Science.gov

Sample records for activates gene transcription

  1. Mechanisms of specificity in neuronal activity-regulated gene transcription

    PubMed Central

    Lyons, Michelle R.; West, Anne E.

    2011-01-01

    The brain is a highly adaptable organ that is capable of converting sensory information into changes in neuronal function. This plasticity allows behavior to be accommodated to the environment, providing an important evolutionary advantage. Neurons convert environmental stimuli into long-lasting changes in their physiology in part through the synaptic activity-regulated transcription of new gene products. Since the neurotransmitter-dependent regulation of Fos transcription was first discovered nearly 25 years ago, a wealth of studies have enriched our understanding of the molecular pathways that mediate activity-regulated changes in gene transcription. These findings show that a broad range of signaling pathways and transcriptional regulators can be engaged by neuronal activity to sculpt complex programs of stimulus-regulated gene transcription. However, the shear scope of the transcriptional pathways engaged by neuronal activity raises the question of how specificity in the nature of the transcriptional response is achieved in order to encode physiologically relevant responses to divergent stimuli. Here we summarize the general paradigms by which neuronal activity regulates transcription while focusing on the molecular mechanisms that confer differential stimulus-, cell-type-, and developmental-specificity upon activity-regulated programs of neuronal gene transcription. In addition, we preview some of the new technologies that will advance our future understanding of the mechanisms and consequences of activity-regulated gene transcription in the brain. PMID:21620929

  2. The CREB Transcription Factor Controls Transcriptional Activity of the Human RIC8B Gene.

    PubMed

    Maureira, Alejandro; Sánchez, Rodolfo; Valenzuela, Nicole; Torrejón, Marcela; Hinrichs, María V; Olate, Juan; Gutiérrez, José L

    2016-08-01

    Proper regulation of gene expression is essential for normal development, cellular growth, and differentiation. Differential expression profiles of mRNA coding for vertebrate Ric-8B during embryo and adult stages have been observed. In addition, Ric-8B is expressed in few cerebral nuclei subareas. These facts point to a dynamic control of RIC8B gene expression. In order to understand the transcriptional regulation of this gene, we searched for cis-elements in the sequence of the human RIC8B promoter region, identifying binding sites for the basic/leucine zipper (bZip) CREB transcription factor family (CRE sites) and C/EBP transcription factor family (C/EBP sites). CRE sites were found clustered near the transcription start site, while the C/EBP sites were found clustered at around 300 bp upstream the CRE sites. Here, we demonstrate the ability of CREB1 and C/EBPβ to bind their respective elements identified in the RIC8B promoter. Comparative protein-DNA interaction analyses revealed only the proximal elements as high affinity sites for CREB1 and only the distal elements as high affinity sites for C/EBPβ. Chromatin immunoprecipitation analyses, carried out using a human neuroblastoma cell line, confirmed the preferential association of CREB to the proximal region of the RIC8B promoter. By performing luciferase reporter assays, we found the CRE sites as the most relevant elements for its transcriptional activity. Taken together, these data show the existence of functional CREB and C/EBP binding sites in the human RIC8B gene promoter, a particular distribution of these sites and demonstrate a relevant role of CREB in stimulating transcriptional activity of this gene. J. Cell. Biochem. 117: 1797-1805, 2016. © 2016 Wiley Periodicals, Inc. PMID:26729411

  3. Transcriptional Activation of the Cyclin A Gene by the Architectural Transcription Factor HMGA2

    PubMed Central

    Tessari, Michela A.; Gostissa, Monica; Altamura, Sandro; Sgarra, Riccardo; Rustighi, Alessandra; Salvagno, Clio; Caretti, Giuseppina; Imbriano, Carol; Mantovani, Roberto; Del Sal, Giannino; Giancotti, Vincenzo; Manfioletti, Guidalberto

    2003-01-01

    The HMGA2 protein belongs to the HMGA family of architectural transcription factors, which play an important role in chromatin organization. HMGA proteins are overexpressed in several experimental and human tumors and have been implicated in the process of neoplastic transformation. Hmga2 knockout results in the pygmy phenotype in mice and in a decreased growth rate of embryonic fibroblasts, thus indicating a role for HMGA2 in cell proliferation. Here we show that HMGA2 associates with the E1A-regulated transcriptional repressor p120E4F, interfering with p120E4F binding to the cyclin A promoter. Ectopic expression of HMGA2 results in the activation of the cyclin A promoter and induction of the endogenous cyclin A gene. In addition, chromatin immunoprecipitation experiments show that HMGA2 associates with the cyclin A promoter only when the gene is transcriptionally activated. These data identify the cyclin A gene as a cellular target for HMGA2 and, for the first time, suggest a mechanism for HMGA2-dependent cell cycle regulation. PMID:14645522

  4. Post-transcriptional gene silencing activity of human GIGYF2.

    PubMed

    Kryszke, Marie-Hélène; Adjeriou, Badia; Liang, Feifei; Chen, Hong; Dautry, François

    2016-07-01

    In mammalian post-transcriptional gene silencing, the Argonaute protein AGO2 indirectly recruits translation inhibitors, deadenylase complexes, and decapping factors to microRNA-targeted mRNAs, thereby repressing mRNA translation and accelerating mRNA decay. However, the exact composition and assembly pathway of the microRNA-induced silencing complex are not completely elucidated. As the GYF domain of human GIGYF2 was shown to bind AGO2 in pulldown experiments, we wondered whether GIGYF2 could be a novel protein component of the microRNA-induced silencing complex. Here we show that full-length GIGYF2 coimmunoprecipitates with AGO2 in human cells, and demonstrate that, upon tethering to a reporter mRNA, GIGYF2 exhibits strong, dose-dependent silencing activity, involving both mRNA destabilization and translational repression. PMID:27157137

  5. Transcriptional Activation of Inflammatory Genes: Mechanistic Insight into Selectivity and Diversity

    PubMed Central

    Ahmed, Afsar U.; Williams, Bryan R. G.; Hannigan, Gregory E.

    2015-01-01

    Acute inflammation, an integral part of host defence and immunity, is a highly conserved cellular response to pathogens and other harmful stimuli. An inflammatory stimulation triggers transcriptional activation of selective pro-inflammatory genes that carry out specific functions such as anti-microbial activity or tissue healing. Based on the nature of inflammatory stimuli, an extensive exploitation of selective transcriptional activations of pro-inflammatory genes is performed by the host to ensure a defined inflammatory response. Inflammatory signal transductions are initiated by the recognition of inflammatory stimuli by transmembrane receptors, followed by the transmission of the signals to the nucleus for differential gene activations. The differential transcriptional activation of pro-inflammatory genes is precisely controlled by the selective binding of transcription factors to the promoters of these genes. Among a number of transcription factors identified to date, NF-κB still remains the most prominent and studied factor for its diverse range of selective transcriptional activities. Differential transcriptional activities of NF-κB are dictated by post-translational modifications, specificities in dimer formation, and variability in activation kinetics. Apart from the differential functions of transcription factors, the transcriptional activation of selective pro-inflammatory genes is also governed by chromatin structures, epigenetic markers, and other regulators as the field is continuously expanding. PMID:26569329

  6. Transcriptional Activation of Inflammatory Genes: Mechanistic Insight into Selectivity and Diversity.

    PubMed

    Ahmed, Afsar U; Williams, Bryan R G; Hannigan, Gregory E

    2015-01-01

    Acute inflammation, an integral part of host defence and immunity, is a highly conserved cellular response to pathogens and other harmful stimuli. An inflammatory stimulation triggers transcriptional activation of selective pro-inflammatory genes that carry out specific functions such as anti-microbial activity or tissue healing. Based on the nature of inflammatory stimuli, an extensive exploitation of selective transcriptional activations of pro-inflammatory genes is performed by the host to ensure a defined inflammatory response. Inflammatory signal transductions are initiated by the recognition of inflammatory stimuli by transmembrane receptors, followed by the transmission of the signals to the nucleus for differential gene activations. The differential transcriptional activation of pro-inflammatory genes is precisely controlled by the selective binding of transcription factors to the promoters of these genes. Among a number of transcription factors identified to date, NF-κB still remains the most prominent and studied factor for its diverse range of selective transcriptional activities. Differential transcriptional activities of NF-κB are dictated by post-translational modifications, specificities in dimer formation, and variability in activation kinetics. Apart from the differential functions of transcription factors, the transcriptional activation of selective pro-inflammatory genes is also governed by chromatin structures, epigenetic markers, and other regulators as the field is continuously expanding. PMID:26569329

  7. Effect Of Simulated Microgravity On Activated T Cell Gene Transcription

    NASA Technical Reports Server (NTRS)

    Morrow, Maureen A.

    2003-01-01

    Studies of T lymphocytes under the shear stress environment of clinorotation have demonstrated an inhibition of activation in response to TCR mediated signaling. These results mimic those observed during space flight. This work investigates the molecular signaling events of T lymphocyte activation with clinorotation. Purified human T lymphocytes and the T cell clone Jurkat exhibit an uncoupling of signaling as mediated through the TCR. Activation of the transcription factor AP-1 is inhibited while activation of NFAT occurs. NFAT dephosphorylation and activation is dependent on sustained Ca(++) influx. Alternatively, AP-1, which consists of two transcription factors, jun and fos, is activated by PKC and Ras mediated pathways. TCR signaling is known to be dependent on cytoskeletal rearrangements, in particular, raft aggregation is critical. Raft aggregation, as mediated through GM, crosslinking, overcomes the inhibition of T lymphocyte activation with clinorotation, indicating that the block is occurring upstream of raft aggregation. Clinorotation is shown to have an effect similar to a weak TCR signal.

  8. Manganese peroxidase gene transcription in Phanerochaete chrysosporium: Activation by manganese

    SciTech Connect

    Brown, J.A.; Alic, M. Gold, M.H. )

    1991-07-01

    The expression of manganese peroxidase in nitrogen-limited cultures of Phanerochaete chrysosporium is dependent on Mn, and initial work suggested that Mn regulates transcription of the mnp gene. In this study, using Northern (RNA) blot analysis of kinetic, dose-response, and inhibitor experiments, the authors demonstrate unequivocally that Mn regulates mnp gene transcription. The amount of mnp mRNA in cells of 4-day-old nitrogen-limited cultures is a direct function of the concentration of Mn in the culture medium up to a maximum of 180 {mu}M. Addition of Mn to nitrogen-limited Mn-deficient secondary metabolic (4-, 5-, and 6-day-old) cultures results in the appearance of mnp mRNA within 40 min. The appearance of this message is completely inhibited by the RNA synthesis inhibitor dactinomycin but not by the protein synthesis inhibitor cycloheximide. Furthermore, the amount of mnp mRNA produced is a direct function of the concentration of added Mn. In contrast, addition of Mn to low-nitrogen Mn-deficient 2- or 3-day-old cultures does not result in the appearance of mnp mRNA. Manganese peroxidase protein is detected by specific immunoprecipitation of the in vitro translation products of poly(A) RNA isolated from Mn-supplemented (but nor from Mn-deficient) cells. All of these results demonstrate that Mn, the substrate for the enzyme, regulates mnp gene transcription via a growth-stage-specific and concentration-dependent mechanism.

  9. E proteins are required to activate germline transcription of the TCR Vbeta8.2 gene.

    PubMed

    Jia, Jingquan; Dai, Meifang; Zhuang, Yuan

    2008-10-01

    Each TCR Vbeta gene is regulated by an individual Vbeta promoter, which becomes active prior to V(D) J recombination and drives germline transcription. It has been shown that Vbeta gene locus activation and recombination are dependent on the Vbeta promoter. However, transcription factors that regulate Vbeta germline transcription remain largely undefined. A major challenge in studying Vbeta gene germline transcription is the quantitative assessment of relatively low-level transcripts in T-cell progenitors. Here we used the established Vbeta8.2(CD2) knock-in mouse model to assess functions of E-protein transcription factors in Vbeta8.2 germline transcription. We show that E proteins are required for the activation but not the maintenance of the Vbeta8.2 germline transcription during thymocyte development. The activation of Vbeta8.2 germline transcription depends more on the E proteins encoded by the E2A gene than by the HEB gene. We further show that IL-7 receptor (IL-7R)-mediated signals are essential for Vbeta8.2 germline transcription. We provide evidence that IL-7R expression is only partially controlled by E2A, suggesting a role for E2A in driving Vbeta8.2 germline transcription independent of IL-7R activation. PMID:18958875

  10. Fur-mediated activation of gene transcription in the human pathogen Neisseria gonorrhoeae.

    PubMed

    Yu, Chunxiao; Genco, Caroline Attardo

    2012-04-01

    It is well established that the ferric uptake regulatory protein (Fur) functions as a transcriptional repressor in diverse microorganisms. Recent studies demonstrated that Fur also functions as a transcriptional activator. In this study we defined Fur-mediated activation of gene transcription in the sexually transmitted disease pathogen Neisseria gonorrhoeae. Analysis of 37 genes which were previously determined to be iron induced and which contained putative Fur boxes revealed that only 30 of these genes exhibited reduced transcription in a gonococcal fur mutant strain. Fur-mediated activation was established by examining binding of Fur to the putative promoter regions of 16 Fur-activated genes with variable binding affinities observed. Only ∼50% of the newly identified Fur-regulated genes bound Fur in vitro, suggesting that additional regulatory circuits exist which may function through a Fur-mediated indirect mechanism. The gonococcal Fur-activated genes displayed variable transcription patterns in a fur mutant strain, which correlated with the position of the Fur box in each (promoter) region. These results suggest that Fur-mediated direct transcriptional activation is fulfilled by multiple mechanisms involving either competing with a repressor or recruiting RNA polymerase. Collectively, our studies have established that gonococcal Fur functions as an activator of gene transcription through both direct and indirect mechanisms. PMID:22287521

  11. Cohesin and Polycomb Proteins Functionally Interact to Control Transcription at Silenced and Active Genes

    PubMed Central

    Schaaf, Cheri A.; Misulovin, Ziva; Gause, Maria; Koenig, Amanda; Gohara, David W.; Watson, Audrey; Dorsett, Dale

    2013-01-01

    Cohesin is crucial for proper chromosome segregation but also regulates gene transcription and organism development by poorly understood mechanisms. Using genome-wide assays in Drosophila developing wings and cultured cells, we find that cohesin functionally interacts with Polycomb group (PcG) silencing proteins at both silenced and active genes. Cohesin unexpectedly facilitates binding of Polycomb Repressive Complex 1 (PRC1) to many active genes, but their binding is mutually antagonistic at silenced genes. PRC1 depletion decreases phosphorylated RNA polymerase II and mRNA at many active genes but increases them at silenced genes. Depletion of cohesin reduces long-range interactions between Polycomb Response Elements in the invected-engrailed gene complex where it represses transcription. These studies reveal a previously unrecognized role for PRC1 in facilitating productive gene transcription and provide new insights into how cohesin and PRC1 control development. PMID:23818863

  12. The yeast Hot1 transcription factor is critical for activating a single target gene, STL1

    PubMed Central

    Bai, Chen; Tesker, Masha; Engelberg, David

    2015-01-01

    Transcription factors are commonly activated by signal transduction cascades and induce expression of many genes. They therefore play critical roles in determining the cell's fate. The yeast Hog1 MAP kinase pathway is believed to control the transcription of hundreds of genes via several transcription factors. To identify the bona fide target genes of Hog1, we inducibly expressed the spontaneously active variant Hog1D170A+F318L in cells lacking the Hog1 activator Pbs2. This system allowed monitoring the effects of Hog1 by itself. Expression of Hog1D170A+F318L in pbs2∆ cells imposed induction of just 105 and suppression of only 26 transcripts by at least twofold. We looked for the Hog1-responsive element within the promoter of the most highly induced gene, STL1 (88-fold). A novel Hog1 responsive element (HoRE) was identified and shown to be the direct target of the transcription factor Hot1. Unexpectedly, we could not find this HoRE in any other yeast promoter. In addition, the only gene whose expression was abolished in hot1∆ cells was STL1. Thus Hot1 is essential for transcription of just one gene, STL1. Hot1 may represent a class of transcription factors that are essential for transcription of a very few genes or even just one. PMID:25904326

  13. Distinct DNA-based epigenetic switches trigger transcriptional activation of silent genes in human dermal fibroblasts

    PubMed Central

    Pandian, Ganesh N.; Taniguchi, Junichi; Junetha, Syed; Sato, Shinsuke; Han, Le; Saha, Abhijit; AnandhaKumar, Chandran; Bando, Toshikazu; Nagase, Hiroki; Vaijayanthi, Thangavel; Taylor, Rhys D.; Sugiyama, Hiroshi

    2014-01-01

    The influential role of the epigenome in orchestrating genome-wide transcriptional activation instigates the demand for the artificial genetic switches with distinct DNA sequence recognition. Recently, we developed a novel class of epigenetically active small molecules called SAHA-PIPs by conjugating selective DNA binding pyrrole-imidazole polyamides (PIPs) with the histone deacetylase inhibitor SAHA. Screening studies revealed that certain SAHA-PIPs trigger targeted transcriptional activation of pluripotency and germ cell genes in mouse and human fibroblasts, respectively. Through microarray studies and functional analysis, here we demonstrate for the first time the remarkable ability of thirty-two different SAHA-PIPs to trigger the transcriptional activation of exclusive clusters of genes and noncoding RNAs. QRT-PCR validated the microarray data, and some SAHA-PIPs activated therapeutically significant genes like KSR2. Based on the aforementioned results, we propose the potential use of SAHA-PIPs as reagents capable of targeted transcriptional activation. PMID:24457603

  14. Assessment of anaerobic toluene biodegradation activity by bssA transcript/gene ratios.

    PubMed

    Brow, Christina N; O'Brien Johnson, Reid; Johnson, Richard L; Simon, Holly M

    2013-09-01

    Benzylsuccinate synthase (bssA) genes associated with toluene degradation were profiled across a groundwater contaminant plume under nitrate-reducing conditions and were detected in significant numbers throughout the plume. However, differences between groundwater and core sediment samples suggested that microbial transport, rather than local activity, was the underlying cause of the high copy numbers within the downgradient plume. Both gene transcript and reactant concentrations were consistent with this hypothesis. Expression of bssA genes from denitrifying toluene degraders was induced by toluene but only in the presence of nitrate, and transcript abundance dropped rapidly following the removal of either toluene or nitrate. The drop in bssA transcripts following the removal of toluene could be described by an exponential decay function with a half-life on the order of 1 h. Interestingly, bssA transcripts never disappeared completely but were always detected at some level if either inducer was present. Therefore, the detection of transcripts alone may not be sufficient evidence for contaminant degradation. To avoid mistakenly associating basal-level gene expression with actively degrading microbial populations, an integrated approach using the ratio of functional gene transcripts to gene copies is recommended. This approach minimizes the impact of microbial transport on activity assessment and allows reliable assessments of microbial activity to be obtained from water samples. PMID:23811506

  15. Helix-loop-helix transcription factors mediate activation and repression of the p75LNGFR gene.

    PubMed Central

    Chiaramello, A; Neuman, K; Palm, K; Metsis, M; Neuman, T

    1995-01-01

    Sequence analysis of rat and human low-affinity nerve growth factor receptor p75LNGFR gene promoter regions revealed a single E-box cis-acting element, located upstream of the major transcription start sites. Deletion analysis of the E-box sequence demonstrated that it significantly contributes to p75LNGFR promoter activity. This E box has a dual function; it mediates either activation or repression of the p75LNGFR promoter activity, depending on the interacting transcription factors. We showed that the two isoforms of the class A basic helix-loop-helix (bHLH) transcription factor ME1 (ME1a and ME1b), the murine homolog of the human HEB transcription factor, specifically repress p75LNGFR promoter activity. This repression can be released by coexpression of the HLH Id2 transcriptional regulator. In vitro analyses demonstrated that ME1a forms a stable complex with the p75LNGFR E box and likely competes with activating E-box-binding proteins. By using ME1a-overexpressing PC12 cells, we showed that the endogenous p75LNGFR gene is a target of ME1a repression. Together, these data demonstrate that the p75LNGFR E box and the interacting bHLH transcription factors are involved in the regulation of p75LNGFR gene expression. These results also show that class A bHLH transcription factors can repress and Id-like negative regulators can stimulate gene expression. PMID:7565756

  16. Encoding four gene expression programs in the activation dynamics of a single transcription factor.

    PubMed

    Hansen, Anders S; O'Shea, Erin K

    2016-04-01

    Cellular signaling response pathways often exhibit a bow-tie topology [1,2]: multiple upstream stress signals converge on a single shared transcription factor, which is thought to induce different downstream gene expression programs (Figure 1A). However, if several different signals activate the same transcription factor, can each signal then induce a specific gene expression response? A growing body of literature supports a temporal coding theory where information about environmental signals can be encoded, at least partially, in the temporal dynamics of the shared transcription factor [1,2]. For example, in the case of the budding yeast transcription factor Msn2, different stresses induce distinct Msn2 activation dynamics: Msn2 shows pulsatile nuclear activation with dose-dependent frequency under glucose limitation, but sustained nuclear activation with dose-dependent amplitude under oxidative stress [3]. These dynamic patterns can then lead to differential gene expression responses [3-5], but it is not known how much specificity can be obtained. Thus, a major question of this temporal coding theory is how many gene response programs or cellular functions can be robustly encoded by dynamic control of a single transcription factor. Here we provide the first direct evidence that, simply by regulating the activation dynamics of a single transcription factor, it is possible to preferentially induce four distinct gene expression programs. PMID:27046808

  17. Inhibition of human insulin gene transcription and MafA transcriptional activity by the dual leucine zipper kinase

    PubMed Central

    Stahnke, Marie-Jeannette; Dickel, Corinna; Schröder, Sabine; Kaiser, Diana; Blume, Roland; Stein, Roland; Pouponnot, Celio; Oetjen, Elke

    2016-01-01

    Insulin biosynthesis is an essential β-cell function and inappropriate insulin secretion and biosynthesis contribute to the pathogenesis of diabetes mellitus type 2. Previous studies showed that the dual leucine zipper kinase (DLK) induces β-cell apoptosis. Since β-cell dysfunction precedes β-cell loss, in the present study the effect of DLK on insulin gene transcription was investigated in the HIT-T15 β-cell line. Downregulation of endogenous DLK increased whereas overexpression of DLK decreased human insulin gene transcription. 5′- and 3′-deletion human insulin promoter analyses resulted in the identification of a DLK responsive element that mapped to the DNA binding-site for the β-cell specific transcription factor MafA. Overexpression of DLK wild-type but not its kinase-dead mutant inhibited MafA transcriptional activity conferred by its transactivation domain. Furthermore, in the non-β-cell line JEG DLK inhibited MafA overexpression-induced human insulin promoter activity. Overexpression of MafA and DLK or its kinase-dead mutant into JEG cells revealed that DLK but not its mutant reduced MafA protein content. Inhibition of the down-stream DLK kinase c-Jun N-terminal kinase (JNK) by SP600125 attenuated DLK-induced MafA loss. Furthermore, mutation of the serine 65 to alanine, shown to confer MafA protein stability, increased MafA-dependent insulin gene transcription and prevented DLK-induced MafA loss in JEG cells. These data suggest that DLK by activating JNK triggers the phosphorylation and degradation of MafA thereby attenuating insulin gene transcription. Given the importance of MafA for β-cell function, the inhibition of DLK might preserve β-cell function and ultimately retard the development of diabetes mellitus type 2. PMID:24726898

  18. Inhibition of human insulin gene transcription and MafA transcriptional activity by the dual leucine zipper kinase.

    PubMed

    Stahnke, Marie-Jeannette; Dickel, Corinna; Schröder, Sabine; Kaiser, Diana; Blume, Roland; Stein, Roland; Pouponnot, Celio; Oetjen, Elke

    2014-09-01

    Insulin biosynthesis is an essential β-cell function and inappropriate insulin secretion and biosynthesis contribute to the pathogenesis of diabetes mellitus type 2. Previous studies showed that the dual leucine zipper kinase (DLK) induces β-cell apoptosis. Since β-cell dysfunction precedes β-cell loss, in the present study the effect of DLK on insulin gene transcription was investigated in the HIT-T15 β-cell line. Downregulation of endogenous DLK increased whereas overexpression of DLK decreased human insulin gene transcription. 5'- and 3'-deletion human insulin promoter analyses resulted in the identification of a DLK responsive element that mapped to the DNA binding-site for the β-cell specific transcription factor MafA. Overexpression of DLK wild-type but not its kinase-dead mutant inhibited MafA transcriptional activity conferred by its transactivation domain. Furthermore, in the non-β-cell line JEG DLK inhibited MafA overexpression-induced human insulin promoter activity. Overexpression of MafA and DLK or its kinase-dead mutant into JEG cells revealed that DLK but not its mutant reduced MafA protein content. Inhibition of the down-stream DLK kinase c-Jun N-terminal kinase (JNK) by SP600125 attenuated DLK-induced MafA loss. Furthermore, mutation of the serine 65 to alanine, shown to confer MafA protein stability, increased MafA-dependent insulin gene transcription and prevented DLK-induced MafA loss in JEG cells. These data suggest that DLK by activating JNK triggers the phosphorylation and degradation of MafA thereby attenuating insulin gene transcription. Given the importance of MafA for β-cell function, the inhibition of DLK might preserve β-cell function and ultimately retard the development of diabetes mellitus type 2. PMID:24726898

  19. Transcriptional activation of jun and actin genes by estrogen during mitogenic stimulation of rat uterine cells.

    PubMed

    Cicatiello, L; Ambrosino, C; Coletta, B; Scalona, M; Sica, V; Bresciani, F; Weisz, A

    1992-03-01

    Estrogens induce transcriptional activation of c-fos and c-myc proto-oncogenes during mitogenic stimulation of human, chicken, mouse and rat cells in vivo and in vitro. In this paper we show that 17 beta-estradiol injected into adult ovariectomized rats increases c-jun, jun-B and jun-D gene transcription in the uterus. Kinetics and amplitude of response are different for each gene, since c-jun is activated first, within 30 min after injection, followed by jun-D and jun-B, 60 and 90 min after injection, respectively. Maximal activation of jun-B marks a drop in transcription of all the jun genes. Furthermore, transcriptional activation by 17 beta-estradiol of the growth-regulated beta- and gamma-cytoskeletal actin genes is prevented by an inhibitor of protein synthesis, indicating that it is a secondary response to the hormone. These data support the hypothesis that during growth stimulation of target cells the estrogen receptor induces transcription of regulatory genes, triggering in this way a cascade of gene regulation events that results in progression through the cell cycle. PMID:1373300

  20. ZXDC, a novel zinc finger protein that binds CIITA and activates MHC gene transcription

    PubMed Central

    Al-Kandari, Wafa; Jambunathan, Srikarthika; Navalgund, Vandana; Koneni, Rupa; Freer, Margot; Parimi, Neeta; Mudhasani, Rajini; Fontes, Joseph D.

    2006-01-01

    The class II trans-activator (CIITA) is recognized as the master regulator of major histocompatibility complex (MHC) class II gene transcription and contributes to the transcription of MHC class I genes. To better understand the function of CIITA, we performed yeast two-hybrid with the C-terminal 807 amino acids of CIITA, and cloned a novel human cDNA named zinc finger, X-linked, duplicated family member C (ZXDC). The 858 amino acid ZXDC protein contains 10 zinc fingers and a transcriptional activation domain, and was found to interact with the region of CIITA containing leucine-rich repeats. Over-expression of ZXDC in human cell lines resulted in super-activation of MHC class I and class II promoters by CIITA. Conversely, silencing of ZXDC expression reduced the ability of CIITA to activate transcription of MHC class II genes. Given the specific interaction between the ZXDC and CIITA proteins, as well as the effect of ZXDC on MHC gene transcription, it appears that ZXDC is an important regulator of both MHC class I and class II transcription. PMID:16600381

  1. Activation of vascular endothelial growth factor gene transcription by hypoxia-inducible factor 1.

    PubMed Central

    Forsythe, J A; Jiang, B H; Iyer, N V; Agani, F; Leung, S W; Koos, R D; Semenza, G L

    1996-01-01

    Expression of vascular endothelial growth factor (VEGF) is induced in cells exposed to hypoxia or ischemia. Neovascularization stimulated by VEGF occurs in several important clinical contexts, including myocardial ischemia, retinal disease, and tumor growth. Hypoxia-inducible factor 1 (HIF-1) is a heterodimeric basic helix-loop-helix protein that activates transcription of the human erythropoietin gene in hypoxic cells. Here we demonstrate the involvement of HIF-1 in the activation of VEGF transcription. VEGF 5'-flanking sequences mediated transcriptional activation of reporter gene expression in hypoxic Hep3B cells. A 47-bp sequence located 985 to 939 bp 5' to the VEGF transcription initiation site mediated hypoxia-inducible reporter gene expression directed by a simian virus 40 promoter element that was otherwise minimally responsive to hypoxia. When reporters containing VEGF sequences, in the context of the native VEGF or heterologous simian virus 40 promoter, were cotransfected with expression vectors encoding HIF-1alpha and HIF-1beta (ARNT [aryl hydrocarbon receptor nuclear translocator]), reporter gene transcription was much greater in both hypoxic and nonhypoxic cells than in cells transfected with the reporter alone. A HIF-1 binding site was demonstrated in the 47-bp hypoxia response element, and a 3-bp substitution eliminated the ability of the element to bind HIF-1 and to activate transcription in response to hypoxia and/or recombinant HIF-1. Cotransfection of cells with an expression vector encoding a dominant negative form of HIF-1alpha inhibited the activation of reporter transcription in hypoxic cells in a dose-dependent manner. VEGF mRNA was not induced by hypoxia in mutant cells that do not express the HIF-1beta (ARNT) subunit. These findings implicate HIF-1 in the activation of VEGF transcription in hypoxic cells. PMID:8756616

  2. The Sch9 kinase is a chromatin-associated transcriptional activator of osmostress-responsive genes

    PubMed Central

    Pascual-Ahuir, Amparo; Proft, Markus

    2007-01-01

    The yeast Sch9 kinase has been implicated in the cellular adjustment to nutrient availability and in the regulation of aging. Here, we define a novel role for Sch9 in the transcriptional activation of osmostress inducible genes. Loss-of-function mutants sch9 are sensitive to hyperosmotic stress and show an impaired transcriptional response upon osmotic shock of several defense genes. We show that Sch9 is required for gene expression regulated by Sko1, a transcription factor, which is directly targeted by the Hog1 MAP kinase. Sch9 interacts in vitro with both Sko1 and Hog1. Additionally, Sch9 phosphorylates Sko1 in vitro. When artificially tethered to promoter DNA, Sch9 strongly activates transcription independently of osmotic stress. Using in vivo chromatin immunoprecipitation, we demonstrate that Sch9 is recruited to the GRE2 and CTT1 genes exclusively under osmostress conditions, and that this recruitment is dependent on Hog1 and Sko1. Furthermore, Sch9 is required for the proper recruitment of Hog1 at the same genes. Our data reveal the complexity of stress-induced transcription by the regulated association of signaling kinases to chromatin. PMID:17568771

  3. Transcriptional Activity of rRNA Genes in Barley Cells after Mutagenic Treatment.

    PubMed

    Kwasniewska, Jolanta; Jaskowiak, Joanna

    2016-01-01

    In the present study, the combination of the micronucleus test with analysis of the activity of the rRNA genes in mutagen-treated Hordeum vulgare (barley) by maleic hydrazide (MH) cells was performed. Simultaneously fluorescence in situ hybridization (FISH) with 25S rDNA as probes and an analysis of the transcriptional activity of 35S rRNA genes with silver staining were performed. The results showed that transcriptional activity is always maintained in the micronuclei although they are eliminated during the next cell cycle. The analysis of the transcriptional activity was extended to barley nuclei. MH influenced the fusion of the nucleoli in barley nuclei. The silver staining enabled detection of the nuclear bodies which arose after MH treatment. The results confirmed the usefulness of cytogenetic techniques in the characterization of micronuclei. Similar analyses can be now extended to other abiotic stresses to study the response of plant cells to the environment. PMID:27257817

  4. Transcriptional Activity of rRNA Genes in Barley Cells after Mutagenic Treatment

    PubMed Central

    2016-01-01

    In the present study, the combination of the micronucleus test with analysis of the activity of the rRNA genes in mutagen-treated Hordeum vulgare (barley) by maleic hydrazide (MH) cells was performed. Simultaneously fluorescence in situ hybridization (FISH) with 25S rDNA as probes and an analysis of the transcriptional activity of 35S rRNA genes with silver staining were performed. The results showed that transcriptional activity is always maintained in the micronuclei although they are eliminated during the next cell cycle. The analysis of the transcriptional activity was extended to barley nuclei. MH influenced the fusion of the nucleoli in barley nuclei. The silver staining enabled detection of the nuclear bodies which arose after MH treatment. The results confirmed the usefulness of cytogenetic techniques in the characterization of micronuclei. Similar analyses can be now extended to other abiotic stresses to study the response of plant cells to the environment. PMID:27257817

  5. Genetic Evidence for Transcriptional Activation by the Yeast Ime1 Gene Product

    PubMed Central

    Smith, H. E.; Driscoll, S. E.; Sia, RAL.; Yuan, H. E.; Mitchell, A. P.

    1993-01-01

    IME1 is required in yeast for meiosis and for expression of IME2 and other early meiotic genes. IME1 is a 360-amino acid polypeptide with central and C-terminal tyrosine-rich regions. We report here that a fusion protein composed of the lexA DNA-binding domain and IME1 activates transcription in vivo of a reporter gene containing upstream lexA binding sites. Activation by the fusion protein shares several features with natural IME1 activity: both are dependent on the RIM11 gene product; both are impaired by the same ime1 missense mutations; both are restored by intragenic suppressors. The central tyrosine-rich region is sufficient to activate transcription when fused to lexA. Deletion of this putative activation domain results in a defective IME1 derivative. Function of the deletion derivative is restored by fusion to the acidic Herpesvirus VP16 activation domain. The C-terminal tyrosine-rich region is dispensable for transcriptional activation; rather it renders activation dependent upon starvation and RIM11. Immunofluorescence studies indicate that an IME1-lacZ fusion protein is concentrated in the nucleus. These observations are consistent with a model in which IME1 normally stimulates IME2 expression by providing a transcriptional activation domain at the IME2 5' regulatory region. PMID:8462841

  6. Selective activation of human heat shock gene transcription by nitrosourea antitumor drugs mediated by isocyanate-induced damage and activation of heat shock transcription factor

    SciTech Connect

    Kroes, R.A. Northwestern Univ., Evanston, IL ); Abravaya, K.; Morimoto, R.I. ); Seidenfeld, J. )

    1991-06-01

    Treatment of cultured human tumor cells with the chloroethylnitrosourea antitumor drug 1,3-bis(2-chloroethyl)-1-nitrosourea (BCNU) selectively induces transcription and protein synthesis of a subset of the human heat shock or stress-induced genes (HSP90 and HSP70) with little effect on other stress genes or on expression of the c-fos, c-myc, or {beta}-actin genes. The active component of BCNU and related compounds appears to be the isocyanate moiety that causes carbamoylation of proteins and nucleic acids. Transcriptional activation of the human HSP70 gene by BCNU is dependent on the heat shock element and correlates with the level of heat shock transcription factor and its binding to the heat shock element in vivo. Unlike activation by heat or heavy metals, BCNU-mediated activation is strongly dependent upon new protein synthesis. This suggests that BCNU-induced, isocyanate-mediated damage to newly synthesized protein(s) may be responsible for activation of the heat shock transcription factor and increased transcription of the HSP90 and HSP70 genes.

  7. Targeted Editing of Myostatin Gene in Sheep by Transcription Activator-like Effector Nucleases.

    PubMed

    Zhao, Xinxia; Ni, Wei; Chen, Chuangfu; Sai, Wujiafu; Qiao, Jun; Sheng, Jingliang; Zhang, Hui; Li, Guozhong; Wang, Dawei; Hu, Shengwei

    2016-03-01

    Myostatin (MSTN) is a secreted growth factor expressed in skeletal muscle and adipose tissue that negatively regulates skeletal muscle mass. Gene knockout of MSTN can result in increasing muscle mass in sheep. The objectives were to investigate whether myostatin gene can be edited in sheep by transcription activator-like effector nucleases (TALENs) in tandem with single-stranded DNA oligonucleotides (ssODNs). We designed a pair of TALENs to target a highly conserved sequence in the coding region of the sheep MSTN gene. The activity of the TALENs was verified by using luciferase single-strand annealing reporter assay in HEK 293T cell line. Co-transfection of TALENs and ssODNs oligonucleotides induced precise gene editing of myostatin gene in sheep primary fibroblasts. MSTN gene-edited cells were successfully used as nuclear donors for generating cloned embryos. TALENs combined with ssDNA oligonucleotides provide a useful approach for precise gene modification in livestock animals. PMID:26950874

  8. Targeted Editing of Myostatin Gene in Sheep by Transcription Activator-like Effector Nucleases

    PubMed Central

    Zhao, Xinxia; Ni, Wei; Chen, Chuangfu; Sai, Wujiafu; Qiao, Jun; Sheng, Jingliang; Zhang, Hui; Li, Guozhong; Wang, Dawei; Hu, Shengwei

    2016-01-01

    Myostatin (MSTN) is a secreted growth factor expressed in skeletal muscle and adipose tissue that negatively regulates skeletal muscle mass. Gene knockout of MSTN can result in increasing muscle mass in sheep. The objectives were to investigate whether myostatin gene can be edited in sheep by transcription activator-like effector nucleases (TALENs) in tandem with single-stranded DNA oligonucleotides (ssODNs). We designed a pair of TALENs to target a highly conserved sequence in the coding region of the sheep MSTN gene. The activity of the TALENs was verified by using luciferase single-strand annealing reporter assay in HEK 293T cell line. Co-transfection of TALENs and ssODNs oligonucleotides induced precise gene editing of myostatin gene in sheep primary fibroblasts. MSTN gene-edited cells were successfully used as nuclear donors for generating cloned embryos. TALENs combined with ssDNA oligonucleotides provide a useful approach for precise gene modification in livestock animals. PMID:26950874

  9. Activated α2-Macroglobulin Regulates Transcriptional Activation of c-MYC Target Genes through Cell Surface GRP78 Protein.

    PubMed

    Gopal, Udhayakumar; Gonzalez-Gronow, Mario; Pizzo, Salvatore Vincent

    2016-05-13

    Activated α2-macroglobulin (α2M*) signals predominantly through cell surface GRP78 (CS-GRP78) to promote proliferation and survival of cancer cells; however, the molecular mechanism remains obscure. c-MYC is an essential transcriptional regulator that controls cell proliferation. We hypothesize that α2M*/CS-GRP78-evoked key signaling events are required for transcriptional activation of c-MYC target genes. Activation of CS-GRP78 by α2M* requires ligation of the GRP78 primary amino acid sequence (Leu(98)-Leu(115)). After stimulation with α2M*, CS-GRP78 signaling activates 3-phosphoinositide-dependent protein kinase-1 (PDK1) to induce phosphorylation of PLK1, which in turn induces c-MYC transcription. We demonstrate that PLK1 binds directly to c-MYC and promotes its transcriptional activity by phosphorylating Ser(62) Moreover, activated c-MYC is recruited to the E-boxes of target genes FOSL1 and ID2 by phosphorylating histone H3 at Ser(10) In addition, targeting the carboxyl-terminal domain of CS-GRP78 with a mAb suppresses transcriptional activation of c-MYC target genes and impairs cell proliferation. This work demonstrates that α2M*/CS-GRP78 acts as an upstream regulator of the PDK1/PLK1 signaling axis to modulate c-MYC transcription and its target genes, suggesting a therapeutic strategy for targeting c-MYC-associated malignant progression. PMID:27002159

  10. TRIM33 switches off Ifnb1 gene transcription during the late phase of macrophage activation

    PubMed Central

    Ferri, Federica; Parcelier, Aude; Petit, Vanessa; Gallouet, Anne-Sophie; Lewandowski, Daniel; Dalloz, Marion; van den Heuvel, Anita; Kolovos, Petros; Soler, Eric; Squadrito, Mario Leonardo; De Palma, Michele; Davidson, Irwin; Rousselet, Germain; Romeo, Paul-Henri

    2015-01-01

    Despite its importance during viral or bacterial infections, transcriptional regulation of the interferon-β gene (Ifnb1) in activated macrophages is only partially understood. Here we report that TRIM33 deficiency results in high, sustained expression of Ifnb1 at late stages of toll-like receptor-mediated activation in macrophages but not in fibroblasts. In macrophages, TRIM33 is recruited by PU.1 to a conserved region, the Ifnb1 Control Element (ICE), located 15 kb upstream of the Ifnb1 transcription start site. ICE constitutively interacts with Ifnb1 through a TRIM33-independent chromatin loop. At late phases of lipopolysaccharide activation of macrophages, TRIM33 is bound to ICE, regulates Ifnb1 enhanceosome loading, controls Ifnb1 chromatin structure and represses Ifnb1 gene transcription by preventing recruitment of CBP/p300. These results characterize a previously unknown mechanism of macrophage-specific regulation of Ifnb1 transcription whereby TRIM33 is critical for Ifnb1 gene transcription shutdown. PMID:26592194

  11. SUMOylation of DRIL1 Directs Its Transcriptional Activity Towards Leukocyte Lineage-Specific Genes

    PubMed Central

    van Lohuizen, Maarten; Peeper, Daniel S.

    2009-01-01

    DRIL1 is an ARID family transcription factor that can immortalize primary mouse fibroblasts, bypass RASV12-induced cellular senescence and collaborate with RASV12 or MYC in mediating oncogenic transformation. It also activates immunoglobulin heavy chain transcription and engages in heterodimer formation with E2F to stimulate E2F-dependent transcription. Little, however, is known about the regulation of DRIL1 activity. Recently, DRIL1 was found to interact with the SUMO-conjugating enzyme Ubc9, but the functional relevance of this association has not been assessed. Here, we show that DRIL1 is sumoylated both in vitro and in vivo at lysine 398. Moreover, we provide evidence that PIASy functions as a specific SUMO E3-ligase for DRIL1 and promotes its sumoylation both in vitro and in vivo. Furthermore, consistent with the subnuclear localization of PIASy in the Matrix-Associated Region (MAR), SUMO-modified DRIL1 species are found exclusively in the MAR fraction. This post-translational modification interferes neither with the subcellular localization nor the DNA-binding activity of the protein. In contrast, DRIL1 sumoylation impairs its interaction with E2F1 in vitro and modifies its transcriptional activity in vivo, driving transcription of subset of genes regulating leukocyte fate. Taken together, these results identify sumoylation as a novel post-translational modification of DRIL1 that represents an important mechanism for targeting and modulating DRIL1 transcriptional activity. PMID:19436740

  12. Transcriptional activators in yeast

    PubMed Central

    2006-01-01

    Eukaryotic transcription activation domains (ADs) are not well defined on the proteome scale. We systematicallly tested ∼6000 yeast proteins for transcriptional activity using a yeast one-hybrid system and identified 451 transcriptional activators. We then determined their transcription activation strength using fusions to the Gal4 DNA-binding domain and a His3 reporter gene which contained a promoter with a Gal4-binding site. Among the 132 strongest activators 32 are known transcription factors while another 35 have no known function. Although zinc fingers, helix–loop–helix domains and several other domains are highly overrepresented among the activators, only few contain characterized ADs. We also found some striking correlations: the stronger the activation activity, the more acidic, glutamine-rich, proline-rich or asparagine-rich the activators were. About 29% of the activators have been found previously to specifically interact with the transcription machinery, while 10% are known to be components of transcription regulatory complexes. Based on their transcriptional activity, localization and interaction patterns, at least six previously uncharacterized proteins are suggested to be bona fide transcriptional regulators (namely YFL049W, YJR070C, YDR520C, YGL066W/Sgf73, YKR064W and YCR082W/Ahc2). PMID:16464826

  13. Transcriptional regulation of the presenilin-1 gene controls gamma-secretase activity.

    PubMed

    Lee, Sebum; Das, Hriday K

    2010-01-01

    Inhibition of basal JNK activity by JNK inhibitor SP600125 or JNK1siRNA repressed presenilin-1 (PS1) expression in SK-N-SH cells by augmenting the level of p53, a repressor of the PS1 gene (1). We now showed that repression of PS1 transcription by JNK inhibitor SP600125 inhibited gamma-secretase mediated processing of amyloid precursor protein (APP) resulting in the accumulation of C99 fragment and the reduction of secreted Abeta40 level without altering the expression of nicastrin (NCT). Co-treatment of cells with SP600125 and p53 inhibitor, pifithrin-alpha, partially nullified the suppressive effects of SP610025 on PS1 expression and secreted Abeta40 level. Suppression of JNK1 by JNK1siRNA also decreased Abeta40 level. Furthermore, overexpression of the repressors p53, ZNF237 and CHD3 of the PS1 gene also suppressed the processing of APP through repression of PS1 transcription by deacetylation of histone at the PS1 promoter. Transcriptional activator Ets2 increased PS1 protein and secreted Abeta40 levels without affecting the expression of NCT by activating PS1 transcription via hyper-acetylation of histone at the PS1 promoter. Therefore, regulation of PS1 transcription modulates gamma-secretase activity. PMID:20036849

  14. Neuronal activity-regulated gene transcription: how are distant synaptic signals conveyed to the nucleus?

    PubMed Central

    Matamales, Miriam

    2012-01-01

    Synaptic activity can trigger gene expression programs that are required for the stable change of neuronal properties, a process that is essential for learning and memory. Currently, it is still unclear how the stimulation of dendritic synapses can be coupled to transcription in the nucleus in a timely way given that large distances can separate these two cellular compartments. Although several mechanisms have been proposed to explain long distance communication between synapses and the nucleus, the possible co-existence of these models and their relevance in physiological conditions remain elusive. One model suggests that synaptic activation triggers the translocation to the nucleus of certain transcription regulators localised at postsynaptic sites that function as synapto-nuclear messengers. Alternatively, it has been hypothesised that synaptic activity initiates propagating regenerative intracellular calcium waves that spread through dendrites into the nucleus where nuclear transcription machinery is thereby regulated. It has also been postulated that membrane depolarisation of voltage-gated calcium channels on the somatic membrane is sufficient to increase intracellular calcium concentration and activate transcription without the need for transported signals from distant synapses. Here I provide a critical overview of the suggested mechanisms for coupling synaptic stimulation to transcription, the underlying assumptions behind them and their plausible physiological significance. PMID:24327840

  15. Mitochondrial dysfunction induces SESN2 gene expression through Activating Transcription Factor 4.

    PubMed

    Garaeva, Alisa A; Kovaleva, Irina E; Chumakov, Peter M; Evstafieva, Alexandra G

    2016-01-01

    We found that inhibitors of mitochondrial respiratory chain complexes III (myxothiazol) and I (piericidin A) in some epithelial carcinoma cell lines induce transcription of the p53-responsive SESN2 gene that plays an important role in stress response and homeostatic regulation. However, the effect did not depend on p53 because i) there was no induction of p53 after the treatment with piericidin A; ii) after the treatment with myxothiazol the peak of SESN2 gene upregulation occurred as early as 5h, before the onset of p53 activation (13h); iii) a supplementation with uridine that abolishes the p53 activation in response to myxothiazol did not abrogate the induction of SESN2 transcripts; iv) in the p53 negative HCT116 p53 -/- cells SESN2 transcription could be also induced by myxothiazol. In response to the respiratory chain inhibitors we observed an induction of ATF4, the key transcription factor of the integrated stress response (ISR). We found that the induction of SESN2 transcripts could be prevented by the ISR inhibitory small molecule ISRIB. Also, by inhibiting or overexpressing ATF4 with specific shRNA or ATF4-expressing constructs, respectively, we have confirmed the role of ATF4 in the SESN2 gene upregulation induced by mitochondrial dysfunction. At a distance of 228 bp upstream from the SESN2 transcription start site we found a candidate sequence for the ATF4 binding site and confirmed its requirement for the induction of SESN2 in luciferase reporter experiments. We suggest that the upregulation of SESN2 by mitochondrial dysfunction provides a homeostatic feedback that attenuates biosynthetic processes during temporal losses of energy supply from mitochondria thereby assisting better adaptation and viability of cells in hostile environments. PMID:26771712

  16. The murine Sim-2 gene product inhibits transcription by active repression and functional interference.

    PubMed

    Moffett, P; Reece, M; Pelletier, J

    1997-09-01

    The Drosophila single-minded (Dsim) gene encodes a master regulatory protein involved in cell fate determination during midline development. This protein is a member of a rapidly expanding family of gene products possessing basic helix-loop-helix (bHLH) and hydrophobic PAS (designated a conserved region among PER, ARNT [aryl hydrocarbon receptor nuclear translocator] and SIM) protein association domains. Members of this family function as central transcriptional regulators in cellular differentiation and in the response to environmental stimuli such as xenobiotics and hypoxia. We have previously identified a murine member of this family, called mSim-2, showing sequence homology to the bHLH and PAS domains of Dsim. Immunoprecipitation experiments with recombinant proteins indicate that mSIM-2 associates with the arnt gene product. In the present work, by using fine-structure mapping we found that the HLH and PAS motifs of both proteins are required for optimal association. Forced expression of GAL4/mSIM-2 fusion constructs in mammalian cells demonstrated the presence of two separable repression domains within the carboxy terminus of mSIM-2. We found that mSIM-2 is capable of repressing ARNT-mediated transcriptional activation in a mammalian two-hybrid system. This effect (i) is dependent on the ability of mSIM-2 and ARNT to heterodimerize, (ii) is dependent on the presence of the mSIM-2 carboxy-terminal repression domain, and (iii) is not specific to the ARNT activation domain. These results suggest that mSIM-2 repression activity can dominantly override the activation potential of adjacent transcription factors. We also demonstrated that mSIM-2 can functionally interfere with hypoxia-inducible factor 1alpha (HIF-1alpha)/ARNT transcription complexes, providing a second mechanism by which mSIM-2 may inhibit transcription. PMID:9271372

  17. Prolyl 4-hydroxylase activity-responsive transcription factors: From hydroxylation to gene expression and neuroprotection

    PubMed Central

    Siddiq, Ambreena; Aminova, Leila R; Ratan, Rajiv R

    2008-01-01

    Most homeostatic processes including gene transcription occur as a result of deviations in physiological tone that threatens the survival of the organism. A prototypical homeostatic stress response includes changes in gene expression following alterations in oxygen, iron or 2-oxoglutarate levels. Each of these cofactors plays an important role in cellular metabolism. Accordingly, a family of enzymes known as the Prolyl 4-hydroxylase (PHD) enzymes are a group of dioxygenases that have evolved to sense changes in 2-oxoglutarate, oxygen and iron via changes in enzyme activity. Indeed, PHDs are a part of an established oxygen sensor system that regulates transcriptional regulation of hypoxia/stress-regulated genes and thus are an important component of events leading to cellular rescue from oxygen, iron or 2-oxoglutarate deprivations. The ability of PHD activity to regulate homeostatic responses to oxygen, iron or 2-oxoglutarate metabolism has led to the development of small molecule inhibitors of the PHDs as a strategy for activating or augmenting cellular stress responses. These small molecules are proving effective in preclinical models of stroke and Parkinson's disease. However the precise protective pathways engaged by PHD inhibition are only beginning to be defined. In the current review, we summarize the role of iron, 2-oxoglutarate and oxygen in the PHD catalyzed hydroxylation reaction and provide a brief discussion of some of the transcription factors that play an effective role in neuroprotection against oxidative stress as a result of changes in PHD activity. PMID:17981760

  18. Transcriptional activity of acetylcholinesterase gene is regulated by DNA methylation during C2C12 myogenesis.

    PubMed

    Lau, Kei M; Gong, Amy G W; Xu, Miranda L; Lam, Candy T W; Zhang, Laura M L; Bi, Cathy W C; Cui, D; Cheng, Anthony W M; Dong, Tina T X; Tsim, Karl W K; Lin, Huangquan

    2016-07-01

    The expression of acetylcholinesterase (AChE), an enzyme hydrolyzes neurotransmitter acetylcholine at vertebrate neuromuscular junction, is regulated during myogenesis, indicating the significance of muscle intrinsic factors in controlling the enzyme expression. DNA methylation is essential for temporal control of myogenic gene expression during myogenesis; however, its role in AChE regulation is not known. The promoter of vertebrate ACHE gene carries highly conserved CG-rich regions, implying its likeliness to be methylated for epigenetic regulation. A DNA methyltransferase inhibitor, 5-azacytidine (5-Aza), was applied onto C2C12 cells throughout the myotube formation. When DNA methylation was inhibited, the promoter activity, transcript expression and enzymatic activity of AChE were markedly increased after day 3 of differentiation, which indicated the putative role of DNA methylation. By bisulfite pyrosequencing, the overall methylation rate was found to peak at day 3 during C2C12 cell differentiation; a SP1 site located at -1826bp upstream of mouse ACHE gene was revealed to be heavily methylated. The involvement of transcriptional factor SP1 in epigenetic regulation of AChE was illustrated here: (i) the SP1-driven transcriptional activity was increased in 5-Aza-treated C2C12 culture; (ii) the binding of SP1 onto the SP1 site of ACHE gene was fully blocked by the DNA methylation; and (iii) the sequence flanking SP1 sites of ACHE gene was precipitated by chromatin immuno-precipitation assay. The findings suggested the role of DNA methylation on AChE transcriptional regulation and provided insight in elucidating the DNA methylation-mediated regulatory mechanism on AChE expression during muscle differentiation. PMID:27021952

  19. Transcriptional Activation of Human Matrix Metalloproteinase-9 Gene Expression by Multiple Coactivators

    PubMed Central

    Zhao, Xueyan; Benveniste, Etty N.

    2008-01-01

    Summary Matrix metalloproteinase-9 (MMP-9), a proteolytic enzyme for matrix proteins, chemokines and cytokines, is a major target in cancer and autoimmune diseases since it is aberrantly upregulated. To control MMP-9 expression in pathological conditions, it is necessary to understand the regulatory mechanisms of MMP-9 expression. MMP-9 gene expression is regulated primarily at the transcriptional level. In this study, we investigated the role of multiple coactivators in regulating MMP-9 transcription. We demonstrate that multiple transcriptional coactivators are involved in MMP-9 promoter activation, including CBP/p300, PCAF, CARM1 and GRIP1. Furthermore, enhancement of MMP-9 promoter activity requires the histone acetyltransferase activity of PCAF but not that of CBP/p300, and the methyltransferase activity of CARM1. More importantly, these coactivators are not only able to activate MMP-9 promoter activity independently, but also function in a synergistic manner. Significant synergy was observed among CARM1, p300 and GRIP1, which is dependent on the interaction of p300 and CARM1 with the AD1 and AD2 domains of GRIP1, respectively. This suggests the formation of a ternary coactivator complex on the MMP-9 promoter. Chromatin immunoprecipitation assays demonstrate that these coactivators associate with the endogenous MMP-9 promoter, and that siRNA knockdown of expression of these coactivators reduces endogenous MMP-9 expression. Taken together, these studies demonstrate a new level of transcriptional regulation of MMP-9 expression by the cooperative action of coactivators. PMID:18790699

  20. Transcriptional activation of the human cytotoxic serine protease gene CSP-B in T lymphocytes.

    PubMed Central

    Hanson, R D; Ley, T J

    1990-01-01

    The cytotoxic serine protease B (CSP-B) gene is activated during cytotoxic T-lymphocyte maturation. In this report, we demonstrate that the PEER T-cell line (bearing gamma/delta T-cell receptors) accumulates CSP-B mRNA following exposure to 12-O-tetradecanoylphorbol-13-acetate (TPA) and N6-2'-O-dibutyryladenosine 3',5'-cyclic monophosphate (bt2cAMP) because of transcriptional activation of the CSP-B gene. TPA and bt2cAMP act synergistically to induce CSP-B expression, since neither agent alone causes activation of CSP-B transcription or mRNA accumulation. Chromatin upstream from the CSP-B gene is resistant to DNase I digestion in untreated PEER cells, but becomes sensitive following TPA-bt2cAMP treatment. Upon activation of PEER cells, a DNase I-hypersensitive site forms upstream from the CSP-B gene within a region that is highly conserved in the mouse. Transient transfection of CSP-B promoter constructs identified two regulatory regions in the CSP-B 5'-flanking sequence, located at positions -609 to -202 and positions -202 to -80. The region from -615 to -63 is sufficient to activate a heterologous promoter in activated PEER cells, but activation is orientation specific, suggesting that this region behaves as an upstream promoter element rather than a classical enhancer. Consensus AP-1, AP-2, and cAMP response elements are found upstream from the CSP-B gene (as are several T-cell-specific consensus elements), but the roles of these elements in CSP-B gene activation have yet to be determined. Images PMID:2233710

  1. Telomerase activates transcription of cyclin D1 gene through an interaction with NOL1.

    PubMed

    Hong, Juyeong; Lee, Ji Hoon; Chung, In Kwon

    2016-04-15

    Telomerase is a ribonucleoprotein enzyme that is required for the maintenance of telomere repeats. Although overexpression of telomerase in normal human somatic cells is sufficient to overcome replicative senescence, the ability of telomerase to promote tumorigenesis requires additional activities that are independent of its role in telomere extension. Here, we identify proliferation-associated nucleolar antigen 120 (NOL1, also known as NOP2) as a telomerase RNA component (TERC)-binding protein that is found in association with catalytically active telomerase. Although NOL1 is highly expressed in the majority of human tumor cells, the molecular mechanism by which NOL1 contributes to tumorigenesis remained unclear. We show that NOL1 binds to the T-cell factor (TCF)-binding element of the cyclin D1 promoter and activates its transcription. Interestingly, telomerase is also recruited to the cyclin D1 promoter in a TERC-dependent manner through the interaction with NOL1, further enhancing transcription of the cyclin D1 gene. Depletion of NOL1 suppresses cyclin D1 promoter activity, thereby leading to induction of growth arrest and altered cell cycle distributions. Collectively, our findings suggest that NOL1 represents a new route by which telomerase activates transcription of cyclin D1 gene, thus maintaining cell proliferation capacity. PMID:26906424

  2. GATA2 Mediates Thyrotropin-Releasing Hormone-Induced Transcriptional Activation of the Thyrotropin β Gene

    PubMed Central

    Ohba, Kenji; Sasaki, Shigekazu; Matsushita, Akio; Iwaki, Hiroyuki; Matsunaga, Hideyuki; Suzuki, Shingo; Ishizuka, Keiko; Misawa, Hiroko; Oki, Yutaka; Nakamura, Hirotoshi

    2011-01-01

    Thyrotropin-releasing hormone (TRH) activates not only the secretion of thyrotropin (TSH) but also the transcription of TSHβ and α-glycoprotein (αGSU) subunit genes. TSHβ expression is maintained by two transcription factors, Pit1 and GATA2, and is negatively regulated by thyroid hormone (T3). Our prior studies suggest that the main activator of the TSHβ gene is GATA2, not Pit1 or unliganded T3 receptor (TR). In previous studies on the mechanism of TRH-induced activation of the TSHβ gene, the involvements of Pit1 and TR have been investigated, but the role of GATA2 has not been clarified. Using kidney-derived CV1 cells and pituitary-derived GH3 and TαT1 cells, we demonstrate here that TRH signaling enhances GATA2-dependent activation of the TSHβ promoter and that TRH-induced activity is abolished by amino acid substitution in the GATA2-Zn finger domain or mutation of GATA-responsive element in the TSHβ gene. In CV1 cells transfected with TRH receptor expression plasmid, GATA2-dependent transactivation of αGSU and endothelin-1 promoters was enhanced by TRH. In the gel shift assay, TRH signal potentiated the DNA-binding capacity of GATA2. While inhibition by T3 is dominant over TRH-induced activation, unliganded TR or the putative negative T3-responsive element are not required for TRH-induced stimulation. Studies using GH3 cells showed that TRH-induced activity of the TSHβ promoter depends on protein kinase C but not the mitogen-activated protein kinase, suggesting that the signaling pathway is different from that in the prolactin gene. These results indicate that GATA2 is the principal mediator of the TRH signaling pathway in TSHβ expression. PMID:21533184

  3. Genetic factors affecting gene transcription and catalytic activity of UDP-glucuronosyltransferases in human liver

    PubMed Central

    Liu, Wanqing; Ramírez, Jacqueline; Gamazon, Eric R.; Mirkov, Snezana; Chen, Peixian; Wu, Kehua; Sun, Chang; Cox, Nancy J.; Cook, Edwin; Das, Soma; Ratain, Mark J.

    2014-01-01

    The aim of this study was to discover cis- and trans-acting factors significantly affecting mRNA expression and catalytic activity of human hepatic UDP-glucuronosyltransferases (UGTs). Transcription levels of five major hepatic UGT1A (UGT1A1, UGT1A3, UGT1A4, UGT1A6 and UGT1A9) and five UGT2B (UGT2B4, UGT2B7, UGT2B10, UGT2B15 and UGT2B17) genes were quantified in human liver tissue samples (n = 125) using real-time PCR. Glucuronidation activities of 14 substrates were measured in 47 livers. We genotyped 167 tagSNPs (single-nucleotide polymorphisms) in UGT1A (n = 43) and UGT2B (n = 124), as well as the known functional UGT1A1*28 and UGT2B17 CNV (copy number variation) polymorphisms. Transcription levels of 15 transcription factors (TFs) known to regulate these UGTs were quantified. We found that UGT expression and activity were highly variable among the livers (median and range of coefficient of variations: 135%, 74–217% and 52%, 39–105%, respectively). CAR, PXR and ESR1 were found to be the most important trans-regulators of UGT transcription (median and range of correlation coefficients: 46%, 6–58%; 47%, 9–58%; and 52%, 24–75%, respectively). Hepatic UGT activities were mainly determined by UGT gene transcription levels. Twenty-one polymorphisms were significantly (FDR-adjusted P < 0.05) associated with mRNA expression and/or activities of UGT1A1, UGT1A3 and UGT2B17. We found novel SNPs in the UGT2B17 CNV region accounting for variability in UGT2B17 gene transcription and testosterone glucuronidation rate, in addition to that attributable to the UGT2B17 CNV. Our study discovered novel pharmacogenetic markers and provided detailed insight into the genetic network regulating hepatic UGTs. PMID:24879639

  4. MYRF is a membrane-associated transcription factor that autoproteolytically cleaves to directly activate myelin genes.

    PubMed

    Bujalka, Helena; Koenning, Matthias; Jackson, Stacey; Perreau, Victoria M; Pope, Bernard; Hay, Curtis M; Mitew, Stanlislaw; Hill, Andrew F; Lu, Q Richard; Wegner, Michael; Srinivasan, Rajini; Svaren, John; Willingham, Melanie; Barres, Ben A; Emery, Ben

    2013-01-01

    The myelination of axons is a crucial step during vertebrate central nervous system (CNS) development, allowing for rapid and energy efficient saltatory conduction of nerve impulses. Accordingly, the differentiation of oligodendrocytes, the myelinating cells of the CNS, and their expression of myelin genes are under tight transcriptional control. We previously identified a putative transcription factor, Myelin Regulatory Factor (Myrf), as being vital for CNS myelination. Myrf is required for the generation of CNS myelination during development and also for its maintenance in the adult. It has been controversial, however, whether Myrf directly regulates transcription, with reports of a transmembrane domain and lack of nuclear localization. Here we show that Myrf is a membrane-associated transcription factor that undergoes an activating proteolytic cleavage to separate its transmembrane domain-containing C-terminal region from a nuclear-targeted N-terminal region. Unexpectedly, this cleavage event occurs via a protein domain related to the autoproteolytic intramolecular chaperone domain of the bacteriophage tail spike proteins, the first time this domain has been found to play a role in eukaryotic proteins. Using ChIP-Seq we show that the N-terminal cleavage product directly binds the enhancer regions of oligodendrocyte-specific and myelin genes. This binding occurs via a defined DNA-binding consensus sequence and strongly promotes the expression of target genes. These findings identify Myrf as a novel example of a membrane-associated transcription factor and provide a direct molecular mechanism for its regulation of oligodendrocyte differentiation and CNS myelination. PMID:23966833

  5. Histone modifications defining active genes persist after transcriptional and mitotic inactivation.

    PubMed

    Kouskouti, Antigone; Talianidis, Iannis

    2005-01-26

    We examined various histone modifications across the promoter and the coding regions of constitutively active hepatic genes in G0/G1-enriched, mitotically arrested and alpha-amanitin-blocked cells. Gene activation correlated with localized histone hyperacetylation, H3-K4 tri- or dimethylation and H3-K79 dimethylation and localized nucleosome remodeling at the promoter and the 5' portion of the coding regions. Nucleosomes at more downstream locations were monomethylated at H3-K4. CBP, PCAF, Brg-1, SNF2H and FACT were recruited to the coding regions in a gene-specific manner, in a similarly restricted promoter-proximal pattern. Elongator, however, associated with the more downstream regions. While all factors were dissociated from the chromatin after transcriptional inactivation by alpha-amanitin, the histone modifications remained stable. In mitotic cells, histone modifications on parental nucleosomes were preserved and were regenerated in a transcription-dependent manner at the newly deposited nucleosomes, as the cells entered the next G1 phase. The findings suggest that histone modifications may function as molecular memory bookmarks for previously active locations of the genome, thus contributing to the maintenance of active chromatin states through cell division. PMID:15616580

  6. Intermedin/adrenomedullin 2 is a stress-inducible gene controlled by activating transcription factor 4.

    PubMed

    Kovaleva, Irina E; Garaeva, Alisa A; Chumakov, Peter M; Evstafieva, Alexandra G

    2016-09-15

    Intermedin or adrenomedullin 2 is a set of calcitonin-related peptides with a putative tumor angiogenesis promoting activity that are formed by proteolytic processing of the ADM2 gene product. It has been proposed that the ADM2 gene is regulated by the estrogen response element (ERE) and hypoxia response elements (HRE) found within its promoter region. In the present study we reveal a functional mechanism by which ADM2 participates in the unfolded protein response (UPR) and in responses to the mitochondrial respiration chain inhibition. We show that the ADM2 gene is controlled by activating transcription factor 4 (ATF4), the principal regulator of the integrated stress response (ISR). The upregulation of ADM2 mRNA could be prevented by the pharmacological ISR inhibitor ISRIB and by the downregulation of ATF4 with specific shRNA, while ectopic expression of ATF4 cDNA resulted in a notable increase in ADM2 gene transcription. A potential ATF4-binding site was identified in the coding region of the ADM2 gene and the requirement of this site during the ATF4-mediated ADM2 gene promoter activation was validated by the luciferase reporter assay. Mutagenesis of the putative ATF4-response element prevented the induction of luciferase activity in response to ATF4 overproduction, as well as in response to mitochondrial electron transfer chain inhibition by piericidin A and ER stress induction by tunicamycin and brefeldin A. Since ADM2 was shown to inhibit ATF4 expression during myocardial ER stress, a feedback mechanism could be proposed for the ADM2 regulation under ER stress conditions. PMID:27328454

  7. EGR1 regulates hepatic clock gene amplitude by activating Per1 transcription

    PubMed Central

    Tao, Weiwei; Wu, Jing; Zhang, Qian; Lai, Shan-Shan; Jiang, Shan; Jiang, Chen; Xu, Ying; Xue, Bin; Du, Jie; Li, Chao-Jun

    2015-01-01

    The mammalian clock system is composed of a master clock and peripheral clocks. At the molecular level, the rhythm-generating mechanism is controlled by a molecular clock composed of positive and negative feedback loops. However, the underlying mechanisms for molecular clock regulation that affect circadian clock function remain unclear. Here, we show that Egr1 (early growth response 1), an early growth response gene, is expressed in mouse liver in a circadian manner. Consistently, Egr1 is transactivated by the CLOCK/BMAL1 heterodimer through a conserved E-box response element. In hepatocytes, EGR1 regulates the transcription of several core clock genes, including Bmal1, Per1, Per2, Rev-erbα and Rev-erbβ, and the rhythm amplitude of their expression is dependent on EGR1’s transcriptional function. Further mechanistic studies indicated that EGR1 binds to the proximal region of the Per1 promoter to activate its transcription directly. When the peripheral clock is altered by light or feeding behavior transposition in Egr1-deficient mice, the expression phase of hepatic clock genes shifts normally, but the amplitude is also altered. Our data reveal a critical role for EGR1 in the regulation of hepatic clock circuitry, which may contribute to the rhythm stability of peripheral clock oscillators. PMID:26471974

  8. Ldb1-nucleated transcription complexes function as primary mediators of global erythroid gene activation.

    PubMed

    Li, LiQi; Freudenberg, Johannes; Cui, Kairong; Dale, Ryan; Song, Sang-Hyun; Dean, Ann; Zhao, Keji; Jothi, Raja; Love, Paul E

    2013-05-30

    Erythropoiesis is dependent on the lineage-specific transcription factors Gata1, Tal1, and Klf1. Several erythroid genes have been shown to require all 3 factors for their expression, suggesting that they function synergistically; however, there is little direct evidence for widespread cooperation. Gata1 and Tal1 can assemble within higher-order protein complexes (Ldb1 complexes) that include the adapter molecules Lmo2 and Ldb1. Ldb1 proteins are capable of coassociation, and long-range Ldb1-mediated oligomerization of enhancer- and promoter-bound Ldb1 complexes has been shown to be required for β-globin gene expression. In this study, we generated a genomewide map of Ldb1 complex binding sites that revealed widespread binding at erythroid genes and at known erythroid enhancer elements. Ldb1 complex binding sites frequently colocalized with Klf1 binding sites and with consensus binding motifs for other erythroid transcription factors. Transcriptomic analysis demonstrated a strong correlation between Ldb1 complex binding and Ldb1 dependency for gene expression and identified a large cohort of genes coregulated by Ldb1 complexes and Klf1. Together, these results provide a foundation for defining the mechanism and scope of Ldb1 complex activity during erythropoiesis. PMID:23610375

  9. A flower-specific Myb protein activates transcription of phenylpropanoid biosynthetic genes.

    PubMed

    Sablowski, R W; Moyano, E; Culianez-Macia, F A; Schuch, W; Martin, C; Bevan, M

    1994-01-01

    Synthesis of flavonoid pigments in flowers requires the co-ordinated expression of genes encoding enzymes in th phenylpropanoid biosynthetic pathway. Some cis-elements involved in the transcriptional control of these genes have been defined. We report binding of petal-specific activities from tobacco and Antirrhinum majus (snapdragon) to an element conserved in promoters of phenylpropanoid biosynthetic genes and implicated in expression in flowers. These binding activities were inhibited by antibodies raised against Myb305, a flower-specific Myb protein previously cloned from Antirrhinum by sequence homology. Myb305 bound to the same element and formed a DNA-protein complex with the same mobility as the Antirrhinum petal protein in electrophoretic mobility shift experiments. Myb305 activated expression from its binding site in yeast and in tobacco protoplasts. In protoplasts, activation also required a G-box-like element, suggesting co-operation with other elements and factors. The results strongly suggest a role for Myb305-related proteins in the activation of phenylpropanoid biosynthetic genes in flowers. This is consistent with the genetically demonstrated role of plant Myb proteins in the regulation of genes involved in flavonoid synthesis. PMID:8306956

  10. Acetohydroxyacid synthase activity and transcripts profiling reveal tissue-specific regulation of ahas genes in sunflower.

    PubMed

    Ochogavía, Ana C; Breccia, Gabriela; Vega, Tatiana; Felitti, Silvina A; Picardi, Liliana A; Nestares, Graciela

    2014-07-01

    Acetohydroxyacid synthase (AHAS) is the target site of several herbicides and catalyses the first step in the biosynthesis of branched chain amino acid. Three genes coding for AHAS catalytic subunit (ahas1, ahas2 and ahas3) have been reported for sunflower. The aim of this work was to study the expression pattern of ahas genes family and AHAS activity in sunflower (Helianthus annuus L.). Different organs (leaves, hypocotyls, roots, flowers and embryos) were evaluated at several developmental stages. The transcriptional profile was studied through RT-qPCR. The highest expression for ahas1 was shown in leaves, where all the induced and natural gene mutations conferring herbicide resistance were found. The maximal expression of ahas2 and ahas3 occurred in immature flowers and embryos. The highest AHAS activity was found in leaves and immature embryos. Correlation analysis among ahas gene expression and AHAS activity was discussed. Our results show that differences in ahas genes expression are tissue-specific and temporally regulated. Moreover, the conservation of multiple AHAS isoforms in sunflower seems to result from different expression requirements controlled by tissue-specific regulatory mechanisms at different developmental stages. PMID:24908515

  11. Gene activation by metazoan enhancers: Diverse mechanisms stimulate distinct steps of transcription.

    PubMed

    Beagrie, Robert A; Pombo, Ana

    2016-09-01

    Enhancers can stimulate transcription by a number of different mechanisms which control different stages of the transcription cycle of their target genes, from recruitment of the transcription machinery to elongation by RNA polymerase. These mechanisms may not be mutually exclusive, as a single enhancer may act through different pathways by binding multiple transcription factors. Multiple enhancers may also work together to regulate transcription of a shared target gene. Most of the evidence supporting different enhancer mechanisms comes from the study of single genes, but new high-throughput experimental frameworks offer the opportunity to integrate and generalize disparate mechanisms identified at single genes. This effort is especially important if we are to fully understand how sequence variation within enhancers contributes to human disease. PMID:27452946

  12. High-efficiency and heritable gene targeting in mouse by transcription activator-like effector nucleases

    PubMed Central

    Qiu, Zhongwei; Liu, Meizhen; Chen, Zhaohua; Shao, Yanjiao; Pan, Hongjie; Wei, Gaigai; Yu, Chao; Zhang, Long; Li, Xia; Wang, Ping; Fan, Heng-Yu; Du, Bing; Liu, Bin; Liu, Mingyao; Li, Dali

    2013-01-01

    Transcription activator-like effector nucleases (TALENs) are a powerful new approach for targeted gene disruption in various animal models, but little is known about their activities in Mus musculus, the widely used mammalian model organism. Here, we report that direct injection of in vitro transcribed messenger RNA of TALEN pairs into mouse zygotes induced somatic mutations, which were stably passed to the next generation through germ-line transmission. With one TALEN pair constructed for each of 10 target genes, mutant F0 mice for each gene were obtained with the mutation rate ranged from 13 to 67% and an average of ∼40% of total healthy newborns with no significant differences between C57BL/6 and FVB/N genetic background. One TALEN pair with single mismatch to their intended target sequence in each side failed to yield any mutation. Furthermore, highly efficient germ-line transmission was obtained, as all the F0 founders tested transmitted the mutations to F1 mice. In addition, we also observed that one bi-allele mutant founder of Lepr gene, encoding Leptin receptor, had similar diabetic phenotype as db/db mouse. Together, our results suggest that TALENs are an effective genetic tool for rapid gene disruption with high efficiency and heritability in mouse with distinct genetic background. PMID:23630316

  13. PAX5 IS THE TRANSCRIPTIONAL ACTIVATOR OF MUCOLIPIN-2 (MCOLN2) GENE

    PubMed Central

    Valadez, Jessica A.; Cuajungco, Math P.

    2014-01-01

    Transient Receptor Potential Mucolipin (TRPML) proteins belong to the TRP superfamily of non-selective cation channels. The TRPML1, -2, and -3 proteins are encoded by Mucolipin (MCOLN)-1, -2 and -3 genes, respectively. TRPML1 has been associated with Mucolipidosis type IV (MLIV), while no disease phenotype has been linked with TRPML2 or -3 protein. The TRPML proteins share high sequence similarities, form hetero-tetramers, and serve in membrane trafficking, autophagy, and metal homeostasis. Previous studies suggest that TRPML2 serves a role in the immune system; however, the evidence is mostly indirect. We hypothesize that if TRPML2 is involved in immune function its expression would be likely regulated by an immune-associated transcription factor protein. Thus, we set out to identify the core promoter region and the transcription factor responsible for MCOLN2 gene expression. Using dual-luciferase assay and over-expression analyses, we reveal for the first time that B-cell lineage specific activator protein (BSAP), also known as paired box 5 (PAX5), controls MCOLN2 expression. Specifically, heterologous expression of PAX5 in HEK-293 cells significantly increased endogenous MCOLN2 transcript and TRPML2 protein levels, while RNA interference targeting endogenous PAX5 reduced its effect. Site-directed mutagenesis studies showed that the core promoter and PAX5 binding region to be between -79 and -60 base pairs upstream of the transcriptional start site. Thus, our findings add to a growing list of evidence for TRPML2’s possible involvement in the immune system. The knowledge gained from this study could be used to further characterize the role of TRPML2 in B-cell development and function. PMID:25445271

  14. Transcript degradation and noise of small RNA-controlled genes in a switch activated network in Escherichia coli.

    PubMed

    Arbel-Goren, Rinat; Tal, Asaf; Parasar, Bibudha; Dym, Alvah; Costantino, Nina; Muñoz-García, Javier; Court, Donald L; Stavans, Joel

    2016-08-19

    Post-transcriptional regulatory processes may change transcript levels and affect cell-to-cell variability or noise. We study small-RNA downregulation to elucidate its effects on noise in the iron homeostasis network of Escherichia coli In this network, the small-RNA RyhB undergoes stoichiometric degradation with the transcripts of target genes in response to iron stress. Using single-molecule fluorescence in situ hybridization, we measured transcript numbers of the RyhB-regulated genes sodB and fumA in individual cells as a function of iron deprivation. We observed a monotonic increase of noise with iron stress but no evidence of theoretically predicted, enhanced stoichiometric fluctuations in transcript numbers, nor of bistable behavior in transcript distributions. Direct detection of RyhB in individual cells shows that its noise is much smaller than that of these two targets, when RyhB production is significant. A generalized two-state model of bursty transcription that neglects RyhB fluctuations describes quantitatively the dependence of noise and transcript distributions on iron deprivation, enabling extraction of in vivo RyhB-mediated transcript degradation rates. The transcripts' threshold-linear behavior indicates that the effective in vivo interaction strength between RyhB and its two target transcripts is comparable. Strikingly, the bacterial cell response exhibits Fur-dependent, switch-like activation instead of a graded response to iron deprivation. PMID:27085802

  15. Identification of a Caulobacter basal body structural gene and a cis-acting site required for activation of transcription.

    PubMed Central

    Dingwall, A; Gober, J W; Shapiro, L

    1990-01-01

    The genes that encode the components and regulatory proteins of the Caulobacter crescentus flagellum are transcribed at specific times in the cell cycle. One of these genes, flbN, is required early in the flagellar assembly process. The flbN gene was cloned and sequenced, and the time of transcription activation was determined. The derived amino acid sequence indicates that fibN encodes a 25-kilodalton protein with a cleavable leader peptide. The flbN-encoded protein has 30.8% identity with the protein encoded by the Salmonella typhimurium basal body L-ring gene, flgH. Site-directed mutagenesis and gel mobility shift assays identified a binding site at -100 from the transcription start site for a trans-acting protein, RF-2, that functions to partially activate flbN transcription at a defined time in the cell cycle. The RF-2 binding region is similar to a NifA binding site normally used in the activation of some sigma 54 promoters involved in nitrogen fixation in other bacteria. Transcription of a flbN-reporter gene fusion in an Escherichia coli background was dependent on the presence of a NifA transcription factor supplied by a plasmid-borne Rhizobium meliloti gene encoding NifA. A deletion or base changes in the RF-2 binding region eliminated expression of the flbN gene in E. coli even when a NifA protein was provided in trans, suggesting that a sigma 54 promoter with an upstream activator element is used by the C. crescentus flbN gene. A consensus sequence for a sigma 54 promoter was found at the appropriate distance 5' to one of two identified transcription start sites. Site-directed mutagenesis confirmed that a conserved nucleotide in this sigma 54 promoter consensus sequence was required for transcription. Deletion of the region 5' to the apparent sigma 54 promoter caused a complete loss of transcription activation. Transcription activation of flbN in C. crescentus involves the combination of several elements: the NifA-like site is required for full

  16. Transcriptional activity of the human pseudogene psi alpha globin compared with alpha globin, its functional gene counterpart.

    PubMed Central

    Whitelaw, E; Proudfoot, N J

    1983-01-01

    Transcriptional analysis of the human pseudogene psi alpha globin has revealed the following features: (1) The promoter with a 23 bp deletion between the CCAAT and ATA boxes is functional both in vitro and in vivo, 3 fold and 10 fold less efficient, respectively, than alpha. (2) Both the psi alpha and alpha globin gene promoters are active in the absence of transcriptional enhancers, either a gene-encoded or viral enhancer. (3) The mutated poly(A) addition signal in psi alpha (AATGAA) appears to be completely nonfunctional. This result provides an explanation for the absence of psi alpha transcripts in human erythroid cells. Images PMID:6316269

  17. Rcs signalling-activated transcription of rcsA induces strong anti-sense transcription of upstream fliPQR flagellar genes from a weak intergenic promoter: regulatory roles for the anti-sense transcript in virulence and motility.

    PubMed

    Wang, Qingfeng; Harshey, Rasika M

    2009-10-01

    In Salmonella enterica, an activated Rcs signalling system inhibits initiation of transcription of the flhD master operon. Under these conditions, where motility is shut down, microarray experiments showed an increased RNA signal for three flagellar genes -fliPQR- located upstream of rcsA. We show here that it is the anti-sense (AS) strand of these genes that is transcribed, originating at a weak promoter in the intergenic region between fliR and rcsA. RcsA is an auxiliary regulator for the Rcs system, whose transcription is dependent on the response regulator RcsB. Rcs-activated rightward transcription, but not translation, of rcsA is required for stimulation of leftward AS transcription. Our results implicate a combined action of RcsB and rcsA transcription in activating the AS promoter, likely by modulating DNA superhelicity in the intergenic region. We show that the AS transcript regulates many genes in the Rcs regulon, including SPI-1 and SPI-2 virulence and stress-response genes. In the wild-type strain the AS transcript is present in low amounts, independent of Rcs signalling. Here, AS transcription modulates complementary sense RNA levels and impacts swarming motility. It appears that the flagellar AS transcript has been co-opted by the Rcs system to regulate virulence. PMID:19703110

  18. Rcs signaling-activated transcription of rcsA induces strong anti-sense transcription of upstream fliPQR flagellar genes from a weak intergenic promoter: regulatory roles for the anti-sense transcript in virulence and motility

    PubMed Central

    Wang, Qingfeng; Harshey, Rasika M.

    2009-01-01

    Summary In Salmonella enterica, an activated Rcs signaling system inhibits initiation of transcription of the flhD master operon. Under these conditions, where motility is shut down, microarray experiments showed an increased RNA signal for three flagellar genes - fliPQR - located upstream of rcsA. We show here that it is the anti-sense (AS) strand of these genes that is transcribed, originating at a weak promoter in the intergenic region between fliR and rcsA. RcsA is an auxiliary regulator for the Rcs system, whose transcription is dependent on the response regulator RcsB. Rcs-activated rightward transcription, but not translation, of rcsA is required for stimulation of leftward AS transcription. Our results implicate a combined action of RcsB and rcsA transcription in activating the AS promoter, likely by modulating DNA superhelicity in the intergenic region. We show that the AS transcript regulates many genes in the Rcs regulon, including SPI-1 and SPI-2 virulence and stress-response genes. In the wild-type strain the AS transcript is present in low amounts, independent of Rcs signaling. Here, AS transcription modulates complementary sense RNA levels and impacts swarming motility. It appears that the flagellar AS transcript has been co-opted by the Rcs system to regulate virulence. PMID:19703110

  19. Binding of TFIIIC to SINE Elements Controls the Relocation of Activity-Dependent Neuronal Genes to Transcription Factories

    PubMed Central

    Crepaldi, Luca; Policarpi, Cristina; Coatti, Alessandro; Sherlock, William T.; Jongbloets, Bart C.; Down, Thomas A.; Riccio, Antonella

    2013-01-01

    In neurons, the timely and accurate expression of genes in response to synaptic activity relies on the interplay between epigenetic modifications of histones, recruitment of regulatory proteins to chromatin and changes to nuclear structure. To identify genes and regulatory elements responsive to synaptic activation in vivo, we performed a genome-wide ChIPseq analysis of acetylated histone H3 using somatosensory cortex of mice exposed to novel enriched environmental (NEE) conditions. We discovered that Short Interspersed Elements (SINEs) located distal to promoters of activity-dependent genes became acetylated following exposure to NEE and were bound by the general transcription factor TFIIIC. Importantly, under depolarizing conditions, inducible genes relocated to transcription factories (TFs), and this event was controlled by TFIIIC. Silencing of the TFIIIC subunit Gtf3c5 in non-stimulated neurons induced uncontrolled relocation to TFs and transcription of activity-dependent genes. Remarkably, in cortical neurons, silencing of Gtf3c5 mimicked the effects of chronic depolarization, inducing a dramatic increase of both dendritic length and branching. These findings reveal a novel and essential regulatory function of both SINEs and TFIIIC in mediating gene relocation and transcription. They also suggest that TFIIIC may regulate the rearrangement of nuclear architecture, allowing the coordinated expression of activity-dependent neuronal genes. PMID:23966877

  20. A Homeodomain Transcription Factor Gene, PfMSX, Activates Expression of Pif Gene in the Pearl Oyster Pinctada fucata

    PubMed Central

    Zhao, Mi; He, Maoxian; Huang, Xiande; Wang, Qi

    2014-01-01

    We reported pearl oyster Pinctada fucata cDNA and genomic characterization of a new homeobox-containing protein, PfMSX. The PfMSX gene encodes a transcription factor that was localized to the nucleus. Analyses of PfMSX mRNA in tissues and developmental stages showed high expressions in mantle or D-shaped larvae. In electrophoretic mobility shift assays (EMSAs) PfMSX binded to MSX consensus binding sites in the 5′ flanking region of the Pif promoter. In co-transfection experiment PfMSX transactivated reporter constructs containing Pif promoter sequences, and mutation of the MSX-binding sites attenuated transactivation. A knockdown experiment using PfMSX dsRNA showed decreased Pif mRNA and unregular crystallization of the nacreous layer using scanning electron microscopy. Our results suggested that PfMSX was a conserved homeodomain transcription factor gene, which can activate Pif gene expression through MSX binding site, and was then involved in the mineralization process in pearl oyster Pinctada fucata. Our data provided important clues about mechanisms regulating biomineralization in pearl oyster. PMID:25099698

  1. The vaccinia virus E8R gene product is required for formation of transcriptionally active virions.

    PubMed

    Kato, Sayuri E M; Condit, Richard C; Moussatché, Nissin

    2007-10-25

    Two vaccinia virus temperature-sensitive mutants were mapped to the E8R gene and subjected to phenotypic characterization. Dts23 contains a missense mutation in the coding region of E8R (L81F), and in Cts19 the initiating methionine codon is changed from ATG to ATA (M1I). The two ts mutants display normal patterns of gene expression and DNA replication during infection. The E8 protein is synthesized exclusively late during infection and packaged into virion cores Western blot analysis revealed that E8 synthesis is reduced in Dts23 infected cells at permissive (31 degrees C) and non-permissive temperature (39.7 degrees C) and absent in Cts19 infection under both conditions. Dts23 virions produced at 39.7 degrees C were indistinguishable in appearance from wt virions. Cts19 fails to produce identifiable viral structures when incubated at 39.7 degrees C. Purified Dts23 virions produced at 39.7 degrees C contain reduced amounts of E8 and have a high particle to infectivity ratio; purified Cts19 virions grown at 31 degrees C also show reduced infectivity and do not contain detectable E8. Dts23 grown at 39.7 degrees C could enter cells but failed to synthesize early mRNA or produce CPE. Soluble extracts from mutant virions were active in a promoter dependent in vitro transcription assay, however intact mutant cores were defective in transcription. We suggest that E8 plays a subtle role in virion core structure that impacts directly or indirectly on core transcription. PMID:17619043

  2. Transcription factors GAF and HSF act at distinct regulatory steps to modulate stress-induced gene activation

    PubMed Central

    Fuda, Nicholas J.; Mahat, Dig B.; Core, Leighton J.; Guertin, Michael J.

    2016-01-01

    The coordinated regulation of gene expression at the transcriptional level is fundamental to development and homeostasis. Inducible systems are invaluable when studying transcription because the regulatory process can be triggered instantaneously, allowing the tracking of ordered mechanistic events. Here, we use precision run-on sequencing (PRO-seq) to examine the genome-wide heat shock (HS) response in Drosophila and the function of two key transcription factors on the immediate transcription activation or repression of all genes regulated by HS. We identify the primary HS response genes and the rate-limiting steps in the transcription cycle that GAGA-associated factor (GAF) and HS factor (HSF) regulate. We demonstrate that GAF acts upstream of promoter-proximally paused RNA polymerase II (Pol II) formation (likely at the step of chromatin opening) and that GAF-facilitated Pol II pausing is critical for HS activation. In contrast, HSF is dispensable for establishing or maintaining Pol II pausing but is critical for the release of paused Pol II into the gene body at a subset of highly activated genes. Additionally, HSF has no detectable role in the rapid HS repression of thousands of genes. PMID:27492368

  3. Excess iodide downregulates Na(+)/I(-) symporter gene transcription through activation of PI3K/Akt pathway.

    PubMed

    Serrano-Nascimento, Caroline; Nicola, Juan Pablo; Teixeira, Silvania da Silva; Poyares, Leonice Lourenço; Lellis-Santos, Camilo; Bordin, Silvana; Masini-Repiso, Ana Maria; Nunes, Maria Tereza

    2016-05-01

    Transcriptional mechanisms associated with iodide-induced downregulation of NIS expression remain uncertain. Here, we further analyzed the transcriptional regulation of NIS gene expression by excess iodide using PCCl3 cells. NIS promoter activity was reduced in cells treated for 12-24 h with 10(-5) to 10(-3) M NaI. Site-directed mutagenesis of Pax8 and NF-κB cis-acting elements abrogated the iodide-induced NIS transcription repression. Indeed, excess iodide (10(-3) M) excluded Pax8 from the nucleus, decreased p65 total expression and reduced their transcriptional activity. Importantly, p65-Pax8 physical interaction and binding to NIS upstream enhancer were reduced upon iodide treatment. PI3K/Akt pathway activation by iodide-induced ROS production is involved in the transcriptional repression of NIS expression. In conclusion, the results indicated that excess iodide transcriptionally represses NIS gene expression through the impairment of Pax8 and p65 transcriptional activity. Furthermore, the data presented herein described novel roles for PI3K/Akt signaling pathway and oxidative status in the thyroid autoregulatory phenomenon. PMID:26872612

  4. Activation of transcription at divergent urea-dependent promoters by the urease gene regulator UreR.

    PubMed

    D'Orazio, S E; Thomas, V; Collins, C M

    1996-08-01

    The Proteus mirabilis and plasmid-encoded urease loci contain seven contiguous structural and accessory genes (ureDABCEFG) and the divergently transcribed ureR, which codes for an AraC-like transcriptional activator. Previously, it was shown that the plasmid-encoded ureR to ureD intergenic region contained divergent promoters (ureRp and ureDp). Transcription from these promoters required both the effector molecule urea and the activator protein UreR. In this report, we demonstrate that the P. mirabilis urease gene cluster contains similar divergent urea- and UreR-dependent promoters. The ureR gene products from either urease locus were able to activate transcription at both the plasmid-encoded and P. mirabilis promoters. The minimal concentration of urea required to activate transcription at ureRp or ureDp from either gene cluster was approximately 4 mM. The transcriptional start sites for the plasmid-encoded and P. mirabilis divergent promoters were similar in an Escherichia coli DH5 alpha background, as determined by primer-extension analysis. However, in P. mirabilis HI4320, transcription of ureR initiated predominately at an alternative site. Physical mapping and inhibition studies were used to localize the UreR-binding sites within the plasmid-encoded ureRp and ureDp intergenic sequences to regions of 68 bp and 86 bp, respectively. Gel shift analysis demonstrated that UreR bound to a 135 bp fragment in the approximate centre of the plasmid-encoded ureR to ureD intergenic region. The results presented here suggest that the P. mirabilis and plasmid-encoded urease gene clusters utilize similar mechanisms of transcriptional activation in response to urea. PMID:8866486

  5. Inhibition of human insulin gene transcription by peroxisome proliferator-activated receptor γ and thiazolidinedione oral antidiabetic drugs

    PubMed Central

    Schinner, S; Krätzner, R; Baun, D; Dickel, C; Blume, R; Oetjen, E

    2009-01-01

    Background and purpose: The transcription factor peroxisome proliferator-activated receptor γ (PPARγ) is essential for glucose homeostasis. PPARγ ligands reducing insulin levels in vivo are used as drugs to treat type 2 diabetes mellitus. Genes regulated by PPARγ have been found in several tissues including insulin-producing pancreatic islet β-cells. However, the role of PPARγ at the insulin gene was unknown. Therefore, the effect of PPARγ and PPARγ ligands like rosiglitazone on insulin gene transcription was investigated. Experimental approach: Reporter gene assays were used in the β-cell line HIT and in primary mature pancreatic islets of transgenic mice. Mapping studies and internal mutations were carried out to locate PPARγ-responsive promoter regions. Key results: Rosiglitazone caused a PPARγ-dependent inhibition of insulin gene transcription in a β-cell line. This inhibition was concentration-dependent and had an EC50 similar to that for the activation of a reporter gene under the control of multimerized PPAR binding sites. Also in normal primary pancreatic islets of transgenic mice, known to express high levels of PPARγ, rosiglitazone inhibited glucose-stimulated insulin gene transcription. Transactivation and mapping experiments suggest that, in contrast to the rat glucagon gene, the inhibition of the human insulin gene promoter by PPARγ/rosiglitazone does not depend on promoter-bound Pax6 and is attributable to the proximal insulin gene promoter region around the transcription start site from −56 to +18. Conclusions and implications: The human insulin gene represents a novel PPARγ target that may contribute to the action of thiazolidinediones in type 2 diabetes mellitus. PMID:19338578

  6. Transcriptional activation of the cholesterol 7alpha-hydroxylase gene (CYP7A) by nuclear hormone receptors.

    PubMed

    Crestani, M; Sadeghpour, A; Stroup, D; Galli, G; Chiang, J Y

    1998-11-01

    The gene encoding cholesterol 7alpha-hydroxylase (CYP7A), the rate-limiting enzyme in bile acid synthesis, is transcriptionally regulated by bile acids and hormones. Previously, we have identified two bile acid response elements (BARE) in the promoter of the CYP7A gene. The BARE II is located in nt -149/-118 region and contains three hormone response element (HRE)-like sequences that form two overlapping nuclear receptor binding sites. One is a direct repeat separated by one nucleotide DR1 (-146- TGGACTtAGTTCA-134) and the other is a direct repeat separated by five nucleotides DR5 (-139-AGTTCAaggccGGG TAA-123). Mutagenesis of these HRE sequences resulted in lower transcriptional activity of the CYP7A promoter/reporter genes in transient transfection assay in HepG2 cells. The orphan nuclear receptor, hepatocyte nuclear factor 4 (HNF-4)1, binds to the DR1 sequence as assessed by electrophoretic mobility shift assay, and activates the CYP7A promoter/reporter activity by about 9-fold. Cotransfection of HNF-4 plasmid with another orphan nuclear receptor, chicken ovalbumin upstream promoter-transcription factor II (COUP-TFII), synergistically activated the CYP7A transcription by 80-fold. The DR5 binds the RXR/RAR heterodimer. A hepatocyte nuclear factor-3 (HNF-3) binding site (-175-TGTTTGTTCT-166) was identified. HNF-3 was required for both basal transcriptional activity and stimulation of the rat CYP7A promoter activity by retinoic acid. Combinatorial interactions and binding of these transcription factors to BAREs may modulate the promoter activity and also mediate bile acid repression of CYP7A gene transcription. PMID:9799805

  7. Characterization of the human CD4 gene promoter: transcription from the CD4 gene core promoter is tissue-specific and is activated by Ets proteins.

    PubMed Central

    Salmon, P; Giovane, A; Wasylyk, B; Klatzmann, D

    1993-01-01

    We analyzed the 5' transcription control sequences of the human CD4 gene. We located the transcription initiation site and showed that the CD4 core promoter (positions -40 to +16) lacks a classical "TATA" or initiator positioning consensus sequence but directs precise and efficient transcription when coupled to the ubiquitously active simian virus 40 enhancer. The transcriptional activity of the CD4 gene promoter correlated with CD4 expression in various cell types. Interestingly, the CD4 core promoter also displayed a tissue-specific transcriptional activity. Within this fragment, three nucleic acid sequences are completely conserved in the murine CD4 gene. One of these sequences contains a perfect ETS consensus sequence. Another ETS consensus sequence is located 1060 nt upstream. Electrophoretic-mobility-shift assays showed that the core promoter ETS motif binds an Ets-related protein specifically expressed at high levels in CD4+ cells. Moreover, in CD4- cells, overexpression of Ets-1 or Ets-2 efficiently and specifically activated transcription from the CD4 promoter and core promoter. These data indicate that Ets transcription factors play a central role in controlling CD4 gene expression, by binding to both a classical remote site and an unusual proximal activator sequence. Images Fig. 2 Fig. 4 PMID:8356078

  8. YY1 Acts as a Transcriptional Activator of Hoxa5 Gene Expression in Mouse Organogenesis

    PubMed Central

    Bérubé-Simard, Félix-Antoine; Prudhomme, Christelle; Jeannotte, Lucie

    2014-01-01

    The Hox gene family encodes homeodomain-containing transcriptional regulators that confer positional information to axial and paraxial tissues in the developing embryo. The dynamic Hox gene expression pattern requires mechanisms that differentially control Hox transcription in a precise spatio-temporal fashion. This implies an integrated regulation of neighbouring Hox genes achieved through the sharing and the selective use of defined enhancer sequences. The Hoxa5 gene plays a crucial role in lung and gut organogenesis. To position Hoxa5 in the regulatory hierarchy that drives organ morphogenesis, we searched for cis-acting regulatory sequences and associated trans-acting factors required for Hoxa5 expression in the developing lung and gut. Using mouse transgenesis, we identified two DNA regions included in a 1.5-kb XbaI-XbaI fragment located in the Hoxa4-Hoxa5 intergenic domain and known to control Hoxa4 organ expression. The multifunctional YY1 transcription factor binds the two regulatory sequences in vitro and in vivo. Moreover, the mesenchymal deletion of the Yy1 gene function in mice results in a Hoxa5-like lung phenotype with decreased Hoxa5 and Hoxa4 gene expression. Thus, YY1 acts as a positive regulator of Hoxa5 expression in the developing lung and gut. Our data also support a role for YY1 in the coordinated expression of Hox genes for correct organogenesis. PMID:24705708

  9. Transcriptional activation by EBV nuclear antigen 1 is essential for the expression of EBV's transforming genes

    PubMed Central

    Altmann, Markus; Pich, Dagmar; Ruiss, Romana; Wang, Jindong; Sugden, Bill; Hammerschmidt, Wolfgang

    2006-01-01

    EBV is a paradigm for human tumor viruses because, although it infects most people benignly, it also can cause a variety of cancers. Both in vivo and in vitro, EBV infects B lymphocytes in G0, induces them to become blasts, and can maintain their proliferation in cell culture or in vivo as tumors. How EBV succeeds in these contrasting cellular environments in expressing its genes that control the host has not been explained. We have genetically dissected the EBV nuclear antigen 1 (EBNA1) gene that is required for replication of the viral genome, to elucidate its possible role in the transcription of viral genes. Strikingly, EBNA1 is essential to drive transcription of EBV's transforming genes after infection of primary B lymphocytes. PMID:16966603

  10. Reverse transcriptase genes are highly abundant and transcriptionally active in marine plankton assemblages.

    PubMed

    Lescot, Magali; Hingamp, Pascal; Kojima, Kenji K; Villar, Emilie; Romac, Sarah; Veluchamy, Alaguraj; Boccara, Martine; Jaillon, Olivier; Iudicone, Daniele; Bowler, Chris; Wincker, Patrick; Claverie, Jean-Michel; Ogata, Hiroyuki

    2016-05-01

    Genes encoding reverse transcriptases (RTs) are found in most eukaryotes, often as a component of retrotransposons, as well as in retroviruses and in prokaryotic retroelements. We investigated the abundance, classification and transcriptional status of RTs based on Tara Oceans marine metagenomes and metatranscriptomes encompassing a wide organism size range. Our analyses revealed that RTs predominate large-size fraction metagenomes (>5 μm), where they reached a maximum of 13.5% of the total gene abundance. Metagenomic RTs were widely distributed across the phylogeny of known RTs, but many belonged to previously uncharacterized clades. Metatranscriptomic RTs showed distinct abundance patterns across samples compared with metagenomic RTs. The relative abundances of viral and bacterial RTs among identified RT sequences were higher in metatranscriptomes than in metagenomes and these sequences were detected in all metatranscriptome size fractions. Overall, these observations suggest an active proliferation of various RT-assisted elements, which could be involved in genome evolution or adaptive processes of plankton assemblage. PMID:26613339

  11. Crystal structure of the caseinolytic protease gene regulator, a transcriptional activator in actinomycetes.

    PubMed

    Russo, Santina; Schweitzer, Jens-Eric; Polen, Tino; Bott, Michael; Pohl, Ehmke

    2009-02-20

    Human pathogens of the genera Corynebacterium and Mycobacterium possess the transcriptional activator ClgR (clp gene regulator) which in Corynebacterium glutamicum has been shown to regulate the expression of the ClpCP protease genes. ClgR specifically binds to pseudo-palindromic operator regions upstream of clpC and clpP1P2. Here, we present the first crystal structure of a ClgR protein from C. glutamicum. The structure was determined from two different crystal forms to resolutions of 1.75 and 2.05 A, respectively. ClgR folds into a five-helix bundle with a helix-turn-helix motif typical for DNA-binding proteins. Upon dimerization the two DNA-recognition helices are arranged opposite to each other at the protein surface in a distance of approximately 30 A, which suggests that they bind into two adjacent major grooves of B-DNA in an anti-parallel manner. A binding pocket is situated at a strategic position in the dimer interface and could possess a regulatory role altering the positions of the DNA-binding helices. PMID:19019826

  12. Direct activation of human and mouse Oct4 genes using engineered TALE and Cas9 transcription factors.

    PubMed

    Hu, Jiabiao; Lei, Yong; Wong, Wing-Ki; Liu, Senquan; Lee, Kai-Chuen; He, Xiangjun; You, Wenxing; Zhou, Rui; Guo, Jun-Tao; Chen, Xiongfong; Peng, Xianlu; Sun, Hao; Huang, He; Zhao, Hui; Feng, Bo

    2014-04-01

    The newly developed transcription activator-like effector protein (TALE) and clustered regularly interspaced short palindromic repeats/Cas9 transcription factors (TF) offered a powerful and precise approach for modulating gene expression. In this article, we systematically investigated the potential of these new tools in activating the stringently silenced pluripotency gene Oct4 (Pou5f1) in mouse and human somatic cells. First, with a number of TALEs and sgRNAs targeting various regions in the mouse and human Oct4 promoters, we found that the most efficient TALE-VP64s bound around -120 to -80 bp, while highly effective sgRNAs targeted from -147 to -89-bp upstream of the transcription start sites to induce high activity of luciferase reporters. In addition, we observed significant transcriptional synergy when multiple TFs were applied simultaneously. Although individual TFs exhibited marginal activity to up-regulate endogenous gene expression, optimized combinations of TALE-VP64s could enhance endogenous Oct4 transcription up to 30-fold in mouse NIH3T3 cells and 20-fold in human HEK293T cells. More importantly, the enhancement of OCT4 transcription ultimately generated OCT4 proteins. Furthermore, examination of different epigenetic modifiers showed that histone acetyltransferase p300 could enhance both TALE-VP64 and sgRNA/dCas9-VP64 induced transcription of endogenous OCT4. Taken together, our study suggested that engineered TALE-TF and dCas9-TF are useful tools for modulating gene expression in mammalian cells. PMID:24500196

  13. Proto-oncogene FBI-1 (Pokemon) and SREBP-1 synergistically activate transcription of fatty-acid synthase gene (FASN).

    PubMed

    Choi, Won-Il; Jeon, Bu-Nam; Park, Hyejin; Yoo, Jung-Yoon; Kim, Yeon-Sook; Koh, Dong-In; Kim, Myung-Hwa; Kim, Yu-Ri; Lee, Choong-Eun; Kim, Kyung-Sup; Osborne, Timothy F; Hur, Man-Wook

    2008-10-24

    FBI-1 (Pokemon/ZBTB7A) is a proto-oncogenic transcription factor of the BTB/POZ (bric-à-brac, tramtrack, and broad complex and pox virus zinc finger) domain family. Recent evidence suggested that FBI-1 might be involved in adipogenic gene expression. Coincidentally, expression of FBI-1 and fatty-acid synthase (FASN) genes are often increased in cancer and immortalized cells. Both FBI-1 and FASN are important in cancer cell proliferation. SREBP-1 is a major regulator of many adipogenic genes, and FBI-1 and SREBP-1 (sterol-responsive element (SRE)-binding protein 1) interact with each other directly via their DNA binding domains. FBI-1 enhanced the transcriptional activation of SREBP-1 on responsive promoters, pGL2-6x(SRE)-Luc and FASN gene. FBI-1 and SREBP-1 synergistically activate transcription of the FASN gene by acting on the proximal GC-box and SRE/E-box. FBI-1, Sp1, and SREBP-1 can bind to all three SRE, GC-box, and SRE/E-box. Binding competition among the three transcription factors on the GC-box and SRE/E-box appears important in the transcription regulation. FBI-1 is apparently changing the binding pattern of Sp1 and SREBP-1 on the two elements in the presence of induced SREBP-1 and drives more Sp1 binding to the proximal promoter with less of an effect on SREBP-1 binding. The changes induced by FBI-1 appear critical in the synergistic transcription activation. The molecular mechanism revealed provides insight into how proto-oncogene FBI-1 may attack the cellular regulatory mechanism of FASN gene expression to provide more phospholipid membrane components needed for rapid cancer cell proliferation. PMID:18682402

  14. SATB1 Packages Densely Looped, Transcriptionally Active Chromatin for Coordinated Expression of Cytokine Genes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    SATB1 (special AT-rich sequence binding protein 1) organizes cell type–specific nuclear architecture by anchoring specialized DNA sequences and recruiting chromatin remodeling factors to control gene transcription. We studied the role of SATB1 in regulating the coordinated expression of Il5, Il4 and...

  15. Intrinsic HER4/4ICD transcriptional activation domains are required for STAT5A activated gene expression.

    PubMed

    Han, Wen; Sfondouris, Mary E; Semmes, Eleanor C; Meyer, Alicia M; Jones, Frank E

    2016-10-30

    The epidermal growth factor receptor family member HER4 undergoes proteolytic processing at the cell surface to release the HER4 intracellular domain (4ICD) nuclear protein. Interestingly, 4ICD directly interacts with STAT5 and functions as an obligate STAT5 nuclear chaperone. Once in the nucleus 4ICD binds with STAT5 at STAT5 target genes, dramatically potentiating STAT5 transcriptional activation. These observations raise the possibility that 4ICD directly coactivates STAT5 gene expression. Using both yeast and mammalian transactivation reporter assays, we performed truncations of 4ICD fused to a GAL4 DNA binding domain and identified two independent 4ICD transactivation domains located between residues 1022 and 1090 (TAD1) and 1192 and 1225 (TAD2). The ability of the 4ICD DNA binding domain fusions to transactivate reporter gene expression required deletion of the intrinsic tyrosine kinase domain. In addition, we identified the 4ICD carboxyl terminal TVV residues, a PDZ domain binding motif (PDZ-DBM), as a potent transcriptional repressor. The transactivation activity of the HER4 carboxyl terminal domain lacking the tyrosine kinase (CTD) was significantly lower than similar EGFR or HER2 CTD. However, deletion of the HER4 CTD PDZ-DBM enhanced HER4 CTD transactivation to levels equivalent to the EGFR and HER2 CTDs. To determine if 4ICD TAD1 and TAD2 have a physiologically relevant role in STAT5 transactivation, we coexpressed 4ICD or 4ICD lacking TAD2 or both TAD1 and TAD2 with STAT5 in a luciferase reporter assay. Our results demonstrate that each 4ICD TAD contributes additively to STAT5A transactivation and the ability of STAT5A to transactivate the β-casein promoter requires the 4ICD TADs. Taken together, published data and our current results demonstrate that both 4ICD nuclear chaperone and intrinsic coactivation activities are essential for STAT5 regulated gene expression. PMID:27502417

  16. The Zinc Finger Transcription Factor ZXDC Activates CCL2 Gene Expression by Opposing BCL6-mediated Repression

    PubMed Central

    Ramsey, Jon E.; Fontes, Joseph D.

    2013-01-01

    The zinc finger X-linked duplicated (ZXD) family of transcription factors has been implicated in regulating transcription of major histocompatibility complex class II genes in antigen presenting cells; roles beyond this function are not yet known. The expression of one gene in this family, ZXD family zinc finger C (ZXDC), is enriched in myeloid lineages and therefore we hypothesized that ZXDC may regulate myeloid-specific gene expression. Here we demonstrate that ZXDC regulates genes involved in myeloid cell differentiation and inflammation. Overexpression of the larger isoform of ZXDC, ZXDC1, activates expression of monocyte-specific markers of differentiation and synergizes with phorbol 12-myristate 13-acetate (which causes differentiation) in the human leukemic monoblast cell line U937. To identify additional gene targets of ZXDC1, we performed gene expression profiling which revealed multiple inflammatory gene clusters regulated by ZXDC1. Using a combination of approaches we show that ZXDC1 activates transcription of a gene within one of the regulated clusters, chemokine (C-C motif) ligand 2 (CCL2; monocyte chemoattractant protein 1; MCP1) via a previously defined distal regulatory element. Further, ZXDC1-dependent up-regulation of the gene involves eviction of the transcriptional repressor B-cell CLL/lymphoma 6 (BCL6), a factor known to be important in resolving inflammatory responses, from this region of the promoter. Collectively, our data show that ZXDC1 is a regulator in the process of myeloid function and that ZXDC1 is responsible for Ccl2 gene de-repression by BCL6. PMID:23954399

  17. Repression of the genes for lysine biosynthesis in Saccharomyces cerevisiae is caused by limitation of Lys14-dependent transcriptional activation.

    PubMed Central

    Feller, A; Dubois, E; Ramos, F; Piérard, A

    1994-01-01

    The product of the LYS14 gene of Saccharomyces cerevisiae activates the transcription of at least four genes involved in lysine biosynthesis. Physiological and genetic studies indicate that this activation is dependent on the inducer alpha-aminoadipate semialdehyde, an intermediate of the pathway. The gene LYS14 was sequenced and, from its nucleotide sequence, predicted to encode a 790-amino-acid protein carrying a cysteine-rich DNA-binding motif of the Zn(II)2Cys6 type in its N-terminal portion. Deletion of this N-terminal portion including the cysteine-rich domain resulted in the loss of LYS14 function. To test the function of Lys14 as a transcriptional activator, this protein without its DNA-binding motif was fused to the DNA-binding domain of the Escherichia coli LexA protein. The resulting LexA-Lys14 hybrid protein was capable of activating transcription from a promoter containing a lexA operator, thus confirming the transcriptional activation function of Lys14. Furthermore, evidence that this function, which is dependent on the presence of alpha-aminoadipate semialdehyde, is antagonized by lysine was obtained. Such findings suggest that activation by alpha-aminoadipate semialdehyde and the apparent repression by lysine are related mechanisms. Lysine possibly acts by limiting the supply of the coinducer, alpha-aminoadipate semialdehyde. PMID:7935367

  18. YY1 and Sp1 activate transcription of the human NDUFS8 gene encoding the mitochondrial complex I TYKY subunit.

    PubMed

    Lescuyer, Pierre; Martinez, Pascal; Lunardi, Joël

    2002-03-19

    Complex I is the most complicated of the multimeric enzymes that constitute the mitochondrial respiratory chain. It is encoded by both mitochondrial and nuclear genomes. We have previously characterized the human NDUFS8 gene that encodes the TYKY subunit. This essential subunit is thought to participate in the electron transfer and proton pumping activities of complex I. Here, we have analyzed the transcriptional regulation of the NDUFS8 gene. Using primer extension assays, we have identified two transcription start sites. The basal promoter was mapped to a 247 bp sequence upstream from the main transcription start site by reporter gene analysis in HeLa cells and in differentiated or non-differentiated C2C12 cells. Three Sp1 sites and one YY1 site were identified in this minimal promoter. Through gel shift analysis, all sites were shown to bind to their cognate transcription factors. Site-directed mutagenesis revealed that the YY1 site and two upstream adjacent Sp1 sites drive most of the promoter activity. This work represents the first promoter analysis for a complex I gene. Together with previous studies, our results indicate that YY1 and Sp1 control the expression of genes encoding proteins that are involved in almost all steps of the oxidative phosphorylation metabolism. PMID:11955626

  19. Activation of proglucagon gene transcription by protein kinase-A in a novel mouse enteroendocrine cell line.

    PubMed

    Drucker, D J; Jin, T; Asa, S L; Young, T A; Brubaker, P L

    1994-12-01

    The gene encoding proglucagon is expressed predominantly in the pancreas and intestine. The physiological importance of glucagon secreted from the islets of Langerhans has engendered considerable interest in the molecular control of proglucagon gene transcription in the endocrine pancreas. In contrast, little is known about the molecular control of proglucagon gene expression in the intestine. The recent demonstration that glucagon-like peptide-1 (GLP-1) secreted from the intestine is a potent regulator of insulin secretion and glucose homeostasis has stimulated renewed interest in the factors that control GLP-1 synthesis in the intestinal L-cell. To develop a model for the analysis of intestinal proglucagon gene expression, we have targeted expression of a proglucagon gene-simian virus-40 large T-antigen fusion gene to enteroendocrine cells in transgenic mice. These mice develop intestinal tumors that were used to derive a novel cell line, designated GLUTag, that expresses the proglucagon gene and secretes immunoreactive GLP-1 in vitro. GLUTag cells demonstrate morphological characteristics of enteroendocrine cells by electron microscopy and are plurihormonal, as shown by immunocytochemistry and RNA analyses. GLUTag cells express the proglucagon and cholecystokinin genes, consistent with the pattern of lineage-specific enteroendocrine differentiation described for mouse intestine. Proglucagon gene expression was induced by activators of the protein kinase-A pathway, and a combination of messenger RNA half-life and nuclear run-on experiments demonstrated that the protein kinase-A-induction is mediated by an increase in proglucagon gene transcription. In contrast, activators of protein kinase-C stimulated secretion, but not biosynthesis of the PGDPs in GLUTag cell cultures. Analysis of proglucagon processing in GLUTag cells demonstrated the liberation of glucagon, oxyntomodulin, glicentin, and multiple forms of GLP-1. These observations provide evidence for the

  20. Gene switching rate determines response to extrinsic perturbations in the self-activation transcriptional network motif.

    PubMed

    de Franciscis, Sebastiano; Caravagna, Giulio; Mauri, Giancarlo; d'Onofrio, Alberto

    2016-01-01

    Gene switching dynamics is a major source of randomness in genetic networks, also in the case of large concentrations of the transcription factors. In this work, we consider a common network motif - the positive feedback of a transcription factor on its own synthesis - and assess its response to extrinsic noises perturbing gene deactivation in a variety of settings where the network might operate. These settings are representative of distinct cellular types, abundance of transcription factors and ratio between gene switching and protein synthesis rates. By investigating noise-induced transitions among the different network operative states, our results suggest that gene switching rates are key parameters to shape network response to external perturbations, and that such response depends on the particular biological setting, i.e. the characteristic time scales and protein abundance. These results might have implications on our understanding of irreversible transitions for noise-related phenomena such as cellular differentiation. In addition these evidences suggest to adopt the appropriate mathematical model of the network in order to analyze the system consistently to the reference biological setting. PMID:27256916

  1. Gene switching rate determines response to extrinsic perturbations in the self-activation transcriptional network motif

    PubMed Central

    de Franciscis, Sebastiano; Caravagna, Giulio; Mauri, Giancarlo; d’Onofrio, Alberto

    2016-01-01

    Gene switching dynamics is a major source of randomness in genetic networks, also in the case of large concentrations of the transcription factors. In this work, we consider a common network motif - the positive feedback of a transcription factor on its own synthesis - and assess its response to extrinsic noises perturbing gene deactivation in a variety of settings where the network might operate. These settings are representative of distinct cellular types, abundance of transcription factors and ratio between gene switching and protein synthesis rates. By investigating noise-induced transitions among the different network operative states, our results suggest that gene switching rates are key parameters to shape network response to external perturbations, and that such response depends on the particular biological setting, i.e. the characteristic time scales and protein abundance. These results might have implications on our understanding of irreversible transitions for noise-related phenomena such as cellular differentiation. In addition these evidences suggest to adopt the appropriate mathematical model of the network in order to analyze the system consistently to the reference biological setting. PMID:27256916

  2. A unique nucleosome arrangement, maintained actively by chromatin remodelers facilitates transcription of yeast tRNA genes

    PubMed Central

    2013-01-01

    Background RNA polymerase (pol) III transcribes a unique class of genes with intra-genic promoters and high transcriptional activity. The major contributors to the pol III transcriptome, tRNAs genes are found scattered on all chromosomes of yeast. A prototype tDNA of <150 bp length, is generally considered nucleosome-free while some pol III-transcribed genes have been shown to have nucleosome-positioning properties. Results Using high resolution ChIP-chip and ChIP-seq methods, we found several unique features associated with nucleosome profiles on all tRNA genes of budding yeast, not seen on nucleosome-dense counterparts in fission yeast and resting human CD4+ T cells. The nucleosome-free region (NFR) on all but three yeast tDNAs is found bordered by an upstream (US) nucleosome strongly positioned at −140 bp position and a downstream (DS) nucleosome at variable positions with respect to the gene terminator. Perturbation in this nucleosomal arrangement interferes with the tRNA production. Three different chromatin remodelers generate and maintain the NFR by targeting different gene regions. Isw1 localizes to the gene body and makes it nucleosome-depleted, Isw2 maintains periodicity in the upstream nucleosomal array, while RSC targets the downstream nucleosome. Direct communication of pol III with RSC serves as a stress-sensory mechanism for these genes. In its absence, the downstream nucleosome moves towards the gene terminator. Levels of tRNAs from different families are found to vary considerably as different pol III levels are seen even on isogenes within a family. Pol III levels show negative correlation with the nucleosome occupancies on different genes. Conclusions Budding yeast tRNA genes maintain an open chromatin structure, which is not due to sequence-directed nucleosome positioning or high transcription activity of genes. Unlike 5′ NFR on pol II-transcribed genes, the tDNA NFR, which facilitates tDNA transcription, results from action of chromatin

  3. An Activator of Transcription Regulates Phage TP901-1 Late Gene Expression

    PubMed Central

    Brøndsted, Lone; Pedersen, Margit; Hammer, Karin

    2001-01-01

    A promoter active in the late phase of the lytic cycle of lactococcal bacteriophage TP901-1 has been identified. The promoter is tightly regulated and requires the product of the phage TP901-1 orf29 for activity. A deletion analysis of the late promoter region showed that a fragment as small as 99 bp contains both the promoter and the region necessary for activation by ORF29. The transcriptional start site of the promoter was identified by primer extension to position 13073 on the TP901-1 genome, thus located 87 bp downstream of orf29 in a 580-bp intergenic region between orf29 and orf30. Furthermore, the region located −85 to −61 bp upstream of the start site was shown to be necessary for promoter activity. During infection, the transcript arising from the late promoter is fully induced at 40 min postinfection, and our results suggest that a certain level of ORF29 must be reached in order to activate transcription of the promoter. Several lactococcal bacteriophages encode ORF29 homologous proteins, indicating that late transcription may be controlled by a similar mechanism in these phages. With the identification of this novel regulator, our results suggest that within the P335 group of lactococcal phages at least two regulatory systems controlling transcription in the late stage of infection exist. PMID:11722916

  4. Activating Transcription Factor 4 and X Box Binding Protein 1 of Litopenaeus vannamei Transcriptional Regulated White Spot Syndrome Virus Genes Wsv023 and Wsv083

    PubMed Central

    Li, Xiao-Yun; Pang, Li-Ran; Chen, Yong-Gui; Weng, Shao-Ping; Yue, Hai-Tao; Zhang, Ze-Zhi; Chen, Yi-Hong; He, Jian-Guo

    2013-01-01

    In response to endoplasmic reticulum (ER) stress, the signaling pathway termed unfolded protein response (UPR) is activated. To investigate the role of UPR in Litopenaeus vannamei immunity, the activating transcription factor 4 (designated as LvATF4) which belonged to a branch of the UPR, the [protein kinase RNA (PKR)-like ER kinase, (PERK)]-[eukaryotic initiation factor 2 subunit alpha (eIF2α)] pathway, was identified and characterized. The full-length cDNA of LvATF4 was 1972 bp long, with an open reading frame of 1299 bp long that encoded a 432 amino acid protein. LvATF4 was highly expressed in gills, intestines and stomach. For the white spot syndrome virus (WSSV) challenge, LvATF4 was upregulated in the gills after 3 hpi and increased by 1.9-fold (96 hpi) compared to the mock-treated group. The LvATF4 knock-down by RNA interference resulted in a lower cumulative mortality of L. vannamei under WSSV infection. Reporter gene assays show that LvATF4 could upregulate the expression of the WSSV gene wsv023 based on the activating transcription factor/cyclic adenosine 3′, 5′-monophosphate response element (ATF/CRE). Another transcription factor of L. vannamei, X box binding protein 1 (designated as LvXBP1), has a significant function in [inositol-requiring enzyme-1(IRE1) – (XBP1)] pathway. This transcription factor upregulated the expression of the WSSV gene wsv083 based on the UPR element (UPRE). These results suggest that in L. vannamei UPR signaling pathway transcription factors are important for WSSV and might facilitate WSSV infection. PMID:23638122

  5. Human Kruppel-related 3 (HKR3) is a novel transcription activator of alternate reading frame (ARF) gene.

    PubMed

    Yoon, Jae-Hyeon; Choi, Won-Il; Jeon, Bu-Nam; Koh, Dong-In; Kim, Min-Kyeong; Kim, Myung-Hwa; Kim, Jungho; Hur, Sujin Susanne; Kim, Kyung-Sup; Hur, Man-Wook

    2014-02-14

    HKR3 (Human Krüppel-related 3) is a novel POK (POZ-domain Krüppel-like zinc-finger) family transcription factor. Recently, some of the POK (POZ-domain Krüppel-like zinc finger) family proteins have been shown to play roles in cell cycle arrest, apoptosis, cell proliferation, and oncogenesis. We investigated whether HKR3, an inhibitor of cell proliferation and an uncharacterized POK family protein, could regulate the cell cycle by controlling expression of genes within the p53 pathway (ARF-MDM2-TP53-p21WAF/CDKN1A). HKR3 potently activated the transcription of the tumor suppressor gene ARF by acting on the proximal promoter region (bp, -149∼+53), which contains Sp1 and FBI-1 binding elements (FREs). HKR3 interacted with the co-activator p300 to activate ARF transcription, which increased the acetylation of histones H3 and H4 within the proximal promoter. Oligonucleotide pull-down assays and ChIP assays revealed that HKR3 interferes with the binding of the proto-oncogenic transcription repressor FBI-1 to proximal FREs, thus derepressing ARF transcription. PMID:24382891

  6. Human Krüppel-related 3 (HKR3) Is a Novel Transcription Activator of Alternate Reading Frame (ARF) Gene*

    PubMed Central

    Yoon, Jae-Hyeon; Choi, Won-Il; Jeon, Bu-Nam; Koh, Dong-In; Kim, Min-Kyeong; Kim, Myung-Hwa; Kim, Jungho; Hur, Sujin Susanne; Kim, Kyung-Sup; Hur, Man-Wook

    2014-01-01

    HKR3 (Human Krüppel-related 3) is a novel POK (POZ-domain Krüppel-like zinc-finger) family transcription factor. Recently, some of the POK (POZ-domain Krüppel-like zinc finger) family proteins have been shown to play roles in cell cycle arrest, apoptosis, cell proliferation, and oncogenesis. We investigated whether HKR3, an inhibitor of cell proliferation and an uncharacterized POK family protein, could regulate the cell cycle by controlling expression of genes within the p53 pathway (ARF-MDM2-TP53-p21WAF/CDKN1A). HKR3 potently activated the transcription of the tumor suppressor gene ARF by acting on the proximal promoter region (bp, −149∼+53), which contains Sp1 and FBI-1 binding elements (FREs). HKR3 interacted with the co-activator p300 to activate ARF transcription, which increased the acetylation of histones H3 and H4 within the proximal promoter. Oligonucleotide pull-down assays and ChIP assays revealed that HKR3 interferes with the binding of the proto-oncogenic transcription repressor FBI-1 to proximal FREs, thus derepressing ARF transcription. PMID:24382891

  7. Peach MYB7 activates transcription of the proanthocyanidin pathway gene encoding leucoanthocyanidin reductase, but not anthocyanidin reductase

    PubMed Central

    Zhou, Hui; Lin-Wang, Kui; Liao, Liao; Gu, Chao; Lu, Ziqi; Allan, Andrew C.; Han, Yuepeng

    2015-01-01

    Proanthocyanidins (PAs) are a group of natural phenolic compounds that have a great effect on both flavor and nutritious value of fruit. It has been shown that PA synthesis is regulated by R2R3-MYB transcription factors (TFs) via activation of PA-specific pathway genes encoding leucoanthocyanidin reductase and anthocyanidin reductase. Here, we report the isolation and characterization of a MYB gene designated PpMYB7 in peach. The peach PpMYB7 represents a new group of R2R3-MYB genes regulating PA synthesis in plants. It is able to activate transcription of PpLAR1 but not PpANR, and has a broader selection of potential bHLH partners compared with PpMYBPA1. Transcription of PpMYB7 can be activated by the peach basic leucine-zipper 5 TF (PpbZIP5) via response to ABA. Our study suggests a transcriptional network regulating PA synthesis in peach, with the results aiding the understanding of the functional divergence between R2R3-MYB TFs in plants. PMID:26579158

  8. Expression of multiple tfb genes in different Halobacterium salinarum strains and interaction of TFB with transcriptional activator GvpE.

    PubMed

    Bleiholder, Anne; Frommherz, Regina; Teufel, Katharina; Pfeifer, Felicitas

    2012-04-01

    Halobacterium salinarum NRC-1 contains multiple TBP and TFB proteins required for the recruitment of RNA polymerase for transcription initiation. The presence and the expression of genes encoding TFB were investigated in the two Hbt. salinarum strains NRC-1 and PHH1 and the mutant strain PHH4. The plasmid-encoded tfbC and tfbE genes of NRC-1 were lacking in PHH1 and PHH4. The 5'-end of the tfbF transcript was determined and contained a 5'-untranslated region of 39 nucleotides able to form a stem-loop structure. The expression of these tfb genes was studied in cultures growing at 15, 37°C and under heat shock conditions. Cold temperatures reduced growth and except for tfbF also the amounts of all tfb transcripts. However, the formation of gas vesicles increased in PHH1 and NRC-1. Heat shock reduced growth of PHH1 and NRC-1, but PHH4 was not affected. A 100-fold increase in tfbA and tfbB mRNA was observed in PHH1 and PHH4, whereas NRC-1 reduced the amounts of these transcripts and increased the expression of tfbG. All TFB proteins tested were able to interact with the transcription activator GvpE involved in gas vesicle formation that thus is able to recruit TFB to the gvp promoter. PMID:21969032

  9. Transcriptional activities of the Pax6 gene eyeless regulate tissue specificity of ectopic eye formation in Drosophila

    PubMed Central

    Weasner, Bonnie M.; Weasner, Brandon; DeYoung, Stephanie M.; Michaels, Scott D.; Kumar, Justin P.

    2009-01-01

    Pax genes encode DNA binding proteins that play pivotal roles in the determination of complex tissues. Members of one subclass, Pax6, function as selector genes and play key roles in the retinal development of all seeing animals. Mutations within the Pax6 homologs including fly eyeless, mouse Small eye and human Pax6 lead to severe retinal defects in their respective systems. In Drosophila eyeless and twin of eyeless, play non-redundant roles in the developing retina. One particularly interesting characteristic of these genes is that, although expression of either gene can induce ectopic eye formation in non-retinal tissues, there are differences in the location and frequencies at which the eyes develop. eyeless induces much larger ectopic eyes, at higher frequencies, and in a broader range of tissues than twin of eyeless. In this report we describe a series of experiments conducted in both yeast and flies that has identified protein modules that are responsible for the differences in tissue transformation. These domains appear to contain transcriptional activator and repressor activity of distinct strengths. We propose a model in which the selective presence of these activities and their relative strengths accounts, in part, for the disparity to which ectopic eyes are induced in response to the forced expression of eyeless and twin of eyeless. The identification of both transcriptional activator and repressor activity within the Pax6 protein furthers our understanding of how this gene family regulates tissue determination. PMID:19406113

  10. Abiotic-stress induces demethylation and transcriptional activation of a gene encoding a glycerophosphodiesterase-like protein in tobacco plants.

    PubMed

    Choi, Chang-Sun; Sano, Hiroshi

    2007-05-01

    To examine the relationship between gene expression and DNA methylation, transcriptionally activated genes were screened in hypomethylated transgenic tobacco plants expressing an anti-DNA methyltransferase sequence. Among 16 genes initially identified, one clone was found to encode a glycerophosphodiesterase-like protein (NtGPDL), earlier reported to be responsive to aluminium stress. When detached leaves from wild type tobacco plants were treated with aluminium, NtGPDL transcripts were induced within 6 h, and corresponding genomic loci were demethylated at CCGG sites within 1 h. Direct bisulfite methylation mapping revealed that CG sites in coding regions were selectively demethylated, and that promoter regions were totally unmethylated regardless of the stress. Salt and low temperature treatments also induced similar demethylation patterns. Such effects could be attributable to oxidative stress, since reactive oxygen species generated by paraquat efficiently induced the same pattern of demethylation at coding regions. Pathogen infection induced neither transcripts nor genomic demethylation. These results suggested a close correlation between methylation and expression of NtGPDL upon abiotic stresses with a cause-effect relationship. Since DNA methylation is linked to histone modification, it is conceivable that demethylation at coding regions might induce alteration of chromatin structure, thereby enhancing transcription. We propose that environmental responses of plants are partly mediated through active alteration of the DNA methylation status. PMID:17273870

  11. Deduction of upstream sequences of Xanthomonas campestris flagellar genes responding to transcription activation by FleQ

    SciTech Connect

    Hu, R.-M.; Yang, T.-C.; Yang, S.-H.; Tseng, Y.-H. . E-mail: yhtseng@chtai.ctc.edu.tw

    2005-10-07

    Xanthomonas campestris pv. campestris (Xcc), a close relative to Pseudomonas aeruginosa, is the pathogen causing black rot in cruciferous plants. In P. aeruginosa, FleQ serves as a cognate activator of {sigma}{sup 54} in transcription from several {sigma}{sup 54}-dependent promoters of flagellar genes. These P. aeruginosa promoters have been analyzed for FleQ-binding sequences; however, no consensus was deduced. Xcc, although lacks fleSR, has a fleQ homologue residing among over 40 contiguously clustered flagellar genes. A fleQ mutant, Xc17fleQ, constructed by insertional mutation is deficient in FleQ protein, non-flagellated, and immobile. Transcriptional fusion assays on six putative {sigma}{sup 54}-dependent promoters of the flagellar genes, fliE, fliQ, fliL, flgG, flgB, and flhF, indicated that each of them is also FleQ dependent. Each of these promoters has a sequence with weak consensus to 5'-gaaacCCgccgCcgctTt-3', immediately upstream of the predicted {sigma}{sup 54}-binding site, with an imperfect inverted repeat containing a GC-rich center flanked by several A and T at 5'- and 3'-ends, respectively. Replacing this region in fliE promoter with a HindIII recognition sequence abolished the transcription, indicating that this region responds to transcription activation by FleQ.

  12. Induction of human adiponectin gene transcription by telmisartan, angiotensin receptor blocker, independently on PPAR-{gamma} activation

    SciTech Connect

    Moriuchi, Akie ||. E-mail: f1195@cc.nagasaki-u-ac.jp; Shimamura, Mika; Kita, Atsushi; Kuwahara, Hironaga; Satoh, Tsuyoshi; Satoh, Tsuyoshi; Fujishima, Keiichiro; Fukushima, Keiko |; Hayakawa, Takao; Mizuguchi, Hiroyuki; Nagayama, Yuji; Kawasaki, Eiji

    2007-05-18

    Adiponectin, an adipose tissue-specific plasma protein, has been shown to ameliorate insulin resistance and inhibit the process of atherosclerosis. Recently, several reports have stated that angiotensin type 1 receptor blockers (ARBs), increase adiponectin plasma level, and ameliorate insulin resistance. Telmisartan, a subclass of ARBs, has been shown to be a partial agonist of the peroxisome proliferator-activated receptor (PPAR)-{gamma}, and to increase the plasma adiponectin level. However, the transcriptional regulation of the human adiponectin gene by telmisartan has not been determined yet. To elucidate the effect of telmisartan on adiponectin, the stimulatory regulation of human adiponectin gene by telmisartan was investigated in 3T3-L1 adipocytes, utilizing adenovirus-mediated luciferase reporter gene-transferring technique. This study indicates that telmisartan may stimulate adiponectin transcription independent of PPAR-{gamma}.

  13. Characterization of a putative cis-regulatory element that controls transcriptional activity of the pig uroplakin II gene promoter

    SciTech Connect

    Kwon, Deug-Nam; Park, Mi-Ryung; Park, Jong-Yi; Cho, Ssang-Goo; Park, Chankyu; Oh, Jae-Wook; Song, Hyuk; Kim, Jae-Hwan; Kim, Jin-Hoi

    2011-07-01

    Highlights: {yields} The sequences of -604 to -84 bp of the pUPII promoter contained the region of a putative negative cis-regulatory element. {yields} The core promoter was located in the 5F-1. {yields} Transcription factor HNF4 can directly bind in the pUPII core promoter region, which plays a critical role in controlling promoter activity. {yields} These features of the pUPII promoter are fundamental to development of a target-specific vector. -- Abstract: Uroplakin II (UPII) is a one of the integral membrane proteins synthesized as a major differentiation product of mammalian urothelium. UPII gene expression is bladder specific and differentiation dependent, but little is known about its transcription response elements and molecular mechanism. To identify the cis-regulatory elements in the pig UPII (pUPII) gene promoter region, we constructed pUPII 5' upstream region deletion mutants and demonstrated that each of the deletion mutants participates in controlling the expression of the pUPII gene in human bladder carcinoma RT4 cells. We also identified a new core promoter region and putative negative cis-regulatory element within a minimal promoter region. In addition, we showed that hepatocyte nuclear factor 4 (HNF4) can directly bind in the pUPII core promoter (5F-1) region, which plays a critical role in controlling promoter activity. Transient cotransfection experiments showed that HNF4 positively regulates pUPII gene promoter activity. Thus, the binding element and its binding protein, HNF4 transcription factor, may be involved in the mechanism that specifically regulates pUPII gene transcription.

  14. The rolB gene activates secondary metabolism in Arabidopsis calli via selective activation of genes encoding MYB and bHLH transcription factors.

    PubMed

    Bulgakov, Victor P; Veremeichik, Galina N; Grigorchuk, Valeria P; Rybin, Viacheslav G; Shkryl, Yuri N

    2016-05-01

    It is known that the rolB gene of Agrobacterium rhizogenes increases the production of secondary metabolites in transformed plant cells, but its mechanism of action remains unclear. In this report, we demonstrate that rolB expression in Arabidopsis thaliana calli led to the activation of most genes encoding secondary metabolism-specific MYB and bHLH transcription factors (TFs), such as MYB11, MYB12, MYB28, MYB76, MYB34, MYB51, MYB122, TT2 and TT8. Accordingly, a higher transcript abundance of main biosynthetic genes related to these factors was detected. The rolB-transformed calli produced 3-fold higher levels of indolic glucosinolates (GSs) compared with normal calli but did not produce secondary metabolites from other groups. Enhanced accumulation of indolic GSs was caused by activation of MYB34, MYB51 and MYB122, and the absence of aliphatic GSs in transformed calli was caused by the inability of rolB to induce MYB29. The inability of rolB-calli to produce flavonoids was caused by the lack of MYB111 expression, induced by the rolB-mediated conversion of MYB expression from cotyledon-specific to root-specific patterns. The high specificity of rolB on secondary metabolism-specific TFs was demonstrated for the first time. PMID:26913794

  15. The transcriptional regulator SsuR activates expression of the Corynebacterium glutamicum sulphonate utilization genes in the absence of sulphate.

    PubMed

    Koch, Daniel J; Rückert, Christian; Albersmeier, Andreas; Hüser, Andrea T; Tauch, Andreas; Pühler, Alfred; Kalinowski, Jörn

    2005-10-01

    In a recent study, the putative regulatory gene cg0012 was shown to belong to the regulon of McbR, a global transcriptional regulator of sulphur metabolism in Corynebacterium glutamicum ATCC 13032. A deletion of cg0012, now designated ssuR (sulphonate sulphur utilization regulator), led to the mutant strain C. glutamicum DK100, which was shown to be blocked in the utilization of sulphonates as sulphur sources. According to DNA microarray hybridizations, transcription of the ssu and seu genes, encoding the sulphonate utilization system of C. glutamicum, was considerably decreased in C. glutamicum DK100 when compared with the wild-type strain. Electrophoretic mobility shift assays with purified SsuR protein demonstrated that the upstream regions of ssuI, seuABC, ssuD2 and ssuD1CBA contain SsuR binding sites. A nucleotide sequence alignment of the four DNA fragments containing the SsuR binding sites revealed a common 21 bp motif consisting of T-, GC- and A-rich domains. Mapping of the transcriptional start sites in front of ssuI, seuABC, ssuD2 and ssuD1CBA indicated that the SsuR binding sites are located directly upstream of identified promoter sequences and that the ssu genes are expressed by leaderless transcripts. Binding of the SsuR protein to its operator was shown to be diminished in vitro by the effector substance sulphate and its direct assimilation products adenosine 5'-phosphosulphate, sulphite and sulphide. Real-time reverse transcription polymerase chain reaction experiments verified that the expression of the ssu and seu genes was also repressed in vivo by the presence of sulphate or sulphite. Therefore, the regulatory protein SsuR activates the expression of the ssu and seu genes in C. glutamicum in the absence of the preferred sulphur source sulphate. PMID:16194234

  16. Cyclic AMP-dependent activation of rhodopsin gene transcription in cultured retinal precursor cells of chicken embryo.

    PubMed

    Voisin, Pierre; Bernard, Marianne

    2009-07-01

    The present study describes a robust 50-fold increase in rhodopsin gene transcription by cAMP in cultured retinal precursor cells of chicken embryo. Retinal cells isolated at embryonic day 8 (E8) and cultured for 3 days in serum-supplemented medium differentiated mostly into red-sensitive cones and to a lesser degree into green-sensitive cones, as indicated by real-time RT-PCR quantification of each specific opsin mRNA. In contrast, both rhodopsin mRNA concentration and rhodopsin gene promoter activity required the presence of cAMP-increasing agents [forskolin and 3-isobutyl-1-methylxanthine (IBMX)] to reach significant levels. This response was rod-specific and was sufficient to activate rhodopsin gene transcription in serum-free medium. The increase in rhodopsin mRNA levels evoked by a series of cAMP analogs suggested the response was mediated by protein kinase A, not by EPAC. Membrane depolarization by high KCl concentration also increased rhodopsin mRNA levels and this response was strongly potentiated by IBMX. The rhodopsin gene response to cAMP-increasing agents was developmentally gated between E6 and E7. Rod-specific transducin alpha subunit mRNA levels also increased up to 50-fold in response to forskolin and IBMX, while rod-specific phosphodiesterase-VI and rod arrestin transcripts increased 3- to 10-fold. These results suggest a cAMP-mediated signaling pathway may play a role in rod differentiation. PMID:19457115

  17. The full-length transcript of a caulimovirus is a polycistronic mRNA whose genes are trans activated by the product of gene VI.

    PubMed

    Scholthof, H B; Gowda, S; Wu, F C; Shepherd, R J

    1992-05-01

    Gene expression of figwort mosaic virus (FMV), a caulimovirus, was investigated by electroporation of Nicotiana edwardsonii cell suspension protoplasts with cloned viral constructs in which a reporter gene was inserted at various positions on the genome. The results showed that the genome of FMV contains two promoters; one is used for the production of a full-length RNA and another initiates synthesis of a separate monocistronic RNA for gene VI. Evidence is provided that the full-length transcript, the probable template for reverse transcription, can serve as a polycistronic mRNA for translation of genes I through V and perhaps also gene VI. Expression of all the genes on the polycistronic mRNA is trans activated by the gene VI protein. Reporter gene expression appears most efficient when its start codon is in close proximity to the stop codon of the preceding gene, as for the native genes of caulimoviruses. We propose that the gene VI product enables expression of the polycistronic mRNA by promoting reinitiation of ribosomes to give translational coupling of individual genes. PMID:1560539

  18. Indirubin derivatives alter DNA binding activity of the transcription factor NF-Y and inhibit MDR1 gene promoter.

    PubMed

    Tanaka, Toru; Ohashi, Sachiyo; Saito, Hiroaki; Higuchi, Takashi; Tabata, Keiichi; Kosuge, Yasuhiro; Suzuki, Takashi; Miyairi, Shinichi; Kobayashi, Shunsuke

    2014-10-15

    Indirubin derivatives exert antitumor activity. However, their effects on the expression of multidrug resistance gene 1 (MDR1) have not been investigated. Here we found three derivatives that inhibit the MDR1 gene promoter. To investigate the effects of indirubins on the DNA binding of NF-Y, a major MDR1 gene transcription factor that recognizes an inverted CCAAT element in the promoter, gel mobility shift assay was performed using the element as a probe with nuclear extracts from NG108-15, MCF7, HepG2, C2C12, and SK-N-SH cells. Among 17 compounds, 5-methoxyindirubin inhibited the DNA binding of NF-Y significantly, whereas indirubin-3'-oxime and 7-methoxyindirubin 3'-oxime increased the binding considerably. After evaluating a suitable concentration of each compound for transcription analysis using living tumor cells, we performed a reporter gene assay using a reporter DNA plasmid containing EGFP cDNA fused to the MDR1 gene promoter region. Indirubin-3'-oxime exerted a significant inhibitory effect on the MDR1 promoter activity in MCF7 and HepG2 cells, and 5-methoxyindirubin inhibited the activity only in MCF7 cells; 7-methoxyindirubin 3'-oxime suppressed the activity in all of the cell lines. We further confirmed that the compounds reduced endogenous MDR1 transcription without any inhibitory effect on NF-Y expression. Moreover, each compound increased the doxorubicin sensitivity of MCF7 cells. These results indicate that each indirubin derivative acts on the DNA binding of NF-Y and represses the MDR1 gene promoter with tumor cell-type specificity. PMID:25066113

  19. A Global Genomic and Genetic Strategy to Identify, Validate and Use Gene Signatures of Xenobiotic-Responsive Transcription Factors in Prediction of Pathway Activation in the Mouse Liver

    EPA Science Inventory

    Many drugs and environmentally-relevant chemicals activate xenobiotic-responsive transcription factors. Identification of target genes of these factors would be useful in predicting pathway activation in in vitro chemical screening as well as their involvement in disease states. ...

  20. Activation of rhodopsin gene transcription in cultured retinal precursors of chicken embryo: role of Ca(2+) signaling and hyperpolarization-activated cation channels.

    PubMed

    Bernard, Marianne; Dejos, Camille; Bergès, Thierry; Régnacq, Matthieu; Voisin, Pierre

    2014-04-01

    This study reports that the spontaneous 50-fold activation of rhodopsin gene transcription, observed in cultured retinal precursors from 13-day chicken embryo, relies on a Ca(2+)-dependent mechanism. Activation of a transiently transfected rhodopsin promoter (luciferase reporter) in these cells was inhibited (60%) by cotransfection of a dominant-negative form of the cAMP-responsive element-binding protein. Both rhodopsin promoter activity and rhodopsin mRNA accumulation were blocked by Ca(2+)/calmodulin-dependent kinase II inhibitors, but not by protein kinase A inhibitors, suggesting a role of Ca(2+) rather than cAMP. This was confirmed by the inhibitory effect of general and T-type selective Ca(2+) channel blockers. Oscillations in Ca(2+) fluorescence (Fluo8) could be observed in 1/10 cells that activated the rhodopsin promoter (DsRed reporter). A robust and reversible inhibition of rhodopsin gene transcription by ZD7288 indicated a role of hyperpolarization-activated channels (HCN). Cellular localization and developmental expression of HCN1 were compatible with a role in the onset of rhodopsin gene transcription. Together, the data suggest that the spontaneous activation of rhodopsin gene transcription in cultured retinal precursors results from a signaling cascade that involves the pacemaker activity of HCN channels, the opening of voltage-gated Ca(2+)-channels, activation of Ca(2+)/calmodulin-dependent kinase II and phosphorylation of cAMP-responsive element-binding protein. Rhodopsin gene expression in cultured retinal precursors from chicken embryo relies on a Ca2+-dependent mechanism whereby hyperpolarization-activated cyclic nucleotide-gated channels (HCN) activate T-type voltage-dependent Ca2+ channels (VDCC) through membrane depolarization, causing calmodulin-dependent kinase II (CaMKII) to phosphorylate the cAMP-responsive element-binding protein (CREB) and leading to activation of rhodopsin gene transcription. Photoreceptor localization and development

  1. Cystatin D locates in the nucleus at sites of active transcription and modulates gene and protein expression.

    PubMed

    Ferrer-Mayorga, Gemma; Alvarez-Díaz, Silvia; Valle, Noelia; De Las Rivas, Javier; Mendes, Marta; Barderas, Rodrigo; Canals, Francesc; Tapia, Olga; Casal, J Ignacio; Lafarga, Miguel; Muñoz, Alberto

    2015-10-30

    Cystatin D is an inhibitor of lysosomal and secreted cysteine proteases. Strikingly, cystatin D has been found to inhibit proliferation, migration, and invasion of colon carcinoma cells indicating tumor suppressor activity that is unrelated to protease inhibition. Here, we demonstrate that a proportion of cystatin D locates within the cell nucleus at specific transcriptionally active chromatin sites. Consistently, transcriptomic analysis show that cystatin D alters gene expression, including that of genes encoding transcription factors such as RUNX1, RUNX2, and MEF2C in HCT116 cells. In concordance with transcriptomic data, quantitative proteomic analysis identified 292 proteins differentially expressed in cystatin D-expressing cells involved in cell adhesion, cytoskeleton, and RNA synthesis and processing. Furthermore, using cytokine arrays we found that cystatin D reduces the secretion of several protumor cytokines such as fibroblast growth factor-4, CX3CL1/fractalkine, neurotrophin 4 oncostatin-M, pulmonary and activation-regulated chemokine/CCL18, and transforming growth factor B3. These results support an unanticipated role of cystatin D in the cell nucleus, controlling the transcription of specific genes involved in crucial cellular functions, which may mediate its protective action in colon cancer. PMID:26364852

  2. Scc2 regulates gene expression by recruiting cohesin to the chromosome as a transcriptional activator during yeast meiosis

    PubMed Central

    Lin, Weiqiang; Jin, Hui; Liu, Xiuwen; Hampton, Kristin; Yu, Hong-Guo

    2011-01-01

    To tether sister chromatids, a protein-loading complex, including Scc2, recruits cohesin to the chromosome at discrete loci. Cohesin facilitates the formation of a higher-order chromosome structure that could also influence gene expression. How cohesin directly regulates transcription remains to be further elucidated. We report that in budding yeast Scc2 is required for sister-chromatid cohesion during meiosis for two reasons. First, Scc2 is required for activating the expression of REC8, which encodes a meiosis-specific cohesin subunit; second, Scc2 is necessary for recruiting meiotic cohesin to the chromosome to generate sister-chromatid cohesion. Using a heterologous reporter assay, we have found that Scc2 increases the activity of its target promoters by recruiting cohesin to establish an upstream cohesin-associated region in a position-dependent manner. Rec8-associated meiotic cohesin is required for the full activation of the REC8 promoter, revealing that cohesin has a positive feedback on transcriptional regulation. Finally, we provide evidence that chromosomal binding of cohesin is sufficient for target-gene activation during meiosis. Our data support a noncanonical role for cohesin as a transcriptional activator during cell differentiation. PMID:21508318

  3. Perinucleolar relocalization and nucleolin as crucial events in the transcriptional activation of key genes in mantle cell lymphoma.

    PubMed

    Allinne, Jeanne; Pichugin, Andrei; Iarovaia, Olga; Klibi, Manel; Barat, Ana; Zlotek-Zlotkiewicz, Ewa; Markozashvili, Diana; Petrova, Natalia; Camara-Clayette, Valérie; Ioudinkova, Elena; Wiels, Joëlle; Razin, Sergey V; Ribrag, Vincent; Lipinski, Marc; Vassetzky, Yegor S

    2014-03-27

    In mantle cell lymphoma (MCL), one allele of the cyclin D1 (Ccnd1) gene is translocated from its normal localization on chromosome 11 to chromosome 14. This is considered as the crucial event in the transformation process of a normal naive B-cell; however, the actual molecular mechanism leading to Ccnd1 activation remains to be deciphered. Using a combination of three-dimensional and immuno-fluorescence in situ hybridization experiments, the radial position of the 2 Ccnd1 alleles was investigated in MCL-derived cell lines and malignant cells from affected patients. The translocated Ccnd1 allele was observed significantly more distant from the nuclear membrane than its nontranslocated counterpart, with a very high proportion of IgH-Ccnd1 chromosomal segments localized next to a nucleolus. These perinucleolar areas were found to contain active RNA polymerase II (PolII) clusters. Nucleoli are rich in nucleolin, a potent transcription factor that we found to bind sites within the Ccnd1 gene specifically in MCL cells and to activate Ccnd1 transcription. We propose that the Ccnd1 transcriptional activation in MCL cells relates to the repositioning of the rearranged IgH-Ccnd1-carrying chromosomal segment in a nuclear territory with abundant nucleolin and active PolII molecules. Similar transforming events could occur in Burkitt and other B-cell lymphomas. PMID:24452204

  4. Transcriptional activation of human 12-lipoxygenase gene promoter is mediated through Sp1 consensus sites in A431 cells.

    PubMed Central

    Liu, Y W; Arakawa, T; Yamamoto, S; Chang, W C

    1997-01-01

    The functional 5' flanking region of the human 12-lipoxygenase in epidermoid carcinoma A431 cells was characterized. By a primer extension method, the transcription initiation sites were mapped at -47 adenosine, -48 guanosine and -55 guanosine upstream of the ATG translation start codon. Transient transfection with a series of 5' and 3' deletion constructs showed that the 5' flanking region spanning from -224 to -100 bp was important for the basal expression of 12-lipoxygenase gene. Gel mobility shift assays with antibodies of transcription factors showed that both Sp1 and Sp3 required highly GC-rich Sp1 sites within this region for binding. Disruption of two Sp1 recognition motifs residing at -158 to -150 bp and -123 to -114 bp by site-directed mutagenesis markedly reduced the basal 12-lipoxygenase promoter activity and abolished the retarded bands in a gel-shift assay, indicating that these two Sp1-binding sites were essential for gene expression. The same two Sp1-binding sites in this promoter region were also responsible for epidermal growth factor (EGF)-induced expression of 12-lipoxygenase gene. Moreover, EGF also induced the transcriptional activation of luciferase driven by SV40 early promoter, which contained rich Sp1-binding sites. Taken together, the results suggest that two specific Sp1 consensus sites are involved in the mediation of the basal promoter activity as well as EGF induction of the 12-lipoxygenase gene and that Sp1 and Sp3 transcription factors might have a role in their regulation. PMID:9164849

  5. A novel PRD I and TG binding activity involved in virus-induced transcription of IFN-A genes.

    PubMed Central

    Génin, P; Bragança, J; Darracq, N; Doly, J; Civas, A

    1995-01-01

    Comparative analysis of the inducible elements of the mouse interferon A4 and A11 gene promoters (IE-A4 and IE-A11) by transient transfection experiments, DNase 1 footprinting and electrophoretic mobility shift assays resulted in identification of a virus-induced binding activity suggested to be involved in NDV-induced activation of transcription of these genes. The virus-induced factor, termed VIF, is activated early by contact of virions with cells. It specifically recognizes the PRD I-like domain shared by both inducible elements, as well as the TG-like domain of IE-A4. This factor, distinct from the IRF-1, IRF-2 and the alpha F1 binding proteins and presenting a different affinity pattern from that of the TG protein, is proposed as a candidate for IFN-type I gene regulation. Images PMID:8559665

  6. Mithramycin inhibits SP1 binding and selectively inhibits transcriptional activity of the dihydrofolate reductase gene in vitro and in vivo.

    PubMed Central

    Blume, S W; Snyder, R C; Ray, R; Thomas, S; Koller, C A; Miller, D M

    1991-01-01

    The promoter of the human dihydrofolate reductase (DHFR) gene contains two consensus binding sites for the DNA binding protein Sp1. DNAse protection and gel mobility shift assays demonstrate binding of recombinant Sp1 to both decanucleotide Sp1 binding sequences which are located 49 and 14 base pairs upstream of the transcription start site. The more distal of the two binding sites exhibits a somewhat higher affinity for Sp1. The G-C specific DNA binding drug, mithramycin, binds to both consensus sequences and prevents subsequent Sp1 binding. Promoter-dependent in vitro transcription of a DHFR template is selectively inhibited by mithramycin when compared to the human H2b histone gene. A similar effect is also noted in vivo. Mithramycin treatment of MCF-7 human breast carcinoma cells containing an amplified DHFR gene induces selective inhibition of DHFR transcription initiation, resulting in a decline in DHFR mRNA level and enzyme activity. This selective inhibition of DHFR expression suggests that it is possible to modulate the overexpression of the DHFR gene in methotrexate resistant cells. Images PMID:1834700

  7. Creating small transcription activating RNAs.

    PubMed

    Chappell, James; Takahashi, Melissa K; Lucks, Julius B

    2015-03-01

    We expanded the mechanistic capability of small RNAs by creating an entirely synthetic mode of regulation: small transcription activating RNAs (STARs). Using two strategies, we engineered synthetic STAR regulators to disrupt the formation of an intrinsic transcription terminator placed upstream of a gene in Escherichia coli. This resulted in a group of four highly orthogonal STARs that had up to 94-fold activation. By systematically modifying sequence features of this group, we derived design principles for STAR function, which we then used to forward engineer a STAR that targets a terminator found in the Escherichia coli genome. Finally, we showed that STARs could be combined in tandem to create previously unattainable RNA-only transcriptional logic gates. STARs provide a new mechanism of regulation that will expand our ability to use small RNAs to construct synthetic gene networks that precisely control gene expression. PMID:25643173

  8. The role of an inverted CCAAT element in transcriptional activation of the human DNA topoisomerase IIalpha gene by heat shock.

    PubMed

    Furukawa, M; Uchiumi, T; Nomoto, M; Takano, H; Morimoto, R I; Naito, S; Kuwano, M; Kohno, K

    1998-04-24

    Expression of the DNA topoisomerase IIalpha (topoIIalpha) gene is highly sensitive to various environmental stimuli including heat shock. The amount of topoIIalpha mRNA was increased 1.5-3-fold 6-24 h after exposure of T24 human urinary bladder cancer cells to heat shock stress at 43 degreesC for 1 h. The effect of heat shock on the transcriptional activity of the human topoIIalpha gene promoter was investigated by transient transfection of T24 cells with luciferase reporter plasmids containing various lengths of the promoter sequence. The transcriptional activity of the full-length promoter (nucleotides (nt) -295 to +85) and of three deletion constructs (nt -197 to +85, -154 to +85, and -74 to +85) was increased approximately 3-fold 24 h after heat shock stress. In contrast, the transcriptional activity of the minimal promoter (nt -20 to +85), which lacks the first inverted CCAAT element (ICE1), the GC box, and the heat shock element located between nt -74 and -21, was not increased by heat shock. Furthermore, the transcriptional activity of promoter constructs containing mutations in the GC box or heat shock element, but not that of a construct containing mutations in ICE1, was significantly increased by heat shock. Electrophoretic mobility shift assays revealed reduced binding of a nuclear factor to an oligonucleotide containing ICE1 when nuclear extracts were derived from cells cultured for 3-24 h after heat shock. No such change in factor binding was apparent with an oligonucleotide containing the heat shock element of the topoIIalpha gene promoter. Finally, in vivo footprint analysis of the topoIIalpha gene promoter revealed that two G residues of ICE1 that were protected in control cells became sensitive to dimethyl sulfate modification after heat shock. These results suggest that transcriptional activation of the topoIIalpha gene by heat shock requires the release of a negative regulatory factor from ICE1. PMID:9553115

  9. Gene 33/Mig-6, a Transcriptionally Inducible Adapter Protein That Binds GTP-Cdc42 and Activates SAPK/JNK*

    PubMed Central

    Makkinje, Anthony; Quinn, Deborah A.; Chen, Ang; Cadilla, Carmen L.; Force, Thomas; Bonventre, Joseph V.; Kyriakis, John M.

    2013-01-01

    Chronic stresses, including the mechanical strain caused by hypertension or excess pulmonary ventilation pressure, lead to important clinical consequences, including hypertrophy and acute respiratory distress syndrome. Pathologic hypertrophy contributes to decreased organ function and, ultimately, organ failure; and cardiac and diabetic renal hypertrophy are major causes of morbidity and morality in the developed world. Likewise, acute respiratory distress syndrome is a serious potential side effect of mechanical pulmonary ventilation. Whereas the deleterious effects of chronic stress are well established, the molecular mechanisms by which these stresses affect cell function are still poorly characterized. gene 33 (also called mitogen-inducible gene-6, mig-6) is an immediate early gene that is transcriptionally induced by a divergent array of extra-cellular stimuli. The physiologic function of Gene 33 is unknown. Here we show that gene 33 mRNA levels increase sharply in response to a set of commonly occurring chronic stress stimuli: mechanical strain, vasoactive peptides, and diabetic nephropathy. Induction of gene 33 requires the stress-activated protein kinases (SAPKs)/c-Jun NH2-terminal kinases. This expression pattern suggests that gene 33 is a potential marker for diabetic nephropathy and other pathologic responses to persistent sublethal stress. The structure of Gene 33 indicates an adapter protein capable of binding monomeric GTPases of the Rho subfamily. Consistent with this, Gene 33 interacts in vivo and, in a GTP-dependent manner, in vitro with Cdc42Hs; and transient expression of Gene 33 results in the selective activation of the SAPKs. These results imply a reciprocal, positive feedback relationship between Gene 33 expression and SAPK activation. Expression of Gene 33 at sufficient levels may enable a compensatory reprogramming of cellular function in response to chronic stress, which may have pathophysiological consequences. PMID:10749885

  10. Statins Increase Plasminogen Activator Inhibitor Type 1 Gene Transcription through a Pregnane X Receptor Regulated Element

    PubMed Central

    Stanley, Frederick M.; Linder, Kathryn M.; Cardozo, Timothy J.

    2015-01-01

    Plasminogen activator inhibitor type 1 (PAI-1) is a multifunctional protein that has important roles in inflammation and wound healing. Its aberrant regulation may contribute to many disease processes such as heart disease. The PAI-1 promoter is responsive to multiple inputs including cytokines, growth factors, steroids and oxidative stress. The statin drugs, atorvastatin, mevastatin and rosuvastatin, increased basal and stimulated expression of the PAI-1 promoter 3-fold. A statin-responsive, nuclear hormone response element was previously identified in the PAI-1 promoter, but it was incompletely characterized. We characterized this direct repeat (DR) of AGGTCA with a 3-nucleotide spacer at -269/-255 using deletion and directed mutagenesis. Deletion or mutation of this element increased basal transcription from the promoter suggesting that it repressed PAI-1 transcription in the unliganded state. The half-site spacing and the ligand specificity suggested that this might be a pregnane X receptor (PXR) responsive element. Computational molecular docking showed that atorvastatin, mevastatin and rosuvastatin were structurally compatible with the PXR ligand-binding pocket in its agonist conformation. Experiments with Gal4 DNA binding domain fusion proteins showed that Gal4-PXR was activated by statins while other DR + 3 binding nuclear receptor fusions were not. Overexpression of PXR further enhanced PAI-1 transcription in response to statins. Finally, ChIP experiments using Halo-tagged PXR and RXR demonstrated that both components of the PXR-RXR heterodimer bound to this region of the PAI-1 promoter. PMID:26379245

  11. Transcriptional activation by heterodimers of the achaete-scute and daughterless gene products of Drosophila.

    PubMed Central

    Cabrera, C V; Alonso, M C

    1991-01-01

    The achaete-scute complex (AS-C) and the daughterless (da) genes encode helix-loop-helix proteins which have been shown to interact in vivo and to be required for neurogenesis. We show in vitro that heterodimers of three AS-C products with DA bind DNA strongly, whereas DA homodimers bind weakly and homo or heterocombinations of AS-C products not at all. Proteins unable to dimerize did not bind DNA. Target sequences for the heterodimers were found in the promoters of the hunchback and the achaete genes. Using sequences of the former we show that the DNA binding results obtained in vitro fully correlate with the ability of different combinations to activate the expression of a reporter gene in yeast. Embryos deficient for the lethal of scute gene fail to activate hunchback in some neural lineages in a pattern consistent with the lack of a member of a multigene family. Images PMID:1915272

  12. Identification of a Potent Inhibitor of CREB-Mediated Gene Transcription with Efficacious in Vivo Anticancer Activity

    PubMed Central

    2015-01-01

    Recent studies have shown that nuclear transcription factor cyclic adenosine monophosphate response element binding protein (CREB) is overexpressed in many different types of cancers. Therefore, CREB has been pursued as a novel cancer therapeutic target. Naphthol AS-E and its closely related derivatives have been shown to inhibit CREB-mediated gene transcription and cancer cell growth. Previously, we identified naphthamide 3a as a different chemotype to inhibit CREB’s transcription activity. In a continuing effort to discover more potent CREB inhibitors, a series of structural congeners of 3a was designed and synthesized. Biological evaluations of these compounds uncovered compound 3i (666-15) as a potent and selective inhibitor of CREB-mediated gene transcription (IC50 = 0.081 ± 0.04 μM). 666-15 also potently inhibited cancer cell growth without harming normal cells. In an in vivo MDA-MB-468 xenograft model, 666-15 completely suppressed the tumor growth without overt toxicity. These results further support the potential of CREB as a valuable cancer drug target. PMID:26023867

  13. Genotoxic Stress Prevents Ndd1-Dependent Transcriptional Activation of G2/M-Specific Genes in Saccharomyces cerevisiae

    PubMed Central

    Yelamanchi, Syam Kumar; Veis, Jiri; Anrather, Dorothea; Klug, Helene

    2014-01-01

    Downregulation of specific transcripts is one of the mechanisms utilized by eukaryotic checkpoint systems to prevent cell cycle progression. Here we identified and explored such a mechanism in the yeast Saccharomyces cerevisiae. It involves the Mec1-Rad53 kinase cascade, which attenuates G2/M-specific gene transcription upon genotoxic stress. This inhibition is achieved via multiple Rad53-dependent inhibitory phosphorylations on the transcriptional activator Ndd1 that prevent its chromatin recruitment via interactions with the forkhead factor Fkh2. Relevant modification sites on Ndd1 were identified by mass spectrometry, and corresponding alanine substitutions were able to suppress a methyl methanesulfonate-induced block in Ndd1 chromatin recruitment. Whereas effective suppression by these Ndd1 mutants is achieved for DNA damage, this is not the case under replication stress conditions, suggesting that additional mechanisms must operate under such conditions. We propose that budding yeast cells prevent the normal transcription of G2/M-specific genes upon genotoxic stress to precisely coordinate the timing of mitotic and postmitotic events with respect to S phase. PMID:24324010

  14. Signal transducer and activator of transcription (STAT)-3 regulates microRNA gene expression in chronic lymphocytic leukemia cells

    PubMed Central

    2013-01-01

    Backgrounds Approximately 1,000 microRNAs (miRs) are present in the human genome; however, little is known about the regulation of miR transcription. Because miR levels are deregulated in chronic lymphocytic leukemia (CLL) and signal transducer and activator of transcription (STAT)-3 is constitutively activated in CLL, we sought to determine whether STAT3 affects the transcription of miR genes in CLL cells. Methods We used publically available data from the ENCODE project to identify putative STAT3 binding sites in the promoters of miR genes. Then we transfected CLL cells with STAT3-shRNA or with an empty vector, and to determine which miRs are differentially expressed, we used a miR microarray approach followed by validation of the microarray results for 6 miRs using quantitative real-time polymerase chain reaction (qRT-PCR). Results We identified putative STAT3 binding sites in 160 promoter regions of 200 miRs, including miR-21, miR-29, and miR-155, whose levels have been reported to be upregulated in CLL. Levels of 72 miRs were downregulated (n = 63) or upregulated (n = 9). qRT-PCR confirmed the array data in 5 of 6 miRs. Conclusions The presence of activated STAT3 has a profound effect on miR expression in CLL cells. PMID:23725032

  15. MCAF1 and synergistic activation of the transcription of Epstein-Barr virus lytic genes by Rta and Zta.

    PubMed

    Chang, Li-Kwan; Chuang, Jian-Ying; Nakao, Mitsuyoshi; Liu, Shih-Tung

    2010-08-01

    Epstein-Barr virus (EBV) expresses two transcription factors, Rta and Zta, during the immediate-early stage of the lytic cycle. The two proteins often collaborate to activate the transcription of EBV lytic genes synergistically. This study demonstrates that Rta and Zta form a complex via an intermediary protein, MCAF1, on Zta response element (ZRE) in vitro. The interaction among these three proteins in P3HR1 cells is also verified via coimmunoprecipitation, CHIP analysis and confocal microscopy. The interaction between Rta and Zta in vitro depends on the region between amino acid 562 and 816 in MCAF1. In addition, overexpressing MCAF1 enhances and introducing MCAF1 siRNA into the cells markedly reduces the level of the synergistic activation in 293T cells. Moreover, the fact that the synergistic activation depends on ZRE but not on Rta response element (RRE) originates from the fact that Rta and Zta are capable of activating the BMRF1 promoter synergistically after an RRE but not ZREs in the promoter are mutated. The binding of Rta-MCAF1-Zta complex to ZRE but not RRE also explains why Rta and Zta do not use RRE to activate transcription synergistically. Importantly, this study elucidates the mechanism underlying synergistic activation, which is important to the lytic development of EBV. PMID:20385599

  16. Dual role of Med12 in PRC1-dependent gene repression and ncRNA-mediated transcriptional activation.

    PubMed

    Papadopoulou, Thaleia; Kaymak, Aysegül; Sayols, Sergi; Richly, Holger

    2016-06-01

    Mediator is considered an enhancer of RNA-Polymerase II dependent transcription but its function and regulation in pluripotent mouse embryonic stem cells (mESCs) remains unresolved. One means of controlling the function of Mediator is provided by the binding of the Cdk8 module (Med12, Cdk8, Ccnc and Med13) to the core Mediator. Here we report that Med12 operates together with PRC1 to silence key developmental genes in pluripotency. At the molecular level, while PRC1 represses genes it is also required to assemble ncRNA containing Med12-Mediator complexes. In the course of cellular differentiation the H2A ubiquitin binding protein Zrf1 abrogates PRC1-Med12 binding and facilitates the association of Cdk8 with Mediator. This remodeling of Mediator-associated protein complexes converts Mediator from a transcriptional repressor to a transcriptional enhancer, which then mediates ncRNA-dependent activation of Polycomb target genes. Altogether, our data reveal how the interplay of PRC1, ncRNA and Mediator complexes controls pluripotency and cellular differentiation. PMID:27096886

  17. Crl Activates Transcription Initiation of RpoS-Regulated Genes Involved in the Multicellular Behavior of Salmonella enterica Serovar Typhimurium

    PubMed Central

    Robbe-Saule, Véronique; Jaumouillé, Valentin; Prévost, Marie-Christine; Guadagnini, Stéphanie; Talhouarne, Christelle; Mathout, Hayette; Kolb, Annie; Norel, Françoise

    2006-01-01

    In Salmonella enterica serovar Typhimurium, the stationary-phase sigma factor σS (RpoS) is required for virulence, stress resistance, biofilm formation, and development of the rdar morphotype. This morphotype is a multicellular behavior characterized by expression of the adhesive extracellular matrix components cellulose and curli fimbriae. The Crl protein of Escherichia coli interacts with σS and activates expression of σS-regulated genes, such as the csgBAC operon encoding the subunit of the curli proteins, by an unknown mechanism. Here, we showed using in vivo and in vitro experiments that the Crl protein of Salmonella serovar Typhimurium is required for development of a typical rdar morphotype and for maximal expression of the csgD, csgB, adrA, and bcsA genes, which are involved in curli and cellulose biosynthesis. In vitro transcription assays and potassium permanganate reactivity experiments with purified His6-Crl showed that Crl directly activated σS-dependent transcription initiation at the csgD and adrA promoters. We observed no effect of Crl on σ70-dependent transcription. Crl protein levels increased during the late exponential and stationary growth phases in Luria-Beratani medium without NaCl at 28°C. We obtained complementation of the crl mutation by increasing σS levels. This suggests that Crl has a major physiological impact at low concentrations of σS. PMID:16707690

  18. Transcriptional gene silencing in humans.

    PubMed

    Weinberg, Marc S; Morris, Kevin V

    2016-08-19

    It has been over a decade since the first observation that small non-coding RNAs can functionally modulate epigenetic states in human cells to achieve functional transcriptional gene silencing (TGS). TGS is mechanistically distinct from the RNA interference (RNAi) gene-silencing pathway. TGS can result in long-term stable epigenetic modifications to gene expression that can be passed on to daughter cells during cell division, whereas RNAi does not. Early studies of TGS have been largely overlooked, overshadowed by subsequent discoveries of small RNA-directed post-TGS and RNAi. A reappraisal of early work has been brought about by recent findings in human cells where endogenous long non-coding RNAs function to regulate the epigenome. There are distinct and common overlaps between the proteins involved in small and long non-coding RNA transcriptional regulatory mechanisms, suggesting that the early studies using small non-coding RNAs to modulate transcription were making use of a previously unrecognized endogenous mechanism of RNA-directed gene regulation. Here we review how non-coding RNA plays a role in regulation of transcription and epigenetic gene silencing in human cells by revisiting these earlier studies and the mechanistic insights gained to date. We also provide a list of mammalian genes that have been shown to be transcriptionally regulated by non-coding RNAs. Lastly, we explore how TGS may serve as the basis for development of future therapeutic agents. PMID:27060137

  19. Nuclear actin polymerization from faster growing ends in the initial activation of Hox gene transcription are nuclear speckles involved?

    PubMed

    Naum-Onganía, Gabriela; Díaz, Víctor M; Blasi, Francesco; Rivera-Pomar, Rolando

    2013-01-01

    The HoxB cluster expression is activated by retinoic acid and transcribed in a collinear manner. The DNA-binding Pknox1-Pbx1 complex modulates Hox protein activity. Here, NT2-D1 teratocarcinoma cells -a model of Hox gene expression- were used to show that upon retinoic acid induction, Pknox1 co-localizes with polymeric nuclear actin. We have found that globular actin aggregates, polymeric actin, the elongating RNA polymerase II and THOC match euchromatic regions corresponding to nuclear speckles. Moreover, RNA polymerase II, N-WASP, and transcription/splicing factors p54(nrb) and PSF were validated as Pknox1 interactors by tandem affinity purification. PSF pulled down with THOC and nuclear actin, both of which co-localize in nuclear speckles. Although latrunculin A slightly decreases the general level of HoxB gene expression, inhibition of nuclear actin polymerization by cytochalasin D blocks the expression of HoxB transcripts in a collinear manner. Thus, our results support the hypothesis that nuclear actin polymerization is involved in the activation of HoxB gene expression by means of nuclear speckles. PMID:24406343

  20. A lepidopteran pacifastin member: cloning, gene structure, recombinant production, transcript profiling and in vitro activity.

    PubMed

    Breugelmans, Bert; Simonet, Gert; van Hoef, Vincent; Van Soest, Sofie; Smagghe, Guy; Vanden Broeck, Jozef

    2009-07-01

    Members of the pacifastin family have been characterized as serine peptidase inhibitors (PI), but their target enzyme(s) are unknown in insects. So far, the structural and biochemical characteristics of pacifastin-like PI have only been studied in locusts. Here we report the molecular identification and functional characterization of a pacifastin-like precursor in a lepidopteran insect, i.e. the silkworm Bombyx mori. The bmpp-1 gene contains 17 exons and codes for two pacifastin-related precursors of different length. The longest splice variant encodes 13 inhibitor domains, more than any other pacifastin-like precursor in arthropods. The second transcript lacks two exons and codes for 11 inhibitor domains. By studying the expression profile of the Bombyx pacifastin-like gene a different expression pattern for the two variants was observed suggesting functional diversification. Next, several PI domains of BMPP-1 were produced and, contrary to locust pacifastin peptides, they were found to be potent inhibitors of both bovine trypsin and chymotrypsin. Surprisingly, the same Bombyx PI are only weak inhibitors of endogenous digestive peptidases, indicating that other peptidases are the in vivo targets. Interestingly, the Bombyx PI inhibit a fungal trypsin-like cuticle degrading enzyme, suggesting a protective function for BMPP-1 against entomopathogenic fungi. PMID:19364530

  1. Upstream activation sequence-dependent alteration of chromatin structure and transcription activation of the yeast GAL1-GAL10 genes.

    PubMed Central

    Fedor, M J; Kornberg, R D

    1989-01-01

    Conversion of the positioned nucleosome array characteristic of the repressed GAL1-GAL10 promoter region to the more accessible conformation of the induced state was found to depend on the upstream activation sequence, GAL4 protein, a positive regulator of transcription, and galactose, the inducing agent. The effect of the GAL4 protein-upstream activation sequence complex on the structure of adjacent chromatin required no other promoter sequences. Although sequences protected by histones in the repressed state became more accessible to micrococcal nuclease and (methidiumpropyl-EDTA)iron(II) cleavage following induction of transcription, DNA-protein particles containing these sequences retained the electrophoretic mobility of nucleosomes, indicating that the promoter region can be associated with nucleosomes under conditions of transcription activation. Images PMID:2657404

  2. Insertional Mutagenesis in Neurospora Crassa: Cloning and Molecular Analysis of the Preg(+) Gene Controlling the Activity of the Transcriptional Activator Nuc-1

    PubMed Central

    Kang, S.; Metzenberg, R. L.

    1993-01-01

    The transcriptional activator NUC-1 controls the transcription of the genes for phosphorus acquisition enzymes, and its activity is regulated by the negative regulatory factors, PREG and PGOV. In this report, we describe the cloning and molecular analysis of the preg(+) gene. In Neurospora crassa, as in higher eukaryotes, transformation frequently results in nonhomologous integration of transforming DNA. Insertion of transforming DNA into host genes mutates the gene and provides a molecular tag for cloning it. We obtained two mutants that have an insertion in the preg(+) and pgov(+) genes, respectively, among 2 X 10(5) transformants. The preg(+) gene was cloned by screening a Neurospora genomic DNA library with DNA sequences flanking the transforming DNA of the rescued plasmid. Northern analysis showed that the transcription of the preg(+) gene is not regulated by phosphate. The carboxy-terminal half of PREG shows strong homology with Saccharomyces cerevisiae PHO80 whose function is analogous to that of PREG. The preg(c) mutations are located in the well conserved residues which may directly interact with the residues in the regulatory domain of NUC-1. PMID:8436269

  3. A Novel Peroxisome Proliferator Response Element Modulates Hepatic Low Density Lipoprotein Receptor Gene Transcription in Response to PPARδ Activation

    PubMed Central

    Shende, Vikram R.; Singh, Amar Bahadur; Liu, Jingwen

    2016-01-01

    The hepatic expression of LDLR gene is regulated primarily at the transcriptional level by a sterol-regulatory element (SRE) in its proximal promoter region which is the site of action of SRE-binding protein 2 (SREBP2). However whether additional cis-regulatory elements contribute to LDLR transcription has not been fully explored. We investigated the function of a putative PPAR-response element (PPRE) sequence motif located at −768 to −752 bases upstream of the transcription start site of human LDLR gene in response to PPARδ activation. Promoter luciferase reporter analyses showed that treating HepG2 cells with PPARδ agonist L165041 markedly increased the activity of a full-length LDLR promoter construct (pLDLR-1192) without any effects on the shorter promoter reporter pLDLR-234 that contains only the core regulatory elements SRE-1 and SP1 sites. Importantly, mutation of the PPRE sequence greatly attenuated the induction of the full-length LDLR promoter activity by L165041 without affecting rosuvastatin mediated transactivation. Electrophoretic mobility shift and chromatin immunoprecipitation assays further confirmed the binding of PPARδ to the LDLR-PPRE site. Treating HepG2 cells with L165041 elevated the mRNA and protein expressions of LDLR without affecting the LDLR mRNA decay rate. The induction of LDLR expression by PPARδ agonist was further observed in liver tissue of mice and hamsters treated with L165041. Altogether, our studies identify a novel PPRE-mediated regulatory mechanism for LDLR transcription and suggest that combined treatment of statin with PPARδ agonists may have advantageous effects on LDLR expression. PMID:26443862

  4. Bordetella pertussis fim3 gene regulation by BvgA: phosphorylation controls the formation of inactive vs. active transcription complexes.

    PubMed

    Boulanger, Alice; Moon, Kyung; Decker, Kimberly B; Chen, Qing; Knipling, Leslie; Stibitz, Scott; Hinton, Deborah M

    2015-02-10

    Two-component systems [sensor kinase/response regulator (RR)] are major tools used by microorganisms to adapt to environmental conditions. RR phosphorylation is typically required for gene activation, but few studies have addressed how and if phosphorylation affects specific steps during transcription initiation. We characterized transcription complexes made with RNA polymerase and the Bordetella pertussis RR, BvgA, in its nonphosphorylated or phosphorylated (BvgA∼P) state at P(fim3), the promoter for the virulence gene fim3 (fimbrial subunit), using gel retardation, potassium permanganate and DNase I footprinting, cleavage reactions with protein conjugated with iron bromoacetamidobenzyl-EDTA, and in vitro transcription. Previous work has shown that the level of nonphosphorylated BvgA remains high in vivo under conditions in which BvgA is phosphorylated. Our results here indicate that surprisingly both BvgA and BvgA∼P form open and initiating complexes with RNA polymerase at P(fim3). However, phosphorylation of BvgA is needed to generate the correct conformation that can transition to competent elongation. Footprints obtained with the complexes made with nonphosphorylated BvgA are atypical; while the initiating complex with BvgA synthesizes short RNA, it does not generate full-length transcripts. Extended incubation of the BvgA/RNA polymerase initiated complex in the presence of heparin generates a stable, but defective species that depends on the initial transcribed sequence of fim3. We suggest that the presence of nonphosphorylated BvgA down-regulates P(fim3) activity when phosphorylated BvgA is present and may allow the bacterium to quickly adapt to the loss of inducing conditions by rapidly eliminating P(fim3) activation once the signal for BvgA phosphorylation is removed. PMID:25624471

  5. Phytanic acid, a novel activator of uncoupling protein-1 gene transcription and brown adipocyte differentiation.

    PubMed Central

    Schlüter, Agatha; Barberá, Maria José; Iglesias, Roser; Giralt, Marta; Villarroya, Francesc

    2002-01-01

    Phytanic acid (3,7,11,15-tetramethylhexadecanoic acid) is a phytol-derived branched-chain fatty acid present in dietary products. Phytanic acid increased uncoupling protein-1 (UCP1) mRNA expression in brown adipocytes differentiated in culture. Phytanic acid induced the expression of the UCP1 gene promoter, which was enhanced by co-transfection with a retinoid X receptor (RXR) expression vector but not with other expression vectors driving peroxisome proliferator-activated receptor (PPAR)alpha, PPARgamma or a form of RXR devoid of ligand-dependent sensitivity. The effect of phytanic acid on the UCP1 gene required the 5' enhancer region of the gene and the effects of phytanic acid were mediated in an additive manner by three binding sites for RXR. Moreover, phytanic acid activates brown adipocyte differentiation: long-term exposure of brown preadipocytes to phytanic acid promoted the acquisition of the brown adipocyte morphology and caused a co-ordinate induction of the mRNAs for gene markers of brown adipocyte differentiation, such as UCP1, adipocyte lipid-binding protein aP2, lipoprotein lipase, the glucose transporter GLUT4 or subunit II of cytochrome c oxidase. In conclusion, phytanic acid is a natural product of phytol metabolism that activates brown adipocyte thermogenic function. It constitutes a potential nutritional signal linking dietary status to adaptive thermogenesis. PMID:11829740

  6. HIF-1α and PPARγ during physiological cardiac hypertrophy induced by pregnancy: Transcriptional activities and effects on target genes.

    PubMed

    Soñanez-Organis, José G; Godoy-Lugo, José A; Hernández-Palomares, Magally L E; Rodríguez-Martínez, Daniel; Rosas-Rodríguez, Jesús A; González-Ochoa, Guadalupe; Virgen-Ortiz, Adolfo; Ortiz, Rudy M

    2016-10-15

    Hypoxia inducible factor 1-α (HIF-1α) and peroxisome proliferator-activated receptor γ (PPARγ) are transcription factors that activate genes involved in cellular metabolism. Physiological cardiac hypertrophy induced by pregnancy initiates compensatory changes in metabolism. However, the contributions of HIF-1α and PPARγ to this physiological status and to its reversible, metabolic process (postpartum) in the heart are not well-defined. Therefore, the aim of the present study was to evaluate the transcriptional activities of HIF-1α and PPARγ in the left ventricle of rats before, during, and after pregnancy. Furthermore, the effects of pregnancy on target genes of glycolysis and glycerol-lipid biosynthesis, key regulatory enzymes, and metabolic intermediates were evaluated. The activities of HIF-1α and PPARγ increased 1.2- and 1.6-fold, respectively, during pregnancy, and decreased to basal levels during postpartum. Expressions of mRNA for glucose transport 1 (GLUT1), enzymes of glycolysis (HK2, PFKM, and GAPDH) and glycerol-lipid biosynthesis (GPAT and GPD1) increased 1.6- to 14-fold during pregnancy and returned to basal levels postpartum. The increase in GPD1 expression translated to an increase in its activity, but such was not the case for GAPDH suggesting that post-translational regulation of these proteins is differential during pregnancy. Glycolytic (glucose, lactate, and DHAP) and glycerol-lipid biosynthesis (G3P and FFA) intermediates increased with pregnancy and were maintained postpartum. The results demonstrate that pregnancy-induced, physiological cardiac hypertrophy activates the expression of genes involved in glycolytic and glycerol-lipid biosynthesis suggesting that the shift in cardiac metabolism is mediated by the activation of HIF-1α and PPARγ. PMID:27312951

  7. Transcriptional regulation of the PXR gene: identification and characterization of a functional peroxisome proliferator-activated receptor alpha binding site within the proximal promoter of PXR.

    PubMed

    Aouabdi, Sihem; Gibson, Gordon; Plant, Nick

    2006-01-01

    The pregnane X receptor (PXR, NR1I2) is widely regarded as a central factor in the body's response to changes in the fluxome, the overall metabolite profile in the body. PXR expression is regulated by a number of chemicals at the transcriptional level; the majority of these chemicals are ligands for PXR and substrates for PXR target genes. However, transcriptional activators of PXR, such as clofibrate, do not seem to be PXR ligands or substrates for its target genes. Understanding the molecular mechanisms underlying both these expected and, more importantly, unexpected transcriptional activations is central to fully understanding the roles of PXR in the human body. We have carried out an in silico analysis of the human PXR proximal promoter, identifying putative protein/DNA interaction sites within the 2 kilobases (kb) 5' to the putative transcription start site. These sites included several for liver-enriched transcription factors, such as the hepatic nuclear factors and CAAT-enhancer binding protein alpha, and chicken ovalbumin upstream promoter transcription factor, commensurate with the high expression of PXR in liver. Furthermore, we identified putative binding sites for a number of ligand-activated transcription factors, suggesting that these factors may regulate PXR gene expression. Further analysis of this regulatory region has shown that transcriptional activation of PXR by peroxisome proliferator-activated receptor alpha (PPARalpha) is via a binding site located approximately 1.3 kb upstream of the putative transcription start site, with ablation of this site preventing PPARalpha-mediated activation of PXR gene expression. We present a model of how regulation of PXR gene expression by ligand-activated transcription factors may play a central role in the body's response to xenobiotic exposure. PMID:16243957

  8. Mutations in Gcr1, a Transcriptional Activator of Saccharomyces Cerevisiae Glycolytic Genes, Function as Suppressors of Gcr2 Mutations

    PubMed Central

    Uemura, H.; Jigami, Y.

    1995-01-01

    The Saccharomyces cerevisiae GCR1 and GCR2 genes affect expression of most of the glycolytic genes. Evidence for Gcr1p/Gcr2p interaction has been presented earlier and is now supported by the isolation of mutations in Gcr1p suppressing gcr2, as assessed by growth and enzyme assay. Four specific mutation sites were identified. Together with use of the two-hybrid system of FIELDS and SONG, they show that Gcr1p in its N-terminal half has a potential transcriptional activating function as well as elements for interaction with Gcr2p, which perhaps acts normally to expose an otherwise cryptic activation domain on Gcr1p. Complementation of various gcr1 mutant alleles and results with the two-hybrid system also indicate that Gcr1p itself normally functions as an oligomer. PMID:7713414

  9. Transcriptional Control of the TNF Gene

    PubMed Central

    Falvo, James V.; Tsytsykova, Alla V.; Goldfeld, Anne E.

    2016-01-01

    The cytokine TNF is a critical mediator of immune and inflammatory responses. The TNF gene is an immediate early gene, rapidly transcribed in a variety of cell types following exposure to a broad range of pathogens and signals of inflammation and stress. Regulation of TNF gene expression at the transcriptional level is cell type- and stimulus-specific, involving the recruitment of distinct sets of transcription factors to a compact and modular promoter region. In this review, we describe our current understanding of the mechanisms through which TNF transcription is specifically activated by a variety of extracellular stimuli in multiple cell types, including T cells, B cells, macrophages, mast cells, dendritic cells, and fibroblasts. We discuss the role of nuclear factor of activated T cells and other transcription factors and coactivators in enhanceosome formation, as well as the contradictory evidence for a role for nuclear factor κB as a classical activator of the TNF gene. We describe the impact of evolutionarily conserved cis-regulatory DNA motifs in the TNF locus upon TNF gene transcription, in contrast to the neutral effect of single nucleotide polymorphisms. We also assess the regulatory role of chromatin organization, epigenetic modifications, and long-range chromosomal interactions at the TNF locus. PMID:20173386

  10. Regulation of human hepatic hydroxysteroid sulfotransferase gene expression by the peroxisome proliferator-activated receptor alpha transcription factor.

    PubMed

    Fang, Hai-Lin; Strom, Stephen C; Cai, Hongbo; Falany, Charles N; Kocarek, Thomas A; Runge-Morris, Melissa

    2005-04-01

    Human hydroxysteroid sulfotransferase or (HUMAN)SULT2A1 catalyzes the sulfonation of procarcinogen xenobiotics, hydroxysteroids, and bile acids and plays a dynamic role in hepatic cholesterol homeostasis. The treatment of primary cultured human hepatocytes with a peroxisome proliferator-activated receptor alpha (PPARalpha)-activating concentration of ciprofibrate (10(-) (4) M) increased (HUMAN)SULT2A1 mRNA, immunoreactive protein, and enzymatic activity levels by approximately 2-fold. By contrast, expression of (RAT)SULT2A3, the rat counterpart to (HUMAN)SULT2A1, was induced by treatment of primary hepatocyte cultures with an activator of the pregnane X receptor, but not PPARalpha. In HepG2 cells, transient transfection analyses of luciferase reporter constructs containing upstream regions of the (HUMAN)SULT2A1 gene implicated a candidate peroxisome proliferator response element (PPRE) at nucleotides (nt) -5949 to -5929 relative to the transcription start site. Site-directed mutagenesis and electrophoretic mobility shift assay studies confirmed that this distal PPRE (dPPRE), a direct repeat nuclear receptor motif containing one intervening nt, represented a functional PPRE. Chromatin immunoprecipitation analysis indicated that the (HUMAN)SULT2A1 dPPRE was also a functional element in the context of the human genome. These data support a major role for the PPARalpha transcription factor in the regulation of hepatic (HUMAN)SULT2A1. Results also indicate that important species differences govern the transactivation of SULT2A gene transcription by nuclear receptors. PMID:15635043

  11. Transcriptional Activation of Interferon-Stimulated Genes but Not of Cytokine Genes after Primary Infection of Rhesus Macaques with Dengue Virus Type 1▿

    PubMed Central

    Sariol, Carlos A.; Muñoz-Jordán, Jorge L.; Abel, Kristina; Rosado, Lymarie C.; Pantoja, Petraleigh; Giavedoni, Luis; Rodriguez, Idia Vanessa; White, Laura J.; Martínez, Melween; Arana, Teresa; Kraiselburd, Edmundo N.

    2007-01-01

    Macaques are the only animal model used to test dengue virus (DENV) vaccine candidates. Nevertheless, the pathogenesis of DENV in macaques is not well understood. In this work, by using Affymetrix oligonucleotide microarrays, we studied the broad transcriptional modifications and cytokine expression profile after infecting rhesus macaques with DENV serotype 1. Five days after infection, these animals produced a potent, innate antiviral immune response by inducing the transcription of signature genes from the interferon (IFN) pathway with demonstrated antiviral activity, such as myxoprotein, 2′,5′-oligoadenylate synthetase, phospholipid scramblase 1, and viperin. Also, IFN regulatory element 7, IFN-stimulated gene 15, and protein ligases linked to the ISGylation process were up-regulated. Unexpectedly, no up-regulation of IFN-α, -β, or -γ genes was detected. Transcription of the genes of interleukin-10 (IL-10), IL-8, IL-6, and tumor necrosis factor alpha was neither up-regulated nor down-regulated. Results were confirmed by real-time PCR and by multiplex cytokine detection in serum samples. PMID:17428947

  12. Epstein-Barr virus induces cellular transcription factors to allow active expression of EBER genes by RNA polymerase III.

    PubMed

    Felton-Edkins, Zoë A; Kondrashov, Alexander; Karali, Dimitra; Fairley, Jennifer A; Dawson, Christopher W; Arrand, John R; Young, Lawrence S; White, Robert J

    2006-11-10

    The EBER genes of Epstein-Barr virus (EBV) are transcribed by RNA polymerase (pol) III to produce untranslated RNAs that are implicated in oncogenesis. These EBER transcripts are the most highly expressed viral gene products in EBV-transformed cells. We have identified changes to the cellular transcription machinery that may contribute to the high levels of EBER RNA. These include phosphorylation of ATF2, which interacts with EBER promoters. A second is induction of TFIIIC, a pol III-specific factor that activates EBER genes; all five subunits of TFIIIC are overexpressed in EBV-positive cells. In addition, EBV induces BDP1, a subunit of the pol III-specific factor TFIIIB. Although BDP1 is the only TFIIIB subunit induced by EBV, its induction is sufficient to stimulate EBER expression in vivo, implying a limiting function. The elevated levels of BDP1 and TFIIIC in EBV-positive cells stimulate production of tRNA, 7SL, and 5S rRNA. Abnormally high expression of these cellular pol III products may contribute to the ability of EBV to enhance growth potential. PMID:16956891

  13. Transcription of two classes of rat growth hormone gene-associated repetitive DNA: differences in activity and effects of tandem repeat structure.

    PubMed Central

    Gutierrez-Hartmann, A; Lieberburg, I; Gardner, D; Baxter, J D; Cathala, G G

    1984-01-01

    The rat growth hormone (rGH) gene contains two classes of repetitive DNA arranged as clusters within intron B and the 3' flanking region. The major family is equivalent to the CHO type 2 DNA. The second ("truncated repeat", TR) is a truncated version of the first and occurs in certain neural-specific transcripts and genes ("identifier" elements, ID). Here we report, using the HeLa cell-free transcription assay, that RNA polymerase III (Pol III) efficiently initiates at internal promoters within a tandem array of rGH gene repetitive DNA monomers and results in a novel organization of overlapping Class III transcription units. Transcription competition studies revealed that the rat type 2 structures share Pol III transcription factors with a tRNA gene, a human Alu repeat, and a mutant VA1 gene. Also, the rGH type 2 but not the TR DNA efficiently promotes Pol III initiation, yet other TR members, which differ only in flanking DNA, are transcribed. Thus, the rGH gene is strikingly enriched with 10 repetitive DNA monomers; multimeric type 2 elements are actively transcribed; rGH-TR sequences are expressed only as part of larger transcripts promoted by type 2 DNA; and, type 2 DNA uses tRNA gene transcription factors. These studies show that flanking sequences, promoter organization and factor competition may all affect rat repetitive DNA expression. Images PMID:6091058

  14. Sialic Acid-Mediated Gene Expression in Streptococcus pneumoniae and Role of NanR as a Transcriptional Activator of the nan Gene Cluster

    PubMed Central

    Afzal, Muhammad; Shafeeq, Sulman; Ahmed, Hifza

    2015-01-01

    In this study, we investigated the transcriptomic response of Streptococcus pneumoniae D39 to sialic acid (N-acetylneuraminic acid [Neu5Ac]). Transcriptome comparison of wild-type D39 grown in M17 medium with and without sialic acid revealed the elevated expression of various genes and operons, including the nan gene cluster (nan operon I and nanA gene). Our microarray analysis and promoter-lacZ fusion studies showed that the transcriptional regulator NanR acts as a transcriptional activator of nan operon I and the nanA gene in the presence of sialic acid. The putative regulatory site of NanR in the promoter region of nan operon I is predicted and confirmed by promoter truncation experiments. Furthermore, the role of CcpA in the regulation of the nan gene cluster is demonstrated through microarray analysis and promoter-lacZ fusion studies, suggesting that in the presence of sialic acid and glucose, CcpA represses the expression of nan operon I while the expression of the nanA gene is CcpA independent. PMID:25724955

  15. Transcriptional Silencing by Hairpin RNAs Complementary to a Gene Promoter

    PubMed Central

    Chu, Yongjun; Kalantari, Roya; Dodd, David W.

    2012-01-01

    Double-stranded RNAs can target gene promoters and inhibit transcription. To date, most research has focused on synthetic RNA duplexes. Transcriptional silencing by hairpin RNAs would facilitate a better understanding of endogenous RNA-mediated regulation of transcription within cells. Here we examine transcriptional silencing of progesterone receptor (PR) expression by hairpin RNAs. We identify the guide strand as the strand complementary to an antisense transcript at the PR promoter and that hairpin RNAs are active transcriptional silencing agents. The sequence of the hairpin loop affects activity, with the highest activity achieved when the loop has the potential for full complementarity to the antisense transcript target. Introduction of centrally mismatched bases relative to the target transcript does not prevent transcriptional silencing unless the mismatches are present on both the guide and passenger strands. These data demonstrate that hairpin RNAs can cause transcriptional silencing and offer insights into the mechanism of gene modulation by RNAs that target gene promoters. PMID:22703280

  16. Transcriptional regulation of secretin gene expression.

    PubMed

    Nishitani, J; Rindi, G; Lopez, M J; Upchurch, B H; Leiter, A B

    1995-01-01

    Expression of the gene encoding the hormone secretin is restricted to a specific enteroendocrine cell type and to beta-cells in developing pancreatic islets. To characterize regulatory elements in the secretin gene responsible for its expression in secretin-producing cells, we used a series of reporter genes for transient expression assays in transfection studies carried out in secretin-producing islet cell lines. Analysis of the transcriptional activity of deletion mutants identified a positive cis regulatory domain between 174 and 53 base pairs upstream from the transcriptional initiation site which was required for secretin gene expression in secretin-producing HIT insulinoma cells. Within this enhancer were sequences resembling two binding sites for the transcription factor Sp1, as well as a consensus sequence for binding to helix-loop-helix proteins. Analysis of these three elements by site-directed mutagenesis suggests that each is important for full transcriptional activity. The role of proximal enhancer sequences in directing secretin gene expression to appropriate tissues is further supported by studies in transgenic mice revealing that 1.6 kilobases of the secretin gene 5' flanking sequence were sufficient to direct the expression of either human growth hormone or simian virus 40 large T-antigen reporter genes to all major secretin-producing tissues. PMID:8774991

  17. Isolation and DNA-binding characteristics of a protein involved in transcription activation of two divergently transcribed, essential yeast genes.

    PubMed Central

    Halfter, H; Müller, U; Winnacker, E L; Gallwitz, D

    1989-01-01

    We have identified a protein, BAF1, which has two oppositely oriented, partially overlapping binding sites within a symmetrical sequence located midway between and upstream of the divergently transcribed YPT1 and TUB2 genes of the yeast Saccharomyces cerevisiae. The 120 kd BAF1 protein was purified to near homogeneity and used to delineate the two binding sites and to identify apparent protein contact sites by the missing contact technique, methylation interference and by site-directed mutagenesis. The BAF1-recognition sequence contains a conserved TCN7ACG element recently identified at autonomously replicating sequences (ARS) and in the 5' and 3' flanking region of other yeast genes. The symmetrical sequence of the YPT1/TUB2 intergene region seems not to be involved in DNA replication but activates transcription in an orientation-independent fashion. Images PMID:2684633

  18. Spirulina non-protein components induce BDNF gene transcription via HO-1 activity in C6 glioma cells.

    PubMed

    Morita, Kyoji; Itoh, Mari; Nishibori, Naoyoshi; Her, Song; Lee, Mi-Sook

    2015-01-01

    Blue-green algae are known to contain biologically active proteins and non-protein substances and considered as useful materials for manufacturing the nutritional supplements. Particularly, Spirulina has been reported to contain a variety of antioxidants, such as flavonoids, carotenoids, and vitamin C, thereby exerting their protective effects against the oxidative damage to the cells. In addition to their antioxidant actions, polyphenolic compounds have been speculated to cause the protection of neuronal cells and the recovery of neurologic function in the brain through the production of brain-derived neurotrophic factor (BDNF) in glial cells. Then, the protein-deprived extract was prepared by removing the most part of protein components from aqueous extract of Spirulina platensis, and the effect of this extract on BDNF gene transcription was examined in C6 glioma cells. Consequently, the protein-deprived extract was shown to cause the elevation of BDNF mRNA levels following the expression of heme oxygenase-1 (HO-1) in the glioma cells. Therefore, the non-protein components of S. platensis are considered to stimulate BDNF gene transcription through the HO-1 induction in glial cells, thus proposing a potential ability of the algae to indirectly modulate the brain function through the glial cell activity. PMID:25349086

  19. The Agrobacterium tumefaciens virulence protein VirE3 is a transcriptional activator of the F-box gene VBF.

    PubMed

    Niu, Xiaolei; Zhou, Meiliang; Henkel, Christiaan V; van Heusden, G Paul H; Hooykaas, Paul J J

    2015-12-01

    During Agrobacterium tumefaciens-mediated transformation of plant cells a part of the tumour-inducing plasmid, T-DNA, is integrated into the host genome. In addition, a number of virulence proteins are translocated into the host cell. The virulence protein VirE3 binds to the Arabidopsis thaliana pBrp protein, a plant-specific general transcription factor of the TFIIB family. To study a possible role for VirE3 in transcriptional regulation, we stably expressed virE3 in A. thaliana under control of a tamoxifen-inducible promoter. By RNA sequencing we showed that upon expression of virE3 the RNA levels of 607 genes were increased more than three-fold and those of 132 genes decreased more than three-fold. One of the strongly activated genes was that encoding VBF (At1G56250), an F-box protein that may affect the levels of the VirE2 and VIP1 proteins. Using Arabidopsis cell suspension protoplasts we showed that VirE3 stimulates the VBF promoter, especially when co-expressed with pBrp. Although pBrp is localized at the external surface of plastids, co-expression of VirE3 and pBrp in Arabidopsis cell suspension protoplasts resulted in the accumulation of pBrp in the nucleus. Our results suggest that VirE3 affects the transcriptional machinery of the host cell to favour the transformation process. PMID:26461850

  20. BET Inhibition Attenuates Helicobacter pylori-Induced Inflammatory Response by Suppressing Inflammatory Gene Transcription and Enhancer Activation.

    PubMed

    Chen, Jinjing; Wang, Zhen; Hu, Xiangming; Chen, Ruichuan; Romero-Gallo, Judith; Peek, Richard M; Chen, Lin-Feng

    2016-05-15

    Helicobacter pylori infection causes chronic gastritis and peptic ulceration. H. pylori-initiated chronic gastritis is characterized by enhanced expression of many NF-κB-regulated inflammatory cytokines. Brd4 has emerged as an important NF-κB regulator and regulates the expression of many NF-κB-dependent inflammatory genes. In this study, we demonstrated that Brd4 was not only actively involved in H. pylori-induced inflammatory gene mRNA transcription but also H. pylori-induced inflammatory gene enhancer RNA (eRNA) synthesis. Suppression of H. pylori-induced eRNA synthesis impaired H. pylori-induced mRNA synthesis. Furthermore, H. pylori stimulated NF-κB-dependent recruitment of Brd4 to the promoters and enhancers of inflammatory genes to facilitate the RNA polymerase II-mediated eRNA and mRNA synthesis. Inhibition of Brd4 by JQ1 attenuated H. pylori-induced eRNA and mRNA synthesis for a subset of NF-κB-dependent inflammatory genes. JQ1 also inhibited H. pylori-induced interaction between Brd4 and RelA and the recruitment of Brd4 and RNA polymerase II to the promoters and enhancers of inflammatory genes. Finally, we demonstrated that JQ1 suppressed inflammatory gene expression, inflammation, and cell proliferation in H. pylori-infected mice. These studies highlight the importance of Brd4 in H. pylori-induced inflammatory gene expression and suggest that Brd4 could be a potential therapeutic target for the treatment of H. pylori-triggered inflammatory diseases and cancer. PMID:27084101

  1. Efficient Gene Editing in Pluripotent Stem Cells by Bacterial Injection of Transcription Activator-Like Effector Nuclease Proteins

    PubMed Central

    Jia, Jingyue; Bai, Fang; Jin, Yongxin; Santostefano, Katherine E.; Ha, Un-Hwan; Wu, Donghai

    2015-01-01

    The type III secretion system (T3SS) of Pseudomonas aeruginosa is a powerful tool for direct protein delivery into mammalian cells and has successfully been used to deliver various exogenous proteins into mammalian cells. In the present study, transcription activator-like effector nuclease (TALEN) proteins have been efficiently delivered using the P. aeruginosa T3SS into mouse embryonic stem cells (mESCs), human ESCs (hESCs), and human induced pluripotent stem cells (hiPSCs) for genome editing. This bacterial delivery system offers an alternative method of TALEN delivery that is highly efficient in cleavage of the chromosomal target and presumably safer by avoiding plasmid DNA introduction. We combined the method of bacterial T3SS-mediated TALEN protein injection and transfection of an oligonucleotide template to effectively generate precise genetic modifications in the stem cells. Initially, we efficiently edited a single-base in the gfp gene of a mESC line to silence green fluorescent protein (GFP) production. The resulting GFP-negative mESC was cloned from a single cell and subsequently mutated back to a GFP-positive mESC line. Using the same approach, the gfp gene was also effectively knocked out in hESCs. In addition, a defined single-base edition was effectively introduced into the X-chromosome-linked HPRT1 gene in hiPSCs, generating an in vitro model of Lesch-Nyhan syndrome. T3SS-mediated TALEN protein delivery provides a highly efficient alternative for introducing precise gene editing within pluripotent stem cells for the purpose of disease genotype-phenotype relationship studies and cellular replacement therapies. Significance The present study describes a novel and powerful tool for the delivery of the genome editing enzyme transcription activator-like effector nuclease (TALEN) directly into pluripotent stem cells (PSCs), achieving desired base changes on the genomes of PSCs with high efficiency. This novel approach uses bacteria as a protein delivery

  2. The type 1 human immunodeficiency virus Tat binding protein is a transcriptional activator belonging to an additional family of evolutionarily conserved genes.

    PubMed Central

    Ohana, B; Moore, P A; Ruben, S M; Southgate, C D; Green, M R; Rosen, C A

    1993-01-01

    The type 1 human immunodeficiency virus Tat protein is a powerful transcriptional activator when bound to an RNA structure (TAR) present at the extreme 5' terminus of viral mRNA. Since transcriptional activation requires binding of Tat to RNA, it has been suggested that Tat enhances initiation or elongation through a direct interaction with cellular transcription factors. Here we show through protein fusion experiments that the previously identified cellular Tat binding protein, TBP-1, although unable to bind DNA, is a strong transcriptional activator when brought into proximity of several promoter elements. Transcriptional activity depends upon the integrity of at least two highly conserved domains: one resembling a nucleotide-binding motif and the other motif common to proteins with helicase activity. Our studies further reveal that TBP-1 represents one member of a large, highly conserved gene family that encodes proteins demonstrating strong amino acid conservation across species. Finally, we identified a second family member that, although 77% similar to TBP-1, does not activate transcription from the promoters examined. This finding, together with the observation that TBP-1 does not activate each promoter examined, suggests that this gene family may encode promoter-specific transcriptional activators. Images PMID:8419915

  3. Archaeal amoA and ureC genes and their transcriptional activity in the Arctic Ocean

    PubMed Central

    Pedneault, Estelle; Galand, Pierre E.; Potvin, Marianne; Tremblay, Jean-Éric; Lovejoy, Connie

    2014-01-01

    Thaumarchaeota and the gene encoding for a subunit of ammonia monooxygenase (amoA) are ubiquitous in Polar Seas, and some Thaumarchaeota also have a gene coding for ureC, diagnostic for urease. Using quantitative PCR we investigated the occurrence of genes and transcripts of ureC and amoA in Arctic samples from winter, spring and summer. AmoA genes, ureC genes and amoA transcripts were always present, but ureC transcripts were rarely detected. Over a 48 h light manipulation experiment amoA transcripts persisted under light and dark conditions, but not ureC transcripts. In addition, maxima for amoA transcript were nearer the surface compared to amoA genes. Clone libraries using DNA template recovered shallow and deep amoA clades but only the shallow clade was recovered from cDNA (from RNA). These results imply environmental control of amoA expression with direct or indirect light effects, and rare ureC expression despite its widespread occurrence in the Arctic Ocean. PMID:24722490

  4. Exposure to phenanthrene and depuration: Changes on gene transcription, enzymatic activity and lipid peroxidation in gill of scallops Nodipecten nodosus.

    PubMed

    Piazza, Rômi S; Trevisan, Rafael; Flores-Nunes, Fabrício; Toledo-Silva, Guilherme; Wendt, Nestor; Mattos, Jacó J; Lima, Daína; Taniguchi, Satie; Sasaki, Silvio Tarou; Mello, Álvaro C P; Zacchi, Flávia L; Serrano, Miguel A S; Gomes, Carlos H A M; Bícego, Márcia C; Almeida, Eduardo A de; Bainy, Afonso C D

    2016-08-01

    Understanding the mechanism of phenanthrene (PHE) biotransformation and related cellular responses in bivalves can be an important tool to elucidate the risks of polycyclic aromatic hydrocarbons (PAHs) to aquatic organisms. In the present study it was analyzed the transcriptional levels of 13 biotransformation genes related to cytochrome P450 (CYP), glutathione S-transferase (GST), sulfotransferase (SULT), flavin-containing monooxygenase and fatty acid-binding proteins by qPCR in gill of scallops Nodipecten nodosus exposed for 24 or 96h to 50 or 200μgL(-1) PHE (equivalent to 0.28 and 1.12μM, respectively), followed by depuration in clean water for 96h (DEP). Likewise, it was quantified the activity of catalase (CAT), glutathione peroxidase (GPx), superoxide dismutase (SOD), glutathione reductase (GR), glucose 6-phosphate dehydrogenase (G6PDH), GST and levels of lipid peroxidation. Increased transcriptional levels of CYP2UI-like, CYP2D20-like, CYP3A11-like, GSTomega-like, SULT1B1-like genes were detected in organisms exposed to PHE for 24 or 96h. In parallel, GR and GPX activities increased after 96h exposure to 200μgL(-1) PHE and G6PDH activity increased after 24h exposure to 50μgL(-1) PHE. This enhancement of antioxidant and phase I and II biotransformation systems may be related to the 2.7 and 12.5 fold increases in PHE bioaccumulation after 96h exposure to 50 and 200μgL(-1) PHE, respectively. Interestingly, DEP caused reestablishment of GPX and GR activity, as well as to the transcript levels of all upregulated biotransformation genes (except for SULT1B1-like). Bioaccumulated PHE levels decreased 2.5-2.9 fold after depuration, although some biochemical and molecular modifications were still present. Lipid peroxidation levels remained lower in animals exposed to 200μgL(-1) PHE for 24h and DEP. These data indicate that N. nodosus is able to induce an antioxidant and biotransformation-related response to PHE exposure, counteracting its toxicity, and DEP can

  5. Sublethal effects of the flame retardant intermediate hexachlorocyclopentadiene (HCCPD) on the gene transcription and protein activity of Daphnia magna.

    PubMed

    Houde, Magali; Carter, Barbara; Douville, Mélanie

    2013-09-15

    Hexachlorocyclopentadiene (HCCPD) is a chlorinated chemical of high production volume used as an intermediate in the production of flame retardants. HCCPD may be released to the environment during production, use, and as a result of product degradation. The objectives of this study were to evaluate sublethal effects of HCCPD exposure to Daphnia magna at environmentally relevant concentrations (0.0138-13.8 μg/L) using genomic tools (microarray and qPCR), enzyme activities, and life-history endpoints (survival, reproduction, and growth). In chronic exposures, no differences were observed in life-history endpoints (survival, time of first brood, time of first molt, molt frequency, number of neonates, and body length) between exposed organisms and controls. Microarray analyses indicated significant differential genomic transcription for 46 genes (p-value ≤ 0.05 and fold-change>2). Five identified genes were related to metabolic functions. Enzyme activities of α-amylase and trypsin, selected based on transcriptional responses, were evaluated in D. magna. Although trypsin activity was similar between treatments and controls, the activity of α-amylase significantly decreased with increasing HCCPD concentrations. On the chemical level, instability of HCCPD was observed in spiked culture media, most probably due to photolysis and biodegradation. HCCPD was not detected in surface water samples collected upstream and at the point of discharge of a major wastewater treatment plant effluent. Environmentally, rapid degradation of HCCPD could be outdone by its continuous release into aquatic ecosystems in specific areas of concern (e.g., vicinity of industries and hazardous sites). Toxicity results from this study highlight the use of genomics in the identification of biomarkers and help advance the science, and potential use, of multi-level biological approaches for environmental risk assessment. PMID:23820075

  6. A novel c-Jun-dependent signal transduction pathway necessary for the transcriptional activation of interferon gamma response genes.

    PubMed

    Gough, Daniel J; Sabapathy, Kanaga; Ko, Enoch Yi-No; Arthur, Helen A; Schreiber, Robert D; Trapani, Joseph A; Clarke, Christopher J P; Johnstone, Ricky W

    2007-01-12

    The biological effects of interferon gamma (IFNgamma) are mediated by interferon-stimulated genes (ISGs), many of which are activated downstream of Janus kinase (JAK)/signal transducer and activator of transcription 1 (STAT1) signaling. Herein we have shown that IFNgamma rapidly activated AP-1 DNA binding that required c-Jun but was independent of JAK1 and STAT1. IFNgamma-induced c-Jun phosphorylation and AP-1 DNA binding required the MEK1/2 and ERK1/2 signaling pathways, whereas the JNK1/2 and p38 mitogen-activated protein kinase pathways were dispensable. The induction of several ISGs, including ifi-205 and iNOS, was impaired in IFNgamma-treated c-Jun-/- cells, but others, such as IP-10 and SOCS3, were unaffected, and chromatin immunoprecipitation demonstrated that c-Jun binds to the iNOS promoter following treatment with IFNgamma. Thus, IFNgamma induced JAK1- and STAT1-independent activation of the ERK mitogen-activated protein kinase pathway, phosphorylation of c-Jun, and activation of AP-1 DNA binding, which are important for the induction of a subset of ISGs. This represents a novel signal transduction pathway induced by IFNgamma that proceeds in parallel with conventional JAK/STAT signaling to activate ISGs. PMID:17105733

  7. Transcriptional activation of RNA polymerase III-dependent genes by the human T-cell leukemia virus type 1 tax protein.

    PubMed Central

    Gottesfeld, J M; Johnson, D L; Nyborg, J K

    1996-01-01

    The human T-cell leukemia virus-encoded tax protein is a potent activator of many viral and cellular genes transcribed by RNA polymerase II. We find that both chromatin and cell extracts derived from human T-cell leukemia virus type 1-infected human T lymphocytes support higher levels of 5S rRNA and tRNA gene transcription than chromatin or extracts from uninfected T lymphocytes. The viral protein Tax was likely responsible for this higher level of class II gene transcription, as purified Tax was found to stimulate both genes when added to the uninfected cell extract or in reconstituted systems. Both limiting-component transcription assays and DNA binding assays identified the class III gene transcription factor TFIIIB as the principle target of Tax activity. Surprisingly, we find that Tax increases the effective concentration of active TFIIIB molecules. These data suggest that Tax stimulates RNA polymerase III-dependent gene expression by accelerating the rate and/or extent of transcription initiation complex assembly. PMID:8657153

  8. Linking Smads and transcriptional activation.

    PubMed

    Inman, Gareth J

    2005-02-15

    TGF-beta1 (transforming growth factor-beta1) is the prototypical member of a large family of pleiotropic cytokines that regulate diverse biological processes during development and adult tissue homoeostasis. TGF-beta signals via membrane bound serine/threonine kinase receptors which transmit their signals via the intracellular signalling molecules Smad2, Smad3 and Smad4. These Smads contain conserved MH1 and MH2 domains separated by a flexible linker domain. Smad2 and Smad3 act as kinase substrates for the receptors, and, following phosphorylation, they form complexes with Smad4 and translocate to the nucleus. These Smad complexes regulate gene expression and ultimately determine the biological response to TGF-beta. In this issue of the Biochemical Journal, Wang et al. have shown that, like Smad4, the linker domain of Smad3 contains a Smad transcriptional activation domain. This is capable of recruiting the p300 transcriptional co-activator and is required for Smad3-dependent transcriptional activation. This study raises interesting questions about the nature and regulation of Smad-regulated gene activation and elevates the status of the linker domain to rival that of the much-lauded MH1 and MH2 domains. PMID:15702493

  9. The Mediator Complex MED15 Subunit Mediates Activation of Downstream Lipid-Related Genes by the WRINKLED1 Transcription Factor1[OPEN

    PubMed Central

    Kim, Mi Jung

    2016-01-01

    The Mediator complex is known to be a master coordinator of transcription by RNA polymerase II, and this complex is recruited by transcription factors (TFs) to target promoters for gene activation or repression. The plant-specific TF WRINKLED1 (WRI1) activates glycolysis-related and fatty acid biosynthetic genes during embryogenesis. However, no Mediator subunit has yet been identified that mediates WRI1 transcriptional activity. Promoter-β-glucuronidase fusion experiments showed that MEDIATOR15 (MED15) is expressed in the same cells in the embryo as WRI1. We found that the Arabidopsis (Arabidopsis thaliana) MED15 subunit of the Mediator complex interacts directly with WRI1 in the nucleus. Overexpression of MED15 or WRI1 increased transcript levels of WRI1 target genes involved in glycolysis and fatty acid biosynthesis; these genes were down-regulated in wild-type or WRI1-overexpressing plants by silencing of MED15. However, overexpression of MED15 in the wri1 mutant also increased transcript levels of WRI1 target genes, suggesting that MED15 also may act with other TFs to activate downstream lipid-related genes. Chromatin immunoprecipitation assays confirmed the association of MED15 with six WRI1 target gene promoters. Additionally, silencing of MED15 resulted in reduced fatty acid content in seedlings and mature seeds, whereas MED15 overexpression increased fatty acid content in both developmental stages. Similar results were found in wri1 mutant and WRI1 overexpression lines. Together, our results indicate that the WRI1/MED15 complex transcriptionally regulates glycolysis-related and fatty acid biosynthetic genes during embryogenesis. PMID:27246098

  10. Transcriptional interference among the murine β-like globin genes

    PubMed Central

    Hu, Xiao; Eszterhas, Susan; Pallazzi, Nicolas; Bouhassira, Eric E.; Fields, Jennifer; Tanabe, Osamu; Gerber, Scott A.; Bulger, Michael; Engel, James Douglas; Groudine, Mark

    2007-01-01

    Mammalian β-globin loci contain multiple genes that are activated at different developmental stages. Studies have suggested that the transcription of one gene in a locus can influence the expression of the other locus genes. The prevalent model to explain this transcriptional interference is that all potentially active genes compete for locus control region (LCR) activity. To investigate the influence of transcription by the murine embryonic genes on transcription of the other β-like genes, we generated mice with deletions of the promoter regions of Ey and βh1 and measured transcription of the remaining genes. Deletion of the Ey and βh1 promoters increased transcription of βmajor and βminor 2-fold to 3-fold during primitive erythropoiesis. Deletion of Ey did not affect βh1 nor did deletion of βh1 affect Ey, but Ey deletion uniquely activated transcription from βh0, a β-like globin gene immediately downstream of Ey. Protein analysis showed that βh0 encodes a translatable β-like globin protein that can pair with alpha globin. The lack of transcriptional interference between Ey and βh1 and the gene-specific repression of βh0 did not support LCR competition among the embryonic genes and suggested that direct transcriptional interference from Ey suppressed βh0. PMID:17077320

  11. Transcriptional regulation of the human biglycan gene.

    PubMed

    Ungefroren, H; Krull, N B

    1996-06-28

    The small leucine-rich proteoglycan biglycan is involved in several physiological and pathophysiological processes through the ability of its core protein to interact with other extracellular matrix molecules and transforming growth factor-beta (TGF-beta). To learn more about the regulation of biglycan core protein expression, we have cloned and sequenced 1218 base pairs from the 5'-flanking region of the human biglycan gene, demonstrated functional promoter activity, and investigated the molecular mechanisms through which various agents modulate its transcriptional activity. Sequencing revealed the presence of several cis-acting elements including multiple AP-2 sites and interleukin-6 response elements, a NF-kappaB site, a TGF-beta negative element, and an E-box. The TATA and CAAT box-lacking promoter possesses many features of a growth-related gene, e.g. a GC-rich immediate 5' region, many Sp1 sites, and the use of multiple transcriptional start sites. Transient transfections of the tumor cell lines MG-63, SK-UT-1, and T47D with various biglycan 5'-flanking region-luciferase reporter gene constructs showed that the proximal 78 base pairs are sufficient for full promoter activity. Several agents among them interleukin-6, and tumor necrosis factor-alpha. were capable of altering biglycan promoter activity. However, in MG-63 cells, TGF-beta1 failed to increase either activity of the biglycan promoter constructs or specific transcription from the endogenous biglycan gene. Since TGF-beta1 also did not alter the stability of cytoplasmic biglycan mRNA as determined from Northern analysis after inhibition of transcription with 5,6-dichloro-1beta-D-ribofuranosylbenzimidazole, an as yet unidentified nuclear post-transcriptional mechanism was considered responsible for the TGF-beta effect in this cell type. These results might help to elucidate the molecular pathways leading to pathological alterations of biglycan expression observed in atherosclerosis, glomerulonephritis

  12. Transcription Factor ZBED6 Mediates IGF2 Gene Expression by Regulating Promoter Activity and DNA Methylation in Myoblasts

    NASA Astrophysics Data System (ADS)

    Huang, Yong-Zhen; Zhang, Liang-Zhi; Lai, Xin-Sheng; Li, Ming-Xun; Sun, Yu-Jia; Li, Cong-Jun; Lan, Xian-Yong; Lei, Chu-Zhao; Zhang, Chun-Lei; Zhao, Xin; Chen, Hong

    2014-04-01

    Zinc finger, BED-type containing 6 (ZBED6) is an important transcription factor in placental mammals, affecting development, cell proliferation and growth. In this study, we found that the expression of the ZBED6 and IGF2 were upregulated during C2C12 differentiation. The IGF2 expression levels were negatively associated with the methylation status in beef cattle (P < 0.05). A luciferase assay for the IGF2 intron 3 and P3 promoter showed that the mutant-type 439 A-SNP-pGL3 in driving reporter gene transcription is significantly higher than that of the wild-type 439 G-SNP-pGL3 construct (P < 0.05). An over-expression assay revealed that ZBED6 regulate IGF2 expression and promote myoblast differentiation. Furthermore, knockdown of ZBED6 led to IGF2 expression change in vitro. Taken together, these results suggest that ZBED6 inhibits IGF2 activity and expression via a G to A transition disrupts the interaction. Thus, we propose that ZBED6 plays a critical role in myogenic differentiation.

  13. Crystal structure of HlyU, the hemolysin gene transcription activator, from Vibrio cholerae N16961 and functional implications.

    PubMed

    Mukherjee, Debadrita; Datta, Ajit Bikram; Chakrabarti, Pinak

    2014-10-18

    HlyU in Vibrio cholerae is known to be the transcriptional activator of the hemolysin gene, HlyA and possibly a regulator of other virulence factors influencing growth, colonization and pathogenicity of this infective agent. Here we report the crystal structure of HlyU from V. cholerae N16961 (HlyU_Vc) at 1.8Å. The protein, with five α-helices and three β-strands in the topology of α1-α2-β1-α3-α4-β2-β3-α5, forms a homodimer. Helices α3-α4 and a β sheet form the winged helix-turn-helix (wHTH) DNA-binding motif common to the transcription regulators of the SmtB/ArsR family. In spite of an overall fold similar to SmtB/ArsR family, it lacks any metal binding site seen in SmtB. A comparison of the dimeric interfaces showed that the one in SmtB is much larger and have salt bridges that can be disrupted to accommodate metal ions. A model of HlyU-DNA complex suggests bending of the DNA. Cys38 in the structure was found to be modified as sulfenic acid; the oxidized form was not seen in another structure solved under reducing condition. Although devoid of any metal binding site, the presence of a Cys residue exhibiting oxidation-reduction suggests the possibility of the existence of a redox switch in transcription regulation. A structure-based phylogenetic analysis of wHTH proteins revealed the segregation of metal and non-metal binding proteins as well as those in the latter group that are under redox control. PMID:25450504

  14. Sumoylation of Forkhead L2 by Ubc9 is required for its activity as a transcriptional repressor of the Steroidogenic Acute Regulatory Gene

    PubMed Central

    Kuo, Fang-Ting; Bentsi-Barnes, Ikuko K.; Barlow, Gillian M.; Bae, Jeehyeon; Pisarska, Margareta D.

    2010-01-01

    Forkhead L2 (FOXL2) is a member of the forkhead/hepatocyte nuclear factor 3 (FKH/HNF3) gene family of transcription factors and acts as a transcriptional repressor of the Steroidogenic Acute Regulatory (StAR) gene, a marker of granulosa cell differentiation. FOXL2 may play a role in ovarian follicle maturation and prevent premature follicle depletion leading to premature ovarian failure. In this study, we found that FOXL2 interacts with Ubc9, an E2-conjugating enzyme that mediates sumoylation, a key mechanism in transcriptional regulation. FOXL2 and Ubc9 are co-expressed in granulosa cells of small and medium ovarian follicles. FOXL2 is sumoylated by Ubc9, and this Ubc9-mediated sumoylation is essential to transcription activity of FOXL2 on the StAR promoter. As FOXL2 is endogenous to granulosa cells, we generated a stable cell line expressing FOXL2 and found that activity of the StAR promoter in this cell line is greatly decreased in the presence of Ubc9. The sumoylation site was identified at lysine 25 of FOXL2. Mutation of lysine 25 to arginine leads to loss of transcriptional repressor activity of FOXL2. Taken together, we propose that Ubc9-mediated sumoylation at lysine 25 of FOXL2 is required for transcriptional repression of the StAR gene and may be responsible for controlling the development of ovarian follicles. PMID:19744555

  15. Cooperative Transcriptional Activation of Antimicrobial Genes by STAT and NF-κB Pathways by Concerted Recruitment of the Mediator Complex.

    PubMed

    Wienerroither, Sebastian; Shukla, Priyank; Farlik, Matthias; Majoros, Andrea; Stych, Bernadette; Vogl, Claus; Cheon, HyeonJoo; Stark, George R; Strobl, Birgit; Müller, Mathias; Decker, Thomas

    2015-07-14

    The transcriptional response to infection with the bacterium Listeria monocytogenes (Lm) requires cooperative signals of the type I interferon (IFN-I)-stimulated JAK-STAT and proinflammatory NF-κB pathways. Using ChIP-seq analysis, we define genes induced in Lm-infected macrophages through synergistic transcriptional activation by NF-κB and the IFN-I-activated transcription factor ISGF3. Using the Nos2 and IL6 genes as prime examples of this group, we show that NF-κB functions to recruit enzymes that establish histone marks of transcriptionally active genes. In addition, NF-κB regulates transcriptional elongation by employing the mediator kinase module for the recruitment of the pTEFb complex. ISGF3 has a major role in associating the core mediator with the transcription start as a prerequisite for TFIID and RNA polymerase II (Pol II) binding. Our data suggest that the functional cooperation between two major antimicrobial pathways is based on promoter priming by NF-κB and the engagement of the core mediator for Pol II binding by ISGF3. PMID:26146080

  16. Cooperative Transcriptional Activation of Antimicrobial Genes by STAT and NF-κB Pathways by Concerted Recruitment of the Mediator Complex

    PubMed Central

    Wienerroither, Sebastian; Shukla, Priyank; Farlik, Matthias; Majoros, Andrea; Stych, Bernadette; Vogl, Claus; Cheon, HyeonJoo; Stark, George R.; Strobl, Birgit; Müller, Mathias; Decker, Thomas

    2015-01-01

    Summary The transcriptional response to infection with the bacterium Listeria monocytogenes (Lm) requires cooperative signals of the type I interferon (IFN-I)-stimulated JAK-STAT and proinflammatory NF-κB pathways. Using ChIP-seq analysis, we define genes induced in Lm-infected macrophages through synergistic transcriptional activation by NF-κB and the IFN-I-activated transcription factor ISGF3. Using the Nos2 and IL6 genes as prime examples of this group, we show that NF-κB functions to recruit enzymes that establish histone marks of transcriptionally active genes. In addition, NF-κB regulates transcriptional elongation by employing the mediator kinase module for the recruitment of the pTEFb complex. ISGF3 has a major role in associating the core mediator with the transcription start as a prerequisite for TFIID and RNA polymerase II (Pol II) binding. Our data suggest that the functional cooperation between two major antimicrobial pathways is based on promoter priming by NF-κB and the engagement of the core mediator for Pol II binding by ISGF3. PMID:26146080

  17. H-NS is a repressor of the Proteus mirabilis urease transcriptional activator gene ureR.

    PubMed

    Coker, C; Bakare, O O; Mobley, H L

    2000-05-01

    Expression of Proteus mirabilis urease is governed by UreR, an AraC-like positive transcriptional activator. A poly(A) tract nucleotide sequence, consisting of A(6)TA(2)CA(2)TGGTA(5)GA(6)TGA(5), is located 16 bp upstream of the sigma(70)-like ureR promoter P2. Since poly(A) tracts of DNA serve as binding sites for the gene repressor histone-like nucleoid structuring protein (H-NS), we measured beta-galactosidase activity of wild-type Escherichia coli MC4100 (H-NS(+)) and its isogenic derivative ATM121 (hns::Tn10) (H-NS(-)) harboring a ureR-lacZ operon fusion plasmid (pLC9801). beta-Galactosidase activity in the H-NS(-) host strain was constitutive and sevenfold greater (P < 0.0001) than that in the H-NS(+) host. A recombinant plasmid containing cloned P. mirabilis hns was able to complement and restore repression of the ureR promoter in the H-NS(-) host when provided in trans. Deletion of the poly(A) tract nucleotide sequence from pLC9801 resulted in an increase in beta-galactosidase activity in the H-NS(+) host to nearly the same levels as that observed for wild-type pLC9801 harbored by the H-NS(-) host. Urease activity in strains harboring the recombinant plasmid pMID1010 (encoding the entire urease gene cluster of P. mirabilis) was equivalent in both the H-NS(-) background and the H-NS(+) background in the presence of urea but was eightfold greater (P = 0.0001) in the H-NS(-) background in the absence of urea. We conclude that H-NS represses ureR expression in the absence of urea induction. PMID:10762273

  18. Efficient Gene Editing in Pluripotent Stem Cells by Bacterial Injection of Transcription Activator-Like Effector Nuclease Proteins.

    PubMed

    Jia, Jingyue; Bai, Fang; Jin, Yongxin; Santostefano, Katherine E; Ha, Un-Hwan; Wu, Donghai; Wu, Weihui; Terada, Naohiro; Jin, Shouguang

    2015-08-01

    The type III secretion system (T3SS) of Pseudomonas aeruginosa is a powerful tool for direct protein delivery into mammalian cells and has successfully been used to deliver various exogenous proteins into mammalian cells. In the present study, transcription activator-like effector nuclease (TALEN) proteins have been efficiently delivered using the P. aeruginosa T3SS into mouse embryonic stem cells (mESCs), human ESCs (hESCs), and human induced pluripotent stem cells (hiPSCs) for genome editing. This bacterial delivery system offers an alternative method of TALEN delivery that is highly efficient in cleavage of the chromosomal target and presumably safer by avoiding plasmid DNA introduction. We combined the method of bacterial T3SS-mediated TALEN protein injection and transfection of an oligonucleotide template to effectively generate precise genetic modifications in the stem cells. Initially, we efficiently edited a single-base in the gfp gene of a mESC line to silence green fluorescent protein (GFP) production. The resulting GFP-negative mESC was cloned from a single cell and subsequently mutated back to a GFP-positive mESC line. Using the same approach, the gfp gene was also effectively knocked out in hESCs. In addition, a defined single-base edition was effectively introduced into the X-chromosome-linked HPRT1 gene in hiPSCs, generating an in vitro model of Lesch-Nyhan syndrome. T3SS-mediated TALEN protein delivery provides a highly efficient alternative for introducing precise gene editing within pluripotent stem cells for the purpose of disease genotype-phenotype relationship studies and cellular replacement therapies. PMID:26062981

  19. Identification of the G13 (cAMP-response-element-binding protein-related protein) gene product related to activating transcription factor 6 as a transcriptional activator of the mammalian unfolded protein response.

    PubMed Central

    Haze, K; Okada, T; Yoshida, H; Yanagi, H; Yura, T; Negishi, M; Mori, K

    2001-01-01

    Eukaryotic cells control the levels of molecular chaperones and folding enzymes in the endoplasmic reticulum (ER) by a transcriptional induction process termed the unfolded protein response (UPR). The mammalian UPR is mediated by the cis-acting ER stress response element consisting of 19 nt (CCAATN(9)CCACG), the CCACG part of which is considered to provide specificity. We recently identified the basic leucine zipper (bZIP) protein ATF6 as a mammalian UPR-specific transcription factor; ATF6 is activated by ER stress-induced proteolysis and binds directly to CCACG. Here we report that eukaryotic cells express another bZIP protein closely related to ATF6 in both structure and function. This protein encoded by the G13 (cAMP response element binding protein-related protein) gene is constitutively synthesized as a type II transmembrane glycoprotein anchored in the ER membrane and processed into a soluble form upon ER stress as occurs with ATF6. The proteolytic processing of ATF6 and the G13 gene product is accompanied by their relocation from the ER to the nucleus; their basic regions seem to function as a nuclear localization signal. Overexpression of the soluble form of the G13 product constitutively activates the UPR, whereas overexpression of a mutant lacking the activation domain exhibits a strong dominant-negative effect. Furthermore, the soluble forms of ATF6 and the G13 gene product are unable to bind to several point mutants of the cis-acting ER stress response element in vitro that hardly respond to ER stress in vivo. We thus concluded that the two related bZIP proteins are crucial transcriptional regulators of the mammalian UPR, and propose calling the ATF6 gene product ATF6alpha and the G13 gene product ATF6beta. PMID:11256944

  20. Tumor suppressor p53 inhibits transcriptional activation of invasion gene thromboxane synthase mediated by the proto-oncogenic factor ets-1.

    PubMed

    Kim, Ella; Günther, Willy; Yoshizato, Kimio; Meissner, Hildegard; Zapf, Srenja; Nüsing, Rolf M; Yamamoto, Hirotaka; Van Meir, Erwin G; Deppert, Wolfgang; Giese, Alf

    2003-10-30

    Cancer formation and progression is a complex process determined by several mechanisms that promote cell growth, invasiveness, neo-angiogenesis, and render neoplastic cells resistant to apoptosis. The tumor suppressor p53 and the proto-oncogenic factor ets-1 are important regulators of such mechanisms. While it is well established that p53 and ets-1 influence various aspects of cell behavior by regulating the transcription of specific genes, little is known about the functional relationship between these transcription factors. We found that the gene encoding thromboxane synthase (TXSA), which we recently identified as a factor promoting invasion and resistance to apoptosis in gliomas, is a novel target gene for both p53 and ets-1. We demonstrate that p53 and ets-1 coregulate TXSA in an antagonistic and inter-related manner, with ets-1 being a potent transcriptional activator and p53 inhibiting ets-1-dependent transcription. Negative interference with ets-1 transcription requires functional p53 and is lost in mutant p53 proteins. We show that ets-1 and p53 associate physically in vitro and in vivo and that their interaction, rather than a direct binding of p53 to the TXSA promoter, is required for transcriptional repression of TXSA by wild-type p53. An important implication of our findings is that the loss of p53-mediated negative control over ets-1-dependent transcription may lead to the acquisition of an invasive phenotype in tumor cells. PMID:14586398

  1. Early trypsin activity is part of the signal transduction system that activates transcription of the late trypsin gene in the midgut of the mosquito, Aedes aegypti.

    PubMed

    Barillas-Mury, C V; Noriega, F G; Wells, M A

    1995-02-01

    Trypsin activity during the first hours after feeding is essential to induce late trypsin gene expression. These results are consistent with the idea that free amino acids or other products released during digestion might be the initial signal for transcriptional activation of late trypsin. Besides early trypsin, some other factor(s) have to be translated for induction of late trypsin. This is the first case in which the proteolytic activity of a digestive enzyme is part of the signal transduction system which regulates expression of a second gene. The presence of two trypsins allows the mosquito to assess the quality of the meal and adjust the levels of late trypsin for a particular meal with remarkable flexibility. PMID:7711754

  2. PPARalpha and PPARgamma activators direct a distinct tissue-specific transcriptional response via a PPRE in the lipoprotein lipase gene.

    PubMed Central

    Schoonjans, K; Peinado-Onsurbe, J; Lefebvre, A M; Heyman, R A; Briggs, M; Deeb, S; Staels, B; Auwerx, J

    1996-01-01

    Increased activity of lipoprotein lipase (LPL) may explain the hypotriglyceridemic effects of fibrates, thiazolidinediones and fatty acids, which are known activators (and/or ligands) of the various peroxisome proliferator-activated receptors (PPARs). Treatment with compounds which activate preferentially PPARalpha, such as fenofibrate, induced LPL expression exclusively in rat liver. In contrast, the antidiabetic thiazolidinedione BRL 49653, a high affinity ligand for PPARgamma, had no effect on liver, but induced LPL expression in rat adipose tissue. In the hepatocyte cell line AML-12, fenofibric acid, but not BRL 49653, induced LPL mRNA, whereas in 3T3-L1 preadipocytes, the PPARgamma ligand induced LPL mRNA levels much quicker and to a higher extent than fenofibric acid. In both the in vivo and in vitro studies, inducibility by either PPARalpha or gamma activators, correlated with the tissue distribution of the respective PPARs: an adipocyte-restricted expression of PPARgamma, whereas PPARalpha was expressed predominantly in liver. A sequence element was identified in the human LPL promoter that mediates the functional responsiveness to fibrates and thiazolidinediones. Methylation interference and gel retardation assays demonstrated that a PPARalpha or gamma and the 9-cis retinoic acid receptor (RXR) heterodimers bind to this sequence -169 TGCCCTTTCCCCC -157. These data provide evidence that transcriptional activation of the LPL gene by fibrates and thiazolidinediones is mediated by PPAR-RXR heterodimers and contributes significantly to their hypotriglyceridemic effects in vivo. Whereas thiazolidinediones predominantly affect adipocyte LPL production through activation of PPARgamma, fibrates exert their effects mainly in the liver via activation of PPARalpha. Images PMID:8895578

  3. Chicken ovalbumin upstream-promoter transcription factor (COUP-TF) could act as a transcriptional activator or repressor of the mitochondrial 3-hydroxy-3-methylglutaryl-CoA synthase gene.

    PubMed Central

    Rodríguez, J C; Ortiz, J A; Hegardt, F G; Haro, D

    1997-01-01

    The chicken ovalbumin upstream-promoter transcription factor (COUP-TF) has a dual effect on the regulation of the mitochondrial 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA) synthase gene. COUP-TF could act as a transcriptional activator or repressor of this gene through different DNA sequences. COUP-TF induces expression of a reporter gene linked to the mitochondrial HMG-CoA synthase gene promoter in human hepatoma HepG2 cells, but represses it in a Leydig tumour cell line (R2C); in both these cell lines the expression of the mitochondrial HMG-CoA synthase gene mimics that of liver and testis. The activation is promoted by a fragment of the gene from coordinates -62 to +28, which contains a GC box and a TATA box, and where no COUP-TF binding site was observed by in vitro DNA binding studies. On the other hand, the COUP-TF inhibitory effect is mainly due to repression of peroxisome-proliferator-activated receptor-dependent activation of the gene, interacting with the region from -104 to -92. To our knowledge this work represents the second example of a target gene for COUP-TF I that could be either activated or repressed by the action of this receptor through different DNA sequences of the same gene. PMID:9291136

  4. Resveratrol post-transcriptionally regulates pro-inflammatory gene expression via regulation of KSRP RNA binding activity.

    PubMed

    Bollmann, Franziska; Art, Julia; Henke, Jenny; Schrick, Katharina; Besche, Verena; Bros, Matthias; Li, Huige; Siuda, Daniel; Handler, Norbert; Bauer, Florian; Erker, Thomas; Behnke, Felix; Mönch, Bettina; Härdle, Lorena; Hoffmann, Markus; Chen, Ching-Yi; Förstermann, Ulrich; Dirsch, Verena M; Werz, Oliver; Kleinert, Hartmut; Pautz, Andrea

    2014-11-10

    Resveratrol shows beneficial effects in inflammation-based diseases like cancer, cardiovascular and chronic inflammatory diseases. Therefore, the molecular mechanisms of the anti-inflammatory resveratrol effects deserve more attention. In human epithelial DLD-1 and monocytic Mono Mac 6 cells resveratrol decreased the expression of iNOS, IL-8 and TNF-α by reducing mRNA stability without inhibition of the promoter activity. Shown by pharmacological and siRNA-mediated inhibition, the observed effects are SIRT1-independent. Target-fishing and drug responsive target stability experiments showed selective binding of resveratrol to the RNA-binding protein KSRP, a central post-transcriptional regulator of pro-inflammatory gene expression. Knockdown of KSRP expression prevented resveratrol-induced mRNA destabilization in human and murine cells. Resveratrol did not change KSRP expression, but immunoprecipitation experiments indicated that resveratrol reduces the p38 MAPK-related inhibitory KSRP threonine phosphorylation, without blocking p38 MAPK activation or activity. Mutation of the p38 MAPK target site in KSRP blocked the resveratrol effect on pro-inflammatory gene expression. In addition, resveratrol incubation enhanced KSRP-exosome interaction, which is important for mRNA degradation. Finally, resveratrol incubation enhanced its intra-cellular binding to the IL-8, iNOS and TNF-α mRNA. Therefore, modulation of KSRP mRNA binding activity and, thereby, enhancement of mRNA degradation seems to be the common denominator of many anti-inflammatory effects of resveratrol. PMID:25352548

  5. Phorate-induced oxidative stress, DNA damage and transcriptional activation of p53 and caspase genes in male Wistar rats

    SciTech Connect

    Saquib, Quaiser; Attia, Sabry M.; Siddiqui, Maqsood A.; Aboul-Soud, Mourad A.M.; Al-Khedhairy, Abdulaziz A.; Giesy, John P.; Musarrat, Javed

    2012-02-15

    Male Wistar rats exposed to a systemic organophosphorus insecticide, phorate [O,O-diethyl S-[(ethylthio) methyl] phosphorothioate] at varying oral doses of 0.046, 0.092 or 0.184 mg phorate/kg bw for 14 days, exhibited substantial oxidative stress, cellular DNA damage and activation of apoptosis-related p53, caspase 3 and 9 genes. The histopathological changes including the pyknotic nuclei, inflammatory leukocyte infiltrations, renal necrosis, and cardiac myofiber degeneration were observed in the liver, kidney and heart tissues. Biochemical analysis of catalase and glutathione revealed significantly lesser activities of antioxidative enzymes and lipid peroxidation in tissues of phorate exposed rats. Furthermore, generation of intracellular reactive oxygen species and reduced mitochondrial membrane potential in bone marrow cells confirmed phorate-induced oxidative stress. Significant DNA damage was measured through comet assay in terms of the Olive tail moment in bone marrow cells of treated animals as compared to control. Cell cycle analysis also demonstrated the G{sub 2}/M arrest and appearance of a distinctive SubG{sub 1} peak, which signified induction of apoptosis. Up-regulation of tumor suppressor p53 and caspase 3 and 9 genes, determined by quantitative real-time PCR and enzyme-linked immunosorbent assay, elucidated the activation of intrinsic apoptotic pathways in response to cellular stress. Overall, the results suggest that phorate induces genetic alterations and cellular toxicity, which can adversely affect the normal cellular functioning in rats. -- Highlights: ► This is the first report on molecular toxicity of phorate in an in vivo test system. ► Phorate induces biochemical and histological changes in liver, kidney and heart. ► Rats treated with phorate exhibited DNA damage in bone marrow cells. ► Phorate induces apoptosis, oxidative stress and alters mitochondrial fluorescence. ► Phorate induces transcriptional changes and enhanced

  6. Site-specific gene targeting using transcription activator-like effector (TALE)-based nuclease in Brassica oleracea.

    PubMed

    Sun, Zijian; Li, Nianzu; Huang, Guodong; Xu, Junqiang; Pan, Yu; Wang, Zhimin; Tang, Qinglin; Song, Ming; Wang, Xiaojia

    2013-11-01

    Site-specific recognition modules with DNA nuclease have tremendous potential as molecular tools for genome targeting. The type III transcription activator-like effectors (TALEs) contain a DNA binding domain consisting of tandem repeats that can be engineered to bind user-defined specific DNA sequences. We demonstrated that customized TALE-based nucleases (TALENs), constructed using a method called "unit assembly", specifically target the endogenous FRIGIDA gene in Brassica oleracea L. var. capitata L. The results indicate that the TALENs bound to the target site and cleaved double-strand DNA in vitro and in vivo, whereas the effector binding elements have a 23 bp spacer. The T7 endonuclease I assay and sequencing data show that TALENs made double-strand breaks, which were repaired by a non-homologous end-joining pathway within the target sequence. These data show the feasibility of applying customized TALENs to target and modify the genome with deletions in those organisms that are still in lacking gene target methods to provide germplasms in breeding improvement. PMID:23870552

  7. Broad H3K4me3 is associated with increased transcription elongation and enhancer activity at tumor suppressor genes

    PubMed Central

    Chen, Kaifu; Chen, Zhong; Wu, Dayong; Zhang, Lili; Lin, Xueqiu; Su, Jianzhong; Rodriguez, Benjamin; Xi, Yuanxin; Xia, Zheng; Chen, Xi; Shi, Xiaobing; Wang, Qianben; Li, Wei

    2016-01-01

    Tumor suppressors are mostly defined by inactivating mutations in tumors, yet little is known about their epigenetic features in normal cells. Through integrative analysis of 1,134 genome-wide epigenetic profiles, mutations from >8,200 tumor-normal pairs, and our experimental data from clinical samples, we discovered broad H3K4me3 (wider than 4 kb) as the first epigenetic signature for tumor suppressors in normal cells. Broad H3K4me3 is associated with increased transcription elongation and enhancer activity together leading to exceptionally high gene expression, and is distinct from other broad epigenetic features, such as super-enhancers. Broad H3K4me3 conserved across normal cells may represent pan-cancer tumor suppressors, such as P53 and PTEN, whereas cell-type-specific broad H3K4me3 may indicate cell-identity genes and cell-type-specific tumor suppressors. Furthermore, widespread shortening of broad H3K4me3 in cancers is associated with repression of tumor suppressors. Together, the broad H3K4me3 epigenetic signature provides mutation-independent information for the discovery and characterization of novel tumor suppressors. PMID:26301496

  8. Tailor-Made Zinc-Finger Transcription Factors Activate FLO11 Gene Expression with Phenotypic Consequences in the Yeast Saccharomyces cerevisiae

    PubMed Central

    Shieh, Jia-Ching; Cheng, Yu-Che; Su, Mao-Chang; Moore, Michael; Choo, Yen; Klug, Aaron

    2007-01-01

    Cys2His2 zinc fingers are eukaryotic DNA-binding motifs, capable of distinguishing different DNA sequences, and are suitable for engineering artificial transcription factors. In this work, we used the budding yeast Saccharomyces cerevisiae to study the ability of tailor-made zinc finger proteins to activate the expression of the FLO11 gene, with phenotypic consequences. Two three-finger peptides were identified, recognizing sites from the 5′ UTR of the FLO11 gene with nanomolar DNA-binding affinity. The three-finger domains and their combined six-finger motif, recognizing an 18-bp site, were fused to the activation domain of VP16 or VP64. These transcription factor constructs retained their DNA-binding ability, with the six-finger ones being the highest in affinity. However, when expressed in haploid yeast cells, only one three-finger recombinant transcription factor was able to activate the expression of FLO11 efficiently. Unlike in the wild-type, cells with such transcriptional activation displayed invasive growth and biofilm formation, without any requirement for glucose depletion. The VP16 and VP64 domains appeared to act equally well in the activation of FLO11 expression, with comparable effects in phenotypic alteration. We conclude that the functional activity of tailor-made transcription factors in cells is not easily predicted by the in vitro DNA-binding activity. PMID:17710146

  9. Proto-oncogene FBI-1 (Pokemon) and SREBP-1 Synergistically Activate Transcription of Fatty-acid Synthase Gene (FASN)*S⃞

    PubMed Central

    Choi, Won-Il; Jeon, Bu-Nam; Park, Hyejin; Yoo, Jung-Yoon; Kim, Yeon-Sook; Koh, Dong-In; Kim, Myung-Hwa; Kim, Yu-Ri; Lee, Choong-Eun; Kim, Kyung-Sup; Osborne, Timothy F.; Hur, Man-Wook

    2008-01-01

    FBI-1 (Pokemon/ZBTB7A) is a proto-oncogenic transcription factor of the BTB/POZ (bric-à-brac, tramtrack, and broad complex and pox virus zinc finger) domain family. Recent evidence suggested that FBI-1 might be involved in adipogenic gene expression. Coincidentally, expression of FBI-1 and fatty-acid synthase (FASN) genes are often increased in cancer and immortalized cells. Both FBI-1 and FASN are important in cancer cell proliferation. SREBP-1 is a major regulator of many adipogenic genes, and FBI-1 and SREBP-1 (sterol-responsive element (SRE)-binding protein 1) interact with each other directly via their DNA binding domains. FBI-1 enhanced the transcriptional activation of SREBP-1 on responsive promoters, pGL2-6x(SRE)-Luc and FASN gene. FBI-1 and SREBP-1 synergistically activate transcription of the FASN gene by acting on the proximal GC-box and SRE/E-box. FBI-1, Sp1, and SREBP-1 can bind to all three SRE, GC-box, and SRE/E-box. Binding competition among the three transcription factors on the GC-box and SRE/E-box appears important in the transcription regulation. FBI-1 is apparently changing the binding pattern of Sp1 and SREBP-1 on the two elements in the presence of induced SREBP-1 and drives more Sp1 binding to the proximal promoter with less of an effect on SREBP-1 binding. The changes induced by FBI-1 appear critical in the synergistic transcription activation. The molecular mechanism revealed provides insight into how proto-oncogene FBI-1 may attack the cellular regulatory mechanism of FASN gene expression to provide more phospholipid membrane components needed for rapid cancer cell proliferation. PMID:18682402

  10. Transcript levels of antioxidative genes and oxygen radical scavenging enzyme activities in chilled zucchini squash in response to superatmospheric oxygen

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The transcript levels of antioxidative genes including Mn-superoxide dismutase (Mn-SOD), Cu/Zn SOD, ascorbate peroxidise (APX), and catalase (CAT) do not vary significantly during storage at 5 °C with high oxygen treatment in freshly harvested zucchini squash (Cucurbita pepo L. cv. Elite). However, ...

  11. Involvement of Sp1 and SREBP-1a in transcriptional activation of the LDL receptor gene by insulin and LH in cultured porcine granulosa-luteal cells.

    PubMed

    Sekar, Natesampillai; Veldhuis, Johannes D

    2004-07-01

    Luteinizing hormone (LH) and insulin stimulate transcriptional activity of the porcine low-density lipoprotein (LDL) receptor (LDLR) promoter supra-additively in primary cultures of granulosa-luteal cells. The mechanistic basis of this bihormonal interaction is unknown. The pig LDLR gene promoter includes three putative Sp1/Sp3-binding sites and one sterol response element (SRE) site 5' upstream to the transcriptional start site. To assess the role of SRE-binding protein (SREBP) in LDLR gene regulation, swine granulosa-luteal cells were cotransfected with CMV/SREBP-1a or SREBP-2 and the pLDLR1076/luc promoter. SREBP-1a and SREBP-2 stimulated LDLR gene transcription eight- and fourfold, respectively. LH alone augmented stimulation by SREBP-1 twofold. Conversely, cotransfection of a dominant-negative mutant form of SREBP-1a repressed basal and hormonally stimulated LDLR promoter activity by >80% (P < 0.01). Mutation of the SRE -167 ATCACCCCATG -157 to -167 ATCACCgCATG -157 bp decreased basal expression by 50% and LH + insulin- and LH + IGF-I-stimulated transcriptional activity by 80% and >90%, respectively (both P < 0.01). Mutations within each of the three flanking putative Sp1/Sp3 sites at -216/-211, -201/-196, and -151/-146 bp in the LDLR gene promoter also reduced basal activity (by >85%) and hormonal responsiveness (>95%, P < 0.05). EMSA confirmed that presumptive SRE-1 and Sp1/Sp3 elements bind respective peptides. Mithramycin, an inhibitor of Sp1/Sp3 protein(s) binding, blocked hormonally induced LDLR promoter expression by 80%. Basal transcription and supra-additive stimulation of porcine LDLR gene transcription by LH and insulin in granulosa-luteal cells require SREBP-1a and Sp1/Sp3-binding elements. PMID:14998783

  12. A library of synthetic transcription activator-like effector-activated promoters for coordinated orthogonal gene expression in plants

    PubMed Central

    Brückner, Kathleen; Schäfer, Petra; Weber, Ernst; Grützner, Ramona; Marillonnet, Sylvestre; Tissier, Alain

    2015-01-01

    A library of synthetic promoters containing the binding site of a single designer transcription activator-like effector (dTALE) was constructed. The promoters contain a constant sequence, consisting of an 18-base long dTALE-binding site and a TATA box, flanked by degenerate sequences of 49 bases downstream and 19 bases upstream. Forty-three of these promoters were sequenced and tested in transient assays in Nicotiana benthamiana using a GUS reporter gene. The strength of expression of the promoters ranged from around 5% to almost 100% of the viral 35S promoter activity. We then demonstrated the utility of these promoters for metabolic engineering by transiently expressing three genes for the production of a plant diterpenoid in N. benthamiana. The simplicity of the promoter structure shows great promise for the development of genetic circuits, with wide potential applications in plant synthetic biology and metabolic engineering. PMID:25846505

  13. DIFFERENTIAL TRANSCRIPTION FACTOR ACTIVATION AD GENE EXPRESSION PROFILES IN HUMAN VASCULAR ENDOTHELIAL CELLS ON EXPOSURE TO RESIDUAL OIL FLY ASH (ROFA) AND VANADIUM

    EPA Science Inventory


    Differential transcription factor activation and gene expression profiles in human vascular endothelial cells on exposure to residual oil fly ash (ROFA) and vanadium.
    Srikanth S. Nadadur and Daniel L. Costa, US EPA, ORD, NHEERL (ETD, Pulmonary Toxicology Branch), Research ...

  14. Indirubin, a component of Ban-Lan-Gen, activates CYP3A4 gene transcription through the human pregnane X receptor.

    PubMed

    Kumagai, Takeshi; Aratsu, Yusuke; Sugawara, Ryosuke; Sasaki, Takamitsu; Miyairi, Shinichi; Nagata, Kiyoshi

    2016-04-01

    Ban-Lan-Gen is the common name for the dried roots of indigo plants, including Polygonum tinctorium, Isatis indigotica, Isatis tinctoria, and Strobilanthes cusia. Ban-Lan-Gen is frequently used as an anti-inflammatory and an anti-viral for the treatment of hepatitis, influenza, and various types of inflammation. One of the cytochrome P450 (CYP) enzymes, CYP3A4, is responsible for the metabolism of a wide variety of xenobiotics, including an estimated 60% of all clinically used drugs. In this study, we investigated the effect of Ban-Lan-Gen on the transcriptional activation of the CYP3A4 gene. Ban-Lan-Gen extract increased CYP3A4 gene reporter activity in a dose-dependent manner. Indirubin, one of the biologically active ingredients in the Ban-Lan-Gen, also dose-dependently increased CYP3A4 gene reporter activity. Expression of short hairpin RNA for the human pregnane X receptor (hPXR-shRNA) inhibited CYP3A4 gene reporter activity, and overexpression of human PXR increased indirubin- and rifampicin-induced CYP3A4 gene reporter activity. Furthermore, indirubin induced CYP3A4 mRNA expression in HepG2 cells. Taken together, these results indicate that indirubin, a component of Ban-Lan-Gen, activated CYP3A4 gene transcription through the activation of the human PXR. PMID:26987505

  15. Transgenic tobacco plants expressing siRNA targeted against the Mungbean yellow mosaic virus transcriptional activator protein gene efficiently block the viral DNA accumulation.

    PubMed

    Shanmugapriya, Gnanasekaran; Das, Sudhanshu Sekhar; Veluthambi, Karuppannan

    2015-06-01

    Mungbean yellow mosaic virus (MYMV) is a bipartite begomovirus that infects many pulse crops such as blackgram, mungbean, mothbean, Frenchbean, and soybean. We tested the efficacy of the transgenically expressed intron-spliced hairpin RNA gene of the transcriptional activator protein (hpTrAP) in reducing MYMV DNA accumulation. Tobacco plants transformed with the MYMV hpTrAP gene accumulated 21-22 nt siRNA. Leaf discs of the transgenic plants, agroinoculated with the partial dimers of MYMV, displayed pronounced reduction in MYMV DNA accumulation. Thus, silencing of the TrAP gene, a suppressor of gene silencing, emerged as an effective strategy to control MYMV. PMID:26436122

  16. Stimulation of ribosomal RNA gene promoter by transcription factor Sp1 involves active DNA demethylation by Gadd45-NER pathway.

    PubMed

    Rajput, Pallavi; Pandey, Vijaya; Kumar, Vijay

    2016-08-01

    The well-studied Pol II transcription factor Sp1 has not been investigated for its regulatory role in rDNA transcription. Here, we show that Sp1 bound to specific sites on rDNA and localized into the nucleoli during the G1 phase of cell cycle to activate rDNA transcription. It facilitated the recruitment of Pol I pre-initiation complex and impeded the binding of nucleolar remodeling complex (NoRC) to rDNA resulting in the formation of euchromatin active state. More importantly, Sp1 also orchestrated the site-specific binding of Gadd45a-nucleotide excision repair (NER) complex resulting in active demethylation and transcriptional activation of rDNA. Interestingly, knockdown of Sp1 impaired rDNA transcription due to reduced engagement of the Gadd45a-NER complex and hypermethylation of rDNA. Thus, the present study unveils a novel role of Sp1 in rDNA transcription involving promoter demethylation. PMID:27156884

  17. Transcriptional analysis of human survivin gene expression.

    PubMed Central

    Li, F; Altieri, D C

    1999-01-01

    The preservation of tissue and organ homoeostasis depends on the regulated expression of genes controlling apoptosis (programmed cell death). In this study, we have investigated the basal transcriptional requirements of the survivin gene, an IAP (inhibitor of apoptosis) prominently up-regulated in cancer. Analysis of the 5' flanking region of the human survivin gene revealed the presence of a TATA-less promoter containing a canonical CpG island of approximately 250 nt, three cell cycle dependent elements, one cell cycle homology region and numerous Sp1 sites. PCR-based analysis of human genomic DNA, digested with methylation-sensitive and -insensitive restriction enzymes, indicated that the CpG island was unmethylated in both normal and neoplastic tissues. Primer extension and S1 nuclease mapping of the human survivin gene identified two main transcription start sites at position -72 and within -57/-61 from the initiating ATG. Transfection of cervical carcinoma HeLa cells with truncated or nested survivin promoter-luciferase constructs revealed the presence of both enhancer and repressor sequences and identified a minimal promoter region within the proximal -230 nt of the human survivin gene. Unbiased mutagenesis analysis of the human survivin promoter revealed that targeting the Sp1 sequences at position -171 and -151 abolished basal transcriptional activity by approximately 63-82%. Electrophoretic mobility-shift assay with DNA oligonucleotides confirmed formation of a DNA-protein complex between the survivin Sp1 sequences and HeLa cell extracts in a reaction abolished by mutagenesis of the survivin Sp1 sites. These findings identify the basal transcriptional requirements of survivin gene expression. PMID:10567210

  18. Blue light-mediated transcriptional activation and repression of gene expression in bacteria.

    PubMed

    Jayaraman, Premkumar; Devarajan, Kavya; Chua, Tze Kwang; Zhang, Hanzhong; Gunawan, Erry; Poh, Chueh Loo

    2016-08-19

    Light-regulated modules offer unprecedented new ways to control cellular behavior in precise spatial and temporal resolution. The availability of such tools may dramatically accelerate the progression of synthetic biology applications. Nonetheless, current optogenetic toolbox of prokaryotes has potential issues such as lack of rapid and switchable control, less portable, low dynamic expression and limited parts. To address these shortcomings, we have engineered a novel bidirectional promoter system for Escherichia coli that can be induced or repressed rapidly and reversibly using the blue light dependent DNA-binding protein EL222. We demonstrated that by modulating the dosage of light pulses or intensity we could control the level of gene expression precisely. We show that both light-inducible and repressible system can function in parallel with high spatial precision in a single cell and can be switched stably between ON- and OFF-states by repetitive pulses of blue light. In addition, the light-inducible and repressible expression kinetics were quantitatively analysed using a mathematical model. We further apply the system, for the first time, to optogenetically synchronize two receiver cells performing different logic behaviors over time using blue light as a molecular clock signal. Overall, our modular approach layers a transformative platform for next-generation light-controllable synthetic biology systems in prokaryotes. PMID:27353329

  19. Promoter of CaZF, a Chickpea Gene That Positively Regulates Growth and Stress Tolerance, Is Activated by an AP2-Family Transcription Factor CAP2

    PubMed Central

    Jain, Deepti; Chattopadhyay, Debasis

    2013-01-01

    Plants respond to different forms of stresses by inducing transcription of a common and distinct set of genes by concerted actions of a cascade of transcription regulators. We previously reported that a gene, CaZF encoding a C2H2-zinc finger family protein from chickpea (Cicer arietinum) imparted high salinity tolerance when expressed in tobacco plants. We report here that in addition to promoting tolerance against dehydration, salinity and high temperature, the CaZF overexpressing plants exhibited similar phenotype of growth and development like the plants overexpressing CAP2, encoding an AP2-family transcription factor from chickpea. To investigate any relationship between these two genes, we performed gene expression analysis in the overexpressing plants, promoter-reporter analysis and chromatin immunoprecipitation. A number of transcripts that exhibited enhanced accumulation upon expression of CAP2 or CaZF in tobacco plants were found common. Transient expression of CAP2 in chickpea leaves resulted in increased accumulation of CaZF transcript. Gel mobility shift and transient promoter-reporter assays suggested that CAP2 activates CaZF promoter by interacting with C-repeat elements (CRTs) in CaZF promoter. Chromatin immunoprecipitation (ChIP) assay demonstrated an in vivo interaction of CAP2 protein with CaZF promoter. PMID:23418595

  20. Genomic organization of the mouse peroxisome proliferator-activated receptor beta/delta gene: alternative promoter usage and splicing yield transcripts exhibiting differential translational efficiency.

    PubMed Central

    Larsen, Leif K; Amri, Ez-Zoubir; Mandrup, Susanne; Pacot, Corinne; Kristiansen, Karsten

    2002-01-01

    Peroxisome proliferator-activated receptor (PPAR) beta/delta is ubiquitously expressed, but the level of expression differs markedly between different cell types. In order to determine the molecular mechanisms governing PPARbeta/delta gene expression, we have isolated and characterized the mouse gene encoding PPARbeta/delta. The gene spans approx. 41 kb and comprises 11 exons of which the six exons located in the 3'-end of the gene are included in all transcripts. Primer-extension and 5'-rapid amplification of cDNA ends experiments revealed the presence of multiple transcription start points and splice variants, originating from the use of at least four different promoters. One of these transcription start points was found to be used predominantly in all tissues examined. Initiation from this major transcription start point gives rise to a transcript with a 548 nt 5'-untranslated leader containing eight upstream AUG codons. We show that the presence of the 548 nt leader resulted in a low translational efficiency of the corresponding PPARbeta/delta mRNA and propose, based on structural features of the 5'-untranslated region, that translational initiation may be mediated via an internal ribosome entry site-dependent mechanism. PMID:12059785

  1. Temporal Dissection of Rate Limiting Transcriptional Events Using Pol II ChIP and RNA Analysis of Adrenergic Stress Gene Activation

    PubMed Central

    Morris, Daniel P.; Lei, Beilei; Longo, Lawrence D.; Bomsztyk, Karol; Schwinn, Debra A.; Michelotti, Gregory A.

    2015-01-01

    In mammals, increasing evidence supports mechanisms of co-transcriptional gene regulation and the generality of genetic control subsequent to RNA polymerase II (Pol II) recruitment. In this report, we use Pol II Chromatin Immunoprecipitation to investigate relationships between the mechanistic events controlling immediate early gene (IEG) activation following stimulation of the α1a-Adrenergic Receptor expressed in rat-1 fibroblasts. We validate our Pol II ChIP assay by comparison to major transcriptional events assessable by microarray and PCR analysis of precursor and mature mRNA. Temporal analysis of Pol II density suggests that reduced proximal pausing often enhances gene expression and was essential for Nr4a3 expression. Nevertheless, for Nr4a3 and several other genes, proximal pausing delayed the time required for initiation of productive elongation, consistent with a role in ensuring transcriptional fidelity. Arrival of Pol II at the 3’ cleavage site usually correlated with increased polyadenylated mRNA; however, for Nfil3 and probably Gprc5a expression was delayed and accompanied by apparent pre-mRNA degradation. Intragenic pausing not associated with polyadenylation was also found to regulate and delay Gprc5a expression. Temporal analysis of Nr4a3, Dusp5 and Nfil3 shows that transcription of native IEG genes can proceed at velocities of 3.5 to 4 kilobases/min immediately after activation. Of note, all of the genes studied here also used increased Pol II recruitment as an important regulator of expression. Nevertheless, the generality of co-transcriptional regulation during IEG activation suggests temporal and integrated analysis will often be necessary to distinguish causative from potential rate limiting mechanisms. PMID:26244980

  2. A Model for Aryl Hydrocarbon Receptor-Activated Gene Expression Shows Potency and Efficacy Changes and Predicts Squelching Due to Competition for Transcription Co-Activators

    PubMed Central

    Simon, Ted W.; Budinsky, Robert A.; Rowlands, J. Craig

    2015-01-01

    A stochastic model of nuclear receptor-mediated transcription was developed based on activation of the aryl hydrocarbon receptor (AHR) by 2,3,7,8-tetrachlorodibenzodioxin (TCDD) and subsequent binding the activated AHR to xenobiotic response elements (XREs) on DNA. The model was based on effects observed in cells lines commonly used as in vitro experimental systems. Following ligand binding, the AHR moves into the cell nucleus and forms a heterodimer with the aryl hydrocarbon nuclear translocator (ARNT). In the model, a requirement for binding to DNA is that a generic coregulatory protein is subsequently bound to the AHR-ARNT dimer. Varying the amount of coregulator available within the nucleus altered both the potency and efficacy of TCDD for inducing for transcription of CYP1A1 mRNA, a commonly used marker for activation of the AHR. Lowering the amount of available cofactor slightly increased the EC50 for the transcriptional response without changing the efficacy or maximal response. Further reduction in the amount of cofactor reduced the efficacy and produced non-monotonic dose-response curves (NMDRCs) at higher ligand concentrations. The shapes of these NMDRCs were reminiscent of the phenomenon of squelching. Resource limitations for transcriptional machinery are becoming apparent in eukaryotic cells. Within single cells, nuclear receptor-mediated gene expression appears to be a stochastic process; however, intercellular communication and other aspects of tissue coordination may represent a compensatory process to maintain an organism’s ability to respond on a phenotypic level to various stimuli within an inconstant environment. PMID:26039703

  3. ACE1, a copper-dependent transcription factor, activates expression of the yeast copper, zinc superoxide dismutase gene.

    PubMed Central

    Gralla, E B; Thiele, D J; Silar, P; Valentine, J S

    1991-01-01

    Copper, zinc superoxide dismutase (SOD1 gene product) (superoxide:superoxide oxidoreductase, EC 1.15.1.1) is a copper-containing enzyme that functions to prevent oxygen toxicity. In the yeast Saccharomyces cerevisiae, copper levels exert some control over the level of SOD1 expression. We show that the ACE1 transcriptional activator protein, which is responsible for the induction of yeast metallothionein (CUP1) in response to copper, also controls the SOD1 response to copper. A single binding site for ACE1 is present in the SOD1 promoter region, as demonstrated by DNase I protection and methylation interference experiments, and is highly homologous to a high-affinity ACE1 binding site in the CUP1 promoter. The functional importance of this DNA-protein interaction is demonstrated by the facts that (i) copper induction of SOD1 mRNA does not occur in a strain lacking ACE1 and (ii) it does not occur in a strain containing a genetically engineered SOD1 promoter that lacks a functional ACE1 binding site. Images PMID:1924315

  4. Transcriptional regulation of receptor-like protein genes by environmental stresses and hormones and their overexpression activities in Arabidopsis thaliana.

    PubMed

    Wu, Jinbin; Liu, Zhijun; Zhang, Zhao; Lv, Yanting; Yang, Nan; Zhang, Guohua; Wu, Menyao; Lv, Shuo; Pan, Lixia; Joosten, Matthieu H A J; Wang, Guodong

    2016-05-01

    Receptor-like proteins (RLPs) have been implicated in multiple biological processes, including plant development and immunity to microbial infection. Fifty-seven AtRLP genes have been identified in Arabidopsis, whereas only a few have been functionally characterized. This is due to the lack of suitable physiological screening conditions and the high degree of functional redundancy among AtRLP genes. To overcome the functional redundancy and further understand the role of AtRLP genes, we studied the evolution of AtRLP genes and compiled a comprehensive profile of the transcriptional regulation of AtRLP genes upon exposure to a range of environmental stresses and different hormones. These results indicate that the majority of AtRLP genes are differentially expressed under various conditions that were tested, an observation that will help to select certain AtRLP genes involved in a specific biological process for further experimental studies to eventually dissect their function. A large number of AtRLP genes were found to respond to more than one treatment, suggesting that one single AtRLP gene may be involved in multiple physiological processes. In addition, we performed a genome-wide cloning of the AtRLP genes, and generated and characterized transgenic Arabidopsis plants overexpressing the individual AtRLP genes, presenting new insight into the roles of AtRLP genes, as exemplified by AtRLP3, AtRLP11 and AtRLP28 Our study provides an overview of biological processes in which AtRLP genes may be involved, and presents valuable resources for future investigations into the function of these genes. PMID:27099374

  5. Transcriptional regulation of receptor-like protein genes by environmental stresses and hormones and their overexpression activities in Arabidopsis thaliana

    PubMed Central

    Wu, Jinbin; Liu, Zhijun; Zhang, Zhao; Lv, Yanting; Yang, Nan; Zhang, Guohua; Wu, Menyao; Lv, Shuo; Pan, Lixia; Joosten, Matthieu H. A. J.; Wang, Guodong

    2016-01-01

    Receptor-like proteins (RLPs) have been implicated in multiple biological processes, including plant development and immunity to microbial infection. Fifty-seven AtRLP genes have been identified in Arabidopsis, whereas only a few have been functionally characterized. This is due to the lack of suitable physiological screening conditions and the high degree of functional redundancy among AtRLP genes. To overcome the functional redundancy and further understand the role of AtRLP genes, we studied the evolution of AtRLP genes and compiled a comprehensive profile of the transcriptional regulation of AtRLP genes upon exposure to a range of environmental stresses and different hormones. These results indicate that the majority of AtRLP genes are differentially expressed under various conditions that were tested, an observation that will help to select certain AtRLP genes involved in a specific biological process for further experimental studies to eventually dissect their function. A large number of AtRLP genes were found to respond to more than one treatment, suggesting that one single AtRLP gene may be involved in multiple physiological processes. In addition, we performed a genome-wide cloning of the AtRLP genes, and generated and characterized transgenic Arabidopsis plants overexpressing the individual AtRLP genes, presenting new insight into the roles of AtRLP genes, as exemplified by AtRLP3, AtRLP11 and AtRLP28. Our study provides an overview of biological processes in which AtRLP genes may be involved, and presents valuable resources for future investigations into the function of these genes. PMID:27099374

  6. The Papaya Transcription Factor CpNAC1 Modulates Carotenoid Biosynthesis through Activating Phytoene Desaturase Genes CpPDS2/4 during Fruit Ripening.

    PubMed

    Fu, Chang-Chun; Han, Yan-Chao; Fan, Zhong-Qi; Chen, Jian-Ye; Chen, Wei-Xin; Lu, Wang-Jin; Kuang, Jian-Fei

    2016-07-13

    Papaya fruits accumulate carotenoids during fruit ripening. Although many papaya carotenoid biosynthesis pathway genes have been identified, the transcriptional regulators of these genes have not been characterized. In this study, a NAC transcription factor, designated as CpNAC1, was characterized from papaya fruit. CpNAC1 was localized exclusively in nucleus and possessed transcriptional activation activity. Expression of carotenoid biosynthesis genes phytoene desaturases (CpPDSs) and CpNAC1 was increased during fruit ripening and by propylene treatment, which correlates well with the elevated carotenoid content in papaya. The gel mobility shift assays and transient expression analyses demonstrated that CpNAC1 directly binds to the NAC binding site (NACBS) motifs in CpPDS2/4 promoters and activates them. Collectively, these data suggest that CpNAC1 may act as a positive regulator of carotenoid biosynthesis during papaya fruit ripening possibly via transcriptional activation of CpPDSs such as CpPDS2/4. PMID:27327494

  7. An ortholog of farA of Aspergillus nidulans is implicated in the transcriptional activation of genes involved in fatty acid utilization in the yeast Yarrowia lipolytica

    SciTech Connect

    Poopanitpan, Napapol; Kobayashi, Satoshi; Fukuda, Ryouichi; Horiuchi, Hiroyuki; Ohta, Akinori

    2010-11-26

    Research highlights: {yields} POR1 is a Yarrowia lipolytica ortholog of farA involved in fatty acid response in A. nidulans. {yields} Deletion of POR1 caused growth defects on fatty acids. {yields} {Delta}por1 strain exhibited defects in the induction of genes involved in fatty acid utilization. -- Abstract: The yeast Yarrowia lipolytica effectively utilizes hydrophobic substrates such as fatty acids and n-alkanes. To identify a gene(s) regulating fatty acid utilization in Y. lipolytica, we first studied homologous genes to OAF1 and PIP2 of Saccharomyces cerevisiae, but their disruption did not change growth on oleic acid at all. We next characterized a Y. lipolytica gene, POR1 (primary oleate regulator 1), an ortholog of farA encoding a transcriptional activator that regulates fatty acid utilization in Aspergillus nidulans. The deletion mutant of POR1 was defective in the growth on various fatty acids, but not on glucose, glycerol, or n-hexadecane. It exhibited slight defect on n-decane. The transcriptional induction of genes involved in {beta}-oxidation and peroxisome proliferation by oleate was distinctly diminished in the {Delta}por1 strains. These data suggest that POR1 encodes a transcriptional activator widely regulating fatty acid metabolism in Y. lipolytica.

  8. The Roles of the Catalytic and Noncatalytic Activities of Rpd3L and Rpd3S in the Regulation of Gene Transcription in Yeast

    PubMed Central

    Yeheskely-Hayon, Daniella; Kotler, Anat; Stark, Michal; Hashimshony, Tamar; Sagee, Shira; Kassir, Yona

    2013-01-01

    In budding yeasts, the histone deacetylase Rpd3 resides in two different complexes called Rpd3L (large) and Rpd3S (small) that exert opposing effects on the transcription of meiosis-specific genes. By introducing mutations that disrupt the integrity and function of either Rpd3L or Rpd3S, we show here that Rpd3 function is determined by its association with either of these complexes. Specifically, the catalytic activity of Rpd3S activates the transcription of the two major positive regulators of meiosis, IME1 and IME2, under all growth conditions and activates the transcription of NDT80 only during vegetative growth. In contrast, the effects of Rpd3L depends on nutrients; it represses or activates transcription in the presence or absence of a nitrogen source, respectively. Further, we show that transcriptional activation does not correlate with histone H4 deacetylation, suggesting an effect on a nonhistone protein. Comparison of rpd3-null and catalytic-site point mutants revealed an inhibitory activity that is independent of either the catalytic activity of Rpd3 or the integrity of Rpd3L and Rpd3S. PMID:24358376

  9. The roles of the catalytic and noncatalytic activities of Rpd3L and Rpd3S in the regulation of gene transcription in yeast.

    PubMed

    Yeheskely-Hayon, Daniella; Kotler, Anat; Stark, Michal; Hashimshony, Tamar; Sagee, Shira; Kassir, Yona

    2013-01-01

    In budding yeasts, the histone deacetylase Rpd3 resides in two different complexes called Rpd3L (large) and Rpd3S (small) that exert opposing effects on the transcription of meiosis-specific genes. By introducing mutations that disrupt the integrity and function of either Rpd3L or Rpd3S, we show here that Rpd3 function is determined by its association with either of these complexes. Specifically, the catalytic activity of Rpd3S activates the transcription of the two major positive regulators of meiosis, IME1 and IME2, under all growth conditions and activates the transcription of NDT80 only during vegetative growth. In contrast, the effects of Rpd3L depends on nutrients; it represses or activates transcription in the presence or absence of a nitrogen source, respectively. Further, we show that transcriptional activation does not correlate with histone H4 deacetylation, suggesting an effect on a nonhistone protein. Comparison of rpd3-null and catalytic-site point mutants revealed an inhibitory activity that is independent of either the catalytic activity of Rpd3 or the integrity of Rpd3L and Rpd3S. PMID:24358376

  10. Exogenous calcium induces tolerance to atrazine stress in Pennisetum seedlings and promotes photosynthetic activity, antioxidant enzymes and psbA gene transcripts.

    PubMed

    Erinle, Kehinde Olajide; Jiang, Zhao; Ma, Bingbing; Li, Jinmei; Chen, Yukun; Ur-Rehman, Khalil; Shahla, Andleeb; Zhang, Ying

    2016-10-01

    Calcium (Ca) has been reported to lessen oxidative damages in plants by upregulating the activities of antioxidant enzymes. However, atrazine mediated reactive oxygen species (ROS) reduction by Ca is limited. This study therefore investigated the effect of exogenously applied Ca on ROS, antioxidants activity and gene transcripts, the D1 protein (psbA gene), and chlorophyll contents in Pennisetum seedlings pre-treated with atrazine. Atrazine toxicity increased ROS production and enzyme activities (ascorbate peroxidase APX, peroxidase POD, Superoxide dismutase SOD, glutathione-S-transferase GST); but decreased antioxidants (APX, POD, and Cu/Zn SOD) and psbA gene transcripts. Atrazine also decreased the chlorophyll contents, but increased chlorophyll (a/b) ratio. Contrarily, Ca application to atrazine pre-treated seedlings lowered the harmful effects of atrazine by reducing ROS levels, but enhancing the accumulation of total chlorophyll contents. Ca-protected seedlings in the presence of atrazine manifested reduced APX and POD activity, whereas SOD and GST activity was further increased with Ca application. Antioxidant gene transcripts that were down-regulated by atrazine toxicity were up-regulated with the application of Ca. Calcium application also resulted in up-regulation of the D1 protein. In conclusion, ability of calcium to reverse atrazine-induced oxidative damage and calcium regulatory role on GST in Pennisetum was presented. PMID:27391035

  11. A fusion promoter created by a new insertion sequence, IS1490, activates transcription of 2,4,5-trichlorophenoxyacetic acid catabolic genes in Burkholderia cepacia AC1100.

    PubMed Central

    Hübner, A; Hendrickson, W

    1997-01-01

    Transposition and transcriptional activation by insertion sequences in Burkholderia cepacia AC1100 were investigated. Two closely related new elements, IS1413 and IS1490, were identified and characterized. These elements are not highly related to other insertion sequences identified in AC1100 or other B. cepacia isolates. Based on their structures and the sequences of the inverted terminal repeats and the putative transposase protein, the insertion elements (IS elements) are similar to IST2 of Thiobacillus ferrooxidans and several related elements. All the IS elements that have been identified in this strain are found in multiple copies (10 to 40), and they have high-level promoter activity capable of stimulating transcription from a distance up to 500 bp from a target gene. Strain AC1100 was originally isolated after prolonged selection for the ability to utilize the herbicide 2,4,5-trichlorophenoxyacetic acid (2,4,5-T) as a sole carbon source. Three IS elements are located near the first gene of the 2,4,5-T catabolic pathway, tftA. IS1490 inserted 110 bp upstream of tftA and created a fusion promoter responsible for constitutive transcription of the gene. Our results confirm the hypothesis that IS elements play a central role in transcription of 2,4,5-T genes and likely have stimulated rapid evolution of the metabolic pathway. PMID:9098071

  12. E sub 1 BF is an essential RNA polymerase I transcription factor with an intrinsic protein kinase activity that can modulate rRNA gene transcription

    SciTech Connect

    Ji Zhang; Huifeng Niu; Jacob, S.T. )

    1991-10-01

    The authors previously described the purification and characterization of E{sub 1}BF, a rat rRNA gene core promoter-binding factor that consists of two polypeptides of 89 and 79 kDa. When this factor was incubated in the absence of any exogenous protein kinase under conditions optimal for protein phosphorylation, the 79-kDa polypeptide of E{sub 1}BF was selectively phosphorylated. The labeled phosphate could be removed from the E{sub 1}BF polypeptide by treatment with calf intestinal alkaline phosphatase or potato acid phosphatase. Elution of the protein from the E{sub 1}BF-promoter complex formed in an electrophoretic mobility-shift assay followed by incubation of the concentrated eluent with ({gamma}-{sup 32}P)ATP resulted in the selective labeling o the 79-kDa band. The E{sub 1}BF-associated protein kinase did not phosphorylate casein or histone H1. These data demonstrate that (1) polymerase I promoter-binding factor E{sub 1}BF contains an intrinsic substrate-specific protein kinase and (2) E{sub 1}BF is an essential polymerase I transcription factor that can modulate rRNA gene transcription by protein phosphorylation. Further, these studies have provided a direct means to identify a protein kinase or any other enzyme that can interact with a specific DNA sequence.

  13. Activation of transcription factor AP-2 mediates UVA radiation- and singlet oxygen-induced expression of the human intercellular adhesion molecule 1 gene

    SciTech Connect

    Grether-Beck, S.; Olaizola-Horn, S.; Schmitt, H.; Grewe, M.

    1996-12-10

    UVA radiation is the major component of the UV solar spectrum that reaches the earth, and the therapeutic application of UVA radiation is increasing in medicine. Analysis of the cellular effects of UVA radiation has revealed that exposure of human cells to UVA radiation at physiological doses leads to increased gene expression and that this UVA response is primarily mediated through the generation of singlet oxygen. In this study, the mechanisms by which UVA radiation induces transcriptional activation of the human intercellular adhesion molecule 1 (ICAM-1) were examined. UVA radiation was capable of inducing activation of the human ICAM-1 promoter and increasing OCAM-1 mRNA and protein expression. These UVA radiation effects were inhibited by singlet oxygen quenchers, augmented by enhancement of singlet oxygen life-time, and mimicked in unirradiated cells by a singlet oxygen-generating system. UVA radiation as well as singlet oxygen-induced ICAM-1 promoter activation required activation of the transcription factor AP-2. Accordingly, both stimuli activated AP-2, and deletion of the putative AP-2-binding site abrogated ICAM-1 promoter activation in this system. This study identified the AP-2 site as the UVA radiation- and singlet oxygen-responsive element of the human ICAM-1 gene. The capacity of UVA radiation and/or singlet oxygen to induce human gene expression through activation of AP-2 indicates a previously unrecognized role of this transcription factor in the mammalian stress response. 38 refs., 3 figs., 3 tabs.

  14. A factor that positively regulates cell division by activating transcription of the major cluster of essential cell division genes of Escherichia coli.

    PubMed Central

    Wang, X D; de Boer, P A; Rothfield, L I

    1991-01-01

    Cell division in Escherichia coli requires the products of the ftsQ, ftsA and ftsZ genes. It is not known how the cell regulates the cellular concentrations of these essential elements of the division system. We describe here a factor that activates cell division by specifically increasing transcription from one of the two promoters that lie immediately upstream of the ftsQAZ gene cluster. The trans-acting factor is the product of the sdiA gene, which was isolated on the basis of its ability to suppress the division inhibitory effect of the MinC/MinD division inhibitor. In addition, the sdiA gene product suppressed the action of other chromosomally encoded division inhibitors, induced minicell formation in wild type cells, and restored division activity to an ftsZ temperature-sensitive mutant grown under nonpermissive conditions. All of these properties were explained by the ability of the sdiA gene product specifically to increase transcription of the ftsQAZ gene cluster, resulting in an increase in cellular concentration of the FtsZ protein. The sdiA gene product is the first factor thus far identified that specifically regulates expression of this key group of cell division genes. Images PMID:1915297

  15. Identification of InuR, a new Zn(II)2Cys6 transcriptional activator involved in the regulation of inulinolytic genes in Aspergillus niger.

    PubMed

    Yuan, Xiao-Lian; Roubos, Johannes A; van den Hondel, Cees A M J J; Ram, Arthur F J

    2008-01-01

    The expression of inulinolytic genes in Aspergillus niger is co-regulated and induced by inulin and sucrose. We have identified a positive acting transcription factor InuR, which is required for the induced expression of inulinolytic genes. InuR is a member of the fungal specific class of transcription factors of the Zn(II)2Cys6 type. Involvement of InuR in inulin and sucrose metabolism was suspected because of the clustering of inuR gene with sucB, which encodes an intracellular invertase with transfructosylation activity and a putative sugar transporter encoding gene (An15g00310). Deletion of the inuR gene resulted in a strain displaying a severe reduction in growth on inulin and sucrose medium. Northern analysis revealed that expression of inulinolytic and sucrolytic genes, e.g., inuE, inuA, sucA, as well as the putative sugar transporter gene (An15g00310) is dependent on InuR. Genome-wide expression analysis revealed, three additional putative sugar transporters encoding genes (An15g04060, An15g03940 and An17g01710), which were strongly induced by sucrose in an InuR dependent way. In silico analysis of the promoter sequences of strongly InuR regulated genes suggests that InuR might bind as dimer to two CGG triplets, which are separated by eight nucleotides. PMID:17917744

  16. Transcriptional regulation of tenascin genes

    PubMed Central

    Chiovaro, Francesca; Chiquet-Ehrismann, Ruth; Chiquet, Matthias

    2015-01-01

    Extracellular matrix proteins of the tenascin family resemble each other in their domain structure, and also share functions in modulating cell adhesion and cellular responses to growth factors. Despite these common features, the 4 vertebrate tenascins exhibit vastly different expression patterns. Tenascin-R is specific to the central nervous system. Tenascin-C is an “oncofetal” protein controlled by many stimuli (growth factors, cytokines, mechanical stress), but with restricted occurrence in space and time. In contrast, tenascin-X is a constituitive component of connective tissues, and its level is barely affected by external factors. Finally, the expression of tenascin-W is similar to that of tenascin-C but even more limited. In accordance with their highly regulated expression, the promoters of the tenascin-C and -W genes contain TATA boxes, whereas those of the other 2 tenascins do not. This article summarizes what is currently known about the complex transcriptional regulation of the 4 tenascin genes in development and disease. PMID:25793574

  17. Transcriptional regulation of tenascin genes.

    PubMed

    Chiovaro, Francesca; Chiquet-Ehrismann, Ruth; Chiquet, Matthias

    2015-01-01

    Extracellular matrix proteins of the tenascin family resemble each other in their domain structure, and also share functions in modulating cell adhesion and cellular responses to growth factors. Despite these common features, the 4 vertebrate tenascins exhibit vastly different expression patterns. Tenascin-R is specific to the central nervous system. Tenascin-C is an "oncofetal" protein controlled by many stimuli (growth factors, cytokines, mechanical stress), but with restricted occurrence in space and time. In contrast, tenascin-X is a constituitive component of connective tissues, and its level is barely affected by external factors. Finally, the expression of tenascin-W is similar to that of tenascin-C but even more limited. In accordance with their highly regulated expression, the promoters of the tenascin-C and -W genes contain TATA boxes, whereas those of the other 2 tenascins do not. This article summarizes what is currently known about the complex transcriptional regulation of the 4 tenascin genes in development and disease. PMID:25793574

  18. Docosahexaenoic acid consumption inhibits deoxynivalenol-induced CREB/ATF1 activation and IL-6 gene transcription in mouse macrophages.

    PubMed

    Jia, Qunshan; Zhou, Hui-Ren; Shi, Yuhui; Pestka, James J

    2006-02-01

    The mycotoxin deoxynivalenol (DON) induces IgA nephropathy in mice by upregulating IL-6 expression, which is suppressed by (n-3) PUFA consumption. The purpose of this study was to test the hypothesis that consumption of the (n-3) PUFA docosahexaenoic acid (DHA) interferes with DON-induced transcriptional and post-transcriptional upregulation of IL-6 mRNA in murine macrophages. DON evoked expression of IL-6 mRNA and IL-6 heterogenous nuclear RNA (hnRNA), an indicator of ongoing IL-6 transcription, in macrophages elicited from mice fed control AIN-93G diet for 4 wk, whereas expression of both RNA species was suppressed in macrophages from mice fed AIN-93G modified to contain 30 g DHA/kg diet for the same time period. DON enhanced IL-6 mRNA stability similarly in macrophages from control and DHA-fed mice suggesting that (n-3) PUFA effects were not post-transcriptional. DON upregulated binding activity of cAMP response element binding protein (CREB) and activator protein (AP-1) to their respective consensus sequences in nuclear extracts from control-fed mice, whereas both activities were suppressed in nuclear extracts from DHA-fed mice. DON induced phosphorylation of CREB at Ser-133 and ATF1 at Ser-63 as well as intranuclear binding of phospho-CREB/ATF1 to the cis element of the IL-6 promoter in control macrophages, whereas both activities were inhibited in macrophages from DHA-fed mice. DHA consumption blocked DON-induced phosphorylation of the CREB kinase AKT. Inhibition of AKT suppressed both CREB/ATF1 phosphorylation and IL-6 transcription. These data suggest that DHA consumption suppresses DON-induced IL-6 transcription in macrophages in part by interfering with AKT-dependent phosphorylation and subsequent binding of CREB/ATF1 to the IL-6 promoter. PMID:16424113

  19. Krüppel-like Factor 6 Is a Co-activator of NF-κB That Mediates p65-dependent Transcription of Selected Downstream Genes*

    PubMed Central

    Zhang, Yu; Lei, Cao-Qi; Hu, Yun-Hong; Xia, Tian; Li, Mi; Zhong, Bo; Shu, Hong-Bing

    2014-01-01

    The transcription factor NF-κB plays a pivotal role in a broad range of physiological and pathological processes, including development, inflammation, and immunity. How NF-κB integrates activating signals to expression of specific sets of target genes is of great interest. Here, we identified Krüppel-like factor 6 (KLF6) as a co-activator of NF-κB after TNFα and IL-1β stimulation. Overexpression of KLF6 enhanced TNFα- and IL-1β-induced activation of NF-κB and transcription of a subset of downstream genes, whereas knockdown of KLF6 had opposite effects. KLF6 interacted with p65 in the nucleus and bound to the promoters of target genes. Upon IL-1β stimulation, KLF6 was recruited to promoters of a subset of NF-κB target genes in a p65-dependent manner, which was in turn required for the optimal binding of p65 to the target gene promoters. Our findings thus identified KLF6 as a previously unknown but essential co-activator of NF-κB and provided new insight into the molecular regulation of p65-dependent gene expression. PMID:24634218

  20. RNA Activation of the Vascular Endothelial Growth Factor Gene (VEGF) Promoter by Double-Stranded RNA and Hypoxia: Role of Noncoding VEGF Promoter Transcripts.

    PubMed

    Lopez, Pascal; Wagner, Kay-Dietrich; Hofman, Paul; Van Obberghen, Emmanuel

    2016-05-15

    RNA activation (RNAa) is a gene regulation process in which promoter-targeted short double-stranded RNAs (dsRNAs) or microRNAs (miRs) induce target gene expression at the transcriptional level. Here, we investigate the presence of cryptic promoter transcripts within the VEGF promoter. Single-strand sense and antisense noncoding vascular endothelial growth factor (NcVEGF) promoter transcripts are identified, and their respective expression is studied in cells transfected with a VEGF promoter targeted dsRNA, namely, dsVEGF706, in hypoxic cells and in human malignant lung tissues. Interestingly, in dsVEGF706-transfected, as well as in hypoxic cells, NcVEGF expression levels increase coordinately with coding VEGF expression. Ago2 interaction with both sense and antisense NcVEGFs is increased in hypoxic cells, whereas in dsVEGF706-transfected cells, Ago2 and the antisense strand of the dsRNA interact specifically with the sense NcVEGF transcript. Furthermore, both dsVEGF706 and ectopic NcVEGF transcripts are able to activate the VEGF promoter endogenously present or in a reporter construct. Finally, using small interfering RNA targeting Ago2, we show that RNAa plays a role in the maintenance of increased VEGF and NcVEGF expression after hypoxia. Given the central role of VEGF in major human diseases, including cancer, this novel molecular mechanism is poised to reveal promising possibilities for therapeutic interventions. PMID:26976645

  1. Role of Calcineurin, hnRNPA2 and Akt in Mitochondrial Respiratory Stress-Mediated Transcription Activation of Nuclear Gene Targets

    PubMed Central

    Guha, Manti; Tang, Weigang; Sondheimer, Neal; Avadhani, Narayan G.

    2010-01-01

    Pathophysiological conditions causing mitochondrial dysfunction and altered transmembrane potential (Δψm) initiate a mitochondrial respiratory stress response, also known as mitochondrial retrograde response, in a variety of mammalian cells. An increase in the cytosolic Ca2+ [Ca2+]c as part of this signaling cascade activates Ca2+ responsive phosphatase, Calcineurin (Cn). Activation of IGF1R accompanied by increased glycolysis, invasiveness, and resistance to apoptosis are phenotypic hallmarks of C2C12 rhabdomyoblast cells subjected to this stress. The signaling is associated with activation and increased nuclear translocation of a number of transcription factors including a novel NFκB (cRel: p50) pathway, NFAT, CREB and C/EBPδ. This culminates in the upregulation of a number of nuclear genes including Cathepsin L, RyR1, Glut4 and Akt1. We observed that stress regulated transcription activation of nuclear genes involves a cooperative interplay between NFκB (cRel:p50), C/EBPδ, CREB, NFAT. Our results show that the functional synergy of these factors requires the stress-activated heterogeneous nuclear ribonucleoprotein, hnRNPA2 as a transcriptional co-activator. We report here that mitochondrial stress leads to induced expression and activation of serine threonine kinase Akt1. Interestingly, we observe that Akt1 phosphorylates hnRNPA2 under mitochondrial stress conditions, which is a crucial step for the recruitment of this coactivator to the stress target promoters and culmination in mitochondrial stress-mediated transcription activation of target genes. We propose that mitochondrial stress plays an important role in tumor progression and emergence of invasive phenotypes. PMID:20153290

  2. The Rel/NF-κB pathway and transcription of immediate early genes in T cell activation are inhibited by microgravity

    PubMed Central

    Chang, Tammy T.; Walther, Isabelle; Li, Chai-Fei; Boonyaratanakornkit, Jim; Galleri, Grazia; Meloni, Maria Antonia; Pippia, Proto; Cogoli, Augusto; Hughes-Fulford, Millie

    2012-01-01

    This study tested the hypothesis that transcription of immediate early genes is inhibited in T cells activated in μg. Immunosuppression during spaceflight is a major barrier to safe, long-term human space habitation and travel. The goals of these experiments were to prove that μg was the cause of impaired T cell activation during spaceflight, as well as understand the mechanisms controlling early T cell activation. T cells from four human donors were stimulated with Con A and anti-CD28 on board the ISS. An on-board centrifuge was used to generate a 1g simultaneous control to isolate the effects of μg from other variables of spaceflight. Microarray expression analysis after 1.5 h of activation demonstrated that μg- and 1g-activated T cells had distinct patterns of global gene expression and identified 47 genes that were significantly, differentially down-regulated in μg. Importantly, several key immediate early genes were inhibited in μg. In particular, transactivation of Rel/NF-κB, CREB, and SRF gene targets were down-regulated. Expression of cREL gene targets were significantly inhibited, and transcription of cREL itself was reduced significantly in μg and upon anti-CD3/anti-CD28 stimulation in simulated μg. Analysis of gene connectivity indicated that the TNF pathway is a major early downstream effector pathway inhibited in μg and may lead to ineffective proinflammatory host defenses against infectious pathogens during spaceflight. Results from these experiments indicate that μg was the causative factor for impaired T cell activation during spaceflight by inhibiting transactivation of key immediate early genes. PMID:22750545

  3. Signal Transducer and Activator of Transcription 1 (STAT1) is Essential for Chromium Silencing of Gene Induction in Human Airway Epithelial Cells

    PubMed Central

    Nemec, Antonia A.; Barchowsky, Aaron

    2009-01-01

    Hexavalent chromium (Cr(VI)) promotes lung injury and pulmonary diseases through poorly defined mechanisms that may involve the silencing of inducible protective genes. The current study investigated the hypothesis that Cr(VI) actively signals through a signal transducer and activator of transcription 1 (STAT1)–dependent pathway to silence nickel (Ni)–induced expression of vascular endothelial cell growth factor A (VEGFA), an important mediator of lung injury and repair. In human bronchial airway epithelial (BEAS-2B) cells, Ni-induced VEGFA transcription by stimulating an extracellular regulated kinase (ERK) signaling cascade that involved Src kinase–activated Sp1 transactivation, as well as increased hypoxia-inducible factor-1α (HIF-1α) stabilization and DNA binding. Ni-stimulated ERK, Src, and HIF-1α activities, as well as Ni-induced VEGFA transcript levels were inhibited in Cr(VI)-exposed cells. We previously demonstrated that Cr(VI) stimulates STAT1 to suppress VEGFA expression. In BEAS-2B cells stably expressing STAT1 short hairpin RNA, Cr(VI) increased VEGFA transcript levels and Sp1 transactivation. Moreover, in the absence of STAT1, Cr(VI), and Ni coexposures positively interacted to further increase VEGFA transcripts. This study demonstrates that metal-stimulated signaling cascades interact to regulate transcription and induction of adaptive or repair responses in airway cells. In addition, the data implicate STAT1 as a rate limiting mediator of Cr(VI)-stimulated gene regulation and suggest that cells lacking STAT1, such as many tumor cell lines, have opposite responses to Cr(VI) relative to normal cells. PMID:19403854

  4. Coordinated regulation of Nrf2 and histone H3 serine 10 phosphorylation in arsenite-activated transcription of the human heme oxygenase-1 gene.

    PubMed

    Ray, Paul D; Huang, Bo-Wen; Tsuji, Yoshiaki

    2015-10-01

    Expression of the antioxidant gene heme oxygenase-1 (HO-1) is primarily induced through NF-E2-related factor 2 (Nrf2)-mediated activation of the antioxidant response element (ARE). Gene transcription is coordinately regulated by transcription factor activity at enhancer elements and epigenetic alterations such as the posttranslational modification of histone proteins. However, the role of histone modifications in the Nrf2-ARE axis remains largely uncharacterized. The environmental contaminant arsenite is a potent inducer of both HO-1 expression and phosphorylation of histone H3 serine 10 (H3S10); therefore, we investigated the relationships between Nrf2 and H3S10 phosphorylation in arsenite-induced, ARE-dependent, transcriptional activation of the human HO-1 gene. Arsenite increased phosphorylation of H3S10 both globally and at the HO-1 promoter concomitantly with HO-1 transcription in human HaCaT keratinocytes. Conversely, arsenite-induced H3S10 phosphorylation and HO-1 expression were blocked by N-acetylcysteine (NAC), the c-Jun N-terminal kinase (JNK) inhibitor SP600125, and JNK knockdown (siJNK). Interestingly, ablation of arsenite-induced H3S10 phosphorylation by SP600125 or siJNK did not inhibit Nrf2 nuclear accumulation nor ARE binding, despite inhibiting HO-1 expression. In response to arsenite, binding of Nrf2 to the HO-1 ARE preceded phosphorylation of H3S10 at the HO-1 ARE. Furthermore, arsenite-mediated occupancy of phosphorylated H3S10 at the HO-1 ARE was decreased in Nrf2-deficient mouse embryonic fibroblasts. These results suggest the involvement of H3S10 phosphorylation in the Nrf2-ARE axis by proposing that Nrf2 may influence H3S10 phosphorylation at the HO-1 ARE and additional promoter regions. Our data highlights the complex interplay between Nrf2 and H3S10 phosphorylation in arsenite-activated HO-1 transcription. PMID:26291278

  5. Signal transducers and activators of transcription 3 (STAT3) inhibits transcription of the inducible nitric oxide synthase gene by interacting with nuclear factor kappaB.

    PubMed Central

    Yu, Zhiyuan; Zhang, Wenzheng; Kone, Bruce C

    2002-01-01

    Prolific generation of NO by inducible nitric oxide synthase (iNOS) can cause unintended injury to host cells during glomerulonephritis and other inflammatory diseases. While much is known about the mechanisms of iNOS induction, few transcriptional repressors have been found. We explored the role of signal transducers and activators of transcription 3 (STAT3) proteins in interleukin (IL)-1beta- and lipopolysaccharide (LPS)+interferon (IFN)-gamma-mediated iNOS induction in murine mesangial cells. Both stimuli induced rapid phosphorylation of STAT3 and sequence-specific STAT3 DNA-binding activity. Supershift assays with a STAT3 element probe demonstrated that nuclear factor kappaB (NF-kappaB) p65 and p50 complexed with STAT3 in the DNA-protein complex. The direct interaction of STAT3 and NF-kappaB p65 was verified in vivo by co-immunoprecipitation and in vitro by pull-down assays with glutathione S-transferase-NF-kappaB p65 fusion protein and in vitro -translated STAT3alpha. Overexpression of STAT3 dramatically inhibited IL-1beta- or LPS+IFN-gamma-mediated induction of iNOS promoter-luciferase constructs that contained the wild-type iNOS promoter or ones harbouring mutated STAT-binding elements. In tests of indirect inhibitory effects of STAT3, overexpression of STAT3 dramatically inhibited the activity of an NF-kappaB-dependent promoter devoid of STAT-binding elements without affecting NF-kappaB DNA-binding activity. Thus STAT3, via direct interactions with NF-kappaB p65, serves as a dominant-negative inhibitor of NF-kappaB activity to suppress indirectly cytokine induction of the iNOS promoter in mesangial cells. These results provide a new model for the termination of NO production by activated iNOS following exposure to pro-inflammatory stimuli. PMID:12057007

  6. Structural basis of transcription activation.

    PubMed

    Feng, Yu; Zhang, Yu; Ebright, Richard H

    2016-06-10

    Class II transcription activators function by binding to a DNA site overlapping a core promoter and stimulating isomerization of an initial RNA polymerase (RNAP)-promoter closed complex into a catalytically competent RNAP-promoter open complex. Here, we report a 4.4 angstrom crystal structure of an intact bacterial class II transcription activation complex. The structure comprises Thermus thermophilus transcription activator protein TTHB099 (TAP) [homolog of Escherichia coli catabolite activator protein (CAP)], T. thermophilus RNAP σ(A) holoenzyme, a class II TAP-dependent promoter, and a ribotetranucleotide primer. The structure reveals the interactions between RNAP holoenzyme and DNA responsible for transcription initiation and reveals the interactions between TAP and RNAP holoenzyme responsible for transcription activation. The structure indicates that TAP stimulates isomerization through simple, adhesive, stabilizing protein-protein interactions with RNAP holoenzyme. PMID:27284196

  7. Transcription Activation by NtcA and 2-Oxoglutarate of Three Genes Involved in Heterocyst Differentiation in the Cyanobacterium Anabaena sp. Strain PCC 7120▿

    PubMed Central

    Valladares, Ana; Flores, Enrique; Herrero, Antonia

    2008-01-01

    In Anabaena sp. strain PCC 7120, differentiation of heterocysts takes place in response to the external cue of combined nitrogen deprivation, allowing the organism to fix atmospheric nitrogen in oxic environments. NtcA, a global transcriptional regulator of cyanobacteria, is required for activation of the expression of multiple genes involved in heterocyst differentiation, including key regulators that are specific to the process. We have set up a fully defined in vitro system, which includes the purified Anabaena RNA polymerase, and have studied the effects of NtcA and its signaling effector 2-oxoglutarate on RNA polymerase binding, open complex formation, and transcript production from promoters of the hetC, nrrA, and devB genes that are activated by NtcA at different stages of heterocyst differentiation. Both RNA polymerase and NtcA could specifically bind to the target DNA in the absence of any effector. 2-Oxoglutarate had a moderate positive effect on NtcA binding, and NtcA had a limited positive effect on RNA polymerase recruitment at the promoters. However, a stringent requirement of both NtcA and 2-oxoglutarate was observed for the detection of open complexes and transcript production at the three investigated promoters. These results support a key role for 2-oxoglutarate in transcription activation in the developing heterocyst. PMID:18658268

  8. Interleukin 3-dependent activation of DREAM is involved in transcriptional silencing of the apoptotic hrk gene in hematopoietic progenitor cells

    PubMed Central

    Sanz, Cristina; Mellstrom, Britt; Link, Wolfgang A.; Naranjo, Jose Ramon; Fernandez-Luna, Jose Luis

    2001-01-01

    The apoptotic protein Hrk is expressed in hematopoietic progenitors after growth factor deprivation. Here we identify a silencer sequence in the 3′ untranslated region of the hrk gene that binds to the transcriptional repressor DREAM in interleukin-3 (IL-3)-dependent hematopoietic progenitor cells, and abrogates the expression of reporter genes when located downstream of the open reading frame. In addition, the binding of DREAM to the hrk gene is reduced or eliminated when cells are cultured in the absence of IL-3 or treated with a calcium ionophore or a phosphatidylinositol 3-kinase-specific inhibitor, suggesting that both calcium mobilization and phosphorylation can regulate the transcriptional activity of DREAM. Furthermore, we have shown that DREAM is phosphorylated by a phosphatidylinositol 3-kinase-dependent, but Akt-independent pathway. In all cases, loss of the DREAM–DNA binding complex was correlated with increased levels of Hrk and apoptosis. These data suggest that IL-3 may trigger the activation of DREAM through different signaling pathways, which in turn binds to a silencer sequence in the hrk gene and blocks transcription, avoiding inappropriate cell death in hematopoietic progenitors. PMID:11331593

  9. Genome-wide identification and transcriptional expression analysis of mitogen-activated protein kinase and mitogen-activated protein kinase kinase genes in Capsicum annuum

    PubMed Central

    Liu, Zhiqin; Shi, Lanping; Liu, Yanyan; Tang, Qian; Shen, Lei; Yang, Sheng; Cai, Jinsen; Yu, Huanxin; Wang, Rongzhang; Wen, Jiayu; Lin, Youquan; Hu, Jiong; Liu, Cailing; Zhang, Yangwen; Mou, Shaoliang; He, Shuilin

    2015-01-01

    The tripartite mitogen-activated protein kinase (MAPK) signaling cascades have been implicated in plant growth, development, and environment adaptation, but a comprehensive understanding of MAPK signaling at genome-wide level is limited in Capsicum annuum. Herein, genome-wide identification and transcriptional expression analysis of MAPK and MAPK kinase (MAPKK) were performed in pepper. A total of 19 pepper MAPK (CaMAPKs) genes and five MAPKK (CaMAPKKs) genes were identified. Phylogenetic analysis indicated that CaMAPKs and CaMAPKKs could be classified into four groups and each group contains similar exon-intron structures. However, significant divergences were also found. Notably, five members of the pepper MAPKK family were much less conserved than those found in Arabidopsis, and 9 Arabidopsis MAPKs did not have orthologs in pepper. Additionally, 7 MAPKs in Arabidopsis had either two or three orthologs in the pepper genome, and six pepper MAPKs and one MAPKK differing in sequence were found in three pepper varieties. Quantitative real-time RT-PCR analysis showed that the majority of MAPK and MAPKK genes were ubiquitously expressed and transcriptionally modified in pepper leaves after treatments with heat, salt, and Ralstonia solanacearum inoculation as well as exogenously applied salicylic acid, methyl jasmonate, ethephon, and abscisic acid. The MAPKK-MAPK interactome was tested by yeast two-hybrid assay, the results showed that one MAPKK might interact with multiple MAPKs, one MAPK might also interact with more than one MAPKKs, constituting MAPK signaling networks which may collaborate in transmitting upstream signals into appropriate downstream cellular responses and processes. These results will facilitate future functional characterization of MAPK cascades in pepper. PMID:26442088

  10. Complementary Activities of TELOMERE REPEAT BINDING Proteins and Polycomb Group Complexes in Transcriptional Regulation of Target Genes[OPEN

    PubMed Central

    Hartwig, Benjamin; James, Geo Velikkakam

    2016-01-01

    In multicellular organisms, Polycomb Repressive Complex 1 (PRC1) and PRC2 repress target genes through histone modification and chromatin compaction. Arabidopsis thaliana mutants strongly compromised in the pathway cannot develop differentiated organs. LIKE HETEROCHROMATIN PROTEIN1 (LHP1) is so far the only known plant PRC1 component that directly binds to H3K27me3, the histone modification set by PRC2, and also associates genome-wide with trimethylation of lysine 27 of histone H3 (H3K27me3). Surprisingly, lhp1 mutants show relatively mild phenotypic alterations. To explain this paradox, we screened for genetic enhancers of lhp1 mutants to identify novel components repressing target genes together with, or in parallel to, LHP1. Two enhancing mutations were mapped to TELOMERE REPEAT BINDING PROTEIN1 (TRB1) and its paralog TRB3. We show that TRB1 binds to thousands of genomic sites containing telobox or related cis-elements with a significant increase of sites and strength of binding in the lhp1 background. Furthermore, in combination with lhp1, but not alone, trb1 mutants show increased transcription of LHP1 targets, such as floral meristem identity genes, which are more likely to be bound by TRB1 in the lhp1 background. By contrast, expression of a subset of LHP1-independent TRB1 target genes, many involved in primary metabolism, is decreased in the absence of TRB1 alone. Thus, TRB1 is a bivalent transcriptional modulator that maintains downregulation of Polycomb Group (PcG) target genes in lhp1 mutants, while it sustains high expression of targets that are regulated independently of PcG. PMID:26721861

  11. Transcription of Oxidative Stress Genes Is Directly Activated by SpxA1 and, to a Lesser Extent, by SpxA2 in Streptococcus mutans

    PubMed Central

    Kajfasz, Jessica K.; Rivera-Ramos, Isamar; Scott-Anne, Kathleen; Gregoire, Stacy; Abranches, Jacqueline

    2015-01-01

    ABSTRACT The SpxA1 and SpxA2 (formerly SpxA and SpxB) transcriptional regulators of Streptococcus mutans are members of a highly conserved family of proteins found in Firmicutes, and they were previously shown to activate oxidative stress responses. In this study, we showed that SpxA1 exerts substantial positive regulatory influence over oxidative stress genes following exposure to H2O2, while SpxA2 appears to have a secondary regulatory role. In vitro transcription (IVT) assays using purified SpxA1 and/or SpxA2 showed that SpxA1 and, less often, SpxA2 directly activate transcription of some of the major oxidative stress genes. Addition of equimolar concentrations of SpxA1 and SpxA2 to the IVT reactions neither enhanced transcription of the tested genes nor disrupted the dominant role of SpxA1. Substitution of a conserved glycine residue (G52) present in both Spx proteins by arginine (SpxG52R) resulted in strains that phenocopied the Δspx strains. Moreover, addition of purified SpxA1G52R completely failed to activate transcription of ahpC, sodA, and tpx, further confirming that the G52 residue is critical for Spx functionality. IMPORTANCE Streptococcus mutans is a pathogen associated with the formation of dental caries in humans. Within the oral cavity, S. mutans routinely encounters oxidative stress. Our previous data revealed that two regulatory proteins, SpxA1 and SpxA2 (formerly SpxA and SpxB), bear high homology to the Spx regulator that has been characterized as a critical activator of oxidative stress genes in Bacillus subtilis. In this report, we prove that Spx proteins of S. mutans directly activate transcription of genes involved in the oxidative stress response, though SpxA1 appears to have a more dominant role than SpxA2. Therefore, the Spx regulators play a critical role in the ability of S. mutans to thrive within the oral cavity. PMID:25897032

  12. The Casuarina NIN gene is transcriptionally activated throughout Frankia root infection as well as in response to bacterial diffusible signals.

    PubMed

    Clavijo, Fernando; Diedhiou, Issa; Vaissayre, Virginie; Brottier, Laurent; Acolatse, Jennifer; Moukouanga, Daniel; Crabos, Amandine; Auguy, Florence; Franche, Claudine; Gherbi, Hassen; Champion, Antony; Hocher, Valerie; Barker, David; Bogusz, Didier; Tisa, Louis S; Svistoonoff, Sergio

    2015-11-01

    Root nodule symbioses (RNS) allow plants to acquire atmospheric nitrogen by establishing an intimate relationship with either rhizobia, the symbionts of legumes or Frankia in the case of actinorhizal plants. In legumes, NIN (Nodule INception) genes encode key transcription factors involved in nodulation. Here we report the characterization of CgNIN, a NIN gene from the actinorhizal tree Casuarina glauca using both phylogenetic analysis and transgenic plants expressing either ProCgNIN::reporter gene fusions or CgNIN RNAi constructs. We have found that CgNIN belongs to the same phylogenetic group as other symbiotic NIN genes and CgNIN is able to complement a legume nin mutant for the early steps of nodule development. CgNIN expression is correlated with infection by Frankia, including preinfection stages in developing root hairs, and is induced by culture supernatants. Knockdown mutants were impaired for nodulation and early root hair deformation responses were severely affected. However, no mycorrhizal phenotype was observed and no induction of CgNIN expression was detected in mycorrhizas. Our results indicate that elements specifically required for nodulation include NIN and possibly related gene networks derived from the nitrate signalling pathways. PMID:26096779

  13. Active Center Control of Termination by RNA Polymerase III and tRNA Gene Transcription Levels In Vivo.

    PubMed

    Rijal, Keshab; Maraia, Richard J

    2016-08-01

    The ability of RNA polymerase (RNAP) III to efficiently recycle from termination to reinitiation is critical for abundant tRNA production during cellular proliferation, development and cancer. Yet understanding of the unique termination mechanisms used by RNAP III is incomplete, as is its link to high transcription output. We used two tRNA-mediated suppression systems to screen for Rpc1 mutants with gain- and loss- of termination phenotypes in S. pombe. 122 point mutation mutants were mapped to a recently solved 3.9 Å structure of yeast RNAP III elongation complex (EC); they cluster in the active center bridge helix and trigger loop, as well as the pore and funnel, the latter of which indicate involvement of the RNA cleavage domain of the C11 subunit in termination. Purified RNAP III from a readthrough (RT) mutant exhibits increased elongation rate. The data strongly support a kinetic coupling model in which elongation rate is inversely related to termination efficiency. The mutants exhibit good correlations of terminator RT in vitro and in vivo, and surprisingly, amounts of transcription in vivo. Because assessing in vivo transcription can be confounded by various parameters, we used a tRNA reporter with a processing defect and a strong terminator. By ruling out differences in RNA decay rates, the data indicate that mutants with the RT phenotype synthesize more RNA than wild type cells, and than can be accounted for by their increased elongation rate. Finally, increased activity by the mutants appears unrelated to the RNAP III repressor, Maf1. The results show that the mobile elements of the RNAP III active center, including C11, are key determinants of termination, and that some of the mutations activate RNAP III for overall transcription. Similar mutations in spontaneous cancer suggest this as an unforeseen mechanism of RNAP III activation in disease. PMID:27518095

  14. Active Center Control of Termination by RNA Polymerase III and tRNA Gene Transcription Levels In Vivo

    PubMed Central

    Rijal, Keshab; Maraia, Richard J.

    2016-01-01

    The ability of RNA polymerase (RNAP) III to efficiently recycle from termination to reinitiation is critical for abundant tRNA production during cellular proliferation, development and cancer. Yet understanding of the unique termination mechanisms used by RNAP III is incomplete, as is its link to high transcription output. We used two tRNA-mediated suppression systems to screen for Rpc1 mutants with gain- and loss- of termination phenotypes in S. pombe. 122 point mutation mutants were mapped to a recently solved 3.9 Å structure of yeast RNAP III elongation complex (EC); they cluster in the active center bridge helix and trigger loop, as well as the pore and funnel, the latter of which indicate involvement of the RNA cleavage domain of the C11 subunit in termination. Purified RNAP III from a readthrough (RT) mutant exhibits increased elongation rate. The data strongly support a kinetic coupling model in which elongation rate is inversely related to termination efficiency. The mutants exhibit good correlations of terminator RT in vitro and in vivo, and surprisingly, amounts of transcription in vivo. Because assessing in vivo transcription can be confounded by various parameters, we used a tRNA reporter with a processing defect and a strong terminator. By ruling out differences in RNA decay rates, the data indicate that mutants with the RT phenotype synthesize more RNA than wild type cells, and than can be accounted for by their increased elongation rate. Finally, increased activity by the mutants appears unrelated to the RNAP III repressor, Maf1. The results show that the mobile elements of the RNAP III active center, including C11, are key determinants of termination, and that some of the mutations activate RNAP III for overall transcription. Similar mutations in spontaneous cancer suggest this as an unforeseen mechanism of RNAP III activation in disease. PMID:27518095

  15. Control of human carnitine palmitoyltransferase II gene transcription by peroxisome proliferator-activated receptor through a partially conserved peroxisome proliferator-responsive element.

    PubMed Central

    Barrero, María J; Camarero, Nuria; Marrero, Pedro F; Haro, Diego

    2003-01-01

    The expression of several genes involved in fatty acid metabolism is regulated by peroxisome proliferator-activated receptors (PPARs). To gain more insight into the control of carnitine palmitoyltransferase (CPT) gene expression, we examined the transcriptional regulation of the human CPT II gene. We show that the 5'-flanking region of this gene is transcriptionally active and binds PPARalpha in vivo in a chromatin immunoprecipitation assay. In addition, we characterized the peroxisome proliferator-responsive element (PPRE) in the proximal promoter of the CPT II gene, which appears to be a novel PPRE. The sequence of this PPRE contains one half-site which is a perfect consensus sequence (TGACCT) but no clearly recognizable second half-site (CAGCAC); this part of the sequence contains only one match to the consensus, which seems to be irrelevant for the binding of PPARalpha. As expected, other members of the nuclear receptor superfamily also bind to this element and repress the activation mediated by PPARalpha, thus showing that the interplay between several nuclear receptors may regulate the entry of fatty acids into the mitochondria, a crucial step in their metabolism. PMID:12408750

  16. Thyroid active agents T3 and PTU differentially affect immune gene transcripts in the head kidney of rainbow trout (Oncorynchus mykiss).

    PubMed

    Quesada-García, Alba; Encinas, Paloma; Valdehita, Ana; Baumann, Lisa; Segner, Helmut; Coll, Julio M; Navas, José M

    2016-05-01

    In mammals, numerous reports describe an immunomodulating effect of thyroid-active compounds. In contrast, only few reports have been published on this subject in fish. We previously demonstrated that immune cells of rainbow trout (Oncorhynchus mykiss) possess thyroid hormone receptors (THRs) and that exposure of trout to the thyroid hormone 3,3',5-triiodo-l-thyronine (T3) or the antithyroid drug propylthiouracil (PTU) alters immune cell transcript levels of THR and several immune genes. The present study aims to further characterize the immunomodulating action of thyroid-active compounds in trout immune cells. We report here the use of a custom-designed 60-mer oligo immune-targeted microarray for rainbow trout to analyze the gene expression profiles induced in the head kidney by T3 and PTU. Morphometric analyses of the thyroid showed that PTU exposure increased the size of the epithelial cells, whereas T3 induced no significant effects. Both T3 and PTU had diverse and partly contrasting effects on immune transcript profiles. The strongest differential effects of T3 and PTU on gene expressions were those targeting the Mitogen Associated Protein Kinase (MAPK), NFkB, Natural Killer (NK) and Toll-Like Receptor (TLR) pathways, a number of multipath genes (MPG) such as those encoding pleiotropic transcription factors (atf1, junb, myc), as well as important pro-inflammatory genes (tnfa, tnf6, il1b) and interferon-related genes (ifng, irf10). With these results we show for the first time in a fish species that the in vivo thyroidal status modulates a diversity of immune genes and pathways. This knowledge provides the basis to investigate both mechanisms and consequences of thyroid hormone- and thyroid disruptor-mediated immunomodulation for the immunocompetence of fish. PMID:26963519

  17. The yeast protein Gcr1p binds to the PGK UAS and contributes to the activation of transcription of the PGK gene.

    PubMed

    Henry, Y A; López, M C; Gibbs, J M; Chambers, A; Kingsman, S M; Baker, H V; Stanway, C A

    1994-11-15

    Analysis of the upstream activation sequence (UAS) of the yeast phosphoglycerate kinase gene (PGK) has demonstrated that a number of sequence elements are involved in its activity and two of these sequences are bound by the multifunctional factors Rap1p and Abf1p. In this report we show by in vivo footprinting that the regulatory factor encoded by GCR1 binds to two elements in the 3' half of the PGK UAS. These elements contain the sequence CTTCC, which was previously suggested to be important for the activity of the PGK UAS and has been shown to be able to bind Gcr1p in vitro. Furthermore, we find that Gcr1p positively influences PGK transcription, although it is not responsible for the carbon source dependent regulation of PGK mRNA synthesis. In order to mediate its transcriptional influence we find that Gcr1p requires the Rap1p binding site, in addition to its own, but not the Abf1p site. As neither a Rap1p nor a Gcr1p binding site alone is able to activate transcription, we propose that Gcr1p and Rap1p interact in an interdependent fashion to activate PGK transcription. PMID:7808400

  18. Rapid activation of plasticity-associated gene transcription in hippocampal neurons provides a mechanism for encoding of one-trial experience

    PubMed Central

    Miyashita, Teiko; Kubik, Stepan; Haghighi, Nahideh; Steward, Oswald; Guzowski, John F.

    2009-01-01

    The hippocampus is hypothesized to support rapid encoding of ongoing experience. A critical prerequisite for such function is the ability to readily recruit enduring synaptic plasticity in hippocampal neurons. Hippocampal long-term potentiation (LTP) and memory consolidation require expression of the immediate-early gene (IEG) Arc. To determine whether Arc transcription could be driven by limited and controlled behavioral experience, we used a rectangular track paradigm. In past electrophysiological studies, pyramidal neurons recorded from rats running in one direction on similar tracks typically exhibited a single firing field. Using fluorescence in situ hybridization, we show that the behavioral activity associated with a single lap around the track was sufficient to trigger Arc transcription in complete CA3 neuronal ensembles, as predicted given the role of CA3 in one-trial learning. By contrast, Arc transcription in CA1 ensembles was recruited incrementally, with maximal activation achieved after 4 laps a day for 4 consecutive days. To test whether Arc transcription is linked to learning and plasticity, or merely elicited by location-specific firing, we inactivated the medial septum, a treatment that compromises hippocampus-dependent learning and LTP, but spares location-specific firing in CA1 neurons. Septal inactivation abolished track training-induced Arc transcription in CA1 and CA3 neurons, showing that Arc transcription requires plasticity-inducing stimuli. Accordingly, LTP induction activated Arc transcription in CA1 neurons in vivo. These findings demonstrate for the first time that a single brief experience, equivalent to a single crossing of a firing field, can trigger IEG expression required for long-term plasticity in the hippocampus. PMID:19176799

  19. UreR, the transcriptional activator of the Proteus mirabilis urease gene cluster, is required for urease activity and virulence in experimental urinary tract infections.

    PubMed

    Dattelbaum, Jonathan D; Lockatell, C Virginia; Johnson, David E; Mobley, Harry L T

    2003-02-01

    Proteus mirabilis, a cause of complicated urinary tract infection, produces urease, an essential virulence factor for this species. UreR, a member of the AraC/XylS family of transcriptional regulators, positively activates expression of the ure gene cluster in the presence of urea. To specifically evaluate the contribution of UreR to urease activity and virulence in the urinary tract, a ureR mutation was introduced into P. mirabilis HI4320 by homologous recombination. The isogenic ureR::aphA mutant, deficient in UreR production, lacked measurable urease activity. Expression was not detected in the UreR-deficient strain by Western blotting with monoclonal antibodies raised against UreD. Urease activity and UreD expression were restored by complementation of the mutant strain with ureR expressed from a low-copy-number plasmid. Virulence was assessed by transurethral cochallenge of CBA mice with wild-type and mutant strains. The isogenic ureR::aphA mutant of HI4320 was outcompeted in the urine (P = 0.004), bladder (P = 0.016), and kidneys (P < or = 0.001) 7 days after inoculation. Thus, UreR is required for basal urease activity in the absence of urea, for induction of urease by urea, and for virulence of P. mirabilis in the urinary tract. PMID:12540589

  20. 6-shogaol, a major compound in ginger, induces aryl hydrocarbon receptor-mediated transcriptional activity and gene expression.

    PubMed

    Yoshida, Kazutaka; Satsu, Hideo; Mikubo, Ayano; Ogiwara, Haru; Yakabe, Takafumi; Inakuma, Takahiro; Shimizu, Makoto

    2014-06-18

    Xenobiotics are usually detoxified by drug-metabolizing enzymes and excreted from the body. The expression of many of drug-metabolizing enzymes is regulated by the aryl hydrocarbon receptor (AHR). Some substances in vegetables have the potential to be AHR ligands. To search for vegetable components that exhibit AHR-mediated transcriptional activity, we assessed the activity of vegetable extracts and identified the active compounds using the previously established stable AHR-responsive HepG2 cell line. Among the hot water extracts of vegetables, the highest activity was found in ginger. The ethyl acetate fraction of the ginger hot water extract remarkably induced AHR-mediated transcriptional activity, and the major active compound was found to be 6-shogaol. Subsequently, the mRNA levels of AHR-targeting drug-metabolizing enzymes (CYP1A1, UGT1A1, and ABCG 2) and the protein level of CYP1A1 in HepG2 cells were shown to be increased by 6-shogaol. This is the first report that 6-shogaol can regulate the expression of detoxification enzymes by AHR activation. PMID:24857157

  1. Gene 33/Mig-6, a transcriptionally inducible adapter protein that binds GTP-Cdc42 and activates SAPK/JNK. A potential marker transcript for chronic pathologic conditions, such as diabetic nephropathy. Possible role in the response to persistent stress.

    PubMed

    Makkinje, A; Quinn, D A; Chen, A; Cadilla, C L; Force, T; Bonventre, J V; Kyriakis, J M

    2000-06-01

    Chronic stresses, including the mechanical strain caused by hypertension or excess pulmonary ventilation pressure, lead to important clinical consequences, including hypertrophy and acute respiratory distress syndrome. Pathologic hypertrophy contributes to decreased organ function and, ultimately, organ failure; and cardiac and diabetic renal hypertrophy are major causes of morbidity and morality in the developed world. Likewise, acute respiratory distress syndrome is a serious potential side effect of mechanical pulmonary ventilation. Whereas the deleterious effects of chronic stress are well established, the molecular mechanisms by which these stresses affect cell function are still poorly characterized. gene 33 (also called mitogen-inducible gene-6, mig-6) is an immediate early gene that is transcriptionally induced by a divergent array of extracellular stimuli. The physiologic function of Gene 33 is unknown. Here we show that gene 33 mRNA levels increase sharply in response to a set of commonly occurring chronic stress stimuli: mechanical strain, vasoactive peptides, and diabetic nephropathy. Induction of gene 33 requires the stress-activated protein kinases (SAPKs)/c-Jun NH(2)-terminal kinases. This expression pattern suggests that gene 33 is a potential marker for diabetic nephropathy and other pathologic responses to persistent sublethal stress. The structure of Gene 33 indicates an adapter protein capable of binding monomeric GTPases of the Rho subfamily. Consistent with this, Gene 33 interacts in vivo and, in a GTP-dependent manner, in vitro with Cdc42Hs; and transient expression of Gene 33 results in the selective activation of the SAPKs. These results imply a reciprocal, positive feedback relationship between Gene 33 expression and SAPK activation. Expression of Gene 33 at sufficient levels may enable a compensatory reprogramming of cellular function in response to chronic stress, which may have pathophysiological consequences. PMID:10749885

  2. ZCT1 and ZCT2 transcription factors repress the activity of a gene promoter from the methyl erythritol phosphate pathway in Madagascar periwinkle cells.

    PubMed

    Chebbi, Mouadh; Ginis, Olivia; Courdavault, Vincent; Glévarec, Gaëlle; Lanoue, Arnaud; Clastre, Marc; Papon, Nicolas; Gaillard, Cécile; Atanassova, Rossitza; St-Pierre, Benoit; Giglioli-Guivarc'h, Nathalie; Courtois, Martine; Oudin, Audrey

    2014-10-15

    In Catharanthus roseus, accumulating data highlighted the existence of a coordinated transcriptional regulation of structural genes that takes place within the secoiridoid biosynthetic branch, including the methyl erythritol phosphate (MEP) pathway and the following steps leading to secologanin. To identify transcription factors acting in these pathways, we performed a yeast one-hybrid screening using as bait a promoter region of the hydroxymethylbutenyl 4-diphosphate synthase (HDS) gene involved in the responsiveness of C. roseus cells to hormonal signals inducing monoterpene indole alkaloid (MIA) production. We identified that ZCT2, one of the three members of the zinc finger Catharanthus protein (ZCT) family, can bind to a HDS promoter region involved in hormonal responsiveness. By trans-activation assays, we demonstrated that ZCT1 and ZCT2 but not ZCT3 repress the HDS promoter activity. Gene expression analyses in C. roseus cells exposed to methyljasmonate revealed a persistence of induction of ZCT2 gene expression suggesting the existence of feed-back regulatory events acting on HDS gene expression in correlation with the MIA production. PMID:25108262

  3. Genome-wide specificity of DNA binding, gene regulation, and chromatin remodeling by TALE- and CRISPR/Cas9-based transcriptional activators

    PubMed Central

    Polstein, Lauren R.; Perez-Pinera, Pablo; Kocak, D. Dewran; Vockley, Christopher M.; Bledsoe, Peggy; Song, Lingyun; Safi, Alexias; Crawford, Gregory E.; Reddy, Timothy E.; Gersbach, Charles A.

    2015-01-01

    Genome engineering technologies based on the CRISPR/Cas9 and TALE systems are enabling new approaches in science and biotechnology. However, the specificity of these tools in complex genomes and the role of chromatin structure in determining DNA binding are not well understood. We analyzed the genome-wide effects of TALE- and CRISPR-based transcriptional activators in human cells using ChIP-seq to assess DNA-binding specificity and RNA-seq to measure the specificity of perturbing the transcriptome. Additionally, DNase-seq was used to assess genome-wide chromatin remodeling that occurs as a result of their action. Our results show that these transcription factors are highly specific in both DNA binding and gene regulation and are able to open targeted regions of closed chromatin independent of gene activation. Collectively, these results underscore the potential for these technologies to make precise changes to gene expression for gene and cell therapies or fundamental studies of gene function. PMID:26025803

  4. Induction of the Gene Encoding Macrophage Chemoattractant Protein 1 by Orientia tsutsugamushi in Human Endothelial Cells Involves Activation of Transcription Factor Activator Protein 1

    PubMed Central

    Cho, Nam-Hyuk; Seong, Seung-Yong; Huh, Myung-Sook; Kim, Na-Hyun; Choi, Myung-sik; Kim, Ik-sang

    2002-01-01

    Human macrophage chemoattractant protein 1 (MCP-1) is a potent mediator of macrophage migration and therefore plays an essential role in early events of inflammation. In endothelial cells, at least three independent pathways regulate MCP-1 expression by NF-κB and AP-1. Orientia tsutsugamushi causes vasculitis in humans by replicating inside macrophages and endothelial cells. In the present study, we investigated the cis-acting and trans-acting elements involved in O. tsutsugamushi-induced MCP-1 gene expression in human umbilical vein endothelial cells (HUVEC). Although NF-κB activation was observed in HUVEC infected with O. tsutsugamushi, inhibition of NF-κB activation did not affect the MCP-1 expression. However, treatment of HUVEC with extracellular signal-regulated kinase (ERK) kinase inhibitor or p38 mitogen-activated protein kinase (MAPK) inhibitor suppressed expression of MCP-1 mRNA concomitant with downregulation of activator protein 1 (AP-1) activation. Deletion of triphorbol acetate response elements (TRE) at position −69 to −63 of MCP-1 gene abolished inducible promoter activity. Deletion of TRE at position −69 to −63−96 to −90 or deletion of NF-κB-binding site at position −69 to −63−88 to −79 did not affect the inducibility of promoter. Site-directed mutagenesis of the NF-κB binding sites at positions −2640 to −2632, −2612 to −2603 in the enhancer region, or the AP-1 biding site at position −2276 to −2270 decreased the inducible activity of the promoter. Taken together, AP-1 activation by both the ERK pathway and the p38 MAPK pathway as well as their binding to TRE at position −69 to −63 in proximal promoter and TRE at position −2276 to −2270 in enhancer region is altogether essential in induction of MCP-1 mRNA in HUVEC infected with O. tsutsugamushi. Although NF-κB activation is not essential per se, the κB site in the enhancer region is important in MCP-1 induction of HUVEC. This discrepancy in the

  5. Gene Transcription Profile of the Detached Retina (An AOS Thesis)

    PubMed Central

    Zacks, David N.

    2009-01-01

    Purpose: Separation of the neurosensory retina from the retinal pigment epithelium (RPE) yields many morphologic and functional consequences, including death of the photoreceptor cells, Müller cell hypertrophy, and inner retinal rewiring. Many of these changes are due to the separation-induced activation of specific genes. In this work, we define the gene transcription profile within the retina as a function of time after detachment. We also define the early activation of kinases that might be responsible for the detachment-induced changes in gene transcription. Methods: Separation of the retina from the RPE was induced in Brown-Norway rats by the injection of 1% hyaluronic acid into the subretinal space. Retinas were harvested at 1, 7, and 28 days after separation. Gene transcription profiles for each time point were determined using the Affymetrix Rat 230A gene microarray chip. Transcription levels in detached retinas were compared to those of nondetached retinas with the BRB-ArrayTools Version 3.6.0 using a random variance analysis of variance (ANOVA) model. Confirmation of the significant transcriptional changes for a subset of the genes was performed using microfluidic quantitative real-time polymerase chain reaction (qRT-PCR) assays. Kinase activation was explored using Western blot analysis to look for early phosphorylation of any of the 3 main families of mitogen-activated protein kinases (MAPK): the p38 family, the Janus kinase family, and the p42/p44 family. Results: Retinas separated from the RPE showed extensive alterations in their gene transcription profile. Many of these changes were initiated as early as 1 day after separation, with significant increases by 7 days. ANOVA analysis defined 144 genes that had significantly altered transcription levels as a function of time after separation when setting a false discovery rate at ≤0.1. Confirmatory RT-PCR was performed on 51 of these 144 genes. Differential transcription detected on the microarray

  6. [Development genes encoding transcription factors and dysmorphology].

    PubMed

    Lacombe, Didier

    2009-04-01

    Studies of children with developmental abnormalities of genetic origin are necessary for accurate diagnosis, prognostication, patient management, and genetic counseling. Such studies can also help to identify genes involved in normal and abnormal morphogenesis, which often act as patterning genes and are also potential oncogenes. Many encode transcription factors that regulate other genes during embryonic development. PMID:20120282

  7. CCAAT/enhancer-binding protein delta activates insulin-like growth factor-I gene transcription in osteoblasts. Identification of a novel cyclic AMP signaling pathway in bone

    NASA Technical Reports Server (NTRS)

    Umayahara, Y.; Ji, C.; Centrella, M.; Rotwein, P.; McCarthy, T. L.

    1997-01-01

    Insulin-like growth factor-I (IGF-I) plays a key role in skeletal growth by stimulating bone cell replication and differentiation. We previously showed that prostaglandin E2 (PGE2) and other cAMP-activating agents enhanced IGF-I gene transcription in cultured primary rat osteoblasts through promoter 1, the major IGF-I promoter, and identified a short segment of the promoter, termed HS3D, that was essential for hormonal regulation of IGF-I gene expression. We now demonstrate that CCAAT/enhancer-binding protein (C/EBP) delta is a major component of a PGE2-stimulated DNA-protein complex involving HS3D and find that C/EBPdelta transactivates IGF-I promoter 1 through this site. Competition gel shift studies first indicated that a core C/EBP half-site (GCAAT) was required for binding of a labeled HS3D oligomer to osteoblast nuclear proteins. Southwestern blotting and UV-cross-linking studies showed that the HS3D probe recognized a approximately 35-kDa nuclear protein, and antibody supershift assays indicated that C/EBPdelta comprised most of the PGE2-activated gel-shifted complex. C/EBPdelta was detected by Western immunoblotting in osteoblast nuclear extracts after treatment of cells with PGE2. An HS3D oligonucleotide competed effectively with a high affinity C/EBP site from the rat albumin gene for binding to osteoblast nuclear proteins. Co-transfection of osteoblast cell cultures with a C/EBPdelta expression plasmid enhanced basal and PGE2-activated IGF-I promoter 1-luciferase activity but did not stimulate a reporter gene lacking an HS3D site. By contrast, an expression plasmid for the related protein, C/EBPbeta, did not alter basal IGF-I gene activity but did increase the response to PGE2. In osteoblasts and in COS-7 cells, C/EBPdelta, but not C/EBPbeta, transactivated a reporter gene containing four tandem copies of HS3D fused to a minimal promoter; neither transcription factor stimulated a gene with four copies of an HS3D mutant that was unable to bind osteoblast

  8. Abscisic acid represses the transcription of chloroplast genes*

    PubMed Central

    Yamburenko, Maria V.; Zubo, Yan O.; Börner, Thomas

    2013-01-01

    Numerous studies have shown effects of abscisic acid (ABA) on nuclear genes encoding chloroplast-localized proteins. ABA effects on the transcription of chloroplast genes, however, have not been investigated yet thoroughly. This work, therefore, studied the effects of ABA (75 μM) on transcription and steady-state levels of transcripts in chloroplasts of basal and apical segments of primary leaves of barley (Hordeum vulgare L.). Basal segments consist of young cells with developing chloroplasts, while apical segments contain the oldest cells with mature chloroplasts. Exogenous ABA reduced the chlorophyll content and caused changes of the endogenous concentrations not only of ABA but also of cytokinins to different extents in the basal and apical segments. It repressed transcription by the chloroplast phage-type and bacteria-type RNA polymerases and lowered transcript levels of most investigated chloroplast genes drastically. ABA did not repress the transcription of psbD and a few other genes and even increased psbD mRNA levels under certain conditions. The ABA effects on chloroplast transcription were more pronounced in basal vs. apical leaf segments and enhanced by light. Simultaneous application of cytokinin (22 μM 6-benzyladenine) minimized the ABA effects on chloroplast gene expression. These data demonstrate that ABA affects the expression of chloroplast genes differentially and points to a role of ABA in the regulation and coordination of the activities of nuclear and chloroplast genes coding for proteins with functions in photosynthesis. PMID:24078671

  9. Transcriptional Activation of the General Amino Acid Permease Gene per1 by the Histone Deacetylase Clr6 Is Regulated by Oca2 Kinase ▿ † ¶

    PubMed Central

    Kaufmann, Isabelle; White, Eleanor; Azad, Abul; Marguerat, Samuel; Bähler, Jürg; Proudfoot, Nicholas J.

    2010-01-01

    Expression of nitrogen metabolism genes is regulated by the quality of the nitrogen supply. Here, we describe a mechanism for the transcriptional regulation of the general amino acid permease gene per1 in Schizosaccharomyces pombe. We show that when ammonia is used as the nitrogen source, low levels of per1 are transcribed and histones in the coding and surrounding regions of per1 are acetylated. In the presence of proline, per1 transcription is upregulated and initiates from a more upstream site, generating 5′-extended mRNAs. Concomitantly, histones at per1 are deacetylated in a Clr6-dependent manner, suggesting a positive role for Clr6 in transcriptional regulation of per1. Upstream initiation and histone deactylation of per1 are constitutive in cells lacking the serine/threonine kinase oca2, indicating that Oca2 is a repressor of per1. Oca2 interacts with a protein homologous to the Saccharomyces cerevisiae transcriptional activator Cha4 and with Ago1. Loss of Cha4 or Ago1 causes aberrant induction of per1 under noninducing conditions, suggesting that these proteins are also involved in per1 regulation and hence in nitrogen utilization. PMID:20404084

  10. Role of Flightless-I (Drosophila) homolog in the transcription activation of type I collagen gene mediated by transforming growth factor beta

    SciTech Connect

    Lim, Mi-Sun; Jeong, Kwang Won

    2014-11-21

    Highlights: • FLII activates TGFβ-mediated expression of COL1A2 gene. • TGFβ induces the association of FLII with SMAD3 and BRG1 in A549 cells. • FLII is required for the recruitment of SWI/SNF complex and chromatin accessibility to COL1A2 promoter. - Abstract: Flightless-I (Drosophila) homolog (FLII) is a nuclear receptor coactivator that is known to interact with other transcriptional regulators such as the SWI/SNF complex, an ATP-dependent chromatin-remodeling complex, at the promoter or enhancer region of estrogen receptor (ER)-α target genes. However, little is known about the role of FLII during transcription initiation in the transforming growth factor beta (TGFβ)/SMAD-dependent signaling pathway. Here, we demonstrate that FLII functions as a coactivator in the expression of type I collagen gene induced by TGFβ in A549 cells. FLII activates the reporter gene driven by COL1A2 promoter in a dose-dependent manner. Co-expression of GRIP1, CARM1, or p300 did not show any synergistic activation of transcription. Furthermore, the level of COL1A2 expression correlated with the endogenous level of FLII mRNA level. Depletion of FLII resulted in a reduction of TGFβ-induced expression of COL1A2 gene. In contrast, over-expression of FLII caused an increase in the endogenous expression of COL1A2. We also showed that FLII is associated with Brahma-related gene 1 (BRG1) as well as SMAD in A549 cells. Notably, the recruitment of BRG1 to the COL1A2 promoter region was decreased in FLII-depleted A549 cells, suggesting that FLII is required for TGFβ-induced chromatin remodeling, which is carried out by the SWI/SNF complex. Furthermore, formaldehyde-assisted isolation of regulatory elements (FAIRE)-quantitative polymerase chain reaction (qPCR) experiments revealed that depletion of FLII caused a reduction in chromatin accessibility at the COL1A2 promoter. These results suggest that FLII plays a critical role in TGFβ/SMAD-mediated transcription of the COL1A2 gene

  11. Decreased sucrase and lactase activity in iron deficiency is accompanied by reduced gene expression and upregulation of the transcriptional repressor PDX-1.

    PubMed

    West, Adrian R; Oates, Phillip S

    2005-12-01

    Disaccharidases are important digestive enzymes whose activities can be reduced by iron deficiency. We hypothesise that this is due to reduced gene expression, either by impairment to enterocyte differentiation or by iron-sensitive mechanisms that regulate mRNA levels in enterocytes. Iron-deficient Wistar rats were generated by dietary means. The enzyme activities and kinetics of sucrase and lactase were tested as well as the activity of intestinal alkaline phosphatase (IAP)-II because it is unrelated to carbohydrate digestion. mRNA levels of beta-actin, sucrase, lactase, and the associated transcription factors pancreatic duodenal homeobox (PDX)-1, caudal-related homeobox (CDX)-2, GATA-binding protein (GATA)-4, and hepatocyte nuclear factor (HNF)-1 were measured by real-time PCR. Spatial patterns of protein and gene expression were assessed by immunofluorescence and in situ hybridization, respectively. It was found that iron-deficient rats had significantly lower sucrase (19.5% lower) and lactase (56.8% lower) but not IAP-II activity than control rats. Kinetic properties of both enzymes remained unchanged from controls, suggesting a decrease in the quantity of enzyme present. Sucrase and lactase mRNA levels were reduced by 44.5% and 67.9%, respectively, by iron deficiency, suggesting that enzyme activity is controlled primarily by gene expression. Iron deficiency did not affect the pattern of protein and gene expression along the crypt to villus axis. Expression of PDX-1, a repressor of sucrase and lactase promoters, was 4.5-fold higher in iron deficiency, whereas CDX-2, GATA-4, and HNF-1 levels were not significantly different. These data suggest that decreases in sucrase and lactase activities result from a reduction in gene expression, following from increased levels of the transcriptional repressor PDX-1. PMID:16081762

  12. Chromatin insulation by a transcriptional activator

    PubMed Central

    Sutter, Nathan B.; Scalzo, David; Fiering, Steven; Groudine, Mark; Martin, David I. K.

    2003-01-01

    In eukaryotic genomes, transcriptionally active regions are interspersed with silent chromatin that may repress genes in its vicinity. Chromatin insulators are elements that can shield a locus from repressive effects of flanking chromatin. Few such elements have been characterized in higher eukaryotes, but transcriptional activating elements are an invariant feature of active loci and have been shown to suppress transgene silencing. Hence, we have assessed the ability of a transcriptional activator to cause chromatin insulation, i.e., to relieve position effects at transgene integration sites in cultured cells. The transgene contained a series of binding sites for the metal-inducible transcriptional activator MTF, linked to a GFP reporter. Clones carrying single integrated transgenes were derived without selection for expression, and in most clones the transgene was silent. Induction of MTF resulted in transition of the transgene from the silent to the active state, prolongation of the active state, and a marked narrowing of the range of expression levels at different genomic sites. At one genomic site, prolonged induction of MTF resulted in suppression of transgene silencing that persisted after withdrawal of the induction stimulus. These results are consistent with MTF acting as a chromatin insulator and imply that transcriptional activating elements can insulate active loci against chromatin repression. PMID:12547916

  13. Functional analysis of differences in transcriptional activity conferred by genetic variants in the 5' flanking region of the IL12RB2 gene.

    PubMed

    Kato-Kogoe, Nahoko; Ohyama, Hideki; Okano, Soichiro; Yamanegi, Koji; Yamada, Naoko; Hata, Masaki; Nishiura, Hiroshi; Abiko, Yoshimitsu; Terada, Nobuyuki; Nakasho, Keiji

    2016-01-01

    Interleukin 12 receptor β chain (IL12RB2) is a crucial regulatory factor involved in cell-mediated immune responses, and genetic variants of the gene encoding IL12RB2 are associated with susceptibility to various immune-related diseases. We previously demonstrated that haplotypes with single nucleotide polymorphisms (SNPs) in the 5' flanking region of IL12RB2, including -1035A>G (rs3762315) and -1023A>G (rs3762316), affect the expression of IL12RB2, thereby altering susceptibility to leprosy and periodontal diseases. In the present study, we identified transcription factors associated with the haplotype-specific transcriptional activity of IL12RB2 in T cells and NK cells. The -1023G polymorphism was found to create a consensus binding site for the transcription factor activating protein (AP)-1, and enzyme-linked immunosorbent assay (ELISA)-based binding assays showed that these SNPs enhanced AP-1 binding to this region. In reporter assays, suppression of JunB expression using siRNA eliminated differences in the -1035G/-1023G and -1035A/-1023A regions containing IL12RB2 promoter activity in Jurkat T cells and NK3.3 cells. These results suggested that the -1035/-1023 polymorphisms created differential binding affinities for JunB that could lead to differential IL12RB2 expression. Moreover, the -1035G and -1035A alleles formed binding sites for GATA-3 and myocyte enhancer factor-2 (MEF-2), respectively. Our data indicated that in addition to JunB, the SNP at -1035/-1023 influenced GATA-3 and MEF-2 binding affinity, potentially altering IL12RB2 transcriptional activity. These findings confirm the effects of rs3762315 and rs3762316 on IL12RB2 transcription. These genetic variants may alter cellular activation of T cells and NK cells and modify cell-mediated immune responses. PMID:26552659

  14. Transcription Activation by NtcA in the Absence of Consensus NtcA-Binding Sites in an Anabaena Heterocyst Differentiation Gene Promoter

    PubMed Central

    Camargo, Sergio; Valladares, Ana; Flores, Enrique

    2012-01-01

    Heterocyst differentiation is orchestrated by the N control transcriptional regulator NtcA and the differentiation-specific factor HetR. In Anabaena sp. strain PCC 7120, the devBCA operon is expressed from two different promoters activated upon N stepdown. The distal devB promoter (transcription start point [TSP] located at position −704) represents a canonical class II NtcA-activated promoter, including a consensus NtcA-binding site centered 39.5 nucleotides upstream from the TSP. Transcription activation from a second TSP (−454) requires NtcA and is impaired in hetR mutants. In a wild-type background, three different DNA fragments, including both or each individual promoter, directed gfp expression localized mainly to proheterocysts and heterocysts. Expression was undetectable in an ntcA background and, for the fragment including the proximal promoter alone, also in a hetR background. In spite of the absence of consensus NtcA-binding sequences between the two TSPs, NtcA was shown to interact with this DNA region, and NtcA and its effector, 2-oxoglutarate, were necessary and sufficient for in vitro transcription from the −454 TSP. No HetR binding to the DNA or in vitro transcription from the proximal devB TSP promoted by HetR alone were detected. However, a moderate positive effect of HetR on NtcA binding to the DNA between the two devB TSPs was observed. The proximal devB promoter appears to represent a suboptimal NtcA-activated promoter for which HetR may act as a coactivator, with the physiological effect of restricting gene activation to conditions of prevalence of high NtcA and HetR levels, such as those taking place during heterocyst differentiation. PMID:22467790

  15. The toxic dinoflagellate Alexandrium minutum disrupts daily rhythmic activities at gene transcription, physiological and behavioral levels in the oyster Crassostrea gigas.

    PubMed

    Tran, Damien; Ciutat, Aurélie; Mat, Audrey; Massabuau, Jean-Charles; Hégaret, Hélène; Lambert, Christophe; Le Goic, Nelly; Soudant, Philippe

    2015-01-01

    The objective of the present work was to study the effect of the harmful alga Alexandrium minutum on the daily rhythm of the oyster Crassostrea gigas. Many metabolic and physiological functions are rhythmic in living animals. Their cycles are modeled in accordance with environmental cycles such as the day/night cycle, which are fundamental to increase the fitness of an organism in its environment. A disruption of rhythmic activities is known to possibly impact the health of an animal. This study focused in C. gigas, on a gene known to be involved in circadian rhythmicity, cryptochrome gene (CgCry), on putative clock-controlled genes involved in metabolic and physiological functions, on the length cycle of the style, a structure involved in digestion, and on the rhythmicity of valve activity involved in behavior. The results indicate that daily activity is synchronized at the gene level by light:dark cycles in C. gigas. A daily rhythm of valve activity and a difference in crystalline style length between scotophase and photophase were also demonstrated. Additionally, A. minutum exposure was shown to alter cyclic activities: in exposed oysters, gene transcription remained at a constant low level throughout a daily cycle, valve opening duration remained maximal and crystalline style length variation disappeared. The results show that a realistic bloom of A. minutum clearly can disrupt numerous and diverse molecular, physiological and behavioral functions via a loss of rhythmicity. PMID:25461744

  16. Single molecule real-time sequencing of Xanthomonas oryzae genomes reveals a dynamic structure and complex TAL (transcription activator-like) effector gene relationships

    PubMed Central

    Booher, Nicholas J.; Carpenter, Sara C. D.; Sebra, Robert P.; Wang, Li; Salzberg, Steven L.; Leach, Jan E.; Bogdanove, Adam J.

    2016-01-01

    Pathogen-injected, direct transcriptional activators of host genes, TAL (transcription activator-like) effectors play determinative roles in plant diseases caused by Xanthomonas spp. A large domain of nearly identical, 33–35 aa repeats in each protein mediates DNA recognition. This modularity makes TAL effectors customizable and thus important also in biotechnology. However, the repeats render TAL effector (tal) genes nearly impossible to assemble using next-generation, short reads. Here, we demonstrate that long-read, single molecule real-time (SMRT) sequencing solves this problem. Taking an ensemble approach to first generate local, tal gene contigs, we correctly assembled de novo the genomes of two strains of the rice pathogen X. oryzae completed previously using the Sanger method and even identified errors in those references. Sequencing two more strains revealed a dynamic genome structure and a striking plasticity in tal gene content. Our results pave the way for population-level studies to inform resistance breeding, improve biotechnology and probe TAL effector evolution. PMID:27148456

  17. Sp5 and Sp8 recruit β-catenin and Tcf1-Lef1 to select enhancers to activate Wnt target gene transcription.

    PubMed

    Kennedy, Mark W; Chalamalasetty, Ravindra B; Thomas, Sara; Garriock, Robert J; Jailwala, Parthav; Yamaguchi, Terry P

    2016-03-29

    The ancient, highly conserved, Wnt signaling pathway regulates cell fate in all metazoans. We have previously shown that combined null mutations of the specificity protein (Sp) 1/Klf-like zinc-finger transcription factorsSp5andSp8(i.e.,Sp5/8) result in an embryonic phenotype identical to that observed when core components of the Wnt/β-catenin pathway are mutated; however, their role in Wnt signal transduction is unknown. Here, we show in mouse embryos and differentiating embryonic stem cells that Sp5/8 are gene-specific transcriptional coactivators in the Wnt/β-catenin pathway. Sp5/8 bind directly to GC boxes in Wnt target gene enhancers and to adjacent, or distally positioned, chromatin-bound T-cell factor (Tcf) 1/lymphoid enhancer factor (Lef) 1 to facilitate recruitment of β-catenin to target gene enhancers. BecauseSp5is itself directly activated by Wnt signals, we propose that Sp5 is a Wnt/β-catenin pathway-specific transcripton factor that functions in a feed-forward loop to robustly activate select Wnt target genes. PMID:26969725

  18. Transcriptional Regulators Cph1p and Efg1p Mediate Activation of the Candida albicans Virulence Gene SAP5 during Infection

    PubMed Central

    Staib, Peter; Kretschmar, Marianne; Nichterlein, Thomas; Hof, Herbert; Morschhäuser, Joachim

    2002-01-01

    The opportunistic fungal pathogen Candida albicans can cause superficial as well as systemic infections. Successful adaptation to the different host niches encountered during infection requires coordinated expression of various virulence traits, including the switch between yeast and hyphal growth forms and secretion of aspartic proteinases. Using an in vivo expression technology that is based on genetic recombination as a reporter of gene activation during experimental candidiasis in mice, we investigated whether two signal transduction pathways controlling hyphal growth, a mitogen-activated protein kinase cascade ending in the transcriptional activator Cph1p and a cyclic AMP-dependent regulatory pathway that involves the transcription factor Efg1p, also control expression of the SAP5 gene, which encodes one of the secreted aspartic proteinases and is induced by host signals soon after infection. Our results show that both transcriptional regulators are important for SAP5 activation in vivo. SAP5 expression was reduced in a cph1 mutant, although filamentous growth in infected tissue was not detectably impaired. SAP5 expression was also reduced, but not eliminated, in an efg1 null mutant, although this strain grew exclusively in the yeast form in infected tissue, demonstrating that in contrast to in vitro conditions, SAP5 activation during infection does not depend on growth of C. albicans in the hyphal form. In a cph1 efg1 double mutant, however, SAP5 expression in infected mice was almost completely eliminated, suggesting that the two signal transduction pathways are important for SAP5 expression in vivo. The avirulence of the cph1 efg1 mutant seemed to be caused not only by the inability to form hyphae but also by a loss of expression of additional virulence genes in the host. PMID:11796627

  19. Structure–activity relationship studies of naphthol AS-E and its derivatives as anticancer agents by inhibiting CREB-mediated gene transcription

    PubMed Central

    Li, Bingbing X.; Yamanaka, Kinrin; Xiao, Xiangshu

    2012-01-01

    CREB (cyclic AMP-response element binding protein) is a downstream transcription factor of a multitude of signaling pathways emanating from receptor tyrosine kinases or G-protein coupled receptors. CREB is not activated until it is phosphorylated at Ser133 and its subsequent binding to CREB-binding protein (CBP) through kinase-inducible domain (KID) in CREB and KID-interacting (KIX) domain in CBP. Tumor tissues from various organs present higher level of expression and activation of CREB. Thus CREB has been proposed as a promising cancer drug target. We previously described naphthol AS-E (1a) as a small molecule inhibitor of CREB-mediated gene transcription in living cells. Here we report the structure–activity relationship (SAR) studies of 1a by modifying the appendant phenyl ring. All the compounds were evaluated for in vitro inhibition of KIX–KID interaction, cellular inhibition of CREB-mediated gene transcription and inhibition of proliferation of four cancer cell lines (A549, MCF-7, MDA-MB-231 and MDA-MB-468). SAR indicated that a small and electron-withdrawing group was preferred at the para-position for KIX–KID interaction inhibition. Compound 1a was selected for further biological characterization and it was found that 1a down-regulated the expression of endogenous CREB target genes. Expression of a constitutively active CREB mutant, VP16-CREB in MCF-7 cells rendered the cells resistant to 1a, suggesting that CREB was critical in mediating its anticancer activity. Furthermore, 1a was not toxic to normal human cells. Collectively, these data support that 1a represents a structural template for further development into potential cancer therapeutics with a novel mechanism of action. PMID:23102993

  20. Gene regulatory cascade of senescence-associated NAC transcription factors activated by ETHYLENE-INSENSITIVE2-mediated leaf senescence signalling in Arabidopsis

    PubMed Central

    Kim, Hyo Jung; Hong, Sung Hyun; Kim, You Wang; Lee, Il Hwan; Jun, Ji Hyung; Phee, Bong-Kwan; Rupak, Timilsina; Jeong, Hana; Lee, Yeonmi; Hong, Byoung Seok; Nam, Hong Gil; Woo, Hye Ryun; Lim, Pyung Ok

    2014-01-01

    Leaf senescence is a finely tuned and genetically programmed degeneration process, which is critical to maximize plant fitness by remobilizing nutrients from senescing leaves to newly developing organs. Leaf senescence is a complex process that is driven by extensive reprogramming of global gene expression in a highly coordinated manner. Understanding how gene regulatory networks involved in controlling leaf senescence are organized and operated is essential to decipher the mechanisms of leaf senescence. It was previously reported that the trifurcate feed-forward pathway involving EIN2, ORE1, and miR164 in Arabidopsis regulates age-dependent leaf senescence and cell death. Here, new components of this pathway have been identified, which enhances knowledge of the gene regulatory networks governing leaf senescence. Comparative gene expression analysis revealed six senescence-associated NAC transcription factors (TFs) (ANAC019, AtNAP, ANAC047, ANAC055, ORS1, and ORE1) as candidate downstream components of ETHYLENE-INSENSITIVE2 (EIN2). EIN3, a downstream signalling molecule of EIN2, directly bound the ORE1 and AtNAP promoters and induced their transcription. This suggests that EIN3 positively regulates leaf senescence by activating ORE1 and AtNAP, previously reported as key regulators of leaf senescence. Genetic and gene expression analyses in the ore1 atnap double mutant revealed that ORE1 and AtNAP act in distinct and overlapping signalling pathways. Transient transactivation assays further demonstrated that ORE1 and AtNAP could activate common as well as differential NAC TF targets. Collectively, the data provide insight into an EIN2-mediated senescence signalling pathway that coordinates global gene expression during leaf senescence via a gene regulatory network involving EIN3 and senescence-associated NAC TFs. PMID:24659488

  1. Does every transcript originate from a gene?

    PubMed

    Raabe, Carsten A; Brosius, Jürgen

    2015-04-01

    Outdated gene definitions favored regions corresponding to mature messenger RNAs, in particular, the open reading frame. In eukaryotes, the intergenic space was widely regarded nonfunctional and devoid of RNA transcription. Original concepts were based on the assumption that RNA expression was restricted to known protein-coding genes and a few so-called structural RNA genes, such as ribosomal RNAs or transfer RNAs. With the discovery of introns and, more recently, sensitive techniques for monitoring genome-wide transcription, this view had to be substantially modified. Tiling microarrays and RNA deep sequencing revealed myriads of transcripts, which cover almost entire genomes. The tremendous complexity of non-protein-coding RNA transcription has to be integrated into novel gene definitions. Despite an ever-growing list of functional RNAs, questions concerning the mass of identified transcripts are under dispute. Here, we examined genome-wide transcription from various angles, including evolutionary considerations, and suggest, in analogy to novel alternative splice variants that do not persist, that the vast majority of transcripts represent raw material for potential, albeit rare, exaptation events. PMID:25847549

  2. Nuclear factor of activated T cell (NFAT) transcription proteins regulate genes involved in adipocyte metabolism and lipolysis

    SciTech Connect

    Holowachuk, Eugene W. . E-mail: geneh@telenet.net

    2007-09-21

    NFAT involvement in adipocyte physiological processes was examined by treatment with CsA and/or GSK3{beta} inhibitors (Li{sup +} or TZDZ-8), which prevent or increase NFAT nuclear translocation, respectively. CsA treatment reduced basal and TNF{alpha}-induced rates of lipolysis by 50%. Adipocytes preincubated with Li{sup +} or TZDZ-8 prior to CsA and/or TNF{alpha}, exhibited enhanced basal rates of lipolysis and complete inhibition of CsA-mediated decreased rates of lipolysis. CsA treatment dramatically reduced the mRNA levels of adipocyte-specific genes (aP2, HSL, PPAR{gamma}, ACS and Adn), compared with control or TNF{alpha}-treatment, whereas Li{sup +} pretreatment blocked the inhibitory effects of CsA, and mRNA levels of aP2, HSL, PPAR{gamma}, and ACS were found at or above control levels. NFAT nuclear localization, assessed by EMSA, confirmed that CsA or Li{sup +} treatments inhibited or increased NFAT nuclear translocation, respectively. These results show that NFAT proteins in mature adipocytes participate in the transcriptional control of genes involved in adipocyte metabolism and lipolysis.

  3. Knockout of the adp gene related with colonization in Bacillus nematocida B16 using customized transcription activator-like effectors nucleases.

    PubMed

    Niu, Qiuhong; Zheng, Haoying; Zhang, Lin; Qin, Fujun; Facemire, Loryn; Zhang, Guo; Cao, Feng; Zhang, Ke-Qin; Huang, Xiaowei; Yang, Jianwei; He, Lei; Liu, Chanjuan

    2015-07-01

    Bacillus nematocida B16 is able to dominate in the intestines of the worm Caenorhabditis elegans in 'Trojan horse' pathogenic mechanism. The adp is one candidate gene which potentially play a vital role in the colonization from our previous random mutagenesis screening results. To analyse the functional role of this gene, we constructed the adp knockout mutant through customized transcription activator-like effectors nucleases (TALEN), which has been successfully used in yeasts, nematodes, zebrafish and human pluripotent cells. Here, we first time report this knockout method in bacteria on this paper. Bioassay experiments demonstrated that the adp knockout mutant of B16 showed considerably lower colonization activity, reduced numbers of intestines and less than 80% nematocidal activity compared with the wild-type strain when infected for 48 h. However, no obvious change on proteolytic activity was observed in the mutant. Conversely, the complementation of adp gene restored most of the above deficient phenotypes. These results indicated that the adp gene was involved in surface adhesion and played a comparatively important role in colonizing host nematodes. Moreover, TALENs successfully disrupt target genes in bacteria. PMID:25912819

  4. Knockout of the adp gene related with colonization in Bacillus nematocida B16 using customized transcription activator-like effectors nucleases

    PubMed Central

    Niu, Qiuhong; Zheng, Haoying; Zhang, Lin; Qin, Fujun; Facemire, Loryn; Zhang, Guo; Cao, Feng; Zhang, Ke-qin; Huang, Xiaowei; Yang, Jianwei; He, Lei; Liu, Chanjuan

    2015-01-01

    Bacillus nematocida B16 is able to dominate in the intestines of the worm Caenorhabditis elegans in ‘Trojan horse’ pathogenic mechanism. The adp is one candidate gene which potentially play a vital role in the colonization from our previous random mutagenesis screening results. To analyse the functional role of this gene, we constructed the adp knockout mutant through customized transcription activator-like effectors nucleases (TALEN), which has been successfully used in yeasts, nematodes, zebrafish and human pluripotent cells. Here, we first time report this knockout method in bacteria on this paper. Bioassay experiments demonstrated that the adp knockout mutant of B16 showed considerably lower colonization activity, reduced numbers of intestines and less than 80% nematocidal activity compared with the wild-type strain when infected for 48 h. However, no obvious change on proteolytic activity was observed in the mutant. Conversely, the complementation of adp gene restored most of the above deficient phenotypes. These results indicated that the adp gene was involved in surface adhesion and played a comparatively important role in colonizing host nematodes. Moreover, TALENs successfully disrupt target genes in bacteria. PMID:25912819

  5. Hypoxia-induced endothelial NO synthase gene transcriptional activation is mediated through the tax-responsive element in endothelial cells.

    PubMed

    Min, Jiho; Jin, Yoon-Mi; Moon, Je-Sung; Sung, Min-Sun; Jo, Sangmee Ahn; Jo, Inho

    2006-06-01

    Although hypoxia is known to induce upregulation of endothelial NO synthase (eNOS) gene expression, the underlying mechanism is largely unclear. In this study, we show that hypoxia increases eNOS gene expression through the binding of phosphorylated cAMP-responsive element binding (CREB) protein (pCREB) to the eNOS gene promoter. Hypoxia (1% O2) increased both eNOS expression and NO production, peaking at 24 hours, in bovine aortic endothelial cells, and these increases were accompanied by increases in pCREB. Treatment with the protein kinase A inhibitor H-89 or transfection with dominant-negative inhibitor of CREB reversed the hypoxia-induced increases in eNOS expression and NO production, with concomitant inhibition of the phosphorylation of CREB induced by hypoxia, suggesting an involvement of protein kinase A/pCREB-mediated pathway. To map the regulatory elements of the eNOS gene responsible for pCREB binding under hypoxia, we constructed an eNOS gene promoter (-1600 to +22 nucleotides) fused with a luciferase reporter gene [pGL2-eNOS(-1600)]. Hypoxia (for 24-hour incubation) increased the promoter activity by 2.36+/-0.18-fold in the bovine aortic endothelial cells transfected with pGL2-eNOS(-1600). However, progressive 5'-deletion from -1600 to -873 completely attenuated the hypoxia-induced increase in promoter activity. Electrophoretic mobility shift, anti-pCREB antibody supershift, and site-specific mutation analyses showed that pCREB is bound to the Tax-responsive element (TRE) site, a cAMP-responsive element-like site, located at -924 to -921 of the eNOS promoter. Our data demonstrate that the interaction between pCREB and the Tax-responsive element site within the eNOS promoter may represent a novel mechanism for the mediation of hypoxia-stimulated eNOS gene expression. PMID:16651461

  6. Azotobacter vinelandii NIFL is a flavoprotein that modulates transcriptional activation of nitrogen-fixation genes via a redox-sensitive switch.

    PubMed

    Hill, S; Austin, S; Eydmann, T; Jones, T; Dixon, R

    1996-03-01

    The NIFL regulatory protein controls transcriptional activation of nitrogen fixation (nif) genes in Azotobacter vinelandii by direct interaction with the enhancer binding protein NIFA. Modulation of NIFA activity by NIFL, in vivo occurs in response to external oxygen concentration or the level of fixed nitrogen. Spectral features of purified NIFL and chromatographic analysis indicate that it is a flavoprotein with FAD as the prosthetic group, which undergoes reduction in the presence of sodium dithionite. Under anaerobic conditions, the oxidized form of NIFL inhibits transcriptional activation by NIFA in vitro, and this inhibition is reversed when NIFL is in the reduced form. Hence NIFL is a redox-sensitive regulatory protein and may represent a type of flavoprotein in which electron transfer is not coupled to an obvious catalytic activity. In addition to its ability to act as a redox sensor, the activity of NIFL is also responsive to adenosine nucleotides, particularly ADP. This response overrides the influence of redox status on NIFL and is also observed with refolded NIFL apoprotein, which lacks the flavin moiety. These observations suggest that both energy and redox status are important determinants of nif gene regulation in vivo. PMID:8700899

  7. Azotobacter vinelandii NIFL is a flavoprotein that modulates transcriptional activation of nitrogen-fixation genes via a redox-sensitive switch.

    PubMed Central

    Hill, S; Austin, S; Eydmann, T; Jones, T; Dixon, R

    1996-01-01

    The NIFL regulatory protein controls transcriptional activation of nitrogen fixation (nif) genes in Azotobacter vinelandii by direct interaction with the enhancer binding protein NIFA. Modulation of NIFA activity by NIFL, in vivo occurs in response to external oxygen concentration or the level of fixed nitrogen. Spectral features of purified NIFL and chromatographic analysis indicate that it is a flavoprotein with FAD as the prosthetic group, which undergoes reduction in the presence of sodium dithionite. Under anaerobic conditions, the oxidized form of NIFL inhibits transcriptional activation by NIFA in vitro, and this inhibition is reversed when NIFL is in the reduced form. Hence NIFL is a redox-sensitive regulatory protein and may represent a type of flavoprotein in which electron transfer is not coupled to an obvious catalytic activity. In addition to its ability to act as a redox sensor, the activity of NIFL is also responsive to adenosine nucleotides, particularly ADP. This response overrides the influence of redox status on NIFL and is also observed with refolded NIFL apoprotein, which lacks the flavin moiety. These observations suggest that both energy and redox status are important determinants of nif gene regulation in vivo. Images Fig. 2 PMID:8700899

  8. A cluster region of AP-1 responsive elements is required for transcriptional activity of mouse ODC gene by hepatocyte growth factor.

    PubMed

    Bianchi, Laura; Tacchini, Lorenza; Matteucci, Emanuela; Desiderio, Maria Alfonsina

    2002-05-01

    Ornithine decarboxylase (ODC) activity is regulated by a variety of mechanisms including transcription, translation, and RNA and protein half-life. Since in mouse B16-F1 melanoma cells an early and remarkable (about 6-fold) increase in steady state mRNA levels was observed after hepatocyte growth factor (HGF) treatment, we investigated the transcriptional regulation of mouse ODC promoter. Transient transfection of various ODC-luciferase promoter constructs into the B16-Fl cells in combination with electrophoretic mobility shift assays identified the HGF-responsive element as a cluster of three AP-1 binding sites (-1660 to -1572). Even if each site differs from the canonical TPA responsive element for one nucleotide, only the first two AP-1 consensus sequences seemed to be functional since allowed DNA-binding activity of nuclear proteins after HGF treatment. Comparison of the results of transfection assays with the pOD2.5-luc (2.5 kb gene fragment) and with the construct deprived of the AP-1 cluster pOD-B-luc showed that this 50 bp region was required for ODC transactivating activity in response to HGF. Since in B16-F1 cells HGF increased AP-1 activity and the mRNA expression of various AP-1 subunits, we may conclude that HGF-induced transcription of mouse ODC was largely due to triggering of AP-1 pathway. PMID:12054494

  9. Transcriptional activation of the tumor suppressor and differentiation gene S100A2 by a novel p63-binding site.

    PubMed

    Kirschner, Ralf D; Sänger, Katja; Müller, Gerd A; Engeland, Kurt

    2008-05-01

    S100A2 is generally found expressed in the epidermis and was recently shown to play a crucial role in the differentiation of keratinocytes. Also known as CaN19, S100A2 was identified as a potential tumor suppressor. Expression of S100A2 is upregulated by p53. The proteins p63 and p73 are related to p53 and are expressed as several splice variants with partially overlapping tasks but also functions different from p53. It had been shown that p63 proteins with mutations in their DNA-binding domain cause severe phenotypes in man as autosomal dominantly inherited disease including EEC, AEC, SHFM, LMS and ADULT syndromes. Here we show that S100A2 is a transcriptional target of p63/p73 family members, particularly the p63 splice variant TAp63gamma. The regulation is mediated by a novel transcriptional element in the S100A2 promoter which is bound by TAp63gamma but not by p53. Mutant p63 proteins derived from EEC and ADULT syndrome patients cannot activate S100A2 transcription whereas SHFM-related mutants still can stimulate the S100A2 promoter. Consistent with a function in tumor suppression S100A2 expression is stimulated upon DNA damage. After doxorubicin treatment p63gamma proteins are recruited to the S100A2 promoter in vivo. This may indicate a function of the p63-dependent S100A2 regulation in tumor suppression. PMID:18388131

  10. The Etv1 transcription factor activity-dependently downregulates a set of genes controlling cell growth and differentiation in maturing cerebellar granule cells.

    PubMed

    Okazawa, Makoto; Abe, Haruka; Nakanishi, Shigetada

    2016-05-13

    In the early postnatal period, cerebellar granule cells exhibit an activity-dependent downregulation of a set of immaturation genes involved in cell growth and migration and are shifted to establishment of a mature network formation. Through the use of a granule cell culture and both pharmacological and RNA interference (siRNA) analyses, the present investigation revealed that the downregulation of these immaturation genes is controlled by strikingly unified signaling mechanisms that operate sequentially through the stimulation of AMPA and NMDA receptors, tetrodotoxin-sensitive Na(+) channels and Ca(2+)/calmodulin-dependent protein kinase II (CaMKII). This signaling cascade induces the Etv1 transcription factor, and knockdown of Etv1 by a siRNA technique prevented this activity-dependent downregulation of immaturation genes. Thus, taken into consideration the mechanism that controls the upregulation of maturation genes involved in synaptic formation, these results indicate that Etv1 orchestrates the activity-dependent regulation of both maturation and immaturation genes in developing granule cells and plays a key role in specifying the identity of mature granule cells in the cerebellum. PMID:27059140

  11. Constitutive activation of Epstein-Barr virus (EBV) nuclear antigen 1 gene transcription by IRF1 and IRF2 during restricted EBV latency.

    PubMed Central

    Schaefer, B C; Paulson, E; Strominger, J L; Speck, S H

    1997-01-01

    The Epstein-Barr virus (EBV) EBNA1 gene promoter active in the type I program of restricted viral latency was recently identified and shown to reside in the viral BamHI Q fragment. This promoter, Qp, is active in a wide variety of cell lines and has an architecture reminiscent of eukaryotic housekeeping gene promoters (B. C. Schaefer, J. L. Strominger, and S. H. Speck, Proc. Natl. Acad. Sci. USA 92:10565-10569, 1995; B. C. Schaefer, J. L. Strominger, and S. H. Speck, Mol. Cell. Biol. 17:364-377, 1997). Here we demonstrate by deletion analysis that the important cis-acting elements regulating Qp are clustered in a relatively small region (ca. 80 bp) surrounding the site of transcription initiation. Immediately upstream of the site of initiation is a region which is protected from DNase I digestion by crude nuclear extracts. Electrophoretic mobility shift analyses (EMSA) employing probes spanning this region demonstrated the presence of two major protein complexes. Deletion analysis of Qp demonstrated that at least one of these complexes plays an important role in Qp activity. Evidence that interferon response factor 2 (IRF2) is a major constituent of the most prominent EMSA complex and that IRF1 may be a minor component of this complex is presented. Transfections into IRF1-/-, IRF2-/-, and IRF1,2-/- fibroblasts demonstrated that absence of both IRF1 and IRF2 reduced Qp activity to approximately the same extent as mutation of the IRF-binding site in Qp, strongly implicating IRF2, and perhaps IRF1, in the regulation of Qp activity. Notably, transcription from Qp was not inducible by either alpha or gamma interferon in EBV-negative B cells but rather was shown to be constitutively activated by IRF1 and IRF2. This observation suggests that IRF1 and IRF2 have a previously unrecognized role as constitutive activators of specific genes. Additionally, data presented indicate that a protein complex containing the nonhistone architectural protein HMG-I(Y) binds to the region

  12. Transcriptional Activity of the MADS Box ARLEQUIN/TOMATO AGAMOUS-LIKE1 Gene Is Required for Cuticle Development of Tomato Fruit1

    PubMed Central

    Giménez, Estela; Dominguez, Eva; Pineda, Benito; Heredia, Antonio; Moreno, Vicente; Angosto, Trinidad

    2015-01-01

    Fruit development and ripening entail key biological and agronomic events, which ensure the appropriate formation and dispersal of seeds and determine productivity and yield quality traits. The MADS box gene ARLEQUIN/TOMATO AGAMOUS-LIKE1 (hereafter referred to as TAGL1) was reported as a key regulator of tomato (Solanum lycopersicum) reproductive development, mainly involved in flower development, early fruit development, and ripening. It is shown here that silencing of the TAGL1 gene (RNA interference lines) promotes significant changes affecting cuticle development, mainly a reduction of thickness and stiffness, as well as a significant decrease in the content of cuticle components (cutin, waxes, polysaccharides, and phenolic compounds). Accordingly, overexpression of TAGL1 significantly increased the amount of cuticle and most of its components while rendering a mechanically weak cuticle. Expression of the genes involved in cuticle biosynthesis agreed with the biochemical and biomechanical features of cuticles isolated from transgenic fruits; it also indicated that TAGL1 participates in the transcriptional control of cuticle development mediating the biosynthesis of cuticle components. Furthermore, cell morphology and the arrangement of epidermal cell layers, on whose activity cuticle formation depends, were altered when TAGL1 was either silenced or constitutively expressed, indicating that this transcription factor regulates cuticle development, probably through the biosynthetic activity of epidermal cells. Our results also support cuticle development as an integrated event in the fruit expansion and ripening processes that characterize fleshy-fruited species such as tomato. PMID:26019301

  13. Ascorbic acid-dependent gene expression in Streptococcus pneumoniae and the activator function of the transcriptional regulator UlaR2

    PubMed Central

    Afzal, Muhammad; Shafeeq, Sulman; Kuipers, Oscar P.

    2015-01-01

    In this study, we have explored the impact of ascorbic acid on the transcriptome of Streptococcus pneumoniae D39. The expression of several genes and operons, including the ula operon (which has been previously shown to be involved in ascorbic acid utilization), the AdcR regulon (which has been previously shown to be involved in zinc transport and virulence) and a PTS operon (which we denote here as ula2 operon) were altered in the presence of ascorbic acid. The ula2 operon consists of five genes, including the transcriptional activator ulaR2. Our β-galactosidase assay data and transcriptome comparison of the ulaR2 mutant with the wild-type demonstrated that the transcriptional activator UlaR2 in the presence of ascorbic acid activates the expression of the ula2 operon. We further predict a 16-bp regulatory site (5′-ATATTGTGCTCAAATA-3′) for UlaR2 in the Pula2. Furthermore, we have explored the effect of ascorbic acid on the expression of the AdcR regulon. Our ICP-MS analysis showed that addition of ascorbic acid to the medium causes zinc starvation in the cell which leads to the activation of the AdcR regulon. PMID:25717320

  14. Identification of the cAMP response element that controls transcriptional activation of the insulin-like growth factor-I gene by prostaglandin E2 in osteoblasts

    NASA Technical Reports Server (NTRS)

    Thomas, M. J.; Umayahara, Y.; Shu, H.; Centrella, M.; Rotwein, P.; McCarthy, T. L.

    1996-01-01

    Insulin-like growth factor-I (IGF-I), a multifunctional growth factor, plays a key role in skeletal growth and can enhance bone cell replication and differentiation. We previously showed that prostaglandin E2 (PGE2) and other agents that increase cAMP activated IGF-I gene transcription in primary rat osteoblast cultures through promoter 1 (P1), the major IGF-I promoter, and found that transcriptional induction was mediated by protein kinase A. We now have identified a short segment of P1 that is essential for full hormonal regulation and have characterized inducible DNA-protein interactions involving this site. Transient transfections of IGF-I P1 reporter genes into primary rat osteoblasts showed that the 328-base pair untranslated region of exon 1 was required for a full 5.3-fold response to PGE2; mutation in a previously footprinted site, HS3D (base pairs +193 to +215), reduced induction by 65%. PGE2 stimulated nuclear protein binding to HS3D. Binding, as determined by gel mobility shift assay, was not seen in nuclear extracts from untreated osteoblast cultures, was detected within 2 h of PGE2 treatment, and was maximal by 4 h. This DNA-protein interaction was not observed in cytoplasmic extracts from PGE2-treated cultures, indicating nuclear localization of the protein kinase A-activated factor(s). Activation of this factor was not blocked by cycloheximide (Chx), and Chx did not impair stimulation of IGF-I gene expression by PGE2. In contrast, binding to a consensus cAMP response element (CRE; 5'-TGACGTCA-3') from the rat somatostatin gene was not modulated by PGE2 or Chx. Competition gel mobility shift analysis using mutated DNA probes identified 5'-CGCAATCG-3' as the minimal sequence needed for inducible binding. All modified IGF-I P1 promoterreporter genes with mutations within this CRE sequence also showed a diminished functional response to PGE2. These results identify the CRE within the 5'-untranslated region of IGF-I exon 1 that is required for hormonal

  15. TGF-beta transcriptionally activates the gene encoding the high-affinity adenosine transporter CNT2 in rat liver parenchymal cells.

    PubMed

    Valdés, R; Fernández-Veledo, S; Aymerich, I; Casado, F J; Pastor-Anglada, M

    2006-11-01

    The nucleoside transporter CNT2 is the highest-affinity adenosine transporter identified so far. Recent evidence suggests that CNT2 has functions other than salvage (i.e. modulation of purinergic responses). Here we identified TGF-beta1 as a potent inducer of CNT2 protein expression in liver parenchymal cells. By contrast, CNT1, which is a target of multifunctional cytokines involved in liver cell proliferation, does not respond to TGF-beta1 treatment. Cloning of a murine CNT2 gene sequence with promoter-like activity enabled us to demonstrate that this cytokine exerts this effect by transcriptionally activating the CNT2-encoding gene in a JNK-dependent manner. The evidence that CNT2 is not a target of multifunctional cytokines involved in hepatocyte proliferation, but instead, of a cytokine that plays major roles in differentiation and apoptosis, further supports the view that the main physiological role of this transporter protein is not nucleoside salvage. PMID:17013559

  16. The transcriptional regulation of regucalcin gene expression.

    PubMed

    Yamaguchi, Masayoshi

    2011-01-01

    Regucalcin, which is discovered as a calcium-binding protein in 1978, has been shown to play a multifunctional role in many tissues and cell types; regucalcin has been proposed to play a pivotal role in keeping cell homeostasis and function for cell response. Regucalcin and its gene are identified in over 15 species consisting of regucalcin family. Comparison of the nucleotide sequences of regucalcin from vertebrate species is highly conserved in their coding region with throughout evolution. The regucalcin gene is localized on the chromosome X in rat and human. The organization of rat regucalcin gene consists of seven exons and six introns and several consensus regulatory elements exist upstream of the 5'-flanking region. AP-1, NF1-A1, RGPR-p117, β-catenin, and other factors have been found to be a transcription factor in the enhancement of regucalcin gene promoter activity. The transcription activity of regucalcin gene is enhanced through intracellular signaling factors that are mediated through the phosphorylation and dephosphorylation of nuclear protein in vitro. Regucalcin mRNA and its protein are markedly expressed in the liver and kidney cortex of rats. The expression of regucalcin mRNA in the liver and kidney cortex has been shown to stimulate by hormonal factors (including calcium, calcitonin, parathyroid hormone, insulin, estrogen, and dexamethasone) in vivo. Regucalcin mRNA expression is enhanced in the regenerating liver after partial hepatectomy of rats in vivo. The expression of regucalcin mRNA in the liver and kidney with pathophysiological state has been shown to suppress, suggesting an involvement of regucalcin in disease. Liver regucalcin expression is down-regulated in tumor cells, suggesting a suppressive role in the development of carcinogenesis. Liver regucalcin is markedly released into the serum of rats with chemically induced liver injury in vivo. Serum regucalcin has a potential sensitivity as a specific biochemical marker of chronic

  17. Convergent Transcription of Interferon-stimulated Genes by TNF-α and IFN-α Augments Antiviral Activity against HCV and HEV

    PubMed Central

    Wang, Wenshi; Xu, Lei; Brandsma, Johannes H.; Wang, Yijin; Hakim, Mohamad S.; Zhou, Xinying; Yin, Yuebang; Fuhler, Gwenny M.; van der Laan, Luc J. W.; van der Woude, C. Janneke; Sprengers, Dave; Metselaar, Herold J.; Smits, Ron; Poot, Raymond A.; Peppelenbosch, Maikel P.; Pan, Qiuwei

    2016-01-01

    IFN-α has been used for decades to treat chronic hepatitis B and C, and as an off-label treatment for some cases of hepatitis E virus (HEV) infection. TNF-α is another important cytokine involved in inflammatory disease, which can interact with interferon signaling. Because interferon-stimulated genes (ISGs) are the ultimate antiviral effectors of the interferon signaling, this study aimed to understand the regulation of ISG transcription and the antiviral activity by IFN-α and TNF-α. In this study, treatment of TNF-α inhibited replication of HCV by 71 ± 2.4% and HEV by 41 ± 4.9%. Interestingly, TNF-α induced the expression of a panel of antiviral ISGs (2-11 fold). Blocking the TNF-α signaling by Humira abrogated ISG induction and its antiviral activity. Chip-seq data analysis and mutagenesis assay further revealed that the NF-κB protein complex, a key downstream element of TNF-α signaling, directly binds to the ISRE motif in the ISG promoters and thereby drives their transcription. This process is independent of interferons and JAK-STAT cascade. Importantly, when combined with IFN-α, TNF-α works cooperatively on ISG induction, explaining their additive antiviral effects. Thus, our study reveals a novel mechanism of convergent transcription of ISGs by TNF-α and IFN-α, which augments their antiviral activity against HCV and HEV. PMID:27150018

  18. Convergent Transcription of Interferon-stimulated Genes by TNF-α and IFN-α Augments Antiviral Activity against HCV and HEV.

    PubMed

    Wang, Wenshi; Xu, Lei; Brandsma, Johannes H; Wang, Yijin; Hakim, Mohamad S; Zhou, Xinying; Yin, Yuebang; Fuhler, Gwenny M; van der Laan, Luc J W; van der Woude, C Janneke; Sprengers, Dave; Metselaar, Herold J; Smits, Ron; Poot, Raymond A; Peppelenbosch, Maikel P; Pan, Qiuwei

    2016-01-01

    IFN-α has been used for decades to treat chronic hepatitis B and C, and as an off-label treatment for some cases of hepatitis E virus (HEV) infection. TNF-α is another important cytokine involved in inflammatory disease, which can interact with interferon signaling. Because interferon-stimulated genes (ISGs) are the ultimate antiviral effectors of the interferon signaling, this study aimed to understand the regulation of ISG transcription and the antiviral activity by IFN-α and TNF-α. In this study, treatment of TNF-α inhibited replication of HCV by 71 ± 2.4% and HEV by 41 ± 4.9%. Interestingly, TNF-α induced the expression of a panel of antiviral ISGs (2-11 fold). Blocking the TNF-α signaling by Humira abrogated ISG induction and its antiviral activity. Chip-seq data analysis and mutagenesis assay further revealed that the NF-κB protein complex, a key downstream element of TNF-α signaling, directly binds to the ISRE motif in the ISG promoters and thereby drives their transcription. This process is independent of interferons and JAK-STAT cascade. Importantly, when combined with IFN-α, TNF-α works cooperatively on ISG induction, explaining their additive antiviral effects. Thus, our study reveals a novel mechanism of convergent transcription of ISGs by TNF-α and IFN-α, which augments their antiviral activity against HCV and HEV. PMID:27150018

  19. Bortezomib induces DNA hypomethylation and silenced gene transcription by interfering with Sp1/NF-κB–dependent DNA methyltransferase activity in acute myeloid leukemia

    PubMed Central

    Liu, Shujun; Liu, Zhongfa; Xie, Zhiliang; Pang, Jiuxia; Yu, Jianhua; Lehmann, Esther; Huynh, Lenguyen; Vukosavljevic, Tamara; Takeki, Mitsui; Klisovic, Rebecca B.; Baiocchi, Robert A.; Blum, William; Porcu, Pierluigi; Garzon, Ramiro; Byrd, John C.; Perrotti, Danilo; Caligiuri, Michael A.; Chan, Kenneth K.; Wu, Lai-Chu

    2008-01-01

    Bortezomib reversibly inhibits 26S proteasomal degradation, interferes with NF-κB, and exhibits antitumor activity in human malignancies. Zinc finger protein Sp1 transactivates DNMT1 gene in mice and is functionally regulated through protein abundance, posttranslational modifications (ie, ubiquitination), or interaction with other transcription factors (ie, NF-κB). We hypothesize that inhibition of proteasomal degradation and Sp1/NF-κB–mediated transactivation may impair aberrant DNA methyltransferase activity. We show here that, in addition to inducing accumulation of polyubiquitinated proteins and abolishment of NF-κB activities, bortezomib decreases Sp1 protein levels, disrupts the physical interaction of Sp1/NF-κB, and prevents binding of the Sp1/NF-κB complex to the DNMT1 gene promoter. Abrogation of Sp1/NF-κB complex by bortezomib causes transcriptional repression of DNMT1 gene and down-regulation of DNMT1 protein, which in turn induces global DNA hypomethylation in vitro and in vivo and re-expression of epigenetically silenced genes in human cancer cells. The involvement of Sp1/NF-κB in DNMT1 regulation is further demonstrated by the observation that Sp1 knockdown using mithramycin A or shRNA decreases DNMT1 protein levels, which instead are increased by Sp1 or NF-κB overexpression. Our results unveil the Sp1/NF-κB pathway as a modulator of DNA methyltransferase activity in human cancer and identify bortezomib as a novel epigenetic-targeting drug. PMID:18083845

  20. Structural basis of eukaryotic gene transcription.

    PubMed

    Boeger, Hinrich; Bushnell, David A; Davis, Ralph; Griesenbeck, Joachim; Lorch, Yahli; Strattan, J Seth; Westover, Kenneth D; Kornberg, Roger D

    2005-02-01

    An RNA polymerase II promoter has been isolated in transcriptionally activated and repressed states. Topological and nuclease digestion analyses have revealed a dynamic equilibrium between nucleosome removal and reassembly upon transcriptional activation, and have further shown that nucleosomes are removed by eviction of histone octamers rather than by sliding. The promoter, once exposed, assembles with RNA polymerase II, general transcription factors, and Mediator in a approximately 3 MDa transcription initiation complex. X-ray crystallography has revealed the structure of RNA polymerase II, in the act of transcription, at atomic resolution. Extension of this analysis has shown how nucleotides undergo selection, polymerization, and eventual release from the transcribing complex. X-ray and electron crystallography have led to a picture of the entire transcription initiation complex, elucidating the mechanisms of promoter recognition, DNA unwinding, abortive initiation, and promoter escape. PMID:15680971

  1. A position-dependent transcription-activating domain in TFIIIA.

    PubMed

    Mao, X; Darby, M K

    1993-12-01

    Transcription of the Xenopus 5S RNA gene by RNA polymerase III requires the gene-specific factor TFIIIA. To identify domains within TFIIIA that are essential for transcriptional activation, we have expressed C-terminal deletion, substitution, and insertion mutants of TFIIIA in bacteria as fusions with maltose-binding protein (MBP). The MBP-TFIIIA fusion protein specifically binds to the 5S RNA gene internal control region and complements transcription in a TFIIIA-depleted oocyte nuclear extract. Random, cassette-mediated mutagenesis of the carboxyl region of TFIIIA, which is not required for promoter binding, has defined a 14-amino-acid region that is critical for transcriptional activation. In contrast to activators of RNA polymerase II, the activity of the TFIIIA activation domain is strikingly sensitive to its position relative to the DNA-binding domain. When the eight amino acids that separate the transcription-activating domain from the last zinc finger are deleted, transcriptional activity is lost. Surprisingly, diverse amino acids can replace these eight amino acids with restoration of full transcriptional activity, suggesting that the length and not the sequence of this region is important. Insertion of amino acids between the zinc finger region and the transcription-activating domain causes a reduction in transcription proportional to the number of amino acids introduced. We propose that to function, the transcription-activating domain of TFIIIA must be correctly positioned at a minimum distance from the DNA-binding domain. PMID:8246967

  2. Regulation of Lactobacillus casei sorbitol utilization genes requires DNA-binding transcriptional activator GutR and the conserved protein GutM.

    PubMed

    Alcántara, Cristina; Sarmiento-Rubiano, Luz Adriana; Monedero, Vicente; Deutscher, Josef; Pérez-Martínez, Gaspar; Yebra, María J

    2008-09-01

    Sequence analysis of the five genes (gutRMCBA) downstream from the previously described sorbitol-6-phosphate dehydrogenase-encoding Lactobacillus casei gutF gene revealed that they constitute a sorbitol (glucitol) utilization operon. The gutRM genes encode putative regulators, while the gutCBA genes encode the EIIC, EIIBC, and EIIA proteins of a phosphoenolpyruvate-dependent sorbitol phosphotransferase system (PTS(Gut)). The gut operon is transcribed as a polycistronic gutFRMCBA messenger, the expression of which is induced by sorbitol and repressed by glucose. gutR encodes a transcriptional regulator with two PTS-regulated domains, a galactitol-specific EIIB-like domain (EIIB(Gat) domain) and a mannitol/fructose-specific EIIA-like domain (EIIA(Mtl) domain). Its inactivation abolished gut operon transcription and sorbitol uptake, indicating that it acts as a transcriptional activator. In contrast, cells carrying a gutB mutation expressed the gut operon constitutively, but they failed to transport sorbitol, indicating that EIIBC(Gut) negatively regulates GutR. A footprint analysis showed that GutR binds to a 35-bp sequence upstream from the gut promoter. A sequence comparison with the presumed promoter region of gut operons from various firmicutes revealed a GutR consensus motif that includes an inverted repeat. The regulation mechanism of the L. casei gut operon is therefore likely to be operative in other firmicutes. Finally, gutM codes for a conserved protein of unknown function present in all sequenced gut operons. A gutM mutant, the first constructed in a firmicute, showed drastically reduced gut operon expression and sorbitol uptake, indicating a regulatory role also for GutM. PMID:18676710

  3. Activation of the Yeast UBI4 Polyubiquitin Gene by Zap1 Transcription Factor via an Intragenic Promoter Is Critical for Zinc-deficient Growth.

    PubMed

    MacDiarmid, Colin W; Taggart, Janet; Jeong, Jeeyon; Kerdsomboon, Kittikhun; Eide, David J

    2016-09-01

    Stability of many proteins requires zinc. Zinc deficiency disrupts their folding, and the ubiquitin-proteasome system may help manage this stress. In Saccharomyces cerevisiae, UBI4 encodes five tandem ubiquitin monomers and is essential for growth in zinc-deficient conditions. Although UBI4 is only one of four ubiquitin-encoding genes in the genome, a dramatic decrease in ubiquitin was observed in zinc-deficient ubi4Δ cells. The three other ubiquitin genes were strongly repressed under these conditions, contributing to the decline in ubiquitin. In a screen for ubi4Δ suppressors, a hypomorphic allele of the RPT2 proteasome regulatory subunit gene (rpt2(E301K)) suppressed the ubi4Δ growth defect. The rpt2(E301K) mutation also increased ubiquitin accumulation in zinc-deficient cells, and by using a ubiquitin-independent proteasome substrate we found that proteasome activity was reduced. These results suggested that increased ubiquitin supply in suppressed ubi4Δ cells was a consequence of more efficient ubiquitin release and recycling during proteasome degradation. Degradation of a ubiquitin-dependent substrate was restored by the rpt2(E301K) mutation, indicating that ubiquitination is rate-limiting in this process. The UBI4 gene was induced ∼5-fold in low zinc and is regulated by the zinc-responsive Zap1 transcription factor. Surprisingly, Zap1 controls UBI4 by inducing transcription from an intragenic promoter, and the resulting truncated mRNA encodes only two of the five ubiquitin repeats. Expression of a short transcript alone complemented the ubi4Δ mutation, indicating that it is efficiently translated. Loss of Zap1-dependent UBI4 expression caused a growth defect in zinc-deficient conditions. Thus, the intragenic UBI4 promoter is critical to preventing ubiquitin deficiency in zinc-deficient cells. PMID:27432887

  4. Regulation of Lactobacillus casei Sorbitol Utilization Genes Requires DNA-Binding Transcriptional Activator GutR and the Conserved Protein GutM▿

    PubMed Central

    Alcántara, Cristina; Sarmiento-Rubiano, Luz Adriana; Monedero, Vicente; Deutscher, Josef; Pérez-Martínez, Gaspar; Yebra, María J.

    2008-01-01

    Sequence analysis of the five genes (gutRMCBA) downstream from the previously described sorbitol-6-phosphate dehydrogenase-encoding Lactobacillus casei gutF gene revealed that they constitute a sorbitol (glucitol) utilization operon. The gutRM genes encode putative regulators, while the gutCBA genes encode the EIIC, EIIBC, and EIIA proteins of a phosphoenolpyruvate-dependent sorbitol phosphotransferase system (PTSGut). The gut operon is transcribed as a polycistronic gutFRMCBA messenger, the expression of which is induced by sorbitol and repressed by glucose. gutR encodes a transcriptional regulator with two PTS-regulated domains, a galactitol-specific EIIB-like domain (EIIBGat domain) and a mannitol/fructose-specific EIIA-like domain (EIIAMtl domain). Its inactivation abolished gut operon transcription and sorbitol uptake, indicating that it acts as a transcriptional activator. In contrast, cells carrying a gutB mutation expressed the gut operon constitutively, but they failed to transport sorbitol, indicating that EIIBCGut negatively regulates GutR. A footprint analysis showed that GutR binds to a 35-bp sequence upstream from the gut promoter. A sequence comparison with the presumed promoter region of gut operons from various firmicutes revealed a GutR consensus motif that includes an inverted repeat. The regulation mechanism of the L. casei gut operon is therefore likely to be operative in other firmicutes. Finally, gutM codes for a conserved protein of unknown function present in all sequenced gut operons. A gutM mutant, the first constructed in a firmicute, showed drastically reduced gut operon expression and sorbitol uptake, indicating a regulatory role also for GutM. PMID:18676710

  5. Identification and expression profiling analysis of calmodulin-binding transcription activator genes in maize (Zea mays L.) under abiotic and biotic stresses

    PubMed Central

    Yue, Runqing; Lu, Caixia; Sun, Tao; Peng, Tingting; Han, Xiaohua; Qi, Jianshuang; Yan, Shufeng; Tie, Shuanggui

    2015-01-01

    The calmodulin-binding transcription activators (CAMTA) play critical roles in plant growth and responses to environmental stimuli. However, how CAMTAs function in responses to abiotic and biotic stresses in maize (Zea mays L.) is largely unknown. In this study, we first identified all the CAMTA homologous genes in the whole genome of maize. The results showed that nine ZmCAMTA genes showed highly diversified gene structures and tissue-specific expression patterns. Many ZmCAMTA genes displayed high expression levels in the roots. We then surveyed the distribution of stress-related cis-regulatory elements in the −1.5 kb promoter regions of ZmCAMTA genes. Notably, a large number of stress-related elements present in the promoter regions of some ZmCAMTA genes, indicating a genetic basis of stress expression regulation of these genes. Quantitative real-time PCR was used to test the expression of ZmCAMTA genes under several abiotic stresses (drought, salt, and cold), various stress-related hormones [abscisic acid, auxin, salicylic acid (SA), and jasmonic acid] and biotic stress [rice black-streaked dwarf virus (RBSDV) infection]. Furthermore, the expression pattern of ZmCAMTA genes under RBSDV infection was analyzed to investigate their potential roles in responses of different maize cultivated varieties to RBSDV. The expression of most ZmCAMTA genes responded to both abiotic and biotic stresses. The data will help us to understand the roles of CAMTA-mediated Ca2+ signaling in maize tolerance to environmental stresses. PMID:26284092

  6. Topologies for perfect adaptation in gene transcription

    NASA Astrophysics Data System (ADS)

    Shi, Wenjia; Tang, Chao

    2014-03-01

    Adaptation is commonly used in sensory systems and signaling networks to allow the detection of further stimuli. Despite enzymatic network topologies for adaptation have been investigated systematically, the topology of transcriptional network that could perform adaptation still remains unclear, due to the complexity of transcriptional regulation. Here, we systematically investigated all three-node transcriptional networks, and found the topologies of transcriptional networks for adaptation are different from that of enzymatic ones. While both negative feedback loop (NFBL) and incoherent feed forward loop (IFFL) are capable of performing adaptation analytically, a positive self-regulation on buffer node is necessary for NFBL topology and more flexible structures emerge for IFFL than that of enzymatic networks. Most of the simulation results agree with analytical predictions. This study may explain the mechanism of adapted gene regulation behavior and supply a design table for gene regulatory adaptation.

  7. Aeromonas hydrophila Lateral Flagellar Gene Transcriptional Hierarchy

    PubMed Central

    Wilhelms, Markus; Gonzalez, Victor; Merino, Susana

    2013-01-01

    Aeromonas hydrophila AH-3 lateral flagella are not assembled when bacteria grow in liquid media; however, lateral flagellar genes are transcribed. Our results indicate that A. hydrophila lateral flagellar genes are transcribed at three levels (class I to III genes) and share some similarities with, but have many important differences from, genes of Vibrio parahaemolyticus. A. hydrophila lateral flagellum class I gene transcription is σ70 dependent, which is consistent with the fact that lateral flagellum is constitutively transcribed, in contrast to the characteristics of V. parahaemolyticus. The fact that multiple genes are included in class I highlights that lateral flagellar genes are less hierarchically transcribed than polar flagellum genes. The A. hydrophila lafK-fliEJL gene cluster (where the subscript L distinguishes genes for lateral flagella from those for polar flagella) is exclusively from class I and is in V. parahaemolyticus class I and II. Furthermore, the A. hydrophila flgAMNL cluster is not transcribed from the σ54/LafK-dependent promoter and does not contain class II genes. Here, we propose a gene transcriptional hierarchy for the A. hydrophila lateral flagella. PMID:23335410

  8. Conserved Structural Domains in FoxD4L1, a Neural Forkhead Box Transcription Factor, Are Required to Repress or Activate Target Genes

    PubMed Central

    Klein, Steven L.; Neilson, Karen M.; Orban, John; Yaklichkin, Sergey; Hoffbauer, Jennifer; Mood, Kathy; Daar, Ira O.; Moody, Sally A.

    2013-01-01

    FoxD4L1 is a forkhead transcription factor that expands the neural ectoderm by down-regulating genes that promote the onset of neural differentiation and up-regulating genes that maintain proliferative neural precursors in an immature state. We previously demonstrated that binding of Grg4 to an Eh-1 motif enhances the ability of FoxD4L1 to down-regulate target neural genes but does not account for all of its repressive activity. Herein we analyzed the protein sequence for additional interaction motifs and secondary structure. Eight conserved motifs were identified in the C-terminal region of fish and frog proteins. Extending the analysis to mammals identified a high scoring motif downstream of the Eh-1 domain that contains a tryptophan residue implicated in protein-protein interactions. In addition, secondary structure prediction programs predicted an α-helical structure overlapping with amphibian-specific Motif 6 in Xenopus, and similarly located α-helical structures in other vertebrate FoxD proteins. We tested functionality of this site by inducing a glutamine-to-proline substitution expected to break the predicted α-helical structure; this significantly reduced FoxD4L1’s ability to repress zic3 and irx1. Because this mutation does not interfere with Grg4 binding, these results demonstrate that at least two regions, the Eh-1 motif and a more C-terminal predicted α-helical/Motif 6 site, additively contribute to repression. In the N-terminal region we previously identified a 14 amino acid motif that is required for the up-regulation of target genes. Secondary structure prediction programs predicted a short β-strand separating two acidic domains. Mutant constructs show that the β-strand itself is not required for transcriptional activation. Instead, activation depends upon a glycine residue that is predicted to provide sufficient flexibility to bring the two acidic domains into close proximity. These results identify conserved predicted motifs with secondary

  9. Gene transcription and electromagnetic fields

    SciTech Connect

    Henderson, A.S.

    1992-01-01

    Our overall aim is to obtain sufficient information to allow us to ultimately determine whether ELF EM field exposure is an initiating factor in neoplastic transformation and/or if exposure can mimic characteristics of the second-step counterpart in neoplastic disease. This aim is based on our previous findings that levels of some transcripts are increased in cells exposed to EM fields. While the research is basic in nature, the ramifications have bearing on the general safety of exposure to EM fields in industrial and everyday life. A large array of diverse biological effects are reported to occur as the result of exposure to elf EM fields, suggesting that the cell response to EM fields is at a basic level, presumably initiated by molecular and/or biophysical events at the cell membrane. The hypothesized route is a signal transduction pathway involving membrane calcium fluxes. Information flow resulting from signal transduction can mediate the induction of regulatory factors in the cell, and directly affect how transcription is regulated.

  10. Transcriptional responses to loss or gain of function of the leucine-rich repeat kinase 2 (LRRK2) gene uncover biological processes modulated by LRRK2 activity

    PubMed Central

    Nikonova, Elena V.; Xiong, Yulan; Tanis, Keith Q.; Dawson, Valina L.; Vogel, Robert L.; Finney, Eva M.; Stone, David J.; Reynolds, Ian J.; Kern, Jonathan T.; Dawson, Ted M.

    2012-01-01

    Mutations in the leucine-rich repeat kinase 2 gene (LRRK2) are the most common genetic cause of Parkinson's disease (PD) and cause both autosomal dominant familial and sporadic PD. Currently, the physiological and pathogenic activities of LRRK2 are poorly understood. To decipher the biological functions of LRRK2, including the genes and pathways modulated by LRRK2 kinase activity in vivo, we assayed genome-wide mRNA expression in the brain and peripheral tissues from LRRK2 knockout (KO) and kinase hyperactive G2019S (G2019S) transgenic mice. Subtle but significant differences in mRNA expression were observed relative to wild-type (WT) controls in the cortex, striatum and kidney of KO animals, but only in the striatum in the G2019S model. In contrast, robust, consistent and highly significant differences were identified by the direct comparison of KO and G2019S profiles in the cortex, striatum, kidney and muscle, indicating opposite effects on mRNA expression by the two models relative to WT. Ribosomal and glycolytic biological functions were consistently and significantly up-regulated in LRRK2 G2019S compared with LRRK2 KO tissues. Genes involved in membrane-bound organelles, oxidative phosphorylation, mRNA processing and the endoplasmic reticulum were down-regulated in LRRK2 G2019S mice compared with KO. We confirmed the expression patterns of 35 LRRK2-regulated genes using quantitative reverse transcription polymerase chain reaction. These findings provide the first description of the transcriptional responses to genetically modified LRRK2 activity and provide preclinical target engagement and/or pharmacodynamic biomarker strategies for LRRK2 and may inform future therapeutic strategies for LRRK2-associated PD. PMID:21972245

  11. Functional analysis of the promoter of the mitochondrial phosphate carrier human gene: identification of activator and repressor elements and their transcription factors

    PubMed Central

    2005-01-01

    The phosphate carrier (PiC) catalyses the import of phosphate into mitochondria where it is needed for ATP synthesis. We have analysed the 5′-flanking region of the human PiC gene and found that it has a single transcriptional initiation site and lacks a TATA box. Through deletion analysis of the −1213/−25 nt region, we identified an activation domain (−223/−25) and an inhibition domain (−1017/−814). The most effective promoter activity in transfected HeLa cells corresponded to the region containing putative binding sites for Sp1 (−163/−142; where Sp1 stands for stimulating protein-1) and CREB (−138/−116; where CREB stands for cAMP-response-element-binding protein). These DNA sequences were active in gel-shift assays in the presence of HeLa cell nuclear extracts or recombinant Sp1 and CREB respectively. Forskolin increased PiC promoter activity via the CREB site. Both footprinting and transfection of deletion constructs of the inhibition region (−1017/−814) showed that PiC silencer activity extends over 25 nt (−943/−919), which specifically binds two proteins present in HeLa cell nuclear extracts. These transcription factors were purified by DNA affinity, analysed by MS and identified as p54nrb/NonO (nuclear RNA binding protein) and PSF (protein-associated splicing factor). The PiC silencer region cloned in front of the ferritin promoter conferred a strong inhibition to the heterologous promoter. These findings may provide insight into control of PiC gene expression in different cell types and under different growth conditions. To our knowledge, this is the first study to analyse the regulation of the PiC gene expression in any cell. PMID:15984930

  12. Changes in Cytokinin Content and Cytokinin Oxidase Activity in Response to Derepression of ipt Gene Transcription in Transgenic Tobacco Calli and Plants.

    PubMed Central

    Motyka, V.; Faiss, M.; Strand, M.; Kaminek, M.; Schmulling, T.

    1996-01-01

    Metabolic control of cytokinin oxidase by its substrate was investigated in planta using wild-type (WT) and conditionally ipt gene-expressing transgenic (IPT) tobacco (Nicotiana tabacum L.) callus cultures and plants. The derepression of the tetracycline (Tc)-dependent ipt gene transcription was followed by a progressive, more than 100-fold increase in total cytokinin content in IPT calli. The activity of cytokinin oxidase extracted from these calli began to increase 16 to 20 h after gene derepression, and after 13 d it was 10-fold higher than from Tc-treated WT calli. An increase in cytokinin oxidase activity, as a consequence of elevated cytokinin levels, was found in detached leaves (8-fold after 4 d) and in roots of intact plants (4-fold after 3 d). The partially purified cytokinin oxidase from WT, repressed IPT, and Tc-derepressed IPT tobacco calli exhibited similar characteristics. It had the same broad pH optimum (pH 6.5-8.5), its activity in vitro was enhanced 4-fold in the presence of copper-imidazole, and the apparent Km(N6-[[delta]2iso-pentenyl]adenine) values were in the range of 3.1 to 4.9 [mu]M. The increase in cytokinin oxidase activity in cytokinin-overproducing tissue was associated with the accumulation of a glycosylated form of the enzyme. The present data indicate the substrate induction of cytokinin oxidase activity in different tobacco tissues, which may contribute to hormone homeostasis. PMID:12226431

  13. Gene looping facilitates TFIIH kinase-mediated termination of transcription

    PubMed Central

    Medler, Scott; Ansari, Athar

    2015-01-01

    TFIIH is a general transcription factor with kinase and helicase activities. The kinase activity resides in the Kin28 subunit of TFIIH. The role of Kin28 kinase in the early steps of transcription is well established. Here we report a novel role of Kin28 in the termination of transcription. We show that RNAPII reads through a termination signal upon kinase inhibition. Furthermore, the recruitment of termination factors towards the 3′ end of a gene was compromised in the kinase mutant, thus confirming the termination defect. A concomitant decrease in crosslinking of termination factors near the 5′ end of genes was also observed in the kinase-defective mutant. Simultaneous presence of termination factors towards both the ends of a gene is indicative of gene looping; while the loss of termination factor occupancy from the distal ends suggest the abolition of a looped gene conformation. Accordingly, CCC analysis revealed that the looped architecture of genes was severely compromised in the Kin28 kinase mutant. In a looping defective sua7-1 mutant, even the enzymatically active Kin28 kinase could not rescue the termination defect. These results strongly suggest a crucial role of Kin28 kinase-dependent gene looping in the termination of transcription in budding yeast. PMID:26286112

  14. Transcriptional activation of the fra-1 gene by AP-1 is mediated by regulatory sequences in the first intron.

    PubMed Central

    Bergers, G; Graninger, P; Braselmann, S; Wrighton, C; Busslinger, M

    1995-01-01

    Constitutive expression of c-Fos, FosB, Fra-1, or c-Jun in rat fibroblasts leads to up-regulation of the immediate-early gene fra-1. Using the posttranslational FosER induction system, we demonstrate that this AP-1-dependent stimulation of fra-1 expression is rapid, depends on a functional DNA-binding domain of FosER, and is a general phenomenon observed in different cell types. In vitro mutagenesis and functional analysis of the rat fra-1 gene in stably transfected Rat-1A-FosER fibroblasts indicated that basal and AP-1-regulated expression of the fra-1 gene depends on regulatory sequences in the first intron which comprise a consensus AP-1 site and two AP-1-like elements. We have also investigated the transactivating and transforming properties of the Fra-1 protein to address the significance of fra-1 up-regulation. The entire Fra-1 protein fused to the DNA-binding domain of Ga14 is shown to lack any transactivation function, and yet it possesses oncogenic potential, as overexpression of Fra-1 in established rat fibroblasts results in anchorage-independent growth in vitro and tumor development in athymic mice, fra-1 is therefore not only induced by members of the Fos family, but its gene product may also contribute to cellular transformation by these proteins. Together, these data identify fra-1 as a unique member of the fos gene family which is under positive control by AP-1 activity. PMID:7791782

  15. The human papillomavirus type 16 E7 gene product interacts with and trans-activates the AP1 family of transcription factors.

    PubMed Central

    Antinore, M J; Birrer, M J; Patel, D; Nader, L; McCance, D J

    1996-01-01

    The E7 gene product of human papillomavirus type 16 (HPV16) binds to the retinoblastoma gene product (pRb) and dissociates pRb-E2F complexes. However, the observation that the ability of E7 to bind pRb is not required for the HPV16-induced immortalization of primary keratinocytes prompted a search for other cellular factors bound by E7. Using a glutathione-S-transferase (GST) fusion protein system, we show that E7 complexes with AP1 transcription factors including c-Jun, JunB, JunD and c-Fos. The ability of E7 to complex with c-Jun in vivo is demonstrated by co-immunoprecipitation and the yeast two-hybrid system. An analysis of E7 point mutants in the GST system indicates that the E7 zinc-finger motif, but not the pRb binding domain, is involved in these interactions. Using c-Jun deletion mutants, E7 binding maps between amino acids 224 and 286 of c-Jun. E7 trans-activates c-Jun-induced transcription from a Jun responsive promoter, and this activity correlates with the ability of E7 mutants to bind Jun proteins. Finally, a transcriptionally inactive c-Jun deletion, which can bind E7, interferes with the E7-induced transformation of rat embryo fibroblasts in cooperation with an activated ras, indicating that the Jun-E7 interaction is physiologically relevant and that Jun factors may be targeted in the E7 transformation pathway. Images PMID:8617242

  16. A nuclear factor for interleukin-6 expression (NF-IL6) and the glucocorticoid receptor synergistically activate transcription of the rat alpha 1-acid glycoprotein gene via direct protein-protein interaction.

    PubMed Central

    Nishio, Y; Isshiki, H; Kishimoto, T; Akira, S

    1993-01-01

    The acute-phase reaction is accompanied by an increase in a variety of serum proteins, named acute-phase proteins. The synthesis of these proteins is synergistically controlled by glucocorticoids and inflammatory cytokines such as interleukin-1 (IL-1), IL-6, and tumor necrosis factor alpha. Recently, we have cloned nuclear factor-IL-6 (NF-IL6), a transcription factor that activates the IL-6 gene, and have demonstrated its involvement in the expression of acute-phase-protein genes. We report here an analysis of the molecular mechanisms by which inflammatory cytokines and glucocorticoid act synergistically to activate expression of the rat alpha 1-acid glycoprotein (AGP) gene. We found that NF-IL6 and ligand-activated rat glucocorticoid receptor acted synergistically to transactivate the AGP gene and that maximal transcriptional activation of the AGP gene required expression of both intact NF-IL6 and rat glucocorticoid receptor. Surprisingly, however, transcriptional synergism was still observed even when one of the two factors lacked either its DNA-binding or transcriptional-activation function. We present evidence for a direct protein-protein interaction between these two distinct transcription factors and propose that this may be responsible for the synergistic activation of the rat AGP gene. Images PMID:8441418

  17. MaJAZ1 Attenuates the MaLBD5-Mediated Transcriptional Activation of Jasmonate Biosynthesis Gene MaAOC2 in Regulating Cold Tolerance of Banana Fruit.

    PubMed

    Ba, Liang-jie; Kuang, Jian-fei; Chen, Jian-ye; Lu, Wang-jin

    2016-02-01

    Previous studies indicated that methyl jasmonate (MeJA) treatment could effectively reduce the chilling injury of many fruits, including banana, but the underlying mechanism is poorly understood. In this study, one lateral organ boundaries (LOB) domain (LBD) gene, designated as MaLBD5, was isolated and characterized from banana fruit. Expression analysis revealed that accumulation of MaLBD5 was induced by cold temperature and MeJA treatment. Subcellular localization and transactivation assays showed that MaLBD5 was localized to the nucleus and possessed transcriptional activation activity. Protein-protein interaction analysis demonstrated that MaLBD5 physically interacted with MaJAZ1, a potential repressor of jasmonate signaling. Furthermore, transient expression assays indicated that MaLBD5 transactivated a jasmonate biosynthesis gene, termed MaAOC2, which was also induced by cold and MeJA. More interestingly, MaJAZ1 attenuated the MaLBD5-mediated transactivation of MaAOC2. These results suggest that MaLBD5 and MaJAZ1 might act antagonistically in relation to MeJA-induced cold tolerance of banana fruit, at least partially via affecting jasmonate biosynthesis. Collectively, our findings expand the knowledge of the transcriptional regulatory network of MeJA-mediated cold tolerance of banana fruit. PMID:26760434

  18. Molecular and functional characterization of the promoter region of the mouse LDH/C gene: enhancer-assisted, Sp1-mediated transcriptional activation.

    PubMed Central

    Yang, J; Thomas, K

    1997-01-01

    Molecular and functional studies of the LDH/C 5' upstream promoter elements were undertaken to elucidate the molecular mechanisms involved in temporal activation of LDH/C gene expression in differentiating germ cells. Ligation mediated-PCR (LM-PCR) gene walking techniques were exploited to isolate a 2.1 kb fragment of the mouse LDH/C 5' promoter region. DNA sequence analysis of this isolated genomic fragment indicated that the mouse LDH/C promoter contained TATA and CCAT boxes as well as a GC-box (Sp1-binding site) situated upstream from the transcription start site. PCR-based in vivo DNase I footprinting analysis of a 600 bp fragment of the proximal LDH/C promoter region (-524/+38) in isolated mouse pachytene spermatocytes identified a single footprint over the GC-box motif. Three DNase I hypersensitive sites were also detectable in vivo, in a region containing (CT)n(GA)n repeats upstream from the CCAT box domain. Functional characterization of the promoter region was carried out in a rat C6 glioma cell line and an SV40 transformed germ cell line (GC-1 spg) using wild-type and mutated LDH/C promoter CAT reporter constructs. These studies provide experimental evidence suggesting that transcriptional activation of the LDH/C promoter is regulated by enhancer-mediated coactivation of the Sp1 proteins bound to the GC-box motif footprinted in vivo in pachytene spermatocytes. PMID:9153323

  19. Transcriptional activation and repression by Fos are independent functions: the C terminus represses immediate-early gene expression via CArG elements.

    PubMed

    Gius, D; Cao, X M; Rauscher, F J; Cohen, D R; Curran, T; Sukhatme, V P

    1990-08-01

    The Fos-Jun complex has been shown to activate transcription through the regulatory element known as the AP-1 binding site. We show that Fos down regulates several immediate-early genes (c-fos, Egr-1, and Egr-2) after mitogenic stimulation. Specifically, we demonstrate that the target for this repression is a sequence of the form CC(A/T)6GG, also known as a CArG box. Whereas Fos bound to the AP-1 site through a domain rich in basic amino acids and associated with Jun via a leucine zipper interaction, mutant Fos proteins lacking these structures were still capable of causing repression. Furthermore, Jun neither enhanced nor inhibited down regulation by Fos. Critical residues required for repression are located within the C-terminal 27 amino acids of c-Fos, since v-Fos and C-terminal truncations of c-Fos did not down regulate. In addition, transfer of 180 c-Fos C-terminal amino acids to Jun conferred upon it the ability to repress. Finally, Fra-1, a Fos-related protein which has striking similarity to Fos in its C-terminal 40 amino acids, also down regulated Egr-1 expression. Thus, Fos is a transcriptional regulator that can activate or repress gene expression by way of two separate functional domains that act on distinct regulatory elements. PMID:2115122

  20. Novel [NiFe]- and [FeFe]-hydrogenase gene transcripts indicative of active facultative aerobes and obligate anaerobes in earthworm gut contents.

    PubMed

    Schmidt, Oliver; Wüst, Pia K; Hellmuth, Susanne; Borst, Katharina; Horn, Marcus A; Drake, Harold L

    2011-09-01

    The concomitant occurrence of molecular hydrogen (H(2)) and organic acids along the alimentary canal of the earthworm is indicative of ongoing fermentation during gut passage. Fermentative H(2) production is catalyzed by [FeFe]-hydrogenases and group 4 [NiFe]-hydrogenases in obligate anaerobes (e.g., Clostridiales) and facultative aerobes (e.g., Enterobacteriaceae), respectively, functional groups that might respond differently to contrasting redox conditions. Thus, the objectives of this study were to assess the redox potentials of the alimentary canal of Lumbricus terrestris and analyze the hydrogenase transcript diversities of H(2) producers in glucose-supplemented gut content microcosms. Although redox potentials in the core of the alimentary canal were variable on an individual worm basis, average redox potentials were similar. The lowest redox potentials occurred in the foregut and midgut regions, averaging 40 and 110 mV, respectively. Correlation plots between hydrogenase amino acid sequences and 16S rRNA gene sequences indicated that closely related hydrogenases belonged to closely related taxa, whereas distantly related hydrogenases did not necessarily belong to distantly related taxa. Of 178 [FeFe]-hydrogenase gene transcripts, 177 clustered in 12 Clostridiales-affiliated operational taxonomic units, the majority of which were indicative of heretofore unknown hydrogenases. Of 86 group 4 [NiFe]-hydrogenase gene transcripts, 79% and 21% were affiliated with organisms in the Enterobacteriaceae and Aeromonadaceae, respectively. The collective results (i) suggest that fermenters must cope with variable and moderately oxidative redox conditions along the alimentary canal, (ii) demonstrate that heretofore undetected hydrogenases are present in the earthworm gut, and (iii) corroborate previous findings implicating Clostridiaceae and Enterobacteriaceae as active fermentative taxa in earthworm gut content. PMID:21784904

  1. Novel [NiFe]- and [FeFe]-Hydrogenase Gene Transcripts Indicative of Active Facultative Aerobes and Obligate Anaerobes in Earthworm Gut Contents▿†

    PubMed Central

    Schmidt, Oliver; Wüst, Pia K.; Hellmuth, Susanne; Borst, Katharina; Horn, Marcus A.; Drake, Harold L.

    2011-01-01

    The concomitant occurrence of molecular hydrogen (H2) and organic acids along the alimentary canal of the earthworm is indicative of ongoing fermentation during gut passage. Fermentative H2 production is catalyzed by [FeFe]-hydrogenases and group 4 [NiFe]-hydrogenases in obligate anaerobes (e.g., Clostridiales) and facultative aerobes (e.g., Enterobacteriaceae), respectively, functional groups that might respond differently to contrasting redox conditions. Thus, the objectives of this study were to assess the redox potentials of the alimentary canal of Lumbricus terrestris and analyze the hydrogenase transcript diversities of H2 producers in glucose-supplemented gut content microcosms. Although redox potentials in the core of the alimentary canal were variable on an individual worm basis, average redox potentials were similar. The lowest redox potentials occurred in the foregut and midgut regions, averaging 40 and 110 mV, respectively. Correlation plots between hydrogenase amino acid sequences and 16S rRNA gene sequences indicated that closely related hydrogenases belonged to closely related taxa, whereas distantly related hydrogenases did not necessarily belong to distantly related taxa. Of 178 [FeFe]-hydrogenase gene transcripts, 177 clustered in 12 Clostridiales-affiliated operational taxonomic units, the majority of which were indicative of heretofore unknown hydrogenases. Of 86 group 4 [NiFe]-hydrogenase gene transcripts, 79% and 21% were affiliated with organisms in the Enterobacteriaceae and Aeromonadaceae, respectively. The collective results (i) suggest that fermenters must cope with variable and moderately oxidative redox conditions along the alimentary canal, (ii) demonstrate that heretofore undetected hydrogenases are present in the earthworm gut, and (iii) corroborate previous findings implicating Clostridiaceae and Enterobacteriaceae as active fermentative taxa in earthworm gut content. PMID:21784904

  2. Constraints on transcriptional activator function contribute to transcriptional quiescence during early Xenopus embryogenesis.

    PubMed Central

    Almouzni, G; Wolffe, A P

    1995-01-01

    We have examined the cause of transcriptional quiescence prior to the mid-blastula transition (MBT) in Xenopus laevis. We have found distinct requirements for transcription of class II and class III genes. An artificial increase of the amount of DNA present within the embryo over that found at the MBT allows precocious transcription of tRNA genes, but not of the adenovirus E4 or human cytomegalovirus (CMV) promoters. Thus titration of an inhibitor by exogenous DNA determines class III but not class II gene activation. We demonstrate that the action of the inhibitor depends on the association of core histones with DNA. The addition of exogenous TBP, together with an increase in the amount of DNA within the embryo, allows significant basal transcription of class II genes prior to the MBT, whereas it does not increase transcription of tRNA genes. To examine the activation of transcription above basal levels, we used a defined minimal promoter containing five Gal4 binding sites and the activator Gal4-VP16. Precocious transcriptional activation is directed by Gal4-VP16 prior to the MBT, demonstrating that a functional transcriptional machinery exists at this early developmental stage. Furthermore, since this activation can occur in the absence of exogenous TBP or chromatin titration, a transcription factor that can penetrate chromatin is sufficient for recruitment of this machinery to a promoter. Our results support the hypothesis that the temporal regulation of transcription during early embryogenesis in Xenopus reflects not only a titration of inhibitors by DNA, but also a deficiency in the activity of transcriptional activators prior to the MBT. Images PMID:7737126

  3. The DOF protein, SAD, interacts with GAMYB in plant nuclei and activates transcription of endosperm-specific genes during barley seed development.

    PubMed

    Diaz, Isabel; Martinez, Manuel; Isabel-LaMoneda, Ines; Rubio-Somoza, Ignacio; Carbonero, Pilar

    2005-06-01

    The DOF protein, SAD, previously shown to be a transcriptional activator in barley aleurone cells upon seed germination, also has an important role in gene regulation during endosperm development. mRNA was detected in early (10 days after flowering) developing barley seeds where it accumulated in the starchy endosperm, aleurone cells, nucellar projection, vascular tissues and the immature embryo, as shown by RT-PCR and in situ hybridization analyses. The SAD protein, expressed in bacteria, binds to oligonucleotides containing the prolamine box, 5'-A/TAAAG-3'sequence, derived from the promoter regions of the endosperm-specific genes Hor2 and Itr1, encoding a B-hordein and trypsin-inhibitor BTI-CMe, respectively. SAD competed for the same binding sites with another endosperm-expressed DOF protein, BPBF. Transient expression experiments in co-bombarded developing endosperms demonstrated that SAD trans-activated transcription from Hor2 and Itr1 promoters through binding to the intact DOF motifs. When the two DOF factors are co-bombarded together an additive effect was observed upon the expression of the Itr1 gene. In-frame fusion of the Sad ORF to the reporter green fluorescent protein gene directs the fluorescence expression to the nucleus in transiently transformed onion epidermal layers. The visualization of fluorescence in the nucleus of onion cells, using the bimolecular fluorescent complex (BiFC) approach, has shown the in vivo interaction between SAD and the R2R3MYB protein GAMYB. The interaction in plant cells has also been documented for the DOF protein BPBF and GAMYB, but nuclear interaction could not be detected between BPBF and SAD by this procedure. PMID:15918880

  4. The transcription of the human fructose-bisphosphate aldolase C gene is activated by nerve-growth-factor-induced B factor in human neuroblastoma cells.

    PubMed Central

    Buono, P; Conciliis, L D; Izzo, P; Salvatore, F

    1997-01-01

    A DNA region located at around -200 bp in the 5' flanking region (region D) of the human brain-type fructose-bisphosphate aldolase (aldolase C) gene has been analysed. We show by transient transfection assay and electrophoretic-mobility-shift assay (EMSA) that the binding of transcriptional activators to region D is much more efficient (80% versus 30%) in human neuroblastoma cells (SKNBE) than in the non-neuronal cell line A1251, which contains low levels of aldolase C mRNA. The sequence of region D, CAAGGTCA, is very similar to the AAAGGTCA motif present in the mouse steroid 21-hydroxylase gene; the latter motif binds nerve-growth-factor-induced B factor (NGFI-B), which is a member of the thyroid/steroid/retinoid nuclear receptor gene family. Competition experiments in EMSA and antibody-directed supershift experiments showed that NGFI-B is involved in the binding to region D of the human aldolase C gene. Furthermore, the regulation of the aldolase C gene (which is the second known target of NGFI-B) expression during development parallels that of NGFI-B. PMID:9173889

  5. The transcriptional activator Opaque2 recognizes two different target sequences in the 22-kD-like alpha-prolamin genes.

    PubMed Central

    Yunes, J A; Cord Neto, G; da Silva, M J; Leite, A; Ottoboni, L M; Arruda, P

    1994-01-01

    The maize Opaque2 (O2) protein is a "leucine zipper" DNA binding factor that interacts with the sequence TCCACGTAGA in the promoters of the 22-kD alpha-zein genes and activates its transcription. A completely different consensus sequence (GATGAPyPuTGPu) identified in b-32, a gene that encodes an abundant albumin that is also under control of the O2 locus, can also be bound by the O2 protein. We showed that the gene encoding the 22-kD-like alpha-coixin, the alpha-prolamin of the maize-related grass Coix, can also be transactivated by the O2 protein. A binding assay in vitro and footprint analysis demonstrated that the GACATGTC sequence of the alpha-coixin promoter can be recognized and protected by the maize O2 protein. Employing transient expression experiments in immature maize endosperm and tobacco mesophyll protoplasts, we demonstrated that the O2 protein can activate expression of the beta-glucuronidase reporter gene placed under the control of the 22-kD-like alpha-coixin promoter. We also demonstrated that a 22-kD-like alpha-coixin pseudogene promoter is transactivated by the maize O2 protein. PMID:8148647

  6. The lipopolysaccharide-binding protein is a secretory class 1 acute-phase protein whose gene is transcriptionally activated by APRF/STAT/3 and other cytokine-inducible nuclear proteins.

    PubMed Central

    Schumann, R R; Kirschning, C J; Unbehaun, A; Aberle, H P; Knope, H P; Lamping, N; Ulevitch, R J; Herrmann, F

    1996-01-01

    Acute-phase reactants (APRs) are proteins synthesized in the liver following induction by interleukin-1 (IL-1), IL-6, and glucocorticoids, involving transcriptional gene activation. Lipopolysaccharide-binding protein (LBP) is a recently identified hepatic secretory protein potentially involved in the pathogenesis of sepsis, capable of binding the bacterial cell wall product endotoxin and directing it to its cellular receptor, CD14. In order to examine the transcriptional induction mechanisms by which the LBP gene is activated, we have investigated the regulation of expression of its mRNA in vitro and in vivo as well as the organization of 5' upstream regulatory DNA sequences. We show that induction of LBP expression is transcriptionally regulated and is dependent on stimulation with IL-1beta, IL-6, and dexamethasone. By definition, LBP thus has to be viewed as a class 1 acute-phase protein and represents the first APR identified which is capable of detecting pathogenic bacteria. Furthermore, cloning of the LBP promoter revealed the presence of regulatory elements, including the common APR promoter motif APRE/STAT-3 (acute-phase response element/signal transducer and activator of transcription 3). Luciferase reporter gene assays utilizing LBP promoter truncation and point mutation variants indicated that transcriptional activation of the LBP gene required a functional APRE/STAT-3 binding site downstream of the transcription start site, as well as an AP-1 and a C/EBP (CCAAT enhancer-binding protein) binding site. Gel retardation and supershift assays confirmed that upon cytokine stimulation APRF/STAT-3 binds to its recognition site, leading to strong activation of the LBP gene. Unraveling of the mechanism of transcriptional activation of the LBP gene, involving three known transcription factors, may contribute to our understanding of the acute-phase response and the pathophysiology of sepsis and septic shock. PMID:8668165

  7. A Role for Poly(ADP-ribose) Polymerase in the Transcriptional Regulation of the Melanoma Growth Stimulatory Activity (CXCL1) Gene Expression*

    PubMed Central

    Nirodi, Chaitanya; NagDas, Subir; Gygi, Steven P.; Olson, Gary; Aebersold, Ruedi; Richmond, Ann

    2012-01-01

    The melanoma growth stimulatory activity/growth-regulated protein, CXCL1, is constitutively expressed at high levels during inflammation and progression of melanocytes into malignant melanoma. It has been shown previously that CXCL1 overexpression in melanoma cells is due to increased transcription as well as stability of the CXCL1 message. The transcription of CXCL1 is regulated through several cis-acting elements including Sp1, NF-κB, HMGI(Y), and the immediate upstream region (IUR) element (nucleotides −94 to −78), which lies immediately upstream to the nuclear factor κB (NF-κB) element. Previously, it has been shown that the IUR is necessary for basal and cytokine-induced transcription of the CXCL1 gene. UV cross-linking and Southwestern blot analyses indicate that the IUR oligonucleotide probe selectively binds a 115-kDa protein. In this study, the IUR element has been further characterized. We show here that proximity of the IUR element to the adjacent NF-κB element is critical to its function as a positive regulatory element. Using binding site oligonucleotide affinity chromatography, we have selectively purified the 115-kDa IUR-F. Mass spectrometry/mass spectrometry/matrix-assisted laser desorption ionization/time of flight spectroscopy and amino acid analysis as well as microcapillary reverse phase chromatography electrospray ionization tandem mass spectrometry identified this protein as the 114-kDa poly(ADP-ribose) polymerase (PARP1). Furthermore, 3-aminobenzamide, an inhibitor of PARP-specific ADP-ribosylation, inhibits CXCL1 promoter activity and reduces levels of CXCL1 mRNA. The data point to the possibility that PARP may be a coactivator of CXCL1 transcription. PMID:11112786

  8. Prophenoloxidase from Pieris rapae: gene cloning, activity, and transcription in response to venom/calyx fluid from the endoparasitoid wasp Cotesia glomerata *

    PubMed Central

    Zhu, Jia-ying; Yang, Pu; Wu, Guo-xing

    2011-01-01

    Prophenoloxidase (PPO) plays an important role in melanization, necessary for defense against intruding parasitoids. Parasitoids have evolved to inject maternal virulence factors into the host hemocoel to suppress hemolymph melanization for the successful development of their progeny. In this study, the full-length complementary DNA (cDNA) of a Pieris rapae PPO was cloned. Its cDNA contained a 2 076-base pair (bp) open reading frame (ORF) encoding 691 amino acids (aa). Two putative copper-binding sites, a proteolytic activation site, three conserved hemocyanin domains, and a thiol ester motif were found in the deduced amino acid sequence. According to both multiple alignment and phylogenetic analysis, P. rapae PPO gene cloned here is a member of the lepidopteran PPO-2 family. Injection of Cotesia glomerata venom or calyx fluid resulted in reduction of P. rapae hemolymph phenoloxidase activity, demonstrating the ability to inhibit the host′s melanization. Real-time reverse transcriptase polymerase chain reaction (RT-PCR) showed that transcripts of P. rapae PPO-2 in the haemocytes from larvae had not significantly changed following venom injection, suggesting that the regulation of PPO messenger RNA (mRNA) expression by venom was not employed by C. glomerata to cause failure of melanization in parasitized host. While decreased P. rapae PPO-2 gene expression was observed in the haemocytes after calyx fluid injection, no detectable transcriptional change was induced by parasitization, indicating that transcriptional down-regulation of PPO by calyx fluid might play a minor role involved in inhibiting the host′s melanization. PMID:21265042

  9. The g.-165 T>C Rather than Methylation Is Associated with Semen Motility in Chinese Holstein Bulls by Regulating the Transcriptional Activity of the HIBADH Gene

    PubMed Central

    Ju, Zhihua; Wang, Xiuge; Jiang, Qiang; Sun, Yan; Huang, Jinming; Zhong, Jifeng; Wang, Changfa

    2015-01-01

    The 3-hydroxyisobutyrate dehydrogenase (HIBADH) is regarded as a human sperm-motility marker. However, the molecular mechanisms involved in the regulation of expression of the HIBADH gene in bulls remain largely unknown. HIBADH was detected in the testis, epididymis, and sperm via reverse transcription polymerase chain reaction and Western blot analysis. It is also expressed in the seminiferous epithelium, spermatids, and the entire epididymis, as detected by immunohistochemistry. Furthermore, HIBADH was expressed in the neck-piece and mid-piece of bull spermatids, as shown in the immunofluorescence assay. Using serially truncated bovine HIBADH promoters and luciferase constructs, we discovered an 878 bp (-703 bp to +175 bp) fragment that constitutes the core promoter region. One SNP g.-165 T>C of HIBADH was identified and genotyped in 307 Chinese Holstein bulls. Correlation analysis revealed that bulls with the TT genotype had higher initial sperm motility than those with the CC genotype (P < 0.05). Furthermore, the T- or C-containing loci (designated as pGL3-T and pGL3-C) were transiently transfected into MLTC-1 to test the effect of SNP on HIBADH expression. The luciferase reporter assay showed that the pGL3-T genotype exhibited 58% higher transcriptional activity than the pGL3-C genotype (P < 0.05). The bisulfite sequencing analysis revealed that the methylation pattern of the core promoter presented hypomethylation in the ejaculated semen in high-motility and low-motility bulls. The results demonstrated for the first time that the g.-165 T>C rather than methylation in the 5'-flanking region could affect the bovine sperm motility through the regulation of HIBADH gene transcriptional activity. PMID:26133183

  10. The g.-165 T>C Rather than Methylation Is Associated with Semen Motility in Chinese Holstein Bulls by Regulating the Transcriptional Activity of the HIBADH Gene.

    PubMed

    Zhang, Shuai; Zhang, Yan; Yang, Chunhong; Ju, Zhihua; Wang, Xiuge; Jiang, Qiang; Sun, Yan; Huang, Jinming; Zhong, Jifeng; Wang, Changfa

    2015-01-01

    The 3-hydroxyisobutyrate dehydrogenase (HIBADH) is regarded as a human sperm-motility marker. However, the molecular mechanisms involved in the regulation of expression of the HIBADH gene in bulls remain largely unknown. HIBADH was detected in the testis, epididymis, and sperm via reverse transcription polymerase chain reaction and Western blot analysis. It is also expressed in the seminiferous epithelium, spermatids, and the entire epididymis, as detected by immunohistochemistry. Furthermore, HIBADH was expressed in the neck-piece and mid-piece of bull spermatids, as shown in the immunofluorescence assay. Using serially truncated bovine HIBADH promoters and luciferase constructs, we discovered an 878 bp (-703 bp to +175 bp) fragment that constitutes the core promoter region. One SNP g.-165 T>C of HIBADH was identified and genotyped in 307 Chinese Holstein bulls. Correlation analysis revealed that bulls with the TT genotype had higher initial sperm motility than those with the CC genotype (P < 0.05). Furthermore, the T- or C-containing loci (designated as pGL3-T and pGL3-C) were transiently transfected into MLTC-1 to test the effect of SNP on HIBADH expression. The luciferase reporter assay showed that the pGL3-T genotype exhibited 58% higher transcriptional activity than the pGL3-C genotype (P < 0.05). The bisulfite sequencing analysis revealed that the methylation pattern of the core promoter presented hypomethylation in the ejaculated semen in high-motility and low-motility bulls. The results demonstrated for the first time that the g.-165 T>C rather than methylation in the 5'-flanking region could affect the bovine sperm motility through the regulation of HIBADH gene transcriptional activity. PMID:26133183

  11. Transcriptional enhancer from milk protein genes

    SciTech Connect

    Casperson, Gerald F.; Schmidhauser, Christian T.; Bissell, Mina J.

    1999-01-01

    The invention relates to novel enhancer nucleotide sequences which stimulate transcription of heterologous DNA in cells in culture. The enhancers are derived from major milk protein genes by the process of deletion mapping and functional analysis. The invention also relates to expression vectors containing the novel enhancers.

  12. Transcriptional enhancer from milk protein genes

    SciTech Connect

    Casperson, G.F.; Schmidhauser, C.T.; Bissell, M.J.

    1999-12-21

    The invention relates to novel enhancer nucleotide sequences which stimulate transcription of heterologous DNA in cells in culture. The enhancers are derived from major milk protein genes by the process of deletion mapping and functional analysis. The invention also relates to expression vectors containing the novel enhancers.

  13. Production of the 2400 kb Duchenne muscular dystrophy (DMD) gene transcript; transcription time and cotranscriptional splicing

    SciTech Connect

    Tennyson, C.N.; Worton, R.G.

    1994-09-01

    The largest known gene in any organism is the human DMD gene which has 79 exons that span 2400 kb. The extreme nature of the DMD gene raises questions concerning the time required for transcription and whether splicing begins before transcription is complete. DMD gene transcription is induced as cultured human myoblasts differentiate to form multinucleated myotubes, providing a system for studying the kinetics of transcription and splicing. Using quantitative RT-PCR, transcript accumulation was monitored from four different regions within the gene following induction of expression. By comparing the accumulation of transcripts from the 5{prime} and 3{prime} ends of the gene we have shown that approximately 12 hours are required to transcribe 1770 kb of the gene, extrapolating to a time of 16 hours for the transcription unit expressed in muscle. Comparison of accumulation profiles for spliced and total transcript demonstrated that transcripts are spliced at the 5{prime} end before transcription is complete, providing strong evidence for cotranscriptional splicing of DMD gene transcripts. Finally, the rate of transcript accumulation was reduced at the 3{prime} end of the gene relative to the 5{prime} end, perhaps due to premature termination of transcription complexes as they traverse this enormous transcription unit. The lag between transcription initiation and the appearance of complete transcripts could be important in limiting transcript production in dividing cells and to the timing of mRNA appearance in differentiating muscle.

  14. Radiation Desiccation Response Motif-Like Sequences Are Involved in Transcriptional Activation of the Deinococcal ssb Gene by Ionizing Radiation but Not by Desiccation▿

    PubMed Central

    Ujaoney, Aman Kumar; Potnis, Akhilesh A.; Kane, Pratiksha; Mukhopadhyaya, Rita; Apte, Shree Kumar

    2010-01-01

    Single-stranded-DNA binding protein (SSB) levels during poststress recovery of Deinococcus radiodurans were significantly enhanced by 60Co gamma rays or mitomycin C treatment but not by exposure to UV rays, hydrogen peroxide (H2O2), or desiccation. Addition of rifampin prior to postirradiation recovery blocked such induction. In silico analysis of the ssb promoter region revealed a 17-bp palindromic radiation/desiccation response motif (RDRM1) at bp −114 to −98 and a somewhat similar sequence (RDRM2) at bp −213 to −197, upstream of the ssb open reading frame. Involvement of these cis elements in radiation-responsive ssb gene expression was assessed by constructing transcriptional fusions of edited versions of the ssb promoter region with a nonspecific acid phosphatase encoding reporter gene, phoN. Recombinant D. radiodurans strains carrying such constructs clearly revealed (i) transcriptional induction of the ssb promoter upon irradiation and mitomycin C treatment but not upon UV or H2O2 treatment and (ii) involvement of both RDRM-like sequences in such activation of SSB expression, in an additive manner. PMID:20802034

  15. Long-chain unsaturated fatty acids reduce the transcriptional activity of the rat follicle-stimulating hormone β-subunit gene

    PubMed Central

    MORIYAMA, Ryutaro; YAMAZAKI, Tsubasa; KATO, Takako; KATO, Yukio

    2016-01-01

    Here, we assessed the effects of long-chain fatty acids (LCFAs) and the LCFA receptor agonist GW9508 on the transcription of the gonadotropin subunit genes Cga, Lhb and Fshb because LCFA receptor GPR120 was observed in mouse gonadotropes in our recent study. A transcription assay using LβT2 cells demonstrated that LCFAs, oleic acid, α-linolenic acid, docosahexaenoic acid and palmitate, repressed the expression of Cga, Lhb, and Fshb at concentrations between 50 and 100 µM. On the other hand, treatment with 10 µM unsaturated LCFAs, oleic acid, α-linolenic acid and docosahexaenoic acid, repressed only Fshb expression, while the same dose of a saturated LCFA, palmitate, had no effect on the expression of gonadotropin subunit genes. Furthermore, GW9508 did not affect promoter activity. Next, we examined deletion mutants of the upstream region of Fshb and found that the upstream regulatory region (-2824 to -2343 bp) of Fshb was responsible for the notable repression by 10 µM unsaturated LCFAs. Our results suggest that the upstream region of Fshb is susceptible to unsaturated LCFAs. In addition, unsaturated LCFAs play a role in repressing Fshb expression through the distal -2824 to -2343 bp region, which might be independent of the LCFA receptor GPR120 pathway. PMID:26853521

  16. Cytochrome P450 1D1: A novel CYP1A-related gene that is not transcriptionally activated by PCB126 or TCDD

    PubMed Central

    Goldstone, J. V.; Jönsson, M. E.; Behrendt, L.; Woodin, B. R.; Jenny, M. J.; Nelson, D. R.; Stegeman, J. J.

    2009-01-01

    Enzymes in the cytochrome P450 1 family oxidize many common environmental toxicants. We identified a new CYP1, termed CYP1D1, in zebrafish. Phylogenetically, CYP1D1 is paralogous to CYP1A and the two share 45% amino acid identity and similar gene structure. In adult zebrafish, CYP1D1 is most highly expressed in liver and is relatively highly expressed in brain. CYP1D1 transcript levels were higher at 9 hours post-fertilization than at later developmental times. Treatment of zebrafish with potent aryl hydrocarbon receptor (AHR) agonists (3,3′,4,4′,5-pentachlorobiphenyl or 2,3,7,8-tetrachlorodibenzo-p-dioxin) did not induce CYP1D1 transcript expression. Morpholino oligonucleotide knockdown of AHR2, which mediates induction of other CYP1s, did not affect CYP1D1 expression. Zebrafish CYP1D1 heterologously expressed in yeast exhibited ethoxyresorufin- and methoxyresorufin-O-dealkylase activities. Antibodies against a CYP1D1 peptide specifically detected a single electrophoretically-resolved protein band in zebrafish liver microsomes, distinct from CYP1A. CYP1D1 in zebrafish is a CYP1A-like gene that could have metabolic functions targeting endogenous compounds. PMID:19103147

  17. Cooperative activation of Xenopus rhodopsin transcription by paired-like transcription factors

    PubMed Central

    2014-01-01

    Background In vertebrates, rod photoreceptor-specific gene expression is regulated by the large Maf and Pax-like transcription factors, Nrl/LNrl and Crx/Otx5. The ubiquitous occurrence of their target DNA binding sites throughout rod-specific gene promoters suggests that multiple transcription factor interactions within the promoter are functionally important. Cooperative action by these transcription factors activates rod-specific genes such as rhodopsin. However, a quantitative mechanistic explanation of transcriptional rate determinants is lacking. Results We investigated the contributions of various paired-like transcription factors and their cognate cis-elements to rhodopsin gene activation using cultured cells to quantify activity. The Xenopus rhodopsin promoter (XOP) has a bipartite structure, with ~200 bp proximal to the start site (RPP) coordinating cooperative activation by Nrl/LNrl-Crx/Otx5 and the adjacent 5300 bp upstream sequence increasing the overall expression level. The synergistic activation by Nrl/LNrl-Crx/Otx5 also occurred when XOP was stably integrated into the genome. We determined that Crx/Otx5 synergistically activated transcription independently and additively through the two Pax-like cis-elements, BAT1 and Ret4, but not through Ret1. Other Pax-like family members, Rax1 and Rax2, do not synergistically activate XOP transcription with Nrl/LNrl and/or Crx/Otx5; rather they act as co-activators via the Ret1 cis-element. Conclusions We have provided a quantitative model of cooperative transcriptional activation of the rhodopsin promoter through interaction of Crx/Otx5 with Nrl/LNrl at two paired-like cis-elements proximal to the NRE and TATA binding site. Further, we have shown that Rax genes act in cooperation with Crx/Otx5 with Nrl/LNrl as co-activators of rhodopsin transcription. PMID:24499263

  18. Regulation of neural gene transcription by optogenetic inhibition of the RE1-silencing transcription factor.

    PubMed

    Paonessa, Francesco; Criscuolo, Stefania; Sacchetti, Silvio; Amoroso, Davide; Scarongella, Helena; Pecoraro Bisogni, Federico; Carminati, Emanuele; Pruzzo, Giacomo; Maragliano, Luca; Cesca, Fabrizia; Benfenati, Fabio

    2016-01-01

    Optogenetics provides new ways to activate gene transcription; however, no attempts have been made as yet to modulate mammalian transcription factors. We report the light-mediated regulation of the repressor element 1 (RE1)-silencing transcription factor (REST), a master regulator of neural genes. To tune REST activity, we selected two protein domains that impair REST-DNA binding or recruitment of the cofactor mSin3a. Computational modeling guided the fusion of the inhibitory domains to the light-sensitive Avena sativa light-oxygen-voltage-sensing (LOV) 2-phototrophin 1 (AsLOV2). By expressing AsLOV2 chimeras in Neuro2a cells, we achieved light-dependent modulation of REST target genes that was associated with an improved neural differentiation. In primary neurons, light-mediated REST inhibition increased Na(+)-channel 1.2 and brain-derived neurotrophic factor transcription and boosted Na(+) currents and neuronal firing. This optogenetic approach allows the coordinated expression of a cluster of genes impinging on neuronal activity, providing a tool for studying neuronal physiology and correcting gene expression changes taking place in brain diseases. PMID:26699507

  19. Regulation of neural gene transcription by optogenetic inhibition of the RE1-silencing transcription factor

    PubMed Central

    Paonessa, Francesco; Criscuolo, Stefania; Sacchetti, Silvio; Amoroso, Davide; Scarongella, Helena; Pecoraro Bisogni, Federico; Carminati, Emanuele; Pruzzo, Giacomo; Maragliano, Luca; Cesca, Fabrizia; Benfenati, Fabio

    2016-01-01

    Optogenetics provides new ways to activate gene transcription; however, no attempts have been made as yet to modulate mammalian transcription factors. We report the light-mediated regulation of the repressor element 1 (RE1)-silencing transcription factor (REST), a master regulator of neural genes. To tune REST activity, we selected two protein domains that impair REST-DNA binding or recruitment of the cofactor mSin3a. Computational modeling guided the fusion of the inhibitory domains to the light-sensitive Avena sativa light–oxygen–voltage-sensing (LOV) 2-phototrophin 1 (AsLOV2). By expressing AsLOV2 chimeras in Neuro2a cells, we achieved light-dependent modulation of REST target genes that was associated with an improved neural differentiation. In primary neurons, light-mediated REST inhibition increased Na+-channel 1.2 and brain-derived neurotrophic factor transcription and boosted Na+ currents and neuronal firing. This optogenetic approach allows the coordinated expression of a cluster of genes impinging on neuronal activity, providing a tool for studying neuronal physiology and correcting gene expression changes taking place in brain diseases. PMID:26699507

  20. Role of Specificity Protein-1 and Activating Protein-2 Transcription Factors in the Regulation of the Gap Junction Protein Beta-2 Gene in the Epididymis of the Rat.

    PubMed

    Adam, Cécile; Cyr, Daniel G

    2016-06-01

    In prepubertal rats, connexin 26 (GJB2) is expressed between adjacent columnar cells of the epididymis. At 28 days of age, when columnar cells differentiate into adult epithelial cell types, Gjb2 mRNA levels decrease to barely detectable levels. There is no information on the regulation of GJB2 in the epididymis. The present study characterized regulation of the Gjb2 gene promoter in the epididymis. A single transcription start site at position -3829 bp relative to the ATG was identified. Computational analysis revealed several TFAP2A, SP1, and KLF4 putative binding sites. A 1.5-kb fragment of the Gjb2 promoter was cloned into a vector containing a luciferase reporter gene. Transfection of the construct into immortalized rat caput epididymal (RCE-1) cells indicated that the promoter contained sufficient information to drive expression of the reporter gene. Deletion constructs showed that the basal activity of the promoter resides in the first -230 bp of the transcriptional start site. Two response elements necessary for GJB2 expression were identified: an overlapping TFAP2A/SP1 site (-136 to -126 bp) and an SP1 site (-50 bp). Chromatin immunoprecipitation (ChIP) and electrophoretic mobility shift assays confirmed that SP1 and TFAP2A were bound to the promoter. ChIP analysis of chromatin from young and pubertal rats indicated that TFAP2A and SP1 binding decreased with age. SP1 and TFAP2A knockdown indicated that SP1 is necessary for Gjb2 expression. DNA methylation did not appear to be involved in the regulation of Gjb2 expression. Results indicate that SP1 and TFAP2A regulate Gjb2 promoter activity during epididymal differentiation in rat. PMID:27053364

  1. Generation of Fibroblasts Lacking the Sal-like 1 Gene by Using Transcription Activator-like Effector Nuclease-mediated Homologous Recombination

    PubMed Central

    Kim, Se Eun; Kim, Ji Woo; Kim, Yeong Ji; Kwon, Deug-Nam; Kim, Jin-Hoi; Kang, Man-Jong

    2016-01-01

    The Sal-like 1 gene (Sall1) is essential for kidney development, and mutations in this gene result in abnormalities in the kidneys. Mice lacking Sall1 show agenesis or severe dysgenesis of the kidneys. In a recent study, blastocyst complementation was used to develop mice and pigs with exogenic organs. In the present study, transcription activator-like effector nuclease (TALEN)-mediated homologous recombination was used to produce Sall1-knockout porcine fibroblasts for developing knockout pigs. The vector targeting the Sall1 locus included a 5.5-kb 5′ arm, 1.8-kb 3′ arm, and a neomycin resistance gene as a positive selection marker. The knockout vector and TALEN were introduced into porcine fibroblasts by electroporation. Antibiotic selection was performed over 11 days by using 300 μg/mL G418. DNA of cells from G418-resistant colonies was amplified using polymerase chain reaction (PCR) to confirm the presence of fragments corresponding to the 3′ and 5′ arms of Sall1. Further, mono- and bi-allelic knockout cells were isolated and analyzed using PCR–restriction fragment length polymorphism. The results of our study indicated that TALEN-mediated homologous recombination induced bi-allelic knockout of the endogenous gene. PMID:26949958

  2. Activation of a novel gene in 3q21 and identification of intergenic fusion transcripts with ecotropic viral insertion site I in leukemia.

    PubMed

    Pekarsky, Y; Rynditch, A; Wieser, R; Fonatsch, C; Gardiner, K

    1997-09-15

    We have identified a novel gene, GR6, located within the leukemia breakpoint region of 3q21, that is normally expressed in early fetal development but not in adult peripheral blood. GR6 is activated in the UCSD-AML1 cell line and in a leukemic sample, both of which carry a t(3;3)(q21;q26). In UCSD-AML1, we have also identified fusion transcripts between the ecotropic viral insertion site I (EVI1) gene in 3q26 and GR6 and between EVI1 and Ribophorin I that maps 30 kb telomeric to GR6 in 3q21. All fusions splice the 5' ends of the 3q21 genes into exon 2 of the EVI1 gene, an event that is similar to the normal intergenic splicing of MDS1-EVI1 and to those previously documented in leukemias with t(3;21) and t(3;12), in which acute myelogenous leukemia 1-EVI1 fusions and ETV6-EVI1 fusions, respectively, occur. The Ribophorin I-EVI1 fusion in particular may be a common occurrence in t(3;3). PMID:9307271

  3. Broad H3K4me3 is associated with increased transcription elongation and enhancer activity at tumor-suppressor genes.

    PubMed

    Chen, Kaifu; Chen, Zhong; Wu, Dayong; Zhang, Lili; Lin, Xueqiu; Su, Jianzhong; Rodriguez, Benjamin; Xi, Yuanxin; Xia, Zheng; Chen, Xi; Shi, Xiaobing; Wang, Qianben; Li, Wei

    2015-10-01

    Tumor suppressors are mostly defined by inactivating mutations in tumors, yet little is known about their epigenetic features in normal cells. Through integrative analysis of 1,134 genome-wide epigenetic profiles, mutations from >8,200 tumor-normal pairs and our experimental data from clinical samples, we discovered broad peaks for trimethylation of histone H3 at lysine 4 (H3K4me3; wider than 4 kb) as the first epigenetic signature for tumor suppressors in normal cells. Broad H3K4me3 is associated with increased transcription elongation and enhancer activity, which together lead to exceptionally high gene expression, and is distinct from other broad epigenetic features, such as super-enhancers. Genes with broad H3K4me3 peaks conserved across normal cells may represent pan-cancer tumor suppressors, such as TP53 and PTEN, whereas genes with cell type-specific broad H3K4me3 peaks may represent cell identity genes and cell type-specific tumor suppressors. Furthermore, widespread shortening of broad H3K4me3 peaks in cancers is associated with repression of tumor suppressors. Thus, the broad H3K4me3 epigenetic signature provides mutation-independent information for the discovery and characterization of new tumor suppressors. PMID:26301496

  4. Human T-cell leukemia virus type 1 Tax activates transcription of the human fra-1 gene through multiple cis elements responsive to transmembrane signals.

    PubMed Central

    Tsuchiya, H; Fujii, M; Niki, T; Tokuhara, M; Matsui, M; Seiki, M

    1993-01-01

    We have shown that Tax1 of human T-cell leukemia virus type 1 stimulates the expression of several cellular immediate-early genes (M. Fujii, T. Niki, T. Mori, T. Matsuda, M. Matsui, N. Nomura, and M. Seiki, Oncogene 6:1023-1029, 1991). In this study, the 5'-flanking region of the human fra-1 gene, which is a Tax1-inducible fos-related gene, was isolated and Tax1 or serum-responsive cis elements were analyzed to obtain further insight into the mechanism of Tax1 action. The 62-bp sequence starting 46 nucleotides upstream from the translation initiation site showed 71% homology with the sequence surrounding the TATA box of the c-fos promoter. Regulatory motifs identified in the c-fos promoter, such as an Ets-binding site, E boxes, a CArG box, c-fos AP-1 sites, and two retinoblastoma control elements, were also found upstream of the c-fos homology region. A 502-bp fragment containing these motifs mediated transcriptional activation by Tax1 or by serum in a transient transfection assay. Three independent Tax1-responsive regions (TRRs) were identified, and mutations in each revealed that one of the retinoblastoma control elements in TRR1 and the c-fos AP-1 sites in TRR2 and TRR3 were essential for the activation. Although TRR2 contains a CArG box-like sequence, it was a weak binding site for p67SRF, if it bound at all, and was not required for activation. All three TRRs could also mediate the signals stimulated by serum. Thus, Tax1 appears to activate fra-1 gene expression by means of a part of the cellular machinery similar to that which mediates growth signals. Images PMID:8230424

  5. Impact of ACTH Signaling on Transcriptional Regulation of Steroidogenic Genes

    PubMed Central

    Ruggiero, Carmen; Lalli, Enzo

    2016-01-01

    The trophic peptide hormone adrenocorticotropic (ACTH) stimulates steroid hormone biosynthesis evoking both a rapid, acute response and a long-term, chronic response, via the activation of cAMP/protein kinase A (PKA) signaling. The acute response is initiated by the mobilization of cholesterol from lipid stores and its delivery to the inner mitochondrial membrane, a process that is mediated by the steroidogenic acute regulatory protein. The chronic response results in the increased coordinated transcription of genes encoding steroidogenic enzymes. ACTH binding to its cognate receptor, melanocortin 2 receptor (MC2R), stimulates adenylyl cyclase, thus inducing cAMP production, PKA activation, and phosphorylation of specific nuclear factors, which bind to target promoters and facilitate coactivator protein recruitment to direct steroidogenic gene transcription. This review provides a general view of the transcriptional control exerted by the ACTH/cAMP system on the expression of genes encoding for steroidogenic enzymes in the adrenal cortex. Special emphasis will be given to the transcription factors required to mediate ACTH-dependent transcription of steroidogenic genes. PMID:27065945

  6. Transcriptional promiscuity of the human /alpha/-globin gene

    SciTech Connect

    Whitelaw, E.; Hogben, P.; Hanscombe, O.; Proudfoot, N.J.

    1989-01-01

    The human /alpha/-globin gene displays the unusual property of transcriptional promiscuity: that is, it functions in the absence of an enhancer when transfected into nonerythroid cell lines. It is also unusual in that its promoter region lies in a hypomethylated HpaII tiny fragment (HTF) island containing multiple copies of the consensus sequence for the SP1-binding site. The authors have investigated whether there is a relationship between these two observations. First, they investigated the mouse /alpha/-globin gene since it does not lie in an HTF island. They have demonstrated that it was not transcriptionally promiscuous. Second, they studied the transcriptional activity of the human /alpha/-globin gene in the absence of the GC-rich region containing putative SP1-binding sites and found a small (two- to threefold) but consistent positive effect of this region on transcriptional activity in both nonerythroid and erythroid cell lines. However, this effect did not account for the promiscuous nature of the human /alpha/-globin gene. They found that in a nonreplicating system, the human //a/-globin gene, like that of the mouse, required a simian virus 40 enhancer in order to be transcriptionally active in nonerythroid and erythroid cell lines. Since they only observed enhancer independence of the human /alpha/-globin gene in a high-copy-number replicating system, they suggest that competition for trans-acting factors could explain these results. Finally, the authors' experiments with the erythroid cell line Putko suggest that there are no tissue-specific enhancers within 1 kilobase 5' of the human /alpha/-globin cap site or within the gene itself.

  7. Transcription factor ZBED6 mediates IGF2 gene expression by regulating promoter activity and DNA methylation in myoblasts

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Zinc finger, BED-type containing 6 (ZBED6) is an important transcription factor in placental mammals, affecting development, cell proliferation and growth. In this study, we found that the expression of the ZBED6 and IGF2 were up regulated during C2C12 differentiation. The IGF2 expression levels wer...

  8. The Hsp90 molecular chaperone complex regulates maltose induction and stability of the Saccharomyces MAL gene transcription activator Mal63p.

    PubMed

    Bali, Mehtap; Zhang, Bin; Morano, Kevin A; Michels, Corinne A

    2003-11-28

    Induction of the Saccharomyces MAL structural genes encoding maltose permease and maltase requires the MAL activator, a DNA-binding transcription activator. Genetic analysis of MAL activator mutations suggested that protein folding and stability play an important role in MAL activator regulation and led us to explore the role of the Hsp90 molecular chaperone complex in the regulation of the MAL activator. Strains carrying mutations in genes encoding components of the Hsp90 chaperone complex, hsc82 Delta hsp82-T101I and hsc82 Delta cpr7 Delta, are defective for maltase induction and exhibit significantly reduced growth rates on media containing a limiting concentration of maltose (0.05%). This growth defect is suppressed by providing maltose in excess. Using epitope-tagged alleles of the MAL63 MAL activator, we showed that Mal63p levels are drastically reduced following depletion of cellular Hsp90. Overexpression ( approximately 3-fold) of Mal63p in the hsc82 Delta hsp82-T101I and hsc82 Delta cpr7 Delta strains suppresses their Mal- growth phenotype, suggesting that Mal63p levels are limiting for maltose utilization in strains with abrogated Hsp90 activity. Consistent with this, the half-life of Mal63p is significantly shorter in the hsc82 Delta cpr7 Delta strain (reduced about 6-fold) and modestly affected in the Hsp90-ts strain (reduced about 2-fold). Most importantly, triple hemagglutinin-tagged Mal63p protein is found in association with Hsp90 as demonstrated by co-immunoprecipitation. Taken together, these results identify the inducible MAL activator as a client protein of the Hsp90 molecular chaperone complex and point to a critical role for chaperone function in alternate carbon source utilization in Saccharomyces cerevisiae. PMID:14500708

  9. A transcription map of a yeast centromere plasmid: unexpected transcripts and altered gene expression.

    PubMed Central

    Marczynski, G T; Jaehning, J A

    1985-01-01

    YCp19 is a yeast centromere plasmid capable of autonomous replication in both yeast and E. coli (J. Mol. Biol., 158: 157-179, 1982). It is stably maintained as a single copy in the yeast cell and is therefore a model yeast "minichromosome" and cloning vector. We have located the positions and measured the abundance of the in vivo yeast transcripts from YCp19. Transcripts from the selectable marker genes TRP1 and URA3 were present at increased levels relative to chromosomal copies of the genes. Unanticipated transcripts from the yeast CEN4 and E. coli pBR322 sequences were also found. Although much of the plasmid vector is actively transcribed in vivo, the regions around the most useful cloning sites (BamHI, EcoRI, SalI) are free of transcripts. We have analyzed transcription of BamHI inserts containing promoter variants of the HIS3 gene and determined that although initiation events are accurate, plasmid context may alter levels of gene expression. Images PMID:3909105

  10. The 26S Proteasome and Initiation of Gene Transcription

    PubMed Central

    Durairaj, Geetha; Kaiser, Peter

    2014-01-01

    Transcription activation is the foremost step of gene expression and is modulated by various factors that act in synergy. Misregulation of this process and its associated factors has severe effects and hence requires strong regulatory control. In recent years, growing evidence has highlighted the 26S proteasome as an important contributor to the regulation of transcription initiation. Well known for its role in protein destruction, its contribution to protein synthesis was initially viewed with skepticism. However, studies over the past several years have established the proteasome as an important component of transcription initiation through proteolytic and non-proteolytic activities. In this review, we discuss findings made so far in understanding the connections between transcription initiation and the 26S proteasome complex. PMID:25211636

  11. The transcriptional corepressor DSP1 inhibits activated transcription by disrupting TFIIA-TBP complex formation.

    PubMed Central

    Kirov, N C; Lieberman, P M; Rushlow, C

    1996-01-01

    Transcriptional repression of eukaryotic genes is essential for many cellular and developmental processes, yet the precise mechanisms of repression remain poorly understood. The Dorsal Switch Protein (DSP1) was identified in a genetic screen for activities which convert Dorsal into a transcriptional repressor. DSP1 shares structural homology with the HMG-1/2 family and inhibits activation by the rel transcription factors Dorsal and NF-kappaB in transfection studies. Here we investigate the mechanism of transcriptional repression by DSP1. We found that DSP1 protein can act as a potent transcriptional repressor for multiple activator families in vitro and in transfection studies. DSP1 bound directly to the TATA binding protein (TBP), and formed a stable ternary complex with TBP bound to DNA. DSP1 preferentially disrupted the DNA binding of TBP complexes containing TFIIA and displaced TFIIA from binding to TBP. Consistent with the inhibition of TFIIA-bound complexes, DSP1 was shown to inhibit activated but not basal transcription reactions in vitro. The ability of DSP1 to interact with TBP and to repress transcription was mapped to the carboxy-terminal domain which contains two HMG boxes. Our results support the model that DSP1 represses activated transcription by interfering with the binding of TFIIA, a general transcription factor implicated in activated transcription pathways. Images PMID:9003783

  12. Regulation of gene transcription by Polycomb proteins

    PubMed Central

    Aranda, Sergi; Mas, Gloria; Di Croce, Luciano

    2015-01-01

    The Polycomb group (PcG) of proteins defines a subset of factors that physically associate and function to maintain the positional identity of cells from the embryo to adult stages. PcG has long been considered a paradigmatic model for epigenetic maintenance of gene transcription programs. Despite intensive research efforts to unveil the molecular mechanisms of action of PcG proteins, several fundamental questions remain unresolved: How many different PcG complexes exist in mammalian cells? How are PcG complexes targeted to specific loci? How does PcG regulate transcription? In this review, we discuss the diversity of PcG complexes in mammalian cells, examine newly identified modes of recruitment to chromatin, and highlight the latest insights into the molecular mechanisms underlying the function of PcGs in transcription regulation and three-dimensional chromatin conformation. PMID:26665172

  13. MarR-type Transcriptional Regulator ChlR Activates Expression of Tetrapyrrole Biosynthesis Genes in Response to Low-oxygen Conditions in Cyanobacteria*

    PubMed Central

    Aoki, Rina; Takeda, Tomoya; Omata, Tatsuo; Ihara, Kunio; Fujita, Yuichi

    2012-01-01

    Oxygen is required for three enzyme reactions in chlorophyll and bilin biosynthesis pathways: coproporphyrinogen III oxidase (HemF), heme oxygenase (HO1), and Mg-protoporphyrin IX monomethylester cyclase (ChlAI). The cyanobacterium Synechocystis sp. PCC 6803 has alternative enzymes, HemN, HO2, and ChlAII, to supply chlorophyll/bilins even under low-oxygen environments. The three genes form an operon, chlAII-ho2-hemN, that is induced in response to low-oxygen conditions to bypass the oxygen-dependent reactions. Here we identified a transcriptional regulator for the induction of the operon in response to low-oxygen conditions. A pseudorevertant, Δho1R, was isolated from a HO1-lacking mutant Δho1 that is lethal under aerobic conditions. Δho1R grew well even under aerobic conditions. In Δho1R, HO2 that is induced only under low-oxygen conditions was anomalously expressed under aerobic conditions to complement the loss of HO1. A G-to-C transversion in sll1512 causing the amino acid change from aspartate 35 to histidine was identified as the relevant mutation by resequencing of the Δho1R genome. Sll1512 is a MarR-type transcriptional regulator. An sll1512-lacking mutant grew poorly under low-oxygen conditions with a remarked decrease in Chl content that would be caused by the suppressed induction of the chlAII and hemN genes in Chl biosynthesis under low-oxygen conditions. These results demonstrated that Sll1512 is an activator in response to low-oxygen environments and that the D35H variant becomes a constitutive activator. This hypothesis was supported by a gel shift assay showing that the Sll1512-D35H variant binds to the DNA fragment upstream of the operon. We propose to name sll1512 chlR. PMID:22375005

  14. A hormone-encoding gene identifies a pathway for cardiac but not skeletal muscle gene transcription.

    PubMed Central

    Grépin, C; Dagnino, L; Robitaille, L; Haberstroh, L; Antakly, T; Nemer, M

    1994-01-01

    In contrast to skeletal muscle, the mechanisms responsible for activation and maintenance of tissue-specific transcription in cardiac muscle remain poorly understood. A family of hormone-encoding genes is expressed in a highly specific manner in cardiac but not skeletal myocytes. This includes the A- and B-type natriuretic peptide (ANP and BNP) genes, which encode peptide hormones with crucial roles in the regulation of blood volume and pressure. Since these genes are markers of cardiac cells, we have used them to probe the mechanisms for cardiac muscle-specific transcription. Cloning and functional analysis of the rat BNP upstream sequences revealed unexpected structural resemblance to erythroid but not to muscle-specific promoters and enhancers, including a requirement for regulatory elements containing GATA motifs. A cDNA clone corresponding to a member of the GATA family of transcription factors was isolated from a cardiomyocyte cDNA library. Transcription of this GATA gene is restricted mostly to the heart and is undetectable in skeletal muscle. Within the heart, GATA transcripts are localized in ANP- and BNP-expressing myocytes, and forced expression of the GATA protein in heterologous cells markedly activates transcription from the natural cardiac muscle-specific ANP and BNP promoters. This GATA-dependent pathway defines the first mechanism for cardiac muscle-specific transcription. Moreover, the present findings reveal striking similarities between the mechanisms controlling gene expression in hematopoietic and cardiac cells and may have important implications for studies of cardiogenesis. Images PMID:8164667

  15. Intersecting transcription networks constrain gene regulatory evolution.

    PubMed

    Sorrells, Trevor R; Booth, Lauren N; Tuch, Brian B; Johnson, Alexander D

    2015-07-16

    Epistasis-the non-additive interactions between different genetic loci-constrains evolutionary pathways, blocking some and permitting others. For biological networks such as transcription circuits, the nature of these constraints and their consequences are largely unknown. Here we describe the evolutionary pathways of a transcription network that controls the response to mating pheromone in yeast. A component of this network, the transcription regulator Ste12, has evolved two different modes of binding to a set of its target genes. In one group of species, Ste12 binds to specific DNA binding sites, while in another lineage it occupies DNA indirectly, relying on a second transcription regulator to recognize DNA. We show, through the construction of various possible evolutionary intermediates, that evolution of the direct mode of DNA binding was not directly accessible to the ancestor. Instead, it was contingent on a lineage-specific change to an overlapping transcription network with a different function, the specification of cell type. These results show that analysing and predicting the evolution of cis-regulatory regions requires an understanding of their positions in overlapping networks, as this placement constrains the available evolutionary pathways. PMID:26153861

  16. Intersecting transcription networks constrain gene regulatory evolution

    PubMed Central

    Sorrells, Trevor R; Booth, Lauren N; Tuch, Brian B; Johnson, Alexander D

    2015-01-01

    Epistasis—the non-additive interactions between different genetic loci—constrains evolutionary pathways, blocking some and permitting others1–8. For biological networks such as transcription circuits, the nature of these constraints and their consequences are largely unknown. Here we describe the evolutionary pathways of a transcription network that controls the response to mating pheromone in yeasts9. A component of this network, the transcription regulator Ste12, has evolved two different modes of binding to a set of its target genes. In one group of species, Ste12 binds to specific DNA binding sites, while in another lineage it occupies DNA indirectly, relying on a second transcription regulator to recognize DNA. We show, through the construction of various possible evolutionary intermediates, that evolution of the direct mode of DNA binding was not directly accessible to the ancestor. Instead, it was contingent on a lineage-specific change to an overlapping transcription network with a different function, the specification of cell type. These results show that analyzing and predicting the evolution of cis-regulatory regions requires an understanding of their positions in overlapping networks, as this placement constrains the available evolutionary pathways. PMID:26153861

  17. Src Subfamily Kinases Regulate Nuclear Export and Degradation of Transcription Factor Nrf2 to Switch Off Nrf2-mediated Antioxidant Activation of Cytoprotective Gene Expression*

    PubMed Central

    Niture, Suryakant K.; Jain, Abhinav K.; Shelton, Phillip M.; Jaiswal, Anil K.

    2011-01-01

    Nrf2 (NF-E2-related factor 2) is a nuclear transcription factor that in response to chemical and radiation stress regulates coordinated induction of a battery of cytoprotective gene expressions leading to cellular protection. In this study, we investigated the role of Src kinases in the regulation of Nrf2 and downstream signaling. siRNA-mediated inhibition of Fyn, Src, Yes, and Fgr, but not Lyn, in mouse hepatoma Hepa-1 cells, led to nuclear accumulation of Nrf2 and up-regulation of Nrf2 downstream gene expression. Mouse embryonic fibroblasts with combined deficiency of Fyn/Src/Yes/Fgr supported results from siRNA. In addition, steady-state overexpression of Fyn, Src, and Yes phosphorylated Nrf2Tyr568 that triggered nuclear export and degradation of Nrf2 and down-regulation of Nrf2 downstream gene expression. Exposure of cells to antioxidant, oxidant, or UV radiation increased nuclear import of Fyn, Src, and Yes kinases, which phosphorylated Nrf2Tyr568 resulting in nuclear export and degradation of Nrf2. Further analysis revealed that stress-activated GSK3β acted upstream to the Src kinases and phosphorylated the Src kinases, leading to their nuclear localization and Nrf2 phosphorylation. The overexpression of Src kinases in Hepa-1 cells led to decreased Nrf2, increased apoptosis, and decreased cell survival. Mouse embryonic fibroblasts deficient in Src kinases showed nuclear accumulation of Nrf2, induction of Nrf2 and downstream gene expression, reduced apoptosis, and increased cell survival. The studies together demonstrate that Src kinases play a critical role in nuclear export and degradation of Nrf2, thereby providing a negative feedback mechanism to switch off Nrf2 activation and restore normal cellular homeostasis. PMID:21690096

  18. Mediator protein mutations that selectively abolish activated transcription.

    PubMed

    Myers, L C; Gustafsson, C M; Hayashibara, K C; Brown, P O; Kornberg, R D

    1999-01-01

    Deletion of any one of three subunits of the yeast Mediator of transcriptional regulation, Med2, Pgd1 (Hrs1), and Sin4, abolished activation by Gal4-VP16 in vitro. By contrast, other Mediator functions, stimulation of basal transcription and of TFIIH kinase activity, were unaffected. A different but overlapping Mediator subunit dependence was found for activation by Gcn4. The genetic requirements for activation in vivo were closely coincident with those in vitro. A whole genome expression profile of a Deltamed2 strain showed diminished transcription of a subset of inducible genes but only minor effects on "basal" transcription. These findings make an important connection between transcriptional activation in vitro and in vivo, and identify Mediator as a "global" transcriptional coactivator. PMID:9874773

  19. The role of the 5'-flanking sequence of a human tRNA(Glu) gene in modulation of its transcriptional activity in vitro.

    PubMed Central

    Gonos, E S; Goddard, J P

    1990-01-01

    The role of a tRNA-like structure within the 5'-flanking sequence of a human tRNA(Glu) gene in the modulation of its transcription in vitro by HeLa cell extracts has been investigated using several deletion mutants of a recombinant of the gene which lacked part or all of the tRNA-like structure. The transcriptional efficiency of four mutants was the same as that of the wild-type recombinant, two mutants had decreased transcriptional efficiency, one was more efficient, and one, lacking part of the 5' intragenic control region, was inactive. Correlation of the transcriptional efficiencies with the position and the size of the 5'-flanking sequence that was deleted indicated that the tRNA-like structure may be deleted without loss of transcriptional efficiency. Current models for the modulation of tRNA gene transcription by the 5'-flanking sequence are assessed in the light of the results obtained, and a potential model is presented. Images Fig. 2. Fig. 4. PMID:2268303

  20. A tobacco bZip transcription activator (TAF-1) binds to a G-box-like motif conserved in plant genes.

    PubMed Central

    Oeda, K; Salinas, J; Chua, N H

    1991-01-01

    Tobacco nuclear extract contains a factor that binds specifically to the motif I sequence (5'-GTACGTGGCG-3') conserved among rice rab genes and cotton lea genes. We isolated from a tobacco cDNA expression library, a partial cDNA clone encoding a truncated derivative of a protein designated as TAF-1. The truncated TAF-1 (Mr = 26,000) contains an acidic region at its N-terminus and a bZip motif at its C-terminus. Using a panel of motif I mutants as probes, we showed that the truncated TAF-1 and the tobacco nuclear factor for motif I have similar, it not identical, binding specificities. In particular, both show high-affinity binding to the perfect palindrome 5'-GCCACGTGGC-3' which is also known as the G-box motif. TAF-1 mRNA is highly expressed in root, but the level is at least 10 times lower in stem and leaf. Consistent with this observation, we found that a motif I tetramer, when fused to the -90 derivative of the CaMV 35S promoter, is inactive in leaf of transgenic tobacco. The activity, however, can be elevated by transient expression of the truncated TAF-1. We conclude from these results that TAF-1 can bind to the G-box and related motifs and that it functions as a transcription activator. Images PMID:2050116

  1. Dynamic gene expression patterns in animal models of early and late heart failure reveal biphasic-bidirectional transcriptional activation of signaling pathways.

    PubMed

    Rowell, Janelle; Koitabashi, Norimichi; Kass, David A; Barth, Andreas S

    2014-10-15

    Altered cardiac gene expression in heart failure (HF) has mostly been identified by single-point analysis of end-stage disease. This may miss earlier changes in gene expression that are transient and/or directionally opposite to those observed later. Myocardial datasets from the largest microarray data repository (Gene Expression Omnibus) yielded six HF studies with time-course data. Differentially expressed transcripts between nonfailing controls, early HF (<3 days after cardiac insult) and late HF (usually >2 wk) were determined, and analysis of KEGG pathways and predicted regulatory control elements performed. We found that gene expression followed varying patterns: Downregulation of metabolic pathways occurred early and was sustained into late-stage HF. In contrast, most signaling pathways undergo a complex biphasic pattern: Calcium signaling, p53, apoptosis, and MAPK pathways displayed a bidirectional response, declining early but rising late. These profiles were compatible with specific microRNA (miRNA) and transcription regulators: Estrogen-related receptor-α and myocyte-enhancer factor-2 binding sites were overrepresented in the promoter regions of downregulated transcripts. Concurrently, there were overrepresented binding sites for E2f and ETS family members (E-Twenty Six, including Gabp, Elf1, and Ets2), serum response and interferon regulated factor in biphasic-bidirectional and late-upregulated transcripts. Binding sites for miRNAs downregulated by HF were more common in upregulated transcripts (e.g., miRNA-22,-133a/b, and -150 in early HF and miRNA-1,-9,-499 in late HF). During the development of HF, gene expression is characterized by dynamic overlapping sets of transcripts controlled by specific interrelated regulatory mechanisms. While metabolic gene classes show early and sustained downregulation in HF, signaling pathways undergo a complex biphasic pattern with early down- and more pronounced late upregulation. PMID:25159852

  2. Transcriptional activation of vascular cell adhesion molecule-1 gene in vivo and its role in the pathophysiology of neutrophil-induced liver injury in murine endotoxin shock.

    PubMed

    Essani, N A; Bajt, M L; Farhood, A; Vonderfecht, S L; Jaeschke, H

    1997-06-15

    Polymorphonuclear leukocytes (neutrophils) can cause hepatic parenchymal cell injury during endotoxin (ET) shock. Because adhesion molecules are critical for inflammatory cell damage, the role of vascular cell adhesion molecule-1 (VCAM-1) was studied in the pathophysiology of ET shock. ET-sensitive mice (C3Heb/FeJ) were treated with 700 mg/kg galactosamine in combination with 100 microg/kg Salmonella abortus equi ET, 15 microg/kg TNF-alpha, or 13 to 23 microg/kg IL-1. VCAM-1 mRNA formation was strongly activated in animals treated with ET, TNF-alpha, or IL-1. In contrast, only TNF-alpha and IL-1, not ET, induced VCAM-1 gene transcription in livers of ET-resistant mice (C3H/HeJ). Immunohistochemistry and isolation of liver cells during endotoxemia indicated that VCAM-1 mRNA and protein were only formed in endothelial cells and Kupffer cells, not in hepatocytes. Galactosamine/ET induced neutrophil accumulation in sinusoids (515 +/- 30 neutrophils/50 high power fields) followed by transmigration at 7 h. At that time, severe liver injury was observed (necrosis, 53 +/- 5%). An anti-VCAM-1 Ab (3 mg/kg) attenuated the area of necrosis by 60%. The Ab reduced neutrophil transmigration by 84%, but had no effect on the total number of cells in the liver vasculature. Flow cytometric analysis identified the presence of very late Ag-4 on mouse peripheral neutrophils. Our data demonstrated cytokine-dependent VCAM-1 gene transcription and protein expression in the liver during endotoxemia. Neutrophils were able to use very late Ag-4/VCAM-1 interactions to transmigrate into liver parenchyma in vivo. Preventing transmigration by blocking VCAM-1 protected hepatocytes against neutrophil-induced injury. PMID:9190948

  3. The Transcription Factor AmrZ Utilizes Multiple DNA Binding Modes to Recognize Activator and Repressor Sequences of Pseudomonas aeruginosa Virulence Genes

    PubMed Central

    Pryor, Edward E.; Waligora, Elizabeth A.; Xu, Binjie; Dellos-Nolan, Sheri; Wozniak, Daniel J.; Hollis, Thomas

    2012-01-01

    AmrZ, a member of the Ribbon-Helix-Helix family of DNA binding proteins, functions as both a transcriptional activator and repressor of multiple genes encoding Pseudomonas aeruginosa virulence factors. The expression of these virulence factors leads to chronic and sustained infections associated with worsening prognosis. In this study, we present the X-ray crystal structure of AmrZ in complex with DNA containing the repressor site, amrZ1. Binding of AmrZ to this site leads to auto-repression. AmrZ binds this DNA sequence as a dimer-of-dimers, and makes specific base contacts to two half sites, separated by a five base pair linker region. Analysis of the linker region shows a narrowing of the minor groove, causing significant distortions. AmrZ binding assays utilizing sequences containing variations in this linker region reveals that secondary structure of the DNA, conferred by the sequence of this region, is an important determinant in binding affinity. The results from these experiments allow for the creation of a model where both intrinsic structure of the DNA and specific nucleotide recognition are absolutely necessary for binding of the protein. We also examined AmrZ binding to the algD promoter, which results in activation of the alginate exopolysaccharide biosynthetic operon, and found the protein utilizes different interactions with this site. Finally, we tested the in vivo effects of this differential binding by switching the AmrZ binding site at algD, where it acts as an activator, for a repressor binding sequence and show that differences in binding alone do not affect transcriptional regulation. PMID:22511872

  4. The C175R mutation alters nuclear localization and transcriptional activity of the nephronophthisis NPHP7 gene product

    PubMed Central

    Ramachandran, Haribaskar; Yakulov, Toma A; Engel, Christina; Müller, Barbara; Walz, Gerd

    2016-01-01

    Nephronophthisis (NPH) is a rare autosomal ciliopathy, but the leading cause for hereditary end-stage renal disease in children. Most NPH family members form large protein networks, which appear to participate in structural elements of the cilium and/or function to restrict access of molecules to the ciliary compartment. The zinc-finger protein GLIS2/NPHP7 represents an exception as it has been implicated in transcriptional regulation; only two families with GLIS2/NPHP7 mutations and typical NPH manifestations have been identified so far. We describe here that the recently identified GLIS2/NPHP7C175R point mutation abolished the nuclear localization of GLIS2/NPHP7. Forced nuclear import did not rescue the transcriptional defects of GLIS2/NPHP7C175R, indicating additional defects as DNA-binding protein. We further observed that wild type, but not GLIS2/NPHP7C175R, prevented the cyst formation caused by depletion of nphp7 in zebrafish embryos. Taken together, our findings indicate that the C175R mutation affects both localization and function of GLIS2/NPHP7, supporting a role of this mutation in NPH, but questioning the direct involvement of GLIS2/NPHP7 in ciliary functions. PMID:26374130

  5. Gene Expression and Metabolite Profiling of Developing Highbush Blueberry Fruit Indicates Transcriptional Regulation of Flavonoid Metabolism and Activation of Abscisic Acid Metabolism1[W][OA

    PubMed Central

    Zifkin, Michael; Jin, Alena; Ozga, Jocelyn A.; Zaharia, L. Irina; Schernthaner, Johann P.; Gesell, Andreas; Abrams, Suzanne R.; Kennedy, James A.; Constabel, C. Peter

    2012-01-01

    Highbush blueberry (Vaccinium corymbosum) fruits contain substantial quantities of flavonoids, which are implicated in a wide range of health benefits. Although the flavonoid constituents of ripe blueberries are known, the molecular genetics underlying their biosynthesis, localization, and changes that occur during development have not been investigated. Two expressed sequence tag libraries from ripening blueberry fruit were constructed as a resource for gene identification and quantitative real-time reverse transcription-polymerase chain reaction primer design. Gene expression profiling by quantitative real-time reverse transcription-polymerase chain reaction showed that flavonoid biosynthetic transcript abundance followed a tightly regulated biphasic pattern, and transcript profiles were consistent with the abundance of the three major classes of flavonoids. Proanthocyanidins (PAs) and corresponding biosynthetic transcripts encoding anthocyanidin reductase and leucoanthocyanidin reductase were most concentrated in young fruit and localized predominantly to the inner fruit tissue containing the seeds and placentae. Mean PA polymer length was seven to 8.5 subunits, linked predominantly via B-type linkages, and was relatively constant throughout development. Flavonol accumulation and localization patterns were similar to those of the PAs, and the B-ring hydroxylation pattern of both was correlated with flavonoid-3′-hydroxylase transcript abundance. By contrast, anthocyanins accumulated late in maturation, which coincided with a peak in flavonoid-3-O-glycosyltransferase and flavonoid-3′5′-hydroxylase transcripts. Transcripts of VcMYBPA1, which likely encodes an R2R3-MYB transcriptional regulator of PA synthesis, were prominent in both phases of development. Furthermore, the initiation of ripening was accompanied by a substantial rise in abscisic acid, a growth regulator that may be an important component of the ripening process and contribute to the regulation

  6. Gene expression and metabolite profiling of developing highbush blueberry fruit indicates transcriptional regulation of flavonoid metabolism and activation of abscisic acid metabolism.

    PubMed

    Zifkin, Michael; Jin, Alena; Ozga, Jocelyn A; Zaharia, L Irina; Schernthaner, Johann P; Gesell, Andreas; Abrams, Suzanne R; Kennedy, James A; Constabel, C Peter

    2012-01-01

    Highbush blueberry (Vaccinium corymbosum) fruits contain substantial quantities of flavonoids, which are implicated in a wide range of health benefits. Although the flavonoid constituents of ripe blueberries are known, the molecular genetics underlying their biosynthesis, localization, and changes that occur during development have not been investigated. Two expressed sequence tag libraries from ripening blueberry fruit were constructed as a resource for gene identification and quantitative real-time reverse transcription-polymerase chain reaction primer design. Gene expression profiling by quantitative real-time reverse transcription-polymerase chain reaction showed that flavonoid biosynthetic transcript abundance followed a tightly regulated biphasic pattern, and transcript profiles were consistent with the abundance of the three major classes of flavonoids. Proanthocyanidins (PAs) and corresponding biosynthetic transcripts encoding anthocyanidin reductase and leucoanthocyanidin reductase were most concentrated in young fruit and localized predominantly to the inner fruit tissue containing the seeds and placentae. Mean PA polymer length was seven to 8.5 subunits, linked predominantly via B-type linkages, and was relatively constant throughout development. Flavonol accumulation and localization patterns were similar to those of the PAs, and the B-ring hydroxylation pattern of both was correlated with flavonoid-3'-hydroxylase transcript abundance. By contrast, anthocyanins accumulated late in maturation, which coincided with a peak in flavonoid-3-O-glycosyltransferase and flavonoid-3'5'-hydroxylase transcripts. Transcripts of VcMYBPA1, which likely encodes an R2R3-MYB transcriptional regulator of PA synthesis, were prominent in both phases of development. Furthermore, the initiation of ripening was accompanied by a substantial rise in abscisic acid, a growth regulator that may be an important component of the ripening process and contribute to the regulation of

  7. Analysis of DNA sequences which regulate the transcription of herpes simplex virus immediate early gene 3: DNA sequences required for enhancer-like activity and response to trans-activation by a virion polypeptide.

    PubMed Central

    Bzik, D J; Preston, C M

    1986-01-01

    The far upstream region of herpes simplex virus (HSV) immediate early (IE) gene 3 has previously been shown to increase gene expression in an enhancer-like manner, and to contain sequences which respond to stimulation of transcription by a virion polypeptide, Vmw65. To analyse the specific DNA sequences which mediate these functions, sequential deletions from each end of the far upstream region were made. The effects of the deletions on transcription in the absence or presence of the Vmw65 were measured by use of a transient expression assay. The enhancer-like activity was due to three separable elements, whereas two additional DNA regions were involved in the response to Vmw65. One of the responding elements corresponded to an AT-rich consensus (TAATGARATTC, where R = purine) present in all IE gene far upstream regions, and the other was a GA-rich sequence also present in IE genes 2 and 4/5. The TAATGARATTC element could mediate responsiveness to Vmw65 but it was fully active only in the presence of the GA-rich element. The GA-rich element was unable to confer a strong response alone but could activate an otherwise nonfunctional homologue of TAATGARATTC. PMID:3003700

  8. Analysis of DNA sequences which regulate the transcription of herpes simplex virus immediate early gene 3: DNA sequences required for enhancer-like activity and response to trans-activation by a virion polypeptide.

    PubMed

    Bzik, D J; Preston, C M

    1986-01-24

    The far upstream region of herpes simplex virus (HSV) immediate early (IE) gene 3 has previously been shown to increase gene expression in an enhancer-like manner, and to contain sequences which respond to stimulation of transcription by a virion polypeptide, Vmw65. To analyse the specific DNA sequences which mediate these functions, sequential deletions from each end of the far upstream region were made. The effects of the deletions on transcription in the absence or presence of the Vmw65 were measured by use of a transient expression assay. The enhancer-like activity was due to three separable elements, whereas two additional DNA regions were involved in the response to Vmw65. One of the responding elements corresponded to an AT-rich consensus (TAATGARATTC, where R = purine) present in all IE gene far upstream regions, and the other was a GA-rich sequence also present in IE genes 2 and 4/5. The TAATGARATTC element could mediate responsiveness to Vmw65 but it was fully active only in the presence of the GA-rich element. The GA-rich element was unable to confer a strong response alone but could activate an otherwise nonfunctional homologue of TAATGARATTC. PMID:3003700

  9. Transcriptional activation of a MYB gene controls the tissue-specific anthocyanin accumulation in a purple cauliflower mutant

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Flavonoids such as anthocyanins possess significant health benefits to humans and play important physiological roles in plants. An interesting Purple gene mutation in cauliflower confers an abnormal pattern of anthocyanin accumulation, giving intense purple color in very young leaves, curds, and see...

  10. Cohesin: genomic insights into controlling gene transcription and development

    PubMed Central

    Dorsett, Dale

    2011-01-01

    Over the past decade it has emerged that the cohesin protein complex, which functions in sister chromatid cohesion, chromosome segregation and DNA repair, also regulates gene expression and development. Even minor changes in cohesin activity alter several aspects of development. Genome-wide analysis indicates that cohesin directly regulates transcription of genes involved in cell proliferation, pluripotency, and differentiation through multiple mechanisms. These mechanisms are poorly understood, but involve both partial gene repression in concert with Polycomb group proteins, and facilitating long-range looping, both between enhancers and promoters, and between CTCF protein binding sites. PMID:21324671

  11. The nuclear-encoded sigma factor SIG4 directly activates transcription of chloroplast psbA and ycf17 genes in the unicellular red alga Cyanidioschyzon merolae.

    PubMed

    Fujii, Gaku; Imamura, Sousuke; Era, Atsuko; Miyagishima, Shin-ya; Hanaoka, Mitsumasa; Tanaka, Kan

    2015-05-01

    The plant organelle chloroplast originated from the endosymbiosis of a cyanobacterial-like photosynthetic bacterium, and still retains its own genome derived from this ancestor. We have been focusing on a unicellular red alga, Cyanidioschyzon merolae, as a model photosynthetic eukaryote. In this study, we analyzed the transcriptional specificity of SIG4, which is one of four nuclear-encoded chloroplast RNA polymerase sigma factors in this alga. Accumulation of the SIG4 protein was observed in response to nitrogen depletion or high light conditions. By comparing the chloroplast transcriptomes under nitrogen depletion and SIG4-overexpressing conditions, we identified several candidate genes as SIG4 targets. Together with the results of chromatin immunoprecipitation analysis, the promoters of the psbA (encoding the D1 protein of the photosystem II reaction center) and ycf17 (encoding a protein of the early light-inducible protein family) genes were shown to be direct activation targets. The phycobilisome (PBS) CpcB protein was decreased by SIG4 overexpression, which suggests the negative involvement of SIG4 in PBS accumulation. PMID:25883111

  12. The Smad3 linker region contains a transcriptional activation domain.

    PubMed

    Wang, Guannan; Long, Jianyin; Matsuura, Isao; He, Dongming; Liu, Fang

    2005-02-15

    Transforming growth factor-beta (TGF-beta)/Smads regulate a wide variety of biological responses through transcriptional regulation of target genes. Smad3 plays a key role in TGF-beta/Smad-mediated transcriptional responses. Here, we show that the proline-rich linker region of Smad3 contains a transcriptional activation domain. When the linker region is fused to a heterologous DNA-binding domain, it activates transcription. We show that the linker region physically interacts with p300. The adenovirus E1a protein, which binds to p300, inhibits the transcriptional activity of the linker region, and overexpression of p300 can rescue the linker-mediated transcriptional activation. In contrast, an adenovirus E1a mutant, which cannot bind to p300, does not inhibit the linker-mediated transcription. The native Smad3 protein lacking the linker region is unable to mediate TGF-beta transcriptional activation responses, although it can be phosphorylated by the TGF-beta receptor at the C-terminal tail and has a significantly increased ability to form a heteromeric complex with Smad4. We show further that the linker region and the C-terminal domain of Smad3 synergize for transcriptional activation in the presence of TGF-beta. Thus our findings uncover an important function of the Smad3 linker region in Smad-mediated transcriptional control. PMID:15588252

  13. Essential role of NF-E2 in remodeling of chromatin structure and transcriptional activation of the epsilon-globin gene in vivo by 5' hypersensitive site 2 of the beta-globin locus control region.

    PubMed Central

    Gong, Q H; McDowell, J C; Dean, A

    1996-01-01

    Much of our understanding of the process by which enhancers activate transcription has been gained from transient-transfection studies in which the DNA is not assembled with histones and other chromatin proteins as it is in the cell nucleus. To study the activation of a mammalian gene in a natural chromatin context in vivo, we constructed a minichromosome containing the human epsilon-globin gene and portions of the beta-globin locus control region (LCR). The minichromosomes replicate and are maintained at stable copy number in human erythroid cells. Expression of the minichromosomal epsilon-globin gene requires the presence of beta-globin LCR elements in cis, as is the case for the chromosomal gene. We determined the chromatin structure of the epsilon-globin gene in both the active and inactive states. The transcriptionally inactive locus is covered by an array of positioned nucleosomes extending over 1,400 bp. In minichromosomes with a (mu)LCR or DNase I-hypersensitive site 2 (HS2) which actively transcribe the epsilon-globin gene, the nucleosome at the promoter is altered or disrupted while positioning of nucleosomes in the rest of the locus is retained. All or virtually all minichromosomes are simultaneously hypersensitive to DNase I both at the promoter and at HS2. Transcriptional activation and promoter remodeling, as well as formation of the HS2 structure itself, depended on the presence of the NF-E2 binding motif in HS2. The nucleosome at the promoter which is altered upon activation is positioned over the transcriptional elements of the epsilon-globin gene, i.e., the TATA, CCAAT, and CACCC elements, and the GATA-1 site at -165. The simple availability of erythroid transcription factors that recognize these motifs is insufficient to allow expression. As in the chromosomal globin locus, regulation also occurs at the level of chromatin structure. These observations are consistent with the idea that one role of the beta-globin LCR is to maintain promoters free

  14. Cooperative antiproliferative signaling by aspirin and indole-3-carbinol targets microphthalmia-associated transcription factor gene expression and promoter activity in human melanoma cells.

    PubMed

    Poindexter, Kevin M; Matthew, Susanne; Aronchik, Ida; Firestone, Gary L

    2016-04-01

    Antiproliferative signaling of combinations of the nonsteroidal anti-inflammatory drug acetylsalicylic acid (aspirin) and indole-3-carbinol (I3C), a natural indolecarbinol compound derived from cruciferous vegetables, was investigated in human melanoma cells. Melanoma cell lines with distinct mutational profiles were sensitive to different extents to the antiproliferative response of aspirin, with oncogenic BRAF-expressing G361 cells and wild-type BRAF-expressing SK-MEL-30 cells being the most responsive. I3C triggered a strong proliferative arrest of G361 melanoma cells and caused only a modest decrease in the proliferation of SK-MEL-30 cells. In both cell lines, combinations of aspirin and I3C cooperatively arrested cell proliferation and induced a G1 cell cycle arrest, and nearly ablated protein and transcript levels of the melanocyte master regulator microphthalmia-associated transcription factor isoform M (MITF-M). In melanoma cells transfected with a -333/+120-bp MITF-M promoter-luciferase reporter plasmid, treatment with aspirin and I3C cooperatively disrupted MITF-M promoter activity, which accounted for the loss of MITF-M gene products. Mutational analysis revealed that the aspirin required the LEF1 binding site, whereas I3C required the BRN2 binding site to mediate their combined and individual effects on MITF-M promoter activity. Consistent with LEF1 being a downstream effector of Wnt signaling, aspirin, but not I3C, downregulated protein levels of the Wnt co-receptor LDL receptor-related protein-6 and β-catenin and upregulated the β-catenin destruction complex component Axin. Taken together, our results demonstrate that aspirin-regulated Wnt signaling and I3C-targeted signaling pathways converge at distinct DNA elements in the MITF-M promoter to cooperatively disrupt MITF-M expression and melanoma cell proliferation. PMID:27055402

  15. Platelet-activating factor and hydrogen peroxide exert a dual modulatory effect on the transcription of LXRα and its target genes in human neutrophils.

    PubMed

    Reyes-Quiroz, María E; Alba, Gonzalo; Sáenz, Javier; Geniz, Isabel; Jiménez, Juan; Martín-Nieto, José; Santa-María, Consuelo; Sobrino, Francisco

    2016-09-01

    Liver X receptors (LXRs) are ligand-activated nuclear receptors involved mainly in the regulation of cholesterol metabolism in many organs, including liver and intestine, as well as in macrophages and neutrophils. Besides, both anti-inflammatory and pro-inflammatory properties have been ascribed to LXRs. The effect of the inflammatory condition on the expression of LXRα and its target genes has not been previously addressed in human neutrophils. We have described that platelet-activating factor (PAF) and hydrogen peroxide (H2O2) are potent pro-inflammatory mediators that link the haemostatic and innate immune systems. In this work we report that H2O2 at low doses (1 pM-1μM) exerts an inhibitory effect on TO901317-induced mRNA expression of LXRα and of its target genes encoding the ATP-binding cassette (ABC) transporters ABCA1 and ABCG1, and the sterol regulatory element-binding protein 1c (SREBP1c). However, an opposite behaviour, i.e., a transcription-enhancing effect, was found at higher H2O2 doses (100-500μM) on most of these genes. A similar dual effect was observed when the pro-inflammatory molecule PAF was used. Interestingly, H2O2 production separately elicited by 10nM PAF or 1μM H2O2 was similarly low, and analogously, H2O2 production levels elicited by 5μM PAF or 100μM H2O2 were similarly high when they were compared. On the other hand, low doses of PAF or H2O2 induced phosphorylation of extracellular signal-regulated kinases 1 and 2 (ERK 1/2) and NF-κB activation, However, PAF or H2O2 at high doses did not produce changes in NF-κB activation levels. In summary, our results show that H2O2, either exogenous or PAF-induced, exerts a dual regulation on mRNA expression of LXRα and its target genes. PMID:27351826

  16. 11q23 Translocations split the [open quotes]AT-hook[close quotes] cruciform DNA-binding region and the transcriptional repression domain from the activation domain of the mixed-lineage leukemia (MLL) gene

    SciTech Connect

    Zeleznik-Le, N.J.; Harden, A.M.; Rowley, J.D. )

    1994-10-25

    Translocations involving chromosome band 11q23, found in acute lymphoid and myeloid leukemias, disrupt the MLL gene. This gene encodes a putative transcription factor with homology to the zinc fingers and other domains of the Drosophila trithorax gene product and to the [open quotes]AT-hook[close quotes] motif of high mobility group proteins. To map potential transcriptional activation or repression domains of the MLL protein, yeast GAL4 DNA-binding domain and MLL hybrid protein-expressing plasmids were cotransfected with chloramphenicol acetyltransferase reporter plasmids in a transient transfection system. We found that MLL contains a strong activation domain and a repression domain. The former, located telomeric (3[prime]) to the breakpoint region, activated transcription 18-fold to >200-fold, depending on the promoter and cell line used for transfection. A repression domain that repressed transcription 4-fold was located centromeric (5[prime]) to the breakpoint region of MLL. The MLL AT-hook domain protein was expressed in bacteria and was utilized in a gel mobility shift assay to assess DNA-binding activity. The MLL AT-hook domain could bind cruciform DNA, recognizing structure rather than sequence of the target DNA. In translocations involving MLL, loss of an activation domain with retention of a repression domain and a DNA-binding domain on the der(11) chromosome could alter the expression of downstream target genes, suggesting a potential mechanism of action for MLL in leukemia. 35 refs., 5 figs., 1 tab.

  17. Transcriptional regulatory elements downstream of the JunB gene.

    PubMed Central

    Perez-Albuerne, E D; Schatteman, G; Sanders, L K; Nathans, D

    1993-01-01

    JunB is an immediate early transcription factor that is induced by a variety of extracellular signaling agents, including growth factors, phorbol esters, and agents that elevate cyclic AMP. The mechanism of activation of the gene encoding JunB by these agents is not well understood. By using the JunB gene together with flanking DNA in transfection experiments, we show that a serum response element (SRE) and/or a cAMP response element (CRE) downstream of the gene mediate the response of the gene in mouse NIH 3T3 cells to serum, platelet-derived growth factor, basic fibroblast growth factor, phorbol ester, and forskolin. In addition, a segment of DNA just upstream of the TATA box is required for optimal activation of the gene. Images Fig. 1 Fig. 5 PMID:8265655

  18. Dietary control of late trypsin gene transcription in Aedes aegypti.

    PubMed

    Noriega, F G; Barillas-Mury, C; Wells, M A

    1994-06-01

    In Aedes aegypti the levels of midgut trypsin activity after feeding are directly proportional to the protein concentration in the meal. The mechanisms of this up-regulatory event were investigated by analyzing the expression of the late trypsin gene under different dietary conditions. Transcription of the gene was dependent on both the quality and quantity of protein in the meal. As measured by Northern blot analysis, the levels of late trypsin gene expression increased up to 100-fold 24 h after feeding on gamma-globulin, hemoglobin or albumin (100 mg/ml). In contrast, gelatin, histone, amino acids, saline or agarose were very poor inducers of transcription. The rates of late trypsin transcription induced during the first 24 h were directly proportional to the concentration of protein in the meal. These data further support the suggestion that the primary mechanism that regulates the synthesis of trypsin in the mosquito midgut is transcriptional regulation of the gene. This regulatory mechanism enables the midgut to maintain the appropriate balance between protease synthesis and the protein content of the meal. PMID:7519098

  19. Toll-like receptor 4 (Tlr4) knockout rats produced by transcriptional activator-like effector nuclease- (TALEN)-mediated gene inactivation

    PubMed Central

    Ferguson, Carolyn; McKay, Matthew; Harris, R. Adron; Homanics, Gregg E.

    2013-01-01

    Genetically engineered mice are a valuable resource for studies of the behavioral effects of ethanol. However, for some behavioral tests of ethanol action, the rat is a superior model organism. Production of genetically engineered rats has been severely hampered due to technical limitations. Here we utilized a promising new technique for efficient site-specific gene modification to create a novel gene knockout rat line. This approach is based on Transcriptional Activator-Like Effector Nucleases (TALENs). TALENs function in pairs and bind DNA in a sequence-specific manner. Upon binding to the target sequence, a functional nuclease is reconstituted that creates double-stranded breaks in the DNA that are efficiently repaired by non-homologous end joining. This error-prone process often results in deletions of varying lengths at the targeted locus. The toll-like receptor 4 (Tlr4) gene was selected for TALEN-mediated gene inactivation. Tlr4 has been implicated in ethanol-induced neuroinflammation and neurodegeneration, as well as multiple ethanol-induced behavioral effects. To generate Tlr4 knockout rats, a pair of TALEN constructs was created that specifically target Exon 1 immediately downstream of the start of translation. TALEN mRNAs were microinjected into the cytoplasm of one-cell Wistar rat embryos. Of 13 live-born pups that resulted, one harbored a mutation in Exon 1 of Tlr4. The mutated allele consisted of a 13 base-pair deletion that was predicted to create a frameshift mutation after amino acid 25. This founder rat successfully transmitted the mutation to F1 offspring. Heterozygous F1 offspring were interbred to produce homozygous F2 animals. Homozygous mutants expressed the 13-bp deletion in Tlr4 mRNA. In contrast to control rats that produced a robust increase in plasma tumor necrosis factor alpha in response to a lipopolysaccharide challenge, homozygous rats had a markedly attenuated response. Thus, the mutant Tlr4 allele generated by TALEN-mediated gene

  20. Differential activation of nuclear transcription factor kappaB, gene expression, and proteins by amifostine's free thiol in human microvascular endothelial and glioma cells.

    PubMed

    Grdina, David J; Murley, Jeffrey S; Kataoka, Yasushi; Calvin, Douglas P

    2002-01-01

    The effects of WR1065 (SH), the free thiol form of amifostine, on nuclear transcription factor kappaB (NFkappaB) activation, manganese superoxide dismutase (MnSOD) gene expression, and secretion of human vascular endothelial cell growth factor (hVEGF), basic fibroblast growth factor (bFGF), tumor necrosis factor-alpha (TNF-alpha), vascular cell adhesion molecule-1 (VCAM-1), intercellular adhesion molecule-1 (ICAM-1), E-selectin, P-selectin, and interleukins IL-1alpha, IL-6, and IL-8 were investigated and compared in human microvascular endothelial (HMEC) and human glioma cells. WR1065 was evaluated at 2 concentrations, 4 mmol/L, ie, its most effective cytoprotective dose, and 40 micromol/L, a noncytoprotective but highly effective dose capable of preventing radiation and chemotherapeutic drug-induced mutations in exposed cells. A 30-minute exposure of HMEC and glioma cell lines U87 and U251 to WR1065 at either of the concentrations resulted in a marked activation of NFkappaB as determined by a gel shift assay, with the maximum effect observed between 30 minutes and 1 hour after treatment. Using a supershift assay, WR1065 exposure was observed to affect only the p50-p65 heterodimer, and not the homodimers or heterodimers containing p52 or c-Rel subunits of NFkappaB. WR1065 was also found to enhance MnSOD gene expression in both HMEC and glioma cells. Gene expression was enhanced 1.8-fold over control levels in HMEC over a period ranging from 12 to 24 hours after the time of maximum activation of NFkappaB. In contrast, MnSOD gene expression in U87 cells rose 3.5 times above control levels over this same period. WR1065 had no effect on the levels of adhesion molecules, cytokines, and growth factors secreted by cells exposed for up to 24 hours as measured by enzyme-linked immunosorbent assay. PMID:11917294

  1. Activation of heat shock gene transcription by heat shock factor 1 involves oligomerization, acquisition of DNA-binding activity, and nuclear localization and can occur in the absence of stress.

    PubMed Central

    Sarge, K D; Murphy, S P; Morimoto, R I

    1993-01-01

    The existence of multiple heat shock factor (HSF) genes in higher eukaryotes has promoted questions regarding the functions of these HSF family members, especially with respect to the stress response. To address these questions, we have used polyclonal antisera raised against mouse HSF1 and HSF2 to examine the biochemical, physical, and functional properties of these two factors in unstressed and heat-shocked mouse and human cells. We have identified HSF1 as the mediator of stress-induced heat shock gene transcription. HSF1 displays stress-induced DNA-binding activity, oligomerization, and nuclear localization, while HSF2 does not. Also, HSF1 undergoes phosphorylation in cells exposed to heat or cadmium sulfate but not in cells treated with the amino acid analog L-azetidine-2-carboxylic acid, indicating that phosphorylation of HSF1 is not essential for its activation. Interestingly, HSF1 and HSF2 overexpressed in transfected 3T3 cells both display constitutive DNA-binding activity, oligomerization, and transcriptional activity. These results demonstrate that HSF1 can be activated in the absence of physiological stress and also provide support for a model of regulation of HSF1 and HSF2 activity by a titratable negative regulatory factor. Images PMID:8441385

  2. Involvement of GATA transcription factors in the regulation of endogenous bovine interferon-tau gene transcription.

    PubMed

    Bai, Hanako; Sakurai, Toshihiro; Kim, Min-Su; Muroi, Yoshikage; Ideta, Atsushi; Aoyagi, Yoshito; Nakajima, Hiromi; Takahashi, Masashi; Nagaoka, Kentaro; Imakawa, Kazuhiko

    2009-12-01

    Expression of interferon-tau (IFNT), necessary for pregnancy establishment in ruminant ungulates, is regulated in a temporal and spatial manner. However, molecular mechanisms by which IFNT gene transcription is regulated in this manner have not been firmly established. In this study, DNA microarray/RT-PCR analysis between bovine trophoblast CT-1 and Mardin-Darby bovine kidney (MDBK) cells was initially performed, finding that transcription factors GATA2, GATA3, and GATA6 mRNAs were specific to CT-1 cells. These mRNAs were also found in Days 17, 20, and 22 (Day 0 = day of estrus) bovine conceptuses. In examining other bovine cell lines, ovary cumulus granulosa (oCG) and ear fibroblast (EF) cells, GATA2 and GATA3, but not GATA6, were found specific to the bovine trophoblast cells. In transient transfection analyses using the upstream region (-631 to +59 bp) of bovine IFNT gene (bIFNT, IFN-tau-c1), over-expression of GATA2/GATA3 did not affect the transcription of bIFNT-reporter construct in human choriocarcinoma JEG3 cells. Transfection of GATA2, GATA3, ETS2, and/or CDX2, however, was effective in the up-regulation of the bIFNT construct transfected into bovine oCG and EF cells. One Point mutation studies revealed that among six potential GATA binding sites located on the upstream region of the bIFNT gene, the one next to ETS2 site exhibited reduced luciferase activity. In CT-1 cells, endogenous bIFNT gene transcription was up-regulated by over-expression of GATA2 or GATA3, but down-regulated by siRNA specific to GATA2 mRNA. These data suggest that GATA2/3 is involved in trophoblast-specific regulation of bIFNT gene transcription. PMID:19598245

  3. Differential sensitivities of transcription factor target genes underlie cell type-specific gene expression profiles

    PubMed Central

    Johnson, Kirby D.; Kim, Shin-Il; Bresnick, Emery H.

    2006-01-01

    Changes in transcription factor levels and activities dictate developmental fate. Such a change might affect the full ensemble of target genes for a factor or only uniquely sensitive targets. We investigated the relationship among activity of the hematopoietic transcription factor GATA-1, chromatin occupancy, and target gene sensitivity. Graded activation of GATA-1 in GATA-1-null cells revealed high-, intermediate-, and low-sensitivity targets. GATA-1 activity requirements for occupancy and transcription often correlated. A GATA-1 amino-terminal deletion mutant severely deregulated the low-sensitivity gene Tac-2. Thus, cells expressing different levels of a cell type-specific activator can have qualitatively distinct target gene expression patterns, and factor mutations preferentially deregulate low-sensitivity genes. Unlike other target genes, GATA-1-mediated Tac-2 regulation was bimodal, with activation followed by repression, and the coregulator Friend of GATA-1 (FOG-1) selectively mediated repression. A GATA-1 mutant defective in FOG-1 binding occupied a Tac-2 regulatory region at levels higher than wild-type GATA-1, whereas FOG-1 facilitated chromatin occupancy at a distinct target site. These results indicate that FOG-1 is a determinant of GATA factor target gene sensitivity by either facilitating or opposing chromatin occupancy. PMID:17043224

  4. Transcriptional control in the segmentation gene network of Drosophila.

    PubMed

    Schroeder, Mark D; Pearce, Michael; Fak, John; Fan, HongQing; Unnerstall, Ulrich; Emberly, Eldon; Rajewsky, Nikolaus; Siggia, Eric D; Gaul, Ulrike

    2004-09-01

    The segmentation gene network of Drosophila consists of maternal and zygotic factors that generate, by transcriptional (cross-) regulation, expression patterns of increasing complexity along the anterior-posterior axis of the embryo. Using known binding site information for maternal and zygotic gap transcription factors, the computer algorithm Ahab recovers known segmentation control elements (modules) with excellent success and predicts many novel modules within the network and genome-wide. We show that novel module predictions are highly enriched in the network and typically clustered proximal to the promoter, not only upstream, but also in intronic space and downstream. When placed upstream of a reporter gene, they consistently drive patterned blastoderm expression, in most cases faithfully producing one or more pattern elements of the endogenous gene. Moreover, we demonstrate for the entire set of known and newly validated modules that Ahab's prediction of binding sites correlates well with the expression patterns produced by the modules, revealing basic rules governing their composition. Specifically, we show that maternal factors consistently act as activators and that gap factors act as repressors, except for the bimodal factor Hunchback. Our data suggest a simple context-dependent rule for its switch from repressive to activating function. Overall, the composition of modules appears well fitted to the spatiotemporal distribution of their positive and negative input factors. Finally, by comparing Ahab predictions with different categories of transcription factor input, we confirm the global regulatory structure of the segmentation gene network, but find odd skipped behaving like a primary pair-rule gene. The study expands our knowledge of the segmentation gene network by increasing the number of experimentally tested modules by 50%. For the first time, the entire set of validated modules is analyzed for binding site composition under a uniform set of

  5. Transcriptional Control in the Segmentation Gene Network of Drosophila

    PubMed Central

    Fan, HongQing; Unnerstall, Ulrich; Emberly, Eldon; Rajewsky, Nikolaus; Siggia, Eric D

    2004-01-01

    The segmentation gene network of Drosophila consists of maternal and zygotic factors that generate, by transcriptional (cross-) regulation, expression patterns of increasing complexity along the anterior-posterior axis of the embryo. Using known binding site information for maternal and zygotic gap transcription factors, the computer algorithm Ahab recovers known segmentation control elements (modules) with excellent success and predicts many novel modules within the network and genome-wide. We show that novel module predictions are highly enriched in the network and typically clustered proximal to the promoter, not only upstream, but also in intronic space and downstream. When placed upstream of a reporter gene, they consistently drive patterned blastoderm expression, in most cases faithfully producing one or more pattern elements of the endogenous gene. Moreover, we demonstrate for the entire set of known and newly validated modules that Ahab's prediction of binding sites correlates well with the expression patterns produced by the modules, revealing basic rules governing their composition. Specifically, we show that maternal factors consistently act as activators and that gap factors act as repressors, except for the bimodal factor Hunchback. Our data suggest a simple context-dependent rule for its switch from repressive to activating function. Overall, the composition of modules appears well fitted to the spatiotemporal distribution of their positive and negative input factors. Finally, by comparing Ahab predictions with different categories of transcription factor input, we confirm the global regulatory structure of the segmentation gene network, but find odd skipped behaving like a primary pair-rule gene. The study expands our knowledge of the segmentation gene network by increasing the number of experimentally tested modules by 50%. For the first time, the entire set of validated modules is analyzed for binding site composition under a uniform set of

  6. Imaging transcription dynamics at endogenous genes in living Drosophila tissues.

    PubMed

    Yao, Jie; Zobeck, Katie L; Lis, John T; Webb, Watt W

    2008-07-01

    How transcription of individual genes is regulated in a single, intact, three-dimensionally organized cell nucleus remains mysterious. Recently, live cell imaging has become an essential tool to dissect the in vivo mechanisms of gene transcription. It not only examines functions of transcription factors at their gene targets within the chromatin context, but it also provides a non-disruptive approach for observing the dynamics of a transcription cycle in real time. However, the identification of any endogenous gene loci and their associated transcription factors remains technically difficult. Here, we describe the method of imaging the transcriptional dynamics of heat shock genes in Drosophila polytene chromosomes in living salivary gland tissues by multiphoton microscopy (MPM). This method has provided the experimental capability to visualize the assembly and dynamics of individual transcription factors and regulators and to dissect their functions at their endogenous gene targets in living cells. PMID:18586105

  7. The OsCYP19-4 Gene Is Expressed as Multiple Alternatively Spliced Transcripts Encoding Isoforms with Distinct Cellular Localizations and PPIase Activities under Cold Stress

    PubMed Central

    Lee, Areum; Lee, Sang Sook; Jung, Won Yong; Park, Hyun Ji; Lim, Bo Ra; Kim, Hyun-Soon; Ahn, Jun Cheul; Cho, Hye Sun

    2016-01-01

    Alternative splicing (AS) is an important molecular mechanism by which single genes can generate multiple mRNA isoforms. We reported previously that, in Oryza sativa, the cyclophilin 19-4 (OsCYP19-4.1) transcript was significantly upregulated in response to cold stress, and that transgenic plants were cold tolerant. Here we show that, under cold stress, OsCYP19-4 produces eight transcript variants by intron retention and exon skipping, resulting in production of four distinct protein isoforms. The OsCYP19-4 AS isoforms exhibited different cellular localizations in the epidermal cells: in contrast to OsCYP19-4.1, the OsCYP19-4.2 and OsCYP19-4.3 proteins were primarily targeted to guard and subsidiary cells, whereas OsCYP19-4.5, which consists largely of an endoplasmic reticulum (ER) targeting signal, was co-localized with the RFP-BiP marker in the ER. In OsCYP19-4.2, the key residues of the PPIase domain are altered; consistent with this, recombinant OsCYP19-4.2 had significantly lower PPIase activity than OsCYP19-4.1 in vitro. Specific protein-protein interactions between OsCYP19-4.2/3 and AtRCN1 were verified in yeast two-hybrid (Y2H) and bimolecular fluoresence complementation (BiFC assays), although the OsCYP19-4 isoforms could not bind each other. Based on these results, we propose that two OsCYP19-4 AS isoforms, OsCYP19-4.2 and OsCYP19-4.3, play roles linking auxin transport and cold stress via interactions with RCN1. PMID:27447607

  8. The OsCYP19-4 Gene Is Expressed as Multiple Alternatively Spliced Transcripts Encoding Isoforms with Distinct Cellular Localizations and PPIase Activities under Cold Stress.

    PubMed

    Lee, Areum; Lee, Sang Sook; Jung, Won Yong; Park, Hyun Ji; Lim, Bo Ra; Kim, Hyun-Soon; Ahn, Jun Cheul; Cho, Hye Sun

    2016-01-01

    Alternative splicing (AS) is an important molecular mechanism by which single genes can generate multiple mRNA isoforms. We reported previously that, in Oryza sativa, the cyclophilin 19-4 (OsCYP19-4.1) transcript was significantly upregulated in response to cold stress, and that transgenic plants were cold tolerant. Here we show that, under cold stress, OsCYP19-4 produces eight transcript variants by intron retention and exon skipping, resulting in production of four distinct protein isoforms. The OsCYP19-4 AS isoforms exhibited different cellular localizations in the epidermal cells: in contrast to OsCYP19-4.1, the OsCYP19-4.2 and OsCYP19-4.3 proteins were primarily targeted to guard and subsidiary cells, whereas OsCYP19-4.5, which consists largely of an endoplasmic reticulum (ER) targeting signal, was co-localized with the RFP-BiP marker in the ER. In OsCYP19-4.2, the key residues of the PPIase domain are altered; consistent with this, recombinant OsCYP19-4.2 had significantly lower PPIase activity than OsCYP19-4.1 in vitro. Specific protein-protein interactions between OsCYP19-4.2/3 and AtRCN1 were verified in yeast two-hybrid (Y2H) and bimolecular fluoresence complementation (BiFC assays), although the OsCYP19-4 isoforms could not bind each other. Based on these results, we propose that two OsCYP19-4 AS isoforms, OsCYP19-4.2 and OsCYP19-4.3, play roles linking auxin transport and cold stress via interactions with RCN1. PMID:27447607

  9. Transcriptional regulation of Bacillus subtilis citrate synthase genes.

    PubMed Central

    Jin, S; Sonenshein, A L

    1994-01-01

    The Bacillus subtilis citrate synthase genes citA and citZ were repressed during early exponential growth phase in nutrient broth medium and were induced as cells reached the end of exponential phase. Both genes were also induced by treatment of cells with the drug decoyinine. After induction, the steady-state level of citZ mRNA was about five times higher than that of citA mRNA. At least some of the citZ transcripts read through into the isocitrate dehydrogenase (citC) gene. Transcription from an apparent promoter site located near the 3' end of the citZ gene also contributed to expression of citC. In minimal medium, citA transcription was about 6-fold lower when glucose was the sole carbon source than it was when succinate was the carbon source. Expression of the citZ gene was repressed 2-fold by glucose and 10-fold when glucose and glutamate were present simultaneously. This latter synergistic repression is similar to the effect of glucose and glutamate on steady-state citrate synthase enzyme activity. CitR, a protein of the LysR family, appeared to be a repressor of citA but not of citZ. Images PMID:8045899

  10. Involvement of cAMP-CRP in transcription activation and repression of the pck gene encoding PEP carboxykinase, the key enzyme of gluconeogenesis.

    PubMed

    Nakano, Masahiro; Ogasawara, Hiroshi; Shimada, Tomohiro; Yamamoto, Kaneyoshi; Ishihama, Akira

    2014-06-01

    cAMP receptor protein (CRP) is the best characterized global regulator of Escherichia coli. After genomic SELEX screening, a total of minimum 378 promoters have been identified as its regulation targets on the E. coli genome. Among a number of promoters carrying two CRP-binding sites, several promoters carry two CRP-binding sites, one upstream but another downstream of transcription initiation sites. The regulatory role of downstream CRP site remains unsolved. Using the pck gene encoding phosphoenolpyruvate carboxykinase as a model promoter, we analyzed the role of CRP-associated downstream of the transcription initiation site. Gel shift assay and AFM observation indicate that CRP binds to both the promoter-distal site (CRP box-1) at -90.5 and the site (CRP box-2) at +13.5 downstream of transcription initiation site. The binding affinity is higher for CRP box-1. Roles of two CRP sites were examined using in vitro transcription assay and in vivo reporter assay. In both cases, transcription repression was observed in the presence of high concentrations of CRP. Taken together, we propose that cAMP-CRP associated at downstream CRP box-2 plays as a repressor for pck transcription only in the presence of high levels of cAMP-CRP. PMID:24814025

  11. Activation of myoD gene transcription by 3,5,3'-triiodo-L-thyronine: a direct role for the thyroid hormone and retinoid X receptors.

    PubMed Central

    Muscat, G E; Mynett-Johnson, L; Dowhan, D; Downes, M; Griggs, R

    1994-01-01

    Thyroid hormones are major determinants of skeletal muscle differentiation in vivo. Triiodo-L-thyronine treatment promotes terminal muscle differentiation and results in increased MyoD gene transcription in myogenic cell lines; furthermore myoD and fast myosin heavy chain gene expression are activated in rodent slow twitch muscle fibers (Molecular Endocrinology 6: 1185-1194, 1992; Development 118: 1137-1147, 1993). We have identified a T3 response element (TRE) in the mouse MyoD promoter between nucleotide positions -337 and -309 (5' CTGAGGTCAGTACAGGCTGGAGGAGTAGA 3'). This sequence conferred an appropriate T3 response to an enhancerless SV40 promoter. In vitro binding studies showed that the thyroid hormone receptor alpha (TR alpha) formed a heterodimeric complex, with either the retinoid X receptor alpha or gamma 1 isoforms (RXR alpha, RXR gamm), on the MyoD TRE that was specifically competed by other well characterised TREs and not by other response elements. Analyses of this heterodimer with a battery of steroid hormone response elements indicated that the complex was efficiently competed by a direct repeat of the AGGTCA motif separated by 4 nucleotides as predicted by the 3-4-5 rule. EMSA experiments demonstrated that the nuclear factor(s) present in muscle cells that bound to the myoD TRE were constitutively expressed during myogenesis; this complex was competed by the myosin heavy chain, DR-4 and PAL-0 TREs in a sequence specific fashion. Western blot analysis indicated that TR alpha 1 was constitutively expressed during C2C12 differentiation. Mutagenesis of the myoD TRE indicated that the sequence of the direct repeats (AGGTCA) and the 4 nucleotide gap were necessary for efficient binding to the TR alpha/RXR alpha heterodimeric complex. In conclusion our data suggest that the TRE in the helix loop helix gene, myoD, is a target for the direct heterodimeric binding of TR alpha and RXR alpha/gamma. These results provide a molecular mechanism/model for the

  12. Interactive Roles of Ets-1, Sp1, and Acetylated Histones in the Retinoic Acid-dependent Activation of Guanylyl Cyclase/Atrial Natriuretic Peptide Receptor-A Gene Transcription*

    PubMed Central

    Kumar, Prerna; Garg, Renu; Bolden, Gevoni; Pandey, Kailash N.

    2010-01-01

    Cardiac hormones atrial and brain natriuretic peptides activate guanylyl cyclase/natriuretic peptide receptor-A (GC-A/NPRA), which plays a critical role in reduction of blood pressure and blood volume. Currently, the mechanisms responsible for regulating the Npr1 gene (coding for GC-A/NPRA) transcription are not well understood. The present study was conducted to examine the interactive roles of all-trans retinoic acid (ATRA), Ets-1, Sp1, and histone acetylation on the transcriptional regulation and function of the Npr1 gene. Deletion analysis of the Npr1 promoter and luciferase assays showed that ATRA enhanced a 16-fold Npr1 promoter activity and greatly stimulated guanylyl cyclase (GC) activity of the receptor protein in both atrial natriuretic peptide (ANP)-dependent and -independent manner. As confirmed by gel shift and chromatin immunoprecipitation assays, ATRA enhanced the binding of both Ets-1 and Sp1 to the Npr1 promoter. The retinoic acid receptor α (RARα) was recruited by Ets-1 and Sp1 to form a transcriptional activator complex with their binding sites in the Npr1 promoter. Interestingly, ATRA also increased the acetylation of histones H3 and H4 and enhanced their recruitment to Ets-1 and Sp1 binding sites within the Npr1 promoter. Collectively, the present results demonstrate that ATRA regulates Npr1 gene transcription and GC activity of the receptor by involving the interactive actions of Ets-1, Sp1, and histone acetylation. PMID:20864529

  13. The Heterochromatic Rolled Gene of Drosophila Melanogaster Is Extensively Polytenized and Transcriptionally Active in the Salivary Gland Chromocenter

    PubMed Central

    Berghella, L.; Dimitri, P.

    1996-01-01

    This paper reports a cytogenetic and molecular study of the structural and functional organization of the Drosophila melanogaster chromocenter. The relations between mitotic (constitutive) heterochromatin and α- and β-heterochromatin are not fully understood. In the present work, we have studied the polytenization of the rolled (rl) locus, a 100-kb genomic region that maps to the proximal heterochromatin of chromosome 2 and has been previously thought to contribute to α-heterochromatin. We show that rolled undergoes polytenization in salivary gland chromosomes to a degree comparable to that of euchromatic genes, despite its deep heterochromatic location. In contrast, both the Bari-1 sequences and the AAGAC satellite repeats, located respectively to the left and right of rl, are severely underrepresented and thus both appear to be α-heterochromatic. In addition, we found that rl is transcribed in polytene tissues. Together, the results reported here indicate that functional sequences located within the proximal constitutive heterochromatin can undergo polytenization, contributing to the formation of β-heterochromatin. The implications of this finding to chromocenter structure are discussed. PMID:8878678

  14. Post-transcriptional gene silencing, transcriptional gene silencing and human immunodeficiency virus

    PubMed Central

    Méndez, Catalina; Ahlenstiel, Chantelle L; Kelleher, Anthony D

    2015-01-01

    While human immunodeficiency virus 1 (HIV-1) infection is controlled through continuous, life-long use of a combination of drugs targeting different steps of the virus cycle, HIV-1 is never completely eradicated from the body. Despite decades of research there is still no effective vaccine to prevent HIV-1 infection. Therefore, the possibility of an RNA interference (RNAi)-based cure has become an increasingly explored approach. Endogenous gene expression is controlled at both, transcriptional and post-transcriptional levels by non-coding RNAs, which act through diverse molecular mechanisms including RNAi. RNAi has the potential to control the turning on/off of specific genes through transcriptional gene silencing (TGS), as well as fine-tuning their expression through post-transcriptional gene silencing (PTGS). In this review we will describe in detail the canonical RNAi pathways for PTGS and TGS, the relationship of TGS with other silencing mechanisms and will discuss a variety of approaches developed to suppress HIV-1 via manipulation of RNAi. We will briefly compare RNAi strategies against other approaches developed to target the virus, highlighting their potential to overcome the major obstacle to finding a cure, which is the specific targeting of the HIV-1 reservoir within latently infected cells. PMID:26279984

  15. Modular construction of mammalian gene circuits using TALE transcriptional repressors.

    PubMed

    Li, Yinqing; Jiang, Yun; Chen, He; Liao, Weixi; Li, Zhihua; Weiss, Ron; Xie, Zhen

    2015-03-01

    An important goal of synthetic biology is the rational design and predictable implementation of synthetic gene circuits using standardized and interchangeable parts. However, engineering of complex circuits in mammalian cells is currently limited by the availability of well-characterized and orthogonal transcriptional repressors. Here, we introduce a library of 26 reversible transcription activator-like effector repressors (TALERs) that bind newly designed hybrid promoters and exert transcriptional repression through steric hindrance of key transcriptional initiation elements. We demonstrate that using the input-output transfer curves of our TALERs enables accurate prediction of the behavior of modularly assembled TALER cascade and switch circuits. We also show that TALER switches using feedback regulation exhibit improved accuracy for microRNA-based HeLa cancer cell classification versus HEK293 cells. Our TALER library is a valuable toolkit for modular engineering of synthetic circuits, enabling programmable manipulation of mammalian cells and helping elucidate design principles of coupled transcriptional and microRNA-mediated post-transcriptional regulation. PMID:25643171

  16. From immunogenetics to immunomics: functional prospecting of genes and transcripts.

    PubMed

    Schönbach, Christian

    2003-01-01

    Human and mouse genome and transcriptome projects have expanded the field of 'immunogenetics' beyond the traditional study of the genetics and evolution of MHC, TCR and Ig loci into the new interdisciplinary area of 'immunomics'. Immunomics is the study of the molecular functions associated with all immune-related coding and non-coding mRNA transcripts. To unravel the function, regulation and diversity of the immunome requires that we identify and correctly categorize all immune-related transcripts. The importance of intercalated genes, antisense transcripts and non-coding RNAs and their potential role in regulation of immune development and function are only just starting to be appreciated. To better understand immune function and regulation, transcriptome projects (e.g. Functional Annotation of the Mouse, FANTOM), that focus on sequencing full-length transcripts from multiple tissue sources, ideally should include specific immune cells (e.g. T cell, B cells, macrophages, dendritic cells) at various states of development, in activated and unactivated states and in different disease contexts. Progress in deciphering immune regulatory networks will require the cooperative efforts of immunologists, immunogeneticists, molecular biologists and bioinformaticians. Although primary sequence analysis remains useful for annotation of new transcripts it is less useful for identifying novel functions of known transcripts in a new context (protein interaction network or pathway). The most efficient approach to mine useful information from the vast a priori knowledge contained in biological databases and the scientific literature, is to use a combination of computational and expert-driven knowledge discovery strategies. This paper will illustrate the challenges posed in attempts to functionally infer transcriptional regulation and interaction of immune-related genes from text and sequence-based data sources. PMID:14712938

  17. OsARF12, a transcription activator on auxin response gene, regulates root elongation and affects iron accumulation in rice (Oryza sativa).

    PubMed

    Qi, YanHua; Wang, SuiKang; Shen, ChenJia; Zhang, SaiNa; Chen, Yue; Xu, YanXia; Liu, Yu; Wu, YunRong; Jiang, DeAn

    2012-01-01

    • Auxin has an important role in maintaining optimal root system architecture (RSA) that can cope with growth reductions of crops caused by water or nutrient shortages. However, the mechanism of controlling RSA remains largely unclear. Here, we found a limiting factor of RSA--OsARF12--an auxin response factor whose knockout led to decreased primary root length in rice (Oryza sativa). • OsARF12 as a transcription activator can facilitate the expression of the auxin response element DR5::GFP, and OsARF12 was inhibited by osa-miRNA167d by transient expression in tobacco and rice callus. • The root elongation zones of osarf12 and osarf12/25, which had lower auxin concentrations, were distinctly shorter than for the wild-type, possibly as a result of decreased expression of auxin synthesis genes OsYUCCAs and auxin efflux carriers OsPINs and OsPGPs. The knockout of OsARF12 also altered the abundance of mitochondrial iron-regulated (OsMIR), iron (Fe)-regulated transporter1 (OsIRT1) and short postembryonic root1 (OsSPR1) in roots of rice, and resulted in lower Fe content. • The data provide evidence for the biological function of OsARF12, which is implicated in regulating root elongation. Our investigation contributes a novel insight for uncovering regulation of RSA and the relationship between auxin response and Fe acquisition. PMID:21973088

  18. Simian virus 40 T antigen can transcriptionally activate and mediate viral DNA replication in cells which lack the retinoblastoma susceptibility gene product.

    PubMed Central

    Trifillis, P; Picardi, J; Alwine, J C

    1990-01-01

    Simian virus 40 T antigen is a multifunctional protein which has recently been shown to form a complex with the retinoblastoma susceptibility gene product (Rb protein) (J.A. DeCaprio, J.W. Ludlow, J. Figge, J.-Y. Shaw, C.-M. Huang, W.-H. Lee, E. Marsilio, E. Paucha, and D.M. Livingston, Cell 54:275-283, 1988; P. Whyte, K.J. Buchkovich, J.M. Horowitz, S.H. Friend, M. Raybuck, R.A. Weinberg, and E. Harlow, Nature (London) 334:124-129, 1988). This interaction may facilitate some of the functions of T antigen. The ability of simian virus 40 T antigen to mediate transcriptional activation and viral DNA replication was tested in human osteosarcoma cell lines U-2OS and Saos-2, which are Rb positive and Rb negative, respectively. Both functions of T antigen were efficient in both cell lines. Hence, these functions can occur in the absence of Rb protein. Images PMID:2154611

  19. Transcriptional regulation of the ferritin heavy-chain gene: the activity of the CCAAT binding factor NF-Y is modulated in heme-treated Friend leukemia cells and during monocyte-to-macrophage differentiation.

    PubMed Central

    Marziali, G; Perrotti, E; Ilari, R; Testa, U; Coccia, E M; Battistini, A

    1997-01-01

    The ferritin H-chain gene promoter regulation was analyzed in heme-treated Friend leukemia cells (FLCs) and during monocyte-to-macrophage differentiation. In the majority of cell lines studied, the regulation of ferritin expression was exerted mostly at the translational level. However, in differentiating erythroid cells, which must incorporate high levels of iron to sustain hemoglobin synthesis, and in macrophages, which are involved in iron storage, transcriptional regulation seemed to be a relevant mechanism. We show here that the minimum region of the ferritin H-gene promoter that is able to confer transcriptional regulation by heme in FLCs to a reporter gene is 77 nucleotides upstream of the TATA box. This cis element binds a protein complex referred to as HRF (heme-responsive factor), which is greatly enhanced both in heme-treated FLCs and during monocyte-to-macrophage differentiation. The CCAAT element present in reverse orientation in this promoter region of the ferritin H-chain gene is necessary for binding and for gene activity, since a single point mutation is able to abolish the binding of HRF and the transcriptional activity in transfected cells. By competition experiments and supershift assays, we identified the induced HRF as containing at least the ubiquitous transcription factor NF-Y. NF-Y is formed by three subunits, A, B, and C, all of which are necessary for DNA binding. Cotransfection with a transdominant negative mutant of the NF-YA subunit abolishes the transcriptional activation by heme, indicating that NF-Y plays an essential role in this activation. We have also observed a differential expression of the NF-YA subunit in heme-treated and control FLCs and during monocyte-to-macrophage differentiation. PMID:9032265

  20. Stochastic model for gene transcription on Drosophila melanogaster embryos.

    PubMed

    Prata, Guilherme N; Hornos, José Eduardo M; Ramos, Alexandre F

    2016-02-01

    We examine immunostaining experimental data for the formation of stripe 2 of even-skipped (eve) transcripts on D. melanogaster embryos. An estimate of the factor converting immunofluorescence intensity units into molecular numbers is given. The analysis of the eve dynamics at the region of stripe 2 suggests that the promoter site of the gene has two distinct regimes: an earlier phase when it is predominantly activated until a critical time when it becomes mainly repressed. That suggests proposing a stochastic binary model for gene transcription on D. melanogaster embryos. Our model has two random variables: the transcripts number and the state of the source of mRNAs given as active or repressed. We are able to reproduce available experimental data for the average number of transcripts. An analysis of the random fluctuations on the number of eves and their consequences on the spatial precision of stripe 2 is presented. We show that the position of the anterior or posterior borders fluctuate around their average position by ∼1% of the embryo length, which is similar to what is found experimentally. The fitting of data by such a simple model suggests that it can be useful to understand the functions of randomness during developmental processes. PMID:26986358

  1. Stochastic model for gene transcription on Drosophila melanogaster embryos

    NASA Astrophysics Data System (ADS)

    Prata, Guilherme N.; Hornos, José Eduardo M.; Ramos, Alexandre F.

    2016-02-01

    We examine immunostaining experimental data for the formation of stripe 2 of even-skipped (eve) transcripts on D. melanogaster embryos. An estimate of the factor converting immunofluorescence intensity units into molecular numbers is given. The analysis of the eve dynamics at the region of stripe 2 suggests that the promoter site of the gene has two distinct regimes: an earlier phase when it is predominantly activated until a critical time when it becomes mainly repressed. That suggests proposing a stochastic binary model for gene transcription on D. melanogaster embryos. Our model has two random variables: the transcripts number and the state of the source of mRNAs given as active or repressed. We are able to reproduce available experimental data for the average number of transcripts. An analysis of the random fluctuations on the number of eves and their consequences on the spatial precision of stripe 2 is presented. We show that the position of the anterior or posterior borders fluctuate around their average position by ˜1 % of the embryo length, which is similar to what is found experimentally. The fitting of data by such a simple model suggests that it can be useful to understand the functions of randomness during developmental processes.

  2. Mammalian Glutaminase Gls2 Gene Encodes Two Functional Alternative Transcripts by a Surrogate Promoter Usage Mechanism

    PubMed Central

    Campos-Sandoval, José A.; Manzanares, Elisa; Lobo, Carolina; Segura, J. A.; Alonso, Francisco J.; Matés, José M.; Márquez, Javier

    2012-01-01

    Background Glutaminase is expressed in most mammalian tissues and cancer cells, but the regulation of its expression is poorly understood. An essential step to accomplish this goal is the characterization of its species- and cell-specific isoenzyme pattern of expression. Our aim was to identify and characterize transcript variants of the mammalian glutaminase Gls2 gene. Methodology/Principal Findings We demonstrate for the first time simultaneous expression of two transcript variants from the Gls2 gene in human, rat and mouse. A combination of RT-PCR, primer-extension analysis, bioinformatics, real-time PCR, in vitro transcription and translation and immunoblot analysis was applied to investigate GLS2 transcripts in mammalian tissues. Short (LGA) and long (GAB) transcript forms were isolated in brain and liver tissue of human, rat and mouse. The short LGA transcript arises by a combination of two mechanisms of transcriptional modulation: alternative transcription initiation and alternative promoter. The LGA variant contains both the transcription start site (TSS) and the alternative promoter in the first intron of the Gls2 gene. The full human LGA transcript has two in-frame ATGs in the first exon, which are missing in orthologous rat and mouse transcripts. In vitro transcription and translation of human LGA yielded two polypeptides of the predicted size, but only the canonical full-length protein displayed catalytic activity. Relative abundance of GAB and LGA transcripts showed marked variations depending on species and tissues analyzed. Conclusions/Significance This is the first report demonstrating expression of alternative transcripts of the mammalian Gls2 gene. Transcriptional mechanisms giving rise to GLS2 variants and isolation of novel GLS2 transcripts in human, rat and mouse are presented. Results were also confirmed at the protein level, where catalytic activity was demonstrated for the human LGA protein. Relative abundance of GAB and LGA transcripts was

  3. Glutathione depletion impairs transcriptional activation of heat shock genes in primary cultures of guinea pig gastric mucosal cells.

    PubMed

    Rokutan, K; Hirakawa, T; Teshima, S; Honda, S; Kishi, K

    1996-05-15

    When primary cultures of guinea pig gastric mucosal cells were exposed to heat (43 degree C), ethanol, hydrogen peroxide (H2O2), or diamide, heat shock proteins (HSP90, HSP70, HSP60, and HSC73) were rapidly synthesized. The extent of each HSP induction varied with the type of stress. Ethanol, H2O2, and diamide increased the syntheses of several other undefined proteins besides the HSPs. However, none of these proteins were induced by exposure to heat or the reagents, when intracellular glutathione was depleted to <10% of the control level by pretreatment with DL-buthionine-[S,R]-sulfoximine. Gel mobility shift assay using a synthetic oligonucleotide coding HSP70 heat shock element showed that glutathione depletion inhibited the heat- and the reagent-initiated activation of the heat shock factor 1 (HSF1) and did not promote the expression of HSP70 mRNA. Immunoblot analysis with antiserum against HSF1 demonstrated that the steady-state level of HSF1 was not changed in glutathione-depleted cells, but glutathione depletion inhibited the nuclear translocation of HSF1 after exposure to heat stress. These results suggest that intracellular glutathione may support early and important biochemical events in the acquisition by gastric mucosal cells of an adaptive response to irritants. PMID:8636403

  4. The elicitor-responsive gene for a GRAS family protein, CIGR2, suppresses cell death in rice inoculated with rice blast fungus via activation of a heat shock transcription factor, OsHsf23.

    PubMed

    Tanabe, Shigeru; Onodera, Haruko; Hara, Naho; Ishii-Minami, Naoko; Day, Brad; Fujisawa, Yukiko; Hagio, Takashi; Toki, Seiichi; Shibuya, Naoto; Nishizawa, Yoko; Minami, Eiichi

    2015-01-01

    We show that a rice GRAS family protein, CIGR2, is a bonafide transcriptional activator, and through this function, targets the B-type heat shock protein-encoding gene OsHsf23 (Os09g0456800). CIGR2 (Os07g0583600) is an N-acetylchitooligosaccharide elicitor-responsive gene whose activity, through the direct transcriptional control of OsHsf23, is required for mediating hypersensitive cell death activation during pathogen infection. RNAi lines of CIGR2 and OsHsf23 similarly exhibited the higher level of granulation in the epidermal cells of leaf sheath inoculated with an avirulent isolate of rice blast fungus. Interestingly, we did not observe altered levels of resistance, suggesting that CIGR2 suppresses excessive cell death in the incompatible interaction with blast fungus via activation of OsHsf23. PMID:26287768

  5. Signal structure for transcriptional activation in the upstream regions of virulence genes on the hairy-root-inducing plasmid A4.

    PubMed Central

    Aoyama, T; Takanami, M; Oka, A

    1989-01-01

    The inducibility of the vir genes (virA, -B, -C, -D, -E, and -G) on pRiA4 was examined at the transcriptional level, and the RNA-starting sites were determined by S1-nuclease mapping and primer-extension experiments. All of these genes were inducible, while virA, -E, and -G were transcribed even under noninducing conditions. Each transcription of virB, -C, -D, and -E was initiated at one particular site, but that of virA and -G occurred at two and three sites, respectively, depending on the conditions used. In the DNA region upstream from each inducible transcript, one or more blocks of six base-pairs, 5'TGATAACT3' (vir box), were found to be placed characteristically. These blocks were phasing with an interval of 11 base-pairs, and the most upstream one in each upstream region was preceded by an additional block in the inverted orientation. Although the distance between the block(s) and the promoter varied with the vir gene, every block was placed in a phase nearly opposite to the -35 and -10 regions of the promoter. Images PMID:2479910

  6. Land use type significantly affects microbial gene transcription in soil.

    PubMed

    Nacke, Heiko; Fischer, Christiane; Thürmer, Andrea; Meinicke, Peter; Daniel, Rolf

    2014-05-01

    Soil microorganisms play an essential role in sustaining biogeochemical processes and cycling of nutrients across different land use types. To gain insights into microbial gene transcription in forest and grassland soil, we isolated mRNA from 32 sampling sites. After sequencing of generated complementary DNA (cDNA), a total of 5,824,229 sequences could be further analyzed. We were able to assign nonribosomal cDNA sequences to all three domains of life. A dominance of bacterial sequences, which were affiliated to 25 different phyla, was found. Bacterial groups capable of aromatic compound degradation such as Phenylobacterium and Burkholderia were detected in significantly higher relative abundance in forest soil than in grassland soil. Accordingly, KEGG pathway categories related to degradation of aromatic ring-containing molecules (e.g., benzoate degradation) were identified in high abundance within forest soil-derived metatranscriptomic datasets. The impact of land use type forest on community composition and activity is evidently to a high degree caused by the presence of wood breakdown products. Correspondingly, bacterial groups known to be involved in lignin degradation and containing ligninolytic genes such as Burkholderia, Bradyrhizobium, and Azospirillum exhibited increased transcriptional activity in forest soil. Higher solar radiation in grassland presumably induced increased transcription of photosynthesis-related genes within this land use type. This is in accordance with high abundance of photosynthetic organisms and plant-infecting viruses in grassland. PMID:24553913

  7. A Novel POK Family Transcription Factor, ZBTB5, Represses Transcription of p21CIP1 Gene*

    PubMed Central

    Koh, Dong-In; Choi, Won-Il; Jeon, Bu-Nam; Lee, Choong-Eun; Yun, Chae-Ok; Hur, Man-Wook

    2009-01-01

    Transcriptional repression through chromatin remodeling and histone deacetylation has been postulated as a driving force for tumorigenesis. We isolated and characterized a novel POZ domain Krüppel-like zinc finger transcription repressor, ZBTB5 (zinc finger and BTB domain-containing 5). Serial analysis of gene expression (SAGE) analysis showed that ZBTB5 expression is higher in retinoblastoma and muscle cancer tissues. Immunocytochemistry showed that ZBTB5 was localized to the nucleus, particularly nuclear speckles. ZBTB5 directly repressed transcription of cell cycle arrest gene p21 by binding to the proximal GC-box 5/6 elements and the two distal p53-responsive elements (bp −2323 ∼ −2299; bp −1416 ∼ −1392). Chromatin immunoprecipitation assays showed that ZBTB5 and p53 competed with each other in occupying the p53 binding elements. ZBTB5 interacted with co-repressor-histone deacetylase complexes such as BCoR (BCL-6-interacting corepressor), NCoR (nuclear receptor corepressor), and SMRT (silencing mediator for retinoid and thyroid receptors) via its POZ domain. These interactions resulted in deacetylation of histones Ac-H3 and Ac-H4 at the proximal promoter, which is important in the transcriptional repression of p21. MTT (3-(4,5-di meth yl thi azol-2-yl)-2,5-diphenyltetrazolium bromide) assays and fluorescent-activated cell sorter analysis revealed that ZBTB5 stimulated both cell proliferation and cell cycle progression, significantly increasing the number of cells in S-phase. Overall, our data suggest that ZBTB5 is a potent transcription repressor of cell cycle arrest gene p21 and a potential proto-oncogene stimulating cell proliferation. PMID:19491398

  8. Involvement of V-Ets erythroblastosis virus E26 oncogene homolog 2 in regulation of transcription activity of MDR1 gene.

    PubMed

    Wang, Jian; Zeng, Xiaoqing; Luo, Tiancheng; Jin, Wei; Chen, Shiyao

    2012-09-01

    Over-expression of MDR1 confers multidrug resistance (MDR) in cancers and remains a major cause for the failure of chemotherapy. In the present study, we found that V-Ets erythroblastosis virus E26 oncogene homolog 2 (ETS2) could activate MDR1 transcription and P-glycoprotein (P-gp) expression in SGC7901 cells. Knockdown of ETS2 attenuated MDR1 transcription and P-gp expression, and increased the sensitivity of MDR cancer cells to cytotoxic drugs that were transported by P-gp in SGC7901/VCR cells. ETS2 could bind to the ETS2 sites on the MDR1 promoter and activate its transcription. The regulation of MDR1 expression by ETS2 may provide potential ways to overcome MDR in cancer treatment. PMID:22819965

  9. A mitogen-activated protein kinase/extracellular signal-regulated kinase kinase (MEK)-dependent transcriptional program controls activation of the early growth response 1 (EGR1) gene during amino acid limitation.

    PubMed

    Shan, Jixiu; Balasubramanian, Mukundh N; Donelan, William; Fu, Lingchen; Hayner, Jaclyn; Lopez, Maria-Cecilia; Baker, Henry V; Kilberg, Michael S

    2014-08-29

    Amino acid (AA) limitation in mammalian cells triggers a collection of signaling cascades jointly referred to as the AA response (AAR). In human HepG2 hepatocellular carcinoma, the early growth response 1 (EGR1) gene was induced by either AA deprivation or endoplasmic reticulum stress. AAR-dependent EGR1 activation was discovered to be independent of the well characterized GCN2-ATF4 pathway and instead dependent on MEK-ERK signaling, one of the MAPK pathways. ChIP showed that constitutively bound ELK1 at the EGR1 proximal promoter region was phosphorylated after AAR activation. Increased p-ELK1 binding was associated with increased de novo recruitment of RNA polymerase II to the EGR1 promoter. EGR1 transcription was not induced in HEK293T cells lacking endogenous MEK activity, but overexpression of exogenous constitutively active MEK in HEK293T cells resulted in increased basal and AAR-induced EGR1 expression. ChIP analysis of the human vascular endothelial growth factor A (VEGF-A) gene, a known EGR1-responsive gene, revealed moderate increases in AAR-induced EGR1 binding within the proximal promoter and highly inducible binding to a site within the first intron. Collectively, these data document a novel AA-activated MEK-ERK-ELK1 signaling mechanism. PMID:25028509

  10. A Mitogen-activated Protein Kinase/Extracellular Signal-regulated Kinase Kinase (MEK)-dependent Transcriptional Program Controls Activation of the Early Growth Response 1 (EGR1) Gene during Amino Acid Limitation*

    PubMed Central

    Shan, Jixiu; Balasubramanian, Mukundh N.; Donelan, William; Fu, Lingchen; Hayner, Jaclyn; Lopez, Maria-Cecilia; Baker, Henry V.; Kilberg, Michael S.

    2014-01-01

    Amino acid (AA) limitation in mammalian cells triggers a collection of signaling cascades jointly referred to as the AA response (AAR). In human HepG2 hepatocellular carcinoma, the early growth response 1 (EGR1) gene was induced by either AA deprivation or endoplasmic reticulum stress. AAR-dependent EGR1 activation was discovered to be independent of the well characterized GCN2-ATF4 pathway and instead dependent on MEK-ERK signaling, one of the MAPK pathways. ChIP showed that constitutively bound ELK1 at the EGR1 proximal promoter region was phosphorylated after AAR activation. Increased p-ELK1 binding was associated with increased de novo recruitment of RNA polymerase II to the EGR1 promoter. EGR1 transcription was not induced in HEK293T cells lacking endogenous MEK activity, but overexpression of exogenous constitutively active MEK in HEK293T cells resulted in increased basal and AAR-induced EGR1 expression. ChIP analysis of the human vascular endothelial growth factor A (VEGF-A) gene, a known EGR1-responsive gene, revealed moderate increases in AAR-induced EGR1 binding within the proximal promoter and highly inducible binding to a site within the first intron. Collectively, these data document a novel AA-activated MEK-ERK-ELK1 signaling mechanism. PMID:25028509

  11. Proteins of the ETS family with transcriptional repressor activity.

    PubMed

    Mavrothalassitis, G; Ghysdael, J

    2000-12-18

    ETS proteins form one of the largest families of signal-dependent transcriptional regulators, mediating cellular proliferation, differentiation and tumorigenesis. Most of the known ETS proteins have been shown to activate transcription. However, four ETS proteins (YAN, ERF, NET and TEL) can act as transcriptional repressors. In three cases (ERF, NET and TEL) distinct repression domains have been identified and there are indications that NET and TEL may mediate transcription via Histone Deacetylase recruitment. All four proteins appear to be regulated by MAPKs, though for YAN and ERF this regulation seems to be restricted to ERKs. YAN, ERF and TEL have been implicated in cellular proliferation although there are indications suggesting a possible involvement of YAN and TEL in differentiation as well. Other ETS-domain proteins have been shown to repress transcription in a context specific manner, and there are suggestions that the ETS DNA-binding domain may act as a transcriptional repressor. Transcriptional repression by ETS domain proteins adds an other level in the orchestrated regulation by this diverse family of transcription factors that often recognize similar if not identical binding sites on DNA and are believed to regulate critical genes in a variety of biological processes. Definitive assessment of the importance of this novel regulatory level will require the identification of ETS proteins target genes and the further analysis of transcriptional control and biological function of these proteins in defined pathways. PMID:11175368

  12. Forcing FAK into Transcriptional Activity.

    PubMed

    Lietha, Daniel

    2016-08-01

    Focal adhesion kinase (FAK) has known signaling roles in cytoplasmic adhesion structures, but was recently shown to act as a transcriptional regulator in the nucleus. In this issue of Structure, Cardoso et al. (2016) report that mechanical forces translocate FAK to the nucleus of cardiomyocytes, and provide structural insights into how FAK interacts with the MEF2 transcription factor to control cardiac hypertrophy. PMID:27486913

  13. Transcriptional activation in yeast cells lacking transcription factor IIA.

    PubMed Central

    Chou, S; Chatterjee, S; Lee, M; Struhl, K

    1999-01-01

    The general transcription factor IIA (TFIIA) forms a complex with TFIID at the TATA promoter element, and it inhibits the function of several negative regulators of the TATA-binding protein (TBP) subunit of TFIID. Biochemical experiments suggest that TFIIA is important in the response to transcriptional activators because activation domains can interact with TFIIA, increase recruitment of TFIID and TFIIA to the promoter, and promote isomerization of the TFIID-TFIIA-TATA complex. Here, we describe a double-shut-off approach to deplete yeast cells of Toa1, the large subunit of TFIIA, to <1% of the wild-type level. Interestingly, such TFIIA-depleted cells are essentially unaffected for activation by heat shock factor, Ace1, and Gal4-VP16. However, depletion of TFIIA causes a general two- to threefold decrease of transcription from most yeast promoters and a specific cell-cycle arrest at the G2-M boundary. These results indicate that transcriptional activation in vivo can occur in the absence of TFIIA. PMID:10581267

  14. Regulation of maternal transcript destabilization during egg activation in Drosophila.

    PubMed Central

    Tadros, Wael; Houston, Simon A; Bashirullah, Arash; Cooperstock, Ramona L; Semotok, Jennifer L; Reed, Bruce H; Lipshitz, Howard D

    2003-01-01

    In animals, the transfer of developmental control from maternal RNAs and proteins to zygotically derived products occurs at the midblastula transition. This is accompanied by the destabilization of a subset of maternal transcripts. In Drosophila, maternal transcript destabilization occurs in the absence of fertilization and requires specific cis-acting instability elements. We show here that egg activation is necessary and sufficient to trigger transcript destabilization. We have identified 13 maternal-effect lethal loci that, when mutated, result in failure of maternal transcript degradation. All mutants identified are defective in one or more additional processes associated with egg activation. These include vitelline membrane reorganization, cortical microtubule depolymerization, translation of maternal mRNA, completion of meiosis, and chromosome condensation (the S-to-M transition) after meiosis. The least pleiotropic class of transcript destabilization mutants consists of three genes: pan gu, plutonium, and giant nuclei. These three genes regulate the S-to-M transition at the end of meiosis and are thought to be required for the maintenance of cyclin-dependent kinase (CDK) activity during this cell cycle transition. Consistent with a possible functional connection between this S-to-M transition and transcript destabilization, we show that in vitro-activated eggs, which exhibit aberrant postmeiotic chromosome condensation, fail to initiate transcript degradation. Several genetic tests exclude the possibility that reduction of CDK/cyclin complex activity per se is responsible for the failure to trigger transcript destabilization in these mutants. We propose that the trigger for transcript destabilization occurs coincidently with the S-to-M transition at the end of meiosis and that pan gu, plutonium, and giant nuclei regulate maternal transcript destabilization independent of their role in cell cycle regulation. PMID:12871909

  15. Gene expression in plant mitochondria: transcriptional and post-transcriptional control.

    PubMed Central

    Binder, Stefan; Brennicke, Axel

    2003-01-01

    The informational content of the mitochondrial genome in plants is, although small, essential for each cell. Gene expression in these organelles involves a number of distinct transcriptional and post-transcriptional steps. The complex post-transcriptional processes of plant mitochondria such as 5' and 3' RNA processing, intron splicing, RNA editing and controlled RNA stability extensively modify individual steady-state RNA levels and influence the mRNA quantities available for translation. In this overview of the processes in mitochondrial gene expression, we focus on confirmed and potential sites of regulatory interference and discuss the evolutionary origins of the transcriptional and post-transcriptional processes. PMID:12594926

  16. Group I Metabotropic Glutamate Receptor-Mediated Gene Transcription and Implications for Synaptic Plasticity and Diseases

    PubMed Central

    Wang, Hansen; Zhuo, Min

    2012-01-01

    Stimulation of group I metabotropic glutamate receptors (mGluRs) initiates a wide variety of signaling pathways. Group I mGluR activation can regulate gene expression at both translational and transcriptional levels, and induces translation or transcription-dependent synaptic plastic changes in neurons. The group I mGluR-mediated translation-dependent neural plasticity has been well reviewed. In this review, we will highlight group I mGluR-induced gene transcription and its role in synaptic plasticity. The signaling pathways (PKA, CaMKs, and MAPKs) which have been shown to link group I mGluRs to gene transcription, the relevant transcription factors (CREB and NF-κB), and target proteins (FMRP and ARC) will be documented. The significance and future direction for characterizing group I mGluR-mediated gene transcription in fragile X syndrome, schizophrenia, drug addiction, and other neurological disorders will also be discussed. PMID:23125836

  17. PbaR, an IclR family transcriptional activator for the regulation of the 3-phenoxybenzoate 1',2'-dioxygenase gene cluster in Sphingobium wenxiniae JZ-1T.

    PubMed

    Cheng, Minggen; Chen, Kai; Guo, Suhui; Huang, Xing; He, Jian; Li, Shunpeng; Jiang, Jiandong

    2015-12-01

    The 3-phenoxybenzoate (3-PBA) 1',2'-dioxygenase gene cluster (pbaA1A2B cluster), which is responsible for catalyzing 3-phenoxybenzoate to 3-hydroxybenzoate and catechol, is inducibly expressed in Sphingobium wenxiniae strain JZ-1(T) by its substrate 3-PBA. In this study, we identified a transcriptional activator of the pbaA1A2B cluster, PbaR, using a DNA affinity approach. PbaR is a 253-amino-acid protein with a molecular mass of 28,000 Da. PbaR belongs to the IclR family of transcriptional regulators and shows 99% identity to a putative transcriptional regulator that is located on the carbazole-degrading plasmid pCAR3 in Sphingomonas sp. strain KA1. Gene disruption and complementation showed that PbaR was essential for transcription of the pbaA1A2B cluster in response to 3-PBA in strain JZ-1(T). However, PbaR does not regulate the reductase component gene pbaC. An electrophoretic mobility shift assay and DNase I footprinting showed that PbaR binds specifically to the 29-bp motif AATAGAAAGTCTGCCGTACGGCTATTTTT in the pbaA1A2B promoter area and that the palindromic sequence (GCCGTACGGC) within the motif is essential for PbaR binding. The binding site was located between the -10 box and the ribosome-binding site (downstream of the transcriptional start site), which is distinct from the location of the binding site in previously reported IclR family transcriptional regulators. This study reveals the regulatory mechanism for 3-PBA degradation in strain JZ-1(T), and the identification of PbaR increases the variety of regulatory models in the IclR family of transcriptional regulators. PMID:26386050

  18. PbaR, an IclR Family Transcriptional Activator for the Regulation of the 3-Phenoxybenzoate 1′,2′-Dioxygenase Gene Cluster in Sphingobium wenxiniae JZ-1T

    PubMed Central

    Cheng, Minggen; Chen, Kai; Guo, Suhui; Huang, Xing; He, Jian; Li, Shunpeng

    2015-01-01

    The 3-phenoxybenzoate (3-PBA) 1′,2′-dioxygenase gene cluster (pbaA1A2B cluster), which is responsible for catalyzing 3-phenoxybenzoate to 3-hydroxybenzoate and catechol, is inducibly expressed in Sphingobium wenxiniae strain JZ-1T by its substrate 3-PBA. In this study, we identified a transcriptional activator of the pbaA1A2B cluster, PbaR, using a DNA affinity approach. PbaR is a 253-amino-acid protein with a molecular mass of 28,000 Da. PbaR belongs to the IclR family of transcriptional regulators and shows 99% identity to a putative transcriptional regulator that is located on the carbazole-degrading plasmid pCAR3 in Sphingomonas sp. strain KA1. Gene disruption and complementation showed that PbaR was essential for transcription of the pbaA1A2B cluster in response to 3-PBA in strain JZ-1T. However, PbaR does not regulate the reductase component gene pbaC. An electrophoretic mobility shift assay and DNase I footprinting showed that PbaR binds specifically to the 29-bp motif AATAGAAAGTCTGCCGTACGGCTATTTTT in the pbaA1A2B promoter area and that the palindromic sequence (GCCGTACGGC) within the motif is essential for PbaR binding. The binding site was located between the −10 box and the ribosome-binding site (downstream of the transcriptional start site), which is distinct from the location of the binding site in previously reported IclR family transcriptional regulators. This study reveals the regulatory mechanism for 3-PBA degradation in strain JZ-1T, and the identification of PbaR increases the variety of regulatory models in the IclR family of transcriptional regulators. PMID:26386050

  19. Sug1 modulates yeast transcription activation by Cdc68.

    PubMed Central

    Xu, Q; Singer, R A; Johnston, G C

    1995-01-01

    The Cdc68 protein is required for the transcription of a variety of genes in the yeast Saccharomyces cerevisiae. In a search for proteins involved in the activity of the Cdc68 protein, we identified four suppressor genes in which mutations reverse the temperature sensitivity caused by the cdc68-1 allele. We report here the molecular characterization of mutations in one suppressor gene, the previously identified SUG1 gene. The Sug1 protein has been implicated in both transcriptional regulation and proteolysis. sug1 suppressor alleles reversed most aspects of the cdc68-1 mutant phenotype but did not suppress the lethality of a cdc68 null allele, indicating that sug1 suppression is by restoration of Cdc68 activity. Our evidence suggests that suppression by sug1 is unlikely to be due to increased stability of mutant Cdc68 protein, despite the observation that Sug1 affected proteolysis of mutant Cdc68. We report here that attenuated Sug1 activity strengthens mutant Cdc68 activity, whereas increased Sug1 activity further inhibits enfeebled Cdc68 activity, suggesting that Sug1 antagonizes the activator function of Cdc68 for transcription. Consistent with this hypothesis, we find that Sug1 represses transcription in vivo. PMID:7565755

  20. Transcriptional regulation of cathelicidin genes in chicken bone marrow cells.

    PubMed

    Lee, Sang In; Jang, Hyun June; Jeon, Mi-hyang; Lee, Mi Ock; Kim, Jeom Sun; Jeon, Ik-Soo; Byun, Sung June

    2016-04-01

    Cathelicidins form a family of vertebrate-specific immune molecules with an evolutionarily conserved gene structure. We analyzed the expression patterns of cathelicidin genes (CAMP, CATH3, and CATHB1) in chicken bone marrow cells (BMCs) and chicken embryonic fibroblasts (CEFs). We found that CAMP and CATHB1 were significantly up-regulated in BMCs, whereas the expression of CATH3 did not differ significantly between BMCs and CEFs. To study the mechanism underlying the up-regulation of cathelicidin genes in BMCs, we predicted the transcription factors (TFs) that bind to the 5'-flanking regions of cathelicidin genes. CEBPA, EBF1, HES1, MSX1, and ZIC3 were up-regulated in BMCs compared to CEFs. Subsequently, when a siRNA-mediated knockdown assay was performed for MSX1, the expression of CAMP and CATHB1 was decreased in BMCs. We also showed that the transcriptional activity of the CAMP promoter was decreased by mutation of the MSX1-binding sites present within the 5'-flanking region of CAMP. These results increase our understanding of the regulatory mechanisms controlling cathelicidin genes in BMCs. PMID:26908883

  1. Understanding Transcription Factor Regulation by Integrating Gene Expression and DNase I Hypersensitive Sites

    PubMed Central

    Wang, Guohua; Wang, Fang; Huang, Qian; Li, Yu; Liu, Yunlong; Wang, Yadong

    2015-01-01

    Transcription factors are proteins that bind to DNA sequences to regulate gene transcription. The transcription factor binding sites are short DNA sequences (5–20 bp long) specifically bound by one or more transcription factors. The identification of transcription factor binding sites and prediction of their function continue to be challenging problems in computational biology. In this study, by integrating the DNase I hypersensitive sites with known position weight matrices in the TRANSFAC database, the transcription factor binding sites in gene regulatory region are identified. Based on the global gene expression patterns in cervical cancer HeLaS3 cell and HelaS3-ifnα4h cell (interferon treatment on HeLaS3 cell for 4 hours), we present a model-based computational approach to predict a set of transcription factors that potentially cause such differential gene expression. Significantly, 6 out 10 predicted functional factors, including IRF, IRF-2, IRF-9, IRF-1 and IRF-3, ICSBP, belong to interferon regulatory factor family and upregulate the gene expression levels responding to the interferon treatment. Another factor, ISGF-3, is also a transcriptional activator induced by interferon alpha. Using the different transcription factor binding sites selected criteria, the prediction result of our model is consistent. Our model demonstrated the potential to computationally identify the functional transcription factors in gene regulation. PMID:26425553

  2. Estrogen Signaling Multiple Pathways to Impact Gene Transcription

    PubMed Central

    Marino, Maria; Galluzzo, Paola; Ascenzi, Paolo

    2006-01-01

    Steroid hormones exert profound effects on cell growth, development, differentiation, and homeostasis. Their effects are mediated through specific intracellular steroid receptors that act via multiple mechanisms. Among others, the action mechanism starting upon 17β-estradiol (E2) binds to its receptors (ER) is considered a paradigmatic example of how steroid hormones function. Ligand-activated ER dimerizes and translocates in the nucleus where it recognizes specific hormone response elements located in or near promoter DNA regions of target genes. Behind the classical genomic mechanism shared with other steroid hormones, E2 also modulates gene expression by a second indirect mechanism that involves the interaction of ER with other transcription factors which, in turn, bind their cognate DNA elements. In this case, ER modulates the activities of transcription factors such as the activator protein (AP)-1, nuclear factor-κB (NF-κB) and stimulating protein-1 (Sp-1), by stabilizing DNA-protein complexes and/or recruiting co-activators. In addition, E2 binding to ER may also exert rapid actions that start with the activation of a variety of signal transduction pathways (e.g. ERK/MAPK, p38/MAPK, PI3K/AKT, PLC/PKC). The debate about the contribution of different ER-mediated signaling pathways to coordinate the expression of specific sets of genes is still open. This review will focus on the recent knowledge about the mechanism by which ERs regulate the expression of target genes and the emerging field of integration of membrane and nuclear receptor signaling, giving examples of the ways by which the genomic and non-genomic actions of ERs on target genes converge. PMID:18369406

  3. Activation of the E2F transcription factor in adenovirus-infected cells involves E1A-dependent stimulation of DNA-binding activity and induction of cooperative binding mediated by an E4 gene product.

    PubMed Central

    Raychaudhuri, P; Bagchi, S; Neill, S D; Nevins, J R

    1990-01-01

    Previous experiments have demonstrated that the DNA-binding activity of the E2F transcription factor is increased upon adenovirus infection and that both the E1A and E4 genes are required for activation. In this study, we demonstrated that this enhanced binding of E2F to the E2 promoter is the result of two events. (i) There is stimulation of the DNA-binding activity of the E2F factor; this stimulation is E1A dependent but independent of E4. (ii) There is also induction of a stabilized interaction between E2F molecules bound to adjacent promoter sites; induction of stable E2F binding requires E4 gene function. This two-step activation process was also demonstrated in vitro. A heat-stable fraction from extracts of adenovirus-infected cells, which contains the 19-kilodalton E4 protein, was capable of stimulating stable E2F binding in an ATP-independent manner and appeared to involve direct interaction of the E4 protein with E2F. An extract from virus-infected cells devoid of the E4 19-kilodalton protein stimulated E2F DNA binding without forming the stable complex. This reaction required ATP. We conclude that activation of E2F during adenovirus infection is a two-step process involving a change in both the DNA-binding activity of the factor and the capacity to stabilize the interaction through protein-protein contacts. Images PMID:2139893

  4. Local potentiation of stress-responsive genes by upstream noncoding transcription

    PubMed Central

    Takemata, Naomichi; Oda, Arisa; Yamada, Takatomi; Galipon, Josephine; Miyoshi, Tomoichiro; Suzuki, Yutaka; Sugano, Sumio; Hoffman, Charles S.; Hirota, Kouji; Ohta, Kunihiro

    2016-01-01

    It has been postulated that a myriad of long noncoding RNAs (lncRNAs) contribute to gene regulation. In fission yeast, glucose starvation triggers lncRNA transcription across promoter regions of stress-responsive genes including fbp1 (fructose-1,6-bisphosphatase1). At the fbp1 promoter, this transcription promotes chromatin remodeling and fbp1 mRNA expression. Here, we demonstrate that such upstream noncoding transcription facilitates promoter association of the stress-responsive transcriptional activator Atf1 at the sites of transcription, leading to activation of the downstream stress genes. Genome-wide analyses revealed that ∼50 Atf1-binding sites show marked decrease in Atf1 occupancy when cells are treated with a transcription inhibitor. Most of these transcription-enhanced Atf1-binding sites are associated with stress-dependent induction of the adjacent mRNAs or lncRNAs, as observed in fbp1. These Atf1-binding sites exhibit low Atf1 occupancy and high histone density in glucose-rich conditions, and undergo dramatic changes in chromatin status after glucose depletion: enhanced Atf1 binding, histone eviction, and histone H3 acetylation. We also found that upstream transcripts bind to the Groucho-Tup1 type transcriptional corepressors Tup11 and Tup12, and locally antagonize their repressive functions on Atf1 binding. These results reveal a new mechanism in which upstream noncoding transcription locally magnifies the specific activation of stress-inducible genes via counteraction of corepressors. PMID:26945040

  5. Local potentiation of stress-responsive genes by upstream noncoding transcription.

    PubMed

    Takemata, Naomichi; Oda, Arisa; Yamada, Takatomi; Galipon, Josephine; Miyoshi, Tomoichiro; Suzuki, Yutaka; Sugano, Sumio; Hoffman, Charles S; Hirota, Kouji; Ohta, Kunihiro

    2016-06-20

    It has been postulated that a myriad of long noncoding RNAs (lncRNAs) contribute to gene regulation. In fission yeast, glucose starvation triggers lncRNA transcription across promoter regions of stress-responsive genes including fbp1 (fructose-1,6-bisphosphatase1). At the fbp1 promoter, this transcription promotes chromatin remodeling and fbp1 mRNA expression. Here, we demonstrate that such upstream noncoding transcription facilitates promoter association of the stress-responsive transcriptional activator Atf1 at the sites of transcription, leading to activation of the downstream stress genes. Genome-wide analyses revealed that ∼50 Atf1-binding sites show marked decrease in Atf1 occupancy when cells are treated with a transcription inhibitor. Most of these transcription-enhanced Atf1-binding sites are associated with stress-dependent induction of the adjacent mRNAs or lncRNAs, as observed in fbp1 These Atf1-binding sites exhibit low Atf1 occupancy and high histone density in glucose-rich conditions, and undergo dramatic changes in chromatin status after glucose depletion: enhanced Atf1 binding, histone eviction, and histone H3 acetylation. We also found that upstream transcripts bind to the Groucho-Tup1 type transcriptional corepressors Tup11 and Tup12, and locally antagonize their repressive functions on Atf1 binding. These results reveal a new mechanism in which upstream noncoding transcription locally magnifies the specific activation of stress-inducible genes via counteraction of corepressors. PMID:26945040

  6. Digital gene expression analysis of male and female bud transition in Metasequoia reveals high activity of MADS-box transcription factors and hormone-mediated sugar pathways.

    PubMed

    Zhao, Ying; Liang, Haiying; Li, Lan; Tang, Sha; Han, Xiao; Wang, Congpeng; Xia, Xinli; Yin, Weilun

    2015-01-01

    Metasequoia glyptostroboides is a famous redwood tree of ecological and economic importance, and requires more than 20 years of juvenile-to-adult transition before producing female and male cones. Previously, we induced reproductive buds using a hormone solution in juvenile Metasequoia trees as young as 5-to-7 years old. In the current study, hormone-treated shoots found in female and male buds were used to identify candidate genes involved in reproductive bud transition in Metasequoia. Samples from hormone-treated cone reproductive shoots and naturally occurring non-cone setting shoots were analyzed using 24 digital gene expression (DGE) tag profiles using Illumina, generating a total of 69,520 putative transcripts. Next, 32 differentially and specifically expressed transcripts were determined using quantitative real-time polymerase chain reaction, including the upregulation of MADS-box transcription factors involved in male bud transition and flowering time control proteins involved in female bud transition. These differentially expressed transcripts were associated with 243 KEGG pathways. Among the significantly changed pathways, sugar pathways were mediated by hormone signals during the vegetative-to-reproductive phase transition, including glycolysis/gluconeogenesis and sucrose and starch metabolism pathways. Key enzymes were identified in these pathways, including alcohol dehydrogenase (NAD) and glutathione dehydrogenase for the glycolysis/gluconeogenesis pathway, and glucanphosphorylase for sucrose and starch metabolism pathways. Our results increase our understanding of the reproductive bud transition in gymnosperms. In addition, these studies on hormone-mediated sugar pathways increase our understanding of the relationship between sugar and hormone signaling during female and male bud initiation in Metasequoia. PMID:26157452

  7. Digital gene expression analysis of male and female bud transition in Metasequoia reveals high activity of MADS-box transcription factors and hormone-mediated sugar pathways

    PubMed Central

    Zhao, Ying; Liang, Haiying; Li, Lan; Tang, Sha; Han, Xiao; Wang, Congpeng; Xia, Xinli; Yin, Weilun

    2015-01-01

    Metasequoia glyptostroboides is a famous redwood tree of ecological and economic importance, and requires more than 20 years of juvenile-to-adult transition before producing female and male cones. Previously, we induced reproductive buds using a hormone solution in juvenile Metasequoia trees as young as 5-to-7 years old. In the current study, hormone-treated shoots found in female and male buds were used to identify candidate genes involved in reproductive bud transition in Metasequoia. Samples from hormone-treated cone reproductive shoots and naturally occurring non-cone setting shoots were analyzed using 24 digital gene expression (DGE) tag profiles using Illumina, generating a total of 69,520 putative transcripts. Next, 32 differentially and specifically expressed transcripts were determined using quantitative real-time polymerase chain reaction, including the upregulation of MADS-box transcription factors involved in male bud transition and flowering time control proteins involved in female bud transition. These differentially expressed transcripts were associated with 243 KEGG pathways. Among the significantly changed pathways, sugar pathways were mediated by hormone signals during the vegetative-to-reproductive phase transition, including glycolysis/gluconeogenesis and sucrose and starch metabolism pathways. Key enzymes were identified in these pathways, including alcohol dehydrogenase (NAD) and glutathione dehydrogenase for the glycolysis/gluconeogenesis pathway, and glucanphosphorylase for sucrose and starch metabolism pathways. Our results increase our understanding of the reproductive bud transition in gymnosperms. In addition, these studies on hormone-mediated sugar pathways increase our understanding of the relationship between sugar and hormone signaling during female and male bud initiation in Metasequoia. PMID:26157452

  8. Transcriptional and Posttranscriptional Regulation of Dormancy-Associated Gene Expression by Afterripening in Wild Oat.

    PubMed Central

    Li, Bailin.; Foley, M. E.

    1996-01-01

    To investigate whether the afterripening-induced changes in gene expression are at the transcriptional or posttranscriptional level in wild oat (Avena fatua) seeds, we chose four dormancy-associated genes to estimate their relative transcription activities and the stability of their corresponding transcripts in afterripened and dormant embryos. The transcription activities for those genes were 1.5 to 7 times higher in dormant embryos than in afterripened embryos 24 h after incubation, as determined by nuclear run-on assays. The half-lives of the transcripts in afterripened and dormant embryos were estimated by the use of actinomycin D. The application of actinomycin D resulted in the stabilization of the transcripts. Nevertheless, the results indicated that the half-lives of the transcripts were much greater in dormant embryos than in afterripened embryos. Considering the great differences in the steady-state levels and the half-lives of the mRNAs, and the relatively small differences in transcription activities of the genes between afterripened and dormant embryos, we conclude that afterripening regulates the expression of dormancy-associated genes in excised embryos mainly at the posttranscriptional level and that transcriptional control plays a minor role. PMID:12226258

  9. Transcriptional Activation of the Cholecystokinin Gene by DJ-1 through Interaction of DJ-1 with RREB1 and the Effect of DJ-1 on the Cholecystokinin Level in Mice

    PubMed Central

    Yamane, Takuya; Suzui, Sayaka; Kitaura, Hirotake; Takahashi-Niki, Kazuko; Iguchi-Ariga, Sanae M. M.; Ariga, Hiroyoshi

    2013-01-01

    DJ-1 is an oncogene and also causative gene for familial Parkinson’s disease. DJ-1 has multiple functions, including transcriptional regulation. DJ-1 acts as a coactivator that binds to various transcription factors, resulting in stimulation or repression of the expression of their target genes. In this study, we found that the cholecystokinin (CCK) gene is a transcriptional target gene for DJ-1. CCK is a peptide hormone and plays roles in contraction of the gallbladder and in promotion of secretion of pancreatic fluid. CCK is co-localized with dopamine in the substantia nigra to regulate release of dopamine. Reduced expression of CCK mRNA was observed in DJ-1-knockdown cells. The Ras-responsive element (RRE) and Sp1 site were essential for promoter activity, and DJ-1 stimulated promoter activity by binding to RRE-binding protein 1 (RREBP1). The complex of DJ-1 with RREB1 but not with Sp1 bound to the RRE. Furthermore, the reduced CCK level in the serum from DJ-1-knockout mice compared to that from wild-type mice was observed. This is the first report showing that DJ-1 participates in peptide hormone synthesis. PMID:24348900

  10. Requirement of gene VII in cis for the expression of downstream genes on the major transcript of figwort mosaic virus.

    PubMed

    Gowda, S; Scholthof, H B; Wu, F C; Shepherd, R J

    1991-12-01

    The six major conserved genes of figwort mosaic virus (FMV), a caulimovirus, appear in tandem array on an RNA transcript that spans the entire viral genome. Gene VI, the only cistron that appears as a separate subgenomic RNA, has been reported to transactivate the expression of downstream genes of the full-length transcript. This transcript has a long 5'-leader of about 600 nucleotides followed by a small nonconserved region (gene VII), a smaller intergenic region (57 nucleotides), and the major conserved genes in a closely spaced array. In our present experiments we have constructed expression units containing the promoter for the full-length transcript followed by the 5' leader region, gene VII, and a reporter gene. These have been tested for expression with and without gene VI as a separate plasmid by electroporation into plant protoplasts. A series of these expression units containing truncated versions of the 5' leader region placed upstream of a reporter gene (CAT) showed that gene VI transactivation occurred only when gene VII sequences were present in cis between the leader region and the reporter gene. In addition, a more complete version of the FMV genome containing the reporter gene further downstream (in viral gene IV) showed CAT expression only when gene VII sequences were present in an upstream position. A similar construct failed to express CAT activity when gene VII was absent. PMID:1962457

  11. Early Growth Response 4 Is Involved in Cell Proliferation of Small Cell Lung Cancer through Transcriptional Activation of Its Downstream Genes

    PubMed Central

    Yoshimaru, Tetsuro; Daizumoto, Kei; Sone, Saburo; Nishioka, Yasuhiko; Katagiri, Toyomasa

    2014-01-01

    Small cell lung cancer (SCLC) is aggressive, with rapid growth and frequent bone metastasis; however, its detailed molecular mechanism remains poorly understood. Here, we report the critical role of early growth factor 4 (EGR4), a DNA-binding, zinc-finger transcription factor, in cell proliferation of SCLC. EGR4 overexpression in HEK293T cells conferred significant upregulation of specific splice variants of the parathyroid hormone-related protein (PTHrP) gene, resulting in enhancement of the secretion of PTHrP protein, a known mediator of osteolytic bone metastasis. More importantly, depletion of EGR4 expression by siRNA significantly suppressed growth of the SCLC cell lines, SBC-5, SBC-3 and NCI-H1048. On the other hand, introduction of EGR4 into NIH3T3 cells significantly enhanced cell growth. We identified four EGR4 target genes, SAMD5, RAB15, SYNPO and DLX5, which were the most significantly downregulated genes upon depletion of EGR4 expression in all of the SCLC cells examined, and demonstrated the direct recruitment of EGR4 to their promoters by ChIP and luciferase reporter analysis. Notably, knockdown of the expression of these genes by siRNA remarkably suppressed the growth of all the SCLC cells. Taken together, our findings suggest that EGR4 likely regulates the bone metastasis and proliferation of SCLC cells via transcriptional regulation of several target genes, and may therefore be a promising target for the development of anticancer drugs for SCLC patients. PMID:25411851

  12. Regulation of endogenous human gene expression by ligand-inducible TALE transcription factors.

    PubMed

    Mercer, Andrew C; Gaj, Thomas; Sirk, Shannon J; Lamb, Brian M; Barbas, Carlos F

    2014-10-17

    The construction of increasingly sophisticated synthetic biological circuits is dependent on the development of extensible tools capable of providing specific control of gene expression in eukaryotic cells. Here, we describe a new class of synthetic transcription factors that activate gene expression in response to extracellular chemical stimuli. These inducible activators consist of customizable transcription activator-like effector (TALE) proteins combined with steroid hormone receptor ligand-binding domains. We demonstrate that these ligand-responsive TALE transcription factors allow for tunable and conditional control of gene activation and can be used to regulate the expression of endogenous genes in human cells. Since TALEs can be designed to recognize any contiguous DNA sequence, the conditional gene regulatory system described herein will enable the design of advanced synthetic gene networks. PMID:24251925

  13. WRKY transcription factor genes in wild rice Oryza nivara.

    PubMed

    Xu, Hengjian; Watanabe, Kenneth A; Zhang, Liyuan; Shen, Qingxi J

    2016-08-01

    The WRKY transcription factor family is one of the largest gene families involved in plant development and stress response. Although many WRKY genes have been studied in cultivated rice (Oryza sativa), the WRKY genes in the wild rice species Oryza nivara, the direct progenitor of O. sativa, have not been studied. O. nivara shows abundant genetic diversity and elite drought and disease resistance features. Herein, a total of 97 O. nivara WRKY (OnWRKY) genes were identified. RNA-sequencing demonstrates that OnWRKY genes were generally expressed at higher levels in the roots of 30-day-old plants. Bioinformatic analyses suggest that most of OnWRKY genes could be induced by salicylic acid, abscisic acid, and drought. Abundant potential MAPK phosphorylation sites in OnWRKYs suggest that activities of most OnWRKYs can be regulated by phosphorylation. Phylogenetic analyses of OnWRKYs support a novel hypothesis that ancient group IIc OnWRKYs were the original ancestors of only some group IIc and group III WRKYs. The analyses also offer strong support that group IIc OnWRKYs containing the HVE sequence in their zinc finger motifs were derived from group Ia WRKYs. This study provides a solid foundation for the study of the evolution and functions of WRKY genes in O. nivara. PMID:27345721

  14. WRKY transcription factor genes in wild rice Oryza nivara

    PubMed Central

    Xu, Hengjian; Watanabe, Kenneth A.; Zhang, Liyuan; Shen, Qingxi J.

    2016-01-01

    The WRKY transcription factor family is one of the largest gene families involved in plant development and stress response. Although many WRKY genes have been studied in cultivated rice (Oryza sativa), the WRKY genes in the wild rice species Oryza nivara, the direct progenitor of O. sativa, have not been studied. O. nivara shows abundant genetic diversity and elite drought and disease resistance features. Herein, a total of 97 O. nivara WRKY (OnWRKY) genes were identified. RNA-sequencing demonstrates that OnWRKY genes were generally expressed at higher levels in the roots of 30-day-old plants. Bioinformatic analyses suggest that most of OnWRKY genes could be induced by salicylic acid, abscisic acid, and drought. Abundant potential MAPK phosphorylation sites in OnWRKYs suggest that activities of most OnWRKYs can be regulated by phosphorylation. Phylogenetic analyses of OnWRKYs support a novel hypothesis that ancient group IIc OnWRKYs were the original ancestors of only some group IIc and group III WRKYs. The analyses also offer strong support that group IIc OnWRKYs containing the HVE sequence in their zinc finger motifs were derived from group Ia WRKYs. This study provides a solid foundation for the study of the evolution and functions of WRKY genes in O. nivara. PMID:27345721

  15. Inosine monophosphate dehydrogenase expression: transcriptional regulation of the type I and type II genes.

    PubMed

    Zimmermann, A; Gu, J J; Spychala, J; Mitchell, B S

    1996-01-01

    Inosine 5'-monophosphate dehydrogenase (IMPDH) is an essential rate-limiting enzyme in the de novo guanine nucleotide synthetic pathway that catalyzes the conversion of IMP to XMP. Enzyme activity is accounted for by the expression of two distinct but closely related genes termed IMPDH I and II. Increased IMPDH activity has been linked to both cellular proliferation and neoplastic transformation and generally ascribed to an increase in the expression of the type II gene. We have characterized the type I and type II genes and identified elements important in the transcriptional regulation of both genes. The type II IMPDH gene contains a 466 bp 5' flanking region spanning the translation start site that contains several transcription factor binding sites and mediates increased transcription of a CAT reporter gene in peripheral blood T lymphocytes when these cells are induced to proliferate. The single functional IMPDH type I gene contains exon-intron boundaries and exon structures that are nearly identical to those in the type II gene. In contrast to the type II gene, however, it contains two putative promoter sites, each with the potential for transcriptional regulation. We conclude that these two genes most probably arose from an early gene duplication event and that their highly conserved structures and differential regulation at the transcriptional level argue strongly for a significant role for each gene in cellular metabolism, growth, and differentiation. PMID:8869741

  16. Modular composition of gene transcription networks.

    PubMed

    Gyorgy, Andras; Del Vecchio, Domitilla

    2014-03-01

    Predicting the dynamic behavior of a large network from that of the composing modules is a central problem in systems and synthetic biology. Yet, this predictive ability is still largely missing because modules display context-dependent behavior. One cause of context-dependence is retroactivity, a phenomenon similar to loading that influences in non-trivial ways the dynamic performance of a module upon connection to other modules. Here, we establish an analysis framework for gene transcription networks that explicitly accounts for retroactivity. Specifically, a module's key properties are encoded by three retroactivity matrices: internal, scaling, and mixing retroactivity. All of them have a physical interpretation and can be computed from macroscopic parameters (dissociation constants and promoter concentrations) and from the modules' topology. The internal retroactivity quantifies the effect of intramodular connections on an isolated module's dynamics. The scaling and mixing retroactivity establish how intermodular connections change the dynamics of connected modules. Based on these matrices and on the dynamics of modules in isolation, we can accurately predict how loading will affect the behavior of an arbitrary interconnection of modules. We illustrate implications of internal, scaling, and mixing retroactivity on the performance of recurrent network motifs, including negative autoregulation, combinatorial regulation, two-gene clocks, the toggle switch, and the single-input motif. We further provide a quantitative metric that determines how robust the dynamic behavior of a module is to interconnection with other modules. This metric can be employed both to evaluate the extent of modularity of natural networks and to establish concrete design guidelines to minimize retroactivity between modules in synthetic systems. PMID:24626132

  17. Modular Composition of Gene Transcription Networks

    PubMed Central

    Gyorgy, Andras; Del Vecchio, Domitilla

    2014-01-01

    Predicting the dynamic behavior of a large network from that of the composing modules is a central problem in systems and synthetic biology. Yet, this predictive ability is still largely missing because modules display context-dependent behavior. One cause of context-dependence is retroactivity, a phenomenon similar to loading that influences in non-trivial ways the dynamic performance of a module upon connection to other modules. Here, we establish an analysis framework for gene transcription networks that explicitly accounts for retroactivity. Specifically, a module's key properties are encoded by three retroactivity matrices: internal, scaling, and mixing retroactivity. All of them have a physical interpretation and can be computed from macroscopic parameters (dissociation constants and promoter concentrations) and from the modules' topology. The internal retroactivity quantifies the effect of intramodular connections on an isolated module's dynamics. The scaling and mixing retroactivity establish how intermodular connections change the dynamics of connected modules. Based on these matrices and on the dynamics of modules in isolation, we can accurately predict how loading will affect the behavior of an arbitrary interconnection of modules. We illustrate implications of internal, scaling, and mixing retroactivity on the performance of recurrent network motifs, including negative autoregulation, combinatorial regulation, two-gene clocks, the toggle switch, and the single-input motif. We further provide a quantitative metric that determines how robust the dynamic behavior of a module is to interconnection with other modules. This metric can be employed both to evaluate the extent of modularity of natural networks and to establish concrete design guidelines to minimize retroactivity between modules in synthetic systems. PMID:24626132

  18. A polymorphism of the GTP-cyclohydrolase I feedback regulator gene alters transcriptional activity and may affect response to SSRI antidepressants.

    PubMed

    McHugh, P C; Joyce, P R; Deng, X; Kennedy, M A

    2011-06-01

    Tetrahydrobiopterin (BH(4)) is an essential cofactor for synthesis of many neurotransmitters including serotonin. In serotonergic neurons, BH(4) is tightly regulated by GTP-cyclohydrolase I feedback regulator (GFRP). Given the pivotal role of the serotonergic system in mood disorders and selective serotonin reuptake inhibitors (SSRIs) antidepressant function, we tested the hypothesis that GFRP gene (GCHFR) variants would modify response to antidepressants in subjects with major depression. Two single nucleotide polymorphisms (rs7164342 and rs7163862) in the GCHFR promoter were identified and occurred as two haplotypes (GA or TT). A multiple regression analysis revealed that homozygous individuals for the TT haplotype were less likely to respond to the SSRI fluoxetine than to the tricyclic antidepressant nortriptyline (P = 0.037). Moreover, the TT haplotype showed a reduced transcription rate in luciferase reporter gene assays, which may impact on BH(4)-mediated neurotransmitter production, thus suggesting a biological process through which GCHFR promoter variants might influence antidepressant response. PMID:20351752

  19. Human MAF1 targets and represses active RNA polymerase III genes by preventing recruitment rather than inducing long-term transcriptional arrest

    PubMed Central

    Orioli, Andrea; Praz, Viviane; Lhôte, Philippe; Hernandez, Nouria

    2016-01-01

    RNA polymerase III (Pol III) is tightly controlled in response to environmental cues, yet a genomic-scale picture of Pol III regulation and the role played by its repressor MAF1 is lacking. Here, we describe genome-wide studies in human fibroblasts that reveal a dynamic and gene-specific adaptation of Pol III recruitment to extracellular signals in an mTORC1-dependent manner. Repression of Pol III recruitment and transcription are tightly linked to MAF1, which selectively localizes at Pol III loci, even under serum-replete conditions, and increasingly targets transcribing Pol III in response to serum starvation. Combining Pol III binding profiles with EU-labeling and high-throughput sequencing of newly synthesized small RNAs, we show that Pol III occupancy closely reflects ongoing transcription. Our results exclude the long-term, unproductive arrest of Pol III on the DNA as a major regulatory mechanism and identify previously uncharacterized, differential coordination in Pol III binding and transcription under different growth conditions. PMID:26941251

  20. Galactose and Lactose Genes from the Galactose-Positive Bacterium Streptococcus salivarius and the Phylogenetically Related Galactose-Negative Bacterium Streptococcus thermophilus: Organization, Sequence, Transcription, and Activity of the gal Gene Products

    PubMed Central

    Vaillancourt, Katy; Moineau, Sylvain; Frenette, Michel; Lessard, Christian; Vadeboncoeur, Christian

    2002-01-01

    Streptococcus salivarius is a lactose- and galactose-positive bacterium that is phylogenetically closely related to Streptococcus thermophilus, a bacterium that metabolizes lactose but not galactose. In this paper, we report a comparative characterization of the S. salivarius and S. thermophilus gal-lac gene clusters. The clusters have the same organization with the order galR (codes for a transcriptional regulator and is transcribed in the opposite direction), galK (galactokinase), galT (galactose-1-P uridylyltransferase), galE (UDP-glucose 4-epimerase), galM (galactose mutarotase), lacS (lactose transporter), and lacZ (β-galactosidase). An analysis of the nucleotide sequence as well as Northern blotting and primer extension experiments revealed the presence of four promoters located upstream from galR, the gal operon, galM, and the lac operon of S. salivarius. Putative promoters with virtually identical nucleotide sequences were found at the same positions in the S. thermophilus gal-lac gene cluster. An additional putative internal promoter at the 3′ end of galT was found in S. thermophilus but not in S. salivarius. The results clearly indicated that the gal-lac gene cluster was efficiently transcribed in both species. The Shine-Dalgarno sequences of galT and galE were identical in both species, whereas the ribosome binding site of S. thermophilus galK differed from that of S. salivarius by two nucleotides, suggesting that the S. thermophilus galK gene might be poorly translated. This was confirmed by measurements of enzyme activities. PMID:11790749

  1. NF-Y activates mouse tryptophan hydroxylase transcription.

    PubMed

    Reed, G E; Kirchner, J E; Carr, L G

    1995-06-01

    Tryptophan hydroxylase catalyses the rate-limiting step in the biosynthesis of serotonin, a neurotransmitter which has been implicated in the etiologies of clinically important psychiatric illnesses. Tryptophan hydroxylase is expressed in a tissue-specific manner, but little is known about its transcriptional regulation. By analysing transcriptional activities of a set 5'-deletion constructs of promoter-reporter plasmids in P815-HTR mastocytoma cells, we found that transcription was activated by sequences between nucleotides -343 and -21. DNase I footprint analysis, using nuclear protein extracts from P815-HTR cells, revealed a protein-DNA interaction between nucleotides -77 and -46. A double stranded oligonucleotide, representing this binding site, specifically bound nuclear protein in a gel shift assay. Methylation interference analysis of this complex revealed that nuclear protein interacted with an inverted GGCCAAT element, which is a high-affinity binding motif for the transcription factor NF-Y (also known as CP1 or CBF). An NF-Y specific antibody abolished protein binding in a gel shift assay. Mutagenesis of specific base pairs abolished protein binding in vitro, and mutagenesis of the same base pairs in a reporter gene construct resulted in a 65% decrease in transcriptional activity. Our results suggest that the transcription factor NF-Y binds to a GGCCAAT motif in the tph proximal promoter and activates transcription. PMID:7552299

  2. Evolution of gene regulation during transcription and translation.

    PubMed

    Wang, Zhe; Sun, Xuepeng; Zhao, Yi; Guo, Xiaoxian; Jiang, Huifeng; Li, Hongye; Gu, Zhenglong

    2015-04-01

    Understanding how gene regulation evolves is a key area in the current evolutionary field. Gene regulation occurs at various levels. Previous work on the evolution of gene regulation has largely focused on gene transcription. In this study, we used a recently developed ribosomal footprint profiling method to investigate how gene regulation evolves at both the transcription (mRNA abundance) and translation (ribosomal density) levels. By constructing a hybrid between Saccharomyces cerevisiae (Scer) and Saccharomyces bayanus (Sbay), which diverged ∼20 Ma, and quantifying transcriptome and translatome in both parental strains and their hybrid, we showed that translation is much more conserved than transcription, mostly due to the buffering effect of translational regulation for the transcriptional divergence. More conservation in translation than transcription is also confirmed by the inheritance mode of transcription and translation between two species. Furthermore, cis and trans effects are widely involved in changes at both transcription and translation levels. Finally, our results showed that genes with certain functions and sequence features might employ specific modes for evolution at these two critical levels of gene regulation. Our results demonstrated that it is essential to investigate the evolution of gene regulation at various levels from different genetic backgrounds to obtain a complete picture of its evolutionary modes in nature. PMID:25877616

  3. Transcriptional Regulation of Gene Expression in C. elegans

    PubMed Central

    Reinke, Valerie; Krause, Michael; Okkema, Peter

    2013-01-01

    Protein coding gene sequences are converted to mRNA by the highly regulated process of transcription. The precise temporal and spatial control of transcription for many genes is an essential part of development in metazoans. Thus, understanding the molecular mechanisms underlying transcriptional control is essential to understanding cell fate determination during embryogenesis, post-embryonic development, many environmental interactions, and disease-related processes. Studies of transcriptional regulation in C. elegans exploit its genomic simplicity and physical characteristics to define regulatory events with single cell and minute time scale resolution. When combined with the genetics of the system, C. elegans offers a unique and powerful vantage point from which to study how chromatin-associated protein and their modifications interact with transcription factors and their binding sites to yield precise control of gene expression through transcriptional regulation. PMID:23801596

  4. The relationship between gene transcription and combinations of histone modifications

    NASA Astrophysics Data System (ADS)

    Cui, Xiangjun; Li, Hong; Luo, Liaofu

    2012-09-01

    Histone modification is an important subject of epigenetics which plays an intrinsic role in transcriptional regulation. It is known that multiple histone modifications act in a combinatorial fashion. In this study, we demonstrated that the pathways within constructed Bayesian networks can give an indication for the combinations among 12 histone modifications which have been studied in the TSS+1kb region in S. cerevisiae. After Bayesian networks for the genes with high transcript levels (H-network) and low transcript levels (L-network) were constructed, the combinations of modifications within the two networks were analyzed from the view of transcript level. The results showed that different combinations played dissimilar roles in the regulation of gene transcription when there exist differences for gene expression at transcription level.

  5. Combinatorial influence of environmental parameters on transcription factor activity

    PubMed Central

    Knijnenburg, T.A.; Wessels, L.F.A.; Reinders, M.J.T.

    2008-01-01

    Motivation: Cells receive a wide variety of environmental signals, which are often processed combinatorially to generate specific genetic responses. Changes in transcript levels, as observed across different environmental conditions, can, to a large extent, be attributed to changes in the activity of transcription factors (TFs). However, in unraveling these transcription regulation networks, the actual environmental signals are often not incorporated into the model, simply because they have not been measured. The unquantified heterogeneity of the environmental parameters across microarray experiments frustrates regulatory network inference. Results: We propose an inference algorithm that models the influence of environmental parameters on gene expression. The approach is based on a yeast microarray compendium of chemostat steady-state experiments. Chemostat cultivation enables the accurate control and measurement of many of the key cultivation parameters, such as nutrient concentrations, growth rate and temperature. The observed transcript levels are explained by inferring the activity of TFs in response to combinations of cultivation parameters. The interplay between activated enhancers and repressors that bind a gene promoter determine the possible up- or downregulation of the gene. The model is translated into a linear integer optimization problem. The resulting regulatory network identifies the combinatorial effects of environmental parameters on TF activity and gene expression. Availability: The Matlab code is available from the authors upon request. Contact: t.a.knijnenburg@tudelft.nl Supplementary information: Supplementary data are available at Bioinformatics online. PMID:18586711

  6. Precisely modulated pathogenicity island interference with late phage gene transcription.

    PubMed

    Ram, Geeta; Chen, John; Ross, Hope F; Novick, Richard P

    2014-10-01

    Having gone to great evolutionary lengths to develop resistance to bacteriophages, bacteria have come up with resistance mechanisms directed at every aspect of the bacteriophage life cycle. Most genes involved in phage resistance are carried by plasmids and other mobile genetic elements, including bacteriophages and their relatives. A very special case of phage resistance is exhibited by the highly mobile phage satellites, staphylococcal pathogenicity islands (SaPIs), which carry and disseminate superantigen and other virulence genes. Unlike the usual phage-resistance mechanisms, the SaPI-encoded interference mechanisms are carefully crafted to ensure that a phage-infected, SaPI-containing cell will lyse, releasing the requisite crop of SaPI particles as well as a greatly diminished crop of phage particles. Previously described SaPI interference genes target phage functions that are not required for SaPI particle production and release. Here we describe a SaPI-mediated interference system that affects expression of late phage gene transcription and consequently is required for SaPI and phage. Although when cloned separately, a single SaPI gene totally blocks phage production, its activity in situ is modulated accurately by a second gene, achieving the required level of interference. The advantage for the host bacteria is that the SaPIs curb excessive phage growth while enhancing their gene transfer activity. This activity is in contrast to that of the clustered regularly interspaced short palindromic repeats (CRISPRs), which totally block phage growth at the cost of phage-mediated gene transfer. In staphylococci the SaPI strategy seems to have prevailed during evolution: The great majority of Staphylococcus aureus strains carry one or more SaPIs, whereas CRISPRs are extremely rare. PMID:25246539

  7. Cyclin D1 transcriptional activation in MCL.

    PubMed

    Beà, Sílvia

    2014-03-27

    In this issue of Blood, Allinne et al propose the nucleolin-dependent activation of the translocated CCND1 allele in mantle cell lymphoma (MCL) because of its relocalization to a transcriptionally favorable area in the perinucleolar region. PMID:24677400

  8. Oxygen-evoked changes in transcriptional activity of the 5'-flanking region of the human amiloride-sensitive sodium channel (alphaENaC) gene: role of nuclear factor kappaB.

    PubMed Central

    Baines, Deborah L; Janes, Mandy; Newman, David J; Best, Oliver G

    2002-01-01

    Expression of the alpha-subunit of the amiloride-sensitive sodium channel (alphaENaC) is regulated by a number of factors in the lung, including oxygen partial pressure (PO2). As transcriptional activation is a mechanism for raising cellular mRNA levels, we investigated the effect of physiological changes in PO2 on the activity of the redox-sensitive transcription factor nuclear factor kappaB (NF-kappaB) and transcriptional activity of 5'-flanking regions of the human alphaENaC gene using luciferase reporter-gene vectors transiently transfected into human adult alveolar carcinoma A549 cells. By Western blotting we confirmed the presence of NF-kappaB p65 but not p50 in these cells. Transiently increasing PO2 from 23 to 42 mmHg for 24 h evoked a significant increase in NF-kappaB DNA-binding activity and transactivation of a NF-kappaB-driven luciferase construct (pGLNF-kappaBpro), which was blocked by the NF-kappaB activation inhibitor sulphasalazine (5 mM). Transcriptional activity of alphaENaC-luciferase constructs containing 5'-flanking sequences (including the NF-kappaB consensus) were increased by raising PO2 from 23 to 142 mmHg if they contained transcriptional initiation sites (TIS) for exons 1A and 1B (pGL3E2.2) or the 3' TIS of exon 1B alone (pGL3E0.8). Sulphasalazine had no significant effect on the activity of these constructs, suggesting that the PO2-evoked rise in activity was not a direct consequence of NF-kappaB activation. Conversely, the relative luciferase activity of a construct that lacked the 3' TIS, a 3' intron and splice site but still retained the 5' TIS and NF-kappaB consensus sequence was suppressed significantly by raising PO2. This effect was reversed by sulphasalazine, suggesting that activation of NF-kappaB mediated PO2-evoked suppression of transcription from the exon 1A TIS of alphaENaC. PMID:12023897

  9. Assessment of the Role of MAP Kinase in Mediating Activity-Dependent Transcriptional Activation of the Immediate Early Gene "Arc/Arg3.1" in the Dentate Gyrus in Vivo

    ERIC Educational Resources Information Center

    Chotiner, Jennifer K.; Nielson, Jessica; Farris, Shannon; Lewandowski, Gail; Huang, Fen; Banos, Karla; de Leon, Ray; Steward, Oswald

    2010-01-01

    Different physiological and behavioral events activate transcription of "Arc/Arg3.1" in neurons in vivo, but the signal transduction pathways that mediate induction in particular situations remain to be defined. Here, we explore the relationships between induction of "Arc/Arg3.1" transcription in dentate granule cells in vivo and activation of…

  10. NM23-H2 may play an indirect role in transcriptional activation of c-myc gene expression but does not cleave the nuclease hypersensitive element III[subscript 1

    SciTech Connect

    Dexheimer, Thomas S.; Carey, Steven S.; Zuohe, Song; Gokhale, Vijay M.; Hu, Xiaohui; Murata, Lauren B.; Maes, Estelle M.; Weichsel, Andrzej; Sun, Daekyu; Meuillet, Emmanuelle J.; Montfort, William R.; Hurley, Laurence H.

    2009-05-13

    The formation of G-quadruplex structures within the nuclease hypersensitive element (NHE) III{sub 1} region of the c-myc promoter and the ability of these structures to repress c-myc transcription have been well established. However, just how these extremely stable DNA secondary structures are transformed to activate c-myc transcription is still unknown. NM23-H2/nucleoside diphosphate kinase B has been recognized as an activator of c-myc transcription via interactions with the NHE III{sub 1} region of the c-myc gene promoter. Through the use of RNA interference, we confirmed the transcriptional regulatory role of NM23-H2. In addition, we find that further purification of NM23-H2 results in loss of the previously identified DNA strand cleavage activity, but retention of its DNA binding activity. NM23-H2 binds to both single-stranded guanine- and cytosine-rich strands of the c-myc NHE III{sub 1} and, to a lesser extent, to a random single-stranded DNA template. However, it does not bind to or cleave the NHE III{sub 1} in duplex form. Significantly, potassium ions and compounds that stabilize the G-quadruplex and i-motif structures have an inhibitory effect on NM23-H2 DNA-binding activity. Mutation of Arg{sup 88} to Ala{sup 88} (R88A) reduced both DNA and nucleotide binding but had minimal effect on the NM23-H2 crystal structure. On the basis of these data and molecular modeling studies, we have proposed a stepwise trapping-out of the NHE III{sub 1} region in a single-stranded form, thus allowing single-stranded transcription factors to bind and activate c-myc transcription. Furthermore, this model provides a rationale for how the stabilization of the G-quadruplex or i-motif structures formed within the c-myc gene promoter region can inhibit NM23-H2 from activating c-myc gene expression.

  11. Activation of archaeal transcription mediated by recruitment of transcription factor B.

    PubMed

    Ochs, Simon M; Thumann, Sybille; Richau, Renate; Weirauch, Matt T; Lowe, Todd M; Thomm, Michael; Hausner, Winfried

    2012-05-25

    Archaeal promoters consist of a TATA box and a purine-rich adjacent upstream sequence (transcription factor B (TFB)-responsive element (BRE)), which are bound by the transcription factors TATA box-binding protein (TBP) and TFB. Currently, only a few activators of archaeal transcription have been experimentally characterized. The best studied activator, Ptr2, mediates activation by recruitment of TBP. Here, we present a detailed biochemical analysis of an archaeal transcriptional activator, PF1088, which was identified in Pyrococcus furiosus by a bioinformatic approach. Operon predictions suggested that an upstream gene, pf1089, is polycistronically transcribed with pf1088. We demonstrate that PF1088 stimulates in vitro transcription by up to 7-fold when the pf1089 promoter is used as a template. By DNase I and hydroxyl radical footprinting experiments, we show that the binding site of PF1088 is located directly upstream of the BRE of pf1089. Mutational analysis indicated that activation requires the presence of the binding site for PF1088. Furthermore, we show that activation of transcription by PF1088 is dependent upon the presence of an imperfect BRE and is abolished when the pf1089 BRE is replaced with a BRE from a strong archaeal promoter. Gel shift experiments showed that TFB recruitment to the pf1089 operon is stimulated by PF1088, and TFB seems to stabilize PF1088 operator binding even in the absence of TBP. Taken together, these results represent the first biochemical evidence for a transcriptional activator working as a TFB recruitment factor in Archaea, for which the designation TFB-RF1 is suggested. PMID:22496454

  12. Stimulus-induced modulation of transcriptional bursting in a single mammalian gene.

    PubMed

    Molina, Nacho; Suter, David M; Cannavo, Rosamaria; Zoller, Benjamin; Gotic, Ivana; Naef, Félix

    2013-12-17

    Mammalian genes are often transcribed discontinuously as short bursts of RNA synthesis followed by longer silent periods. However, how these "on" and "off" transitions, together with the burst sizes, are modulated in single cells to increase gene expression upon stimulation is poorly characterized. By combining single-cell time-lapse luminescence imaging with stochastic modeling of the time traces, we quantified the transcriptional responses of the endogenous connective tissue growth factor gene to different physiological stimuli: serum and TGF-β1. Both stimuli caused a rapid and acute increase in burst sizes. Whereas TGF-β1 showed prolonged transcriptional activation mediated by an increase of transcription rate, serum stimulation resulted in a large and temporally tight first transcriptional burst, followed by a refractory period in the range of hours. Our study thus reveals how different physiological stimuli can trigger kinetically distinct transcriptional responses of the same gene. PMID:24297917

  13. NanoScript: A Nanoparticle-Based Artificial Transcription Factor for Effective Gene Regulation

    PubMed Central

    2015-01-01

    Transcription factor (TF) proteins are master regulators of transcriptional activity and gene expression. TF-based gene regulation is a promising approach for many biological applications; however, several limitations hinder the full potential of TFs. Herein, we developed an artificial, nanoparticle-based transcription factor, termed NanoScript, which is designed to mimic the structure and function of TFs. NanoScript was constructed by tethering functional peptides and small molecules called synthetic transcription factors, which mimic the individual TF domains, onto gold nanoparticles. We demonstrate that NanoScript localizes within the nucleus and initiates transcription of a reporter plasmid by over 15-fold. Moreover, NanoScript can effectively transcribe targeted genes on endogenous DNA in a nonviral manner. Because NanoScript is a functional replica of TF proteins and a tunable gene-regulating platform, it has great potential for various stem cell applications. PMID:25133310

  14. 3′, 5′-Cyclic Adenosine 5′-Monophosphate Response Element-Dependent Transcriptional Regulation of the Secretogranin II Gene Promoter Depends on Gonadotropin-Releasing Hormone-Induced Mitogen-Activated Protein Kinase Activation and the Transactivator Activating Transcription Factor 3

    PubMed Central

    Xie, Jianjun; Roberson, Mark S.

    2008-01-01

    Previous studies demonstrated that GnRH-induced secretogranin II (SgII) promoter regulation required a consensus cAMP response element (CRE) and protein kinase A/CRE binding protein. The present studies examined the role of additional components of the GnRH signaling network on SgII promoter activity with particular attention devoted to CRE-dependent gene regulation. Disruption of the SgII CRE by mutagenesis resulted in inhibition of GnRH agonist (GnRHa) induction of this promoter in αT3-1 cells. Pharmacological and dominant-negative inhibition of the ERK and c-Jun N-terminal kinase (JNK) signaling pathways revealed that GnRHa-induced SgII promoter activity required functional JNK and ERK modules. Combined inhibition of both pathways nearly abolished GnRHa-induced SgII promoter activity. Specific induction of the ERK cascade alone using overexpression of Raf-CAAX was not sufficient to activate the SgII gene promoter. In contrast, overexpression of the catalytic domain of the more pleiotropic MAPK activator, MAPK/ERK kinase-1, was sufficient to induce SgII promoter activity. The effect(s) of mitogen-activated protein/ERK kinase-1 on SgII promoter activity was CRE dependent and was reversed by the combined pharmacological inhibition of both JNK and ERK modules. CRE DNA binding studies demonstrated the recruitment of activating transcription factor (ATF)-3 and c-Jun to the CRE after administration of GnRHa to αT3-1 cells. Specific small interfering RNA knockdown of ATF3 reduced ATF3 DNA binding and the effect of GnRHa on the SgII promoter. These studies support the conclusion that MAPK signaling and ATF3 action are essential for full SgII promoter activation by GnRHa through a canonical CRE. Moreover, we suggest that within the GnRH signaling network, CRE-dependent gene regulation in general may be mediated primarily through the immediate early response gene ATF3. PMID:17962349

  15. Transcriptional and Post-Transcriptional Regulation of Nucleotide Excision Repair Genes in Human Cells

    PubMed Central

    Lefkofsky, Hailey B.; Veloso, Artur; Ljungman, Mats

    2014-01-01

    Nucleotide excision repair (NER) removes DNA helix-distorting lesions induced by UV light and various chemotherapeutic agents such as cisplatin. These lesions efficiently block the elongation of transcription and need to be rapidly removed by transcription-coupled NER (TC-NER) to avoid the induction of apoptosis. Twenty-nine genes have been classified to code for proteins participating in nucleotide excision repair (NER) in human cells. Here we explored the transcriptional and post-transcriptional regulation of these NER genes across 13 human cell lines using Bru-seq and BruChase-seq, respectively. Many NER genes are relatively large in size and therefore will be easily inactivated by UV-induced transcription-blocking lesions. Furthermore, many of these genes produce transcripts that are rather unstable. Thus, these genes are expected to rapidly lose expression leading to a diminished function of NER. One such gene is ERCC6 that codes for the CSB protein critical for TC-NER. Due to its large gene size and high RNA turnover rate, the ERCC6 gene may act as dosimeter of DNA damage so that at high levels of damage, ERCC6 RNA levels would be diminished leading to the loss of CSB expression, inhibition of TC-NER and the promotion of cell death. PMID:26255935

  16. Transcriptional and post-transcriptional regulation of nucleotide excision repair genes in human cells.

    PubMed

    Lefkofsky, Hailey B; Veloso, Artur; Ljungman, Mats

    2015-06-01

    Nucleotide excision repair (NER) removes DNA helix-distorting lesions induced by UV light and various chemotherapeutic agents such as cisplatin. These lesions efficiently block the elongation of transcription and need to be rapidly removed by transcription-coupled NER (TC-NER) to avoid the induction of apoptosis. Twenty-nine genes have been classified to code for proteins participating in nucleotide excision repair (NER) in human cells. Here we explored the transcriptional and post-transcriptional regulation of these NER genes across 13 human cell lines using Bru-seq and BruChase-seq, respectively. Many NER genes are relatively large in size and therefore will be easily inactivated by UV-induced transcription-blocking lesions. Furthermore, many of these genes produce transcripts that are rather unstable. Thus, these genes are expected to rapidly lose expression leading to a diminished function of NER. One such gene is ERCC6 that codes for the CSB protein critical for TC-NER. Due to its large gene size and high RNA turnover rate, the ERCC6 gene may act as dosimeter of DNA damage so that at high levels of damage, ERCC6 RNA levels would be diminished leading to the loss of CSB expression, inhibition of TC-NER and the promotion of cell death. PMID:26255935

  17. Regulating the regulators: modulators of transcription factor activity.

    PubMed

    Everett, Logan; Hansen, Matthew; Hannenhalli, Sridhar

    2010-01-01

    Gene transcription is largely regulated by DNA-binding transcription factors (TFs). However, the TF activity itself is modulated via, among other things, post-translational modifications (PTMs) by specific modification enzymes in response to cellular stimuli. TF-PTMs thus serve as "molecular switchboards" that map upstream signaling events to the downstream transcriptional events. An important long-term goal is to obtain a genome-wide map of "regulatory triplets" consisting of a TF, target gene, and a modulator gene that specifically modulates the regulation of the target gene by the TF. A variety of genome-wide data sets can be exploited by computational methods to obtain a rough map of regulatory triplets, which can guide directed experiments. However, a prerequisite to developing such computational tools is a systematic catalog of known instances of regulatory triplets. We first describe PTM-Switchboard, a recent database that stores triplets of genes such that the ability of one gene (the TF) to regulate a target gene is dependent on one or more PTMs catalyzed by a third gene, the modifying enzyme. We also review current computational approaches to infer regulatory triplets from genome-wide data sets and conclude with a discussion of potential future research. PTM-Switchboard is accessible at http://cagr.pcbi.upenn.edu/PTMswitchboard / PMID:20827600

  18. Transcriptional regulation of gilthead seabream bone morphogenetic protein (BMP) 2 gene by bone- and cartilage-related transcription factors.

    PubMed

    Marques, Cátia L; Cancela, M Leonor; Laizé, Vincent

    2016-01-15

    Bone morphogenetic protein (BMP) 2 belongs to the transforming growth factor β (TGFβ) superfamily of cytokines and growth factors. While it plays important roles in embryo morphogenesis and organogenesis, BMP2 is also critical to bone and cartilage formation. Protein structure and function have been remarkably conserved throughout evolution and BMP2 transcription has been proposed to be tightly regulated, although few data is available. In this work we report the cloning and functional analysis of gilthead seabream BMP2 promoter. As in other vertebrates, seabream BMP2 gene has a 5′ non-coding exon, a feature already present in DPP gene, the fruit fly ortholog of vertebrate BMP2 gene, and maintained throughout evolution. In silico analysis of seabream BMP2 promoter revealed several binding sites for bone and cartilage related transcription factors (TFs) and their functionality was evaluated using promoter-luciferase constructions and TF-expressing vectors. Runt-related transcription factor 3 (RUNX3) was shown to negatively regulate BMP2 transcription and combination with the core binding factor β (CBFβ) further reduced transcriptional activity of the promoter. Although to a lesser extent, myocyte enhancer factor 2C (MEF2C) had also a negative effect on the regulation of BMP2 gene transcription, when associated with SRY (sex determining region Y)-box 9 (SOX9b). Finally, v-ets avian erythroblastosis virus E26 oncogene homolog 1 (ETS1) was able to slightly enhance BMP2 transcription. Data reported here provides new insights toward the better understanding of the transcriptional regulation of BMP2 gene in a bone and cartilage context. PMID:26456102

  19. Oxytocin Regulates Stress-Induced Crf Gene Transcription through CREB-Regulated Transcription Coactivator 3

    PubMed Central

    Jurek, Benjamin; Slattery, David A.; Hiraoka, Yuichi; Liu, Ying; Nishimori, Katsuhiko; Aguilera, Greti; van den Burg, Erwin H.

    2015-01-01

    The major regulator of the neuroendocrine stress response in the brain is corticotropin releasing factor (CRF), whose transcription is controlled by CREB and its cofactors CRTC2/3 (TORC2/3). Phosphorylated CRTCs are sequestered in the cytoplasm, but rapidly dephosphorylated and translocated into the nucleus following a stressful stimulus. As the stress response is attenuated by oxytocin (OT), we tested whether OT interferes with CRTC translocation and, thereby, Crf expression. OT (1 nmol, i.c.v.) delayed the stress-induced increase of nuclear CRTC3 and Crf hnRNA levels in the paraventricular nucleus of male rats and mice, but did not affect either parameter in the absence of the stressor. The increase in Crf hnRNA levels at later time points was parallel to elevated nuclear CRTC2/3 levels. A direct effect of Thr4 Gly7-OT (TGOT) on CRTC3 translocation and Crf expression was found in rat primary hypothalamic neurons, amygdaloid (Ar-5), hypothalamic (H32), and human neuroblastoma (Be(2)M17) cell lines. CRTC3, but not CRCT2, knockdown using siRNA in Be(2)M17 cells prevented the effect of TGOT on Crf hnRNA levels. Chromatin-immunoprecipitation demonstrated that TGOT reduced CRTC3, but not CRTC2, binding to the Crf promoter after 10 min of forskolin stimulation. Together, the results indicate that OT modulates CRTC3 translocation, the binding of CRTC3 to the Crf promoter and, ultimately, transcription of the Crf gene. SIGNIFICANCE STATEMENT The neuropeptide oxytocin has been proposed to reduce hypothalamic-pituitary-adrenal (HPA) axis activation during stress. The underlying mechanisms are, however, elusive. In this study we show that activation of the oxytocin receptor in the paraventricular nucleus delays transcription of the gene encoding corticotropin releasing factor (Crf), the main regulator of the stress response. It does so by sequestering the coactivator of the transcription factor CREB, CRTC3, in the cytosol, resulting in reduced binding of CRTC3 to the Crf

  20. The Positive Transcription Elongation Factor b Is an Essential Cofactor for the Activation of Transcription by Myocyte Enhancer Factor 2

    PubMed Central

    Nojima, Masanori; Huang, Yehong; Tyagi, Mudit; Kao, Hung-Ying; Fujinaga, Koh

    2014-01-01

    The positive transcription elongation factor b (P-TEFb), composed of cyclin-dependent kinase 9 and cyclin T1, stimulates the elongation of transcription by hyperphosphorylating the C-terminal region of RNA polymerase II. Aberrant activation of P-TEFb results in manifestations of cardiac hypertrophy in mice, suggesting that P-TEFb is an essential factor for cardiac myocyte function and development. Here, we present evidence that P-TEFb selectively activates transcription mediated by the myocyte enhancer factor 2 (MEF2) family of transcription factors, key regulatory factors for myocyte development. Knockdown of endogenous cyclin T1 in murine C2C12 cells abolishes MEF2-dependent reporter gene expression as well as transcription of endogenous MEF2 target genes, whereas overexpression of P-TEFb enhances MEF2-dependent transcription. P-TEFb interacts with MEF2 both in vitro and in vivo. Activation of MEF2-dependent transcription induced by serum starvation is mediated by a rapid dissociation of P-TEFb from its inhibitory subunit, HEXIM1, and a subsequent recruitment of P-TEFb to MEF2 binding sites in the promoter region of MEF2 target genes. These results indicate that recruitment of P-TEFb is a critical step for stimulation of MEF2-dependent transcription, therefore providing a fundamentally important regulatory mechanism underlying the transcriptional program in muscle cells. PMID:18662700

  1. A yeast transcription system for the 5S rRNA gene.

    PubMed Central

    van Keulen, H; Thomas, D Y

    1982-01-01

    A cell-free extract of yeast nuclei that can specifically transcribe cloned yeast 5S rRNA genes has been developed. Optima for transcription of 5S rDNA were determined and conditions of extract preparation leading to reproducible activities and specificities established. The major in vitro product has the same size and oligonucleotide composition as in vivo 5S rRNA. The in vitro transcription extract does not transcribe yeast tRNA genes. The extract does increase the transcription of tRNA genes packaged in chromatin. Images PMID:7145700

  2. Substrate-Induced Transcriptional Activation of the MoCel7C Cellulase Gene Is Associated with Methylation of Histone H3 at Lysine 4 in the Rice Blast Fungus Magnaporthe oryzae

    PubMed Central

    Vu, Ba Van; Pham, Kieu Thi Minh

    2013-01-01

    The mechanisms involved in substrate-dependent regulation of a Magnaporthe oryzae gene encoding a cellulase which we designate MoCel7C (MGG_14954) were investigated. The levels of MoCel7C transcript were dramatically increased more than 1,000-fold, 16 to 24 h after transfer to a medium containing 2% carboxymethylcellulose (CMC), while levels were very low or undetectable in conventional rich medium. Green fluorescent protein reporter assays showed that the MoCel7C promoter was activated by cello-oligosaccharides larger than a pentamer. CMC-induced activation of the MoCel7C promoter was suppressed by glucose and cellobiose. Chromatin immunoprecipitation assays revealed that histone H3 methylation on lysine 4 (H3K4) at the MoCel7C locus was associated with activation of the gene by CMC. Consistently, CMC-induced MoCel7C gene activation was drastically diminished in a knockout (KO) mutant of the MoSET1 gene, which encodes a histone lysine methyltransferase that catalyzes H3K4 methylation in M. oryzae. Interestingly, however, MoCel7C transcript levels under noninducing conditions were significantly increased in the MoSET1 KO mutant, suggesting that MoSET1 directly or indirectly plays a role in both activation and suppression of the MoCel7C gene in response to environmental signals. In addition, gene expression a