locus plays a role in biofilm formation, and protection against host innate defenses and disinfectants suggesting that PNAG is a possible virulence factor for the organism. The first aim of this thesis will define the pgaABCD locus. We have previously identified Bap, a protein with similarity to those described for S. aureus and we have demonstrated that this protein is involved in maintaining the stability of biofilms on glass. We hypothesized that A. baumannii Bap plays a role in persistence and pathogenesis and is regulated by quorum sensing. In our second aim we will examine the role of Bap in attachment and biofilm formation on medically relevant surfaces and also determine if Bap is involved in

  17. Evaluation of CHROMagar Acinetobacter for Detection of Enteric Carriage of Multidrug-Resistant Acinetobacter baumannii in Samples from Critically Ill Patients▿

    PubMed Central

    Gordon, N. C.; Wareham, D. W.

    2009-01-01

    CHROMagar Acinetobacter was used to screen stool and perineal swabs for enteric carriage of multidrug-resistant Acinetobacter baumannii in samples from critically ill patients. Results were compared with a molecular assay resulting in sensitivity and specificity of culture compared to PCR of 91.7% and 89.6%, respectively. PMID:19439546

  18. Taxonomy of haemolytic and/or proteolytic strains of the genus Acinetobacter with the proposal of Acinetobacter courvalinii sp. nov. (genomic species 14 sensu Bouvet & Jeanjean), Acinetobacter dispersus sp. nov. (genomic species 17), Acinetobacter modestus sp. nov., Acinetobacter proteolyticus sp. nov. and Acinetobacter vivianii sp. nov.

    PubMed

    Nemec, Alexandr; Radolfova-Krizova, Lenka; Maixnerova, Martina; Vrestiakova, Eliska; Jezek, Petr; Sedo, Ondrej

    2016-04-01

    We aimed to define the taxonomic status of 40 haemolytic and/or proteolytic strains of the genus Acinetobacter which were previously classified into five putative species termed as genomic species 14BJ (n = 9), genomic species 17 (n = 9), taxon 18 (n = 7), taxon 19 (n = 6) and taxon 20 (n = 9). The strains were recovered mostly from human clinical specimens or soil and water ecosystems and were highly diverse in geographical origin and time of isolation. Comparative analysis of the rpoB and gyrB gene sequences of all strains, and the whole-genome sequences of selected strains, showed that these putative species formed five respective, well-supported clusters within a distinct clade of the genus Acinetobacter which typically, although not exclusively, encompasses strains with strong haemolytic activity. The whole-genome-based average nucleotide identity (ANIb) values supported the species status of each of these clusters. Moreover, the distinctness and coherence of the clusters were supported by whole-cell profiling based on MALDI-TOF MS. Congruent with these findings were the results of metabolic and physiological testing. We conclude that the five putative taxa represent respective novel species, for which the names Acinetobacter courvalinii sp. nov. (type strain ANC 3623T = CCUG 67960T = CIP 110480T = CCM 8635T), Acinetobacter dispersus sp. nov. (type strain ANC 4105T = CCUG 67961T = CIP 110500T = CCM 8636T), Acinetobacter modestus sp. nov. (type strain NIPH 236T = CCUG 67964T = CIP 110444T = CCM 8639T), Acinetobacter proteolyticus sp. nov. (type strain NIPH 809T = CCUG 67965T = CIP 110482T = CCM 8640T) and Acinetobacter vivianii sp. nov. (type strain NIPH 2168T = CCUG 67967T = CIP 110483T = CCM 8642T) are proposed. PMID:26822020

  19. Acinetobacter lipases: molecular biology, biochemical properties and biotechnological potential.

    PubMed

    Snellman, Erick A; Colwell, Rita R

    2004-10-01

    Lipases (EC 3.1.1.3) have received increased attention recently, evidenced by the increasing amount of information about lipases in the current literature. The renewed interest in this enzyme class is due primarily to investigations of their role in pathogenesis and their increasing use in biotechnological applications. Also, many microbial lipases are available as commercial products, the majority of which are used in detergents, cosmetic production, food flavoring, and organic synthesis. Lipases are valued biocatalysts because they act under mild conditions, are highly stable in organic solvents, show broad substrate specificity, and usually show high regio- and/or stereo-selectivity in catalysis. A number of lipolytic strains of Acinetobacter have been isolated from a variety of sources and their lipases possess many biochemical properties similar to those that have been developed for biotechnological applications. This review discusses the biology of lipase expression in Acinetobacter, with emphasis on those aspects relevant to potential biotechnology applications. PMID:15378387

  20. Membrane proteomes of Pseudomonas aeruginosa and Acinetobacter baumannii.

    PubMed

    Dé, E; Cosette, P; Coquet, L; Siroy, A; Alexandre, S; Duncan, A; Naudin, B; Rihouey, C; Schaumann, A; Junter, G A; Jouenne, T

    2011-12-01

    Acinetobacter baumannii and Pseudomonas aeruginosa are known for their intrinsic resistance to antibiotics. Between mechanisms involved in this resistance, diminished expression of outer membrane proteins and up-regulation of efflux pumps play an important role. The characterization of membrane proteins is consequently necessary because of their importance in the antibiotic resistance but also in virulence. This review presents proteomic investigations aiming to describe the protein content of the membranes of these two bacterial species. PMID:19942379

  1. First report of OXA-72 producing Acinetobacter baumannii in Romania.

    PubMed

    Georgescu, M; Gheorghe, I; Dudu, A; Czobor, I; Costache, M; Cristea, V-C; Lazăr, V; Chifiriuc, M C

    2016-09-01

    This is the first report of an OXA-72-producing Acinetobacter baumannii strain in Romania, isolated from chronic leg ulcer samples. Identification of the strain was performed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. Presence of carbapenem resistance genes was investigated by PCR and sequencing. Our data support the spread of the bla OXA-72 gene in Eastern Europe. PMID:27547405

  2. Tigecycline Efflux as a Mechanism for Nonsusceptibility in Acinetobacter baumannii.

    PubMed

    Peleg, Anton Y; Adams, Jennifer; Paterson, David L

    2007-06-01

    Tigecycline has an extended spectrum of in vitro antimicrobial activities, including that against multidrug-resistant Acinetobacter. After identifying bloodstream isolates of Acinetobacter with reduced susceptibilities to tigecycline, we performed a study to assess tigecycline efflux mediated by the resistance-nodulation-division-type transporter AdeABC. After exposure of two tigecycline-nonsusceptible isolates to the efflux pump inhibitor phenyl-arginine-beta-naphthylamide (PABN), a fourfold reduction in the tigecycline MIC was observed. Both tigecycline-susceptible and -nonsusceptible isolates were found to carry the gene coding for the transmembrane component of the AdeABC pump, adeB, and the two-component regulatory system comprising adeS and adeR. Previously unreported point mutations were identified in the regulatory system in tigecycline-nonsusceptible isolates. Real-time PCR identified 40-fold and 54-fold increases in adeB expression in the two tigecycline-nonsusceptible isolates compared to that in a tigecycline-susceptible isolate. In vitro exposure of a tigecycline-susceptible clinical strain to tigecycline caused a rapid rise in the MIC of tigecycline from 2 microg/ml to 24 microg/ml, which was reversible with PABN. A 25-fold increase in adeB expression was observed in a comparison between this tigecycline-susceptible isolate and its isogenic tigecycline-nonsusceptible mutant. These results indicate that an efflux-based mechanism plays a role in reduced tigecycline susceptibility in Acinetobacter. PMID:17420217

  3. Tigecycline Efflux as a Mechanism for Nonsusceptibility in Acinetobacter baumannii▿

    PubMed Central

    Peleg, Anton Y.; Adams, Jennifer; Paterson, David L.

    2007-01-01

    Tigecycline has an extended spectrum of in vitro antimicrobial activities, including that against multidrug-resistant Acinetobacter. After identifying bloodstream isolates of Acinetobacter with reduced susceptibilities to tigecycline, we performed a study to assess tigecycline efflux mediated by the resistance-nodulation-division-type transporter AdeABC. After exposure of two tigecycline-nonsusceptible isolates to the efflux pump inhibitor phenyl-arginine-β-naphthylamide (PABN), a fourfold reduction in the tigecycline MIC was observed. Both tigecycline-susceptible and -nonsusceptible isolates were found to carry the gene coding for the transmembrane component of the AdeABC pump, adeB, and the two-component regulatory system comprising adeS and adeR. Previously unreported point mutations were identified in the regulatory system in tigecycline-nonsusceptible isolates. Real-time PCR identified 40-fold and 54-fold increases in adeB expression in the two tigecycline-nonsusceptible isolates compared to that in a tigecycline-susceptible isolate. In vitro exposure of a tigecycline-susceptible clinical strain to tigecycline caused a rapid rise in the MIC of tigecycline from 2 μg/ml to 24 μg/ml, which was reversible with PABN. A 25-fold increase in adeB expression was observed in a comparison between this tigecycline-susceptible isolate and its isogenic tigecycline-nonsusceptible mutant. These results indicate that an efflux-based mechanism plays a role in reduced tigecycline susceptibility in Acinetobacter. PMID:17420217

  4. Acinetobacter community-acquired pneumonia in a healthy child.

    PubMed

    Moreira Silva, G; Morais, L; Marques, L; Senra, V

    2012-01-01

    Acinetobacter is involved in a variety of infectious diseases primarily associated with healthcare. Recently there has been increasing evidence of the important role these pathogens play in community acquired infections. We report on the case of a previously healthy child, aged 28 months, admitted for fever, cough and pain on the left side of the chest, which on radiographic examination corresponded to a lower lobe necrotizing pneumonia. After detailed diagnostic work-up, community acquired Acinetobacter lwoffii pneumonia was diagnosed. The child had frequently shared respiratory equipment with elderly relatives with chronic obstructive pulmonary disease. As there were no other apparent risk factors, it could be assumed that the sharing of the equipment was the source of infection. The authors wish to draw attention to this possibility, that a necrotising community-acquired pneumonia due to Acinetobacter lwoffii can occur in a previously healthy child and to the dangers of inappropriate use and poor sterilisation of nebulisers. This case is a warning of the dangers that these bacteria may pose in the future in a community setting. PMID:21963110

  5. Genome Sequence of Jumbo Phage vB_AbaM_ME3 of Acinetobacter baumanni

    PubMed Central

    Buttimer, Colin; O’Sullivan, Lisa; Elbreki, Mohamed; Neve, Horst; McAuliffe, Olivia; Ross, R. Paul; Hill, Colin; O’Mahony, Jim

    2016-01-01

    Bacteriophage (phage) vB_AbaM_ME3 was previously isolated from wastewater effluent using the propagating host Acinetobacter baumannii DSM 30007. The full genome was sequenced, revealing it to be the largest Acinetobacter bacteriophage sequenced to date with a size of 234,900 bp and containing 326 open reading frames (ORFs). PMID:27563033

  6. Genome Sequence of Jumbo Phage vB_AbaM_ME3 of Acinetobacter baumanni.

    PubMed

    Buttimer, Colin; O'Sullivan, Lisa; Elbreki, Mohamed; Neve, Horst; McAuliffe, Olivia; Ross, R Paul; Hill, Colin; O'Mahony, Jim; Coffey, Aidan

    2016-01-01

    Bacteriophage (phage) vB_AbaM_ME3 was previously isolated from wastewater effluent using the propagating host Acinetobacter baumannii DSM 30007. The full genome was sequenced, revealing it to be the largest Acinetobacter bacteriophage sequenced to date with a size of 234,900 bp and containing 326 open reading frames (ORFs). PMID:27563033

  7. Emergence of NDM-1 and OXA-72 producing Acinetobacter pittii clinical isolates in Lebanon.

    PubMed

    Al Atrouni, A; Joly-Guillou, M-L; Hamze, M; Kempf, M

    2016-07-01

    Acinetobacter spp. have emerged as global opportunistic pathogen causing a wide range of infections. Emergence of carbapenem resistance in these organisms is a matter of great concern. We report here the first detection of Acinetobacter pittii clinical isolates in Lebanon carrying either the bla NDM-1 or the bla OXA-72 gene. PMID:27222717

  8. Molecular analysis of imipenem-resistant Acinetobacter baumannii isolated from US service members wounded in Iraq, 2003–2008

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Clonal spread and global dissemination of imipenem resistant (IR) A. baumannii-A. calcoaceticus complex (ABC) have been reported in recent years. However, the epidemiological features of the IR-ABCs in military treatment facilities (MTFs) have not been systematically studied. In this study, 298 ABC...

  9. Molecular characteristics of Multidrug Resistant Acinetobacter baumannii Isolates from US soldiers from Iraq at the National Naval Medical Center

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background: Infections with A. baumannii-calcoaceticus complex (ABC) have complicated the care of combat casualties. The majority of A. baumannii isolates cultured from injured personnel from OIF and OEF have been multi drug resistant (MDR). Therefore, the genes causing MDR and genotypes related to ...

  10. Molecular characteristics of Multidrug Resistant Acinetobacter baumannii Isolates from US soldiers from Iraq at the National Naval Medical Center

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background: Infections with A. baumannii-calcoaceticus complex (ABC) have complicated the care of combat casualties, and the spread and global dissemination of imipenem resistant (IR) clones of ABC have been reported in recent years. However, the epidemiological features of the IR-ABCs in military t...

  11. Acinetobacter sp. isolates from emergency departments in two hospitals of South Korea.

    PubMed

    Choi, Ji-Young; Ko, Eun Ah; Kwon, Ki Tae; Lee, Shinwon; Kang, Choel In; Chung, Doo-Ryeon; Peck, Kyong Ran; Song, Jae-Hoon; Ko, Kwan Soo

    2014-10-01

    A total of 114 Acinetobacter sp. isolates were collected from patients in the emergency departments (EDs) of two Korean hospitals. Most isolates belonged to the Acinetobacter baumannii complex (105 isolates, 92.1 %). Imipenem resistance was found in 39 isolates (34.2 %) of the Acinetobacter sp. isolates, and 6 colistin-resistant isolates were also identified. Species distribution and antimicrobial-resistance rates were different between the two hospitals. In addition, two main clones were identified in the imipenem-resistant A. baumannii isolates from hospital B, but very diverse and novel genotypes were found in those from hospital A. Many Acinetobacter sp. isolates, including the imipenem-resistant A. baumannii, are considered to be associated with the community. The evidence of high antimicrobial resistance and different features in these Acinetobacter sp. isolates between the two EDs suggests the need for continuous testing to monitor changes in epidemiology. PMID:25062943

  12. Coculture degradation of selected PCB congeners by two Acinetobacter sp

    SciTech Connect

    Adriaens, P.

    1989-01-01

    Polychlorinated biphenyls (PCBs) have been introduced in the environment for nearly six decades and are considered to be refractile to microbial attack, since PCBs have to be degraded via cometabolic processes, which occur in the obligate presence of an alternative growth substrate. However, cometabolism of PCBs has been demonstrated to accumulate chlorobenzoates as the main intermediates. Therefore, the complete mineralization of PCBs can only be obtained by coculturing at least a PCB cometabolizing and a chlorobenzoate utilizing microorganism, or by constructing a recombinant strain harboring the complementary pathways of both strains. Therefore, coculture mineralization of PCBs in suspended culture was obtained by providing biphenyl or 4-chlorobiphenyl as the growth substrate for Acinetobacter sp. strain P6, a PCB cometabolizer, while the chlorobenzoates were used as growth substrates by Acinetobacter sp. strain 4-CB1, which was isolated on 4-chlorobenzoate. 4-Chlorobenzoate (4-CB) was metabolized after hydrolytic dehalogenation to 4-hydroxybenzoate (4-HB) via the protocatechuate pathway. Acinetobacter sp. strain 4-CB1 has the metabolic ability to carry out the degradation of 3,4-DCB. Although this strain does not grow on this compound, it cometabolizes 3,4-DCB to 3-chloro-4-hydroxybenzoate (3-C-4-OHB), which is used as a growth substrate and further metabolized via 4-carboxy-1,2-benzoquinone. This degradation process was termed cryptic cometabolism. 3,4-DCB has shown to be a substrate inhibitor (Ki = 1,840 {mu}M) and an uncompetitive inhibitor for 4-CB metabolism. Additionally, 3-C-4-OHB was a competitive inhibitor (Ki = 12 {mu}M) for the 4-HB monooxygenase, while the quinone uncompetitively inhibited 4-CB metabolism (Ki = 50 {mu}M).

  13. Proliferation of spacecraft-associated Acinetobacter on alcohol solvents

    NASA Astrophysics Data System (ADS)

    Mogul, Rakesh; Cepeda, Ivonne; Brasali, Hania; Gornick, Trevor; Jain, Chirag; Kim, Eun Jin; Nguyen, Vinh Bao; Oei, Alex; Rodriguez, Joseph; Walker, Jillian; Savla, Gautam

    The Acinetobacter are the most abundant Gram-negative and non-spore forming bacteria found in the cleanroom facilities for Mars spacecraft. The spacecraft-associated Acinetobacter are extremotolerant towards hydrogen peroxide and have been shown to increase in abundance as a result of the spacecraft assembly process. To better understand the oligotrophic growth in the cleanroom environments, we have measured the growth of several Acinetobacter strains against ethanol and isopropanol, which are cleaning solvents used in the spacecraft assembly process. Our studies show that A. radioresistens 50v1, which was isolated from Mars Odyssey orbiter, optimally proliferates on 300 mM ethanol under minimal conditions at a growth rate that is 2-fold higher than that of the A. radioresistens type strain (strain 43998 (T) ). The impact of transition metals on the growth rates followed the trend of Fe (2+) > Mn (2+) > Zn (2+) , where Zn (2+) was inhibitory. In contrast, no growth on ethanol was observed for the novel species A. phoenicis 2P01AA, which was isolated from the facilities for the Mars Phoenix lander. Alcohol dehydrogenase activities measured in rich and minimal media paralleled these observations with the 50v1 strain possessing higher specific activities than the type strain, and the 2P01AA strain displaying no measurable activity in rich media. Preliminary studies indicate that isopropanol is insufficient as an energy source when in culture. The significance of these results as well as the observed differences between the Odyssey and Phoenix-associated strains will be discussed.

  14. Efflux-Mediated Antibiotic Resistance in Acinetobacter spp. ▿

    PubMed Central

    Coyne, Sébastien; Courvalin, Patrice; Périchon, Bruno

    2011-01-01

    Among Acinetobacter spp., A. baumannii is the most frequently implicated in nosocomial infections, in particular in intensive care units. It was initially thought that multidrug resistance (MDR) in this species was due mainly to horizontal acquisition of resistance genes. However, it has recently become obvious that increased expression of chromosomal genes for efflux systems plays a major role in MDR. Among the five superfamilies of pumps, resistance-nodulation-division (RND) systems are the most prevalent in multiply resistant A. baumannii. RND pumps typically exhibit a wide substrate range that can include antibiotics, dyes, biocides, detergents, and antiseptics. Overexpression of AdeABC, secondary to mutations in the adeRS genes encoding a two-component regulatory system, constitutes a major mechanism of multiresistance in A. baumannii. AdeIJK, intrinsic to this species, is responsible for natural resistance, but since overexpression above a certain threshold is toxic for the host, its contribution to acquired resistance is minimal. The recently described AdeFGH, probably regulated by a LysR-type transcriptional regulator, also confers multidrug resistance when overexpressed. Non-RND efflux systems, such as CraA, AmvA, AbeM, and AbeS, have also been characterized for A. baumannii, as have AdeXYZ and AdeDE for other Acinetobacter spp. Finally, acquired narrow-spectrum efflux pumps, such as the major facilitator superfamily (MFS) members TetA, TetB, CmlA, and FloR and the small multidrug resistance (SMR) member QacE in Acinetobacter spp., have been detected and are mainly encoded by mobile genetic elements. PMID:21173183

  15. Modifying enzymes related aminoglycoside: analyses of resistant Acinetobacter isolates

    PubMed Central

    Atasoy, Ali Riza; Ciftci, Ihsan Hakki; Petek, Mustafa

    2015-01-01

    Enzymatic modification of aminoglycosides by nucleotidyltransferases, acetyltransferases and/or phosphotransferases accounts for the majority of aminoglycoside-resistant Acinetobacter isolates. In this study, we investigated the relationship between aminoglycoside resistance and the presence of aminoglycoside-modifying enzymes in Acinetobacter baumannii clinical isolate groups with different resistance profiles. Thirty-two clinical A. baumannii isolates were included in this study. Acinetobacter isolates were divided into 4 groups according to results of susceptibility testing. The presence of genes encoding the following aminoglycoside-modifying enzymes; aph (3’)-V1, aph (3’)-Ia, aac (3)-Ia, aac (3) IIa, aac (6’)-Ih, aac (6’)-Ib and ant (2’)-Ia responsible for resistance was investigated by PCR in all strains. The acetyltransferase (aac (6’)-Ib, aac (3)-Ia) and phosphotransferase (aph (3’)-Ia) gene regions were identified in the first group, which comprised nine imipenem, meropenem, and gentamicin-resistant isolates. The acetyltransferase (aac (6’)-Ib, aac (3)-Ia), phosphotransferase (aph (3’)-VI) and nucleotidyltransferase (ant2-Ia) gene regions were identified in the second group, which was composed of nine imipenem-resistant, meropenem-resistant and gentamicin-sensitive isolates. The acetyltransferase (aac (3)-Ia) and phosphotransferase (aph (3’)-Ia) regions were identified in the fourth group, which comprised eight imipenem-sensitive, meropenem-sensitive and gentamicin-resistant isolates. Modifying enzyme gene regions were not detected in the third group, which was composed of six imipenem, meropenem and gentamicin-sensitive isolates. Our data are consistent with previous reports, with the exception of four isolates. Both acetyltransferases and phosphotransferases were widespread in A. baumannii clinical isolates in our study. However, the presence of the enzyme alone is insufficient to explain the resistance rates. Therefore, the

  16. Prevalence of Aminoglycoside Resistance Genes in Acinetobacter baumannii Isolates

    PubMed Central

    Aliakbarzade, Katayun; Farajnia, Safar; Karimi Nik, Ashraf; Zarei, Farzaneh; Tanomand, Asghar

    2014-01-01

    Background: Acinetobacter baumannii is one of the major causes of nosocomial infections and is resistant to most available antibiotics. Aminoglycosides remain as drugs of choice for treatment of Acinetobacter infections yet resistance to aminoglycosides has increased in the recent years. Objectives: The present study investigated the prevalence of genes encoding aminoglycoside-modifying enzymes in A. baumannii strains isolated from patients of Tabriz city, northwest of Iran. Materials and Methods: A total of 103 Acinetobacter isolates were collected from Imam Reza Hospital of Tabriz University of medical sciences. Antimicrobial susceptibility patterns of the isolates to different antimicrobial agents including cephalosporins, gentamicin, amikacin, tobramycin, colistin and polymyxin, were evaluated by the disc diffusion method. The frequency of aminoglycoside modifying enzymes encoding genes aacC1, aphA6, aadA1 and aadB was analyzed by the PCR method. Results: Antimicrobial susceptibility analysis showed that the highest resistance was towards beta−lactam antibiotics including cephalosporins whereas the highest sensitivity was observed towards colistin (77%) and polymyxin (84%). The resistance rate to aminoglycosides was 81%, 86% and 63% for amikacin, gentamicin and tobramycin, respectively. The PCR results showed that among the 103 A. baumannii isolates, 56 (65.11 %) were positive for aacC1, 52 (60.46 %) for aphA6, 24 (27.9 %) for aadA1 and 16 (18.6 %) for aadB resistant genes. Conclusions: The results of this study indicated that the genes encoding aminoglycoside-modifying enzymes are prevalent in A. baumannii isolates in the study region, which highlighted the necessity of considering preventive measures to control dissemination of these resistance genes. PMID:25632323

  17. Antimicrobial susceptibilities of clinical isolates of Acinetobacter baumannii from Singapore.

    PubMed

    Kuah, B G; Kumarasinghe, G; Doran, J; Chang, H R

    1994-10-01

    The in vitro activities of 17 antimicrobial agents alone or in combination against 70 clinical isolates of Acinetobacter baumannii from Singapore were determined by broth microdilution. The MICs of amoxicillin, ampicillin, ceftazidime, ceftriaxone, gentamicin, and piperacillin for 90% of the strains were > or = 128 micrograms/ml. Addition of sulbactam to ampicillin produced improved activity, whereas adding tazobactam to piperacillin did not. The MICs of amikacin, ciprofloxacin, and imipenem for 90% of the strains were 32, 32, and 16 micrograms/ml, respectively. PMID:7840598

  18. Acinetobacter infection is associated with acquired glucose intolerance in burn patients.

    PubMed

    Furniss, Dominic; Gore, Sinclair; Azadian, Berge; Myers, Simon R

    2005-01-01

    Infection with antibiotic-resistant Acinetobacter spp. is an increasing problem in critical care environments worldwide. Acinetobacter spp. are known to produce an insulin-cleaving protease. We hypothesized that infection with Acinetobacter spp. was associated with the acquisition of glucose intolerance in burn patients. Data were collected prospectively on all 473 patients admitted to the Burns Centre between January 2002 and March 2003. A total of 3.4% of patients acquired glucose intolerance during admission. Patients with Acinetobacter spp. infection were 9.8 times more likely to develop glucose intolerance than those without the infection (P < .0001). The association persisted after controlling for TBSA (P < .001). In patients with deep Acinetobacter spp. infection, 47% had glucose intolerance, compared with 12% in those with infection of the burn only (P = .03). In patients with pre-existing diabetes mellitus, 27% developed Acinetobacter spp. infection compared with only 8.5% of patients without diabetes (P = .04). This study demonstrates a clear association between Acinetobacter spp. infection and glucose intolerance in burns patients. PMID:16151285

  19. Successful Eradication of Multidrug Resistant Acinetobacter in the Helsinki Burn Centre.

    PubMed

    Lindford, Andrew; Kiuru, Valtteri; Anttila, Veli-Jukka; Vuola, Jyrki

    2015-01-01

    Multidrug-resistant (MDR) Acinetobacter is an important pathogen implicated in nosocomial infections in healthcare environments. Virulence factors, resistance mechanisms, and limited therapeutic options make this pathogen a major problem currently facing burn intensive care units (ICUs) worldwide. The purpose of this study was to assess the effect of infection control measures taken in Helsinki Burn Centre in 2001 on MDR Acinetobacter prevalence in ICU burn patients. Data were retrospectively collected from patient files from 1998 to 2012. ICU burn patients were defined as those with either over 30% of total body surface area burnt or requiring mechanical ventilation. Inclusion criteria consisted of patients who tested positive for Acinetobacter sp. in routine bacterial cultures or cultures taken because of a clinically suspected infection. Infection control interventions performed in 2001 consisted of various shower room renovations and changes in hospital hygiene and burn treatment regimes. Between 1998 and 2012, 75 patients were diagnosed with Acinetobacter sp. colonization. Following the infection control interventions the incidence of Acinetobacter sp. radically declined. Between 1998 and 2001, there were 31 cases of MDR Acinetobacter colonizations diagnosed, but from 2002 to 2012 no MDR strains were found. Changes to hospital hygiene and wound treatment protocols as well as structural changes to the hospital environment can have a major impact on preventing and treating Acinetobacter outbreaks in burn centers. PMID:25501783

  20. Treatment for patients with multidrug resistant Acinetobacter baumannii pulmonary infection

    PubMed Central

    PAN, TAO; LIU, XIAOYUN; XIANG, SHOUGUI; JI, WENLI

    2016-01-01

    Bacterial infections are common but have become increasingly resistant to drugs. The aim of the present study was to examine the combined treatment of traditional Chinese and Western medicine in 30 cases of pulmonary infection with multidrug resistant Acinetobacter baumannii. Patients were divided into groups A and B according to drug treatments. Cefoperazone or sulbactam and tanreqing were administered in group A, and cefoperazone or sulbactam in group B. The curative effect and prognosis of the two groups were recorded and the remaining treatments were performed routinely in the clinic. For the combined therapy group, which was administered sulperazone and tanreqing, 8 patients were recovered, 6 patients had significant effects, 3 patients exhibited some improvement and 1 patient had no response. One of the patients did not survive after 28 days. By contrast, there were 4 patients that were successfully treated, 3 patients with significant effects, 2 patients with some improvement and 2 patients had no response in the sulperazone group, and 4 patients did not survive after 28 days. In conclusion, the combined therapy of cefoperazone or sulbactam supplemented with tanreqing was identified to be more effective than cefoperazone or sulbactam as monotherapy, for treating multidrug resistant Acinetobacter baumannii. PMID:27073447

  1. Antimicrobial active herbal compounds against Acinetobacter baumannii and other pathogens.

    PubMed

    Tiwari, Vishvanath; Roy, Ranita; Tiwari, Monalisa

    2015-01-01

    Bacterial pathogens cause a number of lethal diseases. Opportunistic bacterial pathogens grouped into ESKAPE pathogens that are linked to the high degree of morbidity, mortality and increased costs as described by Infectious Disease Society of America. Acinetobacter baumannii is one of the ESKAPE pathogens which cause respiratory infection, pneumonia and urinary tract infections. The prevalence of this pathogen increases gradually in the clinical setup where it can grow on artificial surfaces, utilize ethanol as a carbon source and resists desiccation. Carbapenems, a β-lactam, are the most commonly prescribed drugs against A. baumannii. The high level of acquired and intrinsic carbapenem resistance mechanisms acquired by these bacteria makes their eradication difficult. The pharmaceutical industry has no solution to this problem. Hence, it is an urgent requirement to find a suitable alternative to carbapenem, a commonly prescribed drug for Acinetobacter infection. In order to do this, here we have made an effort to review the active compounds of plants that have potent antibacterial activity against many bacteria including carbapenem resistant strain of A. baumannii. We have also briefly highlighted the separation and identification methods used for these active compounds. This review will help researchers involved in the screening of herbal active compounds that might act as a replacement for carbapenem. PMID:26150810

  2. Antimicrobial active herbal compounds against Acinetobacter baumannii and other pathogens

    PubMed Central

    Tiwari, Vishvanath; Roy, Ranita; Tiwari, Monalisa

    2015-01-01

    Bacterial pathogens cause a number of lethal diseases. Opportunistic bacterial pathogens grouped into ESKAPE pathogens that are linked to the high degree of morbidity, mortality and increased costs as described by Infectious Disease Society of America. Acinetobacter baumannii is one of the ESKAPE pathogens which cause respiratory infection, pneumonia and urinary tract infections. The prevalence of this pathogen increases gradually in the clinical setup where it can grow on artificial surfaces, utilize ethanol as a carbon source and resists desiccation. Carbapenems, a β-lactam, are the most commonly prescribed drugs against A. baumannii. The high level of acquired and intrinsic carbapenem resistance mechanisms acquired by these bacteria makes their eradication difficult. The pharmaceutical industry has no solution to this problem. Hence, it is an urgent requirement to find a suitable alternative to carbapenem, a commonly prescribed drug for Acinetobacter infection. In order to do this, here we have made an effort to review the active compounds of plants that have potent antibacterial activity against many bacteria including carbapenem resistant strain of A. baumannii. We have also briefly highlighted the separation and identification methods used for these active compounds. This review will help researchers involved in the screening of herbal active compounds that might act as a replacement for carbapenem. PMID:26150810

  3. Acinetobacter baumannii in Localised Cutaneous Mycobacteriosis in Falcons.

    PubMed

    Muller, Margit Gabriele; George, Ancy Rajeev; Walochnik, Julia

    2010-01-01

    Between May 2007 and April 2009, 29 falcons with identically localized, yellowish discolored cutaneous lesions in the thigh and lateral body wall region were presented at Abu Dhabi Falcon Hospital. Out of 18 falcons integrated in this study, 16 tested positive to Mycobacterium. avium complex. The 2 negative falcons tested positive in the Mycobacterium genus PCR. Moreover, 1 falcon tested positive to M. avium. paratuberculosis in tissue samples by PCR. In all cases, blood and fecal samples tested negative. In the acid-fast stain, all samples showed the for mycobacteriosis typical rods. Moreover, in 13 samples Acinetobacter baumannii was detected by PCR and proven by DNA sequencing. Clinical features included highly elevated WBCs, heterophilia, lymphocytopenia, monocytosis, severe anemia and weight loss. A. baumannii, a gram-negative bacillus with the ability to integrate foreign DNA, has emerged as one of the major multidrug resistant bacteria. In veterinary medicine, it has so far been detected in dogs, cats, horses and wild birds. To the authors' knowledge, this is the first report of an A. baumannii infection in falcons and of a veterinary Mycobacterium-Acinetobacter coinfection. PMID:20871867

  4. Occurrence of High Catalase-containing Acinetobacter in Spacecraft Assembly Facilities

    NASA Astrophysics Data System (ADS)

    McCoy, K. B.; Derecho, I.; La Duc, M. T.; Vaishampayan, P.; Venkateswaran, K. J.; Mogul, R.

    2010-04-01

    In summary, the measurement of high catalase specific activity values for spacecraft-associated Acinetobacter strains is potentially the result of adaptation towards the harsh conditions of the clean rooms and assembly process.

  5. Antibiotic susceptibility of Acinetobacter species in intensive care unit in Montenegro.

    PubMed

    Mijovic, Gordana; Pejakov, Ljubica; Vujosevic, Danijela

    2016-08-01

    The global increase in multidrug resistance of Acinetobacter has created widespread problems in the treatment of patients in intensive care units (ICUs). The aim of this study was to assess the current level of antimicrobial susceptibility of Acinetobacter species in ICU of Clinical Centre of Montenegro and determine their epidemiology. Antibiotic susceptibility was tested in 70 isolates of Acinetobacter collected from non-repeating samples taken from 40 patients. The first nine isolates were genotyped by repetitive sequence-based PCR (rep-PCR). Tigecycline was found to be the most active antimicrobial agent with 80.6% of susceptibility. All the isolates were multidrug resistant with fully resistance to cefalosporinas, piperacillin and piperacillin/tazobactam. More than half of them (58.5%) were probably extensively resistant. Seven out of nine examined strains were clonally related by rep-PCR. Our results showed extremely high rate of multidrug resistance (MDR) of Acinetobacter isolates and high percentage of its clonally spreading. PMID:25979577

  6. The first cases of human bacteremia caused by Acinetobacter seifertii in Japan.

    PubMed

    Kishii, Kozue; Kikuchi, Ken; Tomida, Junko; Kawamura, Yoshiaki; Yoshida, Atsushi; Okuzumi, Katsuko; Moriya, Kyoji

    2016-05-01

    Acinetobacter seifertii, a novel species of Acinetobacter, was first reported in 2015. A. seifertii strains were isolated from human clinical specimens (blood, respiratory tract, and ulcer) and hospital environments. Here, we report the first cases of bacteremia caused by A. seifertii in patients with catheter-related bloodstream infection in Japan. The patients favorably recovered, without any complications, after removal of the peripheral intravenous catheters and administration of antibiotics. The pathogens were initially identified as Acinetobacter baumannii, using phenotypic methods and the MicroScan Walkaway System; however, rpoB gene sequence analysis indicated 99.54% similarity to A. seifertii. Moreover, antimicrobial susceptibility testing revealed that one of the strains was not susceptible to gentamicin and ceftazidime. Our report shows that Acinetobacter species other than A. baumannii can also cause nosocomial infections and that accurate methods for the identification of causative agents should be developed. PMID:26778251

  7. Contamination of Ambient Air with Acinetobacter baumannii on Consecutive Inpatient Days.

    PubMed

    Shimose, Luis A; Doi, Yohei; Bonomo, Robert A; De Pascale, Dennise; Viau, Roberto A; Cleary, Timothy; Namias, Nicholas; Kett, Daniel H; Munoz-Price, L Silvia

    2015-07-01

    Acinetobacter-positive patients had their ambient air tested for up to 10 consecutive days. The air was Acinetobacter positive for an average of 21% of the days; the rate of contamination was higher among patients colonized in the rectum than in the airways (relative risk [RR], 2.35; P = 0.006). Of the 6 air/clinical isolate pairs available, 4 pairs were closely related according to rep-PCR results. PMID:25926496

  8. Draft Genome Sequences of Acinetobacter baumannii Isolates from Wounded Military Personnel.

    PubMed

    Arivett, Brock A; Ream, Dave C; Fiester, Steven E; Kidane, Destaalem; Actis, Luis A

    2016-01-01

    Acinetobacter baumannii is a Gram-negative bacterium capable of causing hospital-acquired infections that has been grouped with Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter species as ESKAPE pathogens because of their extensive drug resistance phenotypes and increasing risk to human health. Twenty-four multidrug-resistant A. baumannii strains isolated from wounded military personnel were sequenced and annotated. PMID:27563036

  9. Characterization and identification of newly isolated Acinetobacter baumannii strain serdang 1 for phenol removal

    NASA Astrophysics Data System (ADS)

    Yadzir, Z. H. M.; Shukor, M. Y.; Nazir, M. S.; Abdullah, M. A.

    2012-09-01

    A new indigenous bacterial strain from Malaysian soil contaminated with petroleum waste had been successfully isolated, characterized and identified for phenol removal. The gram negative bacteria showed 98% identity with Acinetobacter baumannii based on Biolog{trade mark, serif} Identification System and the determination of a partial 16S ribosomal RNA (rRNA) sequence. The isolate clustered with species belonging to Acinetobacter clade in a 16S rDNA-based neighbour-joining phylogenetic tree.

  10. Draft Genome Sequences of Acinetobacter baumannii Isolates from Wounded Military Personnel

    PubMed Central

    Arivett, Brock A.; Ream, Dave C.; Fiester, Steven E.; Kidane, Destaalem

    2016-01-01

    Acinetobacter baumannii is a Gram-negative bacterium capable of causing hospital-acquired infections that has been grouped with Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter species as ESKAPE pathogens because of their extensive drug resistance phenotypes and increasing risk to human health. Twenty-four multidrug-resistant A. baumannii strains isolated from wounded military personnel were sequenced and annotated. PMID:27563036

  11. Update on the Epidemiology, Treatment, and Outcomes of Carbapenem-resistant Acinetobacter infections

    PubMed Central

    Kim, Uh Jin; Kim, Hee Kyung; An, Joon Hwan; Cho, Soo Kyung; Park, Kyung-Hwa

    2014-01-01

    Carbapenem-resistant Acinetobacter species are increasingly recognized as major nosocomial pathogens, especially in patients with critical illnesses or in intensive care. The ability of these organisms to accumulate diverse mechanisms of resistance limits the available therapeutic agents, makes the infection difficult to treat, and is associated with a greater risk of death. In this review, we provide an update on the epidemiology, resistance mechanisms, infection control measures, treatment, and outcomes of carbapenem-resistant Acinetobacter infections. PMID:25229014

  12. Study of the resistance of Acinetobacter sp. to mercuric chloride

    SciTech Connect

    Lomovskaya, O.L.; Mindlin, S.Z.; Khesin, R.B.

    1986-06-01

    In addition to large plasmids (approx 60 kb) a small plasmid (almost 7.5 kb), plasmid PKL1, has been found in HgCl/sub 2/-resistant strains of Acinetobacter sp. isolated from soil in the vicinity of the Khaidarkan mercury deposit. With the aid of conjugation and transformation studies it was established that plasmid pKL1 is a mobilized plasmid with a broad host range and that this plasmid carries the Hg/sup r/-determinant. A restriction map of plasmid pKL1 was constructed, and the site of the Hg/sup r/-determinant and the regions essential for replication were localized. By comparing the results of the present study and previously-obtained data it was proposed that in a given microbiocoenosis the Hg/sup r/-determinants may occur in plasmids which differ markedly in structure and properties.

  13. Stress responses in the opportunistic pathogen Acinetobacter baumannii

    PubMed Central

    Fiester, Steven E; Actis, Luis A

    2013-01-01

    Acinetobacter baumannii causes a wide range of severe infections among compromised and injured patients worldwide. The relevance of these infections are, in part, due to the ability of this pathogen to sense and react to environmental and host stress signals, allowing it to persist and disseminate in medical settings and the human host. This review summarizes current knowledge on the roles that environmental and cellular stressors play in the ability of A. baumannii to resist nutrient deprivation, oxidative and nitrosative injury, and even the presence of the commonly used antiseptic ethanol, which could serve as a nutrient- and virulence-enhancing signal rather than just being a convenient disinfectant. Emerging experimental evidence supports the role of some of these responses in the pathogenesis of the infections A. baumannii causes in humans and its capacity to resist antibiotics and host response effectors. PMID:23464372

  14. Acinetobacter baumannii Infection and IL-17 Mediated Immunity

    PubMed Central

    Yan, Zihe; Yang, Junjun; Hu, Renjing; Hu, Xichi; Chen, Kong

    2016-01-01

    Acinetobacter baumannii is a significant cause of severe hospital-acquired infections with a recent rise in multidrug-resistant infections involving traumatic wounds of military personnel. The interleukin-17 (IL-17) pathway is essential for neutrophil recruitment in response to a variety of pathogens, while the control of A. baumannii infection is known to be dependent on neutrophils. This suggests that IL-17 may play an important role in A. baumannii infection; however, this has yet to be studied. Here, we summarize the recent advances in understanding the host-pathogen interaction of A. baumannii and propose a potential role of the IL-17 pathway in generating a protective immune response. PMID:26977122

  15. Acinetobacter cyclohexanone monooxygenase: gene cloning and sequence determination.

    PubMed Central

    Chen, Y C; Peoples, O P; Walsh, C T

    1988-01-01

    The gene coding for cyclohexanone monooxygenase from Acinetobacter sp. strain NCIB 9871 was isolated by immunological screening methods. We located and determined the nucleotide sequence of the gene. The structural gene is 1,626 nucleotides long and codes for a polypeptide of 542 amino acids; 389 nucleotides 5' and 108 nucleotides 3' of the coding region are also reported. The complete amino acid sequence of the enzyme was derived by translation of the nucleotide sequence. From a comparison of the amino acid sequence with consensus sequences of nucleotide-binding folds, we identified a potential flavin-binding site at the NH2 terminus of the enzyme (residues 6 to 18) and a potential nicotinamide-binding site extending from residue 176 to residue 208 of the protein. An overproduction system for the gene to facilitate genetic manipulations was also constructed by using the tac promoter vector pKK223-3 in Escherichia coli. Images PMID:3338974

  16. Genetic Determinants of Intrinsic Colistin Tolerance in Acinetobacter baumannii

    PubMed Central

    Hood, M. Indriati; Becker, Kyle W.; Roux, Christelle M.; Dunman, Paul M.

    2013-01-01

    Acinetobacter baumannii is a leading cause of multidrug-resistant infections worldwide. This organism poses a particular challenge due to its ability to acquire resistance to new antibiotics through adaptation or mutation. This study was undertaken to determine the mechanisms governing the adaptability of A. baumannii to the antibiotic colistin. Screening of a transposon mutant library identified over 30 genes involved in inducible colistin resistance in A. baumannii. One of the genes identified was lpsB, which encodes a glycosyltransferase involved in lipopolysaccharide (LPS) synthesis. We demonstrate that loss of LpsB function results in increased sensitivity to both colistin and cationic antimicrobial peptides of the innate immune system. Moreover, LpsB is critical for pathogenesis in a pulmonary model of infection. Taken together, these data define bacterial processes required for intrinsic colistin tolerance in A. baumannii and underscore the importance of outer membrane structure in both antibiotic resistance and the pathogenesis of A. baumannii. PMID:23230287

  17. Herellea (Acinetobacter) and Pseudomonas ovalis (P. putida) from Frozen Foods

    PubMed Central

    Eller, Charles

    1969-01-01

    Seventeen strains of Herellea vaginicola (Acinetobacter antitratus) and 8 of Pseudomonas ovalis (P. putida), isolated from 23 (6.3%) of 364 samples of frozen, foil-pack foods, were identified and characterized morphologically and biochemically. Herellea was isolated from 17 foods (4.7%), P. ovalis from 6 (1.6%). No Mima were found. The food samples included precooked frozen meats, precooked and uncooked frozen vegetables, and uncooked frozen desserts. The bacteria were detected in the food with a procedure used generally for the detection of salmonellae. The pseudomonad simulated the characteristics of Herellea on Sellers differential agar, except for the fact that it fluoresced. From consideration of the habitat and pathogenicity of Herellea and Mima, it is concluded that, although the presence of these bacteria may not be desirable, their significance in food remains unanswered. PMID:4886860

  18. Antimicrobial susceptibility of clinical isolates of Acinetobacter baumannii.

    PubMed

    Shi, Z Y; Liu, P Y; Lau, Y; Lin, Y; Hu, B S; Shir J-M

    1996-02-01

    The in-vitro activity of 18 antimicrobial agents alone or in combination against 248 clinical isolates of Acinetobacter baumannii from Taiwan were tested by agar dilution. The MIC90S of ampicillin, amoxicillin, piperacillin, cefuroxime, cefotaxime, ceftriaxone, gentamicin, and amikacin were at least 128 mu g/ml. Ceftazidime, cefepime, sulbactam, clavulanic acid, and tazobactam presented moderate activity with MIC90S of 32, 16, 16, 32, and 32 mu g/ml, respectively. The increased activity of ampicillin/sulbactam, amoxicillin/clavulanic acid, and piperacillin/tazobactam was due to the intrinsic effect of sulbactam, clavulanic acid, and tazobactam, respectively. Imipenem, meropenem, and ciprofloxacin were the most active antimicrobial agents with MIC90S of 1, 1, and 0.5 mu g/ml, respectively. Nineteen isolates (7.7%) were resistant to all aminoglycosides and beta-lactam antibiotics, except carbapenems and ciprofloxacin. We are concerned about the multidrug resistance of A. baumannii in this study. PMID:9147913

  19. A Case of Acinetobacter Septic Pulmonary Embolism in an Infant

    PubMed Central

    Ananthan, Anitha; David, Jane; Ghildiyal, Radha

    2016-01-01

    Case Characteristics. An 11-month-old girl presented with fever and breathlessness for 5 days. Patient had respiratory distress with bilateral coarse crepitations. Chest radiograph revealed diffuse infiltrations in the right lung with thick walled cavities in mid and lower zone. Computed tomography showed multiple cystic spaces and emboli. Blood culture grew Acinetobacter species. Intervention. Patient was treated with Meropenem and Vancomycin. Outcome. Complete clinical and radiological recovery was seen in child. Message. Blood cultures and CT of the chest are invaluable in the evaluation of a patient with suspected septic pulmonary embolism. With early diagnosis and appropriate antimicrobial therapy, complete recovery can be expected in patients with septic pulmonary embolism. PMID:27529040

  20. The Response of Acinetobacter baumannii to Zinc Starvation.

    PubMed

    Nairn, Brittany L; Lonergan, Zachery R; Wang, Jiefei; Braymer, Joseph J; Zhang, Yaofang; Calcutt, M Wade; Lisher, John P; Gilston, Benjamin A; Chazin, Walter J; de Crécy-Lagard, Valerie; Giedroc, David P; Skaar, Eric P

    2016-06-01

    Zinc (Zn) is an essential metal that vertebrates sequester from pathogens to protect against infection. Investigating the opportunistic pathogen Acinetobacter baumannii's response to Zn starvation, we identified a putative Zn metallochaperone, ZigA, which binds Zn and is required for bacterial growth under Zn-limiting conditions and for disseminated infection in mice. ZigA is encoded adjacent to the histidine (His) utilization (Hut) system. The His ammonia-lyase HutH binds Zn very tightly only in the presence of high His and makes Zn bioavailable through His catabolism. The released Zn enables A. baumannii to combat host-imposed Zn starvation. These results demonstrate that A. baumannii employs several mechanisms to ensure bioavailability of Zn during infection, with ZigA functioning predominately during Zn starvation, but HutH operating in both Zn-deplete and -replete conditions to mobilize a labile His-Zn pool. PMID:27281572

  1. Community-acquired Acinetobacter baumannii: clinical characteristics, epidemiology and pathogenesis.

    PubMed

    Dexter, Carina; Murray, Gerald L; Paulsen, Ian T; Peleg, Anton Y

    2015-05-01

    Community-acquired Acinetobacter baumannii (CA-Ab) is a rare but serious cause of community-acquired pneumonia in tropical regions of the world. CA-Ab infections predominantly affect individuals with risk factors, which include excess alcohol consumption, diabetes mellitus, smoking and chronic lung disease. CA-Ab pneumonia presents as a surprisingly fulminant course and is characterized by a rapid onset of fever, severe respiratory symptoms and multi-organ dysfunction, with a mortality rate reported as high as 64%. It is unclear whether the distinct clinical syndrome caused by CA-Ab is because of host predisposing factors or unique bacterial characteristics, or a combination of both. Deepening our understanding of the drivers of overwhelming CA-Ab infection will provide important insights into preventative and therapeutic strategies. PMID:25850806

  2. Analysis of drug resistance in 1,861 strains of Acinetobacter baumannii

    PubMed Central

    JIN, HAO; QIU, FAN; JI, HONG JIAN; LU, QIANG

    2016-01-01

    Acinetobacter baumannii is an emerging human pathogen that causes hospital-acquired infections. The trend in increased antimicrobial resistance limits the choice of effective antimicrobial agents. The present study reports the resistance to Acinetobacter baumannii and analyzes the associations between antibiotic use and resistance rates at a general hospital between 2010 and 2014. A total of 1,861 isolates were obtained from clinical cultures, accounting for 10.33% of all detected bacteria (1,861/18,016). The strains were mainly from respiratory samples (1,628 isolates, 87.5%) and the intensive care unit (696 isolates, 37.4%). The resistance rates of Acinetobacter baumannii to the majority of antibiotics were >50%, particularly the resistance rate to cefoperazone/sulbactam increased from 47.37 in 2011 to 89.25% in 2014. However, the rates of imipenem and cilastatin sodium decreased from 81.03 to 69.44% due to the antibiotic policy. There were Pearson significant associations between the use of three antibiotics and resistance in Acinetobacter baumannii to this drug, piperacillin/tazobactam (r=0.976, P<0.01), gentamicin (r=0.870, P<0.01) and cefoxitin (r=0.741, P<0.05). Therefore, a combination of drugs should be adopted to treat Acinetobacter baumannii infections. Microbiology laboratory support and surveillance policies are essential to control the emergence of multidrug-resistance Acinetobacter baumannii. PMID:27073633

  3. Impact of empirical antimicrobial therapy on the outcome of critically ill patients with Acinetobacter bacteremia

    PubMed Central

    Al-Dorzi, Hasan M.; Asiri, Abdulaziz M.; Shimemri, Abdullah; Tamim, Hani M.; Al Johani, Sameera M.; Al Dabbagh, Tarek; Arabi, Yaseen M.

    2015-01-01

    RATIONALE: Empirical antimicrobial therapy (EAT) for Acinetobacter infections may not be appropriate as it tends to be multidrug-resistant. This study evaluated the relationship between appropriate EAT and the outcomes of Intensive Care Unit (ICU) patients with Acinetobacter bacteremia. METHODS: This is a retrospective study of patients admitted to a medical-surgical ICU (2005-2010) and developed Acinetobacter bacteremia during the stay. Patients were categorized according to EAT appropriateness, defined as administration of at least one antimicrobial agent to which the Acinetobacter was susceptible before susceptibility results were known. The relation between EAT appropriateness and outcomes was evaluated. RESULTS: Sixty patients developed Acinetobacter bacteremia in the 6-year period (age = 50 ± 19 years; 62% males; Acute Physiology and Chronic Health Evaluation II score = 28 ± 9; 98.3% with central lines; 67% in shock and 59% mechanically ventilated) on average on day 23 of ICU and day 38 of hospital stay. All isolates were resistant to at least three of the tested antimicrobials. Appropriate EAT was administered to 60% of patients, mostly as intravenous colistin. Appropriate EAT was associated with lower ICU mortality risk (odds ratio: 0.15; 95% confidence interval: 0.03-0.96) on multivariate analysis. CONCLUSIONS: In this 6-year cohort, Acinetobacter bacteremia was related to multidrug-resistant strains. Appropriate EAT was associated with decreased ICU mortality risk. PMID:26664563

  4. Identification of Ata, a Multifunctional Trimeric Autotransporter of Acinetobacter baumannii

    PubMed Central

    Bentancor, Leticia V.; Camacho-Peiro, Ana; Bozkurt-Guzel, Cagla; Pier, Gerald B.

    2012-01-01

    Acinetobacter baumannii has recently emerged as a highly troublesome nosocomial pathogen, especially in patients in intensive care units and in those undergoing mechanical ventilation. We have identified a surface protein adhesin of A. baumannii, designated the Acinetobacter trimeric autotransporter (Ata), that contains all of the typical features of trimeric autotransporters (TA), including a long signal peptide followed by an N-terminal, surface-exposed passenger domain and a C-terminal domain encoding 4 β-strands. To demonstrate that Ata encoded a TA, we created a fusion protein in which we replaced the entire passenger domain of Ata with the epitope tag V5, which can be tracked with specific monoclonal antibodies, and demonstrated that the C-terminal 101 amino acids of Ata were capable of exporting the heterologous V5 tag to the surface of A. baumannii in a trimeric form. We found that Ata played a role in biofilm formation and bound to various extracellular matrix/basal membrane (ECM/BM) components, including collagen types I, III, IV, and V and laminin. Moreover, Ata mediated the adhesion of whole A. baumannii cells to immobilized collagen type IV and played a role in the survival of A. baumannii in a lethal model of systemic infection in immunocompetent mice. Taken together, these results reveal that Ata is a TA of A. baumannii involved in virulence, including biofilm formation, binding to ECM/BM proteins, mediating the adhesion of A. baumannii cells to collagen type IV, and contributing to the survival of A. baumannii in a mouse model of lethal infection. PMID:22609912

  5. Epidemiological Monitoring of Nosocomial Infections Caused by Acinetobacter Baumannii

    PubMed Central

    Custovic, Amer; Smajlovic, Jasmina; Tihic, Nijaz; Hadzic, Sadeta; Ahmetagic, Sead; Hadzagic, Haris

    2014-01-01

    Introduction: Acinetobacter baumannii is a frequent cause of infections in hospitals around the world, which is very difficult to control and treat. It is particularly prevalent in intensive care wards. Aim: The main objective of the research was to establish the application of epidemiological monitoring of nosocomial infections (NIs) caused by A. baumannii in order to determine: the type and distribution of NIs, and to investigate antimicrobial drug resistance of A. baumannii. Material and Methods: 855 patients treated at the Clinic of Anesthesiology and Reanimation, University Clinical Center Tuzla during 2013 were followed prospectively for the development of NIs. Infections caused by A. baumannii were characterized by the anatomical site and antibiotics resistance profile. Results: NIs were registered in 105 patients (12.3%; 855/105). The predominant cause of infection was A. baumannii with an incidence of 51.4% (54/105), followed by ESBL-producing Klebsiella pneumoniae with 15.2% (16/105) of cases, methicillin-resistant Staphylococcus aureus with 8.6% (9/105), and ESBL-producing Proteus mirabilis with 7.6% (8/105). According to the anatomical site, and type of NIs caused by A. baumannii, the most frequent were respiratory infections (74.1%; 40/54). Infections of surgical sites were registered in 11.1% (6/54) of cases, while bloodstream infections in 9.2% (5/54). A. baumannii isolates tested resistant against most antibiotics examined, but showed a high degree of susceptibility to tobramycin (87%; 47/54) and colistin (100%; 54/54). Conclusion: The increasing incidence of multi- and extensively drug-resistant Acinetobacter spp. emphasizes the importance of administration of an adequate antibiotic strategy and the implementation of strict monitoring of the measures for controlling nosocomial infections. PMID:25648217

  6. Extremotolerant survival and proteomics of Acinetobacter isolated from spacecraft assembly facilities

    NASA Astrophysics Data System (ADS)

    Mogul, Rakesh; Vaishampayan, Parag; Venkateswaran, Kasthuri; McCoy, Kelly; Derecho, Ivy; Dallal, Freida

    2012-07-01

    Herein, we report on the extreme hydrogen peroxide resistance of Acinetobacter isolated from the assembly facilities for the Mars Odyssey orbiter and Phoenix lander. Specific activity experiments on 10 different spacecraft-associated Acinetobacter strains show that the catalase contents are 15-250-fold greater than that of E. coli. Among this group, the highest and lowest catalase-containing strains, which were Acinetobacter nov. sp. 2P01AA and Acinetobacter radioresistens 50v1, demonstrated no significant and 2-log reductions in survivability upon exposure to 100 mM hydrogen peroxide (1 hr), respectively. These survivals are among the highest reported for non-spore forming Gram-negative bacteria. Comparative proteomics on these strains reveals that alkyl hydroperoxide reductase, ATP synthase, dihydrolipoamide dehydrogenase, and peptidyl-tRNA hydrolase also contribute to the hydrogen peroxide extremotolerance. Together, the survival and metabolic features of the spacecraft-associated Acinetobacter indicate that survival in the dry and low-nutrient environments of clean rooms is supported by factors such as oxidant degradation, energy management, and protein biosynthesis.

  7. Comparative genomic analysis of novel Acinetobacter symbionts: A combined systems biology and genomics approach.

    PubMed

    Gupta, Vipin; Haider, Shazia; Sood, Utkarsh; Gilbert, Jack A; Ramjee, Meenakshi; Forbes, Ken; Singh, Yogendra; Lopes, Bruno S; Lal, Rup

    2016-01-01

    The increasing trend of antibiotic resistance in Acinetobacter drastically limits the range of therapeutic agents required to treat multidrug resistant (MDR) infections. This study focused on analysis of novel Acinetobacter strains using a genomics and systems biology approach. Here we used a network theory method for pathogenic and non-pathogenic Acinetobacter spp. to identify the key regulatory proteins (hubs) in each strain. We identified nine key regulatory proteins, guaA, guaB, rpsB, rpsI, rpsL, rpsE, rpsC, rplM and trmD, which have functional roles as hubs in a hierarchical scale-free fractal protein-protein interaction network. Two key hubs (guaA and guaB) were important for insect-associated strains, and comparative analysis identified guaA as more important than guaB due to its role in effective module regulation. rpsI played a significant role in all the novel strains, while rplM was unique to sheep-associated strains. rpsM, rpsB and rpsI were involved in the regulation of overall network topology across all Acinetobacter strains analyzed in this study. Future analysis will investigate whether these hubs are useful as drug targets for treating Acinetobacter infections. PMID:27378055

  8. Resistance mechanism of Acinetobacter spp. strains resistant to DW-116, a new quinolone.

    PubMed

    Choi, K H; Baek, M C; Kim, B K; Choi, E C

    1998-06-01

    DW-116 is a new fluoroquinolone antimicrobial agent with a broad spectrum. In order to elucidate the resistance mechanism to DW-116 in Acinetobacter spp. bacteria, total chromosomal DNA was isolated from 10 strains of Acinetobacter spp. resistant to DW-116. Quinolone resistance determinant region (QRDR) of DNA gyrase gene was amplified by PCR. The 345 bp nucleotide fragment yielded was inserted into pKF 3 which was used as the vector. Comparisons of the DNA sequences of 8 strains with that of the wild type strain revealed a Ser-83 to Leu mutation in mutants and all ten strains contained one silent mutation(T-->G) in QRDR. From Acinetobacter MB4-8 strain, DNA gyrase was isolated and purified, through no-vobiocin-sepharose, heparin-sepharose affinity column chromatography. The enzyme was composed of two subunits and the molecular mass of subunits A and B were 75.6 and 51.9 kDa, respectively. The supercoiling activity of the reconstituted DNA gyrase composed of subunit A from Acinetobacter MB4-8 and subunit B from E. coli was not inhibited by 128 micrograms/ml of ciprofloxacin. It might be said that one of the resistance mechanisms to DW-116 in A-cinetobacter MB4-8 was subunit A alteration of DNA gyrase. PMID:9875449

  9. Comparative genomic analysis of novel Acinetobacter symbionts: A combined systems biology and genomics approach

    PubMed Central

    Gupta, Vipin; Haider, Shazia; Sood, Utkarsh; Gilbert, Jack A.; Ramjee, Meenakshi; Forbes, Ken; Singh, Yogendra; Lopes, Bruno S.; Lal, Rup

    2016-01-01

    The increasing trend of antibiotic resistance in Acinetobacter drastically limits the range of therapeutic agents required to treat multidrug resistant (MDR) infections. This study focused on analysis of novel Acinetobacter strains using a genomics and systems biology approach. Here we used a network theory method for pathogenic and non-pathogenic Acinetobacter spp. to identify the key regulatory proteins (hubs) in each strain. We identified nine key regulatory proteins, guaA, guaB, rpsB, rpsI, rpsL, rpsE, rpsC, rplM and trmD, which have functional roles as hubs in a hierarchical scale-free fractal protein-protein interaction network. Two key hubs (guaA and guaB) were important for insect-associated strains, and comparative analysis identified guaA as more important than guaB due to its role in effective module regulation. rpsI played a significant role in all the novel strains, while rplM was unique to sheep-associated strains. rpsM, rpsB and rpsI were involved in the regulation of overall network topology across all Acinetobacter strains analyzed in this study. Future analysis will investigate whether these hubs are useful as drug targets for treating Acinetobacter infections. PMID:27378055

  10. CarbAcineto NP Test for Rapid Detection of Carbapenemase-Producing Acinetobacter spp.

    PubMed Central

    Dortet, Laurent; Poirel, Laurent; Errera, Caroline

    2014-01-01

    Multidrug-resistant Acinetobacter baumannii isolates, particularly those that produce carbapenemases, are increasingly reported worldwide. The biochemically based Carba NP test, extensively validated for the detection of carbapenemase producers among Enterobacteriaceae and Pseudomonas spp., has been modified to detect carbapenemase production in Acinetobacter spp. A collection of 151 carbapenemase-producing and 69 non-carbapenemase-producing Acinetobacter spp. were tested using the Carba NP test and a modified Carba NP protocol (the CarbAcineto NP test) in this study. The CarbAcineto NP test requires modified lysis conditions and an increased bacterial inoculum compared to those of the original Carba NP test. The Carba NP test detects metallo-β-lactamase producers but failed to detect the production of other carbapenemase types among Acinetobacter spp. In contrast, the newly designed CarbAcineto NP test, which is rapid and reproducible, detects all types of carbapenemases with a sensitivity of 94.7% and a specificity of 100%. This cost-effective technique offers a reliable and affordable technique for identifying carbapenemase production in Acinetobacter spp., which is a marker of multidrug resistance in those species. Its use will facilitate the recognition of these carbapenemases and prevent their spread. PMID:24759709

  11. Place of Colistin-Rifampicin Association in the Treatment of Multidrug-Resistant Acinetobacter Baumannii Meningitis: A Case Study

    PubMed Central

    Souhail, Dahraoui; Bouchra, Belefquih; Belarj, Badia; Laila, Rar; Mohammed, Frikh; Nassirou, Oumarou Mamane; Azeddine, Ibrahimi; Haimeur, Charki; Lemnouer, Abdelhay; Elouennass, Mostafa

    2016-01-01

    Treatment of Acinetobacter baumannii meningitis is an important challenge due to the accumulation of resistance of this bacteria and low meningeal diffusion of several antimicrobial requiring use of an antimicrobial effective combination to eradicate these species. We report a case of Acinetobacter baumannii multidrug-resistant nosocomial meningitis which was successfully treated with intravenous and intrathecal colistin associated with rifampicin. PMID:27064923

  12. Draft Genome Sequence of Acinetobacter sp. Strain VT-511 Isolated from the Stomach of a Patient with Gastric Cancer

    PubMed Central

    Tetz, Victor

    2015-01-01

    We report the draft genome sequence of Acinetobacter sp. strain VT-511, which was obtained from the stomach of a patient with gastric cancer. The genome of Acinetobacter sp. VT-511 is composed of approximately 3,416,321 bp and includes 3,214 predicted protein-coding genes. PMID:26472843

  13. Antimicrobial resistance in Acinetobacter baumannii: From bench to bedside

    PubMed Central

    Lin, Ming-Feng; Lan, Chung-Yu

    2014-01-01

    Acinetobacter baumannii (A. baumannii) is undoubtedly one of the most successful pathogens in the modern healthcare system. With invasive procedures, antibiotic use and immunocompromised hosts increasing in recent years, A. baumannii has become endemic in hospitals due to its versatile genetic machinery, which allows it to quickly evolve resistance factors, and to its remarkable ability to tolerate harsh environments. Infections and outbreaks caused by multidrug-resistant A. baumannii (MDRAB) are prevalent and have been reported worldwide over the past twenty or more years. To address this problem effectively, knowledge of species identification, typing methods, clinical manifestations, risk factors, and virulence factors is essential. The global epidemiology of MDRAB is monitored by persistent surveillance programs. Because few effective antibiotics are available, clinicians often face serious challenges when treating patients with MDRAB. Therefore, a deep understanding of the resistance mechanisms used by MDRAB can shed light on two possible strategies to combat the dissemination of antimicrobial resistance: stringent infection control and antibiotic treatments, of which colistin-based combination therapy is the mainstream strategy. However, due to the current unsatisfying therapeutic outcomes, there is a great need to develop and evaluate the efficacy of new antibiotics and to understand the role of other potential alternatives, such as antimicrobial peptides, in the treatment of MDRAB infections. PMID:25516853

  14. Global evolution of multidrug-resistant Acinetobacter baumannii clonal lineages.

    PubMed

    Zarrilli, Raffaele; Pournaras, Spyros; Giannouli, Maria; Tsakris, Athanassios

    2013-01-01

    The rapid expansion of Acinetobacter baumannii clinical isolates exhibiting resistance to carbapenems and most or all available antibiotics during the last decade is a worrying evolution. The apparent predominance of a few successful multidrug-resistant lineages worldwide underlines the importance of elucidating the mode of spread and the epidemiology of A. baumannii isolates in single hospitals, at a country-wide level and on a global scale. The evolutionary advantage of the dominant clonal lineages relies on the capability of the A. baumannii pangenome to incorporate resistance determinants. In particular, the simultaneous presence of divergent strains of the international clone II and their increasing prevalence in international hospitals further support the ongoing adaptation of this lineage to the hospital environment. Indeed, genomic and genetic studies have elucidated the role of mobile genetic elements in the transfer of antibiotic resistance genes and substantiate the rate of genetic alterations associated with acquisition in A. baumannii of various resistance genes, including OXA- and metallo-β-lactamase-type carbapenemase genes. The significance of single nucleotide polymorphisms and transposon mutagenesis in the evolution of A. baumannii has been also documented. Establishment of a network of reference laboratories in different countries would generate a more complete picture and a fuller understanding of the importance of high-risk A. baumannii clones in the international dissemination of antibiotic resistance. PMID:23127486

  15. The structure of alanine racemase from Acinetobacter baumannii

    PubMed Central

    Davis, Emily; Scaletti-Hutchinson, Emma; Opel-Reading, Helen; Nakatani, Yoshio; Krause, Kurt L.

    2014-01-01

    Acinetobacter baumannii is an opportunistic Gram-negative bacterium which is a common cause of hospital-acquired infections. Numerous antibiotic-resistant strains exist, emphasizing the need for the development of new antimicrobials. Alanine racemase (Alr) is a pyridoxal 5′-phosphate dependent enzyme that is responsible for racemization between enantiomers of alanine. As d-alanine is an essential component of the bacterial cell wall, its inhibition is lethal to prokaryotes, making it an excellent antibiotic drug target. The crystal structure of A. baumannii alanine racemase (AlrAba) from the highly antibiotic-resistant NCTC13302 strain has been solved to 1.9 Å resolution. Comparison of AlrAba with alanine racemases from closely related bacteria demonstrates a conserved overall fold. The substrate entryway and active site of the enzymes were shown to be highly conserved. The structure of AlrAba will provide the template required for future structure-based drug-design studies. PMID:25195891

  16. [Emerging Acinetobacter baumannii infections and factors favouring their occurrence].

    PubMed

    Eveillard, M; Joly-Guillou, M-L

    2012-10-01

    During the last decade, Acinetobacter baumannii (AB) has been increasingly responsible for infections occurring in three particular contexts (in terms of patients and environment). Community AB pneumonia is severe infections, mainly described around the Indian Ocean, and which mainly concern patients with major co-morbidities. AB is also responsible for infections occurring among soldiers wounded in action during operations conducted in Iraq or Afghanistan. Lastly, this bacterium is responsible for infections occurring among casualties from natural disasters like earthquakes and tsunamis. Those infections are often due to multidrug-resistant strains, which can be implicated in nosocomial outbreaks when patients are hospitalized in a local casualty department or during their repatriation thereafter. The source of the contaminations which lead to AB infections following injuries (warfare or natural disasters) is still poorly known. Three hypotheses are usually considered: a contamination of wounds with environmental bacteria, a wound contamination from a previous cutaneous or oropharyngeal endogenous reservoir, or hospital acquisition. The implication of telluric or agricultural primary reservoirs in human AB infections is a common hypothesis which remains to be demonstrated by further specifically designed studies. PMID:21963271

  17. Stress Conditions Induced by Carvacrol and Cinnamaldehyde on Acinetobacter baumannii.

    PubMed

    Montagu, Angélique; Joly-Guillou, Marie-Laure; Rossines, Elisabeth; Cayon, Jérome; Kempf, Marie; Saulnier, Patrick

    2016-01-01

    Acinetobacter baumannii has emerged as a major cause of nosocomial infections. The ability of A. baumannii to display various resistance mechanisms against antibiotics has transformed it into a successful nosocomial pathogen. The limited number of antibiotics in development and the disengagement of the pharmaceutical industry have prompted the development of innovative strategies. One of these strategies is the use of essential oils, especially aromatic compounds that are potent antibacterial molecules. Among them, the combination of carvacrol and cinnamaldehyde has already demonstrated antibacterial efficacy against A. baumannii. The aim of this study was to determine the biological effects of these two compounds in A. baumannii, describing their effect on the rRNA and gene regulation under environmental stress conditions. Results demonstrated rRNA degradation by the carvacrol/cinnamaldehyde mixture, and this effect was due to carvacrol. Degradation was conserved after encapsulation of the mixture in lipid nanocapsules. Results showed an upregulation of the genes coding for heat shock proteins, such as groES, groEL, dnaK, clpB, and the catalase katE, after exposure to carvacrol/cinnamaldehyde mixture. The catalase was upregulated after carvacrol exposure wich is related to an oxidative stress. The combination of thiourea (hydroxyl radical scavenger) and carvacrol demonstrated a potent bactericidal effect. These results underline the development of defense strategies of the bacteria by synthesis of reactive oxygen species in response to environmental stress conditions, such as carvacrol. PMID:27486453

  18. Stress Conditions Induced by Carvacrol and Cinnamaldehyde on Acinetobacter baumannii

    PubMed Central

    Montagu, Angélique; Joly-Guillou, Marie-Laure; Rossines, Elisabeth; Cayon, Jérome; Kempf, Marie; Saulnier, Patrick

    2016-01-01

    Acinetobacter baumannii has emerged as a major cause of nosocomial infections. The ability of A. baumannii to display various resistance mechanisms against antibiotics has transformed it into a successful nosocomial pathogen. The limited number of antibiotics in development and the disengagement of the pharmaceutical industry have prompted the development of innovative strategies. One of these strategies is the use of essential oils, especially aromatic compounds that are potent antibacterial molecules. Among them, the combination of carvacrol and cinnamaldehyde has already demonstrated antibacterial efficacy against A. baumannii. The aim of this study was to determine the biological effects of these two compounds in A. baumannii, describing their effect on the rRNA and gene regulation under environmental stress conditions. Results demonstrated rRNA degradation by the carvacrol/cinnamaldehyde mixture, and this effect was due to carvacrol. Degradation was conserved after encapsulation of the mixture in lipid nanocapsules. Results showed an upregulation of the genes coding for heat shock proteins, such as groES, groEL, dnaK, clpB, and the catalase katE, after exposure to carvacrol/cinnamaldehyde mixture. The catalase was upregulated after carvacrol exposure wich is related to an oxidative stress. The combination of thiourea (hydroxyl radical scavenger) and carvacrol demonstrated a potent bactericidal effect. These results underline the development of defense strategies of the bacteria by synthesis of reactive oxygen species in response to environmental stress conditions, such as carvacrol. PMID:27486453

  19. Host resistance to intranasal Acinetobacter baumannii reinfection in mice.

    PubMed

    Qiu, Hongyu; Li, Zack; KuoLee, Rhonda; Harris, Greg; Gao, Xiaoling; Yan, Hongbin; Xu, H Howard; Chen, Wangxue

    2016-07-01

    Acinetobacter baumannii is a major causative agent of healthcare-associated infection and develops multidrug resistance rapidly. However, little is known in the host defense mechanisms against this infection. In this study, we examined if mice recovered from a previous intranasal A. baumannii infection (recovered mice) are fully protected against a subsequent reinfection. We found that, despite the presence of specific serum IgG and mucosal IgA responses prior to the reinfection, the recovered mice were only marginally better protected against intranasal challenge with low doses of homologous or heterologous A. baumannii strains than the naïve mice. Post-challenge immune and inflammatory (cells and cytokines) responses were generally comparable between recovered and naïve mice although the recovered mice produced significantly higher amounts of IFN-γ and IL-17 and had higher percentages and numbers of resident lung CD44(hi)CD62L(-)CD4(+) and CD19(+) B lymphocytes. Taken together, our results suggest that mice recovered from a previous A. baumannii infection remain susceptible to reinfection, indicating the complexity of immune protection mechanism for this Gram-negative, multidrug-resistant emerging pathogen. PMID:27194730

  20. Pregnancy and Perinatal Outcomes Associated with Acinetobacter baumannii Infection.

    PubMed

    He, Mai; Kostadinov, Stefan; Gundogan, Fusun; Struminsky, Judith; Pinar, Halit; Sung, C James

    2013-05-01

    Objective To determine perinatal and pregnancy outcomes of Acinetobacter baumannii infection using clinicopathologic material from pregnant women, neonates, and perinatal postmortem examinations with positive cultures. Study Design This is a retrospective record review with placental and postmortem examination. Results During a 5-year period, 40 positive cultures were found. Three pregnancies with positive cultures close in the peripartum period were all associated with adverse outcomes including spontaneous abortion, preterm labor, and one full-term birth with histological chorioamnionitis. Two positive cultures were found in preterm neonates in the neonatal intensive care unit. Two of three cases of perinatal death grew pure cultures from blood and/or fetal tissue with placental or fetal examination demonstrating evidence of infection/inflammation with fetal inflammatory response. Conclusion This is the first case series report of A. baumannii-positive cultures in maternal, fetal, and neonatal specimen, with histopathologic evidence of infection. The results suggest a significant role of A. baumannii infection in adverse pregnancy and perinatal outcomes. PMID:23943711

  1. Pregnancy and Perinatal Outcomes Associated with Acinetobacter baumannii Infection

    PubMed Central

    He, Mai; Kostadinov, Stefan; Gundogan, Fusun; Struminsky, Judith; Pinar, Halit; Sung, C. James

    2013-01-01

    Objective To determine perinatal and pregnancy outcomes of Acinetobacter baumannii infection using clinicopathologic material from pregnant women, neonates, and perinatal postmortem examinations with positive cultures. Study Design This is a retrospective record review with placental and postmortem examination. Results During a 5-year period, 40 positive cultures were found. Three pregnancies with positive cultures close in the peripartum period were all associated with adverse outcomes including spontaneous abortion, preterm labor, and one full-term birth with histological chorioamnionitis. Two positive cultures were found in preterm neonates in the neonatal intensive care unit. Two of three cases of perinatal death grew pure cultures from blood and/or fetal tissue with placental or fetal examination demonstrating evidence of infection/inflammation with fetal inflammatory response. Conclusion This is the first case series report of A. baumannii-positive cultures in maternal, fetal, and neonatal specimen, with histopathologic evidence of infection. The results suggest a significant role of A. baumannii infection in adverse pregnancy and perinatal outcomes. PMID:23943711

  2. Acinetobacter baumannii: evolution of antimicrobial resistance-treatment options.

    PubMed

    Doi, Yohei; Murray, Gerald L; Peleg, Anton Y

    2015-02-01

    The first decade of the 20th century witnessed a surge in the incidence of infections due to several highly antimicrobial-resistant bacteria in hospitals worldwide. Acinetobacter baumannii is one such organism that turned from an occasional respiratory pathogen into a major nosocomial pathogen. An increasing number of A. baumannii genome sequences have broadened our understanding of the genetic makeup of these bacteria and highlighted the extent of horizontal transfer of DNA. Animal models of disease combined with bacterial mutagenesis have provided some valuable insights into mechanisms of A. baumannii pathogenesis. Bacterial factors known to be important for disease include outer membrane porins, surface structures including capsule and lipopolysaccharide, enzymes such as phospholipase D, iron acquisition systems, and regulatory proteins. A. baumannii has a propensity to accumulate resistance to various groups of antimicrobial agents. In particular, carbapenem resistance has become commonplace, accounting for the majority of A. baumannii strains in many hospitals today. Carbapenem-resistant strains are often resistant to all other routinely tested agents. Treatment of carbapenem-resistant A. baumannii infection therefore involves the use of combinations of last resort agents such as colistin and tigecycline, but the efficacy and safety of these approaches are yet to be defined. Antimicrobial-resistant A. baumannii has high potential to spread among ill patients in intensive care units. Early recognition and timely implementation of appropriate infection control measures is crucial in preventing outbreaks. PMID:25643273

  3. Acinetobacter baumannii: Evolution of Antimicrobial Resistance—Treatment Options

    PubMed Central

    Doi, Yohei; Murray, Gerald L.; Peleg, Anton Y.

    2015-01-01

    The first decade of the 20th century witnessed a surge in the incidence of infections due to several highly antimicrobial-resistant bacteria in hospitals worldwide. Acinetobacter baumannii is one such organism that turned from an occasional respiratory pathogen into a major nosocomial pathogen. An increasing number of A. baumannii genome sequences have broadened our understanding of the genetic makeup of these bacteria and highlighted the extent of horizontal transfer of DNA. Animal models of disease combined with bacterial mutagenesis have provided some valuable insights into mechanisms of A. baumannii pathogenesis. Bacterial factors known to be important for disease include outer membrane porins, surface structures including capsule and lipopolysaccharide, enzymes such as phospholipase D, iron acquisition systems, and regulatory proteins. A. baumannii has a propensity to accumulate resistance to various groups of antimicrobial agents. In particular, carbapenem resistance has become commonplace, accounting for the majority of A. baumannii strains in many hospitals today. Carbapenem-resistant strains are often resistant to all other routinely tested agents. Treatment of carbapenem-resistant A. baumannii infection therefore involves the use of combinations of last resort agents such as colistin and tigecycline, but the efficacy and safety of these approaches are yet to be defined. Antimicrobial-resistant A. baumannii has high potential to spread among ill patients in intensive care units. Early recognition and timely implementation of appropriate infection control measures is crucial in preventing outbreaks. PMID:25643273

  4. Evaluation of Parameters for High Efficiency Transformation of Acinetobacter baumannii

    PubMed Central

    Yildirim, Suleyman; Thompson, Mitchell G.; Jacobs, Anna C.; Zurawski, Daniel V.; Kirkup, Benjamin C.

    2016-01-01

    Acinetobacter baumannii is an emerging, nosocomial pathogen that is poorly characterized due to a paucity of genetic tools and methods. While whole genome sequence data from several epidemic and environmental strains have recently become available, the functional characterization of genes is significantly lagging. Efficient transformation is one of the first steps to develop molecular tools that can be used to address these shortcomings. Here we report parameters allowing high efficiency transformation of A. baumannii. Using a multi-factorial experimental design we found that growth phase, voltage, and resistance all significantly contribute to transformation efficiency. The highest efficiency (4.3 × 108 Transformants/μg DNA) was obtained at the stationary growth phase of the bacterium (OD 6.0) using 25 ng of plasmid DNA under 100 Ohms resistance and 1.7 kV/cm voltage. The optimized electroporation parameters reported here provide a useful tool for genetic manipulation of A. baumannii. PMID:26911658

  5. [Susceptibility to antibiotics and biochemical activity of strains of Acinetobacter sp. isolated from various sources].

    PubMed

    Gospodarek, E

    1993-01-01

    The study was performed on 576 Acinetobacter strains isolated from clinical material, objects from hospital, environment, soil, water and from animals. Applying API 20NE system identification was following: A. baumanii (61.1%), A. junii (19.4%), A. haemolyticus (4.3%), A. lwoffii (3.3%), A. johnsonii (0.52%) and not belonging to above genus strains (11.3%). Over 47% strains of Acinetobacter were isolated from clinical material as the only bacteria (mainly from samples received from intensive care units and surgical and urological wards). Out of 23 antibiotics and antimicrobials used for investigation of 535 strains of Acinetobacter, most active were imipenem (99%) of susceptible strains, ofloxacin and ciprofloxacin (95%) and netilmicin (88%). Multiple resistant strains were isolated more frequently from hospital environment than from other sources--these were mostly A. baumanii and A. junii. PMID:8189806

  6. Detection of aac(6')-I genes in amikacin-resistant Acinetobacter spp. by PCR.

    PubMed Central

    Ploy, M C; Giamarellou, H; Bourlioux, P; Courvalin, P; Lambert, T

    1994-01-01

    The distribution of aac(6')-I genes in 62 strains of Acinetobacter spp. resistant to amikacin, netilmicin, and tobramycin and susceptible to gentamicin, a phenotype compatible with synthesis of an AAC(6')-I enzyme, was studied by PCR and by DNA hybridization. Both methods gave similar results. Among the 51 Acinetobacter baumannii strains, aac(6')-Ib was found in 19 isolates and aac(6')-Ih was found in the remaining strains. The aac(6')-Ig gene was present in all 10 A. haemolyticus strains studied and was detected only in this species. A pair of degenerate oligonucleotides complementary to conserved regions of aac(6')-Ic, -Id, -If, -Ig, and -Ih enabled detection of these genes and also of aac(6')-Ij, recently recognized in Acinetobacter sp. strain 13. Images PMID:7695286

  7. Acinetobacter Infections and Outcomes at an Academic Medical Center: A Disease of Long-Term Care

    PubMed Central

    Townsend, Jennifer; Park, An Na; Gander, Rita; Orr, Kathleen; Arocha, Doramarie; Zhang, Song; Greenberg, David E.

    2015-01-01

    Background. Our study aims to describe the epidemiology, microbial resistance patterns, and clinical outcomes of Acinetobacter infections at an academic university hospital. This retrospective study analyzed all inpatient clinical isolates of Acinetobacter collected at an academic medical center over 4 years. The data were obtained from an Academic tertiary referral center between January 2008 and December 2011. All consecutive inpatients during the study period who had a clinical culture positive for Acinetobacter were included in the study. Patients without medical records available for review or less than 18 years of age were excluded. Methods. Records were reviewed to determine source of isolation, risk factors for acquisition, drug resistance patterns, and clinical outcomes. Repetitive sequence-based polymerase chain reaction of selected banked isolates was used to determine patterns of clonal spread in and among institutions during periods of higher infection rates. Results. Four hundred eighty-seven clinical isolates of Acinetobacter were found in 212 patients (in 252 admissions). Patients with Acinetobacter infections were frequently admitted from healthcare facilities (HCFs) (59%). One hundred eighty-three of 248 (76%) initial isolates tested were resistant to meropenem. One hundred ninety-eight of 249 (79.5%) initial isolates were multidrug resistant (MDR). Factors associated with mortality included bacteremia (odds ratio [OR] = 1.93, P = .024), concomitant steroid use (OR = 2.87, P < .001), admission from a HCF (OR = 6.34, P = .004), and chronic obstructive pulmonary disease (OR = 3.17, P < .001). Conclusions. Acinetobacter isolates at our institution are frequently MDR and are more common among those who reside in HCFs. Our findings underline the need for new strategies to prevent and treat this pathogen, including stewardship efforts in long-term care settings. PMID:26034772

  8. Analysis on distribution features and drug resistance of clinically isolated Acinetobacter baumannii

    PubMed Central

    Ren, Guangming; Zhou, Min; Ding, Ning; Zhou, Ning; Li, Qingling

    2016-01-01

    The aim of the present study was to examine the clinical distribution and drug resistance of Acinetobacter baumannii infection, and provide evidence of clinical medication as well as the prophylaxis for the treatment of drug resistance bacteria. In total, 306 Acinetobacter baumanniis selected from routine culture were collected between January 2012 and December 2013, to analyze the distributions among clinical specimens and wards and their drug resistance state. Of the 306 Acinetobacter baumanniis, the main distribution of specimens was sputum, accounting for 77.78%. The distribution of administrative office was dominated by intensive care unit with a proportion of 40.0% in 2012, which rapidly increased to 60.9% in 2013, followed by neurosurgery, respiration medicine and orthopedics with proportions of 23, 12 and 9.0% in 2012 and 9.71, 8.74 and 3.88% in 2013, respectively. The Acinetobacter baumannii's drug resistance rate of Tazobactam and Piperacillin was increased from 68.0% in 2012 to 71.36% in 2013. At the same time, the drug resistance rate of imipenem was enhanced from 66.0% in 2012 to 72.81% in 2013. By 2013, the drug resistance rates of penbritin, ceftizoxime, cefotetan and macrodantin reached ≤100%. In conclusion, Acinetobacter baumannii mainly causes respiratory tract infection with severe drug resistance. The drug resistance of Acinetobacter baumannii was mainly manifested as multidrug resistance or even pan-drug resistance with an obvious increasing trend of tolerance. Thus, it is necessary to prevent and treat nosocomial infection, to minimize usage of antibiotics and to standardize medical operating, to reduce the increase in persistence. PMID:27602085

  9. Prognostic differences between VAP from Acinetobacter baumanii and VAP from other microorganisms.

    PubMed

    Di Bonito, Marianna; Caiazzo, Simona; Iannazzone, Marta; Miccichè, Viviana; De Marco, Giuseppe; De Robertis, Edoardo; Tufano, Rosalba; Piazza, Ornella

    2012-05-01

    Nosocomial infection, in particular pneumonia, is an important risk factor for hospital mortality and morbidity. Acinetobacter baumanii is a common multi-resistant microorganism responsible of Ventilator Associated Pneumonia (VAP). Currently Colistin is a rescue therapy for this pathogen. The purpose of this retrospective study is to compare the outcome of VAP caused by Acinetobacter baumanii and VAP from other microorganisms in critical patients. Comorbidity, prognostic scores, mortality and eradication frequency did not turn out significantly different between the two study groups. Colistin safety was tested. PMID:23905048

  10. Prognostic differences between VAP from Acinetobacter baumanii and VAP from other microorganisms

    PubMed Central

    Di Bonito, Marianna; Caiazzo, Simona; Iannazzone, Marta; Miccichè, Viviana; De Marco, Giuseppe; De Robertis, Edoardo; Tufano, Rosalba; Piazza, Ornella

    2012-01-01

    Nosocomial infection, in particular pneumonia, is an important risk factor for hospital mortality and morbidity. Acinetobacter baumanii is a common multi-resistant microorganism responsible of Ventilator Associated Pneumonia (VAP). Currently Colistin is a rescue therapy for this pathogen. The purpose of this retrospective study is to compare the outcome of VAP caused by Acinetobacter baumanii and VAP from other microorganisms in critical patients. Comorbidity, prognostic scores, mortality and eradication frequency did not turn out significantly different between the two study groups. Colistin safety was tested. PMID:23905048

  11. Comparative Genomics of Multidrug Resistance in Acinetobacter baumannii

    PubMed Central

    2006-01-01

    Acinetobacter baumannii is a species of nonfermentative gram-negative bacteria commonly found in water and soil. This organism was susceptible to most antibiotics in the 1970s. It has now become a major cause of hospital-acquired infections worldwide due to its remarkable propensity to rapidly acquire resistance determinants to a wide range of antibacterial agents. Here we use a comparative genomic approach to identify the complete repertoire of resistance genes exhibited by the multidrug-resistant A. baumannii strain AYE, which is epidemic in France, as well as to investigate the mechanisms of their acquisition by comparison with the fully susceptible A. baumannii strain SDF, which is associated with human body lice. The assembly of the whole shotgun genome sequences of the strains AYE and SDF gave an estimated size of 3.9 and 3.2 Mb, respectively. A. baumannii strain AYE exhibits an 86-kb genomic region termed a resistance island—the largest identified to date—in which 45 resistance genes are clustered. At the homologous location, the SDF strain exhibits a 20 kb-genomic island flanked by transposases but devoid of resistance markers. Such a switching genomic structure might be a hotspot that could explain the rapid acquisition of resistance markers under antimicrobial pressure. Sequence similarity and phylogenetic analyses confirm that most of the resistance genes found in the A. baumannii strain AYE have been recently acquired from bacteria of the genera Pseudomonas, Salmonella, or Escherichia. This study also resulted in the discovery of 19 new putative resistance genes. Whole-genome sequencing appears to be a fast and efficient approach to the exhaustive identification of resistance genes in epidemic infectious agents of clinical significance. PMID:16415984

  12. Photodynamic therapy for Acinetobacter baumannii burn infections in mice.

    PubMed

    Dai, Tianhong; Tegos, George P; Lu, Zongshun; Huang, Liyi; Zhiyentayev, Timur; Franklin, Michael J; Baer, David G; Hamblin, Michael R

    2009-09-01

    Multidrug-resistant Acinetobacter baumannii infections represent a growing problem, especially in traumatic wounds and burns suffered by military personnel injured in Middle Eastern conflicts. Effective treatment with traditional antibiotics can be extremely difficult, and new antimicrobial approaches are being investigated. One of these alternatives to antimicrobials could be the combination of nontoxic photosensitizers (PSs) and visible light, known as photodynamic therapy (PDT). We report on the establishment of a new mouse model of full-thickness thermal burns infected with a bioluminescent derivative of a clinical Iraqi isolate of A. baumannii and its PDT treatment by topical application of a PS produced by the covalent conjugation of chlorin(e6) to polyethylenimine, followed by illumination of the burn surface with red light. Application of 10(8) A. baumannii cells to the surface of 10-s burns made on the dorsal surface of shaved female BALB/c mice led to chronic infections that lasted, on average, 22 days and that were characterized by a remarkably stable bacterial bioluminescence. PDT carried out on day 0 soon after application of the bacteria gave over 3 log units of loss of bacterial luminescence in a light exposure-dependent manner, while PDT carried out on day 1 and day 2 gave an approximately 1.7-log reduction. The application of PS dissolved in 10% or 20% dimethyl sulfoxide without light gave only a modest reduction in the bacterial luminescence from mouse burns. Some bacterial regrowth in the treated burn was observed but was generally modest. It was also found that PDT did not lead to the inhibition of wound healing. The data suggest that PDT may be an effective new treatment for multidrug-resistant localized A. baumannii infections. PMID:19564369

  13. Inverse PCR for subtyping of Acinetobacter baumannii carrying ISAba1.

    PubMed

    Kim, Shukho; Park, Yun-Ju; Kim, Jungmin

    2016-05-01

    Acinetobacter baumannii has been prevalent in nosocomial infections, often causing outbreaks in intensive care units. ISAba1 is an insertion sequence that has been identified only in A. baumannii and its copy number varies among strains. It has been reported that ISAba1 provides a promoter for bla OXA-51-like, bla OXA-23-like, and bla ampC, which are associated with the resistance of A. baumannii to carbapenems and cephalosporins. The main purpose of this study was to develop a novel inverse PCR method capable of typing A. baumannii strains. The method involves three major steps: cutting of genomic DNA with a restriction enzyme, ligation, and PCR. In the first step, bacterial genomic DNA was digested with DpnI. In the second step, the digested genomic DNAs were ligated to form intramolecular circular DNAs. In the last step, the ligated circular DNAs were amplified by PCR with primers specific for ISAba1 and the amplified PCR products were electrophoresed. Twenty-two clinical isolates of A. baumannii were used for the evaluation of the inverse PCR (iPCR) typing method. Dendrogram analysis revealed two major clusters, similar to pulsed-field gel electrophoresis (PFGE) results. Three ISAba1-associated genes - bla ampC, bla OXA-66-like, and csuD - were amplified and detected in the clinical isolates. This novel iPCR typing method is comparable to PFGE in its ability to discriminate A. baumannii strains, and is a promising molecular epidemiological tool for investigating A. baumannii carrying ISAba1. PMID:27095456

  14. Virstatin inhibits biofilm formation and motility of Acinetobacter baumannii

    PubMed Central

    2014-01-01

    Background Acinetobacter baumannii has emerged as an opportunistic nosocomial pathogen causing infections worldwide. One reason for this emergence is due to its natural ability to survive in the hospital environment, which may be explained by its capacity to form biofilms. Cell surface appendages are important determinants of the A. baumannii biofilm formation and as such constitute interesting targets to prevent the development of biofilm-related infections. A chemical agent called virstatin was recently described to impair the virulence of Vibrio cholerae by preventing the expression of its virulence factor, the toxin coregulated pilus (type IV pilus). The objective of this work was to investigate the potential effect of virstatin on A. baumannii biofilms. Results After a dose–response experiment, we determined that 100 μM virstatin led to an important decrease (38%) of biofilms formed by A. baumannii ATCC17978 grown under static mode. We demonstrated that the production of biofilms grown under dynamic mode was also delayed and reduced. The biofilm susceptibility to virstatin was then tested for 40 clinical and reference A. baumannii strains. 70% of the strains were susceptible to virstatin (with a decrease of 10 to 65%) when biofilms grew in static mode, whereas 60% of strains respond to the treatment when their biofilms grew in dynamic mode. As expected, motility and atomic force microscopy experiments showed that virstatin acts on the A. baumannii pili biogenesis. Conclusions By its action on pili biogenesis, virstatin demonstrated a very promising antibiofilm activity affecting more than 70% of the A. baumannii clinical isolates. PMID:24621315

  15. Assessment of Minocycline and Polymyxin B Combination against Acinetobacter baumannii

    PubMed Central

    Bowers, Dana R.; Cao, Henry; Zhou, Jian; Ledesma, Kimberly R.; Sun, Dongxu; Lomovskaya, Olga

    2015-01-01

    Antimicrobial resistance among Acinetobacter baumannii is increasing worldwide, often necessitating combination therapy. The clinical utility of using minocycline with polymyxin B is not well established. In this study, we investigated the activity of minocycline and polymyxin B against 1 laboratory isolate and 3 clinical isolates of A. baumannii. Minocycline susceptibility testing was performed with and without an efflux pump inhibitor, phenylalanine-arginine β-naphthylamide (PAβN). The intracellular minocycline concentration was determined with and without polymyxin B (0.5 μg/ml). Time-kill studies were performed over 24 h using approximately 106 CFU/ml of each strain with clinically relevant minocycline concentrations (2 μg/ml and 8 μg/ml), with and without polymyxin B (0.5 μg/ml). The in vivo efficacy of the combination was assessed in a neutropenic murine pneumonia model. Infected animals were administered minocycline (50 mg/kg), polymyxin B (10 mg/kg), or both to achieve clinically equivalent exposures in humans. A reduction in the minocycline MIC (≥4×) was observed in the presence of PAβN. The intracellular concentration and in vitro bactericidal effect of minocycline were both enhanced by polymyxin B. With 2 minocycline-susceptible strains, the bacterial burden in lung tissue at 24 h was considerably reduced by the combination compared to monotherapy with minocycline or polymyxin B. In addition, the combination prolonged survival of animals infected with a minocycline-susceptible strain. Polymyxin B increased the intracellular concentration of minocycline in bacterial cells and enhanced the bactericidal activity of minocycline, presumably due to efflux pump disruption. The clinical utility of this combination should be further investigated. PMID:25712362

  16. Prevalence of hypermutators among clinical Acinetobacter baumannii isolates

    PubMed Central

    Komp Lindgren, Patricia; Higgins, Paul G.; Seifert, Harald; Cars, Otto

    2016-01-01

    Objectives The objectives of this study were to study the presence of mutators in a set of Acinetobacter baumannii isolates and to explore whether there is a correlation between mutation rates and antibiotic resistance. Methods The variation in mutation rate was evaluated for 237 clinical A. baumannii isolates by determining the frequency of their mutation to rifampicin resistance. For each isolate, the antibiotic resistance profile was determined by disc diffusion and/or Etest. Isolates were divided into susceptible, resistant and MDR groups according to their resistance to five groups of different antibiotics. A comparison between differences in mutation frequency (f) and strain-specific factors was performed. Results Of the 237 isolates 32%, 18% and 50% were classified as susceptible, resistant and MDR, respectively. The f of rifampicin resistance varied between 2.2 × 10−10 and 1.2 × 10−6. Of the strains under investigation, 16% had an ≥2.5- to 166-fold higher f. The presence of mutators (definition ≥2.5-fold increase in f compared with ATCC 19606) in the MDR group (22%) was significantly higher (P < 0.05) than that in the susceptible and resistant groups (11% and 7%, respectively). Furthermore, f was significantly higher in the MDR group compared with that in the susceptible and resistant groups. Conclusions The facts that 26 of 37 mutator isolates (70%) in the population were MDR and that there was a significantly higher general f in isolates exhibiting an MDR profile suggest that hypermutability can be of advantage for the organism in a selective environment with extensive exposure to antimicrobials. PMID:26660878

  17. The rise of carbapenem-resistant Acinetobacter baumannii.

    PubMed

    Evans, Benjamin A; Hamouda, Ahmed; Amyes, Sebastian G B

    2013-01-01

    Acinetobacter spp. are Gram-negative bacteria that have become one of the most difficult pathogens to treat. The species A. baumannii, largely unknown 30 years ago, has risen to prominence particularly because of its ability to cause infections in immunocompromised patients. It is now a predominant pathogen in many hospitals as it has acquired resistance genes to virtually all antibiotics capable of treating Gram-negative bacteria, including the fluoroquinolones and the cephalosporins. Some members of the species have accumulated these resistance genes in large resistance islands, located in a "hot-spot" within the bacterial chromosome. The only conventional remaining treatment options were the carbapenems. However, A. baumannii possesses an inherent class D β-lactamase gene (blaOXA-51-like) that can have the ability to confer carbapenem resistance. Additionally, mechanisms of carbapenem resistance have emerged that derive from the importation of the distantly related class D β-lactamase genes blaOXA-23 and blaOXA-58. Although not inducible, the expression of these genes is controlled by mobile promoters carried on ISAba elements. It has also been found that other resistance genes including the chromosomal class C β-lactamase genes conferring cephalosporin resistance are controlled in the same manner. Colistin is now considered to be the final drug capable of treating infections caused by carbapenem-resistant A. baumannii; however, strains are now being isolated that are resistant to this antibiotic as well. The increasing inability to treat infections caused by A. baumannii ensures that this pathogen more than ranks with MRSA or Clostridium difficile as a threat to modern medicine. PMID:22894617

  18. Epidemiologic and Clinical Impact of Acinetobacter baumannii Colonization and Infection

    PubMed Central

    Villar, Macarena; Cano, María E.; Gato, Eva; Garnacho-Montero, José; Miguel Cisneros, José; Ruíz de Alegría, Carlos; Fernández-Cuenca, Felipe; Martínez-Martínez, Luis; Vila, Jordi; Pascual, Alvaro; Tomás, María; Bou, Germán; Rodríguez-Baño, Jesús

    2014-01-01

    Abstract Acinetobacter baumannii is one of the most important antibiotic-resistant nosocomial bacteria. We investigated changes in the clinical and molecular epidemiology of A. baumannii over a 10-year period. We compared the data from 2 prospective multicenter cohort studies in Spain, one performed in 2000 (183 patients) and one in 2010 (246 patients), which included consecutive patients infected or colonized by A. baumannii. Molecular typing was performed by repetitive extragenic palindromic polymerase chain reaction (REP-PCR), pulsed-field gel electrophoresis (PFGE), and multilocus sequence typing (MLST). The incidence density of A. baumannii colonization or infection increased significantly from 0.14 in 2000 to 0.52 in 2010 in medical services (p < 0.001). The number of non-nosocomial health care-associated cases increased from 1.2% to 14.2%, respectively (p < 0.001). Previous exposure to carbapenems increased in 2010 (16.9% in 2000 vs 27.3% in 2010, p = 0.03). The drugs most frequently used for definitive treatment of patients with infections were carbapenems in 2000 (45%) and colistin in 2010 (50.3%). There was molecular-typing evidence of an increase in the frequency of A. baumannii acquisition in non-intensive care unit wards in 2010 (7.6% in 2000 vs 19.2% in 2010, p = 0.01). By MSLT, the ST2 clonal group predominated and increased in 2010. This epidemic clonal group was more frequently resistant to imipenem and was associated with an increased risk of sepsis, although not with severe sepsis or mortality. Some significant changes were noted in the epidemiology of A. baumannii, which is increasingly affecting patients admitted to conventional wards and is also the cause of non-nosocomial health care-associated infections. Epidemic clones seem to combine antimicrobial resistance and the ability to spread, while maintaining their clinical virulence. PMID:25181313

  19. Rapid identification of Acinetobacter spp. by fluorescence in situ hybridization (FISH) from colony and blood culture material

    PubMed Central

    Essig, A.; Hagen, R. M.; Riecker, M.; Jerke, K.; Ellison, D.; Poppert, S.

    2011-01-01

    Multi-drug-resistant strains of the Acinetobacter baumannii complex cause nosocomial infections. Rapid identification of Acinetobacter spp. is desirable in order to facilitate therapeutic or hygiene decisions. We evaluated a newly designed DNA probe that can be used under standard conditions in both a microwave oven and a slide chamber for the rapid identification of Acinetobacter spp. by fluorescence in situ hybridization (FISH). Using FISH, the new probe correctly identified 81/81 Acinetobacter spp. isolates and excluded 109/109 tested non-target organisms from agar culture. Furthermore, the new probe correctly identified 7/7 Acinetobacter spp. in 214 blood cultures determined to contain Gram-negative bacteria by Gram staining. Using either the microwave oven or slide chamber technique, the new probe was able to identify Acinetobacter spp. in 100% of the samples tested. FISH used in conjunction with our newly designed probe provides an easy, cheap, precise, and rapid method for the preliminary identification of Acinetobacter spp., especially in laboratories where more sophisticated methods like matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF-MS) are not available. PMID:24516735

  20. Occurrence of an Environmental Acinetobacter baumannii Strain Similar to a Clinical Isolate in Paleosol from Croatia

    PubMed Central

    Durn, Goran; Goic-Barisic, Ivana; Kovacic, Ana

    2014-01-01

    Over the past decade, bacteria of the genus Acinetobacter have emerged as a leading cause of hospital-acquired infections. Outbreaks of Acinetobacter infections are considered to be caused exclusively by contamination and transmission in hospital environments. The natural habitats of clinically important multiresistant Acinetobacter spp. remain to be defined. In this paper, we report an incidental finding of a viable multidrug-resistant strain of Acinetobacter baumannii, related to clinical isolates, in acid paleosol from Croatia. The environmental isolate of A. baumannii showed 87% similarity to a clinical isolate originating from a hospital in this geographic area and was resistant to gentamicin, trimethoprim-sulfamethoxazole, ciprofloxacin, and levofloxacin. In paleosol, the isolate was able to survive a low pH (3.37), desiccation, and a high temperature (50°C). The probable source of A. baumannii in paleosol is illegally disposed waste of external origin situated in the abandoned quarry near the sampling site. The bacteria could have been leached from waste by storm water and thus infiltrated the paleosol. PMID:24584245

  1. First Genome Sequence of a Mexican Multidrug-Resistant Acinetobacter baumannii Isolate

    PubMed Central

    Graña-Miraglia, Lucía; Lozano, Luis; Castro-Jaimes, Semiramis; Cevallos, Miguel A.; Volkow, Patricia

    2016-01-01

    Acinetobacter baumannii has emerged as an important nosocomial pathogen worldwide. Here, we present the draft genome of the first multidrug-resistant A. baumannii isolate, sampled from a tertiary hospital in Mexico City. This genome will provide a starting point for studying the genomic diversity of this species in Mexico. PMID:27013043

  2. Is Aerosalization a Problem With Carbapenem-Resistant Acinetobacter baumannii in Thailand Hospital?

    PubMed Central

    Apisarnthanarak, Anucha; Tantajina, Ploenpit; Laovachirasuwan, Pornpimol; Weber, David J.; Singh, Nalini

    2016-01-01

    We evaluated the presence of air contamination with carbapenem-resistant Acinetobacter baumannii (CRAB) in medical units where patients with CRAB pneumonia were hospitalized, and in Obstetrics and Gynecology units with open-air ventilation in-patient settings. There was no evidence of CRAB contamination in either of the units. PMID:27419187

  3. Is Aerosalization a Problem With Carbapenem-Resistant Acinetobacter baumannii in Thailand Hospital?

    PubMed

    Apisarnthanarak, Anucha; Tantajina, Ploenpit; Laovachirasuwan, Pornpimol; Weber, David J; Singh, Nalini

    2016-09-01

    We evaluated the presence of air contamination with carbapenem-resistant Acinetobacter baumannii (CRAB) in medical units where patients with CRAB pneumonia were hospitalized, and in Obstetrics and Gynecology units with open-air ventilation in-patient settings. There was no evidence of CRAB contamination in either of the units. PMID:27419187

  4. Molecular epidemiology of Acinetobacter baumannii in central intensive care unit in Kosova Teaching Hospital.

    PubMed

    Raka, Lul; Kalenć, Smilja; Bosnjak, Zrinka; Budimir, Ana; Katić, Stjepan; Sijak, Dubravko; Mulliqi-Osmani, Gjyle; Zoutman, Dick; Jaka, Arbëresha

    2009-12-01

    Infections caused by bacteria of genus Acinetobacter pose a significant health care challenge worldwide. Information on molecular epidemiological investigation of outbreaks caused by Acinetobacter species in Kosova is lacking. The present investigation was carried out to enlight molecular epidemiology of Acinetobacter baumannii in the Central Intensive Care Unit (CICU) of a University hospital in Kosova using pulse field gel electrophoresis (PFGE). During March - July 2006, A. baumannii was isolated from 30 patients, of whom 22 were infected and 8 were colonised. Twenty patients had ventilator-associated pneumonia, one patient had meningitis, and two had coinfection with bloodstream infection and surgical site infection. The most common diagnoses upon admission to the ICU were politrauma and cerebral hemorrhage. Bacterial isolates were most frequently recovered from endotracheal aspirate (86.7%). First isolation occurred, on average, on day 8 following admission (range 1-26 days). Genotype analysis of A. baumannii isolates identified nine distinct PFGE patterns, with predominance of PFGE clone E represented by isolates from 9 patients. Eight strains were resistant to carbapenems. The genetic relatedness of Acinetobacter baumannii was high, indicating cross-transmission within the ICU setting. These results emphasize the need for measures to prevent nosocomial transmission of A. baumannii in ICU. PMID:20464330

  5. Draft Genome Sequence of Acinetobacter johnsonii MB44, Exhibiting Nematicidal Activity against Caenorhabditis elegans

    PubMed Central

    Tian, Shijing; Ali, Muhammad; Xie, Li

    2016-01-01

    Acinetobacter johnsonii MB44 was isolated from a frost-plant-tissue sample, which showed noteworthy nematicidal activity against the model organism Caenorhabditis elegans. Here, we report the 3.4 Mb draft genome of A. johnsonii MB44, which will help in understanding the molecular mechanism of its ability to infect nematodes. PMID:26893438

  6. First Identification of OXA-72 Carbapenemase from Acinetobacter pittii in Colombia

    PubMed Central

    Montealegre, Maria Camila; Maya, Juan José; Correa, Adriana; Espinal, Paula; Mojica, Maria F.; Ruiz, Sory J.; Rosso, Fernando; Vila, Jordi; Quinn, John P.

    2012-01-01

    OXA-72 has been reported in few countries around the world. We report the first case in Colombia in an Acinetobacter pittii clinical isolate. The arrival of a new OXA, into a country with high endemic resistance, poses a significant threat, especially because the potential for widespread dissemination is considerable. PMID:22508295

  7. Whole-Genome Sequence of a Multidrug-Resistant Clinical Isolate of Acinetobacter lwoffii▿

    PubMed Central

    Hu, Yongfei; Zhang, Wei; Liang, Hui; Liu, Liping; Peng, Guojun; Pan, Yuanlong; Yang, Xi; Zheng, Beiwen; Gao, George F.; Zhu, Baoli; Hu, Hongyan

    2011-01-01

    Acinetobacter lwoffii has been considered an opportunistic pathogen that can cause nosocomial infections in humans. Here, we present the genome sequence of A. lwoffii WJ10621, a multidrug-resistant clinical isolate that carries a plasmid with the NDM-1 resistance gene. PMID:21742884

  8. Whole-Genome Sequencing Elucidates Epidemiology of Nosocomial Clusters of Acinetobacter baumannii.

    PubMed

    Willems, Stefanie; Kampmeier, Stefanie; Bletz, Stefan; Kossow, Annelene; Köck, Robin; Kipp, Frank; Mellmann, Alexander

    2016-09-01

    We characterized two epidemiologically similar Acinetobacter baumannii clusters from two separate intensive care units (ICU) using core genome multilocus sequence typing. Clonal spread was confirmed in ICU-1 (12 of 14 isolates shared genotypes); in ICU-2, all genotypes (13 isolates) were diverse, thus excluding transmissions and enabling adequate infection control measures. PMID:27358465

  9. Diversity and antibiotic resistance of Acinetobacter spp. in water from the source to the tap.

    PubMed

    Narciso-da-Rocha, Carlos; Vaz-Moreira, Ivone; Svensson-Stadler, Liselott; Moore, Edward R B; Manaia, Célia M

    2013-01-01

    Acinetobacter spp. are ubiquitous bacteria in the environment. Acinetobacter spp. isolated from a municipal drinking water treatment plant and from connected tap water were identified to the species level on the basis of rpoB gene partial sequence analysis. Intraspecies variation was assessed based on the analysis of partial sequences of housekeeping genes (rpoB, gyrB, and recA). Antibiotic resistance was characterized using the disk diffusion method and isolates were classified as wild or non-wild type (non-WT), according to the observed phenotype. The strains of Acinetobacter spp. were related to 11 different validly published species, although three groups of isolates, presenting low rpoB sequence similarities with previously described species, may represent new species. Most of the isolates were related to the species A. johnsonii and A. lwoffii. These two groups, as well as others related to the species A. parvus and A. tjernbergiae, were detected in the water treatment plant and in tap water. Other strains, related to the species A. pittii and A. beijerinckii, were isolated only from tap water. Most of the isolates (80 %) demonstrated wild type (WT) to all of the 12 antibiotics tested. Non-WT for tetracycline, meropenem, and ceftazidime, among others, were observed in water treatment plant or in tap water samples. Although, in general, this study suggests a low prevalence of acquired antibiotic resistance in water Acinetobacter spp., the potential of some species to acquire and disseminate resistance via drinking water is suggested. PMID:22669636

  10. A Taxonomically Unique Acinetobacter Strain with Proteolytic and Hemolytic Activities Recovered from a Patient with a Soft Tissue Injury

    PubMed Central

    Almuzara, Marisa; Traglia, German Matías; Krizova, Lenka; Barberis, Claudia; Montaña, Sabrina; Bakai, Romina; Tuduri, Alicia; Vay, Carlos

    2014-01-01

    A taxonomically unique bacterial strain, Acinetobacter sp. A47, has been recovered from several soft tissue samples from a patient undergoing reconstructive surgery owing to a traumatic amputation. The results of 16S rRNA, rpoB, and gyrB gene comparative sequence analyses showed that A47 does not belong to any of the hitherto-known taxa and may represent an as-yet-unknown Acinetobacter species. The recognition of this novel organism contributes to our knowledge of the taxonomic complexity underlying infections caused by Acinetobacter. PMID:25392359

  11. [Identification and determination of sensitivity to antibiotics of 31 clinical strains of Acinetobacter other than A. baumannii].

    PubMed

    Freney, J; Bouvet, P J; Tixier, C

    1989-01-01

    Precise identification and determination of MICs of clinical isolates of Acinetobacter identified to other species than the hospital species A. baumannii were carried out. On 260 Acinetobacter strains isolated in an hospital over a 6 months period, 31 strains (12 p. cent) were identified to species other than A. baumannii. Among these 31 strains, A. Iwoffii sensu stricto (16 strains) and A. haemolyticus (6 strains) were mostly recovered. Eight glucose oxidizing strains were identified to A. haemolyticus (6 strains), Acinetobacter genospecies 3 (2 strains), and A. Iwoffii sensu stricto (1 strain). Antibiotic susceptibilities of these strains were greater than those commonly observed with A. baumannii strains. PMID:2930020

  12. Acinetobacter baumannii Genes Required for Bacterial Survival during Bloodstream Infection

    PubMed Central

    Subashchandrabose, Sargurunathan; Smith, Sara; DeOrnellas, Valerie; Crepin, Sebastien; Kole, Monica; Zahdeh, Carina

    2015-01-01

    ABSTRACT Acinetobacter baumannii is emerging as a leading global multiple-antibiotic-resistant nosocomial pathogen. The identity of genes essential for pathogenesis in a mammalian host remains largely unknown. Using transposon-directed insertion-site sequencing (TraDIS), we identified A. baumannii genes involved in bacterial survival in a leukopenic mouse model of bloodstream infection. Mice were inoculated with a pooled transposon mutant library derived from 109,000 mutants, and TraDIS was used to map transposon insertion sites in the genomes of bacteria in the inoculum and of bacteria recovered from mouse spleens. Unique transposon insertion sites were mapped and used to calculate a fitness factor for every insertion site based on its relative abundance in the inoculum and postinfection libraries. Eighty-nine transposon insertion mutants that were underrepresented after experimental infection in mice compared to their presence in the inocula were delineated as candidates for further evaluation. Genetically defined mutants lacking feoB (ferrous iron import), ddc (d-ala-d-ala-carboxypeptidase), and pntB (pyridine nucleotide transhydrogenase subunit) exhibited a fitness defect during systemic infection resulting from bacteremia. In vitro, these mutants, as well as a fepA (ferric enterobactin receptor) mutant, are defective in survival in human serum and within macrophages and are hypersensitive to killing by antimicrobial peptides compared to the survival of the parental strain under these conditions. Our data demonstrate that FepA is involved in the uptake of exogenous enterobactin in A. baumannii. Genetic complementation rescues the phenotypes of mutants in assays that emulate conditions encountered during infection. In summary, we have determined novel A. baumannii fitness genes involved in the pathogenesis of mammalian infection. IMPORTANCE A. baumannii is a significant cause of bacterial bloodstream infection in humans. Since multiple antibiotic resistance

  13. Acinetobacter variabilis sp. nov. (formerly DNA group 15 sensu Tjernberg & Ursing), isolated from humans and animals.

    PubMed

    Krizova, Lenka; McGinnis, Jana; Maixnerova, Martina; Nemec, Matej; Poirel, Laurent; Mingle, Lisa; Sedo, Ondrej; Wolfgang, William; Nemec, Alexandr

    2015-03-01

    We aimed to define the taxonomic status of 16 strains which were phenetically congruent with Acinetobacter DNA group 15 described by Tjernberg & Ursing in 1989. The strains were isolated from a variety of human and animal specimens in geographically distant places over the last three decades. Taxonomic analysis was based on an Acinetobacter-targeted, genus-wide approach that included the comparative sequence analysis of housekeeping, protein-coding genes, whole-cell profiling based on matrix-assisted laser desorption ionization-time-of-flight mass spectrometry (MALDI-TOF MS), an array of in-house physiological and metabolic tests, and whole-genome comparative analysis. Based on analyses of the rpoB and gyrB genes, the 16 strains formed respective, strongly supported clusters clearly separated from the other species of the genus Acinetobacter. The distinctness of the group at the species level was indicated by average nucleotide identity values of ≤82 % between the whole genome sequences of two of the 16 strains (NIPH 2171(T) and NIPH 899) and those of the known species. In addition, the coherence of the group was also supported by MALDI-TOF MS. All 16 strains were non-haemolytic and non-gelatinase-producing, grown at 41 °C and utilized a rather limited number of carbon sources. Virtually every strain displayed a unique combination of metabolic and physiological features. We conclude that the 16 strains represent a distinct species of the genus Acinetobacter, for which the name Acinetobacter variabilis sp. nov. is proposed to reflect its marked phenotypic heterogeneity. The type strain is NIPH 2171(T) ( = CIP 110486(T) = CCUG 26390(T) = CCM 8555(T)). PMID:25510976

  14. Acinetobacter variabilis sp. nov. (formerly DNA group 15 sensu Tjernberg & Ursing), isolated from humans and animals

    PubMed Central

    Krizova, Lenka; McGinnis, Jana; Maixnerova, Martina; Nemec, Matej; Poirel, Laurent; Mingle, Lisa; Sedo, Ondrej; Wolfgang, William

    2015-01-01

    We aimed to define the taxonomic status of 16 strains which were phenetically congruent with Acinetobacter DNA group 15 described by Tjernberg & Ursing in 1989. The strains were isolated from a variety of human and animal specimens in geographically distant places over the last three decades. Taxonomic analysis was based on an Acinetobacter-targeted, genus-wide approach that included the comparative sequence analysis of housekeeping, protein-coding genes, whole-cell profiling based on matrix-assisted laser desorption ionization-time-of-flight mass spectrometry (MALDI-TOF MS), an array of in-house physiological and metabolic tests, and whole-genome comparative analysis. Based on analyses of the rpoB and gyrB genes, the 16 strains formed respective, strongly supported clusters clearly separated from the other species of the genus Acinetobacter. The distinctness of the group at the species level was indicated by average nucleotide identity values of ≤82 % between the whole genome sequences of two of the 16 strains (NIPH 2171T and NIPH 899) and those of the known species. In addition, the coherence of the group was also supported by MALDI-TOF MS. All 16 strains were non-haemolytic and non-gelatinase-producing, grown at 41 °C and utilized a rather limited number of carbon sources. Virtually every strain displayed a unique combination of metabolic and physiological features. We conclude that the 16 strains represent a distinct species of the genus Acinetobacter, for which the name Acinetobacter variabilis sp. nov. is proposed to reflect its marked phenotypic heterogeneity. The type strain is NIPH 2171T ( = CIP 110486T = CCUG 26390T = CCM 8555T). PMID:25510976

  15. In vitro antimicrobial activity of ceftizoxime against glucose-nonfermentative gram-negative rods.

    PubMed

    Yabuuchi, E; Ito, T; Tanimura, E; Yamamoto, N; Ohyama, A

    1981-07-01

    Ceftizoxime, a new cephalosporin, was active against Pseudomonas cepacia, Flavobacterium meningosepticum, Alcaligenes faecalis, and Acinetobacter calcoaceticus and was more potent against Pseudomonas aeruginosa and Pseudomonas putida than was carbenicillin. PMID:6269480

  16. Colistin and tigecycline for management of external ventricular device-related ventriculitis due to multidrug-resistant Acinetobacter baumannii.

    PubMed

    Shrestha, Gentle Sunder; Tamang, Sushil; Paneru, Hem Raj; Shrestha, Pramesh Sunder; Keyal, Niraj; Acharya, Subhash Prasad; Marhatta, Moda Nath; Shilpakar, Sushil

    2016-01-01

    Acinetobacter baumannii is an important cause of nosocomial ventriculitis associated with external ventricular device (EVD). It is frequently multidrug resistant (MDR), carries a poor outcome, and is difficult to treat. We report a case of MDR Acinetobacter ventriculitis treated with intravenous and intraventricular colistin together with intravenous tigecycline. The patient developed nephrotoxicity and poor neurological outcome despite microbiological cure. Careful implementation of bundle of measures to minimize EVD-associated ventriculitis is valuable. PMID:27365967

  17. Colistin and tigecycline for management of external ventricular device-related ventriculitis due to multidrug-resistant Acinetobacter baumannii

    PubMed Central

    Shrestha, Gentle Sunder; Tamang, Sushil; Paneru, Hem Raj; Shrestha, Pramesh Sunder; Keyal, Niraj; Acharya, Subhash Prasad; Marhatta, Moda Nath; Shilpakar, Sushil

    2016-01-01

    Acinetobacter baumannii is an important cause of nosocomial ventriculitis associated with external ventricular device (EVD). It is frequently multidrug resistant (MDR), carries a poor outcome, and is difficult to treat. We report a case of MDR Acinetobacter ventriculitis treated with intravenous and intraventricular colistin together with intravenous tigecycline. The patient developed nephrotoxicity and poor neurological outcome despite microbiological cure. Careful implementation of bundle of measures to minimize EVD-associated ventriculitis is valuable. PMID:27365967

  18. Prevalence of Pseudomonas aeruginosa and Acinetobacter spp. in subgingival biofilm and saliva of subjects with chronic periodontal infection.

    PubMed

    Souto, Renata; Silva-Boghossian, Carina M; Colombo, Ana Paula Vieira

    2014-01-01

    P. aeruginosa and Acinetobacter spp. are important pathogens associated with late nosocomial pneumonia in hospitalized and institutionalized individuals. The oral cavity may be a major source of these respiratory pathogens, particularly in the presence of poor oral hygiene and periodontal infection. This study investigated the prevalence of P. aeruginosa and Acinetobacter spp. in subgingival biofilm and saliva of subjects with periodontal disease or health. Samples were obtained from 55 periodontally healthy (PH) and 169 chronic periodontitis (CP) patients. DNA was obtained from the samples and detection of P. aeruginosa and Acinetobacter spp. was carried out by multiplex and nested PCR. P. aeruginosa and Acinetobacter spp. were detected in 40% and 45% of all samples, respectively. No significant differences in the distribution of these microorganisms between men and women, subgingival biofilm and saliva samples, patients ≤ 35 and > 35 years of age, and smokers and non-smokers were observed regardless periodontal status (p > 0.05). In contrast, the frequencies of P. aeruginosa and Acinetobacter spp. in saliva and biofilm samples were significantly greater in CP than PH patients (p < 0.01). Smokers presenting P. aeruginosa and high frequencies of supragingival plaque were more likely to present CP than PH. P. aeruginosa and Acinetobacter spp. are frequently detected in the oral microbiota of CP. Poor oral hygiene, smoking and the presence of P. aeruginosa are strongly associated with periodontitis. PMID:25242933

  19. Sensitive, resistant and multi-drug resistant Acinetobacter baumanii at Saudi Arabia hospital eastern region.

    PubMed

    Ahmed, Mughis Uddin; Farooq, Reshma; Al-Hawashim, Nadia; Ahmed, Motasim; Yiannakou, Nearchos; Sayeed, Fatima; Sayed, Ali Rifat; Lutfullah, Sualiha

    2015-05-01

    Since the Physicians start use of antibiotics long ago with un-notice drug resistance. However actual problem was recognized about 85 years ago. Antibiotic resistant and Multi-drug resistant bacterial strains are at rise throughout the world. It is physicians and researchers to take scientific research based appropriate action to overcome this ever-spreading problem. This study is designed to find out sensitive (S), resistant (R) and multi-drug resistant (MDR) Acinetobacter baumanii strain along with other isolates in the resident patients of Eastern Region of Saudi Arabia. Pseudomonas aeruginosa is excluded from other gram-negative organisms isolated from different sites as it will be dealt separately. This study is based in was retrospective observations designed to collect data of different stains of Acinetobacter baumanii with reference to their Sensitivity (S), Resistance (R), Multi-Drug Resistance (MDR) along with other Gram negative isolated from different sites (from 1st January 2004 to 31st December 2011) at King Abdulaziz Hospital located Eastern Region of Kingdom of Saudi Arabia (KSA). All necessary techniques were used to culture and perform sensitivity of these isolates. There were 4532 isolates out of which 3018 (67%) were from patients. Out of Acinetobacter baumanii infected were 906 (20%) while other 3626 (80%) isolates were miscellaneous. Numbers of patients or cases were 480 (53%) out of 906 isolates and numbers of patients or cases in other organisms were 2538 (70%) out of 3626 isolates. Acinetobacter baumanii infected patients 221 (46%) were male and 259 (54%) were female and the male and female ratio of 1:1.2. In other organisms this male female ratio was almost same. There was steady rise in number of patients and the hence the isolates from 2004 to 2011. Majority of the bacterial strains were isolated as single organism but some were isolated as double or triple or quadruple or more organisms from different sites. Sensitive, Resistant and

  20. Bacteremia due to Acinetobacter ursingii in infants: Reports of two cases

    PubMed Central

    Yakut, Nurhayat; Kepenekli, Eda Kadayifci; Karaaslan, Ayse; Atici, Serkan; Akkoc, Gulsen; Demir, Sevliya Ocal; Soysal, Ahmet; Bakir, Mustafa

    2016-01-01

    Acinetobacter ursingii is an aerobic, gram-negative, opportunistic microorganism which is rarely isolated among Acinetobacter species. We present two immunocompetent infants who developed bacteremia due to A. ursingii. The first patient is a two -month- old boy who had been hospitalized in pediatric surgery unit for suspected tracheo-esophageal fistula because of recurrent aspiration pneumonia unresponsive to antibiotic therapy. The second patient is a fourteen -month- old boy with prolonged vomiting and diarrhea. A. ursingii was isolated from their blood cultures. They were successfully treated with ampicillin-sulbactam. Although A. ursingii has recently been isolated from a clinical specimen; reports of infection with A. ursingii in children are rare. A. ursingii should be kept in mind as an opportunistic microorganism in children. PMID:27347282

  1. Culturable populations of Acinetobacter can promptly respond to contamination by alkanes in mangrove sediments.

    PubMed

    Rocha, Lidianne L; Colares, Geórgia B; Angelim, Alysson L; Grangeiro, Thalles B; Melo, Vânia M M

    2013-11-15

    This study evaluated the potential of bacterial isolates from mangrove sediments to degrade hexadecane, an paraffin hydrocarbon that is a large constituent of diesel and automobile lubricants. From a total of 18 oil-degrading isolates obtained by an enrichment technique, four isolates showed a great potential to degrade hexadecane. The strain MSIC01, which was identified by 16S rRNA gene sequencing as Acinetobacter sp., showed the best performance in degrading this hydrocarbon, being capable of completely degrading 1% (v/v) hexadecane within 48 h without releasing biosurfactants. Its hydrophobic surface probably justifies its potential to degrade high concentrations of hexadecane. Thus, the sediments from the studied mangrove harbour bacterial communities that are able to use oil as a carbon source, which is a particularly interesting feature due to the risk of oil spills in coastal areas. Moreover, Acinetobacter sp. MSIC01 emerged as a promising candidate for applications in bioremediation of contaminated mangrove sediments. PMID:24050127

  2. Toll-Like Receptor 9 Contributes to Defense against Acinetobacter baumannii Infection

    PubMed Central

    Noto, Michael J.; Boyd, Kelli L.; Burns, William J.; Varga, Matthew G.; Peek, Richard M.

    2015-01-01

    Acinetobacter baumannii is a common nosocomial pathogen capable of causing severe diseases associated with significant morbidity and mortality in impaired hosts. Pattern recognition receptors, such as the Toll-like receptors (TLRs), play a key role in pathogen detection and function to alert the immune system to infection. Here, we examine the role for TLR9 signaling in response to A. baumannii infection. In a murine model of A. baumannii pneumonia, TLR9−/− mice exhibit significantly increased bacterial burdens in the lungs, increased extrapulmonary bacterial dissemination, and more severe lung pathology compared with those in wild-type mice. Following systemic A. baumannii infection, TLR9−/− mice have significantly increased bacterial burdens in the lungs, as well as decreased proinflammatory cytokine and chemokine production. These results demonstrate that TLR9-mediated pathogen detection is important for host defense against the opportunistic pathogen Acinetobacter baumannii. PMID:26238713

  3. Efficacy of Tigecycline for Secondary Acinetobacter Bacteremia and Factors Associated with Treatment Failure

    PubMed Central

    Liou, Bo-Huang; Lee, Yi-Tzu; Liu, Po-Yu; Fung, Chang-Phone

    2015-01-01

    We describe the clinical outcome of 17 patients with secondary Acinetobacter bacteremia whose isolates had a tigecycline MIC of ≤2 mg/liter and who received tigecycline within 2 days of bacteremia onset. The 14-day mortality rate of the tigecycline cohort was 41.2% (7/17), which was significantly higher than that of those receiving other appropriate antimicrobial agents (13.8%, 9/65; P = 0.018). However, the percentages of end-stage renal disease and congestive heart failure were higher in the tigecycline cohort. The efficacy of tigecycline was contingent upon the illness severity and bacterial species. Tigecycline should be applied cautiously for treatment of Acinetobacter bacteremia. PMID:25824230

  4. Detection of Multi-drug Resistant Acinetobacter Lwoffii Isolated from Soil of Mink Farm.

    PubMed

    Sun, Na; Wen, Yong Jun; Zhang, Shu Qin; Zhu, Hong Wei; Guo, Li; Wang, Feng Xue; Chen, Qiang; Ma, Hong Xia; Cheng, Shi Peng

    2016-07-01

    There were 4 Acinetobacter lwoffii obtained from soil samples. The antimicrobial susceptibility of the strains to 16 antimicrobial agents was investigated using K-B method. Three isolates showed the multi-drug resistance. The presence of resistance genes and integrons was determined using PCR. The aadA1, aac(3')-IIc, aph(3')-VII, aac(6')-Ib, sul2, cat2, floR, and tet(K) genes were detected, respectively. Three class 1 integrons were obtained. The arr-3-aacA4 and blaPSE-1 gene cassette, which cause resistance to aminoglycoside and beta-lactamase antibiotics. Our results reported the detection of multi-drug resistant and carried resistant genes Acinetobacter lwoffii from soil. The findings suggested that we should pay close attention to the prevalence of multi-drug resistant bacterial species of environment. PMID:27554122

  5. Post-neurosurgical meningitis caused by acinetobacter baumannii: case series and review of the literature

    PubMed Central

    Ni, Shunlan; Li, Shanshan; Yang, Naibin; Zhang, Sainan; Hu, Danping; Li, Qian; Lu, Mingqin

    2015-01-01

    Background: Acinetobacter baumannii (A. baumannii), a gram-negative bacterium, has now become an important hospital pathogen, which causes various serious nosocomial infections worldwide. Bacterial meningitis is a common complication after neurosurgical operation, and the percentage of A. baumannii meningitis is growing, especially the one resisting multiple drugs. Method: We retrospectively reviewed the cases with postoperative A. baumannii meningitis (PABM) in the First Affiliated Hospital of Wenzhou Medical University from January 2013 to October 2014. And we retrieved the PubMed for cases with PABM and reviewed them. Result: Five cases were included in our retrospective study. Two cases with sensitive A. baumannii and one with multidrug-resistant acinetobacter baumannii (MRAB) were cured, and other two with MRAB died. Conclusion: Intraventricular or intrathecal colistin could be a treatment to the MRAB. PMID:26885152

  6. Role of OmpA in the Multidrug Resistance Phenotype of Acinetobacter baumannii

    PubMed Central

    Fàbrega, Anna; Roca, Ignasi; Sánchez-Encinales, Viviana; Vila, Jordi; Pachón, Jerónimo

    2014-01-01

    Acinetobacter baumannii has emerged as a nosocomial pathogen with an increased prevalence of multidrug-resistant strains. The role of the outer membrane protein A (OmpA) in antimicrobial resistance remains poorly understood. In this report, disruption of the ompA gene led to decreased MICs of chloramphenicol, aztreonam, and nalidixic acid. We have characterized, for the first time, the contribution of OmpA in the antimicrobial resistance phenotype of A. baumannii. PMID:24379205

  7. Draft Genome Sequences of Two Extensively Drug-Resistant Acinetobacter baumannii Strains Isolated from Pus Samples

    PubMed Central

    Mahalingam, Niranjana; Manivannan, Bhavani; Jadhao, Sudhir; Mishra, Gayathri; Nilawe, Pravin

    2016-01-01

    We report the draft genomes of two extensively drug-resistant (XDR) Acinetobacter baumannii strains isolated from pus samples of two patients with surgical site infections at Sri Sathya Sai Institute of Higher Medical Sciences, Prasanthigram, India. The average genomic size and G+C content are 4 Mbp and 38.96% (AB28) and 4 Mbp and 38.94% (AB30), respectively. PMID:27013044

  8. Draft Genome Sequences of Two Extensively Drug-Resistant Acinetobacter baumannii Strains Isolated from Pus Samples.

    PubMed

    Mahalingam, Niranjana; Manivannan, Bhavani; Jadhao, Sudhir; Mishra, Gayathri; Nilawe, Pravin; Pradeep, Bulagonda Eswarappa

    2016-01-01

    We report the draft genomes of two extensively drug-resistant (XDR)Acinetobacter baumanniistrains isolated from pus samples of two patients with surgical site infections at Sri Sathya Sai Institute of Higher Medical Sciences, Prasanthigram, India. The average genomic size and G+C content are 4 Mbp and 38.96% (AB28) and 4 Mbp and 38.94% (AB30), respectively. PMID:27013044

  9. First report of NDM-1-producing Acinetobacter baumannii sequence type 25 in Brazil.

    PubMed

    Pillonetto, Marcelo; Arend, Lavinia; Vespero, Eliana Carolina; Pelisson, Marsileni; Chagas, Thiago Pavoni Gomes; Carvalho-Assef, Ana Paula D'Alincourt; Asensi, Marise Dutra

    2014-12-01

    New Delhi metallo-β-lactamase 1 (NDM-1) was first identified in Brazil in Enterobacter hormaechei and Providencia rettgeri in 2013. Here, we describe the first case of NDM-1-producing Acinetobacter baumannii sequence type 25 isolated from the urinary tract of a 71-year-old man who died of multiple complications, including A. baumannii infection. The NDM-1 gene was detected by quantitative PCR, and its sequence confirmed its presence in an ∼ 100-kb plasmid. PMID:25288087

  10. Isolation of Acinetobacter lwoffii from a lovebird (Agapornis roseicollis) with severe respiratory symptoms.

    PubMed

    Robino, P; Bert, E; Tramuta, C; Cerruti Sola, S; Nebbia, P

    2005-05-01

    Although Acinetobacter lwoffii is generally considered an ubiquitous and opportunistic bacterium, this germ has been isolated from the pulmonary and abdominal air sac swabs obtained from a Lovebird (Agapornis roseicollis), which died of a severe respiratory disease. Bacteriological tests (phenotypic and genotypic) led to the identification of A. lwoffii in pure culture. All the other parrots in the breeding centre were treated orally with oxytetracycline for 14 days and 3 months later no bird showed any signs of respiratory symptoms. PMID:15999637

  11. Severe Community-Acquired Bloodstream Infection with Acinetobacter ursingii in Person who Injects Drugs

    PubMed Central

    Salzer, Helmut J.F.; Rolling, Thierry; Schmiedel, Stefan; Klupp, Eva-Maria; Lange, Christoph

    2016-01-01

    We report a community-acquired bloodstream infection with Acinteobacter ursingii in an HIV-negative woman who injected drugs. The infection was successfully treated with meropenem. Species identification was performed by using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. Improved identification of Acinetobacter spp. by using this method will help identify clinical effects of this underdiagnosed pathogen. PMID:26689082

  12. Metabolism of spacecraft cleaning reagents by Mars Odyssey and Phoenix-associated Acinetobacter

    NASA Astrophysics Data System (ADS)

    Mogul, Rakesh; Barding, Gregory; Baki, Ryan; Perkins, Nicole; Lee, Sooji; Lalla, Sid; Campos, Alexa; Sripong, Kimberly; Madrid, Steve

    2016-07-01

    The metabolomic and proteomic properties that promote microbial survival in spacecraft assembly facilities are important aspects to planetary protection and astrobiology. In this presentation, we will provide molecular and biological evidence that the spacecraft-associated Acinetobacter metabolize/degrade spacecraft cleaning reagents such as ethanol, 2-propanol, and Kleenol-30. Gas chromatography-mass spectrometry (GC-MS) studies on A. radioresistens 50v1 (Mars Odyssey) show that the metabolome is dependent upon growth conditions and that ^{13}C-labeled ethanol is incorporated into metabolites such as TCA/glyoxylate cycle intermediates, amino acids, monosaccharides, and disaccharides (e.g., trehalose). In fact, plate count assays show that ethanol is a sole carbon source under minimal conditions for several Mars Phoenix and Odyssey-associated Acinetobacter strains, which may explain why the Acinetobacter are among the most abundant genera found in spacecraft assembly facilities. Biochemical analyses support the enzymatic oxidation of ethanol and 2-propanol by a membrane-bound and NAD+/PQQ-dependent alcohol dehydrogenase, with current kinetic data providing similar apparent K _{M} and maximum growth rate values of ˜5 and 8 mM ethanol, respectively. Preliminary GC-MS analysis also suggests that Kleenol-30 is degraded by A. radioresistens 50v1 when grown in ethanol mixtures. Under minimal conditions, A. radioresistens 50v1 (˜10 ^{8} cfu/mL) also displays a remarkable oxidative extremotolerance (˜2-log reduction in 10 mM hydrogen peroxide), which suggests crucial roles for metabolites associated with oxidative stress (e.g., trehalose) and the observed appreciable catalase specific activities. In conclusion, these results provide key insights into the survival strategies of spacecraft-associated Acinetobacter and emphasize the importance of characterizing the carbon metabolism of forward contaminants.

  13. Draft Genome Sequence of Ammonia-Producing Acinetobacter sp. Strain MCC2139 from Dairy Effluent

    PubMed Central

    Chatterjee, Debasmita; Thakur, Ashoke Ranjan

    2013-01-01

    We report the draft genome sequence of an ammonia-producing, esculin-hydrolyzing, catalase-positive, gram-negative bacterium, Acinetobacter sp. strain MCC2139. This bacterium, isolated from dairy sludge and with optimum growth at 37°C, has a genome size of 2,967,280 bp with a G+C content of 42.3%. PMID:23814111

  14. The Genomic Diversification of the Whole Acinetobacter Genus: Origins, Mechanisms, and Consequences

    PubMed Central

    Touchon, Marie; Cury, Jean; Yoon, Eun-Jeong; Krizova, Lenka; Cerqueira, Gustavo C.; Murphy, Cheryl; Feldgarden, Michael; Wortman, Jennifer; Clermont, Dominique; Lambert, Thierry; Grillot-Courvalin, Catherine; Nemec, Alexandr; Courvalin, Patrice; Rocha, Eduardo P.C.

    2014-01-01

    Bacterial genomics has greatly expanded our understanding of microdiversification patterns within a species, but analyses at higher taxonomical levels are necessary to understand and predict the independent rise of pathogens in a genus. We have sampled, sequenced, and assessed the diversity of genomes of validly named and tentative species of the Acinetobacter genus, a clade including major nosocomial pathogens and biotechnologically important species. We inferred a robust global phylogeny and delimited several new putative species. The genus is very ancient and extremely diverse: Genomes of highly divergent species share more orthologs than certain strains within a species. We systematically characterized elements and mechanisms driving genome diversification, such as conjugative elements, insertion sequences, and natural transformation. We found many error-prone polymerases that may play a role in resistance to toxins, antibiotics, and in the generation of genetic variation. Surprisingly, temperate phages, poorly studied in Acinetobacter, were found to account for a significant fraction of most genomes. Accordingly, many genomes encode clustered regularly interspaced short palindromic repeats (CRISPR)-Cas systems with some of the largest CRISPR-arrays found so far in bacteria. Integrons are strongly overrepresented in Acinetobacter baumannii, which correlates with its frequent resistance to antibiotics. Our data suggest that A. baumannii arose from an ancient population bottleneck followed by population expansion under strong purifying selection. The outstanding diversification of the species occurred largely by horizontal transfer, including some allelic recombination, at specific hotspots preferentially located close to the replication terminus. Our work sets a quantitative basis to understand the diversification of Acinetobacter into emerging resistant and versatile pathogens. PMID:25313016

  15. Continuous coculture degradation of selected polychlorinated biphenyl congeners by Acinetobacter spp. in an aerobic reactor system

    SciTech Connect

    Adriaens, P.; Focht, D.D. )

    1990-07-01

    A coculture of two Acinetobacter spp. was applied to degrade polychlorinated biphenyls during a 42-day incubation study in a continuous aerobic fixed-bed reactor system, filled with polyurethane foam boards as support for bacterial biofilm development. The reactor was supplied with mineral medium containing 500 ppm sodium benzoate as a growth (primary) substrate, while the incoming airstream was saturated with biphenyl vapors to induce for PCB cometabolism in Acinetobacter sp. strain P6. The chlorobenzoates thus generated from 4,4{prime}-dichlorobiphenyl (4,4{prime}-DCBP), 3,4-dichlorobiphenyl (3,4-DCBP), and 3,3{prime},4,4{prime}-tetrachlorobiphenyl were further metabolized by Acinetobacter sp. strain 4-CB1. The chlorobenzoate metabolites, as well as ring-fission product ({lambda}{sub max} = 442 nm) from the PCB congeners, accounted for the degradation of 63% (2.8 mM) of the 4,4{prime}-DCBP, 100% (0.5 mM) of the 3,4-DCBP, and 32% (0.12 mM) of the 3,3{prime},4,4{prime}-TCBP, the biofilm responded with a concurrent higher release of chlorobenzoates and chloride through cosubstrate utilization.

  16. Fatty aldehyde dehydrogenases in Acinetobacter sp. strain HO1-N: role in hexadecane and hexadecanol metabolism

    SciTech Connect

    Singer, M.E.; Finnerty, W.R.

    1985-12-01

    The role of fatty aldehyde dehydrogenases (FALDHs) in hexadecane and hexadecanol metabolism was studied in Acinetobacter sp. strain HO1-N. Two distinct FALDHs were demonstrated in Acinetobacter sp. strain HO1-N: (i) a membrane-bound, NADP-dependent FALDH activity induced 5-, 15-, and 9 fold by growth on hexadecanol, dodecyl aldehyde, and hexadecane, respectively, and (ii) a constitutive, NAD-dependent, membrane-localized FALDH. Dodecyl aldehyde-negative mutants were isolated and grouped into two phenotypic classes based on growth: class 1 mutants were hexadecane and hexadecanol negative and class 2 mutants were hexadecane and hexadecanol positive. Specific activity of NADP-dependent FALDH in Ald21 (class 1 mutant) was 85% lower than that of wild-type FALDH, while the specific activity of Ald24 (class 2 mutant) was 55% greater than that of wild-type FALDH. Ald21R, a dodecyl aldehyde-positive revertant able to grow on hexadecane, hexadecanol, and dodecyl aldehyde, exhibited a 100% increase in the specific activity of the NADP-dependent FALDH. This study provides genetic and physiological evidence for the role of fatty aldehyde as an essential metabolic intermediate and NADP-dependent FALDH as a key enzyme in the dissimilation of hexadecane, hexadecanol, and dodecyl aldehyde in Acinetobacter sp. strain HO1-N.

  17. Risk factors and outcomes of imipenem-resistant Acinetobacter bloodstream infection in North-eastern Malaysia

    PubMed Central

    Deris, Zakuan Zainy; Shafei, Mohd Nazri; Harun, Azian

    2011-01-01

    Objective To determine the risk factors and outcomes of imipenem-resistant Acinetobacter baumannii (IRAB) bloodstream infection (BSI) cases, since there is very little publication on Acinetobacter baumannii infections from Malaysia. Methods A cross sectional study of 41 cases (73.2%) of imipenem-sensitive Acinetobacter baumanii (ISAB) and 15 cases (26.8%) of IRAB was conducted in a teaching hospital which was located at North-Eastern state of Malaysia. Results There was no independent risk factor for IRAB BSI identified but IRAB BSI was significantly associated with longer bacteraemic days [OR 1.23 (95% CI 1.01, 1.50)]. Although prior use of carbepenems and cephalosporin were higher among IRAB than ISAB group, statistically they were not significant. There was no significant difference in term of outcomes between the two groups. Conclusions Although statistically not significant, this analysis compliments previous publication highlighting the importance of appropriate empiric antibiotic usage in hospital especially carbepenems and need further evaluation with bigger subjects. PMID:23569782

  18. Genome-sequence analysis of Acinetobacter johnsonii MB44 reveals potential nematode-virulent factors.

    PubMed

    Tian, Shijing; Ali, Muhammad; Xie, Li; Li, Lin

    2016-01-01

    Acinetobacter johnsonii is generally recognized as a nonpathogenic bacterium although it is often found in hospital environments. However, a newly identified isolate of this species from a frost-plant-tissue sample, namely, A. johnsonii MB44, showed significant nematicidal activity against the model organism Caenorhabditis elegans. To expand our understanding of this bacterial species, we generated a draft genome sequence of MB44 and analyzed its genomic features related to nematicidal attributes. The 3.36 Mb long genome contains 3636 predicted protein-coding genes and 95 RNA genes (including 14 rRNA genes), with a G + C content of 41.37 %. Genomic analysis of the prediction of nematicidal proteins using the software MP3 revealed a total of 108 potential virulence proteins. Some of these proteins were homologous to the known virulent proteins identified from Acinetobacter baumannii, a pathogenic species of the genus Acinetobacter. These virulent proteins included the outer membrane protein A, the phospholipase D, and penicillin-binding protein 7/8. Moreover, one siderophore biosynthesis gene cluster and one capsular polysaccharide gene cluster, which were predicted to be important virulence factors for C. elegans, were identified in the MB44 genome. The current study demonstrated that A. johnsonii MB44, with its nematicidal activity, could be an opportunistic pathogen to animals. PMID:27429894

  19. Biofilm may not be Necessary for the Epidemic Spread of Acinetobacter baumannii

    PubMed Central

    Hu, Yuan; He, Lihua; Tao, Xiaoxia; Meng, Fanliang; Zhang, Jianzhong

    2016-01-01

    Biofilm is recognized as a contributing factor to the capacity of Acinetobacter baumannii to persist and prosper in medical settings, but it is still unknown whether biofilms contribute to the spread of A. baumannii. In this study, the biofilm formation of 114 clinical A. baumannii isolates and 32 non-baumannii Acinetobacter isolates was investigated using a microtiter plate assay. The clonal relationships among A. baumannii isolates were assessed using pulsed-field gel electrophoresis and multilocus sequence typing, and one major outbreak clone and 5 other epidemic clones were identified. Compared with the epidemic or outbreak A. baumannii isolates, the sporadic isolates had significantly higher biofilm formation, but no significant difference was observed between the sporadic A. baumannii isolates and the non-baumannii Acinetobacter isolates, suggesting that biofilm is not important for the epidemic spread of A. baumannii. Of the multidrug-resistant (MDR) A. baumannii isolates in this study, 95.7% were assigned to international clone 2 (IC2) and showed significantly lower biofilm formations than the other isolates, suggesting that biofilm did not contribute to the high success of IC2. These findings have increased our understanding of the potential relationship between biofilm formation and the epidemic capacity of A. baumannii. PMID:27558010

  20. The Population Structure of Acinetobacter baumannii: Expanding Multiresistant Clones from an Ancestral Susceptible Genetic Pool

    PubMed Central

    Diancourt, Laure; Passet, Virginie; Nemec, Alexandr; Dijkshoorn, Lenie; Brisse, Sylvain

    2010-01-01

    Outbreaks of hospital infections caused by multidrug resistant Acinetobacter baumannii strains are of increasing concern worldwide. Although it has been reported that particular outbreak strains are geographically widespread, little is known about the diversity and phylogenetic relatedness of A. baumannii clonal groups. Sequencing of internal portions of seven housekeeping genes (total 2,976 nt) was performed in 154 A. baumannii strains covering the breadth of known diversity and including representatives of previously recognized international clones, and in 19 representatives of other Acinetobacter species. Restricted amounts of diversity and a star-like phylogeny reveal that A. baumannii is a genetically compact species that suffered a severe bottleneck in the recent past, possibly linked to a restricted ecological niche. A. baumannii is neatly demarcated from its closest relative (genomic species 13TU) and other Acinetobacter species. Multilocus sequence typing analysis demonstrated that the previously recognized international clones I to III correspond to three clonal complexes, each made of a central, predominant genotype and few single locus variants, a hallmark of recent clonal expansion. Whereas antimicrobial resistance was almost universal among isolates of these and a novel international clone (ST15), isolates of the other genotypes were mostly susceptible. This dichotomy indicates that antimicrobial resistance is a major selective advantage that drives the ongoing rapid clonal expansion of these highly problematic agents of nosocomial infections. PMID:20383326

  1. Biofilm may not be Necessary for the Epidemic Spread of Acinetobacter baumannii.

    PubMed

    Hu, Yuan; He, Lihua; Tao, Xiaoxia; Meng, Fanliang; Zhang, Jianzhong

    2016-01-01

    Biofilm is recognized as a contributing factor to the capacity of Acinetobacter baumannii to persist and prosper in medical settings, but it is still unknown whether biofilms contribute to the spread of A. baumannii. In this study, the biofilm formation of 114 clinical A. baumannii isolates and 32 non-baumannii Acinetobacter isolates was investigated using a microtiter plate assay. The clonal relationships among A. baumannii isolates were assessed using pulsed-field gel electrophoresis and multilocus sequence typing, and one major outbreak clone and 5 other epidemic clones were identified. Compared with the epidemic or outbreak A. baumannii isolates, the sporadic isolates had significantly higher biofilm formation, but no significant difference was observed between the sporadic A. baumannii isolates and the non-baumannii Acinetobacter isolates, suggesting that biofilm is not important for the epidemic spread of A. baumannii. Of the multidrug-resistant (MDR) A. baumannii isolates in this study, 95.7% were assigned to international clone 2 (IC2) and showed significantly lower biofilm formations than the other isolates, suggesting that biofilm did not contribute to the high success of IC2. These findings have increased our understanding of the potential relationship between biofilm formation and the epidemic capacity of A. baumannii. PMID:27558010

  2. Enrichment, isolation and characterization of pentachlorophenol degrading bacterium Acinetobacter sp. ISTPCP-3 from effluent discharge site.

    PubMed

    Sharma, Ashwani; Thakur, Indu Shekhar; Dureja, Prem

    2009-09-01

    Three pentachlorophenol (PCP) degrading bacterial strains were isolated from sediment core of pulp and paper mill effluent discharge site. The strains were continuously enriched in mineral salts medium supplemented with PCP as sole source of carbon and energy. One of the acclimated strains with relatively high PCP degradation capability was selected and characterized in this study. Based on morphology, biochemical tests, 16S rDNA sequence analysis and phylogenetic characteristics, the strains showed greatest similarity with Acinetobacter spp. The strain was identified as Acinetobacter sp. ISTPCP-3. The physiological characteristics and optimum growth conditions of the bacterial strain were investigated. The results of optimum growth temperature revealed that it was a mesophile. The optimum growth temperature for the strain was 30 degrees C. The preferential initial pH for the strain was ranging at 6.5-7.5, the optimum pH was 7. The bacterium was able to tolerate and degrade PCP up to a concentration of 200 mg/l. Increase in PCP concentration had a negative effect on biodegradation rate and PCP concentration above 250 mg/l was inhibitory to its growth. Acinetobacter sp. ISTPCP-3 was able to utilize PCP through an oxidative route with ortho ring-cleavage with the formation of 2,3,5,6-tetrachlorohydroquinone and 2-chloro-1,4-benzenediol, identified using gas chromatograph-mass spectrometric (GC-MS) analysis. The degradation pathway followed by isolated bacterium is different from previously characterized pathway. PMID:19214760

  3. Blood stream infections caused by Acinetobacter ursingii in an obstetrics ward.

    PubMed

    Horii, Toshinobu; Tamai, Kiyoko; Mitsui, Mayumi; Notake, Shigeyuki; Yanagisawa, Hideji

    2011-01-01

    The genus Acinetobacter is an important causative pathogen of nosocomial infections in the healthcare setting. The objectives of this study were to determine the species of causative pathogens and the sources of Acinetobacter blood stream infections that occurred in 2 immunocompetent pregnant women admitted to an obstetrics ward within a 2-month period. Phenotypic identification of the two isolates from blood stream infections was inconsistent among the ID test, the MicroScan WalkAway and the Vitek2 systems. In addition to the growth profile and detailed biochemical analysis, genotypic identification and phylogenetic tree analysis based on the almost complete 16S rRNA sequence and the partial rpoB gene sequence confirmed the identification of these isolates as A. ursingii. Environmental investigation of the obstetrics ward revealed A. ursingii and different strains of Acinetobacter junii in specimens obtained from the ward shower bath, although the source and route of transmission for the A. ursingii infections were not clarified. Our findings show that A. ursingii can inhabit the hospital environment. PMID:20969979

  4. Acinetobacter guangdongensis sp. nov., isolated from abandoned lead-zinc ore.

    PubMed

    Feng, Guang-Da; Yang, Song-Zhen; Wang, Yong-Hong; Deng, Ming-Rong; Zhu, Hong-Hui

    2014-10-01

    A Gram-stain-negative, non-motile bacterial strain designated 1NM-4(T) was isolated from an abandoned lead-zinc ore mine site in Mei County, Meizhou, Guangdong Province, southern China. The isolate was light yellow, strictly aerobic, oxidase-negative and catalase-positive. Phylogenetic analyses based on 16S rRNA, rpoB and gyrB gene sequences, together with DNA-DNA hybridization values less than 70%, revealed that strain 1NM-4(T) belongs to the genus Acinetobacter and may represent a novel species. The major respiratory quinone was ubiquinone 9 (Q-9) and the major cellular fatty acids consisted of C18:1ω9c, summed feature 3 (C16:1ω7c and/or C16:1ω6c), C16:0 and C12:0. The major polar lipids were diphosphatidylglycerol, phosphatidylethanolamine, phosphatidylglycerol, phosphatidylcholine, an unidentified aminolipid and two unidentified phospholipids. The genomic DNA G+C content of strain 1NM-4(T) was 47.17 ± 0.02 mol%. Based on phenotypic, phylogenetic and chemotaxonomic characteristics, strain 1NM-4(T) should be assigned to a novel species of the genus Acinetobacter, for which the name Acinetobacter guangdongensis sp. nov. is proposed. The type strain is 1NM-4(T) ( = GIMCC 1.656(T) = CCTCC AB 2014199(T) = KCTC 42012(T)). PMID:25015678

  5. Unique features revealed by the genome sequence of Acinetobacter sp. ADP1, a versatile and naturally transformation competent bacterium

    PubMed Central

    Barbe, Valérie; Vallenet, David; Fonknechten, Nuria; Kreimeyer, Annett; Oztas, Sophie; Labarre, Laurent; Cruveiller, Stéphane; Robert, Catherine; Duprat, Simone; Wincker, Patrick; Ornston, L. Nicholas; Weissenbach, Jean; Marlière, Philippe; Cohen, Georges N.; Médigue, Claudine

    2004-01-01

    Acinetobacter sp. strain ADP1 is a nutritionally versatile soil bacterium closely related to representatives of the well-characterized Pseudomonas aeruginosa and Pseudomonas putida. Unlike these bacteria, the Acinetobacter ADP1 is highly competent for natural transformation which affords extraordinary convenience for genetic manipulation. The circular chromosome of the Acinetobacter ADP1, presented here, encodes 3325 predicted coding sequences, of which 60% have been classified based on sequence similarity to other documented proteins. The close evolutionary proximity of Acinetobacter and Pseudomonas species, as judged by the sequences of their 16S RNA genes and by the highest level of bidirectional best hits, contrasts with the extensive divergence in the GC content of their DNA (40 versus 62%). The chromosomes also differ significantly in size, with the Acinetobacter ADP1 chromosome <60% of the length of the Pseudomonas counterparts. Genome analysis of the Acinetobacter ADP1 revealed genes for metabolic pathways involved in utilization of a large variety of compounds. Almost all of these genes, with orthologs that are scattered in other species, are located in five major ‘islands of catabolic diversity’, now an apparent ‘archipelago of catabolic diversity’, within one-quarter of the overall genome. Acinetobacter ADP1 displays many features of other aerobic soil bacteria with metabolism oriented toward the degradation of organic compounds found in their natural habitat. A distinguishing feature of this genome is the absence of a gene corresponding to pyruvate kinase, the enzyme that generally catalyzes the terminal step in conversion of carbohydrates to pyruvate for respiration by the citric acid cycle. This finding supports the view that the cycle itself is centrally geared to the catabolic capabilities of this exceptionally versatile organism. PMID:15514110

  6. Effect of Acinetobacter sp on metalaxyl degradation and metabolite profile of potato seedlings (Solanum tuberosum L.) alpha variety.

    PubMed

    Zuno-Floriano, Fabiola G; Miller, Marion G; Aldana-Madrid, Maria L; Hengel, Matt J; Gaikwad, Nilesh W; Tolstikov, Vladimir; Contreras-Cortés, Ana G

    2012-01-01

    One of the most serious diseases in potato cultivars is caused by the pathogen Phytophthora infestans, which affects leaves, stems and tubers. Metalaxyl is a fungicide that protects potato plants from Phytophthora infestans. In Mexico, farmers apply metalaxyl 35 times during the cycle of potato production and the last application is typically 15 days before harvest. There are no records related to the presence of metalaxyl in potato tubers in Mexico. In the present study, we evaluated the effect of Acinetobacter sp on metalaxyl degradation in potato seedlings. The effect of bacteria and metalaxyl on the growth of potato seedlings was also evaluated. A metabolite profile analysis was conducted to determine potential molecular biomarkers produced by potato seedlings in the presence of Acinetobacter sp and metalaxyl. Metalaxyl did not affect the growth of potato seedlings. However, Acinetobacter sp strongly affected the growth of inoculated seedlings, as confirmed by plant length and plant fresh weights which were lower in inoculated potato seedlings (40% and 27%, respectively) compared to the controls. Acinetobacter sp also affected root formation. Inoculated potato seedlings showed a decrease in root formation compared to the controls. LC-MS/MS analysis of metalaxyl residues in potato seedlings suggests that Acinetobacter sp did not degrade metalaxyl. GC-TOF-MS platform was used in metabolic profiling studies. Statistical data analysis and metabolic pathway analysis allowed suggesting the alteration of metabolic pathways by both Acinetobacter sp infection and metalaxyl treatment. Several hundred metabolites were detected, 137 metabolites were identified and 15 metabolic markers were suggested based on statistical change significance found with PLS-DA analysis. These results are important for better understanding the interactions of putative endophytic bacteria and pesticides on plants and their possible effects on plant metabolism. PMID:22363586

  7. Effect of Acinetobacter sp on Metalaxyl Degradation and Metabolite Profile of Potato Seedlings (Solanum tuberosum L.) Alpha Variety

    PubMed Central

    Zuno-Floriano, Fabiola G.; Miller, Marion G.; Aldana-Madrid, Maria L.; Hengel, Matt J.; Gaikwad, Nilesh W.; Tolstikov, Vladimir; Contreras-Cortés, Ana G.

    2012-01-01

    One of the most serious diseases in potato cultivars is caused by the pathogen Phytophthora infestans, which affects leaves, stems and tubers. Metalaxyl is a fungicide that protects potato plants from Phytophthora infestans. In Mexico, farmers apply metalaxyl 35 times during the cycle of potato production and the last application is typically 15 days before harvest. There are no records related to the presence of metalaxyl in potato tubers in Mexico. In the present study, we evaluated the effect of Acinetobacter sp on metalaxyl degradation in potato seedlings. The effect of bacteria and metalaxyl on the growth of potato seedlings was also evaluated. A metabolite profile analysis was conducted to determine potential molecular biomarkers produced by potato seedlings in the presence of Acinetobacter sp and metalaxyl. Metalaxyl did not affect the growth of potato seedlings. However, Acinetobacter sp strongly affected the growth of inoculated seedlings, as confirmed by plant length and plant fresh weights which were lower in inoculated potato seedlings (40% and 27%, respectively) compared to the controls. Acinetobacter sp also affected root formation. Inoculated potato seedlings showed a decrease in root formation compared to the controls. LC-MS/MS analysis of metalaxyl residues in potato seedlings suggests that Acinetobacter sp did not degrade metalaxyl. GC–TOF–MS platform was used in metabolic profiling studies. Statistical data analysis and metabolic pathway analysis allowed suggesting the alteration of metabolic pathways by both Acinetobacter sp infection and metalaxyl treatment. Several hundred metabolites were detected, 137 metabolites were identified and 15 metabolic markers were suggested based on statistical change significance found with PLS-DA analysis. These results are important for better understanding the interactions of putative endophytic bacteria and pesticides on plants and their possible effects on plant metabolism. PMID:22363586

  8. Detection of New Delhi metallo-β-lactamase (encoded by blaNDM-1) in Acinetobacter schindleri during routine surveillance.

    PubMed

    McGann, Patrick; Milillo, Michael; Clifford, Robert J; Snesrud, Erik; Stevenson, Lindsay; Backlund, Michael G; Viscount, Helen B; Quintero, Reyes; Kwak, Yoon I; Zapor, Michael J; Waterman, Paige E; Lesho, Emil P

    2013-06-01

    A carbapenem-resistant Alcaligenes faecalis strain was isolated from a surveillance swab of a service member injured in Afghanistan. The isolate was positive for bla(NDM) by real-time PCR. Species identification was reevaluated on three identification systems but was inconclusive. Genome sequencing indicated that the closest relative was Acinetobacter schindleri and that bla(NDM-1) was carried on a plasmid that shared >99% identity with one identified in an Acinetobacter lwoffii isolate. The isolate also carried a novel chromosomally encoded class D oxacillinase. PMID:23554204

  9. Characterizing In Vivo Pharmacodynamics of Carbapenems against Acinetobacter baumannii in a Murine Thigh Infection Model To Support Breakpoint Determinations

    PubMed Central

    MacVane, Shawn H.; Crandon, Jared L.

    2014-01-01

    Pharmacodynamic profiling data of carbapenems for Acinetobacter spp. are sparse. This study aimed to determine the pharmacodynamic targets of carbapenems for Acinetobacter baumannii based on a range of percentages of the dosing interval in which free drug concentrations remained above the MIC (fT>MIC) in the neutropenic murine thigh infection model. fT>MIC values of 23.7%, 32.8%, and 47.5% resulted in stasis, 1-log reductions, and 2-log reductions in bacterial density after 24 h, respectively. The pharmacodynamic targets of carbapenems for A. baumannii demonstrated in vivo are similar to those of other Gram-negative bacteria. PMID:24165174

  10. AdeIJK, a Resistance-Nodulation-Cell Division Pump Effluxing Multiple Antibiotics in Acinetobacter baumannii▿

    PubMed Central

    Damier-Piolle, Laurence; Magnet, Sophie; Brémont, Sylvie; Lambert, Thierry; Courvalin, Patrice

    2008-01-01

    We have identified a second resistance-nodulation-cell division (RND)-type efflux pump, AdeIJK, in clinical isolate Acinetobacter baumannii BM4454. The adeI, adeJ, and adeK genes encode, respectively, the membrane fusion, RND, and outer membrane components of the pump. AdeJ belongs to the AcrB protein family (57% identity with AcrB from Escherichia coli). mRNA analysis by Northern blotting and reverse transcription-PCR indicated that the genes were cotranscribed. Overexpression of the cloned adeIJK operon was toxic in both E. coli and Acinetobacter. The adeIJK genes were detected in all of the 60 strains of A. baumannii tested. The two latter observations suggest that the AdeIJK complex might contribute to intrinsic but not to acquired antibiotic resistance in Acinetobacter. To characterize the substrate specificity of the pump, we have constructed derivatives of BM4454 in which adeIJK (strain BM4579), adeABC (strain BM4561), or both groups of genes (strain BM4652) were inactivated by deletion-insertion. Determination of the antibiotic susceptibility of these strains and of BM4652 and BM4579, in which the adeIJK operon was provided in trans, indicated that the AdeIJK pump contributes to resistance to β-lactams, chloramphenicol, tetracycline, erythromycin, lincosamides, fluoroquinolones, fusidic acid, novobiocin, rifampin, trimethoprim, acridine, safranin, pyronine, and sodium dodecyl sulfate. The chemical structure of these molecules suggests that amphiphilic compounds are the preferred substrates. The AdeABC and AdeIJK efflux systems contributed in a more than additive fashion to tigecycline resistance. PMID:18086852

  11. Characterization of hydrogen peroxide-resistant Acinetobacter species isolated during the Mars Phoenix spacecraft assembly.

    PubMed

    Derecho, I; McCoy, K B; Vaishampayan, P; Venkateswaran, K; Mogul, R

    2014-10-01

    The microbiological inventory of spacecraft and the associated assembly facility surfaces represent the primary pool of forward contaminants that may impact the integrity of life-detection missions. Herein, we report on the characterization of several strains of hydrogen peroxide-resistant Acinetobacter, which were isolated during the Mars Phoenix lander assembly. All Phoenix-associated Acinetobacter strains possessed very high catalase specific activities, and the specific strain, A. gyllenbergii 2P01AA, displayed a survival against hydrogen peroxide (no loss in 100 mM H2O2 for 1 h) that is perhaps the highest known among Gram-negative and non-spore-forming bacteria. Proteomic characterizations reveal a survival mechanism inclusive of proteins coupled to peroxide degradation (catalase and alkyl hydroperoxide reductase), energy/redox management (dihydrolipoamide dehydrogenase), protein synthesis/folding (EF-G, EF-Ts, peptidyl-tRNA hydrolase, DnaK), membrane functions (OmpA-like protein and ABC transporter-related protein), and nucleotide metabolism (HIT family hydrolase). Together, these survivability and biochemical parameters support the hypothesis that oxidative tolerance and the related biochemical features are the measurable phenotypes or outcomes for microbial survival in the spacecraft assembly facilities, where the low-humidity (desiccation) and clean (low-nutrient) conditions may serve as selective pressures. Hence, the spacecraft-associated Acinetobacter, due to the conferred oxidative tolerances, may ultimately hinder efforts to reduce spacecraft bioburden when using chemical sterilants, thus suggesting that non-spore-forming bacteria may need to be included in the bioburden accounting for future life-detection missions. PMID:25243569

  12. Acinetobacter, Aeromonas, and Trichococcus populations dominate the microbial community within urban sewer infrastructure

    PubMed Central

    VandeWalle, J. L.; Goetz, G.W.; Huse, S.M.; Morrison, H. G.; Sogin, M.L.; Hoffmann, R.G.; Yan, K.; McLellan, S.L.

    2012-01-01

    We evaluated the population structure and temporal dynamics of the dominant community members within sewage influent from two wastewater treatment plants (WWTPs) in Milwaukee, WI. We generated >1.1M bacterial pyrotag sequences from the V6 hypervariable region of 16S rRNA genes from 38 influent samples and two samples taken upstream in the sanitary sewer system. Only a small fraction of pyrotags from influent samples (~15%) matched sequences from human fecal samples. The fecal components of the sewage samples included enriched pyrotag populations from Lactococcus and Enterobacteriaceae relative to their fractional representation in human fecal samples. In contrast to the large number of distinct pyrotags that represent fecal bacteria such as Lachnospiraceae and Bacteroides, only one or two unique V6 sequences represented Acinetobacter, Trichococcus and Aeromonas, which collectively account for nearly 35% of the total sewage community. Two dominant Acinetobacter V6 pyrotags (designated Acineto tag 1 and Acineto tag 2) fluctuated inversely with a seasonal pattern over a 3-year period, suggesting two distinct Acinetobacter populations respond differently to ecological forcings in the system. A single nucleotide change in the V6 pyrotags accounted for the difference in these populations and corresponded to two phylogenically distinct clades based on full-length sequences. Analysis of wavelet functions, derived from a mathematical model of temporal fluctuations, demonstrated that other abundant sewer associated populations including Trichococcus and Aeromonas had temporal patterns similar to either Acineto tag 1 or Acineto tag 2. Populations with related temporal fluctuations were found to significantly correlate with the same WWTP variables (5-day BOD, flow, ammonia, total phosphorous, and suspended solids). These findings illustrate that small differences in V6 sequences can represent phylogenetically and ecologically distinct taxa. This work provides insight into

  13. Escherichia coli Overexpressing a Baeyer-Villiger Monooxygenase from Acinetobacter radioresistens Becomes Resistant to Imipenem

    PubMed Central

    Minerdi, Daniela; Zgrablic, Ivan; Castrignanò, Silvia; Catucci, Gianluca; Medana, Claudio; Terlizzi, Maria Elena; Gribaudo, Giorgio; Gilardi, Gianfranco

    2015-01-01

    Antimicrobial resistance is a global issue currently resulting in the deaths of hundreds of thousands of people a year worldwide. Data present in the literature illustrate the emergence of many bacterial species that display resistance to known antibiotics; Acinetobacter spp. are a good example of this. We report here that Acinetobacter radioresistens has a Baeyer-Villiger monooxygenase (Ar-BVMO) with 100% amino acid sequence identity to the ethionamide monooxygenase of multidrug-resistant (MDR) Acinetobacter baumannii. Both enzymes are only distantly phylogenetically related to other canonical bacterial BVMO proteins. Ar-BVMO not only is capable of oxidizing two anticancer drugs metabolized by human FMO3, danusertib and tozasertib, but also can oxidize other synthetic drugs, such as imipenem. The latter is a member of the carbapenems, a clinically important antibiotic family used in the treatment of MDR bacterial infections. Susceptibility tests performed by the Kirby-Bauer disk diffusion method demonstrate that imipenem-sensitive Escherichia coli BL21 cells overexpressing Ar-BVMO become resistant to this antibiotic. An agar disk diffusion assay proved that when imipenem reacts with Ar-BVMO, it loses its antibiotic property. Moreover, an NADPH consumption assay with the purified Ar-BVMO demonstrates that this antibiotic is indeed a substrate, and its product is identified by liquid chromatography-mass spectrometry to be a Baeyer-Villiger (BV) oxidation product of the carbonyl moiety of the β-lactam ring. This is the first report of an antibiotic-inactivating BVMO enzyme that, while mediating its usual BV oxidation, also operates by an unprecedented mechanism of carbapenem resistance. PMID:26459905

  14. Gene-Silencing Antisense Oligomers Inhibit Acinetobacter Growth In Vitro and In Vivo

    PubMed Central

    Geller, Bruce L.; Marshall-Batty, Kimberly; Schnell, Frederick J.; McKnight, Mattie M.; Iversen, Patrick L.; Greenberg, David E.

    2013-01-01

    Background. Peptide-conjugated phosphorodiamidate morpholino oligomers (PPMOs) are synthetic DNA/RNA analogues that silence expression of specific genes. We studied whether PPMOs targeted to essential genes in Acinetobacter lwoffii and Acinetobacter baumannii are active in vitro and in vivo. Methods. PPMOs were evaluated in vitro using minimum inhibitory concentration (MIC) and viability assays, and in vivo using murine pulmonary infection models with intranasal PPMO treatment. Results. MICs of PPMOs ranged from 0.1 to 64 µM (approximately 0.6–38 µg/mL). The most effective PPMO tested was (RXR)4-AcpP, which is targeted to acpP. (RXR)4-AcpP reduced viability of A. lwoffii and A. baumannii by >103 colony-forming units/mL at 5–8 times MIC. Mice treated with ≥0.25 mg/kg of (RXR)4-AcpP survived longer and had less inflammation and bacterial lung burden than mice treated with a scrambled-sequence PPMO or phosphate-buffered saline. Treatment could be delayed after infection and still increase survival. Conclusions. PPMOs targeted to essential genes of A. lwoffii and A. baumannii were bactericidal and had MICs in a clinically relevant range. (RXR)4-AcpP increased survival of mice infected with A. lwoffii or A. baumannii, even when initial treatment was delayed after infection. PPMOs could be a viable therapeutic approach in dealing with multidrug-resistant Acinetobacter species. PMID:24130069

  15. Emergence of Acinetobacter baumannii international clone II in Brazil: reflection of a global expansion

    PubMed Central

    Martins, Natacha; Dalla-Costa, Libera; Uehara, Aline Almeida; Riley, Lee Woodland; Moreira, Beatriz Meurer

    2013-01-01

    The aim of this study was to investigate the occurrence of carbapenem-resistant Acinetobacter baumannii international clones (IC) in Curitiba, Brazil, using multilocus sequence typing and trilocus PCR-based typing schemes. IC2 was the first emerging clone. This IC was detected in an isolate from 2003 of a PFGE type spread in at least two hospitals since 1999. Subsequently, IC2 waned while IC1 and clonal complex 15/104 prevailed. This is the first description of IC2 in Brazil and Latin America. PMID:24121023

  16. Investigation of Metallo Beta Lactamases and Oxacilinases in Carbapenem Resistant Acinetobacter baumannii Strains Isolated from Inpatients

    PubMed Central

    Aksoy, M. Duygu; Çavuşlu, Şaban; Tuğrul, H. Murat

    2015-01-01

    Background: Resistance to beta-lactam antibiotics is widespread among Acinetobacter strains. Plasmid-mediated metallo beta lactamases (MBL) are responsible for carbapenem resistance, as are oxacillinases (OXA). In recent years, MBL producing carbapenem-resistant strains have been reported in the world and in Turkey in increasing rates. In our country, besides the OXA 51-like enzyme which is inherent in A. baumannii strains, OXA 58-like and OXA 23-like carbapenemases producing strains have also been widely detected. In addition, Verona Imipenemase (VIM) and (IMP)-type MBL have been reported in some centers. Aims: The aim of our study was to investigate the presence of carbapenemases in Acinetobacter strains isolated from hospitalized patients in Edirne. Study Design: Cross-sectional study. Methods: A total of 52 imipenem-resistant A. baumannii strains isolated between January and March 2013 were investigated. The presence of MBL was described phenotypically by the combined disk diffusion test (CDDT), double disk synergy test (DDST), MBL E-test (only performed in 28 strains) and modified Hodge test. blaIMP, blaVIM, blaGIM, blaSIM, blaSPM genes and blaOXA-23, blaOXA-51, blaOXA-40, blaOXA-58 genes were investigated by multiplex polymerase chain reaction (PCR). The blaNDM-1 gene was determined by PCR. Results: By modified Hodge test, 50 strains (96%) were found to be MBL positive. Positivity of MBL was 21% by both CDDT (0.1 M EDTA) and DDST. Twenty-four of 28 strains (85.7%) were positive by MBL E-test. OXA 23-like and OXA 51-like carbapenemases were detected in all strains, but OXA 58-like and OXA 40-like carbapenemases-producing A. baumannii were not detected. Also, MBL genes were not detected by genotypic methods. Conclusion: Only OXA 23-like carbapenemase was responsible for carbapenem resistance in carbapenem-resistant Acinetobacter strains in Edirne. The MBL-producing Acinetobacter strain is not yet a problem in our hospital. MBL resistance was found by

  17. Draft genome sequence of Acinetobacter baumannii strain NCTC 13423, a multidrug-resistant clinical isolate.

    PubMed

    Michiels, Joran E; Van den Bergh, Bram; Fauvart, Maarten; Michiels, Jan

    2016-01-01

    Acinetobacter baumannii is a pathogen that is becoming increasingly important and causes serious hospital-acquired infections. We sequenced the genome of A. baumannii NCTC 13423, a multidrug-resistant strain belonging to the international clone II group, isolated from a human infection in the United Kingdom in 2003. The 3,937,944 bp draft genome has a GC-content of 39.0 % and a total of 3672 predicted protein-coding sequences. The availability of genome sequences of multidrug-resistant A. baumannii isolates will fuel comparative genomic studies to help understand the worrying spread of multidrug resistance in this pathogen. PMID:27594976

  18. Clonal spread of blaOXA-72-carrying Acinetobacter baumannii sequence type 512 in Taiwan.

    PubMed

    Kuo, Han-Yueh; Hsu, Po-Jui; Chen, Jiann-Yuan; Liao, Po-Cheng; Lu, Chia-Wei; Chen, Chang-Hua; Liou, Ming-Li

    2016-07-01

    This is the first report to show an insidious outbreak of armA- and blaOXA-72-carrying Acinetobacter baumannii sequence type 512 (ST512) at a study hospital in northern Taiwan. Multilocus sequence typing revealed that this was a ST512 clone. All of the isolates with ST512 carried a novel 12,056-bp repGR2 in combination with a repGR12-type plasmid. This plasmid, designated pAB-ML, had one copy of the blaOXA-72 gene that was flanked by XerC/XerD-like sites and conferred resistance to carbapenems. PMID:27242318

  19. Colistin-Resistant Acinetobacter baumannii Clinical Strains with Deficient Biofilm Formation

    PubMed Central

    Dafopoulou, Konstantina; Xavier, Basil Britto; Hotterbeekx, An; Janssens, Lore; Lammens, Christine; Dé, Emmanuelle; Goossens, Herman; Tsakris, Athanasios; Malhotra-Kumar, Surbhi

    2015-01-01

    In two pairs of clinical colistin-susceptible/colistin-resistant (Csts/Cstr) Acinetobacter baumannii strains, the Cstr strains showed significantly decreased biofilm formation in static and dynamic assays (P < 0.001) and lower relative fitness (P < 0.05) compared with those of the Csts counterparts. The whole-genome sequencing comparison of strain pairs identified a mutation converting a stop codon to lysine (*241K) in LpsB (involved in lipopolysaccharide [LPS] synthesis) in one Cstr strain and a frameshift mutation in CarO and the loss of a 47,969-bp element containing multiple genes associated with biofilm production in the other. PMID:26666921

  20. Inhibition of LpxC Increases Antibiotic Susceptibility in Acinetobacter baumannii.

    PubMed

    García-Quintanilla, Meritxell; Caro-Vega, José M; Pulido, Marina R; Moreno-Martínez, Patricia; Pachón, Jerónimo; McConnell, Michael J

    2016-08-01

    LpxC inhibitors have generally shown poor in vitro activity against Acinetobacter baumannii We show that the LpxC inhibitor PF-5081090 inhibits lipid A biosynthesis, as determined by silver staining and measurements of endotoxin levels, and significantly increases cell permeability. The presence of PF-5081090 at 32 mg/liter increased susceptibility to rifampin, vancomycin, azithromycin, imipenem, and amikacin but had no effect on susceptibility to ciprofloxacin and tigecycline. Potentiating existing antibiotics with LpxC inhibitors may represent an alternative treatment strategy for multidrug-resistant A. baumannii. PMID:27270288

  1. Transferable amikacin resistance in Acinetobacter spp. due to a new type of 3'-aminoglycoside phosphotransferase.

    PubMed Central

    Lambert, T; Gerbaud, G; Courvalin, P

    1988-01-01

    Acinetobacter baumannii BM2580 resistant to kanamycin and structurally related antibiotics, including amikacin, was isolated from a clinical specimen. A phosphocellulose paper-binding assay and DNA annealing studies indicated that resistance to aminoglycosides in BM2580 was due to synthesis of a new type of 3'-aminoglycoside phosphotransferase. The gene conferring resistance to kanamycin-amikacin in this strain was carried by a 63-kilobase plasmid, pIP1841, self-transferable to A. baumannii, A. haemolyticus, and A. lwoffii but not to Escherichia coli. The aminoglycoside resistance gene of pIP1841 was cloned in E. coli, where it was expressed. Images PMID:2831812

  2. Tn125-Related Acquisition of blaNDM-Like Genes in Acinetobacter baumannii

    PubMed Central

    Poirel, Laurent; Bonnin, Rémy A.; Boulanger, Anne; Schrenzel, Jacques; Kaase, Martin

    2012-01-01

    A multidrug-resistant Acinetobacter baumannii isolate recovered from a patient hospitalized in Switzerland after a transfer from Serbia produced the NDM-1 carbapenemase. The blaNDM-1 gene was part of a chromosomally located Tn125 composite transposon bracketed by two copies of the same insertion sequence, ISAba125. This transposon was also associated with the acquisition and expression of the blaNDM-2 gene in an A. baumannii isolate in Germany. Tn125 appears to be the main vehicle for dissemination of blaNDM genes in that species. PMID:22143526

  3. Growth of Acinetobacter sp. strain HO1-N on n-hexadecanol: physiological and ultrastructural characteristics

    SciTech Connect

    Singer, M.E.; Tyler, S.M.; Finnerty, W.R.

    1985-04-01

    The growth of Acinetobacter sp. strain HO1-N on hexadecanol results in the formation of intracytoplasmic membranes and intracellular rectangular inclusions containing one of the end products of hexadecanol metabolism, hexadecyl palmitate. The intracellular inclusions were purified and characterized as wax ester inclusions consisting of 85.6% hexadecyl palmitate, 4.8% hexadecanol, and 9.6% phospholipid, with a phospholipid-to-protein ratio of 0.42 ..mu..mol of lipid phosphate per mg of inclusion protein. The cellular lipids consisted of 69.8% hexadecyl palmitate, 22.8% phospholipid, 1.9% triglyceride, 4.7% mono- and diglyceride, 0.1% free fatty acid, and 0.8% hexadecanol, as compared with 98% hexadecyl palmitate and 1.9% triglyceride, which comprised the extracellular lipids. Cell-associated hexadecanol represented 0.05% of the exogenously supplied hexadecanol, with hexadecyl palmitate accounting for 14.7% of the total cellular dry weight. Acinetobacter sp. strain HO1-N possesses a mechanism for the intracellular packaging of hexadecyl palmitate in wax ester inclusions, which differ in structure and chemical composition from hydrocarbon inclusions isolated from hexadecane-grown cells.

  4. Characterization and application of a novel bioemulsifier in crude oil degradation by Acinetobacter beijerinckii ZRS.

    PubMed

    Zhao, Yi-He; Chen, Li-Yuan; Tian, Zi-Jing; Sun, Yue; Liu, Jin-Biao; Huang, Lei

    2016-02-01

    Bioemulsifiers can be applicated in a variety of areas such as bioremediation and microbial-enhanced oil recovery. The present study was aimed at bioemulsifier production, optimization, stability studies, and applications of the bioemulsifier produced by one of these strains, Acinetobacter beijerinckii ZRS. When Acinetobacter beijerinckii ZRS is cultured with hexadecane as a carbon source, it produces a novel extracellular emulsifying agent that does not cause remarkable reductions in surface tension. In order to enhance bioemulsifier production, response surface methodology was applied to optimize the culture medium. The bioemulsifier was subjected to thin-layer chromatography, Fourier transform infrared spectroscopy (FTIR), gel filtration chromatography, matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF), and nuclear magnetic resonance (NMR), which allowed for the identification of a novel polymeric bioemulsifier. The bioemulsifier retained its properties at a wide range of pH values, high temperatures and high salinities (up to 5% [w⁄v] Na(+) and 24% Ca(2+)). To deduce the role of this bioemulsifier in a coastal zone oil spill, the propagation of oil-degrading bacteria on oil-coated grains of gravel immersed in seawater was investigated in beach-simulating tanks. The bioemulsifier played a positive role in the degradation of these hydrocarbons and increasing the light crude oil degradation rate of the bacterial strain from 37.5 to 58.3% within 56 days. Therefore, this bioemulsifier shows strong potential to be used for bioremediation of oil pollution in marine environments. PMID:26576943

  5. Structure and context of Acinetobacter transposons carrying the oxa23 carbapenemase gene.

    PubMed

    Nigro, Steven J; Hall, Ruth M

    2016-05-01

    Theoxa23gene encoding the OXA-23 carbapenemase (and several minor variants of it) is widespread inAcinetobacter baumanniiclinical isolates and compromises treatment with carbapenem antibiotics. The gene is derived from the chromosome ofAcinetobacter radioresistenswhere it is an intrinsic gene, here designatedoxaAr InA. baumanniiand otherAcinetobacterspecies,oxa23is usually preceded by an IS, ISAba1, which supplies the strong promoter required for the gene to confer clinically relevant levels of resistance. TheoxaArgene appears to have been mobilized twice creating Tn2008and Tn2008B, both of which consist of a single ISAba1 and anA. radioresistens-derived fragment. Tn2006and Tn2009are clearly derived from Tn2008Band are each made up of Tn2008Bwith an additional segment of unknown origin and an additional ISAba1, creating a compound transposon. Tn2006, Tn2008and possibly Tn2008Bare globally disseminated, while Tn2009has as yet only been found in China. Of the four ISAba1-associated transposons, Tn2006has been most frequently observed worldwide and Tn2006in Tn6022, known as AbaR4, appears to contribute significantly to the dissemination ofoxa23 Moreover, AbaR4, Tn2006, Tn2008and Tn2009have each been found in conjugative plasmids, further facilitating their spread. PMID:26755496

  6. Resources for Genetic and Genomic Analysis of Emerging Pathogen Acinetobacter baumannii

    PubMed Central

    Ramage, Elizabeth; Weiss, Eli J.; Radey, Matthew; Hayden, Hillary S.; Held, Kiara G.; Huse, Holly K.; Zurawski, Daniel V.; Brittnacher, Mitchell J.; Manoil, Colin

    2015-01-01

    ABSTRACT Acinetobacter baumannii is a Gram-negative bacterial pathogen notorious for causing serious nosocomial infections that resist antibiotic therapy. Research to identify factors responsible for the pathogen's success has been limited by the resources available for genome-scale experimental studies. This report describes the development of several such resources for A. baumannii strain AB5075, a recently characterized wound isolate that is multidrug resistant and displays robust virulence in animal models. We report the completion and annotation of the genome sequence, the construction of a comprehensive ordered transposon mutant library, the extension of high-coverage transposon mutant pool sequencing (Tn-seq) to the strain, and the identification of the genes essential for growth on nutrient-rich agar. These resources should facilitate large-scale genetic analysis of virulence, resistance, and other clinically relevant traits that make A. baumannii a formidable public health threat. IMPORTANCE Acinetobacter baumannii is one of six bacterial pathogens primarily responsible for antibiotic-resistant infections that have become the scourge of health care facilities worldwide. Eliminating such infections requires a deeper understanding of the factors that enable the pathogen to persist in hospital environments, establish infections, and resist antibiotics. We present a set of resources that should accelerate genome-scale genetic characterization of these traits for a reference isolate of A. baumannii that is highly virulent and representative of current outbreak strains. PMID:25845845

  7. An alkaline lipase from organic solvent tolerant Acinetobacter sp. EH28: Application for ethyl caprylate synthesis.

    PubMed

    Ahmed, Eltayib Hassan; Raghavendra, Tripti; Madamwar, Datta

    2010-05-01

    A mesophilic bacterium producing a thermostable alkaline lipase was isolated from oil rich soil sample and identified as Acinetobacter sp. EH28. The lipase was partially purified by ammonium sulphate precipitation followed by hydrophobic interaction chromatography with 24.2-fold purification and 57.1U/ml specific activity. The partially purified enzyme exhibited maximum activity at pH 10.0 and at 50 degrees C and was highly stable at 50 degrees C retaining 100% of its activity up to 90min. It was highly stable and retained more than 80% of its initial activity upon exposure to various organic solvents. The EH28 lipase was used for synthesis of the flavor ester ethyl caprylate in organic solvents, thus providing a concept of application of Acinetobacter sp. lipase in non-aqueous catalysis. Reaction parameters best suited for this esterification reaction were 40 degrees C reaction temperature, 1.3:1 ratio of caprylic acid to ethanol and cyclohexane as the medium. PMID:20096565

  8. Comparative analysis of the lipids of Acinetobacter species grown on hexadecane.

    PubMed Central

    Makula, R A; Lockwood, P J; Finnerty, W R

    1975-01-01

    A comparative analysis of the cellular and extracellular lipids of Acinetobacter species HO1-N indicated basic physiological differences in hexadecane-grown cells. The cellular lipids obtained from hexadecane-grown cells were characterized by 3- and 18-fold increases in the phospholipid fraction and the mono- and diglyceride fraction, respectively, over that obtained from nutrient broth-yeast extract-grown cells. The cellular-associated pools of hexadecane were shown to comprise approximately 8% of the dry cell weight of hexadecane-grown cells. The extracellular lipids obtained from the culture broths of hexadecane-grown cells were comprised of triglyceride, mono- and diglyceride, free fatty acid, and wax ester. These lipids were either absent or present in minor concentrations in the culture broths of nutrient broth-yeast extract-grown cells. The exponential growth of Acinetobacter sp. on hexadecane was characterized by the significant accumulation of free fatty acid, monoglyceride, and diglyceride in the culture medium. Wax ester was shown to represent a minor portion of the extracellular lipids during the exponential growth phase, appearing in significant proportion only after the culture had entered the stationary phase of growth. PMID:1116989

  9. Chemical Analysis of the Outer Membrane and Other Layers of the Cell Envelope of Acinetobacter sp

    PubMed Central

    Thorne, Kareen J. I.; Thornley, Margaret J.; Glauert, Audrey M.

    1973-01-01

    Chemical analysis of fractions of the cell envelope of Acinetobacter sp. strain MJT/F5/199A, prepared by breakage in the French press and removal of plasma membranes, followed by sequential treatment with lysozyme and with papain, confirmed the existence of layers previously identified by electron microscopy. Outside the plasma membrane and periplasmic space, the envelope is composed of (i) a peptidoglycan-containing dense layer, (ii) an intermediate layer, (iii) a lipopolysaccharide-containing outer membrane, and (iv) an ordered array of protein subunits. A small amount of carbohydrate (3%) is found associated with protein in the fraction containing both the surface subunits and the intermediate layer. The papain-treated outer membranes contain 67% protein, 24% lipid, together with 11% lipopolysaccharide, and about 6% of non-lipopolysaccharide hexosamine. Lipid is located only in the papain-treated outer-membrane and is mainly phospholipid: 29% phosphatidyl glycerol, 30% phosphatidyl ethanolamine, and 40% cardiolipin. The principal fatty acid is C18:1. Significant amounts of alcohols16:1 and alcohols18:1, which are found in Acinetobacter waxes, were recovered from the outer membrane. Images PMID:4745422

  10. Antibiotic-Resistant Acinetobacter baumannii Increasing Success Remains a Challenge as a Nosocomial Pathogen

    PubMed Central

    Gonzalez-Villoria, Ana Maria; Valverde-Garduno, Veronica

    2016-01-01

    Antibiotic-resistant infectious bacteria currently imply a high risk and therefore constitute a strong challenge when treating patients in hospital settings. Characterization of these species and of particular strains is a priority for the establishment of diagnostic tests and preventive procedures. The relevance of Acinetobacter baumannii as a problematic microorganism in inpatient facilities, particularly intensive care units, has increased over time. This review aims to draw attention to (i) the historical emergence of carbapenem-resistant Acinetobacter baumannii, (ii) the current status of surveillance needs in Latin America, and (iii) recent data suggesting that A. baumannii continues to spread and evolve in hospital settings. First, we present synopsis of the series of events leading to the discovery and precise identification of this microorganism in hospital settings. Then key events in the acquisition of antibiotic-resistant genes by this microorganism are summarized, highlighting the race between new antibiotic generation and emergence of A. baumannii resistant strains. Here we review the historical development of this species as an infectious threat, the current state of its distribution, and antibiotic resistance characteristics, and we discuss future prospects for its control. PMID:26966582

  11. Screening of Herbal-Based Bioactive Extract Against Carbapenem-Resistant Strain of Acinetobacter baumannii.

    PubMed

    Tiwari, Monalisa; Roy, Ranita; Tiwari, Vishvanath

    2016-07-01

    Acinetobacter baumannii is grouped in the ESKAPE pathogens by Infectious Disease Society of America, which is linked to high degree of morbidity, mortality, and increased costs. The high level of acquired and intrinsic resistance mechanisms of these bacteria makes it an urgent requirement to find a suitable alternative to carbapenem, a commonly prescribed drug for Acinetobacter infection. In this study, methanolic extracts of six medicinal plants were subjected to phytochemical screening and their antimicrobial activity was tested against two strains of A. baumannii (ATCC 19606, carbapenem-sensitive strain, and RS 307, carbapenem-resistant strain). Synergistic effect of the plant extracts and antibiotics was also tested. Bael or Aegle marmelos contains tannin, phenol, terpenoids, glycoside, alkaloids, coumarine, steroid, and quinones. Flowers of madar or Calotropis procera possess tannin, phenol, terpenoids, glycoside, quinone, anthraquinone, anthocyanin, coumarin, and steroid. An inhibitory growth curve was seen for both the bacterial strains when treated with A. marmelos, Curcuma longa, and leaves and flowers of C. procera. Antibiotics alone showed a small zone of inhibition, but when used with herbal extracts they exhibited larger zone of inhibition. Synergistic effect of A. marmelos and imipenem was the best against both the strains of A. baumannii. From this study, it can be concluded that extracts from A. marmelos and leaves and flowers of C. procera exhibited the most effective antibacterial activity. These herbal extracts may be used to screen the bioactive compound against the carbapenem-resistant strain of A. baumannii. PMID:26910023

  12. Characterisation of Pellicles Formed by Acinetobacter baumannii at the Air-Liquid Interface

    PubMed Central

    Nait Chabane, Yassine; Marti, Sara; Rihouey, Christophe; Alexandre, Stéphane; Hardouin, Julie; Lesouhaitier, Olivier; Vila, Jordi; Kaplan, Jeffrey B.; Jouenne, Thierry; Dé, Emmanuelle

    2014-01-01

    The clinical importance of Acinetobacter baumannii is partly due to its natural ability to survive in the hospital environment. This persistence may be explained by its capacity to form biofilms and, interestingly, A. baumannii can form pellicles at the air-liquid interface more readily than other less pathogenic Acinetobacter species. Pellicles from twenty-six strains were morphologically classified into three groups: I) egg-shaped (27%); II) ball-shaped (50%); and III) irregular pellicles (23%). One strain representative of each group was further analysed by Brewster’s Angle Microscopy to follow pellicle development, demonstrating that their formation did not require anchoring to a solid surface. Total carbohydrate analysis of the matrix showed three main components: Glucose, GlcNAc and Kdo. Dispersin B, an enzyme that hydrolyzes poly-N-acetylglucosamine (PNAG) polysaccharide, inhibited A. baumannii pellicle formation, suggesting that this exopolysaccharide contributes to pellicle formation. Also associated with the pellicle matrix were three subunits of pili assembled by chaperon-usher systems: the major CsuA/B, A1S_1510 (presented 45% of identity with the main pilin F17-A from enterotoxigenic Escherichia coli pili) and A1S_2091. The presence of both PNAG polysaccharide and pili systems in matrix of pellicles might contribute to the virulence of this emerging pathogen. PMID:25360550

  13. Clonal diversity of Acinetobacter baumannii clinical isolates revealed by a snapshot study

    PubMed Central

    2013-01-01

    Background Acinetobacter baumannii is a notorious opportunistic pathogen mainly associated with hospital-acquired infections. Studies on the clonal relatedness of isolates could lay the foundation for effective infection control. A snapshot study was performed to investigate the clonal relatedness of A. baumannii clinical isolates in our local settings. Results Among 82 non-repetitive Acinetobacter spp. clinical isolates that were recovered during a period of four days in 13 hospitals in Sichuan, Southwest China, 67 isolates were identified as A. baumannii. Half of the 67 A. baumannii isolates were non-susceptible to carbapenems. blaOXA-23 was the only acquired carbapenemase gene detected, present in 40 isolates including five carbapenem-susceptible ones. The isolates belonged to 62 pulsotypes determined by PFGE and 31 sequence types (ST) by multi-locus sequence typing. Forty-three isolates belonged to the globally-disseminated clonal complex 92, among which ST75, ST92 and ST208 were the most common sequence types. Conclusions Clinical isolates of A. baumannii were diverse in clonality in this snapshot study. However, most of the isolates belonged to the globally-distributed clonal complex CC92. ST75, ST92 and ST208 were the most common types in our region. In particular, ST208 might be an emerging lineage carrying blaOXA-23. PMID:24144168

  14. Code blue: Acinetobacter baumannii, a nosocomial pathogen with a role in the oral cavity.

    PubMed

    Richards, A M; Abu Kwaik, Y; Lamont, R J

    2015-02-01

    Actinetobacter baumannii is an important nosocomial pathogen that can cause a wide range of serious conditions including pneumonia, meningitis, necrotizing fasciitis and sepsis. It is also a major cause of wound infections in military personnel injured during the conflicts in Afghanistan and Iraq, leading to its popular nickname of 'Iraqibacter'. Contributing to its success in clinical settings is resistance to environmental stresses such as desiccation and disinfectants. Moreover, in recent years there has been a dramatic increase in the number of A. baumannii strains with resistance to multiple antibiotic classes. Acinetobacter baumannii is an inhabitant of oral biofilms, which can act as a reservoir for pneumonia and chronic obstructive pulmonary disease. Subgingival colonization by A. baumannii increases the risk of refractory periodontitis. Pathogenesis of the organism involves adherence, biofilm formation and iron acquisition. In addition, A. baumannii can induce apoptotic cell death in epithelial cells and kill hyphal forms of Candida albicans. Virulence factors that have been identified include pili, the outer membrane protein OmpA, phospholipases and extracellular polysaccharide. Acinetobacter baumannii can sense blue light through a blue-light sensing using flavin (BLUF) domain protein, BlsA. The resulting conformational change in BlsA leads to changes in gene expression, including virulence genes. PMID:25052812

  15. Characterisation of pellicles formed by Acinetobacter baumannii at the air-liquid interface.

    PubMed

    Nait Chabane, Yassine; Marti, Sara; Rihouey, Christophe; Alexandre, Stéphane; Hardouin, Julie; Lesouhaitier, Olivier; Vila, Jordi; Kaplan, Jeffrey B; Jouenne, Thierry; Dé, Emmanuelle

    2014-01-01

    The clinical importance of Acinetobacter baumannii is partly due to its natural ability to survive in the hospital environment. This persistence may be explained by its capacity to form biofilms and, interestingly, A. baumannii can form pellicles at the air-liquid interface more readily than other less pathogenic Acinetobacter species. Pellicles from twenty-six strains were morphologically classified into three groups: I) egg-shaped (27%); II) ball-shaped (50%); and III) irregular pellicles (23%). One strain representative of each group was further analysed by Brewster's Angle Microscopy to follow pellicle development, demonstrating that their formation did not require anchoring to a solid surface. Total carbohydrate analysis of the matrix showed three main components: Glucose, GlcNAc and Kdo. Dispersin B, an enzyme that hydrolyzes poly-N-acetylglucosamine (PNAG) polysaccharide, inhibited A. baumannii pellicle formation, suggesting that this exopolysaccharide contributes to pellicle formation. Also associated with the pellicle matrix were three subunits of pili assembled by chaperon-usher systems: the major CsuA/B, A1S_1510 (presented 45% of identity with the main pilin F17-A from enterotoxigenic Escherichia coli pili) and A1S_2091. The presence of both PNAG polysaccharide and pili systems in matrix of pellicles might contribute to the virulence of this emerging pathogen. PMID:25360550

  16. Fatal skin and soft tissue infection of multidrug resistant Acinetobacter baumannii: A case report

    PubMed Central

    Ali, Aqsa; Botha, John; Tiruvoipati, Ravindranath

    2014-01-01

    INTRODUCTION Acinetobacter baumannii is usually associated with respiratory tract, urinary tract and bloodstream infections. Recent reports suggest that it is increasingly causing skin and soft tissue infections. It is also evolving as a multidrug resistant organism that can be difficult to treat. We present a fatal case of multidrug resistant A. baumannii soft tissue infection and review of relevant literature. PRESENTATION OF CASE A 41 year old morbidly obese man, with history of alcoholic liver disease presented with left superficial pre-tibial abrasions and cellulitis caused by multidrug resistant (MDR) A. baumannii. In spite of early antibiotic administration he developed extensive myositis and fat necrosis requiring extensive and multiple surgical debridements. He deteriorated despite appropriate antibiotic therapy and multiple surgical interventions with development of multi-organ failure and died. DISCUSSION Managing Acinetobacter infections remains difficult due to the array of resistance and the pathogens ability to develop new and ongoing resistance. The early diagnosis of necrotizing soft tissue infection may be challenging, but the key to successful management of patients with necrotizing soft tissue infection are early recognition and complete surgical debridement. CONCLUSION A. baumannii is emerging as an important cause of severe, life-threatening soft tissue infections. Multidrug resistant A. baumannii soft tissue infections may carry a high mortality in spite of early and aggressive treatment. Clinicians need to consider appropriate early empirical antibiotic coverage or the use of combination therapy to include MDR A. baumannii as a cause of skin and soft tissue infections. PMID:25016080

  17. Heterotrophic nitrogen removal by Acinetobacter sp. Y1 isolated from coke plant wastewater.

    PubMed

    Liu, YuXiang; Hu, Tingting; Song, Yujie; Chen, Hongping; Lv, YongKang

    2015-11-01

    A strain of Acinetobacter sp. Y1, which exhibited an amazing ability to remove ammonium, nitrite and nitrate, was isolated from the activated sludge of a coking wastewater treatment plant. The aim of this work was to study the ability, influence factors and possible pathway of nitrogen removal by Acinetobacter sp. Y1. Results showed that maximum removal rate of NH4(+)-N by the strain was 10.28 mg-N/L/h. Carbon source had significant influence on the growth and ammonium removal efficiencies of strain Y1. Pyruvate, citrate and acetate were favourable carbon sources for the strain. Temperature, pH value and shaking speed could affect the growth and nitrogen removal ability. Nitrate or nitrite could be used as a sole nitrogen source for the growth and removed efficiently by the strain. N2 levels increased to 53.74%, 50.21% and 55.13% within 36 h when 100 mg/L NH4(+)-N, NO2(-)-N or NO3(-) -N was used as sole nitrogen source in the gas detection experiment. The activities of hydroxylamine oxidoreductase (HAO), nitrate reductase (NR) and nitrite reductase (NiR), which are key enzymes in heterotrophic nitrification and aerobic denitrification, were all detectable in the strain. Consequently, a possible pathway for ammonium removal by the strain was also suggested. PMID:25910961

  18. Genome Instability Mediates the Loss of Key Traits by Acinetobacter baylyi ADP1 during Laboratory Evolution

    PubMed Central

    Renda, Brian A.; Dasgupta, Aurko; Leon, Dacia

    2014-01-01

    Acinetobacter baylyi ADP1 has the potential to be a versatile bacterial host for synthetic biology because it is naturally transformable. To examine the genetic reliability of this desirable trait and to understand the potential stability of other engineered capabilities, we propagated ADP1 for 1,000 generations of growth in rich nutrient broth and analyzed the genetic changes that evolved by whole-genome sequencing. Substantially reduced transformability and increased cellular aggregation evolved during the experiment. New insertions of IS1236 transposable elements and IS1236-mediated deletions led to these phenotypes in most cases and were common overall among the selected mutations. We also observed a 49-kb deletion of a prophage region that removed an integration site, which has been used for genome engineering, from every evolved genome. The comparatively low rates of these three classes of mutations in lineages that were propagated with reduced selection for 7,500 generations indicate that they increase ADP1 fitness under common laboratory growth conditions. Our results suggest that eliminating transposable elements and other genetic failure modes that affect key organismal traits is essential for improving the reliability of metabolic engineering and genome editing in undomesticated microbial hosts, such as Acinetobacter baylyi ADP1. PMID:25512307

  19. Complete Genome Sequence of a Multidrug-Resistant Acinetobacter baumannii Isolate Obtained from a Mexican Hospital (Sequence Type 422).

    PubMed

    Castro-Jaimes, Semiramis; Salgado-Camargo, Abraham David; Graña-Miraglia, Lucía; Lozano, Luis; Bocanegra-Ibarias, Paola; Volkow-Fernández, Patricia; Silva-Sanchez, Jesus; Castillo-Ramírez, Santiago; Cevallos, Miguel A

    2016-01-01

    Acinetobacter baumannii has emerged as a dangerous nosocomial pathogen, particularly for severely ill patients in intensive care units and patients with hematologic malignancies. Here, we present the complete genome sequence of a multidrug-resistant A. baumannii isolate, recovered from a Mexican hospital and classified as sequence type 422 according to the multilocus sequence typing Pasteur scheme. PMID:27340065

  20. Draft Genome Sequence and Complete Plasmid Sequence of Acinetobacter lwoffii F78, an Isolate with Strong Allergy-Protective Properties.

    PubMed

    Fritzenwanker, Moritz; Hain, Torsten; Kesper, Dörthe A; Harb, Hani; Renz, Harald; Domann, Eugen

    2016-01-01

    The hygiene hypothesis states that the tremendous increase in atopic diseases correlates significantly with less contact to microbes in childhood. Here, we report the draft genome sequence of Acinetobacter lwoffii F78, a rural cowshed isolate with strong allergy-protective properties that contains an 8,579-bp plasmid. PMID:27445377

  1. Draft Genome Sequence and Complete Plasmid Sequence of Acinetobacter lwoffii F78, an Isolate with Strong Allergy-Protective Properties

    PubMed Central

    Fritzenwanker, Moritz; Hain, Torsten; Kesper, Dörthe A.; Harb, Hani; Renz, Harald

    2016-01-01

    The hygiene hypothesis states that the tremendous increase in atopic diseases correlates significantly with less contact to microbes in childhood. Here, we report the draft genome sequence of Acinetobacter lwoffii F78, a rural cowshed isolate with strong allergy-protective properties that contains an 8,579-bp plasmid. PMID:27445377

  2. Draft Genome Sequences of Seven Multidrug-Resistant Acinetobacter baumannii Strains, Isolated from Respiratory Samples in Spain

    PubMed Central

    Labrador-Herrera, Gema; Álvarez, Rocío; López-Rojas, Rafael; Smani, Younes; Cebrero-Cangueiro, Tania; Rueda, Antonio; Pérez Florido, Javier; Pachón-Ibáñez, María Eugenia

    2016-01-01

    The draft genome sequences of seven multidrug-resistant Acinetobacter baumannii clinical strains belonging to sequence types ST-208 and ST-218 are reported in this study. They were isolated from tracheobronchial aspirate of mechanically ventilated adult patients admitted to the intensive care unit of a Spanish tertiary hospital during 2010 to 2011. PMID:27034482

  3. Comparison between phenotypic and PCR for detection of OXA-23 type and metallo-beta-lactamases producer Acinetobacter spp.

    PubMed Central

    Azimi, Leila; Lari, Abdolaziz Rastegar; Talebi, Malihe; Namvar, Amirmorteza Ebrahimzadeh; Jabbari, Mosadegh

    2013-01-01

    Background: Resistance to carbapenems is developing around the world and can cause many problems for treatment of patients. Production of metallo-beta-lactamase (MBL) is one of the main mechanism for this type of resistance. So, detection of MBL-producer microorganisms can prevent the spread of this type of resistance. Materials and methods: In this study 94 Acinetobacter spp. were investigated. Resistance to imipenem was conducted after purification and identification. Combination disc (CD) and Double Disc Synergy Test (DDST) were performed for phenotypic detection of MBL and the molecular PCR method was done for vim-1, vim-2, imp-1 and OXA-23 genes. Results: According to TSI, SIM and oxidation-fermentation (OF) test and PCR assay 93 Acinetobacter baumannii and one strain Acinetobacter lwoffii were identified. 85% of them were resistant to imipenem. 34% of them have a positive combination disc test (CD) while Double Disc Synergy Test (DDST) was negative for all of them. The vim-1, vim-2 and imp-1 genes were not detected in PCR molecular method, however in 74% of strains with positive results in combination disc, were positive for the OXA-23 gene after PCR test. This study shows that the blaOXA-23 resistance determinant may become an emerging therapeutic problem. Discussion: According to the results, it seems that combination disc does not have enough specificity for detection of MBL-producer Acinetobacter and using Double Disc Synergy Test (DDST) can be more convenient. PMID:24327942

  4. Draft Genome Sequence of Extensively Drug-Resistant Acinetobacter baumannii Strain CUAB1 from a Patient in Hong Kong, China

    PubMed Central

    Leung, Alden King-Yung; Lau, Hiuus Hiu-Yu; Chan, Ting-Fung; Ip, Margaret

    2015-01-01

    We report the draft genome sequence of an extensively drug-resistant strain of Acinetobacter baumannii, CUAB1, isolated from a patient in a local Hong Kong hospital. MIC testing was performed, and genes previously associated with drug resistance were located. PMID:25977429

  5. Complete Genome Sequence of a Multidrug-Resistant Acinetobacter baumannii Isolate Obtained from a Mexican Hospital (Sequence Type 422)

    PubMed Central

    Castro-Jaimes, Semiramis; Salgado-Camargo, Abraham David; Graña-Miraglia, Lucía; Lozano, Luis; Bocanegra-Ibarias, Paola; Volkow-Fernández, Patricia; Silva-Sanchez, Jesus; Castillo-Ramírez, Santiago

    2016-01-01

    Acinetobacter baumannii has emerged as a dangerous nosocomial pathogen, particularly for severely ill patients in intensive care units and patients with hematologic malignancies. Here, we present the complete genome sequence of a multidrug-resistant A. baumannii isolate, recovered from a Mexican hospital and classified as sequence type 422 according to the multilocus sequence typing Pasteur scheme. PMID:27340065

  6. Genome sequence of Acinetobacter sp. strain HA, isolated from the gut of the polyphagous insect pest Helicoverpa armigera.

    PubMed

    Malhotra, Jaya; Dua, Ankita; Saxena, Anjali; Sangwan, Naseer; Mukherjee, Udita; Pandey, Neeti; Rajagopal, Raman; Khurana, Paramjit; Khurana, Jitendra P; Lal, Rup

    2012-09-01

    In this study, Acinetobacter sp. strain HA was isolated from the midgut of a fifth-instar larva of Helicoverpa armigera. Here, we report the draft genome sequence (3,125,085 bp) of this strain that consists of 102 contigs, 2,911 predicted coding sequences, and a G+C content of 41%. PMID:22933775

  7. Genome Sequence of Acinetobacter sp. Strain HA, Isolated from the Gut of the Polyphagous Insect Pest Helicoverpa armigera

    PubMed Central

    Malhotra, Jaya; Dua, Ankita; Saxena, Anjali; Sangwan, Naseer; Mukherjee, Udita; Pandey, Neeti; Rajagopal, Raman; Khurana, Paramjit; Khurana, Jitendra P.

    2012-01-01

    In this study, Acinetobacter sp. strain HA was isolated from the midgut of a fifth-instar larva of Helicoverpa armigera. Here, we report the draft genome sequence (3,125,085 bp) of this strain that consists of 102 contigs, 2,911 predicted coding sequences, and a G+C content of 41%. PMID:22933775

  8. [Candida peritonitis and sepsis due to Acinetobacter baumannii in peritoneal dialysis: an association with prognosis not always unfavourable].

    PubMed

    Rapisarda, Francesco; Aliotta, Roberta; Pocorobba, Barbara; Portale, Grazia; Ferrario, Silvia; Zanoli, Luca; Fatuzzo, Pasquale

    2015-01-01

    Fungal infections have a high incidence in patients receiving peritoneal dialysis. (1)
Peritoneal dialysis is often complicated by peritonitis which has only minimally mycotic etiology, but nonetheless it is associated with 15-45% mortality (8).
 The opportunistic pathogens such as Candida can cause infection in immunocompromised conditions. Even the Acinetobacter tends to infect immunocompromised individuals and it has the same risk factors for infection as Candida: immunosuppression, malignancy, HIV positivity and all the other conditions of immunosuppression, central venous catheterization, mechanical ventilation and prolonged antibiotic therapy. The sepsis by Acinetobacter predicts a negative prognosis with the mortality rate between 20 to 60% (12), especially in cases of isolation of multi-resistant germs.
 We present a case report of a CKD patient undergoing peritoneal dialysis therapy who was hospitalized for acute pancreatitis, later complicated by the development of pancreatic pseudocysts, C. albicans peritonitis with hematologic spread of the fungus, superimposed Acinetobacter baumannii sepsis and pneumonia. She has been subjected to percutaneous drainage of pseudocysts, to switch from peritoneal dialysis to hemodialysis, to various evacuative thoracentesis, and to polymicrobial therapy (meropenem, teicoplanina, tigeciclina, linezolid, colimicina, fluconazolo, etc.) that allowed the resolution of sepsis. The peculiarity of this case is represented by the numerous morbidity that the patient developed simultaneously, with the genesis of a complex clinical picture, by the combination of infections due to Candida albicans and Acinetobacter baumannii. Successful treatment strategies allowed to fight and cure a medical condition associated with a high mortality rate. PMID:26845211

  9. Complete Genome Sequence of a Dimethyl Sulfide-Utilizing Bacterium, Acinetobacter guillouiae Strain 20B (NBRC 110550)

    PubMed Central

    Yee, LiiMien; Hosoyama, Akira; Ohji, Shoko; Tsuchikane, Keiko; Shimodaira, Jun; Yamazoe, Atsushi; Fujita, Nobuyuki; Suzuki-Minakuchi, Chiho

    2014-01-01

    Acinetobacter guillouiae strain 20B can utilize dimethyl sulfide (DMS) as the sole sulfur source and degrade chloroethylenes. We report here the complete 4,648,418-bp genome sequence for this strain, which contains 4,367 predicted coding sequences (CDSs), including a well-characterized DMS degradative operon. PMID:25323718

  10. Biodegradation of 4-nitroaniline by plant-growth promoting Acinetobacter sp. AVLB2 and toxicological analysis of its biodegradation metabolites.

    PubMed

    Silambarasan, Sivagnanam; Vangnai, Alisa S

    2016-01-25

    4-nitroaniline (4-NA) is one of the major priority pollutants generated from industrial productions and pesticide transformation; however very limited biodegradation details have been reported. This work is the first to report 4-NA biodegradation kinetics and toxicity reduction using a newly isolated plant-growth promoting bacterium, Acinetobacter sp. AVLB2. The 4-NA-dependent growth kinetics parameters: μmax, Ks and Ki, were determined to be 0.039 h(-1), 6.623 mg L(-1) and 25.57 mg L(-1), respectively using Haldane inhibition model, while the maximum biodegradation rate (Vmax) of 4-NA was at 0.541 mg L(-1) h(-1) and 0.551 mg L(-1) h(-1), following Michaelis-Menten and Hanes-Woolf models, respectively. Biodegradation pathway of 4-NA by Acinetobacter sp. AVLB2 was proposed, and successfully led to the reduction of 4-NA toxicity according to the following toxicity assessments: microbial toxicity using Escherichia coli DH5α, phytotoxicity with Vigna radiata and Crotalaria juncea, and cytogenotoxicity with Allium cepa root-tip cells. In addition, Acinetobacter sp. AVLB2 possess important plant-growth promoting traits, both in the presence and absence of 4-NA. This study has provided a new insight into 4-NA biodegradation ability and concurrent plant-growth promoting activities of Acinetobacter sp. AVLB2, which may indicate its potential role for rhizoremediation, while sustaining crop production even under 4-NA stressed environment. PMID:26489917

  11. Evaluation of Vitek2 and BD Phoenix in antimicrobial susceptibility testing of Acinetobacter baumannii and Pseudomonas aeruginosa.

    PubMed

    Jekarl, Dong Wook; Han, Sang Bong; Kim, Yoon Joo; Shin, Sang Hyun; Park, Kang Gyun; Park, Jung Jun; Han, Kyungja; Park, Yeon-Joon

    2010-08-01

    The accuracy of antimicrobial susceptibility testing of Vitek2 and BD Phoenix against Acinetobacter baumannii and Pseudomonas aeruginosa was evaluated. Both systems showed overall categoric agreement of < or =90% for cefepime and ceftazidime against A. baumannii and imipenem and cefepime (and ceftazidime with Vitek2) against P. aeruginosa because of high minor error rates. PMID:20638609

  12. Acinetobacter infections prevalence and frequency of the antibiotics resistance: comparative study of intensive care units versus other hospital units

    PubMed Central

    Uwingabiye, Jean; Frikh, Mohammed; Lemnouer, Abdelhay; Bssaibis, Fatna; Belefquih, Bouchra; Maleb, Adil; Dahraoui, Souhail; Belyamani, Lahcen; Bait, Abdelouahed; Haimeur, Charki; Louzi, Lhoussain; Ibrahimi, Azeddine; Elouennass, Mostafa

    2016-01-01

    Introduction This study aims to determine the Acinetobacter sp clinical isolates frequency and its antibiotic susceptibility pattern by comparing results obtained from the Intensive Care Units (ICUs) to that of other units at the Mohammed V Military Teaching Hospital in Rabat. Methods This is a retrospective study over a 2-years period where we collected all clinical isolates of Acinetobacter sp obtained from samples for infection diagnosis performed on hospitalized patients between 2012 to 2014. Results During the study period, 441 clinical and non-repetitive isolates of Acinetobacter sp were collected representing 6.94% of all bacterial clinical isolates (n = 6352) and 9.6% of Gram negative rods (n = 4569). More than a half of the isolates were from the ICUs and were obtained from 293 infected patients of which 65, 2% (191 cases) were males (sex ratio = 1.9) and the median age was 56 years (interquartile range: 42-68 years). Acinetobacter clinical isolates were obtained from respiratory samples (44.67%) followed by blood cultures (14.51%). The resistance to ciprofloxacin, ceftazidime, piperacillin / tazobactam, imipenem, amikacin, tobramycin, netilmicin, rifampicin and colistin was respectively 87%, 86%, 79%, 76%; 52%, 43%, 33% 32% and 1.7%. The difference in resistance between the ICUs and the other units was statistically significant (p <0.05) except for colistin, tetracycline and rifampicin. Conclusion This paper shows that solving the problem of prevalence and high rate of multidrug resistant Acinetobacter infection which represents a therapeutic impasse, requires the control of the hospital environment and optimizing hands hygiene and antibiotics use in the hospital. PMID:27347280

  13. Biochemical and Structural Analysis of Inhibitors Targeting the ADC-7 Cephalosporinase of Acinetobacter baumannii

    PubMed Central

    2015-01-01

    β-Lactam resistance in Acinetobacter baumannii presents one of the greatest challenges to contemporary antimicrobial chemotherapy. Much of this resistance to cephalosporins derives from the expression of the class C β-lactamase enzymes, known as Acinetobacter-derived cephalosporinases (ADCs). Currently, β-lactamase inhibitors are structurally similar to β-lactam substrates and are not effective inactivators of this class C cephalosporinase. Herein, two boronic acid transition state inhibitors (BATSIs S02030 and SM23) that are chemically distinct from β-lactams were designed and tested for inhibition of ADC enzymes. BATSIs SM23 and S02030 bind with high affinity to ADC-7, a chromosomal cephalosporinase from Acinetobacter baumannii (Ki = 21.1 ± 1.9 nM and 44.5 ± 2.2 nM, respectively). The X-ray crystal structures of ADC-7 were determined in both the apo form (1.73 Å resolution) and in complex with S02030 (2.0 Å resolution). In the complex, S02030 makes several canonical interactions: the O1 oxygen of S02030 is bound in the oxyanion hole, and the R1 amide group makes key interactions with conserved residues Asn152 and Gln120. In addition, the carboxylate group of the inhibitor is meant to mimic the C3/C4 carboxylate found in β-lactams. The C3/C4 carboxylate recognition site in class C enzymes is comprised of Asn346 and Arg349 (AmpC numbering), and these residues are conserved in ADC-7. Interestingly, in the ADC-7/S02030 complex, the inhibitor carboxylate group is observed to interact with Arg340, a residue that distinguishes ADC-7 from the related class C enzyme AmpC. A thermodynamic analysis suggests that ΔH driven compounds may be optimized to generate new lead agents. The ADC-7/BATSI complex provides insight into recognition of non-β-lactam inhibitors by ADC enzymes and offers a starting point for the structure-based optimization of this class of novel β-lactamase inhibitors against a key resistance target. PMID:25380506

  14. Evaluation of the Bruker Biotyper Matrix-Assisted Laser Desorption Ionization–Time of Flight Mass Spectrometry System for Identification of Blood Isolates of Acinetobacter Species

    PubMed Central

    Hsueh, Po-Ren; Kuo, Lu-Cheng; Chang, Tsung-Chain; Lee, Tai-Fen; Teng, Shih-Hua; Chuang, Yu-Chung; Teng, Lee-Jene

    2014-01-01

    Matrix-assisted laser desorption ionization–time of flight mass spectrometry (MALDI-TOF MS) (Bruker Biotyper) was able to accurately identify 98.6% (142/144) of Acinetobacter baumannii isolates, 72.4% (63/87) of A. nosocomialis isolates, and 97.6% (41/42) of A. pittii isolates. All Acinetobacter junii, A. ursingii, A. johnsonii, and A. radioresistens isolates (n = 28) could also be identified correctly by Bruker Biotyper. PMID:24899038

  15. Complete Genome Sequence of the Multiresistant Acinetobacter baumannii Strain AbH12O-A2, Isolated during a Large Outbreak in Spain.

    PubMed

    Merino, M; Alvarez-Fraga, L; Gómez, M J; Aransay, A M; Lavín, J L; Chaves, F; Bou, G; Poza, M

    2014-01-01

    We report the complete genome sequence of Acinetobacter baumannii strain AbH12O-A2, isolated during a large outbreak in Spain. The genome has 3,875,775 bp and 3,526 coding sequences, with 39.4% G+C content. The availability of this genome will facilitate the study of the pathogenicity of the Acinetobacter species. PMID:25395646

  16. Complete Genome Sequence of the Multiresistant Acinetobacter baumannii Strain AbH12O-A2, Isolated during a Large Outbreak in Spain

    PubMed Central

    Merino, M.; Alvarez-Fraga, L.; Gómez, M. J.; Aransay, A. M.; Lavín, J. L.; Chaves, F.

    2014-01-01

    We report the complete genome sequence of Acinetobacter baumannii strain AbH12O-A2, isolated during a large outbreak in Spain. The genome has 3,875,775 bp and 3,526 coding sequences, with 39.4% G+C content. The availability of this genome will facilitate the study of the pathogenicity of the Acinetobacter species. PMID:25395646

  17. Isolation and characterization of diesel degrading bacteria, Sphingomonas sp. and Acinetobacter junii from petroleum contaminated soil

    NASA Astrophysics Data System (ADS)

    Zhang, Qiuzhuo; Wang, Duanchao; Li, Mengmeng; Xiang, Wei-Ning; Achal, Varenyam

    2014-03-01

    Two indigenous bacteria of petroleum contaminated soil were characterized to utilize diesel fuel as the sole carbon and energy sources in this work. 16S rRNA gene sequence analysis identified these bacteria as Sphingomonas sp. and Acinetobacter junii. The ability to degrade diesel fuel has been demonstrated for the first time by these isolates. The results of IR analyses showed that Sphingomonas sp. VA1 and A. junii VA2 degraded up to 82.6% and 75.8% of applied diesel over 15 days, respectively. In addition, Sphingomonas sp. VA1 possessed the higher cellular hydrophobicities of 94% for diesel compared to 81% by A. junii VA2. The isolates Sphingomonas sp. VA1 and A. junii VA2 exhibited 24% and 18%, respectively emulsification activity. This study reports two new diesel degrading bacterial species, which can be effectively used for bioremediation of petroleum contaminated sites.

  18. Factors affecting inactivation of Moraxell-Acinetobacter cells in an irradiation process. [/sup 137/Cs

    SciTech Connect

    Firstenberg-Eden, R.; Rowley, D.B.; Shattuck, G.E.

    1980-09-01

    The effect of various stages of the irradiation processing of beef on the injury and inactivation of radiation-resistant Moraxella-Acinetobactor cells was studied. Moraxella-Acinetobacter cells were more resistant to heat inactivation and injury when heated in meat with salts (0.75% NaCl and 0.375% sodium tripolyphosphate) than in meat without salts. These salts had no effect on radiation resistance. Heated cells were more sensitive to radiation inactivation and injury than unheated cells. After repair, the cells regained their resistance to both NaCl and irradiation. Freezing and storage at -40/sup 0/C for 14 days had only a slight effect on either unstressed or heat-stressed cells.

  19. Preferential carriage of class 2 integrons in Acinetobacter baumannii CC113 and novel singletons.

    PubMed

    Ramírez, M S; Montaña, S; Cassini, M; Centrón, D

    2015-10-01

    Our understanding of the distribution of integrons associated with multidrug resistance in Acinetobacter baumannii isolates around the world remains incomplete. The association between the class 1 and 2 integron A. baumannii-positive isolates (n = 60), recovered since 1982 from 11 Argentinean hospitals, and the circulating lineages, was investigated. While class 2 integrons were highly significantly associated with clonal lineage CC113B/CC79P (P = 0·009) and novel singletons (P = 0·001), class 1 integrons were found not to be associated with CC109B/CC1P or other lineages. The study reveals a differential distribution of class 2 integrons in lineages, and suggests that the prevalence of intI2 in Argentina is related to the emergence of novel singletons in recent years and to the abundance of CC113B/CC79P, which has been the local dominant lineage for several decades. PMID:25697643

  20. Distribution of AdeABC efflux system genes in genotypically diverse strains of clinical Acinetobacter baumannii.

    PubMed

    Wieczorek, Piotr; Sacha, Paweł; Czaban, Sławomir; Hauschild, Tomasz; Ojdana, Dominika; Kowalczuk, Oksana; Milewski, Robert; Poniatowski, Bogusław; Nikliński, Jacek; Tryniszewska, Elżbieta

    2013-10-01

    Acinetobacter baumannii has emerged as a highly problematic hospital-associated pathogen. Different mechanisms contribute to the formation of multidrug resistance in A. baumannii, including the AdeABC efflux system. Distribution of the structural and regulatory genes encoding the AdeABC efflux system among genetically diverse clinical A. baumannii strains was achieved by using PCR and pulsed-field gel electrophoresis techniques. The distribution of adeABRS genes is extremely high among our A. baumannii strains, except the adeC gene. We have observed a large proportion of strains presenting multidrug-resistance phenotype for several years. The efflux pump could be an important mechanism in these strains in resistance to antibiotics. PMID:23886790

  1. Emerging broad-spectrum resistance in Pseudomonas aeruginosa and Acinetobacter baumannii: Mechanisms and epidemiology.

    PubMed

    Potron, Anaïs; Poirel, Laurent; Nordmann, Patrice

    2015-06-01

    Multidrug resistance is quite common among non-fermenting Gram-negative rods, in particular among clinically relevant species including Pseudomonas aeruginosa and Acinetobacter baumannii. These bacterial species, which are mainly nosocomial pathogens, possess a diversity of resistance mechanisms that may lead to multidrug or even pandrug resistance. Extended-spectrum β-lactamases (ESBLs) conferring resistance to broad-spectrum cephalosporins, carbapenemases conferring resistance to carbapenems, and 16S rRNA methylases conferring resistance to all clinically relevant aminoglycosides are the most important causes of concern. Concomitant resistance to fluoroquinolones, polymyxins (colistin) and tigecycline may lead to pandrug resistance. The most important mechanisms of resistance in P. aeruginosa and A. baumannii and their most recent dissemination worldwide are detailed here. PMID:25857949

  2. Biofilm Formation and Motility Depend on the Nature of the Acinetobacter baumannii Clinical Isolates

    PubMed Central

    Vijayakumar, Saranya; Rajenderan, Sangeetha; Laishram, Shakti; Anandan, Shalini; Balaji, Veeraraghavan; Biswas, Indranil

    2016-01-01

    Acinetobacter baumannii is a nosocomial pathogen involved in various infections ranging from minor soft-tissue infections to more severe infections such as ventilator-associated pneumonia and bacteremia. The severity and the type of infections depend on the genetic and phenotypic variations of the strains. In this study, we compared the extent of biofilm formation and motility displayed by 60 multidrug-resistant A. baumannii clinical strains isolated from blood and sputum samples from patients from Southern India. Our results showed that isolates from the sputum samples formed significantly more robust biofilm compared to the blood isolates. On the other hand, we observed that the blood isolates were more motile than the sputum isolates. To the best of our knowledge, this is the first study that systematically evaluated the correlation between these two phenotypic traits and the nature of the isolates. PMID:27252939

  3. VEB-1 Extended-Spectrum β-lactamase–producing Acinetobacter baumannii, France1

    PubMed Central

    Coignard, Bruno; Carbonne, Anne; Blanckaert, Karine; Bajolet, Odile; Bernet, Claude; Verdeil, Xavier; Astagneau, Pascal; Desenclos, Jean-Claude; Nordmann, Patrice

    2006-01-01

    VEB-1 extended-spectrum β-lactamase–producing Acinetobacter baumannii was responsible for an outbreak in hospitals in France. A national alert was triggered in September 2003 when 4 hospitals reported clusters of A. baumannii infection with similar susceptibility profiles. Case definitions and laboratory guidelines were disseminated, and prospective surveillance was implemented; strains were sent to a single laboratory for characterization and typing. From April 2003 through June 2004, 53 hospitals reported 290 cases of A. baumannii infection or colonization; 275 isolates were blaVEB-1-positive and clonally related. Cases were first reported in 5 districts of northern France, then in 10 other districts in 4 regions. Within a region, interhospital spread was associated with patient transfer. In northern France, investigation and control measures led to a reduction of reported cases after January 2004. The national alert enabled early control of new clusters, demonstrating the usefulness of early warning about antimicrobial drug resistance. PMID:16965700

  4. Kinetic analysis of simultaneous denitrification and biomineralization of novel Acinetobacter sp. CN86.

    PubMed

    Su, Jun-Feng; Shi, Jing-Xin; Huang, Ting-Lin; Ma, Fang

    2016-08-15

    A novel aerobic denitrification and biomineralization strain CN86 was isolated from the Qu Jiang artificial lake. Based on phylogenetic characteristics, the isolated strain was identified as Acinetobacter species. Strain CN86 was confirmed to have the ability to perform simultaneous denitrification and biomineralization. Exponential decay equation was used for the matching of kinetic processes on denitrification and biomineralization. A highest nitrate removal rate was achieved at the pH7.0, organic concentration of 1.5g/L and temperature of 30°C. An optimal hardness removal rate was obtained at the pH9.0, organic concentration of 2.0g/L and temperature of 30°C. Strain CN86 is a suitable candidate for the simultaneous removal of nitrate and hardness in groundwater treatment. PMID:27287863

  5. Donor platelet plasma components inactivate sensitive and multidrug resistant Acinetobacter baumannii isolates.

    PubMed

    Edelblute, Chelsea M; Pakhomova, Olga N; Li, Fanying; Hargrave, Barbara Y; Heller, Loree C

    2015-12-01

    Acinetobacter baumannii is an environmentally resilient healthcare-associated opportunistic pathogen responsible for infections at many body sites. In the last 10 years, clinical strains resistant to many or all commonly used antibiotics have emerged globally. With few antimicrobial agents in the pharmaceutical pipeline, new and alternative agents are essential. Platelets secrete a large number of proteins, including proteins with antimicrobial activity. In a previous study, we demonstrated that donor platelet supernatants and plasma significantly inhibited the growth of a reference strain of A. baumannii in broth and on skin. This inhibition appeared to be unrelated to the platelet activation state. In this study, we demonstrate that this growth inhibition extends to clinical multidrug resistant isolates. We also demonstrate that there is no relationship between this activity and selected platelet-derived antimicrobial proteins. Instead, the donor plasma components complement and alpha-2 macroglobulin are implicated. PMID:26500225

  6. Genes Involved in the Biosynthesis and Transport of Acinetobactin in Acinetobacter baumannii

    PubMed Central

    Hasan, Tarik; Choi, Chul Hee

    2015-01-01

    Pathogenic bacteria survive in iron-limited host environments by using several iron acquisition mechanisms. Acinetobacter baumannii, causing serious infections in compromised patients, produces an iron-chelating molecule, called acinetobactin, which is composed of equimolar quantities of 2,3-dihydroxybenzoic acid (DHBA), L-threonine, and N-hydroxyhistamine, to compete with host cells for iron. Genes that are involved in the production and transport of acinetobactin are clustered within the genome of A. baumannii. A recent study showed that entA, located outside of the acinetobactin gene cluster, plays important roles in the biosynthesis of the acinetobactin precursor DHBA and in bacterial pathogenesis. Therefore, understanding the genes that are associated with the biosynthesis and transport of acinetobactin in the bacterial genome is required. This review is intended to provide a general overview of the genes in the genome of A. baumannii that are required for acinetobactin biosynthesis and transport. PMID:25873846

  7. Biofilm Formation and Motility Depend on the Nature of the Acinetobacter baumannii Clinical Isolates.

    PubMed

    Vijayakumar, Saranya; Rajenderan, Sangeetha; Laishram, Shakti; Anandan, Shalini; Balaji, Veeraraghavan; Biswas, Indranil

    2016-01-01

    Acinetobacter baumannii is a nosocomial pathogen involved in various infections ranging from minor soft-tissue infections to more severe infections such as ventilator-associated pneumonia and bacteremia. The severity and the type of infections depend on the genetic and phenotypic variations of the strains. In this study, we compared the extent of biofilm formation and motility displayed by 60 multidrug-resistant A. baumannii clinical strains isolated from blood and sputum samples from patients from Southern India. Our results showed that isolates from the sputum samples formed significantly more robust biofilm compared to the blood isolates. On the other hand, we observed that the blood isolates were more motile than the sputum isolates. To the best of our knowledge, this is the first study that systematically evaluated the correlation between these two phenotypic traits and the nature of the isolates. PMID:27252939

  8. Outbreak of extensively drug-resistant Acinetobacter baumannii indigo-pigmented strains.

    PubMed

    Vilacoba, Elisabet; Almuzara, Marisa; Gulone, Lucia; Rodriguez, Rocio; Pallone, Elida; Bakai, Romina; Centrón, Daniela; Ramírez, María Soledad

    2013-11-01

    Acinetobacter baumannii pigmented strains are not common in clinical settings. Here, we report an outbreak caused by indigo-pigmented A. baumannii strains isolated in an acute care hospital in Argentina from March to September 2012. Pan-PCR assays exposed a unique pattern belonging to the recently described regional CC113(B)/CC79(P) clonal complex that confirms the relevant relationships among the indigo-pigmented A. baumannii strains. All of them were extensively drug resistant and harbored different genetic elements associated with horizontal genetic transfer, such as the transposon Tn2006, class 2 integrons, AbaR-type islands, IS125, IS26, strA, strB, florR, and the small recombinase ISCR2 associated with the sul2 gene preceded by ISAba1. PMID:23985923

  9. Genome shuffling improves production of the low-temperature alkalophilic lipase by Acinetobacter johnsonii.

    PubMed

    Wang, HaiKuan; Zhang, Jie; Wang, XiaoJie; Qi, Wei; Dai, YuJie

    2012-01-01

    The production of a low-temperature alkalophilic lipase from Acinetobacter johnsonii was improved using genome shuffling. The starting populations, obtained by UV irradiation and diethyl sulfate mutagenesis, were subjected to recursive protoplast fusion. The optimal conditions for protoplast formation and regeneration were 0.15 mg lysozyme/ml for 45 min at 37°C. The protoplasts were inactivated under UV for 20 min or heated at 60°C for 60 min and a fusant probability of ~98% was observed. The positive colonies were created by fusing the inactivated protoplasts. After two rounds of genome shuffling, one strain, F22, with a lipase activity of 7 U/ml was obtained. PMID:21972140

  10. Brain abscess caused by multidrug-resistant Acinetobacter baumannii. Case report.

    PubMed

    Guinand Vives, Carlos H; Monsalve Duarte, Guillermo A; Beltrán, Sandra Valderrama; Pinzón, Johanna Osorio

    2009-08-01

    This 24-year-old soldier had a history of polytrauma caused by firearm missiles of a fragmentation weapon. He was referred to the Hospital Militar Central, where multiple shrapnel wounds in the head, face, thorax, and extremities were found. A brain abscess was documented and drained, and a culture grew a multidrug-resistant Acinetobacter baumannii. An appropriate antibiotic treatment was started but did not lead to a good response, and the patient died. The clinical course of the illness is presented, as is its treatment and the role of A baumannii as an etiological agent of a brain abscess. To the authors' knowledge, there have been no reported cases in the worldwide literature of brain abscess by this infectious agent. PMID:19061347

  11. Ultrafast Structural Dynamics of BlsA, a Photoreceptor from the Pathogenic Bacterium Acinetobacter baumannii

    PubMed Central

    2013-01-01

    Acinetobacter baumannii is an important human pathogen that can form biofilms and persist under harsh environmental conditions. Biofilm formation and virulence are modulated by blue light, which is thought to be regulated by a BLUF protein, BlsA. To understand the molecular mechanism of light sensing, we have used steady-state and ultrafast vibrational spectroscopy to compare the photoactivation mechanism of BlsA to the BLUF photosensor AppA from Rhodobacter sphaeroides. Although similar photocycles are observed, vibrational data together with homology modeling identify significant differences in the β5 strand in BlsA caused by photoactivation, which are proposed to be directly linked to downstream signaling. PMID:24723998

  12. [Management of a 4MRGN Acinetobacter baumanii outbreak in a burn unit].

    PubMed

    Siemers, F; Fanghänel, S; Bergmann, P A; Tamouridis, G; Stuttmann, R; Stolze, B; Hofmann, G O

    2014-08-01

    Patients with 4MRGN Acinetobacter baumanii infections in a burn unit represent great challenge. The structured management with 7 involved patients in such a situation is presented. After discovering the infectious trigger a management team is established. An immediate stop for further admissions was announced and all infected room areas and medical equipment were analysed for infection foci. The infected patients were transferred to regional hospitals or a rehabiltation hospital after finishing all surgical procedures. In one case, for whom further operations were needed, a transfer to a separated area of the intermediate care unit (IMC) within the hospital was arranged. The performed analysis of infection foci indicated a bronchoscopy tower to be the infection source. The outbreak was terminated after transferring all patients, final disinfection and subsequent nebulisation with 5-6% hydrogen peroxide within 18 days. PMID:25162239

  13. Membrane-permeabilizing activity of reverse-amide 2-aminoimidazole antibiofilm agents against Acinetobacter baumannii.

    PubMed

    Stowe, Sean D; Thompson, Richele J; Peng, Lingling; Su, Zhaoming; Blackledge, Meghan S; Draughn, G Logan; Coe, William H; Johannes, Eva; Lapham, Valerie K; Mackenzie, John; Melander, Christian; Cavanagh, John

    2015-01-01

    Acinetobacter baumannii has quickly become one of the most insidious and prevalent nosocomial infections. Recently, the reverse-amide class of 2-aminoimidazole compounds (RA-2AI) was found both to prevent A. baumannii biofilm formation and also to disperse preexisting formations, putatively through interactions with cytosolic response regulators. Here we focus on how this class of antibiofilm agent traverses cellular membranes. Following the discovery of dosage-dependent growth rate changes, the cellular effects of RA-2AI were investigated using a combination of molecular assays and microscopic techniques. It was found that RA-2AI exposure has measureable effects on the bacterial membranes, resulting in a period of increased permeability and visible structural aberrations. Based on these results, we propose a model that describes how the structure of RA-2AI allows it to insert itself into and disrupt the fluidity of the membrane, creating an opportunity for increased molecular permeability. PMID:25348099

  14. Acinetobactin Isomerization Enables Adaptive Iron Acquisition in Acinetobacter baumannii through pH-Triggered Siderophore Swapping.

    PubMed

    Shapiro, Justin A; Wencewicz, Timothy A

    2016-02-12

    Pathogenic strains of Acinetobacter baumannii excrete multiple siderophores that enhance iron scavenging from host sources. The oxazoline siderophore pre-acinetobactin undergoes an unusual non-enzymatic isomerization, producing the isoxazolidinone acinetobactin. In this study, we explored the kinetics, mechanism, and biological consequence of this siderophore swapping. Pre-acinetobactin is excreted to the extracellular space where the isomerization to acinetobactin occurs with a pH-rate profile consistent with 5-exo-tet cyclization at C5' with clean stereochemical inversion. Pre-acinetobactin persists at pH <6, and acinetobactin is rapidly formed at pH >7, matching each siderophore's pH preference for iron(III) chelation and A. baumannii growth promotion. Acinetobactin isomerization provides two siderophores for the price of one, enabling A. baumannii to sequester iron over a broad pH range likely to be encountered during the course of an infection. PMID:27624967

  15. Correlation of Ciprofloxacin Resistance with the AdeABC Efflux System in Acinetobacter baumannii Clinical Isolates

    PubMed Central

    Ardebili, Abdollah; Talebi, Malihe

    2014-01-01

    Background Acinetobacter baumannii is one of the most important pathogens capable of colonization in burn patients, leading to drug-resistant wound infections. This study evaluated the distribution of the AdeABC efflux system genes and their relationship to ciprofloxacin resistance in A. baumannii isolates collected from burn patients. Methods A total of 68 A. baumannii clinical strains were isolated from patients hospitalized in Motahari Burns Center in Tehran, Iran. Ciprofloxacin susceptibility was tested by the disk diffusion and agar dilution methods. PCR amplification of the adeRS-adeB drug efflux genes was performed for all resistant and susceptible isolates. To assess the role of the drug efflux pump in ciprofloxacin susceptibility, carbonyl cyanide 3-chlorophenylhydrazone (CCCP) was used as an efflux pump inhibitor (EPI). Results Approximately 95.6% of the Acinetobacter isolates were resistant to ciprofloxacin, with minimum inhibitory concentration (MIC) values ranging from 4 to ≥128 µg/mL. The susceptibility of 86.1% of the resistant isolates increased by factors of 2 to 64 in the presence of CCCP. All resistant isolates were positive for the adeRS-adeB genes, and 73.2% of them had mutations in the AdeRS regulatory system. Conclusions The results showed that AdeABC genes are common in A. baumannii, which might be associated with ciprofloxacin non-susceptibility, as indicated by the observed linkage to the presence of the genes essential for the activity of the AdeABC, several single mutations occurring in the adeRS regulatory system, and an increase of ciprofloxacin susceptibility in the presence of a CCCP EPI. PMID:25368818

  16. Variation in the Complex Carbohydrate Biosynthesis Loci of Acinetobacter baumannii Genomes

    PubMed Central

    Kenyon, Johanna J.; Hall, Ruth M.

    2013-01-01

    Extracellular polysaccharides are major immunogenic components of the bacterial cell envelope. However, little is known about their biosynthesis in the genus Acinetobacter, which includes A. baumannii, an important nosocomial pathogen. Whether Acinetobacter sp. produce a capsule or a lipopolysaccharide carrying an O antigen or both is not resolved. To explore these issues, genes involved in the synthesis of complex polysaccharides were located in 10 complete A. baumannii genome sequences, and the function of each of their products was predicted via comparison to enzymes with a known function. The absence of a gene encoding a WaaL ligase, required to link the carbohydrate polymer to the lipid A-core oligosaccharide (lipooligosaccharide) forming lipopolysaccharide, suggests that only a capsule is produced. Nine distinct arrangements of a large capsule biosynthesis locus, designated KL1 to KL9, were found in the genomes. Three forms of a second, smaller variable locus, likely to be required for synthesis of the outer core of the lipid A-core moiety, were designated OCL1 to OCL3 and also annotated. Each K locus includes genes for capsule export as well as genes for synthesis of activated sugar precursors, and for glycosyltransfer, glycan modification and oligosaccharide repeat-unit processing. The K loci all include the export genes at one end and genes for synthesis of common sugar precursors at the other, with a highly variable region that includes the remaining genes in between. Five different capsule loci, KL2, KL6, KL7, KL8 and KL9 were detected in multiply antibiotic resistant isolates belonging to global clone 2, and two other loci, KL1 and KL4, in global clone 1. This indicates that this region is being substituted repeatedly in multiply antibiotic resistant isolates from these clones. PMID:23614028

  17. Identification of Acinetobacter baumannii Serum-Associated Antibiotic Efflux Pump Inhibitors

    PubMed Central

    Blanchard, Catlyn; Barnett, Pamela; Perlmutter, Jessamyn

    2014-01-01

    Adaptive antibiotic resistance is a newly described phenomenon by which Acinetobacter baumannii induces efflux pump activity in response to host-associated environmental cues that may, in part, account for antibiotic treatment failures against clinically defined susceptible strains. To that end, during adaptation to growth in human serum, the organism induces approximately 22 putative efflux-associated genes and displays efflux-mediated minocycline tolerance at antibiotic concentrations corresponding to patient serum levels. Here, we show that in addition to minocycline, growth in human serum elicits A. baumannii efflux-mediated tolerance to the antibiotics ciprofloxacin, meropenem, tetracycline, and tigecycline. Moreover, using a whole-cell high-throughput screen and secondary assays, we identified novel serum-associated antibiotic efflux inhibitors that potentiated the activities of antibiotics toward serum-grown A. baumannii. Two compounds, Acinetobacter baumannii efflux pump inhibitor 1 (ABEPI1) [(E)-4-((4-chlorobenzylidene)amino)benezenesulfonamide] and ABEPI2 [N-tert-butyl-2-(1-tert-butyltetrazol-5-yl)sulfanylacetamide], were shown to lead to minocycline accumulation within A. baumannii during serum growth and inhibit the efflux potential of the organism. While both compounds also inhibited the antibiotic efflux properties of the bacterial pathogen Pseudomonas aeruginosa, they did not display significant cytotoxicity toward human cells or mammalian Ca2+ channel inhibitory effects, suggesting that ABEPI1 and ABEPI2 represent promising structural scaffolds for the development of new classes of bacterial antibiotic efflux pump inhibitors that can be used to potentiate the activities of current and future antibiotics for the therapeutic intervention of Gram-negative bacterial infections. PMID:25114126

  18. Structural and bioinformatic characterization of an Acinetobacter baumannii type II carrier protein

    SciTech Connect

    Allen, C. Leigh; Gulick, Andrew M.

    2014-06-01

    The high-resolution crystal structure of a free-standing carrier protein from Acinetobacter baumannii that belongs to a larger NRPS-containing operon, encoded by the ABBFA-003406–ABBFA-003399 genes of A. baumannii strain AB307-0294, that has been implicated in A. baumannii motility, quorum sensing and biofilm formation, is presented. Microorganisms produce a variety of natural products via secondary metabolic biosynthetic pathways. Two of these types of synthetic systems, the nonribosomal peptide synthetases (NRPSs) and polyketide synthases (PKSs), use large modular enzymes containing multiple catalytic domains in a single protein. These multidomain enzymes use an integrated carrier protein domain to transport the growing, covalently bound natural product to the neighboring catalytic domains for each step in the synthesis. Interestingly, some PKS and NRPS clusters contain free-standing domains that interact intermolecularly with other proteins. Being expressed outside the architecture of a multi-domain protein, these so-called type II proteins present challenges to understand the precise role they play. Additional structures of individual and multi-domain components of the NRPS enzymes will therefore provide a better understanding of the features that govern the domain interactions in these interesting enzyme systems. The high-resolution crystal structure of a free-standing carrier protein from Acinetobacter baumannii that belongs to a larger NRPS-containing operon, encoded by the ABBFA-003406–ABBFA-003399 genes of A. baumannii strain AB307-0294, that has been implicated in A. baumannii motility, quorum sensing and biofilm formation, is presented here. Comparison with the closest structural homologs of other carrier proteins identifies the requirements for a conserved glycine residue and additional important sequence and structural requirements within the regions that interact with partner proteins.

  19. Growth of Acinetobacter baumannii in Pellicle Enhanced the Expression of Potential Virulence Factors

    PubMed Central

    Alexandre, Stéphane; Coquet, Laurent; Vila, Jordi; Jouenne, Thierry; Dé, Emmanuelle

    2011-01-01

    Background Interestingly, Acinetobacter baumannii presents an enhanced capacity to form biofilms (also named pellicles) at the air-liquid interface as compared to the other Acinetobacter species. This characteristic questions the contribution of this phenotype to an increased risk of clinical infections by this pathogen. Methodology/Principal Findings By a proteomic approach using 2-D gel electrophoresis-LC-MS/MS mass spectrometry, we compared the membrane protein patterns of A. baumannii 77, a pellicle-forming clinical isolate, grown in planktonic and in sessile modes. We identified 52 proteins with a differential expression, including 32 up-regulated and 20 down-regulated in the pellicle state. Several proteins, differentially expressed during pellicle development, were of particular interest. We determined the over-expression of four siderophore iron uptake systems including the acinetobactin and enterobactin receptors and confirmed that the development of this type of biofilm is promoted by ferric ions. Two over-expressed proteins, CarO and an OprD-homologue, putative carbapenem-resistance associated porins, would be involved in the transport of specific compounds, like ornithine, a biosynthesis precursor of a siderophore from the hydroxamate family. We evidenced the overexpression of a lipase and a transporter of LCFA that may be involved in the recycling of lipids inside the pellicle matrix. Finally, we demonstrated both by proteomic and by AFM studies that this particular type of biofilm required multiple pili systems to maintain this cohesive structure at the air-liquid interface; two of these systems have never been described in A. baumannii. Conclusions/Significance Our study demonstrated that several proteins, overexpressed at a late state of pellicle development, could be potentially involved in virulence processes. Therefore, regarding the number of potential virulence factors that are over-expressed in this growth mode, the pellicle-forming clinical

  20. Biofilm-Related Genes: Analyses in Multi-Antibiotic Resistant Acinetobacter Baumannii Isolates From Mainland China

    PubMed Central

    Liu, Hui; Wu, Yong-Quan; Chen, Li-Ping; Gao, Xiang; Huang, Hao-Nan; Qiu, Fu-Lan; Wu, Ding-Chang

    2016-01-01

    Background Acinetobacter baumannii is an important nosocomial pathogen which shows a high level of mortality risk. Several papers have reported biofilm formation as a well-known pathogenic mechanism in A. baumannii infections and exceptional antibiotic resistance. The study aims to explore the potential relationships between biofilm-related genes and antimicrobial resistance. Material/Methods Samples from 122 patients with lower respiratory tract infections of A. baumannii were collected at Fujian Longyan First Hospital from January 2013 to September 2014. A. baumannii was isolated from sputum specimens. Biofilm-related genes including abaI, csuE, ompA, and bla-PER1 were analyzed by PCR. The minimum inhibitory concentration method was used to determine the sensitivity of each strain to antibiotics. Results The clinical manifestations of A. baumannii-induced lower respiratory tract infections lacked specificity. Infected patients were most commonly admitted to intensive care units (54.9%) and frequently had chronic obstructive pulmonary disease (27.0%). The detection rates of abaI and csuE were both 59.8%, and those of ompA and bla-PER1 were 100% and 0%, respectively. After genetic testing, antimicrobial resistance to amikacin, ampicillin/sulbactam, and 14 other types of antimicrobials was higher in abaI- and csuE-positive strains than in abaI- and csuE-negative strains (P<0.05). Conclusions The findings of our study suggest that abaI- and csuE-positive Acinetobacter baumannii strains are associated with a higher incidence of antibiotic resistance in 14 types of antimicrobials. PMID:27234982

  1. Biofilm-Related Genes: Analyses in Multi-Antibiotic Resistant Acinetobacter Baumannii Isolates From Mainland China.

    PubMed

    Liu, Hui; Wu, Yong-Quan; Chen, Li-Ping; Gao, Xiang; Huang, Hao-Nan; Qiu, Fu-Lan; Wu, Ding-Chang

    2016-01-01

    BACKGROUND Acinetobacter baumannii is an important nosocomial pathogen which shows a high level of mortality risk. Several papers have reported biofilm formation as a well-known pathogenic mechanism in A. baumannii infections and exceptional antibiotic resistance. The study aims to explore the potential relationships between biofilm-related genes and antimicrobial resistance. MATERIAL AND METHODS Samples from 122 patients with lower respiratory tract infections of A. baumannii were collected at Fujian Longyan First Hospital from January 2013 to September 2014. A. baumannii was isolated from sputum specimens. Biofilm-related genes including abaI, csuE, ompA, and bla-PER1 were analyzed by PCR. The minimum inhibitory concentration method was used to determine the sensitivity of each strain to antibiotics. RESULTS The clinical manifestations of A. baumannii-induced lower respiratory tract infections lacked specificity. Infected patients were most commonly admitted to intensive care units (54.9%) and frequently had chronic obstructive pulmonary disease (27.0%). The detection rates of abaI and csuE were both 59.8%, and those of ompA and bla-PER1 were 100% and 0%, respectively. After genetic testing, antimicrobial resistance to amikacin, ampicillin/sulbactam, and 14 other types of antimicrobials was higher in abaI- and csuE-positive strains than in abaI- and csuE-negative strains (P<0.05). CONCLUSIONS The findings of our study suggest that abaI- and csuE-positive Acinetobacter baumannii strains are associated with a higher incidence of antibiotic resistance in 14 types of antimicrobials. PMID:27234982

  2. Clinically Relevant Growth Conditions Alter Acinetobacter baumannii Antibiotic Susceptibility and Promote Identification of Novel Antibacterial Agents

    PubMed Central

    Colquhoun, Jennifer M.; Wozniak, Rachel A. F.; Dunman, Paul M.

    2015-01-01

    Biological processes that govern bacterial proliferation and survival in the host-environment(s) are likely to be vastly different from those that are required for viability in nutrient-rich laboratory media. Consequently, growth-based antimicrobial screens performed in conditions modeling aspects of bacterial disease states have the potential to identify new classes of antimicrobials that would be missed by screens performed in conventional laboratory media. Accordingly, we performed screens of the Selleck library of 853 FDA approved drugs for agents that exhibit antimicrobial activity toward the Gram-negative bacterial pathogen Acinetobacter baumannii during growth in human serum, lung surfactant, and/or the organism in the biofilm state and compared those results to that of conventional laboratory medium. Results revealed that a total of 90 compounds representing 73 antibiotics and 17 agents that were developed for alternative therapeutic indications displayed antimicrobial properties toward the test strain in at least one screening condition. Of the active library antibiotics only four agents, rifampin, rifaximin, ciprofloxacin and tetracycline, exhibited antimicrobial activity toward the organism during all screening conditions, whereas the remainder were inactive in ≥ 1 condition; 56 antibiotics were inactive during serum growth, 25 and 38 were inactive toward lung surfactant grown and biofilm-associated cells, respectively, suggesting that subsets of antibiotics may outperform others in differing infection settings. Moreover, 9 antibiotics that are predominantly used for the treatment Gram-positive pathogens and 10 non-antibiotics lacked detectable antimicrobial activity toward A. baumannii grown in conventional medium but were active during ≥ 1 alternative growth condition(s). Such agents may represent promising anti-Acinetobacter agents that would have likely been overlooked by antimicrobial whole cell screening assays performed in traditional

  3. Rapid detection of blaOXA in carbapenem-susceptible Acinetobacter radioresistens bacteremia leading to unnecessary antimicrobial administration.

    PubMed

    Brady, Adam C; Lewis, James S; Pfeiffer, Christopher D

    2016-08-01

    Rapid molecular techniques to identify resistant pathogens are revolutionizing antibiotic stewardship; however, it is important to recognize the limitations of these techniques. Herein we describe two cases of bacteremia that were both initially identified by genotypic testing as carbapenem-resistant Acinetobacter spp. and subsequently identified phenotypically as carbapenem-susceptible A. radioresistens. The genotypic results prompted unnecessary broad-spectrum antibiotic use and infection control concerns. PMID:27236714

  4. Novel Resistance-Nodulation-Cell Division Efflux System AdeDE in Acinetobacter Genomic DNA Group 3

    PubMed Central

    Chau, Sze-Lok; Chu, Yiu-Wai; Houang, Elizabeth T. S.

    2004-01-01

    Resistance-nodulation-cell division type efflux pump AdeDE was identified in acinetobacters belonging to genomic DNA group 3. Inactivation of adeE showed that it may be responsible for reduced susceptibility to amikacin, ceftazidime, chloramphenicol, ciprofloxacin, erythromycin, ethidium bromide, meropenem, rifampin, and tetracycline. However, unlike what was found for other similar efflux systems, the open reading frame for the outer membrane component was not found downstream of the adeDE gene cluster. PMID:15388479

  5. Emergence of Carbapenem-Resistant Acinetobacter baumannii in Nursing Homes With High Background Rates of MRSA Colonization.

    PubMed

    Cheng, Vincent C C; Chen, Jonathan H K; Ng, W C; Wong, Janet Y H; Chow, Denise M K; Law, T C; So, Simon Y C; Wong, Sally C Y; Chan, T C; Chan, Felix H W; Ho, P L; Yuen, K Y

    2016-08-01

    Carbapenem-resistant Acinetobacter baumannii (CRAB) with diverse multilocus sequence typing emerged among our nursing home residents (6.5%) with a high background rate of MRSA (32.2%). Rectal swabs yielded a higher rate of CRAB detection than axillary or nasal swabs. Bed-bound status, use of adult diapers, and nasogastric tube were risk factors for CRAB colonization. Infect Control Hosp Epidemiol 2016;37:983-986. PMID:27108526

  6. Identification of Novel Genes Involved in Long-Chain n-Alkane Degradation by Acinetobacter sp. Strain DSM 17874▿

    PubMed Central

    Throne-Holst, Mimmi; Wentzel, Alexander; Ellingsen, Trond E.; Kotlar, Hans-Kristian; Zotchev, Sergey B.

    2007-01-01

    Acinetobacter sp. strain DSM 17874 is capable of utilizing n-alkanes with chain lengths ranging from that of decane (C10H22) to that of tetracontane (C40H82) as a sole carbon source. Two genes encoding AlkB-type alkane hydroxylase homologues, designated alkMa and alkMb, have been shown to be involved in the degradation of n-alkanes with chain lengths of from 10 to 20 C atoms in this strain. Here, we describe a novel high-throughput screening method and the screening of a transposon mutant library to identify genes involved in the degradation of n-alkanes with C chain lengths longer than 20, which are solid at 30°C, the optimal growth temperature for Acinetobacter sp. strain DSM 17874. A library consisting of approximately 6,800 Acinetobacter sp. strain DSM 17874 transposon mutants was constructed and screened for mutants unable to grow on dotriacontane (C32H66) while simultaneously showing wild-type growth characteristics on shorter-chain n-alkanes. For 23 such mutants isolated, the genes inactivated by transposon insertion were identified. Targeted inactivation and complementation studies of one of these genes, designated almA and encoding a putative flavin-binding monooxygenase, confirmed its involvement in the strain's metabolism of long-chain n-alkanes. To our knowledge, almA represents the first cloned gene shown to be involved in the bacterial degradation of long-chain n-alkanes of 32 C's and longer. Genes encoding AlmA homologues were also identified in other long-chain n-alkane-degrading Acinetobacter strains. PMID:17400787

  7. Origin in Acinetobacter guillouiae and Dissemination of the Aminoglycoside-Modifying Enzyme Aph(3′)-VI

    PubMed Central

    Yoon, Eun-Jeong; Goussard, Sylvie; Touchon, Marie; Krizova, Lenka; Cerqueira, Gustavo; Murphy, Cheryl; Lambert, Thierry; Grillot-Courvalin, Catherine; Nemec, Alexandr

    2014-01-01

    ABSTRACT The amikacin resistance gene aphA6 was first detected in the nosocomial pathogen Acinetobacter baumannii and subsequently in other genera. Analysis of 133 whole-genome sequences covering the taxonomic diversity of Acinetobacter spp. detected aphA6 in the chromosome of 2 isolates of A. guillouiae, which is an environmental species, 1 of 8 A. parvus isolates, and 5 of 34 A. baumannii isolates. The gene was also present in 29 out of 36 A. guillouiae isolates screened by PCR, indicating that it is ancestral to this species. The Pnative promoter for aphA6 in A. guillouiae and A. parvus was replaced in A. baumannii by PaphA6, which was generated by use of the insertion sequence ISAba125, which brought a −35 sequence. Study of promoter strength in Escherichia coli and A. baumannii indicated that PaphA6 was four times more potent than Pnative. There was a good correlation between aminoglycoside MICs and aphA6 transcription in A. guillouiae isolates that remained susceptible to amikacin. The marked topology differences of the phylogenetic trees of aphA6 and of the hosts strongly support its recent direct transfer within Acinetobacter spp. and also to evolutionarily remote bacterial genera. Concomitant expression of aphA6 must have occurred because, contrary to the donors, it can confer resistance to the new hosts. Mobilization and expression of aphA6 via composite transposons and the upstream IS-generating hybrid PaphA6, followed by conjugation, seems the most plausible mechanism. This is in agreement with the observation that, in the recipients, aphA6 is carried by conjugative plasmids and flanked by IS that are common in Acinetobacter spp. Our data indicate that resistance genes can also be found in susceptible environmental bacteria.   PMID:25336457

  8. Investigation of the Distributions and Types of Multidrug-Resistant Acinetobacter baumannii in Different Departments in a General Hospital

    PubMed Central

    Qian, Yaner; Dong, Xuejun; Wang, Zongxin; Yang, Guocan; Liu, Qi

    2015-01-01

    Background: Acinetobacter baumannii is the most prevalent strain in hospitals and different clinical departments. Objectives: The current study aimed to investigate the genetic characteristics and resistance mechanisms of A. baumannii isolated from clinical samples in Shaoxing people’s hospital affiliated to Zhejiang University, Shaoxing, China. Patients and Methods: Acinetobacter baumannii strains were isolated from blood, phlegm and skin of the patients hospitalized in different departments as respiratory medicine, plastic surgery and intensive care unit (ICU). Multilocus sequence typing (MLST) was used to characterize the isolates. Kirby-Bauer test was used to evaluate antibiotic resistance of the bacteria. The expression of resistance inducing genes was detected by reverse transcription polymerase chain reaction (RT-PCR). The results were analyzed and compared. Results: Two bacterial types, ST208, and ST218, were identified in all 140 samples. The ST208 mainly came from ICU and department of respiratory medicine, while ST218 from department of plastic surgery; 70.21% of ST208 and 84.78% of ST218 were carbapenem-resistant Acinetobacter baumannii (CRAB) and carbapenem-susceptible Acinetobacter baumannii (CSAB), respectively. Multidrug-resistance genes in CRAB isolated from the hospital mainly included, oxa-23, oxa-5, intl 1 and qaceΔ1-sul 1. Besides, the highest and lowest antibiotic resistance was observed in the strains isolated from blood samples and wounds, respectively. Conclusions: The distribution of AB varies in different clinical departments and samples. In the hospital under study, the main types of AB were ST208 and ST218. The genes which affect the ability of antibiotic-resistance were oxa-23, oxa-51, intl 1 and qaceΔ1-sul 1. PMID:26487921

  9. Emergence and spread of plasmid-borne tet(B)::ISCR2 in minocycline-resistant Acinetobacter baumannii isolates.

    PubMed

    Vilacoba, Elisabet; Almuzara, Marisa; Gulone, Lucia; Traglia, German Matías; Figueroa, Silvia A; Sly, Gabriela; Fernández, Analia; Centrón, Daniela; Ramírez, María Soledad

    2013-01-01

    Resistance to minocycline has emerged in multidrug-resistant Acinetobacter baumannii isolates from Buenos Aires hospitals. Few reports about the description and dispersion of tet genes in this species have been published. We observed the presence of tet(B) in all minocycline-resistant isolates. This gene was found to be associated with the ISCR2 mobile element, which may, in part, explain its dispersion. PMID:23147737

  10. First report of an OXA-23 carbapenemase-producing Acinetobacter baumannii clinical isolate related to Tn2006 in Spain.

    PubMed

    Espinal, P; Macià, M D; Roca, I; Gato, E; Ruíz, E; Fernández-Cuenca, F; Oliver, A; Rodríguez-Baño, J; Bou, G; Tomás, M; Vila, J

    2013-01-01

    A carbapenem-resistant Acinetobacter baumannii clinical isolate belonging to European clone II and sequence type 2 was recovered from a patient in the Son Espases hospital in Mallorca, Spain. Genetic analysis showed the presence of the bla(OXA-23) gene in association with the widely disseminated transposon Tn2006. This is the first reported identification of A. baumannii carrying bla(OXA-23) in Spain. PMID:23070166

  11. Impaired Virulence and Fitness of a Colistin-Resistant Clinical Isolate of Acinetobacter baumannii in a Rat Model of Pneumonia

    PubMed Central

    Hraiech, Sami; Roch, Antoine; Lepidi, Hubert; Atieh, Thérèse; Audoly, Gilles; Rolain, Jean-Marc; Raoult, Didier; Brunel, Jean-Michel; Papazian, Laurent

    2013-01-01

    We compared the fitness and lung pathogenicity of two isogenic clinical isolates of Acinetobacter baumannii, one resistant (ABCR) and the other susceptible (ABCS) to colistin. In vitro, ABCR exhibited slower growth kinetics than ABCS. In a rat model of pneumonia, ABCR was associated with less pronounced signs of infection (lung bacterial count, systemic dissemination, and lung damage) and a better outcome (ABCR and ABCS mortality rates, 20 and 50%, respectively [P = 0.03]). PMID:23836181

  12. [Extended spectrum beta lactamases (ESBL) production in Acinetobacter baumannii strains isolated from Chilean hospitals belonging to VIII Region].

    PubMed

    Pino I, Carolina; Domínguez Y, Mariana; González R, Gerardo; Bello T, Helia; Sepúlveda A, Marcela; Mella M, Sergio; Zemelman M, Claudia; Zemelman Z, Raúl

    2007-04-01

    The resistance of Acinetobacter baumannii to ss-lactam antibiotics is mainly due to the synthesis of ss-lactamases. From a clinical point of view, this bacteria and others, grouped under the acronym SPACE (S: Serratia, P: Pseudomonas, A: Acinetobacter, C: Citrobacter, E: Enterobacter) are essentially Amp-C ss-lactamases producers. There is no local information about ESBL presence in Acinetobacter. We studied ESBL production using the Ho and col. technique modified by adding cloxacillin as chromosomal ss-lactamases inhibitor. From 69 isolates, with resistance to at least one third generation cephalosporin, only 7 showed positive synergy test. Four of these amplified for TEM family gene, and one of these amplified also for the OXA family. Our study found a low ESBL production percentage, which agrees with the premise of Amp-C as the main mechanism of resistance to ss-lactam antibiotics in A. baumannii. However, the ESBL description in these bacteria emphasizes the capacity of expressing multiple resistance mechanisms. PMID:17453072

  13. Characterization of carbapenem-resistant Acinetobacter baumannii clinical isolates in a tertiary care hospital in Saudi Arabia.

    PubMed

    Abdalhamid, Baha; Hassan, Hoda; Itbaileh, Ahmad; Shorman, Mahmoud

    2014-01-01

    This study characterized the occurrence of carbapenem resistance of Acinetobacter baumannii isolates in a tertiary care hospital in Saudi Arabia. From January 2010 until February 2012, Acinetobacter spp. isolates were collected from different wards and were identified using Vitek 2 system and 16S rRNA gene sequencing. Vitek 2 system and Etest were used for susceptibility testing. PCR and Pulse field gel electrophoresis (PFGE) were used for detecting and typing genes associated with carbapenem resistance. A total of 141 isolates were identified as A. baumannii. A total of 46 (32.6%) isolates were carbapenem-resistant Acinetobacter baumannii (CRAB) isolates and had wild diversity by PFGE. Metallo ?-lactamase confirmatory test was positive for 43 isolates with negative PCR for blaIMP and blaVIM. Among the 46 CRAB strains, 37 isolates harbored blaOXA-23 which was encoded downstream of ISAba1 and 1 isolate had ISAba1 encoded upstream blaOXA-51. These data reveal that the interhospital transmission of CRAB isolates was apparently insignificant. BlaOXA-23 adjacent to ISAba1 was the main mechanism of carbapenem resistance in these isolates. To our knowledge, this is the first molecular study characterizing carbapenem resistance in A. baumannii in the Eastern Province of Saudi Arabia. PMID:24531172

  14. Medically Relevant Acinetobacter Species Require a Type II Secretion System and Specific Membrane-Associated Chaperones for the Export of Multiple Substrates and Full Virulence

    PubMed Central

    Harding, Christian M.; Kinsella, Rachel L.; Palmer, Lauren D.; Skaar, Eric P.; Feldman, Mario F.

    2016-01-01

    Acinetobacter baumannii, A. nosocomialis, and A. pittii have recently emerged as opportunistic human pathogens capable of causing severe human disease; however, the molecular mechanisms employed by Acinetobacter to cause disease remain poorly understood. Many pathogenic members of the genus Acinetobacter contain genes predicted to encode proteins required for the biogenesis of a type II secretion system (T2SS), which have been shown to mediate virulence in many Gram-negative organisms. Here we demonstrate that Acinetobacter nosocomialis strain M2 produces a functional T2SS, which is required for full virulence in both the Galleria mellonella and murine pulmonary infection models. Importantly, this is the first bona fide secretion system shown to be required for virulence in Acinetobacter. Using bioinformatics, proteomics, and mutational analyses, we show that Acinetobacter employs its T2SS to export multiple substrates, including the lipases LipA and LipH as well as the protease CpaA. Furthermore, the Acinetobacter T2SS, which is found scattered amongst five distinct loci, does not contain a dedicated pseudopilin peptidase, but instead relies on the type IV prepilin peptidase, reinforcing the common ancestry of these two systems. Lastly, two of the three secreted proteins characterized in this study require specific chaperones for secretion. These chaperones contain an N-terminal transmembrane domain, are encoded adjacently to their cognate effector, and their disruption abolishes type II secretion of their cognate effector. Bioinformatic analysis identified putative chaperones located adjacent to multiple previously known type II effectors from several Gram-negative bacteria, which suggests that T2SS chaperones constitute a separate class of membrane-associated chaperones mediating type II secretion. PMID:26764912

  15. Conference focuses on microbial enhancement of oil recovery

    SciTech Connect

    Donaldson, E.C.; Clark, J.B.

    1982-12-20

    The conference proceedings described research developments on MEOR that have occurred during the last 2-3 years, and these are focused in the conclusions that follow: 1. The biopolymer from Xanthamonas campestris is used extensively by the petroleum industry in drilling mud preparations. 2. A biosurfactant product from Acinetobacter calcoaceticus RAG 1 can be prepared in commercial quantities and is proposed for emulsification of crude oils which may be important for cleaning of tanks and pipelines. 3. An extracellular polysaccharide prepared from aerobic fermentation of crude oil has been developed in China and is proposed as a waterflood additive. 4. Salt-tolerant bacteria of the genus Clostridium have been isolated and shown to produce relatively large amounts of carbon dioxide and low molecular weight organic solvents in 6-7% salt solutions. 5. Methods were developed to induce stimulation of indigenous anaerobic bacteria in oil fields for production of methane and other gases. 6. Living cells have been found to be strongly adsorbed on sandstone which restricts the injection of nonspore-forming bacteria unless carrier solutions are developed that inhibit cell adsorption. 7. Laboratory experiments indicate that some bacteria can be injected into high permeability zones to increase the sweep efficiency of a waterflood. 8. Mixed bacteria cultures (Gramnegative, facultative rods) have been isolated that produce large amounts of gas and are designated for possible repressurization of oil fields in Canada. 9. A mixed culture has been developed which produces a biosurfactant when fermented aerobically with crude oil that causes a decrease of the phase viscosity of 95% and produces a non-wetting (on glass of steel) emulsion. 10. The biosurfactant produced by Corynebacterium lepus has been demonstrated to be effective for the release of bitumen from tar sands.

  16. Antimicrobial susceptibility profiling and genomic diversity of Acinetobacter baumannii isolates: A study in western Iran

    PubMed Central

    Mohajeri, Parviz; Farahani, Abbas; Feizabadi, Mohammad Mehdi; Ketabi, Hosnieh; Abiri, Ramin; Najafi, Farid

    2013-01-01

    Background and Objective Acinetobacter baumannii is an aerobic non-motile Gram-negative bacterial pathogen that is resistant to most antibiotics. Carbapenems are the most common antibiotics for the treatment of infections caused by this pathogen. Mechanisms of antibiotic-resistance in A. baumannii are mainly mediated by efflux pumps-lactamases. The aim of this study was to determine antibiotic susceptibility, the possibility of existence of OXAs genes and fingerprinting by Pulsed-Field Gel Electrophoresis (PFGE) among clinical isolates of Acinetobacter collected from Kermanshah hospitals. Materials and Methods One hundred and four isolates were collected from patients attending Imam Reza, Taleghani and Imam Khomeini hospitals of Kermanshah (Iran). Isolates were identified by biochemical tests and API 20NE kit. The susceptibility to different antibiotics was assessed with Kirby-Bauer disk diffusion method. PCR was performed for detection of bla OXA-23, bla OXA-24, bla OXA-51 and bla OXA-58 beta-lactamase genes. Clonal relatedness was estimated by PFGE (with the restriction enzyme Apa I) and DNA patterns were analyzed by Gel compare II 6.5 software. Results All isolates showed high-level of resistance to imipenem, meropenem as well as to other antimicrobial agents, while no resistance to polymyxin B, colistin, tigecylcine and minocycline was observed. The bla OXA-23like and bla OXA-24 like were found among 77.9% and 19.2% of the isolates, respectively. All isolates were positive for bla OXA-51, but none produced any amplicon for bla OXA-58. PFGE genotype analysis suggested the existence of eight clones among the 104 strains [A (n = 35), B (n = 29), C (n = 19), D (n = 10), E (n = 4), F (n = 3), G (n = 3), H (n = 1)]. Clone A was the dominant clone in hospital settings particularly infection wards so that the isolates in this group, compared to the other clones, showed higher levels of resistance to antibiotics. Conclusion The bla OXA-51-like and bla OXA-23like were

  17. Paradoxical Effect of Polymyxin B: High Drug Exposure Amplifies Resistance in Acinetobacter baumannii.

    PubMed

    Tsuji, Brian T; Landersdorfer, Cornelia B; Lenhard, Justin R; Cheah, Soon-Ee; Thamlikitkul, Visanu; Rao, Gauri G; Holden, Patricia N; Forrest, Alan; Bulitta, Jürgen B; Nation, Roger L; Li, Jian

    2016-07-01

    Administering polymyxin antibiotics in a traditional fashion may be ineffective against Gram-negative ESKAPE (Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter species) pathogens. Here, we explored increasing the dose intensity of polymyxin B against two strains of Acinetobacter baumannii in the hollow-fiber infection model. The following dosage regimens were simulated for polymyxin B (t1/2 = 8 h): non-loading dose (1.43 mg/kg of body weight every 12 h [q12h]), loading dose (2.22 mg/kg q12h for 1 dose and then 1.43 mg/kg q12h), front-loading dose (3.33 mg/kg q12h for 1 dose followed by 1.43 mg/kg q12h), burst (5.53 mg/kg for 1 dose), and supraburst (18.4 mg/kg for 1 dose). Against both A. baumannii isolates, a rapid initial decline in the total population was observed within the first 6 h of polymyxin exposure, whereby greater polymyxin B exposure resulted in greater maximal killing of -1.25, -1.43, -2.84, -2.84, and -3.40 log10 CFU/ml within the first 6 h. Unexpectedly, we observed a paradoxical effect whereby higher polymyxin B exposures dramatically increased resistant subpopulations that grew on agar containing up to 10 mg/liter of polymyxin B over 336 h. High drug exposure also proliferated polymyxin-dependent growth. A cost-benefit pharmacokinetic/pharmacodynamic relationship between 24-h killing and 336-h resistance was explored. The intersecting point, where the benefit of bacterial killing was equal to the cost of resistance, was an fAUC0-24 (area under the concentration-time curve from 0 to 24 h for the free, unbound fraction of drug) of 38.5 mg · h/liter for polymyxin B. Increasing the dose intensity of polymyxin B resulted in amplification of resistance, highlighting the need to utilize polymyxins as part of a combination against high-bacterial-density A. baumannii infections. PMID:27067330

  18. Prophage induction and differential RecA and UmuDAb transcriptome regulation in the DNA damage responses of Acinetobacter baumannii and Acinetobacter baylyi.

    PubMed

    Hare, Janelle M; Ferrell, Joshua C; Witkowski, Travis A; Grice, Alison N

    2014-01-01

    The SOS response to DNA damage that induces up to 10% of the prokaryotic genome requires RecA action to relieve LexA transcriptional repression. In Acinetobacter species, which lack LexA, the error-prone polymerase accessory UmuDAb is instead required for ddrR induction after DNA damage, suggesting it might be a LexA analog. RNA-Seq experiments defined the DNA damage transcriptome (mitomycin C-induced) of wild type, recA and umuDAb mutant strains of both A. baylyi ADP1 and A. baumannii ATCC 17978. Of the typical SOS response genes, few were differentially regulated in these species; many were repressed or absent. A striking 38.4% of all ADP1 genes, and 11.4% of all 17978 genes, were repressed under these conditions. In A. baylyi ADP1, 66 genes (2.0% of the genome), including a CRISPR/Cas system, were DNA damage-induced, and belonged to four regulons defined by differential use of recA and umuDAb. In A. baumannii ATCC 17978, however, induction of 99% of the 152 mitomycin C-induced genes depended on recA, and only 28 of these genes required umuDAb for their induction. 90% of the induced A. baumannii genes were clustered in three prophage regions, and bacteriophage particles were observed after mitomycin C treatment. These prophages encoded esvI, esvK1, and esvK2, ethanol-stimulated virulence genes previously identified in a Caenorhabditis elegans model, as well as error-prone polymerase alleles. The induction of all 17978 error-prone polymerase alleles, whether prophage-encoded or not, was recA dependent, but only these DNA polymerase V-related genes were de-repressed in the umuDAb mutant in the absence of DNA damage. These results suggest that both species possess a robust and complex DNA damage response involving both recA-dependent and recA-independent regulons, and further demonstrates that although umuDAb has a specialized role in repressing error-prone polymerases, additional regulators likely participate in these species' transcriptional response to DNA damage

  19. Prophage Induction and Differential RecA and UmuDAb Transcriptome Regulation in the DNA Damage Responses of Acinetobacter baumannii and Acinetobacter baylyi

    PubMed Central

    Hare, Janelle M.; Ferrell, Joshua C.; Witkowski, Travis A.; Grice, Alison N.

    2014-01-01

    The SOS response to DNA damage that induces up to 10% of the prokaryotic genome requires RecA action to relieve LexA transcriptional repression. In Acinetobacter species, which lack LexA, the error-prone polymerase accessory UmuDAb is instead required for ddrR induction after DNA damage, suggesting it might be a LexA analog. RNA-Seq experiments defined the DNA damage transcriptome (mitomycin C-induced) of wild type, recA and umuDAb mutant strains of both A. baylyi ADP1 and A. baumannii ATCC 17978. Of the typical SOS response genes, few were differentially regulated in these species; many were repressed or absent. A striking 38.4% of all ADP1 genes, and 11.4% of all 17978 genes, were repressed under these conditions. In A. baylyi ADP1, 66 genes (2.0% of the genome), including a CRISPR/Cas system, were DNA damage-induced, and belonged to four regulons defined by differential use of recA and umuDAb. In A. baumannii ATCC 17978, however, induction of 99% of the 152 mitomycin C-induced genes depended on recA, and only 28 of these genes required umuDAb for their induction. 90% of the induced A. baumannii genes were clustered in three prophage regions, and bacteriophage particles were observed after mitomycin C treatment. These prophages encoded esvI, esvK1, and esvK2, ethanol-stimulated virulence genes previously identified in a Caenorhabditis elegans model, as well as error-prone polymerase alleles. The induction of all 17978 error-prone polymerase alleles, whether prophage-encoded or not, was recA dependent, but only these DNA polymerase V-related genes were de-repressed in the umuDAb mutant in the absence of DNA damage. These results suggest that both species possess a robust and complex DNA damage response involving both recA-dependent and recA-independent regulons, and further demonstrates that although umuDAb has a specialized role in repressing error-prone polymerases, additional regulators likely participate in these species' transcriptional response to DNA damage

  20. Development of an rRNA-targeted oligonucleotide probe specific for the genus Acinetobacter and its application for in situ monitoring in activated sludge.

    PubMed Central

    Wagner, M; Erhart, R; Manz, W; Amann, R; Lemmer, H; Wedi, D; Schleifer, K H

    1994-01-01

    Enhanced biological phosphate removal in an anaerobic-aerobic activated sludge system has generally been ascribed to members of the genus Acinetobacter. A genus-specific 16S rRNA-targeted oligonucleotide probe was developed to investigate the role of Acinetobacter spp. in situ. Nonisotopic dot blot hybridization to 66 reference strains, including the seven described Acinetobacter spp., demonstrated the expected probe specificity. Fluorescent derivatives were used for in situ monitoring of Acinetobacter spp. in the anaerobic and aerobic compartments of a sewage treatment plant with enhanced biological phosphate removal. Microbial community structures were further analyzed with oligonucleotide probes specific for the alpha, beta, or gamma subclasses of the class Proteobacteria, for the Cytophaga-Flavobacterium cluster, for gram-positive bacteria with a high G + C DNA content, and for all bacteria. Total cell counts were determined by 4',6-diamidino-2-phenylindole staining. In both the anaerobic and the aerobic basins, the activated sludge samples were dominated by members of the class Proteobacteria belonging to the beta subclass and by gram-positive bacteria with a high G + C DNA content. Acinetobacter spp. constituted less than 10% of all bacteria. For both basins, the microbial community structures determined with molecular techniques were compared with the compositions of the heterotrophic saprophytic microbiota determined with agar plating techniques. Isolates on nutrient-rich medium were classified by whole-cell hybridization with rRNA-targeted probes and fatty acid analysis.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:7512807

  1. Genetic diversity of endophytic diazotrophs of the wild rice, Oryza alta and identification of the new diazotroph, Acinetobacter oryzae sp. nov.

    PubMed

    Chaudhary, Hassan Javed; Peng, Guixiang; Hu, Mei; He, Yumei; Yang, Lijuan; Luo, Yan; Tan, Zhiyuan

    2012-05-01

    Thirty-three endophytic diazotrophs were isolated from surface-sterilized leaves, stem, and roots of wild rice Oryza alta. The SDS-PAGE profile of total protein and insertion sequence-based polymerase chain reaction (IS-PCR) fingerprinting grouped the isolates into four clusters (I-IV). The 16S rRNA gene sequence homology of the representative strains B21, B31, B1, and B23 of clusters I, II, III, and IV were assigned to Pseudomonas oleovorans (99.2% similarity), Burkholderia fungorum (99.4% similarity), Enterobacter cloacae (98.9% similarity), and Acinetobacter johnsonii (98.4% similarity), respectively. The results showed wide genetic diversity of the putative diazotrophic strains of the wild rice, O. alta, and the strains of cluster IV are the first report of nitrogen-fixing Acinetobacter species. The cell size, phenotypic characters, total protein profile, genomic DNA fingerprinting, DNA-DNA hybridization, and antibiotic resistance differentiated strain B23(T) from its closest relatives A. johnsonii LMG999(T) and Acinetobacter haemolyticus LMG996(T). The DNA-DNA hybridization also distinguished the strain B23(T) from the closely related Acinetobacter species. Based on these data, a novel species, Acinetobacter oryzae sp. nov., and strain B23(T) (=LMG25575(T) = CGMCC1.10689(T)) as the type strain were proposed. PMID:22105517

  2. Outer membrane Protein A plays a role in pathogenesis of Acinetobacter nosocomialis.

    PubMed

    Kim, Sang Woo; Oh, Man Hwan; Jun, So Hyun; Jeon, Hyejin; Kim, Seung Il; Kim, Kwangho; Lee, Yoo Chul; Lee, Je Chul

    2016-05-18

    Acinetobacter nosocomialis is an important nosocomial pathogen that causes a variety of human infections. However, the specific virulence factors of this microorganism have not yet been determined. We investigated the role of outer membrane protein A (OmpA) in the pathogenesis of A. nosocomialis. A ΔompA mutant of the A. nosocomialis ATCC 17903(T) strain was constructed using markerless gene deletion. The ΔompA mutant displayed reduced biofilm formation in polystyrene tubes and reduced adherence to A549 cells in comparison to the wild-type strain. These virulence traits of the ΔompA mutant strain were restored when the ompA gene was complemented. Cytotoxicity was not significantly different between the wild-type strain and the ΔompA mutant when A549 cells were infected with bacteria or treated with outer membrane vesicles (OMVs). However, OMVs from the wild-type strain induced cytotoxicity in HEp-2 cells, whereas OMVs from the ΔompA mutant did not induce cytotoxicity. Proteomic analysis of OMVs revealed that OmpA influenced the distribution of envelope and periplasmic proteins. Overall, this study is the first report that links OmpA to A. nosocomialis pathogenesis, and highlights OmpA as a putative target to develop anti-virulence agents or vaccines against A. nosocomialis infection. PMID:26759990

  3. Isolation and characterization of antimicrobial compounds in plant extracts against multidrug-resistant Acinetobacter baumannii.

    PubMed

    Miyasaki, Yoko; Rabenstein, John D; Rhea, Joshua; Crouch, Marie-Laure; Mocek, Ulla M; Kittell, Patricia Emmett; Morgan, Margie A; Nichols, Wesley Stephen; Van Benschoten, M M; Hardy, William David; Liu, George Y

    2013-01-01

    The number of fully active antibiotic options that treat nosocomial infections due to multidrug-resistant Acinetobacter baumannii (A. baumannii) is extremely limited. Magnolia officinalis, Mahonia bealei, Rabdosia rubescens, Rosa rugosa, Rubus chingii, Scutellaria baicalensis, and Terminalia chebula plant extracts were previously shown to have growth inhibitory activity against a multidrug-resistant clinical strain of A. baumannii. In this study, the compounds responsible for their antimicrobial activity were identified by fractionating each plant extract using high performance liquid chromatography, and determining the antimicrobial activity of each fraction against A. baumannii. The chemical structures of the fractions inhibiting >40% of the bacterial growth were elucidated by liquid chromatography/mass spectrometry analysis and nuclear magnetic resonance spectroscopy. The six most active compounds were identified as: ellagic acid in Rosa rugosa; norwogonin in Scutellaria baicalensis; and chebulagic acid, chebulinic acid, corilagin, and terchebulin in Terminalia chebula. The most potent compound was identified as norwogonin with a minimum inhibitory concentration of 128 µg/mL, and minimum bactericidal concentration of 256 µg/mL against clinically relevant strains of A. baumannii. Combination studies of norwogonin with ten anti-Gram negative bacterial agents demonstrated that norwogonin did not enhance the antimicrobial activity of the synthetic antibiotics chosen for this study. In conclusion, of all identified antimicrobial compounds, norwogonin was the most potent against multidrug-resistant A. baumannii strains. Further studies are warranted to ascertain the prophylactic and therapeutic potential of norwogonin for infections due to multidrug-resistant A. baumannii. PMID:23630600

  4. Long-Term Diversity and Genome Adaptation of Acinetobacter baylyi in a Minimal-Medium Chemostat

    PubMed Central

    Jezequel, Nadia; Lagomarsino, Marco Cosentino; Heslot, Francois; Thomen, Philippe

    2013-01-01

    Laboratory-based evolution experiments on microorganisms that do not recombine frequently show two distinct phases: an initial rapid increase in fitness followed by a slower regime. To explore the population structure and the evolutionary tree in the later stages of adaptation, we evolved a very large population (∼3 × 10) of Acinetobacter baylyi bacteria for approximately 2,800 generations from a single clone. The population was maintained in a chemostat at a high dilution rate. Nitrate in limiting amount and as the sole nitrogen source was used as a selection pressure. Analysis via resequencing of genomes extracted from populations at different generations provides evidence that long-term diversity can be established in the chemostat in a very simple medium. To find out which biological parameters were targeted by adaptation, we measured the maximum growth rate, the nitrate uptake, and the resistance to starvation. Overall, we find that maximum growth rate could be a reasonably good proxy for fitness. The late slow adaptation is compatible with selection coefficients spanning a typical range of 10–10 per generation as estimated by resequencing, pointing to a possible subpopulations structuring. PMID:23254395

  5. Alcohol dehydrogenases in Acinetobacter sp. strain HO1-N: role in hexadecanse and hexadecanol metabolism

    SciTech Connect

    Singer, M.E.; Finnerty, W.R.

    1985-12-01

    Multiple alcohol dehydrogenases (ADH) were demonstrated in Acinetobacter sp. strain HO1-N. ADH-A and ADH-B were distinguished on the basis of electrophoretic mobility, pyridine nucleotide cofactor requirement, and substrate specificity. ADH-A is a soluble, NAD-linked, inducible ethanol dehydrogenase (EDH). An ethanol-negative mutant (Eth1) was isolated which contained 6.5% of wild-type EDH activity and was deficient in ADH-A. Eth1 exhibited normal growth on hexadecane and hexadecanol. A second ethanol-negative mutant (Eth3) was acetaldehyde dehydrogenase (ALDH) deficient, having 12.5% of wild-type ALDH activity. Eth3 had threefold-higher EDH activity than the wild-type strain. ALDH is a soluble, NAD-linked, ethanol-inducible enzyme. Eth3 exhibited normal growth on hexadecane, hexadecanol, and fatty aldehyde. ADH-B is soluble, constitutive, NADP-linked ADH which was active with medium-chain-length alcohols. Hexadecanol dehydrogenase (HDH), a soluble and membrane-bound, NAD-linked ADH, was induced 5- to 11-fold by growth on hexadecane or hexadecanol. HDH was distinct from ADH-A and ADH-B. NAD-linked HDH appears to possess a functional role in hexadecane and hexadecanol dissimilation.

  6. Biological remediation of polynuclear aromatic hydrocarbon contaminated soils using Acinetobacter sp.

    SciTech Connect

    Joshi, M.M.; Lee, S.

    1996-03-01

    Soils contaminated with polynuclear aromatic hydrocarbons (PAHs) pose a hazard to life. The remediation of such sites has been attempted using various methods such as solvent washing, air stripping, incineration, composting, electrokinetic remediation, and supercritical extraction. However, applicability of these physical, chemical, and biological treatment methods or their combination is critically dependent on soil characteristics, nature and level of contamination, site specifications, and economic feasibility, to name a few. Present research is aimed at studying the applicability of biological treatment for decontamination of industrial soil containing PAHs. The current preliminary study included soil analysis, contaminant characterization, and soil treatment using Acinetobacter sp. The soil treatment over a 5-week period, with minimal supplemental nutrient addition, showed removal efficiencies of 80% and more. The effect of initial microbial population in soil on the removal efficiency over a 5-week treatment period was studied. Experiments were designed to compare the removal efficiencies occurring in packed beds versus continuously-stirred tank reactor (CSTR)-type fermentation conditions. This also estimated a conservative range of decontamination efficiencies achievable using minimal control.

  7. Bacterial O-methylation of halogen-substituted phenols. [Rhodococcus; Acinetobacter

    SciTech Connect

    Allard, A.S.; Remberger, M.; Neilson, A.H.

    1987-04-01

    Two strains of bacteria capable of carrying out the O-methylation of phenolic compounds, one from the gram-positive genus Rhodococcus and one from the gram-negative genus Acinetobacter, were used to examine the O-methylation of phenols carrying fluoro-, chloro-, and bromo-substituents. Zero-order rates of O-methylation were calculated from data for the chloro- and bromophenols; there was no simple relationship between the rate of reaction and the structure of the substrates, and significant differences were observed in the responses of the two test organisms. For the gram-negative strain, the pattern of substitution was as important as the number of substituents. Hexachlorophene was resistant to O-methylation by both strains, and tetrabromobisphenol-A was O-methylated only by the gram-positive strain. It is suggested that in the natural environment, bacterial O-methylation of phenols carrying electron-attracting substituents might be a significant alternative to biodegradation.

  8. Construction of a 3-chlorobiphenyl-utilizing recombinant from an intergeneric mating. [Pseudomonas; Acinetobacter

    SciTech Connect

    Adams, R.H.; Huang, C.M.; Higson, F.K.; Brenner, V.; Focht, D.D. )

    1992-02-01

    Recombinant Pseudomonas sp. strain CB15, which grows on 3-chlorobiphenyl (3CB), was constructed from Pseudomonas sp. strain HF1, which grows on 3-chlorobenzoate, and from Acinetobacter sp. strain P6, which grows on biphenyl, by using a continuous amalgamated culture apparatus. DNA from strains CB15 and HF1 hybridized very strongly to each other, while hybridization between both parental strains, HF1 and P6, was negligible. However, DNA from the recombinant CB15 hybridized moderately to strongly with three specific fragments of parental strain P6. Strains HF1 and P6 did not grow on 3CB, but recombinant strain CB15 mineralized this compound and released inorganic chloride. When growing on 3CB, strain CB15 accumulated brown products, one of which was identified as 3-chloro-5-(2{prime}-hydroxy-3{prime}-chlorophenyl)-1,2-benzoquinone by mass spectrometry. At least three methods of inhibition from catecholic intermediates may account for slow growth on 3CB. In resting-cell assays, recombinant strain CB15 and strain P6 both metabolized 3CB faster than 3,3{prime}-dichlorobiphenyl. However, 3,3{prime}-dichlorobiphenyl could not be utilized as a growth substrate by strain CB15, nor did its presence have any effect on the rate of 3CB mineralization.

  9. Acinetobacter baumannii-Associated Skin and Soft Tissue Infections: Recognizing a Broadening Spectrum of Disease*

    PubMed Central

    Guerrero, Dubert M.; Perez, Federico; Conger, Nicholas G.; Solomkin, Joseph S.; Adams, Mark D.; Rather, Philip N.

    2010-01-01

    Abstract Background Acinetobacter baumannii is gaining importance as a cause of nosocomial infections, but its role in skin and soft tissue infection (SSTI) is not well defined. As a result of the outbreak of A. baumannii occurring in military personnel in Iraq and Afghanistan, reports of severe wound infections and SSTI caused by this pathogen are increasing in frequency. Methods We describe four cases of monomicrobial and polymicrobial A. baumannii–associated necrotizing SSTI accompanied by A. baumannii bacteremia and offer a review of similar experiences published in the literature. Results Our comparative analysis reveals four unique features associated with necrotizing SSTI associated with A. baumannii: i) Occurs in hosts with underlying comorbidities (e.g., trauma, cirrhosis); ii) is often accompanied by bacteremia; iii) multiple drug resistance and the presence of co-pathogens frequently complicated treatment (64% of cases); iv) the cases reported here and in our review required surgical debridement (84% of cases) and led to substantial mortality (∼30%). Conclusions As the prevalence of A. baumannii continues to increase in our health care system, SSTIs caused by this organism may become more common. Clinicians must be aware that the spectrum of disease caused by A. baumannii could include severe necrotizing SSTI and that vigilance for potential complications is necessary. PMID:19788383

  10. Identification and Characterization of a Glycosyltransferase Involved in Acinetobacter baumannii Lipopolysaccharide Core Biosynthesis▿

    PubMed Central

    Luke, Nicole R.; Sauberan, Shauna L.; Russo, Thomas A.; Beanan, Janet M.; Olson, Ruth; Loehfelm, Thomas W.; Cox, Andrew D.; St. Michael, Frank; Vinogradov, Evgeny V.; Campagnari, Anthony A.

    2010-01-01

    Although Acinetobacter baumannii has emerged as a significant cause of nosocomial infections worldwide, there have been few investigations describing the factors important for A. baumannii persistence and pathogenesis. This paper describes the first reported identification of a glycosyltransferase, LpsB, involved in lipopolysaccharide (LPS) biosynthesis in A. baumannii. Mutational, structural, and complementation analyses indicated that LpsB is a core oligosaccharide glycosyl transferase. Using a genetic approach, lpsB was compared with the lpsB homologues of several A. baumannii strains. These analyses indicated that LpsB is highly conserved among A. baumannii isolates. Furthermore, we developed a monoclonal antibody, monoclonal antibody 13C11, which reacts to an LPS core epitope expressed by approximately one-third of the A. baumannii clinical isolates evaluated to date. Previous studies describing the heterogeneity of A. baumannii LPS were limited primarily to structural analyses; therefore, studies evaluating the correlation between these surface glycolipids and pathogenesis were warranted. Our data from an evaluation of LpsB mutant 307::TN17, which expresses a deeply truncated LPS glycoform consisting of only two 3-deoxy-d-manno-octulosonic acid residues and lipid A, suggest that A. baumannii LPS is important for resistance to normal human serum and confers a competitive advantage for survival in vivo. These results have important implications for the role of LPS in A. baumannii infections. PMID:20194587

  11. Treatment Options for Carbapenem-Resistant and Extensively Drug-Resistant Acinetobacter baumannii Infections

    PubMed Central

    Viehman, J. Alexander; Nguyen, Minh-Hong; Doi, Yohei

    2014-01-01

    Acinetobacter baumannii is a leading cause of healthcare-associated infections worldwide. Due to various intrinsic and acquired mechanisms of resistance, most β-lactam agents are not effective against many strains, and carbapenems have played an important role in therapy. Recent trends show many infections are caused by carbapenem-resistant, or even extensively drug-resistant (XDR) strains, for which effective therapy is not well established. Evidence to date suggests that colistin constitutes the backbone of therapy, but the unique pharmacokinetic properties of colistin have led many to suggest the use of combination antimicrobial therapy. However, the combination of agents and dosing regimens that delivers the best clinical efficacy while minimizing toxicity is yet to be defined. Carbapenems, sulbactam, rifampin and tigecycline have been the most studied in the context of combination therapy. Most data regarding therapy for invasive, resistant A. baumannii infections come from uncontrolled case series and retrospective analyses, though some clinical trials have been completed and others are underway. Early institution of appropriate antimicrobial therapy is shown to consistently improve survival of patients with carbapenem-resistant and XDR A. baumannii infection, but the choice of empiric therapy in these infections remains an open question. This review summarizes the most current knowledge regarding the epidemiology, mechanisms of resistance, and treatment considerations of carbapenem-resistant and XDR A. baumannii. PMID:25091170

  12. Epidemiology of Carbapenemase-Producing Enterobacteriaceae and Acinetobacter baumannii in Mediterranean Countries

    PubMed Central

    Djahmi, Nassima; Dunyach-Remy, Catherine; Pantel, Alix; Dekhil, Mazouz; Sotto, Albert; Lavigne, Jean-Philippe

    2014-01-01

    The emergence and global spread of carbapenemase-producing Enterobacteriaceae and Acinetobacter baumannii are of great concern to health services worldwide. These β-lactamases hydrolyse almost all β-lactams, are plasmid-encoded, and are easily transferable among bacterial species. They are mostly of the KPC, VIM, IMP, NDM, and OXA-48 types. Their current extensive spread worldwide in Enterobacteriaceae is an important source of concern. Infections caused by these bacteria have limited treatment options and have been associated with high mortality rates. Carbapenemase producers are mainly identified among Klebsiella pneumoniae, Escherichia coli, and A. baumannii and still mostly in hospital settings and rarely in the community. The Mediterranean region is of interest due to a great diversity and population mixing. The prevalence of carbapenemases is particularly high, with this area constituting one of the most important reservoirs. The types of carbapenemase vary among countries, partially depending on the population exchange relationship between the regions and the possible reservoirs of each carbapenemase. This review described the epidemiology of carbapenemases produced by enterobacteria and A. baumannii in this part of the world highlighting the worrisome situation and the need to screen and detect these enzymes to prevent and control their dissemination. PMID:24955354

  13. Characterization of carbapenem-resistant Acinetobacter baumannii isolates in a Chinese teaching hospital

    PubMed Central

    Chang, Yaowen; Luan, Guangxin; Xu, Ying; Wang, Yanhong; Shen, Min; Zhang, Chi; Zheng, Wei; Huang, Jinwei; Yang, Jingni; Jia, Xu; Ling, Baodong

    2015-01-01

    Carbapenem-resistant Acinetobacter baumannii (CRAB) presents a serious therapeutic and infection control challenge. In this study, we investigated the epidemiological and molecular differences of CRAB and the threatening factors for contributing to increased CRAB infections at a hospital in western China. A total of 110 clinical isolates of A. baumannii, collected in a recent 2-year period, were tested for carbapenem antibiotic susceptibility, followed by a molecular analysis of carbapenemase genes. Genetic relatedness of the isolates was characterized by multilocus sequence typing. Sixty-seven of the 110 isolates (60.9%) were resistant to carbapenems, 80.60% (54/67) of which carried the blaOXA-23 gene. Most of these CRAB isolates (77.62%) were classified as clone complex 92 (CC92), and sequence type (ST) 92 was the most prevalent STs, followed by ST195, ST136, ST843, and ST75. One CRAB isolate of ST195 harbored plasmid pAB52 from a Chinese patient without travel history. This plasmid contains toxin–antitoxin elements related to adaptation for growth, which might have emerged as a common vehicle indirectly mediating the spread of OXA-23 in CRAB. Thus, CC92 A. baumannii carrying OXA-23 is a major drug-resistant strain spreading in China. Our findings indicate that rational application of antibiotics is indispensable for minimizing widespread of drug resistance. PMID:26388854

  14. Role of Fibronectin in the Adhesion of Acinetobacter baumannii to Host Cells

    PubMed Central

    Smani, Younes; McConnell, Michael J.; Pachón, Jerónimo

    2012-01-01

    Adhesion to host cells is an initial and important step in Acinetobacter baumannii pathogenesis. However, there is relatively little information on the mechanisms by which A. baumannii binds to and interacts with host cells. Adherence to extracellular matrix proteins, such as fibronectin, affords pathogens with a mechanism to invade epithelial cells. Here, we found that A. baumannii adheres more avidly to immobilized fibronectin than to control protein. Free fibronectin used as a competitor resulted in dose-dependent decreased binding of A. baumannii to fibronectin. Three outer membrane preparations (OMPs) were identified as fibronectin binding proteins (FBPs): OMPA, TonB-dependent copper receptor, and 34 kDa OMP. Moreover, we demonstrated that fibronectin inhibition and neutralization by specific antibody prevented significantly the adhesion of A. baumannii to human lung epithelial cells (A549 cells). Similarly, A. baumannii OMPA neutralization by specific antibody decreased significantly the adhesion of A. baumannii to A549 cells. These data indicate that FBPs are key adhesins that mediate binding of A. baumannii to human lung epithelial cells through interaction with fibronectin on the surface of these host cells. PMID:22514602

  15. Screening and Quantification of the Expression of Antibiotic Resistance Genes in Acinetobacter baumannii with a Microarray▿

    PubMed Central

    Coyne, Sébastien; Guigon, Ghislaine; Courvalin, Patrice; Périchon, Bruno

    2010-01-01

    An oligonucleotide-based DNA microarray was developed to evaluate expression of genes for efflux pumps in Acinetobacter baumannii and to detect acquired antibiotic resistance determinants. The microarray contained probes for 205 genes, including those for 47 efflux systems, 55 resistance determinants, and 35 housekeeping genes. The microarray was validated by comparative analysis of mutants overexpressing or deficient in the pumps relative to the parental strain. The performance of the microarray was also evaluated using in vitro single-step mutants obtained on various antibiotics. Overexpression, confirmed by quantitative reverse transcriptase PCR, of RND efflux pumps AdeABC, due to a G30D substitution in AdeS in a multidrug-resistant (MDR) strain obtained on gentamicin, and AdeIJK, in two mutants obtained on cefotaxime or tetracycline, was detected. A new efflux pump, AdeFGH, was found to be overexpressed in a mutant obtained on chloramphenicol. Study of MDR clinical isolates, including the AYE strain, whose entire sequence has been determined, indicated overexpression of AdeABC and of the chromosomally encoded cephalosporinase as well as the presence of several acquired resistance genes. The overexpressed and acquired determinants detected by the microarray could account for nearly the entire MDR phenotype of the isolates. The microarray is potentially useful for detection of resistance in A. baumannii and should allow detection of new efflux systems associated with antibiotic resistance. PMID:19884373

  16. Crystal structure of 5-enolpyruvylshikimate-3-phosphate (EPSP) synthase from the ESKAPE pathogen Acinetobacter baumannii.

    PubMed

    Sutton, Kristin A; Breen, Jennifer; Russo, Thomas A; Schultz, L Wayne; Umland, Timothy C

    2016-03-01

    The enzyme 5-enolpyruvylshikimate-3-phosphate (EPSP) synthase catalyzes the sixth step of the seven-step shikimate pathway. Chorismate, the product of the pathway, is a precursor for the biosynthesis of aromatic amino acids, siderophores and metabolites such as folate, ubiquinone and vitamin K. The shikimate pathway is present in bacteria, fungi, algae, plants and apicomplexan parasites, but is absent in humans. The EPSP synthase enzyme produces 5-enolpyruvylshikimate 3-phosphate and phosphate from phosphoenolpyruvate and shikimate 3-phosphate via a transferase reaction, and is the target of the herbicide glyphosate. The Acinetobacter baumannii gene encoding EPSP synthase, aroA, has previously been demonstrated to be essential during host infection for the growth and survival of this clinically important drug-resistant ESKAPE pathogen. Prephenate dehydrogenase is also encoded by the bifunctional A. baumannii aroA gene, but its activity is dependent upon EPSP synthase since it operates downstream of the shikimate pathway. As part of an effort to evaluate new antimicrobial targets, recombinant A. baumannii EPSP (AbEPSP) synthase, comprising residues Ala301-Gln756 of the aroA gene product, was overexpressed in Escherichia coli, purified and crystallized. The crystal structure, determined to 2.37 Å resolution, is described in the context of a potential antimicrobial target and in comparison to EPSP synthases that are resistant or sensitive to the herbicide glyphosate. PMID:26919521

  17. A complete collection of single-gene deletion mutants of Acinetobacter baylyi ADP1

    PubMed Central

    de Berardinis, Véronique; Vallenet, David; Castelli, Vanina; Besnard, Marielle; Pinet, Agnès; Cruaud, Corinne; Samair, Sumitta; Lechaplais, Christophe; Gyapay, Gabor; Richez, Céline; Durot, Maxime; Kreimeyer, Annett; Le Fèvre, François; Schächter, Vincent; Pezo, Valérie; Döring, Volker; Scarpelli, Claude; Médigue, Claudine; Cohen, Georges N; Marlière, Philippe; Salanoubat, Marcel; Weissenbach, Jean

    2008-01-01

    We have constructed a collection of single-gene deletion mutants for all dispensable genes of the soil bacterium Acinetobacter baylyi ADP1. A total of 2594 deletion mutants were obtained, whereas 499 (16%) were not, and are therefore candidate essential genes for life on minimal medium. This essentiality data set is 88% consistent with the Escherichia coli data set inferred from the Keio mutant collection profiled for growth on minimal medium, while 80% of the orthologous genes described as essential in Pseudomonas aeruginosa are also essential in ADP1. Several strategies were undertaken to investigate ADP1 metabolism by (1) searching for discrepancies between our essentiality data and current metabolic knowledge, (2) comparing this essentiality data set to those from other organisms, (3) systematic phenotyping of the mutant collection on a variety of carbon sources (quinate, 2-3 butanediol, glucose, etc.). This collection provides a new resource for the study of gene function by forward and reverse genetic approaches and constitutes a robust experimental data source for systems biology approaches. PMID:18319726

  18. Wide Dissemination of GES-Type Carbapenemases in Acinetobacter baumannii Isolates in Kuwait

    PubMed Central

    Bonnin, Rémy A.; Rotimi, Vincent O.; Al Hubail, Mona; Gasiorowski, Elise; Al Sweih, Noura; Poirel, Laurent

    2013-01-01

    Acinetobacter baumannii is an opportunistic pathogen that is an important source of nosocomial infections. Production of extended-spectrum β-lactamases (ESBLs) of the GES type in A. baumannii has been increasingly reported, and some of these GES-type enzymes possess some carbapenemase activity. Our aim was to analyze the resistance determinants and the clonal relationships of carbapenem-nonsusceptible A. baumannii clinical isolates recovered from hospitals in Kuwait. A total of 63 isolates were analyzed, and all were found to be positive for blaGES-type genes. One isolate harbored the blaGES-14 gene encoding an ESBL with significant carbapenemase activity, whereas the other isolates harbored the blaGES-11 ESBL gene. Thirty-three isolates coharbored the blaOXA-23 and blaGES-11 genes. Analyses of the genetic locations indicated that the blaGES-11/-14 genes were plasmid located. It is noteworthy that the blaOXA-23 and blaGES-11 genes were colocated onto a single plasmid. Nine different pulsotypes were observed among the 63 isolates. This study showed the emergence of GES-type ESBLs in A. baumannii in Kuwait, further suggesting that the Middle East region might be a reservoir for carbapenemase-producing A. baumannii. PMID:23089751

  19. Phylogenetic and genomic diversity in isolates from the globally distributed Acinetobacter baumannii ST25 lineage

    PubMed Central

    Sahl, Jason W.; Del Franco, Mariateresa; Pournaras, Spyros; Colman, Rebecca E.; Karah, Nabil; Dijkshoorn, Lenie; Zarrilli, Raffaele

    2015-01-01

    Acinetobacter baumannii is a globally distributed nosocomial pathogen that has gained interest due to its resistance to most currently used antimicrobials. Whole genome sequencing (WGS) and phylogenetics has begun to reveal the global genetic diversity of this pathogen. The evolution of A. baumannii has largely been defined by recombination, punctuated by the emergence and proliferation of defined clonal lineages. In this study we sequenced seven genomes from the sequence type (ST)25 lineage and compared them to 12 ST25 genomes deposited in public databases. A recombination analysis identified multiple genomic regions that are homoplasious in the ST25 phylogeny, indicating active or historical recombination. Genes associated with antimicrobial resistance were differentially distributed between ST25 genomes, which matched our laboratory-based antimicrobial susceptibility typing. Differences were also observed in biofilm formation between ST25 isolates, which were demonstrated to produce significantly more extensive biofilm than an isolate from the ST1 clonal lineage. These results demonstrate that within A. baumannii, even a fairly recently derived monophyletic lineage can still exhibit significant genotypic and phenotypic diversity. These results have implications for associating outbreaks with sequence typing as well as understanding mechanisms behind the global propagation of successful A. baumannii lineages. PMID:26462752

  20. A fatal case of multidrug resistant acinetobacter necrotizing fasciitis: the changing scary face of nosocomial infection.

    PubMed

    Sinha, Nupur; Niazi, Masooma; Lvovsky, Dmitry

    2014-01-01

    Necrotizing fasciitis is an uncommon soft-tissue infection, associated with high morbidity and mortality. Early recognition and treatment are crucial for survival. Acinetobacter baumannii is rarely associated with necrotizing fasciitis. Wound infections due to A. baumannii have been described in association with severe trauma in soldiers. There are only sporadic reports of monomicrobial A. baumannii necrotizing fasciitis. We report a unique case of monomicrobial necrotizing fasciitis caused by multidrug resistant (MDR) A. baumannii, in absence of any preceding trauma, surgery, or any obvious breech in the continuity of skin or mucosa. A 48-year-old woman with history of HIV, asthma, hypertension, and tobacco and excocaine use presented with acute respiratory failure requiring mechanical ventilation. She was treated for pneumonia for 7 days and was successfully extubated. All septic work-up was negative. Two days later, she developed rapidly spreading nonblanching edema with bleb formation at the lateral aspect of right thigh. Emergent extensive debridement and fasciotomy were performed. Operative findings and histopathology were consistent with necrotizing fasciitis. Despite extensive debridement, she succumbed to septic shock in the next few hours. Blood, wound, and tissue cultures grew A. baumannii, sensitive only to amikacin and polymyxin. Histopathology was consistent with necrotizing fasciitis. PMID:25349748

  1. The Acinetobacter baumannii Oxymoron: Commensal Hospital Dweller Turned Pan-Drug-Resistant Menace

    PubMed Central

    Roca, Ignasi; Espinal, Paula; Vila-Farrés, Xavier; Vila, Jordi

    2012-01-01

    During the past few decades Acinetobacter baumannii has evolved from being a commensal dweller of health-care facilities to constitute one of the most annoying pathogens responsible for hospitalary outbreaks and it is currently considered one of the most important nosocomial pathogens. In a prevalence study of infections in intensive care units conducted among 75 countries of the five continents, this microorganism was found to be the fifth most common pathogen. Two main features contribute to the success of A. baumannii: (i) A. baumannii exhibits an outstanding ability to accumulate a great variety of resistance mechanisms acquired by different mechanisms, either mutations or acquisition of genetic elements such as plasmids, integrons, transposons, or resistant islands, making this microorganism multi- or pan-drug-resistant and (ii) The ability to survive in the environment during prolonged periods of time which, combined with its innate resistance to desiccation and disinfectants, makes A. baumannii almost impossible to eradicate from the clinical setting. In addition, its ability to produce biofilm greatly contributes to both persistence and resistance. In this review, the pathogenesis of the infections caused by this microorganism as well as the molecular bases of antibacterial resistance and clinical aspects such as treatment and potential future therapeutic strategies are discussed in depth. PMID:22536199

  2. CspE is Overproduced by Temperature Downshift in the Acinetobacter johnsonii DBP-3.

    PubMed

    Su, Dan; Hao, Linlin; Chen, Fuwang; Li, Siming; Abdelrahman, Ahmed Mohamed; Zhang, Yu; Yu, Hao; Liu, Songcai; Li, Mingtang

    2016-05-01

    The denitrifying bacterium Acinetobacter johnsonii strain DBP-3 which was capable of removing phosphate, nitrate, and ammoniacal salt is psychrotolerant, whereas, the cold shock response mechanisms or the cold shock proteins (Csps) was unclear. In this article, the optimal growth temperature (25 °C) and cold shock temperature (7.5 °C) were determined firstly by an Arrhenius plot of the growth of the strain DBP-3. Then, among the seven cold shock-like protein genes which were cloned and identified referenced by A. johnsonii SH046 genome, qRT-PCR and shotgun-LTQ mass spectrometry showed that Csp3 and Csp4 were overexpressed under cold shock condition. Furthermore, Western blotting confirmed the result with the antibodies against Csp3 and Csp4 prepared by ourselves. Finally, the phylogenetic analysis showed that the similarity percent between Csp3 and Csp4 was 76.85 %, and Csp3 and Csp4 belonged to CspE family. The results indicated that CspE is overproduced by temperature downshift and may play an important role in the psychrotolerant process of strain DBP-3. PMID:26794214

  3. Crystal Structure of Hcp from Acinetobacter baumannii: A Component of the Type VI Secretion System

    PubMed Central

    Ruiz, Federico M.; Santillana, Elena; Spínola-Amilibia, Mercedes; Torreira, Eva; Culebras, Esther; Romero, Antonio

    2015-01-01

    The type VI secretion system (T6SS) is a bacterial macromolecular machine widely distributed in Gram-negative bacteria, which transports effector proteins into eukaryotic host cells or other bacteria. Membrane complexes and a central tubular structure, which resembles the tail of contractile bacteriophages, compose the T6SS. One of the proteins forming this tube is the hemolysin co-regulated protein (Hcp), which acts as virulence factor, as transporter of effectors and as a chaperone. In this study, we present the structure of Hcp from Acinetobacter baumannii, together with functional and oligomerization studies. The structure of this protein exhibits a tight β barrel formed by two β sheets and flanked at one side by a short α-helix. Six Hcp molecules associate to form a donut-shaped hexamer, as observed in both the crystal structure and solution. These results emphasize the importance of this oligomerization state in this family of proteins, despite the low similarity of sequence among them. The structure presented in this study is the first one for a protein forming part of a functional T6SS from A. baumannii. These results will help us to understand the mechanism and function of this secretion system in this opportunistic nosocomial pathogen. PMID:26079269

  4. Anthelmintic closantel enhances bacterial killing of polymyxin B against multidrug-resistant Acinetobacter baumannii

    PubMed Central

    Tran, Thien B.; Cheah, Soon-Ee; Yu, Heidi H.; Bergen, Phillip J.; Nation, Roger L.; Creek, Darren J.; Purcell, Anthony; Forrest, Alan; Doi, Yohei; Song, Jiangning; Velkov, Tony; Li, Jian

    2015-01-01

    Polymyxins, an old class of antibiotics, are currently used as the last resort for the treatment of multidrug-resistant (MDR) Acinetobacter baumannii. However, recent pharmacokinetic and pharmacodynamic data indicate that monotherapy can lead to the development of resistance. Novel approaches are urgently needed to preserve and improve the efficacy of this last-line class of antibiotics. This study examined the antimicrobial activity of novel combination of polymyxin B with anthelmintic closantel against A. baumannii. Closantel monotherapy (16 mg/L) was ineffective against most tested A. baumannii isolates. However, closantel at 4–16 mg/L with a clinically achievable concentration of polymyxin B (2 mg/L) successfully inhibited the development of polymyxin resistance in polymyxin-susceptible isolates, and provided synergistic killing against polymyxin-resistant isolates (MIC ≥4 mg/L). Our findings suggest that the combination of polymyxin B with closantel could be potentially useful for the treatment of MDR, including polymyxin-resistant, A. baumannii infections. The re-positioning of non-antibiotic drugs to treat bacterial infections may significantly expedite discovery of new treatment options for bacterial ‘superbugs’. PMID:26669752

  5. Neutropenia exacerbates infection by Acinetobacter baumannii clinical isolates in a murine wound model

    PubMed Central

    Grguric-Smith, Laryssa M.; Lee, Hiu H.; Gandhi, Jay A.; Brennan, Melissa B.; DeLeon-Rodriguez, Carlos M.; Coelho, Carolina; Han, George; Martinez, Luis R.

    2015-01-01

    The Gram negative coccobacillus Acinetobacter baumannii has become an increasingly prevalent cause of hospital-acquired infections in recent years. The majority of clinical A. baumannii isolates display high-level resistance to antimicrobials, which severely compromises our capacity to care for patients with A. baumannii disease. Neutrophils are of major importance in the host defense against microbial infections. However, the contribution of these cells of innate immunity in host resistance to cutaneous A. baumannii infection has not been directly investigated. Hence, we hypothesized that depletion of neutrophils increases severity of bacterial disease in an experimental A. baumannii murine wound model. In this study, the Ly-6G-specific monoclonal antibody (mAb), 1A8, was used to generate neutropenic mice and the pathogenesis of several A. baumannii clinical isolates on wounded cutaneous tissue was investigated. We demonstrated that neutrophil depletion enhances bacterial burden using colony forming unit determinations. Also, mAb 1A8 reduces global measurements of wound healing in A. baumannii-infected animals. Interestingly, histological analysis of cutaneous tissue excised from A. baumannii-infected animals treated with mAb 1A8 displays enhanced collagen deposition. Furthermore, neutropenia and A. baumannii infection alter pro-inflammatory cytokine release leading to severe microbial disease. Our findings provide a better understanding of the impact of these innate immune cells in controlling A. baumannii skin infections. PMID:26528277

  6. Sensitivity of cultured pancreatic carcinoma cells to Acinetobacter glutaminase-asparaginase.

    PubMed

    Wu, M C; Arimura, G K; Holcenberg, J S; Yunis, A A

    1982-09-01

    Cultured human pancreatic carcinoma cells (MIA PaCa-2) have been shown previously to be very sensitive to E. coli L-asparaginase (EC II). The present studies have demonstrated that another enzyme, Acinetobacter glutaminase-asparaginase (AGA) is much more effective in inhibiting cell growth. At the concentration of 0.0025 U/ml of AGA activity the enzyme totally inhibited cell growth, whereas the EC II with the same concentration did not show any effect. The inhibition of cell growth correlated well with inhibition of protein and glycoprotein synthesis. The addition of L-glutamine at the concentration of 1 mM completely reversed the inhibition of protein synthesis. Similarly, the addition of L-glutamine at the concentration of 3 mM daily on 3 successive days after adding AGA resulted in significant reversal of growth inhibition. The results of this study indicate that the action of AGA on MIA PaCa-2 is, to a great extent, exerted through its L-glutaminase activity. PMID:7173949

  7. Differential protection from tobramycin by extracellular polymeric substances from Acinetobacter baumannii and Staphylococcus aureus biofilms.

    PubMed

    Davenport, Emily K; Call, Douglas R; Beyenal, Haluk

    2014-08-01

    We investigated biofilms of two pathogens, Acinetobacter baumannii and Staphylococcus aureus, to characterize mechanisms by which the extracellular polymeric substance (EPS) found in biofilms can protect bacteria against tobramycin exposure. To do so, it is critical to study EPS-antibiotic interactions in a homogeneous environment without mass transfer limitations. Consequently, we developed a method to grow biofilms, harvest EPS, and then augment planktonic cultures with isolated EPS and tobramycin. We demonstrated that planktonic cultures respond differently to being treated with different types of EPS (A. baumannii versus S. aureus) in the presence of tobramycin. By harvesting EPS from the biofilms, we found that A. baumannii EPS acts as a "universal protector" by inhibiting tobramycin activity against bacterial cells regardless of species; S. aureus EPS did not show any protective ability in cell cultures. Adding Mg(2+) or Ca(2+) reduced the protective effect of A. baumannii EPS. Finally, when we selectively digested the proteins or DNA of the EPS, we found that the protective ability did not change, suggesting that neither has a significant role in protection. To the best of our knowledge, this is the first study that demonstrates how EPS protects pathogens against antibiotics in a homogeneous system without mass transfer limitations. Our results suggest that EPS protects biofilm communities, in part, by adsorbing antibiotics near the surface. This may limit antibiotic diffusion to the bottom of the biofilms but is not likely to be the only mechanism of protection. PMID:24913166

  8. Differential Protection from Tobramycin by Extracellular Polymeric Substances from Acinetobacter baumannii and Staphylococcus aureus Biofilms

    PubMed Central

    Davenport, Emily K.; Call, Douglas R.

    2014-01-01

    We investigated biofilms of two pathogens, Acinetobacter baumannii and Staphylococcus aureus, to characterize mechanisms by which the extracellular polymeric substance (EPS) found in biofilms can protect bacteria against tobramycin exposure. To do so, it is critical to study EPS-antibiotic interactions in a homogeneous environment without mass transfer limitations. Consequently, we developed a method to grow biofilms, harvest EPS, and then augment planktonic cultures with isolated EPS and tobramycin. We demonstrated that planktonic cultures respond differently to being treated with different types of EPS (A. baumannii versus S. aureus) in the presence of tobramycin. By harvesting EPS from the biofilms, we found that A. baumannii EPS acts as a “universal protector” by inhibiting tobramycin activity against bacterial cells regardless of species; S. aureus EPS did not show any protective ability in cell cultures. Adding Mg2+ or Ca2+ reduced the protective effect of A. baumannii EPS. Finally, when we selectively digested the proteins or DNA of the EPS, we found that the protective ability did not change, suggesting that neither has a significant role in protection. To the best of our knowledge, this is the first study that demonstrates how EPS protects pathogens against antibiotics in a homogeneous system without mass transfer limitations. Our results suggest that EPS protects biofilm communities, in part, by adsorbing antibiotics near the surface. This may limit antibiotic diffusion to the bottom of the biofilms but is not likely to be the only mechanism of protection. PMID:24913166

  9. Clinical Use of Colistin Induces Cross-Resistance to Host Antimicrobials in Acinetobacter baumannii

    PubMed Central

    Napier, Brooke A.; Burd, Eileen M.; Satola, Sarah W.; Cagle, Stephanie M.; Ray, Susan M.; McGann, Patrick; Pohl, Jan; Lesho, Emil P.; Weiss, David S.

    2013-01-01

    ABSTRACT The alarming rise in antibiotic resistance has led to an increase in patient mortality and health care costs. This problem is compounded by the absence of new antibiotics close to regulatory approval. Acinetobacter baumannii is a human pathogen that causes infections primarily in patients in intensive care units (ICUs) and is highly antibiotic resistant. Colistin is one of the last-line antibiotics for treating A. baumannii infections; however, colistin-resistant strains are becoming increasingly common. This cationic antibiotic attacks negatively charged bacterial membranes in a manner similar to that seen with cationic antimicrobials of the innate immune system. We therefore set out to determine if the increasing use of colistin, and emergence of colistin-resistant strains, is concomitant with the generation of cross-resistance to host cationic antimicrobials. We found that there is indeed a positive correlation between resistance to colistin and resistance to the host antimicrobials LL-37 and lysozyme among clinical isolates. Importantly, isolates obtained before and after treatment of individual patients demonstrated that colistin use correlated with increased resistance to cationic host antimicrobials. These data reveal the overlooked risk of inducing cross-resistance to host antimicrobials when treating patients with colistin as a last-line antibiotic. PMID:23695834

  10. Purification and characterization of catalase from marine bacterium Acinetobacter sp. YS0810.

    PubMed

    Fu, Xinhua; Wang, Wei; Hao, Jianhua; Zhu, Xianglin; Sun, Mi

    2014-01-01

    The catalase from marine bacterium Acinetobacter sp. YS0810 (YS0810CAT) was purified and characterized. Consecutive steps were used to achieve the purified enzyme as follows: ethanol precipitation, DEAE Sepharose ion exchange, Superdex 200 gel filtration, and Resource Q ion exchange. The active enzyme consisted of four identical subunits of 57.256 kDa. It showed a Soret peak at 405 nm, indicating the presence of iron protoporphyrin IX. The catalase was not apparently reduced by sodium dithionite but was inhibited by 3-amino-1,2,4-triazole, hydroxylamine hydrochloride, and sodium azide. Peroxidase-like activity was not found with the substrate o-phenylenediamine. So the catalase was determined to be a monofunctional catalase. N-terminal amino acid of the catalase analysis gave the sequence SQDPKKCPVTHLTTE, which showed high degree of homology with those of known catalases from bacteria. The analysis of amino acid sequence of the purified catalase by matrix-assisted laser desorption ionization time-of-flight mass spectrometry showed that it was a new catalase, in spite of its high homology with those of known catalases from other bacteria. The catalase showed high alkali stability and thermostability. PMID:25045672

  11. Higher Isolation of NDM-1 Producing Acinetobacter baumannii from the Sewage of the Hospitals in Beijing

    PubMed Central

    Cui, Jiajun; Wang, Pan; Huang, Liuyu; Klena, John D.; Song, Hongbin

    2013-01-01

    Multidrug resistant microbes present in the environment are a potential public health risk. In this study, we investigate the presence of New Delhi metallo-β-lactamase 1 (NDM-1) producing bacteria in the 99 water samples in Beijing City, including river water, treated drinking water, raw water samples from the pools and sewage from 4 comprehensive hospitals. For the blaNDM-1 positive isolate, antimicrobial susceptibility testing was further analyzed, and Pulsed Field Gel Electrophoresis (PFGE) was performed to determine the genetic relationship among the NDM-1 producing isolates from sewage and human, as well as the clinical strains without NDM-1. The results indicate that there was a higher isolation of NDM-1 producing Acinetobacter baumannii from the sewage of the hospitals, while no NDM-1 producing isolates were recovered from samples obtained from the river, drinking, or fishpond water. Surprisingly, these isolates were markedly different from the clinical isolates in drug resistance and pulsed field gel electrophoresis profiles, suggesting different evolutionary relationships. Our results showed that the hospital sewage may be one of the diffusion reservoirs of NDM-1 producing bacteria. PMID:23755152

  12. Biotechnological tools to improve bioremediation of phenol by Acinetobacter sp. RTE1.4.

    PubMed

    Paisio, Cintia E; Talano, Melina A; González, Paola S; Magallanes-Noguera, Cynthia; Kurina-Sanz, Marcela; Agostini, Elizabeth

    2016-09-01

    The use of native bacteria is a useful strategy to decontaminate industrial effluents as well as the environment. Acinetobacter sp. RTE1.4 was previously isolated from polluted environments and constitutes a promising alternative for this purpose due to its capability to remove phenol from synthetic solutions and industrial effluents. In this work, this strain was identified at species level as A. tandoii RTE1.4. Phenol degradation pathway was studied and some reaction intermediates were detected, confirming that this strain degraded phenol through ortho-cleavage of the aromatic ring. Phenol removal assays were carried out in a stirred tank bioreactor and a complete degradation of the contaminant was achieved after only 7 h, at an aeration rate of 3 vvm and at agitation of 600 rpm. Moreover, this bacterium was immobilized into calcium alginate beads and an increase in phenol biodegradation with respect to free cells was observed. The immobilized cells were reused for four consecutive cycles and stored at 4°C for 9 months, during which phenol removal efficiency was maintained. Post-removal solutions were evaluated by Microtox® test, showing a toxicity reduction after bacterial treatment. These findings demonstrated that A. tandoii RTE1.4 might be considered as a useful biotechnological tool for an efficient treatment of different solutions contaminated with phenol in bioreactors, using either free or immobilized cells. PMID:26853946

  13. Isotherm kinetics of Cr(III) removal by non-viable cells of Acinetobacter haemolyticus.

    PubMed

    Yahya, Siti Khairunnisa; Zakaria, Zainul Akmar; Samin, Jefri; Raj, A S Santhana; Ahmad, Wan Azlina

    2012-06-01

    The potential use of non-viable biomass of a Gram negative bacterium i.e. Acinetobacter haemolyticus to remove Cr(III) species from aqueous environment was investigated. Highest Cr(III) removal of 198.80 mg g(-1) was obtained at pH 5, biomass dosage of 15 mg cell dry weight, initial Cr(III) of 100 mg L(-1) and 30 min of contact time. The Langmuir and Freundlich models fit the experimental data (R(2)>0.95) while the kinetic data was best described using the pseudo second-order kinetic model (R(2)>0.99). Cr(III) was successfully recovered from the bacterial biomass using either 1M of CH(3)COOH, HNO(3) or H(2)SO(4) with 90% recovery. TEM and FTIR suggested the involvement of amine, carboxyl, hydroxyl and phosphate groups during the biosorption of Cr(III) onto the cell surface of A. haemolyticus. A. haemolyticus was also capable to remove 79.87 mg g(-1) Cr(III) (around 22.75%) from raw leather tanning wastewater. This study demonstrates the potential of using A. haemolyticus as biosorbent to remove Cr(III) from both synthetic and industrial wastewater. PMID:22398363

  14. The Genetic Analysis of an Acinetobacter johnsonii Clinical Strain Evidenced the Presence of Horizontal Genetic Transfer

    PubMed Central

    Montaña, Sabrina; Schramm, Sareda T. J.; Traglia, German Matías; Chiem, Kevin; Parmeciano Di Noto, Gisela; Almuzara, Marisa; Barberis, Claudia; Vay, Carlos; Quiroga, Cecilia; Tolmasky, Marcelo E.; Iriarte, Andrés; Ramírez, María Soledad

    2016-01-01

    Acinetobacter johnsonii rarely causes human infections. While most A. johnsonii isolates are susceptible to virtually all antibiotics, strains harboring a variety of β-lactamases have recently been described. An A. johnsonii Aj2199 clinical strain recovered from a hospital in Buenos Aires produces PER-2 and OXA-58. We decided to delve into its genome by obtaining the whole genome sequence of the Aj2199 strain. Genome comparison studies on Aj2199 revealed 240 unique genes and a close relation to strain WJ10621, isolated from the urine of a patient in China. Genomic analysis showed evidence of horizontal genetic transfer (HGT) events. Forty-five insertion sequences and two intact prophages were found in addition to several resistance determinants such as blaPER-2, blaOXA-58, blaTEM-1, strA, strB, ereA, sul1, aacC2 and a new variant of blaOXA-211, called blaOXA-498. In particular, blaPER-2 and blaTEM-1 are present within the typical contexts previously described in the Enterobacteriaceae family. These results suggest that A. johnsonii actively acquires exogenous DNA from other bacterial species and concomitantly becomes a reservoir of resistance genes. PMID:27548264

  15. Screening of antibiotics resistance to Enterobacteriaceae, Pseudomonas aeruginosa, and Acinetobacter baumannii by an advanced expert system.

    PubMed

    Nakamura, Tatsuya; Takahashi, Hakuo

    2005-12-01

    The VITEK2 advanced expert system (AES) gives information about the antibiotics-resistance mechanisms based on the biological validation derived from the VITEK2 susceptibility result. In this study, we investigated whether or not this system correctly categorized the beta-lactamase resistance mechanism data derived from the VITEK2 susceptibility result using the testing card, AST-N025, with Enterobacteriaceae, Pseudomonas aeruginosa, and Acinetobacter baumannii. We used 131 strains, and their phenotypes were determined according to the biological and genetic screening. The AES analysis result matched the phenotype testing in 120 (91.6%) of the 131 strains. Incorrect findings were found in six strains, including three strains of Serratia marcescens. The resistance mechanism could not be determined in five strains, including three strains of Providencia rettgeri. The analysis of those phenotypes agreed in 34 (97.1%) among 35 strains with extended spectrum beta-lactamase (ESBL), and in 27 (96.4%) among 28 strains with high-level cephalosporinase. The agreement ratio in the phenotype was very high as we expected. The incorrect and nondeterminable samples were strains with relatively high cephalosporinase that has variation of outer membrane protein. The AES was able to detect the phenotype for carbapenemase. The AES is a clinically useful system that allows taking prompt measures to treat patients because it can provide information about the resistance mechanism in less than half a day after starting the analysis. PMID:16369735

  16. Acinetobacter baumannii Virulence Is Mediated by the Concerted Action of Three Phospholipases D

    PubMed Central

    Stahl, Julia; Bergmann, Holger; Göttig, Stephan; Ebersberger, Ingo; Averhoff, Beate

    2015-01-01

    Acinetobacter baumannii causes a broad range of opportunistic infections in humans. Its success as an emerging pathogen is due to a combination of increasing antibiotic resistance, environmental persistence and adaptation to the human host. To date very little is known about the molecular basis of the latter. Here we demonstrate that A. baumannii can use phosphatidylcholine, an integral part of human cell membranes, as sole carbon and energy source. We report on the identification of three phospholipases belonging to the PLD superfamily. PLD1 and PLD2 appear restricted to the bacteria and display the general features of bacterial phospholipases D. They possess two PLDc_2 PFAM domains each encompassing the HxKx4Dx6GS/GGxN (HKD) motif necessary for forming the catalytic core. The third candidate, PLD3, is found in bacteria as well as in eukaryotes and harbours only one PLDc_2 PFAM domain and one conserved HKD motif, which however do not overlap. Employing a markerless mutagenesis system for A. baumannii ATCC 19606T, we generated a full set of PLD knock-out mutants. Galleria mellonella infection studies as well as invasion experiments using A549 human lung epithelial cells revealed that the three PLDs act in a concerted manner as virulence factors and are playing an important role in host cell invasion. PMID:26379240

  17. The contribution of nutrient metal acquisition and metabolism to Acinetobacter baumannii survival within the host

    PubMed Central

    Mortensen, Brittany L.; Skaar, Eric P.

    2013-01-01

    Acinetobacter baumannii is a significant contributor to intensive care unit (ICU) mortality causing numerous types of infection in this susceptible ICU population, most notably ventilator-associated pneumonia. The substantial disease burden attributed to A. baumannii and the rapid acquisition of antibiotic resistance make this bacterium a serious health care threat. A. baumannii is equipped to tolerate the hostile host environment through modification of its metabolism and nutritional needs. Among these adaptations is the evolution of mechanisms to acquire nutrient metals that are sequestered by the host as a defense against infection. Although all bacteria require nutrient metals, there is diversity in the particular metal needs among species and within varying tissue types and bacterial lifecycles. A. baumannii is well-equipped with the metal homeostatic systems required for the colonization of a diverse array of tissues. Specifically, iron and zinc homeostasis is important for A. baumannii interactions with biotic surfaces and for growth within vertebrates. This review discusses what is currently known regarding the interaction of A. baumannii with vertebrate cells with a particular emphasis on the contributions of metal homeostasis systems. Overall, published research supports the utility of exploiting these systems as targets for the development of much-needed antimicrobials against this emerging infectious threat. PMID:24377089

  18. Joint Transcriptional Control of Virulence and Resistance to Antibiotic and Environmental Stress in Acinetobacter baumannii

    PubMed Central

    Gallagher, Larry A.; Jacobson, Rachael K.; Usacheva, Elena A.; Peterson, Lance R.; Zurawski, Daniel V.; Shuman, Howard A.

    2015-01-01

    ABSTRACT The increasing emergence of antibiotic-resistant bacterial pathogens represents a serious risk to human health and the entire health care system. Many currently circulating strains of Acinetobacter baumannii exhibit resistance to multiple antibiotics. A key limitation in combating A. baumannii is that our understanding of the molecular mechanisms underlying the pathogenesis of A. baumannii is lacking. To identify potential virulence determinants of a contemporary multidrug-resistant isolate of A. baumannii, we used transposon insertion sequencing (TnSeq) of strain AB5075. A collection of 250,000 A. baumannii transposon mutants was analyzed for growth within Galleria mellonella larvae, an insect-based infection model. The screen identified 300 genes that were specifically required for survival and/or growth of A. baumannii inside G. mellonella larvae. These genes encompass both known, established virulence factors and several novel genes. Among these were more than 30 transcription factors required for growth in G. mellonella. A subset of the transcription factors was also found to be required for resistance to antibiotics and environmental stress. This work thus establishes a novel connection between virulence and resistance to both antibiotics and environmental stress in A. baumannii. PMID:26556274

  19. Synergistic Effects and Antibiofilm Properties of Chimeric Peptides against Multidrug-Resistant Acinetobacter baumannii Strains

    PubMed Central

    Gopal, Ramamourthy; Kim, Young Gwon; Lee, Jun Ho; Lee, Seog Ki; Chae, Jeong Don; Son, Byoung Kwan; Seo, Chang Ho

    2014-01-01

    The increasing prevalence of drug-resistant pathogens highlights the need to identify novel antibiotics. Here we investigated the efficacies of four new antimicrobial peptides (AMPs) for potential drug development. The antibacterial activities, synergistic effects, and antibiofilm properties of the four chimeric AMPs were tested against Acinetobacter baumannii, an emerging Gram-negative, nosocomial, drug-resistant pathogen. Nineteen A. baumannii strains resistant to ampicillin, cefotaxime, ciprofloxacin, tobramycin, and erythromycin were isolated at a hospital from patients with cholelithiasis. All four peptides exhibited significant antibacterial effects (MIC = 3.12 to 12.5 μM) against all 19 strains, whereas five commercial antibiotics showed little or no activity against the same pathogens. An exception was polymyxin, which was effective against all of the strains tested. Each of the peptides showed synergy against one or more strains when administered in combination with cefotaxime, ciprofloxacin, or erythromycin. The peptides also exhibited an ability to prevent biofilm formation, which was not seen with cefotaxime, ciprofloxacin, or erythromycin, though polymyxin also inhibited biofilm formation. Indeed, when administered in combination with ciprofloxacin, the AMP HPMA exerted a potent synergistic effect against A. baumannii biofilm formation. Collectively, our findings indicate that the AMPs tested have no cytotoxicity but possess potent antibacterial and antibiofilm activities and may act synergistically with commercial antibiotics. PMID:24366740

  20. Treatment of multidrug-resistant Acinetobacter baumannii meningitis with ampicillin/sulbactam.

    PubMed

    Jiménez-Mejías, M E; Pachón, J; Becerril, B; Palomino-Nicás, J; Rodríguez-Cobacho, A; Revuelta, M

    1997-05-01

    The clinical features and the outcomes of eight cases of nosocomial Acinetobacter baumannii meningitis treated with ampicillin/sulbactam are reported. All the patients had fever, neck stiffness or meningeal signs, and a low consciousness level, and in their cerebrospinal fluid (CSF), pleocytosis, a low glucose level, and an elevated protein level were noted. For all CSF isolates of A. baumannii, the MIC of ampicillin/sulbactam was < or = 8/4 microg/mL. The MICs of sulbactam by microdilution in two cases were 4 microg/mL. All isolates were resistant to cefotaxime, ceftriaxone, ceftazidime, ureidopenicillins, ciprofloxacin, and gentamicin. Seven isolates were resistant to imipenem. A. baumannii was isolated from other samples in seven episodes. All patients were treated with ampicillin/sulbactam (seven with 2 g/l g every 6 hours and one with 2 g/l g every 8 hours). Six patients were cured and two patients died of meningitis. There were no side effects with the ampicillin/sulbactam treatment. In conclusion, ampicillin/sulbactam may be effective as therapy for meningitis caused by A. baumanii resistant to imipenem and other beta-lactam drugs. PMID:9142795

  1. Activity of Gallium Meso- and Protoporphyrin IX against Biofilms of Multidrug-Resistant Acinetobacter baumannii Isolates

    PubMed Central

    Chang, David; Garcia, Rebecca A.; Akers, Kevin S.; Mende, Katrin; Murray, Clinton K.; Wenke, Joseph C.; Sanchez, Carlos J.

    2016-01-01

    Acinetobacter baumannii is a challenging pathogen due to antimicrobial resistance and biofilm development. The role of iron in bacterial physiology has prompted the evaluation of iron-modulation as an antimicrobial strategy. The non-reducible iron analog gallium(III) nitrate, Ga(NO3)3, has been shown to inhibit A. baumannii planktonic growth; however, utilization of heme-iron by clinical isolates has been associated with development of tolerance. These observations prompted the evaluation of iron-heme sources on planktonic and biofilm growth, as well as antimicrobial activities of gallium meso- and protoporphyrin IX (Ga-MPIX and Ga-PPIX), metal heme derivatives against planktonic and biofilm bacteria of multidrug-resistant (MDR) clinical isolates of A. baumannii in vitro. Ga(NO3)3 was moderately effective at reducing planktonic bacteria (64 to 128 µM) with little activity against biofilms (≥512 µM). In contrast, Ga-MPIX and Ga-PPIX were highly active against planktonic bacteria (0.25 to 8 µM). Cytotoxic effects in human fibroblasts were observed following exposure to concentrations exceeding 128 µM of Ga-MPIX and Ga-PPIX. We observed that the gallium metal heme conjugates were more active against planktonic and biofilm bacteria, possibly due to utilization of heme-iron as demonstrated by the enhanced effects on bacterial growth and biofilm formation. PMID:26999163

  2. Combination therapy with polymyxin B and netropsin against clinical isolates of multidrug-resistant Acinetobacter baumannii.

    PubMed

    Chung, Joon-Hui; Bhat, Abhayprasad; Kim, Chang-Jin; Yong, Dongeun; Ryu, Choong-Min

    2016-01-01

    Polymyxins are last-resort antibiotics for treating infections of Gram-negative bacteria. The recent emergence of polymyxin-resistant bacteria, however, urgently demands clinical optimisation of polymyxin use to minimise further evolution of resistance. In this study we developed a novel combination therapy using minimal concentrations of polymyxin B. After large-scale screening of Streptomyces secondary metabolites, we identified a reliable polymixin synergist and confirmed as netropsin using high-pressure liquid chromatography, nuclear magnetic resonance, and mass spectrometry followed by in vitro assays using various Gram-negative pathogenic bacteria. To evaluate the effectiveness of combining polymixin B and netropsin in vivo, we performed survival analysis on greater wax moth Galleria mellonella infected with colistin-resistant clinical Acinetobacter baumannii isolates as well as Escherichia coli, Shigella flexineri, Salmonella typhimuruim, and Pseudomonas aeruginosa. The survival of infected G. mellonella was significantly higher when treated with polymyxin B and netropsin in combination than when treated with polymyxin B or netropsin alone. We propose a netropsin combination therapy that minimises the use of polymyxin B when treating infections with multidrug resistant Gram-negative bacteria. PMID:27306928

  3. Impact of Acinetobacter baumannii Superoxide Dismutase on Motility, Virulence, Oxidative Stress Resistance and Susceptibility to Antibiotics

    PubMed Central

    Heider, Christine; Skiebe, Evelyn; Wilharm, Gottfried

    2014-01-01

    Acinetobacter baumannii is a Gram-negative bacterium appearing as an opportunistic pathogen in hospital settings. Superoxide dismutase (SOD) contributes to virulence in several pathogenic bacteria by detoxifying reactive oxygen species released in the course of host defense reactions. However, the biological role of SODs in A. baumannii has not yet been elucidated. Here, we inactivated in A. baumannii ATCC 17978 gene A1S_2343, encoding a putative SOD of the Fe-Mn type by transposon insertion, resulting in mutant ATCC 17978 sod2343::Km. The mutation was also introduced in two naturally competent A. baumannii isolates by transformation with chromosomal DNA derived from mutant ATCC 17978 sod2343::Km. We demonstrate that inactivation of sod2343 leads to significant motility defects in all three A. baumannii strains. The mutant strains were more susceptible to oxidative stress compared to their parental strains. Susceptibility to colistin and tetracycline was increased in all mutant strains while susceptibility of the mutants to gentamicin, levofloxacin and imipenem was strain-dependent. In the Galleria mellonella infection model the mutant strains were significantly attenuated. In conclusion, sod2343 plays an important role in motility, resistance to oxidative stress, susceptibility to antibiotics and virulence in A. baumannii. PMID:25000585

  4. Enhanced Efficacy of Combinations of Pexiganan with Colistin Versus Acinetobacter Baumannii in Experimental Sepsis.

    PubMed

    Cirioni, Oscar; Simonetti, Oriana; Pierpaoli, Elisa; Barucca, Alessandra; Ghiselli, Roberto; Orlando, Fiorenza; Pelloni, Maria; Minardi, Daniele; Trombettoni, Maria Michela Cappelletti; Guerrieri, Mario; Offidani, Annamaria; Giacometti, Andrea; Provinciali, Mauro

    2016-08-01

    We investigated the efficacy of colistin combined with pexiganan in experimental mouse models of Acinetobacter baumannii infection.Adult male BALB/c mice received intraperitoneally 1 mL saline containing 2 × 10 CFU of susceptible and multiresistant A. baumannii. Two hours after bacterial challenge, animals received 1 mg/kg of colistin, 1 mg/kg of pexiganan, or 1 mg/kg of colistin plus 1 mg/kg of pexiganan.Blood culture positivity, the quantities of bacteria in the intra-abdominal fluid, the rate of lethality and immunological studies, such as immunophenotyping and NK cytotoxicity, were evaluated.In the in vitro study, A. baumannii showed susceptibility to colistin and pexiganan and a strong synergy was observed by testing colistin combined with pexiganan with fractionary inhibitory concentration index of 0.312 for both strains.In the in vivo study colistin or pexiganan alone showed a good antimicrobial efficacy. When colistin was combined with pexiganan, the positive interaction produced low bacterial counts that were statistically significant versus singly treated groups. For both strains the highest rate of survival was observed in combined-treated groups (90%).Pexiganan increased NK cytotoxic activity over the levels of infected and colistin-treated animals.In conclusion, pexiganan combined with colistin was found to be efficacious against A. baumannii infection. PMID:26849630

  5. Cloning and characterization of two catA genes in Acinetobacter lwoffii K24.

    PubMed

    Kim, S I; Leem, S H; Choi, J S; Chung, Y H; Kim, S; Park, Y M; Park, Y K; Lee, Y N; Ha, K S

    1997-08-01

    Two novel type I catechol 1,2-dioxygenases inducible on aniline media were isolated from Acinetobacter lwoffii K24. Although the two purified enzymes, CD I1 and CD I2, had similar intradiol cleavage activities, they showed different substrate specificities for catechol analogs, physicochemical properties, and amino acid sequences. Two catA genes, catA1 and catA2, encoding by CD I1 and CD I2, respectively, were isolated from the A. lwoffii K24 genomic library by using colony hybridization and PCR. Two DNA fragments containing the catA1 and catA2 genes were located on separate regions of the chromosome. They contained open reading frames encoding 33.4- and 30.4-kDa proteins. The amino acid sequences of the two proteins matched well with previously determined sequences. Interestingly, further analysis of the two DNA fragments revealed the locations of the catB and catC genes as well. Moreover, the DNA fragment containing catA1 had a cluster of genes in the order catB1-catC1-catA1 while the catB2-catA2-catC2 arrangement was found in the catA2 DNA fragment. These results may provide an explanation of the different substrate specificities and physicochemical properties of CD I1 and CD I2. PMID:9260969

  6. Outbreak of multiresistant OXA-24- and OXA-51-producing Acinetobacter baumannii in an internal medicine ward.

    PubMed

    Tena, Daniel; Martínez, Nora Mariela; Oteo, Jesús; Sáez, David; Vindel, Ana; Azañedo, María Luisa; Sánchez, Lorenzo; Espinosa, Alfredo; Cobos, Juan; Sánchez, Rosario; Otero, Ignacio; Bisquert, Julia

    2013-01-01

    Here we describe the clinical, microbiological, epidemiological, and molecular characterization of an outbreak of multidrug-resistant Acinetobacter baumannii (MRAB) involving 5 patients admitted to the internal medicine ward of our hospital. Over a 6-week period, 5 MRAB isolates were recovered from 5 patients, including 1 with fatal meningitis, 3 with skin and soft tissue infections, and 1 with respiratory colonization. One sample obtained during environmental monitoring in the ward was A. baumannii-positive. According to the pulsed-field gel electrophoresis typing results, the strains isolated from all patients and the environmental sample belonged to a single clone, identified as ST79 by multilocus sequence typing. The blaOXA-24 and blaOXA-51 carbapenemases were detected in all isolates. Four patients died, but only the death of the meningitis patient was probably related to the A. baumannii infection. The infection source was probably the hands of the healthcare workers because the outbreak strain was isolated from the surface of a serum container. The results of the present study revealed the importance of strict adherence to control measures by all healthcare workers because the consequences of noncompliance can be very serious. PMID:23883845

  7. Endogenous hydrogen peroxide increases biofilm formation by inducing exopolysaccharide production in Acinetobacter oleivorans DR1

    PubMed Central

    Jang, In-Ae; Kim, Jisun; Park, Woojun

    2016-01-01

    In this study, we investigated differentially expressed proteins in Acinetobacter oleivorans cells during planktonic and biofilm growth by using 2-dimensional gel electrophoresis combined with matrix-assisted laser desorption time-of-flight mass spectrometry. We focused on the role of oxidative stress resistance during biofilm formation using mutants defective in alkyl hydroperoxide reductase (AhpC) because its production in aged biofilms was enhanced compared to that in planktonic cells. Results obtained using an ahpC promoter-gfp reporter vector showed that aged biofilms expressed higher ahpC levels than planktonic cells at 48 h. However, at 24 h, ahpC expression was higher in planktonic cells than in biofilms. Deletion of ahpC led to a severe growth defect in rich media that was not observed in minimal media and promoted early biofilm formation through increased production of exopolysaccharide (EPS) and EPS gene expression. Increased endogenous H2O2 production in the ahpC mutant in rich media enhanced biofilm formation, and this enhancement was not observed in the presence of antioxidants. Exogenous addition of H2O2 promoted biofilm formation in wild type cells, which suggested that biofilm development is linked to defense against H2O2. Collectively, our data showed that EPS production caused by H2O2 stress enhances biofilm formation in A. oleivorans. PMID:26884212

  8. Emergence of multidrug-resistant Acinetobacter baumannii producing OXA-23 Carbapenemase in Qatar.

    PubMed

    Rolain, J-M; Loucif, L; Al-Maslamani, M; Elmagboul, E; Al-Ansari, N; Taj-Aldeen, S; Shaukat, A; Ahmedullah, H; Hamed, M

    2016-05-01

    The objective of our study was to describe the molecular support of carbapenem resistance from randomly selected clinical isolates of multidrug-resistant (MDR) Acinetobacter baumannii as a pilot study from the Hamad Medical Corporation (HMC), Qatar. Results of our report will be used to study carbapenemases using molecular techniques in all isolated MDR A. baumannii. Forty-eight MDR A. baumannii were randomly selected from isolates preserved at HMC. Identification of all isolates was confirmed by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. Antibiotic resistance was tested phenotypically by Phoenix and confirmed by Etest. The molecular support of carbapenemases (bla OXA-23, bla OXA-24, bla OXA-58, bla NDM) was investigated by real-time PCR. The epidemiologic relatedness of the isolates was verified by phylogenetic analysis based on partial sequences of CsuE and bla OXA-51 genes. All 48 isolates were identified as A. baumannii and were confirmed to be resistant to most antibiotics, especially meropenem, imipenems, ciprofloxacin, levofloxacin, amikacin, gentamicin and most of the β-lactams; they were sensitive to colistin. All the isolates were positive for bla OXA-23 and negative for the other tested carbapenemase genes. Clonality analysis demonstrated that different lineages were actually circulating in Qatar; and we suggest that an outbreak occurred in the medical intensive care unit of HMC between 2011 and 2012. Here we report the emergence of MDR A. baumannii producing the carbapenemase OXA-23 in Qatar. PMID:27054039

  9. Identification of novel vaccine candidates against Acinetobacter baumannii using reverse vaccinology

    PubMed Central

    Chiang, Ming-Hsien; Sung, Wang-Chou; Lien, Shu-Pei; Chen, Ying-Zih; Lo, Annie Fei-yun; Huang, Jui-Hsin; Kuo, Shu-Chen; Chong, Pele

    2015-01-01

    Acinetobacter baumannii (Ab) is a global emerging bacterium causing nosocomial infections such as pneumonia, meningitis, bacteremia and soft tissue infections especially in intensive care units. Since Ab is resistant to almost all conventional antibiotics, it is now one of the 6 top-priorities of the dangerous microorganisms listed by the Infectious Disease Society of America. The development of vaccine is one of the most promising and cost-effective strategies to prevent infections. In this study, we identified potential protective vaccine candidates using reverse vaccinology. We have analyzed 14 on-line available Ab genome sequences and found 2752 homologous core genes. Using information obtained from immuno-proteomic experiments, published proteomic information and the bioinformatics PSORTb v3.0 software to predict the location of extracellular and/or outer membrane proteins, 77 genes were identified and selected for further studies. After excluding those antigens have been used as vaccine candidates reported by the in silico search-engines of PubMed and Google Scholar, 13 proteins could potentially be vaccine candidates. We have selected and cloned the genes of 3 antigens that were further expressed and purified. These antigens were found to be highly immunogenic and conferred partial protection (60%) in a pneumonia animal model. The strategy described in the present study incorporates the advantages of reverse vaccinology, bioinformatics and immuno-proteomic platform technologies and is easy to perform to identify novel immunogens for multi-component vaccines development. PMID:25751377

  10. Efficacy of Artilysin Art-175 against Resistant and Persistent Acinetobacter baumannii.

    PubMed

    Defraine, Valerie; Schuermans, Joris; Grymonprez, Barbara; Govers, Sander K; Aertsen, Abram; Fauvart, Maarten; Michiels, Jan; Lavigne, Rob; Briers, Yves

    2016-06-01

    Bacteriophage-encoded endolysins have shown promise as a novel class of antibacterials with a unique mode of action, i.e., peptidoglycan degradation. However, Gram-negative pathogens are generally not susceptible due to their protective outer membrane. Artilysins overcome this barrier. Artilysins are optimized, engineered fusions of selected endolysins with specific outer membrane-destabilizing peptides. Artilysin Art-175 comprises a modified variant of endolysin KZ144 with an N-terminal fusion to SMAP-29. Previously, we have shown the high susceptibility of Pseudomonas aeruginosa to Art-175. Here, we report that Art-175 is highly bactericidal against stationary-phase cells of multidrug-resistant Acinetobacter baumannii, even resulting in a complete elimination of large inocula (≥10(8) CFU/ml). Besides actively dividing cells, Art-175 also kills persisters. Instantaneous killing of A. baumannii upon contact with Art-175 could be visualized after immobilization of the bacteria in a microfluidic flow cell. Effective killing of a cell takes place through osmotic lysis after peptidoglycan degradation. The killing rate is enhanced by the addition of 0.5 mM EDTA. No development of resistance to Art-175 under selection pressure and no cross-resistance with existing resistance mechanisms could be observed. In conclusion, Art-175 represents a highly active Artilysin against both A. baumannii and P. aeruginosa, two of the most life-threatening pathogens of the order Pseudomonadales. PMID:27021321

  11. The induction and identification of novel Colistin resistance mutations in Acinetobacter baumannii and their implications

    PubMed Central

    Thi Khanh Nhu, Nguyen; Riordan, David W.; Do Hoang Nhu, Tran; Thanh, Duy Pham; Thwaites, Guy; Huong Lan, Nguyen Phu; Wren, Brendan W.; Baker, Stephen; Stabler, Richard A

    2016-01-01

    Acinetobacter baumannii is a significant cause of opportunistic hospital acquired infection and has been identified as an important emerging infection due to its high levels of antimicrobial resistance. Multidrug resistant A. baumannii has risen rapidly in Vietnam, where colistin is becoming the drug of last resort for many infections. In this study we generated spontaneous colistin resistant progeny (up to >256 μg/μl) from four colistin susceptible Vietnamese isolates and one susceptible reference strain (MIC <1.5 μg/μl). Whole genome sequencing was used to identify single nucleotide mutations that could be attributed to the reduced colistin susceptibility. We identified six lpxACD and three pmrB mutations, the majority of which were novel. In addition, we identified further mutations in six A. baumannii genes (vacJ, pldA, ttg2C, pheS and conserved hypothetical protein) that we hypothesise have a role in reduced colistin susceptibility. This study has identified additional mutations that may be associated with colistin resistance through novel resistance mechanisms. Our work further demonstrates how rapidly A. baumannii can generate resistance to a last resort antimicrobial and highlights the need for improved surveillance to identified A. baumannii with an extensive drug resistance profile. PMID:27329501

  12. The First Outbreak Caused by Acinetobacter baumannii ST208 and ST195 in China

    PubMed Central

    Qu, Junyan; Du, Yu

    2016-01-01

    This study aimed to analyze the clinical characteristics of patients and molecular mechanisms of the first outbreak mainly caused by sequence types (STs) 208 multidrug resistant (MDR) Acinetobacter baumannii in China. A total of 10 clinical samples were collected from 5 patients who were involved in the outbreak. Bacterial identification and antibiotic sensitivity tests were performed by the VITEK-2 COMPACT automated system. MICs of tigecycline for clinical isolates were determined using broth microdilution. The clonal relatedness of A. baumannii clinical isolates in our local settings was determinated by pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing (MLST). A total of 7 A. baumannii strains were isolated and all were MDR strains; two of them were carbapenem-nonsusceptible strains. blaOXA-23 was the only acquired carbapenemase gene in the isolates. The isolates belonged to a single clonal pulsotype determined by PFGE and two sequences types (STs) determined by MLST. The isolates belonged to the globally disseminated clonal complex 92, among which ST195 and ST208 were the most common sequence types (71.43% and 28.57%). The outbreak was successfully controlled by stringent infection control measures, especially improving the hand hygiene compliance and enhancing antimicrobial stewardship. In conclusion, this is the first description of an outbreak caused mainly by A. baumannii of ST208 in China. Infection control measures should be strengthened when infection outbreaks in hospital. PMID:27144176

  13. Colistin Resistance in Acinetobacter baumannii Is Mediated by Complete Loss of Lipopolysaccharide Production ▿

    PubMed Central

    Moffatt, Jennifer H.; Harper, Marina; Harrison, Paul; Hale, John D. F.; Vinogradov, Evgeny; Seemann, Torsten; Henry, Rebekah; Crane, Bethany; St. Michael, Frank; Cox, Andrew D.; Adler, Ben; Nation, Roger L.; Li, Jian; Boyce, John D.

    2010-01-01

    Infections caused by multidrug-resistant (MDR) Gram-negative bacteria represent a major global health problem. Polymyxin antibiotics such as colistin have resurfaced as effective last-resort antimicrobials for use against MDR Gram-negative pathogens, including Acinetobacter baumannii. Here we show that A. baumannii can rapidly develop resistance to polymyxin antibiotics by complete loss of the initial binding target, the lipid A component of lipopolysaccharide (LPS), which has long been considered to be essential for the viability of Gram-negative bacteria. We characterized 13 independent colistin-resistant derivatives of A. baumannii type strain ATCC 19606 and showed that all contained mutations within one of the first three genes of the lipid A biosynthesis pathway: lpxA, lpxC, and lpxD. All of these mutations resulted in the complete loss of LPS production. Furthermore, we showed that loss of LPS occurs in a colistin-resistant clinical isolate of A. baumannii. This is the first report of a spontaneously occurring, lipopolysaccharide-deficient, Gram-negative bacterium. PMID:20855724

  14. Effect of carbonyl cyanide 3-chlorophenylhydrazone (CCCP) on killing Acinetobacter baumannii by colistin.

    PubMed

    Park, Young Kyoung; Ko, Kwan Soo

    2015-01-01

    We investigated the effect of cyanide 3-chlorophenylhydrazone (CCCP) and other efflux pump inhibitors (EPIs) on the colistin susceptibility in Acinetobacter baumannii. While minimum inhibitory concentrations (MICs) of colistin in all colistin-resistant strains decreased significantly with 25 μM of CCCP and 2,4-dinitrophenol (DNP), phenyl-arginine-β-naphthylamide (PAβN), and reserpine did not decrease the colistin MICs. However, CCCP and DNP as well as PAβN and reserpine did not have a significant effect on the MICs of the other agents. Efflux pump gene expressions in colistin-resistant strains were not increased compared with those in colistin-susceptible strains. When only 5X MIC of colistin (5 mg/L) was provided to a colistin-susceptible A. baumannii strain, the bacterial cell number was reduced by 9 h after exposure to colistin, but regrowth was observed. When CCCP was added to colistin, bacterial cells were completely killed after 24 to 48 h of incubation, which was not due to the toxicity of CCCP itself. Colistin resistance in A. baumannii may not be due to efflux pumps. Our present study suggests that bacterial cells with reduced metabolic activity by CCCP are more susceptible to colistin in A. baumannii. It may show the possibility that combined therapy with colistin and other antimicrobial agents could effective against A. baumannii infections. PMID:25557480

  15. Emergence and clonal dissemination of carbapenem-hydrolysing OXA-58-producing Acinetobacter baumannii isolates in Bolivia.

    PubMed

    Sevillano, Elena; Fernández, Elena; Bustamante, Zulema; Zabalaga, Silvia; Rosales, Ikerne; Umaran, Adelaida; Gallego, Lucía

    2012-01-01

    Acinetobacter baumannii is an emerging multidrug-resistant pathogen and very little information is available regarding its imipenem resistance in Latin American countries such as Bolivia. This study investigated the antimicrobial resistance profile of 46 clinical strains from different hospitals in Cochabamba, Bolivia, from March 2008 to July 2009, and the presence of carbapenemases as a mechanism of resistance to imipenem. Isolates were obtained from 46 patients (one isolate per patient; 30 males,16 females) with an age range of 1 day to 84 years, and were collected from different sample types, the majority from respiratory tract infections (17) and wounds (13). Resistance to imipenem was detected in 15 isolates collected from different hospitals of the city. These isolates grouped into the same genotype, named A, and were resistant to all antibiotics tested including imipenem, with susceptibility only to colistin. Experiments to detect carbapenemases revealed the presence of the OXA-58 carbapenemase. Further analysis revealed the location of the bla(OXA-58) gene on a 40 kb plasmid. To our knowledge, this is the first report of carbapenem resistance in A. baumannii isolates from Bolivia that is conferred by the OXA-58 carbapenemase. The presence of this gene in a multidrug-resistant clone and its location within a plasmid is of great concern with regard to the spread of carbapenem-resistant A. baumannii in the hospital environment in Bolivia. PMID:21873380

  16. Clonal diversity of Acinetobacter baumannii from diabetic patients in Saudi Arabian hospitals.

    PubMed

    Alsultan, Abdulrahman A; Aboulmagd, Elsayed; Evans, Benjamin A; Amyes, Sebastian G B

    2014-11-01

    Carbapenem-resistant Acinetobacter baumannii (CR-AB) represents a major health-care problem, causing high rates of morbidity and mortality. This study investigated the clonality of CR-AB isolated from diabetic patients from different regions in Saudi Arabia, as well as the relatedness of the β-lactamase genes. A total of 64 non-repetitive CR-AB clinical isolates were collected from 16 different regions in Saudi Arabia from intensive care patients. Isolates were identified phenotypically by the Vitek 2 compact system and genotypically by amplification of the blaOXA-51-like gene. The target sequences were amplified by PCR and the clonal diversity of the isolates was explored by PFGE. Resistance studies revealed that the prevalence of imipenem and meropenem resistance was 92% and 96%, respectively, while the vast majority of the isolates were susceptible to tigecycline and colistin. In addition, blaVIM and blaOXA-23 were the most prevalent genes in the isolates under investigation, while ISAba1 was the most dominant insertion sequence. PFGE results showed 13 clusters; clone H was dominant, comprising 20 isolates from four hospitals, followed by clones C and F, comprising 11 isolates each from three and six hospitals, respectively. Moreover, the current study signified the clonal diversity of CR-AB in Saudi Arabia and showed the ability of some clones to infect patients in many different cities. PMID:25106863

  17. Antimicrobial Resistance of Acinetobacter baumannii to Imipenem in Iran: A Systematic Review and Meta-Analysis

    PubMed Central

    Pourhajibagher, Maryam; Hashemi, Farhad B.; Pourakbari, Babak; Aziemzadeh, Masoud; Bahador, Abbas

    2016-01-01

    Imipenem-resistant multi-drug resistant (IR-MDR) Acinetobacter baumannii has been emerged as a morbidity successful nosocomial pathogen throughout the world.To address imipenem being yet the most effective antimicrobial agent against A. baumannii to control outbreaks and treat patients, a systematic review and meta-analysis was performed to evaluate the prevalence of IR-MDR A. baumannii. We systematically searched Web of Science, PubMed, MEDLINE, Science Direct, EMBASE, Scopus, Cochrane Library, Google Scholar, and Iranian databases to identify studies addressing the antibiotic resistance of A. baumannii to imipenem and the frequency of MDR strains in Iran. Out of 58 articles and after a secondary screening using inclusion and exclusion criteria and on the basis of title and abstract evaluation, 51 studies were selected for analysis. The meta-analysis revealed that 55% [95% confidence interval (CI), 53.0–56.5] of A. baumannii were resistant to imipenem and 74% (95% CI, 61.3–83.9) were MDR. The MDR A. baumannii population in Iran is rapidly changing toward a growing resistance to imipenem. Our findings highlight the critical need for a comprehensive monitoring and infection control policy as well as a national susceptibility review program that evaluates IR-MDR A. baumannii isolates from various parts of Iran. PMID:27099638

  18. Differential Role of the T6SS in Acinetobacter baumannii Virulence

    PubMed Central

    Foucault-Grunenwald, Marie-Laure; Borges, Vitor; Charpentier, Xavier; Limansky, Adriana S.; Gomes, João Paulo; Viale, Alejandro M.; Salcedo, Suzana P.

    2015-01-01

    Gram-negative bacteria, such as Acinetobacter baumannii, are an increasing burden in hospitals worldwide with an alarming spread of multi-drug resistant (MDR) strains. Herein, we compared a type strain (ATCC17978), a non-clinical isolate (DSM30011) and MDR strains of A. baumannii implicated in hospital outbreaks (Ab242, Ab244 and Ab825), revealing distinct patterns of type VI secretion system (T6SS) functionality. The T6SS genomic locus is present and was actively transcribed in all of the above strains. However, only the A. baumannii DSM30011 strain was capable of killing Escherichia coli in a T6SS-dependent manner, unlike the clinical isolates, which failed to display an active T6SS in vitro. In addition, DSM30011 was able to outcompete ATCC17978 as well as Pseudomonas aeruginosa and Klebsiella pneumoniae, bacterial pathogens relevant in mixed nosocomial infections. Finally, we found that the T6SS of DSM30011 is required for host colonization of the model organism Galleria mellonella suggesting that this system could play an important role in A. baumannii virulence in a strain-specific manner. PMID:26401654

  19. Identification and Characterization of Type II Toxin-Antitoxin Systems in the Opportunistic Pathogen Acinetobacter baumannii

    PubMed Central

    Jurėnaitė, Milda; Markuckas, Arvydas

    2013-01-01

    Acinetobacter baumannii is an opportunistic pathogen that causes nosocomial infections. Due to the ability to persist in the clinical environment and rapidly acquire antibiotic resistance, multidrug-resistant A. baumannii clones have spread in medical units in many countries in the last decade. The molecular basis of the emergence and spread of the successful multidrug-resistant A. baumannii clones is not understood. Bacterial toxin-antitoxin (TA) systems are abundant genetic loci harbored in low-copy-number plasmids and chromosomes and have been proposed to fulfill numerous functions, from plasmid stabilization to regulation of growth and death under stress conditions. In this study, we have performed a thorough bioinformatic search for type II TA systems in genomes of A. baumannii strains and estimated at least 15 possible TA gene pairs, 5 of which have been shown to be functional TA systems. Three of them were orthologs of bacterial and archaeal RelB/RelE, HicA/HicB, and HigB/HigA systems, and others were the unique SplT/SplA and CheT/CheA TA modules. The toxins of all five TA systems, when expressed in Escherichia coli, inhibited translation, causing RNA degradation. The HigB/HigA and SplT/SplA TA pairs of plasmid origin were highly prevalent in clinical multidrug-resistant A. baumannii isolates from Lithuanian hospitals belonging to the international clonal lineages known as European clone I (ECI) and ECII. PMID:23667234

  20. Identification of a DNA-Damage-Inducible Regulon in Acinetobacter baumannii

    PubMed Central

    Aranda, Jesús; Poza, Margarita; Shingu-Vázquez, Miguel; Cortés, Pilar; Boyce, John D.; Adler, Ben; Barbé, Jordi

    2013-01-01

    The transcriptional response of Acinetobacter baumannii, a major cause of nosocomial infections, to the DNA-damaging agent mitomycin C (MMC) was studied using DNA microarray technology. Most of the 39 genes induced by MMC were related to either prophages or encoded proteins involved in DNA repair. Electrophoretic mobility shift assays demonstrated that the product of the A. baumannii MMC-inducible umuD gene (umuDAb) specifically binds to the palindromic sequence TTGAAAATGTAACTTTTTCAA present in its promoter region. Mutations in this palindromic region abolished UmuDAb protein binding. A comparison of the promoter regions of all MMC-induced genes identified four additional transcriptional units with similar palindromic sequences recognized and specifically bound by UmuDAb. Therefore, the UmuDAb regulon consists of at least eight genes encoding seven predicted error-prone DNA polymerase V components and DddR, a protein of unknown function. Expression of these genes was not induced in the MMC-treated recA mutant. Furthermore, inactivation of the umuDAb gene resulted in the deregulation of all DNA-damage-induced genes containing the described palindromic DNA motif. Together, these findings suggest that UmuDAb is a direct regulator of the DNA damage response in A. baumannii. PMID:24123815

  1. Inactivation of Acinetobacter baumannii Biofilms on Polystyrene, Stainless Steel, and Urinary Catheters by Octenidine Dihydrochloride

    PubMed Central

    Narayanan, Amoolya; Nair, Meera S.; Karumathil, Deepti P.; Baskaran, Sangeetha A.; Venkitanarayanan, Kumar; Amalaradjou, Mary Anne Roshni

    2016-01-01

    Acinetobacter baumannii is a major nosocomial pathogen causing human infections with significant mortality rates. In most cases, infections are acquired through exposure to A. baumannii biofilms that persist on contaminated hospital equipment and surfaces. Thus, it is imperative to develop effective measures for controlling A. baumannii biofilms in nosocomial settings. This study investigated the efficacy of octenidine dihydrochloride (OH), a new generation disinfectant for reducing A. baumannii biofilms on polystyrene, stainless steel and catheters. OH at 0.3% (5 mM), 0.6% (10 mM), and 0.9% (15 mM) was effective in significantly inactivating A. baumannii biofilms on all tested surfaces (P < 0.05). Furthermore, OH was equally effective in inactivating biofilms of multidrug resistant and drug susceptible A. baumannii isolates. In addition, confocal imaging revealed the predominance of dead cells in the OH-treated samples in comparison to the control. Further, scanning electron microscopy of biofilms formed on catheters revealed that OH treatment significantly reduced A. baumannii biofilm populations in corroboration with our antibiofilm assay. These data underscore the efficacy of OH in inactivating A. baumannii biofilms, thereby suggesting its potential use as a disinfectant or a catheter lock solution to control A. baumannii infections. PMID:27375572

  2. Detoxification of Indole by an Indole-Induced Flavoprotein Oxygenase from Acinetobacter baumannii

    PubMed Central

    Lin, Guang-Huey; Chen, Hao-Ping; Shu, Hung-Yu

    2015-01-01

    Indole, a derivative of the amino acid tryptophan, is a toxic signaling molecule, which can inhibit bacterial growth. To overcome indole-induced toxicity, many bacteria have developed enzymatic defense systems to convert indole to non-toxic, water-insoluble indigo. We previously demonstrated that, like other aromatic compound-degrading bacteria, Acinetobacter baumannii can also convert indole to indigo. However, no work has been published investigating this mechanism. Here, we have shown that the growth of wild-type A. baumannii is severely inhibited in the presence of 3.5 mM indole. However, at lower concentrations, growth is stable, implying that the bacteria may be utilizing a survival mechanism to oxidize indole. To this end, we have identified a flavoprotein oxygenase encoded by the iifC gene of A. baumannii. Further, our results suggest that expressing this recombinant oxygenase protein in Escherichia coli can drive indole oxidation to indigo in vitro. Genome analysis shows that the iif operon is exclusively present in the genomes of A. baumannii and Pseudomonas syringae pv. actinidiae. Quantitative PCR and Western blot analysis also indicate that the iif operon is activated by indole through the AraC-like transcriptional regulator IifR. Taken together, these data suggest that this species of bacteria utilizes a novel indole-detoxification mechanism that is modulated by IifC, a protein that appears to be, at least to some extent, regulated by IifR. PMID:26390211

  3. Thai ethnomedicinal plants as resistant modifying agents for combating Acinetobacter baumannii infections

    PubMed Central

    2012-01-01

    Abstracts Background Acinetobacter baumannii is well-recognized as an important nosocomial pathogen, however, due to their intrinsic resistance to several antibiotics, treatment options are limited. Synergistic effects between antibiotics and medicinal plants, particularly their active components, have intensively been studied as alternative approaches. Methods Fifty-one ethanol extracts obtained from 44 different selected medicinal plant species were tested for resistance modifying agents (RMAs) of novobiocin against A. baumannii using growth inhibition assay. Results At 250 μg/ml, Holarrhena antidysenterica, Punica granatum, Quisqualis indica, Terminalia bellirica, Terminalia chebula, and Terminalia sp. that possessed low intrinsic antibacterial activity significantly enhanced the activity of novobiocin at 1 μg/ml (1/8xminimum inhibitory concentration) against this pathogen. Holarrhena antidysenterica at 7.8 μg/ml demonstrated remarkable resistant modifying ability against A. baumannii in combination with novobiocin. The phytochemical study revealed that constituents of this medicinal plant contain alkaloids, condensed tannins, and triterpenoids. Conclusion The use of Holarrhena antidysenterica in combination with novobiocin provides an effective alternative treatment for multidrug resistant A. baumannii infections. PMID:22536985

  4. Disinfection of Acinetobacter baumannii-contaminated surfaces relevant to medical treatment facilities with ultraviolet C light.

    PubMed

    Rastogi, Vipin K; Wallace, Lalena; Smith, Lisa S

    2007-11-01

    The efficacy of ultraviolet C (UVC) light (100-280 nm) in the decontamination of three hospital-related surfaces, namely, unpainted/painted aluminum (bed railings), stainless steel (operating tables), and scrubs (laboratory coats), was investigated. Acinetobacter baumannii cells were inoculated (10(5) or 10(3) cells) on small coupons and dried overnight in a class II biosafety cabinet. Drying resulted in < or =50% loss of viability. The UVC fluence of 90 J/m2 was observed to be very effective in the decontamination of cells from all metal coupon surfaces (complete killing). However, the same fluence was ineffective in the decontamination of scrubs. The effectiveness of two other common disinfection practices, that is, 15 minutes of boiling or spraying with 70% ethanol, was investigated for the scrubs. Although ethanol treatment was ineffective, the boiling treatment was very effective (complete killing). These results establish that metal surfaces can be decontaminated with UVC irradiation and boiling treatment is effective for scrub decontamination. PMID:18062390

  5. Effects of silver nanoparticles in combination with antibiotics on the resistant bacteria Acinetobacter baumannii.

    PubMed

    Wan, Guoqing; Ruan, Lingao; Yin, Yu; Yang, Tian; Ge, Mei; Cheng, Xiaodong

    2016-01-01

    Acinetobacter baumannii resistance to carbapenem antibiotics is a serious clinical challenge. As a newly developed technology, silver nanoparticles (AgNPs) show some excellent characteristics compared to older treatments, and are a candidate for combating A. baumannii infection. However, its mechanism of action remains unclear. In this study, we combined AgNPs with antibiotics to treat carbapenem-resistant A. baumannii (aba1604). Our results showed that single AgNPs completely inhibited A. baumannii growth at 2.5 μg/mL. AgNP treatment also showed synergistic effects with the antibiotics polymixin B and rifampicin, and an additive effect with tigecyline. In vivo, we found that AgNPs-antibiotic combinations led to better survival ratios in A. baumannii-infected mouse peritonitis models than that by single drug treatment. Finally, we employed different antisense RNA-targeted Escherichia coli strains to elucidate the synergistic mechanism involved in bacterial responses to AgNPs and antibiotics. PMID:27574420

  6. Translation Elongation Factor Tuf of Acinetobacter baumannii Is a Plasminogen-Binding Protein

    PubMed Central

    Koenigs, Arno; Zipfel, Peter F.; Kraiczy, Peter

    2015-01-01

    Acinetobacter baumannii is an important nosocomial pathogen, causing a variety of opportunistic infections of the skin, soft tissues and wounds, urinary tract infections, secondary meningitis, pneumonia and bacteremia. Over 63% of A. baumannii infections occurring in the United States are caused by multidrug resistant isolates, and pan-resistant isolates have begun to emerge that are resistant to all clinically relevant antibiotics. The complement system represents the first line of defense against invading pathogens. However, many A. baumannii isolates, especially those causing severe bacteremia are resistant to complement-mediated killing, though the underlying mechanisms remain poorly understood. Here we show for the first time that A. baumannii binds host-derived plasminogen and we identify the translation elongation factor Tuf as a moonlighting plasminogen-binding protein that is exposed on the outer surface of A. baumannii. Binding of plasminogen to Tuf is at least partly dependent on lysine residues and ionic interactions. Plasminogen, once bound to Tuf can be converted to active plasmin and proteolytically degrade fibrinogen as well as the key complement component C3b. Thus, Tuf acts as a multifunctional protein that may contribute to virulence of A. baumannii by aiding in dissemination and evasion of the complement system. PMID:26230848

  7. Demonstration of the interactions between aromatic compound-loaded lipid nanocapsules and Acinetobacter baumannii bacterial membrane.

    PubMed

    Montagu, A; Joly-Guillou, M-L; Guillet, C; Bejaud, J; Rossines, E; Saulnier, P

    2016-06-15

    Acinetobacter baumannii is an important nosocomial pathogen that is resistant to many commonly-used antibiotics. One strategy for treatment is the use of aromatic compounds (carvacrol, cinnamaldehyde) against A. baumannii. The aim of this study was to determine the interactions between bacteria and lipid nanocapsules (LNCs) over time based on the fluorescence of 3,3'-Dioctadecyloxacarbocyanine Perchlorate-LNCs (DiO-LNCs) and the properties of trypan blue to analyse the physicochemical mechanisms occurring at the level of the biological membrane. The results demonstrated the capacity of carvacrol-loaded LNCs to interact with and penetrate the bacterial membrane in comparison with cinnamaldehyde-loaded LNCs and unloaded LNCs. Modifications of carvacrol after substitution of hydroxyl functional groups by fatty acids demonstrated the crucial role of hydroxyl functions in antibacterial activity. Finally, after contact with the efflux pump inhibitor, carbonylcyanide-3-chlorophenyl hydrazine (CCCP), the results indicated the total synergistic antibacterial effect with Car-LNCs, showing that CCCP is associated with the action mechanism of carvacrol, especially at the level of the efflux pump mechanism. PMID:27039148

  8. Functional Exposed Amino Acids of BauA as Potential Immunogen Against Acinetobacter baumannii.

    PubMed

    Sefid, Fatemeh; Rasooli, Iraj; Jahangiri, Abolfazl; Bazmara, Hadise

    2015-06-01

    Multidrug-resistant Acinetobacter baumannii is recognized to be among the most difficult antimicrobial-resistant gram negative bacilli to control and treat. One of the major challenges that the pathogenic bacteria face in their host is the scarcity of freely available iron. To survive under such conditions, bacteria express new proteins on their outer membrane and also secrete iron chelators called siderophores. Antibodies directed against these proteins associated with iron uptake exert a bacteriostatic or bactericidal effect against A. baumanii in vitro, by blocking siderophore mediated iron uptake pathways. Attempts should be made to discover peptides that could mimic protein epitopes and possess the same immunogenicity as the whole protein. Subsequently, theoretical methods for epitope prediction have been developed leading to synthesis of such peptides that are important for development of immunodiagnostic tests and vaccines. The present study was designed to in silico resolving the major obstacles in the control or in prevention of the diseases caused by A. baumannii. We exploited bioinformatic tools to better understand and characterize the Baumannii acinetobactin utilization structure of A. baumannii and select appropriate regions as effective B cell epitopes. In conclusion, amino acids 26-191 of cork domain and 321-635 of part of the barrel domain including L4-L9, were selected as vaccine candidates. These two regions contain functional exposed amino acids with higher score of B cell epitopes properties. Majority of amino acids are hydrophilic, flexible, accessible, and favorable for B cells from secondary structure point of view. PMID:25840681

  9. Resistance and integron characterization of Acinetobacter baumannii in a teaching hospital in Chongqing, China

    PubMed Central

    Huang, C.; Long, Q.; Qian, K.; Fu, T.; Zhang, Z.; Liao, P.; Xie, J.

    2015-01-01

    A total of 189 Acinetobacter baumannii isolates were collected in 2011 from a teaching hospital in Chongqing, China. Susceptibility data showed strains carrying integrons were significantly more resistant to all tested antibiotics that strains lacking integrons. Five types of gene cassettes belonging to class I integrons were identified in this study, and for the first time two types of gene cassettes belonging to class II integrons are reported. Most of the cassettes belong to a class I integron (136/144) encoding arr3, aacA4, dfrA17, aadA5, aadB, cat, blaOXA10, aadA1, aadA2, dfrA and aacC1. Isolates contained a class I gene cassette; AadA2-HP-dfrA was the prevalent strain in this hospital. A class II integron was detected in eight strains, which contained the type IV fimbriae expression regulatory gene pilR and sulfate adenylyltransferase, suggesting a possible role in multidrug resistance. The major epidemic strains from intensive care unit patients belong to international clone 2. In conclusion, the presence of integrons was significantly associated with multiple drug resistance of A. baumannii in this hospital, and class I integron isolates bearing AadA2-HP-dfrA were the prevalent strain in this hospital. PMID:26649184

  10. Identification and characterization of a glycosyltransferase involved in Acinetobacter baumannii lipopolysaccharide core biosynthesis.

    PubMed

    Luke, Nicole R; Sauberan, Shauna L; Russo, Thomas A; Beanan, Janet M; Olson, Ruth; Loehfelm, Thomas W; Cox, Andrew D; St Michael, Frank; Vinogradov, Evgeny V; Campagnari, Anthony A

    2010-05-01

    Although Acinetobacter baumannii has emerged as a significant cause of nosocomial infections worldwide, there have been few investigations describing the factors important for A. baumannii persistence and pathogenesis. This paper describes the first reported identification of a glycosyltransferase, LpsB, involved in lipopolysaccharide (LPS) biosynthesis in A. baumannii. Mutational, structural, and complementation analyses indicated that LpsB is a core oligosaccharide glycosyl transferase. Using a genetic approach, lpsB was compared with the lpsB homologues of several A. baumannii strains. These analyses indicated that LpsB is highly conserved among A. baumannii isolates. Furthermore, we developed a monoclonal antibody, monoclonal antibody 13C11, which reacts to an LPS core epitope expressed by approximately one-third of the A. baumannii clinical isolates evaluated to date. Previous studies describing the heterogeneity of A. baumannii LPS were limited primarily to structural analyses; therefore, studies evaluating the correlation between these surface glycolipids and pathogenesis were warranted. Our data from an evaluation of LpsB mutant 307::TN17, which expresses a deeply truncated LPS glycoform consisting of only two 3-deoxy-d-manno-octulosonic acid residues and lipid A, suggest that A. baumannii LPS is important for resistance to normal human serum and confers a competitive advantage for survival in vivo. These results have important implications for the role of LPS in A. baumannii infections. PMID:20194587

  11. Effects of silver nanoparticles in combination with antibiotics on the resistant bacteria Acinetobacter baumannii

    PubMed Central

    Wan, Guoqing; Ruan, Lingao; Yin, Yu; Yang, Tian; Ge, Mei; Cheng, Xiaodong

    2016-01-01

    Acinetobacter baumannii resistance to carbapenem antibiotics is a serious clinical challenge. As a newly developed technology, silver nanoparticles (AgNPs) show some excellent characteristics compared to older treatments, and are a candidate for combating A. baumannii infection. However, its mechanism of action remains unclear. In this study, we combined AgNPs with antibiotics to treat carbapenem-resistant A. baumannii (aba1604). Our results showed that single AgNPs completely inhibited A. baumannii growth at 2.5 μg/mL. AgNP treatment also showed synergistic effects with the antibiotics polymixin B and rifampicin, and an additive effect with tigecyline. In vivo, we found that AgNPs–antibiotic combinations led to better survival ratios in A. baumannii-infected mouse peritonitis models than that by single drug treatment. Finally, we employed different antisense RNA-targeted Escherichia coli strains to elucidate the synergistic mechanism involved in bacterial responses to AgNPs and antibiotics. PMID:27574420

  12. Resistance patterns of multidrug resistant Acinetobacter baumannii in an ICU of a tertiary care hospital, Malaysia

    PubMed Central

    Janahiraman, Sivakami; Aziz, Muhammad Nazri; Hoo, Fan Kee; P’ng, Hon Shen; Boo, Yang Liang; Ramachandran, Vasudevan; Shamsuddin, Ahmad Fuad

    2015-01-01

    Backgrounds & Objective: Antimicrobial resistance is a major health problem worldwide in hospitals. The main contributing factors are exposures to broad-spectrum antimicrobials and cross-infections. Understanding the extent and type of antimicrobial use in tertiary care hospitals will aid in developing national antimicrobial stewardship priorities. Methods: In this study, we have analyzed the antimicrobial agents’ usage for acquisition of multidrug resistant using retrospective, cross-sectional, single-centre study in a multidisciplinary ICU at tertiary care hospital. Results: Acinetobacter baumannii (ACB) was isolated in various specimens from 662 patients. From these, 136 patients who were diagnosed with Ventilator-associated pneumonia (VAP) caused by ACB were included into the study. In our study, MDR strain accounts for 51% of all VAP cases caused by ACB. The development of ACB VAP were 10.5 + 6.4 days for MDR strains compared to susceptible organism (7.8 + 4.5 days) and had significantly longer ICU stay. Conclusion: The study concludes that prudent use of antimicrobial agents is important to reduce acquisition of MDR ACB. PMID:26870101

  13. Outbreak of septicaemic cases caused by Acinetobacter ursingii in a neonatal intensive care unit.

    PubMed

    Máder, Krisztina; Terhes, Gabriella; Hajdú, Edit; Urbán, Edit; Sóki, József; Magyar, Tibor; Márialigeti, Károly; Katona, Márta; Nagy, Elisabeth; Túri, Sándor

    2010-06-01

    Neonatal infections may be caused by various microorganisms, but as far as we are aware, Acinetobacter ursingii has not yet been reported in connection with nosocomial infections of premature infants. During 2 months, 3 premature babies were treated with nosocomial infection caused by A. ursingii at the same ward, and on the basis of molecular typing results the same strain was responsible for all of these cases. Traditional biochemical methods and automatic identification systems failed to identify this bacterium on the species level, and only 16S rDNA sequencing gave acceptable species identifications. The isolated strains proved to be susceptible to all of the tested antimicrobials, including ampicillin/sulbactam, doxycyclin, netilmicin, ciprofloxacin, piperacillin/tazobactam, ceftazidime, imipenem, meropenem, trimethoprim/sulfametoxazole, gentamicin, tobramycin, amikacin, and levofloxacin according to the CLSI standard. In spite of the environmental screening, the source of the infection could not be clarified. One of 3 neonates died, the others recovered and were discharged home after several months of hospitalization. PMID:19931486

  14. Carbapenem-resistant isolates of Acinetobacter baumannii in a municipal wastewater treatment plant, Croatia, 2014.

    PubMed

    Hrenovic, Jasna; Goic-Barisic, Ivana; Kazazic, Snjezana; Kovacic, Ana; Ganjto, Marin; Tonkic, Marija

    2016-04-14

    Acinetobacter baumannii is an emerging hospital pathogen. Whereas A. baumannii isolated from patients or hospitals has been reported, there are few data regarding propagation of viable A. baumannii in the natural environment. This study investigates the occurrence and antimicrobial susceptibility of viable A. baumannii in municipal wastewater and its persistence through the wastewater treatment process. A total of 21 A. baumannii isolates were recovered at a secondary type of municipal wastewater treatment plant in Zagreb, Croatia: 15 from raw influent wastewater and six from final effluent. All isolates were carbapenem- and multidrug-resistant. Among 14 isolates tested for blaOXA genes, all harboured the constitutive blaOXA-51-like gene, while the acquired blaOXA-23-like and blaOXA-40-like genes were found in 10 and three isolates respectively. Six A. baumannii isolates recovered from effluent wastewater multiplied and survived in sterilised effluent wastewater up to 50 days. These findings support the idea that multidrug-resistant A. baumannii can occur and have the ability to survive in the environment. PMID:27105318

  15. The Genetic Analysis of an Acinetobacter johnsonii Clinical Strain Evidenced the Presence of Horizontal Genetic Transfer.

    PubMed

    Montaña, Sabrina; Schramm, Sareda T J; Traglia, German Matías; Chiem, Kevin; Parmeciano Di Noto, Gisela; Almuzara, Marisa; Barberis, Claudia; Vay, Carlos; Quiroga, Cecilia; Tolmasky, Marcelo E; Iriarte, Andrés; Ramírez, María Soledad

    2016-01-01

    Acinetobacter johnsonii rarely causes human infections. While most A. johnsonii isolates are susceptible to virtually all antibiotics, strains harboring a variety of β-lactamases have recently been described. An A. johnsonii Aj2199 clinical strain recovered from a hospital in Buenos Aires produces PER-2 and OXA-58. We decided to delve into its genome by obtaining the whole genome sequence of the Aj2199 strain. Genome comparison studies on Aj2199 revealed 240 unique genes and a close relation to strain WJ10621, isolated from the urine of a patient in China. Genomic analysis showed evidence of horizontal genetic transfer (HGT) events. Forty-five insertion sequences and two intact prophages were found in addition to several resistance determinants such as blaPER-2, blaOXA-58, blaTEM-1, strA, strB, ereA, sul1, aacC2 and a new variant of blaOXA-211, called blaOXA-498. In particular, blaPER-2 and blaTEM-1 are present within the typical contexts previously described in the Enterobacteriaceae family. These results suggest that A. johnsonii actively acquires exogenous DNA from other bacterial species and concomitantly becomes a reservoir of resistance genes. PMID:27548264

  16. The induction and identification of novel Colistin resistance mutations in Acinetobacter baumannii and their implications.

    PubMed

    Thi Khanh Nhu, Nguyen; Riordan, David W; Do Hoang Nhu, Tran; Thanh, Duy Pham; Thwaites, Guy; Huong Lan, Nguyen Phu; Wren, Brendan W; Baker, Stephen; Stabler, Richard A

    2016-01-01

    Acinetobacter baumannii is a significant cause of opportunistic hospital acquired infection and has been identified as an important emerging infection due to its high levels of antimicrobial resistance. Multidrug resistant A. baumannii has risen rapidly in Vietnam, where colistin is becoming the drug of last resort for many infections. In this study we generated spontaneous colistin resistant progeny (up to >256 μg/μl) from four colistin susceptible Vietnamese isolates and one susceptible reference strain (MIC <1.5 μg/μl). Whole genome sequencing was used to identify single nucleotide mutations that could be attributed to the reduced colistin susceptibility. We identified six lpxACD and three pmrB mutations, the majority of which were novel. In addition, we identified further mutations in six A. baumannii genes (vacJ, pldA, ttg2C, pheS and conserved hypothetical protein) that we hypothesise have a role in reduced colistin susceptibility. This study has identified additional mutations that may be associated with colistin resistance through novel resistance mechanisms. Our work further demonstrates how rapidly A. baumannii can generate resistance to a last resort antimicrobial and highlights the need for improved surveillance to identified A. baumannii with an extensive drug resistance profile. PMID:27329501

  17. Antibacterial Activity of a Novel Peptide-Modified Lysin Against Acinetobacter baumannii and Pseudomonas aeruginosa

    PubMed Central

    Yang, Hang; Wang, Mengyue; Yu, Junping; Wei, Hongping

    2015-01-01

    The global emergence of multidrug-resistant (MDR) bacteria is a growing threat to public health worldwide. Natural bacteriophage lysins are promising alternatives in the treatment of infections caused by Gram-positive pathogens, but not Gram-negative ones, like Acinetobacter baumannii and Pseudomonas aeruginosa, due to the barriers posed by their outer membranes. Recently, modifying a natural lysin with an antimicrobial peptide was found able to break the barriers, and to kill Gram-negative pathogens. Herein, a new peptide-modified lysin (PlyA) was constructed by fusing the cecropin A peptide residues 1–8 (KWKLFKKI) with the OBPgp279 lysin and its antibacterial activity was studied. PlyA showed good and broad antibacterial activities against logarithmic phase A. baumannii and P. aeruginosa, but much reduced activities against the cells in stationary phase. Addition of outer membrane permeabilizers (EDTA and citric acid) could enhance the antibacterial activity of PlyA against stationary phase cells. Finally, no antibacterial activity of PlyA could be observed in some bio-matrices, such as culture media, milk, and sera. In conclusion, we reported here a novel peptide-modified lysin with significant antibacterial activity against both logarithmic (without OMPs) and stationary phase (with OMPs) A. baumannii and P. aeruginosa cells in buffer, but further optimization is needed to achieve broad activity in diverse bio-matrices. PMID:26733995

  18. Characterization of the anaerobic denitrification bacterium Acinetobacter sp. SZ28 and its application for groundwater treatment.

    PubMed

    Su, Jun feng; Zheng, Sheng Chen; Huang, Ting lin; Ma, Fang; Shao, Si Cheng; Yang, Shao Fei; Zhang, Li na

    2015-09-01

    Acinetobacter sp. SZ28 exhibited efficient autotrophic denitrification ability using Mn(2+) as an electron donor. Sequence amplification identified the presence of the nirS gene. Meteorological chromatography analysis showed that N2 was produced as an end product. Response surface methodology experiments showed that the maximum removal of nitrate occurred under the following conditions: Mn(2+) concentration of 143.56 mg/L, C/N ratio of 6.82, initial pH of 5.17, and temperature of 34.26 °C, where the initial Mn(2+) concentration produced the largest effect. In the groundwater experiment, nitrate levels decreased from 1.63 mg/L to 0 mg/L. Three-dimensional fluorescence analysis showed a decrease in the peak intensity of the original humus. Humus and the small-molecule amino acid tryptophan were detected. These results demonstrated that strain SZ28 is a suitable candidate for the simultaneous removal of nitrogen and Mn(2+) in groundwater treatment. PMID:26094190

  19. Detoxification of Indole by an Indole-Induced Flavoprotein Oxygenase from Acinetobacter baumannii.

    PubMed

    Lin, Guang-Huey; Chen, Hao-Ping; Shu, Hung-Yu

    2015-01-01

    Indole, a derivative of the amino acid tryptophan, is a toxic signaling molecule, which can inhibit bacterial growth. To overcome indole-induced toxicity, many bacteria have developed enzymatic defense systems to convert indole to non-toxic, water-insoluble indigo. We previously demonstrated that, like other aromatic compound-degrading bacteria, Acinetobacter baumannii can also convert indole to indigo. However, no work has been published investigating this mechanism. Here, we have shown that the growth of wild-type A. baumannii is severely inhibited in the presence of 3.5 mM indole. However, at lower concentrations, growth is stable, implying that the bacteria may be utilizing a survival mechanism to oxidize indole. To this end, we have identified a flavoprotein oxygenase encoded by the iifC gene of A. baumannii. Further, our results suggest that expressing this recombinant oxygenase protein in Escherichia coli can drive indole oxidation to indigo in vitro. Genome analysis shows that the iif operon is exclusively present in the genomes of A. baumannii and Pseudomonas syringae pv. actinidiae. Quantitative PCR and Western blot analysis also indicate that the iif operon is activated by indole through the AraC-like transcriptional regulator IifR. Taken together, these data suggest that this species of bacteria utilizes a novel indole-detoxification mechanism that is modulated by IifC, a protein that appears to be, at least to some extent, regulated by IifR. PMID:26390211

  20. Acinetobacter baumannii phenylacetic acid metabolism influences infection outcome through a direct effect on neutrophil chemotaxis.

    PubMed

    Bhuiyan, Md Saruar; Ellett, Felix; Murray, Gerald L; Kostoulias, Xenia; Cerqueira, Gustavo M; Schulze, Keith E; Mahamad Maifiah, Mohd Hafidz; Li, Jian; Creek, Darren J; Lieschke, Graham J; Peleg, Anton Y

    2016-08-23

    Innate cellular immune responses are a critical first-line defense against invading bacterial pathogens. Leukocyte migration from the bloodstream to a site of infection is mediated by chemotactic factors that are often host-derived. More recently, there has been a greater appreciation of the importance of bacterial factors driving neutrophil movement during infection. Here, we describe the development of a zebrafish infection model to study Acinetobacter baumannii pathogenesis. By using isogenic A. baumannii mutants lacking expression of virulence effector proteins, we demonstrated that bacterial drivers of disease severity are conserved between zebrafish and mammals. By using transgenic zebrafish with fluorescent phagocytes, we showed that a mutation of an established A. baumannii global virulence regulator led to marked changes in neutrophil behavior involving rapid neutrophil influx to a localized site of infection, followed by prolonged neutrophil dwelling. This neutrophilic response augmented bacterial clearance and was secondary to an impaired A. baumannii phenylacetic acid catabolism pathway, which led to accumulation of phenylacetate. Purified phenylacetate was confirmed to be a neutrophil chemoattractant. These data identify a previously unknown mechanism of bacterial-guided neutrophil chemotaxis in vivo, providing insight into the role of bacterial metabolism in host innate immune evasion. Furthermore, the work provides a potentially new therapeutic paradigm of targeting a bacterial metabolic pathway to augment host innate immune responses and attenuate disease. PMID:27506797

  1. The effect of silver or gallium doped titanium against the multidrug resistant Acinetobacter baumannii.

    PubMed

    Cochis, A; Azzimonti, B; Della Valle, C; De Giglio, E; Bloise, N; Visai, L; Cometa, S; Rimondini, L; Chiesa, R

    2016-02-01

    Implant-related infection of biomaterials is one of the main causes of arthroplasty and osteosynthesis failure. Bacteria, such as the rapidly-emerging Multi Drug Resistant (MDR) pathogen Acinetobacter Baumannii, initiate the infection by adhering to biomaterials and forming a biofilm. Since the implant surface plays a crucial role in early bacterial adhesion phases, titanium was electrochemically modified by an Anodic Spark Deposition (ASD) treatment, developed previously and thought to provide osseo-integrative properties. In this study, the treatment was modified to insert gallium or silver onto the titanium surface, to provide antibacterial properties. The material was characterized morphologically, chemically, and mechanically; biological properties were investigated by direct cytocompatibility assay, Alkaline Phosphatase (ALP) activity, Scanning Electron Microscopy (SEM), and Immunofluorescent (IF) analysis; antibacterial activity was determined by counting Colony Forming Units, and viability assay. The various ASD-treated surfaces showed similar morphology, micrometric pore size, and uniform pore distribution. Of the treatments studied, gallium-doped specimens showed the best ALP synthesis and antibacterial properties. This study demonstrates the possibility of successfully doping the surface of titanium with gallium or silver, using the ASD technique; this approach can provide antibacterial properties and maintain high osseo-integrative potential. PMID:26708086

  2. Combination therapy with polymyxin B and netropsin against clinical isolates of multidrug-resistant Acinetobacter baumannii

    PubMed Central

    Chung, Joon-hui; Bhat, Abhayprasad; Kim, Chang-Jin; Yong, Dongeun; Ryu, Choong-Min

    2016-01-01

    Polymyxins are last-resort antibiotics for treating infections of Gram-negative bacteria. The recent emergence of polymyxin-resistant bacteria, however, urgently demands clinical optimisation of polymyxin use to minimise further evolution of resistance. In this study we developed a novel combination therapy using minimal concentrations of polymyxin B. After large-scale screening of Streptomyces secondary metabolites, we identified a reliable polymixin synergist and confirmed as netropsin using high-pressure liquid chromatography, nuclear magnetic resonance, and mass spectrometry followed by in vitro assays using various Gram-negative pathogenic bacteria. To evaluate the effectiveness of combining polymixin B and netropsin in vivo, we performed survival analysis on greater wax moth Galleria mellonella infected with colistin-resistant clinical Acinetobacter baumannii isolates as well as Escherichia coli, Shigella flexineri, Salmonella typhimuruim, and Pseudomonas aeruginosa. The survival of infected G. mellonella was significantly higher when treated with polymyxin B and netropsin in combination than when treated with polymyxin B or netropsin alone. We propose a netropsin combination therapy that minimises the use of polymyxin B when treating infections with multidrug resistant Gram-negative bacteria. PMID:27306928

  3. Sheltering Effect and Indirect Pathogenesis of Carbapenem-Resistant Acinetobacter baumannii in Polymicrobial Infection

    PubMed Central

    Liao, Yu-Ting; Kuo, Shu-Chen; Lee, Yi-Tzu; Chen, Chien-Pei; Lin, Shu-Wen; Shen, Li-Jiuan; Fung, Chang-Phone

    2014-01-01

    The role of carbapenem-resistant Acinetobacter baumannii (CRAb) in polymicrobial infection remains elusive. Having observed the ability of CRAb to shelter other susceptible bacteria from carbapenem killing, we sought to determine the factors contributing to this sheltering effect by transforming different recombinant plasmids into recipient A. baumannii cells. The sheltering effects of CRAb were reproduced in recipient A. baumannii cells that highly expressed carbapenem-hydrolyzing class D β-lactamases (CHDLs) through their associated strong promoter. With the use of Western blot analysis and a bioassay, the highly expressed CHDLs were found to be extracellularly released and led to hydrolysis of carbapenem. The level of extracellular CHDLs increased after challenge with a higher concentration of CHDL substrates, such as carbapenem and ticarcillin. This increased CHDL may, in part, be attributed to cell lysis, as indicated by the presence of extracellular gyrase. In the planktonic condition, the sheltering effect for the cocultured susceptible bacteria might represent an indirect and passive effect of the CRAb self-defense mechanism, because coculture with the susceptible pathogen did not augment the amount of the extracellular CHDLs. Polymicrobial infection caused by CRAb and a susceptible counterpart exerted higher pathogenicity than monomicrobial infection caused by either pathogen alone in mice receiving carbapenem therapy. This study demonstrated that CHDL-producing CRAb appears to provide a sheltering effect for carbapenem-susceptible pathogens via the extracellular release of CHDLs and, by this mechanism, can enhance the pathogenesis of polymicrobial infection in the presence of carbapenem therapy. PMID:24798276

  4. A mouse model of Acinetobacter baumannii-associated pneumonia using a clinically isolated hypervirulent strain.

    PubMed

    Harris, Greg; Kuo Lee, Rhonda; Lam, Christopher K; Kanzaki, Gregory; Patel, Girishchandra B; Xu, H Howard; Chen, Wangxue

    2013-08-01

    Acinetobacter baumannii is an important emerging pathogen in health care-acquired infections and is responsible for severe nosocomial and community-acquired pneumonia. Currently available mouse models of A. baumannii pneumonia show poor colonization with little to no extrapulmonary dissemination. Here, we describe a mouse model of A. baumannii pneumonia using a clinical isolate (LAC-4 strain) that reliably reproduces the most relevant features of human pulmonary A. baumannii infection and pathology. Using this model, we have shown that LAC-4 infection induced rapid bacterial replication in the lungs, significant extrapulmonary dissemination, and severe bacteremia by 24 h postintranasal inoculation. Infected mice showed severe bronchopneumonia and dilatation and inflammatory cell infiltration in the perivascular space. More significantly, 100% of C57BL/6 and BALB/c mice succumbed to 10(8) CFU of LAC-4 inoculation within 48 h. When this model was used to assess the efficacy of antimicrobials, all mice treated with imipenem and tigecycline survived a lethal intranasal challenge, with minimal clinical signs and body weight loss. Moreover, intranasal immunization of mice with formalin-fixed LAC-4 protected 40% of mice from a lethal (100× 100% lethal dose) intraperitoneal challenge. Thus, this model offers a reproducible acute course of A. baumannii pneumonia without requiring additional manipulation of host immune status, which will facilitate the development of therapeutic agents and vaccines against A. baumannii pneumonia in humans. PMID:23689726

  5. DNA microarray for genotyping antibiotic resistance determinants in Acinetobacter baumannii clinical isolates.

    PubMed

    Dally, Simon; Lemuth, Karin; Kaase, Martin; Rupp, Steffen; Knabbe, Cornelius; Weile, Jan

    2013-10-01

    In recent decades, Acinetobacter baumannii has emerged as an organism of great concern due to its ability to accumulate antibiotic resistance. In order to improve the diagnosis of resistance determinants in A. baumannii in terms of lead time and accuracy, we developed a microarray that can be used to detect 91 target sequences associated with antibiotic resistance within 4 h from bacterial culture to result. The array was validated with 60 multidrug-resistant strains of A. baumannii in a blinded, prospective study. The results were compared to phenotype results determined by the automated susceptibility testing system VITEK2. Antibiotics considered were piperacillin-tazobactam, ceftazidime, imipenem, meropenem, trimethoprim-sulfamethoxazole, amikacin, gentamicin, tobramycin, ciprofloxacin, and tigecycline. The average positive predictive value, negative predictive value, sensitivity, and specificity were 98, 98, 99, and 94%, respectively. For carbapenemase genes, the array results were compared to singleplex PCR results provided by the German National Reference Center for Gram-Negative Pathogens, and results were in complete concordance. The presented array is able to detect all relevant resistance determinants of A. baumannii in parallel. The short handling time of 4 h from culture to result helps to provide fast results in order to initiate adequate anti-infective therapy for critically ill patients. Another application would be data acquisition for epidemiologic surveillance. PMID:23856783

  6. [In vitro activity of tigecycline against multiple resistant Acinetobacter baumannii and carbapenem resistant Klebsiella pneumoniae isolates].

    PubMed

    Arikan Akan, Ozay; Uysal, Sevil

    2008-04-01

    In order to detect the in vitro activity of tigecycline against multiple resistant gram-negative bacilli isolated in our hospital, tigecycline susceptibilities of clinical isolates of multiple and/or panresistant 100 Acinetobacter baumannii isolates, and 38 carbapenem resistant Klebsiella pneumoniae (17 of which were panresistant), obtained between January 2005 and August 2007, were evaluated by using E-test (AB Biodisc, Sweden). Carbapenem resistance rate was found to be 59% for A.baumannii, using Vitek2 Compact System (Bio-Merieux, France) which is present in our laboratory for routine use. Minimal inhibitory concentration (MIC) levels for tigecycline were < or =2 mcg/ml in 93% of the isolates while the MIC level was 3 mcg/ml for 7% of the isolates. Tigecycline MIC50 and MIC 90 values were 1.5 and 2 mcg/ml, respectively. Among K. pneumoniae the least resistance was detected against amikacin (52.6% resistant) while tigecycline MIC levels were between 0.13 mcg/ml and 2 mcg/ml. All of the K.pneumoniae strains were susceptible to tigecycline, and the MIC50 ve MIC90 values of these isolates were 1 mcg/ml and 1.5 mcg/ml, respectively. The in vitro susceptibility rates of tigecycline against multiple and/or panresistant A. baumannii and K. pneumoniae isolates are found to be promising for use in therapy. PMID:18697418

  7. Synergistic Effect of Oleanolic Acid on Aminoglycoside Antibiotics against Acinetobacter baumannii

    PubMed Central

    Shin, Bora; Park, Woojun

    2015-01-01

    Difficulties involved in treating drug-resistant pathogens have created a need for new therapies. In this study, we investigated the possibility of using oleanolic acid (OA), a natural pentacyclic triterpenoid, as a natural adjuvant for antibiotics against Acinetobacter baumannii. High concentrations of OA can kill cells, partly because it generates reactive oxygen species. Measurement of the fractional inhibitory concentration (FIC) for OA and time-kill experiments demonstrated that it only synergizes with aminoglycoside antibiotics (e.g., gentamicin, kanamycin). Other classes of antibiotics (e.g., ampicillin, rifampicin, norfloxacin, chloramphenicol, and tetracycline) have no interactions with OA. Microarray and quantitative reverse transcription-PCR analysis indicated that genes involved in ATP synthesis and cell membrane permeability, the gene encoding glycosyltransferase, peptidoglycan-related genes, phage-related genes, and DNA repair genes were upregulated under OA. OA highly induces the expression of adk, which encodes an adenylate kinase, and des6, which encodes a linoleoyl-CoA desaturase, and deletion of these genes increased FICs; these observations indicate that adk and des6 are involved in the synergism of OA with aminoglycosides. Data obtained using 8-anilino-1-naphthalenesulfonic acid, fluorescence-conjugated gentamicin, and membrane fatty acid analysis indicates that adk and des6 are involved in changes in membrane permeability. Proton-motive force and ATP synthesis tests show that those genes are also involved in energy metabolism. Taken together, our data show that OA boosts aminoglycoside uptake by changing membrane permeability and energy metabolism in A. baumannii. PMID:26360766

  8. Novel Engineered Peptides of a Phage Lysin as Effective Antimicrobials against Multidrug-Resistant Acinetobacter baumannii.

    PubMed

    Thandar, Mya; Lood, Rolf; Winer, Benjamin Y; Deutsch, Douglas R; Euler, Chad W; Fischetti, Vincent A

    2016-05-01

    Acinetobacter baumannii is a Gram-negative bacterial pathogen responsible for a range of nosocomial infections. The recent rise and spread of multidrug-resistant A. baumannii clones has fueled a search for alternative therapies, including bacteriophage endolysins with potent antibacterial activities. A common feature of these lysins is the presence of a highly positively charged C-terminal domain with a likely role in promoting outer membrane penetration. In the present study, we show that the C-terminal amino acids 108 to 138 of phage lysin PlyF307, named P307, alone were sufficient to kill A. baumannii (>3 logs). Furthermore, P307 could be engineered for improved activity, the most active derivative being P307SQ-8C (>5-log kill). Both P307 and P307SQ-8C showed high in vitro activity against A. baumannii in biofilms. Moreover, P307SQ-8C exhibited MICs comparable to those of levofloxacin and ceftazidime and acted synergistically with polymyxin B. Although the peptides were shown to kill by disrupting the bacterial cytoplasmic membrane, they did not lyse human red blood cells or B cells; however, serum was found to be inhibitory to lytic activity. In a murine model of A. baumannii skin infection, P307SQ-8C reduced the bacterial burden by ∼2 logs in 2 h. This study demonstrates the prospect of using peptide derivatives from bacteriophage lysins to treat topical infections and remove biofilms caused by Gram-negative pathogens. PMID:26856847

  9. [A urinary outbreak of Acinetobacter baumanii in a spinal cord injury unit].

    PubMed

    Pedraza, F; Andreu, A; Saune, M; Moreno, A; Ramírez, L; García, L

    1993-02-01

    From January 1990 to April 1992, 114 urinary strains of Acinetobacter baumanii were isolated in 57 patients with traumatic spinal cord [correction of medular] injury. The strains were characterized by having all of them the same biochemical identification, except for citrate, maltose and tryptophan-desaminase. Until December 1990, (5 strains) were resistant to all antibiotics, except to tobramicine, amikacine, cotrimoxazol and imipenem (6.3%, 33.9%, 26.7% and 0% of resistances, respectively); since January 1991, (99 strains) became resistant to all of them, except to imipenem. 39.5% of AB were isolated in pure cultures, 46% of them with pyuria. Between February 1991 and January 1992, we observed the highest number of affected patients, although without seasonal predominance. We observed as well a higher incidence among males (46 males, 11 females). 80% of them carried a permanent probe. Only 6 patients presented clinical signs directly related to AB. The environmental study could not demonstrate any source of contagion or transmission mechanism. PMID:8452972

  10. Extracellular Polymeric Substance Architecture Influences Natural Genetic Transformation of Acinetobacter baylyi in Biofilms

    PubMed Central

    Merod, Robin T.

    2014-01-01

    Genetic exchange by natural transformation is an important mechanism of horizontal gene transfer in biofilms. Thirty-two biofilm metrics were quantified in a heavily encapsulated Acinetobacter baylyi strain and a miniencapsulated mutant strain, accounting for cellular architecture, extracellular polymeric substances (EPS) architecture, and their combined biofilm architecture. In general, transformation location, abundance, and frequency were more closely correlated to EPS architecture than to cellular or combined architecture. Transformation frequency and transformant location had the greatest correlation with the EPS metric surface area-to-biovolume ratio. Transformation frequency peaked when EPS surface area-to-biovolume ratio was greater than 3 μm2/μm3 and less than 5 μm2/μm3. Transformant location shifted toward the biofilm-bulk fluid interface as the EPS surface area-to-biovolume ratio increased. Transformant biovolume was most closely correlated with EPS biovolume and peaked when transformation occurred in close proximity to the substratum. This study demonstrates that biofilm architecture influences A. baylyi transformation frequency and transformant location and abundance. The major role of EPS may be to facilitate the binding and stabilization of plasmid DNA for cellular uptake. PMID:25304505

  11. Molecular Epidemiology and Characterization of Genotypes of Acinetobacter baumannii Isolates from Regions of South China.

    PubMed

    Ying, Jun; Lu, Junwan; Zong, Li; Li, Ailing; Pan, Ruowang; Cheng, Cong; Li, Kunpeng; Chen, Liqiang; Ying, Jianchao; Tou, Huifen; Zhu, Chuanxin; Xu, Teng; Yi, Huiguang; Li, Jinsong; Ni, Liyan; Xu, Zuyuan; Bao, Qiyu; Li, Peizhen

    2016-05-20

    The aim of this study was to analyze the molecular epidemiologic characteristics of Acinetobacter baumannii. A total of 398 isolates were collected in 7 regions of South China from January to June of 2012. Drug sensitivity was tested toward 15 commonly used antibiotics; thus, 146 multi-drug-resistant strains (resistant to more than 7 drugs) were identified, representing 36.7% of all isolates. Pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing (MLST) were used for molecular subtyping. According to the PFGE results (with a cutoff of 70% similarity for the DNA electrophoretic bands), 146 strains were subdivided into 15 clusters, with cluster A being the largest (33.6%, distributed in all districts except Jiaxing). Cluster B was also widespread and included 14.4% of all strains. In addition, MLST results revealed 11 sequence types (ST), with ST208 being the most prevalent, followed by ST191 and ST729. Furthermore, 4 novel alleles and 6 novel STs were identified. Our results showed that multi-drug-resistant A. baumannii in South China shares the origin with other widespread strains in other countries. The nosocomial infections caused by A. baumannii have been severe in South China. Continuous monitoring and judicious antibiotic use are required. PMID:26166496

  12. Aptamer-nanobody based ELASA for specific detection of Acinetobacter baumannii isolates.

    PubMed

    Rasoulinejad, Samaneh; Gargari, Seyed Latif Mousavi

    2016-08-10

    Acinetobacter baumannii has turned into an important threat in nosocomial outbreak infections and multidrug resistance leading to high mortality rates in the 21st century. In recent years its mortality has increased by 15% which in part could be due to lack of a rapid and sensitive diagnostic test. In this work we introduced a new detection test for A. baumannii with two highly specific aptamer and nanobody molecules. High binding affinity DNA oligonucleotide aptamers toward A. baumannii were selected through 12 rounds of whole cell System Evolution of Ligands by EXponential enrichment process (SELEX). The SELEX procedures was monitored by flow cytometry. The dissociation constant and binding efficiency of the selected aptamer Aci49 was 7.547±1:353pM and 47.50%, respectively. A sandwich enzyme linked aptamer sorbent assay (ELASA) was designed with the biotinylated Aci49 aptamer and our previously developed nanobody against biofilm associated protein (Bap). The assay system was optimized with A. baumannii (ATCC 19606) and 47 clinical isolates of A. baumannii were tested. The threshold of detection in sandwich ELASA process was10(3) CFU/ml. The sensitivity of test toward the clinical isolates was 95.47%. Our results reveal that the sandwich ELASA is sensitive and specific enough for the rapid detection of A. baumannii from clinical isolates. PMID:27234880

  13. A metallo-keratinase from a newly isolated Acinetobacter sp. R-1 with low collagenase activity and its biotechnological application potential in leather industry.

    PubMed

    Zhang, Rong-Xian; Gong, Jin-Song; Zhang, Dan-Dan; Su, Chang; Hou, Ying-Shuo; Li, Heng; Shi, Jin-Song; Xu, Zheng-Hong

    2016-01-01

    Microbial keratinase is a well-recognized enzyme that can specifically degrade insoluble keratins. A keratinase-producing bacterium was isolated from a duck ranch soil and identified as Acinetobacter sp. R-1 based on the biochemical characteristics and 16S rDNA gene sequencing. It showed high keratinase activity and low collagenase activity. The keratinase was purified to electrophoretic homogeneity with 6.69% recovery, 2.68-fold purification and an estimated molecular weight of 25 kDa. Additionally, the keratinase showed optimal activity at 50 °C and pH11. Keratinase activity of Acinetobacter sp. significantly increased in the presence of Li(+), Na(+), and Ca(2+), while it was completely inhibited by EDTA, indicating it was a metallo-keratinase. Moreover, the crude keratinase from Acinetobacter sp. R-1 could thoroughly depilate goat skin and simultaneously modify the wool surface, which indicated its applicable potential in leather and textile industries. PMID:26589609

  14. Spread of carbapenem-resistant international clones of Acinetobacter baumannii in Turkey and Azerbaijan: a collaborative study.

    PubMed

    Ahmed, S S; Alp, E; Ulu-Kilic, A; Dinc, G; Aktas, Z; Ada, B; Bagirova, F; Baran, I; Ersoy, Y; Esen, S; Guven, T G; Hopman, J; Hosoglu, S; Koksal, F; Parlak, E; Yalcin, A N; Yilmaz, G; Voss, A; Melchers, W

    2016-09-01

    Epidemic clones of Acinetobacter baumannii, described as European clones I, II, and III, are associated with hospital epidemics throughout the world. We aimed to determine the molecular characteristics and genetic diversity between European clones I, II, and III from Turkey and Azerbaijan. In this study, a total of 112 bloodstream isolates of carbapenem-resistant Acinetobacter spp. were collected from 11 hospitals across Turkey and Azerbaijan. The identification of Acinetobacter spp. using conventional and sensitivity tests was performed by standard criteria. Multiplex polymerase chain reaction (PCR) was used to detect OXA carbapenemase-encoding genes (bla OXA-23-like, bla OXA-24-like, bla OXA-51-like, and bla OXA-58-like). Pulsed-field gel electrophoresis (PFGE) typing was used to investigate genetic diversity. The bla OXA-51-like gene was present in all 112 isolates, 75 (67 %) carried bla OXA-23-like, 7 (6.2 %) carried bla OXA-58-like genes, and 5 (4.5 %) carried bla OXA-24-like genes. With a 90 % similarity cut-off value, 15 clones and eight unique isolates were identified. The largest clone was cluster D, with six subtypes. Isolates from clusters D and I were widely spread in seven different geographical regions throughout Turkey. However, F cluster was found in the northern and eastern regions of Turkey. EU clone I was grouped within J cluster with three isolates found in Antalya, Istanbul, and Erzurum. EU clone II was grouped in the U cluster with 15 isolates and found in Kayseri and Diyarbakır. The bla OXA-24-like gene in carbapenemases was identified rarely in Turkey and has been reported for the first time from Azerbaijan. Furthermore, this is the first multicenter study in Turkey and Azerbaijan to identify several major clusters belonging to European clones I and II of A. baumannii. PMID:27259712

  15. Genomic and proteomic evidences unravel the UV-resistome of the poly-extremophile Acinetobacter sp. Ver3

    PubMed Central

    Kurth, Daniel; Belfiore, Carolina; Gorriti, Marta F.; Cortez, Néstor; Farias, María E.; Albarracín, Virginia H.

    2015-01-01

    Ultraviolet radiation can damage biomolecules, with detrimental or even lethal effects for life. Even though lower wavelengths are filtered by the ozone layer, a significant amount of harmful UV-B and UV-A radiation reach Earth’s surface, particularly in high altitude environments. high-altitude Andean lakes (HAALs) are a group of disperse shallow lakes and salterns, located at the Dry Central Andes region in South America at altitudes above 3,000 m. As it is considered one of the highest UV-exposed environments, HAAL microbes constitute model systems to study UV-resistance mechanisms in environmental bacteria at various complexity levels. Herein, we present the genome sequence of Acinetobacter sp. Ver3, a gammaproteobacterium isolated from Lake Verde (4,400 m), together with further experimental evidence supporting the phenomenological observations regarding this bacterium ability to cope with increased UV-induced DNA damage. Comparison with the genomes of other Acinetobacter strains highlighted a number of unique genes, such as a novel cryptochrome. Proteomic profiling of UV-exposed cells identified up-regulated proteins such as a specific cytoplasmic catalase, a putative regulator, and proteins associated to amino acid and protein synthesis. Down-regulated proteins were related to several energy-generating pathways such as glycolysis, beta-oxidation of fatty acids, and electronic respiratory chain. To the best of our knowledge, this is the first report on a genome from a polyextremophilic Acinetobacter strain. From the genomic and proteomic data, an “UV-resistome” was defined, encompassing the genes that would support the outstanding UV-resistance of this strain. PMID:25954258

  16. Genomic and proteomic evidences unravel the UV-resistome of the poly-extremophile Acinetobacter sp. Ver3.

    PubMed

    Kurth, Daniel; Belfiore, Carolina; Gorriti, Marta F; Cortez, Néstor; Farias, María E; Albarracín, Virginia H

    2015-01-01

    Ultraviolet radiation can damage biomolecules, with detrimental or even lethal effects for life. Even though lower wavelengths are filtered by the ozone layer, a significant amount of harmful UV-B and UV-A radiation reach Earth's surface, particularly in high altitude environments. high-altitude Andean lakes (HAALs) are a group of disperse shallow lakes and salterns, located at the Dry Central Andes region in South America at altitudes above 3,000 m. As it is considered one of the highest UV-exposed environments, HAAL microbes constitute model systems to study UV-resistance mechanisms in environmental bacteria at various complexity levels. Herein, we present the genome sequence of Acinetobacter sp. Ver3, a gammaproteobacterium isolated from Lake Verde (4,400 m), together with further experimental evidence supporting the phenomenological observations regarding this bacterium ability to cope with increased UV-induced DNA damage. Comparison with the genomes of other Acinetobacter strains highlighted a number of unique genes, such as a novel cryptochrome. Proteomic profiling of UV-exposed cells identified up-regulated proteins such as a specific cytoplasmic catalase, a putative regulator, and proteins associated to amino acid and protein synthesis. Down-regulated proteins were related to several energy-generating pathways such as glycolysis, beta-oxidation of fatty acids, and electronic respiratory chain. To the best of our knowledge, this is the first report on a genome from a polyextremophilic Acinetobacter strain. From the genomic and proteomic data, an "UV-resistome" was defined, encompassing the genes that would support the outstanding UV-resistance of this strain. PMID:25954258

  17. Risk factors and outcome for colistin-resistant Acinetobacter nosocomialis bacteraemia in patients without previous colistin exposure.

    PubMed

    Wang, Y-C; Lee, Y-T; Yang, Y-S; Chen, C-T; Chiu, C-H; Yin, T; Kuo, S-C; Chen, T-L; Lin, J-C; Wang, F-D; Fung, C-P; Chang, F-Y

    2015-08-01

    The clinical characteristics of patients with colistin-resistant Acinetobacter baumannii bacteraemia have been documented, but those of patients with bacteraemia caused by other Acinetobacter species remain unknown. Previous exposure to colistin has been shown to be associated with the emergence of colistin resistance, but may be not the only predisposing factor. In the current study, we highlight the risk and outcome of patients without previous exposure to colistin who acquired colistin-resistant Acinetobacter nosocomialis (ColRAN) bacteraemia. This 11-year single-centre retrospective study analysed 58 patients with ColRAN bacteraemia and 213 patients with colistin-susceptible A. nosocomialis (ColSAN) bacteraemia. Antimicrobial susceptibilities were determined with an agar dilution method. The clonal relationship of ColRAN isolates was determined with pulsed-field gel electrophoresis. A conjugation mating-out assay was conducted to delineate the potential transfer of colistin resistance genes. Multivariable analysis was performed to evaluate the risk factors for ColRAN bacteraemia. Chronic obstructive pulmonary disease (COPD) was independently associated with ColRAN bacteraemia (OR 3.04; 95% CI 1.45-6.37; p 0.003). Patients with ColRAN bacteraemia had higher APACHE II scores, but the two groups showed no significant differences in 14-day mortality (10.3% vs. 10.3%) or 28-day mortality (15.5% vs. 15.0%). ColRAN isolates had greater resistance than ColSAN isolates to all antimicrobial agents except for ciprofloxacin (0% vs. 6.6%). There were 16 different ColRAN pulsotypes, and two major clones were found. Colistin resistance did not transfer to colistin-susceptible A. baumannii or A. nosocomialis. These results show that COPD is an independent risk factor for acquisition of ColRAN bacteraemia. The mortality rates were similar between patients with ColRAN and ColSAN bacteraemia. PMID:25980356

  18. NDM-1-Producing Citrobacter freundii, Escherichia coli, and Acinetobacter baumannii Identified from a Single Patient in China

    PubMed Central

    Huang, Ying-Min; Zhong, Lan-lan; Zhang, Xue-Fei; Hu, Hang-tong; Li, Yu-qi; Yang, Xiao-rong; Feng, Lian-Qiang; Huang, Xi

    2015-01-01

    We identified New Delhi metallo-β-lactamase (NDM-1)-producing Citrobacter freundii GB032, Escherichia coli GB102, and Acinetobacter baumannii GB661 in urine and stool samples from a single patient in China. Plasmid profiling and Southern blotting indicated that blaNDM-1 from GB032 and that from GB102 were likely located on the same plasmid, while blaNDM-1 from GB661 was located on a very large (>400-kb) plasmid. This case underscores the broad host range of blaNDM-1 and its potential to spread between members of the family Enterobacteriaceae and A. baumannii. PMID:26055374

  19. First occurrence of blaOXA-58 in Acinetobacter baumannii isolated from a clinical sample in Southern Brazil

    PubMed Central

    de Souza Gusatti, Carolina; Bertholdo, Lauren Martins; Otton, Letícia Muner; Marchetti, Desirée Padilha; Ferreira, Alessandra Einsfeld; Corção, Gertrudes

    2012-01-01

    This is the first report of an Acinetobacter baumannii from clinical origin carrying the blaOXA-58 gene in Brazil. The isolate included in this study was from a patient during an outbreak in Porto Alegre, RS, Southern Brazil, in 2007. It was resistant to most of the beta-lactams tested, it has also the blaOXA-65 gene and the ISAbal sequence located upstream to both blaOXA genes detected and it has a MIC of imipenem of 64 μg/mL. PMID:24031824

  20. Potent in vitro antibacterial activity of DS-8587, a novel broad-spectrum quinolone, against Acinetobacter baumannii.

    PubMed

    Higuchi, Saito; Onodera, Yoshikuni; Chiba, Megumi; Hoshino, Kazuki; Gotoh, Naomasa

    2013-04-01

    We investigated the in vitro activity of DS-8587, a novel fluoroquinolone, against Acinetobacter baumannii. The MICs of DS-8587 against clinical isolates and its inhibitory activity against target enzymes were superior to those of ciprofloxacin and levofloxacin. Furthermore, the antibacterial activity of DS-8587 was less affected by adeA/adeB/adeC or abeM efflux pumps than was that of ciprofloxacin and the frequency of single-step mutations with DS-8587 was lower than that with ciprofloxacin. DS-8587 might be an effective agent against A. baumannii infection. PMID:23380726