Science.gov

Sample records for actin gene family

  1. Phylogenetic Patterns of Codon Evolution in the ACTIN-DEPOLYMERIZING FACTOR/COFILIN (ADF/CFL) Gene Family.

    PubMed

    Roy-Zokan, Eileen M; Dyer, Kelly A; Meagher, Richard B

    2015-01-01

    The actin-depolymerizing factor/cofilin (ADF/CFL) gene family encodes a diverse group of relatively small proteins. Once known strictly as modulators of actin filament dynamics, recent research has demonstrated that these proteins are involved in a variety of cellular processes, from signal transduction to the cytonuclear trafficking of actin. In both plant and animal lineages, expression patterns of paralogs in the ADF/CFL gene family vary among tissue types and developmental stages. In this study we use computational approaches to investigate the evolutionary forces responsible for the diversification of the ADF/CFL gene family. Estimating the rate of non-synonymous to synonymous mutations (dN/dS) across phylogenetic lineages revealed that the majority of ADF/CFL codon positions were under strong purifying selection, with rare episodic events of accelerated protein evolution. In both plants and animals these instances of accelerated evolution were ADF/CFL subclass specific, and all of the sites under selection were located in regions of the protein that could serve in new functional roles. We suggest these sites may have been important in the functional diversification of ADF/CFL proteins.

  2. Evolution of the Actin Gene Family in Testate Lobose Amoebae (Arcellinida) is Characterized by Two Distinct Clades of Paralogs and Recent Independent Expansions

    PubMed Central

    Lahr, Daniel J. G.; Nguyen, Truc B.; Barbero, Erika; Katz, Laura A.

    2011-01-01

    The evolution of actin gene families is characterized by independent expansions and contractions across the eukaryotic tree of life. Here, we assess diversity of actin gene sequences within three lineages of the genus Arcella, a free-living testate (shelled) amoeba in the Arcellinida. We established four clonal lines of two morphospecies, Arcella hemisphaerica and A. vulgaris, and assessed their phylogenetic relationship within the “Amoebozoa” using small subunit ribosomal DNA (SSU-rDNA) genealogy. We determined that the two lines of A. hemisphaerica are identical in SSU-rDNA, while the two A. vulgaris are independent genetic lineages. Furthermore, we characterized multiple actin gene copies from all lineages. Analyses of the resulting sequences reveal numerous diverse actin genes, which differ mostly by synonymous substitutions. We estimate that the actin gene family contains 40–50 paralogous members in each lineage. None of the three independent lineages share the same paralog with another, and divergence between actins reaches 29% in contrast to just 2% in SSU-rDNA. Analyses of effective number of codons (ENC), compositional bias, recombination signatures, and genetic diversity in the context of a gene tree indicate that there are two groups of actins evolving with distinct patterns of molecular evolution. Within these groups, there have been multiple independent expansions of actin genes within each lineage. Together, these data suggest that the two groups are located in different regions of the Arcella genome. Furthermore, we compare the Arcella actin gene family with the relatively well-described gene family in the slime mold Dictyostelium discoideum and other members of the Amoebozoa clade. Overall patterns of molecular evolution are similar in Arcella and Dictyostelium. However, the separation of genes in two distinct groups coupled with recent expansion is characteristic of Arcella and might reflect an unusual pattern of gene family evolution in the

  3. The ADF/cofilin family: actin-remodeling proteins.

    PubMed

    Maciver, Sutherland K; Hussey, Patrick J

    2002-01-01

    The ADF/cofilins are a family of actin-binding proteins expressed in all eukaryotic cells so far examined. Members of this family remodel the actin cytoskeleton, for example during cytokinesis, when the actin-rich contractile ring shrinks as it contracts through the interaction of ADF/cofilins with both monomeric and filamentous actin. The depolymerizing activity is twofold: ADF/cofilins sever actin filaments and also increase the rate at which monomers leave the filament's pointed end. The three-dimensional structure of ADF/cofilins is similar to a fold in members of the gelsolin family of actin-binding proteins in which this fold is typically repeated three or six times; although both families bind polyphosphoinositide lipids and actin in a pH-dependent manner, they share no obvious sequence similarity. Plants and animals have multiple ADF/cofilin genes, belonging in vertebrates to two types, ADF and cofilins. Other eukaryotes (such as yeast, Acanthamoeba and slime moulds) have a single ADF/cofilin gene. Phylogenetic analysis of the ADF/cofilins reveals that, with few exceptions, their relationships reflect conventional views of the relationships between the major groups of organisms.

  4. Bioinformatics study of the mangrove actin genes

    NASA Astrophysics Data System (ADS)

    Basyuni, M.; Wasilah, M.; Sumardi

    2017-01-01

    This study describes the bioinformatics methods to analyze eight actin genes from mangrove plants on DDBJ/EMBL/GenBank as well as predicted the structure, composition, subcellular localization, similarity, and phylogenetic. The physical and chemical properties of eight mangroves showed variation among the genes. The percentage of the secondary structure of eight mangrove actin genes followed the order of a helix > random coil > extended chain structure for BgActl, KcActl, RsActl, and A. corniculatum Act. In contrast to this observation, the remaining actin genes were random coil > extended chain structure > a helix. This study, therefore, shown the prediction of secondary structure was performed for necessary structural information. The values of chloroplast or signal peptide or mitochondrial target were too small, indicated that no chloroplast or mitochondrial transit peptide or signal peptide of secretion pathway in mangrove actin genes. These results suggested the importance of understanding the diversity and functional of properties of the different amino acids in mangrove actin genes. To clarify the relationship among the mangrove actin gene, a phylogenetic tree was constructed. Three groups of mangrove actin genes were formed, the first group contains B. gymnorrhiza BgAct and R. stylosa RsActl. The second cluster which consists of 5 actin genes the largest group, and the last branch consist of one gene, B. sexagula Act. The present study, therefore, supported the previous results that plant actin genes form distinct clusters in the tree.

  5. Identification of a Novel Member of the Chloride Intracellular Channel Gene Family (CLIC5) That Associates with the Actin Cytoskeleton of Placental Microvilli

    PubMed Central

    Berryman, Mark; Bretscher, Anthony

    2000-01-01

    The chloride intracellular channel (CLIC) gene family has been implicated in chloride ion transport within various subcellular compartments. We report here the molecular, biochemical, and cellular characterization of a new member of this gene family termed CLIC5. CLIC5 was isolated from extracts of placental microvilli as a component of a multimeric complex consisting of several known cytoskeletal proteins, including actin, ezrin, α-actinin, gelsolin, and IQGAP1. We cloned human cDNAs and generated antibodies specific for CLIC5, CLIC1/NCC27, and CLIC4/huH1/p64H1. CLIC5 shares 52–76% overall identity with human CLIC1, CLIC2, CLIC3, and CLIC4. Northern blot analysis showed that CLIC5 has a distinct pattern of expression compared with CLIC1 and CLIC4. Immunoblot analysis of extracts from placental tissues demonstrated that CLIC4 and CLIC5 are enriched in isolated placental microvilli, whereas CLIC1 is not. Moreover, in contrast to CLIC1 and CLIC4, CLIC5 is associated with the detergent-insoluble cytoskeletal fraction of microvilli. Indirect immunofluorescence microscopy revealed that CLIC4 and CLIC5 are concentrated within the apical region of the trophoblast, whereas CLIC1 is distributed throughout the cytoplasm. These studies suggest that CLIC1, CLIC4, and CLIC5 play distinct roles in chloride transport and that CLIC5 interacts with the cortical actin cytoskeleton in polarized epithelial cells. PMID:10793131

  6. Cardiac actin is the major actin gene product in skeletal muscle cell differentiation in vitro.

    PubMed Central

    Bains, W; Ponte, P; Blau, H; Kedes, L

    1984-01-01

    We examined the expression of alpha-skeletal, alpha-cardiac, and beta- and gamma-cytoskeletal actin genes in a mouse skeletal muscle cell line (C2C12) during differentiation in vitro. Using isotype-specific cDNA probes, we showed that the alpha-skeletal actin mRNA pool reached only 15% of the level reached in adult skeletal muscle and required several days to attain this peak, which was then stably maintained. However, these cells accumulated a pool of alpha-cardiac actin six times higher than the alpha-skeletal actin mRNA peak within 24 h of the initiation of differentiation. After cells had been cultured for an additional 3 days, this pool declined to 10% of its peak level. In contrast, over 95% of the actin mRNA in adult skeletal muscle coded for alpha-actin. This suggests that C2C12 cells express a pattern of sarcomeric actin genes typical of either muscle development or regeneration and distinct from that seen in mature, adult tissue. Concurrently in the course of differentiation the beta- and gamma-cytoskeletal actin mRNA pools decreased to less than 10% of their levels in proliferating cells. The decreases in beta- and gamma-cytoskeletal actin mRNAs are apparently not coordinately regulated. Images PMID:6493226

  7. Multiple actin-based motor genes in Dictyostelium.

    PubMed Central

    Titus, M A; Warrick, H M; Spudich, J A

    1989-01-01

    Dictyostelium cells, devoid of conventional myosin, display a variety of motile activities, consistent with the presence of other molecular motors. The Dictyostelium genome was probed at low stringency with a gene fragment containing the conserved conventional myosin head domain sequences to identify other actin-based motors that may play a role in the observed motility of these mutant cells. One gene (abmA) has been characterized and encodes a polypeptide of approximately 135 kDa with a head region homologous to other myosin head sequences and a tail region that is not predicted to form either an alpha-helical structure of coiled-coil interactions. Comparisons of the amino acid sequences of the tail regions of abmA, Dictyostelium myosin I, and Acanthamoeba myosins IB and IL reveal an area of sequence similarity in the amino terminal half of the tail that may be a membrane-binding domain. The abmA gene, however, does not contain an unusual Gly, Pro, Ala stretch typical of many of the previously described myosin Is. Two additional genes (abmB and abmC) were identified using this approach and also found to contain sequences that encode proteins with typical conserved myosin head sequences. The abm genes may be part of a large family of actin-based motors that play various roles in diverse aspects of cellular motility. Images PMID:2519618

  8. Involvement of PCH family proteins in cytokinesis and actin distribution.

    PubMed

    Lippincott, J; Li, R

    2000-04-15

    Pombe Cdc15 homology (PCH) proteins constitute an extensive protein family whose members have been found in diverse eukaryotic organisms. These proteins are characterized by the presence of several conserved sequence and structural motifs. Recent studies in yeast and mammalian cultured cells have implicated these proteins in actin-based processes, in particular, cytokinesis. Here we review the recent findings on the in vivo localization, function, and binding partners of PCH family members. We also provide new microscopy data regarding the in vivo dynamics of a budding yeast PCH protein involved in cytokinesis.

  9. A family of ROP proteins that suppresses actin dynamics, and is essential for polarized growth and cell adhesion.

    PubMed

    Burkart, Graham M; Baskin, Tobias I; Bezanilla, Magdalena

    2015-07-15

    In plants, the ROP family of small GTPases has been implicated in the polarized growth of tip-growing cells, such as root hairs and pollen tubes; however, most of the data derive from overexpressing ROP genes or constitutively active and dominant-negative isoforms, whereas confirmation by using loss-of-function studies has generally been lacking. Here, in the model moss Physcomitrella patens, we study ROP signaling during tip growth by using a loss-of-function approach based on RNA interference (RNAi) to silence the entire moss ROP family. We find that plants with reduced expression of ROP genes, in addition to failing to initiate tip growth, have perturbed cell wall staining, reduced cell adhesion and have increased actin-filament dynamics. Although plants subjected to RNAi against the ROP family also have reduced microtubule dynamics, this reduction is not specific to loss of ROP genes, as it occurs when actin function is compromised chemically or genetically. Our data suggest that ROP proteins polarize the actin cytoskeleton by suppressing actin-filament dynamics, leading to an increase in actin filaments at the site of polarized secretion.

  10. Nuclear actin activates human transcription factor genes including the OCT4 gene.

    PubMed

    Yamazaki, Shota; Yamamoto, Koji; Tokunaga, Makio; Sakata-Sogawa, Kumiko; Harata, Masahiko

    2015-01-01

    RNA microarray analyses revealed that nuclear actin activated many human transcription factor genes including OCT4, which is required for gene reprogramming. Oct4 is known to be activated by nuclear actin in Xenopus oocytes. Our findings imply that this process of OCT4 activation is conserved in vertebrates and among cell types and could be used for gene reprogramming of human cells.

  11. The actin multigene family and livestock speciation using the polymerase chain reaction.

    PubMed

    Fairbrother, K S; Hopwood, A J; Lockley, A K; Bardsley, R G

    1998-01-01

    Actins constitute a family of highly-conserved multifunctional intracellular proteins, best known as myofibrillar components in striated muscle fibres. Most vertebrate genomes contain numerous actin genes with high sequence homology in protein coding regions but considerable variability in intron number and sizes. This genetic diversity can be utilised for livestock speciation purposes. The high sequence conservation has enabled a single pair of oligonucleotides to be used to prime the polymerase chain reaction (PCR) with DNA extracted from all animals so far studied. Multiple amplification products were obtained which on gel electrophoresis constituted characteristic species-specific 'fingerprints'. The patterns were reproducible, did not vary between individuals of the same breed or between different breeds within a species, and could be generated even from heat-processed muscle held at 120 degrees C for one hour. Given the capacity of PCR to amplify relatively short sequences in highly-degraded DNA, this approach may be suitable for authentication of processed meat products.

  12. Cloning and sequence analysis of an actin gene in aloe.

    PubMed

    Wen, S S; He, D W; Liao, C M; Li, J; Wen, G Q; Liu, X H

    2014-07-04

    Aloe (Aloe spp), containing abundant polysaccharides and numerous bioactive ingredients, has remarkable medical, ornamental, calleidic, and edible values. In the present study, the total RNA was extracted from aloe leaf tissue. The isolated high-quality RNA was further used to clone actin gene by using reverse transcription-polymerase chain reaction (RT-PCR). The result of sequence analysis for the amplified fragment revealed that the cloned actin gene was 1012 bp in length (GenBank accession No. KC751541.1) and contained a 924-bp coding region and encoded a protein consisting of 307 amino acids. Homologous alignment showed that it shared over 80 and 96% identity with the nucleotide and amino acid sequences of actin from other plants, respectively. In addition, the cloned gene was used for phylogenetic analyses based on the deduced amino acid sequences, and the results suggested that the actin gene is highly conserved in evolution. The findings of this study will be useful for investigating the expression patterns of other genes in Aloe.

  13. Structure, chromosome location, and expression of the human. gamma. -actin gene: Differential evolution, location, and expression of the cytoskeletal BETA- and. gamma. -actin genes

    SciTech Connect

    Erba, H.P.; Eddy, R.; Shows, T.; Kedes, L.; Gunning, P.

    1988-04-01

    The accumulation of the cytoskeletal ..beta..-and ..gamma..-actin mRNAs was determined in a variety of mouse tissues and organs. The ..beta..-iosform is always expressed in excess of the ..gamma..-isoform. However, the molar ratio of ..beta..- to ..gamma..-actin mRNA varies from 1.7 in kidney and testis to 12 in sarcomeric muscle to 114 in liver. The authors conclude that, whereas the cytoskeletal ..beta..- and ..gamma..-actins are truly coexpressed, their mRNA levels are subject to differential regulation between different cell types. The human ..gamma..-actin gene has been cloned and sequenced, and its chromosome location has been determined. The gene is located on human chromosome 17, unlike ..beta..-actin which is on chromosome 7. Thus, if these genes are also unlinked in the mouse, the coexpression of the ..beta..- and ..gamma..-actin genes in rodent tissues cannot be determined by gene linkage. Comparison of the human ..beta..- and ..gamma..-actin genes reveals that noncoding sequences in the 5'-flanking region and in intron III have been conserved since the duplication that gave rise to these two genes. In contrast, there are sequences in intron III and the 3'-untranslated region which are not present in the ..beta..-actin gene but are conserved between the human ..gamma..-actin and the Xenopus borealis type 1 actin genes. Such conserved noncoding sequences may contribute to the coexpression of ..beta..- and ..gamma..-actin or to the unique regulation and function of the ..gamma..-actin gene. Finally, the authors demonstrate that the human ..gamma..-actin gene is expressed after introduction into mouse L cells and C2 myoblasts and that, upon fusion of C2 cells to form myotubes, the human ..gamma..-actin gene is appropriately regulated.

  14. Stability domains of actin genes and genomic evolution

    NASA Astrophysics Data System (ADS)

    Carlon, E.; Dkhissi, A.; Malki, M. Lejard; Blossey, R.

    2007-11-01

    In eukaryotic genes, the protein coding sequence is split into several fragments, the exons, separated by noncoding DNA stretches, the introns. Prokaryotes do not have introns in their genomes. We report calculations of the stability domains of actin genes for various organisms in the animal, plant, and fungi kingdoms. Actin genes have been chosen because they have been highly conserved during evolution. In these genes, all introns were removed so as to mimic ancient genes at the time of the early eukaryotic development, i.e., before intron insertion. Common stability boundaries are found in evolutionarily distant organisms, which implies that these boundaries date from the early origin of eukaryotes. In general, the boundaries correspond with intron positions in the actins of vertebrates and other animals, but not much for plants and fungi. The sharpest boundary is found in a locus where fungi, algae, and animals have introns in positions separated by one nucleotide only, which identifies a hot spot for insertion. These results suggest that some introns may have been incorporated into the genomes through a thermodynamically driven mechanism, in agreement with previous observations on human genes. They also suggest a different mechanism for intron insertion in plants and animals.

  15. The arabidopsis ACT7 actin gene is expressed in rapidly developing tissues and responds to several external stimuli.

    PubMed Central

    McDowell, J M; An, Y Q; Huang, S; McKinney, E C; Meagher, R B

    1996-01-01

    ACT7 encodes one of the six distinct and ancient subclasses of actin protein in the complex Arabidopsis actin gene family. We determined the sequence and structure of the Arabidopsis thaliana ACT7 actin gene and investigated its tissue-specific expression and regulation. The ACT7 mRNA levels varied by 128-fold among several different tissues and organs. The highest levels of aCT7 mRNA were found in rapidly expanding vegetative organs, the lowest in pollen. A translational fusion with the 5' end of ACT 7 (1.9 kb) joined to the beta-glucuronidase reporter gene was strongly and preferentially expressed in all young, developing vegetative tissues of transgenic Arabidopsis plants. ACT7 was the only Arabidopsis actin gene strongly expressed in the hypocotyl and seed coat. Although no beta-glucuronidase expression was seen in developing ovules or immature seeds, strong expression was seen in dry seeds and immediately after imbibition in the entire seedling. ACT7 was the only Arabidopsis actin gene to respond strongly to auxin, other hormone treatments, light regime, and wounding, and may be the primary actin gene responding to external stimuli. The ACT7 promoter sequence contains a remarkable number of motifs with sequence similarity to putative phytohormone response elements. PMID:8754679

  16. Fetal akinesia caused by a novel actin filament aggregate myopathy skeletal muscle actin gene (ACTA1) mutation.

    PubMed

    Stenzel, Werner; Prokop, Stefan; Kress, Wolfram; Huppmann, Stephanie; Loui, Andrea; Sarioglu, Nanette M E; Laing, Nigel G; Sparrow, John C; Heppner, Frank L; Goebel, Hans H

    2010-08-01

    We report a female newborn, diagnosed with fetal akinesia in utero, who died one hour after birth. Post-mortem muscle biopsy demonstrated actin-filament myopathy based on immunolabelling for sarcomeric actin, and large areas of filaments, without rod formation, ultrastructurally. Analysis of DNA extracted from the muscle disclosed a novel de novo heterozygous c.44G>A, GGC>GAC, 'p.Gly15Asp' mutation in the ACTA1 gene. Analysis of the location of the mutated amino-acid in the actin molecule suggests the mutation most likely causes abnormal nucleotide binding, and consequent pathological actin polymerization. This case emphasizes the association of fetal akinesia with actin-filament myopathy.

  17. Structural features and gene-expression profiles of actin homologs in Porphyra yezoensis (Rhodophyta).

    PubMed

    Kitade, Yukihiro; Nakamura, Michiko; Uji, Toshiki; Fukuda, Satoru; Endo, Hirotoshi; Saga, Naotsune

    2008-10-15

    The marine red alga Porphyra yezoensis contains an actin gene family consisting of at least four isoforms (PyACT1, 2, 3 and 4). The amino acid identity between isoforms exceeds 83%, and each contains a putative nuclear export signal (NES). We scanned the sequences for amino acids in regions homologous to the intermonomeric interface of actin filaments. Few residues expected to engage in cross-linking were conserved between the four isoforms. The results of the sequence analyses suggest that PyACT2 probably functions in the nucleus as a monomer (G-actin) or in other unconventional forms. In addition, the distribution and position of the introns were different from those in florideophycean actin genes. The expression level of PyACT3 in matured gametophytes was significantly higher than in those in a vegetative state, although the mRNA was detected at similar levels in both apical and basal parts of thalli. The expression levels of PyACT2 and 4, on the other hand, did not change significantly between the matured and vegetative gametophytes. The PyACT3 may serve as a molecular marker for monitoring thallus maturation in this species.

  18. Actin organization and gene expression in Beta vulgaris seedlings under clinorotation

    NASA Astrophysics Data System (ADS)

    Kozeko, L. Y.; Shevchenko, G. V.; Artemenko, O. A.; Martyn, G. G.; Kordyum, E. L.

    2005-08-01

    Actin microfilaments (MFs) as highly dynamic structure respond by rapid reorganization to different external influences, including gravity. The object of our experiments was to examine both the actin organization and actin gene expression during growth and differentiation of root cells under clinorotation. It was shown that MFs acted as the indicator of changes caused by altered gravity in distal elongation zone (DEZ) cells, particularly actin cytoskeleton is enhanced in cortex cells. The data testify stable actin expression under altered gravity. The F-actin MFs enhancement in cortex cells of the DEZ occurred under clinorotation at the same level of the total actin content as in the stationary conditions is suggested to be caused by transformation of G-actin into F-actin.

  19. The Drosophila javelin Gene Encodes a Novel Actin-Associated Protein Required for Actin Assembly in the Bristle ▿

    PubMed Central

    Shapira, Shira; Bakhrat, Anna; Bitan, Amir; Abdu, Uri

    2011-01-01

    The Drosophila melanogaster bristle is a highly polarized cell that builds specialized cytoskeletal structures. Whereas actin is required for increasing bristle length, microtubules are essential for bristle axial growth. To identify new proteins involved in cytoskeleton organization during bristle development, we focused on identifying and characterizing the javelin (jv) locus. We found that in a jv mutant, the bristle tip is swollen and abnormal organization of bristle grooves is seen over the entire bristle. Using confocal and electron microscopy, we found that in jv mutant bristles, actin bundles do not form properly due to a loss of actin filaments within the bundle. We show that jv is an allele of the predicted CG32397 gene that encodes a protein with no homologs outside insects. Expression of the Jv protein fused to a green fluorescent protein (GFP) shows that the protein is colocalized with actin bundles in the bristle. Moreover, expression of Jv-GFP within the germ line led to the formation of ectopic actin bundles that surround the nucleus of nurse cells. Thus, we report that Jv is a novel actin-associated protein required for actin assembly during Drosophila bristle development. PMID:21930794

  20. Nuclear actin-binding proteins as modulators of gene transcription.

    PubMed

    Gettemans, Jan; Van Impe, Katrien; Delanote, Veerle; Hubert, Thomas; Vandekerckhove, Joël; De Corte, Veerle

    2005-10-01

    Dynamic transformations in the organization of the cellular microfilament system are the driving force behind fundamental biological processes such as cellular motility, cytokinesis, wound healing and secretion. Eukaryotic cells express a plethora of actin-binding proteins (ABPs) allowing cells to control the organization of the actin cytoskeleton in a flexible manner. These structural proteins were, not surprisingly, originally described as (major) constituents of the cytoplasm. However, in recent years, there has been a steady flow of reports detailing not only translocation of ABPs into and out of the nucleus but also describing their role in the nuclear compartment. This review focuses on recent developments pertaining to nucleocytoplasmic transport of ABPs, including their mode of translocation and nuclear function. In particular, evidence that structurally and functionally unrelated cytoplasmic ABPs regulate transcription activation by various nuclear (steroid hormone) receptors is steadily accruing. Furthermore, the recent finding that actin is a necessary component of the RNA polymerase II-containing preinitiation complex opens up new opportunities for nuclear ABPs in gene transcription regulation.

  1. Cloning and characterization of an actin gene of Chlamys farreri and the phylogenetic analysis of mollusk actins

    NASA Astrophysics Data System (ADS)

    Ma, Hongming; Mai, Kangsen; Liufu, Zhiguo; Xu, Wei

    2007-07-01

    An actingene (CfACTI) was cloned by using RT-PCR, 3’ and 5’RACE from hemocytes of the sea scallop Chlamys farreri. The full length of the transcript is 1 535 bp, which contains a long 3’ un-translated region of 436bp and 59bp of a 5’ un-translated sequence. The open reading frame encodes a polypeptide of 376 amino acids. Sequence comparisons indicated that CfACTI is more closely related to vertebrate cytoplasmic actins than muscle types. Phylogenetic analysis showed that molluscan actins could be generally divided into two categories: muscle and cytoplasmic, although both are similar to vertebrate cytoplasmic actins. It was also inferred that different isotypes existed in muscle or cytoplasma in mollusks. The genomic sequence of CfACTI was cloned and sequenced. Only one intron was detected: it was located between codons 42 and 43 and different from vertebrate actin genes.

  2. A mutation in the gamma actin 1 (ACTG1) gene causes autosomal dominant hearing loss (DFNA20/26)

    PubMed Central

    van Wijk, E; Krieger, E; Kemperman, M; De Leenheer, E M R; Huygen, P; Cremers, C; Cremers, F; Kremer, H

    2003-01-01

    Linkage analysis in a multigenerational family with autosomal dominant hearing loss yielded a chromosomal localisation of the underlying genetic defect in the DFNA20/26 locus at 17q25-qter. The 6-cM critical region harboured the γ-1-actin (ACTG1) gene, which was considered an attractive candidate gene because actins are important structural elements of the inner ear hair cells. In this study, a Thr278Ile mutation was identified in helix 9 of the modelled protein structure. The alteration of residue Thr278 is predicted to have a small but significant effect on the γ 1 actin structure owing to its close proximity to a methionine residue at position 313 in helix 11. Met313 has no space in the structure to move away. Moreover, the Thr278 residue is highly conserved throughout eukaryotic evolution. Using a known actin structure the mutation could be predicted to impair actin polymerisation. These findings strongly suggest that the Thr278Ile mutation in ACTG1 represents the first disease causing germline mutation in a cytoplasmic actin isoform. PMID:14684684

  3. Upregulation of two actin genes and redistribution of actin during diapause and cold stress in the northern house mosquito, Culex pipiens

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Two actin genes cloned from Culex pipiens L. are upregulated during adult diapause. Though actins 1 and 2 were expressed throughout diapause, both genes were most highly expressed early in diapause. These changes in gene expression were accompanied by a conspicuous redistribution of polymerized acti...

  4. Characterizing gene family evolution

    PubMed Central

    Liberles, David A.

    2008-01-01

    Gene families are widely used in comparative genomics, molecular evolution, and in systematics. However, they are constructed in different manners, their data analyzed and interpreted differently, with different underlying assumptions, leading to sometimes divergent conclusions. In systematics, concepts like monophyly and the dichotomy between homoplasy and homology have been central to the analysis of phylogenies. We critique the traditional use of such concepts as applied to gene families and give examples of incorrect inferences they may lead to. Operational definitions that have emerged within functional genomics are contrasted with the common formal definitions derived from systematics. Lastly, we question the utility of layers of homology and the meaning of homology at the character state level in the context of sequence evolution. From this, we move forward to present an idealized strategy for characterizing gene family evolution for both systematic and functional purposes, including recent methodological improvements. PMID:19461954

  5. MRP-1/CD9 gene transduction regulates the actin cytoskeleton through the downregulation of WAVE2.

    PubMed

    Huang, C-L; Ueno, M; Liu, D; Masuya, D; Nakano, J; Yokomise, H; Nakagawa, T; Miyake, M

    2006-10-19

    Motility-related protein-1 (MRP-1/CD9) is involved in cell motility. We studied the change in the actin cytoskeleton, and the expression of actin-related protein (Arp) 2 and Arp3 and the Wiskott-Aldrich syndrome protein (WASP) family according to MRP-1/CD9 gene transduction into HT1080 cells. The frequency of cells with lamellipodia was significantly lower in MRP-1/CD9-transfected HT1080 cells than in control HT1080 cells (P<0.0001). MRP-1/CD9 gene transduction affected the subcellular localization of Arp2 and Arp3 proteins. Furthermore, MRP-1/CD9 gene transduction induced a downregulation of WAVE2 expression (P<0.0001). However, no difference was observed in the expression of Arp2, Arp3 or other WASPs. A neutralizing anti-MRP-1/CD9 monoclonal antibody inhibited downregulation of WAVE2 in MRP-1/CD9-transfected HT1080 cells (P<0.0001), and reversed the morphological effects of MRP-1/CD9 gene transduction. Furthermore, downregulation of WAVE2 by transfection of WAVE2-specific small interfering RNA (siRNA) mimicked the morphological effects of MRP-1/CD9 gene transduction and suppressed cell motility. However, transfection of each siRNA for Wnt1, Wnt2b1 or Wnt5a did not affect WAVE2 expression. Transfection of WAVE2-specific siRNA also did not affect expressions of these Wnts. These results indicate that MRP-1/CD9 regulates the actin cytoskeleton by downregulating of the WAVE2, through the Wnt-independent signal pathway.

  6. Signalling to actin assembly via the WASP (Wiskott-Aldrich syndrome protein)-family proteins and the Arp2/3 complex.

    PubMed Central

    Millard, Thomas H; Sharp, Stewart J; Machesky, Laura M

    2004-01-01

    The assembly of a branched network of actin filaments provides the mechanical propulsion that drives a range of dynamic cellular processes, including cell motility. The Arp2/3 complex is a crucial component of such filament networks. Arp2/3 nucleates new actin filaments while bound to existing filaments, thus creating a branched network. In recent years, a number of proteins that activate the filament nucleation activity of Arp2/3 have been identified, most notably the WASP (Wiskott-Aldrich syndrome protein) family. WASP-family proteins activate the Arp2/3 complex, and consequently stimulate actin assembly, in response to extracellular signals. Structural studies have provided a significant refinement in our understanding of the molecular detail of how the Arp2/3 complex nucleates actin filaments. There has also been much progress towards an understanding of the complicated signalling processes that regulate WASP-family proteins. In addition, the use of gene disruption in a number of organisms has led to new insights into the specific functions of individual WASP-family members. The present review will discuss the Arp2/3 complex and its regulators, in particular the WASP-family proteins. Emphasis will be placed on recent developments in the field that have furthered our understanding of actin dynamics and cell motility. PMID:15040784

  7. Cloning and characterization of an abalone (Haliotis discus hannai) actin gene

    NASA Astrophysics Data System (ADS)

    Ma, Hongming; Xu, Wei; Mai, Kangsen; Liufu, Zhiguo; Chen, Hong

    2004-10-01

    An actin encoding gene was cloned by using RT-PCR, 3‧ RACE and 5‧ RACE from abalone Haliotis discus hannai. The full length of the gene is 1532 base pairs, which contains a long 3‧ untranslated region of 307 base pairs and 79 base pairs of 5‧ untranslated sequence. The open reading frame encodes 376 amino acid residues. Sequence comparison with those of human and other mollusks showed high conservation among species at amino acid level. The identities was 96%, 97% and 96% respectively compared with Aplysia californica, Biomphalaria glabrata and Homo sapience β-actin. It is also indicated that this actin is more similar to the human cytoplasmic actin (β-actin) than to human muscle actin.

  8. The sulfatase gene family.

    PubMed

    Parenti, G; Meroni, G; Ballabio, A

    1997-06-01

    During the past few years, molecular analyses have provided important insights into the biochemistry and genetics of the sulfatase family of enzymes, identifying the molecular bases of inherited diseases caused by sulfatase deficiencies. New members of the sulfatase gene family have been identified in man and other species using a genomic approach. These include the gene encoding arylsulfatase E, which is involved in X-linked recessive chondrodysplasia punctata, a disorder of cartilage and bone development. Another important breakthrough has been the discovery of the biochemical basis of multiple sulfatase deficiency, an autosomal recessive disorder characterized by a severe of all sulfatase activities. These discoveries, together with the resolution of the crystallographic structure of sulfatases, have improved our understanding of the function and evolution of this fascinating family of enzymes.

  9. The actin family protein ARP6 contributes to the structure and the function of the nucleolus

    SciTech Connect

    Kitamura, Hiroshi; Matsumori, Haruka; Kalendova, Alzbeta; Hozak, Pavel; Goldberg, Ilya G.; Nakao, Mitsuyoshi; Saitoh, Noriko; Harata, Masahiko

    2015-08-21

    The actin family members, consisting of actin and actin-related proteins (ARPs), are essential components of chromatin remodeling complexes. ARP6, one of the nuclear ARPs, is part of the Snf-2-related CREB-binding protein activator protein (SRCAP) chromatin remodeling complex, which promotes the deposition of the histone variant H2A.Z into the chromatin. In this study, we showed that ARP6 influences the structure and the function of the nucleolus. ARP6 is localized in the central region of the nucleolus, and its knockdown induced a morphological change in the nucleolus. We also found that in the presence of high concentrations of glucose ARP6 contributed to the maintenance of active ribosomal DNA (rDNA) transcription by placing H2A.Z into the chromatin. In contrast, under starvation, ARP6 was required for cell survival through the repression of rDNA transcription independently of H2A.Z. These findings reveal novel pleiotropic roles for the actin family in nuclear organization and metabolic homeostasis. - Highlights: • ARP6, an actin related protein, is important for nucleolar function and structure. • A population of ARP6 is localized in the center of nucleolus. • Depletion of ARP6 resulted in aberrant shape of the nucleolus. • ARP6 maintains the active rDNA transcription under high glucose. • ARP6 is required for the repression of rDNA transcription under starvation.

  10. Upregulation of two actin genes and redistribution of actin during diapause and cold stress in the northern house mosquito, Culex pipiens.

    PubMed Central

    Kim, Mijung; Robich, Rebecca M.; Rinehart, Joseph P.; Denlinger, David L.

    2007-01-01

    Two actin genes cloned from Culex pipiens L. are upregulated during adult diapause. Though actins 1 and 2 were expressed throughout diapause, both genes were most highly expressed early in diapause. These changes in gene expression were accompanied by a conspicuous redistribution of polymerized actin that was most pronounced in the midguts of diapausing mosquitoes that were exposed to low temperature. In nondiapausing mosquitoes reared at 25°C and in diapausing mosquitoes reared at 18°C, polymerized actin was clustered at high concentrations at the intersections of the muscle fibers that form the midgut musculature. When adults 7–10 days post-eclosion were exposed to low temperature (-5°C for 12h), the polymerized actin was evenly distributed along the muscle fibers in both nondiapausing and diapausing mosquitoes. Exposure of older adults (1month post-eclosion) to low temperature (−5°C for 12h) elicited an even greater distribution of polymerized actin, an effect that was especially pronounced in diapausing mosquitoes. These changes in gene expression and actin distribution suggest a role for actins in enhancing survival of diapausing adults during the low temperatures of winter by fortification of the cytoskeleton. PMID:17078965

  11. The yeast gene, MDM20, is necessary for mitochondrial inheritance and organization of the actin cytoskeleton.

    PubMed

    Hermann, G J; King, E J; Shaw, J M

    1997-04-07

    In Saccharomyces cerevisiae, the growing bud inherits a portion of the mitochondrial network from the mother cell soon after it emerges. Although this polarized transport of mitochondria is thought to require functions of the cytoskeleton, there are conflicting reports concerning the nature of the cytoskeletal element involved. Here we report the isolation of a yeast mutant, mdm20, in which both mitochondrial inheritance and actin cables (bundles of actin filaments) are disrupted. The MDM20 gene encodes a 93-kD polypeptide with no homology to other characterized proteins. Extra copies of TPM1, a gene encoding the actin filament-binding protein tropomyosin, suppress mitochondrial inheritance defects and partially restore actin cables in mdm20 delta cells. Synthetic lethality is also observed between mdm20 and tpm1 mutant strains. Overexpression of a second yeast tropomyosin, Tpm2p, rescues mutant phenotypes in the mdm20 strain to a lesser extent. Together, these results provide compelling evidence that mitochondrial inheritance in yeast is an actin-mediated process. MDM20 and TPM1 also exhibit the same pattern of genetic interactions; mutations in MDM20 are synthetically lethal with mutations in BEM2 and MYO2 but not SAC6. Although MDM20 and TPM1 are both required for the formation and/or stabilization of actin cables, mutations in these genes disrupt mitochondrial inheritance and nuclear segregation to different extents. Thus, Mdm20p and Tpm1p may act in vivo to establish molecular and functional heterogeneity of the actin cytoskeleton.

  12. Molecular cloning and characterization of mutant and wild-type human. beta. -actin genes

    SciTech Connect

    Leavitt, J.; Gunning, P.; Porreca, P.; Ng, S.Y.; Lin, C.H.; Kedes, L.

    1984-10-01

    There are more than 20 ..beta..-actin-specific sequences in the human genome, many of which are pseudogenes. To facilitate the isolation of potentially functional ..beta..-actin genes, they used the new method of B. Seed for selecting genomic clones by homologous recombination. A derivative of the ..pi..VX miniplasmid, ..pi..AN7..beta..1, was constructed by insertion of the 600-base-pair 3' untranslated region of the ..beta..-actin mRNA expressed in human fibroblasts. Five clones containing ..beta..-actin sequences were selected from an amplified human fetal gene library by homologous recombination between library phage and the miniplasmid. One of these clones contained a complete ..beta..-actin gene with a coding sequence identical to that determined for the mRNA of human fibroblasts. A DNA fragment consisting of mostly intervening sequences from this gene was then use to identify 13 independent recombinant copies of the analogous gene from two specially constructed gene libraries, each containing one of the two types of mutant ..beta..-actin genes found in a line of neoplastic human fibroblasts. The amino acid and nucleotide sequences encoded by the unmutated gene predict that a guanine-to-adenine transition is responsible for the glycine-to-aspartic acid mutation at codon 244 and would also result in the loss of a HaeIII site. Detection of this HaeIII polymorphism among the fibroblast-derived closed verified the identity of the ..beta..-actin gene expressed in human fibroblasts.

  13. The Nf-actin gene is an important factor for food-cup formation and cytotoxicity of pathogenic Naegleria fowleri.

    PubMed

    Sohn, Hae-Jin; Kim, Jong-Hyun; Shin, Myeong-Heon; Song, Kyoung-Ju; Shin, Ho-Joon

    2010-03-01

    Naegleria fowleri destroys target cells by trogocytosis, a phagocytosis mechanism, and a process of piecemeal ingestion of target cells by food-cups. Phagocytosis is an actin-dependent process that involves polymerization of monomeric G-actin into filamentous F-actin. However, despite the numerous studies concerning phagocytosis, its role in the N. fowleri food-cup formation related with trogocytosis has been poorly reported. In this study, we cloned and characterized an Nf-actin gene to elucidate the role of Nf-actin gene in N. fowleri pathogenesis. The Nf-actin gene is composed of 1,128-bp and produced a 54.1-kDa recombinant protein (Nf-actin). The sequence identity was 82% with nonpathogenic Naegleria gruberi but has no sequence identity with other mammals or human actin gene. Anti-Nf-actin polyclonal antibody was produced in BALB/c mice immunized with recombinant Nf-actin. The Nf-actin was localized on the cytoplasm, pseudopodia, and especially, food-cup structure (amoebastome) in N. fowleri trophozoites using immunofluorescence assay. When N. fowleri co-cultured with Chinese hamster ovary cells, Nf-actin was observed to localize around on phagocytic food-cups. We also observed that N. fowleri treated with cytochalasin D as actin polymerization inhibitor or transfected with antisense oligomer of Nf-actin gene had shown the reduced ability of food-cup formation and in vitro cytotoxicity. Finally, it suggests that Nf-actin plays an important role in phagocytic activity of pathogenic N. fowleri.

  14. Expression of actin genes in the arrow worm Paraspadella gotoi (Chaetognatha).

    PubMed

    Yasuda, E; Goto, T; Makabe, K W; Satoh, N

    1997-12-01

    Arrow worms (the phylum Chaetognatha), one of the major marine planktonic animals, exhibit features characteristic to both deuterostomes and protostomes, and their ancestry therefore remains unknown. As the first step to elucidate the molecular bases of arrow worm phylogeny, physiology and embryology, we isolated cDNA clones for three different actin genes (PgAct1, PgAct2 and PgAct3) from the benthic species Paraspadella gotoi, and examined their expression patterns in adults and juveniles. The amino acid sequences of the three actins resembled each other, with identities ranging from 86% to 92%. However, the patterns of the spatial expression of the genes were independent. The PgAct1 gene might encode a cytoplasmic actin and was expressed in oogenic cells, spermatogenic cells, and cells in the ventral ganglion. The PgAct2 and PgAct3 genes encoded actins of divergent types. The former was expressed in well-developed muscle of the head (gnathic) region and trunk muscle cells, whereas the latter was expressed in muscle of the trunk and tail regions and oogenic cells. These results suggest that, similarly to other metazoans, the chaetognath contains multiple forms of actins, which are expressed in various manners in the adult and juvenile arrow worm.

  15. The genomic nucleotide sequences of two differentially expressed actin-coding genes from the sea star Pisaster ochraceus.

    PubMed

    Kowbel, D J; Smith, M J

    1989-04-30

    The genomic sequences of two differentially expressed actin genes from the sea star Pisaster ochraceus are reported. The cytoplasmic actin gene (Cy) is expressed in eggs and early development. The muscle actin gene (M) is expressed in tube feet and testes. Both genes contain an 1125-nucleotide coding region interrupted by three introns at codons 41, 121 and 204. Gene M contains two additional introns at codons 150 and 267. The intron position at codon 150, although present in higher vertebrate actins, has not been reported in actin genes from invertebrates. The M gene coding region has 89.5% nucleotide homology to the Cy gene, and differs from the Cy actin gene in 13 of 375 amino acids (aa), 11 of which are found in the C-terminal half of the gene. The C-terminal half of the M gene contains a significant number of muscle isotype codons. Even though there is only 1 aa change in the first 150 codons, there have been limited substitutions at many four-fold degenerate sites which may indicate selection pressure upon the secondary structure of the mRNA and/or a biased codon usage. Variant CCAAT, TATA, and poly(A)-addition signals have been identified in the 5' and 3' flanking regions. The presence of 5' and 3' splice junction sequences in the 5' flanking region of the Cy gene suggests the potential for an intron there.

  16. Role of Proteins of the Ena/VASP Family in Actin-based Motility of Listeria monocytogenes

    PubMed Central

    Laurent, Valérie; Loisel, Thomas P.; Harbeck, Birgit; Wehman, Ann; Gröbe, Lothar; Jockusch, Brigitte M.; Wehland, Jürgen; Gertler, Frank B.; Carlier, Marie-France

    1999-01-01

    Intracellular propulsion of Listeria monocytogenes is the best understood form of motility dependent on actin polymerization. We have used in vitro motility assays of Listeria in platelet and brain extracts to elucidate the function of the focal adhesion proteins of the Ena (Drosophila Enabled)/VASP (vasodilator-stimulated phosphoprotein) family in actin-based motility. Immunodepletion of VASP from platelet extracts and of Evl (Ena/VASP-like protein) from brain extracts of Mena knockout (−/−) mice combined with add-back of recombinant (bacterial or eukaryotic) VASP and Evl show that VASP, Mena, and Evl play interchangeable roles and are required to transform actin polymerization into active movement and propulsive force. The EVH1 (Ena/VASP homology 1) domain of VASP is in slow association–dissociation equilibrium high-affinity binding to the zyxin-homologous, proline-rich region of ActA. VASP also interacts with F-actin via its COOH-terminal EVH2 domain. Hence VASP/ Ena/Evl link the bacterium to the actin tail, which is required for movement. The affinity of VASP for F-actin is controlled by phosphorylation of serine 157 by cAMP-dependent protein kinase. Phospho-VASP binds with high affinity (0.5 × 108 M−1); dephospho-VASP binds 40-fold less tightly. We propose a molecular ratchet model for insertional polymerization of actin, within which frequent attachment–detachment of VASP to F-actin allows its sliding along the growing filament. PMID:10087267

  17. Molecular typing of the actin gene of Trichomonas vaginalis isolates by PCR-RFLP in Iran.

    PubMed

    Momeni, Zohreh; Sadraei, Javid; Kazemi, Bahram; Dalimi, Abdolhossein

    2015-12-01

    Trichomonas vaginalis is a human urogenital pathogen that causes trichomoniasis, the most common nonviral, parasitic sexually transmitted infection in the world. At present, little is known regarding the degree of strain variability of T. vaginalis. A classification method for T. vaginalis strains would be a useful tool in the study of the epidemiology, drug resistance, pathogenesis and transmission of T. vaginalis. Eight different types of actin genes have been identified by PCR-RFLP in T. vaginalis; the purpose of this study is to determine the genotypes of this parasite in Karaj city, Iran. Forty-five clinical T. vaginalis isolates from vaginal secretions and urine sediment were collected from Karaj city from 2012 through 2014. DNA was extracted and the actin gene was amplified by nested-PCR; all samples were positive. To determine the genetic differences, sequencing on seven samples was conducted. Then, all PCR products were digested with HindII, MseI, and RsaI restriction enzymes. Of 45 isolates, 23 samples (51.1%) were of actin genotype G, 11 samples (24.4%) of genotype E, six samples (13.3%) of genotype H, three samples (6.6%) of genotype I, and two samples (4.4%) were mixed genotypes of G and E. Genetic diversity of T. vaginalis isolates is notable. The actin genotype G may be the dominant genotype in Karaj city, Iran.

  18. Actin Family Proteins in the Human INO80 Chromatin Remodeling Complex Exhibit Functional Roles in the Induction of Heme Oxygenase-1 with Hemin.

    PubMed

    Takahashi, Yuichiro; Murakami, Hirokazu; Akiyama, Yusuke; Katoh, Yasutake; Oma, Yukako; Nishijima, Hitoshi; Shibahara, Kei-Ichi; Igarashi, Kazuhiko; Harata, Masahiko

    2017-01-01

    Nuclear actin family proteins, comprising of actin and actin-related proteins (Arps), are essential functional components of the multiple chromatin remodeling complexes. The INO80 chromatin remodeling complex, which is evolutionarily conserved and has roles in transcription, DNA replication and repair, consists of actin and actin-related proteins Arp4, Arp5, and Arp8. We generated Arp5 knockout (KO) and Arp8 KO cells from the human Nalm-6 pre-B cell line and used these KO cells to examine the roles of Arp5 and Arp8 in the transcriptional regulation mediated by the INO80 complex. In both of Arp5 KO and Arp8 KO cells, the oxidative stress-induced expression of HMOX1 gene, encoding for heme oxygenase-1 (HO-1), was significantly impaired. Consistent with these observations, chromatin immunoprecipitation (ChIP) assay revealed that oxidative stress caused an increase in the binding of the INO80 complex to the regulatory sites of HMOX1 in wild-type cells. The binding of INO80 complex to chromatin was reduced in Arp8 KO cells compared to that in the wild-type cells. On the other hand, the binding of INO80 complex to chromatin in Arp5 KO cells was similar to that in the wild-type cells even under the oxidative stress condition. However, both remodeling of chromatin at the HMOX1 regulatory sites and binding of a transcriptional activator to these sites were impaired in Arp5 KO cells, indicating that Arp5 is required for the activation of the INO80 complex. Collectively, these results suggested that these nuclear Arps play indispensable roles in the function of the INO80 chromatin remodeling complex.

  19. Actin Family Proteins in the Human INO80 Chromatin Remodeling Complex Exhibit Functional Roles in the Induction of Heme Oxygenase-1 with Hemin

    PubMed Central

    Takahashi, Yuichiro; Murakami, Hirokazu; Akiyama, Yusuke; Katoh, Yasutake; Oma, Yukako; Nishijima, Hitoshi; Shibahara, Kei-ichi; Igarashi, Kazuhiko; Harata, Masahiko

    2017-01-01

    Nuclear actin family proteins, comprising of actin and actin-related proteins (Arps), are essential functional components of the multiple chromatin remodeling complexes. The INO80 chromatin remodeling complex, which is evolutionarily conserved and has roles in transcription, DNA replication and repair, consists of actin and actin-related proteins Arp4, Arp5, and Arp8. We generated Arp5 knockout (KO) and Arp8 KO cells from the human Nalm-6 pre-B cell line and used these KO cells to examine the roles of Arp5 and Arp8 in the transcriptional regulation mediated by the INO80 complex. In both of Arp5 KO and Arp8 KO cells, the oxidative stress-induced expression of HMOX1 gene, encoding for heme oxygenase-1 (HO-1), was significantly impaired. Consistent with these observations, chromatin immunoprecipitation (ChIP) assay revealed that oxidative stress caused an increase in the binding of the INO80 complex to the regulatory sites of HMOX1 in wild-type cells. The binding of INO80 complex to chromatin was reduced in Arp8 KO cells compared to that in the wild-type cells. On the other hand, the binding of INO80 complex to chromatin in Arp5 KO cells was similar to that in the wild-type cells even under the oxidative stress condition. However, both remodeling of chromatin at the HMOX1 regulatory sites and binding of a transcriptional activator to these sites were impaired in Arp5 KO cells, indicating that Arp5 is required for the activation of the INO80 complex. Collectively, these results suggested that these nuclear Arps play indispensable roles in the function of the INO80 chromatin remodeling complex. PMID:28270832

  20. Expression of two actin genes during larval development in the sea urchin Strongylocentrotus purpuratus.

    PubMed

    Cameron, R A; Britten, R J; Davidson, E H

    1989-01-01

    We report the first measurements of cell number, total RNA, and transcript accumulations for two actin genes during larval development of the sea urchin Strongylocentrotus purpuratus. At 5 weeks of feeding, when development of laboratory-raised larvae is completed, the cell number has increased about 100-fold with respect to the pluteus-stage embryo to about 150,000 +/- 50,000, and the total RNA has increased 46-fold to about 130 ng per larva. The transcripts of the Cylla cytoskeletal actin gene, which is expressed in adult tissues, continue to accumulate throughout larval development. A contrasting pattern of transcript accumulation is observed for Cyllla, a different cytoskeletal actin gene that in the embryo is expressed only in aboral ectoderm. These transcripts increase in number early in larval development, when the larval epidermis is differentiating, and then decline in quantity. It is known that at metamorphosis the larval epidermis is largely histolyzed and that the Cyllla gene is not expressed in the juvenile or adult.

  1. Use of staurosporine, an actin-modifying agent, to enhance fibrochondrocyte matrix gene expression and synthesis.

    PubMed

    Hoben, Gwendolyn M; Athanasiou, Kyriacos A

    2008-12-01

    Modulation of the actin cytoskeleton in chondrocytes has been used to prevent or reverse dedifferentiation and to enhance protein synthesis. We have hypothesized that an actin-modifying agent, staurosporine, could be used with fibrochondrocytes to increase the gene expression and synthesis of critical fibrocartilage proteins. A range of concentrations (0.1-100 nM) was applied to fibrochondrocytes in monolayer and evaluated after 24 h and after 4 days. High-dose staurosporine treatment (10-100 nM) increased cartilage oligomeric matrix protein 60- to 500-fold and aggrecan gene expression two-fold. This effective range of staurosporine was then applied to scaffoldless tissue-engineered fibrochondrocyte constructs for 4 weeks. Whereas glycosaminoglycan synthesis was not affected, collagen content doubled, from 27.6 +/- 8.8 microg in the untreated constructs to 55.2 +/- 12.2 microg per construct with 100 nM treatment. When analyzed for specific collagens, the 10-nM group showed a significant increase in collagen type I content, whereas collagen type II was unaffected. A concomitant dose-dependent reduction was noted in construct contraction, reflecting the actin-disrupting action of staurosporine. Thus, staurosporine increases the gene expression for important matrix proteins and can be used to enhance matrix production and reduce contraction in tissue-engineered fibrocartilage constructs.

  2. The Insect SNMP Gene Family

    DTIC Science & Technology

    2009-01-01

    The insect SNMP gene family Richard G. Vogt a,*,1, Natalie E. Miller a, Rachel Litvack a, Richard A. Fandino a, Jackson Sparks a, Jon Staples a...Wallace Beltsville Agricultural Research Center Plant Sciences Institute, Invasive Insect Biocontrol and Behavior Laboratory, Bldg. 007, Rm. 030...keywords: Pheromone Receptors Olfactory Gustatory Chemosensory Gustatory Mosquito Fly a b s t r a c t SNMPs are membrane proteins observed to associate with

  3. Three cotton genes preferentially expressed in flower tissues encode actin-depolymerizing factors which are involved in F-actin dynamics in cells.

    PubMed

    Li, Xue-Bao; Xu, Dan; Wang, Xiu-Lan; Huang, Geng-Qing; Luo, Juan; Li, Deng-Di; Zhang, Ze-Ting; Xu, Wen-Liang

    2010-01-01

    To investigate whether the high expression levels of actin-depolymerizing factor genes are related to pollen development, three GhADF genes (cDNAs) were isolated and characterized in cotton. Among them, GhADF6 and GhADF8 were preferentially expressed in petals, whereas GhADF7 displayed the highest level of expression in anthers, revealing its anther specificity. The GhADF7 transcripts in anthers reached its peak value at flowering, suggesting that its expression is developmentally-regulated in anthers. The GhADF7 gene including the promoter region was isolated from the cotton genome. To demonstrate the specificity of the GhADF7 promoter, the 5'-flanking region, including the promoter and 5'-untranslated region, was fused with the GUS gene. Histochemical assays demonstrated that the GhADF7:GUS gene was specifically expressed in pollen grains. When pollen grains germinated, very strong GUS staining was detected in the elongating pollen tube. Furthermore, overexpression of GhADF7 gene in Arabidopsis thaliana reduced the viable pollen grains and, consequently, transgenic plants were partially male-sterile. Overexpression of GhADF7 in fission yeast (Schizosaccharomyces pombe) altered the balance of actin depolymerization and polymerization, leading to the defective cytokinesis and multinucleate formation in the cells. Given all the above results together, it is proposed that the GhADF7 gene may play an important role in pollen development and germination.

  4. Familial aggregation analysis of gene expressions

    PubMed Central

    Rao, Shao-Qi; Xu, Liang-De; Zhang, Guang-Mei; Li, Xia; Li, Lin; Shen, Gong-Qing; Jiang, Yang; Yang, Yue-Ying; Gong, Bin-Sheng; Jiang, Wei; Zhang, Fan; Xiao, Yun; Wang, Qing K

    2007-01-01

    Traditional studies of familial aggregation are aimed at defining the genetic (and non-genetic) causes of a disease from physiological or clinical traits. However, there has been little attempt to use genome-wide gene expressions, the direct phenotypic measures of genes, as the traits to investigate several extended issues regarding the distributions of familially aggregated genes on chromosomes or in functions. In this study we conducted a genome-wide familial aggregation analysis by using the in vitro cell gene expressions of 3300 human autosome genes (Problem 1 data provided to Genetic Analysis Workshop 15) in order to answer three basic genetics questions. First, we investigated how gene expressions aggregate among different types (degrees) of relative pairs. Second, we conducted a bioinformatics analysis of highly familially aggregated genes to see how they are distributed on chromosomes. Third, we performed a gene ontology enrichment test of familially aggregated genes to find evidence to support their functional consensus. The results indicated that 1) gene expressions did aggregate in families, especially between sibs. Of 3300 human genes analyzed, there were a total of 1105 genes with one or more significant (empirical p < 0.05) familial correlation; 2) there were several genomic hot spots where highly familially aggregated genes (e.g., the chromosome 6 HLA genes cluster) were clustered; 3) as we expected, gene ontology enrichment tests revealed that the 1105 genes were aggregating not only in families but also in functional categories. PMID:18466548

  5. The insect SNMP gene family.

    PubMed

    Vogt, Richard G; Miller, Natalie E; Litvack, Rachel; Fandino, Richard A; Sparks, Jackson; Staples, Jon; Friedman, Robert; Dickens, Joseph C

    2009-07-01

    SNMPs are membrane proteins observed to associate with chemosensory neurons in insects; in Drosophila melanogaster, SNMP1 has been shown to be essential for the detection of the pheromone cis-vaccenyl acetate (CVA). SNMPs are one of three insect gene clades related to the human fatty acid transporter CD36. We previously characterized the CD36 gene family in 4 insect Orders that effectively cover the Holometabola, or some 80% of known insect species and the 300 million years of evolution since this lineage emerged: Lepidoptera (e.g. Bombyx mori, Antheraea polyphemus, Manduca sexta, Heliothis virescens, Helicoverpa assulta, Helicoverpa armigera, Mamestra brassicae); Diptera (D. melanogaster, Drosophila pseudoobscura, Aedes aegypti, Anopheles gambiae, Culex pipiens quinquefasciatus); Hymenoptera (Apis mellifera); and Coleoptera (Tribolium castaneum). This previous study suggested a complex topography within the SNMP clade including a strongly supported SNMP1 sub-clade plus additional SNMP genes. To further resolve the SNMP clade here, we used cDNA sequences of SNMP1 and SNMP2 from various Lepidoptera species, D. melanogaster and Ae. aegypti, as well as BAC derived genomic sequences from Ae. aegypti as models for proposing corrected sequences of orthologues in the D. pseudoobscura and An. gambiae genomes, and for identifying orthologues in the B. mori and C. pipiens q. genomes. We then used these sequences to analyze the SNMP clade of the insect CD36 gene family, supporting the existence of two well supported sub-clades, SNMP1 and SNMP2, throughout the dipteran and lepidopteran lineages, and plausibly throughout the Holometabola and across a broad evolutionary time scale. We present indirect evidence based on evolutionary selection (dN/dS) that the dipteran SNMPs are expressed as functional proteins. We observed expansions of the SNMP1 sub-clade in C. pipiens q. and T. castaneum suggesting that the SNMP1s may have an expanded functional role in these species.

  6. A new member of the Rho family, Rnd1, promotes disassembly of actin filament structures and loss of cell adhesion.

    PubMed

    Nobes, C D; Lauritzen, I; Mattei, M G; Paris, S; Hall, A; Chardin, P

    1998-04-06

    Members of the Rho GTPase family regulate the organization of the actin cytoskeleton in response to extracellular growth factors. We have identified three proteins that form a distinct branch of the Rho family: Rnd1, expressed mostly in brain and liver; Rnd2, highly expressed in testis; and Rnd3/RhoE, showing a ubiquitous low expression. At the subcellular level, Rnd1 is concentrated at adherens junctions both in confluent fibroblasts and in epithelial cells. Rnd1 has a low affinity for GDP and spontaneously exchanges nucleotide rapidly in a physiological buffer. Furthermore, Rnd1 lacks intrinsic GTPase activity suggesting that in vivo, it might be constitutively in a GTP-bound form. Expression of Rnd1 or Rnd3/RhoE in fibroblasts inhibits the formation of actin stress fibers, membrane ruffles, and integrin-based focal adhesions and induces loss of cell-substrate adhesion leading to cell rounding (hence Rnd for "round"). We suggest that these proteins control rearrangements of the actin cytoskeleton and changes in cell adhesion.

  7. Polymorphism in the Alpha Cardiac Muscle Actin 1 Gene Is Associated to Susceptibility to Chronic Inflammatory Cardiomyopathy

    PubMed Central

    Frade, Amanda Farage; Teixeira, Priscila Camilo; Ianni, Barbara Maria; Pissetti, Cristina Wide; Saba, Bruno; Wang, Lin Hui Tzu; Kuramoto, Andréia; Nogueira, Luciana Gabriel; Buck, Paula; Dias, Fabrício; Giniaux, Helene; Llored, Agnes; Alves, Sthefanny; Schmidt, Andre; Donadi, Eduardo; Marin-Neto, José Antonio; Hirata, Mario; Sampaio, Marcelo; Fragata, Abílio; Bocchi, Edimar Alcides; Stolf, Antonio Noedir; Fiorelli, Alfredo Inacio; Santos, Ronaldo Honorato Barros; Rodrigues, Virmondes; Pereira, Alexandre Costa; Kalil, Jorge; Cunha-Neto, Edecio; Chevillard, Christophe

    2013-01-01

    Aims Chagas disease, caused by the protozoan Trypanosoma cruzi is endemic in Latin America, and may lead to a life-threatening inflammatory dilated, chronic Chagas cardiomyopathy (CCC). One third of T. cruzi-infected individuals progress to CCC while the others remain asymptomatic (ASY). A possible genetic component to disease progression was suggested by familial aggregation of cases and the association of markers of innate and adaptive immunity genes with CCC development. Since mutations in multiple sarcomeric genes, including alpha-cardiac actin (ACTC1) have been involved in hereditary dilated cardiomyopathy, we investigated the involvement of the ACTC1 gene in CCC pathogenesis. Methods and Results We conducted a proteomic and genetic study on a Brazilian study population. The genetic study was done on a main cohort including 118 seropositive asymptomatic subjects and 315 cases and the replication was done on 36 asymptomatic and 102 CCC cases. ACTC1 protein and mRNA levels were lower in myocardial tissue from patients with end-stage CCC than those found in hearts from organ donors. Genotyping a case-control cohort of CCC and ASY subjects for all informative single nucleotide polymorphism (SNP) in the ACTC1 gene identified rs640249 SNP, located at the 5’ region, as associated to CCC. Associations are borderline after correction for multiple testing. Correlation and haplotype analysis led to the identification of a susceptibility haplotype. Functional assays have shown that the rs640249A/C polymorphism affects the binding of transcriptional factors in the promoter regions of the ACTC1 gene. Confirmation of the detected association on a larger independent replication cohort will be useful. Conclusions Genetic variations at the ACTC1 gene may contribute to progression to chronic Chagas Cardiomyopathy among T. cruzi-infected patients, possibly by modulating transcription factor binding to ACTC1 promoter regions. PMID:24367596

  8. Identification of two nuclear factor-binding domains on the chicken cardiac actin promoter: implications for regulation of the gene.

    PubMed Central

    Quitschke, W W; DePonti-Zilli, L; Lin, Z Y; Paterson, B M

    1989-01-01

    The cis-acting regions that appear to be involved in negative regulation of the chicken alpha-cardiac actin promoter both in vivo and in vitro have been identified. A nuclear factor(s) binding to the proximal region mapped over the TATA element between nucleotides -50 and -25. In the distal region, binding spanned nucleotides -136 to -112, a region that included a second CArG box (CArG2) 5' to the more familiar CCAAT-box (CArG1) consensus sequence. Nuclear factors binding to these different domains were found in both muscle and nonmuscle preparations but were detectable at considerably lower levels in tissues expressing the alpha-cardiac actin gene. In contrast, concentrations of the beta-actin CCAAT-box binding activity were similar in all extracts tested. The role of these factor-binding domains on the activity of the cardiac actin promoter in vivo and in vitro and the prevalence of the binding factors in nonmuscle extracts are consistent with the idea that these binding domains and their associated factors are involved in the tissue-restricted expression of cardiac actin through both positive and negative regulatory mechanisms. In the absence of negative regulatory factors, these same binding domains act synergistically, via other factors, to activate the cardiac actin promoter during myogenesis. Images PMID:2552286

  9. Inhibition of FSS-induced actin cytoskeleton reorganization by silencing LIMK2 gene increases the mechanosensitivity of primary osteoblasts.

    PubMed

    Yang, Zhi; Tan, Shuyi; Shen, Yun; Chen, Rui; Wu, Changjing; Xu, Yajuan; Song, Zijun; Fu, Qiang

    2015-05-01

    Mechanical stimulation plays an important role in bone cell metabolic activity. However, bone cells lose their mechanosensitivity upon continuous mechanical stimulation (desensitization) and they can recover the sensitivity with insertion of appropriate rest period into the mechanical loading profiles. The concrete molecular mechanism behind the regulation of cell mechanosensitivity still remains unclear. As one kind of mechanosensitive cell to react to the mechanical stimulation, osteoblasts respond to fluid shear stress (FSS) with actin cytoskeleton reorganization, and the remodeling of actin cytoskeleton is closely associated with the alteration of cell mechanosensitivity. In order to find out whether inhibiting the actin cytoskeleton reorganization by silencing LIM-kinase 2 (LIMK2) gene would increase the mechanosensitivity of primary osteoblasts, we attenuated the formation of actin stress fiber under FSS in a more specific way: inhibiting the LIMK2 expression by RNA interference. We found that inhibition of LIMK2 expression by RNA interference attenuated the formation of FSS-induced actin stress fiber, and simultaneously maintained the integrity of actin cytoskeleton in primary osteoblasts. We confirmed that the decreased actin cytoskeleton reorganization in response to LIMK2 inhibition during FSS increased the mechanosensitivity of the osteoblasts, based on the increased c-Fos and COX-2 expression as well as the enhanced proliferative activity in response to FSS. These data suggest that osteoblasts can increase their mechanosensitivity under continuous mechanical stimulation by reducing the actin stress fiber formation through inhibiting the LIMK2 expression. This study provides us with a new and more specific method to regulate the osteoblast mechanosensitivity, and also a new therapeutic target to cure bone related diseases, which is of importance in maintaining bone mass and promoting osteogenesis.

  10. Leiomodins: larger members of the tropomodulin (Tmod) gene family

    NASA Technical Reports Server (NTRS)

    Conley, C. A.; Fritz-Six, K. L.; Almenar-Queralt, A.; Fowler, V. M.

    2001-01-01

    The 64-kDa autoantigen D1 or 1D, first identified as a potential autoantigen in Graves' disease, is similar to the tropomodulin (Tmod) family of actin filament pointed end-capping proteins. A novel gene with significant similarity to the 64-kDa human autoantigen D1 has been cloned from both humans and mice, and the genomic sequences of both genes have been identified. These genes form a subfamily closely related to the Tmods and are here named the Leiomodins (Lmods). Both Lmod genes display a conserved intron-exon structure, as do three Tmod genes, but the intron-exon structure of the Lmods and the Tmods is divergent. mRNA expression analysis indicates that the gene formerly known as the 64-kDa autoantigen D1 is most highly expressed in a variety of human tissues that contain smooth muscle, earning it the name smooth muscle Leiomodin (SM-Lmod; HGMW-approved symbol LMOD1). Transcripts encoding the novel Lmod gene are present exclusively in fetal and adult heart and adult skeletal muscle, and it is here named cardiac Leiomodin (C-Lmod; HGMW-approved symbol LMOD2). Human C-Lmod is located near the hypertrophic cardiomyopathy locus CMH6 on human chromosome 7q3, potentially implicating it in this disease. Our data demonstrate that the Lmods are evolutionarily related and display tissue-specific patterns of expression distinct from, but overlapping with, the expression of Tmod isoforms. Copyright 2001 Academic Press.

  11. Lineage-Specific Expansion of IFIT Gene Family: An Insight into Coevolution with IFN Gene Family

    PubMed Central

    Liu, Ying; Zhang, Yi-Bing; Liu, Ting-Kai; Gui, Jian-Fang

    2013-01-01

    In mammals, IFIT (Interferon [IFN]-induced proteins with Tetratricopeptide Repeat [TPR] motifs) family genes are involved in many cellular and viral processes, which are tightly related to mammalian IFN response. However, little is known about non-mammalian IFIT genes. In the present study, IFIT genes are identified in the genome databases from the jawed vertebrates including the cartilaginous elephant shark but not from non-vertebrates such as lancelet, sea squirt and acorn worm, suggesting that IFIT gene family originates from a vertebrate ancestor about 450 million years ago. IFIT family genes show conserved gene structure and gene arrangements. Phylogenetic analyses reveal that this gene family has expanded through lineage-specific and species-specific gene duplication. Interestingly, IFN gene family seem to share a common ancestor and a similar evolutionary mechanism; the function link of IFIT genes to IFN response is present early since the origin of both gene families, as evidenced by the finding that zebrafish IFIT genes are upregulated by fish IFNs, poly(I:C) and two transcription factors IRF3/IRF7, likely via the IFN-stimulated response elements (ISRE) within the promoters of vertebrate IFIT family genes. These coevolution features creates functional association of both family genes to fulfill a common biological process, which is likely selected by viral infection during evolution of vertebrates. Our results are helpful for understanding of evolution of vertebrate IFN system. PMID:23818968

  12. The skeletal muscle alpha-actin gene of channel catfish (Ictalurus punctatus) and its association with piscine specific SINE elements.

    PubMed

    Kim, S; Karsi, A; Dunham, R A; Liu, Z

    2000-07-11

    The alpha-actin gene of channel catfish (Ictalurus punctatus) was cloned and sequenced. The gene has a similar organization and exhibited a high level of sequence similarity to those from other vertebrate animals. The upstream region of the alpha-actin gene included a TATA box, a CAAT box, three E-boxes, and a CArG box. Nested deletion segments containing these transcriptional motifs were fused to the reporter gene chloramphenicol acetyl transferase (CAT). Transfection of the clones into C2C12 cells indicated that all these motifs are required for transcriptional activities. The channel catfish alpha-actin gene is associated with two distinct short interspersed repetitive elements (SINEs). The first SINE element showed high levels of sequence similarity to the zebrafish Mermaid element, while the second SINE element is not similar to the Mermaid element except for an 8bp sequence CCCCGTGC suggesting their evolutionary linkage. However, the second SINE element appeared to co-exist with the Mermaid element in most cases and therefore was designated as the Merman element. Approximately 9000 copies and 1200 copies of the Mermaid and Merman elements exist per haploid channel catfish genome, respectively. BLAST searches indicated that both the Mermaid and the Merman elements were frequently associated with gene sequences, mostly those of aquatic animals, suggesting their evolutionary origin in association with aquatic organisms and their function in shaping the evolution of genomes in aquatic animals.

  13. The actin gene ACT1 is required for phagocytosis, motility, and cell separation of Tetrahymena thermophila.

    PubMed

    Williams, Norman E; Tsao, Che-Chia; Bowen, Josephine; Hehman, Gery L; Williams, Ruth J; Frankel, Joseph

    2006-03-01

    A previously identified Tetrahymena thermophila actin gene (C. G. Cupples and R. E. Pearlman, Proc. Natl. Acad. Sci. USA 83:5160-5164, 1986), here called ACT1, was disrupted by insertion of a neo3 cassette. Cells in which all expressed copies of this gene were disrupted exhibited intermittent and extremely slow motility and severely curtailed phagocytic uptake. Transformation of these cells with inducible genetic constructs that contained a normal ACT1 gene restored motility. Use of an epitope-tagged construct permitted visualization of Act1p in the isolated axonemes of these rescued cells. In ACT1Delta mutant cells, ultrastructural abnormalities of outer doublet microtubules were present in some of the axonemes. Nonetheless, these cells were still able to assemble cilia after deciliation. The nearly paralyzed ACT1Delta cells completed cleavage furrowing normally, but the presumptive daughter cells often failed to separate from one another and later became reintegrated. Clonal analysis revealed that the cell cycle length of the ACT1Delta cells was approximately double that of wild-type controls. Clones could nonetheless be maintained for up to 15 successive fissions, suggesting that the ACT1 gene is not essential for cell viability or growth. Examination of the cell cortex with monoclonal antibodies revealed that whereas elongation of ciliary rows and formation of oral structures were normal, the ciliary rows of reintegrated daughter cells became laterally displaced and sometimes rejoined indiscriminately across the former division furrow. We conclude that Act1p is required in Tetrahymena thermophila primarily for normal ciliary motility and for phagocytosis and secondarily for the final separation of daughter cells.

  14. Structure and function analysis of the CMS/CIN85 protein family identifies actin-bundling properties and heterotypic-complex formation.

    PubMed

    Gaidos, Gabriel; Soni, Shefali; Oswald, Duane J; Toselli, Paul A; Kirsch, Kathrin H

    2007-07-15

    Members of the CMS/CIN85 protein family participate in clathrin-mediated endocytosis and play a crucial role in maintaining the kidney filtration barrier. The CMS protein structure includes three Src homology 3 (SH3) domains and a proline-rich (PR) region that is connected by a 'linker' sequence to a coiled-coil (CC) domain. We show that CMS is a component of special actin-rich adhesion structures--podosomes--and demonstrate specific actin-binding properties of CMS. We have found that the entire C-terminal half of CMS is necessary for efficient binding to filamentous actin (F-actin). CMS and CIN85 can crosslink F-actin into bundles, a function that depends on the PR region and the CC domain. Removal of these domains reduces migration. CMS can also form heterotypic complexes with CIN85. CIN85 is expressed as multiple isoforms that share the CC domain, suggesting that heterotypic interactions with CMS provides a mechanism to regulate CMS binding to F-actin and thus for modulating dynamic rearrangements of the cytoskeleton.

  15. Nuclear role of WASp in gene transcription is uncoupled from its ARP2/3-dependent cytoplasmic role in actin polymerization.

    PubMed

    Sadhukhan, Sanjoy; Sarkar, Koustav; Taylor, Matthew; Candotti, Fabio; Vyas, Yatin M

    2014-07-01

    Defects in Wiskott-Aldrich Syndrome protein (WASp) underlie development of WAS, an X-linked immunodeficiency and autoimmunity disorder of childhood. Nucleation-promoting factors (NPFs) of the WASp family generate F-actin in the cytosol via the VCA (verprolin-homology, cofilin-homology, and acidic) domain and support RNA polymerase II-dependent transcription in the nucleus. Whether nuclear-WASp requires the integration of its actin-related protein (ARP)2/3-dependent cytoplasmic function to reprogram gene transcription, however, remains unresolved. Using the model of human TH cell differentiation, we find that WASp has a functional nuclear localizing and nuclear exit sequences, and accordingly, its effects on transcription are controlled mainly at the level of its nuclear entry and exit via the nuclear pore. Human WASp does not use its VCA-dependent, ARP2/3-driven, cytoplasmic effector mechanisms to support histone H3K4 methyltransferase activity in the nucleus of TH1-skewed cells. Accordingly, an isolated deficiency of nuclear-WASp is sufficient to impair the transcriptional reprogramming of TBX21 and IFNG promoters in TH1-skewed cells, whereas an isolated deficiency of cytosolic-WASp does not impair this process. In contrast, nuclear presence of WASp in TH2-skewed cells is small, and its loss does not impair transcriptional reprogramming of GATA3 and IL4 promoters. Our study unveils an ARP2/3:VCA-independent function of nuclear-WASp in TH1 gene activation that is uncoupled from its cytoplasmic role in actin polymerization.

  16. Increased expression of a plant actin gene during a biotrophic interaction between round-leaved mallow, Malva pusilla, and Colletotrichum gloeosporioides f. sp. malvae.

    PubMed

    Jin, S; Xu, R; Wei, Y; Goodwin, P H

    1999-10-01

    Two actin genes, actA from the hemibiotrophic anthracnose fungus, Colletotrichum gloeosporioides (Penz.) Penz. & Sacc. f. sp. malvae, and act1 from its host, Malva pusilla (Sm.) were cloned from a cDNA library developed from infected host tissue. The actin gene, actA, of C. gloeosporioides f. sp. malvae, which is similar to that of other euascomycetes, appears to be expressed constitutively. The actin gene of M. pusilla is most similar to one of the actin genes of Arabidopsis thaliana that is unique in being responsive to environmental stimuli such as wounding. Expression of actA was used to follow the growth of the fungus in the plant tissue. Low actA expression occurred until 72-96 h after inoculation and then increased rapidly, corresponding with the timing of the shift from slower biotrophic fungal growth to much more rapid necrotrophic growth. In contrast, expression of act1 approximately doubled during the biotrophic phase and then rapidly declined during the necrotrophic phase. Increased host actin expression could be due to host cytoskeleton rearrangement in response to biotrophic infection, and the subsequent decrease in host actin expression could be due to host cell disruption resulting from tissue maceration during necrosis. This is the first report of a host actin gene that can increase in expression during a compatible plant-pathogen interaction.

  17. The β-actin gene promoter of rohu carp (Labeo rohita) drives reporter gene expressions in transgenic rohu and various cell lines, including spermatogonial stem cells.

    PubMed

    Barman, Hirak Kumar; Mohanta, Ramya; Patra, Swagat Kumar; Chakrapani, Vemulawada; Panda, Rudra Prasanna; Nayak, Swapnarani; Jena, Sasmita; Jayasankar, Pallipuram; Nandanpawar, Priyanka

    2015-06-01

    We previously characterized the β-actin gene promoter of Indian domesticated rohu carp (Labeo rohita) and made a reporter construct via fusion to green fluorescence protein (GFP) cDNA. In this study, the same construct was used to breed transgenic rohu fish. About 20% of the transgenic offspring showed ubiquitous expression of the reporter GFP gene. In a few of the transgenic fish, we documented massive epithelial and/or muscular expression with visible green color under normal light. The expression of GFP mRNA was higher in the muscle tissue of transgenic fish than in that of non-transgenic fish. A highly efficient nucleofection protocol was optimized to transfect proliferating spermatogonial cells of rohu using this reporter construct. The β-actin promoter also drove expressions in HEK293 (derived from human embryonic kidney cells), K562 (human leukemic cells) and SF21 (insect ovarian cells) lines. These findings imply conserved regulatory mechanisms of β-actin gene expression across eukaryotes. Furthermore, the isolated β-actin promoter with consensus regulatory elements has the potential to be used in generating transgenic carp with genes of interest and in basic biology research.

  18. Metazoan Gene Families from Metazome

    DOE Data Explorer

    Metazome is a joint project of the Department of Energy's Joint Genome Institute and the Center for Integrative Genomics to facilitate comparative genomic studies amongst metazoans. Clusters of orthologous and paralogous genes that represent the modern descendents of ancestral gene sets are constructed at key phylogenetic nodes. These clusters allow easy access to clade specific orthology/paralogy relationships as well as clade specific genes and gene expansions. As of version 2.0.4, Metazome provides access to twenty-four sequenced and annotated metazoan genomes, clustered at nine evolutionarily significant nodes. Where possible, each gene has been annotated with PFAM, KOG, KEGG, and PANTHER assignments, and publicly available annotations from RefSeq, UniProt, Ensembl, and JGI are hyper-linked and searchable. The included organisms (by common name) are: Human, Mouse, Rat, Dog, Opossum, Chicken, Frog, Stickleback, Medaka, Fugu pufferfish; Zebrafish, Seasquirt - savignyi, Seasquirt - intestinalis, Amphioxus, Sea Urchin, Fruitfly, Mosquite, Yellow Fever Mosquito, Silkworm, Red Flour Beetle, Worm, Briggsae Worm, Owl limpet (snail), and Sea anemone. [Copied from Metazome Overview at http://www.metazome.net/Metazome_info.php

  19. Screens for Extragenic Mutations That Fail to Complement Act1 Alleles Identify Genes That Are Important for Actin Function in Saccharomyces Cerevisiae

    PubMed Central

    Welch, M. D.; Vinh, DBN.; Okamura, H. H.; Drubin, D. G.

    1993-01-01

    Null mutations in SAC6 and ABP1, genes that encode actin-binding proteins, failed to complement the temperature-sensitive phenotype caused by a mutation in the ACT1 gene. To identify novel genes whose protein products interact with actin, mutations that fail to complement act1-1 or act1-4, two temperature-sensitive alleles of ACT1, were isolated. A total of 14 extragenic noncomplementing mutations and 12 new alleles of ACT1 were identified in two independent screens. The 14 extragenic noncomplementing mutations represent alleles of at least four different genes, ANC1, ANC2, ANC3 and ANC4 (Actin NonComplementing). Mutations in the ANC1 gene were shown to cause osmosensitivity and defects in actin organization; phenotypes that are similar to those caused by act1 mutations. We conclude that the ANC1 gene product plays an important role in actin cytoskeletal function. The 12 new alleles of ACT1 will be useful for further elucidation of the functions of actin in yeast. PMID:8243992

  20. Family reunion--the ZIP/prion gene family.

    PubMed

    Ehsani, Sepehr; Huo, Hairu; Salehzadeh, Ashkan; Pocanschi, Cosmin L; Watts, Joel C; Wille, Holger; Westaway, David; Rogaeva, Ekaterina; St George-Hyslop, Peter H; Schmitt-Ulms, Gerold

    2011-03-01

    Prion diseases are fatal neurodegenerative diseases of humans and animals which, in addition to sporadic and familial modes of manifestation, can be acquired via an infectious route of propagation. In disease, the prion protein (PrP(C)) undergoes a structural transition to its disease-causing form (PrP(Sc)) with profoundly different physicochemical properties. Surprisingly, despite intense interest in the prion protein, its function in the context of other cellular activities has largely remained elusive. We recently employed quantitative mass spectrometry to characterize the interactome of the prion protein in a murine neuroblastoma cell line (N2a), an established cell model for prion replication. Extensive bioinformatic analyses subsequently established an evolutionary link between the prion gene family and the family of ZIP (Zrt-, Irt-like protein) metal ion transporters. More specifically, sequence alignments, structural threading data and multiple additional pieces of evidence placed a ZIP5/ZIP6/ZIP10-like ancestor gene at the root of the PrP gene family. In this review we examine the biology of prion proteins and ZIP transporters from the viewpoint of a shared phylogenetic origin. We summarize and compare available data that shed light on genetics, function, expression, signaling, post-translational modifications and metal binding preferences of PrP and ZIP family members. Finally, we explore data indicative of retropositional origins of the prion gene founder and discuss a possible function for the prion-like (PL) domain within ZIP transporters. While throughout the article emphasis is placed on ZIP proteins, the intent is to highlight connections between PrP and ZIP transporters and uncover promising directions for future research.

  1. The human crystallin gene families

    PubMed Central

    2012-01-01

    Crystallins are the abundant, long-lived proteins of the eye lens. The major human crystallins belong to two different superfamilies: the small heat-shock proteins (α-crystallins) and the βγ-crystallins. During evolution, other proteins have sometimes been recruited as crystallins to modify the properties of the lens. In the developing human lens, the enzyme betaine-homocysteine methyltransferase serves such a role. Evolutionary modification has also resulted in loss of expression of some human crystallin genes or of specific splice forms. Crystallin organization is essential for lens transparency and mutations; even minor changes to surface residues can cause cataract and loss of vision. PMID:23199295

  2. Functional analysis of the promoter region of amphioxus β-actin gene: a useful tool for driving gene expression in vivo.

    PubMed

    Feng, Jun; Li, Guang; Liu, Xin; Wang, Jing; Wang, Yi-Quan

    2014-10-01

    Amphioxus is a promising new animal model for developmental biology. To develop molecular tools for this model, we characterized the promoter region of a cytoplasmic β-actin gene (Bb-actin-6-2) from the Chinese amphioxus Branchiostoma belcheri. In situ hybridization and real time-quantitative PCR analyses showed that this gene is expressed in many tissues throughout embryonic development. Cloning of cDNA revealed two isoforms with distinct transcription start sites. Isoform #1 exhibits a similar exon/intron and regulatory element organization to that of vertebrate β-actin, whereas isoform #2 lacks the first exon of isoform #1 and recruits its first intron as a promoter. The activities of upstream promoter regions in the two isoforms were examined using the lacZ reporter system in amphioxus embryos. The proximal promoter of isoform #1 drove reporter gene expression broadly in 58.6 % of injected embryos. That of isoform #2 exhibited much higher activity (91.5 %) than that of isoform #1 or the human EF-1-α gene (38.2 %). We determined the minimal promoter regions of the two isoforms via functional analysis. These two regions, alone or inserted a random DNA fragment upstream, had no detectable activity, but when an upstream enhancer was inserted, the promoters directed reporter gene expression in 61.0 and 93.8 %, respectively, of injected embryos in a tissue-specific manner. Our study not only provides insight into the regulatory mechanism underlying amphioxus Bb-actin-6-2 gene expression, but also identifies two sets of efficient proximal and minimal promoters. These promoters could be used to construct gene expression vectors for transgenic studies using amphioxus as a model.

  3. Moesin, ezrin, and p205 are actin-binding proteins associated with neutrophil plasma membranes.

    PubMed Central

    Pestonjamasp, K; Amieva, M R; Strassel, C P; Nauseef, W M; Furthmayr, H; Luna, E J

    1995-01-01

    Actin-binding proteins in bovine neutrophil plasma membranes were identified using blot overlays with 125I-labeled F-actin. Along with surface-biotinylated proteins, membranes were enriched in major actin-binding polypeptides of 78, 81, and 205 kDa. Binding was specific for F-actin because G-actin did not bind. Further, unlabeled F-actin blocked the binding of 125I-labeled F-actin whereas other acidic biopolymers were relatively ineffective. Binding also was specifically inhibited by myosin subfragment 1, but not by CapZ or plasma gelsolin, suggesting that the membrane proteins, like myosin, bind along the sides of the actin filaments. The 78- and 81-kDa polypeptides were identified as moesin and ezrin, respectively, by co-migration on sodium dodecyl sulfate-polyacrylamide gel electrophoresis and immunoprecipitation with antibodies specific for moesin and ezrin. Although not present in detectable amounts in bovine neutrophils, radixin (a third and closely related member of this gene family) also bound 125I-labeled F-actin on blot overlays. Experiments with full-length and truncated bacterial fusion proteins localized the actin-binding site in moesin to the extreme carboxy terminus, a highly conserved sequence. Immunofluorescence micrographs of permeabilized cells and cell "footprints" showed moesin co-localization with actin at the cytoplasmic surface of the plasma membrane, consistent with a role as a membrane-actin-linking protein. Images PMID:7612961

  4. Actinic keratosis

    MedlinePlus

    Solar keratosis; Sun-induced skin changes - keratosis; Keratosis - actinic (solar); Skin lesion - actinic keratosis ... likely to develop it if you: Have fair skin, blue or green eyes, or blond or red ...

  5. Correlation between the structure and biochemical activities of FtsA, an essential cell division protein of the actin family.

    PubMed Central

    Sánchez, M; Valencia, A; Ferrándiz, M J; Sander, C; Vicente, M

    1994-01-01

    Cell division protein FtsA, predicted to belong to the actin family, is present in different cell compartments depending on its phosphorylation state. The FtsA fraction isolated from the cytoplasm is phosphorylated and capable of binding ATP, while the membrane-bound form is unphosphorylated and does not bind ATP. A variant of the protein FtsA102, in which the nucleotide binding site was destroyed by mutagenesis of a highly conserved residue predicted to be needed for the binding, does not bind ATP. Another variant, FtsA104, cannot be phosphorylated because the predicted phosphorylatable residue has been replaced by a non-phosphorylatable one. This protein although unable to bind ATP in vitro, is able to rescue the reversible ftsA2, the irreversible ftsA3 and, almost with the same efficiency, the ftsA16 amber alleles. Consequently, phosphorylation and ATP binding may not be essential for the function of FtsA. Alternatively they may have a regulatory role on the action of FtsA in the septator. Images PMID:7957059

  6. Correlation between the structure and biochemical activities of FtsA, an essential cell division protein of the actin family.

    PubMed

    Sánchez, M; Valencia, A; Ferrándiz, M J; Sander, C; Vicente, M

    1994-10-17

    Cell division protein FtsA, predicted to belong to the actin family, is present in different cell compartments depending on its phosphorylation state. The FtsA fraction isolated from the cytoplasm is phosphorylated and capable of binding ATP, while the membrane-bound form is unphosphorylated and does not bind ATP. A variant of the protein FtsA102, in which the nucleotide binding site was destroyed by mutagenesis of a highly conserved residue predicted to be needed for the binding, does not bind ATP. Another variant, FtsA104, cannot be phosphorylated because the predicted phosphorylatable residue has been replaced by a non-phosphorylatable one. This protein although unable to bind ATP in vitro, is able to rescue the reversible ftsA2, the irreversible ftsA3 and, almost with the same efficiency, the ftsA16 amber alleles. Consequently, phosphorylation and ATP binding may not be essential for the function of FtsA. Alternatively they may have a regulatory role on the action of FtsA in the septator.

  7. Gene-Family Extension Measures and Correlations

    PubMed Central

    Carmi, Gon; Bolshoy, Alexander

    2016-01-01

    The existence of multiple copies of genes is a well-known phenomenon. A gene family is a set of sufficiently similar genes, formed by gene duplication. In earlier works conducted on a limited number of completely sequenced and annotated genomes it was found that size of gene family and size of genome are positively correlated. Additionally, it was found that several atypical microbes deviated from the observed general trend. In this study, we reexamined these associations on a larger dataset consisting of 1484 prokaryotic genomes and using several ranking approaches. We applied ranking methods in such a way that genomes with lower numbers of gene copies would have lower rank. Until now only simple ranking methods were used; we applied the Kemeny optimal aggregation approach as well. Regression and correlation analysis were utilized in order to accurately quantify and characterize the relationships between measures of paralog indices and genome size. In addition, boxplot analysis was employed as a method for outlier detection. We found that, in general, all paralog indexes positively correlate with an increase of genome size. As expected, different groups of atypical prokaryotic genomes were found for different types of paralog quantities. Mycoplasmataceae and Halobacteria appeared to be among the most interesting candidates for further research of evolution through gene duplication. PMID:27527218

  8. The glutamine synthetase gene family in Populus

    PubMed Central

    2011-01-01

    Background Glutamine synthetase (GS; EC: 6.3.1.2, L-glutamate: ammonia ligase ADP-forming) is a key enzyme in ammonium assimilation and metabolism of higher plants. The current work was undertaken to develop a more comprehensive understanding of molecular and biochemical features of GS gene family in poplar, and to characterize the developmental regulation of GS expression in various tissues and at various times during the poplar perennial growth. Results The GS gene family consists of 8 different genes exhibiting all structural and regulatory elements consistent with their roles as functional genes. Our results indicate that the family members are organized in 4 groups of duplicated genes, 3 of which code for cytosolic GS isoforms (GS1) and 1 which codes for the choroplastic GS isoform (GS2). Our analysis shows that Populus trichocarpa is the first plant species in which it was observed the complete GS family duplicated. Detailed expression analyses have revealed specific spatial and seasonal patterns of GS expression in poplar. These data provide insights into the metabolic function of GS isoforms in poplar and pave the way for future functional studies. Conclusions Our data suggest that GS duplicates could have been retained in order to increase the amount of enzyme in a particular cell type. This possibility could contribute to the homeostasis of nitrogen metabolism in functions associated to changes in glutamine-derived metabolic products. The presence of duplicated GS genes in poplar could also contribute to diversification of the enzymatic properties for a particular GS isoform through the assembly of GS polypeptides into homo oligomeric and/or hetero oligomeric holoenzymes in specific cell types. PMID:21867507

  9. Trichosanthin-induced specific changes of cytoskeleton configuration were associated with the decreased expression level of actin and tubulin genes in apoptotic Hela cells.

    PubMed

    Wang, Ping; Li, Ji-Cheng

    2007-09-15

    Trichosanthin (TCS) possesses a broad spectrum of biological and pharmacological activities, including anti-cancer activities through apoptosis pathway. However, little is known about the effects of TCS on the cytoskeleton configuration and expression of actin and tubulin genes in Hela cell apoptosis. In the present study, apoptotic cytoskeleton structures were observed by confocal immunofluorescence microscopy, absolute amounts of actin and tubulin subunit mRNAs were determined by quantitative real-time PCR assays (QRT-PCR). Our results showed that the execution phase of cell apoptosis was a highly coordinated process of cellular reorganization, depolymerized microfilaments (MFs) accumulated in the coarsened cytoplasm and apoptotic bodies, followed by the formation of a ring microtubule (MT) structure beneath the plasma membrane. Importantly, apoptosis occurred by a suppression of actin and tubulin subunit gene expression. In particular, a rapid decrease in the amounts of gamma-actin mRNA preceded that of beta-actin; alpha- and beta-tubulin mRNAs were subsequently down-regulated in the later stage of Hela cell apoptosis. These results suggested that the execution of Hela cell apoptosis induced by TCS accompanied the specific changes of cytoskeleton configuration and, significantly, decreased the expression level of actin and tubulin subunit genes in different stages.

  10. Upregulation of alpha-skeletal muscle actin and myosin heavy polypeptide gene products in degenerating rotator cuff muscles.

    PubMed

    Fuchs, Bruno; Zumstein, Matthias; Regenfelder, Felix; Steinmann, Patrick; Fuchs, Thomas; Husmann, Knut; Hellermann, Jens; Jost, Bernhard; Hodler, Jürg; Born, Walter; Gerber, C

    2008-07-01

    Impaired function of shoulder muscles, resulting from rotator cuff tears, is associated with abnormal deposition of fat in muscle tissue, but corresponding cellular and molecular mechanisms, likely reflected by altered gene expression profiles, are largely unknown. Here, an analysis of muscle gene expression was carried out by semiquantitative RT-PCR in total RNA extracts of supraspinatus biopsies collected from 60 patients prior to shoulder surgery. A significant increase of alpha-skeletal muscle actin (p = 0.0115) and of myosin heavy polypeptide 1 (p = 0.0147) gene transcripts was observed in parallel with progressive fat deposition in the muscle, assessed on parasagittal T1-weighted turbo-spin-echo magnetic resonance images according to Goutallier. Upregulation of alpha-skeletal muscle actin and of myosin heavy polypeptide-1 has been reported to be associated with increased muscle tissue metabolism and oxidative stress. The findings of the present study, therefore, challenge the hypothesis that increased fat deposition in rotator cuff muscle after injury reflects muscle degeneration.

  11. Evolutionary history of the Asr gene family.

    PubMed

    Frankel, Nicolás; Carrari, Fernando; Hasson, Esteban; Iusem, Norberto D

    2006-08-15

    The Asr gene family is widespread in higher plants. Most Asr genes are up-regulated under different environmental stress conditions and during fruit ripening. ASR proteins are localized in the nucleus and their likely function is transcriptional regulation. In cultivated tomato, we identified a novel fourth family member, named Asr4, which maps close to its sibling genes Asr1-Asr2-Asr3 and displays an unshared region coding for a domain containing a 13-amino acid repeat. In this work we were able to expand our previous analysis for Asr2 and investigated the coding regions of the four known Asr paralogous genes in seven tomato species from different geographic locations. In addition, we performed a phylogenetic analysis on ASR proteins. The first conclusion drawn from this work is that tomato ASR proteins cluster together in the tree. This observation can be explained by a scenario of concerted evolution or birth and death of genes. Secondly, our study showed that Asr1 is highly conserved at both replacement and synonymous sites within the genus Lycopersicon. ASR1 protein sequence conservation might be associated with its multiple functions in different tissues while the low rate of synonymous substitutions suggests that silent variation in Asr1 is selectively constrained, which is probably related to its high expression levels. Finally, we found that Asr1 activation under water stress is not conserved between Lycopersicon species.

  12. NFAT Gene Family in Inflammation and Cancer

    PubMed Central

    Pan, M.-G.; Xiong, Y.; Chen, F.

    2013-01-01

    Calcineurin-NFAT signaling is critical for numerous aspects of vertebrate function during and after embryonic development. Initially discovered in T cells, the NFAT gene family, consisting of five members, regulates immune system, inflammatory response, angiogenesis, cardiac valve formation, myocardial development, axonal guidance, skeletal muscle development, bone homeostasis, development and metastasis of cancer, and many other biological processes. In this review we will focus on the NFAT literature relevant to the two closely related pathological systems: inflammation and cancer. PMID:22950383

  13. Quantitative analysis of dinoflagellates and diatoms community via Miseq sequencing of actin gene and v9 region of 18S rDNA

    PubMed Central

    Guo, Liliang; Sui, Zhenghong; Liu, Yuan

    2016-01-01

    Miseq sequencing and data analysis for the actin gene and v9 region of 18S rDNA of 7 simulated samples consisting of different mixture of dinoflagellates and diatoms were carried out. Not all the species were detectable in all the 18S v9 samples, and sequence percent in all the v9 samples were not consistent with the corresponding cell percent which may suggest that 18S rDNA copy number in different cells of these species differed greatly which result in the large deviation of the amplification. And 18S rDNA amplification of the microalgae was prone to be contaminated by fungus. The amplification of actin gene all was from the dinoflagellates because of its targeted degenerate primers. All the actin sequences of dinoflagellates were detected in the act samples except act4, and sequence percentage of the dinoflagellates in the act samples was not completely consistent with the dinoflagellates percentage of cell samples, but with certain amplification deviations. Indexes of alpha diversity of actin gene sequencing may be better reflection of community structure, and beta diversity analysis could cluster the dinoflagellates samples with identical or similar composition together and was distinguishable with blooming simulating samples at the generic level. Hence, actin gene was more proper than rDNA as the molecular marker for the community analysis of the dinoflagellates. PMID:27721499

  14. Synthetic lethality screen identifies a novel yeast myosin I gene (MYO5): myosin I proteins are required for polarization of the actin cytoskeleton

    PubMed Central

    1996-01-01

    The organization of the actin cytoskeleton plays a critical role in cell physiology in motile and nonmotile organisms. Nonetheless, the function of the actin based motor molecules, members of the myosin superfamily, is not well understood. Deletion of MYO3, a yeast gene encoding a "classic" myosin I, has no detectable phenotype. We used a synthetic lethality screen to uncover genes whose functions might overlap with those of MYO3 and identified a second yeast myosin 1 gene, MYO5. MYO5 shows 86 and 62% identity to MYO3 across the motor and non- motor regions. Both genes contain an amino terminal motor domain, a neck region containing two IQ motifs, and a tail domain consisting of a positively charged region, a proline-rich region containing sequences implicated in ATP-insensitive actin binding, and an SH3 domain. Although myo5 deletion mutants have no detectable phenotype, yeast strains deleted for both MYO3 and MYO5 have severe defects in growth and actin cytoskeletal organization. Double deletion mutants also display phenotypes associated with actin disorganization including accumulation of intracellular membranes and vesicles, cell rounding, random bud site selection, sensitivity to high osmotic strength, and low pH as well as defects in chitin and cell wall deposition, invertase secretion, and fluid phase endocytosis. Indirect immunofluorescence studies using epitope-tagged Myo5p indicate that Myo5p is localized at actin patches. These results indicate that MYO3 and MYO5 encode classical myosin I proteins with overlapping functions and suggest a role for Myo3p and Myo5p in organization of the actin cytoskeleton of Saccharomyces cerevisiae. PMID:8682864

  15. Actin evolution in ciliates (Protist, Alveolata) is characterized by high diversity and three duplication events.

    PubMed

    Yi, Zhenzhen; Huang, Lijuan; Yang, Ran; Lin, Xiaofeng; Song, Weibo

    2016-03-01

    Ciliates possess two distinct nuclear genomes and unique genomic features, including highly fragmented chromosomes and extensive chromosomal rearrangements. Recent transcriptomic surveys have revealed that ciliates have several multi-copy genes providing an ideal template to study gene family evolution. Nonetheless, this process remains little studied in ciliated protozoa and consequently, the evolutionary patterns that govern it are not well understood. In this study, we focused on obtaining fine-scale information relative to ciliate species divergence for the first time. A total of 230 actin gene sequences were derived from this study, among which 217 were from four closely related Pseudokeronopsis species and 13 from other hypotrichous ciliates. Our investigation shows that: (1) At least three duplication events occurred in ciliates: diversification of three actin genes (Actin I, II, III) happened after the divergence of ciliate classes but before that of subclasses. And several recent and genus-specific duplications were followed within Actin I (Sterkiella, Oxytricha, Uroleptus, etc.), Actin II (Sterkiella), respectively. (2) Within the genus Pseudokeronopsis, Actin I gene duplication events happened after P. carnea and P. erythrina diverged. In contrast, in the morphologically similar species P. flava and P. rubra, the duplication event preceded diversification of the two species. The Actin II gene duplication events preceded divergence of the genus Pseudokeronopsis. (3) Phylogenetic analyses revealed that actin is suitable for resolving ciliate classes, but may not be used to infer lower taxon relationships.

  16. Facioscapulohumeral muscular dystrophy region gene 1 is a dynamic RNA-associated and actin-bundling protein.

    PubMed

    Sun, Chia-Yun Jessica; van Koningsbruggen, Silvana; Long, Steven W; Straasheijm, Kirsten; Klooster, Rinse; Jones, Takako I; Bellini, Michel; Levesque, Lyne; Brieher, William M; van der Maarel, Silvère M; Jones, Peter L

    2011-08-12

    FSHD region gene 1 (FRG1) is a dynamic nuclear and cytoplasmic protein that, in skeletal muscle, shows additional localization to the sarcomere. Maintaining appropriate levels of FRG1 protein is critical for muscular and vascular development in vertebrates; however, its precise molecular function is unknown. This study investigates the molecular functions of human FRG1, along with mouse FRG1 and Xenopus frg1, using molecular, biochemical, and cellular-biological approaches, to provide further insight into its roles in vertebrate development. The nuclear fraction of the endogenous FRG1 is localized in nucleoli, Cajal bodies, and actively transcribed chromatin; however, contrary to overexpressed FRG1, the endogenous FRG1 is not associated with nuclear speckles. We characterize the nuclear and nucleolar import of FRG1, the potential effect of phosphorylation, and its interaction with the importin karyopherin α2. Consistent with a role in RNA biogenesis, human FRG1 is associated with mRNA in vivo and invitro, interacts directly with TAP (Tip-associated protein; the major mRNA export receptor), and is a dynamic nuclear-cytoplasmic shuttling protein supporting a function for FRG1 in mRNA transport. Biochemically, we characterize FRG1 actin binding activity and show that the cytoplasmic pool of FRG1 is dependent on an intact actin cytoskeleton for its localization. These data provide the first biochemical activities (actin binding and RNA binding) for human FRG1 and the characterization of the endogenous human FRG1, together indicating that FRG1 is involved in multiple aspects of RNA biogenesis, including mRNA transport and, potentially, cytoplasmic mRNA localization.

  17. The Pax gene family: Highlights from cephalopods

    PubMed Central

    Baratte, Sébastien; Andouche, Aude; Bonnaud-Ponticelli, Laure

    2017-01-01

    Pax genes play important roles in Metazoan development. Their evolution has been extensively studied but Lophotrochozoa are usually omitted. We addressed the question of Pax paralog diversity in Lophotrochozoa by a thorough review of available databases. The existence of six Pax families (Pax1/9, Pax2/5/8, Pax3/7, Pax4/6, Paxβ, PoxNeuro) was confirmed and the lophotrochozoan Paxβ subfamily was further characterized. Contrary to the pattern reported in chordates, the Pax2/5/8 family is devoid of homeodomain in Lophotrochozoa. Expression patterns of the three main pax classes (pax2/5/8, pax3/7, pax4/6) during Sepia officinalis development showed that Pax roles taken as ancestral and common in metazoans are modified in S. officinalis, most likely due to either the morphological specificities of cephalopods or to their direct development. Some expected expression patterns were missing (e.g. pax6 in the developing retina), and some expressions in unexpected tissues have been found (e.g. pax2/5/8 in dermal tissue and in gills). This study underlines the diversity and functional plasticity of Pax genes and illustrates the difficulty of using probable gene homology as strict indicator of homology between biological structures. PMID:28253300

  18. Bacterial nucleators: actin' on actin

    PubMed Central

    Bugalhão, Joana N.; Mota, Luís Jaime; Franco, Irina S.

    2015-01-01

    The actin cytoskeleton is a key target of numerous microbial pathogens, including protozoa, fungi, bacteria and viruses. In particular, bacterial pathogens produce and deliver virulence effector proteins that hijack actin dynamics to enable bacterial invasion of host cells, allow movement within the host cytosol, facilitate intercellular spread or block phagocytosis. Many of these effector proteins directly or indirectly target the major eukaryotic actin nucleator, the Arp2/3 complex, by either mimicking nucleation promoting factors or activating upstream small GTPases. In contrast, this review is focused on a recently identified class of effector proteins from Gram-negative bacteria that function as direct actin nucleators. These effector proteins mimic functional activities of formins, WH2-nucleators and Ena/VASP assembly promoting factors demonstrating that bacteria have coopted the complete set of eukaryotic actin assembly pathways. Structural and functional analyses of these nucleators have revealed several motifs and/or mechanistic activities that are shared with eukaryotic actin nucleators. However, functional effects of these proteins during infection extend beyond plain actin polymerization leading to interference with other host cell functions such as vesicle trafficking, cell cycle progression and cell death. Therefore, their use as model systems could not only help in the understanding of the mechanistic details of actin polymerization but also provide novel insights into the connection between actin dynamics and other cellular pathways. PMID:26416078

  19. Actinous enigma or enigmatic actin

    PubMed Central

    Povarova, Olga I; Uversky, Vladimir N; Kuznetsova, Irina M; Turoverov, Konstantin K

    2014-01-01

    Being the most abundant protein of the eukaryotic cell, actin continues to keep its secrets for more than 60 years. Everything about this protein, its structure, functions, and folding, is mysteriously counterintuitive, and this review represents an attempt to solve some of the riddles and conundrums commonly found in the field of actin research. In fact, actin is a promiscuous binder with a wide spectrum of biological activities. It can exist in at least three structural forms, globular, fibrillar, and inactive (G-, F-, and I-actin, respectively). G-actin represents a thermodynamically instable, quasi-stationary state, which is formed in vivo as a result of the energy-intensive, complex posttranslational folding events controlled and driven by cellular folding machinery. The G-actin structure is dependent on the ATP and Mg2+ binding (which in vitro is typically substituted by Ca2+) and protein is easily converted to the I-actin by the removal of metal ions and by action of various denaturing agents (pH, temperature, and chemical denaturants). I-actin cannot be converted back to the G-form. Foldable and “natively folded” forms of actin are always involved in interactions either with the specific protein partners, such as Hsp70 chaperone, prefoldin, and the CCT chaperonin during the actin folding in vivo or with Mg2+ and ATP as it takes place in the G-form. We emphasize that the solutions for the mysteries of actin multifunctionality, multistructurality, and trapped unfolding can be found in the quasi-stationary nature of this enigmatic protein, which clearly possesses many features attributed to both globular and intrinsically disordered proteins.

  20. Rubisco small subunit gene family in cassava.

    PubMed

    Yeo, T W; Mak, Y M; Ho, K K

    1999-01-01

    Cassava leaves of two different cultivars, Brazil and Buloh, were used to isolate mRNA. The mRNA isolated was successfully used in the construction of cDNA libraries for each of the cultivars. The cDNA libraries were screened for members of ribulose-1,5-bisphosphate carboxylase/oxygenase small subunit gene family and positive clones were sequenced. A total of seven different SSU genes, of which five were from cultivar Brazil and two were from cultivar Buloh, were isolated. Comparison results show that even though all the sequences are highly similar, they can be classified into three subfamilies. Homology between members of the same subfamily is higher than homology between members from the same cultivar.

  1. Actin stress in cell reprogramming

    PubMed Central

    Guo, Jun; Wang, Yuexiu; Sachs, Frederick; Meng, Fanjie

    2014-01-01

    Cell mechanics plays a role in stem cell reprogramming and differentiation. To understand this process better, we created a genetically encoded optical probe, named actin–cpstFRET–actin (AcpA), to report forces in actin in living cells in real time. We showed that stemness was associated with increased force in actin. We reprogrammed HEK-293 cells into stem-like cells using no transcription factors but simply by softening the substrate. However, Madin-Darby canine kidney (MDCK) cell reprogramming required, in addition to a soft substrate, Harvey rat sarcoma viral oncogene homolog expression. Replating the stem-like cells on glass led to redifferentiation and reduced force in actin. The actin force probe was a FRET sensor, called cpstFRET (circularly permuted stretch sensitive FRET), flanked by g-actin subunits. The labeled actin expressed efficiently in HEK, MDCK, 3T3, and bovine aortic endothelial cells and in multiple stable cell lines created from those cells. The viability of the cell lines demonstrated that labeled actin did not significantly affect cell physiology. The labeled actin distribution was similar to that observed with GFP-tagged actin. We also examined the stress in the actin cross-linker actinin. Actinin force was not always correlated with actin force, emphasizing the need for addressing protein specificity when discussing forces. Because actin is a primary structural protein in animal cells, understanding its force distribution is central to understanding animal cell physiology and the many linked reactions such as stress-induced gene expression. This new probe permits measuring actin forces in a wide range of experiments on preparations ranging from isolated proteins to transgenic animals. PMID:25422450

  2. Regulation of actin polymerization and adhesion-dependent cell edge protrusion by the Abl-related gene (Arg) tyrosine kinase and N-WASp.

    PubMed

    Miller, Matthew M; Lapetina, Stefanie; MacGrath, Stacey M; Sfakianos, Mindan K; Pollard, Thomas D; Koleske, Anthony J

    2010-03-16

    Extracellular cues stimulate the Abl family nonreceptor tyrosine kinase Arg to promote actin-based cell edge protrusions. Several Arg-interacting proteins are potential links to the actin cytoskeleton, but exactly how Arg stimulates actin polymerization and cellular protrusion has not yet been fully elucidated. We used affinity purification to identify N-WASp as a novel binding partner of Arg. N-WASp activates the Arp2/3 complex and is an effector of Abl. We find that the Arg SH3 domain binds directly to N-WASp. Arg phosphorylates N-WASp on Y256, modestly increasing the affinity of Arg for N-WASp, an interaction that does not require the Arg SH2 domain. The Arg SH3 domain stimulates N-WASp-dependent actin polymerization in vitro, and Arg phosphorylation of N-WASp weakly stimulates this effect. Arg and N-WASp colocalize to adhesion-dependent cell edge protrusions in vivo. The cell edge protrusion defects of arg-/- fibroblasts can be complemented by re-expression of an Arg-yellow fluorescent protein (YFP) fusion, but not by an N-WASp binding-deficient Arg SH3 domain point mutant. These results suggest that Arg promotes actin-based protrusions in response to extracellular stimuli through phosphorylation of and physical interactions with N-WASp.

  3. The tomato cis-prenyltransferase gene family.

    PubMed

    Akhtar, Tariq A; Matsuba, Yuki; Schauvinhold, Ines; Yu, Geng; Lees, Hazel A; Klein, Samuel E; Pichersky, Eran

    2013-02-01

    cis-prenyltransferases (CPTs) are predicted to be involved in the synthesis of long-chain polyisoprenoids, all with five or more isoprene (C5) units. Recently, we identified a short-chain CPT, neryl diphosphate synthase (NDPS1), in tomato (Solanum lycopersicum). Here, we searched the tomato genome and identified and characterized its entire CPT gene family, which comprises seven members (SlCPT1-7, with NDPS1 designated as SlCPT1). Six of the SlCPT genes encode proteins with N-terminal targeting sequences, which, when fused to GFP, mediated GFP transport to the plastids of Arabidopsis protoplasts. The SlCPT3-GFP fusion protein was localized to the cytosol. Enzymatic characterization of recombinant SlCPT proteins demonstrated that SlCPT6 produces Z,Z-FPP, and SlCPT2 catalyzes the formation of nerylneryl diphosphate while SlCPT4, SlCPT5 and SlCPT7 synthesize longer-chain products (C25-C55). Although no in vitro activity was demonstrated for SlCPT3, its expression in the Saccharomyces cerevisiae dolichol biosynthesis mutant (rer2) complemented the temperature-sensitive growth defect. Transcripts of SlCPT2, SlCPT4, SlCPT5 and SlCPT7 are present at low levels in multiple tissues, SlCPT6 is exclusively expressed in red fruit and roots, and SlCPT1, SlCPT3 and SlCPT7 are highly expressed in trichomes. RNAi-mediated suppression of NDPS1 led to a large decrease in β-phellandrene (which is produced from neryl diphosphate), with greater reductions achieved with the general 35S promoter compared to the trichome-specific MKS1 promoter. Phylogenetic analysis revealed CPT gene families in both eudicots and monocots, and showed that all the short-chain CPT genes from tomato (SlCPT1, SlCPT2 and SlCPT6) are closely linked to terpene synthase gene clusters.

  4. Tumor suppressor genes in familial adenomatous polyposis

    PubMed Central

    Eshghifar, Nahal; Farrokhi, Naser; Naji, Tahereh; Zali, Mohammadreza

    2017-01-01

    Colorectal cancer (CRC) is mostly due to a series of genetic alterations that are being greatly under the influence of the environmental factors. These changes, mutational or epigenetic modifications at transcriptional forefront and/or post-transcriptional effects via miRNAs, include inactivation and the conversion of proto-oncogene to oncogenes, and/or inactivation of tumor suppressor genes (TSG). Here, a thorough review was carried out on the role of TSGs with the focus on the APC as the master regulator, mutated genes and mal-/dysfunctional pathways that lead to one type of hereditary form of the CRC; namely familial adenomatous polyposis (FAP). This review provides a venue towards defining candidate genes that can be used as new PCR-based markers for early diagnosis of FAP. In addition to diagnosis, defining the modes of genetic alterations will open door towards genome editing to either suppress the disease or reduce its progression during the course of action. PMID:28331559

  5. The knock-out of ARP3a gene affects F-actin cytoskeleton organization altering cellular tip growth, morphology and development in moss Physcomitrella patens.

    PubMed

    Finka, Andrija; Saidi, Younousse; Goloubinoff, Pierre; Neuhaus, Jean-Marc; Zrÿd, Jean-Pierre; Schaefer, Didier G

    2008-10-01

    The seven subunit Arp2/3 complex is a highly conserved nucleation factor of actin microfilaments. We have isolated the genomic sequence encoding a putative Arp3a protein of the moss Physcomitrella patens. The disruption of this ARP3A gene by allele replacement has generated loss-of-function mutants displaying a complex developmental phenotype. The loss-of function of ARP3A gene results in shortened, almost cubic chloronemal cells displaying affected tip growth and lacking differentiation to caulonemal cells. In moss arp3a mutants, buds differentiate directly from chloronemata to form stunted leafy shoots having differentiated leaves similar to wild type. Yet, rhizoids never differentiate from stem epidermal cells. To characterize the F-actin organization in the arp3a-mutated cells, we disrupted ARP3A gene in the previously described HGT1 strain expressing conditionally the GFP-talin marker. In vivo observation of the F-actin cytoskeleton during P. patens development demonstrated that loss-of-function of Arp3a is associated with the disappearance of specific F-actin cortical structures associated with the establishment of localized cellular growth domains. Finally, we show that constitutive expression of the P. patens Arp3a and its Arabidopsis thaliana orthologs efficiently complement the mutated phenotype indicating a high degree of evolutionary conservation of the Arp3 function in land plants.

  6. Actin-related protein Arp6 influences H2A.Z-dependent and -independent gene expression and links ribosomal protein genes to nuclear pores.

    PubMed

    Yoshida, Takahito; Shimada, Kenji; Oma, Yukako; Kalck, Véronique; Akimura, Kazumi; Taddei, Angela; Iwahashi, Hitoshi; Kugou, Kazuto; Ohta, Kunihiro; Gasser, Susan M; Harata, Masahiko

    2010-04-15

    Actin-related proteins are ubiquitous components of chromatin remodelers and are conserved from yeast to man. We have examined the role of the budding yeast actin-related protein Arp6 in gene expression, both as a component of the SWR1 complex (SWR-C) and in its absence. We mapped Arp6 binding sites along four yeast chromosomes using chromatin immunoprecipitation from wild-type and swr1 deleted (swr1Delta) cells. We find that a majority of Arp6 binding sites coincide with binding sites of Swr1, the catalytic subunit of SWR-C, and with the histone H2A variant Htz1 (H2A.Z) deposited by SWR-C. However, Arp6 binding detected at centromeres, the promoters of ribosomal protein (RP) genes, and some telomeres is independent of Swr1 and Htz1 deposition. Given that RP genes and telomeres both show association with the nuclear periphery, we monitored the ability of Arp6 to mediate the localization of chromatin to nuclear pores. Arp6 binding is sufficient to shift a randomly positioned locus to nuclear periphery, even in a swr1Delta strain. Arp6 is also necessary for the pore association of its targeted RP promoters possibly through cell cycle-dependent factors. Loss of Arp6, but not Htz1, leads to an up-regulation of these RP genes. In contrast, the pore-association of GAL1 correlates with Htz1 deposition, and loss of Arp6 reduces both GAL1 activation and peripheral localization. We conclude that Arp6 functions both together with the nucleosome remodeler Swr1 and also without it, to mediate Htz1-dependent and Htz1-independent binding of chromatin domains to nuclear pores. This association is shown to have modulating effects on gene expression.

  7. The Arabidopsis Cyclophilin Gene Family1

    PubMed Central

    Romano, Patrick G.N.; Horton, Peter; Gray, Julie E.

    2004-01-01

    Database searching has allowed the identification of a number of previously unreported single and multidomain isoform members of the Arabidopsis cyclophilin gene family. In addition to the cyclophilin-like peptidyl-prolyl cis-trans isomerase domain, the latter contain a variety of other domains with characterized functions. Transcriptional analysis showed they are expressed throughout the plant, and different isoforms are present in all parts of the cell including the cytosol, nucleus, mitochondria, secretory pathway, and chloroplast. The abundance and diversity of cyclophilin isoforms suggests that, like their animal counterparts, plant cyclophilins are likely to be important proteins involved in a wide variety of cellular processes. As well as fulfilling the basic role of protein folding, they may also play important roles in mRNA processing, protein degradation, and signal transduction and thus may be crucial during both development and stress responsiveness. PMID:15051864

  8. Persistent nuclear actin filaments inhibit transcription by RNA polymerase II.

    PubMed

    Serebryannyy, Leonid A; Parilla, Megan; Annibale, Paolo; Cruz, Christina M; Laster, Kyle; Gratton, Enrico; Kudryashov, Dmitri; Kosak, Steven T; Gottardi, Cara J; de Lanerolle, Primal

    2016-09-15

    Actin is abundant in the nucleus and it is clear that nuclear actin has important functions. However, mystery surrounds the absence of classical actin filaments in the nucleus. To address this question, we investigated how polymerizing nuclear actin into persistent nuclear actin filaments affected transcription by RNA polymerase II. Nuclear filaments impaired nuclear actin dynamics by polymerizing and sequestering nuclear actin. Polymerizing actin into stable nuclear filaments disrupted the interaction of actin with RNA polymerase II and correlated with impaired RNA polymerase II localization, dynamics, gene recruitment, and reduced global transcription and cell proliferation. Polymerizing and crosslinking nuclear actin in vitro similarly disrupted the actin-RNA-polymerase-II interaction and inhibited transcription. These data rationalize the general absence of stable actin filaments in mammalian somatic nuclei. They also suggest a dynamic pool of nuclear actin is required for the proper localization and activity of RNA polymerase II.

  9. Multiple 5'-flanking regions of the human alpha-skeletal actin gene synergistically modulate muscle-specific expression.

    PubMed

    Muscat, G E; Kedes, L

    1987-11-01

    Transfection into myogenic and nonmyogenic cell lines was used to investigate the transcriptional regulation of the human alpha-skeletal actin gene. We demonstrated that 1,300 base pairs of the 5'-flanking region directed high-level transient expression of the bacterial chloramphenicol acetyltransferase gene in differentiated mouse C2C12 and rat L8 myotubes but not in mouse nonmuscle L.TK- and HuT-12 cells. Unidirectional 5' deletion analysis and heterologous promoter stimulation experiments demonstrated that at least three transcription-regulating subdomains lie in this 1,300-base-pair region. A proximal cis-acting transcriptional element located between positions -153 and -87 relative to the start of transcription at +1 was both sufficient and necessary for muscle-specific expression and developmental regulation during myogenesis in the two myogenic cell systems. The region 3' of position -87 interacted with factors present in both myogenic and fibroblastic cells and appeared to define, or to be a major component of, the basal promoter. In C2C12 myotubes, but not in L8 myotubes, a distal sequence domain between positions -1300 and -626 and the proximal sequence domain between positions -153 and -87 each induced transcription about 10-fold and synergistically increased CAT expression 100-fold over levels achieved by the sequences 3' of position -87. Furthermore, these cis-acting elements independently and synergistically modulated an enhancerless, heterologous simian virus 40 promoter in a tissue-specific manner. DNA fragments which included the proximal domain displayed classical enhancerlike properties. The central region between positions -626 and -153, although required in neither cell line, had a positive, two- to threefold, additive role in augmenting expression in L8 cells but not in C2C12 cells. This suggests that certain elements between positions -1300 and -153 appear to be differentially utilized for maximal expression in different myogenic cells and

  10. IRF4, MC1R and TYR genes are risk factors for actinic keratosis independent of skin color.

    PubMed

    Jacobs, Leonie C; Liu, Fan; Pardo, Luba M; Hofman, Albert; Uitterlinden, André G; Kayser, Manfred; Nijsten, Tamar

    2015-06-01

    Actinic keratosis (AK) is a pre-malignant skin disease, highly prevalent in elderly Europeans. This study investigates genetic susceptibility to AK with a genome-wide association study (GWAS). A full body skin examination was performed in 3194 elderly individuals from the Rotterdam Study (RS) of exclusive north-western European origin (aged 51-99 years, 45% male). Physicians graded the number of AK into four severity levels: none (76%), 1-3 (14%), 4-9 (6%) and ≥10 (5%), and skin color was quantified using a spectrophotometer on sun-unexposed skin. A GWAS for AK severity was conducted, where promising signals at IRF4 and MC1R (P < 4.2 × 10(-7)) were successfully replicated in an additional cohort of 623 RS individuals (IRF4, rs12203592, Pcombined = 6.5 × 10(-13) and MC1R, rs139810560, Pcombined = 4.1 × 10(-9)). Further, in an analysis of ten additional well-known human pigmentation genes, TYR also showed significant association with AK (rs1393350, P = 5.3 × 10(-4)) after correction for multiple testing. Interestingly, the strength and significance of above-mentioned associations retained largely the same level after skin color adjustment. Overall, our data strongly suggest that IRF4, MC1R and TYR genes likely have pleiotropic effects, a combination of pigmentation and oncogenic functions, resulting in an increased risk of AK.

  11. Modelling the evolution of multi-gene families.

    PubMed

    Nye, Tom M W

    2009-10-01

    A number of biological processes can lead to genes being copied within the genome of some given species. Duplicate genes of this form are called paralogs and such genes share a high degree sequence similarity as well as often having closely related functions. Some genes have become widely duplicated to form multigene families in which the copies are distributed both within the genomes of individual species and across different species. Statistical modelling of gene duplication and the evolution of multi-gene families currently lags behind well-established models of DNA sequence evolution despite an increasing volume of available data, but the analysis of multi-gene families is important as part of a wider effort to understand evolution at the genomic level. This article reviews existing approaches to modelling multi-gene families and presents various challenges and possibilities for this exciting area of research.

  12. Single step detection of HIV-1 proviral DNA and housekeeping β-actin gene from dried blood spots by a monoplex polymerase chain reaction.

    PubMed

    Choudhary, Ipsita; Chimanpure, Vaishali; Patil, Ajit; Mukhopadhyaya, Robin; Paranjape, Ramesh; Bhattacharya, Jayanta

    2013-01-01

    There is a growing need for developing a simple, rapid, reliable and cost effective method for detection of HIV-1 for early diagnosis of the infection especially in developing countries and in resource limited settings. A method for simultaneous detection of the HIV-1 p17 gene and the house keeping human β-actin gene from dried blood spots (DBS) by a monoplex polymerase chain reaction (PCR) is described. Genomic DNA was extracted from 40 HIV-1 positive and 40 HIV-1 negative DBS and used as templates to amplify both the HIV-1 p17 and β-actin genes simultaneously under the same cycling condition by a single round PCR. This method of detection of HIV-1 may provide a simple, rapid and cost effective alternative in resource limited settings; however, it would require testing a larger number of samples before widespread use.

  13. Evolutionary analyses of non-family genes in plants

    SciTech Connect

    Ye, Chuyu; Li, Ting; Yin, Hengfu; Weston, David; Tuskan, Gerald A; Tschaplinski, Timothy J; Yang, Xiaohan

    2013-01-01

    There are a large number of non-family (NF) genes that do not cluster into families with three or more members per genome. While gene families have been extensively studied, a systematic analysis of NF genes has not been reported. We performed comparative studies on NF genes in 14 plant species. Based on the clustering of protein sequences, we identified ~94 000 NF genes across these species that were divided into five evolutionary groups: Viridiplantae wide, angiosperm specific, monocot specific, dicot specific, and those that were species specific. Our analysis revealed that the NF genes resulted largely from less frequent gene duplications and/or a higher rate of gene loss after segmental duplication relative to genes in both lowcopy- number families (LF; 3 10 copies per genome) and high-copy-number families (HF; >10 copies). Furthermore, we identified functions enriched in the NF gene set as compared with the HF genes. We found that NF genes were involved in essential biological processes shared by all plant lineages (e.g. photosynthesis and translation), as well as gene regulation and stress responses associated with phylogenetic diversification. In particular, our analysis of an Arabidopsis protein protein interaction network revealed that hub proteins with the top 10% most connections were over-represented in the NF set relative to the HF set. This research highlights the roles that NF genes may play in evolutionary and functional genomics research.

  14. Evolutionary analyses of non-family genes in plants

    SciTech Connect

    Ye, Chuyu; Li, Ting; Yin, Hengfu; Weston, David; Tuskan, Gerald A; Tschaplinski, Timothy J; Yang, Xiaohan

    2013-03-01

    There are a large number of non-family (NF) genes that do not cluster into families with three or more members per genome. While gene families have been extensively studied, a systematic analysis of NF genes has not been reported. We performed comparative studies on NF genes in 14 plant species. Based on the clustering of protein sequences, we identified ~94,000 NF genes across these species that were divided into five evolutionary groups: Viridiplantae-wide, angiosperm-specific, monocot-specific, dicot-specific, and those that were species-specific. Our analysis revealed that the NF genes resulted largely from less frequent gene duplications and/or a higher rate of gene loss after segmental duplication relative to genes in both low-copy-number families (LF; 3 10 copies per genome) and high-copy-number families (HF; >10 copies). Furthermore, we identified functions enriched in the NF gene set as compared with the HF genes. We found that NF genes were involved in essential biological processes shared by all plant lineages (e.g., photosynthesis and translation), as well as gene regulation and stress responses associated with phylogenetic diversification. In particular, our analysis of an Arabidopsis protein-protein interaction network revealed that hub proteins with the top 10% most connections were over-represented in the NF set relative to the HF set. This research highlights the roles that NF genes may play in evolutionary and functional genomics research.

  15. The yeast ubiquitin genes: a family of natural gene fusions.

    PubMed Central

    Ozkaynak, E; Finley, D; Solomon, M J; Varshavsky, A

    1987-01-01

    Ubiquitin is a 76-residue protein highly conserved among eukaryotes. Conjugation of ubiquitin to intracellular proteins mediates their selective degradation in vivo. We describe a family of four ubiquitin-coding loci in the yeast Saccharomyces cerevisiae. UB11, UB12 and UB13 encode hybrid proteins in which ubiquitin is fused to unrelated ('tail') amino acid sequences. The ubiquitin coding elements of UB11 and UB12 are interrupted at identical positions by non-homologous introns. UB11 and UB12 encode identical 52-residue tails, whereas UB13 encodes a different 76-residue tail. The tail amino acid sequences are highly conserved between yeast and mammals. Each tail contains a putative metal-binding, nucleic acid-binding domain of the form Cys-X2-4-Cys-X2-15-Cys-X2-4-Cys, suggesting that these proteins may function by binding to DNA. The fourth gene, UB14, encodes a polyubiquitin precursor protein containing five ubiquitin repeats in a head-to-tail, spacerless arrangement. All four ubiquitin genes are expressed in exponentially growing cells, while in stationary-phase cells the expression of UB11 and UB12 is repressed. The UB14 gene, which is strongly inducible by starvation, high temperatures and other stresses, contains in its upstream region strong homologies to the consensus 'heat shock box' nucleotide sequence. Elsewhere we show that the essential function of the UB14 gene is to provide ubiquitin to cells under stress. Images Fig. 1. Fig. 7. PMID:3038523

  16. Expression analysis of LIM gene family in poplar, toward an updated phylogenetic classification

    PubMed Central

    2012-01-01

    Background Plant LIM domain proteins may act as transcriptional activators of lignin biosynthesis and/or as actin binding and bundling proteins. Plant LIM genes have evolved in phylogenetic subgroups differing in their expression profiles: in the whole plant or specifically in pollen. However, several poplar PtLIM genes belong to uncharacterized monophyletic subgroups and the expression patterns of the LIM gene family in a woody plant have not been studied. Findings In this work, the expression pattern of the twelve duplicated poplar PtLIM genes has been investigated by semi quantitative RT-PCR in different vegetative and reproductive tissues. As in other plant species, poplar PtLIM genes were widely expressed in the tree or in particular tissues. Especially, PtXLIM1a, PtXLIM1b and PtWLIM1b genes were preferentially expressed in the secondary xylem, suggesting a specific function in wood formation. Moreover, the expression of these genes and of the PtPLIM2a gene was increased in tension wood. Western-blot analysis confirmed the preferential expression of PtXLIM1a protein during xylem differentiation and tension wood formation. Genes classified within the pollen specific PLIM2 and PLIM2-like subgroups were all strongly expressed in pollen but also in cottony hairs. Interestingly, pairs of duplicated PtLIM genes exhibited different expression patterns indicating subfunctionalisations in specific tissues. Conclusions The strong expression of several LIM genes in cottony hairs and germinating pollen, as well as in xylem fibers suggests an involvement of plant LIM domain proteins in the control of cell expansion. Comparisons of expression profiles of poplar LIM genes with the published functions of closely related plant LIM genes suggest conserved functions in the areas of lignin biosynthesis, pollen tube growth and mechanical stress response. Based on these results, we propose a novel nomenclature of poplar LIM domain proteins. PMID:22339987

  17. Actinic reticuloid

    SciTech Connect

    Marx, J.L.; Vale, M.; Dermer, P.; Ragaz, A.; Michaelides, P.; Gladstein, A.H.

    1982-09-01

    A 58-year-old man has his condition diagnosed as actinic reticuloid on the basis of clinical and histologic findings and phototesting data. He had clinical features resembling mycosis fungoides in light-exposed areas. Histologic findings disclosed a bandlike infiltrate with atypical mononuclear cells in the dermis and scattered atypical cells in the epidermis. Electron microscopy disclosed mononuclear cells with bizarre, convoluted nuclei, resembling cerebriform cells of Lutzner. Phototesting disclosed a diminished minimal erythemal threshold to UV-B and UV-A. Microscopic changes resembling actinic reticuloid were reproduced in this patient 24 and 72 hours after exposure to 15 minimal erythemal doses of UV-B.

  18. G-actin regulates rapid induction of actin nucleation by mDia1 to restore cellular actin polymers.

    PubMed

    Higashida, Chiharu; Suetsugu, Shiro; Tsuji, Takahiro; Monypenny, James; Narumiya, Shuh; Watanabe, Naoki

    2008-10-15

    mDia1 belongs to the formin family of proteins that share FH1 and FH2 domains. Although formins play a critical role in the formation of many actin-based cellular structures, the physiological regulation of formin-mediated actin assembly within the cell is still unknown. Here we show that cells possess an acute actin polymer restoration mechanism involving mDia1. By using single-molecule live-cell imaging, we found that several treatments including low-dose G-actin-sequestering drugs and unpolymerizable actin mutants activate mDia1 to initiate fast directional movement. The FH2 region, the core domain for actin nucleation, is sufficient to respond to latrunculin B (LatB) to increase its actin nucleation frequency. Simulation analysis revealed an unexpected paradoxical effect of LatB that leads to a several fold increase in free G-actin along with an increase in total G-actin. These results indicate that in cells, the actin nucleation frequency of mDia1 is enhanced not only by Rho, but also strongly through increased catalytic efficiency of the FH2 domain. Consistently, frequent actin nucleation by mDia1 was found around sites of vigorous actin disassembly. Another major actin nucleator, the Arp2/3 complex, was not affected by the G-actin increase induced by LatB. Taken together, we propose that transient accumulation of G-actin works as a cue to promote mDia1-catalyzed actin nucleation to execute rapid reassembly of actin filaments.

  19. Functional divergence in the Arabidopsis LOB-domain gene family

    PubMed Central

    Mangeon, Amanda; Lin, Wan-ching; Springer, Patricia S.

    2012-01-01

    The Arabidopsis LOB-domain (LBD) gene family is composed by 43 members divided in two classes based on amino acid conservation within the LOB-domain. The LOB domain is known to be responsible for DNA binding and protein-protein interactions. There is very little functional information available for most genes in the LBD family and many lbd single mutants do not exhibit conspicuous phenotypes. One plausible explanation for the limited loss-of-function phenotypes observed in this family is that LBD genes exhibit significant functional redundancy. Here we discuss an example of one phylogenetic subgroup of the LBD family, in which genes that are closely related based on phylogeny exhibit distinctly different expression patterns and do not have overlapping functions. We discuss the challenges of using phylogenetic analyses to predict redundancy in gene families. PMID:23073009

  20. Cell elasticity is regulated by the tropomyosin isoform composition of the actin cytoskeleton.

    PubMed

    Jalilian, Iman; Heu, Celine; Cheng, Hong; Freittag, Hannah; Desouza, Melissa; Stehn, Justine R; Bryce, Nicole S; Whan, Renee M; Hardeman, Edna C; Fath, Thomas; Schevzov, Galina; Gunning, Peter W

    2015-01-01

    The actin cytoskeleton is the primary polymer system within cells responsible for regulating cellular stiffness. While various actin binding proteins regulate the organization and dynamics of the actin cytoskeleton, the proteins responsible for regulating the mechanical properties of cells are still not fully understood. In the present study, we have addressed the significance of the actin associated protein, tropomyosin (Tpm), in influencing the mechanical properties of cells. Tpms belong to a multi-gene family that form a co-polymer with actin filaments and differentially regulate actin filament stability, function and organization. Tpm isoform expression is highly regulated and together with the ability to sort to specific intracellular sites, result in the generation of distinct Tpm isoform-containing actin filament populations. Nanomechanical measurements conducted with an Atomic Force Microscope using indentation in Peak Force Tapping in indentation/ramping mode, demonstrated that Tpm impacts on cell stiffness and the observed effect occurred in a Tpm isoform-specific manner. Quantitative analysis of the cellular filamentous actin (F-actin) pool conducted both biochemically and with the use of a linear detection algorithm to evaluate actin structures revealed that an altered F-actin pool does not absolutely predict changes in cell stiffness. Inhibition of non-muscle myosin II revealed that intracellular tension generated by myosin II is required for the observed increase in cell stiffness. Lastly, we show that the observed increase in cell stiffness is partially recapitulated in vivo as detected in epididymal fat pads isolated from a Tpm3.1 transgenic mouse line. Together these data are consistent with a role for Tpm in regulating cell stiffness via the generation of specific populations of Tpm isoform-containing actin filaments.

  1. Cell Elasticity Is Regulated by the Tropomyosin Isoform Composition of the Actin Cytoskeleton

    PubMed Central

    Jalilian, Iman; Heu, Celine; Cheng, Hong; Freittag, Hannah; Desouza, Melissa; Stehn, Justine R.; Bryce, Nicole S.; Whan, Renee M.; Hardeman, Edna C.

    2015-01-01

    The actin cytoskeleton is the primary polymer system within cells responsible for regulating cellular stiffness. While various actin binding proteins regulate the organization and dynamics of the actin cytoskeleton, the proteins responsible for regulating the mechanical properties of cells are still not fully understood. In the present study, we have addressed the significance of the actin associated protein, tropomyosin (Tpm), in influencing the mechanical properties of cells. Tpms belong to a multi-gene family that form a co-polymer with actin filaments and differentially regulate actin filament stability, function and organization. Tpm isoform expression is highly regulated and together with the ability to sort to specific intracellular sites, result in the generation of distinct Tpm isoform-containing actin filament populations. Nanomechanical measurements conducted with an Atomic Force Microscope using indentation in Peak Force Tapping in indentation/ramping mode, demonstrated that Tpm impacts on cell stiffness and the observed effect occurred in a Tpm isoform-specific manner. Quantitative analysis of the cellular filamentous actin (F-actin) pool conducted both biochemically and with the use of a linear detection algorithm to evaluate actin structures revealed that an altered F-actin pool does not absolutely predict changes in cell stiffness. Inhibition of non-muscle myosin II revealed that intracellular tension generated by myosin II is required for the observed increase in cell stiffness. Lastly, we show that the observed increase in cell stiffness is partially recapitulated in vivo as detected in epididymal fat pads isolated from a Tpm3.1 transgenic mouse line. Together these data are consistent with a role for Tpm in regulating cell stiffness via the generation of specific populations of Tpm isoform-containing actin filaments. PMID:25978408

  2. Facioscapulohumeral muscular dystrophy region gene-1 (FRG-1) is an actin-bundling protein associated with muscle-attachment sites.

    PubMed

    Liu, Qian; Jones, Takako Iida; Tang, Vivian W; Brieher, William M; Jones, Peter L

    2010-04-01

    In vertebrates, overexpression of facioscapulohumeral muscular dystrophy (FSHD) region gene 1 (FRG1) recapitulates the pathophysiology exhibited by FSHD patients, although the role of FRG1 in FSHD remains controversial and no precise function for FRG1 has been described in any organism. To gain insight into the function and potential role of FRG1 in FSHD, we analyzed the highly conserved Caenorhabditis elegans ortholog, frg-1. C. elegans body-wall muscles contain two distinct subcellular pools of FRG-1: nuclear FRG-1, concentrated in the nucleoli; and cytoplasmic FRG-1, associated with the Z-disk and costamere-like structures known as dense bodies. Functionally, we demonstrate that FRG-1 is an F-actin-bundling protein, consistent with its localization to dense bodies; this activity is conserved in human FRG1. This is particularly intriguing because it places FRG-1 along side the list of dense-body components whose vertebrate orthologs are involved in the myriad myopathies associated with disrupted costameres and Z-disks. Interestingly, overexpressed FRG-1 preferentially accumulates in the nucleus and, when overexpressed specifically from the frg-1 promoter, disrupts the adult ventral muscle structure and organization. Together, these data further support a role for FRG1 overexpression in FSHD pathophysiology and reveal the previously unsuspected direct involvement of FRG-1 in muscle structure and integrity.

  3. Complexity of the MSG gene family of Pneumocystis carinii

    PubMed Central

    Keely, Scott P; Stringer, James R

    2009-01-01

    Background The relationship between the parasitic fungus Pneumocystis carinii and its host, the laboratory rat, presumably involves features that allow the fungus to circumvent attacks by the immune system. It is hypothesized that the major surface glycoprotein (MSG) gene family endows Pneumocystis with the capacity to vary its surface. This gene family is comprised of approximately 80 genes, which each are approximately 3 kb long. Expression of the MSG gene family is regulated by a cis-dependent mechanism that involves a unique telomeric site in the genome called the expression site. Only the MSG gene adjacent to the expression site is represented by messenger RNA. Several P. carinii MSG genes have been sequenced, which showed that genes in the family can encode distinct isoforms of MSG. The vast majority of family members have not been characterized at the sequence level. Results The first 300 basepairs of MSG genes were subjected to analysis herein. Analysis of 581 MSG sequence reads from P. carinii genomic DNA yielded 281 different sequences. However, many of the sequence reads differed from others at only one site, a degree of variation consistent with that expected to be caused by error. Accounting for error reduced the number of truly distinct sequences observed to 158, roughly twice the number expected if the gene family contains 80 members. The size of the gene family was verified by PCR. The excess of distinct sequences appeared to be due to allelic variation. Discounting alleles, there were 73 different MSG genes observed. The 73 genes differed by 19% on average. Variable regions were rich in nucleotide differences that changed the encoded protein. The genes shared three regions in which at least 16 consecutive basepairs were invariant. There were numerous cases where two different genes were identical within a region that was variable among family members as a whole, suggesting recombination among family members. Conclusion A set of sequences that

  4. Quantification of fungal abundance on cultural heritage using real time PCR targeting the β-actin gene.

    PubMed

    Ettenauer, Jörg; Piñar, Guadalupe; Tafer, Hakim; Sterflinger, Katja

    2014-01-01

    The traditional methodology used for the identification of microbes colonizing our cultural heritage was the application of cultivation methods and/or microscopy. This approach has many advantages, as living microorganisms may be obtained for physiological investigations. In addition, these techniques allow the quantitative and qualitative assessment of the investigated environment. Quantitative analyses are done by plate count and the determination of abundance by the colony forming unit (CFU). Nevertheless, these techniques have many drawbacks that lead to an underestimation of the cell numbers and do not provide a comprehensive overview of the composition of the inhabiting microbiota. In the last decades, several molecular techniques have been developed enabling many advantages over the cultivation approach. Mainly PCR-based, fingerprinting techniques allow a qualitative detection and identification of the microbiota. In this study, we developed a real time PCR method as a simple, rapid and reliable tool to detect and quantify fungal abundance using the β-actin gene, which is known to appear as a single-copy gene in fungi. To this end, five different indoor thermal insulation materials applied for historical buildings that were previously tested for their bio-susceptibility against various fungi were subjected to qPCR analyses. The obtained results were compared with those obtained from a previous study investigating the bio-susceptibility of the insulation materials using classical cultivation experiments. Both results correlated well, revealing that Perlite plaster was the most suitable insulation material, showing the lowest fungal CFU and qPCR values. In contrast, insulations made of wood showed to be not recommendable from the microbiological point of view. In addition, the potential of qPCR was tested in other materials of cultural heritage, as old parchments, showing to be a suitable method for measuring fungal abundance in these delicate materials.

  5. Comprehensive Phylogenetic Reconstruction of Amoebozoa Based on Concatenated Analyses of SSU-rDNA and Actin Genes

    PubMed Central

    Lahr, Daniel J. G.; Grant, Jessica; Nguyen, Truc; Lin, Jian Hua; Katz, Laura A.

    2011-01-01

    Evolutionary relationships within Amoebozoa have been the subject of controversy for two reasons: 1) paucity of morphological characters in traditional surveys and 2) haphazard taxonomic sampling in modern molecular reconstructions. These along with other factors have prevented the erection of a definitive system that resolves confidently both higher and lower-level relationships. Additionally, the recent recognition that many protosteloid amoebae are in fact scattered throughout the Amoebozoa suggests that phylogenetic reconstructions have been excluding an extensive and integral group of organisms. Here we provide a comprehensive phylogenetic reconstruction based on 139 taxa using molecular information from both SSU-rDNA and actin genes. We provide molecular data for 13 of those taxa, 12 of which had not been previously characterized. We explored the dataset extensively by generating 18 alternative reconstructions that assess the effect of missing data, long-branched taxa, unstable taxa, fast evolving sites and inclusion of environmental sequences. We compared reconstructions with each other as well as against previously published phylogenies. Our analyses show that many of the morphologically established lower-level relationships (defined here as relationships roughly equivalent to Order level or below) are congruent with molecular data. However, the data are insufficient to corroborate or reject the large majority of proposed higher-level relationships (above the Order-level), with the exception of Tubulinea, Archamoebae and Myxogastrea, which are consistently recovered. Moreover, contrary to previous expectations, the inclusion of available environmental sequences does not significantly improve the Amoebozoa reconstruction. This is probably because key amoebozoan taxa are not easily amplified by environmental sequencing methodology due to high rates of molecular evolution and regular occurrence of large indels and introns. Finally, in an effort to facilitate

  6. Quantification of fungal abundance on cultural heritage using real time PCR targeting the β-actin gene

    PubMed Central

    Ettenauer, Jörg; Piñar, Guadalupe; Tafer, Hakim; Sterflinger, Katja

    2014-01-01

    The traditional methodology used for the identification of microbes colonizing our cultural heritage was the application of cultivation methods and/or microscopy. This approach has many advantages, as living microorganisms may be obtained for physiological investigations. In addition, these techniques allow the quantitative and qualitative assessment of the investigated environment. Quantitative analyses are done by plate count and the determination of abundance by the colony forming unit (CFU). Nevertheless, these techniques have many drawbacks that lead to an underestimation of the cell numbers and do not provide a comprehensive overview of the composition of the inhabiting microbiota. In the last decades, several molecular techniques have been developed enabling many advantages over the cultivation approach. Mainly PCR-based, fingerprinting techniques allow a qualitative detection and identification of the microbiota. In this study, we developed a real time PCR method as a simple, rapid and reliable tool to detect and quantify fungal abundance using the β-actin gene, which is known to appear as a single-copy gene in fungi. To this end, five different indoor thermal insulation materials applied for historical buildings that were previously tested for their bio-susceptibility against various fungi were subjected to qPCR analyses. The obtained results were compared with those obtained from a previous study investigating the bio-susceptibility of the insulation materials using classical cultivation experiments. Both results correlated well, revealing that Perlite plaster was the most suitable insulation material, showing the lowest fungal CFU and qPCR values. In contrast, insulations made of wood showed to be not recommendable from the microbiological point of view. In addition, the potential of qPCR was tested in other materials of cultural heritage, as old parchments, showing to be a suitable method for measuring fungal abundance in these delicate materials. PMID

  7. Differential expression of the ras gene family in mice.

    PubMed Central

    Leon, J; Guerrero, I; Pellicer, A

    1987-01-01

    We compared the expression of the ras gene family (H-ras, K-ras, and N-ras) in adult mouse tissues and during development. We found substantial variations in expression among different organs and in the amounts of the different transcripts originating from each gene, especially for the N-ras gene. The expression patterns were consistent with the reported preferential tissue activation of ras genes and suggested different cellular functions for each of the ras genes. Images PMID:3600635

  8. Formin' actin in the nucleus.

    PubMed

    Baarlink, Christian; Grosse, Robert

    2014-01-01

    Many if not most proteins can, under certain conditions, change cellular compartments, such as, for example, shuttling from the cytoplasm to the nucleus. Thus, many proteins may exert functions in various and very different subcellular locations, depending on the signaling context. A large amount of actin regulatory proteins has been detected in the mammalian cell nucleus, although their potential roles are much debated and are just beginning to emerge. Recently, members of the formin family of actin nucleators were also reported to dynamically localize to the nuclear environment. Here we discuss our findings that specific diaphanous-related formins can promote nuclear actin assembly in a signal-dependent manner.

  9. The Expansion of the PRAME Gene Family in Eutheria

    PubMed Central

    Chang, Ti-Cheng; Yang, Yang; Yasue, Hiroshi; Bharti, Arvind K.; Retzel, Ernest F.; Liu, Wan-Sheng

    2011-01-01

    The PRAME gene family belongs to the group of cancer/testis genes whose expression is restricted primarily to the testis and a variety of cancers. The expansion of this gene family as a result of gene duplication has been observed in primates and rodents. We analyzed the PRAME gene family in Eutheria and discovered a novel Y-linked PRAME gene family in bovine, PRAMEY, which underwent amplification after a lineage-specific, autosome-to-Y transposition. Phylogenetic analyses revealed two major evolutionary clades. Clade I containing the amplified PRAMEYs and the unamplified autosomal homologs in cattle and other eutherians is under stronger functional constraints; whereas, Clade II containing the amplified autosomal PRAMEs is under positive selection. Deep-sequencing analysis indicated that eight of the identified 16 PRAMEY loci are active transcriptionally. Compared to the bovine autosomal PRAME that is expressed predominantly in testis, the PRAMEY gene family is expressed exclusively in testis and is up-regulated during testicular maturation. Furthermore, the sense RNA of PRAMEY is expressed specifically whereas the antisense RNA is expressed predominantly in spermatids. This study revealed that the expansion of the PRAME family occurred in both autosomes and sex chromosomes in a lineage-dependent manner. Differential selection forces have shaped the evolution and function of the PRAME family. The positive selection observed on the autosomal PRAMEs (Clade II) may result in their functional diversification in immunity and reproduction. Conversely, selective constraints have operated on the expanded PRAMEYs to preserve their essential function in spermatogenesis. PMID:21347312

  10. Genome-Wide Identification, Characterization and Expression Profiling of ADF Family Genes in Solanum lycopersicum L.

    PubMed Central

    Khatun, Khadiza; Robin, Arif Hasan Khan; Park, Jong-In; Kim, Chang Kil; Lim, Ki-Byung; Kim, Min-Bae; Lee, Do-Jin; Nou, Ill Sup; Chung, Mi-Young

    2016-01-01

    The actin depolymerizing factor (ADF) proteins have growth, development, defense-related and growth regulatory functions in plants. The present study used genome-wide analysis to investigate ADF family genes in tomato. Eleven tomato ADF genes were identified and differential expression patterns were found in different organs. SlADF6 was preferentially expressed in roots, suggesting its function in root development. SlADF1, SlADF3 and SlADF10 were predominately expressed in the flowers compared to the other organs and specifically in the stamen compared to other flower parts, indicating their potential roles in pollen development. The comparatively higher expression of SlADF3 and SlADF11 at early fruit developmental stages might implicate them in determining final fruit size. SlADF5 and SlADF8 had relatively higher levels of expression five days after the breaker stage of fruit development, suggesting their possible role in fruit ripening. Notably, six genes were induced by cold and heat, seven by drought, five by NaCl, and four each by abscisic acid (ABA), jasmonic acid (JA) and wounding treatments. The differential expression patterns of the SlADF genes under different types of stresses suggested their function in stress tolerance in tomato plants. Our results will be helpful for the functional characterization of ADF genes during organ and fruit development of tomato under different stresses. PMID:27690110

  11. Genome-Wide Identification, Characterization and Expression Profiling of ADF Family Genes in Solanum lycopersicum L.

    PubMed

    Khatun, Khadiza; Robin, Arif Hasan Khan; Park, Jong-In; Kim, Chang Kil; Lim, Ki-Byung; Kim, Min-Bae; Lee, Do-Jin; Nou, Ill Sup; Chung, Mi-Young

    2016-09-29

    The actin depolymerizing factor (ADF) proteins have growth, development, defense-related and growth regulatory functions in plants. The present study used genome-wide analysis to investigate ADF family genes in tomato. Eleven tomato ADF genes were identified and differential expression patterns were found in different organs. SlADF6 was preferentially expressed in roots, suggesting its function in root development. SlADF1, SlADF3 and SlADF10 were predominately expressed in the flowers compared to the other organs and specifically in the stamen compared to other flower parts, indicating their potential roles in pollen development. The comparatively higher expression of SlADF3 and SlADF11 at early fruit developmental stages might implicate them in determining final fruit size. SlADF5 and SlADF8 had relatively higher levels of expression five days after the breaker stage of fruit development, suggesting their possible role in fruit ripening. Notably, six genes were induced by cold and heat, seven by drought, five by NaCl, and four each by abscisic acid (ABA), jasmonic acid (JA) and wounding treatments. The differential expression patterns of the SlADF genes under different types of stresses suggested their function in stress tolerance in tomato plants. Our results will be helpful for the functional characterization of ADF genes during organ and fruit development of tomato under different stresses.

  12. α-Synuclein and Its A30P Mutant Affect Actin Cytoskeletal Structure and Dynamics

    PubMed Central

    Sousa, Vítor L.; Bellani, Serena; Giannandrea, Maila; Yousuf, Malikmohamed; Valtorta, Flavia; Meldolesi, Jacopo

    2009-01-01

    The function of α-synuclein, a soluble protein abundant in the brain and concentrated at presynaptic terminals, is still undefined. Yet, α-synuclein overexpression and the expression of its A30P mutant are associated with familial Parkinson's disease. Working in cell-free conditions, in two cell lines as well as in primary neurons we demonstrate that α-synuclein and its A30P mutant have different effects on actin polymerization. Wild-type α-synuclein binds actin, slows down its polymerization and accelerates its depolymerization, probably by monomer sequestration; A30P mutant α-synuclein increases the rate of actin polymerization and disrupts the cytoskeleton during reassembly of actin filaments. Consequently, in cells expressing mutant α-synuclein, cytoskeleton-dependent processes, such as cell migration, are inhibited, while exo- and endocytic traffic is altered. In hippocampal neurons from mice carrying a deletion of the α-synuclein gene, electroporation of wild-type α-synuclein increases actin instability during remodeling, with growth of lamellipodia-like structures and apparent cell enlargement, whereas A30P α-synuclein induces discrete actin-rich foci during cytoskeleton reassembly. In conclusion, α-synuclein appears to play a major role in actin cytoskeletal dynamics and various aspects of microfilament function. Actin cytoskeletal disruption induced by the A30P mutant might alter various cellular processes and thereby play a role in the pathogenesis of neurodegeneration. PMID:19553474

  13. [Regulatory functions of Pax gene family in Drosophila development].

    PubMed

    Li, Li; Yang, Yang; Xue, Lei

    2010-02-01

    The Pax gene family encodes a group of important transcription factors that have been evolutionary conserved from Drosophila to human. Pax genes play pivotal roles in regulating diverse signal transduction pathways and organogenesis during embryonic development through modulating cell proliferation and self-renewal, embryonic precursor cell migration, and the coordination of specific differentiation programs. Ten members of the Pax gene family, which perform crucial regulatory functions during embryonic and postembryonic development, have been identified in Drosophila. In this report, we described the protein structures, expression patterns, and main functions of Drosophila Pax genes.

  14. Bacterial Actins and Their Interactors.

    PubMed

    Gayathri, Pananghat

    2017-01-01

    Bacterial actins polymerize in the presence of nucleotide (preferably ATP), form a common arrangement of monomeric interfaces within a protofilament, and undergo ATP hydrolysis-dependent change in stability of the filament-all of which contribute to performing their respective functions. The relative stability of the filament in the ADP-bound form compared to that of ATP and the rate of addition of monomers at the two ends decide the filament dynamics. One of the major differences between eukaryotic actin and bacterial actins is the variety in protofilament arrangements and dynamics exhibited by the latter. The filament structure and the polymerization dynamics enable them to perform various functions such as shape determination in rod-shaped bacteria (MreB), cell division (FtsA), plasmid segregation (ParM family of actin-like proteins), and organelle positioning (MamK). Though the architecture and dynamics of a few representative filaments have been studied, information on the effect of interacting partners on bacterial actin filament dynamics is not very well known. The chapter reviews some of the structural and functional aspects of bacterial actins, with special focus on the effect that interacting partners exert on the dynamics of bacterial actins, and how these assist them to carry out the functions within the bacterial cell.

  15. Nuclear Actin in Development and Transcriptional Reprogramming.

    PubMed

    Misu, Shinji; Takebayashi, Marina; Miyamoto, Kei

    2017-01-01

    Actin is a highly abundant protein in eukaryotic cells and dynamically changes its polymerized states with the help of actin-binding proteins. Its critical function as a constituent of cytoskeleton has been well-documented. Growing evidence demonstrates that actin is also present in nuclei, referred to as nuclear actin, and is involved in a number of nuclear processes, including transcriptional regulation and chromatin remodeling. The contribution of nuclear actin to transcriptional regulation can be explained by its direct interaction with transcription machineries and chromatin remodeling factors and by controlling the activities of transcription factors. In both cases, polymerized states of nuclear actin affect the transcriptional outcome. Nuclear actin also plays an important role in activating strongly silenced genes in somatic cells for transcriptional reprogramming. When these nuclear functions of actin are considered, it is plausible to speculate that nuclear actin is also implicated in embryonic development, in which numerous genes need to be activated in a well-coordinated manner. In this review, we especially focus on nuclear actin's roles in transcriptional activation, reprogramming and development, including stem cell differentiation and we discuss how nuclear actin can be an important player in development and cell differentiation.

  16. Expression of ets family genes in hematopoietic-cells.

    PubMed

    Romanospica, V; Suzuki, H; Georgiou, P; Chen, S; Ascione, R; Papas, T; Bhat, N

    1994-03-01

    We have examined the expression of the ets family of transcription factors in different types of hematopoietic cells. Our results demonstrate that several members of the ets gene family are expressed differentially in hematopoietic cells. During phorbol ester induced differentiation of HL60 cells, ETS2, PEA3, as well as GABPalpha and GABPbeta mRNAs are coordinately induced. During the activation of T-cells, ETS2 proteins are induced; however, the expression of the ETS1 and ERGB gene products are reduced. These results demonstrate that the regulation of ets family of genes is complex and depends on cell type. This observation leads to the conclusion that the regulation of ets target genes, will be dependent, in part, upon the type of ets genes expressed in each particular cell type.

  17. Predictions of Gene Family Distributions in Microbial Genomes: Evolution by Gene Duplication and Modification

    NASA Astrophysics Data System (ADS)

    Yanai, Itai; Camacho, Carlos J.; Delisi, Charles

    2000-09-01

    A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications.

  18. Transgelin is a TGFβ-inducible gene that regulates osteoblastic and adipogenic differentiation of human skeletal stem cells through actin cytoskeleston organization.

    PubMed

    Elsafadi, M; Manikandan, M; Dawud, R A; Alajez, N M; Hamam, R; Alfayez, M; Kassem, M; Aldahmash, A; Mahmood, A

    2016-08-04

    Regenerative medicine is a novel approach for treating conditions in which enhanced bone regeneration is required. We identified transgelin (TAGLN), a transforming growth factor beta (TGFβ)-inducible gene, as an upregulated gene during in vitro osteoblastic and adipocytic differentiation of human bone marrow-derived stromal (skeletal) stem cells (hMSC). siRNA-mediated gene silencing of TAGLN impaired lineage differentiation into osteoblasts and adipocytes but enhanced cell proliferation. Additional functional studies revealed that TAGLN deficiency impaired hMSC cell motility and in vitro transwell cell migration. On the other hand, TAGLN overexpression reduced hMSC cell proliferation, but enhanced cell migration, osteoblastic and adipocytic differentiation, and in vivo bone formation. In addition, deficiency or overexpression of TAGLN in hMSC was associated with significant changes in cellular and nuclear morphology and cytoplasmic organelle composition as demonstrated by high content imaging and transmission electron microscopy that revealed pronounced alterations in the distribution of the actin filament and changes in cytoskeletal organization. Molecular signature of TAGLN-deficient hMSC showed that several genes and genetic pathways associated with cell differentiation, including regulation of actin cytoskeleton and focal adhesion pathways, were downregulated. Our data demonstrate that TAGLN has a role in generating committed progenitor cells from undifferentiated hMSC by regulating cytoskeleton organization. Targeting TAGLN is a plausible approach to enrich for committed hMSC cells needed for regenerative medicine application.

  19. Evolutionary History of the Cancer Immunity Antigen MAGE Gene Family

    PubMed Central

    Katsura, Yukako; Satta, Yoko

    2011-01-01

    The evolutionary mode of a multi-gene family can change over time, depending on the functional differentiation and local genomic environment of family members. In this study, we demonstrate such a change in the melanoma antigen (MAGE) gene family on the mammalian X chromosome. The MAGE gene family is composed of ten subfamilies that can be categorized into two types. Type I genes are of relatively recent origin, and they encode epitopes for human leukocyte antigen (HLA) in cancer cells. Type II genes are relatively ancient and some of their products are known to be involved in apoptosis or cell proliferation. The evolutionary history of the MAGE gene family can be divided into four phases. In phase I, a single-copy state of an ancestral gene and the evolutionarily conserved mode had lasted until the emergence of eutherian mammals. In phase II, eight subfamily ancestors, with the exception for MAGE-C and MAGE-D subfamilies, were formed via retrotransposition independently. This would coincide with a transposition burst of LINE elements at the eutherian radiation. However, MAGE-C was generated by gene duplication of MAGE-A. Phase III is characterized by extensive gene duplication within each subfamily and in particular the formation of palindromes in the MAGE-A subfamily, which occurred in an ancestor of the Catarrhini. Phase IV is characterized by the decay of a palindrome in most Catarrhini, with the exception of humans. Although the palindrome is truncated by frequent deletions in apes and Old World monkeys, it is retained in humans. Here, we argue that this human-specific retention stems from negative selection acting on MAGE-A genes encoding epitopes of cancer cells, which preserves their ability to bind to highly divergent HLA molecules. These findings are interpreted with consideration of the biological factors shaping recent human MAGE-A genes. PMID:21695252

  20. The CBF gene family in apple (malus x domestica Borkh.)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Many vascular plants have evolved mechanisms for protecting themselves from freeze damage. One of the key pathways controlling higher plant responses to low temperature involves a family of genes which belong to the AP2 domain class of transcription factors. The promoters of many genes involved in...

  1. Recommended nomenclature for five mammalian carboxylesterase gene families: human, mouse, and rat genes and proteins.

    PubMed

    Holmes, Roger S; Wright, Matthew W; Laulederkind, Stanley J F; Cox, Laura A; Hosokawa, Masakiyo; Imai, Teruko; Ishibashi, Shun; Lehner, Richard; Miyazaki, Masao; Perkins, Everett J; Potter, Phillip M; Redinbo, Matthew R; Robert, Jacques; Satoh, Tetsuo; Yamashita, Tetsuro; Yan, Bingfan; Yokoi, Tsuyoshi; Zechner, Rudolf; Maltais, Lois J

    2010-10-01

    Mammalian carboxylesterase (CES or Ces) genes encode enzymes that participate in xenobiotic, drug, and lipid metabolism in the body and are members of at least five gene families. Tandem duplications have added more genes for some families, particularly for mouse and rat genomes, which has caused confusion in naming rodent Ces genes. This article describes a new nomenclature system for human, mouse, and rat carboxylesterase genes that identifies homolog gene families and allocates a unique name for each gene. The guidelines of human, mouse, and rat gene nomenclature committees were followed and "CES" (human) and "Ces" (mouse and rat) root symbols were used followed by the family number (e.g., human CES1). Where multiple genes were identified for a family or where a clash occurred with an existing gene name, a letter was added (e.g., human CES4A; mouse and rat Ces1a) that reflected gene relatedness among rodent species (e.g., mouse and rat Ces1a). Pseudogenes were named by adding "P" and a number to the human gene name (e.g., human CES1P1) or by using a new letter followed by ps for mouse and rat Ces pseudogenes (e.g., Ces2d-ps). Gene transcript isoforms were named by adding the GenBank accession ID to the gene symbol (e.g., human CES1_AB119995 or mouse Ces1e_BC019208). This nomenclature improves our understanding of human, mouse, and rat CES/Ces gene families and facilitates research into the structure, function, and evolution of these gene families. It also serves as a model for naming CES genes from other mammalian species.

  2. Mutation in δ-Sg Gene in Familial Dilated Cardiomyopathy

    PubMed Central

    Asadi, Marzieh; Foo, Roger; Salehi, Ahmad Reza; Salehi, Rasoul; Samienasab, Mohammad Reza

    2017-01-01

    Background: Mutations in different genes including dystrophin-associated glycoprotein complex caused familial dilated cardiomyopathy which is a genetically heterogeneous disease. The δ-SG gene contains nine exons spanning a 433-kb region of genomic DNA. It encodes a 35-kDa, singlepass, and type II transmembrane glycoprotein. Materials and Methods: In this study for the first time in Iran we screened 6 patients of a large family that they had positive family history of MI or sudden death by next generation sequencing method. Results: By employing NGS method we found missense mutation (p.R97Q) of δ-SG gene in 2 of 6 patients. Conclusions: The missense mutation (p.R97Q) in familial DCM patients is reported for the first time in Iranian patients with cardiac disease. Although this mutation is already known in other populations in Iran, it is not reported before.

  3. Complexity, polymorphism, and connectivity of mouse Vk gene families.

    PubMed

    Kofler, R; Duchosal, M A; Dixon, F J

    1989-01-01

    To define the polymorphism and extent of the mouse immunoglobulin kappa (Igk) gene complex, we have analyzed restriction-enzyme digested genomic DNA from 33 inbred strains of mice with labeled DNA probes corresponding to 16 Vk protein groups (1 of them previously undescribed) and the Jk/Ck region (V, variable; J, joining; C, constant). These probes detected between 1 and 25 distinct restriction enzyme fragments (REF) that appeared in up to eight polymorphic patterns, thus defining eight mouse Igk haplotypes. The investigated portion of the Vk repertoire was estimated to encompass between 60 and 120 discernable Vk gene-containing REFs. In contrast to mouse VH gene families, several Vk gene families defined by these probes appeared to overlap. This observation has implications for Vk gene analyses by nucleic acid hybridization and raises the possibility that the Vk gene complex is a continuum of related sequences.

  4. Characterizations of 9p21 candidate genes in familial melanoma

    SciTech Connect

    Walker, G.J.; Flores, J.F.; Glendening, J.M.

    1994-09-01

    We have previously collected and characterized 16 melanoma families for the inheritance of a familial melanoma predisposition gene on 9p21. Clear evidence for genetic linkage has been detected in 8 of these families with the 9p21 markers D9S126 and 1FNA, while linkage of the remaining families to this region is less certain. A candidate for the 9p21 familial melanoma gene, the cyclin kinase inhibitor gene p16 (also known as the multiple tumor suppressor 1 (MTS1) gene), has been recently indentified. Notably, a nonsense mutation within the p16 gene has been detected in the lymphoblastoid cell line DNA from a dysplastic nevus syndrome (DNS), or familial melanoma, patient. The p16 gene is also known to be frequently deleted or mutated in a variety of tumor cell lines (including melanoma) and resides within a region that has been defined as harboring the 9p21 melanoma predisposition locus. This region is delineated on the distal side by the marker D9S736 (which resides just distal to the p16 gene) and extends in a proximal direction to the marker D9S171. Overall, the entire distance between these two loci is estimated at 3-5Mb. Preliminary analysis of our two largest 9p21-linked melanoma kindreds (by direct sequencing of PCR products) has not yet revealed mutations within the coding region of the p16 gene. Others have reported that 8/11 unrelated 9p21-linked melanoma families do not appear to carry p16 mutations; thus the possibility exists that p16 is not a melanoma susceptibility gene per se, although it appears to play some role in melanoma tumor progression. Our melanoma kindred DNAs are currently being analyzed by SSCP using primers that amplify exons of other candidate genes from the 9p21 region implicated in familial melanoma. These novel genes reside within a distinct critical region of homozygous loss in melanoma which is located >2 Mb from the p16 gene on 9p21.

  5. Identification of a family of muscarinic acetylcholine receptor genes

    SciTech Connect

    Bonner, T.I.; Buckley, N.J.; Young, A.C.; Brann, M.R.

    1987-07-31

    Complementary DNAs for three different muscarinic acetylcholine receptors were isolated from a rat cerebral cortex library, and the cloned receptors were expressed in mammalian cells. Analysis of human and rat genomic clones indicates that there are at least four functional muscarinic receptor genes and that these genes lack introns in the coding sequence. This gene family provides a new basis for evaluating the diversity of muscarinic mechanisms in the nervous system.

  6. Identification and Functional Analysis of Light-Responsive Unique Genes and Gene Family Members in Rice

    PubMed Central

    Jung, Ki-Hong; Lee, Jinwon; Dardick, Chris; Seo, Young-Su; Cao, Peijian; Canlas, Patrick; Phetsom, Jirapa; Xu, Xia; Ouyang, Shu; An, Kyungsook; Cho, Yun-Ja; Lee, Geun-Cheol; Lee, Yoosook; An, Gynheung; Ronald, Pamela C.

    2008-01-01

    Functional redundancy limits detailed analysis of genes in many organisms. Here, we report a method to efficiently overcome this obstacle by combining gene expression data with analysis of gene-indexed mutants. Using a rice NSF45K oligo-microarray to compare 2-week-old light- and dark-grown rice leaf tissue, we identified 365 genes that showed significant 8-fold or greater induction in the light relative to dark conditions. We then screened collections of rice T-DNA insertional mutants to identify rice lines with mutations in the strongly light-induced genes. From this analysis, we identified 74 different lines comprising two independent mutant lines for each of 37 light-induced genes. This list was further refined by mining gene expression data to exclude genes that had potential functional redundancy due to co-expressed family members (12 genes) and genes that had inconsistent light responses across other publicly available microarray datasets (five genes). We next characterized the phenotypes of rice lines carrying mutations in ten of the remaining candidate genes and then carried out co-expression analysis associated with these genes. This analysis effectively provided candidate functions for two genes of previously unknown function and for one gene not directly linked to the tested biochemical pathways. These data demonstrate the efficiency of combining gene family-based expression profiles with analyses of insertional mutants to identify novel genes and their functions, even among members of multi-gene families. PMID:18725934

  7. Evolution of the Sox gene family within the chordate phylum.

    PubMed

    Heenan, Phoebe; Zondag, Lisa; Wilson, Megan J

    2016-01-10

    The ancient Sox gene family is a group of related transcription factors that perform a number of essential functions during embryonic development. During evolution, this family has undergone considerable expansion, particularly within the vertebrate lineage. In vertebrates SOX proteins are required for the specification, development and/or morphogenesis of most vertebrate innovations. Tunicates and lancelets are evolutionarily positioned as the closest invertebrate relatives to the vertebrate group. By identifying their Sox gene complement we can begin to reconstruct the gene set of the last common chordate ancestor before the split into invertebrates and vertebrate groups. We have identified core SOX family members from the genomes of six invertebrate chordates. Using phylogenetic analysis we determined their evolutionary relationships. We propose that the last common ancestor of chordates had at least seven Sox genes, including the core suite of SoxB, C, D, E and F as well as SoxH.

  8. Actin dynamics and cofilin-actin rods in Alzheimer disease

    PubMed Central

    Bamburg, James R.; Bernstein, Barbara W.

    2017-01-01

    Cytoskeletal abnormalities and synaptic loss, typical of both familial and sporadic Alzheimer disease (AD), are induced by diverse stresses such as neuroinflammation, oxidative stress, and energetic stress, each of which may be initiated or enhanced by proinflammatory cytokines or amyloid-β (Aβ) peptides. Extracellular Aβ-containing plaques and intracellular phospho-tau-containing neurofibrillary tangles are postmortem pathologies required to confirm AD and have been the focus of most studies. However, AD brain, but not normal brain, also have increased levels of cytoplasmic rod-shaped bundles of filaments composed of ADF/cofilin-actin in a 1:1 complex (rods). Cofilin, the major ADF/cofilin isoform in mammalian neurons, severs actin filaments at low cofilin/actin ratios and stabilizes filaments at high cofilin/actin ratios. It binds cooperatively to ADP-actin subunits in F-actin. Cofilin is activated by dephosphorylation and may be oxidized in stressed neurons to form disulfide-linked dimers, required for bundling cofilin-actin filaments into stable rods. Rods form within neurites causing synaptic dysfunction by sequestering cofilin, disrupting normal actin dynamics, blocking transport, and exacerbating mitochondrial membrane potential loss. Aβ and proinflammatory cytokines induce rods through a cellular prion protein-dependent activation of NADPH oxidase and production of reactive oxygen species. Here we review recent advances in our understanding of cofilin biochemistry, rod formation, and the development of cognitive deficits. We will then discuss rod formation as a molecular pathway for synapse loss that may be common between all three prominent current AD hypotheses, thus making rods an attractive therapeutic target. PMID:26873625

  9. Molecular cloning of the tomato Hairless gene implicates actin dynamics in trichome-mediated defense and mechanical properties of stem tissue

    PubMed Central

    Kang, Jin-Ho; Campos, Marcelo L.; Zemelis-Durfee, Starla; Al-Haddad, Jameel M.; Jones, A. Daniel; Telewski, Frank W.; Brandizzi, Federica; Howe, Gregg A.

    2016-01-01

    Trichomes are epidermal structures that provide a first line of defense against arthropod herbivores. The recessive hairless (hl) mutation in tomato (Solanum lycopersicum L.) causes severe distortion of trichomes on all aerial tissues, impairs the accumulation of sesquiterpene and polyphenolic compounds in glandular trichomes, and compromises resistance to the specialist herbivore Manduca sexta. Here, we demonstrate that the tomato Hl gene encodes a subunit (SRA1) of the highly conserved WAVE regulatory complex that controls nucleation of actin filaments in a wide range of eukaryotic cells. The tomato SRA1 gene spans a 42-kb region containing both Solyc11g013280 and Solyc11g013290. The hl mutation corresponds to a complex 3-kb deletion that removes the last exon of the gene. Expression of a wild-type SRA1 cDNA in the hl mutant background restored normal trichome development, accumulation of glandular trichome-derived metabolites, and resistance to insect herbivory. These findings establish a role for SRA1 in the development of tomato trichomes and also implicate the actin-cytoskeleton network in cytosolic control of specialized metabolism for plant defense. We also show that the brittleness of hl mutant stems is associated with altered mechanical and cell morphological properties of stem tissue, and demonstrate that this defect is directly linked to the mutation in SRA1. PMID:27481446

  10. Molecular cloning of the tomato Hairless gene implicates actin dynamics in trichome-mediated defense and mechanical properties of stem tissue.

    PubMed

    Kang, Jin-Ho; Campos, Marcelo L; Zemelis-Durfee, Starla; Al-Haddad, Jameel M; Jones, A Daniel; Telewski, Frank W; Brandizzi, Federica; Howe, Gregg A

    2016-10-01

    Trichomes are epidermal structures that provide a first line of defense against arthropod herbivores. The recessive hairless (hl) mutation in tomato (Solanum lycopersicum L.) causes severe distortion of trichomes on all aerial tissues, impairs the accumulation of sesquiterpene and polyphenolic compounds in glandular trichomes, and compromises resistance to the specialist herbivore Manduca sexta Here, we demonstrate that the tomato Hl gene encodes a subunit (SRA1) of the highly conserved WAVE regulatory complex that controls nucleation of actin filaments in a wide range of eukaryotic cells. The tomato SRA1 gene spans a 42-kb region containing both Solyc11g013280 and Solyc11g013290 The hl mutation corresponds to a complex 3-kb deletion that removes the last exon of the gene. Expression of a wild-type SRA1 cDNA in the hl mutant background restored normal trichome development, accumulation of glandular trichome-derived metabolites, and resistance to insect herbivory. These findings establish a role for SRA1 in the development of tomato trichomes and also implicate the actin-cytoskeleton network in cytosolic control of specialized metabolism for plant defense. We also show that the brittleness of hl mutant stems is associated with altered mechanical and cell morphological properties of stem tissue, and demonstrate that this defect is directly linked to the mutation in SRA1.

  11. Nuclear Actin in Development and Transcriptional Reprogramming

    PubMed Central

    Misu, Shinji; Takebayashi, Marina; Miyamoto, Kei

    2017-01-01

    Actin is a highly abundant protein in eukaryotic cells and dynamically changes its polymerized states with the help of actin-binding proteins. Its critical function as a constituent of cytoskeleton has been well-documented. Growing evidence demonstrates that actin is also present in nuclei, referred to as nuclear actin, and is involved in a number of nuclear processes, including transcriptional regulation and chromatin remodeling. The contribution of nuclear actin to transcriptional regulation can be explained by its direct interaction with transcription machineries and chromatin remodeling factors and by controlling the activities of transcription factors. In both cases, polymerized states of nuclear actin affect the transcriptional outcome. Nuclear actin also plays an important role in activating strongly silenced genes in somatic cells for transcriptional reprogramming. When these nuclear functions of actin are considered, it is plausible to speculate that nuclear actin is also implicated in embryonic development, in which numerous genes need to be activated in a well-coordinated manner. In this review, we especially focus on nuclear actin’s roles in transcriptional activation, reprogramming and development, including stem cell differentiation and we discuss how nuclear actin can be an important player in development and cell differentiation. PMID:28326098

  12. Actinic Prurigo.

    PubMed

    Rodríguez-Carreón, Alma Angélica; Rodríguez-Lobato, Erika; Rodríguez-Gutiérrez, Georgina; Cuevas-González, Juan Carlos; Mancheno-Valencia, Alexandra; Solís-Arias, Martha Patricia; Vega-Memije, María Elisa; Hojyo-Tomoka, María Teresa; Domínguez-Soto, Luciano

    2015-01-01

    Actinic prurigo is an idiopathic photodermatosis that affects the skin, as well as the labial and conjunctival mucosa in indigenous and mestizo populations of Latin America. It starts predominantly in childhood, has a chronic course, and is exacerbated with solar exposure. Little is known of its pathophysiology, including the known mechanisms of the participation of HLA-DR4 and an abnormal immunologic response with increase of T CD4+ lymphocytes. The presence of IgE, eosinophils, and mast cells suggests that it is a hypersensitivity reaction (likely type IVa or b). The diagnosis is clinical, and the presence of lymphoid follicles in the mucosal histopathologic study of mucosa is pathognomonic. The best available treatment to date is thalidomide, despite its secondary effects.

  13. Gene turnover and differential retention in the relaxin/insulin-like gene family in primates.

    PubMed

    Arroyo, José Ignacio; Hoffmann, Federico G; Opazo, Juan C

    2012-06-01

    The relaxin/insulin-like gene family is related to the insulin gene family, and includes two separate types of peptides: relaxins (RLNs) and insulin-like peptides (INSLs) that perform a variety of physiological roles including testicular descent, growth and differentiation of the mammary glands, trophoblast development, and cell differentiation. In vertebrates, these genes are found on three separate genomic loci, and in mammals, variation in the number and nature of genes in this family is mostly restricted to the Relaxin Family Locus B. For example, this locus contains a single copy of RLN in platypus and opossum, whereas it contains copies of the INSL6, INSL4, RLN2 and RLN1 genes in human and chimp. The main objective of this research is to characterize changes in the size and membership composition of the RLN/INSL gene family in primates, reconstruct the history of the RLN/INSL genes of primates, and test competing evolutionary scenarios regarding the origin of INSL4 and of the duplicated copies of the RLN gene of apes. Our results show that the relaxin/INSL-like gene family of primates has had a more dynamic evolutionary history than previously thought, including several examples of gene duplications and losses which are consistent with the predictions of the birth-and-death model of gene family evolution. In particular, we found that the differential retention of relatively old paralogs played a key role in shaping the gene complement of this family in primates. Two examples of this phenomenon are the origin of the INSL4 gene of catarrhines (the group that includes Old World monkeys and apes), and of the duplicate RLN1 and RLN2 paralogs of apes. In the case of INSL4, comparative genomics and phylogenetic analyses indicate that the origin of this gene, which was thought to represent a catarrhine-specific evolutionary innovation, is as old as the split between carnivores and primates, which took place approximately 97 million years ago. In addition, in the case

  14. The ubiquilin gene family: evolutionary patterns and functional insights

    PubMed Central

    2014-01-01

    Background Ubiquilins are proteins that function as ubiquitin receptors in eukaryotes. Mutations in two ubiquilin-encoding genes have been linked to the genesis of neurodegenerative diseases. However, ubiquilin functions are still poorly understood. Results In this study, evolutionary and functional data are combined to determine the origin and diversification of the ubiquilin gene family and to characterize novel potential roles of ubiquilins in mammalian species, including humans. The analysis of more than six hundred sequences allowed characterizing ubiquilin diversity in all the main eukaryotic groups. Many organisms (e. g. fungi, many animals) have single ubiquilin genes, but duplications in animal, plant, alveolate and excavate species are described. Seven different ubiquilins have been detected in vertebrates. Two of them, here called UBQLN5 and UBQLN6, had not been hitherto described. Significantly, marsupial and eutherian mammals have the most complex ubiquilin gene families, composed of up to 6 genes. This exceptional mammalian-specific expansion is the result of the recent emergence of four new genes, three of them (UBQLN3, UBQLN5 and UBQLNL) with precise testis-specific expression patterns that indicate roles in the postmeiotic stages of spermatogenesis. A gene with related features has independently arisen in species of the Drosophila genus. Positive selection acting on some mammalian ubiquilins has been detected. Conclusions The ubiquilin gene family is highly conserved in eukaryotes. The infrequent lineage-specific amplifications observed may be linked to the emergence of novel functions in particular tissues. PMID:24674348

  15. BranchClust: a phylogenetic algorithm for selecting gene families

    PubMed Central

    Poptsova, Maria S; Gogarten, J Peter

    2007-01-01

    Background Automated methods for assembling families of orthologous genes include those based on sequence similarity scores and those based on phylogenetic approaches. The first are easy to automate but usually they do not distinguish between paralogs and orthologs or have restriction on the number of taxa. Phylogenetic methods often are based on reconciliation of a gene tree with a known rooted species tree; a limitation of this approach, especially in case of prokaryotes, is that the species tree is often unknown, and that from the analyses of single gene families the branching order between related organisms frequently is unresolved. Results Here we describe an algorithm for the automated selection of orthologous genes that recognizes orthologous genes from different species in a phylogenetic tree for any number of taxa. The algorithm is capable of distinguishing complete (containing all taxa) and incomplete (not containing all taxa) families and recognizes in- and outparalogs. The BranchClust algorithm is implemented in Perl with the use of the BioPerl module for parsing trees and is freely available at . Conclusion BranchClust outperforms the Reciprocal Best Blast hit method in selecting more sets of putatively orthologous genes. In the test cases examined, the correctness of the selected families and of the identified in- and outparalogs was confirmed by inspection of the pertinent phylogenetic trees. PMID:17425803

  16. Identification and characterization of TIFY family genes in Brachypodium distachyon.

    PubMed

    Zhang, Lihua; You, Jun; Chan, Zhulong

    2015-11-01

    The TIFY family is a plant-specific gene family encoding proteins characterized by a conserved TIFY domain. This family encodes four subfamilies of proteins, including ZIM-like (ZML), TIFY, PPD and JASMONATE ZIM-Domain (JAZ) proteins. TIFY proteins play important roles in plant development and stress responses. In this study, 21 BdTIFYs were identified in Brachypodium distachyon through genome-wide analysis, including 15 JAZ and 6 ZML genes. Analysis of the distribution of conserved domains showed that there are three additional domains (CCT domain, GATA domain and Jas domain) in the BdTIFY proteins besides the TIFY domain. Phylogenetic analysis indicated that these 21 proteins were classified into two major groups. Expression profile of BdTIFY genes in response to abiotic stresses and phytohormones was analyzed using quantitative real-time RT-PCR. Among 21 BdTIFY genes, 12 of them were induced by JA treatment, and 4 of them were induced by ABA treatment. Most of BdTIFY genes were responsive to one or more abiotic stresses including drought, salinity, low temperature and heat. Especially, BdTIFY5, 9a, 9b, 10c and 11a were significantly up-regulated by multiple abiotic stresses. These results provided important clues for functional analysis of TIFY family genes in B. distachyon.

  17. Evolution of the YABBY gene family in seed plants.

    PubMed

    Finet, Cédric; Floyd, Sandra K; Conway, Stephanie J; Zhong, Bojian; Scutt, Charles P; Bowman, John L

    2016-01-01

    Members of the YABBY gene family of transcription factors in angiosperms have been shown to be involved in the initiation of outgrowth of the lamina, the maintenance of polarity, and establishment of the leaf margin. Although most of the dorsal-ventral polarity genes in seed plants have homologs in non-spermatophyte lineages, the presence of YABBY genes is restricted to seed plants. To gain insight into the origin and diversification of this gene family, we reconstructed the evolutionary history of YABBY gene lineages in seed plants. Our findings suggest that either one or two YABBY genes were present in the last common ancestor of extant seed plants. We also examined the expression of YABBY genes in the gymnosperms Ephedra distachya (Gnetales), Ginkgo biloba (Ginkgoales), and Pseudotsuga menziesii (Coniferales). Our data indicate that some YABBY genes are expressed in a polar (abaxial) manner in leaves and female cones in gymnosperms. We propose that YABBY genes already acted as polarity genes in the last common ancestor of extant seed plants.

  18. The role of CCN family genes in haematological malignancies.

    PubMed

    Wells, J E; Howlett, M; Cheung, L C; Kees, Ursula R

    2015-09-01

    Haematological malignancies, although a broad range of specific disease types, continue to show considerable overlap in classification, and patients are treated using similar chemotherapy regimes. In this review we look at the role of the CCN family of matricellular proteins and indicate their role in nine haematological malignancies including both myeloid and lymphoid neoplasms. The potential for further haematological neoplasms with CCN family associations is argued by summarising the demonstrated role of CCN family genes in the differentiation of haematopoietic stem cells (HSC) and mesenchymal stem cells. The expanding field of knowledge encompassing CCN family genes and cancers of the HSC-lineage highlights the importance of extracellular matrix-interactions in both normal physiology and tumorigenesis of the blood, bone marrow and lymph nodes.

  19. Molecular Evolution of the Glycosyltransferase 6 Gene Family in Primates

    PubMed Central

    Mendonça-Mattos, Patricia Jeanne de Souza; Harada, Maria Lúcia

    2016-01-01

    Glycosyltransferase 6 gene family includes ABO, Ggta1, iGb3S, and GBGT1 genes and by three putative genes restricted to mammals, GT6m6, GTm6, and GT6m7, only the latter is found in primates. GT6 genes may encode functional and nonfunctional proteins. Ggta1 and GBGT1 genes, for instance, are pseudogenes in catarrhine primates, while iGb3S gene is only inactive in human, bonobo, and chimpanzee. Even inactivated, these genes tend to be conversed in primates. As some of the GT6 genes are related to the susceptibility or resistance to parasites, we investigated (i) the selective pressure on the GT6 paralogs genes in primates; (ii) the basis of the conservation of iGb3S in human, chimpanzee, and bonobo; and (iii) the functional potential of the GBGT1 and GT6m7 in catarrhines. We observed that the purifying selection is prevalent and these genes have a low diversity, though ABO and Ggta1 genes have some sites under positive selection. GT6m7, a putative gene associated with aggressive periodontitis, may have regulatory function, but experimental studies are needed to assess its function. The evolutionary conservation of iGb3S in humans, chimpanzee, and bonobo seems to be the result of proximity to genes with important biological functions. PMID:28044107

  20. Exploiting Gene Families for Phylogenomic Analysis of Myzostomid Transcriptome Data

    PubMed Central

    Hartmann, Stefanie; Helm, Conrad; Nickel, Birgit; Meyer, Matthias; Struck, Torsten H.; Tiedemann, Ralph; Selbig, Joachim; Bleidorn, Christoph

    2012-01-01

    Background In trying to understand the evolutionary relationships of organisms, the current flood of sequence data offers great opportunities, but also reveals new challenges with regard to data quality, the selection of data for subsequent analysis, and the automation of steps that were once done manually for single-gene analyses. Even though genome or transcriptome data is available for representatives of most bilaterian phyla, some enigmatic taxa still have an uncertain position in the animal tree of life. This is especially true for myzostomids, a group of symbiotic (or parasitic) protostomes that are either placed with annelids or flatworms. Methodology Based on similarity criteria, Illumina-based transcriptome sequences of one myzostomid were compared to protein sequences of one additional myzostomid and 29 reference metazoa and clustered into gene families. These families were then used to investigate the phylogenetic position of Myzostomida using different approaches: Alignments of 989 sequence families were concatenated, and the resulting superalignment was analyzed under a Maximum Likelihood criterion. We also used all 1,878 gene trees with at least one myzostomid sequence for a supertree approach: the individual gene trees were computed and then reconciled into a species tree using gene tree parsimony. Conclusions Superalignments require strictly orthologous genes, and both the gene selection and the widely varying amount of data available for different taxa in our dataset may cause anomalous placements and low bootstrap support. In contrast, gene tree parsimony is designed to accommodate multilocus gene families and therefore allows a much more comprehensive data set to be analyzed. Results of this supertree approach showed a well-resolved phylogeny, in which myzostomids were part of the annelid radiation, and major bilaterian taxa were found to be monophyletic. PMID:22276131

  1. The Actinome of Dictyostelium discoideum in Comparison to Actins and Actin-Related Proteins from Other Organisms

    PubMed Central

    Joseph, Jayabalan M.; Fey, Petra; Ramalingam, Nagendran; Liu, Xiao I.; Rohlfs, Meino; Noegel, Angelika A.; Müller-Taubenberger, Annette; Glöckner, Gernot; Schleicher, Michael

    2008-01-01

    Actin belongs to the most abundant proteins in eukaryotic cells which harbor usually many conventional actin isoforms as well as actin-related proteins (Arps). To get an overview over the sometimes confusing multitude of actins and Arps, we analyzed the Dictyostelium discoideum actinome in detail and compared it with the genomes from other model organisms. The D. discoideum actinome comprises 41 actins and actin-related proteins. The genome contains 17 actin genes which most likely arose from consecutive gene duplications, are all active, in some cases developmentally regulated and coding for identical proteins (Act8-group). According to published data, the actin fraction in a D. discoideum cell consists of more than 95% of these Act8-type proteins. The other 16 actin isoforms contain a conventional actin motif profile as well but differ in their protein sequences. Seven actin genes are potential pseudogenes. A homology search of the human genome using the most typical D. discoideum actin (Act8) as query sequence finds the major actin isoforms such as cytoplasmic beta-actin as best hit. This suggests that the Act8-group represents a nearly perfect actin throughout evolution. Interestingly, limited data from D. fasciculatum, a more ancient member among the social amoebae, show different relationships between conventional actins. The Act8-type isoform is most conserved throughout evolution. Modeling of the putative structures suggests that the majority of the actin-related proteins is functionally unrelated to canonical actin. The data suggest that the other actin variants are not necessary for the cytoskeleton itself but rather regulators of its dynamical features or subunits in larger protein complexes. PMID:18612387

  2. Runx Family Genes in Tissue Stem Cell Dynamics.

    PubMed

    Wang, Chelsia Qiuxia; Mok, Michelle Meng Huang; Yokomizo, Tomomasa; Tergaonkar, Vinay; Osato, Motomi

    2017-01-01

    The Runx family genes play important roles in development and cancer, largely via their regulation of tissue stem cell behavior. Their involvement in two organs, blood and skin, is well documented. This review summarizes currently known Runx functions in the stem cells of these tissues. The fundamental core mechanism(s) mediated by Runx proteins has been sought; however, it appears that there does not exist one single common machinery that governs both tissue stem cells. Instead, Runx family genes employ multiple spatiotemporal mechanisms in regulating individual tissue stem cell populations. Such specific Runx requirements have been unveiled by a series of cell type-, developmental stage- or age-specific gene targeting studies in mice. Observations from these experiments revealed that the regulation of stem cells by Runx family genes turned out to be far more complex than previously thought. For instance, although it has been reported that Runx1 is required for the endothelial-to-hematopoietic cell transition (EHT) but not thereafter, recent studies clearly demonstrated that Runx1 is also needed during the period subsequent to EHT, namely at perinatal stage. In addition, Runx1 ablation in the embryonic skin mesenchyme eventually leads to complete loss of hair follicle stem cells (HFSCs) in the adult epithelium, suggesting that Runx1 facilitates the specification of skin epithelial stem cells in a cell extrinsic manner. Further in-depth investigation into how Runx family genes are involved in stem cell regulation is warranted.

  3. Expansion of transducin subunit gene families in early vertebrate tetraploidizations.

    PubMed

    Lagman, David; Sundström, Görel; Ocampo Daza, Daniel; Abalo, Xesús M; Larhammar, Dan

    2012-10-01

    Hundreds of gene families expanded in the early vertebrate tetraploidizations including many gene families in the phototransduction cascade. We have investigated the evolution of the heterotrimeric G-proteins of photoreceptors, the transducins, in relation to these events using both phylogenetic analyses and synteny comparisons. Three alpha subunit genes were identified in amniotes and the coelacanth, GNAT1-3; two of these were identified in amphibians and teleost fish, GNAT1 and GNAT2. Most tetrapods have four beta genes, GNB1-4, and teleosts have additional duplicates. Finally, three gamma genes were identified in mammals, GNGT1, GNG11 and GNGT2. Of these, GNGT1 and GNGT2 were found in the other vertebrates. In frog and zebrafish additional duplicates of GNGT2 were identified. Our analyses show all three transducin families expanded during the early vertebrate tetraploidizations and the beta and gamma families gained additional copies in the teleost-specific genome duplication. This suggests that the tetraploidizations contributed to visual specialisations.

  4. Evolution of an expanded mannose receptor gene family.

    PubMed

    Staines, Karen; Hunt, Lawrence G; Young, John R; Butter, Colin

    2014-01-01

    Sequences of peptides from a protein specifically immunoprecipitated by an antibody, KUL01, that recognises chicken macrophages, identified a homologue of the mammalian mannose receptor, MRC1, which we called MRC1L-B. Inspection of the genomic environment of the chicken gene revealed an array of five paralogous genes, MRC1L-A to MRC1L-E, located between conserved flanking genes found either side of the single MRC1 gene in mammals. Transcripts of all five genes were detected in RNA from a macrophage cell line and other RNAs, whose sequences allowed the precise definition of spliced exons, confirming or correcting existing bioinformatic annotation. The confirmed gene structures were used to locate orthologues of all five genes in the genomes of two other avian species and of the painted turtle, all with intact coding sequences. The lizard genome had only three genes, one orthologue of MRC1L-A and two orthologues of the MRC1L-B antigen gene resulting from a recent duplication. The Xenopus genome, like that of most mammals, had only a single MRC1-like gene at the corresponding locus. MRC1L-A and MRC1L-B genes had similar cytoplasmic regions that may be indicative of similar subcellular migration and functions. Cytoplasmic regions of the other three genes were very divergent, possibly indicating the evolution of a new functional repertoire for this family of molecules, which might include novel interactions with pathogens.

  5. Structure and regulation of the Asr gene family in banana.

    PubMed

    Henry, Isabelle M; Carpentier, Sebastien C; Pampurova, Suzana; Van Hoylandt, Anais; Panis, Bart; Swennen, Rony; Remy, Serge

    2011-10-01

    Abscisic acid, stress, ripening proteins (ASR) are a family of plant-specific small hydrophilic proteins. Studies in various plant species have highlighted their role in increased resistance to abiotic stress, including drought, but their specific function remains unknown. As a first step toward their potential use in crop improvement, we investigated the structure and regulation of the Asr gene family in Musa species (bananas and plantains). We determined that the Musa Asr gene family contained at least four members, all of which exhibited the typical two exons, one intron structure of Asr genes and the "ABA/WDS" (abscisic acid/water deficit stress) domain characteristic of Asr genes. Phylogenetic analyses determined that the Musa Asr genes were closely related to each other, probably as the product of recent duplication events. For two of the four members, two versions corresponding to the two sub-genomes of Musa, acuminata and balbisiana were identified. Gene expression and protein analyses were performed and Asr expression could be detected in meristem cultures, root, pseudostem, leaf and cormus. In meristem cultures, mAsr1 and mAsr3 were induced by osmotic stress and wounding, while mAsr3 and mAsr4 were induced by exposure to ABA. mASR3 exhibited the most variation both in terms of amino acid sequence and expression pattern, making it the most promising candidate for further functional study and use in crop improvement.

  6. The d4 gene family in the human genome

    SciTech Connect

    Chestkov, A.V.; Baka, I.D.; Kost, M.V.

    1996-08-15

    The d4 domain, a novel zinc finger-like structural motif, was first revealed in the rat neuro-d4 protein. Here we demonstrate that the d4 domain is conserved in evolution and that three related genes form a d4 family in the human genome. The human neuro-d4 is very similar to rat neuro-d4 at both the amino acid and the nucleotide levels. Moreover, the same splice variants have been detected among rat and human neuro-d4 transcripts. This gene has been localized on chromosome 19, and two other genes, members of the d4 family isolated by screening of the human genomic library at low stringency, have been mapped to chromosomes 11 and 14. The gene on chromosome 11 is the homolog of the ubiquitously expressed mouse gene ubi-d4/requiem, which is required for cell death after deprivation of trophic factors. A gene with a conserved d4 domain has been found in the genome of the nematode Caenorhabditis elegans. The conservation of d4 proteins from nematodes to vertebrates suggests that they have a general importance, but a diversity of d4 proteins expressed in vertebrate nervous systems suggests that some family members have special functions. 11 refs., 2 figs.

  7. An evolutionary screen highlights canonical and noncanonical candidate antiviral genes within the primate TRIM gene family.

    PubMed

    Malfavon-Borja, Ray; Sawyer, Sara L; Wu, Lily I; Emerman, Michael; Malik, Harmit S

    2013-01-01

    Recurrent viral pressure has acted on host-encoded antiviral genes during primate and mammalian evolution. This selective pressure has resulted in dramatic episodes of adaptation in host antiviral genes, often detected via positive selection. These evolutionary signatures of adaptation have the potential to highlight previously unrecognized antiviral genes (also called restriction factors). Although the TRIM multigene family is recognized for encoding several bona fide restriction factors (e.g., TRIM5alpha), most members of this expansive gene family remain uncharacterized. Here, we investigated the TRIM multigene family for signatures of positive selection to identify novel candidate antiviral genes. Our analysis reveals previously undocumented signatures of positive selection in 17 TRIM genes, 10 of which represent novel candidate restriction factors. These include the unusual TRIM52 gene, which has evolved under strong positive selection despite its encoded protein lacking a putative viral recognition (B30.2) domain. We show that TRIM52 arose via gene duplication from the TRIM41 gene. Both TRIM52 and TRIM41 have dramatically expanded RING domains compared with the rest of the TRIM multigene family, yet this domain has evolved under positive selection only in primate TRIM52, suggesting that it represents a novel host-virus interaction interface. Our evolutionary-based screen not only documents positive selection in known TRIM restriction factors but also highlights candidate novel restriction factors, providing insight into the interfaces of host-pathogen interactions mediated by the TRIM multigene family.

  8. Analysis of the Prefoldin Gene Family in 14 Plant Species

    PubMed Central

    Cao, Jun

    2016-01-01

    Prefoldin is a hexameric molecular chaperone complex present in all eukaryotes and archaea. The evolution of this gene family in plants is unknown. Here, I identified 140 prefoldin genes in 14 plant species. These prefoldin proteins were divided into nine groups through phylogenetic analysis. Highly conserved gene organization and motif distribution exist in each prefoldin group, implying their functional conservation. I also observed the segmental duplication of maize prefoldin gene family. Moreover, a few functional divergence sites were identified within each group pairs. Functional network analyses identified 78 co-expressed genes, and most of them were involved in carrying, binding and kinase activity. Divergent expression profiles of the maize prefoldin genes were further investigated in different tissues and development periods and under auxin and some abiotic stresses. I also found a few cis-elements responding to abiotic stress and phytohormone in the upstream sequences of the maize prefoldin genes. The results provided a foundation for exploring the characterization of the prefoldin genes in plants and will offer insights for additional functional studies. PMID:27014333

  9. Sucrose metabolism gene families and their biological functions

    PubMed Central

    Jiang, Shu-Ye; Chi, Yun-Hua; Wang, Ji-Zhou; Zhou, Jun-Xia; Cheng, Yan-Song; Zhang, Bao-Lan; Ma, Ali; Vanitha, Jeevanandam; Ramachandran, Srinivasan

    2015-01-01

    Sucrose, as the main product of photosynthesis, plays crucial roles in plant development. Although studies on general metabolism pathway were well documented, less information is available on the genome-wide identification of these genes, their expansion and evolutionary history as well as their biological functions. We focused on four sucrose metabolism related gene families including sucrose synthase, sucrose phosphate synthase, sucrose phosphate phosphatase and UDP-glucose pyrophosphorylase. These gene families exhibited different expansion and evolutionary history as their host genomes experienced differentiated rates of the whole genome duplication, tandem and segmental duplication, or mobile element mediated gene gain and loss. They were evolutionarily conserved under purifying selection among species and expression divergence played important roles for gene survival after expansion. However, we have detected recent positive selection during intra-species divergence. Overexpression of 15 sorghum genes in Arabidopsis revealed their roles in biomass accumulation, flowering time control, seed germination and response to high salinity and sugar stresses. Our studies uncovered the molecular mechanisms of gene expansion and evolution and also provided new insight into the role of positive selection in intra-species divergence. Overexpression data revealed novel biological functions of these genes in flowering time control and seed germination under normal and stress conditions. PMID:26616172

  10. New Genes Originated via Multiple Recombinational Pathways in the β-Globin Gene Family of Rodents

    PubMed Central

    Hoffmann, Federico G.; Opazo, Juan C.; Storz, Jay F.

    2008-01-01

    Species differences in the size or membership composition of multigene families can be attributed to lineage-specific additions of new genes via duplication, losses of genes via deletion or inactivation, and the creation of chimeric genes via domain shuffling or gene fusion. In principle, it should be possible to infer the recombinational pathways responsible for each of these different types of genomic change by conducting detailed comparative analyses of genomic sequence data. Here, we report an attempt to unravel the complex evolutionary history of the β-globin gene family in a taxonomically diverse set of rodent species. The main objectives were: 1) to characterize the genomic structure of the β-globin gene cluster of rodents; 2) to assign orthologous and paralogous relationships among duplicate copies of β-like globin genes; and 3) to infer the specific recombinational pathways responsible for gene duplications, gene deletions, and the creation of chimeric fusion genes. Results of our comparative genomic analyses revealed that variation in gene family size among rodent species is mainly attributable to the differential gain and loss of later expressed β-globin genes via unequal crossing-over. However, two distinct recombinational mechanisms were implicated in the creation of chimeric fusion genes. In muroid rodents, a chimeric γ/ε fusion gene was created by unequal crossing-over between the embryonic ε- and γ-globin genes. Interestingly, this γ/ε fusion gene was generated in the same fashion as the “anti-Lepore” 5′-δ-(β/δ)-β-3′ duplication mutant in humans (the reciprocal exchange product of the pathological hemoglobin Lepore deletion mutant). By contrast, in the house mouse, Mus musculus, a chimeric β/δ fusion pseudogene was created by a β-globin → δ-globin gene conversion event. Although the γ/ε and β/δ fusion genes share a similar chimeric gene structure, they originated via completely different recombinational pathways. PMID

  11. Vascular disease-causing mutation R258C in ACTA2 disrupts actin dynamics and interaction with myosin

    PubMed Central

    Lu, Hailong; Fagnant, Patricia M.; Bookwalter, Carol S.; Joel, Peteranne; Trybus, Kathleen M.

    2015-01-01

    Point mutations in vascular smooth muscle α-actin (SM α-actin), encoded by the gene ACTA2, are the most prevalent cause of familial thoracic aortic aneurysms and dissections (TAAD). Here, we provide the first molecular characterization, to our knowledge, of the effect of the R258C mutation in SM α-actin, expressed with the baculovirus system. Smooth muscles are unique in that force generation requires both interaction of stable actin filaments with myosin and polymerization of actin in the subcortical region. Both aspects of R258C function therefore need investigation. Total internal reflection fluorescence (TIRF) microscopy was used to quantify the growth of single actin filaments as a function of time. R258C filaments are less stable than WT and more susceptible to severing by cofilin. Smooth muscle tropomyosin offers little protection from cofilin cleavage, unlike its effect on WT actin. Unexpectedly, profilin binds tighter to the R258C monomer, which will increase the pool of globular actin (G-actin). In an in vitro motility assay, smooth muscle myosin moves R258C filaments more slowly than WT, and the slowing is exacerbated by smooth muscle tropomyosin. Under loaded conditions, small ensembles of myosin are unable to produce force on R258C actin-tropomyosin filaments, suggesting that tropomyosin occupies an inhibitory position on actin. Many of the observed defects cannot be explained by a direct interaction with the mutated residue, and thus the mutation allosterically affects multiple regions of the monomer. Our results align with the hypothesis that defective contractile function contributes to the pathogenesis of TAAD. PMID:26153420

  12. Evolutionary Dynamics of the wnt Gene Family: A Lophotrochozoan Perspective

    PubMed Central

    Cho, Sung-Jin; Vallès, Yvonne; Giani, Vincent C.; Seaver, Elaine C.; Weisblat, David A.

    2010-01-01

    The wnt gene family encodes a set of secreted glycoproteins involved in key developmental processes, including cell fate specification and regulation of posterior growth (Cadigan KM, Nusse R. 1997. Wnt signaling: a common theme in animal development. Genes Dev. 11:3286–3305.; Martin BL, Kimelman D. 2009. Wnt signaling and the evolution of embryonic posterior development. Curr Biol. 19:R215–R219.). As for many other gene families, evidence for expansion and/or contraction of the wnt family is available from deuterostomes (e.g., echinoderms and vertebrates [Nusse R, Varmus HE. 1992. Wnt genes. Cell. 69:1073–1087.; Schubert M, Holland LZ, Holland ND, Jacobs DK. 2000. A phylogenetic tree of the Wnt genes based on all available full-length sequences, including five from the cephalochordate amphioxus. Mol Biol Evol. 17:1896–1903.; Croce JC, Wu SY, Byrum C, Xu R, Duloquin L, Wikramanayake AH, Gache C, McClay DR. 2006. A genome-wide survey of the evolutionarily conserved Wnt pathways in the sea urchin Strongylocentrotus purpuratus. Dev Biol. 300:121–131.]) and ecdysozoans (e.g., arthropods and nematodes [Eisenmann DM. 2005. Wnt signaling. WormBook. 1–17.; Bolognesi R, Farzana L, Fischer TD, Brown SJ. 2008. Multiple Wnt genes are required for segmentation in the short-germ embryo of Tribolium castaneum. Curr Biol. 18:1624–1629.]), but little is known from the third major bilaterian group, the lophotrochozoans (e.g., mollusks and annelids [Prud'homme B, Lartillot N, Balavoine G, Adoutte A, Vervoort M. 2002. Phylogenetic analysis of the Wnt gene family. Insights from lophotrochozoan members. Curr Biol. 12:1395.]). To obtain a more comprehensive scenario of the evolutionary dynamics of this gene family, we exhaustively mined wnt gene sequences from the whole genome assemblies of a mollusk (Lottia gigantea) and two annelids (Capitella teleta and Helobdella robusta) and examined them by phylogenetic, genetic linkage, intron–exon structure, and embryonic

  13. Genome-Wide Analysis of Homeobox Gene Family in Legumes: Identification, Gene Duplication and Expression Profiling

    PubMed Central

    Garg, Rohini; Jain, Mukesh

    2015-01-01

    Homeobox genes encode transcription factors that are known to play a major role in different aspects of plant growth and development. In the present study, we identified homeobox genes belonging to 14 different classes in five legume species, including chickpea, soybean, Medicago, Lotus and pigeonpea. The characteristic differences within homeodomain sequences among various classes of homeobox gene family were quite evident. Genome-wide expression analysis using publicly available datasets (RNA-seq and microarray) indicated that homeobox genes are differentially expressed in various tissues/developmental stages and under stress conditions in different legumes. We validated the differential expression of selected chickpea homeobox genes via quantitative reverse transcription polymerase chain reaction. Genome duplication analysis in soybean indicated that segmental duplication has significantly contributed in the expansion of homeobox gene family. The Ka/Ks ratio of duplicated homeobox genes in soybean showed that several members of this family have undergone purifying selection. Moreover, expression profiling indicated that duplicated genes might have been retained due to sub-functionalization. The genome-wide identification and comprehensive gene expression profiling of homeobox gene family members in legumes will provide opportunities for functional analysis to unravel their exact role in plant growth and development. PMID:25745864

  14. Genome-wide analysis of homeobox gene family in legumes: identification, gene duplication and expression profiling.

    PubMed

    Bhattacharjee, Annapurna; Ghangal, Rajesh; Garg, Rohini; Jain, Mukesh

    2015-01-01

    Homeobox genes encode transcription factors that are known to play a major role in different aspects of plant growth and development. In the present study, we identified homeobox genes belonging to 14 different classes in five legume species, including chickpea, soybean, Medicago, Lotus and pigeonpea. The characteristic differences within homeodomain sequences among various classes of homeobox gene family were quite evident. Genome-wide expression analysis using publicly available datasets (RNA-seq and microarray) indicated that homeobox genes are differentially expressed in various tissues/developmental stages and under stress conditions in different legumes. We validated the differential expression of selected chickpea homeobox genes via quantitative reverse transcription polymerase chain reaction. Genome duplication analysis in soybean indicated that segmental duplication has significantly contributed in the expansion of homeobox gene family. The Ka/Ks ratio of duplicated homeobox genes in soybean showed that several members of this family have undergone purifying selection. Moreover, expression profiling indicated that duplicated genes might have been retained due to sub-functionalization. The genome-wide identification and comprehensive gene expression profiling of homeobox gene family members in legumes will provide opportunities for functional analysis to unravel their exact role in plant growth and development.

  15. Origin and evolution of laminin gene family diversity.

    PubMed

    Fahey, Bryony; Degnan, Bernard M

    2012-07-01

    Laminins are a family of multidomain glycoproteins that are important contributors to the structure of metazoan extracellular matrices. To investigate the origin and evolution of the laminin family, we characterized the full complement of laminin-related genes in the genome of the sponge, Amphimedon queenslandica. As a representative of the Demospongiae, a group consistently placed within the earliest diverging branch of animals by molecular phylogenies, Amphimedon is uniquely placed to provide insight into early steps in the evolution of metazoan gene families. Five Amphimedon laminin-related genes possess the conserved molecular features, and most of the domains found in bilaterian laminins, but all display domain architectures distinct from those of the canonical laminin chain types known from model bilaterians. This finding prompted us to perform a comparative genomic analysis of laminins and related genes from a choanoflagellate and diverse metazoans and to conduct phylogenetic analyses using the conserved Laminin N-terminal domain in order to explore the relationships between genes with distinct architectures. Laminin-like genes appear to have originated in the holozoan lineage (choanoflagellates + metazoans + several other unicellular opisthokont taxa), with several laminin domains originating later and appearing only in metazoan (animal) or eumetazoan (placozoans + ctenophores + cnidarians + bilaterians) laminins. Typical bilaterian α, β, and γ laminin chain forms arose in the eumetazoan stem and another chain type that is conserved in Amphimedon, the cnidarian, Nematostella vectensis, and the echinoderm, Strongylocentrotus purpuratus, appears to have been lost independently from the placozoan, Trichoplax adhaerens, and from multiple bilaterians. Phylogenetic analysis did not clearly reconstruct relationships between the distinct laminin chain types (with the exception of the α chains) but did reveal how several members of the netrin family were

  16. The FT/TFL1 gene family in grapevine.

    PubMed

    Carmona, María José; Calonje, Myriam; Martínez-Zapater, José Miguel

    2007-03-01

    The FT/TFL1 gene family encodes proteins with similarity to phosphatidylethanolamine binding proteins which function as flowering promoters and repressors. We show here that the FT/TFL1 gene family in Vitis vinifera is composed of at least five genes. Sequence comparisons with homologous genes identified in other dicot species group them in three major clades, the FT, MFT and TFL1 subfamilies, the latter including three of the Vitis sequences. Gene expression patterns are in agreement with a role of VvFT and VvMFT as flowering promoters; while VvTFL1A, VvTFL1B and VvTFL1C could be associated with vegetative development and maintenance of meristem indetermination. Overexpression of VvFT in transgenic Arabidopsis plants generates early flowering phenotypes similar to those produced by FT supporting a role for this gene in flowering promotion. Overexpression of VvTFL1A does not affect flowering time but the determination of flower meristems, strongly altering inflorescence structure, which is consistent with the biological roles assigned to similar genes in other species.

  17. CHD7 Gene Polymorphisms and Familial Idiopathic Scoliosis

    PubMed Central

    Tilley, Mera K.; Justice, Cristina M.; Swindle, Kandice; Marosy, Beth; Wilson, Alexander F.; Miller, Nancy H.

    2013-01-01

    Study Design Model-independent linkage analysis and tests of association were performed for 22 single nucleotide polymorphisms (SNPs) in the CHD7 gene in 244 families of European descent with familial idiopathic scoliosis (FIS). Objective To replicate an association between FIS and the CHD7 gene on 8q12.2 in an independent sample of families of European descent. Summary of Background Data The CHD7 gene on chromosome 8, responsible for the CHARGE syndrome, was previously associated with FIS in an independent study that included 52 families of European descent. Methods Model-independent linkage analysis and intra-familial tests of association were performed on the degree of lateral curvature considered as a qualitative trait (with thresholds of ≥10°, ≥15°, ≥20° and ≥30°) and as a quantitative trait (degree of lateral curvature). Results from the tests of associations from this study and the previous study were combined in a weighted meta-analysis. Results No significant results (P< 0.01) were found for linkage analysis or tests of association between genetic variants of the CHD7 and FIS in this study sample, failing to replicate the findings from the previous study. Furthermore, no significant results (P< 0.01) were found from meta-analysis of the results from the tests of association from this sample and from the previous sample. Conclusion No association between the 22 genotyped SNPs in the CHD7 gene and FIS within this study sample was found, failing to replicate the earlier findings. Further investigation of the CHD7 gene and its potential association to FIS may be required. PMID:23883829

  18. Function and cancer genomics of FAT family genes

    PubMed Central

    KATOH, MASARU

    2012-01-01

    FAT1, FAT2, FAT3 and FAT4 are human homologs of Drosophila Fat, which is involved in tumor suppression and planar cell polarity (PCP). FAT1 and FAT4 undergo the first proteolytic cleavage by Furin and are predicted to undergo the second cleavage by γ-secretase to release intracellular domain (ICD). Ena/VAPS-binding to FAT1 induces actin polymerization at lamellipodia and filopodia to promote cell migration, while Scribble-binding to FAT1 induces phosphorylation and functional inhibition of YAP1 to suppress cell growth. FAT1 is repressed in oral cancer owing to homozygous deletion or epigenetic silencing and is preferentially downregulated in invasive breast cancer. On the other hand, FAT1 is upregulated in leukemia and prognosis of preB-ALL patients with FAT1 upregulation is poor. FAT4 directly interacts with MPDZ/MUPP1 to recruit membrane-associated guanylate kinase MPP5/PALS1. FAT4 is involved in the maintenance of PCP and inhibition of cell proliferation. FAT4 mRNA is repressed in breast cancer and lung cancer due to promoter hypermethylation. FAT4 gene is recurrently mutated in several types of human cancers, such as melanoma, pancreatic cancer, gastric cancer and hepatocellular carcinoma. FAT1 and FAT4 suppress tumor growth via activation of Hippo signaling, whereas FAT1 promotes tumor migration via induction of actin polymerization. FAT1 is tumor suppressive or oncogenic in a context-dependent manner, while FAT4 is tumor suppressive. Copy number aberration, translocation and point mutation of FAT1, FAT2, FAT3, FAT4, FRMD1, FRMD6, NF2, WWC1, WWC2, SAV1, STK3, STK4, MOB1A, MOB1B, LATS1, LATS2, YAP1 and WWTR1/TAZ genes should be comprehensively investigated in various types of human cancers to elucidate the mutation landscape of the FAT-Hippo signaling cascades. Because YAP1 and WWTR1 are located at the crossroads of adhesion, GPCR, RTK and stem-cell signaling network, cancer genomics of the FAT signaling cascades could be applied for diagnostics, prognostics

  19. Differential Gene Expression in the Laccase Gene Family from Basidiomycete I-62 (CECT 20197)

    PubMed Central

    Mansur, Mariana; Suárez, Teresa; González, Aldo E.

    1998-01-01

    A family of genes encoding laccases has recently been described for the basidiomycete I-62 (CECT 20197). Transcript levels of genes lcc1, lcc2, and lcc3 were analyzed under four different culture conditions to study their expression patterns. Two of the laccase genes were clearly inducible by veratryl alcohol: the lcc1 gene is inducible in early stages of growth, and the lcc2 gene is also inducible but only when the organism reaches the stationary phase. Transcript levels for the third gene, lcc3, were uninduced by veratryl alcohol and repressed by glucose. PMID:16349507

  20. Effects of the Family Environment: Gene-Environment Interaction and Passive Gene-Environment Correlation

    ERIC Educational Resources Information Center

    Price, Thomas S.; Jaffee, Sara R.

    2008-01-01

    The classical twin study provides a useful resource for testing hypotheses about how the family environment influences children's development, including how genes can influence sensitivity to environmental effects. However, existing statistical models do not account for the possibility that children can inherit exposure to family environments…

  1. The Yeast V159N Actin Mutant Reveals Roles for Actin Dynamics In Vivo

    PubMed Central

    Belmont, Lisa D.; Drubin, David G.

    1998-01-01

    Actin with a Val 159 to Asn mutation (V159N) forms actin filaments that depolymerize slowly because of a failure to undergo a conformational change after inorganic phosphate release. Here we demonstrate that expression of this actin results in reduced actin dynamics in vivo, and we make use of this property to study the roles of rapid actin filament turnover. Yeast strains expressing the V159N mutant (act1-159) as their only source of actin have larger cortical actin patches and more actin cables than wild-type yeast. Rapid actin dynamics are not essential for cortical actin patch motility or establishment of cell polarity. However, fluid phase endocytosis is defective in act1-159 strains. act1-159 is synthetically lethal with cofilin and profilin mutants, supporting the conclusion that mutations in all of these genes impair the polymerization/ depolymerization cycle. In contrast, act1-159 partially suppresses the temperature sensitivity of a tropomyosin mutant, and the loss of cytoplasmic cables seen in fimbrin, Mdm20p, and tropomyosin null mutants, suggesting filament stabilizing functions for these actin-binding proteins. Analysis of the cables in these double-mutant cells supports a role for fimbrin in organizing cytoplasmic cables and for Mdm20p and tropomyosin in excluding cofilin from the cables. PMID:9732289

  2. Predictions of Gene Family Distributions in Microbial Genomes: Evolution by Gene Duplication and Modification

    SciTech Connect

    Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles

    2000-09-18

    A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society.

  3. Population- and Family-Based Studies Associate the "MTHFR" Gene with Idiopathic Autism in Simplex Families

    ERIC Educational Resources Information Center

    Liu, Xudong; Solehdin, Fatima; Cohen, Ira L.; Gonzalez, Maripaz G.; Jenkins, Edmund C.; Lewis, M. E. Suzanne; Holden, Jeanette J. A.

    2011-01-01

    Two methylenetetrahydrofolate reductase gene ("MTHFR") functional polymorphisms were studied in 205 North American simplex (SPX) and 307 multiplex (MPX) families having one or more children with an autism spectrum disorder. Case-control comparisons revealed a significantly higher frequency of the low-activity 677T allele, higher prevalence of the…

  4. A Combinatorial Approach to Detecting Gene-Gene and Gene-Environment Interactions in Family Studies

    PubMed Central

    Lou, Xiang-Yang; Chen, Guo-Bo; Yan, Lei; Ma, Jennie Z.; Mangold, Jamie E.; Zhu, Jun; Elston, Robert C.; Li, Ming D.

    2008-01-01

    Widespread multifactor interactions present a significant challenge in determining risk factors of complex diseases. Several combinatorial approaches, such as the multifactor dimensionality reduction (MDR) method, have emerged as a promising tool for better detecting gene-gene (G × G) and gene-environment (G × E) interactions. We recently developed a general combinatorial approach, namely the generalized multifactor dimensionality reduction (GMDR) method, which can entertain both qualitative and quantitative phenotypes and allows for both discrete and continuous covariates to detect G × G and G × E interactions in a sample of unrelated individuals. In this article, we report the development of an algorithm that can be used to study G × G and G × E interactions for family-based designs, called pedigree-based GMDR (PGMDR). Compared to the available method, our proposed method has several major improvements, including allowing for covariate adjustments and being applicable to arbitrary phenotypes, arbitrary pedigree structures, and arbitrary patterns of missing marker genotypes. Our Monte Carlo simulations provide evidence that the PGMDR method is superior in performance to identify epistatic loci compared to the MDR-pedigree disequilibrium test (PDT). Finally, we applied our proposed approach to a genetic data set on tobacco dependence and found a significant interaction between two taste receptor genes (i.e., TAS2R16 and TAS2R38) in affecting nicotine dependence. PMID:18834969

  5. The genetics of alcoholism: identifying specific genes through family studies.

    PubMed

    Edenberg, Howard J; Foroud, Tatiana

    2006-09-01

    Alcoholism is a complex disorder with both genetic and environmental risk factors. Studies in humans have begun to elucidate the genetic underpinnings of the risk for alcoholism. Here we briefly review strategies for identifying individual genes in which variations affect the risk for alcoholism and related phenotypes, in the context of one large study that has successfully identified such genes. The Collaborative Study on the Genetics of Alcoholism (COGA) is a family-based study that has collected detailed phenotypic data on individuals in families with multiple alcoholic members. A genome-wide linkage approach led to the identification of chromosomal regions containing genes that influenced alcoholism risk and related phenotypes. Subsequently, single nucleotide polymorphisms (SNPs) were genotyped in positional candidate genes located within the linked chromosomal regions, and analyzed for association with these phenotypes. Using this sequential approach, COGA has detected association with GABRA2, CHRM2 and ADH4; these associations have all been replicated by other researchers. COGA has detected association to additional genes including GABRG3, TAS2R16, SNCA, OPRK1 and PDYN, results that are awaiting confirmation. These successes demonstrate that genes contributing to the risk for alcoholism can be reliably identified using human subjects.

  6. Plant Ion Channels: Gene Families, Physiology, and Functional Genomics Analyses

    PubMed Central

    Ward, John M.; Mäser, Pascal; Schroeder, Julian I.

    2016-01-01

    Distinct potassium, anion, and calcium channels in the plasma membrane and vacuolar membrane of plant cells have been identified and characterized by patch clamping. Primarily owing to advances in Arabidopsis genetics and genomics, and yeast functional complementation, many of the corresponding genes have been identified. Recent advances in our understanding of ion channel genes that mediate signal transduction and ion transport are discussed here. Some plant ion channels, for example, ALMT and SLAC anion channel subunits, are unique. The majority of plant ion channel families exhibit homology to animal genes; such families include both hyperpolarization-and depolarization-activated Shaker-type potassium channels, CLC chloride transporters/channels, cyclic nucleotide–gated channels, and ionotropic glutamate receptor homologs. These plant ion channels offer unique opportunities to analyze the structural mechanisms and functions of ion channels. Here we review gene families of selected plant ion channel classes and discuss unique structure-function aspects and their physiological roles in plant cell signaling and transport. PMID:18842100

  7. Actin dynamics shape microglia effector functions.

    PubMed

    Uhlemann, Ria; Gertz, Karen; Boehmerle, Wolfgang; Schwarz, Tobias; Nolte, Christiane; Freyer, Dorette; Kettenmann, Helmut; Endres, Matthias; Kronenberg, Golo

    2016-06-01

    Impaired actin filament dynamics have been associated with cellular senescence. Microglia, the resident immune cells of the brain, are emerging as a central pathophysiological player in neurodegeneration. Microglia activation, which ranges on a continuum between classical and alternative, may be of critical importance to brain disease. Using genetic and pharmacological manipulations, we studied the effects of alterations in actin dynamics on microglia effector functions. Disruption of actin dynamics did not affect transcription of genes involved in the LPS-triggered classical inflammatory response. By contrast, in consequence of impaired nuclear translocation of phospho-STAT6, genes involved in IL-4 induced alternative activation were strongly downregulated. Functionally, impaired actin dynamics resulted in reduced NO secretion and reduced release of TNFalpha and IL-6 from LPS-stimulated microglia and of IGF-1 from IL-4 stimulated microglia. However, pathological stabilization of the actin cytoskeleton increased LPS-induced release of IL-1beta and IL-18, which belong to an unconventional secretory pathway. Reduced NO release was associated with decreased cytoplasmic iNOS protein expression and decreased intracellular arginine uptake. Furthermore, disruption of actin dynamics resulted in reduced microglia migration, proliferation and phagocytosis. Finally, baseline and ATP-induced [Ca(2+)]int levels were significantly increased in microglia lacking gelsolin, a key actin-severing protein. Together, the dynamic state of the actin cytoskeleton profoundly and distinctly affects microglia behaviours. Disruption of actin dynamics attenuates M2 polarization by inhibiting transcription of alternative activation genes. In classical activation, the role of actin remodelling is complex, does not relate to gene transcription and shows a major divergence between cytokines following conventional and unconventional secretion.

  8. GJB2 gene mutations causing familial hereditary deafness in Turkey.

    PubMed

    Bayazit, Yildirim A; Cable, Benjamin B; Cataloluk, Osman; Kara, Cengiz; Chamberlin, Parker; Smith, Richard J H; Kanlikama, Muzaffer; Ozer, Enver; Cakmak, Ecir Ali; Mumbuc, Semih; Arslan, Ahmet

    2003-12-01

    Mutations in Connexin 26 (Cx26) play an important role in autosomal non-syndromic hereditary hearing loss. In this study, our objective was to find out the significance of Cx26 mutations in Turkish families who had hereditary deafness. Fourteen families who had at least two prelingually deaf children per family were included in the study. One affected child from each of the 14 families was selected for single-stranded conformational polymorphism SSCP analysis. Three PCR reactions were used for each subject to amplify the entire Cx26 coding region with overlap. PCR products were sequenced on an Applied Biosystems (ABI) model 3700 automated sequencer. Six of the 14 representative family members (42.9%) demonstrated shifts on SSCP and were subsequently sequenced for Exons 1 and 2 of GJB2 and were tested for the 432 kb upstream deletion. No mutations were found in Exon 1 and no 432 kb deletions were noted. Three different GJB2 mutations were found in Exon 2 of the probands, which were 35delG, 299-300delAT, and 487G > A (M163V). GJB2 mutations were detected in 21.4% of the families. Two patients were homozygous for 35delG and 299-300delAT mutations, and were given a diagnosis of DFNB1 deafness (14.3%). Two different polymorphisms, 457G > A (V153I) and 380G > AG (R127H) were also found. In conclusion, although GJB2 mutations were detected in 21.4% of the families tested, only 14.3% of subject representatives were homozygous and therefore deafness caused by Cx26 mutation segregated with DFNB1. Thus, contribution of GJB2 mutations appears less significant in familial deafness. This necessitates further assessment for the other known gene regions as well as a search for new genetic factors in familial type of genetic deafness.

  9. Early evolution of the LIM homeobox gene family

    SciTech Connect

    Srivastava, Mansi; Larroux, Claire; Lu, Daniel R; Mohanty, Kareshma; Chapman, Jarrod; Degnan, Bernard M; Rokhsar, Daniel S

    2010-01-01

    LIM homeobox (Lhx) transcription factors are unique to the animal lineage and have patterning roles during embryonic development in flies, nematodes and vertebrates, with a conserved role in specifying neuronal identity. Though genes of this family have been reported in a sponge and a cnidarian, the expression patterns and functions of the Lhx family during development in non-bilaterian phyla are not known. We identified Lhx genes in two cnidarians and a placozoan and report the expression of Lhx genes during embryonic development in Nematostella and the demosponge Amphimedon. Members of the six major LIM homeobox subfamilies are represented in the genomes of the starlet sea anemone, Nematostella vectensis, and the placozoan Trichoplax adhaerens. The hydrozoan cnidarian, Hydra magnipapillata, has retained four of the six Lhx subfamilies, but apparently lost two others. Only three subfamilies are represented in the haplosclerid demosponge Amphimedon queenslandica. A tandem cluster of three Lhx genes of different subfamilies and a gene containing two LIM domains in the genome of T. adhaerens (an animal without any neurons) indicates that Lhx subfamilies were generated by tandem duplication. This tandem cluster in Trichoplax is likely a remnant of the original chromosomal context in which Lhx subfamilies first appeared. Three of the six Trichoplax Lhx genes are expressed in animals in laboratory culture, as are all Lhx genes in Hydra. Expression patterns of Nematostella Lhx genes correlate with neural territories in larval and juvenile polyp stages. In the aneural demosponge, A. queenslandica, the three Lhx genes are expressed widely during development, including in cells that are associated with the larval photosensory ring. The Lhx family expanded and diversified early in animal evolution, with all six subfamilies already diverged prior to the cnidarian-placozoan-bilaterian last common ancestor. In Nematostella, Lhx gene expression is correlated with neural

  10. Mutation Analysis of HTRA2 Gene in Chinese Familial Essential Tremor and Familial Parkinson's Disease.

    PubMed

    He, Ya-Chao; Huang, Pei; Li, Qiong-Qiong; Sun, Qian; Li, Dun-Hui; Wang, Tian; Shen, Jun-Yi; Du, Juan-Juan; Cui, Shi-Shuang; Gao, Chao; Fu, Rao; Chen, Sheng-Di

    2017-01-01

    Background. HTRA2 has already been nominated as PARK13 which may cause Parkinson's disease, though there are still discrepancies among these results. Recently, Gulsuner et al.'s study found that HTRA2 p.G399S is responsible for hereditary essential tremor and homozygotes of this allele develop Parkinson's disease by examining a six-generation family segregating essential tremor and essential tremor coexisting with Parkinson's disease. We performed this study to validate the condition of HTRA2 gene in Chinese familial essential tremor and familial Parkinson's disease patients, especially essential tremor. Methods. We directly sequenced all eight exons, exon-intron boundaries, and part of the introns in 101 familial essential tremor patients, 105 familial Parkinson's disease patients, and 100 healthy controls. Results. No exonic variant was identified, while one exon-intron boundary variant (rs2241028) and one intron variant (rs2241027) were detected, both with no clinical significance and uncertain function. There was no difference in allele, genotype, and haplotype between groups. Conclusions. HTRA2 exonic variant might be rare among Chinese Parkinson's disease and essential tremor patients with family history, and HTRA2 may not be the cause of familial Parkinson's disease and essential tremor in China.

  11. Mutation Analysis of HTRA2 Gene in Chinese Familial Essential Tremor and Familial Parkinson's Disease

    PubMed Central

    Li, Qiong-Qiong; Fu, Rao

    2017-01-01

    Background. HTRA2 has already been nominated as PARK13 which may cause Parkinson's disease, though there are still discrepancies among these results. Recently, Gulsuner et al.'s study found that HTRA2 p.G399S is responsible for hereditary essential tremor and homozygotes of this allele develop Parkinson's disease by examining a six-generation family segregating essential tremor and essential tremor coexisting with Parkinson's disease. We performed this study to validate the condition of HTRA2 gene in Chinese familial essential tremor and familial Parkinson's disease patients, especially essential tremor. Methods. We directly sequenced all eight exons, exon-intron boundaries, and part of the introns in 101 familial essential tremor patients, 105 familial Parkinson's disease patients, and 100 healthy controls. Results. No exonic variant was identified, while one exon-intron boundary variant (rs2241028) and one intron variant (rs2241027) were detected, both with no clinical significance and uncertain function. There was no difference in allele, genotype, and haplotype between groups. Conclusions. HTRA2 exonic variant might be rare among Chinese Parkinson's disease and essential tremor patients with family history, and HTRA2 may not be the cause of familial Parkinson's disease and essential tremor in China. PMID:28243480

  12. A Candida albicans CRISPR system permits genetic engineering of essential genes and gene families.

    PubMed

    Vyas, Valmik K; Barrasa, M Inmaculada; Fink, Gerald R

    Candida albicans is a pathogenic yeast that causes mucosal and systematic infections with high mortality. The absence of facile molecular genetics has been a major impediment to analysis of pathogenesis. The lack of meiosis coupled with the absence of plasmids makes genetic engineering cumbersome, especially for essential functions and gene families. We describe a C. albicans CRISPR system that overcomes many of the obstacles to genetic engineering in this organism. The high frequency with which CRISPR-induced mutations can be directed to target genes enables easy isolation of homozygous gene knockouts, even without selection. Moreover, the system permits the creation of strains with mutations in multiple genes, gene families, and genes that encode essential functions. This CRISPR system is also effective in a fresh clinical isolate of undetermined ploidy. Our method transforms the ability to manipulate the genome of Candida and provides a new window into the biology of this pathogen.

  13. MORC Family ATPases Required for Heterochromatin Condensation and Gene Silencing#

    PubMed Central

    Moissiard, Guillaume; Cokus, Shawn J.; Cary, Joshua; Feng, Suhua; Billi, Allison C.; Stroud, Hume; Husmann, Dylan; Zhan, Ye; Lajoie, Bryan R.; McCord, Rachel Patton; Hale, Christopher J.; Feng, Wei; Michaels, Scott D.; Frand, Alison R.; Pellegrini, Matteo; Dekker, Job; Kim, John K.; Jacobsen, Steve

    2012-01-01

    Transposable elements (TEs) and DNA repeats are commonly targeted by DNA and histone methylation to achieve epigenetic gene silencing. We isolated mutations in two Arabidopsis genes, AtMORC1 and AtMORC6, which cause de-repression of DNA-methylated genes and TEs, but no losses of DNA or histone methylation. AtMORC1 and AtMORC6 are members of the conserved Microrchidia (MORC) adenosine triphosphatase (ATPase) family, predicted to catalyze alterations in chromosome superstructure. The atmorc1 and atmorc6 mutants show decondensation of pericentromeric heterochromatin, increased interaction of pericentromeric regions with the rest of the genome, and transcriptional defects that are largely restricted to loci residing in pericentromeric regions. Knockdown of the single MORC homolog in Caenorhabditis elegans also impairs transgene silencing. We propose that the MORC ATPases are conserved regulators of gene silencing in eukaryotes. PMID:22555433

  14. Signalling Pathways Controlling Cellular Actin Organization.

    PubMed

    Steffen, Anika; Stradal, Theresia E B; Rottner, Klemens

    2017-01-01

    The actin cytoskeleton is essential for morphogenesis and virtually all types of cell shape changes. Reorganization is per definition driven by continuous disassembly and re-assembly of actin filaments, controlled by major, ubiquitously operating machines. These are specifically employed by the cell to tune its activities in accordance with respective environmental conditions or to satisfy specific needs.Here we sketch some fundamental signalling pathways established to contribute to the reorganization of specific actin structures at the plasma membrane. Rho-family GTPases are at the core of these pathways, and dissection of their precise contributions to actin reorganization in different cell types and tissues will thus continue to improve our understanding of these important signalling nodes. Furthermore, we will draw your attention to the emerging theme of actin reorganization on intracellular membranes, its functional relation to Rho-GTPase signalling, and its relevance for the exciting phenomenon autophagy.

  15. Chlamydial TARP is a bacterial nucleator of actin.

    PubMed

    Jewett, Travis J; Fischer, Elizabeth R; Mead, David J; Hackstadt, Ted

    2006-10-17

    Chlamydia trachomatis entry into host cells results from a parasite-directed remodeling of the actin cytoskeleton. A type III secreted effector, TARP (translocated actin recruiting phosphoprotein), has been implicated in the recruitment of actin to the site of internalization. To elucidate the role of TARP in actin recruitment, we identified host cell proteins that associated with recombinant GST-TARP fusions. TARP directly associated with actin, and this interaction promoted actin nucleation as determined by in vitro polymerization assays. Domain analysis of TARP identified an actin-binding domain that bears structural and primary amino acid sequence similarity to WH2 domain family proteins. In addition, a proline-rich domain was found to promote TARP oligomerization and was required for TARP-dependent nucleation of new actin filaments. Our findings reveal a mechanism by which chlamydiae induce localized cytoskeletal changes by the translocated effector TARP during entry into host cells.

  16. Massive expansion of the calpain gene family in unicellular eukaryotes

    PubMed Central

    2012-01-01

    Background Calpains are Ca2+-dependent cysteine proteases that participate in a range of crucial cellular processes. Dysfunction of these enzymes may cause, for instance, life-threatening diseases in humans, the loss of sex determination in nematodes and embryo lethality in plants. Although the calpain family is well characterized in animal and plant model organisms, there is a great lack of knowledge about these genes in unicellular eukaryote species (i.e. protists). Here, we study the distribution and evolution of calpain genes in a wide range of eukaryote genomes from major branches in the tree of life. Results Our investigations reveal 24 types of protein domains that are combined with the calpain-specific catalytic domain CysPc. In total we identify 41 different calpain domain architectures, 28 of these domain combinations have not been previously described. Based on our phylogenetic inferences, we propose that at least four calpain variants were established in the early evolution of eukaryotes, most likely before the radiation of all the major supergroups of eukaryotes. Many domains associated with eukaryotic calpain genes can be found among eubacteria or archaebacteria but never in combination with the CysPc domain. Conclusions The analyses presented here show that ancient modules present in prokaryotes, and a few de novo eukaryote domains, have been assembled into many novel domain combinations along the evolutionary history of eukaryotes. Some of the new calpain genes show a narrow distribution in a few branches in the tree of life, likely representing lineage-specific innovations. Hence, the functionally important classical calpain genes found among humans and vertebrates make up only a tiny fraction of the calpain family. In fact, a massive expansion of the calpain family occurred by domain shuffling among unicellular eukaryotes and contributed to a wealth of functionally different genes. PMID:23020305

  17. Chromosomal evolution of the PKD1 gene family in primates

    PubMed Central

    2008-01-01

    Background The autosomal dominant polycystic kidney disease (ADPKD) is mostly caused by mutations in the PKD1 (polycystic kidney disease 1) gene located in 16p13.3. Moreover, there are six pseudogenes of PKD1 that are located proximal to the master gene in 16p13.1. In contrast, no pseudogene could be detected in the mouse genome, only a single copy gene on chromosome 17. The question arises how the human situation originated phylogenetically. To address this question we applied comparative FISH-mapping of a human PKD1-containing genomic BAC clone and a PKD1-cDNA clone to chromosomes of a variety of primate species and the dog as a non-primate outgroup species. Results Comparative FISH with the PKD1-cDNA clone clearly shows that in all primate species studied distinct single signals map in subtelomeric chromosomal positions orthologous to the short arm of human chromosome 16 harbouring the master PKD1 gene. Only in human and African great apes, but not in orangutan, FISH with both BAC and cDNA clones reveals additional signal clusters located proximal of and clearly separated from the PKD1 master genes indicating the chromosomal position of PKD1 pseudogenes in 16p of these species, respectively. Indeed, this is in accordance with sequencing data in human, chimpanzee and orangutan. Apart from the master PKD1 gene, six pseudogenes are identified in both, human and chimpanzee, while only a single-copy gene is present in the whole-genome sequence of orangutan. The phylogenetic reconstruction of the PKD1-tree reveals that all human pseudogenes are closely related to the human PKD1 gene, and all chimpanzee pseudogenes are closely related to the chimpanzee PKD1 gene. However, our statistical analyses provide strong indication that gene conversion events may have occurred within the PKD1 family members of human and chimpanzee, respectively. Conclusion PKD1 must have undergone amplification very recently in hominid evolution. Duplicative transposition of the PKD1 gene and

  18. NDP gene mutations in 14 French families with Norrie disease.

    PubMed

    Royer, Ghislaine; Hanein, Sylvain; Raclin, Valérie; Gigarel, Nadine; Rozet, Jean-Michel; Munnich, Arnold; Steffann, Julie; Dufier, Jean-Louis; Kaplan, Josseline; Bonnefont, Jean-Paul

    2003-12-01

    Norrie disease is a rare X-inked recessive condition characterized by congenital blindness and occasionally deafness and mental retardation in males. This disease has been ascribed to mutations in the NDP gene on chromosome Xp11.1. Previous investigations of the NDP gene have identified largely sixty disease-causing sequence variants. Here, we report on ten different NDP gene allelic variants in fourteen of a series of 21 families fulfilling inclusion criteria. Two alterations were intragenic deletions and eight were nucleotide substitutions or splicing variants, six of them being hitherto unreported, namely c.112C>T (p.Arg38Cys), c.129C>G (p.His43Gln), c.133G>A (p.Val45Met), c.268C>T (p.Arg90Cys), c.382T>C (p.Cys128Arg), c.23479-1G>C (unknown). No NDP gene sequence variant was found in seven of the 21 families. This observation raises the issue of misdiagnosis, phenocopies, or existence of other X-linked or autosomal genes, the mutations of which would mimic the Norrie disease phenotype.

  19. The Maize PIN Gene Family of Auxin Transporters.

    PubMed

    Forestan, Cristian; Farinati, Silvia; Varotto, Serena

    2012-01-01

    Auxin is a key regulator of plant development and its differential distribution in plant tissues, established by a polar cell to cell transport, can trigger a wide range of developmental processes. A few members of the two families of auxin efflux transport proteins, PIN-formed (PIN) and P-glycoprotein (ABCB/PGP), have so far been characterized in maize. Nine new Zea mays auxin efflux carriers PIN family members and two maize PIN-like genes have now been identified. Four members of PIN1 (named ZmPIN1a-d) cluster, one gene homologous to AtPIN2 (ZmPIN2), three orthologs of PIN5 (ZmPIN5a-c), one gene paired with AtPIN8 (ZmPIN8), and three monocot-specific PINs (ZmPIN9, ZmPIN10a, and ZmPIN10b) were cloned and the phylogenetic relationships between early-land plants, monocots, and eudicots PIN proteins investigated, including the new maize PIN proteins. Tissue-specific expression patterns of the 12 maize PIN genes, 2 PIN-like genes and ZmABCB1, an ABCB auxin efflux carrier, were analyzed together with protein localization and auxin accumulation patterns in normal conditions and in response to drug applications. ZmPIN gene transcripts have overlapping expression domains in the root apex, during male and female inflorescence differentiation and kernel development. However, some PIN family members have specific tissue localization: ZmPIN1d transcript marks the L1 layer of the shoot apical meristem and inflorescence meristem during the flowering transition and the monocot-specific ZmPIN9 is expressed in the root endodermis and pericycle. The phylogenetic and gene structure analyses together with the expression pattern of the ZmPIN gene family indicate that subfunctionalization of some maize PINs can be associated to the differentiation and development of monocot-specific organs and tissues and might have occurred after the divergence between dicots and monocots.

  20. The Maize PIN Gene Family of Auxin Transporters

    PubMed Central

    Forestan, Cristian; Farinati, Silvia; Varotto, Serena

    2012-01-01

    Auxin is a key regulator of plant development and its differential distribution in plant tissues, established by a polar cell to cell transport, can trigger a wide range of developmental processes. A few members of the two families of auxin efflux transport proteins, PIN-formed (PIN) and P-glycoprotein (ABCB/PGP), have so far been characterized in maize. Nine new Zea mays auxin efflux carriers PIN family members and two maize PIN-like genes have now been identified. Four members of PIN1 (named ZmPIN1a–d) cluster, one gene homologous to AtPIN2 (ZmPIN2), three orthologs of PIN5 (ZmPIN5a–c), one gene paired with AtPIN8 (ZmPIN8), and three monocot-specific PINs (ZmPIN9, ZmPIN10a, and ZmPIN10b) were cloned and the phylogenetic relationships between early-land plants, monocots, and eudicots PIN proteins investigated, including the new maize PIN proteins. Tissue-specific expression patterns of the 12 maize PIN genes, 2 PIN-like genes and ZmABCB1, an ABCB auxin efflux carrier, were analyzed together with protein localization and auxin accumulation patterns in normal conditions and in response to drug applications. ZmPIN gene transcripts have overlapping expression domains in the root apex, during male and female inflorescence differentiation and kernel development. However, some PIN family members have specific tissue localization: ZmPIN1d transcript marks the L1 layer of the shoot apical meristem and inflorescence meristem during the flowering transition and the monocot-specific ZmPIN9 is expressed in the root endodermis and pericycle. The phylogenetic and gene structure analyses together with the expression pattern of the ZmPIN gene family indicate that subfunctionalization of some maize PINs can be associated to the differentiation and development of monocot-specific organs and tissues and might have occurred after the divergence between dicots and monocots. PMID:22639639

  1. Clock-associated genes in Arabidopsis: a family affair.

    PubMed Central

    Somers, D E

    2001-01-01

    The identification of components of the plant circadian clock has been advanced recently with the success of two forward genetics approaches. The ZEITLUPE and TOC1 loci were cloned and each was found to be part of two separate, larger gene families with intriguing domain structures. The ZTL family of proteins contains a subclass of the PAS domain coupled to an F box and kelch motifs, suggesting that they play a role in a novel light-regulated ubiquitination mechanism. TOC1 shares similarity to the receiver domain of the well-known two-component phosphorelay signalling systems, combined with a strong similarity to a region of the CONSTANS transcription factor, which is involved in controlling flowering time. When added to the repertoire of previously identified clock-associated genes, it is clear that both similarities and differences with other circadian systems will emerge in the coming years. PMID:11710981

  2. Epigenetic balance of gene expression by Polycomb and COMPASS families.

    PubMed

    Piunti, Andrea; Shilatifard, Ali

    2016-06-03

    Epigenetic regulation of gene expression in metazoans is central for establishing cellular diversity, and its deregulation can result in pathological conditions. Although transcription factors are essential for implementing gene expression programs, they do not function in isolation and require the recruitment of various chromatin-modifying and -remodeling machineries. A classic example of developmental chromatin regulation is the balanced activities of the Polycomb group (PcG) proteins within the PRC1 and PRC2 complexes, and the Trithorax group (TrxG) proteins within the COMPASS family, which are highly mutated in a large number of human diseases. In this review, we will discuss the latest findings regarding the properties of the PcG and COMPASS families and the insight they provide into the epigenetic control of transcription under physiological and pathological settings.

  3. Variation in the RAD51 gene and familial breast cancer

    PubMed Central

    Lose, Felicity; Lovelock, Paul; Chenevix-Trench, Georgia; Mann, Graham J; Pupo, Gulietta M; Spurdle, Amanda B

    2006-01-01

    Introduction Human RAD51 is a homologue of the Escherichia coli RecA protein and is known to function in recombinational repair of double-stranded DNA breaks. Mutations in the lower eukaryotic homologues of RAD51 result in a deficiency in the repair of double-stranded DNA breaks. Loss of RAD51 function would therefore be expected to result in an elevated mutation rate, leading to accumulation of DNA damage and, hence, to increased cancer risk. RAD51 interacts directly or indirectly with a number of proteins implicated in breast cancer, such as BRCA1 and BRCA2. Similar to BRCA1 mice, RAD51-/- mice are embryonic lethal. The RAD51 gene region has been shown to exhibit loss of heterozygosity in breast tumours, and deregulated RAD51 expression in breast cancer patients has also been reported. Few studies have investigated the role of coding region variation in the RAD51 gene in familial breast cancer, with only one coding region variant – exon 6 c.449G>A (p.R150Q) – reported to date. Methods All nine coding exons of the RAD51 gene were analysed for variation in 46 well-characterised, BRCA1/2-negative breast cancer families using denaturing high-performance liquid chromatography. Genotyping of the exon 6 p.R150Q variant was performed in an additional 66 families. Additionally, lymphoblastoid cell lines from breast cancer patients were subjected to single nucleotide primer extension analysis to assess RAD51 expression. Results No coding region variation was found, and all intronic variation detected was either found in unaffected controls or was unlikely to have functional consequences. Single nucleotide primer extension analysis did not reveal any allele-specific changes in RAD51 expression in all lymphoblastoid cell lines tested. Conclusion Our study indicates that RAD51 is not a major familial breast cancer predisposition gene. PMID:16762046

  4. The carboxylesterase/cholinesterase gene family in invertebrate deuterostomes.

    PubMed

    Johnson, Glynis; Moore, Samuel W

    2012-06-01

    Carboxylesterase/cholinesterase family members are responsible for controlling the nerve impulse, detoxification and various developmental functions, and are a major target of pesticides and chemical warfare agents. Comparative structural analysis of these enzymes is thus important. The invertebrate deuterostomes (phyla Echinodermata and Hemichordata and subphyla Urochordata and Cephalochordata) lie in the transition zone between invertebrates and vertebrates, and are thus of interest to the study of evolution. Here we have investigated the carboxylesterase/cholinesterase gene family in the sequenced genomes of Strongylocentrotus purpuratus (Echinodermata), Saccoglossus kowalevskii (Hemichordata), Ciona intestinalis (Urochordata) and Branchiostoma floridae (Cephalochordata), using sequence analysis of the catalytic apparatus and oligomerisation domains, and phylogenetic analysis. All four genomes show blurring of structural boundaries between cholinesterases and carboxylesterases, with many intermediate enzymes. Non-enzymatic proteins are well represented. The Saccoglossus and Branchiostoma genomes show evidence of extensive gene duplication and retention. There is also evidence of domain shuffling, resulting in multidomain proteins consisting either of multiple carboxylesterase domains, or of carboxylesterase/cholinesterase domains linked to other domains, including RING finger, chitin-binding, immunoglobulin, fibronectin type 3, CUB, cysteine-rich-Frizzled, caspase activation and 7tm-1, amongst others. Such gene duplication and domain shuffling in the carboxylesterase/cholinesterase family appears to be unique to the invertebrate deuterostomes, and we hypothesise that these factors may have contributed to the evolution of the morphological complexity, particularly of the nervous system and neural crest, of the vertebrates.

  5. Tomato ABSCISIC ACID STRESS RIPENING (ASR) gene family revisited.

    PubMed

    Golan, Ido; Dominguez, Pia Guadalupe; Konrad, Zvia; Shkolnik-Inbar, Doron; Carrari, Fernando; Bar-Zvi, Dudy

    2014-01-01

    Tomato ABSCISIC ACID RIPENING 1 (ASR1) was the first cloned plant ASR gene. ASR orthologs were then cloned from a large number of monocot, dicot and gymnosperm plants, where they are mostly involved in response to abiotic (drought and salinity) stress and fruit ripening. The tomato genome encodes five ASR genes: ASR1, 2, 3 and 5 encode low-molecular-weight proteins (ca. 110 amino acid residues each), whereas ASR4 encodes a 297-residue polypeptide. Information on the expression of the tomato ASR gene family is scarce. We used quantitative RT-PCR to assay the expression of this gene family in plant development and in response to salt and osmotic stresses. ASR1 and ASR4 were the main expressed genes in all tested organs and conditions, whereas ASR2 and ASR3/5 expression was two to three orders of magnitude lower (with the exception of cotyledons). ASR1 is expressed in all plant tissues tested whereas ASR4 expression is limited to photosynthetic organs and stamens. Essentially, ASR1 accounted for most of ASR gene expression in roots, stems and fruits at all developmental stages, whereas ASR4 was the major gene expressed in cotyledons and young and fully developed leaves. Both ASR1 and ASR4 were expressed in flower organs, with ASR1 expression dominating in stamens and pistils, ASR4 in sepals and petals. Steady-state levels of ASR1 and ASR4 were upregulated in plant vegetative organs following exposure to salt stress, osmotic stress or the plant abiotic stress hormone abscisic acid (ABA). Tomato plants overexpressing ASR1 displayed enhanced survival rates under conditions of water stress, whereas ASR1-antisense plants displayed marginal hypersensitivity to water withholding.

  6. Profilin connects actin assembly with microtubule dynamics

    PubMed Central

    Nejedla, Michaela; Sadi, Sara; Sulimenko, Vadym; de Almeida, Francisca Nunes; Blom, Hans; Draber, Pavel; Aspenström, Pontus; Karlsson, Roger

    2016-01-01

    Profilin controls actin nucleation and assembly processes in eukaryotic cells. Actin nucleation and elongation promoting factors (NEPFs) such as Ena/VASP, formins, and WASP-family proteins recruit profilin:actin for filament formation. Some of these are found to be microtubule associated, making actin polymerization from microtubule-associated platforms possible. Microtubules are implicated in focal adhesion turnover, cell polarity establishment, and migration, illustrating the coupling between actin and microtubule systems. Here we demonstrate that profilin is functionally linked to microtubules with formins and point to formins as major mediators of this association. To reach this conclusion, we combined different fluorescence microscopy techniques, including superresolution microscopy, with siRNA modulation of profilin expression and drug treatments to interfere with actin dynamics. Our studies show that profilin dynamically associates with microtubules and this fraction of profilin contributes to balance actin assembly during homeostatic cell growth and affects micro­tubule dynamics. Hence profilin functions as a regulator of microtubule (+)-end turnover in addition to being an actin control element. PMID:27307590

  7. Organization of the human lipoprotein lipase gene and evolution of the lipase gene family.

    PubMed Central

    Kirchgessner, T G; Chuat, J C; Heinzmann, C; Etienne, J; Guilhot, S; Svenson, K; Ameis, D; Pilon, C; d'Auriol, L; Andalibi, A

    1989-01-01

    The human lipoprotein lipase gene was cloned and characterized. It is composed of 10 exons spanning approximately equal to 30 kilobases. The first exon encodes the 5'-untranslated region, the signal peptide plus the first two amino acids of the mature protein. The next eight exons encode the remaining 446 amino acids, and the tenth exon encodes the long 3'-untranslated region of 1948 nucleotides. The lipoprotein lipase transcription start site and the sequence of the 5'-flanking region were also determined. We compared the organization of genes for lipoprotein lipase, hepatic lipase, pancreatic lipase, and Drosophila yolk protein 1, which are members of a family of related genes. A model for the evolution of the lipase gene family is presented that involves multiple rounds of gene duplication plus exon-shuffling and intron-loss events. Images PMID:2602366

  8. A functional interplay between the small GTPase Rab11a and mitochondria-shaping proteins regulates mitochondrial positioning and polarization of the actin cytoskeleton downstream of Src family kinases.

    PubMed

    Landry, Marie-Claude; Champagne, Claudia; Boulanger, Marie-Chloé; Jetté, Alexandra; Fuchs, Margit; Dziengelewski, Claire; Lavoie, Josée N

    2014-01-24

    It is believed that mitochondrial dynamics is coordinated with endosomal traffic rates during cytoskeletal remodeling, but the mechanisms involved are largely unknown. The adenovirus early region 4 ORF4 protein (E4orf4) subverts signaling by Src family kinases (SFK) to perturb cellular morphology, membrane traffic, and organellar dynamics and to trigger cell death. Using E4orf4 as a model, we uncovered a functional connection between mitochondria-shaping proteins and the small GTPase Rab11a, a key regulator of polarized transport via recycling endosomes. We found that E4orf4 induced dramatic changes in the morphology of mitochondria along with their mobilization at the vicinity of a polarized actin network typifying E4orf4 action, in a manner controlled by SFK and Rab11a. Mitochondrial remodeling was associated with increased proximity between Rab11a and mitochondrial membranes, changes in fusion-fission dynamics, and mitochondrial relocalization of the fission factor dynamin-related protein 1 (Drp1), which was regulated by the Rab11a effector protein FIP1/RCP. Knockdown of FIP1/RCP or inhibition of Drp1 markedly impaired mitochondrial remodeling and actin assembly, involving Rab11a-mediated mitochondrial dynamics in E4orf4-induced signaling. A similar mobilization of mitochondria near actin-rich structures was mediated by Rab11 and Drp1 in viral Src-transformed cells and contributed to the biogenesis of podosome rosettes. These findings suggest a role for Rab11a in the trafficking of Drp1 to mitochondria upon SFK activation and unravel a novel functional interplay between Rab11a and mitochondria during reshaping of the cell cytoskeleton, which would facilitate mitochondria redistribution near energy-requiring actin-rich structures.

  9. The END3 gene encodes a protein that is required for the internalization step of endocytosis and for actin cytoskeleton organization in yeast.

    PubMed Central

    Bénédetti, H; Raths, S; Crausaz, F; Riezman, H

    1994-01-01

    Two Saccharomyces cerevisiae mutants, end3 and end4, defective in the internalization step of endocytosis, have previously been isolated. The END3 gene was cloned by complementation of the temperature-sensitive growth defect caused by the end3 mutation and the END3 nucleotide sequence was determined. The END3 gene product is a 40-kDa protein that has a putative EF-hand Ca(2+)-binding site, a consensus sequence for the binding of phosphotidylinositol 4,5-bisphosphate (PIP2), and a C-terminal domain containing two homologous regions of 17-19 aa. The EF-hand consensus and the putative PIP2-binding sites are seemingly not required for End3 protein function. In contrast, different portions of the End3p N-terminal domain, and at least one of the two repeated regions in its C-terminus, are required for End3p activity. Disruption of the END3 gene yielded cells with the same phenotype as the original end3 mutant. An end3ts allele was obtained and this allowed us to demonstrate that End3p is specifically involved in the internalization step of endocytosis. In addition, End3p was shown to be required for proper organization of the actin cytoskeleton and for the correct distribution of chitin at the cell surface. Images PMID:7841519

  10. The Evolution of Novelty in Conserved Gene Families

    PubMed Central

    Markov, Gabriel V.; Sommer, Ralf J.

    2012-01-01

    One of the major aims of contemporary evolutionary biology is the understanding of the current pattern of biological diversity. This involves, first, the description of character distribution at various nodes of the phylogenetic tree of life and, second, the functional explanation of such changes. The analysis of character distribution is a powerful tool at both the morphological and molecular levels. Recent high-throughput sequencing approaches provide new opportunities to study the genetic architecture of organisms at the genome-wide level. In eukaryotes, one overarching finding is the absence of simple correlations of gene count and biological complexity. Instead, the domain architecture of proteins is becoming a central focus for large-scale evolutionary innovations. Here, we review examples of the evolution of novelty in conserved gene families in insects and nematodes. We highlight how in the absence of whole-genome duplications molecular novelty can arise, how members of gene families have diversified at distinct mechanistic levels, and how gene expression can be maintained in the context of multiple innovations in regulatory mechanisms. PMID:22779028

  11. F-actin aggregates in transformed cells

    PubMed Central

    1981-01-01

    Polymerized actin has been found aggregated into distinctive patches inside transformed cells in culture. The F-actin-specific fluorescent probe, nitrobenzoxadiazole-phallacidin, labels these F-actin aggregates near the ventral cell surface of cells transformed by RNA or DNA tumor viruses, or by chemical mutagens, or spontaneously. Their appearance in all eight transformed cell types studied suggests their ubiquity and involvement in transformation morphology. Actin patches developed in normal rat kidney (NRK) cells transformed by a temperature-sensitive mutant of Rous sarcoma virus (LA23-NRK) within 30 min after a shift from the nonpermissive (39 degrees C) to the permissive temperature (32 degrees C). Patch appearance paralleling viral src gene expression tends to implicate pp60src kinase activity in destabilizing the cytoskeleton. However, appearance of the actin aggregates in cells not transformed by retrovirus calls for alternative mechanisms, perhaps involving an endogenous kinase, for this apparently common trait. PMID:6270163

  12. Evolution of the tyrosinase gene family in bivalve molluscs: independent expansion of the mantle gene repertoire.

    PubMed

    Aguilera, Felipe; McDougall, Carmel; Degnan, Bernard M

    2014-09-01

    Tyrosinase is a copper-containing enzyme that mediates the hydroxylation of monophenols and oxidation of o-diphenols to o-quinones. This enzyme is involved in a variety of biological processes, including pigment production, innate immunity, wound healing, and exoskeleton fabrication and hardening (e.g. arthropod skeleton and mollusc shell). Here we show that the tyrosinase gene family has undergone large expansions in pearl oysters (Pinctada spp.) and the Pacific oyster (Crassostrea gigas). Phylogenetic analysis reveals that pearl oysters possess at least four tyrosinase genes that are not present in the Pacific oyster. Likewise, C. gigas has multiple tyrosinase genes that are not orthologous to the Pinctada genes, indicating that this gene family has expanded independently in these bivalve lineages. Many of the tyrosinase genes in these bivalves are expressed at relatively high levels in the mantle, the organ responsible for shell fabrication. Detailed comparisons of tyrosinase gene expression in different regions of the mantle in two closely related pearl oysters, P. maxima and P. margaritifera, reveals that recently evolved orthologous tyrosinase genes can have markedly different expression profiles. The expansion of tyrosinase genes in these oysters and their co-option into the mantle's gene regulatory network is consistent with mollusc shell formation being underpinned by a rapidly evolving transcriptome.

  13. PRODH gene is associated with executive function in schizophrenic families.

    PubMed

    Li, Tao; Ma, Xiaohong; Hu, Xun; Wang, Yingcheng; Yan, Chengying; Meng, Huaqing; Liu, Xiehe; Toulopoulou, Timothea; Murray, Robin M; Collier, David A

    2008-07-05

    The aim of this study was to investigate the relationship between polymorphisms in the PRODH and COMT genes and selected neurocognitive functions. Six SNPs in PRODH and two SNPs in COMT were genotyped in 167 first-episode schizophrenic families who had been assessed by a set of 14 neuropsychological tests. Neuropsychological measures were selected as quantitative traits for association analysis. The haplotype of SNPs PRODH 1945T/C and PRODH 1852G/A was associated with impaired performance on the Tower of Hanoi, a problem-solving task mainly reflecting planning capacity. There was no significant evidence for association with any other neuropsychological traits for other SNPs or haplotypes of paired SNPs in the two genes. This study takes previous findings of association between PRODH and schizophrenia further by associating variation within the gene with performance on a neurocognitive trait characteristic of the illness. It fails to confirm previous reports of an association between COMT and cognitive function.

  14. Biofuel Potential of Plants Transformed Genetically with NAC Family Genes

    PubMed Central

    Singh, Sadhana; Grover, Atul; Nasim, M.

    2016-01-01

    NAC genes contribute to enhance survivability of plants under conditions of environmental stress and in secondary growth of the plants, thereby building biomass. Thus, genetic transformation of plants using NAC genes provides a possibility to tailor biofuel plants. Over-expression studies have indicated that NAC family genes can provide tolerance to various biotic and abiotic stresses, either by physiological or biochemical changes at the cellular level, or by affecting visible morphological and anatomical changes, for example, by development of lateral roots in a number of plants. Over-expression of these genes also work as triggers for development of secondary cell walls. In our laboratory, we have observed a NAC gene from Lepidium latifolium contributing to both enhanced biomass as well as cold stress tolerance of model plants tobacco. Thus, we have reviewed all the developments of genetic engineering using NAC genes which could enhance the traits required for biofuel plants, either by enhancing the stress tolerance or by enhancing the biomass of the plants. PMID:26858739

  15. Why is Actin Patchy?

    NASA Astrophysics Data System (ADS)

    Carlsson, Anders

    2009-03-01

    The intracellular protein actin, by reversibly polymerizing into filaments, generates forces for motion and shape changes of many types of biological cells. Fluorescence imaging studies show that actin often occurs in the form of localized patches of size roughly one micrometer at the cell membrane. Patch formation is most prevalent when the free-actin concentration is low. I investigate possible mechanisms for the formation of actin patches by numerically simulating the ``dendritic nucleation'' model of actin network growth. The simulations include filament growth, capping, branching, severing, and debranching. The attachment of membrane-bound activators to actin filaments, and subsequent membrane diffusion of unattached activators, are also included. It is found that as the actin concentration increases from zero, the actin occurs in patches at lower actin concentrations, and the size of the patches increases with increasing actin concentration. At a critical value of the actin concentration, the system undergoes a transition to complete coverage. The results are interpreted within the framework of reaction-diffusion equations in two dimensions.

  16. Gene Turnover in the Avian Globin Gene Families and Evolutionary Changes in Hemoglobin Isoform Expression

    PubMed Central

    Opazo, Juan C.; Hoffmann, Federico G.; Natarajan, Chandrasekhar; Witt, Christopher C.; Berenbrink, Michael; Storz, Jay F.

    2015-01-01

    The apparent stasis in the evolution of avian chromosomes suggests that birds may have experienced relatively low rates of gene gain and loss in multigene families. To investigate this possibility and to explore the phenotypic consequences of variation in gene copy number, we examined evolutionary changes in the families of genes that encode the α- and β-type subunits of hemoglobin (Hb), the tetrameric α2β2 protein responsible for blood-O2 transport. A comparative genomic analysis of 52 bird species revealed that the size and membership composition of the α- and β-globin gene families have remained remarkably constant during approximately 100 My of avian evolution. Most interspecific variation in gene content is attributable to multiple independent inactivations of the αD-globin gene, which encodes the α-chain subunit of a functionally distinct Hb isoform (HbD) that is expressed in both embryonic and definitive erythrocytes. Due to consistent differences in O2-binding properties between HbD and the major adult-expressed Hb isoform, HbA (which incorporates products of the αA-globin gene), recurrent losses of αD-globin contribute to among-species variation in blood-O2 affinity. Analysis of HbA/HbD expression levels in the red blood cells of 122 bird species revealed high variability among lineages and strong phylogenetic signal. In comparison with the homologous gene clusters in mammals, the low retention rate for lineage-specific gene duplicates in the avian globin gene clusters suggests that the developmental regulation of Hb synthesis in birds may be more highly conserved, with orthologous genes having similar stage-specific expression profiles and similar functional properties in disparate taxa. PMID:25502940

  17. Gene turnover in the avian globin gene families and evolutionary changes in hemoglobin isoform expression.

    PubMed

    Opazo, Juan C; Hoffmann, Federico G; Natarajan, Chandrasekhar; Witt, Christopher C; Berenbrink, Michael; Storz, Jay F

    2015-04-01

    The apparent stasis in the evolution of avian chromosomes suggests that birds may have experienced relatively low rates of gene gain and loss in multigene families. To investigate this possibility and to explore the phenotypic consequences of variation in gene copy number, we examined evolutionary changes in the families of genes that encode the α- and β-type subunits of hemoglobin (Hb), the tetrameric α2β2 protein responsible for blood-O2 transport. A comparative genomic analysis of 52 bird species revealed that the size and membership composition of the α- and β-globin gene families have remained remarkably constant during approximately 100 My of avian evolution. Most interspecific variation in gene content is attributable to multiple independent inactivations of the α(D)-globin gene, which encodes the α-chain subunit of a functionally distinct Hb isoform (HbD) that is expressed in both embryonic and definitive erythrocytes. Due to consistent differences in O2-binding properties between HbD and the major adult-expressed Hb isoform, HbA (which incorporates products of the α(A)-globin gene), recurrent losses of α(D)-globin contribute to among-species variation in blood-O2 affinity. Analysis of HbA/HbD expression levels in the red blood cells of 122 bird species revealed high variability among lineages and strong phylogenetic signal. In comparison with the homologous gene clusters in mammals, the low retention rate for lineage-specific gene duplicates in the avian globin gene clusters suggests that the developmental regulation of Hb synthesis in birds may be more highly conserved, with orthologous genes having similar stage-specific expression profiles and similar functional properties in disparate taxa.

  18. Molecular genetics of the aip gene in familial pituitary tumorigenesis.

    PubMed

    Tahir, Asil; Chahal, Harvinder S; Korbonits, Márta

    2010-01-01

    Pituitary adenomas usually occur as sporadic tumors, but familial cases are now increasingly identified. As opposed to multiple endocrine neoplasia type 1 and Carney complex, in familial isolated pituitary adenoma (FIPA) syndrome no other disease is associated with the familial occurrence of pituitary adenomas. It is an autosomal dominant disease with incomplete variable penetrance. Approximately 20% of patients with FIPA harbour germline mutations in the aryl hydrocarbon receptor-interacting protein (AIP) gene located on 11q13. Patients with AIP mutations have an overwhelming predominance of somatotroph and lactotroph adenomas, which often present in childhood or young adulthood. AIP, originally identified as a molecular co-chaperone of several nuclear receptors, is thought to act as a tumor suppressor gene; overexpression of wild-type, but not mutant AIP, reduces cell proliferation while knockdown of AIP stimulates it. AIP is shown to bind various proteins, including the aryl hydrocarbon receptor, Hsp90, phosphodiesterases, survivin, RET and the glucocorticoid receptor, but currently it is not clear which interaction has the leading role in pituitary tumorigenesis. This chapter summarizes the available clinical and molecular data regarding the role of AIP in the pituitary gland.

  19. Evolutionary History of Chordate PAX Genes: Dynamics of Change in a Complex Gene Family

    PubMed Central

    Paixão-Côrtes, Vanessa Rodrigues; Salzano, Francisco Mauro; Bortolini, Maria Cátira

    2013-01-01

    Paired box (PAX) genes are transcription factors that play important roles in embryonic development. Although the PAX gene family occurs in animals only, it is widely distributed. Among the vertebrates, its 9 genes appear to be the product of complete duplication of an original set of 4 genes, followed by an additional partial duplication. Although some studies of PAX genes have been conducted, no comprehensive survey of these genes across the entire taxonomic unit has yet been attempted. In this study, we conducted a detailed comparison of PAX sequences from 188 chordates, which revealed restricted variation. The absence of PAX4 and PAX8 among some species of reptiles and birds was notable; however, all 9 genes were present in all 74 mammalian genomes investigated. A search for signatures of selection indicated that all genes are subject to purifying selection, with a possible constraint relaxation in PAX4, PAX7, and PAX8. This result indicates asymmetric evolution of PAX family genes, which can be associated with the emergence of adaptive novelties in the chordate evolutionary trajectory. PMID:24023886

  20. FoxO gene family evolution in vertebrates

    PubMed Central

    Wang, Minghui; Zhang, Xiangzhe; Zhao, Hongbo; Wang, Qishan; Pan, Yuchun

    2009-01-01

    Background Forkhead box, class O (FoxO) belongs to the large family of forkhead transcription factors that are characterized by a conserved forkhead box DNA-binding domain. To date, the FoxO group has four mammalian members: FoxO1, FoxO3a, FoxO4 and FoxO6, which are orthologs of DAF16, an insulin-responsive transcription factor involved in regulating longevity of worms and flies. The degree of homology between these four members is high, especially in the forkhead domain, which contains the DNA-binding interface. Yet, mouse FoxO knockouts have revealed that each FoxO gene has its unique role in the physiological process. Whether the functional divergences are primarily due to adaptive selection pressure or relaxed selective constraint remains an open question. As such, this study aims to address the evolutionary mode of FoxO, which may lead to the functional divergence. Results Sequence similarity searches have performed in genome and scaffold data to identify homologues of FoxO in vertebrates. Phylogenetic analysis was used to characterize the family evolutionary history by identifying two duplications early in vertebrate evolution. To determine the mode of evolution in vertebrates, we performed a rigorous statistical analysis with FoxO gene sequences, including relative rate ratio tests, branch-specific dN/dS ratio tests, site-specific dN/dS ratio tests, branch-site dN/dS ratio tests and clade level amino acid conservation/variation patterns analysis. Our results suggest that FoxO is constrained by strong purifying selection except four sites in FoxO6, which have undergone positive Darwinian selection. The functional divergence in this family is best explained by either relaxed purifying selection or positive selection. Conclusion We present a phylogeny describing the evolutionary history of the FoxO gene family and show that the genes have evolved through duplications followed by purifying selection except for four sites in FoxO6 fixed by positive selection lie

  1. Amelogenesis Imperfecta: 1 Family, 2 Phenotypes, and 2 Mutated Genes.

    PubMed

    Prasad, M K; Laouina, S; El Alloussi, M; Dollfus, H; Bloch-Zupan, A

    2016-12-01

    Amelogenesis imperfecta (AI) is a clinically and genetically heterogeneous group of diseases characterized by enamel defects. The authors have identified a large consanguineous Moroccan family segregating different clinical subtypes of hypoplastic and hypomineralized AI in different individuals within the family. Using targeted next-generation sequencing, the authors identified a novel heterozygous nonsense mutation in COL17A1 (c.1873C>T, p.R625*) segregating with hypoplastic AI and a novel homozygous 8-bp deletion in C4orf26 (c.39_46del, p.Cys14Glyfs*18) segregating with hypomineralized-hypoplastic AI in this family. This study highlights the phenotypic and genotypic heterogeneity of AI that can exist even within a single consanguineous family. Furthermore, the identification of novel mutations in COL17A1 and C4orf26 and their correlation with distinct AI phenotypes can contribute to a better understanding of the pathophysiology of AI and the contribution of these genes to amelogenesis.

  2. The ANKH gene and familial calcium pyrophosphate dihydrate deposition disease.

    PubMed

    Netter, Patrick; Bardin, Thomas; Bianchi, Arnaud; Richette, Pascal; Loeuille, Damien

    2004-09-01

    Familial calcium pyrophosphate dihydrate deposition (CPPD) disease is a chronic condition in which CPPD microcrystals deposit in the joint fluid, cartilage, and periarticular tissues. Two forms of familial CPPD disease have been identified: CCAL1 and CCAL2. The CCAL1 locus is located on the long arm of chromosome 8 and is associated with CPPD and severe osteoarthritis. The CCAL2 locus has been mapped to the short arm of chromosome 5 and identified in families from the Alsace region of France and the United Kingdom. The ANKH protein is involved in pyrophosphate metabolism and, more specifically, in pyrophosphate transport from the intracellular to the extracellular compartment. Numerous ANKH gene mutations cause familial CCAL2; they enhance ANKH protein activity, thereby elevating extracellular pyrophosphate levels and promoting the formation of pyrophosphate crystals, which produce the manifestations of the disease. Recent studies show that growth factors and cytokines can modify the expression of the normal ANKH protein. These results suggest a role for ANKH in sporadic CPPD disease and in CPPD associated with degenerative disease.

  3. Bsp1p/Ypr171p is an adapter that directly links some synaptojanin family members to the cortical actin cytoskeleton in yeast.

    PubMed

    Wicky, Sidonie; Frischmuth, Sabine; Singer-Krüger, Birgit

    2003-02-27

    In this study we identified a novel protein, Bsp1p, that interacts directly with two yeast synaptojanins, Sjl2p and Sjl3p, but not with Sjl1p. The interaction takes place via the Sac1/polyphosphoinositide phosphatase domain, whose conserved C-terminal region is important for binding. Subcellular localization and genetic interactions revealed a function of Bsp1p in the cortical actin cytoskeleton. A fraction of Bsp1p was found to be membrane-associated. Studies with mutants of phosphatidylinositol 4-kinase, PIK1, suggested that the interaction with membranes is facilitated by phosphoinositides. We propose that Bsp1p is an adapter that links Sjl2p and Sjl3p to the cortical actin cytoskeleton.

  4. Multiple Inter-Kingdom Horizontal Gene Transfers in the Evolution of the Phosphoenolpyruvate Carboxylase Gene Family

    PubMed Central

    Wang, Wen; Su, Bing

    2012-01-01

    Pepcase is a gene encoding phosphoenolpyruvate carboxylase that exists in bacteria, archaea and plants,playing an important role in plant metabolism and development. Most plants have two or more pepcase genes belonging to two gene sub-families, while only one gene exists in other organisms. Previous research categorized one plant pepcase gene as plant-type pepcase (PTPC) while the other as bacteria-type pepcase (BTPC) because of its similarity with the pepcase gene found in bacteria. Phylogenetic reconstruction showed that PTPC is the ancestral lineage of plant pepcase, and that all bacteria, protistpepcase and BTPC in plants are derived from a lineage of pepcase closely related with PTPC in algae. However, their phylogeny contradicts the species tree and traditional chronology of organism evolution. Because the diversification of bacteria occurred much earlier than the origin of plants, presumably all bacterialpepcase derived from the ancestral PTPC of algal plants after divergingfrom the ancestor of vascular plant PTPC. To solve this contradiction, we reconstructed the phylogeny of pepcase gene family. Our result showed that both PTPC and BTPC are derived from an ancestral lineage of gamma-proteobacteriapepcases, possibly via an ancient inter-kingdom horizontal gene transfer (HGT) from bacteria to the eukaryotic common ancestor of plants, protists and cellular slime mold. Our phylogenetic analysis also found 48other pepcase genes originated from inter-kingdom HGTs. These results imply that inter-kingdom HGTs played important roles in the evolution of the pepcase gene family and furthermore that HGTsare a more frequent evolutionary event than previouslythought. PMID:23251445

  5. Family Size Evolution in Drosophila Chemosensory Gene Families: A Comparative Analysis with a Critical Appraisal of Methods

    PubMed Central

    Almeida, Francisca C.; Sánchez-Gracia, Alejandro; Campos, Jose Luis; Rozas, Julio

    2014-01-01

    Gene turnover rates and the evolution of gene family sizes are important aspects of genome evolution. Here, we use curated sequence data of the major chemosensory gene families from Drosophila—the gustatory receptor, odorant receptor, ionotropic receptor, and odorant-binding protein families—to conduct a comparative analysis among families, exploring different methods to estimate gene birth and death rates, including an ad hoc simulation study. Remarkably, we found that the state-of-the-art methods may produce very different rate estimates, which may lead to disparate conclusions regarding the evolution of chemosensory gene family sizes in Drosophila. Among biological factors, we found that a peculiarity of D. sechellia’s gene turnover rates was a major source of bias in global estimates, whereas gene conversion had negligible effects for the families analyzed herein. Turnover rates vary considerably among families, subfamilies, and ortholog groups although all analyzed families were quite dynamic in terms of gene turnover. Computer simulations showed that the methods that use ortholog group information appear to be the most accurate for the Drosophila chemosensory families. Most importantly, these results reveal the potential of rate heterogeneity among lineages to severely bias some turnover rate estimation methods and the need of further evaluating the performance of these methods in a more diverse sampling of gene families and phylogenetic contexts. Using branch-specific codon substitution models, we find further evidence of positive selection in recently duplicated genes, which attests to a nonneutral aspect of the gene birth-and-death process. PMID:24951565

  6. Spatial control of the actin cytoskeleton in Drosophila epithelial cells.

    PubMed

    Baum, B; Perrimon, N

    2001-10-01

    The actin cytoskeleton orders cellular space and transduces many of the forces required for morphogenesis. Here we combine genetics and cell biology to identify genes that control the polarized distribution of actin filaments within the Drosophila follicular epithelium. We find that profilin and cofilin regulate actin-filament formation throughout the cell cortex. In contrast, CAP-a Drosophila homologue of Adenylyl Cyclase Associated Proteins-functions specifically to limit actin-filament formation catalysed by Ena at apical cell junctions. The Abl tyrosine kinase also collaborates in this process. We therefore propose that CAP, Ena and Abl act in concert to modulate the subcellular distribution of actin filaments in Drosophila.

  7. Management of asymptomatic gene carriers of transthyretin familial amyloid polyneuropathy

    PubMed Central

    Barroso, Fabio; González‐Duarte, Alejandra; Conceição, Isabel; Obici, Laura; Keohane, Denis; Amass, Leslie

    2016-01-01

    ABSTRACT Transthyretin familial amyloid polyneuropathy (TTR‐FAP) is a rare, severe, and irreversible, adult‐onset, hereditary disorder caused by autosomal‐dominant mutations in the TTR gene that increase the intrinsic propensity of transthyretin protein to misfold and deposit systemically as insoluble amyloid fibrils in nerve tissues, the heart, and other organs. TTR‐FAP is characterized by relentless, progressively debilitating polyneuropathy, and leads to death, on average, within 10 years of symptom onset without treatment. With increased availability of disease‐modifying treatment options for a wider spectrum of patients with TTR‐FAP, timely detection of the disease may offer substantial clinical benefits. This review discusses mutation‐specific predictive genetic testing in first‐degree relatives of index patients diagnosed with TTR‐FAP and the structured clinical follow‐up of asymptomatic gene carriers for prompt diagnosis and early therapeutic intervention before accumulation of substantial damage. Muscle Nerve 54: 353–360, 2016 PMID:27273296

  8. Management of asymptomatic gene carriers of transthyretin familial amyloid polyneuropathy.

    PubMed

    Schmidt, Hartmut H-J; Barroso, Fabio; González-Duarte, Alejandra; Conceição, Isabel; Obici, Laura; Keohane, Denis; Amass, Leslie

    2016-09-01

    Transthyretin familial amyloid polyneuropathy (TTR-FAP) is a rare, severe, and irreversible, adult-onset, hereditary disorder caused by autosomal-dominant mutations in the TTR gene that increase the intrinsic propensity of transthyretin protein to misfold and deposit systemically as insoluble amyloid fibrils in nerve tissues, the heart, and other organs. TTR-FAP is characterized by relentless, progressively debilitating polyneuropathy, and leads to death, on average, within 10 years of symptom onset without treatment. With increased availability of disease-modifying treatment options for a wider spectrum of patients with TTR-FAP, timely detection of the disease may offer substantial clinical benefits. This review discusses mutation-specific predictive genetic testing in first-degree relatives of index patients diagnosed with TTR-FAP and the structured clinical follow-up of asymptomatic gene carriers for prompt diagnosis and early therapeutic intervention before accumulation of substantial damage. Muscle Nerve 54: 353-360, 2016.

  9. Actin dynamics: old friends with new stories.

    PubMed

    Staiger, Christopher J; Blanchoin, Laurent

    2006-12-01

    Actin dynamics, or the rapid turnover of actin filaments, play a central role in numerous cellular processes. A large and diverse cast of characters, accessory proteins known as actin-binding proteins, modulate actin dynamics. They do this by binding to the monomer pool, interacting with the side and ends of filaments, creating breaks along a filament, and generating new filaments de novo. Recent biochemical and single-filament imaging analyses of several conserved classes of plant actin-binding proteins reveal unusual and unexpected properties. Examples that are highlighted in this review include: an abundant monomer-binding protein that catalyzes nucleotide exchange; a barbed-end capping protein that is dissociated from filament ends by the signaling lipid, phosphatidic acid; a villin-like bundling protein that lacks all Ca(2+)-regulated activities; and a formin family member that is non-processive and is sufficient to generate actin filament bundles. These and other stories motivate a careful description of the properties of plant proteins in vitro as a prelude to greater insight into the molecular mechanism(s) underlying the regulation of actin dynamics in vivo.

  10. Functional synergy of actin filament cross-linking proteins.

    PubMed

    Tseng, Yiider; Schafer, Benjamin W; Almo, Steven C; Wirtz, Denis

    2002-07-12

    The organization of filamentous actin (F-actin) in resilient networks is coordinated by various F-actin cross-linking proteins. The relative tolerance of cells to null mutations of genes that code for a single actin cross-linking protein suggests that the functions of those proteins are highly redundant. This apparent functional redundancy may, however, reflect the limited resolution of available assays in assessing the mechanical role of F-actin cross-linking/bundling proteins. Using reconstituted F-actin networks and rheological methods, we demonstrate how alpha-actinin and fascin, two F-actin cross-linking/bundling proteins that co-localize along stress fibers and in lamellipodia, could synergistically enhance the resilience of F-actin networks in vitro. These two proteins can generate microfilament arrays that "yield" at a strain amplitude that is much larger than each one of the proteins separately. F-actin/alpha-actinin/fascin networks display strain-induced hardening, whereby the network "stiffens" under shear deformations, a phenomenon that is non-existent in F-actin/fascin networks and much weaker in F-actin/alpha-actinin networks. Strain-hardening is further enhanced at high rates of deformation and high concentrations of actin cross-linking proteins. A simplified model suggests that the optimum results of the competition between the increased stiffness of bundles and their decreased density of cross-links. Our studies support a re-evaluation of the notion of functional redundancy among cytoskeletal regulatory proteins.

  11. Identification and analysis of the metacaspase gene family in tomato.

    PubMed

    Liu, Hui; Liu, Jian; Wei, Yongxuan

    2016-10-21

    Metacaspases play critical roles in developmentally regulated and environmentally induced programmed cell death in plants. In this study, we systematically identified and analyzed metacaspase gene family in tomato (Solanum lycopersicum). The results illustrated that tomato possesses eight metacaspase genes (SlMC1-8) located on chromosomes 1, 3, 5, 9, and 10. SlMC1-6 belonged to type I metacaspases and had 5 exon/4 intron structures. SlMC7 and 8 were type II metacaspases and had 2 and 3 exons, respectively. Expression analysis revealed distinct expression patterns of SlMCs in various tomato tissues. Cis-regulatory element prediction showed that there were many hormone- and stress-related cis-regulatory elements in SlMCs promoter regions. Quantitative real-time PCR analysis further demonstrated that most of the SlMCs were regulated by drought, cold, salt, methyl viologen, and ethephon treatments. This study provides insights into the characteristics of SlMC genes and laid the foundation for further functional analysis of these genes in tomato.

  12. Babesia bovis expresses Bbo-6cys-E, a member of a novel gene family that is homologous to the 6-cys family of Plasmodium

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A novel Babesia bovis gene family encoding proteins with similarities to the Plasmodium 6cys protein family was identified by TBLASTN searches of the Babesia bovis genome using the sequence of the P. falciparum PFS230 protein as query, and was termed Bbo-6cys gene family. The Bbo-cys6 gene family co...

  13. Identification, Phylogeny, and Transcript of Chitinase Family Genes in Sugarcane

    PubMed Central

    Su, Yachun; Xu, Liping; Wang, Shanshan; Wang, Zhuqing; Yang, Yuting; Chen, Yun; Que, Youxiong

    2015-01-01

    Chitinases are pathogensis-related proteins, which play an important role in plant defense mechanisms. The role of the sugarcane chitinase family genes remains unclear due to the highly heterozygous and aneuploidy chromosome genetic background of sugarcane. Ten differentially expressed chitinase genes (belonging to class I~VII) were obtained from RNA-seq analysis of both incompatible and compatible sugarcane genotypes during Sporisorium scitamineum challenge. Their structural properties and expression patterns were analyzed. Seven chitinases (ScChiI1, ScChiI2, ScChiI3, ScChiIII1, ScChiIII2, ScChiIV1 and ScChiVI1) showed more positive with early response and maintained increased transcripts in the incompatible interaction than those in the compatible one. Three (ScChiII1, ScChiV1 and ScChiVII1) seemed to have no significant difference in expression patterns between incompatible and compatible interactions. The ten chitinases were expressed differentially in response to hormone treatment as well as having distinct tissue specificity. ScChiI1, ScChiIV1 and ScChiVII1 were induced by various abiotic stresses (NaCl, CuCl2, PEG and 4 °C) and their involvement in plant immunity was demonstrated by over-expression in Nicotiana benthamiana. The results suggest that sugarcane chitinase family exhibit differential responses to biotic and abiotic stress, providing new insights into their function. PMID:26035173

  14. Genomics and evolution of the TRIM gene family.

    PubMed

    Meroni, Germana

    2012-01-01

    The TRIM family comprises proteins characterized by the presence of thetripartite motifthat is composed of a RING domain, one or two B-box domains and a Coiled-coil region. These proteins are implicated in a plethora of cellular processes such as apoptosis, cell cycle regulation, muscular physiology and innate immune response. Consistently, their alteration results in several pathological conditions emphasizing their medical relevance. The TRIM members domain structure underscores a common biochemical function as E3 ligases within the ubiquitylation cascade, which is then translated into diverse biological processes. The TRIM proteins represent one of the largest families in mammals counting in human almost 70 members. TRIM proteins are metazoan-specific and have been now identified in several species although the great increase in their number was generated in vertebrate species. The important expansion of the number of TRIM genes underlie the success of the tripartite module in ubiquitylation process. Furthermore, their massive diversification among species was achieved through fast evolution of the TRIM genes implicated in pathogen response.

  15. Short Term Exposure of Beta Cells to Low Concentrations of Interleukin-1β Improves Insulin Secretion through Focal Adhesion and Actin Remodeling and Regulation of Gene Expression*

    PubMed Central

    Arous, Caroline; Ferreira, Pedro G.; Dermitzakis, Emmanouil T.; Halban, Philippe A.

    2015-01-01

    Type 2 diabetes involves defective insulin secretion with islet inflammation governed in part by IL-1β. Prolonged exposure of islets to high concentrations of IL-1β (>24 h, 20 ng/ml) impairs beta cell function and survival. Conversely, exposure to lower concentrations of IL-1β for >24 h improves these same parameters. The impact on insulin secretion of shorter exposure times to IL-1β and the underlying molecular mechanisms are poorly understood and were the focus of this study. Treatment of rat primary beta cells, as well as rat or human whole islets, with 0.1 ng/ml IL-1β for 2 h increased glucose-stimulated (but not basal) insulin secretion, whereas 20 ng/ml was without effect. Similar differential effects of IL-1β depending on concentration were observed after 15 min of KCl stimulation but were prevented by diazoxide. Studies on sorted rat beta cells indicated that the enhancement of stimulated secretion by 0.1 ng/ml IL-1β was mediated by the NF-κB pathway and c-JUN/JNK pathway acting in parallel to elicit focal adhesion remodeling and the phosphorylation of paxillin independently of upstream regulation by focal adhesion kinase. Because the beneficial effect of IL-1β was dependent in part upon transcription, gene expression was analyzed by RNAseq. There were 18 genes regulated uniquely by 0.1 but not 20 ng/ml IL-1β, which are mostly involved in transcription and apoptosis. These results indicate that 2 h of exposure of beta cells to a low but not a high concentration of IL-1β enhances glucose-stimulated insulin secretion through focal adhesion and actin remodeling, as well as modulation of gene expression. PMID:25586177

  16. Reorganization of the actin cytoskeleton via transcriptional regulation of cytoskeletal/focal adhesion genes by myocardin-related transcription factors (MRTFs/MAL/MKLs)

    SciTech Connect

    Morita, Tsuyoshi; Mayanagi, Taira; Sobue, Kenji

    2007-10-01

    RhoA is a crucial regulator of stress fiber and focal adhesion formation through the activation of actin nucleation and polymerization. It also regulates the nuclear translocation of myocardin-related transcription factor-A and -B (MRTF-A/B, MAL or MKL 1/2), which are co-activators of serum response factor (SRF). In dominant-negative MRTF-A (DN-MRTF-A)-expressing NIH 3T3 cell lines, the expressions of several cytoskeletal/focal adhesion genes were down-regulated, and the formation of stress fiber and focal adhesion was severely diminished. MRTF-A/B-knockdown cells also exhibited such cytoskeletal defects. In reporter assays, both RhoA and MRTF-A enhanced promoter activities of these genes in a CArG-box-dependent manner, and DN-MRTF-A inhibited the RhoA-mediated activation of these promoters. In dominant-negative RhoA (RhoA-N19)-expressing NIH 3T3 cell lines, the nuclear translocation of MRTF-A/B was predominantly prevented, resulting in the reduced expression of cytoskeletal/focal adhesion proteins. Further, constitutive-active MRTF-A/B increased the expression of endogenous cytoskeletal/focal adhesion proteins, and thereby rescued the defective phenotype of stress fibers and focal adhesions in RhoA-N19 expressing cells. These results indicate that MRTF-A/B act as pivotal mediators of stress fiber and focal adhesion formation via the transcriptional regulation of a subset of cytoskeletal/focal adhesion genes.

  17. Repeated evolution of chimeric fusion genes in the β-globin gene family of laurasiatherian mammals.

    PubMed

    Gaudry, Michael J; Storz, Jay F; Butts, Gary Tyler; Campbell, Kevin L; Hoffmann, Federico G

    2014-05-09

    The evolutionary fate of chimeric fusion genes may be strongly influenced by their recombinational mode of origin and the nature of functional divergence between the parental genes. In the β-globin gene family of placental mammals, the two postnatally expressed δ- and β-globin genes (HBD and HBB, respectively) have a propensity for recombinational exchange via gene conversion and unequal crossing-over. In the latter case, there are good reasons to expect differences in retention rates for the reciprocal HBB/HBD and HBD/HBB fusion genes due to thalassemia pathologies associated with the HBD/HBB "Lepore" deletion mutant in humans. Here, we report a comparative genomic analysis of the mammalian β-globin gene cluster, which revealed that chimeric HBB/HBD fusion genes originated independently in four separate lineages of laurasiatherian mammals: Eulipotyphlans (shrews, moles, and hedgehogs), carnivores, microchiropteran bats, and cetaceans. In cases where an independently derived "anti-Lepore" duplication mutant has become fixed, the parental HBD and/or HBB genes have typically been inactivated or deleted, so that the newly created HBB/HBD fusion gene is primarily responsible for synthesizing the β-type subunits of adult and fetal hemoglobin (Hb). Contrary to conventional wisdom that the HBD gene is a vestigial relict that is typically inactivated or expressed at negligible levels, we show that HBD-like genes often encode a substantial fraction (20-100%) of β-chain Hbs in laurasiatherian taxa. Our results indicate that the ascendancy or resuscitation of genes with HBD-like coding sequence requires the secondary acquisition of HBB-like promoter sequence via unequal crossing-over or interparalog gene conversion.

  18. Reference gene validation for qPCR on normoxia- and hypoxia-cultured human dermal fibroblasts exposed to UVA: is β-actin a reliable normalizer for photoaging studies?

    PubMed

    Brugè, F; Venditti, E; Tiano, L; Littarru, G P; Damiani, E

    2011-12-10

    Data normalization of gene expression on human dermal fibroblasts (HDF) exposed to UVA has commonly been done using either GAPDH or β-actin as reference genes without any validation of their expression stability. Since this aspect, important for accurate normalization, has been overlooked, we aimed to establish a suitable set of reference genes for studies on UVA-treated HDF cultured under both standard atmospheric oxygen tension (normoxia, 21%) and under a physiological, low oxygen tension for these cells (hypoxia, 5%). The stability of six commonly used reference genes was assessed using the geNorm and NormFinder softwares subsequent to reverse-transcription quantitative real-time PCR (RT-qPCR). GAPDH/SDHA were found to be the most stable genes under normoxia, while SDHA/TBP or HPRT1/β2M were the most stable ones under hypoxia in HDF exposed to 18 J/cm(2) UVA. β-Actin was always the most unstable reference gene. To emphasize the importance of selecting the most stably expressed reference genes for obtaining reliable results, mRNA expression levels of MMP-1 and COL1A1 were analyzed vs the best reference genes and the worst one. These reference genes are hence recommended for future qPCR analyses in studies concerning photo-damage on UVA-treated HDF.

  19. The roles of gene duplication, gene conversion and positive selection in rodent Esp and Mup pheromone gene families with comparison to the Abp family.

    PubMed

    Karn, Robert C; Laukaitis, Christina M

    2012-01-01

    Three proteinaceous pheromone families, the androgen-binding proteins (ABPs), the exocrine-gland secreting peptides (ESPs) and the major urinary proteins (MUPs) are encoded by large gene families in the genomes of Mus musculus and Rattus norvegicus. We studied the evolutionary histories of the Mup and Esp genes and compared them with what is known about the Abp genes. Apparently gene conversion has played little if any role in the expansion of the mouse Class A and Class B Mup genes and pseudogenes, and the rat Mups. By contrast, we found evidence of extensive gene conversion in many Esp genes although not in all of them. Our studies of selection identified at least two amino acid sites in β-sheets as having evolved under positive selection in the mouse Class A and Class B MUPs and in rat MUPs. We show that selection may have acted on the ESPs by determining K(a)/K(s) for Exon 3 sequences with and without the converted sequence segment. While it appears that purifying selection acted on the ESP signal peptides, the secreted portions of the ESPs probably have undergone much more rapid evolution. When the inner gene converted fragment sequences were removed, eleven Esp paralogs were present in two or more pairs with K(a)/K(s) >1.0 and thus we propose that positive selection is detectable by this means in at least some mouse Esp paralogs. We compare and contrast the evolutionary histories of all three mouse pheromone gene families in light of their proposed functions in mouse communication.

  20. Actin filaments as dynamic reservoirs for Drp1 recruitment

    PubMed Central

    Hatch, Anna L.; Ji, Wei-Ke; Merrill, Ronald A.; Strack, Stefan; Higgs, Henry N.

    2016-01-01

    Drp1 is a dynamin-family GTPase recruited to mitochondria and peroxisomes, where it oligomerizes and drives membrane fission. Regulation of mitochondrial Drp1 recruitment is not fully understood. We previously showed that Drp1 binds actin filaments directly, and actin polymerization is necessary for mitochondrial Drp1 oligomerization in mammals. Here we show the Drp1/actin interaction displays unusual properties that are influenced by several factors. At saturation, only a fraction Drp1 binds actin filaments, and the off-rate of actin-bound Drp1 is significantly increased by unbound Drp1. GDP and GTP accelerate and decelerate Drp1/actin binding dynamics, respectively. Actin has a biphasic effect on Drp1 GTP hydrolysis, increasing at low actin:Drp1 ratio but returning to baseline at high ratio. Drp1 also bundles filaments. Bundles have reduced dynamics but follow the same trends as single filaments. Drp1 preferentially incorporates into bundles at higher ionic strength. We measure Drp1 concentration to be ∼0.5 μM in U2OS cell cytosol, suggesting the actin-binding affinity measured here (Kd = 0.6 μM) is in the physiologically relevant range. The ability of Drp1 to bind actin filaments in a highly dynamic manner provides potential for actin filaments to serve as reservoirs of oligomerization-competent Drp1 that can be accessed for mitochondrial fission. PMID:27559132

  1. Recent Developments in Gene Therapy for Homozygous Familial Hypercholesterolemia.

    PubMed

    Ajufo, Ezim; Cuchel, Marina

    2016-05-01

    Homozygous familial hypercholesterolemia (HoFH) is a life-threatening Mendelian disorder with a mean life expectancy of 33 years despite maximally tolerated standard lipid-lowering therapies. This disease is an ideal candidate for gene therapy, and in the last few years, a number of exciting developments have brought this approach closer to the clinic than ever before. In this review, we discuss in detail the most advanced of these developments, a recombinant adeno-associated virus (AAV) vector carrying a low-density lipoprotein receptor (LDLR) transgene which has recently entered phase 1/2a testing. We also review ongoing development of approaches to enhance transgene expression, improve the efficiency of hepatocyte transduction, and minimize the AAV capsid-specific adaptive immune response. We include a summary of key gene therapy approaches for HoFH in pre-clinical development, including RNA silencing of the gene encoding HMG-CoA reductase (HMGCR) and induced pluripotent stem cell transplant therapy.

  2. Gene expression patterns of invertase gene families and modulation of the inhibitor gene in tomato sucrose metabolism.

    PubMed

    Zhang, Y L; Zhang, A H; Jiang, J

    2013-01-24

    Patterns of gene expression in the different types of sucrose metabolism in the tomato are highly variable and heritable. This genetic variation causes considerable functional differences. We examined the patterns of expression of invertase (Inv) gene families and an invertase inhibitor (INH) gene involved in elongating roots, hypocotyls, and fruit of the tomato (Lycopersicon esculentum cv. Micro-Tom and L. chmielewskii) through a real-time quantitative PCR analysis. We found that the Lin6 gene plays an important role in the vegetative growth stage. Lin5 and Lin7 did not express in Micro-Tom, but did express in L. chmielewskii. Overall relative expression levels of sucrose Inv gene families were significantly lower in L. chmielewskii during the reproductive growth stage than in Micro-Tom, being up to hundreds of times lower. It was not expressed in the dissepiment in L. chmielewskii. We suggest that differences in sucrose accumulation in tomato fruit is mainly due to differentially expressed invertase gene families at the later fruit growth stages.

  3. Postsynaptic actin regulates active zone spacing and glutamate receptor apposition at the Drosophila neuromuscular junction.

    PubMed

    Blunk, Aline D; Akbergenova, Yulia; Cho, Richard W; Lee, Jihye; Walldorf, Uwe; Xu, Ke; Zhong, Guisheng; Zhuang, Xiaowei; Littleton, J Troy

    2014-07-01

    Synaptic communication requires precise alignment of presynaptic active zones with postsynaptic receptors to enable rapid and efficient neurotransmitter release. How transsynaptic signaling between connected partners organizes this synaptic apparatus is poorly understood. To further define the mechanisms that mediate synapse assembly, we carried out a chemical mutagenesis screen in Drosophila to identify mutants defective in the alignment of active zones with postsynaptic glutamate receptor fields at the larval neuromuscular junction. From this screen we identified a mutation in Actin 57B that disrupted synaptic morphology and presynaptic active zone organization. Actin 57B, one of six actin genes in Drosophila, is expressed within the postsynaptic bodywall musculature. The isolated allele, act(E84K), harbors a point mutation in a highly conserved glutamate residue in subdomain 1 that binds members of the Calponin Homology protein family, including spectrin. Homozygous act(E84K) mutants show impaired alignment and spacing of presynaptic active zones, as well as defects in apposition of active zones to postsynaptic glutamate receptor fields. act(E84K) mutants have disrupted postsynaptic actin networks surrounding presynaptic boutons, with the formation of aberrant actin swirls previously observed following disruption of postsynaptic spectrin. Consistent with a disruption of the postsynaptic actin cytoskeleton, spectrin, adducin and the PSD-95 homolog Discs-Large are all mislocalized in act(E84K) mutants. Genetic interactions between act(E84K) and neurexin mutants suggest that the postsynaptic actin cytoskeleton may function together with the Neurexin-Neuroligin transsynaptic signaling complex to mediate normal synapse development and presynaptic active zone organization.

  4. Postsynaptic actin regulates active zone spacing and glutamate receptor apposition at the Drosophila neuromuscular junction

    PubMed Central

    Blunk, Aline D.; Akbergenova, Yulia; Cho, Richard W.; Lee, Jihye; Walldorf, Uwe; Xu, Ke; Zhong, Guisheng; Zhuang, Xiaowei; Littleton, J. Troy

    2014-01-01

    Synaptic communication requires precise alignment of presynaptic active zones with postsynaptic receptors to enable rapid and efficient neurotransmitter release. How transsynaptic signaling between connected partners organizes this synaptic apparatus is poorly understood. To further define the mechanisms that mediate synapse assembly, we carried out a chemical mutagenesis screen in Drosophila to identify mutants defective in the alignment of active zones with postsynaptic glutamate receptor fields at the larval neuromuscular junction. From this screen we identified a mutation in actin 57B that disrupted synaptic morphology and presynaptic active zone organization. Actin 57B, one of six actin genes in Drosophila, is expressed within the postsynaptic bodywall musculature. The isolated allele, actE84K, harbors a point mutation in a highly conserved glutamate residue in subdomain 1 that binds members of the Calponin Homology protein family, including spectrin. Homozygous actE84K mutants show impaired alignment and spacing of presynaptic active zones, as well as defects in apposition of active zones to postsynaptic glutamate receptor fields. actE84K mutants have disrupted postsynaptic actin networks surrounding presynaptic boutons, with the formation of aberrant actin swirls previously observed following disruption of postsynaptic spectrin. Consistent with a disruption of the postsynaptic actin cytoskeleton, spectrin, adducin and the PSD-95 homolog Disc-Large are all mislocalized in actE84K mutants. Genetic interactions between actE84K and neurexin mutants suggest that the postsynaptic actin cytoskeleton may function together with the Neurexin-Neuroligin transsynaptic signaling complex to mediate normal synapse development and presynaptic active zone organization. PMID:25066865

  5. Sensing actin dynamics: Structural basis for G-actin-sensitive nuclear import of MAL

    SciTech Connect

    Hirano, Hidemi; Matsuura, Yoshiyuki

    2011-10-22

    Highlights: {yields} MAL has a bipartite NLS that binds to Imp{alpha} in an extended conformation. {yields} Mutational analyses verified the functional significance of MAL-Imp{alpha} interactions. {yields} Induced folding and NLS-masking by G-actins inhibit nuclear import of MAL. -- Abstract: The coordination of cytoskeletal actin dynamics with gene expression reprogramming is emerging as a crucial mechanism to control diverse cellular processes, including cell migration, differentiation and neuronal circuit assembly. The actin-binding transcriptional coactivator MAL (also known as MRTF-A/MKL1/BSAC) senses G-actin concentration and transduces Rho GTPase signals to serum response factor (SRF). MAL rapidly shuttles between the cytoplasm and the nucleus in unstimulated cells but Rho-induced depletion of G-actin leads to MAL nuclear accumulation and activation of transcription of SRF:MAL-target genes. Although the molecular and structural basis of actin-regulated nucleocytoplasmic shuttling of MAL is not understood fully, it is proposed that nuclear import of MAL is mediated by importin {alpha}/{beta} heterodimer, and that G-actin competes with importin {alpha}/{beta} for the binding to MAL. Here we present structural, biochemical and cell biological evidence that MAL has a classical bipartite nuclear localization signal (NLS) in the N-terminal 'RPEL' domain containing Arg-Pro-X-X-X-Glu-Leu (RPEL) motifs. The NLS residues of MAL adopt an extended conformation and bind along the surface groove of importin-{alpha}, interacting with the major- and minor-NLS binding sites. We also present a crystal structure of wild-type MAL RPEL domain in complex with five G-actins. Comparison of the importin-{alpha}- and actin-complexes revealed that the binding of G-actins to MAL is associated with folding of NLS residues into a helical conformation that is inappropriate for importin-{alpha} recognition.

  6. Differential loss of ancestral gene families as a source of genomic divergence in animals.

    PubMed Central

    Hughes, Austin L; Friedman, Robert

    2004-01-01

    A phylogenetic approach was used to reconstruct the pattern of an apparent loss of 2106 ancestral gene families in four animal genomes (Caenorhabditis elegans, Drosophila melanogaster, human and fugu). Substantially higher rates of loss of ancestral gene families were found in the invertebrates than in the vertebrates. These results indicate that the differential loss of ancestral gene families can be a significant factor in the evolutionary diversification of organisms. PMID:15101434

  7. Dissimilar evolutionary histories of two resistance gene families in the genus Solanum.

    PubMed

    Segura, Diana María; Masuelli, Ricardo Williams; Sanchez-Puerta, M Virginia

    2017-01-01

    Genomic analyses have shown that most genes in eukaryotic lineages belong to families. Gene families vary in terms of number of members, nucleotide similarity, gene integrity, expression, and function. Often, the members of gene families are arranged in clusters, which contribute to maintaining similarity among gene copies and also to generate duplicates through replication errors. Gene families offer us an opportunity to examine the forces involved in the evolution of the genomes and to study recombination events and genomic rearrangements. In this work, we focused on the evolution of two plant resistance gene families, Sw5 and Mi-1, and analyzed the completely sequenced nuclear genomes of potato and tomato. We first noticed that the potato genome carries larger resistance gene families than tomato, but all gene copies are pseudogenes. Second, phylogenetic analyses indicated that Sw5 and Mi-1 gene families had dissimilar evolutionary histories. In contrast to Sw5, Mi-1 homologues suffered repeated gene conversion events among the gene copies, particularly in the tomato genome.

  8. Gene recruitment--a common mechanism in the evolution of transfer RNA gene families.

    PubMed

    Wang, Xiujuan; Lavrov, Dennis V

    2011-04-01

    The evolution of alloacceptor transfer RNAs (tRNAs) has been traditionally thought to occur vertically and reflect the evolution of the genetic code. Yet there have been several indications that a tRNA gene could evolve horizontally, from a copy of an alloacceptor tRNA gene in the same genome. Earlier, we provided the first unambiguous evidence for the occurrence of such "tRNA gene recruitment" in nature--in the mitochondrial (mt) genome of the demosponge Axinella corrugata. Yet the extent and the pattern of this process in the evolution of tRNA gene families remained unclear. Here we analyzed tRNA genes from 21 mt genomes of demosponges as well as nuclear genomes of rhesus macaque, chimpanzee and human. We found four new cases of alloacceptor tRNA gene recruitment in mt genomes and eleven cases in the nuclear genomes. In most of these cases we observed a single nucleotide substitution at the middle position of the anticodon, which resulted in the change of not only the tRNA's amino-acid identity but also the class of the amino-acyl tRNA synthetases (aaRSs) involved in amino-acylation. We hypothesize that the switch to a different class of aaRSs may have prevented the conflict between anticodon and amino-acid identities of recruited tRNAs. Overall our results suggest that gene recruitment is a common phenomenon in tRNA multigene family evolution and should be taken into consideration when tRNA evolutionary history is reconstructed.

  9. The Family of Crumbs Genes and Human Disease

    PubMed Central

    Slavotinek, Anne M.

    2016-01-01

    The family of vertebrate Crumbs proteins, homologous to Drosophila Crumbs (Crb), share large extracellular domains with epidermal growth factor-like repeats and laminin-globular domains, a single transmembrane domain, and a short intracellular C-terminus containing a single membrane proximal 4.1/ezrin/radixin/moesin-binding domain and PSD-95/Discs large/ZO-1-binding motifs. There are 3 Crb genes in humans - Crumbs homolog-1 (CRB1), Crumbs homolog-2 (CRB2), and Crumbs homolog-3 (CRB3). Bilallelic loss-of-function mutations in CRB1 cause visual impairment, with Leber's congenital amaurosis and retinitis pigmentosa, whereas CRB2 mutations are associated with raised maternal serum and amniotic fluid alpha feto-protein levels, ventriculomegaly/hydrocephalus, and renal disease, ranging from focal segmental glomerulosclerosis to congenital Finnish nephrosis. CRB3 has not yet been associated with human disease. In this review, we summarize the phenotypic findings associated with deleterious sequence variants in CRB1 and CRB2. We discuss the mutational spectrum, animal models of loss of function for both genes and speculate on the likely mechanisms of disease. PMID:27867342

  10. Gene family encoding the major toxins of lethal Amanita mushrooms.

    PubMed

    Hallen, Heather E; Luo, Hong; Scott-Craig, John S; Walton, Jonathan D

    2007-11-27

    Amatoxins, the lethal constituents of poisonous mushrooms in the genus Amanita, are bicyclic octapeptides. Two genes in A. bisporigera, AMA1 and PHA1, directly encode alpha-amanitin, an amatoxin, and the related bicyclic heptapeptide phallacidin, a phallotoxin, indicating that these compounds are synthesized on ribosomes and not by nonribosomal peptide synthetases. alpha-Amanitin and phallacidin are synthesized as proproteins of 35 and 34 amino acids, respectively, from which they are predicted to be cleaved by a prolyl oligopeptidase. AMA1 and PHA1 are present in other toxic species of Amanita section Phalloidae but are absent from nontoxic species in other sections. The genomes of A. bisporigera and A. phalloides contain multiple sequences related to AMA1 and PHA1. The predicted protein products of this family of genes are characterized by a hypervariable "toxin" region capable of encoding a wide variety of peptides of 7-10 amino acids flanked by conserved sequences. Our results suggest that these fungi have a broad capacity to synthesize cyclic peptides on ribosomes.

  11. Cloning and characterisation of JAZ gene family in Hevea brasiliensis.

    PubMed

    Hong, H; Xiao, H; Yuan, H; Zhai, J; Huang, X

    2015-05-01

    Mechanical wounding or treatment with exogenous jasmonates (JA) induces differentiation of the laticifer in Hevea brasiliensis. JA is a key signal for latex biosynthesis and wounding response in the rubber tree. Identification of JAZ (jasmonate ZIM-domain) family of proteins that repress JA responses has facilitated rapid progress in understanding how this lipid-derived hormone controls gene expression and related physiological processes in plants. In this work, the full-length cDNAs of six JAZ genes were cloned from H. brasiliensis (termed HbJAZ). These HbJAZ have different lengths and sequence diversity, but all of them contain Jas and ZIM domains, and two of them contain an ERF-associated amphiphilic repression (EAR) motif in the N-terminal. Real-time RT-PCR analyses revealed that HbJAZ have different expression patterns and tissue specificity. Four HbJAZ were up-regulated, one was down-regulated, while two were less effected by rubber tapping treatment, suggesting that they might play distinct roles in the wounding response. A yeast two-hybrid assay revealed that HbJAZ proteins interact with each other to form homologous or heterogeneous dimer complexes, indicating that the HbJAZ proteins may expand their function through diverse JAZ-JAZ interactions. This work lays a foundation for identification of the JA signalling pathway and molecular mechanisms of latex biosynthesis in rubber trees.

  12. A Comprehensive Family-Based Replication Study of Schizophrenia Genes

    PubMed Central

    Aberg, Karolina A.; Liu, Youfang; Bukszár, Jozsef; McClay, Joseph L.; Khachane, Amit N.; Andreassen, Ole A.; Blackwood, Douglas; Corvin, Aiden; Djurovic, Srdjan; Gurling, Hugh; Ophoff, Roel; Pato, Carlos N.; Pato, Michele T.; Riley, Brien; Webb, Todd; Kendler, Kenneth; O’Donovan, Mick; Craddock, Nick; Kirov, George; Owen, Mike; Rujescu, Dan; St Clair, David; Werge, Thomas; Hultman, Christina M.; Delisi, Lynn E.; Sullivan, Patrick; van den Oord, Edwin J.

    2017-01-01

    Importance Schizophrenia (SCZ) is a devastating psychiatric condition. Identifying the specific genetic variants and pathways that increase susceptibility to SCZ is critical to improve disease understanding and address the urgent need for new drug targets. Objective To identify SCZ susceptibility genes. Design We integrated results from a meta-analysis of 18 genome-wide association studies (GWAS) involving 1 085 772 single-nucleotide polymorphisms (SNPs) and 6 databases that showed significant informativeness for SCZ. The 9380 most promising SNPs were then specifically genotyped in an independent family-based replication study that, after quality control, consisted of 8107 SNPs. Setting Linkage meta-analysis, brain transcriptome meta-analysis, candidate gene database, OMIM, relevant mouse studies, and expression quantitative trait locus databases. Patients We included 11 185 cases and 10 768 control subjects from 6 databases and, after quality control 6298 individuals (including 3286 cases) from 1811 nuclear families. Main Outcomes and Measures Case-control status for SCZ. Results Replication results showed a highly significant enrichment of SNPs with small P values. Of the SNPs with replication values of P<.01, the proportion of SNPs that had the same direction of effects as in the GWAS meta-analysis was 89% in the combined ancestry group (sign test, P<2.20×10−16) and 93% in subjects of European ancestry only (P<2.20×10−16). Our results supported the major histocompatibility complex region showing a 3.7-fold overall enrichment of replication values of P<.01 in subjects from European ancestry. We replicated SNPs in TCF4 (P=2.53×10−10) and NOTCH4 (P=3.16×10−7) that are among the most robust SCZ findings. More novel findings included POM121L2 (P=3.51×10−7), AS3MT (P=9.01×10−7), CNNM2 (P=6.07×10−7), and NT5C2 (P=4.09×10−7). To explore the many small effects, we performed pathway analyses. The most significant pathways involved neuronal function

  13. Evolution of the multifaceted eukaryotic akirin gene family

    PubMed Central

    Macqueen, Daniel J; Johnston, Ian A

    2009-01-01

    Background Akirins are nuclear proteins that form part of an innate immune response pathway conserved in Drosophila and mice. This studies aim was to characterise the evolution of akirin gene structure and protein function in the eukaryotes. Results akirin genes are present throughout the metazoa and arose before the separation of animal, plant and fungi lineages. Using comprehensive phylogenetic analysis, coupled with comparisons of conserved synteny and genomic organisation, we show that the intron-exon structure of metazoan akirin genes was established prior to the bilateria and that a single proto-orthologue duplicated in the vertebrates, before the gnathostome-agnathan separation, producing akirin1 and akirin2. Phylogenetic analyses of seven vertebrate gene families with members in chromosomal proximity to both akirin1 and akirin2 were compatible with a common duplication event affecting the genomic neighbourhood of the akirin proto-orthologue. A further duplication of akirins occurred in the teleost lineage and was followed by lineage-specific patterns of paralogue loss. Remarkably, akirins have been independently characterised by five research groups under different aliases and a comparison of the available literature revealed diverse functions, generally in regulating gene expression. For example, akirin was characterised in arthropods as subolesin, an important growth factor and in Drosophila as bhringi, which has an essential myogenic role. In vertebrates, akirin1 was named mighty in mice and was shown to regulate myogenesis, whereas akirin2 was characterised as FBI1 in rats and promoted carcinogenesis, acting as a transcriptional repressor when bound to a 14-3-3 protein. Both vertebrate Akirins have evolved under comparably strict constraints of purifying selection, although a likelihood ratio test predicted that functional divergence has occurred between paralogues. Bayesian and maximum likelihood tests identified amino-acid positions where the rate of

  14. Characterization of the multicopper oxidase gene family in Anopheles gambiae

    PubMed Central

    Gorman, Maureen J.; Dittmer, Neal T.; Marshall, Jeremy L.; Kanost, Michael R.

    2008-01-01

    The multicopper oxidase (MCO) family of enzymes includes laccases, which oxidize a broad range of substrates including diphenols, and several oxidases with specific substrates such as iron, copper or ascorbic acid. We have identified five putative MCO genes in the genome of Anopheles gambiae and have cloned cDNAs encompassing the full coding region for each gene. MCO1 mRNA was detected in all developmental stages and in all of the larval and adult tissues tested. We observed an increase in MCO1 transcript abundance in the midguts and Malphighian tubules of adult females following a blood meal and in adult abdominal carcasses in response to an immune challenge. Two alternatively spliced isoforms of MCO2 mRNA were identified. The A isoform of MCO2 was previously detected in larval and pupal cuticle where it probably catalyzes sclerotization reactions (He et al., 2007). The B isoform was transcriptionally upregulated in ovaries in response to a blood meal. MCO3 mRNA was detected in the adult midgut, Malpighian tubules, and male reproductive tissues; like MCO1, it was upregulated in response to an immune challenge or a blood meal. MCO4 and MCO5 were observed primarily in eggs and in the abdominal carcass of larvae. A phylogenetic analysis of insect MCO genes identified putative orthologs of MCO1 and MCO2 in all of the insect genomes tested, whereas MCO3, MCO4 and MCO5 were found only in the two mosquito species analyzed. MCO2 orthologs have especially high sequence similarity, suggesting that they are under strong purifying selection; the A isoforms are more conserved than the B isoforms. The mosquito specific group shares a common ancestor with MCO2. This initial study of mosquito MCOs suggests that MCO2 may be required for egg development or eggshell tanning in addition to cuticle tanning, while MCO1 and MCO3 may be involved in metal metabolism or immunity. PMID:18675911

  15. Molecular Cloning of a cDNA Encoding for Taenia solium TATA-Box Binding Protein 1 (TsTBP1) and Study of Its Interactions with the TATA-Box of Actin 5 and Typical 2-Cys Peroxiredoxin Genes

    PubMed Central

    Rodríguez-Lima, Oscar; García-Gutierrez, Ponciano; Jiménez, Lucía; Zarain-Herzberg, Ángel; Lazzarini, Roberto; Landa, Abraham

    2015-01-01

    TATA-box binding protein (TBP) is an essential regulatory transcription factor for the TATA-box and TATA-box-less gene promoters. We report the cloning and characterization of a full-length cDNA that encodes a Taenia solium TATA-box binding protein 1 (TsTBP1). Deduced amino acid composition from its nucleotide sequence revealed that encodes a protein of 238 residues with a predicted molecular weight of 26.7 kDa, and a theoretical pI of 10.6. The NH2-terminal domain shows no conservation when compared with to pig and human TBP1s. However, it shows high conservation in size and amino acid identity with taeniids TBP1s. In contrast, the TsTBP1 COOH-terminal domain is highly conserved among organisms, and contains the amino acids involved in interactions with the TATA-box, as well as with TFIIA and TFIIB. In silico TsTBP1 modeling reveals that the COOH-terminal domain forms the classical saddle structure of the TBP family, with one α-helix at the end, not present in pig and human. Native TsTBP1 was detected in T. solium cysticerci´s nuclear extract by western blot using rabbit antibodies generated against two synthetic peptides located in the NH2 and COOH-terminal domains of TsTBP1. These antibodies, through immunofluorescence technique, identified the TBP1 in the nucleus of cells that form the bladder wall of cysticerci of Taenia crassiceps, an organism close related to T. solium. Electrophoretic mobility shift assays using nuclear extracts from T. solium cysticerci and antibodies against the NH2-terminal domain of TsTBP1 showed the interaction of native TsTBP1 with the TATA-box present in T. solium actin 5 (pAT5) and 2-Cys peroxiredoxin (Ts2-CysPrx) gene promoters; in contrast, when antibodies against the anti-COOH-terminal domain of TsTBP1 were used, they inhibited the binding of TsTBP1 to the TATA-box of the pAT5 promoter gene. PMID:26529408

  16. Molecular Cloning of a cDNA Encoding for Taenia solium TATA-Box Binding Protein 1 (TsTBP1) and Study of Its Interactions with the TATA-Box of Actin 5 and Typical 2-Cys Peroxiredoxin Genes.

    PubMed

    Rodríguez-Lima, Oscar; García-Gutierrez, Ponciano; Jiménez, Lucía; Zarain-Herzberg, Ángel; Lazzarini, Roberto; Landa, Abraham

    2015-01-01

    TATA-box binding protein (TBP) is an essential regulatory transcription factor for the TATA-box and TATA-box-less gene promoters. We report the cloning and characterization of a full-length cDNA that encodes a Taenia solium TATA-box binding protein 1 (TsTBP1). Deduced amino acid composition from its nucleotide sequence revealed that encodes a protein of 238 residues with a predicted molecular weight of 26.7 kDa, and a theoretical pI of 10.6. The NH2-terminal domain shows no conservation when compared with to pig and human TBP1s. However, it shows high conservation in size and amino acid identity with taeniids TBP1s. In contrast, the TsTBP1 COOH-terminal domain is highly conserved among organisms, and contains the amino acids involved in interactions with the TATA-box, as well as with TFIIA and TFIIB. In silico TsTBP1 modeling reveals that the COOH-terminal domain forms the classical saddle structure of the TBP family, with one α-helix at the end, not present in pig and human. Native TsTBP1 was detected in T. solium cysticerci´s nuclear extract by western blot using rabbit antibodies generated against two synthetic peptides located in the NH2 and COOH-terminal domains of TsTBP1. These antibodies, through immunofluorescence technique, identified the TBP1 in the nucleus of cells that form the bladder wall of cysticerci of Taenia crassiceps, an organism close related to T. solium. Electrophoretic mobility shift assays using nuclear extracts from T. solium cysticerci and antibodies against the NH2-terminal domain of TsTBP1 showed the interaction of native TsTBP1 with the TATA-box present in T. solium actin 5 (pAT5) and 2-Cys peroxiredoxin (Ts2-CysPrx) gene promoters; in contrast, when antibodies against the anti-COOH-terminal domain of TsTBP1 were used, they inhibited the binding of TsTBP1 to the TATA-box of the pAT5 promoter gene.

  17. Effects of latrunculin B on the actin cytoskeleton and hyphal growth in Phytophthora infestans.

    PubMed

    Ketelaar, Tijs; Meijer, Harold J G; Spiekerman, Marjolein; Weide, Rob; Govers, Francine

    2012-12-01

    The actin cytoskeleton is conserved in all eukaryotes, but its functions vary among different organisms. In oomycetes, the function of the actin cytoskeleton has received relatively little attention. We have performed a bioinformatics study and show that oomycete actin genes fall within a distinct clade that is divergent from plant, fungal and vertebrate actin genes. To obtain a better understanding of the functions of the actin cytoskeleton in hyphal growth of oomycetes, we studied the actin organization in Phytophthora infestans hyphae and the consequences of treatment with the actin depolymerising drug latrunculin B (latB). This revealed that latB treatment causes a concentration dependent inhibition of colony expansion and aberrant hyphal growth. The most obvious aberrations observed upon treatment with 0.1 μM latB were increased hyphal branching and irregular tube diameters whereas at higher concentrations latB (0.5 and 1 μM) tips of expanding hyphae changed into balloon-like shapes. This aberrant growth correlated with changes in the organization of the actin cytoskeleton. In untreated hyphae, staining with fluorescently tagged phalloidin revealed two populations of actin filaments: long, axially oriented actin filament cables and cortical actin filament plaques. Two hyphal subtypes were recognized, one containing only plaques and the other containing both cables and plaques. In the latter, some hyphae had an apical zone without actin filament plaques. Upon latB treatment, the proportion of hyphae without actin filament cables increased and there were more hyphae with a short apical zone without actin filament plaques. In general, actin filament plaques were more resilient against actin depolymerisation than actin filament cables. Besides disturbing hyphal growth and actin organization, actin depolymerisation also affected the positioning of nuclei. In the presence of latB, the distance between nuclei and the hyphal tip decreased, suggesting that the actin

  18. Tropomyosin - master regulator of actin filament function in the cytoskeleton.

    PubMed

    Gunning, Peter W; Hardeman, Edna C; Lappalainen, Pekka; Mulvihill, Daniel P

    2015-08-15

    Tropomyosin (Tpm) isoforms are the master regulators of the functions of individual actin filaments in fungi and metazoans. Tpms are coiled-coil parallel dimers that form a head-to-tail polymer along the length of actin filaments. Yeast only has two Tpm isoforms, whereas mammals have over 40. Each cytoskeletal actin filament contains a homopolymer of Tpm homodimers, resulting in a filament of uniform Tpm composition along its length. Evidence for this 'master regulator' role is based on four core sets of observation. First, spatially and functionally distinct actin filaments contain different Tpm isoforms, and recent data suggest that members of the formin family of actin filament nucleators can specify which Tpm isoform is added to the growing actin filament. Second, Tpms regulate whole-organism physiology in terms of morphogenesis, cell proliferation, vesicle trafficking, biomechanics, glucose metabolism and organ size in an isoform-specific manner. Third, Tpms achieve these functional outputs by regulating the interaction of actin filaments with myosin motors and actin-binding proteins in an isoform-specific manner. Last, the assembly of complex structures, such as stress fibers and podosomes involves the collaboration of multiple types of actin filament specified by their Tpm composition. This allows the cell to specify actin filament function in time and space by simply specifying their Tpm isoform composition.

  19. MicroSyn: a user friendly tool for detection of microsynteny in a gene family

    SciTech Connect

    Cai, Bin; Yang, Xiaohan; Tuskan, Gerald A; Cheng, Zong-Ming

    2011-01-01

    Background: The traditional phylogeny analysis within gene family is mainly based on DNA or amino acid sequence homologies. However, these phylogenetic tree analyses are not suitable for those non-traditional gene families like microRNA with very short sequences. For the normal protein-coding gene families, low bootstrap values are frequently encountered in some nodes, suggesting low confidence or likely inappropriateness of placement of those members in those nodes. Results: We introduce MicroSyn software as a means of detecting microsynteny in adjacent genomic regions surrounding genes in gene families. MicroSyn searches for conserved, flanking colinear homologous gene pairs between two genomic fragments to determine the relationship between two members in a gene family. The colinearity of homologous pairs is controlled by a statistical distance function. As a result, gene duplication history can be inferred from the output independent of gene sequences. MicroSyn was designed for both experienced and non-expert users with a user-friendly graphical-user interface. MicroSyn is available from: http://fcsb.njau.edu. cn/microsyn/. Conclusions: Case studies of the microRNA167 genes in plants and Xyloglucan ndotransglycosylase/Hydrolase family in Populus trichocarpa were presented to show the utility of the software. The easy using of MicroSyn in these examples suggests that the software is an additional valuable means to address the problem intrinsic in the computational methods and sequence qualities themselves in gene family analysis.

  20. The rpg4-mediated resistance to wheat stem rust (Puccinia graminis) in barley (Hordeum vulgare) requires Rpg5, a second NBS-LRR gene, and an actin depolymerization factor.

    PubMed

    Wang, X; Richards, J; Gross, T; Druka, A; Kleinhofs, A; Steffenson, B; Acevedo, M; Brueggeman, R

    2013-04-01

    The rpg4 gene confers recessive resistance to several races of wheat stem rust (Puccinia graminis f. sp. tritici) and Rpg5 provides dominant resistance against isolates of the rye stem rust (P. graminis f. sp. secalis) in barley. The rpg4 and Rpg5 genes are tightly linked on chromosome 5H, and positional cloning using high-resolution populations clearly separated the genes, unambiguously identifying Rpg5; however, the identity of rpg4 remained unclear. High-resolution genotyping of critical recombinants at the rpg4/Rpg5 locus, designated here as rpg4-mediated resistance locus (RMRL) delimited two distinct yet tightly linked loci required for resistance, designated as RMRL1 and RMRL2. Utilizing virus-induced gene silencing, each gene at RMRL1, i.e., HvRga1 (a nucleotide-binding site leucine-rich repeat [NBS-LRR] domain gene), Rpg5 (an NBS-LRR-protein kinase domain gene), and HvAdf3 (an actin depolymerizing factor-like gene), was individually silenced followed by inoculation with P. graminis f. sp. tritici race QCCJ. Silencing each gene changed the reaction type from incompatible to compatible, indicating that all three genes are required for rpg4-mediated resistance. This stem rust resistance mechanism in barley follows the emerging theme of unrelated pairs of genetically linked NBS-LRR genes required for specific pathogen recognition and resistance. It also appears that actin cytoskeleton dynamics may play an important role in determining resistance against several races of stem rust in barley.

  1. Actin Mechanics and Fragmentation*

    PubMed Central

    De La Cruz, Enrique M.; Gardel, Margaret L.

    2015-01-01

    Cell physiological processes require the regulation and coordination of both mechanical and dynamical properties of the actin cytoskeleton. Here we review recent advances in understanding the mechanical properties and stability of actin filaments and how these properties are manifested at larger (network) length scales. We discuss how forces can influence local biochemical interactions, resulting in the formation of mechanically sensitive dynamic steady states. Understanding the regulation of such force-activated chemistries and dynamic steady states reflects an important challenge for future work that will provide valuable insights as to how the actin cytoskeleton engenders mechanoresponsiveness of living cells. PMID:25957404

  2. Genome-wide identification and expression profiling of ankyrin-repeat gene family in maize.

    PubMed

    Jiang, Haiyang; Wu, Qingqing; Jin, Jing; Sheng, Lei; Yan, Hanwei; Cheng, Beijiu; Zhu, Suwen

    2013-09-01

    Members of the ankyrin repeats (ANK) gene family encode ANK domain that are common in diverse organisms and play important roles in cell growth and development, such as cell-cell signal transduction and cell cycle regulation. Recently, genome-wide identification and evolutionary analyses of the ANK gene family have been carried out in Arabidopsis and rice. However, little is known regarding the ANK genes in the entire maize genome. In this study, we described the identification and structural characterization of 71 ANK genes in maize (ZmANK). Then, comprehensive bioinformatics analyses of ZmANK genes family were performed including phylogenetic, domain and motif analysis, chromosomal localization, intron/exon structural patterns, gene duplications and expression profiling. Domain composition analyses showed that ZmANK genes formed ten subfamilies. Five tandem duplications and 14 segmental duplications were identified in ZmANK genes. Furthermore, we took comparative analysis of the total ANK gene family in Arabidopsis, rice and maize, ZmANKs were more closely paired with OsANKs than with AtANKs. At last, expression profile analyses were performed. Forty-one members of ZmANK genes held EST sequences records. Semi-quantitative expression and microarray data analysis of these 41 ZmANK genes demonstrated that ZmANK genes exhibit a various expression pattern, suggesting that functional diversification of ZmANK genes family. The results will present significant insights to explore ANK genes expression and function in future studies in maize.

  3. Actin Polymerization is Stimulated by Actin Crosslinking Protein Palladin

    PubMed Central

    Gurung, Ritu; Yadav, Rahul; Brungardt, Joseph G.; Orlova, Albina; Egelman, Edward H.; Beck, Moriah R.

    2016-01-01

    The actin scaffold protein palladin regulates both normal cell migration and invasive cell motility, processes that require the coordinated regulation of actin dynamics. However, the potential effect of palladin on actin dynamics has remained elusive. Here we show that the actin binding immunoglobulin-like domain of palladin, which is directly responsible for both actin binding and bundling, also stimulates actin polymerization in vitro. Palladin eliminated the lag phase that is characteristic of the slow nucleation step of actin polymerization. Furthermore, palladin dramatically reduced depolymerization, slightly enhanced the elongation rate, and did not alter the critical concentration. Microscopy and in vitro crosslinking assays reveal differences in actin bundle architecture when palladin is incubated with actin before or after polymerization. These results suggest a model whereby palladin stimulates a polymerization-competent form of G-actin, akin to metal ions, either through charge neutralization or conformational changes. PMID:26607837

  4. Localization of the feline sarcoma virus fgr gene product (P70gag-actin-fgr): association with the plasma membrane and detergent-insoluble matrix.

    PubMed Central

    Manger, R; Rasheed, S; Rohrschneider, L

    1986-01-01

    The v-fgr oncogene codes for a unique transforming protein (P70gag-actin-fgr) that contains virus-specific determinants and cell-derived sequences for both a tyrosine-specific kinase domain and an actin domain. We examined the subcellular distribution of the v-fgr protein by immunofluorescence microscopy and various cell fractionation techniques. By immunofluorescence, the v-fgr protein was localized in a diffuse cytoplasmic pattern within transformed cells. The v-fgr protein was not detectable at substratum adhesion sites. Crude membrane preparations (P100) obtained from fgr-transformed cells contained elevated levels of P70gag-actin-fgr. Further analysis of membranes on discontinous sucrose gradients revealed that P70gag-actin-fgr cofractionated with plasma membranes. Using an alternate method of fractionation, we found that the majority of the v-fgr protein remained with the insoluble matrix obtained by treating cells with a buffer containing Triton X-100. When membranes were similarly treated with detergent, nearly all of v-fgr protein remained with the residual insoluble matrix. These results suggest that the transforming activity of P70gag-actin-fgr may be directed to subcellular cytoskeletal targets at or near the cytoplasmic face of the plasma membrane. Images PMID:3012121

  5. Sequence and domain organization of scruin, an actin-cross-linking protein in the acrosomal process of Limulus sperm

    PubMed Central

    1995-01-01

    The acrosomal process of Limulus sperm is an 80-microns long finger of membrane supported by a crystalline bundle of actin filaments. The filaments in this bundle are crosslinked by a 102-kD protein, scruin present in a 1:1 molar ratio with actin. Recent image reconstruction of scruin decorated actin filaments at 13-A resolution shows that scruin is organized into two equally sized domains bound to separate actin subunits in the same filament. We have cloned and sequenced the gene for scruin from a Limulus testes cDNA library. The deduced amino acid sequence of scruin reflects the domain organization of scruin: it consists of a tandem pair of homologous domains joined by a linker region. The domain organization of scruin is confirmed by limited proteolysis of the purified acrosomal process. Three different proteases cleave the native protein in a 5-kD Protease-sensitive region in the middle of the molecule to generate an NH2-terminal 47-kD and a COOH-terminal 56-kD protease-resistant domains. Although the protein sequence of scruin has no homology to any known actin-binding protein, it has similarities to several proteins, including four open reading frames of unknown function in poxviruses, as well as kelch, a Drosophila protein localized to actin-rich ring canals. All proteins that show homologies to scruin are characterized by the presence of an approximately 50-amino acid residue motif that is repeated between two and seven times. Crystallographic studies reveal this motif represents a four beta-stranded fold that is characteristic of the "superbarrel" structural fold found in the sialidase family of proteins. These results suggest that the two domains of scruin seen in EM reconstructions are superbarrel folds, and they present the possibility that other members of this family may also bind actin. PMID:7822422

  6. Vgl-4, a novel member of the vestigial-like family of transcription cofactors, regulates alpha1-adrenergic activation of gene expression in cardiac myocytes.

    PubMed

    Chen, Hsiao-Huei; Mullett, Steven J; Stewart, Alexandre F R

    2004-07-16

    Cardiac and skeletal muscle genes are regulated by the transcriptional enhancer factor (TEF-1) family of transcription factors. In skeletal muscle, TEF-1 factors interact with a skeletal muscle-specific cofactor called Vestigial-like 2 (Vgl-2) that is related to the Drosophila protein Vestigial. Here, we characterize Vgl-4, the only member of the Vestigial-like family expressed in the heart. Unlike other members of the Vgl family that have a single TEF-1 interaction domain called the tondu (TDU) motif, Vgl-4 has two TDU motifs in its carboxyl-terminal domain. Like other Vgl factors, Vgl-4 physically interacts with TEF-1 in an immunoprecipitation assay. Vgl-4 functionally interacts with TEF-1 and also with myocyte enhancer factor 2 in a mammalian two-hybrid assay. Overexpression of Vgl-4 in cardiac myocytes interfered with the basal expression and alpha1-adrenergic receptor-dependent activation of a TEF-1-dependent skeletal alpha-actin promoter. In cardiac myocytes cultured in serum and in serum-free medium, a myc-tagged Vgl-4 protein was located in the nucleus and cytoplasm but was exported from the nucleus when cells were treated with alpha1-adrenergic receptor agonist. A chimeric nuclear-retained Vgl-4 protein inhibited alpha1-adrenergic receptor-dependent activation. In contrast, deletion of the TDU motifs of Vgl-4 prevented Vgl-4 nuclear localization, relieved Vgl-4 interference of basal activity, and enhanced alpha1-adrenergic up-regulation of the skeletal alpha-actin promoter. Nuclear export of Vgl-4 is dependent on the nuclear exportin CRM-1. These results suggest that Vgl-4 modulates the activity of TEF-1 factors and counteracts alpha1-adrenergic activation of gene expression in cardiac myocytes.

  7. Divergence pattern of animal gene families and relationship with the Cambrian explosion.

    PubMed

    Miyata, T; Suga, H

    2001-11-01

    There are many gene families that are specific to multicellular animals. These have either diverged from ancestral genes that are shared with fungi and/or plants or evolved from an ancestral gene unique to animals. The evolution of gene families involved in cell-cell communication and developmental control has been studied to establish whether the number of member genes increased dramatically immediately prior to or in concert with the Cambrian explosion. A molecular phylogeny-based analysis of several animal-specific gene families has revealed that gene diversification by duplication occurred during two active periods interrupted by a long intervening quiescent period. Intriguingly, the Cambrian explosion is situated in the silent period, indicating that there is no direct link between the first burst of gene diversification and the Cambrian explosion itself. The importance of gene recruitment as a possible molecular mechanism for morphological diversity, and its possible role for the Cambrian explosion, are discussed.

  8. Characterization of the p16 gene in the mouse: Evidence for a large gene family

    SciTech Connect

    Fountain, J.W.; Giendening, J.M.; Flores, J.F.

    1994-09-01

    The p16 gene product is an inhibitor of the cyclin-dependent kinase 4 (CDK4)/cyclin D complex. When uninhibited, the CDK4/cyclin D complex participates in the phosphorylation of the retinoblastoma (RB) protein and renders it inactive. Upon inactivation of the RB protein, transition from the G{sub 1} to the S phase of mitosis occurs and results in cellular proliferation. Thus, p16 is presumed to act as a negative regulator of cell growth by preventing the phosphorylation, and thereby subsequent inactivation, of RB by CDK4/cyclin D. Recently, the p16 gene (also known as the multiple tumor suppressor 1 (MTS1) gene) has been mapped to chromosome 9p21 and found to be deleted or mutated in a number of tumor cell lines. These findings support the role of p16 as a growth inhibitor or tumor suppressor gene and suggest that the mutation of this gene may have global implications in carcinogenesis. We have chosen to test the functional significance of p16 mutations in vivo through the generation of a mouse mutant for p16. In preparation for this undertaking, eight apparently independent (as judged by restriction enzyme digestion and differential hybridization) mouse genomic embryonic stem cell clones have been identified using exon 2 from the human p16 gene as a probe. The identification of these multiple nonoverlapping clones was not entirely surprising since the reduced stringency hybridization of a zoo blot with the same probe also revealed 10-15 positive EcoRI fragments in all species tested, including human, monkey, cow, dog, cat, rabbit, hamster, mouse, chicken and D. melanogaster. Taken together, these findings suggest that the p16 gene is a member of a large gene family. The location of these genomic clones, as well as their potential expression in the mouse, is currently under investigation.

  9. Bcl-2-related protein family gene expression during oligodendroglial differentiation.

    PubMed

    Itoh, Takayuki; Itoh, Aki; Pleasure, David

    2003-06-01

    Oligodendroglial lineage cells (OLC) vary in susceptibility to both necrosis and apoptosis depending on their developmental stages, which might be regulated by differential expression of Bcl-2-related genes. As an initial step to test this hypothesis, we examined the expression of 19 Bcl-2-related genes in purified cultures of rat oligodendroglial progenitors, immature and mature oligodendrocytes. All 'multidomain' anti-apoptotic members (Bcl-x, Bcl-2, Mcl-1, Bcl-w and Bcl2l10/Diva/Boo) except Bcl2a1/A1 are expressed in OLC. Semiquantitative and real-time RT-PCR revealed that Bcl-xL and Mcl-1 mRNAs are the dominant anti-apoptotic members and increase four- and twofold, respectively, with maturation. Bcl-2 mRNA is less abundant than Bcl-xL mRNA in progenitors and falls an additional 10-fold during differentiation. Bcl-w mRNA also increases, with significant changes in its splicing pattern, as OLC mature. Transfection studies demonstrated that Bcl-xL overexpression protects against kainate-induced excitotoxicity, whereas Bcl-2 overexpression does not. As for 'multidomain' pro-apoptotic members (Bax, Bad and Bok/Mtd), Bax and Bak are highly expressed throughout differentiation. Among 'BH3 domain-only' members examined (Bim, Biklk, DP5/Hrk, Bad, Bid, Noxa, Puma/Bbc3, Bmf, BNip3 and BNip3L), BNip3 and Bmf mRNAs increase markedly during differentiation. These results provide basic information to guide further studies on the roles for Bcl-2-related family proteins in OLC death.

  10. Molecular characterization of edestin gene family in Cannabis sativa L.

    PubMed

    Docimo, Teresa; Caruso, Immacolata; Ponzoni, Elena; Mattana, Monica; Galasso, Incoronata

    2014-11-01

    Globulins are the predominant class of seed storage proteins in a wide variety of plants. In many plant species globulins are present in several isoforms encoded by gene families. The major seed storage protein of Cannabis sativa L. is the globulin edestin, widely known for its nutritional potential. In this work, we report the isolation of seven cDNAs encoding for edestin from the C. sativa variety Carmagnola. Southern blot hybridization is in agreement with the number of identified edestin genes. All seven sequences showed the characteristic globulin features, but they result to be divergent members/forms of two edestin types. According to their sequence similarity four forms named CsEde1A, CsEde1B, CsEde1C, CsEde1D have been assigned to the edestin type 1 and the three forms CsEde2A, CsEde2B, CsEde2C to the edestin type 2. Analysis of the coding sequences revealed a high percentage of similarity (98-99%) among the different forms belonging to the same type, which decreased significantly to approximately 64% between the forms belonging to different types. Quantitative RT-PCR analysis revealed that both edestin types are expressed in developing hemp seeds and the amount of CsEde1 was 4.44 ± 0.10 higher than CsEde2. Both edestin types exhibited a high percentage of arginine (11-12%), but CsEde2 resulted particularly rich in methionine residues (2.36%) respect to CsEde1 (0.82%). The amino acid composition determined in CsEde1 and CsEde2 types suggests that these seed proteins can be used to improve the nutritional quality of plant food-stuffs.

  11. Axonal actin in action: Imaging actin dynamics in neurons.

    PubMed

    Ladt, Kelsey; Ganguly, Archan; Roy, Subhojit

    2016-01-01

    Actin is a highly conserved, key cytoskeletal protein involved in numerous structural and functional roles. In neurons, actin has been intensively investigated in axon terminals-growth cones-and dendritic spines, but details about actin structure and dynamics in axon shafts have remained obscure for decades. A major barrier in the field has been imaging actin. Actin exists as soluble monomers (G-actin) as well as actin filaments (F-actin), and labeling actin with conventional fluorescent probes like GFP/RFP typically leads to a diffuse haze that makes it difficult to discern kinetic behaviors. In a recent publication, we used F-actin selective probes to visualize actin dynamics in axons, resolving striking actin behaviors that have not been described before. However, using these probes to visualize actin dynamics is challenging as they can cause bundling of actin filaments; thus, experimental parameters need to be strictly optimized. Here we describe some practical methodological details related to using these probes for visualizing F-actin dynamics in axons.

  12. Gene conversions in the growth hormone gene family of primates: stronger homogenizing effects in the Hominidae lineage.

    PubMed

    Petronella, Nicholas; Drouin, Guy

    2011-09-01

    In humans, the growth hormone/chorionic somatomammotropin gene family is composed of five highly similar genes. We characterized the gene conversions that occurred between the growth hormone genes of 11 primate species. We detected 48 conversions using GENECONV and others were only detected using phylogenetic analyses. Gene conversions were detected in all species analyzed, their average size (±standard deviation) is 197.8±230.4 nucleotides, the size of the conversions is correlated with sequence similarity and converted regions are significantly more GC-rich than non-converted regions. Gene conversions have a stronger homogenizing effect in Hominidae genes than in other primate species. They are also less frequent in conserved gene regions and towards functionally important genes. This suggests that the high degree of sequence similarity observed between the growth hormone genes of primate species is a consequence of frequent gene conversions in gene regions which are under little selective constraints.

  13. [The MDR3 gene mutation: a rare cause of progressive familial intrahepatic cholestasis (PFIC)].

    PubMed

    Maisonnette, F; Abita, T; Barriere, E; Pichon, N; Vincensini, J F; Descottes, B

    2005-10-01

    A 47-year old man complained about persistant pain and cholestasis 12-years after a cholescystectomy. In his family, all his brothers and sisters had cholecystectomy. Genetic explorations revealed a MDR3 gene mutation. All symptoms disappeared with a treatment by ursodesoxycholic acid. MDR3 gene mutation is to be researched in all cases of familial cholestasis.

  14. Diversity and linkage of genes in the self-incompatibility gene family in Arabidopsis lyrata.

    PubMed Central

    Charlesworth, Deborah; Mable, Barbara K; Schierup, Mikkel H; Bartolomé, Carolina; Awadalla, Philip

    2003-01-01

    We report studies of seven members of the S-domain gene family in Arabidopsis lyrata, a member of the Brassicaceae that has a sporophytic self-incompatibility (SI) system. Orthologs for five loci are identifiable in the self-compatible relative A. thaliana. Like the Brassica stigmatic incompatibility protein locus (SRK), some of these genes have kinase domains. We show that several of these genes are unlinked to the putative A. lyrata SRK, Aly13. These genes have much lower nonsynonymous and synonymous polymorphism than Aly13 in the S-domains within natural populations, and differentiation between populations is higher, consistent with balancing selection at the Aly13 locus. One gene (Aly8) is linked to Aly13 and has high diversity. No departures from neutrality were detected for any of the loci. Comparing different loci within A. lyrata, sites corresponding to hypervariable regions in the Brassica S-loci (SLG and SRK) and in comparable regions of Aly13 have greater replacement site divergence than the rest of the S-domain. This suggests that the high polymorphism in these regions of incompatibility loci is due to balancing selection acting on sites within or near these regions, combined with low selective constraints. PMID:12930757

  15. Nucleotide exchange factor GEF-H1 mediates cross-talk between microtubules and the actin cytoskeleton.

    PubMed

    Krendel, Mira; Zenke, Frank T; Bokoch, Gary M

    2002-04-01

    Regulation of the actin cytoskeleton by microtubules is mediated by the Rho family GTPases. However, the molecular mechanisms that link microtubule dynamics to Rho GTPases have not, as yet, been identified. Here we show that the Rho guanine nucleotide exchange factor (GEF)-H1 is regulated by an interaction with microtubules. GEF-H1 mutants that are deficient in microtubule binding have higher activity levels than microtubule-bound forms. These mutants also induce Rho-dependent changes in cell morphology and actin organization. Furthermore, drug-induced microtubule depolymerization induces changes in cell morphology and gene expression that are similar to the changes induced by the expression of active forms of GEF-H1. Furthermore, these effects are inhibited by dominant-negative versions of GEF-H1. Thus, GEF-H1 links changes in microtubule integrity to Rho-dependent regulation of the actin cytoskeleton.

  16. The Phaseolus vulgaris ZIP gene family: identification, characterization, mapping, and gene expression

    PubMed Central

    Astudillo, Carolina; Fernandez, Andrea C.; Blair, Matthew W.; Cichy, Karen A.

    2013-01-01

    Zinc is an essential mineral for humans and plants and is involved in many physiological and biochemical processes. In humans, Zn deficiency has been associated with retarded growth and reduction of immune response. In plants, Zn is an essential component of more than 300 enzymes including RNA polymerase, alkaline phosphatase, alcohol dehydrogenase, Cu/Zn superoxidase dismutase, and carbonic anhydrase. The accumulation of Zn in plants involves many genes and characterization of the role of these genes will be useful in biofortification. Here we report the identification and phlyogenetic and sequence characterization of the 23 members of the ZIP (ZRT, IRT like protein) family of metal transporters and three transcription factors of the bZIP family in Phaseolus vulgaris L. Expression patterns of seven of these genes were characterized in two bean genotypes (G19833 and DOR364) under two Zn treatments. Tissue analyzed included roots and leaves at vegetative and flowering stages, and pods at 20 days after flowering. Four of the genes, PvZIP12, PvZIP13, PvZIP16, and Pv bZIP1, showed differential expression based on tissue, Zn treatment, and/or genotype. PvZIP12 and PvZIP13 were both more highly expressed in G19833 than DOR364. PvZIP12 was most highly expressed in vegetative leaves under the Zn (−) treatment. PvZIP16 was highly expressed in leaf tissue, especially leaf tissue at flowering stage grown in the Zn (−) treatment. Pv bZIP1 was most highly expressed in leaf and pod tissue. The 23 PvZIP genes and three bZIP genes were mapped on the DOR364 × G19833 linkage map. PvZIP12, PvZIP13, and PvZIP18, Pv bZIP2, and Pv bZIP3 were located near QTLs for Zn accumulation in the seed. Based on the expression and mapping results, PvZIP12 is a good candidate gene for increasing seed Zn concentration and increase understanding of the role of ZIP genes in metal uptake, distribution, and accumulation of zinc in P. vulgaris. PMID:23908661

  17. Actin: its cumbersome pilgrimage through cellular compartments

    PubMed Central

    Schleicher, Michael

    2008-01-01

    In this article, we follow the history of one of the most abundant, most intensely studied proteins of the eukaryotic cells: actin. We report on hallmarks of its discovery, its structural and functional characterization and localization over time, and point to present days’ knowledge on its position as a member of a large family. We focus on the rather puzzling number of diverse functions as proposed for actin as a dual compartment protein. Finally, we venture on some speculations as to its origin. PMID:18438682

  18. Evolutionary diversification of the vertebrate transferrin multi-gene family.

    PubMed

    Hughes, Austin L; Friedman, Robert

    2014-11-01

    In a phylogenetic analysis of vertebrate transferrins (TFs), six major clades (subfamilies) were identified: (a) S, the mammalian serotransferrins; (b) ICA, the mammalian inhibitor of carbonic anhydrase (ICA) homologs; (c) L, the mammalian lactoferrins; (d) O, the ovotransferrins of birds and reptiles; (e) M, the melanotransferrins of bony fishes, amphibians, reptiles, birds, and mammals; and (f) M-like, a newly identified TF subfamily found in bony fishes, amphibians, reptiles, and birds. A phylogenetic tree based on the joint alignment of N-lobes and C-lobes supported the hypothesis that three separate events of internal duplication occurred in vertebrate TFs: (a) in the common ancestor of the M subfamily, (b) in the common ancestor of the M-like subfamily, and (c) in the common ancestor of other vertebrate TFs. The S, ICA, and L subfamilies were found only in placental mammals, and the phylogenetic analysis supported the hypothesis that these three subfamilies arose by gene duplication after the divergence of placental mammals from marsupials. The M-like subfamily was unusual in several respects, including the presence of a uniquely high proportion of clade-specific conserved residues, including distinctive but conserved residues in the sites homologous to those functioning in carbonate binding of human serotransferrin. The M-like family also showed an unusually high proportion of cationic residues in the positively charged region corresponding to human lactoferrampin, suggesting a distinctive role of this region in the M-like subfamily, perhaps in antimicrobial defense.

  19. Evolutionary Diversification of the Vertebrate Transferrin Multi-gene Family

    PubMed Central

    Hughes, Austin L.; Friedman, Robert

    2014-01-01

    In a phylogenetic analysis of vertebrate transferrins (TFs), six major clades (subfamilies) were identified: (1) S, the mammalian serotransferrins; (2) ICA, the mammalian inhibitor of carbonic anhydrase (ICA) homologs; (3) L, the mammalian lactoferrins; (4) O, the ovotransferrins of birds and reptiles; (4) M, the melanotransferrins of bony fishes, amphibians, reptiles, birds, and mammals; and (5) M-like, a newly identified TF subfamily found in bony fishes, amphibians, reptiles, and birds. A phylogenetic tree based on the joint alignment of N-lobes and C-lobes supported the hypothesis that three separate events of internal duplication occurred in vertebrate TFs: (1) in the common ancestor of the M subfamily; (2) in the common ancestor of the M-like subfamily; and (3) in the common ancestor of other vertebrate TFs. The S, ICA, and L subfamilies were found only in placental mammals, and the phylogenetic analysis supported the hypothesis that these three subfamilies arose by gene duplication after the divergence of placental mammals from marsupials. The M-like subfamily was unusual in several respects, including the presence of a uniquely high proportion of clade-specific conserved residues, including distinctive but conserved residues in the sites homologous to those functioning in carbonate binding of human serotransferrin. The M-like family also showed a unusually high proportion of cationic residues in the positively charged region corresponding to human lactoferrampin, suggesting a distinctive role of this region in the M-like subfamily, perhaps in antimicrobial defense. PMID:25142446

  20. Genome-wide analysis reveals diverged patterns of codon bias, gene expression, and rates of sequence evolution in picea gene families.

    PubMed

    De La Torre, Amanda R; Lin, Yao-Cheng; Van de Peer, Yves; Ingvarsson, Pär K

    2015-03-05

    The recent sequencing of several gymnosperm genomes has greatly facilitated studying the evolution of their genes and gene families. In this study, we examine the evidence for expression-mediated selection in the first two fully sequenced representatives of the gymnosperm plant clade (Picea abies and Picea glauca). We use genome-wide estimates of gene expression (>50,000 expressed genes) to study the relationship between gene expression, codon bias, rates of sequence divergence, protein length, and gene duplication. We found that gene expression is correlated with rates of sequence divergence and codon bias, suggesting that natural selection is acting on Picea protein-coding genes for translational efficiency. Gene expression, rates of sequence divergence, and codon bias are correlated with the size of gene families, with large multicopy gene families having, on average, a lower expression level and breadth, lower codon bias, and higher rates of sequence divergence than single-copy gene families. Tissue-specific patterns of gene expression were more common in large gene families with large gene expression divergence than in single-copy families. Recent family expansions combined with large gene expression variation in paralogs and increased rates of sequence evolution suggest that some Picea gene families are rapidly evolving to cope with biotic and abiotic stress. Our study highlights the importance of gene expression and natural selection in shaping the evolution of protein-coding genes in Picea species, and sets the ground for further studies investigating the evolution of individual gene families in gymnosperms.

  1. Ortho2ExpressMatrix—a web server that interprets cross-species gene expression data by gene family information

    PubMed Central

    2011-01-01

    Background The study of gene families is pivotal for the understanding of gene evolution across different organisms and such phylogenetic background is often used to infer biochemical functions of genes. Modern high-throughput experiments offer the possibility to analyze the entire transcriptome of an organism; however, it is often difficult to deduct functional information from that data. Results To improve functional interpretation of gene expression we introduce Ortho2ExpressMatrix, a novel tool that integrates complex gene family information, computed from sequence similarity, with comparative gene expression profiles of two pre-selected biological objects: gene families are displayed with two-dimensional matrices. Parameters of the tool are object type (two organisms, two individuals, two tissues, etc.), type of computational gene family inference, experimental meta-data, microarray platform, gene annotation level and genome build. Family information in Ortho2ExpressMatrix bases on computationally different protein family approaches such as EnsemblCompara, InParanoid, SYSTERS and Ensembl Family. Currently, respective all-against-all associations are available for five species: human, mouse, worm, fruit fly and yeast. Additionally, microRNA expression can be examined with respect to miRBase or TargetScan families. The visualization, which is typical for Ortho2ExpressMatrix, is performed as matrix view that displays functional traits of genes (differential expression) as well as sequence similarity of protein family members (BLAST e-values) in colour codes. Such translations are intended to facilitate the user's perception of the research object. Conclusions Ortho2ExpressMatrix integrates gene family information with genome-wide expression data in order to enhance functional interpretation of high-throughput analyses on diseases, environmental factors, or genetic modification or compound treatment experiments. The tool explores differential gene expression in

  2. Genome-wide identification and analysis of the MADS-box gene family in apple.

    PubMed

    Tian, Yi; Dong, Qinglong; Ji, Zhirui; Chi, Fumei; Cong, Peihua; Zhou, Zongshan

    2015-01-25

    The MADS-box gene family is one of the most widely studied families in plants and has diverse developmental roles in flower pattern formation, gametophyte cell division and fruit differentiation. Although the genome-wide analysis of this family has been performed in some species, little is known regarding MADS-box genes in apple (Malus domestica). In this study, 146 MADS-box genes were identified in the apple genome and were phylogenetically clustered into six subgroups (MIKC(c), MIKC*, Mα, Mβ, Mγ and Mδ) with the MADS-box genes from Arabidopsis and rice. The predicted apple MADS-box genes were distributed across all 17 chromosomes at different densities. Additionally, the MADS-box domain, exon length, gene structure and motif compositions of the apple MADS-box genes were analysed. Moreover, the expression of all of the apple MADS-box genes was analysed in the root, stem, leaf, flower tissues and five stages of fruit development. All of the apple MADS-box genes, with the exception of some genes in each group, were expressed in at least one of the tissues tested, which indicates that the MADS-box genes are involved in various aspects of the physiological and developmental processes of the apple. To the best of our knowledge, this report describes the first genome-wide analysis of the apple MADS-box gene family, and the results should provide valuable information for understanding the classification, cloning and putative functions of this family.

  3. Tandem zinc-finger gene families in mammals: insights and unanswered questions.

    PubMed

    Shannon, M; Kim, J; Ashworth, L; Branscomb, E; Stubbs, L

    1998-01-01

    Evidence for the remarkable conservation of mammalian genomes, in both content and organization of resident genes, is rapidly emerging from comparative mapping studies. The frequent occurrence of familial gene clustering, presumably reflecting a history of tandem in situ duplications starting from a single ancestral gene, is also apparent from these analyses. Genes encoding Kruppel-type zinc-finger (ZNF) proteins, including those containing Kruppel-associated box (KRAB) motifs, are particularly prone to such clustered organization. Existing data suggest that genes in KRAB-ZNF gene clusters have diverged in sequence and expression patterns, possibly yielding families of proteins with distinct, yet related, functions. Comparative mapping studies indicate that at least some of the genes within these clusters in mammals were elaborated prior to the divergence of mammalian orders and, subsequently, have been conserved. These data suggest a possible role for these tandem KRAB-ZNF gene families in mammalian evolution.

  4. Structural, functional, and evolutionary analysis of the unusually large stilbene synthase gene family in grapevine.

    PubMed

    Parage, Claire; Tavares, Raquel; Réty, Stéphane; Baltenweck-Guyot, Raymonde; Poutaraud, Anne; Renault, Lauriane; Heintz, Dimitri; Lugan, Raphaël; Marais, Gabriel A B; Aubourg, Sébastien; Hugueney, Philippe

    2012-11-01

    Stilbenes are a small family of phenylpropanoids produced in a number of unrelated plant species, including grapevine (Vitis vinifera). In addition to their participation in defense mechanisms in plants, stilbenes, such as resveratrol, display important pharmacological properties and are postulated to be involved in the health benefits associated with a moderate consumption of red wine. Stilbene synthases (STSs), which catalyze the biosynthesis of the stilbene backbone, seem to have evolved from chalcone synthases (CHSs) several times independently in stilbene-producing plants. STS genes usually form small families of two to five closely related paralogs. By contrast, the sequence of grapevine reference genome (cv PN40024) has revealed an unusually large STS gene family. Here, we combine molecular evolution and structural and functional analyses to investigate further the high number of STS genes in grapevine. Our reannotation of the STS and CHS gene families yielded 48 STS genes, including at least 32 potentially functional ones. Functional characterization of nine genes representing most of the STS gene family diversity clearly indicated that these genes do encode for proteins with STS activity. Evolutionary analysis of the STS gene family revealed that both STS and CHS evolution are dominated by purifying selection, with no evidence for strong selection for new functions among STS genes. However, we found a few sites under different selection pressures in CHS and STS sequences, whose potential functional consequences are discussed using a structural model of a typical STS from grapevine that we developed.

  5. Arp2/3 complex and actin dynamics are required for actin-based mitochondrial motility in yeast

    PubMed Central

    Boldogh, Istvan R.; Yang, Hyeong-Cheol; Nowakowski, W. Dan; Karmon, Sharon L.; Hays, Lara G.; Yates, John R.; Pon, Liza A.

    2001-01-01

    The Arp2/3 complex is implicated in actin polymerization-driven movement of Listeria monocytogenes. Here, we find that Arp2p and Arc15p, two subunits of this complex, show tight, actin-independent association with isolated yeast mitochondria. Arp2p colocalizes with mitochondria. Consistent with this result, we detect Arp2p-dependent formation of actin clouds around mitochondria in intact yeast. Cells bearing mutations in ARP2 or ARC15 genes show decreased velocities of mitochondrial movement, loss of all directed movement and defects in mitochondrial morphology. Finally, we observe a decrease in the velocity and extent of mitochondrial movement in yeast in which actin dynamics are reduced but actin cytoskeletal structure is intact. These results support the idea that the movement of mitochondria in yeast is actin polymerization driven and that this movement requires Arp2/3 complex. PMID:11248049

  6. A novel heterozygous missense mutation in uromodulin gene in an Indian family with familial juvenile hyperuricemic nephropathy

    PubMed Central

    Saxena, D.; Srivastava, P.; Phadke, S. R.

    2016-01-01

    Familial juvenile hyperuricemic nephropathy (FJHN), characterized by early-onset hyperuricemia, reduced fractional excretion of uric acid, and chronic renal failure is caused due to mutation in uromodulin (UMOD) gene. We identified a novel mutation in a family with multiple members affected with FJHN. Ten coding exons of UMOD gene in three family members with clinical and biochemical features of FJHN and one unaffected family member were sequenced, and sequence variants were analyzed for the pathogenicity by bioinformatics studies. A heterozygous novel missense mutation (c. 949 T >G) in exon 5 leading to the replacement of cysteine by glycine at position 317 was identified in all three affected family members. This mutation has not been reported earlier in Human Gene Mutation Database, Human Genome Variation, Clinvar, and 1000 Genome. The mutation lies in the cysteine-rich 2 domain of the protein, and the affected residue is evolutionary conserved in other species. To our knowledge, this is the first report of the identification of UMOD mutation in an Indian family. PMID:27795632

  7. Characterization of bacterial artificial chromosome transgenic mice expressing mCherry fluorescent protein substituted for the murine smooth muscle-alpha-actin gene

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Smooth muscle a actin (SMA) is a cytoskeletal protein expressed by mesenchymal and smooth muscle cell types, including mural cells(vascular smooth muscle cells and pericytes). Using Bacterial Artificial Chromosome (BAC) recombineering technology, we generated transgenic reporter mice that express a ...

  8. Actin is an evolutionarily-conserved damage-associated molecular pattern that signals tissue injury in Drosophila melanogaster

    PubMed Central

    Srinivasan, Naren; Gordon, Oliver; Ahrens, Susan; Franz, Anna; Deddouche, Safia; Chakravarty, Probir; Phillips, David; Yunus, Ali A; Rosen, Michael K; Valente, Rita S; Teixeira, Luis; Thompson, Barry; Dionne, Marc S; Wood, Will; Reis e Sousa, Caetano

    2016-01-01

    Damage-associated molecular patterns (DAMPs) are molecules released by dead cells that trigger sterile inflammation and, in vertebrates, adaptive immunity. Actin is a DAMP detected in mammals by the receptor, DNGR-1, expressed by dendritic cells (DCs). DNGR-1 is phosphorylated by Src-family kinases and recruits the tyrosine kinase Syk to promote DC cross-presentation of dead cell-associated antigens. Here we report that actin is also a DAMP in invertebrates that lack DCs and adaptive immunity. Administration of actin to Drosophila melanogaster triggers a response characterised by selective induction of STAT target genes in the fat body through the cytokine Upd3 and its JAK/STAT-coupled receptor, Domeless. Notably, this response requires signalling via Shark, the Drosophila orthologue of Syk, and Src42A, a Drosophila Src-family kinase, and is dependent on Nox activity. Thus, extracellular actin detection via a Src-family kinase-dependent cascade is an ancient means of detecting cell injury that precedes the evolution of adaptive immunity. DOI: http://dx.doi.org/10.7554/eLife.19662.001 PMID:27871362

  9. Polycation induced actin bundles.

    PubMed

    Muhlrad, Andras; Grintsevich, Elena E; Reisler, Emil

    2011-04-01

    Three polycations, polylysine, the polyamine spermine and the polycationic protein lysozyme were used to study the formation, structure, ionic strength sensitivity and dissociation of polycation-induced actin bundles. Bundles form fast, simultaneously with the polymerization of MgATP-G-actins, upon the addition of polycations to solutions of actins at low ionic strength conditions. This indicates that nuclei and/or nascent filaments bundle due to attractive, electrostatic effect of polycations and the neutralization of repulsive interactions of negative charges on actin. The attractive forces between the filaments are strong, as shown by the low (in nanomolar range) critical concentration of their bundling at low ionic strength. These bundles are sensitive to ionic strength and disassemble partially in 100 mM NaCl, but both the dissociation and ionic strength sensitivity can be countered by higher polycation concentrations. Cys374 residues of actin monomers residing on neighboring filaments in the bundles can be cross-linked by the short span (5.4Å) MTS-1 (1,1-methanedyl bismethanethiosulfonate) cross-linker, which indicates a tight packing of filaments in the bundles. The interfilament cross-links, which connect monomers located on oppositely oriented filaments, prevent disassembly of bundles at high ionic strength. Cofilin and the polysaccharide polyanion heparin disassemble lysozyme induced actin bundles more effectively than the polylysine-induced bundles. The actin-lysozyme bundles are pathologically significant as both proteins are found in the pulmonary airways of cystic fibrosis patients. Their bundles contribute to the formation of viscous mucus, which is the main cause of breathing difficulties and eventual death in this disorder.

  10. TaADF4, an actin-depolymerizing factor from wheat, is required for resistance to the stripe rust pathogen Puccinia striiformis f. sp. tritici.

    PubMed

    Zhang, Bing; Hua, Yuan; Wang, Juan; Huo, Yan; Shimono, Masaki; Day, Brad; Ma, Qing

    2017-03-01

    Actin filament assembly in plants is a dynamic process, requiring the activity of more than 75 actin-binding proteins. Central to the regulation of filament assembly and stability is the activity of a conserved family of actin-depolymerizing factors (ADFs), whose primarily function is to regulate the severing and depolymerization of actin filaments. In recent years, the activity of ADF proteins has been linked to a variety of cellular processes, including those associated with response to stress. Herein, a wheat ADF gene, TaADF4, was identified and characterized. TaADF4 encodes a 139-amino-acid protein containing five F-actin-binding sites and two G-actin-binding sites, and interacts with wheat (Triticum aestivum) Actin1 (TaACT1), in planta. Following treatment of wheat, separately, with jasmonic acid, abscisic acid or with the avirulent race, CYR23, of the stripe rust pathogen Puccinia striiformis f. sp. tritici, we observed a rapid induction in accumulation of TaADF4 mRNA. Interestingly, accumulation of TaADF4 mRNA was diminished in response to inoculation with a virulent race, CYR31. Silencing of TaADF4 resulted in enhanced susceptibility to CYR23, demonstrating a role for TaADF4 in defense signaling. Using a pharmacological-based approach, coupled with an analysis of host response to pathogen infection, we observed that treatment of plants with the actin-modifying agent latrunculin B enhanced resistance to CYR23, including increased production of reactive oxygen species and enhancement of localized hypersensitive cell death. Taken together, these data support the hypothesis that TaADF4 positively modulates plant immunity in wheat via the modulation of actin cytoskeletal organization.

  11. Genetics Home Reference: actin-accumulation myopathy

    MedlinePlus

    ... fibers and are important for muscle contraction. Attachment (binding) and release of the overlapping thick and thin filaments allows them to move relative to each other so that the muscles can contract. ACTA1 gene mutations that cause actin-accumulation myopathy ...

  12. Out of the Water: Origin and Diversification of the LBD Gene Family.

    PubMed

    Chanderbali, Andre S; He, Fengmei; Soltis, Pamela S; Soltis, Douglas E

    2015-08-01

    LBD (lateral organ boundaries domain) genes are essential to the developmental programs of many fundamental plant organs and function in some of the basic metabolic pathways of plants. However, our historical perspective on the roles of LBD genes during plant evolution has, heretofore, been fragmentary. Here, we show that the LBD gene family underwent an initial radiation that established five gene lineages in the ancestral genome of most charophyte algae and land plants. By inference, the LBD gene family originated after the emergence of the green plants (Viridiplantae), but prior to the diversification of most extant streptophytes. After this initial radiation, we find limited instances of gene family diversification in land plants until successive rounds of expansion in the ancestors of seed plants and flowering plants. The most dynamic phases of LBD gene evolution, therefore, trace to the aquatic ancestors of embryophytes followed by relatively recent lineage-specific expansions on land.

  13. Out of the Water: Origin and Diversification of the LBD Gene Family

    PubMed Central

    Chanderbali, Andre S.; He, Fengmei; Soltis, Pamela S.; Soltis, Douglas E.

    2015-01-01

    LBD (LATERAL ORGAN BOUNDARIES DOMAIN) genes are essential to the developmental programs of many fundamental plant organs and function in some of the basic metabolic pathways of plants. However, our historical perspective on the roles of LBD genes during plant evolution has, heretofore, been fragmentary. Here, we show that the LBD gene family underwent an initial radiation that established five gene lineages in the ancestral genome of most charophyte algae and land plants. By inference, the LBD gene family originated after the emergence of the green plants (Viridiplantae), but prior to the diversification of most extant streptophytes. After this initial radiation, we find limited instances of gene family diversification in land plants until successive rounds of expansion in the ancestors of seed plants and flowering plants. The most dynamic phases of LBD gene evolution, therefore, trace to the aquatic ancestors of embryophytes followed by relatively recent lineage-specific expansions on land. PMID:25839188

  14. Genomic organization of the mouse T-cell receptor beta-chain gene family.

    PubMed Central

    Lai, E; Barth, R K; Hood, L

    1987-01-01

    We have combined three different methods, deletion mapping of T-cell lines, field-inversion gel electrophoresis, and the restriction mapping of a cosmid clone, to construct a physical map of the murine T-cell receptor beta-chain gene family. We have mapped 19 variable (V beta) gene segments and the two clusters of diversity (D beta) and joining (J beta) gene segments and constant (C beta) genes. These members of the beta-chain gene family span approximately equal to 450 kilobases of DNA, excluding one potential gap in the DNA fragment alignments. Images PMID:3035555

  15. A small molecule inhibitor of tropomyosin dissociates actin binding from tropomyosin-directed regulation of actin dynamics

    PubMed Central

    Bonello, Teresa T.; Janco, Miro; Hook, Jeff; Byun, Alex; Appaduray, Mark; Dedova, Irina; Hitchcock-DeGregori, Sarah; Hardeman, Edna C.; Stehn, Justine R.; Böcking, Till; Gunning, Peter W.

    2016-01-01

    The tropomyosin family of proteins form end-to-end polymers along the actin filament. Tumour cells rely on specific tropomyosin-containing actin filament populations for growth and survival. To dissect out the role of tropomyosin in actin filament regulation we use the small molecule TR100 directed against the C terminus of the tropomyosin isoform Tpm3.1. TR100 nullifies the effect of Tpm3.1 on actin depolymerisation but surprisingly Tpm3.1 retains the capacity to bind F-actin in a cooperative manner. In vivo analysis also confirms that, in the presence of TR100, fluorescently tagged Tpm3.1 recovers normally into stress fibers. Assembling end-to-end along the actin filament is thereby not sufficient for tropomyosin to fulfil its function. Rather, regulation of F-actin stability by tropomyosin requires fidelity of information communicated at the barbed end of the actin filament. This distinction has significant implications for perturbing tropomyosin-dependent actin filament function in the context of anti-cancer drug development. PMID:26804624

  16. Different evolutionary histories of two cation/proton exchanger gene families in plants

    PubMed Central

    2013-01-01

    Background Gene duplication events have been proposed to be involved in the adaptation of plants to stress conditions; precisely how is unclear. To address this question, we studied the evolution of two families of antiporters. Cation/proton exchangers are important for normal cell function and in plants, Na+,K+/H+ antiporters have also been implicated in salt tolerance. Two well-known plant cation/proton antiporters are NHX1 and SOS1, which perform Na+ and K+ compartmentalization into the vacuole and Na+ efflux from the cell, respectively. However, our knowledge about the evolution of NHX and SOS1 stress responsive gene families is still limited. Results In this study we performed a comprehensive molecular evolutionary analysis of the NHX and SOS1 families. Using available sequences from a total of 33 plant species, we estimated gene family phylogenies and gene duplication histories, as well as examined heterogeneous selection pressure on amino acid sites. Our results show that, while the NHX family expanded and specialized, the SOS1 family remained a low copy gene family that appears to have undergone neofunctionalization during its evolutionary history. Additionally, we found that both families are under purifying selection although SOS1 is less constrained. Conclusions We propose that the different evolution histories are related with the proteins’ function and localization, and that the NHX and SOS1 families are examples of two different evolutionary paths through which duplication events may result in adaptive evolution of stress tolerance. PMID:23822194

  17. Identification and distribution of the NBS-LRR gene family in the cassava genome

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Plant resistance genes (R genes) exist in large families and usually contain both a nucleotide-binding site domain and a leucine-rich repeat domain, denoted NBS-LRR. The genome sequence of cassava (Manihot esculenta) is a valuable resource for analyzing the genomic organization of resistance genes i...

  18. Evolution of the chitin synthase gene family correlates with fungal morphogenesis and adaption to ecological niches

    PubMed Central

    Liu, Ran; Xu, Chuan; Zhang, Qiangqiang; Wang, Shiyi; Fang, Weiguo

    2017-01-01

    The fungal kingdom potentially has the most complex chitin synthase (CHS) gene family, but evolution of the fungal CHS gene family and its diversification to fulfill multiple functions remain to be elucidated. Here, we identified the full complement of CHSs from 231 fungal species. Using the largest dataset to date, we characterized the evolution of the fungal CHS gene family using phylogenetic and domain structure analysis. Gene duplication, domain recombination and accretion are major mechanisms underlying the diversification of the fungal CHS gene family, producing at least 7 CHS classes. Contraction of the CHS gene family is morphology-specific, with significant loss in unicellular fungi, whereas family expansion is lineage-specific with obvious expansion in early-diverging fungi. ClassV and ClassVII CHSs with the same domain structure were produced by the recruitment of domains PF00063 and PF08766 and subsequent duplications. Comparative analysis of their functions in multiple fungal species shows that the emergence of ClassV and ClassVII CHSs is important for the morphogenesis of filamentous fungi, development of pathogenicity in pathogenic fungi, and heat stress tolerance in Pezizomycotina fungi. This work reveals the evolution of the fungal CHS gene family, and its correlation with fungal morphogenesis and adaptation to ecological niches. PMID:28300148

  19. Genomewide analysis of the lateral organ boundaries domain gene family in Vitis vinifera.

    PubMed

    Cao, Hui; Liu, Cai-Yun; Liu, Chun-Xiang; Zhao, Yue-Ling; Xu, Rui-Rui

    2016-09-01

    In plants, the transcription factor families have been implicated in many important biological processes. These processes include morphogenesis, signal transduction and environmental stress responses. Proteins containing the lateral organ boundaries domain (LBD), which encodes a zinc finger-like domain are only found in plants. This finding indicates that this unique gene family regulates only plant-specific biological processes. LBD genes play crucial roles in the growth and development of plants such as Arabidopsis, Oryza sativa, Zea mays, poplar, apple and tomato. However, relatively little is known about the LBD genes in grape (Vitis vinifera). In this study, we identified 40 LBD genes in the grape genome. A complete overview of the chromosomal locations, phylogenetic relationships, structures and expression profiles of this gene family during development in grape is presented here. Phylogenetic analysis showed that the LBD genes could be divided into classes I and II, together with LBDs from Arabidopsis. We mapped the 40 LBD genes on the grape chromosomes (chr1-chr19) and found that 37 of the predicted grape LBD genes were distributed in different densities across 12 chromosomes. Grape LBDs were found to share a similar intron/exon structure and gene length within the same class. The expression profiles of grape LBD genes at different developmental stages were analysed using microarray data. Results showed that 21 grape LBD genes may be involved in grape developmental processes, including preveraison, veraison and ripening. Finally, we analysed the expression patterns of six LBD genes through quantitative real-time polymerase chain reation analysis. The six LBD genes showed differential expression patterns among the three representative grape tissues, and five of these genes were found to be involved in responses to mannitol, sodium chloride, heat stress and low temperature treatments. To our knowledge, this is the first study to analyse the LBD gene family in

  20. Extensive and continuous duplication facilitates rapid evolution and diversification of gene families.

    PubMed

    Chang, Dan; Duda, Thomas F

    2012-08-01

    The origin of novel gene functions through gene duplication, mutation, and natural selection represents one of the mechanisms by which organisms diversify and one of the possible paths leading to adaptation. Nonetheless, the extent, role, and consequences of duplications in the origins of ecological adaptations, especially in the context of species interactions, remain unclear. To explore the evolution of a gene family that is likely linked to species associations, we investigated the evolutionary history of the A-superfamily of conotoxin genes of predatory marine cone snails (Conus species). Members of this gene family are expressed in the venoms of Conus species and are presumably involved in predator-prey associations because of their utility in prey capture. We recovered sequences of this gene family from genomic DNA of four closely related species of Conus and reconstructed the evolutionary history of these genes. Our study is the first to directly recover conotoxin genes from Conus genomes to investigate the evolution of conotoxin gene families. Our results revealed a phenomenon of rapid and continuous gene turnover that is coupled with heightened rates of evolution. This continuous duplication pattern has not been observed previously, and the rate of gene turnover is at least two times higher than estimates from other multigene families. Conotoxin genes are among the most rapidly evolving protein-coding genes in metazoans, a phenomenon that may be facilitated by extensive gene duplications and have driven changes in conotoxin functions through neofunctionalization. Together these mechanisms led to dramatically divergent arrangements of A-superfamily conotoxin genes among closely related species of Conus. Our findings suggest that extensive and continuous gene duplication facilitates rapid evolution and drastic divergence in venom compositions among species, processes that may be associated with evolutionary responses to predator-prey interactions.

  1. Inferring Hypotheses on Functional Relationships of Genes: Analysis of the Arabidopsis thaliana Subtilase Gene Family

    PubMed Central

    Büssis, Dirk; Stintzi, Annick; Schaller, Andreas; Kopka, Joachim; Altmann, Thomas

    2005-01-01

    The gene family of subtilisin-like serine proteases (subtilases) in Arabidopsis thaliana comprises 56 members, divided into six distinct subfamilies. Whereas the members of five subfamilies are similar to pyrolysins, two genes share stronger similarity to animal kexins. Mutant screens confirmed 144 T-DNA insertion lines with knockouts for 55 out of the 56 subtilases. Apart from SDD1, none of the confirmed homozygous mutants revealed any obvious visible phenotypic alteration during growth under standard conditions. Apart from this specific case, forward genetics gave us no hints about the function of the individual 54 non-characterized subtilase genes. Therefore, the main objective of our work was to overcome the shortcomings of the forward genetic approach and to infer alternative experimental approaches by using an integrative bioinformatics and biological approach. Computational analyses based on transcriptional co-expression and co-response pattern revealed at least two expression networks, suggesting that functional redundancy may exist among subtilases with limited similarity. Furthermore, two hubs were identified, which may be involved in signalling or may represent higher-order regulatory factors involved in responses to environmental cues. A particular enrichment of co-regulated genes with metabolic functions was observed for four subtilases possibly representing late responsive elements of environmental stress. The kexin homologs show stronger associations with genes of transcriptional regulation context. Based on the analyses presented here and in accordance with previously characterized subtilases, we propose three main functions of subtilases: involvement in (i) control of development, (ii) protein turnover, and (iii) action as downstream components of signalling cascades. Supplemental material is available in the Plant Subtilase Database (PSDB) (http://csbdb.mpimp-golm.mpg.de/psdb.html) , as well as from the CSB.DB (http

  2. Methuselah/Methuselah-like G protein-coupled receptors constitute an ancient metazoan gene family

    PubMed Central

    de Mendoza, Alexandre; Jones, Jeffery W.; Friedrich, Markus

    2016-01-01

    Inconsistent conclusions have been drawn regarding the phylogenetic age of the Methuselah/Methuselah-like (Mth/Mthl) gene family of G protein-coupled receptors, the founding member of which regulates development and lifespan in Drosophila. Here we report the results from a targeted homolog search of 39 holozoan genomes and phylogenetic analysis of the conserved seven transmembrane domain. Our findings reveal that the Mth/Mthl gene family is ancient, has experienced numerous extinction and expansion events during metazoan evolution, and acquired the current definition of the Methuselah ectodomain during its exceptional expansion in arthropods. In addition, our findings identify Mthl1, Mthl5, Mthl14, and Mthl15 as the oldest Mth/Mthl gene family paralogs in Drosophila. Future studies of these genes have the potential to define ancestral functions of the Mth/Mthl gene family. PMID:26915348

  3. Evolution of the RH gene family in vertebrates revealed by brown hagfish (Eptatretus atami) genome sequences.

    PubMed

    Suzuki, Akinori; Komata, Hidero; Iwashita, Shogo; Seto, Shotaro; Ikeya, Hironobu; Tabata, Mitsutoshi; Kitano, Takashi

    2017-02-01

    In vertebrates, there are four major genes in the RH (Rhesus) gene family, RH, RHAG, RHBG, and RHCG. These genes are thought to have been formed by the two rounds of whole-genome duplication (2R-WGD) in the common ancestor of all vertebrates. In our previous work, where we analyzed details of the gene duplications process of this gene family, three nucleotide sequences belonging to this family were identified in Far Eastern brook lamprey (Lethenteron reissneri), and the phylogenetic positions of the genes were determined. Lampreys, along with hagfishes, are cyclostomata (jawless fishes), which is a sister group of gnathostomata (jawed vertebrates). Although those results suggested that one gene was orthologous to the gnathostome RHCG genes, we did not identify clear orthologues for other genes. In this study, therefore, we identified three novel cDNA sequences that belong to the RH gene family using de novo transcriptome analysis of another cyclostome: the brown hagfish (Eptatretus atami). We also determined the nucleotide sequences for the RHBG and RHCG genes in a red stingray (Dasyatis akajei), which belongs to the cartilaginous fishes. The phylogenetic tree showed that two brown hagfish genes, which were probably duplicated in the cyclostome lineage, formed a cluster with the gnathostome RHAG genes, whereas another brown hagfish gene formed a cluster with the gnathostome RHCG genes. We estimated that the RH genes had a higher evolutionary rate than the RHAG, RHBG, and RHCG genes. Interestingly, in the RHBG genes, only the bird lineage showed a higher rate of nonsynonymous substitutions. It is likely that this higher rate was caused by a state of relaxed functional constraints rather than positive selection nor by pseudogenization.

  4. Massive Expansion of Ubiquitination-Related Gene Families within the Chlamydiae

    PubMed Central

    Domman, Daryl; Collingro, Astrid; Lagkouvardos, Ilias; Gehre, Lena; Weinmaier, Thomas; Rattei, Thomas; Subtil, Agathe; Horn, Matthias

    2014-01-01

    Gene loss, gain, and transfer play an important role in shaping the genomes of all organisms; however, the interplay of these processes in isolated populations, such as in obligate intracellular bacteria, is less understood. Despite a general trend towards genome reduction in these microbes, our phylogenomic analysis of the phylum Chlamydiae revealed that within the family Parachlamydiaceae, gene family expansions have had pronounced effects on gene content. We discovered that the largest gene families within the phylum are the result of rapid gene birth-and-death evolution. These large gene families are comprised of members harboring eukaryotic-like ubiquitination-related domains, such as F-box and BTB-box domains, marking the largest reservoir of these proteins found among bacteria. A heterologous type III secretion system assay suggests that these proteins function as effectors manipulating the host cell. The large disparity in copy number of members in these families between closely related organisms suggests that nonadaptive processes might contribute to the evolution of these gene families. Gene birth-and-death evolution in concert with genomic drift might represent a previously undescribed mechanism by which isolated bacterial populations diversify. PMID:25069652

  5. Interactions among a Fimbrin, a Capping Protein, and an Actin-depolymerizing Factor in Organization of the Fission Yeast Actin Cytoskeleton

    PubMed Central

    Nakano, Kentaro; Satoh, Kazuomi; Morimatsu, Akeshi; Ohnuma, Masaaki; Mabuchi, Issei

    2001-01-01

    We report studies of the fission yeast fimbrin-like protein Fim1, which contains two EF-hand domains and two actin-binding domains (ABD1 and ABD2). Fim1 is a component of both F-actin patches and the F-actin ring, but not of F-actin cables. Fim1 cross-links F-actin in vitro, but a Fim1 protein lacking either EF-hand domains (Fim1A12) or both the EF-hand domains and ABD1 (Fim1A2) has no actin cross-linking activity. Overexpression of Fim1 induced the formation of F-actin patches throughout the cell cortex, whereas the F-actin patches disappear in cells overexpressing Fim1A12 or Fim1A2. Thus, the actin cross-linking activity of Fim1 is probably important for the formation of F-actin patches. The overexpression of Fim1 also excluded the actin-depolymerizing factor Adf1 from the F-actin patches and inhibited the turnover of actin in these structures. Thus, Fim1 may function in stabilizing the F-actin patches. We also isolated the gene encoding Acp1, a subunit of the heterodimeric F-actin capping protein. fim1 acp1 double null cells showed more severe defects in the organization of the actin cytoskeleton than those seen in each single mutant. Thus, Fim1 and Acp1 may function in a similar manner in the organization of the actin cytoskeleton. Finally, genetic studies suggested that Fim1 may function in cytokinesis in cooperation with Cdc15 (PSTPIP) and Rng2 (IQGAP), respectively. PMID:11694585

  6. Duplicated gelsolin family genes in zebrafish: a novel scinderin-like gene (scinla) encodes the major corneal crystallin.

    PubMed

    Jia, Sujuan; Omelchenko, Marina; Garland, Donita; Vasiliou, Vasilis; Kanungo, Jyotshnabala; Spencer, Michael; Wolf, Yuri; Koonin, Eugene; Piatigorsky, Joram

    2007-10-01

    We have previously identified a gelsolin-like protein (C/L-gelsolin) as a corneal crystallin in zebrafish. Here we show by phylogenetic analysis that there are at least six genes encoding gelsolin-like proteins based on their gelsolin domains in zebrafish: gsna and gsnb group with the vertebrate gelsolin gene, scina and scinb group with the scinderin (adseverin) gene, and scinla (C/L-gelsolin) and scinlb are novel scinderin-like genes. RT-PCR showed that scinla, scinlb, and gsnb are preferentially expressed in the adult cornea whereas gsna is expressed to a similar extent in cornea, lens, brain, and heart; scina and scinb expression were detectable only in whole zebrafish and not in these adult tissues. Quantitative RT-PCR and 2-dimensional polyacrylamide gel electrophoresis followed by MALDI/TOF mass spectroscopy confirmed high expression of beta-actin and scinla, moderate expression of scinlb, and very low expression of gsna and gsnb in the cornea. Finally, transgenic zebrafish carrying a green fluorescent protein reporter transgene driven by a 4 kb scinla promoter fragment showed expression in the cornea, snout, dorsal fin, and tail fin of 3-day-old zebrafish larvae. Our data suggest that scinla and scinlb are diverged paralogs of the vertebrate scinderin gene and show that scinla encodes the zebrafish corneal crystallin previously called C/L-gelsolin.

  7. Cloning of novel rice blast resistance genes from two rapidly evolving NBS-LRR gene families in rice.

    PubMed

    Guo, Changjiang; Sun, Xiaoguang; Chen, Xiao; Yang, Sihai; Li, Jing; Wang, Long; Zhang, Xiaohui

    2016-01-01

    Most rice blast resistance genes (R-genes) encode proteins with nucleotide-binding site (NBS) and leucine-rich repeat (LRR) domains. Our previous study has shown that more rice blast R-genes can be cloned in rapidly evolving NBS-LRR gene families. In the present study, two rapidly evolving R-gene families in rice were selected for cloning a subset of genes from their paralogs in three resistant rice lines. A total of eight functional blast R-genes were identified among nine NBS-LRR genes, and some of these showed resistance to three or more blast strains. Evolutionary analysis indicated that high nucleotide diversity of coding regions served as important parameters in the determination of gene resistance. We also observed that amino-acid variants (nonsynonymous mutations, insertions, or deletions) in essential motifs of the NBS domain contribute to the blast resistance capacity of NBS-LRR genes. These results suggested that the NBS regions might also play an important role in resistance specificity determination. On the other hand, different splicing patterns of introns were commonly observed in R-genes. The results of the present study contribute to improving the effectiveness of R-gene identification by using evolutionary analysis method and acquisition of novel blast resistance genes.

  8. Actin Out: Regulation of the Synaptic Cytoskeleton

    PubMed Central

    Spence, Erin F.; Soderling, Scott H.

    2015-01-01

    The small size of dendritic spines belies the elaborate role they play in excitatory synaptic transmission and ultimately complex behaviors. The cytoskeletal architecture of the spine is predominately composed of actin filaments. These filaments, which at first glance might appear simple, are also surprisingly complex. They dynamically assemble into different structures and serve as a platform for orchestrating the elaborate responses of the spine during spinogenesis and experience-dependent plasticity. Multiple mutations associated with human neurodevelopmental and psychiatric disorders involve genes that encode regulators of the synaptic cytoskeleton. A major, unresolved question is how the disruption of specific actin filament structures leads to the onset and progression of complex synaptic and behavioral phenotypes. This review will cover established and emerging mechanisms of actin cytoskeletal remodeling and how this influences specific aspects of spine biology that are implicated in disease. PMID:26453304

  9. Molecular Basis of Actin Nucleation Factor Cooperativity

    PubMed Central

    Zeth, Kornelius; Pechlivanis, Markos; Samol, Annette; Pleiser, Sandra; Vonrhein, Clemens; Kerkhoff, Eugen

    2011-01-01

    The distinct actin nucleation factors of the Spir and formin subgroup families cooperate in actin nucleation. The Spir/formin cooperativity has been identified to direct two essential steps in mammalian oocyte maturation, the asymmetric spindle positioning and polar body extrusion during meiosis. Understanding the nature and regulation of the Spir/Fmn cooperation is an important requirement to comprehend mammalian reproduction. Recently we dissected the structural elements of the Spir and Fmn family proteins, which physically link the two actin nucleation factors. The trans-regulatory interaction is mediated by the Spir kinase non-catalytic C-lobe domain (KIND) and the C-terminal formin Spir interaction motif (FSI). The interaction inhibits formin nucleation activity and enhances the Spir activity. To get insights into the molecular mechanism of the Spir/Fmn interaction, we determined the crystal structure of the KIND domain alone and in complex with the C-terminal Fmn-2 FSI peptide. Together they confirm the proposed structural homology of the KIND domain to the protein kinase fold and reveal the basis of the Spir/formin interaction. The complex structure showed a large interface with conserved and positively charged residues of the Fmn FSI peptide mediating major contacts to an acidic groove on the surface of KIND. Protein interaction studies verified the electrostatic nature of the interaction. The data presented here provide the molecular basis of the Spir/formin interaction and give a first structural view into the mechanisms of actin nucleation factor cooperativity. PMID:21705804

  10. Isolation of novel human and mouse genes of the recA/RAD51 recombination-repair gene family.

    PubMed Central

    Cartwright, R; Dunn, A M; Simpson, P J; Tambini, C E; Thacker, J

    1998-01-01

    Genes from the recA/RAD51 family play essential roles in homologous recombination in all organisms. Using sequence homologies from eukaryotic members of this family we have identified fragments of two additional mammalian genes with homology to RAD51. Cloning the full-length cDNAs for both human and mouse genes showed that the sequences are highly conserved, and that the predicted proteins have characteristic features of this gene family. One of the novel genes (R51H2) occurs in two forms in human cDNA, differing extensively at the 3' end, probably due to an unusual form of alternative splicing. The new genes (R51H2 and R51H3) were mapped to human chromosomes 14q23-24 and 17q1.2, respectively. Expression studies showed that R51H2 is expressed at lower levels than R51H3 , but that expression of both genes occurs at elevated levels in the testis compared with other tissues. The combination of gene structure conservation and the transcript expression patterns suggests that these new members of the recA/RAD51 family may also function in homologous recombination-repair pathways. PMID:9512535

  11. The Role of the Actin Cytoskeleton in Regulating Drosophila Behavior

    PubMed Central

    Ojelade, Shamsideen A.; Acevedo, Summer F.; Rothenfluh, Adrian

    2014-01-01

    Over the past decade, the function of the cytoskeleton has been extensively studied in developing and in mature neurons. Actin, a major cytoskeletal protein, is indispensable for the structural integrity and plasticity of neurons and their synapses. Disruption of actin dynamics has significant consequence for neurons, neuronal circuits, and the functions they govern. In particular, cell adhesion molecules (CAMs), members of the Rho family of GTPases, and actin binding proteins (ABPs) are important modulators of actin dynamics and neuronal as well as behavioral plasticity. In this review, we discuss recent advances in Drosophila that highlight the importance of actin regulatory proteins in mediating fly behaviors such as circadian rhythm, courtship behavior, learning and memory, and the development of drug addiction. PMID:24077615

  12. The ankyrin repeat gene family in rice: genome-wide identification, classification and expression profiling.

    PubMed

    Huang, Jianyan; Zhao, Xiaobo; Yu, Huihui; Ouyang, Yidan; Wang, Lei; Zhang, Qifa

    2009-10-01

    Ankyrin repeat (ANK) containing proteins comprise a large protein family. Although many members of this family have been implicated in plant growth, development and signal transduction, only a few ANK genes have been reported in rice. In this study, we analyzed the structures, phylogenetic relationship, genome localizations and expression profiles of 175 ankyrin repeat genes identified in rice (OsANK). Domain composition analysis suggested OsANK proteins can be classified into ten subfamilies. Chromosomal localizations of OsANK genes indicated nine segmental duplication events involving 17 genes and 65 OsANK genes were involved in tandem duplications. The expression profiles of 158 OsANK genes were analyzed in 24 tissues covering the whole life cycle of two rice genotypes, Minghui 63 and Zhenshan 97. Sixteen genes showed preferential expression in given tissues compared to all the other tissues in Minghui 63 and Zhenshan 97. Nine genes were preferentially expressed in stamen of 1 day before flowering, suggesting that these genes may play important roles in pollination and fertilization. Expression data of OsANK genes were also obtained with tissues of seedlings subjected to three phytohormone (NAA, GA3 and KT) and light/dark treatments. Eighteen genes showed differential expression with at least one phytohormone treatment while under light/dark treatments, 13 OsANK genes showed differential expression. Our data provided a very useful reference for cloning and functional analysis of members of this gene family in rice.

  13. Holding blame at bay? ‘Gene talk' in family members' accounts of schizophrenia aetiology

    PubMed Central

    Callard, Felicity; Rose, Diana; Hanif, Emma-Louise; Quigley, Jody; Greenwood, Kathryn; Wykes, Til

    2012-01-01

    We provide the first detailed analysis of how, for what purposes and with what consequences people related to someone with a diagnosis of schizophrenia use ‘gene talk'. The article analyses findings from a qualitative interview study conducted in London and involving 19 participants (mostly women). We transcribed the interviews verbatim and analysed them using grounded theory methods. We analyse how and for what purposes participants mobilized ‘gene talk' in their affectively freighted encounter with an unknown interviewer. Gene talk served to (re)position blame and guilt, and was simultaneously used imaginatively to forge family history narratives. Family members used ‘gene talk' to recruit forebears with no psychiatric diagnosis into a family history of mental illness, and presented the origins of the diagnosed family member's schizophrenia as lying temporally before, and hence beyond the agency of the immediate family. Gene talk was also used in attempts to dislodge the distressing figure of the schizophrenia-inducing mother. ‘Gene talk', however, ultimately displaced, rather than resolved, the (self-)blame of many family members, particularly mothers. Our article challenges the commonly expressed view that genetic accounts will absolve family members' sense of (self-)blame in relation to their relative's/relatives' diagnosis. PMID:23227107

  14. Retrieval of glycoside hydrolase family 9 cellulase genes from environmental DNA by metagenomic gene specific multi-primer PCR.

    PubMed

    Xiong, Xiaolong; Yin, Xiaopu; Pei, Xiaolin; Jin, Peng; Zhang, Ao; Li, Yan; Gong, Weibo; Wang, Qiuyan

    2012-05-01

    A new method, termed metagenomic gene specific multi-primer PCR (MGSM-PCR), is presented that uses multiple gene specific primers derived from an isolated gene from a constructed metagenomic library rather than degenerate primers designed based on a known enzyme family. The utility of MGSM-PCR was shown by applying it to search for homologues of the glycoside hydrolase family 9 cellulase in metagenomic DNA. The success of the multiplex PCR was verified by visualizing products on an agarose gel following gel electrophoresis. A total of 127 homologous genes were amplified with combinatorial multi-primer reactions from 34 soil DNA samples. Multiple alignments revealed extensive sequence diversity among these captured sequences with sequence identity varying from 26 to 99.7%. These results indicated that significantly diverse homologous genes were indeed readily accessible when using multiple metagenomic gene specific primers.

  15. Familial isolated pituitary adenoma caused by a Aip gene mutation not described before in a family context.

    PubMed

    García-Arnés, J A; González-Molero, I; Oriola, J; Mazuecos, N; Luque, R; Castaño, J; Arraez, M A

    2013-12-01

    The cause of familial isolated pituitary adenomas (FIPA) remains unknown in a high percentage of cases, but the AIP gene plays an important role in the etiology. The aim of the study is to describe a family with FIPA syndrome and the results of genomic studies. A 16-year-old man had a giant prolactinoma resistant tomedical treatment with delayed growth and pubertal development. His mother had been previously diagnosed with a nonfunctioning pituitary macroadenoma. Transsphenoidal endoscopic resection was performed and a genetic study revealed a heterozygous mutation in exon 6: 974G>A (p.Arg325Gln). Because the AIP gene is a tumor suppressor gene, we searched for loss of heterozygosity within the AIP gene by amplifying exon 6 from tumor tissue of the patient. In the electropherogram, only the A allele was amplified (hemizygous state), indicating loss of the normal allele. We report a Spanish family with FIPA in whom a mutation in the AIP gene previously unreported in a familiar context was identified.

  16. Genome-wide analysis of the GRAS gene family in Chinese cabbage (Brassica rapa ssp. pekinensis).

    PubMed

    Song, Xiao-Ming; Liu, Tong-Kun; Duan, Wei-Ke; Ma, Qing-Hua; Ren, Jun; Wang, Zhen; Li, Ying; Hou, Xi-Lin

    2014-01-01

    The GRAS gene family is one of the most important families of transcriptional regulators. In this study, 48 GRAS genes are identified from Chinese cabbage, and they are classified into eight groups according to the classification of Arabidopsis. The characterization, classification, gene structure and phylogenetic construction of GRAS proteins are performed. Distribution mapping shows that GRAS proteins are nonrandomly localized in 10 chromosomes. Fifty-five orthologous gene pairs are shared by Chinese cabbage and Arabidopsis, and interaction networks of these orthologous genes are constructed. The expansion of GRAS genes in Chinese cabbage results from genome triplication. Among the 17 species examined, 14 higher plants carry the GRAS genes, whereas two lower plants and one fungi species do not. Furthermore, the expression patterns of GRAS genes exhibit differences in three tissues based on RNA-seq data. Taken together, this comprehensive analysis will provide rich resources for studying GRAS protein functions in Chinese cabbage.

  17. Saltatory evolution of the ectodermal neural cortex gene family at the vertebrate origin.

    PubMed

    Feiner, Nathalie; Murakami, Yasunori; Breithut, Lisa; Mazan, Sylvie; Meyer, Axel; Kuraku, Shigehiro

    2013-01-01

    The ectodermal neural cortex (ENC) gene family, whose members are implicated in neurogenesis, is part of the kelch repeat superfamily. To date, ENC genes have been identified only in osteichthyans, although other kelch repeat-containing genes are prevalent throughout bilaterians. The lack of elaborate molecular phylogenetic analysis with exhaustive taxon sampling has obscured the possible link of the establishment of this gene family with vertebrate novelties. In this study, we identified ENC homologs in diverse vertebrates by means of database mining and polymerase chain reaction screens. Our analysis revealed that the ENC3 ortholog was lost in the basal eutherian lineage through single-gene deletion and that the triplication between ENC1, -2, and -3 occurred early in vertebrate evolution. Including our original data on the catshark and the zebrafish, our comparison revealed high conservation of the pleiotropic expression pattern of ENC1 and shuffling of expression domains between ENC1, -2, and -3. Compared with many other gene families including developmental key regulators, the ENC gene family is unique in that conventional molecular phylogenetic inference could identify no obvious invertebrate ortholog. This suggests a composite nature of the vertebrate-specific gene repertoire, consisting not only of de novo genes introduced at the vertebrate origin but also of long-standing genes with no apparent invertebrate orthologs. Some of the latter, including the ENC gene family, may be too rapidly evolving to provide sufficient phylogenetic signals marking orthology to their invertebrate counterparts. Such gene families that experienced saltatory evolution likely remain to be explored and might also have contributed to phenotypic evolution of vertebrates.

  18. Saltatory Evolution of the Ectodermal Neural Cortex Gene Family at the Vertebrate Origin

    PubMed Central

    Feiner, Nathalie; Murakami, Yasunori; Breithut, Lisa; Mazan, Sylvie; Meyer, Axel; Kuraku, Shigehiro

    2013-01-01

    The ectodermal neural cortex (ENC) gene family, whose members are implicated in neurogenesis, is part of the kelch repeat superfamily. To date, ENC genes have been identified only in osteichthyans, although other kelch repeat-containing genes are prevalent throughout bilaterians. The lack of elaborate molecular phylogenetic analysis with exhaustive taxon sampling has obscured the possible link of the establishment of this gene family with vertebrate novelties. In this study, we identified ENC homologs in diverse vertebrates by means of database mining and polymerase chain reaction screens. Our analysis revealed that the ENC3 ortholog was lost in the basal eutherian lineage through single-gene deletion and that the triplication between ENC1, -2, and -3 occurred early in vertebrate evolution. Including our original data on the catshark and the zebrafish, our comparison revealed high conservation of the pleiotropic expression pattern of ENC1 and shuffling of expression domains between ENC1, -2, and -3. Compared with many other gene families including developmental key regulators, the ENC gene family is unique in that conventional molecular phylogenetic inference could identify no obvious invertebrate ortholog. This suggests a composite nature of the vertebrate-specific gene repertoire, consisting not only of de novo genes introduced at the vertebrate origin but also of long-standing genes with no apparent invertebrate orthologs. Some of the latter, including the ENC gene family, may be too rapidly evolving to provide sufficient phylogenetic signals marking orthology to their invertebrate counterparts. Such gene families that experienced saltatory evolution likely remain to be explored and might also have contributed to phenotypic evolution of vertebrates. PMID:23843192

  19. Global identification and expression analysis of stress-responsive genes of the Argonaute family in apple.

    PubMed

    Xu, Ruirui; Liu, Caiyun; Li, Ning; Zhang, Shizhong

    2016-12-01

    Argonaute (AGO) proteins, which are found in yeast, animals, and plants, are the core molecules of the RNA-induced silencing complex. These proteins play important roles in plant growth, development, and responses to biotic stresses. The complete analysis and classification of the AGO gene family have been recently reported in different plants. Nevertheless, systematic analysis and expression profiling of these genes have not been performed in apple (Malus domestica). Approximately 15 AGO genes were identified in the apple genome. The phylogenetic tree, chromosome location, conserved protein motifs, gene structure, and expression of the AGO gene family in apple were analyzed for gene prediction. All AGO genes were phylogenetically clustered into four groups (i.e., AGO1, AGO4, MEL1/AGO5, and ZIPPY/AGO7) with the AGO genes of Arabidopsis. These groups of the AGO gene family were statistically analyzed and compared among 31 plant species. The predicted apple AGO genes are distributed across nine chromosomes at different densities and include three segment duplications. Expression studies indicated that 15 AGO genes exhibit different expression patterns in at least one of the tissues tested. Additionally, analysis of gene expression levels indicated that the genes are mostly involved in responses to NaCl, PEG, heat, and low-temperature stresses. Hence, several candidate AGO genes are involved in different aspects of physiological and developmental processes and may play an important role in abiotic stress responses in apple. To the best of our knowledge, this study is the first to report a comprehensive analysis of the apple AGO gene family. Our results provide useful information to understand the classification and putative functions of these proteins, especially for gene members that may play important roles in abiotic stress responses in M. hupehensis.

  20. Directed actin assembly and motility.

    PubMed

    Boujemaa-Paterski, Rajaa; Galland, Rémi; Suarez, Cristian; Guérin, Christophe; Théry, Manuel; Blanchoin, Laurent

    2014-01-01

    The actin cytoskeleton is a key component of the cellular architecture. However, understanding actin organization and dynamics in vivo is a complex challenge. Reconstitution of actin structures in vitro, in simplified media, allows one to pinpoint the cellular biochemical components and their molecular interactions underlying the architecture and dynamics of the actin network. Previously, little was known about the extent to which geometrical constraints influence the dynamic ultrastructure of these networks. Therefore, in order to study the balance between biochemical and geometrical control of complex actin organization, we used the innovative methodologies of UV and laser patterning to design a wide repertoire of nucleation geometries from which we assembled branched actin networks. Using these methods, we were able to reconstitute complex actin network organizations, closely related to cellular architecture, to precisely direct and control their 3D connections. This methodology mimics the actin networks encountered in cells and can serve in the fabrication of innovative bioinspired systems.

  1. Actin, actin-related proteins and profilin in diatoms: a comparative genomic analysis.

    PubMed

    Aumeier, Charlotte; Polinski, Ellen; Menzel, Diedrik

    2015-10-01

    Diatoms are heterokont unicellular algae with a widespread distribution throughout all aquatic habitats. Research on diatoms has advanced significantly over the last decade due to available genetic transformation methods and publicly available genome databases. Yet up to now, proteins involved in the regulation of the cytoskeleton in diatoms are largely unknown. Consequently, this work focuses on actin and actin-related proteins (ARPs) encoded in the diatom genomes of Thalassiosira pseudonana, Thalassiosira oceanica, Phaeodactylum tricornutum, Fragilariopsis cylindrus and Pseudo-nitzschia multiseries. Our comparative genomic study revealed that most diatoms possess only a single conventional actin and a small set of ARPs. Among these are the highly conserved cytoplasmic Arp1 protein and the nuclear Arp4 as well as Arp6. Diatom genomes contain genes coding for two structurally different homologues of Arp4 that might serve specific functions. All diatom species examined here lack ARP2 and ARP3 proteins, suggesting that diatoms are not capable of forming the Arp2/3 complex, which is essential in most eukaryotes for actin filament branching and plus-end dynamics. Interestingly, none of the sequenced representatives of the Bacillariophyta phylum code for profilin. Profilin is an essential actin-binding protein regulating the monomer actin pool and is involved in filament plus-end dynamics. This is the first report of organisms not containing profilin.

  2. CRDB: Database of Chemosensory Receptor Gene Families in Vertebrate

    PubMed Central

    Wu, Xiaoli; Zhong, Yang

    2012-01-01

    Chemosensory receptors (CR) are crucial for animals to sense the environmental changes and survive on earth. The emergence of whole-genome sequences provides us an opportunity to identify the entire CR gene repertoires. To completely gain more insight into the evolution of CR genes in vertebrates, we identified the nearly all CR genes in 25 vertebrates using homology-based approaches. Among these CR gene repertoires, nearly half of them were identified for the first time in those previously uncharacterized species, such as the guinea pig, giant panda and elephant, etc. Consistent with previous findings, we found that the numbers of CR genes vary extensively among different species, suggesting an extreme form of ‘birth-and-death’ evolution. For the purpose of facilitating CR gene analysis, we constructed a database with the goals to provide a resource for CR genes annotation and a web tool for exploring their evolutionary patterns. Besides a search engine for the gene extraction from a specific chromosome region, an easy-to-use phylogenetic analysis tool was also provided to facilitate online phylogeny study of CR genes. Our work can provide a rigorous platform for further study on the evolution of CR genes in vertebrates. PMID:22393364

  3. Gene Structures, Evolution and Transcriptional Profiling of the WRKY Gene Family in Castor Bean (Ricinus communis L.).

    PubMed

    Zou, Zhi; Yang, Lifu; Wang, Danhua; Huang, Qixing; Mo, Yeyong; Xie, Guishui

    2016-01-01

    WRKY proteins comprise one of the largest transcription factor families in plants and form key regulators of many plant processes. This study presents the characterization of 58 WRKY genes from the castor bean (Ricinus communis L., Euphorbiaceae) genome. Compared with the automatic genome annotation, one more WRKY-encoding locus was identified and 20 out of the 57 predicted gene models were manually corrected. All RcWRKY genes were shown to contain at least one intron in their coding sequences. According to the structural features of the present WRKY domains, the identified RcWRKY genes were assigned to three previously defined groups (I-III). Although castor bean underwent no recent whole-genome duplication event like physic nut (Jatropha curcas L., Euphorbiaceae), comparative genomics analysis indicated that one gene loss, one intron loss and one recent proximal duplication occurred in the RcWRKY gene family. The expression of all 58 RcWRKY genes was supported by ESTs and/or RNA sequencing reads derived from roots, leaves, flowers, seeds and endosperms. Further global expression profiles with RNA sequencing data revealed diverse expression patterns among various tissues. Results obtained from this study not only provide valuable information for future functional analysis and utilization of the castor bean WRKY genes, but also provide a useful reference to investigate the gene family expansion and evolution in Euphorbiaceus plants.

  4. Locus for a human hereditary cataract is closely linked to the. gamma. -crystallin gene family

    SciTech Connect

    Lubsen, N.H.; Renwick, J.H.; Tsui, L.C.; Breitman, M.L.; Schoenmakers, J.G.G.

    1987-01-01

    Within the human ..gamma..-crystallin gene cluster polymorphic Taq I sites are present. These give rise to three sets of allelic fragments from the ..gamma..-crystallin genes. Together these restriction fragment length polymorphisms define eight possible haplotypes, three of which (Q, R, and S) were found in the Dutch and English population. A fourth haplotype (P) was detected within a family in which a hereditary Coppock-like cataract of the embryonic lens nucleus occurs in heterozygotes. Haplotype P was found only in family members who suffered from cataract, and all family members who suffered from cataract had haplotype P. The absolute correlation between the presence of haplotype P and cataract within this family shows that the ..gamma..-crystallin gene cluster and the locus for the Coppock-like cataract are closely linked. This linkage provides genetic evidence that the primary cause of a cataract in humans could possibly be a lesion in a crystallin gene.

  5. Gene duplication event in family 12 glycosyl hydrolase from Phytophthora spp.

    PubMed

    Costanzo, Stefano; Ospina-Giraldo, M D; Deahl, K L; Baker, C J; Jones, Richard W

    2006-10-01

    A total of 18 paralogs of xyloglucan-specific endoglucanases (EGLs) from the glycosyl hydrolase family 12 were identified and characterized in Phytophthora sojae and Phytophthora ramorum. These genes encode predicted extracellular enzymes, with sizes ranging from 189 to 435 amino acid residues, that would be capable of hydrolyzing the xyloglucan component of the host cell wall. In two cases, four and six functional copies of these genes were found in tight succession within a region of 5 and 18 kb, respectively. The overall gene copy number and relative organization appeared well conserved between P. sojae and P. ramorum, with apparent synteny in this region of their respective genomes. Phylogenetic analyses of Phytophthora endoglucanases of family 12 and other known members of EGL 12, revealed a close relatedness with a fairly conserved gene sub-family containing, among others, sequences from the fungi Emericella desertorum and Aspergillus aculeatus. This is the first report of family 12 EGLs present in plant pathogenic eukaryotes.

  6. Exclusion of known gene for enamel development in two Brazilian families with amelogenesis imperfecta.

    PubMed

    Santos, Maria C L G; Hart, P Suzanne; Ramaswami, Mukundhan; Kanno, Cláudia M; Hart, Thomas C; Line, Sergio R P

    2007-01-31

    Amelogenesis imperfecta (AI) is a genetically heterogeneous group of diseases that result in defective development of tooth enamel. Mutations in several enamel proteins and proteinases have been associated with AI. The object of this study was to evaluate evidence of etiology for the six major candidate gene loci in two Brazilian families with AI. Genomic DNA was obtained from family members and all exons and exon-intron boundaries of the ENAM, AMBN, AMELX, MMP20, KLK4 and Amelotin gene were amplified and sequenced. Each family was also evaluated for linkage to chromosome regions known to contain genes important in enamel development. The present study indicates that the AI in these two families is not caused by any of the known loci for AI or any of the major candidate genes proposed in the literature. These findings indicate extensive genetic heterogeneity for non-syndromic AI.

  7. Ultra Large Gene Families: A Matter of Adaptation or Genomic Parasites?

    PubMed Central

    Schiffer, Philipp H.; Gravemeyer, Jan; Rauscher, Martina; Wiehe, Thomas

    2016-01-01

    Gene duplication is an important mechanism of molecular evolution. It offers a fast track to modification, diversification, redundancy or rescue of gene function. However, duplication may also be neutral or (slightly) deleterious, and often ends in pseudo-geneisation. Here, we investigate the phylogenetic distribution of ultra large gene families on long and short evolutionary time scales. In particular, we focus on a family of NACHT-domain and leucine-rich-repeat-containing (NLR)-genes, which we previously found in large numbers to occupy one chromosome arm of the zebrafish genome. We were interested to see whether such a tight clustering is characteristic for ultra large gene families. Our data reconfirm that most gene family inflations are lineage-specific, but we can only identify very few gene clusters. Based on our observations we hypothesise that, beyond a certain size threshold, ultra large gene families continue to proliferate in a mechanism we term “run-away evolution”. This process might ultimately lead to the failure of genomic integrity and drive species to extinction. PMID:27509525

  8. Developmental expression of the N-myc downstream regulated gene (Ndrg) family during Xenopus tropicalis embryogenesis.

    PubMed

    Zhong, Chao; Zhou, Yan-Kuan; Yang, Shan-Shan; Zhao, Jun-Fang; Zhu, Xiao-Long; Chen, Hen-Huang; Chen, Pei-Chao; Huang, Li-Quan; Huang, Xiao

    2015-01-01

    The N-myc downstream regulated gene (Ndrg) family consists of four main members Ndrg1, 2, 3, and 4. The Ndrg genes are involved in many vital biological events including development. However, comprehensive expression patterns of this gene family during vertebrate embryogenesis remain largely unknown. Here, we analyzed the Ndrg family from the evolutionary perspective and examined the expression patterns of the Ndrg genes during Xenopus tropicalis embryogenesis. Different Ndrg family members of vertebrates are separated into different homology clusters which can be further classified into two groups and each Ndrg family member is well conserved during evolution. The temporal and spatial expression patterns of Ndrg1, 2, 3 and 4 are different during early Xenopus tropicalis development. Ndrg1, 2 and 4 are maternally expressed genes while Ndrg3 is a zygotically expressed gene. The Ndrg genes are differentially expressed in the developing central nervous system, the developing sensory organs, and the developing excretory organs. Moreover, they also show other specific expression domains. Our results indicate that the Ndrg genes exhibit specific expression patterns and may play different roles during vertebrate embryogenesis.

  9. Mouse T-cell receptor variable gene segment families

    SciTech Connect

    Arden, B.; Kabelitz, D.; Clark, S.P.; Mak, T.W.

    1995-10-01

    All mouse T-cell receptor {alpha}/{delta}, {beta}, and {gamma} variable (Tcra/d-, b-, and g-V) gene segments were aligned to compare the sequences with one another, to group them into subfamilies, and to derive a name which complies with the standard nomenclature. it was necessary to change the names of some V gene segments because they conflicted with those of other segments. The traditional classification into subfamilies was re-evaluated using a much larger pool of sequences. In the mouse, most V gene segments can be grouped into subfamilies of closely related genes with significantly less similarity between different subfamilies. 118 refs., 11 figs., 4 tabs.

  10. Amplification of actin polymerization forces

    PubMed Central

    Dmitrieff, Serge; Nédélec, François

    2016-01-01

    The actin cytoskeleton drives many essential processes in vivo, using molecular motors and actin assembly as force generators. We discuss here the propagation of forces caused by actin polymerization, highlighting simple configurations where the force developed by the network can exceed the sum of the polymerization forces from all filaments. PMID:27002174

  11. Amplification of actin polymerization forces.

    PubMed

    Dmitrieff, Serge; Nédélec, François

    2016-03-28

    The actin cytoskeleton drives many essential processes in vivo, using molecular motors and actin assembly as force generators. We discuss here the propagation of forces caused by actin polymerization, highlighting simple configurations where the force developed by the network can exceed the sum of the polymerization forces from all filaments.

  12. MS/MS networking guided analysis of molecule and gene cluster families.

    PubMed

    Nguyen, Don Duy; Wu, Cheng-Hsuan; Moree, Wilna J; Lamsa, Anne; Medema, Marnix H; Zhao, Xiling; Gavilan, Ronnie G; Aparicio, Marystella; Atencio, Librada; Jackson, Chanaye; Ballesteros, Javier; Sanchez, Joel; Watrous, Jeramie D; Phelan, Vanessa V; van de Wiel, Corine; Kersten, Roland D; Mehnaz, Samina; De Mot, René; Shank, Elizabeth A; Charusanti, Pep; Nagarajan, Harish; Duggan, Brendan M; Moore, Bradley S; Bandeira, Nuno; Palsson, Bernhard Ø; Pogliano, Kit; Gutiérrez, Marcelino; Dorrestein, Pieter C

    2013-07-09

    The ability to correlate the production of specialized metabolites to the genetic capacity of the organism that produces such molecules has become an invaluable tool in aiding the discovery of biotechnologically applicable molecules. Here, we accomplish this task by matching molecular families with gene cluster families, making these correlations to 60 microbes at one time instead of connecting one molecule to one organism at a time, such as how it is traditionally done. We can correlate these families through the use of nanospray desorption electrospray ionization MS/MS, an ambient pressure MS technique, in conjunction with MS/MS networking and peptidogenomics. We matched the molecular families of peptide natural products produced by 42 bacilli and 18 pseudomonads through the generation of amino acid sequence tags from MS/MS data of specific clusters found in the MS/MS network. These sequence tags were then linked to biosynthetic gene clusters in publicly accessible genomes, providing us with the ability to link particular molecules with the genes that produced them. As an example of its use, this approach was applied to two unsequenced Pseudoalteromonas species, leading to the discovery of the gene cluster for a molecular family, the bromoalterochromides, in the previously sequenced strain P. piscicida JCM 20779(T). The approach itself is not limited to 60 related strains, because spectral networking can be readily adopted to look at molecular family-gene cluster families of hundreds or more diverse organisms in one single MS/MS network.

  13. Mutation analysis in F9 gene of 17 families with haemophilia B from Iran.

    PubMed

    Enayat, M S; Karimi, M; Chana, G; Farjadian, S; Theophilus, B D M; Hill, F G H

    2004-11-01

    Seventeen haemophilia B families from Iran were investigated to determine the causative mutation. All the essential regions of the F9 gene were initially screened by conformational sensitive gel electrophoresis and exons with band shift were sequenced. Seven of the 15 mutations identified in these families were novel mutations. The mutations were authenticated in nine families as other affected members or heterozygous female carriers were available for verification.

  14. Cognitive Functioning in Affected Sibling Pairs with ADHD: Familial Clustering and Dopamine Genes

    ERIC Educational Resources Information Center

    Loo, Sandra K.; Rich, Erika Carpenter; Ishii, Janeen; McGough, James; McCracken, James; Nelson, Stanley; Smalley, Susan L.

    2008-01-01

    Background: This paper examines familiality and candidate gene associations of cognitive measures as potential endophenotypes in attention-deficit/hyperactivity disorder (ADHD). Methods: The sample consists of 540 participants, aged 6 to 18, who were diagnosed with ADHD from 251 families recruited for a larger genetic study of ADHD. All members of…

  15. Actinic keratosis. Current treatment options.

    PubMed

    Jeffes, E W; Tang, E H

    2000-01-01

    Actinic keratoses are hyperkeratotic skin lesions that represent focal abnormal proliferation of epidermal keratinocytes. Some actinic keratoses evolve into squamous cell carcinoma of the skin, while others resolve spontaneously. The conversion rate of actinic keratosis to squamous cell carcinoma is not accurately known, but appears to be in the range of 0.25 to 1% per year. Although there is a low rate of conversion of actinic keratoses to squamous cell carcinoma, 60% of squamous cell carcinomas of the skin probably arise from actinic keratoses. The main cause of actinic keratoses in otherwise healthy Caucasians appears to be the sun. Therapy for actinic keratoses begins with prevention which starts with sun avoidance and physical protection. Sunprotection with sunscreens actually slows the return of actinic keratoses in patients already getting actinic keratoses. Interestingly, a few studies are available that demonstrate that a high fat diet is associated with the production of more actinic keratoses than is a low fat diet. One of the mainstays of therapy has been local destruction of the actinic keratoses with cryotherapy, and curettage and electrodesiccation. A new addition to this group of therapies to treat individual actinic keratoses is photodynamic therapy with topical aminolevulinic acid and light. In patients who have numerous actinic keratoses in an area of severely sun damaged skin, therapies which are applied to the whole actinic keratosis area are used. The goal of treating such an area of skin is to treat all of the early as well as the numerous clinically evident actinic keratoses at the same time. The classical approaches for treating areas of photodamaged skin without treating actinic keratoses individually include: the use of topically applied fluorouracil cream, dermabrasion, and cutaneous peels with various agents like trichloroacetic acid. Both topically as well as orally administered retinoids have been used to treat actinic keratoses but

  16. Familial visceral myopathy diagnosed by exome sequencing of a patient with chronic intestinal pseudo-obstruction.

    PubMed

    Holla, Oystein L; Bock, Gunter; Busk, Oyvind L; Isfoss, Björn Logi

    2014-06-01

    A 55-year-old woman with a history of bowel dysmotility presented with abdominal distension and peritonitis. Family history included premature deaths with intestinal symptomatology, suggesting autosomal dominant inheritance. Computed tomography showed a distended small bowel. Symptoms were alleviated by enterocutaneous stomas. Initial ileal biopsy suggested neuropathy; however, exome sequencing revealed an Arg148Ser mutation in the enteric smooth muscle actin gamma 2 (ACTG2) gene. Histological reassessment showed abnormal muscularis propria and smooth muscle actin, with the same findings in sibling, confirming familial visceral myopathy. Thus, noninvasive genomic analysis can provide early and specific diagnosis of familial visceral myopathy, which may help to avoid inappropriate surgery.

  17. Genome-wide analysis of the MADS-box gene family in Brachypodium distachyon.

    PubMed

    Wei, Bo; Zhang, Rong-Zhi; Guo, Juan-Juan; Liu, Dan-Mei; Li, Ai-Li; Fan, Ren-Chun; Mao, Long; Zhang, Xiang-Qi

    2014-01-01

    MADS-box genes are important transcription factors for plant development, especially floral organogenesis. Brachypodium distachyon is a model for biofuel plants and temperate grasses such as wheat and barley, but a comprehensive analysis of MADS-box family proteins in Brachypodium is still missing. We report here a genome-wide analysis of the MADS-box gene family in Brachypodium distachyon. We identified 57 MADS-box genes and classified them into 32 MIKC(c)-type, 7 MIKC*-type, 9 Mα, 7 Mβ and 2 Mγ MADS-box genes according to their phylogenetic relationships to the Arabidopsis and rice MADS-box genes. Detailed gene structure and motif distribution were then studied. Investigation of their chromosomal localizations revealed that Brachypodium MADS-box genes distributed evenly across five chromosomes. In addition, five pairs of type II MADS-box genes were found on synteny blocks derived from whole genome duplication blocks. We then performed a systematic expression analysis of Brachypodium MADS-box genes in various tissues, particular floral organs. Further detection under salt, drought, and low-temperature conditions showed that some MADS-box genes may also be involved in abiotic stress responses, including type I genes. Comparative studies of MADS-box genes among Brachypodium, rice and Arabidopsis showed that Brachypodium had fewer gene duplication events. Taken together, this work provides useful data for further functional studies of MADS-box genes in Brachypodium distachyon.

  18. The ALP-Enigma protein ALP-1 functions in actin filament organization to promote muscle structural integrity in Caenorhabditis elegans.

    PubMed

    Han, Hsiao-Fen; Beckerle, Mary C

    2009-05-01

    Mutations that affect the Z-disk-associated ALP-Enigma proteins have been linked to human muscular and cardiac diseases. Despite their clear physiological significance for human health, the mechanism of action of ALP-Enigma proteins is largely unknown. In Caenorhabditis elegans, the ALP-Enigma protein family is encoded by a single gene, alp-1; thus C. elegans provides an excellent model to study ALP-Enigma function. Here we present a molecular and genetic analysis of ALP-Enigma function in C. elegans. We show that ALP-1 and alpha-actinin colocalize at dense bodies where actin filaments are anchored and that the proper localization of ALP-1 at dense bodies is dependent on alpha-actinin. Our analysis of alp-1 mutants demonstrates that ALP-1 functions to maintain actin filament organization and participates in muscle stabilization during contraction. Reducing alpha-actinin activity enhances the actin filament phenotype of the alp-1 mutants, suggesting that ALP-1 and alpha-actinin function in the same cellular process. Like alpha-actinin, alp-1 also interacts genetically with a connectin/titin family member, ketn-1, to provide mechanical stability for supporting body wall muscle contraction. Taken together, our data demonstrate that ALP-1 and alpha-actinin function together to stabilize actin filaments and promote muscle structural integrity.

  19. Mutational analysis of PKD1 gene in a Chinese family with autosomal dominant polycystic kidney disease

    PubMed Central

    Liu, Jingyan; Li, Lanrong; Liu, Qingmin

    2015-01-01

    Autosomal dominant polycystic kidney disease (ADPKD) is a hereditary disease and common renal disease. Mutations of PKD genes are responsible for this disease. We analyzed a large Chinese family with ADPKD using Sanger sequencing to identify the mutation responsible for this disease. The family comprised 27 individuals including 10 ADPKD patients. These ADPKD patients had severe renal disease and most of them died very young. We analyzed 6 survival patients gene and found they all had C10529T mutation in exon 35 of PKD1 gene. We did not found gene mutation in any unaffected relatives or 300 unrelated controls. These findings suggested that the C10529T mutation in PKD1 gene might be the pathogenic mutation responsible for the disease in this family. PMID:26722532

  20. Genome-wide analysis of Aux/IAA and ARF gene families in Populus trichocarpa

    SciTech Connect

    Kalluri, Udaya C; DiFazio, Stephen P; Brunner, A.; Tuskan, Gerald A

    2007-01-01

    Auxin/Indole-3-Acetic Acid (Aux/IAA) and Auxin Response Factor (ARF) transcription factors are key regulators of auxin responses in plants. A total of 35 Aux/IAA and 39 ARF genes were identified in the Populus genome. Comparative phylogenetic analysis revealed that the subgroups PoptrARF2, 6, 9 and 16 and PoptrIAA3, 16, 27 and 29 have differentially expanded in Populus relative to Arabidopsis. Activator ARFs were found to be two fold-overrepresented in the Populus genome. PoptrIAA and PoptrARF gene families appear to have expanded due to high segmental and low tandem duplication events. Furthermore, expression studies showed that genes in the expanded PoptrIAA3 subgroup display differential expression. The gene-family analysis reported here will be useful in conducting future functional genomics studies to understand how the molecular roles of these large gene families translate into a diversity of biologically meaningful auxin effects.

  1. Mutational analysis of PKD1 gene in a Chinese family with autosomal dominant polycystic kidney disease.

    PubMed

    Liu, Jingyan; Li, Lanrong; Liu, Qingmin

    2015-01-01

    Autosomal dominant polycystic kidney disease (ADPKD) is a hereditary disease and common renal disease. Mutations of PKD genes are responsible for this disease. We analyzed a large Chinese family with ADPKD using Sanger sequencing to identify the mutation responsible for this disease. The family comprised 27 individuals including 10 ADPKD patients. These ADPKD patients had severe renal disease and most of them died very young. We analyzed 6 survival patients gene and found they all had C10529T mutation in exon 35 of PKD1 gene. We did not found gene mutation in any unaffected relatives or 300 unrelated controls. These findings suggested that the C10529T mutation in PKD1 gene might be the pathogenic mutation responsible for the disease in this family.

  2. Molecular Evolution and Expression Divergence of the Aconitase (ACO) Gene Family in Land Plants

    PubMed Central

    Wang, Yi-Ming; Yang, Qi; Liu, Yan-Jing; Yang, Hai-Ling

    2016-01-01

    Aconitase (ACO) is a key enzyme that catalyzes the isomerization of citrate to isocitrate in the tricarboxylic acid (TCA) and glyoxylate cycles. The function of ACOs has been well studied in model plants, such as Arabidopsis. In contrast, the evolutionary patterns of the ACO family in land plants are poorly understood. In this study, we systematically examined the molecular evolution and expression divergence of the ACO gene family in 12 land plant species. Thirty-six ACO genes were identified from the 12 land plant species representing the four major land plant lineages: Bryophytes, lycophytes, gymnosperms, and angiosperms. All of these ACOs belong to the cytosolic isoform. Three gene duplication events contributed to the expansion of the ACO family in angiosperms. The ancestor of angiosperms may have contained only one ACO gene. One gene duplication event split angiosperm ACOs into two distinct clades. Two clades showed a divergence in selective pressure and gene expression patterns. The cis-acting elements that function in light responsiveness were most abundant in the promoter region of the ACO genes, indicating that plant ACO genes might participate in light regulatory pathways. Our findings provide comprehensive insights into the ACO gene family in land plants. PMID:28018410

  3. Genome-wide identification, characterization, and expression analysis of the MLO gene family in Cucumis sativus.

    PubMed

    Zhou, S J; Jing, Z; Shi, J L

    2013-12-11

    Mildew resistance locus o (MLO) is a plant-specific seven-transmembrane (TM) gene family. Several studies have revealed that certain members of the MLO gene family mediate powdery mildew susceptibility in three plant species, namely, Arabidopsis, barley, and tomato. The sequenced cucumber genome provides an opportunity to conduct a comprehensive overview of the MLO gene family. Fourteen genes (designated CsMLO01 through CsMLO14) have been identified within the Cucumis sativus genome by using an in silico cloning method with the MLO amino acid sequences of Arabidopsis thaliana and rice as probes. Sequence alignment revealed that numerous features of the gene family, such as TMs, a calmodulin-binding domain, peptide domains I and II, and 30 important amino acid residues for MLO function, are well conserved. Phylogenetic analysis of the MLO genes from cucumber and other plant species reveals seven different clades (I through VII). Three of these clades comprised MLO genes from A. thaliana, rice, maize, and cucumber, suggesting that these genes may have evolved after the divergence of monocots and dicots. In silico mapping showed that these CsMLOs were located on chromosomes 1, 2, 3, 4, 5, and 6 without any obvious clustering, except CsMLO01. To our knowledge, this paper is the first comprehensive report on MLO genes in C. sativus. These findings will facilitate the functional characterization of the MLOs related to powdery mildew susceptibility and assist in the development of disease resistance in cucumber.

  4. Structure of the omega-gliadin gene family

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The '-gliadins are one of the classes of wheat seed storage proteins, but are the least characterized. In this report, an analysis is made of all available '-gliadin DNA sequences including '-gliadins genes within a large genomic clone, previously reported gene sequences, and ESTs identified from th...

  5. Gene-Environment Interplay, Family Relationships, and Child Adjustment

    ERIC Educational Resources Information Center

    Horwitz, Briana N.; Neiderhiser, Jenae M.

    2011-01-01

    This paper reviews behavioral genetic research from the past decade that has moved beyond simply studying the independent influences of genes and environments. The studies considered in this review have instead focused on understanding gene-environment interplay, including genotype-environment correlation (rGE) and genotype x environment…

  6. Characterization and Functional Analysis of PEBP Family Genes in Upland Cotton (Gossypium hirsutum L.)

    PubMed Central

    Wang, Congcong; Pang, Chaoyou; Wei, Hengling; Wang, Hantao; Song, Meizhen; Fan, Shuli; Yu, Shuxun

    2016-01-01

    Upland cotton (Gossypium hirsutum L.) is a naturally occurring photoperiod-sensitive perennial plant species. However, sensitivity to the day length was lost during domestication. The phosphatidylethanolamine-binding protein (PEBP) gene family, of which three subclades have been identified in angiosperms, functions to promote and suppress flowering in photoperiod pathway. Recent evidence indicates that PEBP family genes play an important role in generating mobile flowering signals. We isolated homologues of the PEBP gene family in upland cotton and examined their regulation and function. Nine PEBP-like genes were cloned and phylogenetic analysis indicated the genes belonged to four subclades (FT, MFT, TFL1 and PEBP). Cotton PEBP-like genes showed distinct expression patterns in relation to different cotton genotypes, photoperiod responsive and cultivar maturity. The GhFT gene expression of a semi-wild race of upland cotton were strongly induced under short day condition, whereas the GhPEBP2 gene expression was induced under long days. We also elucidated that GhFT but not GhPEBP2 interacted with FD-like bZIP transcription factor GhFD and promote flowering under both long- and short-day conditions. The present result indicated that GhPEBP-like genes may perform different functions. This work corroborates the involvement of PEBP-like genes in photoperiod response and regulation of flowering time in different cotton genotypes, and contributes to an improved understanding of the function of PEBP-like genes in cotton. PMID:27552108

  7. Disease causing mutations of troponin alter regulated actin state distributions.

    PubMed

    Chalovich, Joseph M

    2012-12-01

    Striated muscle contraction is regulated primarily through the action of tropomyosin and troponin that are bound to actin. Activation requires Ca(2+) binding to troponin and/or binding of high affinity myosin complexes to actin. Mutations within components of the regulatory complex may lead to familial cardiomyopathies and myopathies. In several cases examined, either physiological or pathological changes in troponin alter the distribution among states of actin-tropomyosin-troponin that differ in their abilities to stimulate myosin ATPase activity. These observations open possibilities for managing disorders of the troponin complex. Furthermore, analyses of mutant forms of troponin give insights into the regulation of striated muscle contraction.

  8. The Saccharomyces cerevisiae actin-related protein Arp2 is involved in the actin cytoskeleton

    PubMed Central

    1996-01-01

    Arp2p is an essential yeast actin-related protein. Disruption of the corresponding ARP2 gene leads to a terminal phenotype characterized by the presence of a single large bud. Thus, Arp2p may be important for a late stage of the cell cycle (Schwob, E., and R.P. Martin, 1992. Nature (Lond.). 355:179-182). We have localized Arp2p by indirect immunofluorescence. Specific peptide antibodies revealed punctate staining under the plasma membrane, which partially colocalizes with actin. Temperature-sensitive arp2 mutations were created by PCR mutagenesis and selected by an ade2/SUP11 sectoring screen. One temperature-sensitive mutant that was characterized, arp2-H330L, was osmosensitive and had an altered actin cytoskeleton at a nonpermissive temperature, suggesting a role of Arp2p in the actin cytoskeleton. Random budding patterns were observed in both haploid and diploid arp2- H330L mutant cells. Endocytosis, as judged by Lucifer yellow uptake, was severely reduced in the mutant, at all temperatures. In addition, genetic interaction was observed between temperature-sensitive alleles arp2-H330L and cdc10-1. CDC10 is a gene encoding a neck filament- associated protein that is necessary for polarized growth and cytokinesis. Overall, the immunolocalization, mutant phenotypes, and genetic interaction suggest that the Arp2 protein is an essential component of the actin cytoskeleton that is involved in membrane growth and polarity, as well as in endocytosis. PMID:8698808

  9. Familial migraine: Exclusion of the susceptibility gene from the reported locus of familial hemiplegic migraine on 19p

    SciTech Connect

    Hovatta, I.; Peltonen, L.; Kallela, M.; Faerkkilae, M.

    1994-10-01

    Genetic isolates are highly useful in analyses of the molecular background of complex diseases since the enrichment of a limited number of predisposing genes can be predicted in representative families or in specific geographical regions. It has been suggested that the pathophysiology and etiology of familial hemiplegic migraine (FHM) and typical migraine with aura are most probably the same. Recent assignment of FHM locus to chromosome 19p in two French families makes it now possible to test this hypothesis. We report here linkage data on four families with multiple cases of migraine disorder originating from the genetically isolated population of Finland. We were interested to discover whether the migraine in these families would also show linkage to the markers on 19p. We could exclude a region of 50 cM, flanking the reported FHM locus, as a site of migraine locus in our four families. It seems evident that locus heterogeneity exists between different diagnostic classes of migraine spectrum of diseases and also between different ethnic groups. 10 refs., 2 figs., 1 tab.

  10. A new member of the plasma protease inhibitor gene family.

    PubMed Central

    Ragg, H

    1986-01-01

    A 2.1-kb cDNA clone representing a new member of the protease inhibitor family was isolated from a human liver cDNA library. The inhibitor, named human Leuserpin 2 (hLS2), comprises 480 amino acids and contains a leucine residue at its putative reactive center. HLS2 is about 25-28% homologous to three human members of the plasma protease inhibitor family: antithrombin III, alpha 1-antitrypsin and alpha 1-antichymotrypsin. A comparison with published partial amino acid sequences shows that hLS2 is closely related to the thrombin inhibitor heparin cofactor II. Images PMID:3003690

  11. Duplication of OsHAP family genes and their association with heading date in rice.

    PubMed

    Li, Qiuping; Yan, Wenhao; Chen, Huaxia; Tan, Cong; Han, Zhongmin; Yao, Wen; Li, Guangwei; Yuan, Mengqi; Xing, Yongzhong

    2016-03-01

    Heterotrimeric Heme Activator Protein (HAP) family genes are involved in the regulation of flowering in plants. It is not clear how many HAP genes regulate heading date in rice. In this study, we identified 35 HAP genes, including seven newly identified genes, and performed gene duplication and candidate gene-based association analyses. Analyses showed that segmental duplication and tandem duplication are the main mechanisms of HAP gene duplication. Expression profiling and functional identification indicated that duplication probably diversifies the functions of HAP genes. A nucleotide diversity analysis revealed that 13 HAP genes underwent selection. A candidate gene-based association analysis detected four HAP genes related to heading date. An investigation of transgenic plants or mutants of 23 HAP genes confirmed that overexpression of at least four genes delayed heading date under long-day conditions, including the previously cloned Ghd8/OsHAP3H. Our results indicate that the large number of HAP genes in rice was mainly produced by gene duplication, and a few HAP genes function to regulate heading date. Selection of HAP genes is probably caused by their diverse functions rather than regulation of heading.

  12. Evolutionary Dynamics of the Interferon-Induced Transmembrane Gene Family in Vertebrates

    PubMed Central

    Zhang, Zhao; Liu, Jun; Li, Meng; Yang, Hui; Zhang, Chiyu

    2012-01-01

    Vertebrate interferon-induced transmembrane (IFITM) genes have been demonstrated to have extensive and diverse functions, playing important roles in the evolution of vertebrates. Despite observance of their functionality, the evolutionary dynamics of this gene family are complex and currently unknown. Here, we performed detailed evolutionary analyses to unravel the evolutionary history of the vertebrate IFITM family. A total of 174 IFITM orthologous genes and 112 pseudogenes were identified from 27 vertebrate genome sequences. The vertebrate IFITM family can be divided into immunity-related IFITM (IR-IFITM), IFITM5 and IFITM10 sub-families in phylogeny, implying origins from three different progenitors. In general, vertebrate IFITM genes are located in two loci, one containing the IFITM10 gene, and the other locus containing IFITM5 and various numbers of IR-IFITM genes. Conservation of evolutionary synteny was observed in these IFITM genes. Significant functional divergence was detected among the three IFITM sub-families. No gene duplication or positive selection was found in IFITM5 sub-family, implying the functional conservation of IFITM5 in vertebrate evolution, which is involved in bone formation. No IFITM5 locus was identified in the marmoset genome, suggesting a potential association with the tiny size of this monkey. The IFITM10 sub-family was divided into two groups: aquatic and terrestrial types. Functional divergence was detected between the two groups, and five IFITM10-like genes from frog were dispersed into the two groups. Both gene duplication and positive selection were observed in aquatic vertebrate IFITM10-like genes, indicating that IFITM10 might be associated with the adaptation to aquatic environments. A large number of lineage- and species-specific gene duplications were observed in IR-IFITM sub-family and positive selection was detected in IR-IFITM of primates and rodents. Because primates have experienced a long history of viral infection

  13. Natural Killer Cell Receptor Genes in the Family Equidae: Not only Ly49

    PubMed Central

    Futas, Jan; Horin, Petr

    2013-01-01

    Natural killer (NK) cells have important functions in immunity. NK recognition in mammals can be mediated through killer cell immunoglobulin-like receptors (KIR) and/or killer cell lectin-like Ly49 receptors. Genes encoding highly variable NK cell receptors (NKR) represent rapidly evolving genomic regions. No single conservative model of NKR genes was observed in mammals. Single-copy low polymorphic NKR genes present in one mammalian species may expand into highly polymorphic multigene families in other species. In contrast to other non-rodent mammals, multiple Ly49-like genes appear to exist in the horse, while no functional KIR genes were observed in this species. In this study, Ly49 and KIR were sought and their evolution was characterized in the entire family Equidae. Genomic sequences retrieved showed the presence of at least five highly conserved polymorphic Ly49 genes in horses, asses and zebras. These findings confirmed that the expansion of Ly49 occurred in the entire family. Several KIR-like sequences were also identified in the genome of Equids. Besides a previously identified non-functional KIR-Immunoglobulin-like transcript fusion gene (KIR-ILTA) and two putative pseudogenes, a KIR3DL-like sequence was analyzed. In contrast to previous observations made in the horse, the KIR3DL sequence, genomic organization and mRNA expression suggest that all Equids might produce a functional KIR receptor protein molecule with a single non-mutated immune tyrosine-based inhibition motif (ITIM) domain. No evidence for positive selection in the KIR3DL gene was found. Phylogenetic analysis including rhinoceros and tapir genomic DNA and deduced amino acid KIR-related sequences showed differences between families and even between species within the order Perissodactyla. The results suggest that the order Perissodactyla and its family Equidae with expanded Ly49 genes and with a potentially functional KIR gene may represent an interesting model for evolutionary biology of

  14. Natural killer cell receptor genes in the family Equidae: not only Ly49.

    PubMed

    Futas, Jan; Horin, Petr

    2013-01-01

    Natural killer (NK) cells have important functions in immunity. NK recognition in mammals can be mediated through killer cell immunoglobulin-like receptors (KIR) and/or killer cell lectin-like Ly49 receptors. Genes encoding highly variable NK cell receptors (NKR) represent rapidly evolving genomic regions. No single conservative model of NKR genes was observed in mammals. Single-copy low polymorphic NKR genes present in one mammalian species may expand into highly polymorphic multigene families in other species. In contrast to other non-rodent mammals, multiple Ly49-like genes appear to exist in the horse, while no functional KIR genes were observed in this species. In this study, Ly49 and KIR were sought and their evolution was characterized in the entire family Equidae. Genomic sequences retrieved showed the presence of at least five highly conserved polymorphic Ly49 genes in horses, asses and zebras. These findings confirmed that the expansion of Ly49 occurred in the entire family. Several KIR-like sequences were also identified in the genome of Equids. Besides a previously identified non-functional KIR-Immunoglobulin-like transcript fusion gene (KIR-ILTA) and two putative pseudogenes, a KIR3DL-like sequence was analyzed. In contrast to previous observations made in the horse, the KIR3DL sequence, genomic organization and mRNA expression suggest that all Equids might produce a functional KIR receptor protein molecule with a single non-mutated immune tyrosine-based inhibition motif (ITIM) domain. No evidence for positive selection in the KIR3DL gene was found. Phylogenetic analysis including rhinoceros and tapir genomic DNA and deduced amino acid KIR-related sequences showed differences between families and even between species within the order Perissodactyla. The results suggest that the order Perissodactyla and its family Equidae with expanded Ly49 genes and with a potentially functional KIR gene may represent an interesting model for evolutionary biology of

  15. Genome-Wide Identification and Analysis of the TIFY Gene Family in Grape

    PubMed Central

    Zhang, Yucheng; Gao, Min; Singer, Stacy D.; Fei, Zhangjun; Wang, Hua; Wang, Xiping

    2012-01-01

    Background The TIFY gene family constitutes a plant-specific group of genes with a broad range of functions. This family encodes four subfamilies of proteins, including ZML, TIFY, PPD and JASMONATE ZIM-Domain (JAZ) proteins. JAZ proteins are targets of the SCFCOI1 complex, and function as negative regulators in the JA signaling pathway. Recently, it has been reported in both Arabidopsis and rice that TIFY genes, and especially JAZ genes, may be involved in plant defense against insect feeding, wounding, pathogens and abiotic stresses. Nonetheless, knowledge concerning the specific expression patterns and evolutionary history of plant TIFY family members is limited, especially in a woody species such as grape. Methodology/Principal Findings A total of two TIFY, four ZML, two PPD and 11 JAZ genes were identified in the Vitis vinifera genome. Phylogenetic analysis of TIFY protein sequences from grape, Arabidopsis and rice indicated that the grape TIFY proteins are more closely related to those of Arabidopsis than those of rice. Both segmental and tandem duplication events have been major contributors to the expansion of the grape TIFY family. In addition, synteny analysis between grape and Arabidopsis demonstrated that homologues of several grape TIFY genes were found in the corresponding syntenic blocks of Arabidopsis, suggesting that these genes arose before the divergence of lineages that led to grape and Arabidopsis. Analyses of microarray and quantitative real-time RT-PCR expression data revealed that grape TIFY genes are not a major player in the defense against biotrophic pathogens or viruses. However, many of these genes were responsive to JA and ABA, but not SA or ET. Conclusion The genome-wide identification, evolutionary and expression analyses of grape TIFY genes should facilitate further research of this gene family and provide new insights regarding their evolutionary history and regulatory control. PMID:22984514

  16. Variation in the nucleotide sequence of a prolamin gene family in wild rice.

    PubMed

    Barbier, P; Ishihama, A

    1990-07-01

    Variation in the DNA sequence of the 10 kDa prolamin gene family within the wild rice species Oryza rufipogon was probed using the direct sequencing of PCR-amplified genes. A comparison of the nucleotide and deduced amino-acid sequences of eight Asian strains of O. rufipogon and one strain of the related African species O. longistaminata is presented.

  17. Genome-wide identification and phylogenetic analysis of the SBP-box gene family in melons.

    PubMed

    Ma, Y; Guo, J W; Bade, R; Men, Z H; Hasi, A

    2014-10-27

    The SBP-box gene family is specific to plants and encodes a class of zinc finger-containing transcription factors with a broad range of functions. Although SBP-box genes have been identified in numerous plants, including green algae, moss, silver birch, snapdragon, Arabidopsis, rice, and maize, there is little information concerning SBP-box genes, or the corresponding miR156/157, function in melon. Using the highly conserved sequence of the Arabidopsis thaliana SBP-box domain protein as a probe of information sequence, the genome-wide protein database of melon was explored to obtain 13 SBP-box protein sequences, which were further divided into 4 groups, based on phylogenetic analysis. A further analysis centered on the melon SBP-box genetic family's phylogenetic evolution, sequence similarities, gene structure, and miR156 target sequence was also conducted. Analysis of all the expression patterns of melon SBP-box family genes showed that the SBP-box genes were detected in 7 kinds of tissue, and fruit had the highest expression level. CmSBP11 tends to present its specific expression in melon fruit and root. CmSBP09 expression was the highest in flower. Overall, the molecular evolution and expression pattern of the melon SBP-box gene family, revealed by these results, suggest its function differentiation that followed gene duplication.

  18. Cloning and expression analysis of novel Aux/IAA family genes in Gossypium hirsutum

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Members of the auxin/indole-3-acetic acid (Aux/IAA) gene family encode proteins to mediate the responses of auxin gene expression and to regulate various aspects of plant morphological development. In this paper, we report the identification of nine cDNAs that contain complete open reading frame (OR...

  19. Comparative Genome-Wide Analysis of the Malate Dehydrogenase Gene Families in Cotton

    PubMed Central

    Imran, Muhammad; Tang, Kai; Liu, Jin-Yuan

    2016-01-01

    Malate dehydrogenases (MDHs) play crucial roles in the physiological processes of plant growth and development. In this study, 13 and 25 MDH genes were identified from Gossypium raimondii and Gossypium hirsutum, respectively. Using these and 13 previously reported Gossypium arboretum MDH genes, a comparative molecular analysis between identified MDH genes from G. raimondii, G. hirsutum, and G. arboretum was performed. Based on multiple sequence alignments, cotton MDHs were divided into five subgroups: mitochondrial MDH, peroxisomal MDH, plastidial MDH, chloroplastic MDH and cytoplasmic MDH. Almost all of the MDHs within the same subgroup shared similar gene structure, amino acid sequence, and conserved motifs in their functional domains. An analysis of chromosomal localization suggested that segmental duplication played a major role in the expansion of cotton MDH gene families. Additionally, a selective pressure analysis indicated that purifying selection acted as a vital force in the evolution of MDH gene families in cotton. Meanwhile, an expression analysis showed the distinct expression profiles of GhMDHs in different vegetative tissues and at different fiber developmental stages, suggesting the functional diversification of these genes in cotton growth and fiber development. Finally, a promoter analysis indicated redundant but typical cis-regulatory elements for the potential functions and stress activity of many MDH genes. This study provides fundamental information for a better understanding of cotton MDH gene families and aids in functional analyses of the MDH genes in cotton fiber development. PMID:27829020

  20. Evolution of the insect desaturase gene family with an emphasis on social Hymenoptera.

    PubMed

    Helmkampf, Martin; Cash, Elizabeth; Gadau, Jürgen

    2015-02-01

    Desaturase genes are essential for biological processes, including lipid metabolism, cell signaling, and membrane fluidity regulation. Insect desaturases are particularly interesting for their role in chemical communication, and potential contribution to speciation, symbioses, and sociality. Here, we describe the acyl-CoA desaturase gene families of 15 insects, with a focus on social Hymenoptera. Phylogenetic reconstruction revealed that the insect desaturases represent an ancient gene family characterized by eight subfamilies that differ strongly in their degree of conservation and frequency of gene gain and loss. Analyses of genomic organization showed that five of these subfamilies are represented in a highly microsyntenic region conserved across holometabolous insect taxa, indicating an ancestral expansion during early insect evolution. In three subfamilies, ants exhibit particularly large expansions of genes. Despite these expansions, however, selection analyses showed that desaturase genes in all insect lineages are predominantly undergoing strong purifying selection. Finally, for three expanded subfamilies, we show that ants exhibit variation in gene expression between species, and more importantly, between sexes and castes within species. This suggests functional differentiation of these genes and a role in the regulation of reproductive division of labor in ants. The dynamic pattern of gene gain and loss of acyl-CoA desaturases in ants may reflect changes in response to ecological diversification and an increased demand for chemical signal variability. This may provide an example of how gene family expansions can contribute to lineage-specific adaptations through structural and regulatory changes acting in concert to produce new adaptive phenotypes.

  1. The Classical Arabinogalactan Protein Gene Family of Arabidopsis

    PubMed Central

    Schultz, Carolyn J.; Johnson, Kim L.; Currie, Graeme; Bacic, Antony

    2000-01-01

    Arabinogalactan proteins (AGPs) are extracellular proteoglycans implicated in plant growth and development. We searched for classical AGPs in Arabidopsis by identifying expressed sequence tags based on the conserved domain structure of the predicted protein backbone. To confirm that these genes encoded bona fide AGPs, we purified native AGPs and then deglycosylated and deblocked them for N-terminal protein sequencing. In total, we identified 15 genes encoding the protein backbones of classical AGPs, including genes for AG peptides—AGPs with very short backbones (10 to 13 amino acid residues). Seven of the AGPs were verified as AGPs by protein sequencing. A gene encoding a putative cell adhesion molecule with AGP-like domains was also identified. This work provides a firm foundation for beginning functional analysis by using a genetic approach. PMID:11006345

  2. G-actin guides p53 nuclear transport: potential contribution of monomeric actin in altered localization of mutant p53

    PubMed Central

    Saha, Taniya; Guha, Deblina; Manna, Argha; Panda, Abir Kumar; Bhat, Jyotsna; Chatterjee, Subhrangsu; Sa, Gaurisankar

    2016-01-01

    p53 preserves genomic integrity by restricting anomaly at the gene level. Till date, limited information is available for cytosol to nuclear shuttling of p53; except microtubule-based trafficking route, which utilizes minus-end directed motor dynein. The present study suggests that monomeric actin (G-actin) guides p53 traffic towards the nucleus. Histidine-tag pull-down assay using purified p53(1–393)-His and G-actin confirms direct physical association between p53 and monomeric G-actin. Co-immunoprecipitation data supports the same. Confocal imaging explores intense perinuclear colocalization between p53 and G-actin. To address atomistic details of the complex, constraint-based docked model of p53:G-actin complex was generated based on crystal structures. MD simulation reveals that p53 DNA-binding domain arrests very well the G-actin protein. Docking benchmark studies have been carried out for a known crystal structure, 1YCS (complex between p53DBD and BP2), which validates the docking protocol we adopted. Co-immunoprecipitation study using “hot-spot” p53 mutants suggested reduced G-actin association with cancer-associated p53 conformational mutants (R175H and R249S). Considering these findings, we hypothesized that point mutation in p53 structure, which diminishes p53:G-actin complexation results in mutant p53 altered subcellular localization. Our model suggests p53Arg249 form polar-contact with Arg357 of G-actin, which upon mutation, destabilizes p53:G-actin interaction and results in cytoplasmic retention of p53R249S. PMID:27601274

  3. Interferon induced IFIT family genes in host antiviral defense

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Secretion of interferons (IFNs) from virus-infected cells is a hallmark of host antiviral immunity and in fact, IFNs exert their antiviral activities through the induction of antiviral proteins. The IFN-induced protein with tetratricopeptide repeats (IFITs) family is among hundreds of IF stimulated ...

  4. The Wall-associated Kinase gene family in rice genomes.

    PubMed

    de Oliveira, Luiz Felipe Valter; Christoff, Ana Paula; de Lima, Júlio Cesar; de Ross, Bruno Comparsi Feijó; Sachetto-Martins, Gilberto; Margis-Pinheiro, Marcia; Margis, Rogerio

    2014-12-01

    The environment is a dynamic system in which life forms adapt. Wall-Associated Kinases (WAK) are a subfamily of receptor-like kinases associated with the cell wall. These genes have been suggested as sensors of the extracellular environment and triggers of intracellular signals. They belong to the ePK superfamily with or without a conserved arginine before the catalytic subdomain VIB, which characterizes RD and non-RD WAKs. WAK is a large subfamily in rice. We performed an extensive comparison of WAK genes from A. thaliana (AtWAK), O. sativa japonica and indica subspecies (OsWAK). Phylogenetic studies and WAK domain characterization allowed for the identification of two distinct groups of WAK genes in Arabidopsis and rice. One group corresponds to a cluster containing only OsWAKs that most likely expanded after the monocot-dicot separation, which evolved into a non-RD kinase class. The other group comprises classical RD-kinases with both AtWAK and OsWAK representatives. Clusterization analysis using extracellular and kinase domains demonstrated putative functional redundancy for some genes, but also highlighted genes that could recognize similar extracellular stimuli and activate different cascades. The gene expression pattern of WAKs in response to cold suggests differences in the regulation of the OsWAK genes in the indica and japonica subspecies. Our results also confirm the hypothesis of functional diversification between A. thaliana and O. sativa WAK genes. Furthermore, we propose that plant WAKs constitute two evolutionarily related but independent subfamilies: WAK-RD and WAK-nonRD. Recognition of this structural division will further provide insights to understanding WAK functions and regulations.

  5. Atypical Protein Phosphatase 2A Gene Families Do Not Expand via Paleopolyploidization1[OPEN

    PubMed Central

    2017-01-01

    Protein phosphatase 2A (PP2A) presents unique opportunities for analyzing molecular mechanisms of functional divergence between gene family members. The canonical PP2A holoenzyme regulates multiple eukaryotic signaling pathways by dephosphorylating target proteins and contains a catalytic (C) subunit, a structural/scaffolding (A) subunit, and a regulatory (B) subunit. Genes encoding PP2A subunits have expanded into multigene families in both flowering plants and mammals, and the extent to which different isoform functions may overlap is not clearly understood. To gain insight into the diversification of PP2A subunits, we used phylogenetic analyses to reconstruct the evolutionary histories of PP2A gene families in Arabidopsis (Arabidopsis thaliana). Genes encoding PP2A subunits in mammals represent ancient lineages that expanded early in vertebrate evolution, while flowering plant PP2A subunit lineages evolved much more recently. Despite this temporal difference, our data indicate that the expansion of PP2A subunit gene families in both flowering plants and animals was driven by whole-genome duplications followed by nonrandom gene loss. Selection analysis suggests that the expansion of one B subunit gene family (B56/PPP2R5) was driven by functional diversification rather than by the maintenance of gene dosage. We also observed reduced expansion rates in three distinct B subunit subclades. One of these subclades plays a highly conserved role in cell division, while the distribution of a second subclade suggests a specialized function in supporting beneficial microbial associations. Thus, while whole-genome duplications have driven the expansion and diversification of most PP2A gene families, members of functionally specialized subclades quickly revert to singleton status after duplication events. PMID:28034953

  6. Receptor-like kinases from Arabidopsis form a monophyletic gene family related to animal receptor kinases

    PubMed Central

    Shiu, Shin-Han; Bleecker, Anthony B.

    2001-01-01

    Plant receptor-like kinases (RLKs) are proteins with a predicted signal sequence, single transmembrane region, and cytoplasmic kinase domain. Receptor-like kinases belong to a large gene family with at least 610 members that represent nearly 2.5% of Arabidopsis protein coding genes. We have categorized members of this family into subfamilies based on both the identity of the extracellular domains and the phylogenetic relationships between the kinase domains of subfamily members. Surprisingly, this structurally defined group of genes is monophyletic with respect to kinase domains when compared with the other eukaryotic kinase families. In an extended analysis, animal receptor kinases, Raf kinases, plant RLKs, and animal receptor tyrosine kinases form a well supported group sharing a common origin within the superfamily of serine/threonine/tyrosine kinases. Among animal kinase sequences, Drosophila Pelle and related cytoplasmic kinases fall within the plant RLK clade, which we now define as the RLK/Pelle family. A survey of expressed sequence tag records for land plants reveals that mosses, ferns, conifers, and flowering plants have similar percentages of expressed sequence tags representing RLK/Pelle homologs, suggesting that the size of this gene family may have been close to the present-day level before the diversification of land plant lineages. The distribution pattern of four RLK subfamilies on Arabidopsis chromosomes indicates that the expansion of this gene family is partly a consequence of duplication and reshuffling of the Arabidopsis genome and of the generation of tandem repeats. PMID:11526204

  7. Differential expression of a protease gene family in African Trypanosomes

    PubMed Central

    Helm, Jared R.; Wilson, Mary E.; Donelson, John E.

    2008-01-01

    During their life cycle African trypanosomes must quickly adapt to the different environments of the tsetse fly midgut and the mammalian bloodstream by modulating expression of many of their genes. One group of these differentially expressed genes encodes different forms of a major surface protease. Using a luciferase reporter gene transiently or permanently transfected into trypanosomes, we show here that the 3′-UTRs of these protease genes are responsible for their differential expression. Deletion analysis of the 389-bp 3′-UTR of one of the protease genes, MSP-B, demonstrated that it contains a U-rich regulatory region of about 23 bp (UCGUCUGUUAUUUCUUAGUCCAG), which suppresses expression of the reporter protein in bloodstream trypanosomes by as much as 25-fold, but has little effect on the reporter expression in procyclic (tsetse fly) trypanosomes. Replacing the entire 3′-UTR with just this 23-bp element mimicked most of the suppression effect of the complete 3′-UTR. Northern blots showed that the 23-bp element influences the steady state RNA level, but not enough to account for the 25-fold suppression effect. Polysome analyses showed that in procyclic trypanosomes more of the total protease mRNA is associated with intermediate-sized and large polysomes than in bloodstream trypanosomes. Thus, the 23-bp element of this protease gene affects both the level of RNA and its translation. PMID:18848586

  8. Gene Panel Testing in Epileptic Encephalopathies and Familial Epilepsies

    PubMed Central

    Møller, Rikke S.; Larsen, Line H.G.; Johannesen, Katrine M.; Talvik, Inga; Talvik, Tiina; Vaher, Ulvi; Miranda, Maria J.; Farooq, Muhammad; Nielsen, Jens E.K.; Svendsen, Lene Lavard; Kjelgaard, Ditte B.; Linnet, Karen M.; Hao, Qin; Uldall, Peter; Frangu, Mimoza; Tommerup, Niels; Baig, Shahid M.; Abdullah, Uzma; Born, Alfred P.; Gellert, Pia; Nikanorova, Marina; Olofsson, Kern; Jepsen, Birgit; Marjanovic, Dragan; Al-Zehhawi, Lana I.K.; Peñalva, Sofia J.; Krag-Olsen, Bente; Brusgaard, Klaus; Hjalgrim, Helle; Rubboli, Guido; Pal, Deb K.; Dahl, Hans A.

    2016-01-01

    In recent years, several genes have been causally associated with epilepsy. However, making a genetic diagnosis in a patient can still be difficult, since extensive phenotypic and genetic heterogeneity has been observed in many monogenic epilepsies. This study aimed to analyze the genetic basis of a wide spectrum of epilepsies with age of onset spanning from the neonatal period to adulthood. A gene panel targeting 46 epilepsy genes was used on a cohort of 216 patients consecutively referred for panel testing. The patients had a range of different epilepsies from benign neonatal seizures to epileptic encephalopathies (EEs). Potentially causative variants were evaluated by literature and database searches, submitted to bioinformatic prediction algorithms, and validated by Sanger sequencing. If possible, parents were included for segregation analysis. We identified a presumed disease-causing variant in 49 (23%) of the 216 patients. The variants were found in 19 different genes including SCN1A, STXBP1, CDKL5, SCN2A, SCN8A, GABRA1, KCNA2, and STX1B. Patients with neonatal-onset epilepsies had the highest rate of positive findings (57%). The overall yield for patients with EEs was 32%, compared to 17% among patients with generalized epilepsies and 16% in patients with focal or multifocal epilepsies. By the use of a gene panel consisting of 46 epilepsy genes, we were able to find a disease-causing genetic variation in 23% of the analyzed patients. The highest yield was found among patients with neonatal-onset epilepsies and EEs. PMID:27781031

  9. Identification of a new, unorthodox member of the MAGE gene family.

    PubMed

    Põld, M; Zhou, J; Chen, G L; Hall, J M; Vescio, R A; Berenson, J R

    1999-07-15

    Several tumor-associated antigen families, such as MAGE, GAGE/PAGE, PRAME, BAGE, and LAGE/NY-ESO-1, exist. These antigens are of particular interest in tumor immunology, because their expression, with exception of testis and fetal tissues, seems to be restricted to tumor cells only. We have identified a novel member of the MAGE gene family, MAGED1. Northern hybridization and RT-PCR demonstrated that the expression level of MAGED1 in different normal adult tissues is comparable to that in testis and fetal liver. Thus, MAGED1 does not possess an expression pattern characteristic of previously identified MAGE family genes, suggesting that the biology of the MAGE-family genes is more complex than previously thought. Chromosome mapping linked MAGED1 to marker AFM119xd6 (DXS1039) on chromosome Xp11.23.

  10. The SOD Gene Family in Tomato: Identification, Phylogenetic Relationships, and Expression Patterns.

    PubMed

    Feng, Kun; Yu, Jiahong; Cheng, Yuan; Ruan, Meiying; Wang, Rongqing; Ye, Qingjing; Zhou, Guozhi; Li, Zhimiao; Yao, Zhuping; Yang, Yuejian; Zheng, Qingsong; Wan, Hongjian

    2016-01-01

    Superoxide dismutases (SODs) are critical antioxidant enzymes that protect organisms from reactive oxygen species (ROS) caused by adverse conditions, and have been widely found in the cytoplasm, chloroplasts, and mitochondria of eukaryotic and prokaryotic cells. Tomato (Solanum lycopersicum L.) is an important economic crop and is cultivated worldwide. However, abiotic and biotic stresses severely hinder growth and development of the plant, which affects the production and quality of the crop. To reveal the potential roles of SOD genes under various stresses, we performed a systematic analysis of the tomato SOD gene family and analyzed the expression patterns of SlSOD genes in response to abiotic stresses at the whole-genome level. The characteristics of the SlSOD gene family were determined by analyzing gene structure, conserved motifs, chromosomal distribution, phylogenetic relationships, and expression patterns. We determined that there are at least nine SOD genes in tomato, including four Cu/ZnSODs, three FeSODs, and one MnSOD, and they are unevenly distributed on 12 chromosomes. Phylogenetic analyses of SOD genes from tomato and other plant species were separated into two groups with a high bootstrap value, indicating that these SOD genes were present before the monocot-dicot split. Additionally, many cis-elements that respond to different stresses were found in the promoters of nine SlSOD genes. Gene expression analysis based on RNA-seq data showed that most genes were expressed in all tested tissues, with the exception of SlSOD6 and SlSOD8, which were only expressed in young fruits. Microarray data analysis showed that most members of the SlSOD gene family were altered under salt- and drought-stress conditions. This genome-wide analysis of SlSOD genes helps to clarify the function of SlSOD genes under different stress conditions and provides information to aid in further understanding the evolutionary relationships of SOD genes in plants.

  11. The SOD Gene Family in Tomato: Identification, Phylogenetic Relationships, and Expression Patterns

    PubMed Central

    Feng, Kun; Yu, Jiahong; Cheng, Yuan; Ruan, Meiying; Wang, Rongqing; Ye, Qingjing; Zhou, Guozhi; Li, Zhimiao; Yao, Zhuping; Yang, Yuejian; Zheng, Qingsong; Wan, Hongjian

    2016-01-01

    Superoxide dismutases (SODs) are critical antioxidant enzymes that protect organisms from reactive oxygen species (ROS) caused by adverse conditions, and have been widely found in the cytoplasm, chloroplasts, and mitochondria of eukaryotic and prokaryotic cells. Tomato (Solanum lycopersicum L.) is an important economic crop and is cultivated worldwide. However, abiotic and biotic stresses severely hinder growth and development of the plant, which affects the production and quality of the crop. To reveal the potential roles of SOD genes under various stresses, we performed a systematic analysis of the tomato SOD gene family and analyzed the expression patterns of SlSOD genes in response to abiotic stresses at the whole-genome level. The characteristics of the SlSOD gene family were determined by analyzing gene structure, conserved motifs, chromosomal distribution, phylogenetic relationships, and expression patterns. We determined that there are at least nine SOD genes in tomato, including four Cu/ZnSODs, three FeSODs, and one MnSOD, and they are unevenly distributed on 12 chromosomes. Phylogenetic analyses of SOD genes from tomato and other plant species were separated into two groups with a high bootstrap value, indicating that these SOD genes were present before the monocot-dicot split. Additionally, many cis-elements that respond to different stresses were found in the promoters of nine SlSOD genes. Gene expression analysis based on RNA-seq data showed that most genes were expressed in all tested tissues, with the exception of SlSOD6 and SlSOD8, which were only expressed in young fruits. Microarray data analysis showed that most members of the SlSOD gene family were altered under salt- and drought-stress conditions. This genome-wide analysis of SlSOD genes helps to clarify the function of SlSOD genes under different stress conditions and provides information to aid in further understanding the evolutionary relationships of SOD genes in plants. PMID:27625661

  12. Characterization of three members of the ACC synthase gene family in Solanum tuberosum L.

    PubMed

    Destéfano-Beltrán, L J; van Caeneghem, W; Gielen, J; Richard, L; van Montagu, M; van der Straeten, D

    1995-02-20

    Two genomic clones corresponding to three members of the 1-aminocyclopropane-1-carboxylic acid (ACC) synthase gene family in potato (Solanum tuberosum L.) have been isolated and sequenced. Two highly homologous genes, ST-ACS1A and ST-ACS1B, transcribed in opposite directions were found in an 8.9 kb region. Their coding sequences are interrupted by two introns at identical positions. Their closest relative in tomato is the LE-ACS3 gene. The third gene in potato, ST-ACS2, was found in a 4 kb region and shows a gene structure similar to that of the tomato LE-ACS4 gene and to the mung bean VR-ACS4 and VR-ACS5 genes. Based on its lack of significant homology to the tomato gene family and its closeness to the VR-ACS4 and VR-ACS5 genes, we propose that LE-ACS7 represents an additional isoform in the tomato genome. Moreover, in a phylogenetic comparison of known ACC synthases, the ST-ACS2 isoform was grouped in a separate lineage together with the mung bean VR-ACS4 and VR-ACS5, and the moth orchid DS-ACS1A and DS-ACS1B gene products. Expression of the three potato genes was studied by reverse transcription-polymerase chain reaction on total RNA. The twin genes are positively regulated by indole-3-acetic acid in hypocotyls and expression is modulated by wounding in the leaves. The third gene is responsive to ethylene and wounding mainly in tubers. The roles of these three genes and of other members of the ACC synthase gene family in vegetative processes of potato such as tuberization, dormancy, and sprouting have yet to be determined.

  13. High Gene Family Turnover Rates and Gene Space Adaptation in the Compact Genome of the Carnivorous Plant Utricularia gibba.

    PubMed

    Carretero-Paulet, Lorenzo; Librado, Pablo; Chang, Tien-Hao; Ibarra-Laclette, Enrique; Herrera-Estrella, Luis; Rozas, Julio; Albert, Victor A

    2015-05-01

    Utricularia gibba is an aquatic carnivorous plant with highly specialized morphology, featuring fibrous floating networks of branches and leaf-like organs, no recognizable roots, and bladder traps that capture and digest prey. We recently described the compressed genome of U. gibba as sufficient to control the development and reproduction of a complex organism. We hypothesized intense deletion pressure as a mechanism whereby most noncoding DNA was deleted, despite evidence for three independent whole-genome duplications (WGDs). Here, we explore the impact of intense genome fractionation in the evolutionary dynamics of U. gibba's functional gene space. We analyze U. gibba gene family turnover by modeling gene gain/death rates under a maximum-likelihood statistical framework. In accord with our deletion pressure hypothesis, we show that the U. gibba gene death rate is significantly higher than those of four other eudicot species. Interestingly, the gene gain rate is also significantly higher, likely reflecting the occurrence of multiple WGDs and possibly also small-scale genome duplications. Gene ontology enrichment analyses of U. gibba-specific two-gene orthogroups, multigene orthogroups, and singletons highlight functions that may represent adaptations in an aquatic carnivorous plant. We further discuss two homeodomain transcription factor gene families (WOX and HDG/HDZIP-IV) showing conspicuous differential expansions and contractions in U. gibba. Our results 1) reconcile the compactness of the U. gibba genome with its accommodation of a typical number of genes for a plant genome, and 2) highlight the role of high gene family turnover in the evolutionary diversification of U. gibba's functional gene space and adaptations to its unique lifestyle and highly specialized body plan.

  14. The ZIC gene family encodes multi-functional proteins essential for patterning and morphogenesis.

    PubMed

    Houtmeyers, Rob; Souopgui, Jacob; Tejpar, Sabine; Arkell, Ruth

    2013-10-01

    The zinc finger of the cerebellum gene (ZIC) discovered in Drosophila melanogaster (odd-paired) has five homologs in Xenopus, chicken, mice, and humans, and seven in zebrafish. This pattern of gene copy expansion is accompanied by a divergence in gene and protein structure, suggesting that Zic family members share some, but not all, functions. ZIC genes are implicated in neuroectodermal development and neural crest cell induction. All share conserved regions encoding zinc finger domains, however their heterogeneity and specification remain unexplained. In this review, the evolution, structure, and expression patterns of the ZIC homologs are described; specific functions attributable to individual family members are supported. A review of data from functional studies in Xenopus and murine models suggest that ZIC genes encode multifunctional proteins operating in a context-specific manner to drive critical events during embryogenesis. The identification of ZIC mutations in congenital syndromes highlights the relevance of these genes in human development.

  15. Polymorphism and selection in the major histocompatibility complex DRA and DQA genes in the family Equidae.

    PubMed

    Janova, Eva; Matiasovic, Jan; Vahala, Jiri; Vodicka, Roman; Van Dyk, Enette; Horin, Petr

    2009-07-01

    The major histocompatibility complex genes coding for antigen binding and presenting molecules are the most polymorphic genes in the vertebrate genome. We studied the DRA and DQA gene polymorphism of the family Equidae. In addition to 11 previously reported DRA and 24 DQA alleles, six new DRA sequences and 13 new DQA alleles were identified in the genus Equus. Phylogenetic analysis of both DRA and DQA sequences provided evidence for trans-species polymorphism in the family Equidae. The phylogenetic trees differed from species relationships defined by standard taxonomy of Equidae and from trees based on mitochondrial or neutral gene sequence data. Analysis of selection showed differences between the less variable DRA and more variable DQA genes. DRA alleles were more often shared by more species. The DQA sequences analysed showed strong amongst-species positive selection; the selected amino acid positions mostly corresponded to selected positions in rodent and human DQA genes.

  16. Lamellipodin promotes actin assembly by clustering Ena/VASP proteins and tethering them to actin filaments

    PubMed Central

    Hansen, Scott D; Mullins, R Dyche

    2015-01-01

    Enabled/Vasodilator (Ena/VASP) proteins promote actin filament assembly at multiple locations, including: leading edge membranes, focal adhesions, and the surface of intracellular pathogens. One important Ena/VASP regulator is the mig-10/Lamellipodin/RIAM family of adaptors that promote lamellipod formation in fibroblasts and drive neurite outgrowth and axon guidance in neurons. To better understand how MRL proteins promote actin network formation we studied the interactions between Lamellipodin (Lpd), actin, and VASP, both in vivo and in vitro. We find that Lpd binds directly to actin filaments and that this interaction regulates its subcellular localization and enhances its effect on VASP polymerase activity. We propose that Lpd delivers Ena/VASP proteins to growing barbed ends and increases their polymerase activity by tethering them to filaments. This interaction represents one more pathway by which growing actin filaments produce positive feedback to control localization and activity of proteins that regulate their assembly. DOI: http://dx.doi.org/10.7554/eLife.06585.001 PMID:26295568

  17. Gene structure, phylogeny and expression profile of the sucrose synthase gene family in cacao (Theobroma cacao L.).

    PubMed

    Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui

    2015-09-01

    In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.

  18. From manual curation to visualization of gene families and networks across Solanaceae plant species.

    PubMed

    Pujar, Anuradha; Menda, Naama; Bombarely, Aureliano; Edwards, Jeremy D; Strickler, Susan R; Mueller, Lukas A

    2013-01-01

    High-quality manual annotation methods and practices need to be scaled to the increased rate of genomic data production. Curation based on gene families and gene networks is one approach that can significantly increase both curation efficiency and quality. The Sol Genomics Network (SGN; http://solgenomics.net) is a comparative genomics platform, with genetic, genomic and phenotypic information of the Solanaceae family and its closely related species that incorporates a community-based gene and phenotype curation system. In this article, we describe a manual curation system for gene families aimed at facilitating curation, querying and visualization of gene interaction patterns underlying complex biological processes, including an interface for efficiently capturing information from experiments with large data sets reported in the literature. Well-annotated multigene families are useful for further exploration of genome organization and gene evolution across species. As an example, we illustrate the system with the multigene transcription factor families, WRKY and Small Auxin Up-regulated RNA (SAUR), which both play important roles in responding to abiotic stresses in plants. Database URL: http://solgenomics.net/

  19. Duplications and losses in gene families of rust pathogens highlight putative effectors

    PubMed Central

    Pendleton, Amanda L.; Smith, Katherine E.; Feau, Nicolas; Martin, Francis M.; Grigoriev, Igor V.; Hamelin, Richard; Nelson, C. Dana; Burleigh, J. Gordon; Davis, John M.

    2014-01-01

    Rust fungi are a group of fungal pathogens that cause some of the world's most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host's cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of 16 diverse fungal species, which include 15 basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: (i) arose or expanded in rust pathogens relative to other fungi, or (ii) contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity. PMID:25018762

  20. Actin-Capping Protein and the Hippo pathway regulate F-actin and tissue growth in Drosophila.

    PubMed

    Fernández, Beatriz García; Gaspar, Pedro; Brás-Pereira, Catarina; Jezowska, Barbara; Rebelo, Sofia Raquel; Janody, Florence

    2011-06-01

    The conserved Hippo tumor suppressor pathway is a key kinase cascade that controls tissue growth by regulating the nuclear import and activity of the transcription co-activator Yorkie. Here, we report that the actin-Capping Protein αβ heterodimer, which regulates actin polymerization, also functions to suppress inappropriate tissue growth by inhibiting Yorkie activity. Loss of Capping Protein activity results in abnormal accumulation of apical F-actin, reduced Hippo pathway activity and the ectopic expression of several Yorkie target genes that promote cell survival and proliferation. Reduction of two other actin-regulatory proteins, Cofilin and the cyclase-associated protein Capulet, cause abnormal F-actin accumulation, but only the loss of Capulet, like that of Capping Protein, induces ectopic Yorkie activity. Interestingly, F-actin also accumulates abnormally when Hippo pathway activity is reduced or abolished, independently of Yorkie activity, whereas overexpression of the Hippo pathway component expanded can partially reverse the abnormal accumulation of F-actin in cells depleted for Capping Protein. Taken together, these findings indicate a novel interplay between Hippo pathway activity and actin filament dynamics that is essential for normal growth control.

  1. Conservation and diversity of gene families explored using the CODEHOP strategy in higher plants

    PubMed Central

    Morant, Marc; Hehn, Alain; Werck-Reichhart, Danièle

    2002-01-01

    Background Availability of genomewide information on an increasing but still limited number of plants offers the possibility of identifying orthologues, or related genes, in species with major economical impact and complex genomes. In this paper we exploit the recently described CODEHOP primer design and PCR strategy for targeted isolation of homologues in large gene families. Results The method was tested with two different objectives. The first was to analyze the evolution of the CYP98 family of cytochrome P450 genes involved in 3-hydroxylation of phenolic compounds and lignification in a broad range of plant species. The second was to isolate an orthologue of the sorghum glucosyl transferase UGT85B1 and to determine the complexity of the UGT85 family in wheat. P450s of the CYP98 family or closely related sequences were found in all vascular plants. No related sequence was found in moss. Neither extensive duplication of the CYP98 genes nor an orthologue of UGT85B1 were found in wheat. The UGT85A subfamily was however found to be highly variable in wheat. Conclusions Our data are in agreement with the implication of CYP98s in lignification and the evolution of 3-hydroxylation of lignin precursors with vascular plants. High conservation of the CYP98 family strongly argues in favour of an essential function in plant development. Conversely, high duplication and diversification of the UGT85A gene family in wheat suggests its involvement in adaptative response and provides a valuable pool of genes for biotechnological applications. This work demonstrates the high potential of the CODEHOP strategy for the exploration of large gene families in plants. PMID:12153706

  2. Identification and expression of nor efflux family genes in Staphylococcus epidermidis that act against gatifloxacin.

    PubMed

    Juárez-Verdayes, Marco A; Parra-Ortega, Berenice; Hernández-Rodríguez, César; Betanzos-Cabrera, Gabriel; Rodríguez-Martínez, Sandra; Cancino-Diaz, Mario E; Cancino-Diaz, Juan C

    2012-06-01

    NorA, NorB, and NorC are efflux proteins in the Nor family that regulate the secretion of fluoroquinolones, and MgrA/NorR is a transcription factor of the Nor family. Overexpression of Nor family proteins provides fluoroquinolone resistance in Staphylococcus aureus. However, in coagulase-negative staphylococci (CNS), members of the Nor family had not been identified. In this work, the presence of Nor family proteins in Staphylococcus spp. and the expression of Nor family in gatifloxacin resistant S. epidermidis strains obtained from ocular infections (OI) were identified and analyzed. S. epidermidis strains from OIs (n = 44) and healthy skin (HS; n = 52) were isolated. The nor family genes were identified in CNS using PCR, sequencing and phylogenetic approaches. Nor family expression was determined by RT-PCR. NorA efflux activity was determined using the automated ethidium bromide method. In-silico analysis showed that norA, mgrA/norR, and "norB-like" and "norC-like" (norB/norC) genes are present in CNS. The nor family genes were distributed and constitutively expressed in all S. epidermidis strains studied. In one gatifloxacin resistant strain isolated from the endophthalmitis, treatment with gatifloxacin induced overexpression of the norA gene and resulted in high activity of NorA efflux. These results indicate that the Nor family of proteins is present in CNS, and the NorA efflux mechanism for gatifloxacin response occurs in at least one strain of S. epidermidis, contributing to gatifloxacin resistance.

  3. Elevated Glucose Levels Promote Contractile and Cytoskeletal Gene Expression in Vascular Smooth Muscle via Rho/Protein Kinase C and Actin Polymerization*

    PubMed Central

    Hien, Tran Thi; Turczyńska, Karolina M.; Dahan, Diana; Ekman, Mari; Grossi, Mario; Sjögren, Johan; Nilsson, Johan; Braun, Thomas; Boettger, Thomas; Garcia-Vaz, Eliana; Stenkula, Karin; Swärd, Karl; Gomez, Maria F.; Albinsson, Sebastian

    2016-01-01

    Both type 1 and type 2 diabetes are associated with increased risk of cardiovascular disease. This is in part attributed to the effects of hyperglycemia on vascular endothelial and smooth muscle cells, but the underlying mechanisms are not fully understood. In diabetic animal models, hyperglycemia results in hypercontractility of vascular smooth muscle possibly due to increased activation of Rho-kinase. The aim of the present study was to investigate the regulation of contractile smooth muscle markers by glucose and to determine the signaling pathways that are activated by hyperglycemia in smooth muscle cells. Microarray, quantitative PCR, and Western blot analyses revealed that both mRNA and protein expression of contractile smooth muscle markers were increased in isolated smooth muscle cells cultured under high compared with low glucose conditions. This effect was also observed in hyperglycemic Akita mice and in diabetic patients. Elevated glucose activated the protein kinase C and Rho/Rho-kinase signaling pathways and stimulated actin polymerization. Glucose-induced expression of contractile smooth muscle markers in cultured cells could be partially or completely repressed by inhibitors of advanced glycation end products, L-type calcium channels, protein kinase C, Rho-kinase, actin polymerization, and myocardin-related transcription factors. Furthermore, genetic ablation of the miR-143/145 cluster prevented the effects of glucose on smooth muscle marker expression. In conclusion, these data demonstrate a possible link between hyperglycemia and vascular disease states associated with smooth muscle contractility. PMID:26683376

  4. Comparative genome analysis of lignin biosynthesis gene families across the plant kingdom

    PubMed Central

    2009-01-01

    Background As a major component of plant cell wall, lignin plays important roles in mechanical support, water transport, and stress responses. As the main cause for the recalcitrance of plant cell wall, lignin modification has been a major task for bioenergy feedstock improvement. The study of the evolution and function of lignin biosynthesis genes thus has two-fold implications. First, the lignin biosynthesis pathway provides an excellent model to study the coordinative evolution of a biochemical pathway in plants. Second, understanding the function and evolution of lignin biosynthesis genes will guide us to develop better strategies for bioenergy feedstock improvement. Results We analyzed lignin biosynthesis genes from fourteen plant species and one symbiotic fungal species. Comprehensive comparative genome analysis was carried out to study the distribution, relatedness, and family expansion of the lignin biosynthesis genes across the plant kingdom. In addition, we also analyzed the comparative synteny map between rice and sorghum to study the evolution of lignin biosynthesis genes within the Poaceae family and the chromosome evolution between the two species. Comprehensive lignin biosynthesis gene expression analysis was performed in rice, poplar and Arabidopsis. The representative data from rice indicates that different fates of gene duplications exist for lignin biosynthesis genes. In addition, we also carried out the biomass composition analysis of nine Arabidopsis mutants with both MBMS analysis and traditional wet chemistry methods. The results were analyzed together with the genomics analysis. Conclusion The research revealed that, among the species analyzed, the complete lignin biosynthesis pathway first appeared in moss; the pathway is absent in green algae. The expansion of lignin biosynthesis gene families correlates with substrate diversity. In addition, we found that the expansion of the gene families mostly occurred after the divergence of monocots

  5. A new model for the interaction of dystrophin with F-actin

    PubMed Central

    1996-01-01

    The F-actin binding and cross-linking properties of skeletal muscle dystrophin-glycoprotein complex were examined using high and low speed cosedimentation assays, microcapillary falling ball viscometry, and electron microscopy. Dystrophin-glycoprotein complex binding to F-actin saturated near 0.042 +/- 0.005 mol/ mol, which corresponds to one dystrophin per 24 actin monomers. Dystrophin-glycoprotein complex bound to F-actin with an average apparent Kd for dystrophin of 0.5 microM. These results demonstrate that native, full-length dystrophin in the glycoprotein complex binds F-actin with some properties similar to those measured for several members of the actin cross-linking super- family of proteins. However, we failed to observe dystrophin- glycoprotein complex-induced cross-linking of F-actin by three different methods, each positively controlled with alpha-actinin. Furthermore, high speed cosedimentation analysis of dystrophin- glycoprotein complex digested with calpain revealed a novel F-actin binding site located near the middle of the dystrophin rod domain. Recombinant dystrophin fragments corresponding to the novel actin binding site and the first 246 amino acids of dystrophin both bound F- actin but with significantly lower affinity and higher capacity than was observed with purified dystrophin-glycoprotein complex. Finally, dystrophin-glycoprotein complex was observed to significantly slow the depolymerization of F-actin, Suggesting that dystrophin may lie along side an actin filament through interaction with multiple actin monomers. These data suggest that although dystrophin is most closely related to the actin cross-linking superfamily based on sequence homology, dystrophin binds F-actin in a manner more analogous to actin side-binding proteins. PMID:8909541

  6. Evidence for Retrogene Origins of the Prion Gene Family

    PubMed Central

    Ehsani, Sepehr; Tao, Renzhu; Pocanschi, Cosmin L.; Ren, Hezhen; Harrison, Paul M.; Schmitt-Ulms, Gerold

    2011-01-01

    The evolutionary origin of prion genes, only known to exist in the vertebrate lineage, had remained elusive until recently. Following a lead from interactome investigations of the murine prion protein, our previous bioinformatic analyses revealed the evolutionary descent of prion genes from an ancestral ZIP metal ion transporter. However, the molecular mechanism of evolution remained unexplored. Here we present a computational investigation of this question based on sequence, intron-exon, synteny and pseudogene analyses. Our data suggest that during the emergence of metazoa, a cysteine-flanked core domain was modularly inserted, or arose de novo, in a preexisting ZIP ancestor gene to generate a prion-like ectodomain in a subbranch of ZIP genes. Approximately a half-billion years later, a genomic insertion of a spliced transcript coding for such a prion-like ZIP ectodomain may have created the prion founder gene. We document that similar genomic insertions involving ZIP transcripts, and probably relying on retropositional elements, have indeed occurred more than once throughout evolution. PMID:22046361

  7. Human T-cell receptor variable gene segment families

    SciTech Connect

    Arden, B.; Kabelitz, D.; Clark, S.P.; Mak, T.W.

    1995-10-01

    Multiple DNA and protein sequence alignments have been constructed for the human T-cell receptor {alpha}/{delta}, {beta}, and {gamma} (TCRA/D, B, and G) variable (V) gene segments. The traditional classification into subfamilies was confirmed using a much larger pool of sequences. For each sequence, a name was derived which complies with the standard nomenclature. The traditional numbering of V gene segments in the order of their discovery was continued and changed when in conflict with names of other segments. By discriminating between alleles at the same locus versus genes from different loci, we were able to reduce the number of more than 150 different TCRBV sequences in the database to a repertoire of only 47 functional TCRBV gene segments. An extension of this analysis to the over 100 TCRAV sequences results in a predicted repertoire of 42 functional TCRAV gene segments. Our alignment revealed two residues that distinguish between the highly homologous V{delta} and V{alpha}, one at a site that in V{sub H} contacts the constant region, the other at the interface between immunoglobulin V{sub H} and V{sub L}. This site may be responsible for restricted pairing between certain V{delta} and V{gamma} chains. On the other hand, V{beta} and V{gamma} appear to be related by the fact that their CDR2 length is increased by four residues as compared with that of V{alpha}/{delta} peptides. 150 refs., 12 figs., 5 tabs.

  8. Tandem repeat distribution of gene transcripts in three plant families

    PubMed Central

    2009-01-01

    Tandem repeats (microsatellites or SSRs) are molecular markers with great potential for plant genetic studies. Modern strategies include the transfer of these markers among widely studied and orphan species. In silico analyses allow for studying distribution patterns of microsatellites and predicting which motifs would be more amenable to interspecies transfer. Transcribed sequences (Unigene) from ten species of three plant families were surveyed for the occurrence of micro and minisatellites. Transcripts from different species displayed different rates of tandem repeat occurrence, ranging from 1.47% to 11.28%. Both similar and different patterns were found within and among plant families. The results also indicate a lack of association between genome size and tandem repeat fractions in expressed regions. The conservation of motifs among species and its implication on genome evolution and dynamics are discussed. PMID:21637460

  9. The Vertebrate RCAN Gene Family: Novel Insights into Evolution, Structure and Regulation

    PubMed Central

    Serrano-Candelas, Eva; Farré, Domènec; Aranguren-Ibáñez, Álvaro; Martínez-Høyer, Sergio; Pérez-Riba, Mercè

    2014-01-01

    Recently there has been much interest in the Regulators of Calcineurin (RCAN) proteins which are important endogenous modulators of the calcineurin-NFATc signalling pathway. They have been shown to have a crucial role in cellular programmes such as the immune response, muscle fibre remodelling and memory, but also in pathological processes such as cardiac hypertrophy and neurodegenerative diseases. In vertebrates, the RCAN family form a functional subfamily of three members RCAN1, RCAN2 and RCAN3 whereas only one RCAN is present in the rest of Eukarya. In addition, RCAN genes have been shown to collocate with RUNX and CLIC genes in ACD clusters (ACD21, ACD6 and ACD1). How the RCAN genes and their clustering in ACDs evolved is still unknown. After analysing RCAN gene family evolution using bioinformatic tools, we propose that the three RCAN vertebrate genes within the ACD clusters, which evolved from single copy genes present in invertebrates and lower eukaryotes, are the result of two rounds of whole genome duplication, followed by a segmental duplication. This evolutionary scenario involves the loss or gain of some RCAN genes during evolution. In addition, we have analysed RCAN gene structure and identified the existence of several characteristic features that can be involved in RCAN evolution and gene expression regulation. These included: several transposable elements, CpG islands in the 5′ region of the genes, the existence of antisense transcripts (NAT) associated with the three human genes, and considerable evidence for bidirectional promoters that regulate RCAN gene expression. Furthermore, we show that the CpG island associated with the RCAN3 gene promoter is unmethylated and transcriptionally active. All these results provide timely new insights into the molecular mechanisms underlying RCAN function and a more in depth knowledge of this gene family whose members are obvious candidates for the development of future therapies. PMID:24465593

  10. The banana E2 gene family: Genomic identification, characterization, expression profiling analysis.

    PubMed

    Dong, Chen; Hu, Huigang; Jue, Dengwei; Zhao, Qiufang; Chen, Hongliang; Xie, Jianghui; Jia, Liqiang

    2016-04-01

    The E2 is at the center of a cascade of Ub1 transfers, and it links activation of the Ub1 by E1 to its eventual E3-catalyzed attachment to substrate. Although the genome-wide analysis of this family has been performed in some species, little is known about analysis of E2 genes in banana. In this study, 74 E2 genes of banana were identified and phylogenetically clustered into thirteen subgroups. The predicted banana E2 genes were distributed across all 11 chromosomes at different densities. Additionally, the E2 domain, gene structure and motif compositions were analyzed. The expression of all of the banana E2 genes was analyzed in the root, stem, leaf, flower organs, five stages of fruit development and under abiotic stresses. All of the banana E2 genes, with the exception of few genes in each group, were expressed in at least one of the organs and fruit developments, which indicated that the E2 genes might involve in various aspects of the physiological and developmental processes of the banana. Quantitative RT-PCR (qRT-PCR) analysis identified that 45 E2s under drought and 33 E2s under salt were induced. To the best of our knowledge, this report describes the first genome-wide analysis of the banana E2 gene family, and the results should provide valuable information for understanding the classification, cloning and putative functions of this family.

  11. Analysis of the arabidopsis REM gene family predicts functions during flower development

    PubMed Central

    Mantegazza, Otho; Gregis, Veronica; Mendes, Marta Adelina; Morandini, Piero; Alves-Ferreira, Márcio; Patreze, Camila M.; Nardeli, Sarah M.; Kater, Martin M.; Colombo, Lucia

    2014-01-01

    Background and Aims The REM (Reproductive Meristem) gene family of Arabidopsis thaliana is part of the B3 DNA-binding domain superfamily. Despite the fact that several groups have worked on the REM genes for many years, little is known about the function of this transcription factor family. This study aims to identify a set of REM genes involved in flower development and to characterize their function. Methods In order to provide an overview of the REM gene family, a detailed expression analysis for all REM genes of A. thaliana was performed and combined with a meta-analysis of ChIP-sequencing and microarray experiments. Key Results Two sets of phylogenetically closely related REM genes, namely REM23, REM24 and REM25, and REM34, REM35 and REM36, were identified as possibly being involved in the early stages of flower development. Single- and double-mutant combinations were analysed for these genes, and no phenotypic effects were detected during flower development. Conclusions The data suggest that the REM34, REM35 and REM36 group is the most interesting one, as REM34 is co-expressed with the floral meristem identity (FMI) genes, they are bound by AP1, SVP, AP3 and PI, and they are expressed in the floral meristem and during the earliest stages of flower development. However, it appears that high levels of functional redundancy may conceal the exact function of these transcription factor genes. PMID:25002525

  12. Characterization of the laminin gene family and evolution in zebrafish.

    PubMed

    Sztal, Tamar; Berger, Silke; Currie, Peter D; Hall, Thomas E

    2011-02-01

    Laminins are essential components of all basement membranes and are fundamental to tissue development and homeostasis. Humans possess at least 16 different heterotrimeric laminin complexes formed through different combinations of alpha, beta, and gamma chains. Individual chains appear to exhibit unique expression patterns, leading to the notion that overlap between expression domains governs the constitution of complexes found within particular tissues. However, the spatial and temporal expression of laminin genes has not been comprehensively analyzed in any vertebrate model to date. Here, we describe the tissue-specific expression patterns of all laminin genes in the zebrafish, throughout embryonic development and into the "post-juvenile" period, which is representative of the adult body form. In addition, we present phylogenetic and microsynteny analyses, which demonstrate that the majority of our zebrafish sequences are orthologous to human laminin genes. Together, these data represent a fundamental resource for the study of vertebrate laminins.

  13. Fifteen million years of evolution in the Oryza genus shows extensive gene family expansion.

    PubMed

    Jacquemin, Julie; Ammiraju, Jetty S S; Haberer, Georg; Billheimer, Dean D; Yu, Yeisoo; Liu, Liana C; Rivera, Luis F; Mayer, Klaus; Chen, Mingsheng; Wing, Rod A

    2014-04-01

    In analyzing gene families in the whole-genome sequences available for O. sativa (AA), O. glaberrima (AA), and O. brachyantha (FF), we observed large size expansions in the AA genomes compared to FF genomes for the super-families F-box and NB-ARC, and five additional families: the Aspartic proteases, BTB/POZ proteins (BTB), Glutaredoxins, Trypsin α-amylase inhibitor proteins, and Zf-Dof proteins. Their evolutionary dynamic was investigated to understand how and why such important size variations are observed between these closely related species. We show that expansions resulted from both amplification, largely by tandem duplications, and contraction by gene losses. For the F-box and NB-ARC gene families, the genes conserved in all species were under strong purifying selection while expanded orthologous genes were under more relaxed purifying selection. In F-box, NB-ARC, and BTB, the expanded groups were enriched in genes with little evidence of expression, in comparison with conserved groups. We also detected 87 loci under positive selection in the expanded groups. These results show that most of the duplicated copies in the expanded groups evolve neutrally after duplication because of functional redundancy but a fraction of these genes were preserved following neofunctionalization. Hence, the lineage-specific expansions observed between Oryza species were partly driven by directional selection.

  14. Genome-Wide Identification of the Invertase Gene Family in Populus.

    PubMed

    Chen, Zhong; Gao, Kai; Su, Xiaoxing; Rao, Pian; An, Xinmin

    2015-01-01

    Invertase plays a crucial role in carbohydrate partitioning and plant development as it catalyses the irreversible hydrolysis of sucrose into glucose and fructose. The invertase family in plants is composed of two sub-families: acid invertases, which are targeted to the cell wall and vacuole; and neutral/alkaline invertases, which function in the cytosol. In this study, 5 cell wall invertase genes (PtCWINV1-5), 3 vacuolar invertase genes (PtVINV1-3) and 16 neutral/alkaline invertase genes (PtNINV1-16) were identified in the Populus genome and found to be distributed on 14 chromosomes. A comprehensive analysis of poplar invertase genes was performed, including structures, chromosome location, phylogeny, evolutionary pattern and expression profiles. Phylogenetic analysis indicated that the two sub-families were both divided into two clades. Segmental duplication is contributed to neutral/alkaline sub-family expansion. Furthermore, the Populus invertase genes displayed differential expression in roots, stems, leaves, leaf buds and in response to salt/cold stress and pathogen infection. In addition, the analysis of enzyme activity and sugar content revealed that invertase genes play key roles in the sucrose metabolism of various tissues and organs in poplar. This work lays the foundation for future functional analysis of the invertase genes in Populus and other woody perennials.

  15. Genome-Wide Identification of the Invertase Gene Family in Populus

    PubMed Central

    Su, Xiaoxing; Rao, Pian; An, Xinmin

    2015-01-01

    Invertase plays a crucial role in carbohydrate partitioning and plant development as it catalyses the irreversible hydrolysis of sucrose into glucose and fructose. The invertase family in plants is composed of two sub-families: acid invertases, which are targeted to the cell wall and vacuole; and neutral/alkaline invertases, which function in the cytosol. In this study, 5 cell wall invertase genes (PtCWINV1-5), 3 vacuolar invertase genes (PtVINV1-3) and 16 neutral/alkaline invertase genes (PtNINV1-16) were identified in the Populus genome and found to be distributed on 14 chromosomes. A comprehensive analysis of poplar invertase genes was performed, including structures, chromosome location, phylogeny, evolutionary pattern and expression profiles. Phylogenetic analysis indicated that the two sub-families were both divided into two clades. Segmental duplication is contributed to neutral/alkaline sub-family expansion. Furthermore, the Populus invertase genes displayed differential expression in roots, stems, leaves, leaf buds and in response to salt/cold stress and pathogen infection. In addition, the analysis of enzyme activity and sugar content revealed that invertase genes play key roles in the sucrose metabolism of various tissues and organs in poplar. This work lays the foundation for future functional analysis of the invertase genes in Populus and other woody perennials. PMID:26393355

  16. Mimiviridae: clusters of orthologous genes, reconstruction of gene repertoire evolution and proposed expansion of the giant virus family

    PubMed Central

    2013-01-01

    Background The family Mimiviridae belongs to the large monophyletic group of Nucleo-Cytoplasmic Large DNA Viruses (NCLDV; proposed order Megavirales) and encompasses giant viruses infecting amoeba and probably other unicellular eukaryotes. The recent discovery of the Cafeteria roenbergensis virus (CroV), a distant relative of the prototype mimiviruses, led to a substantial expansion of the genetic variance within the family Mimiviridae. In the light of these findings, a reassessment of the relationships between the mimiviruses and other NCLDV and reconstruction of the evolution of giant virus genomes emerge as interesting and timely goals. Results Database searches for the protein sequences encoded in the genomes of several viruses originally classified as members of the family Phycodnaviridae, in particular Organic Lake phycodnaviruses and Phaeocystis globosa viruses (OLPG), revealed a greater number of highly similar homologs in members of the Mimiviridae than in phycodnaviruses. We constructed a collection of 898 Clusters of Orthologous Genes for the putative expanded family Mimiviridae (MimiCOGs) and used these clusters for a comprehensive phylogenetic analysis of the genes that are conserved in most of the NCLDV. The topologies of the phylogenetic trees for these conserved viral genes strongly support the monophyly of the OLPG and the mimiviruses. The same tree topology was obtained by analysis of the phyletic patterns of conserved viral genes. We further employed the mimiCOGs to obtain a maximum likelihood reconstruction of the history of genes losses and gains among the giant viruses. The results reveal massive gene gain in the mimivirus branch and modest gene gain in the OLPG branch. Conclusions These phylogenomic results reported here suggest a substantial expansion of the family Mimiviridae. The proposed expanded family encompasses a greater diversity of viruses including a group of viruses with much smaller genomes than those of the original members of

  17. Eleven ancestral gene families lost in mammals and vertebrates while otherwise universally conserved in animals

    PubMed Central

    Danchin, Etienne GJ; Gouret, Philippe; Pontarotti, Pierre

    2006-01-01

    Background Gene losses played a role which may have been as important as gene and genome duplications and rearrangements, in modelling today species' genomes from a common ancestral set of genes. The set and diversity of protein-coding genes in a species has direct output at the functional level. While gene losses have been reported in all the major lineages of the metazoan tree of life, none have proposed a focus on specific losses in the vertebrates and mammals lineages. In contrast, genes lost in protostomes (i.e. arthropods and nematodes) but still present in vertebrates have been reported and extensively detailed. This probable over-anthropocentric way of comparing genomes does not consider as an important phenomena, gene losses in species that are usually described as "higher". However reporting universally conserved genes throughout evolution that have recently been lost in vertebrates and mammals could reveal interesting features about the evolution of our genome, particularly if these losses can be related to losses of capability. Results We report 11 gene families conserved throughout eukaryotes from yeasts (such as Saccharomyces cerevisiae) to bilaterian animals (such as Drosophila melanogaster or Caenorhabditis elegans). This evolutionarily wide conservation suggests they were present in the last common ancestors of fungi and metazoan animals. None of these 11 gene families are found in human nor mouse genomes, and their absence generally extends to all vertebrates. A total of 8 out of these 11 gene families have orthologs in plants, suggesting they were present in the Last Eukaryotic Common Ancestor (LECA). We investigated known functional information for these 11 gene families. This allowed us to correlate some of the lost gene families to loss of capabilities. Conclusion Mammalian and vertebrate genomes lost evolutionary conserved ancestral genes that are probably otherwise not dispensable in eukaryotes. Hence, the human genome, which is generally

  18. Systematic analysis and identification of stress-responsive genes of the NAC gene family in Brachypodium distachyon.

    PubMed

    You, Jun; Zhang, Lihua; Song, Bo; Qi, Xiaoquan; Chan, Zhulong

    2015-01-01

    Plant-specific NAC proteins are one of the largest families of transcription factors in plants, and members of this family have been characterized with roles in the regulation of diverse biological processes, including development and stress responses. In the present study, we identified 101 putative NAC domain-encoding genes (BdNACs) through systematic sequence analysis in Brachypodium distachyon, a new model plant of family Poaceae. BdNAC proteins were phylogenetically clustered into 13 groups, and each group possesses similar motif compositions. Phylogenetic analysis using known stress-related NACs from Arabidopsis and rice as query sequences identified 18 BdNACs as putative stress-responsive genes. In silico promoter analysis showed that almost all BdNAC genes contain putative stress-related cis-elements in their promoter regions. Expression profile of BdNAC genes in response to abiotic stresses and phytohormones was analyzed by quantitative real-time RT-PCR. Several putative stress-responsive BdNAC genes, including BdNAC003 and BdNAC044 which is ortholog of known stress-responsive rice gene SNAC1 and SNAC2, respectively, were highly regulated by multiple abiotic stresses and stress-related phytohormone treatments. Taken together, our results presented here would be helpful in laying the foundation for understanding of the complex mechanisms of NAC mediated abiotic stress signaling transduction pathways in B. distachyon.

  19. The phylogeny and evolutionary history of the Lesion Simulating Disease (LSD) gene family in Viridiplantae.

    PubMed

    Cabreira, Caroline; Cagliari, Alexandro; Bücker-Neto, Lauro; Margis-Pinheiro, Márcia; de Freitas, Loreta B; Bodanese-Zanettini, Maria Helena

    2015-12-01

    The Lesion Simulating Disease (LSD) genes encode a family of zinc finger proteins that play a role in programmed cell death (PCD) and other biological processes, such as plant growth and photosynthesis. In the present study, we report the reconstruction of the evolutionary history of the LSD gene family in Viridiplantae. Phylogenetic analysis revealed that the monocot and eudicot genes were distributed along the phylogeny, indicating that the expansion of the family occurred prior to the diversification between these clades. Sequences encoding proteins that present one, two, or three LSD domains formed separate groups. The secondary structure of these different LSD proteins presented a similar composition, with the β-sheets being their main component. The evolution by gene duplication was identified only to the genes that contain three LSD domains, which generated proteins with equal structure. Moreover, genes encoding proteins with one or two LSD domains evolved as single-copy genes and did not result from loss or gain in LSD domains. These results were corroborated by synteny analysis among regions containing paralogous/orthologous genes in Glycine max and Populus trichocarpa. The Ka/Ks ratio between paralogous/orthologous genes revealed that a subfunctionalization process possibly could be occurring with the LSD genes, explaining the involvement of LSD members in different biological processes, in addition to the negative regulation of PCD. This study presents important novelty in the evolutionary history of the LSD family and provides a basis for future research on individual LSD genes and their involvement in important pathway networks in plants.

  20. Evolutionary analysis of the jacalin-related lectin family genes in 11 fishes.

    PubMed

    Cao, Jun; Lv, Yueqing

    2016-09-01

    Jacalin-related lectins are a type of carbohydrate-binding proteins, which are distributed across a wide variety of organisms and involved in some important biological processes. The evolution of this gene family in fishes is unknown. Here, 47 putative jacalin genes in 11 fish species were identified and divided into 4 groups through phylogenetic analysis. Conserved gene organization and motif distribution existed in each group, suggesting their functional conservation. Some fishes have eleven jacalin genes, while others have only one or zero gene in their genomes, suggesting dynamic changes in the number of jacalin genes during the evolution of fishes. Intragenic recombination played a key role in the evolution of jacalin genes. Synteny analyses of jacalin genes in some fishes implied conserved and dynamic evolution characteristics of this gene family and related genome segments. Moreover, a few functional divergence sites were identified within each group pairs. Divergent expression profiles of the zebra fish jacalin genes were further investigated in different stresses. The results provided a foundation for exploring the characterization of the jacalin genes in fishes and will offer insights for additional functional studies.

  1. Genome-wide identification of the TIFY gene family in three cultivated Gossypium species and the expression of JAZ genes

    PubMed Central

    Sun, Quan; Wang, Guanghao; Zhang, Xiao; Zhang, Xiangrui; Qiao, Peng; Long, Lu; Yuan, Youlu; Cai, Yingfan

    2017-01-01

    TIFY proteins are plant-specific proteins containing TIFY, JAZ, PPD and ZML subfamilies. A total of 50, 54 and 28 members of the TIFY gene family in three cultivated cotton species—Gossypium hirsutum, Gossypium barbadense and Gossypium arboretum—were identified, respectively. The results of phylogenetic analysis showed that these TIFY genes were divided into eight clusters. The different clusters of gene family members often have similar gene structures, including the number of exons. The results of quantitative reverse transcription polymerase chain reaction (qRT-PCR) showed that different JAZ genes displayed distinct expression patterns in the leaves of upland cotton under treatment with Gibberellin (GA), methyl jasmonate (MeJA), Jasmonic acid (JA) and abscisic acid (ABA). Different groups of JAZ genes exhibited different expression patterns in cotton leaves infected with Verticillium dahliae. The results of the comparative analysis of TIFY genes in the three cultivated species will be useful for understanding the involvement of these genes in development and stress resistance in cotton. PMID:28186193

  2. Organisation and structural evolution of the rice glutathione S-transferase gene family.

    PubMed

    Soranzo, N; Sari Gorla, M; Mizzi, L; De Toma, G; Frova, C

    2004-06-01

    Glutathione S-transferases (GSTs) comprise a large family of key defence enzymes against xenobiotic toxicity. Here we describe the comprehensive characterisation of this important multigene family in the model monocot species rice [ Oryza sativa(L.)]. Furthermore, we investigate the molecular evolution of the family based on the analysis of (1) the patterns of within-genome duplication, and (2) the phylogenetic relationships and evolutionary divergence among rice, Arabidopsis, maize and soybean GSTs. By in-silico screening of the EST and genome divisions of the Genbank/EMBL/DDBJ database we have isolated 59 putative genes and two pseudogenes, making this the largest plant GST family characterised to date. Of these, 38 (62%) are represented by genomic and EST sequences and 23 (38%) are known only from their genomic sequences. A preliminary survey of EST collections shows a large degree of variability in gene expression between different tissues and environmental conditions, with a small number of genes (13) accounting for 80% of all ESTs. Rice GSTs are organised in four main phylogenetic classes, with 91% of all rice genes belonging to the two plant-specific classes Tau (40 genes) and Phi (16 genes). Pairwise identity scores range between 17 and 98% for proteins of the same class, and 7 and 21% for interclass comparisons. Rapid evolution by gene duplication is suggested by the discovery of two large clusters of 7 and 23 closely related genes on chromosomes 1 and 10, respectively. A comparison of the complete GST families in two monocot and two dicot species suggests a monophyletic origin for all Theta and Zeta GSTs, and no more than three common ancestors for all Phi and Tau genes.

  3. Genome-wide analysis of the MADS-box gene family in Brassica rapa (Chinese cabbage).

    PubMed

    Duan, Weike; Song, Xiaoming; Liu, Tongkun; Huang, Zhinan; Ren, Jun; Hou, Xilin; Li, Ying

    2015-02-01

    The MADS-box gene family is an ancient and well-studied transcription factor family that functions in almost every developmental process in plants. There are a number of reports about the MADS-box family in different plant species, but systematic analysis of the MADS-box transcription factor family in Brassica rapa (Chinese cabbage) is still lacking. In this study, 160 MADS-box transcription factors were identified from the entire Chinese cabbage genome and compared with the MADS-box factors from 21 other representative plant species. A detailed list of MADS proteins from these 22 species was sorted. Phylogenetic analysis of the BrMADS genes, together with their Arabidopsis and rice counterparts, showed that the BrMADS genes were categorised into type I (Mα, Mβ, Mγ) and type II (MIKC(C), MIKC*) groups, and the MIKC(C) proteins were further divided into 13 subfamilies. The Chinese cabbage type II group has 95 members, which is twice as much as the Arabidopsis type II group, indicating that the Chinese cabbage type II genes have been retained more frequently than the type I genes. Finally, RNA-seq transcriptome data and quantitative real-time PCR analysis revealed that BrMADS genes are expressed in a tissue-specific manner similar to Arabidopsis. Interestingly, a number of BrMIKC genes showed responses to different abiotic stress treatments, suggesting a function for some of the genes in these processes as well. Taken together, the characterization of the B. rapa MADS-box family presented here, will certainly help in the selection of appropriate candidate genes and further facilitate functional studies in Chinese cabbage.

  4. The zebrafish progranulin gene family and antisense transcripts

    PubMed Central

    Cadieux, Benoît; Chitramuthu, Babykumari P; Baranowski, David; Bennett, Hugh PJ

    2005-01-01

    Background Progranulin is an epithelial tissue growth factor (also known as proepithelin, acrogranin and PC-cell-derived growth factor) that has been implicated in development, wound healing and in the progression of many cancers. The single mammalian progranulin gene encodes a glycoprotein precursor consisting of seven and one half tandemly repeated non-identical copies of the cystine-rich granulin motif. A genome-wide duplication event hypothesized to have occurred at the base of the teleost radiation predicts that mammalian progranulin may be represented by two co-orthologues in zebrafish. Results The cDNAs encoding two zebrafish granulin precursors, progranulins-A and -B, were characterized and found to contain 10 and 9 copies of the granulin motif respectively. The cDNAs and genes encoding the two forms of granulin, progranulins-1 and -2, were also cloned and sequenced. Both latter peptides were found to be encoded by precursors with a simplified architecture consisting of one and one half copies of the granulin motif. A cDNA encoding a chimeric progranulin which likely arises through the mechanism of trans-splicing between grn1 and grn2 was also characterized. A non-coding RNA gene with antisense complementarity to both grn1 and grn2 was identified which may have functional implications with respect to gene dosage, as well as in restricting the formation of the chimeric form of progranulin. Chromosomal localization of the four progranulin (grn) genes reveals syntenic conservation for grna only, suggesting that it is the true orthologue of mammalian grn. RT-PCR and whole-mount in situ hybridization analysis of zebrafish grns during development reveals that combined expression of grna and grnb, but not grn1 and grn2, recapitulate many of the expression patterns observed for the murine counterpart. This includes maternal deposition, widespread central nervous system distribution and specific localization within the epithelial compartments of various organs

  5. Multi-gene panel testing for hereditary cancer susceptibility in a rural Familial Cancer Program.

    PubMed

    Hermel, David J; McKinnon, Wendy C; Wood, Marie E; Greenblatt, Marc S

    2017-01-01

    This study explores our Familial Cancer Program's experience implementing multi-gene panel testing in a largely rural patient population. We conducted a retrospective review of patients undergoing panel testing between May 2011 and August 2015. Our goal was to evaluate factors that might be predictors of identifying variants (pathogenic or uncertain significance) and to assess clinical management changes due to testing. We utilized a structured family history tool to determine the significance of patient's family histories with respect to identification of genetic variants. A total of 227 patients underwent panel testing at our center and 67 patients (29.5 %) had variants identified, with 8 (3.5 %) having multiple variants. Overall, 44 patients (19.4 %) had a variant of uncertain significance (VUS) and 28 patients (12.3 %) had a pathogenic variant detected, with 10 (4.4 %) having pathogenic variants in highly penetrant genes. We found no statistical difference in patient familial and personal cancer history, age, rural status, Ashkenazi Jewish ancestry, insurance coverage and prior single-gene testing among those with pathogenic, VUS and negative panel testing results. There were no predictors of pathogenic variants on regression analysis. Panel testing changed cancer screening and management guidelines from that expected based on family history alone in 13.2 % of patients. Ultimately, cancer panel testing does yield critical information not identified by traditional single gene testing but maximal utility through a broad range of personal and family histories requires improved interpretation of variants.

  6. The GLI-Kruppel family of human genes

    SciTech Connect

    Ruppert, J.M.; Kinzler, K.W.; Wong, A.J.; Bigner, S.H.; Kao, F.T.; Law, M.L.; Seuanez, H.N.; O'Brien, S.J.; Vogelstein, B.

    1988-08-01

    Previous characterization of GLI, a gene found to be amplified and expressed in a subset of human brain tumors, revealed the presence of five tandem fingers related to those of Kruppel (Kr), a Drosophila segmentation gene of the gap class. The authors have used the GLI cDNA as a molecular probe to isolate related sequences from the human genome. Partial characterization of six related loci, including sequence determination, expression studies, and chromosome localization, revealed that each locus could encode a separate finger protein. The predicted proteins all had similar H-C links, i.e., a conserved stretch of 9 amino acids connecting the C-terminal histidine of one finger to the N-terminal cysteine of the next. On the basis of amino acid sequence and intron-exon organization, the genes could be placed into one of two subgroups: the GLI subgroup (with the consensus finger amino acid sequence (Y/F)XCX/sub 3/GCX/sub 3/(F/Y)X/sub 5/LX/sub 2/HX/sub 3-4/H(T/X)GEKP) or the Kr subgroup (with the consensus finger amino acid sequence (Y/F)XCX/sub 2/CX/sub 3/FX/sub 5/LX/sub 2/HXRXHTGEKP). Unlike GLI or Kr, most of the newly isolated genes were expressed in many adult tissues. The predicted proteins probably control the expression of other genes and, by analogy with Kr and GLI, may be important in human development, tissue-specific differentiation, or neoplasia.

  7. Cross-species gene-family fluctuations reveal the dynamics of horizontal transfers.

    PubMed

    Grilli, Jacopo; Romano, Mariacristina; Bassetti, Federico; Cosentino Lagomarsino, Marco

    2014-06-01

    Prokaryotes vary their protein repertoire mainly through horizontal transfer and gene loss. To elucidate the links between these processes and the cross-species gene-family statistics, we perform a large-scale data analysis of the cross-species variability of gene-family abundance (the number of members of the family found on a given genome). We find that abundance fluctuations are related to the rate of horizontal transfers. This is rationalized by a minimal theoretical model, which predicts this link. The families that are not captured by the model show abundance profiles that are markedly peaked around a mean value, possibly because of specific abundance selection. Based on these results, we define an abundance variability index that captures a family's evolutionary behavior (and thus some of its relevant functional properties) purely based on its cross-species abundance fluctuations. Analysis and model, combined, show a quantitative link between cross-species family abundance statistics and horizontal transfer dynamics, which can be used to analyze genome 'flux'. Groups of families with different values of the abundance variability index correspond to genome sub-parts having different plasticity in terms of the level of horizontal exchange allowed by natural selection.

  8. Unique Loss of the PYHIN Gene Family in Bats Amongst Mammals: Implications for Inflammasome Sensing

    PubMed Central

    Ahn, Matae; Cui, Jie; Irving, Aaron T.; Wang, Lin-Fa

    2016-01-01

    Recent genomic analysis of two bat species (Pteropus alecto and Myotis davidii) revealed the absence of the PYHIN gene family. This family is recognized as important immune sensors of intracellular self and foreign DNA and activators of the inflammasome and/or interferon pathways. Further assessment of a wider range of bat genomes was necessary to determine if this is a universal pattern for this large mammalian group. Here we expanded genomic analysis of this gene family to include ten bat species. We confirmed the complete loss of this gene family, with only a truncated AIM2 remaining in one species (Pteronotus parnellii). Divergence of the PYHIN gene loci between the bat lineages infers different loss-of-function histories during bat evolution. While all other major groups of placental mammals have at least one gene member, only bats have lost the entire family. This removal of inflammasome DNA sensors may indicate an important adaptation that is flight-induced and related, at least in part, to pathogen-host co-existence. PMID:26906452

  9. A family of Turandot-related genes in the humoral stress response of Drosophila.

    PubMed

    Ekengren, S; Hultmark, D

    2001-06-22

    The Drosophila Turandot A (TotA) gene was recently shown to encode a stress-induced humoral factor which gives increased resistance to the lethal effects of high temperature. Here we show that TotA belongs to a family of eight Tot genes distributed at three different sites in the Drosophila genome. All Tot genes are induced under stressful conditions such as bacterial infection, heat shock, paraquat feeding or exposure to ultraviolet light, suggesting that all members of this family play a role in Drosophila stress tolerance. The induction of the Tot genes differs in important respects from the heat shock response, such as the strong but delayed response to bacterial infection seen for several of the genes.

  10. Sessile snails, dynamic genomes: gene rearrangements within the mitochondrial genome of a family of caenogastropod molluscs

    PubMed Central

    2010-01-01

    Background Widespread sampling of vertebrates, which comprise the majority of published animal mitochondrial genomes, has led to the view that mitochondrial gene rearrangements are relatively rare, and that gene orders are typically stable across major taxonomic groups. In contrast, more limited sampling within the Phylum Mollusca has revealed an unusually high number of gene order arrangements. Here we provide evidence that the lability of the molluscan mitochondrial genome extends to the family level by describing extensive gene order changes that have occurred within the Vermetidae, a family of sessile marine gastropods that radiated from a basal caenogastropod stock during the Cenozoic Era. Results Major mitochondrial gene rearrangements have occurred within this family at a scale unexpected for such an evolutionarily young group and unprecedented for any caenogastropod examined to date. We determined the complete mitochondrial genomes of four species (Dendropoma maximum, D. gregarium, Eualetes tulipa, and Thylacodes squamigerus) and the partial mitochondrial genomes of two others (Vermetus erectus and Thylaeodus sp.). Each of the six vermetid gastropods assayed possessed a unique gene order. In addition to the typical mitochondrial genome complement of 37 genes, additional tRNA genes were evident in D. gregarium (trnK) and Thylacodes squamigerus (trnV, trnLUUR). Three pseudogenes and additional tRNAs found within the genome of Thylacodes squamigerus provide evidence of a past duplication event in this taxon. Likewise, high sequence similarities between isoaccepting leucine tRNAs in Thylacodes, Eualetes, and Thylaeodus suggest that tRNA remolding has been rife within this family. While vermetids exhibit gene arrangements diagnostic of this family, they also share arrangements with littorinimorph caenogastropods, with which they have been linked based on sperm morphology and primary sequence-based phylogenies. Conclusions We have uncovered major changes in gene

  11. Real-Time Evolution of a Subtelomeric Gene Family in Candida albicans

    PubMed Central

    Anderson, Matthew Z.; Wigen, Lauren J.; Burrack, Laura S.; Berman, Judith

    2015-01-01

    Subtelomeric regions of the genome are notable for high rates of sequence evolution and rapid gene turnover. Evidence of subtelomeric evolution has relied heavily on comparisons of historical evolutionary patterns to infer trends and frequencies of these events. Here, we describe evolution of the subtelomeric TLO gene family in Candida albicans during laboratory passaging for over 4000 generations. C. albicans is a commensal and opportunistic pathogen of humans and the TLO gene family encodes a subunit of the Mediator complex that regulates transcription and affects a range of virulence factors. We identified 16 distinct subtelomeric recombination events that altered the TLO repertoire. Ectopic recombination between subtelomeres on different chromosome ends occurred approximately once per 5000 generations and was often followed by loss of heterozygosity, resulting in the complete loss of one TLO gene sequence with expansion of another. In one case, recombination within TLO genes produced a novel TLO gene sequence. TLO copy number changes were biased, with some TLOs preferentially being copied to novel chromosome arms and other TLO genes being frequently lost. The majority of these nonreciprocal recombination events occurred either within the 3′ end of the TLO coding sequence or within a conserved 50-bp sequence element centromere-proximal to TLO coding sequence. Thus, subtelomeric recombination is a rapid mechanism of generating genotypic diversity through alterations in the number and sequence of related gene family members. PMID:25956943

  12. Multispecies Analysis of Expression Pattern Diversification in the Recently Expanded Insect Ly6 Gene Family

    PubMed Central

    Tanaka, Kohtaro; Hazbun, Alexis; Hijazi, Assia; Vreede, Barbara; Sucena, Élio

    2015-01-01

    Gene families often consist of members with diverse expression domains reflecting their functions in a wide variety of tissues. However, how the expression of individual members, and thus their tissue-specific functions, diversified during the course of gene family expansion is not well understood. In this study, we approached this question through the analysis of the duplication history and transcriptional evolution of a rapidly expanding subfamily of insect Ly6 genes. We analyzed different insect genomes and identified seven Ly6 genes that have originated from a single ancestor through sequential duplication within the higher Diptera. We then determined how the original embryonic expression pattern of the founding gene diversified by characterizing its tissue-specific expression in the beetle Tribolium castaneum, the butterfly Bicyclus anynana, and the mosquito Anopheles stephensi and those of its duplicates in three higher dipteran species, representing various stages of the duplication history (Megaselia abdita, Ceratitis capitata, and Drosophila melanogaster). Our results revealed that frequent neofunctionalization episodes contributed to the increased expression breadth of this subfamily and that these events occurred after duplication and speciation events at comparable frequencies. In addition, at each duplication node, we consistently found asymmetric expression divergence. One paralog inherited most of the tissue-specificities of the founder gene, whereas the other paralog evolved drastically reduced expression domains. Our approach attests to the power of combining a well-established duplication history with a comprehensive coverage of representative species in acquiring unequivocal information about the dynamics of gene expression evolution in gene families. PMID:25743545

  13. Genome-wide evolutionary characterization and expression analyses of WRKY family genes in Brachypodium distachyon.

    PubMed

    Wen, Feng; Zhu, Hong; Li, Peng; Jiang, Min; Mao, Wenqing; Ong, Chermaine; Chu, Zhaoqing

    2014-06-01

    Members of plant WRKY gene family are ancient transcription factors that function in plant growth and development and respond to biotic and abiotic stresses. In our present study, we have investigated WRKY family genes in Brachypodium distachyon, a new model plant of family Poaceae. We identified a total of 86 WRKY genes from B. distachyon and explored their chromosomal distribution and evolution, domain alignment, promoter cis-elements, and expression profiles. Combining the analysis of phylogenetic tree of BdWRKY genes and the result of expression profiling, results showed that most of clustered gene pairs had higher similarities in the WRKY domain, suggesting that they might be functionally redundant. Neighbour-joining analysis of 301 WRKY domains from Oryza sativa, Arabidopsis thaliana, and B. distachyon suggested that BdWRKY domains are evolutionarily more closely related to O. sativa WRKY domains than those of A. thaliana. Moreover, tissue-specific expression profile of BdWRKY genes and their responses to phytohormones and several biotic or abiotic stresses were analysed by quantitative real-time PCR. The results showed that the expression of BdWRKY genes was rapidly regulated by stresses and phytohormones, and there was a strong correlation between promoter cis-elements and the phytohormones-induced BdWRKY gene expression.

  14. Dichotomy in the NRT Gene Families of Dicots and Grass Species

    PubMed Central

    Plett, Darren; Toubia, John; Garnett, Trevor; Tester, Mark; Kaiser, Brent N.; Baumann, Ute

    2010-01-01

    A large proportion of the nitrate (NO3−) acquired by plants from soil is actively transported via members of the NRT families of NO3− transporters. In Arabidopsis, the NRT1 family has eight functionally characterised members and predominantly comprises low-affinity transporters; the NRT2 family contains seven members which appear to be high-affinity transporters; and there are two NRT3 (NAR2) family members which are known to participate in high-affinity transport. A modified reciprocal best hit (RBH) approach was used to identify putative orthologues of the Arabidopsis NRT genes in the four fully sequenced grass genomes (maize, rice, sorghum, Brachypodium). We also included the poplar genome in our analysis to establish whether differences between Arabidopsis and the grasses may be generally applicable to monocots and dicots. Our analysis reveals fundamental differences between Arabidopsis and the grass species in the gene number and family structure of all three families of NRT transporters. All grass species possessed additional NRT1.1 orthologues and appear to lack NRT1.6/NRT1.7 orthologues. There is significant separation in the NRT2 phylogenetic tree between NRT2 genes from dicots and grass species. This indicates that determination of function of NRT2 genes in grass species will not be possible in cereals based simply on sequence homology to functionally characterised Arabidopsis NRT2 genes and that proper functional analysis will be required. Arabidopsis has a unique NRT3.2 gene which may be a fusion of the NRT3.1 and NRT3.2 genes present in all other species examined here. This work provides a framework for future analysis of NO3− transporters and NO3− transport in grass crop species. PMID:21151904

  15. Clade classification of monolignol biosynthesis gene family members reveals target genes to decrease lignin in Lolium perenne.

    PubMed

    van Parijs, F R D; Ruttink, T; Boerjan, W; Haesaert, G; Byrne, S L; Asp, T; Roldán-Ruiz, I; Muylle, H

    2015-07-01

    In monocots, lignin content has a strong impact on the digestibility of the cell wall fraction. Engineering lignin biosynthesis requires a profound knowledge of the role of paralogues in the multigene families that constitute the monolignol biosynthesis pathway. We applied a bioinformatics approach for genome-wide identification of candidate genes in Lolium perenne that are likely to be involved in the biosynthesis of monolignols. More specifically, we performed functional subtyping of phylogenetic clades in four multigene families: 4CL, COMT, CAD and CCR. Essential residues were considered for functional clade delineation within these families. This classification was complemented with previously published experimental evidence on gene expression, gene function and enzymatic activity in closely related crops and model species. This allowed us to assign functions to novel identified L. perenne genes, and to assess functional redundancy among paralogues. We found that two 4CL paralogues, two COMT paralogues, three CCR paralogues and one CAD gene are prime targets for genetic studies to engineer developmentally regulated lignin in this species. Based on the delineation of sequence conservation between paralogues and a first analysis of allelic diversity, we discuss possibilities to further study the roles of these paralogues in lignin biosynthesis, including expression analysis, reverse genetics and forward genetics, such as association mapping. We propose criteria to prioritise paralogues within multigene families and certain SNPs within these genes for developing genotyping assays or increasing power in association mapping studies. Although L. perenne was the target of the analyses presented here, this functional subtyping of phylogenetic clades represents a valuable tool for studies investigating monolignol biosynthesis genes in other monocot species.

  16. A novel form of actin in Leishmania: molecular characterisation, subcellular localisation and association with subpellicular microtubules.

    PubMed

    Sahasrabuddhe, Amogh A; Bajpai, Virendra K; Gupta, Chhitar M

    2004-03-01

    To study the occurrence and subcellular distribution of actin in trypanosomatid parasites, we have cloned and overexpressed Leishmania donovani actin gene in bacteria, purified the protein, and employed the affinity purified rabbit polyclonal anti-recombinant actin antibodies as a probe to study the organisation and subcellular distribution of actin in Leishmania cells. The Leishmania actin did not cross react with antimammalian actin antibodies but was readily recognized by the anti-Leishmania actin antibodies in both the promastigote and amastigote forms of the parasite. About 10(6) copies per cell of this protein (M(r) 42.05 kDa) were present in the Leishmania promastigote. Unlike other eukaryotic actins, the oligomeric forms of Leishmania actin were not stained by phalloidin nor were dissociated by actin filament-disrupting agents, like Latrunculin B and Cytochalasin D. Analysis of the primary structure of this protein revealed that these unusual characteristics may be related to the presence of highly diverged amino acids in the DNase I-binding loop (amino acids 40-50) and the hydrophobic plug (amino acids 262-272) regions of Leishmania actin. The subcellular distribution of actin was studied in the Leishmania promastigotes by employing immunoelectron and immunofluorescence microscopies. This protein was present not only in the flagella, flagellar pocket, nucleus and the kinetoplast but it was also localized on the nuclear, vacuolar and cytoplasmic face of the plasma membranes. Further, the plasma membrane-associated actin was colocalised with subpellicular microtubules, while most of the actin present in the kinetoplast colocalised with the k-DNA network. These results clearly indicate that Leishmania contains a novel form of actin which may structurally and functionally differ from other eukaryotic actins. The functional significance of these observations is discussed.

  17. Cells Lacking β-Actin are Genetically Reprogrammed and Maintain Conditional Migratory Capacity*

    PubMed Central

    Tondeleir, Davina; Lambrechts, Anja; Müller, Matthias; Jonckheere, Veronique; Doll, Thierry; Vandamme, Drieke; Bakkali, Karima; Waterschoot, Davy; Lemaistre, Marianne; Debeir, Olivier; Decaestecker, Christine; Hinz, Boris; Staes, An; Timmerman, Evy; Colaert, Niklaas; Gevaert, Kris; Vandekerckhove, Joël; Ampe, Christophe

    2012-01-01

    Vertebrate nonmuscle cells express two actin isoforms: cytoplasmic β- and γ-actin. Because of the presence and localized translation of β-actin at the leading edge, this isoform is generally accepted to specifically generate protrusive forces for cell migration. Recent evidence also implicates β-actin in gene regulation. Cell migration without β-actin has remained unstudied until recently and it is unclear whether other actin isoforms can compensate for this cytoplasmic function and/or for its nuclear role. Primary mouse embryonic fibroblasts lacking β-actin display compensatory expression of other actin isoforms. Consistent with this preservation of polymerization capacity, β-actin knockout cells have unchanged lamellipodial protrusion rates despite a severe migration defect. To solve this paradox we applied quantitative proteomics revealing a broad genetic reprogramming of β-actin knockout cells. This also explains why reintroducing β-actin in knockout cells does not restore the affected cell migration. Pathway analysis suggested increased Rho-ROCK signaling, consistent with observed phenotypic changes. We therefore developed and tested a model explaining the phenotypes in β-actin knockout cells based on increased Rho-ROCK signaling and increased TGFβ production resulting in increased adhesion and contractility in the knockout cells. Inhibiting ROCK or myosin restores migration of β-actin knockout cells indicating that other actins compensate for β-actin in this process. Consequently, isoactins act redundantly in providing propulsive forces for cell migration, but β-actin has a unique nuclear function, regulating expression on transcriptional and post-translational levels, thereby preventing myogenic differentiation. PMID:22448045

  18. Genome-Wide Analysis of the Aquaporin Gene Family in Chickpea (Cicer arietinum L.).

    PubMed

    Deokar, Amit A; Tar'an, Bunyamin

    2016-01-01

    Aquaporins (AQPs) are essential membrane proteins that play critical role in the transport of water and many other solutes across cell membranes. In this study, a comprehensive genome-wide analysis identified 40 AQP genes in chickpea (Cicer arietinum L.). A complete overview of the chickpea AQP (CaAQP) gene family is presented, including their chromosomal locations, gene structure, phylogeny, gene duplication, conserved functional motifs, gene expression, and conserved promoter motifs. To understand AQP's evolution, a comparative analysis of chickpea AQPs with AQP orthologs from soybean, Medicago, common bean, and Arabidopsis was performed. The chickpea AQP genes were found on all of the chickpea chromosomes, except chromosome 7, with a maximum of six genes on chromosome 6, and a minimum of one gene on chromosome 5. Gene duplication analysis indicated that the expansion of chickpea AQP gene family might have been due to segmental and tandem duplications. CaAQPs were grouped into four subfamilies including 15 NOD26-like intrinsic proteins (NIPs), 13 tonoplast intrinsic proteins (TIPs), eight plasma membrane intrinsic proteins (PIPs), and four small basic intrinsic proteins (SIPs) based on sequence similarities and phylogenetic position. Gene structure analysis revealed a highly conserved exon-intron pattern within CaAQP subfamilies supporting the CaAQP family classification. Functional prediction based on conserved Ar/R selectivity filters, Froger's residues, and specificity-determining positions suggested wide differences in substrate specificity among the subfamilies of CaAQPs. Expression analysis of the AQP genes indicated that some of the genes are tissue-specific, whereas few other AQP genes showed differential expression in response to biotic and abiotic stresses. Promoter profiling of CaAQP genes for conserved cis-acting regulatory elements revealed enrichment of cis-elements involved in circadian control, light response, defense and stress responsiveness

  19. Genome-Wide Analysis of the Aquaporin Gene Family in Chickpea (Cicer arietinum L.)

    PubMed Central

    Deokar, Amit A.; Tar'an, Bunyamin

    2016-01-01

    Aquaporins (AQPs) are essential membrane proteins that play critical role in the transport of water and many other solutes across cell membranes. In this study, a comprehensive genome-wide analysis identified 40 AQP genes in chickpea (Cicer arietinum L.). A complete overview of the chickpea AQP (CaAQP) gene family is presented, including their chromosomal locations, gene structure, phylogeny, gene duplication, conserved functional motifs, gene expression, and conserved promoter motifs. To understand AQP's evolution, a comparative analysis of chickpea AQPs with AQP orthologs from soybean, Medicago, common bean, and Arabidopsis was performed. The chickpea AQP genes were found on all of the chickpea chromosomes, except chromosome 7, with a maximum of six genes on chromosome 6, and a minimum of one gene on chromosome 5. Gene duplication analysis indicated that the expansion of chickpea AQP gene family might have been due to segmental and tandem duplications. CaAQPs were grouped into four subfamilies including 15 NOD26-like intrinsic proteins (NIPs), 13 tonoplast intrinsic proteins (TIPs), eight plasma membrane intrinsic proteins (PIPs), and four small basic intrinsic proteins (SIPs) based on sequence similarities and phylogenetic position. Gene structure analysis revealed a highly conserved exon-intron pattern within CaAQP subfamilies supporting the CaAQP family classification. Functional prediction based on conserved Ar/R selectivity filters, Froger's residues, and specificity-determining positions suggested wide differences in substrate specificity among the subfamilies of CaAQPs. Expression analysis of the AQP genes indicated that some of the genes are tissue-specific, whereas few other AQP genes showed differential expression in response to biotic and abiotic stresses. Promoter profiling of CaAQP genes for conserved cis-acting regulatory elements revealed enrichment of cis-elements involved in circadian control, light response, defense and stress responsiveness

  20. Characterization of resistance gene analogues (RGAs) in Apple (Malus 6domestica Borkh.) and their evolutionary history of the Rosaceae family

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The family of resistance gene analogues (RGAs) with a nucleotide-binding site (NBS) domain accounts for the largest number of disease resistance genes and is one of the largest gene families in plants. We have identified 868 RGAs in the genome of the apple (Malus × domestica Borkh.) cultivar ‘Golden...

  1. Analysis of yeast isolates related to Metschnikowia pulcherrima using the partial sequences of the large subunit rDNA and the actin gene; description of Metschnikowia andauensis sp. nov.

    PubMed

    Molnár, Orsolya; Prillinger, Hansjörg

    2005-10-01

    Thirty-two yeast isolates were cultured from guts or excrements of three different pests of corn or from the stem of healthy corn. The strains were analyzed using MSP-PCR (micro/minisatellite-primed polymerase chain reaction), sequences of the D1/D2 region of the large subunit rDNA and a 979 bp long part of the actin gene (act-1). They seem to belong to three groups that are all sister groups of Metschnikowia pulcherrima, M. fructicola and M. chrysoperlae. A new species, Metschnikowia andauensis (HA 1657T) is described. In contrast to M. pulcherrima and M. fructicola, M. andauensis is well separated in the act-1 phylogenetic tree too.

  2. Distribution of mutations in the PEX gene in families with X-linked hypophosphataemic rickets (HYP).

    PubMed

    Rowe, P S; Oudet, C L; Francis, F; Sinding, C; Pannetier, S; Econs, M J; Strom, T M; Meitinger, T; Garabedian, M; David, A; Macher, M A; Questiaux, E; Popowska, E; Pronicka, E; Read, A P; Mokrzycki, A; Glorieux, F H; Drezner, M K; Hanauer, A; Lehrach, H; Goulding, J N; O'Riordan, J L

    1997-04-01

    Mutations in the PEX gene at Xp22.1 (phosphate-regulating gene with homologies to endopeptidases, on the X-chromosome), are responsible for X-linked hypophosphataemic rickets (HYP). Homology of PEX to the M13 family of Zn2+ metallopeptidases which include neprilysin (NEP) as prototype, has raised important questions regarding PEX function at the molecular level. The aim of this study was to analyse 99 HYP families for PEX gene mutations, and to correlate predicted changes in the protein structure with Zn2+ metallopeptidase gene function. Primers flanking 22 characterised exons were used to amplify DNA by PCR, and SSCP was then used to screen for mutations. Deletions, insertions, nonsense mutations, stop codons and splice mutations occurred in 83% of families screened for in all 22 exons, and 51% of a separate set of families screened in 17 PEX gene exons. Missense mutations in four regions of the gene were informative regarding function, with one mutation in the Zn2+-binding site predicted to alter substrate enzyme interaction and catalysis. Computer analysis of the remaining mutations predicted changes in secondary structure, N-glycosylation, protein phosphorylation and catalytic site molecular structure. The wide range of mutations that align with regions required for protease activity in NEP suggests that PEX also functions as a protease, and may act by processing factor(s) involved in bone mineral metabolism.

  3. Adaptation to drought in two wild tomato species: the evolution of the Asr gene family.

    PubMed

    Fischer, Iris; Camus-Kulandaivelu, Létizia; Allal, François; Stephan, Wolfgang

    2011-06-01

    Wild tomato species are a valuable system in which to study local adaptation to drought: they grow in diverse environments ranging from mesic to extremely arid conditions. Here, we investigate the evolution of members of the Asr (ABA/water stress/ripening induced) gene family, which have been reported to be involved in the water stress response. We analysed molecular variation in the Asr gene family in populations of two closely related species, Solanum chilense and Solanum peruvianum. We concluded that Asr1 has evolved under strong purifying selection. In contrast to previous reports, we did not detect evidence for positive selection at Asr2. However, Asr4 shows patterns consistent with local adaptation in an S. chilense population that lives in an extremely dry environment. We also discovered a new member of the gene family, Asr5. Our results show that the Asr genes constitute a dynamic gene family and provide an excellent example of tandemly arrayed genes that are of importance in adaptation. Taking the potential distribution of the species into account, it appears that S. peruvianum can cope with a great variety of environmental conditions without undergoing local adaptation, whereas S. chilense undergoes local adaptation more frequently.

  4. Challenges and solutions for gene identification in the presence of familial locus heterogeneity

    PubMed Central

    Rehman, Atteeq U; Santos-Cortez, Regie Lyn P; Drummond, Meghan C; Shahzad, Mohsin; Lee, Kwanghyuk; Morell, Robert J; Ansar, Muhammad; Jan, Abid; Wang, Xin; Aziz, Abdul; Riazuddin, Saima; Smith, Joshua D; Wang, Gao T; Ahmed, Zubair M; Gul, Khitab; Shearer, A Eliot; Smith, Richard J H; Shendure, Jay; Bamshad, Michael J; Nickerson, Deborah A; Hinnant, John; Khan, Shaheen N; Fisher, Rachel A; Ahmad, Wasim; Friderici, Karen H; Riazuddin, Sheikh; Friedman, Thomas B; Wilch, Ellen S; Leal, Suzanne M

    2015-01-01

    Next-generation sequencing (NGS) of exomes and genomes has accelerated the identification of genes involved in Mendelian phenotypes. However, many NGS studies fall short of identifying causal variants, with estimates for success rates as low as 25% for uncovering the pathological variant underlying disease etiology. An important reason for such failures is familial locus heterogeneity, where within a single pedigree causal variants in two or more genes underlie Mendelian trait etiology. As examples of intra- and inter-sibship familial locus heterogeneity, we present 10 consanguineous Pakistani families segregating hearing impairment due to homozygous variants in two different hearing impairment genes and a European-American pedigree in which hearing impairment is caused by four variants in three different genes. We have identified 41 additional pedigrees with syndromic and nonsyndromic hearing impairment for which a single previously reported hearing impairment gene has been identified but only segregates with the phenotype in a subset of affected pedigree members. We estimate that locus heterogeneity occurs in 15.3% (95% confidence interval: 11.9%, 19.9%) of the families in our collection. We demonstrate novel approaches to apply linkage analysis and homozygosity mapping (for autosomal recessive consanguineous pedigrees), which can be used to detect locus heterogeneity using either NGS or SNP array data. Results from linkage analysis and homozygosity mapping can also be used to group sibships or individuals most likely to be segregating the same causal variants and thereby increase the success rate of gene identification. PMID:25491636

  5. Analysis of factor VIII gene inversions in 164 unrelated hemophilia A families

    SciTech Connect

    Vnencak-Jones, L.; Phillips, J.A. III; Janco, R.L.

    1994-09-01

    Hemophilia A is an X-linked recessive disease with variable phenotype and both heterogeneous and wide spread mutations in the factor VIII (F8) gene. As a result, diagnostic carrier or prenatal testing often relies upon laborious DNA linkage analysis. Recently, inversion mutations resulting from an intrachromosomal recombination between DNA sequences in one of two A genes {approximately}500 kb upstream from the F8 gene and a homologous A gene in intron 22 of the F8 gene were identified and found in 45% of severe hemophiliacs. We have analyzed banked DNA collected since 1986 from affected males or obligate carrier females representing 164 unrelated hemophilia A families. The disease was sporadic in 37%, familial in 54% and in 10% of families incomplete information was given. A unique deletion was identified in 1/164, a normal pattern was observed in 110/164 (67%), and 53/164 (32%) families had inversion mutations with 43/53 (81%) involving the distal A gene (R3 pattern) and 10/53 (19%) involving the proximal A gene (R2 pattern). While 19% of all rearrangements were R2, in 35 families with severe disease (< 1% VIII:C activity) all 16 rearrangements seen were R3. In 18 families with the R3 pattern and known activities, 16 (89%) had levels < 1%, with the remaining 2 families having {le} 2.4% activity. Further, 18 referrals specifically noted the production of inhibitors and 8/18 (45%) had the R3 pattern. Our findings demonstrate that the R3 inversion mutation patterns is (1) only seen with VIII:C activity levels of {le} 2.4%, (2) seen in 46% of families with severe hemophilia, (3) seen in 45% of hemophiliacs known to have inhibitors, (4) not correlated with sporadic or familial disease and (5) not in disequilibrium with the Bcl I or Taq I intron 18 or ST14 polymorphisms. Finally, in families positive for an inversion mutation, direct testing offers a highly accurate and less expensive alternative to DNA linkage analysis.

  6. RefilinB (FAM101B) targets FilaminA to organize perinuclear actin networks and regulates nuclear shape

    PubMed Central

    Gay, Olivia; Gilquin, Benoît; Nakamura, Fumihiko; Jenkins, Zandra A.; McCartney, Rosannah; Krakow, Deborah; Deshiere, Alexandre; Assard, Nicole; Hartwig, John H.; Robertson, Stephen P.; Baudier, Jacques

    2011-01-01

    The intracellular localization and shape of the nucleus plays a central role in cellular and developmental processes. In fibroblasts, nuclear movement and shape are controlled by a specific perinuclear actin network made of contractile actin filament bundles called transmembrane actin-associated nuclear (TAN) lines that form a structure called the actin cap. The identification of regulatory proteins associated with this specific actin cytoskeletal dynamic is a priority for understanding actin-based changes in nuclear shape and position in normal and pathological situations. Here, we first identify a unique family of actin regulators, the refilin proteins (RefilinA and RefilinB), that stabilize specifically perinuclear actin filament bundles. We next identify the actin-binding filamin A (FLNA) protein as the downstream effector of refilins. Refilins act as molecular switches to convert FLNA from an actin branching protein into one that bundles. In NIH 3T3 fibroblasts, the RefilinB/FLNA complex organizes the perinuclear actin filament bundles forming the actin cap. Finally, we demonstrate that in epithelial normal murine mammary gland (NmuMG) cells, the RefilinB/FLNA complex controls formation of a new perinuclear actin network that accompanies nuclear shape changes during the epithelial–mesenchymal transition (EMT). Our studies open perspectives for further functional analyses of this unique actin-based network and shed light on FLNA function during development and in human syndromes associated with FLNA mutations. PMID:21709252

  7. Genome-wide investigation and transcriptome analysis of the WRKY gene family in Gossypium.

    PubMed

    Ding, Mingquan; Chen, Jiadong; Jiang, Yurong; Lin, Lifeng; Cao, YueFen; Wang, Minhua; Zhang, Yuting; Rong, Junkang; Ye, Wuwei

    2015-02-01

    WRKY transcription factors play important roles in various stress responses in diverse plant species. In cotton, this family has not been well studied, especially in relation to fiber development. Here, the genomes and transcriptomes of Gossypium raimondii and Gossypium arboreum were investigated to identify fiber development related WRKY genes. This represents the first comprehensive comparative study of WRKY transcription factors in both diploid A and D cotton species. In total, 112 G. raimondii and 109 G. arboreum WRKY genes were identified. No significant gene structure or domain alterations were detected between the two species, but many SNPs distributed unequally in exon and intron regions. Physical mapping revealed that the WRKY genes in G. arboreum were not located in the corresponding chromosomes of G. raimondii, suggesting great chromosome rearrangement in the diploid cotton genomes. The cotton WRKY genes, especially subgroups I and II, have expanded through multiple whole genome duplications and tandem duplications compared with other plant species. Sequence comparison showed many functionally divergent sites between WRKY subgroups, while the genes within each group are under strong purifying selection. Transcriptome analysis suggested that many WRKY genes participate in specific fiber development processes such as fiber initiation, elongation and maturation with different expression patterns between species. Complex WRKY gene expression such as differential Dt and At allelic gene expression in G. hirsutum and alternative splicing events were also observed in both diploid and tetraploid cottons during fiber development process. In conclusion, this study provides important information on the evolution and function of WRKY gene family in cotton species.

  8. Genome-wide analysis of the WRKY gene family in physic nut (Jatropha curcas L.).

    PubMed

    Xiong, Wangdan; Xu, Xueqin; Zhang, Lin; Wu, Pingzhi; Chen, Yaping; Li, Meiru; Jiang, Huawu; Wu, Guojiang

    2013-07-25

    The WRKY proteins, which contain highly conserved WRKYGQK amino acid sequences and zinc-finger-like motifs, constitute a large family of transcription factors in plants. They participate in diverse physiological and developmental processes. WRKY genes have been identified and characterized in a number of plant species. We identified a total of 58 WRKY genes (JcWRKY) in the genome of the physic nut (Jatropha curcas L.). On the basis of their conserved WRKY domain sequences, all of the JcWRKY proteins could be assigned to one of the previously defined groups, I-III. Phylogenetic analysis of JcWRKY genes with Arabidopsis and rice WRKY genes, and separately with castor bean WRKY genes, revealed no evidence of recent gene duplication in JcWRKY gene family. Analysis of transcript abundance of JcWRKY gene products were tested in different tissues under normal growth condition. In addition, 47 WRKY genes responded to at least one abiotic stress (drought, salinity, phosphate starvation and nitrogen starvation) in individual tissues (leaf, root and/or shoot cortex). Our study provides a useful reference data set as the basis for cloning and functional analysis of physic nut WRKY genes.

  9. Genome-Wide Analysis of the NADK Gene Family in Plants

    PubMed Central

    Li, Wen-Yan; Wang, Xiang; Li, Ri; Li, Wen-Qiang; Chen, Kun-Ming

    2014-01-01

    Background NAD(H) kinase (NADK) is the key enzyme that catalyzes de novo synthesis of NADP(H) from NAD(H) for NADP(H)-based metabolic pathways. In plants, NADKs form functional subfamilies. Studies of these families in Arabidopsis thaliana indicate that they have undergone considerable evolutionary selection; however, the detailed evolutionary history and functions of the various NADKs in plants are not clearly understood. Principal Findings We performed a comparative genomic analysis that identified 74 NADK gene homologs from 24 species representing the eight major plant lineages within the supergroup Plantae: glaucophytes, rhodophytes, chlorophytes, bryophytes, lycophytes, gymnosperms, monocots and eudicots. Phylogenetic and structural analysis classified these NADK genes into four well-conserved subfamilies with considerable variety in the domain organization and gene structure among subfamily members. In addition to the typical NAD_kinase domain, additional domains, such as adenylate kinase, dual-specificity phosphatase, and protein tyrosine phosphatase catalytic domains, were found in subfamily II. Interestingly, NADKs in subfamily III exhibited low sequence similarity (∼30%) in the kinase domain within the subfamily and with the other subfamilies. These observations suggest that gene fusion and exon shuffling may have occurred after gene duplication, leading to specific domain organization seen in subfamilies II and III, respectively. Further analysis of the exon/intron structures showed that single intron loss and gain had occurred, yielding the diversified gene structures, during the process of structural evolution of NADK family genes. Finally, both available global microarray data analysis and qRT-RCR experiments revealed that the NADK genes in Arabidopsis and Oryza sativa show different expression patterns in different developmental stages and under several different abiotic/biotic stresses and hormone treatments, underscoring the functional diversity

  10. OAS Gene Family Expression Is Associated with HIV-Related Neurocognitive Disorders.

    PubMed

    Sanfilippo, C; Pinzone, M R; Cambria, D; Longo, A; Palumbo, M; Di Marco, R; Condorelli, F; Nunnari, G; Malaguarnera, L; Di Rosa, M

    2017-02-24

    HIV-associated neurocognitive disorders are common in HIV-infected individuals, even in the combination antiretroviral therapy (c-ART) era. Several mechanisms are involved in neuronal damage, including chronic inflammation immune activation. Mammalian 2'-5'-oligoadenylate synthetase (OAS) genes are produced in response to interferon (IFN), mainly by monocytes, and exert their antiviral functions by activation of RNase L that degrades viral and cellular RNAs. In this study, we aimed at exploring OAS gene family RNA expression in simian immunodeficiency virus encephalitis (SIVE), in HIV-associated neurocognitive disorders (HAND), and in HIV-associate dementia (HAD). We analyzed three microarray datasets obtained from the NCBI in order to assess the expression levels of OAS gene family network in brain biopsies of macaques with SIVE vs uninfected animals, as well as post-mortem brain of individuals with HAND (on or off ART) vs uninfected controls and three brain regions of HIV-infected individuals with both neurocognitive impairment (HAD) and encephalitis (HIVE). All OAS genes were upregulated both in SIVE and in HAND. OAS expression was significantly higher in high-viremic individuals; increased expression levels persisted in cART subjects when compared to healthy controls. OAS gene network analysis showed that several genes belonging to the type I IFN pathway, especially CXCL10 and IFIT3, were similarly upregulated in SIVE/HAND. Furthermore, we identified a significant upregulation of OAS gene family RNA expression in basal ganglia, white matter, and frontal cortex of HIV-1, HAD, and HAD/HIVE patients compared to healthy subjects. OAS gene family expression is increased in brain sections from individuals with HAND, HAD, and HIVE as well as macaques with SIVE. OAS family expression is likely to be induced by IFN as a consequence of viral replication in the CNS. Its long-term upregulation may contribute to the chronic inflammatory status and neurocognitive impairment

  11. Genome-wide identification and analysis of the MADS-box gene family in sesame.

    PubMed

    Wei, Xin; Wang, Linhai; Yu, Jingyin; Zhang, Yanxin; Li, Donghua; Zhang, Xiurong

    2015-09-10

    MADS-box genes encode transcription factors that play crucial roles in plant growth and development. Sesame (Sesamum indicum L.) is an oil crop that contributes to the daily oil and protein requirements of almost half of the world's population; therefore, a genome-wide analysis of the MADS-box gene family is needed. Fifty-seven MADS-box genes were identified from 14 linkage groups of the sesame genome. Analysis of phylogenetic relationships with Arabidopsis thaliana, Utricularia gibba and Solanum lycopersicum MADS-box genes was performed. Sesame MADS-box genes were clustered into four groups: 28 MIKC(c)-type, 5 MIKC(⁎)-type, 14 Mα-type and 10 Mγ-type. Gene structure analysis revealed from 1 to 22 exons of sesame MADS-box genes. The number of exons in type II MADS-box genes greatly exceeded the number in type I genes. Motif distribution analysis of sesame MADS-box genes also indicated that type II MADS-box genes contained more motifs than type I genes. These results suggested that type II sesame MADS-box genes had more complex structures. By analyzing expression profiles of MADS-box genes in seven sesame transcriptomes, we determined that MIKC(C)-type MADS-box genes played significant roles in sesame flower and seed development. Although most MADS-box genes in the same clade showed similar expression features, some gene functions were diversified from the orthologous Arabidopsis genes. This research will contribute to uncovering the role of MADS-box genes in sesame development.

  12. A Gly65Val substitution in an actin, GhACT_LI1, disrupts cell polarity and membrane anchoring of F-actin resulting in dwarf, lintless Li1 cotton plants

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Actin polymerizes to form the cytoskeleton and organize polar growth in all eukaryotic cells. Species with numerous actin genes are especially useful for the dissection of actin molecular function due to redundancy and neofunctionalization. Here, we investigated the role of a cotton (Gossypium hi...

  13. Viral Replication Protein Inhibits Cellular Cofilin Actin Depolymerization Factor to Regulate the Actin Network and Promote Viral Replicase Assembly

    PubMed Central

    Kovalev, Nikolay; de Castro Martín, Isabel Fernández; Barajas, Daniel; Risco, Cristina; Nagy, Peter D.

    2016-01-01

    RNA viruses exploit host cells by co-opting host factors and lipids and escaping host antiviral responses. Previous genome-wide screens with Tomato bushy stunt virus (TBSV) in the model host yeast have identified 18 cellular genes that are part of the actin network. In this paper, we show that the p33 viral replication factor interacts with the cellular cofilin (Cof1p), which is an actin depolymerization factor. Using temperature-sensitive (ts) Cof1p or actin (Act1p) mutants at a semi-permissive temperature, we find an increased level of TBSV RNA accumulation in yeast cells and elevated in vitro activity of the tombusvirus replicase. We show that the large p33 containing replication organelle-like structures are located in the close vicinity of actin patches in yeast cells or around actin cable hubs in infected plant cells. Therefore, the actin filaments could be involved in VRC assembly and the formation of large viral replication compartments containing many individual VRCs. Moreover, we show that the actin network affects the recruitment of viral and cellular components, including oxysterol binding proteins and VAP proteins to form membrane contact sites for efficient transfer of sterols to the sites of replication. Altogether, the emerging picture is that TBSV, via direct interaction between the p33 replication protein and Cof1p, controls cofilin activities to obstruct the dynamic actin network that leads to efficient subversion of cellular factors for pro-viral functions. In summary, the discovery that TBSV interacts with cellular cofilin and blocks the severing of existing filaments and the formation of new actin filaments in infected cells opens a new window to unravel the way by which viruses could subvert/co-opt cellular proteins and lipids. By regulating the functions of cofilin and the actin network, which are central nodes in cellular pathways, viruses could gain supremacy in subversion of cellular factors for pro-viral functions. PMID:26863541

  14. Novel mutation of the NOTCH3 gene in a Polish family with CADASIL.

    PubMed

    Buczek, Julia; Błażejewska-Hyżorek, Beata; Cudna, Agnieszka; Lusawa, Małgorzata; Lewandowska, Eliza; Kurkowska-Jastrzębska, Iwona; Członkowska, Anna

    2016-01-01

    Cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL) is an inherited small blood vessels disease caused by mutations in the gene encoding the neurogenic locus notch homolog protein 3 (NOTCH 3). We present a Polish family with a previously unreported novel mutation in exon 12 c.1851C>C/G of the NOTCH3 gene and varying disease expression. One of the two family members with the confirmed mutation presented with all the main CADASIL symptoms; while, his affected father was nearly asymptomatic. Both family members had epilepsy, coronary artery disease, and abdominal aorta aneurysm. Our observation confirms there is phenotypic variability in CADASIL not only between, but also within, families carrying the same mutation.

  15. Phylogenetic conservation and physical mapping of members of the H6 homeobox gene family.

    PubMed

    Stadler, H S; Murray, J C; Leysens, N J; Goodfellow, P J; Solursh, M

    1995-06-01

    Homeobox genes represent a class of transcription factors that play key roles in the regulation of embryogenesis and development. Here we report the identification of a homeobox-containing gene family that is highly conserved at both the nucleotide and amino acid levels in a diverse number of species. These species encompass both vertebrate and invertebrate phylogenies, ranging from Homo sapiens to Drosophila melanogaster. In humans, at least two homeobox sequences from this family were identified representing a previously reported member of this family as well as a novel homeobox sequence that we physically mapped to the 10q25.2-q26.3 region of human Chromosome (Chr) 10. Multiple members of this family were also detected in three additional vertebrate species including Equus caballus (horse), Gallus gallus (Chicken), and Mus musculus (mouse), whereas only single members were detected in Tripneustes gratilla (sea urchin), Petromyzon marinus (lamprey), Salmo salar (salmon), Ovis aries (sheep), and D. melanogaster (fruit fly).

  16. A nonsense mutation in the LDL receptor gene leads to familial hypercholesterolemia in the Druze sect

    SciTech Connect

    Landsberger, D.; Meiner, V.; Reshef, A.; Leitersdorf, E. ); Levy, Yishai ); Westhytzen, D.R. van der; Coetzee, G.A. )

    1992-02-01

    Familial hypercholesterolemia (FH) is an autosomal dominant disease caused by mutations in the LDL receptor gene. Here the authors characterize and LDL receptor mutation that is associated with a distinct haplotype and causes FH in the Druze, a small Middle Eastern Islamic sect with a high degree of inbreeding. The mutation was found in FH families from two distinct Druze villages from the Golan Heights (northern Israel). It was not found either in another Druze FH family residing in a different geographical area nor in eight Arab and four Jewish FH heterozygote index cases whose hypercholesterolemia cosegregates with an identical LDL receptor gene haplotype. The mutation, a single-base substitution, results in a termination codon in exon 4 of the LDL receptor gene that encodes for the fourth repeat of the binding domain of the mature receptor. It can be diagnosed by allele-specific oligonucleotide hybridization of PCR-amplified DNA from FH patients.

  17. Cross-Family Transcription Factor Interactions: An Additional Layer of Gene Regulation.

    PubMed

    Bemer, Marian; van Dijk, Aalt D J; Immink, Richard G H; Angenent, Gerco C

    2017-01-01

    Specific and dynamic gene expression strongly depends on transcription factor (TF) activity and most plant TFs function in a combinatorial fashion. They can bind to DNA and control the expression of the corresponding gene in an additive fashion or cooperate by physical interactions, forming larger protein complexes. The importance of protein-protein interactions between members of a particular plant TF family has long been recognised; however, a significant number of interfamily TF interactions has recently been reported. The biological implications and the molecular mechanisms involved in cross-family interactions have now started to be elucidated and the examples illustrate potential roles in the bridging of biological processes. Hence, cross-family TF interactions expand the molecular toolbox for plants with additional mechanisms to control and fine-tune robust gene expression patterns and to adapt to their continuously changing environment.

  18. The ABC transporter gene family of Daphnia pulex

    PubMed Central

    Sturm, Armin; Cunningham, Phil; Dean, Michael

    2009-01-01

    Background The large gene superfamily of ABC (ATP-binding cassette) transporters encodes membrane proteins involved in trafficking processes across biological membranes and further essential cell biological functions. ABC transporters are evolutionary ancient and involved in the biochemical defence against toxicants. We report here a genome-wide survey of ABC proteins of Daphnia pulex, providing for the first time information on ABC proteins in crustacea, a primarily aquatic arthropod subphylum of high ecological and economical importance. Results We identified 64 ABC proteins in the Daphnia genome, which possesses members of all current ABC subfamilies A to H. To unravel phylogenetic relationships, ABC proteins of Daphnia were compared to those from yeast, worm, fruit fly and human. A high conservation of Daphnia of ABC transporters was observed for proteins involved in fundamental cellular processes, including the mitochondrial half transporters of the ABCB subfamily, which function in iron metabolism and transport of Fe/S protein precursors, and the members of subfamilies ABCD, ABCE and ABCF, which have roles in very long chain fatty acid transport, initiation of gene transcription and protein translation, respectively. A number of Daphnia proteins showed one-to-one orthologous relationships to Drosophila ABC proteins including the sulfonyl urea receptor (SUR), the ecdysone transporter ET23, and the eye pigment precursor transporter scarlet. As the fruit fly, Daphnia lacked homologues to the TAP protein, which plays a role in antigene processing, and the cystic fibrosis transmembrane conductance regulator (CFTR), which functions as a chloride channel. Daphnia showed two proteins homologous to MDR (multidrug resistance) P-glycoproteins (ABCB subfamily) and six proteins homologous to MRPs (multidrug resistance-associated proteins) (ABCC subfamily). However, lineage specific gene duplications in the ABCB and ABCC subfamilies complicated the inference of function. A

  19. Cloning and characterization of a second member of the mouse mdr gene family.

    PubMed Central

    Gros, P; Raymond, M; Bell, J; Housman, D

    1988-01-01

    The mammalian mdr gene family comprises a small number of closely related genes. Previously, we have shown that one member, mdr1, has the capacity to convey multidrug resistance to drug-sensitive recipient cells in a gene transfer protocol. However, the functional characteristics of other members of this gene family have not been examined. In this report, we characterize a second member of the mdr gene family which we designated mdr2. We determined the nucleotide sequence corresponding to the complete coding region of this mdr2 transcript. The predicted amino acid sequence of this protein (1,276 amino acids) showed that it is a membrane glycoprotein highly homologous to mdr1 (85%), strongly suggesting that both genes originate from a common ancestor. Regions of divergence between mdr1 and mdr2 proteins are concentrated in two discrete segments of the predicted polypeptides, each approximately 100 residues in length. The mdr2 protein appears to be formed by the duplication of a structural unit which encodes three putative transmembrane loops and a predicted nucleotide-binding fold and is highly homologous to bacterial transport proteins such as hlyB. This strong homology suggests that mdr2 also participates in an energy-dependent membrane transport process. However, the direct relationship, if any, of this new member of the mdr family to multidrug resistance remains to be established. Knowledge of the complete nucleotide sequence and predicted amino acid sequence of the mdr2 gene product will enable the preparation of gene-specific probes and antibodies necessary to study the functional role of this gene in multidrug resistance and normal physiological processes. PMID:3405218

  20. Evolutionary mechanisms driving the evolution of a large polydnavirus gene family coding for protein tyrosine phosphatases

    PubMed Central

    2012-01-01

    Background Gene duplications have been proposed to be the main mechanism involved in genome evolution and in acquisition of new functions. Polydnaviruses (PDVs), symbiotic viruses associated with parasitoid wasps, are ideal model systems to study mechanisms of gene duplications given that PDV genomes consist of virulence genes organized into multigene families. In these systems the viral genome is integrated in a wasp chromosome as a provirus and virus particles containing circular double-stranded DNA are injected into the parasitoids’ hosts and are essential for parasitism success. The viral virulence factors, organized in gene families, are required collectively to induce host immune suppression and developmental arrest. The gene family which encodes protein tyrosine phosphatases (PTPs) has undergone spectacular expansion in several PDV genomes with up to 42 genes. Results Here, we present strong indications that PTP gene family expansion occurred via classical mechanisms: by duplication of large segments of the chromosomally integrated form of the virus sequences (segmental duplication), by tandem duplications within this form and by dispersed duplications. We also propose a novel duplication mechanism specific to PDVs that involves viral circle reintegration into the wasp genome. The PTP copies produced were shown to undergo conservative evolution along with episodes of adaptive evolution. In particular recently produced copies have undergone positive selection in sites most likely involved in defining substrate selectivity. Conclusion The results provide evidence about the dynamic nature of polydnavirus proviral genomes. Classical and PDV-specific duplication mechanisms have been involved in the production of new gene copies. Selection pressures associated with antagonistic interactions with parasitized hosts have shaped these genes used to manipulate lepidopteran physiology with evidence for positive selection involved in adaptation to host targets. PMID

  1. Evolutionary Pattern and Regulation Analysis to Support Why Diversity Functions Existed within PPAR Gene Family Members

    PubMed Central

    Yan, Xiping; Wang, Guosong; Liu, Hehe; Gan, Xiang; Zhang, Tao; Wang, Jiwen; Li, Liang

    2015-01-01

    Peroxisome proliferators-activated receptor (PPAR) gene family members exhibit distinct patterns of distribution in tissues and differ in functions. The purpose of this study is to investigate the evolutionary impacts on diversity functions of PPAR members and the regulatory differences on gene expression patterns. 63 homology sequences of PPAR genes from 31 species were collected and analyzed. The results showed that three isolated types of PPAR gene family may emerge from twice times of gene duplication events. The conserved domains of HOLI (ligand binding domain of hormone receptors) domain and ZnF_C4 (C4 zinc finger in nuclear in hormone receptors) are essential for keeping basic roles of PPAR gene family, and the variant domains of LCRs may be responsible for their divergence in functions. The positive selection sites in HOLI domain are benefit for PPARs to evolve towards diversity functions. The evolutionary variants in the promoter regions and 3′ UTR regions of PPARs result into differential transcription factors and miRNAs involved in regulating PPAR members, which may eventually affect their expressions and tissues distributions. These results indicate that gene duplication event, selection pressure on HOLI domain, and the variants on promoter and 3′ UTR are essential for PPARs evolution and diversity functions acquired. PMID:25961030

  2. Sequence and Comparative Genomic Analysis of Actin-related ProteinsD⃞

    PubMed Central

    Muller, Jean; Oma, Yukako; Vallar, Laurent; Friederich, Evelyne; Poch, Olivier; Winsor, Barbara

    2005-01-01

    Actin-related proteins (ARPs) are key players in cytoskeleton activities and nuclear functions. Two complexes, ARP2/3 and ARP1/11, also known as dynactin, are implicated in actin dynamics and in microtubule-based trafficking, respectively. ARP4 to ARP9 are components of many chromatin-modulating complexes. Conventional actins and ARPs codefine a large family of homologous proteins, the actin superfamily, with a tertiary structure known as the actin fold. Because ARPs and actin share high sequence conservation, clear family definition requires distinct features to easily and systematically identify each subfamily. In this study we performed an in depth sequence and comparative genomic analysis of ARP subfamilies. A high-quality multiple alignment of ∼700 complete protein sequences homologous to actin, including 148 ARP sequences, allowed us to extend the ARP classification to new organisms. Sequence alignments revealed conserved residues, motifs, and inserted sequence signatures to define each ARP subfamily. These discriminative characteristics allowed us to develop ARPAnno (http://bips.u-strasbg.fr/ARPAnno), a new web server dedicated to the annotation of ARP sequences. Analyses of sequence conservation among actins and ARPs highlight part of the actin fold and suggest interactions between ARPs and actin-binding proteins. Finally, analysis of ARP distribution across eukaryotic phyla emphasizes the central importance of nuclear ARPs, particularly the multifunctional ARP4. PMID:16195354

  3. Distinct patterns of expression of the RB gene family in mouse and human retina.

    PubMed

    Spencer, Clarellen; Pajovic, Sanja; Devlin, Hollie; Dinh, Quynh-Dao; Corson, Timothy W; Gallie, Brenda L

    2005-06-01

    Although RB1 function is disrupted in the majority of human cancers, an undefined cell of developing human retina is uniquely sensitive to cancer induction when the RB1 tumor suppressor gene is lost. Murine retinoblastoma is initiated only when two of the RB family of genes, RB1 and p107 or p130, are inactivated. Although whole embryonic retina shows RB family gene expression by several techniques, when E14 developing retina was depleted of the earliest differentiating cells, ganglion cells, the remaining proliferating murine embryonic retinal progenitor cells clearly did not express RB1 or p130, while the longer splice form of p107 was expressed. Each retinal cell type expressed some member of the RB family at some stage of differentiation. Rod photoreceptors stained for the RB1 protein product, pRB, and p107 in only a brief window of postnatal murine development, with no detectable staining for any of the RB family proteins in adult human and mouse rod photoreceptors. Adult mouse and human Muller glia, ganglion and rare horizontal cells, and adult human, but not adult mouse, cone photoreceptors stained for pRB. The RB gene family is dynamically and variably expressed through retinal development in specific retinal cells.

  4. Evolutionary History of Cathepsin L (L-like) Family Genes in Vertebrates

    PubMed Central

    Zhou, Jin; Zhang, Yao-Yang; Li, Qing-Yun; Cai, Zhong-Hua

    2015-01-01

    Cathepsin L family, an important cysteine protease found in lysosomes, is categorized into cathepsins B, F, H, K, L, S, and W in vertebrates. This categorization is based on their sequence alignment and traditional functional classification, but the evolutionary relationship of family members is unclear. This study determined the evolutionary relationship of cathepsin L family genes in vertebrates through phylogenetic construction. Results showed that cathepsins F, H, S and K, and L and V were chronologically diverged. Tandem-repeat duplication was found to occur in the evolutionary history of cathepsin L family. Cathepsin L in zebrafish, cathepsins S and K in xenopus, and cathepsin L in mice and rats underwent evident tandem-repeat events. Positive selection was detected in cathepsin L-like members in mice and rats, and amino acid sites under positive selection pressure were calculated. Most of these sites appeared at the connection of secondary structures, suggesting that the sites may slightly change spatial structure. Severe positive selection was also observed in cathepsin V (L2) of primates, indicating that this enzyme had some special functions. Our work provided a brief evolutionary history of cathepsin L family and differentiated cathepsins S and K from cathepsin L based on vertebrate appearance. Positive selection was the specific cause of differentiation of cathepsin L family genes, confirming that gene function variation after expansion events was related to interactions with the environment and adaptability. PMID:26221069

  5. Evolutionary History of Cathepsin L (L-like) Family Genes in Vertebrates.

    PubMed

    Zhou, Jin; Zhang, Yao-Yang; Li, Qing-Yun; Cai, Zhong-Hua

    2015-01-01

    Cathepsin L family, an important cysteine protease found in lysosomes, is categorized into cathepsins B, F, H, K, L, S, and W in vertebrates. This categorization is based on their sequence alignment and traditional functional classification, but the evolutionary relationship of family members is unclear. This study determined the evolutionary relationship of cathepsin L family genes in vertebrates through phylogenetic construction. Results showed that cathepsins F, H, S and K, and L and V were chronologically diverged. Tandem-repeat duplication was found to occur in the evolutionary history of cathepsin L family. Cathepsin L in zebrafish, cathepsins S and K in xenopus, and cathepsin L in mice and rats underwent evident tandem-repeat events. Positive selection was detected in cathepsin L-like members in mice and rats, and amino acid sites under positive selection pressure were calculated. Most of these sites appeared at the connection of secondary structures, suggesting that the sites may slightly change spatial structure. Severe positive selection was also observed in cathepsin V (L2) of primates, indicating that this enzyme had some special functions. Our work provided a brief evolutionary history of cathepsin L family and differentiated cathepsins S and K from cathepsin L based on vertebrate appearance. Positive selection was the specific cause of differentiation of cathepsin L family genes, confirming that gene function variation after expansion events was related to interactions with the environment and adaptability.

  6. Different RET gene mutation-induced multiple endocrine neoplasia type 2A in 3 Chinese families

    PubMed Central

    Liu, Qiuli; Tong, Dali; Yuan, Wenqiang; Liu, Gaolei; Yuan, Gang; Lan, Weihua; Zhang, Dianzheng; Zhang, Jun; Huang, Zaoming; Zhang, Yao; Jiang, Jun

    2017-01-01

    Abstract Backgroud: Multiple endocrine neoplasia type 2A (MEN2A) is a condition with inherited autosomal dominant mutations in RET (rearranged during transfection) gene that predisposes the carrier to extremely high risk of medullary thyroid cancer (MTC) and other MEN2A-associated tumors such as parathyroid cancer and/or pheochromocytoma. Little is reported about MEN2A syndrome in the Chinese population. Methods: All members of the 3 families along with specific probands of MEN2A were analyzed for their clinical, laboratory, and genetic characteristics. Exome sequencing was performed on the 3 probands, and specific mutation in RET was further screened on each of the family members. Results: Different mutations in the RET gene were identified: C634S in Family 1, C611Y in Family 2, and C634Y in Family 3. Proband 1 mainly showed pheochromocytoma with MTC, both medullary thyroid carcinoma and pheochromocytoma were seen in proband 2, and proband 3 showed medullary thyroid carcinoma. Conclusion: The genetic evaluation is strongly recommended for patients with a positive family history, early onset of age, or multiple sites of masses. If the results verified the mutations of RET gene, thyroidectomy should be undertaken as the guide for better prognosis. PMID:28099363

  7. Genome-wide analysis of the omega-3 fatty acid desaturase gene family in Gossypium

    DOE PAGES

    Yurchenko, Olga P.; Park, Sunjung; Ilut, Daniel C.; ...

    2014-11-18

    The majority of commercial cotton varieties planted worldwide are derived from Gossypium hirsutum, which is a naturally occurring allotetraploid produced by interspecific hybridization of A- and D-genome diploid progenitor species. While most cotton species are adapted to warm, semi-arid tropical and subtropical regions, and thus perform well in these geographical areas, cotton seedlings are sensitive to cold temperature, which can significantly reduce crop yields. One of the common biochemical responses of plants to cold temperatures is an increase in omega-3 fatty acids, which protects cellular function by maintaining membrane integrity. The purpose of our study was to identify and characterizemore » the omega-3 fatty acid desaturase (FAD) gene family in G. hirsutum, with an emphasis on identifying omega-3 FADs involved in cold temperature adaptation. Results: Eleven omega-3 FAD genes were identified in G. hirsutum, and characterization of the gene family in extant A and D diploid species (G. herbaceum and G. raimondii, respectively) allowed for unambiguous genome assignment of all homoeologs in tetraploid G. hirsutum. The omega-3 FAD family of cotton includes five distinct genes, two of which encode endoplasmic reticulum-type enzymes (FAD3-1 and FAD3-2) and three that encode chloroplast-type enzymes (FAD7/8-1, FAD7/8-2, and FAD7/8-3). The FAD3-2 gene was duplicated in the A genome progenitor species after the evolutionary split from the D progenitor, but before the interspecific hybridization event that gave rise to modern tetraploid cotton. RNA-seq analysis revealed conserved, gene-specific expression patterns in various organs and cell types and semi-quantitative RT-PCR further revealed that FAD7/8-1 was specifically induced during cold temperature treatment of G. hirsutum seedlings. Conclusions: The omega-3 FAD gene family in cotton was characterized at the genome-wide level in three species, showing relatively ancient establishment of the gene family prior

  8. Genome-Wide Identification, Evolution and Expression Analysis of mTERF Gene Family in Maize

    PubMed Central

    Zhao, Yanxin; Cai, Manjun; Zhang, Xiaobo; Li, Yurong; Zhang, Jianhua; Zhao, Hailiang; Kong, Fei; Zheng, Yonglian; Qiu, Fazhan

    2014-01-01

    Plant mitochondrial transcription termination factor (mTERF) genes comprise a large family with important roles in regulating organelle gene expression. In this study, a comprehensive database search yielded 31 potential mTERF genes in maize (Zea mays L.) and most of them were targeted to mitochondria or chloroplasts. Maize mTERF were divided into nine main groups based on phylogenetic analysis, and group IX represented the mitochondria and species-specific clade that diverged from other groups. Tandem and segmental duplication both contributed to the expansion of the mTERF gene family in the maize genome. Comprehensive expression analysis of these genes, using microarray data and RNA-seq data, revealed that these genes exhibit a variety of expression patterns. Environmental stimulus experiments revealed differential up or down-regulation expression of maize mTERF genes in seedlings exposed to light/dark, salts and plant hormones, respectively, suggesting various important roles of maize mTERF genes in light acclimation and stress-related responses. These results will be useful for elucidating the roles of mTERF genes in the growth, development and stress response of maize. PMID:24718683

  9. Genome-wide identification and characterization of the Dof gene family in Medicago truncatula.

    PubMed

    Shu, Y J; Song, L L; Zhang, J; Liu, Y; Guo, C H

    2015-09-09

    The DNA-binding one zinc finger (Dof) family is a classic plant-specific zinc-finger transcription factor family, which is involved in many important processes, including seed maturation and germination, plant growth and development, and light responses. Investigation of the Medicago truncatula genome revealed 42 putative Dof genes, each of which holds one Dof domain. These genes were classified into four groups based on phylogenetic analysis, which are similar to the groups reported for Arabidopsis and rice. Based on genome duplication analysis, it was found that the MtDof genes were distributed on all chromosomes and had expanded through tandem gene duplication and segmental duplication events. Two main duplication regions were identified, one from tandem duplication and another from segmental duplication. By analyzing high-throughput sequencing data from M. truncatula, we found that most of the MtDof genes showed specific expression patterns in different tissues. According to cis-regulatory element analysis, these MtDof genes are regulated by different cis-acting motifs, which are important for the functional divergence of the MtDof genes in different processes. Thus, using genome-wide identification, evolution, and expression pattern analysis of the Dof genes in M. truncatula, our study provides valuable information for understanding the potential function of the Dof genes in regulating the growth and development of M. truncatula.

  10. Expression Pattern of ERF Gene Family under Multiple Abiotic Stresses in Populus simonii × P. nigra.

    PubMed

    Yao, Wenjing; Zhang, Xuemei; Zhou, Boru; Zhao, Kai; Li, Renhua; Jiang, Tingbo

    2017-01-01

    Identification of gene expression patterns of key genes across multiple abiotic stresses is critical for mechanistic understanding of stress resistance in plant. In the present study, we identified differentially expressed genes (DEGs) in di-haploid Populus simonii × P. nigra under respective stresses of NaCl, KCl, CdCl2, and PEG. On the basis of RNA-Seq, we detected 247 DEGs that are shared by the four stresses in wild type poplar, and mRNA abundance of the DEGs were validated in transgenic poplar overexpressing ERF76 gene by RNA-Seq and RT-qPCR. Results from gene ontology analysis indicated that these genes are enriched in significant pathways, such as phenylpropanoid biosynthesis, phenylalanine metabolism, starch and sucrose metabolism, and plant hormone signal transduction. Ethylene response factor (ERF) gene family plays significant role in plant abiotic stress responses. We also investigated expression pattern of ERF gene family under the four stresses. The ERFs and DEGs share similar expression pattern across the four stresses. The transgenic poplar is superior to WT in morphologic, physiological and biochemical traits, which demonstrated the ERF76 gene plays a significant role in stress resistance. These studies will give a rise in understanding the stress response mechanisms in poplar.

  11. Expression Pattern of ERF Gene Family under Multiple Abiotic Stresses in Populus simonii × P. nigra

    PubMed Central

    Yao, Wenjing; Zhang, Xuemei; Zhou, Boru; Zhao, Kai; Li, Renhua; Jiang, Tingbo

    2017-01-01

    Identification of gene expression patterns of key genes across multiple abiotic stresses is critical for mechanistic understanding of stress resistance in plant. In the present study, we identified differentially expressed genes (DEGs) in di-haploid Populus simonii × P. nigra under respective stresses of NaCl, KCl, CdCl2, and PEG. On the basis of RNA-Seq, we detected 247 DEGs that are shared by the four stresses in wild type poplar, and mRNA abundance of the DEGs were validated in transgenic poplar overexpressing ERF76 gene by RNA-Seq and RT-qPCR. Results fro