Science.gov

Sample records for activates transcription factor

  1. Transcriptional activation in yeast cells lacking transcription factor IIA.

    PubMed Central

    Chou, S; Chatterjee, S; Lee, M; Struhl, K

    1999-01-01

    The general transcription factor IIA (TFIIA) forms a complex with TFIID at the TATA promoter element, and it inhibits the function of several negative regulators of the TATA-binding protein (TBP) subunit of TFIID. Biochemical experiments suggest that TFIIA is important in the response to transcriptional activators because activation domains can interact with TFIIA, increase recruitment of TFIID and TFIIA to the promoter, and promote isomerization of the TFIID-TFIIA-TATA complex. Here, we describe a double-shut-off approach to deplete yeast cells of Toa1, the large subunit of TFIIA, to <1% of the wild-type level. Interestingly, such TFIIA-depleted cells are essentially unaffected for activation by heat shock factor, Ace1, and Gal4-VP16. However, depletion of TFIIA causes a general two- to threefold decrease of transcription from most yeast promoters and a specific cell-cycle arrest at the G2-M boundary. These results indicate that transcriptional activation in vivo can occur in the absence of TFIIA. PMID:10581267

  2. Activating transcription factor 2 in mesenchymal tumors.

    PubMed

    Endo, Makoto; Su, Le; Nielsen, Torsten O

    2014-02-01

    Activating transcription factor 2 (ATF2) is a member of activator protein 1 superfamily, which can heterodimerize with other transcription factors regulating cell differentiation and survival. ATF2 assembles into a complex with the synovial sarcoma translocation, chromosome 18 (SS18)-synovial sarcoma, X breakpoint (SSX) fusion oncoprotein, and the transducin-like enhancer of split 1 (TLE1) corepressor, driving oncogenesis in synovial sarcoma. The fusion oncoproteins in many other translocation-associated sarcomas incorporate transcription factors from the ATF/cAMP response element binding or E26 families, which potentially form heterodimers with ATF2 to regulate transcription. ATF2 may therefore play an important role in the oncogenesis of many mesenchymal tumors, but as yet, little is known about its protein expression in patient specimens. Herein we perform immunohistochemical analyses using a validated specific antibody for ATF2 expression and intracellular localization on a cohort of 594 malignant and 207 benign mesenchymal tumors representing 47 diagnostic entities. Melanoma served as a positive control for nuclear and cytoplasmic staining. High nuclear ATF2 expression was mainly observed in translocation-associated and/or spindle cell sarcomas including synovial sarcoma, desmoplastic small round cell tumor, endometrial stromal sarcoma, gastrointestinal stromal tumor, malignant peripheral nerve sheath tumor, and solitary fibrous tumor. Cytoplasmic ATF2 expression was less frequently seen than nuclear expression in malignant mesenchymal tumors. Benign mesenchymal tumors mostly showed much lower nuclear and cytoplasmic ATF2 expression. PMID:24289970

  3. Potential Role of Activating Transcription Factor 5 during Osteogenesis.

    PubMed

    Vicari, Luisa; Calabrese, Giovanna; Forte, Stefano; Giuffrida, Raffaella; Colarossi, Cristina; Parrinello, Nunziatina Laura; Memeo, Lorenzo

    2016-01-01

    Human adipose-derived stem cells are an abundant population of stem cells readily isolated from human adipose tissue that can differentiate into connective tissue lineages including bone, cartilage, fat, and muscle. Activating transcription factor 5 is a transcription factor of the ATF/cAMP response element-binding protein (CREB) family. It is transcribed in two types of mRNAs (activating transcription factor 5 isoform 1 and activating transcription factor 5 isoform 2), encoding the same single 30-kDa protein. Although it is well demonstrated that it regulates the proliferation, differentiation, and apoptosis, little is known about its potential role in osteogenic differentiation. The aim of this study was to evaluate the expression levels of the two isoforms and protein during osteogenic differentiation of human adipose-derived stem cells. Our data indicate that activating transcription factor 5 is differentially expressed reaching a peak of expression at the stage of bone mineralization. These findings suggest that activating transcription factor 5 could play an interesting regulatory role during osteogenesis, which would provide a powerful tool to study bone physiology. PMID:26770207

  4. Selective Activation of Transcription by a Novel CCAAT Binding Factor

    NASA Astrophysics Data System (ADS)

    Maity, Sankar N.; Golumbek, Paul T.; Karsenty, Gerard; de Crombrugghe, Benoit

    1988-07-01

    A novel CCAAT binding factor (CBF) composed of two different subunits has been extensively purified from rat liver. Both subunits are needed for specific binding to DNA. Addition of this purified protein to nuclear extracts of NIH 3T3 fibroblasts stimulates transcription from several promoters including the α 2(I) collagen, the α 1(I) collagen, the Rous sarcoma virus long terminal repeat (RSV-LTR), and the adenovirus major late promoter. Point mutations in the CCAAT motif that show either no binding or a decreased binding of CBF likewise abolish or reduce activation of transcription by CBF. Activation of transcription requires, therefore, the specific binding of CBF to its recognition sites.

  5. Cooperative activation of Xenopus rhodopsin transcription by paired-like transcription factors

    PubMed Central

    2014-01-01

    Background In vertebrates, rod photoreceptor-specific gene expression is regulated by the large Maf and Pax-like transcription factors, Nrl/LNrl and Crx/Otx5. The ubiquitous occurrence of their target DNA binding sites throughout rod-specific gene promoters suggests that multiple transcription factor interactions within the promoter are functionally important. Cooperative action by these transcription factors activates rod-specific genes such as rhodopsin. However, a quantitative mechanistic explanation of transcriptional rate determinants is lacking. Results We investigated the contributions of various paired-like transcription factors and their cognate cis-elements to rhodopsin gene activation using cultured cells to quantify activity. The Xenopus rhodopsin promoter (XOP) has a bipartite structure, with ~200 bp proximal to the start site (RPP) coordinating cooperative activation by Nrl/LNrl-Crx/Otx5 and the adjacent 5300 bp upstream sequence increasing the overall expression level. The synergistic activation by Nrl/LNrl-Crx/Otx5 also occurred when XOP was stably integrated into the genome. We determined that Crx/Otx5 synergistically activated transcription independently and additively through the two Pax-like cis-elements, BAT1 and Ret4, but not through Ret1. Other Pax-like family members, Rax1 and Rax2, do not synergistically activate XOP transcription with Nrl/LNrl and/or Crx/Otx5; rather they act as co-activators via the Ret1 cis-element. Conclusions We have provided a quantitative model of cooperative transcriptional activation of the rhodopsin promoter through interaction of Crx/Otx5 with Nrl/LNrl at two paired-like cis-elements proximal to the NRE and TATA binding site. Further, we have shown that Rax genes act in cooperation with Crx/Otx5 with Nrl/LNrl as co-activators of rhodopsin transcription. PMID:24499263

  6. Transcription factors of Lotus: regulation of isoflavonoid biosynthesis requires coordinated changes in transcription factor activity.

    PubMed

    Shelton, Dale; Stranne, Maria; Mikkelsen, Lisbeth; Pakseresht, Nima; Welham, Tracey; Hiraka, Hideki; Tabata, Satoshi; Sato, Shusei; Paquette, Suzanne; Wang, Trevor L; Martin, Cathie; Bailey, Paul

    2012-06-01

    Isoflavonoids are a class of phenylpropanoids made by legumes, and consumption of dietary isoflavonoids confers benefits to human health. Our aim is to understand the regulation of isoflavonoid biosynthesis. Many studies have shown the importance of transcription factors in regulating the transcription of one or more genes encoding enzymes in phenylpropanoid metabolism. In this study, we coupled bioinformatics and coexpression analysis to identify candidate genes encoding transcription factors involved in regulating isoflavonoid biosynthesis in Lotus (Lotus japonicus). Genes encoding proteins belonging to 39 of the main transcription factor families were examined by microarray analysis of RNA from leaf tissue that had been elicited with glutathione. Phylogenetic analyses of each transcription factor family were used to identify subgroups of proteins that were specific to L. japonicus or closely related to known regulators of the phenylpropanoid pathway in other species. R2R3MYB subgroup 2 genes showed increased expression after treatment with glutathione. One member of this subgroup, LjMYB14, was constitutively overexpressed in L. japonicus and induced the expression of at least 12 genes that encoded enzymes in the general phenylpropanoid and isoflavonoid pathways. A distinct set of six R2R3MYB subgroup 2-like genes was identified. We suggest that these subgroup 2 sister group proteins and those belonging to the main subgroup 2 have roles in inducing isoflavonoid biosynthesis. The induction of isoflavonoid production in L. japonicus also involves the coordinated down-regulation of competing biosynthetic pathways by changing the expression of other transcription factors. PMID:22529285

  7. The Positive Transcription Elongation Factor b Is an Essential Cofactor for the Activation of Transcription by Myocyte Enhancer Factor 2

    PubMed Central

    Nojima, Masanori; Huang, Yehong; Tyagi, Mudit; Kao, Hung-Ying; Fujinaga, Koh

    2014-01-01

    The positive transcription elongation factor b (P-TEFb), composed of cyclin-dependent kinase 9 and cyclin T1, stimulates the elongation of transcription by hyperphosphorylating the C-terminal region of RNA polymerase II. Aberrant activation of P-TEFb results in manifestations of cardiac hypertrophy in mice, suggesting that P-TEFb is an essential factor for cardiac myocyte function and development. Here, we present evidence that P-TEFb selectively activates transcription mediated by the myocyte enhancer factor 2 (MEF2) family of transcription factors, key regulatory factors for myocyte development. Knockdown of endogenous cyclin T1 in murine C2C12 cells abolishes MEF2-dependent reporter gene expression as well as transcription of endogenous MEF2 target genes, whereas overexpression of P-TEFb enhances MEF2-dependent transcription. P-TEFb interacts with MEF2 both in vitro and in vivo. Activation of MEF2-dependent transcription induced by serum starvation is mediated by a rapid dissociation of P-TEFb from its inhibitory subunit, HEXIM1, and a subsequent recruitment of P-TEFb to MEF2 binding sites in the promoter region of MEF2 target genes. These results indicate that recruitment of P-TEFb is a critical step for stimulation of MEF2-dependent transcription, therefore providing a fundamentally important regulatory mechanism underlying the transcriptional program in muscle cells. PMID:18662700

  8. The molecular biology and nomenclature of the activating transcription factor/cAMP responsive element binding family of transcription factors: activating transcription factor proteins and homeostasis.

    PubMed

    Hai, T; Hartman, M G

    2001-07-25

    The mammalian ATF/CREB family of transcription factors represents a large group of basic region-leucine zipper (bZip) proteins which was originally defined in the late 1980s by their ability to bind to the consensus ATF/CRE site 'TGACGTCA'. Over the past decade, cDNA clones encoding identical or homologous proteins have been isolated by different laboratories and given different names. These proteins can be grouped into subgroups according to their amino acid similarity. In this review, we will briefly describe the classification of these proteins with a historical perspective of their nomenclature. We will then review three members of the ATF/CREB family of proteins: ATF3, ATF4 and ATF6. We will address four issues for each protein: (a) homologous proteins and alternative names, (b) dimer formation with other bZip proteins, (c) transcriptional activity, and (d) potential physiological functions. Although the name Activating Transcription Factor (ATF) implies that they are transcriptional activators, some of these proteins are transcriptional repressors. ATF3 homodimer is a transcriptional repressor and ATF4 has been reported to be either an activator or a repressor. We will review the reports on the transcriptional activities of ATF4, and propose potential explanations for the discrepancy. Although the physiological functions of these proteins are not well understood, some clues can be gained from studies with different approaches. When the data are available, we will address the following questions. (a) How is the expression (at the mRNA level or protein level) regulated? (b) How are the transcriptional activities regulated? (c) What are the interacting proteins (other than bZip partners)? (d) What are the consequences of ectopically expressing the gene (gain-of-function) or deleting the gene (loss-of-function)? Although answers to these questions are far from being complete, together they provide clues to the functions of these ATF proteins. Despite the

  9. Combinatorial influence of environmental parameters on transcription factor activity

    PubMed Central

    Knijnenburg, T.A.; Wessels, L.F.A.; Reinders, M.J.T.

    2008-01-01

    Motivation: Cells receive a wide variety of environmental signals, which are often processed combinatorially to generate specific genetic responses. Changes in transcript levels, as observed across different environmental conditions, can, to a large extent, be attributed to changes in the activity of transcription factors (TFs). However, in unraveling these transcription regulation networks, the actual environmental signals are often not incorporated into the model, simply because they have not been measured. The unquantified heterogeneity of the environmental parameters across microarray experiments frustrates regulatory network inference. Results: We propose an inference algorithm that models the influence of environmental parameters on gene expression. The approach is based on a yeast microarray compendium of chemostat steady-state experiments. Chemostat cultivation enables the accurate control and measurement of many of the key cultivation parameters, such as nutrient concentrations, growth rate and temperature. The observed transcript levels are explained by inferring the activity of TFs in response to combinations of cultivation parameters. The interplay between activated enhancers and repressors that bind a gene promoter determine the possible up- or downregulation of the gene. The model is translated into a linear integer optimization problem. The resulting regulatory network identifies the combinatorial effects of environmental parameters on TF activity and gene expression. Availability: The Matlab code is available from the authors upon request. Contact: t.a.knijnenburg@tudelft.nl Supplementary information: Supplementary data are available at Bioinformatics online. PMID:18586711

  10. Activation of archaeal transcription mediated by recruitment of transcription factor B.

    PubMed

    Ochs, Simon M; Thumann, Sybille; Richau, Renate; Weirauch, Matt T; Lowe, Todd M; Thomm, Michael; Hausner, Winfried

    2012-05-25

    Archaeal promoters consist of a TATA box and a purine-rich adjacent upstream sequence (transcription factor B (TFB)-responsive element (BRE)), which are bound by the transcription factors TATA box-binding protein (TBP) and TFB. Currently, only a few activators of archaeal transcription have been experimentally characterized. The best studied activator, Ptr2, mediates activation by recruitment of TBP. Here, we present a detailed biochemical analysis of an archaeal transcriptional activator, PF1088, which was identified in Pyrococcus furiosus by a bioinformatic approach. Operon predictions suggested that an upstream gene, pf1089, is polycistronically transcribed with pf1088. We demonstrate that PF1088 stimulates in vitro transcription by up to 7-fold when the pf1089 promoter is used as a template. By DNase I and hydroxyl radical footprinting experiments, we show that the binding site of PF1088 is located directly upstream of the BRE of pf1089. Mutational analysis indicated that activation requires the presence of the binding site for PF1088. Furthermore, we show that activation of transcription by PF1088 is dependent upon the presence of an imperfect BRE and is abolished when the pf1089 BRE is replaced with a BRE from a strong archaeal promoter. Gel shift experiments showed that TFB recruitment to the pf1089 operon is stimulated by PF1088, and TFB seems to stabilize PF1088 operator binding even in the absence of TBP. Taken together, these results represent the first biochemical evidence for a transcriptional activator working as a TFB recruitment factor in Archaea, for which the designation TFB-RF1 is suggested. PMID:22496454

  11. Theory on the dynamic memory in the transcription-factor-mediated transcription activation

    NASA Astrophysics Data System (ADS)

    Murugan, R.

    2011-04-01

    We develop a theory to explain the origin of the static and dynamical memory effects in transcription-factor-mediated transcription activation. Our results suggest that the following inequality conditions should be satisfied to observe such memory effects: (a) τL≫max(τR,τE), (b) τLT≫τT, and (c) τI⩾(τEL+τTR) where τL is the average time required for the looping-mediated spatial interactions of enhancer—transcription-factor complex with the corresponding promoter—RNA-polymerase or eukaryotic RNA polymerase type II (PolII in eukaryotes) complex that is located L base pairs away from the cis-acting element, (τR,τE) are respectively the search times required for the site-specific binding of the RNA polymerase and the transcription factor with the respective promoter and the cis-regulatory module, τLT is the time associated with the relaxation of the looped-out segment of DNA that connects the cis-acting site and promoter, τT is the time required to generate a complete transcript, τI is the transcription initiation time, τEL is the elongation time, and τTR is the termination time. We have theoretically derived the expressions for the various searching, looping, and loop-relaxation time components. Using the experimentally determined values of various time components we further show that the dynamical memory effects cannot be experimentally observed whenever the segment of DNA that connects the cis-regulatory element with the promoter is not loaded with bulky histone bodies. Our analysis suggests that the presence of histone-mediated compaction of the connecting segment of DNA can result in higher values of looping and loop-relaxation times, which is the origin of the static memory in the transcription activation that is mediated by the memory gene loops in eukaryotes.

  12. Activating transcription factor 6 derepression mediates neuroprotection in Huntington disease

    PubMed Central

    Naranjo, José R.; Zhang, Hongyu; Villar, Diego; González, Paz; Dopazo, Xose M.; Morón-Oset, Javier; Higueras, Elena; Oliveros, Juan C.; Arrabal, María D.; Prieto, Angela; Cercós, Pilar; González, Teresa; De la Cruz, Alicia; Casado-Vela, Juan; Rábano, Alberto; Valenzuela, Carmen; Gutierrez-Rodriguez, Marta; Li, Jia-Yi; Mellström, Britt

    2016-01-01

    Deregulated protein and Ca2+ homeostasis underlie synaptic dysfunction and neurodegeneration in Huntington disease (HD); however, the factors that disrupt homeostasis are not fully understood. Here, we determined that expression of downstream regulatory element antagonist modulator (DREAM), a multifunctional Ca2+-binding protein, is reduced in murine in vivo and in vitro HD models and in HD patients. DREAM downregulation was observed early after birth and was associated with endogenous neuroprotection. In the R6/2 mouse HD model, induced DREAM haplodeficiency or blockade of DREAM activity by chronic administration of the drug repaglinide delayed onset of motor dysfunction, reduced striatal atrophy, and prolonged life span. DREAM-related neuroprotection was linked to an interaction between DREAM and the unfolded protein response (UPR) sensor activating transcription factor 6 (ATF6). Repaglinide blocked this interaction and enhanced ATF6 processing and nuclear accumulation of transcriptionally active ATF6, improving prosurvival UPR function in striatal neurons. Together, our results identify a role for DREAM silencing in the activation of ATF6 signaling, which promotes early neuroprotection in HD. PMID:26752648

  13. Activating transcription factor 6 derepression mediates neuroprotection in Huntington disease.

    PubMed

    Naranjo, José R; Zhang, Hongyu; Villar, Diego; González, Paz; Dopazo, Xose M; Morón-Oset, Javier; Higueras, Elena; Oliveros, Juan C; Arrabal, María D; Prieto, Angela; Cercós, Pilar; González, Teresa; De la Cruz, Alicia; Casado-Vela, Juan; Rábano, Alberto; Valenzuela, Carmen; Gutierrez-Rodriguez, Marta; Li, Jia-Yi; Mellström, Britt

    2016-02-01

    Deregulated protein and Ca2+ homeostasis underlie synaptic dysfunction and neurodegeneration in Huntington disease (HD); however, the factors that disrupt homeostasis are not fully understood. Here, we determined that expression of downstream regulatory element antagonist modulator (DREAM), a multifunctional Ca2+-binding protein, is reduced in murine in vivo and in vitro HD models and in HD patients. DREAM downregulation was observed early after birth and was associated with endogenous neuroprotection. In the R6/2 mouse HD model, induced DREAM haplodeficiency or blockade of DREAM activity by chronic administration of the drug repaglinide delayed onset of motor dysfunction, reduced striatal atrophy, and prolonged life span. DREAM-related neuroprotection was linked to an interaction between DREAM and the unfolded protein response (UPR) sensor activating transcription factor 6 (ATF6). Repaglinide blocked this interaction and enhanced ATF6 processing and nuclear accumulation of transcriptionally active ATF6, improving prosurvival UPR function in striatal neurons. Together, our results identify a role for DREAM silencing in the activation of ATF6 signaling, which promotes early neuroprotection in HD. PMID:26752648

  14. Regulating the regulators: modulators of transcription factor activity.

    PubMed

    Everett, Logan; Hansen, Matthew; Hannenhalli, Sridhar

    2010-01-01

    Gene transcription is largely regulated by DNA-binding transcription factors (TFs). However, the TF activity itself is modulated via, among other things, post-translational modifications (PTMs) by specific modification enzymes in response to cellular stimuli. TF-PTMs thus serve as "molecular switchboards" that map upstream signaling events to the downstream transcriptional events. An important long-term goal is to obtain a genome-wide map of "regulatory triplets" consisting of a TF, target gene, and a modulator gene that specifically modulates the regulation of the target gene by the TF. A variety of genome-wide data sets can be exploited by computational methods to obtain a rough map of regulatory triplets, which can guide directed experiments. However, a prerequisite to developing such computational tools is a systematic catalog of known instances of regulatory triplets. We first describe PTM-Switchboard, a recent database that stores triplets of genes such that the ability of one gene (the TF) to regulate a target gene is dependent on one or more PTMs catalyzed by a third gene, the modifying enzyme. We also review current computational approaches to infer regulatory triplets from genome-wide data sets and conclude with a discussion of potential future research. PTM-Switchboard is accessible at http://cagr.pcbi.upenn.edu/PTMswitchboard / PMID:20827600

  15. The CREB Transcription Factor Controls Transcriptional Activity of the Human RIC8B Gene.

    PubMed

    Maureira, Alejandro; Sánchez, Rodolfo; Valenzuela, Nicole; Torrejón, Marcela; Hinrichs, María V; Olate, Juan; Gutiérrez, José L

    2016-08-01

    Proper regulation of gene expression is essential for normal development, cellular growth, and differentiation. Differential expression profiles of mRNA coding for vertebrate Ric-8B during embryo and adult stages have been observed. In addition, Ric-8B is expressed in few cerebral nuclei subareas. These facts point to a dynamic control of RIC8B gene expression. In order to understand the transcriptional regulation of this gene, we searched for cis-elements in the sequence of the human RIC8B promoter region, identifying binding sites for the basic/leucine zipper (bZip) CREB transcription factor family (CRE sites) and C/EBP transcription factor family (C/EBP sites). CRE sites were found clustered near the transcription start site, while the C/EBP sites were found clustered at around 300 bp upstream the CRE sites. Here, we demonstrate the ability of CREB1 and C/EBPβ to bind their respective elements identified in the RIC8B promoter. Comparative protein-DNA interaction analyses revealed only the proximal elements as high affinity sites for CREB1 and only the distal elements as high affinity sites for C/EBPβ. Chromatin immunoprecipitation analyses, carried out using a human neuroblastoma cell line, confirmed the preferential association of CREB to the proximal region of the RIC8B promoter. By performing luciferase reporter assays, we found the CRE sites as the most relevant elements for its transcriptional activity. Taken together, these data show the existence of functional CREB and C/EBP binding sites in the human RIC8B gene promoter, a particular distribution of these sites and demonstrate a relevant role of CREB in stimulating transcriptional activity of this gene. J. Cell. Biochem. 117: 1797-1805, 2016. © 2016 Wiley Periodicals, Inc. PMID:26729411

  16. The Regulatory Role of Activating Transcription Factor 2 in Inflammation

    PubMed Central

    Yu, Tao; Li, Yong Jun; Bian, Ai Hong; Zuo, Hui Bin; Zhu, Ti Wen; Ji, Sheng Xiang; Kong, Fanming; Yin, De Qing; Wang, Chuan Bao; Wang, Zi Fu; Wang, Hong Qun; Yang, Yanyan; Yoo, Byong Chul

    2014-01-01

    Activating transcription factor 2 (ATF2) is a member of the leucine zipper family of DNA-binding proteins and is widely distributed in tissues including the liver, lung, spleen, and kidney. Like c-Jun and c-Fos, ATF2 responds to stress-related stimuli and may thereby influence cell proliferation, inflammation, apoptosis, oncogenesis, neurological development and function, and skeletal remodeling. Recent studies clarify the regulatory role of ATF2 in inflammation and describe potential inhibitors of this protein. In this paper, we summarize the properties and functions of ATF2 and explore potential applications of ATF2 inhibitors as tools for research and for the development of immunosuppressive and anti-inflammatory drugs. PMID:25049453

  17. Transcriptional Activation of the Cyclin A Gene by the Architectural Transcription Factor HMGA2

    PubMed Central

    Tessari, Michela A.; Gostissa, Monica; Altamura, Sandro; Sgarra, Riccardo; Rustighi, Alessandra; Salvagno, Clio; Caretti, Giuseppina; Imbriano, Carol; Mantovani, Roberto; Del Sal, Giannino; Giancotti, Vincenzo; Manfioletti, Guidalberto

    2003-01-01

    The HMGA2 protein belongs to the HMGA family of architectural transcription factors, which play an important role in chromatin organization. HMGA proteins are overexpressed in several experimental and human tumors and have been implicated in the process of neoplastic transformation. Hmga2 knockout results in the pygmy phenotype in mice and in a decreased growth rate of embryonic fibroblasts, thus indicating a role for HMGA2 in cell proliferation. Here we show that HMGA2 associates with the E1A-regulated transcriptional repressor p120E4F, interfering with p120E4F binding to the cyclin A promoter. Ectopic expression of HMGA2 results in the activation of the cyclin A promoter and induction of the endogenous cyclin A gene. In addition, chromatin immunoprecipitation experiments show that HMGA2 associates with the cyclin A promoter only when the gene is transcriptionally activated. These data identify the cyclin A gene as a cellular target for HMGA2 and, for the first time, suggest a mechanism for HMGA2-dependent cell cycle regulation. PMID:14645522

  18. Transcription factor PIF4 controls the thermosensory activation of flowering.

    PubMed

    Kumar, S Vinod; Lucyshyn, Doris; Jaeger, Katja E; Alós, Enriqueta; Alvey, Elizabeth; Harberd, Nicholas P; Wigge, Philip A

    2012-04-12

    Plant growth and development are strongly affected by small differences in temperature. Current climate change has already altered global plant phenology and distribution, and projected increases in temperature pose a significant challenge to agriculture. Despite the important role of temperature on plant development, the underlying pathways are unknown. It has previously been shown that thermal acceleration of flowering is dependent on the florigen, FLOWERING LOCUS T (FT). How this occurs is, however, not understood, because the major pathway known to upregulate FT, the photoperiod pathway, is not required for thermal acceleration of flowering. Here we demonstrate a direct mechanism by which increasing temperature causes the bHLH transcription factor PHYTOCHROME INTERACTING FACTOR4 (PIF4) to activate FT. Our findings provide a new understanding of how plants control their timing of reproduction in response to temperature. Flowering time is an important trait in crops as well as affecting the life cycles of pollinator species. A molecular understanding of how temperature affects flowering will be important for mitigating the effects of climate change. PMID:22437497

  19. Activation of vascular endothelial growth factor gene transcription by hypoxia-inducible factor 1.

    PubMed Central

    Forsythe, J A; Jiang, B H; Iyer, N V; Agani, F; Leung, S W; Koos, R D; Semenza, G L

    1996-01-01

    Expression of vascular endothelial growth factor (VEGF) is induced in cells exposed to hypoxia or ischemia. Neovascularization stimulated by VEGF occurs in several important clinical contexts, including myocardial ischemia, retinal disease, and tumor growth. Hypoxia-inducible factor 1 (HIF-1) is a heterodimeric basic helix-loop-helix protein that activates transcription of the human erythropoietin gene in hypoxic cells. Here we demonstrate the involvement of HIF-1 in the activation of VEGF transcription. VEGF 5'-flanking sequences mediated transcriptional activation of reporter gene expression in hypoxic Hep3B cells. A 47-bp sequence located 985 to 939 bp 5' to the VEGF transcription initiation site mediated hypoxia-inducible reporter gene expression directed by a simian virus 40 promoter element that was otherwise minimally responsive to hypoxia. When reporters containing VEGF sequences, in the context of the native VEGF or heterologous simian virus 40 promoter, were cotransfected with expression vectors encoding HIF-1alpha and HIF-1beta (ARNT [aryl hydrocarbon receptor nuclear translocator]), reporter gene transcription was much greater in both hypoxic and nonhypoxic cells than in cells transfected with the reporter alone. A HIF-1 binding site was demonstrated in the 47-bp hypoxia response element, and a 3-bp substitution eliminated the ability of the element to bind HIF-1 and to activate transcription in response to hypoxia and/or recombinant HIF-1. Cotransfection of cells with an expression vector encoding a dominant negative form of HIF-1alpha inhibited the activation of reporter transcription in hypoxic cells in a dose-dependent manner. VEGF mRNA was not induced by hypoxia in mutant cells that do not express the HIF-1beta (ARNT) subunit. These findings implicate HIF-1 in the activation of VEGF transcription in hypoxic cells. PMID:8756616

  20. Plant transcription factors.

    PubMed

    Meshi, T; Iwabuchi, M

    1995-12-01

    Transcriptional regulation of gene expression relies on the recognition of promoter elements by transcription factors. In the past several years, a considerable number of (putative) transcription factors have been identified in plants. Some genes coding for these factors were isolated by south-western screening with oligonucleotides as a probe or by homology-based screening, and others were initially isolated by genetic means and subsequently identified as the genes for transcription factors. These transcription factors often form families of structurally related proteins with similar DNA-binding specificities and in addition, they are sometimes involved in related phenomena. Some groups of factors homo- and/or heterodimerize to increase the length and variability of the target sequences. Transcriptional activators, in general, comprise a modular activation domain. The activities of the transcription factors are controlled by post-translational modification, like phosphorylation and glycosylation, as well as at the levels of nuclear transport, oligomerization, etc. In this review, we will summarize the current knowledge of plant transcription factors to help understand the mechanistic aspects of the transcriptional regulation of genes. PMID:8589926

  1. Transcription Factor Arabidopsis Activating Factor1 Integrates Carbon Starvation Responses with Trehalose Metabolism1[OPEN

    PubMed Central

    Garapati, Prashanth; Feil, Regina; Lunn, John Edward; Van Dijck, Patrick; Balazadeh, Salma; Mueller-Roeber, Bernd

    2015-01-01

    Plants respond to low carbon supply by massive reprogramming of the transcriptome and metabolome. We show here that the carbon starvation-induced NAC (for NO APICAL MERISTEM/ARABIDOPSIS TRANSCRIPTION ACTIVATION FACTOR/CUP-SHAPED COTYLEDON) transcription factor Arabidopsis (Arabidopsis thaliana) Transcription Activation Factor1 (ATAF1) plays an important role in this physiological process. We identified TREHALASE1, the only trehalase-encoding gene in Arabidopsis, as a direct downstream target of ATAF1. Overexpression of ATAF1 activates TREHALASE1 expression and leads to reduced trehalose-6-phosphate levels and a sugar starvation metabolome. In accordance with changes in expression of starch biosynthesis- and breakdown-related genes, starch levels are generally reduced in ATAF1 overexpressors but elevated in ataf1 knockout plants. At the global transcriptome level, genes affected by ATAF1 are broadly associated with energy and carbon starvation responses. Furthermore, transcriptional responses triggered by ATAF1 largely overlap with expression patterns observed in plants starved for carbon or energy supply. Collectively, our data highlight the existence of a positively acting feedforward loop between ATAF1 expression, which is induced by carbon starvation, and the depletion of cellular carbon/energy pools that is triggered by the transcriptional regulation of downstream gene regulatory networks by ATAF1. PMID:26149570

  2. Transcription Factor Arabidopsis Activating Factor1 Integrates Carbon Starvation Responses with Trehalose Metabolism.

    PubMed

    Garapati, Prashanth; Feil, Regina; Lunn, John Edward; Van Dijck, Patrick; Balazadeh, Salma; Mueller-Roeber, Bernd

    2015-09-01

    Plants respond to low carbon supply by massive reprogramming of the transcriptome and metabolome. We show here that the carbon starvation-induced NAC (for NO APICAL MERISTEM/ARABIDOPSIS TRANSCRIPTION ACTIVATION FACTOR/CUP-SHAPED COTYLEDON) transcription factor Arabidopsis (Arabidopsis thaliana) Transcription Activation Factor1 (ATAF1) plays an important role in this physiological process. We identified TREHALASE1, the only trehalase-encoding gene in Arabidopsis, as a direct downstream target of ATAF1. Overexpression of ATAF1 activates TREHALASE1 expression and leads to reduced trehalose-6-phosphate levels and a sugar starvation metabolome. In accordance with changes in expression of starch biosynthesis- and breakdown-related genes, starch levels are generally reduced in ATAF1 overexpressors but elevated in ataf1 knockout plants. At the global transcriptome level, genes affected by ATAF1 are broadly associated with energy and carbon starvation responses. Furthermore, transcriptional responses triggered by ATAF1 largely overlap with expression patterns observed in plants starved for carbon or energy supply. Collectively, our data highlight the existence of a positively acting feedforward loop between ATAF1 expression, which is induced by carbon starvation, and the depletion of cellular carbon/energy pools that is triggered by the transcriptional regulation of downstream gene regulatory networks by ATAF1. PMID:26149570

  3. Prediction of Pathway Activation by Xenobiotic-Responsive Transcription Factors in the Mouse Liver

    EPA Science Inventory

    Many drugs and environmentally-relevant chemicals activate xenobioticresponsive transcription factors (TF). Identification of target genes of these factors would be useful in predicting pathway activation in in vitro chemical screening. Starting with a large compendium of Affymet...

  4. Activation domains of transcription factors mediate replication dependent transcription from a minimal HIV-1 promoter.

    PubMed Central

    Williams, R D; Lee, B A; Jackson, S P; Proudfoot, N J

    1996-01-01

    Transcription from a minimal HIV-1 promoter containing the three Sp1 binding sites and TATA box can be activated without Tat by template DNA replication. Here we show that this activation can also be mediated by recombinant GAL4 fusion proteins containing the activation domains of Sp1, VP16 or CTF (or by full-length GAL4) targeted to the HIV-1 promoter by replacing the Sp1 sites with five GAL4 binding sites. Thus Sp1 is not unique in its ability to mediate replication activated transcription, although the degree of processivity elicited by the different activators varied significantly from strongly processive (GAL4-VP16) to relatively non-processive (GAL4-Sp1 or -CTF). Processive GAL4-VP16-activated transcription, but not efficient initiation, required multiple GAL4 binding sites. In the presence of Tat, transcription with GAL4-SP1 and GAL4-CTF was further activated (principally at the level of processivity) but GAL4-VP16-potentiated transcription was only slightly stimulated. The Tat-dependent switch from non-processive to fully processive transcription was particularly marked for GAL4-Sp1, an effect which may be relevant to the selection of Sp1 binding sites by the HIV-1 promoter. PMID:8604293

  5. WRKY transcription factors

    PubMed Central

    Bakshi, Madhunita; Oelmüller, Ralf

    2014-01-01

    WRKY transcription factors are one of the largest families of transcriptional regulators found exclusively in plants. They have diverse biological functions in plant disease resistance, abiotic stress responses, nutrient deprivation, senescence, seed and trichome development, embryogenesis, as well as additional developmental and hormone-controlled processes. WRKYs can act as transcriptional activators or repressors, in various homo- and heterodimer combinations. Here we review recent progress on the function of WRKY transcription factors in Arabidopsis and other plant species such as rice, potato, and parsley, with a special focus on abiotic, developmental, and hormone-regulated processes. PMID:24492469

  6. Variable Glutamine-Rich Repeats Modulate Transcription Factor Activity

    PubMed Central

    Gemayel, Rita; Chavali, Sreenivas; Pougach, Ksenia; Legendre, Matthieu; Zhu, Bo; Boeynaems, Steven; van der Zande, Elisa; Gevaert, Kris; Rousseau, Frederic; Schymkowitz, Joost; Babu, M. Madan; Verstrepen, Kevin J.

    2015-01-01

    Summary Excessive expansions of glutamine (Q)-rich repeats in various human proteins are known to result in severe neurodegenerative disorders such as Huntington’s disease and several ataxias. However, the physiological role of these repeats and the consequences of more moderate repeat variation remain unknown. Here, we demonstrate that Q-rich domains are highly enriched in eukaryotic transcription factors where they act as functional modulators. Incremental changes in the number of repeats in the yeast transcriptional regulator Ssn6 (Cyc8) result in systematic, repeat-length-dependent variation in expression of target genes that result in direct phenotypic changes. The function of Ssn6 increases with its repeat number until a certain threshold where further expansion leads to aggregation. Quantitative proteomic analysis reveals that the Ssn6 repeats affect its solubility and interactions with Tup1 and other regulators. Thus, Q-rich repeats are dynamic functional domains that modulate a regulator’s innate function, with the inherent risk of pathogenic repeat expansions. PMID:26257283

  7. Multiple steps in the regulation of transcription-factor level and activity.

    PubMed Central

    Calkhoven, C F; Ab, G

    1996-01-01

    This review focuses on the regulation of transcription factors, many of which are DNA-binding proteins that recognize cis-regulatory elements of target genes and are the most direct regulators of gene transcription. Transcription factors serve as integration centres of the different signal-transduction pathways affecting a given gene. It is obvious that the regulation of these regulators themselves is of crucial importance for differential gene expression during development and in terminally differentiated cells. Transcription factors can be regulated at two, principally different, levels, namely concentration and activity, each of which can be modulated in a variety of ways. The concentrations of transcription factors, as of intracellular proteins in general, may be regulated at any of the steps leading from DNA to protein, including transcription, RNA processing, mRNA degradation and translation. The activity of a transcription factor is often regulated by (de) phosphorylation, which may affect different functions, e.g. nuclear localization DNA binding and trans-activation. Ligand binding is another mode of transcription-factor activation. It is typical for the large super-family of nuclear hormone receptors. Heterodimerization between transcription factors adds another dimension to the regulatory diversity and signal integration. Finally, non-DNA-binding (accessory) factors may mediate a diverse range of functions, e.g. serving as a bridge between the transcription factor and the basal transcription machinery, stabilizing the DNA-binding complex or changing the specificity of the target sequence recognition. The present review presents an overview of different modes of transcription-factor regulation, each illustrated by typical examples. PMID:8713055

  8. Helix-loop-helix transcription factors mediate activation and repression of the p75LNGFR gene.

    PubMed Central

    Chiaramello, A; Neuman, K; Palm, K; Metsis, M; Neuman, T

    1995-01-01

    Sequence analysis of rat and human low-affinity nerve growth factor receptor p75LNGFR gene promoter regions revealed a single E-box cis-acting element, located upstream of the major transcription start sites. Deletion analysis of the E-box sequence demonstrated that it significantly contributes to p75LNGFR promoter activity. This E box has a dual function; it mediates either activation or repression of the p75LNGFR promoter activity, depending on the interacting transcription factors. We showed that the two isoforms of the class A basic helix-loop-helix (bHLH) transcription factor ME1 (ME1a and ME1b), the murine homolog of the human HEB transcription factor, specifically repress p75LNGFR promoter activity. This repression can be released by coexpression of the HLH Id2 transcriptional regulator. In vitro analyses demonstrated that ME1a forms a stable complex with the p75LNGFR E box and likely competes with activating E-box-binding proteins. By using ME1a-overexpressing PC12 cells, we showed that the endogenous p75LNGFR gene is a target of ME1a repression. Together, these data demonstrate that the p75LNGFR E box and the interacting bHLH transcription factors are involved in the regulation of p75LNGFR gene expression. These results also show that class A bHLH transcription factors can repress and Id-like negative regulators can stimulate gene expression. PMID:7565756

  9. The nuclear factor SPBP contains different functional domains and stimulates the activity of various transcriptional activators.

    PubMed

    Rekdal, C; Sjøttem, E; Johansen, T

    2000-12-22

    SPBP (stromelysin-1 platelet-derived growth factor-responsive element binding protein) was originally cloned from a cDNA expression library by virtue of its ability to bind to a platelet-derived growth factor-responsive element in the human stromelysin-1 promoter. A 937-amino acid-long protein was deduced from a 3995-nucleotide murine cDNA sequence. By analyses of both human and murine cDNAs, we now show that SPBP is twice as large as originally found. The human SPBP gene contains six exons and is located on chromosome 22q13.1-13.3. Two isoforms differing in their C termini are expressed due to alternative splicing. PCR analyses of multitissue cDNA panels showed that SPBP is expressed in most tissues except for ovary and prostate. Functional mapping revealed that SPBP is a nuclear, multidomain protein containing an N-terminal region with transactivating ability, a novel type of DNA-binding domain containing an AT hook motif, and a bipartite nuclear localization signal as well as a C-terminal zinc finger domain. This type of zinc finger domain is also found in the trithorax family of chromatin-based transcriptional regulator proteins. Using cotransfection experiments, we find that SPBP enhances the transcriptional activity of various transcription factors such as c-Jun, Ets1, Sp1, and Pax6. Hence, SPBP seems to act as a transcriptional coactivator. PMID:10995766

  10. Mapping neural circuits with activity-dependent nuclear import of a transcription factor.

    PubMed

    Masuyama, Kaoru; Zhang, Yi; Rao, Yi; Wang, Jing W

    2012-03-01

    Abstract: Nuclear factor of activated T cells (NFAT) is a calcium-responsive transcription factor. We describe here an NFAT-based neural tracing method-CaLexA (calcium-dependent nuclear import of LexA)-for labeling active neurons in behaving animals. In this system, sustained neural activity induces nuclear import of the chimeric transcription factor LexA-VP16-NFAT, which in turn drives green fluorescent protein (GFP) reporter expression only in active neurons. We tested this system in Drosophila and found that volatile sex pheromones excite specific neurons in the olfactory circuit. Furthermore, complex courtship behavior associated with multi-modal sensory inputs activated neurons in the ventral nerve cord. This method harnessing the mechanism of activity-dependent nuclear import of a transcription factor can be used to identify active neurons in specific neuronal population in behaving animals. PMID:22236090

  11. Thyroid Transcription Factor 1 Reprograms Angiogenic Activities of Secretome

    PubMed Central

    Wood, Lauren W.; Cox, Nicole I.; Phelps, Cody A.; Lai, Shao-Chiang; Poddar, Arjun; Talbot, Conover; Mu, David

    2016-01-01

    Through both gain- and loss-of-TTF-1 expression strategies, we show that TTF-1 positively regulates vascular endothelial growth factor (VEGF) and that the VEGF promoter element contains multiple TTF-1-responsive sequences. The major signaling receptor for VEGF, i.e VEGFR2, also appears to be under a direct and positive regulation of TTF-1. The TTF-1-dependent upregulation of VEGF was moderately sensitive to rapamycin, implicating a partial involvement of mammalian target of rapamycin (mTOR). However, hypoxia did not further increase the secreted VEGF level of the TTF-1+ lung cancer cells. The TTF-1-induced VEGF upregulation occurs in both compartments (exosomes and exosome-depleted media (EDM)) of the conditioned media. Surprisingly, the EDM of TTF-1+ lung cancer cells (designated EDM-TTF-1+) displayed an anti-angiogenic activity in the endothelial cell tube formation assay. Mechanistic studies suggest that the increased granulocyte-macrophage colony-stimulating factor (GM-CSF) level in the EDM-TTF-1+ conferred the antiangiogenic activities. In human lung cancer, the expression of TTF-1 and GM-CSF exhibits a statistically significant and positive correlation. In summary, this study provides evidence that TTF-1 may reprogram lung cancer secreted proteome into an antiangiogenic state, offering a novel basis to account for the long-standing observation of favorable prognosis associated with TTF-1+ lung adenocarcinomas. PMID:26912193

  12. Thyroid Transcription Factor 1 Reprograms Angiogenic Activities of Secretome.

    PubMed

    Wood, Lauren W; Cox, Nicole I; Phelps, Cody A; Lai, Shao-Chiang; Poddar, Arjun; Talbot, Conover; Mu, David

    2016-01-01

    Through both gain- and loss-of-TTF-1 expression strategies, we show that TTF-1 positively regulates vascular endothelial growth factor (VEGF) and that the VEGF promoter element contains multiple TTF-1-responsive sequences. The major signaling receptor for VEGF, i.e VEGFR2, also appears to be under a direct and positive regulation of TTF-1. The TTF-1-dependent upregulation of VEGF was moderately sensitive to rapamycin, implicating a partial involvement of mammalian target of rapamycin (mTOR). However, hypoxia did not further increase the secreted VEGF level of the TTF-1(+) lung cancer cells. The TTF-1-induced VEGF upregulation occurs in both compartments (exosomes and exosome-depleted media (EDM)) of the conditioned media. Surprisingly, the EDM of TTF-1(+) lung cancer cells (designated EDM-TTF-1(+)) displayed an anti-angiogenic activity in the endothelial cell tube formation assay. Mechanistic studies suggest that the increased granulocyte-macrophage colony-stimulating factor (GM-CSF) level in the EDM-TTF-1(+) conferred the antiangiogenic activities. In human lung cancer, the expression of TTF-1 and GM-CSF exhibits a statistically significant and positive correlation. In summary, this study provides evidence that TTF-1 may reprogram lung cancer secreted proteome into an antiangiogenic state, offering a novel basis to account for the long-standing observation of favorable prognosis associated with TTF-1(+) lung adenocarcinomas. PMID:26912193

  13. The yeast Hot1 transcription factor is critical for activating a single target gene, STL1

    PubMed Central

    Bai, Chen; Tesker, Masha; Engelberg, David

    2015-01-01

    Transcription factors are commonly activated by signal transduction cascades and induce expression of many genes. They therefore play critical roles in determining the cell's fate. The yeast Hog1 MAP kinase pathway is believed to control the transcription of hundreds of genes via several transcription factors. To identify the bona fide target genes of Hog1, we inducibly expressed the spontaneously active variant Hog1D170A+F318L in cells lacking the Hog1 activator Pbs2. This system allowed monitoring the effects of Hog1 by itself. Expression of Hog1D170A+F318L in pbs2∆ cells imposed induction of just 105 and suppression of only 26 transcripts by at least twofold. We looked for the Hog1-responsive element within the promoter of the most highly induced gene, STL1 (88-fold). A novel Hog1 responsive element (HoRE) was identified and shown to be the direct target of the transcription factor Hot1. Unexpectedly, we could not find this HoRE in any other yeast promoter. In addition, the only gene whose expression was abolished in hot1∆ cells was STL1. Thus Hot1 is essential for transcription of just one gene, STL1. Hot1 may represent a class of transcription factors that are essential for transcription of a very few genes or even just one. PMID:25904326

  14. EGF activates TTP expression by activation of ELK-1 and EGR-1 transcription factors

    PubMed Central

    2012-01-01

    Background Tristetraprolin (TTP) is a key mediator of processes such as inflammation resolution, the inhibition of autoimmunity and in cancer. It carries out this role by the binding and degradation of mRNA transcripts, thereby decreasing their half-life. Transcripts modulated by TTP encode proteins such as cytokines, pro-inflammatory agents and immediate-early response proteins. TTP can also modulate neoplastic phenotypes in many cancers. TTP is induced and functionally regulated by a spectrum of both pro- and anti-inflammatory cytokines, mitogens and drugs in a MAPK-dependent manner. So far the contribution of p38 MAPK to the regulation of TTP expression and function has been best described. Results Our results demonstrate the induction of the gene coding TTP (ZFP36) by EGF through the ERK1/2-dependent pathway and implicates the transcription factor ELK-1 in this process. We show that ELK-1 regulates ZFP36 expression by two mechanisms: by binding the ZFP36 promoter directly through ETS-binding site (+ 883 to +905 bp) and by inducing expression of EGR-1, which in turn increases ZFP36 expression through sequences located between -111 and -103 bp. Conclusions EGF activates TTP expression via ELK-1 and EGR-1 transcription factors. PMID:22433566

  15. Encoding four gene expression programs in the activation dynamics of a single transcription factor.

    PubMed

    Hansen, Anders S; O'Shea, Erin K

    2016-04-01

    Cellular signaling response pathways often exhibit a bow-tie topology [1,2]: multiple upstream stress signals converge on a single shared transcription factor, which is thought to induce different downstream gene expression programs (Figure 1A). However, if several different signals activate the same transcription factor, can each signal then induce a specific gene expression response? A growing body of literature supports a temporal coding theory where information about environmental signals can be encoded, at least partially, in the temporal dynamics of the shared transcription factor [1,2]. For example, in the case of the budding yeast transcription factor Msn2, different stresses induce distinct Msn2 activation dynamics: Msn2 shows pulsatile nuclear activation with dose-dependent frequency under glucose limitation, but sustained nuclear activation with dose-dependent amplitude under oxidative stress [3]. These dynamic patterns can then lead to differential gene expression responses [3-5], but it is not known how much specificity can be obtained. Thus, a major question of this temporal coding theory is how many gene response programs or cellular functions can be robustly encoded by dynamic control of a single transcription factor. Here we provide the first direct evidence that, simply by regulating the activation dynamics of a single transcription factor, it is possible to preferentially induce four distinct gene expression programs. PMID:27046808

  16. Transcription factor expression in lipopolysaccharide-activated peripheral-blood-derived mononuclear cells

    PubMed Central

    Roach, Jared C.; Smith, Kelly D.; Strobe, Katie L.; Nissen, Stephanie M.; Haudenschild, Christian D.; Zhou, Daixing; Vasicek, Thomas J.; Held, G. A.; Stolovitzky, Gustavo A.; Hood, Leroy E.; Aderem, Alan

    2007-01-01

    Transcription factors play a key role in integrating and modulating biological information. In this study, we comprehensively measured the changing abundances of mRNAs over a time course of activation of human peripheral-blood-derived mononuclear cells (“macrophages”) with lipopolysaccharide. Global and dynamic analysis of transcription factors in response to a physiological stimulus has yet to be achieved in a human system, and our efforts significantly advanced this goal. We used multiple global high-throughput technologies for measuring mRNA levels, including massively parallel signature sequencing and GeneChip microarrays. We identified 92 of 1,288 known human transcription factors as having significantly measurable changes during our 24-h time course. At least 42 of these changes were previously unidentified in this system. Our data demonstrate that some transcription factors operate in a functional range below 10 transcripts per cell, whereas others operate in a range three orders of magnitude greater. The highly reproducible response of many mRNAs indicates feedback control. A broad range of activation kinetics was observed; thus, combinatorial regulation by small subsets of transcription factors would permit almost any timing input to cis-regulatory elements controlling gene transcription. PMID:17913878

  17. PTEN regulates p300-dependent hypoxia-inducible factor 1 transcriptional activity through Forkhead transcription factor 3a (FOXO3a)

    PubMed Central

    Emerling, Brooke M.; Weinberg, Frank; Liu, Juinn-Lin; Mak, Tak W.; Chandel, Navdeep S.

    2008-01-01

    The tumor suppressor PTEN is mutated or deleted in many tumors, causing the activation of the PI3K pathway. Here, we show that the loss of PTEN increases the transcriptional activity of hypoxia-inducible factor 1 (HIF-1) through the inactivation of Forkhead transcription factors (FOXO) in PTEN-null cells. Reintroduction of PTEN into the nucleus, overexpression of a nonphosphorylatable FOXO3a, which accumulates in the nucleus, or inhibition of nuclear export of FOXO3a by leptomycin B represses HIF-1 transcriptional activity in PTEN-null cells. HIF-1 transcriptional activity increases in PTEN-positive cells depleted of FOXO3a with siRNA. PTEN and FOXO3a regulate the transactivation domain of HIF-1α. Chromatin immunoprecipitation indicates that FOXO3a complexes with HIF-1α and p300 on the Glut-1 promoter, a HIF-1 target gene. Overexpression of p300 reverses FOXO3a-mediated repression of HIF-1 transcriptional activity. Coimmunoprecipitation and GAL4-HIF-1α transactivation assays reveal that FOXO3a interferes with p300-dependent HIF-1 transcriptional activity. Thus, FOXO3a negatively regulates HIF-1 transcriptional activity. PMID:18268343

  18. Transcriptional activation of Brassica napus β-ketoacyl-ACP synthase II with an engineered zinc finger protein transcription factor.

    PubMed

    Gupta, Manju; DeKelver, Russell C; Palta, Asha; Clifford, Carla; Gopalan, Sunita; Miller, Jeffrey C; Novak, Stephen; Desloover, Daniel; Gachotte, Daniel; Connell, James; Flook, Josh; Patterson, Thomas; Robbins, Kelly; Rebar, Edward J; Gregory, Philip D; Urnov, Fyodor D; Petolino, Joseph F

    2012-09-01

    Targeted gene regulation via designed transcription factors has great potential for precise phenotypic modification and acceleration of novel crop trait development. Canola seed oil composition is dictated largely by the expression of genes encoding enzymes in the fatty acid biosynthetic pathway. In the present study, zinc finger proteins (ZFPs) were designed to bind DNA sequences common to two canola β-ketoacyl-ACP Synthase II (KASII) genes downstream of their transcription start site. Transcriptional activators (ZFP-TFs) were constructed by fusing these ZFP DNA-binding domains to the VP16 transcriptional activation domain. Following transformation using Agrobacterium, transgenic events expressing ZFP-TFs were generated and shown to have elevated KASII transcript levels in the leaves of transgenic T(0) plants when compared to 'selectable marker only' controls as well as of T(1) progeny plants when compared to null segregants. In addition, leaves of ZFP-TF-expressing T(1) plants contained statistically significant decreases in palmitic acid (consistent with increased KASII activity) and increased total C18. Similarly, T(2) seed displayed statistically significant decreases in palmitic acid, increased total C18 and reduced total saturated fatty acid contents. These results demonstrate that designed ZFP-TFs can be used to regulate the expression of endogenous genes to elicit specific phenotypic modifications of agronomically relevant traits in a crop species. PMID:22520333

  19. Regulation of the yeast metabolic cycle by transcription factors with periodic activities

    PubMed Central

    2011-01-01

    Background When growing budding yeast under continuous, nutrient-limited conditions, over half of yeast genes exhibit periodic expression patterns. Periodicity can also be observed in respiration, in the timing of cell division, as well as in various metabolite levels. Knowing the transcription factors involved in the yeast metabolic cycle is helpful for determining the cascade of regulatory events that cause these patterns. Results Transcription factor activities were estimated by linear regression using time series and genome-wide transcription factor binding data. Time-translation matrices were estimated using least squares and were used to model the interactions between the most significant transcription factors. The top transcription factors have functions involving respiration, cell cycle events, amino acid metabolism and glycolysis. Key regulators of transitions between phases of the yeast metabolic cycle appear to be Hap1, Hap4, Gcn4, Msn4, Swi6 and Adr1. Conclusions Analysis of the phases at which transcription factor activities peak supports previous findings suggesting that the various cellular functions occur during specific phases of the yeast metabolic cycle. PMID:21992532

  20. Constitutively expressed ERF-VII transcription factors redundantly activate the core anaerobic response in Arabidopsis thaliana.

    PubMed

    Bui, Liem T; Giuntoli, Beatrice; Kosmacz, Monika; Parlanti, Sandro; Licausi, Francesco

    2015-07-01

    Plant adaptation to hypoxic conditions is mediated by the transcriptional activation of genes involved in the metabolic reprogramming of plant cells to cope with reduced oxygen availability. Recent studies indicated that members of the group VII of the Ethylene Responsive Transcription Factor (ERFs) family act as positive regulators of this molecular response. In the current study, the five ERF-VII transcription factors of Arabidopsis thaliana were compared to infer a hierarchy in their role with respect to the anaerobic response. When the activity of each transcription factor was tested on a set of hypoxia-responsive promoters, RAP2.2, RAP2.3 and RAP2.12 appeared to be the most powerful activators. RAP2.12 was further dissected in transactivation assays in Arabidopsis protoplasts to identify responsible regions for transcriptional activation. An ultimate C-terminal motif was identified as sufficient to drive gene transcription. Finally, using realtime RT-PCR in single and double mutants for the corresponding genes, we confirmed that RAP2.2 and RAP2.12 exert major control upon the anaerobic response. PMID:26025519

  1. O-GlcNAc modification of Sp3 and Sp4 transcription factors negatively regulates their transcriptional activities.

    PubMed

    Ha, Changhoon; Lim, Kihong

    2015-11-13

    The addition of O-linked N-acetylglucosamine (O-GlcNAc) on serine or threonine modifies a myriad of proteins and regulates their function, stability and localization. O-GlcNAc modification is common among chromosome-associated proteins, such as transcription factors, suggesting its extensive involvement in gene expression regulation. In this study, we demonstrate the O-GlcNAc status of the Sp family members of transcription factors and the functional impact on their transcriptional activities. We highlight the presence of O-GlcNAc residues in Sp3 and Sp4, but not Sp2, as demonstrated by their enrichment in GlcNAc positive protein fractions and by detection of O-GlcNAc residues on Sp3 and Sp4 co-expressed in Escherichia coli together with O-GlcNAc transferase (OGT) using an O-GlcNAc-specific antibody. Deletion mutants of Sp3 and Sp4 indicate that the majority of O-GlcNAc sites reside in their N-terminal transactivation domain. Overall, using reporter gene assays and co-immunoprecipitations, we demonstrate a functional inhibitory role of O-GlcNAc modifications in Sp3 and Sp4 transcription factors. Thereby, our study strengthens the current notion that O-GlcNAc modification is an important regulator of protein interactome. PMID:26431879

  2. Transcriptional activators in yeast

    PubMed Central

    2006-01-01

    Eukaryotic transcription activation domains (ADs) are not well defined on the proteome scale. We systematicallly tested ∼6000 yeast proteins for transcriptional activity using a yeast one-hybrid system and identified 451 transcriptional activators. We then determined their transcription activation strength using fusions to the Gal4 DNA-binding domain and a His3 reporter gene which contained a promoter with a Gal4-binding site. Among the 132 strongest activators 32 are known transcription factors while another 35 have no known function. Although zinc fingers, helix–loop–helix domains and several other domains are highly overrepresented among the activators, only few contain characterized ADs. We also found some striking correlations: the stronger the activation activity, the more acidic, glutamine-rich, proline-rich or asparagine-rich the activators were. About 29% of the activators have been found previously to specifically interact with the transcription machinery, while 10% are known to be components of transcription regulatory complexes. Based on their transcriptional activity, localization and interaction patterns, at least six previously uncharacterized proteins are suggested to be bona fide transcriptional regulators (namely YFL049W, YJR070C, YDR520C, YGL066W/Sgf73, YKR064W and YCR082W/Ahc2). PMID:16464826

  3. Specific induction of endogenous viral restriction factors using CRISPR/Cas-derived transcriptional activators

    PubMed Central

    Bogerd, Hal P.; Kornepati, Anand V. R.; Marshall, Joy B.; Kennedy, Edward M.; Cullen, Bryan R.

    2015-01-01

    Whereas several mammalian proteins can restrict the replication of HIV-1 and other viruses, these are often not expressed in relevant target cells. A potential method to inhibit viral replication might therefore be to use synthetic transcription factors to induce restriction factor expression. In particular, mutants of the RNA-guided DNA binding protein Cas9 that have lost their DNA cleavage activity could be used to recruit transcription activation domains to specific promoters. However, initial experiments revealed only weak activation unless multiple promoter-specific single guide RNAs (sgRNAs) were used. Recently, the recruitment of multiple transcription activation domains by a single sgRNA, modified to contain MS2-derived stem loops that recruit fusion proteins consisting of the MS2 coat protein linked to transcription activation domains, was reported to induce otherwise silent cellular genes. Here, we demonstrate that such “synergistic activation mediators” can induce the expression of two restriction factors, APOBEC3G (A3G) and APOBEC3B (A3B), in human cells that normally lack these proteins. We observed modest activation of endogenous A3G or A3B expression using single sgRNAs but high expression when two sgRNAs were used. Whereas the induced A3G and A3B proteins both blocked infection by an HIV-1 variant lacking a functional vif gene by inducing extensive dC-to-dU editing, only the induced A3B protein inhibited wild-type HIV-1. These data demonstrate that Cas9-derived transcriptional activators have the potential to be used for screens for endogenous genes that affect virus replication and raise the possibility that synthetic transcription factors might prove clinically useful if efficient delivery mechanisms could be developed. PMID:26668372

  4. Specific induction of endogenous viral restriction factors using CRISPR/Cas-derived transcriptional activators.

    PubMed

    Bogerd, Hal P; Kornepati, Anand V R; Marshall, Joy B; Kennedy, Edward M; Cullen, Bryan R

    2015-12-29

    Whereas several mammalian proteins can restrict the replication of HIV-1 and other viruses, these are often not expressed in relevant target cells. A potential method to inhibit viral replication might therefore be to use synthetic transcription factors to induce restriction factor expression. In particular, mutants of the RNA-guided DNA binding protein Cas9 that have lost their DNA cleavage activity could be used to recruit transcription activation domains to specific promoters. However, initial experiments revealed only weak activation unless multiple promoter-specific single guide RNAs (sgRNAs) were used. Recently, the recruitment of multiple transcription activation domains by a single sgRNA, modified to contain MS2-derived stem loops that recruit fusion proteins consisting of the MS2 coat protein linked to transcription activation domains, was reported to induce otherwise silent cellular genes. Here, we demonstrate that such "synergistic activation mediators" can induce the expression of two restriction factors, APOBEC3G (A3G) and APOBEC3B (A3B), in human cells that normally lack these proteins. We observed modest activation of endogenous A3G or A3B expression using single sgRNAs but high expression when two sgRNAs were used. Whereas the induced A3G and A3B proteins both blocked infection by an HIV-1 variant lacking a functional vif gene by inducing extensive dC-to-dU editing, only the induced A3B protein inhibited wild-type HIV-1. These data demonstrate that Cas9-derived transcriptional activators have the potential to be used for screens for endogenous genes that affect virus replication and raise the possibility that synthetic transcription factors might prove clinically useful if efficient delivery mechanisms could be developed. PMID:26668372

  5. SUMOylation can regulate the activity of ETS-like transcription factor 4.

    PubMed

    Kaikkonen, Sanna; Makkonen, Harri; Rytinki, Miia; Palvimo, Jorma J

    2010-08-01

    ETS-like transcription factor 4 (ELK4) (a.k.a. serum response factor accessory protein 1) belongs to the ternary complex factor (TCF) subfamily of E twenty-six (ETS) domain transcription factors. Compared to the other TCF subfamily members, ELK1 and ELK3 (NET), there is limited information of the mechanisms regulating the ELK4 activity. Here, we show that the ELK4 can be covalently modified (SUMOylated) by small ubiquitin-related modifier (SUMO) 1 protein, an important regulator of signaling and transcription. SUMOylation of ELK4 was reversed by SUMO-specific proteases (SENP) 1 and 2 and stimulated by SUMO E3 ligase PIAS3. Conserved lysine residue 167 that is located in the NET inhibitory domain of ELK4 was identified as the main site of SUMO-1 conjugation. Interestingly, mutation of the K167 disrupting the SUMOylation markedly enhanced the transcriptional activity of the ELK4, but weakened its repressive function on c-fos promoter. In conclusion, our results suggest that covalent modification by SUMO-1 can regulate the activity of ELK4, contributing to the transcriptional repression by the ELK4. PMID:20637912

  6. Transcription factor activation following exposure of an intact lung preparation to metallic particulate matter.

    PubMed Central

    Samet, James M; Silbajoris, Robert; Huang, Tony; Jaspers, Ilona

    2002-01-01

    Metallic constituents contained in ambient particulate matter have been associated with adverse effects in a number of epidemiologic, in vitro, and in vivo studies. Residual oil fly ash (ROFA) is a metallic by-product of the combustion of fossil fuel oil, which has been shown to induce a variety of proinflammatory responses in lung cells. We have examined signaling pathways activated in response to ROFA exposure and recently reported that ROFA treatment activates multiple mitogen-activated protein (MAP) kinases in the rat lung. In the present study we extended our investigations on the mechanism of toxicity of ROFA to include transcription factors whose activities are regulated by MAP kinases as well as possible effectors of transcriptional changes that mediate the effects of ROFA. We applied immunohistochemical methods to detect ROFA-induced activation of nuclear factor-kappa B (NF kappa B), activating transcription factor-2 (ATF-2), c-Jun, and cAMP response element binding protein (CREB) in intact lung tissue and confirmed and characterized their functional activation using DNA binding assays. We performed these studies using a perfused rabbit lung model that is devoid of blood elements in order to distinguish between intrinsic lung cell effects and effects that are secondary to inflammatory cell influx. We report here that exposure to ROFA results in a rapid activation of all of the transcription factors studied by exerting direct effects on lung cells. These findings validate the use of immunohistochemistry to detect transcription factor activation in vivo and demonstrate the utility of studying signaling changes in response to environmental exposures. PMID:12361922

  7. Maximal stimulation of meiotic recombination by a yeast transcription factor requires the transcription activation domain and a DNA-binding domain.

    PubMed Central

    Kirkpatrick, D T; Fan, Q; Petes, T D

    1999-01-01

    The DNA sequences located upstream of the yeast HIS4 represent a very strong meiotic recombination hotspot. Although the activity of this hotspot requires the transcription activator Rap1p, the level of HIS4 transcription is not directly related to the level of recombination. We find that the recombination-stimulating activity of Rap1p requires the transcription activation domain of the protein. We show that a hybrid protein with the Gal4p DNA-binding domain and the Rap1p activation domain can stimulate recombination in a strain in which Gal4p-binding sites are inserted upstream of HIS4. In addition, we find recombination hotspot activity associated with the Gal4p DNA-binding sites that is independent of known transcription factors. We suggest that yeast cells have two types of recombination hotspots, alpha (transcription factor dependent) and beta (transcription factor independent). PMID:10224246

  8. RNA helicase A activity is inhibited by oncogenic transcription factor EWS-FLI1

    PubMed Central

    Erkizan, Hayriye Verda; Schneider, Jeffrey A.; Sajwan, Kamal; Graham, Garrett T.; Griffin, Brittany; Chasovskikh, Sergey; Youbi, Sarah E.; Kallarakal, Abraham; Chruszcz, Maksymilian; Padmanabhan, Radhakrishnan; Casey, John L.; Üren, Aykut; Toretsky, Jeffrey A.

    2015-01-01

    RNA helicases impact RNA structure and metabolism from transcription through translation, in part through protein interactions with transcription factors. However, there is limited knowledge on the role of transcription factor influence upon helicase activity. RNA helicase A (RHA) is a DExH-box RNA helicase that plays multiple roles in cellular biology, some functions requiring its activity as a helicase while others as a protein scaffold. The oncogenic transcription factor EWS-FLI1 requires RHA to enable Ewing sarcoma (ES) oncogenesis and growth; a small molecule, YK-4-279 disrupts this complex in cells. Our current study investigates the effect of EWS-FLI1 upon RHA helicase activity. We found that EWS-FLI1 reduces RHA helicase activity in a dose-dependent manner without affecting intrinsic ATPase activity; however, the RHA kinetics indicated a complex model. Using separated enantiomers, only (S)-YK-4-279 reverses the EWS-FLI1 inhibition of RHA helicase activity. We report a novel RNA binding property of EWS-FLI1 leading us to discover that YK-4-279 inhibition of RHA binding to EWS-FLI1 altered the RNA binding profile of both proteins. We conclude that EWS-FLI1 modulates RHA helicase activity causing changes in overall transcriptome processing. These findings could lead to both enhanced understanding of oncogenesis and provide targets for therapy. PMID:25564528

  9. Elk3 from hamster--a ternary complex factor with strong transcriptional repressor activity.

    PubMed

    Hjortoe, Gertrud Malene; Weilguny, Dietmar; Willumsen, Berthe Marie

    2005-01-01

    Elk3 belongs to the Ets family of transcription factors, which are regulated by the Ras/mitogen-activated protein kinase-signaling pathway. In the absence of Ras, this protein is a strong inhibitor of transcription and may be directly involved in regulation of growth by downregulating the transcription of genes that are activated during entry into G1. We have isolated the Cricetulus griseus Elk3 gene from the Chinese hamster ovary (CHO) cell line and investigated the transcriptional potential of this factor. Transient transfections revealed that, in addition to its regulation of the c-fos promoter, Elk3 from CHO cells seems to inhibit other promoters controlling expression of proteins involved in G1/S phase progression; Cyclin D1 and DHFR. As has been described for the Elk3 homologs Net (Mouse) and Sap-2 (Human), the results of the present study further indicate that hamster Elk3 is a target of the Ras-Raf-MAPK pathway, and cotransfections with constitutively active H-ras relieves its negative transcriptional activity. No cells stably expressing exogenous Elk3 could be obtained, possibly due to an unspecified toxic or growth retarding effect. These findings support a possible role for Elk3 in growth regulation and reveal a high degree of homology for this protein across species. PMID:15684718

  10. MiT/TFE transcription factors are activated during mitophagy downstream of Parkin and Atg5

    PubMed Central

    Nezich, Catherine L.; Wang, Chunxin; Fogel, Adam I.

    2015-01-01

    The kinase PINK1 and ubiquitin ligase Parkin can regulate the selective elimination of damaged mitochondria through autophagy (mitophagy). Because of the demand on lysosomal function by mitophagy, we investigated a role for the transcription factor EB (TFEB), a master regulator of lysosomal biogenesis, in this process. We show that during mitophagy TFEB translocates to the nucleus and displays transcriptional activity in a PINK1- and Parkin-dependent manner. MITF and TFE3, homologues of TFEB belonging to the same microphthalmia/transcription factor E (MiT/TFE) family, are similarly regulated during mitophagy. Unlike TFEB translocation after starvation-induced mammalian target of rapamycin complex 1 inhibition, Parkin-mediated TFEB relocalization required Atg9A and Atg5 activity. However, constitutively active Rag guanosine triphosphatases prevented TFEB translocation during mitophagy, suggesting cross talk between these two MiT/TFE activation pathways. Analysis of clustered regularly interspaced short palindromic repeats–generated TFEB/MITF/TFE3/TFEC single, double, and triple knockout cell lines revealed that these proteins partly facilitate Parkin-mediated mitochondrial clearance. These results illuminate a pathway leading to MiT/TFE transcription factor activation, distinct from starvation-induced autophagy, which occurs during mitophagy. PMID:26240184

  11. C3 exoenzyme impairs cell proliferation and apoptosis by altering the activity of transcription factors.

    PubMed

    von Elsner, Leonie; Hagemann, Sandra; Just, Ingo; Rohrbeck, Astrid

    2016-09-01

    C3 exoenzyme from C. botulinum is an ADP-ribosyltransferase that inactivates selectively RhoA, B, and C by coupling an ADP-ribose moiety. Rho-GTPases are involved in various cellular processes, such as regulation of actin cytoskeleton, cell proliferation, and apoptosis. Previous studies of our group with the murine hippocampal cell line HT22 revealed a C3-mediated inhibition of cell proliferation after 48 h and a prevention of serum-starved cells from apoptosis. For both effects, alterations of various signaling pathways are already known, including also changes on the transcriptional level. Investigations on the transcriptional activity in HT22 cells treated with C3 for 48 h identified five out of 48 transcription factors namely Sp1, ATF2, E2F-1, CBF, and Stat6 with a significantly regulated activity. For validation of identified transcription factors, studies on the protein level of certain target genes were performed. Western blot analyses exhibited an enhanced abundance of Sp1 target genes p21 and COX-2 as well as an increase in phosphorylation of c-Jun. In contrast, the level of p53 and apoptosis-inducing GADD153, a target gene of ATF2, was decreased. Our results reveal that C3 regulates the transcriptional activity of Sp1 and ATF2 resulting downstream in an altered protein abundance of various target genes. As the affected proteins are involved in the regulation of cell proliferation and apoptosis, thus the C3-mediated anti-proliferative and anti-apoptotic effects are consequences of the Rho-dependent alterations of the activity of certain transcriptional factors. PMID:27351882

  12. The DNA replication factor MCM5 is essential for Stat1-mediated transcriptional activation

    PubMed Central

    Snyder, Marylynn; He, Wei; Zhang, J. Jillian

    2005-01-01

    The eukaryotic minichromosome maintenance (MCM) family of proteins (MCM2–MCM7) is evolutionarily conserved from yeast to human. These proteins are essential for DNA replication. The signal transducer and activator of transcription proteins are critical for the signal transduction of a multitude of cytokines and growth factors leading to the regulation of gene expression. We previously identified a strong interaction between Stat1 and MCM5. However, the physiological significance of this interaction was not clear. We show here by chromatin immunoprecipitation (ChIP) analyses that the MCM5 protein, as well as other members of the MCM family, is inducibly recruited to Stat1 target gene promoters in response to cytokine stimulation. Furthermore, the MCM proteins are shown to move along with the RNA polymerase II during transcription elongation. We have also identified an independent domain in MCM5 that mediates the interaction between Stat1 and MCM5; overexpression of this domain can disrupt the interaction between Stat1 and MCM5 and inhibit Stat1 transcriptional activity. Finally, we used the RNA interference technique to show that MCM5 is essential for transcription activation of Stat1 target genes. Together, these results demonstrate that, in addition to their roles in DNA replication, the MCM proteins are also necessary for transcription activation. PMID:16199513

  13. Dynamic transcription factor activity networks in response to independently altered mechanical and adhesive microenvironmental cues.

    PubMed

    Peñalver Bernabé, Beatriz; Shin, Seungjin; Rios, Peter D; Broadbelt, Linda J; Shea, Lonnie D; Seidlits, Stephanie K

    2016-08-01

    Multiple aspects of the local extracellular environment profoundly affect cell phenotype and function. Physical and chemical cues in the environment trigger intracellular signaling cascades that ultimately activate transcription factors (TFs) - powerful regulators of the cell phenotype. TRACER (TRanscriptional Activity CEll aRrays) was employed for large-scale, dynamic quantification of TF activity in human fibroblasts cultured on hydrogels with a controlled elastic modulus and integrin ligand density. We identified three groups of TFs: responders to alterations in ligand density alone, substrate stiffness or both. Dynamic networks of regulatory TFs were constructed computationally and revealed distinct TF activity levels, directionality (i.e., activation or inhibition), and dynamics for adhesive and mechanical cues. Moreover, TRACER networks predicted conserved hubs of TF activity across multiple cell types, which are significantly altered in clinical fibrotic tissues. Our approach captures the distinct and overlapping effects of adhesive and mechanical stimuli, identifying conserved signaling mechanisms in normal and disease states. PMID:27470442

  14. An auxiliary peptide required for the function of two activation domains in upstream stimulatory factor 2 (USF2) transcription factor.

    PubMed

    Gourdon, L; Lefrançois-Martinez, A M; Viollet, B; Martinez, A; Kahn, A; Raymondjean, M

    1997-04-01

    Ubiquitous upstream stimulatory factors (USF1, USF2a and USF2b) are members of the basic-helix-loop-helix-leucine-zipper family of transcription factors that have been shown to be involved in the transcriptional response of the L-type pyruvate kinase (L-PK) gene to glucose. To understand the mechanisms of action of the USF2 isoforms, we initiated a series of co-transfection assays with deletion mutants and Ga14-USF2 fusions. The transactivating efficiency of the different native and mutant factors was determined at similar DNA binding activity. We found that: (i) exons 3- and 5-encoded regions are activation domains, (ii) a modulator domain encoded by exon 4 could be necessary to their additive action, (iii) a hexapeptide encoded by the first 5' codons of exon 6 is indispensable for transmitting activation due to both exon 3- and exon 5-encoded domains to the transcriptional machinery. Therefore, USF2 presents a modular structure and mediates transcriptional activation thanks to two non-autonomous activation domains dependent on an auxiliary peptide for expressing their activating potential. PMID:9680311

  15. Arsenic Directly Binds to and Activates the Yeast AP-1-Like Transcription Factor Yap8

    PubMed Central

    Kumar, Nallani Vijay; Yang, Jianbo; Pillai, Jitesh K.; Rawat, Swati; Solano, Carlos; Kumar, Abhay; Grøtli, Morten; Stemmler, Timothy L.; Rosen, Barry P.

    2015-01-01

    The AP-1-like transcription factor Yap8 is critical for arsenic tolerance in the yeast Saccharomyces cerevisiae. However, the mechanism by which Yap8 senses the presence of arsenic and activates transcription of detoxification genes is unknown. Here we demonstrate that Yap8 directly binds to trivalent arsenite [As(III)] in vitro and in vivo and that approximately one As(III) molecule is bound per molecule of Yap8. As(III) is coordinated by three sulfur atoms in purified Yap8, and our genetic and biochemical data identify the cysteine residues that form the binding site as Cys132, Cys137, and Cys274. As(III) binding by Yap8 does not require an additional yeast protein, and Yap8 is regulated neither at the level of localization nor at the level of DNA binding. Instead, our data are consistent with a model in which a DNA-bound form of Yap8 acts directly as an As(III) sensor. Binding of As(III) to Yap8 triggers a conformational change that in turn brings about a transcriptional response. Thus, As(III) binding to Yap8 acts as a molecular switch that converts inactive Yap8 into an active transcriptional regulator. This is the first report to demonstrate how a eukaryotic protein couples arsenic sensing to transcriptional activation. PMID:26711267

  16. Stable inhibitory activity of regulatory T cells requires the transcription factor Helios.

    PubMed

    Kim, Hye-Jung; Barnitz, R Anthony; Kreslavsky, Taras; Brown, Flavian D; Moffett, Howell; Lemieux, Madeleine E; Kaygusuz, Yasemin; Meissner, Torsten; Holderried, Tobias A W; Chan, Susan; Kastner, Philippe; Haining, W Nicholas; Cantor, Harvey

    2015-10-16

    The maintenance of immune homeostasis requires regulatory T cells (T(regs)). Given their intrinsic self-reactivity, T(regs) must stably maintain a suppressive phenotype to avoid autoimmunity. We report that impaired expression of the transcription factor (TF) Helios by FoxP3(+) CD4 and Qa-1-restricted CD8 T(regs) results in defective regulatory activity and autoimmunity in mice. Helios-deficient T(regs) develop an unstable phenotype during inflammatory responses characterized by reduced FoxP3 expression and increased effector cytokine expression secondary to diminished activation of the STAT5 pathway. CD8 T(regs) also require Helios-dependent STAT5 activation for survival and to prevent terminal T cell differentiation. The definition of Helios as a key transcription factor that stabilizes T(regs) in the face of inflammatory responses provides a genetic explanation for a core property of T(regs). PMID:26472910

  17. Transcriptional activation of mouse mast cell Protease-7 by activin and transforming growth factor-beta is inhibited by microphthalmia-associated transcription factor.

    PubMed

    Funaba, Masayuki; Ikeda, Teruo; Murakami, Masaru; Ogawa, Kenji; Tsuchida, Kunihiro; Sugino, Hiromu; Abe, Matanobu

    2003-12-26

    Previous studies have revealed that activin A and transforming growth factor-beta1 (TGF-beta1) induced migration and morphological changes toward differentiation in bone marrow-derived cultured mast cell progenitors (BMCMCs). Here we show up-regulation of mouse mast cell protease-7 (mMCP-7), which is expressed in differentiated mast cells, by activin A and TGF-beta1 in BMCMCs, and the molecular mechanism of the gene induction of mmcp-7. Smad3, a signal mediator of the activin/TGF-beta pathway, transcriptionally activated mmcp-7. Microphthalmia-associated transcription factor (MITF), a tissue-specific transcription factor predominantly expressed in mast cells, melanocytes, and heart and skeletal muscle, inhibited Smad3-mediated mmcp-7 transcription. MITF associated with Smad3, and the C terminus of MITF and the MH1 and linker region of Smad3 were required for this association. Complex formation between Smad3 and MITF was neither necessary nor sufficient for the inhibition of Smad3 signaling by MITF. MITF inhibited the transcriptional activation induced by the MH2 domain of Smad3. In addition, MITF-truncated N-terminal amino acids could associate with Smad3 but did not inhibit Smad3-mediated transcription. The level of Smad3 was decreased by co-expression of MITF but not of dominant-negative MITF, which resulted from proteasomal protein degradation. The changes in the level of Smad3 protein were paralleled by those in Smad3-mediated signaling activity. These findings suggest that MITF negatively regulates Smad-dependent activin/TGF-beta signaling in a tissue-specific manner. PMID:14527958

  18. Selective activation of human heat shock gene transcription by nitrosourea antitumor drugs mediated by isocyanate-induced damage and activation of heat shock transcription factor

    SciTech Connect

    Kroes, R.A. Northwestern Univ., Evanston, IL ); Abravaya, K.; Morimoto, R.I. ); Seidenfeld, J. )

    1991-06-01

    Treatment of cultured human tumor cells with the chloroethylnitrosourea antitumor drug 1,3-bis(2-chloroethyl)-1-nitrosourea (BCNU) selectively induces transcription and protein synthesis of a subset of the human heat shock or stress-induced genes (HSP90 and HSP70) with little effect on other stress genes or on expression of the c-fos, c-myc, or {beta}-actin genes. The active component of BCNU and related compounds appears to be the isocyanate moiety that causes carbamoylation of proteins and nucleic acids. Transcriptional activation of the human HSP70 gene by BCNU is dependent on the heat shock element and correlates with the level of heat shock transcription factor and its binding to the heat shock element in vivo. Unlike activation by heat or heavy metals, BCNU-mediated activation is strongly dependent upon new protein synthesis. This suggests that BCNU-induced, isocyanate-mediated damage to newly synthesized protein(s) may be responsible for activation of the heat shock transcription factor and increased transcription of the HSP90 and HSP70 genes.

  19. In vivo bioimaging with tissue-specific transcription factor activated luciferase reporters

    PubMed Central

    Buckley, Suzanne M. K.; Delhove, Juliette M. K. M.; Perocheau, Dany P.; Karda, Rajvinder; Rahim, Ahad A.; Howe, Steven J.; Ward, Natalie J.; Birrell, Mark A.; Belvisi, Maria G.; Arbuthnot, Patrick; Johnson, Mark R.; Waddington, Simon N.; McKay, Tristan R.

    2015-01-01

    The application of transcription factor activated luciferase reporter cassettes in vitro is widespread but potential for in vivo application has not yet been realized. Bioluminescence imaging enables non-invasive tracking of gene expression in transfected tissues of living rodents. However the mature immune response limits luciferase expression when delivered in adulthood. We present a novel approach of tissue-targeted delivery of transcription factor activated luciferase reporter lentiviruses to neonatal rodents as an alternative to the existing technology of generating germline transgenic light producing rodents. At this age, neonates acquire immune tolerance to the conditionally responsive luciferase reporter. This simple and transferrable procedure permits surrogate quantitation of transcription factor activity over the lifetime of the animal. We show principal efficacy by temporally quantifying NFκB activity in the brain, liver and lungs of somatotransgenic reporter mice subjected to lipopolysaccharide (LPS)-induced inflammation. This response is ablated in Tlr4−/− mice or when co-administered with the anti-inflammatory glucocorticoid analogue dexamethasone. Furthermore, we show the malleability of this technology by quantifying NFκB-mediated luciferase expression in outbred rats. Finally, we use somatotransgenic bioimaging to longitudinally quantify LPS- and ActivinA-induced upregulation of liver specific glucocorticoid receptor and Smad2/3 reporter constructs in somatotransgenic mice, respectively. PMID:26138224

  20. Mitotic bookmarking by transcription factors

    PubMed Central

    2013-01-01

    Mitosis is accompanied by dramatic changes in chromatin organization and nuclear architecture. Transcription halts globally and most sequence-specific transcription factors and co-factors are ejected from mitotic chromatin. How then does the cell maintain its transcriptional identity throughout the cell division cycle? It has become clear that not all traces of active transcription and gene repression are erased within mitotic chromatin. Many histone modifications are stable or only partially diminished throughout mitosis. In addition, some sequence-specific DNA binding factors have emerged that remain bound to select sites within mitotic chromatin, raising the possibility that they function to transmit regulatory information through the transcriptionally silent mitotic phase, a concept that has been termed “mitotic bookmarking.” Here we review recent approaches to studying potential bookmarking factors with regards to their mitotic partitioning, and summarize emerging ideas concerning the in vivo functions of mitotically bound nuclear factors. PMID:23547918

  1. Activation of BPV-1 replication in vitro by the transcription factor E2

    NASA Astrophysics Data System (ADS)

    Yang, Liu; Li, Rong; Mohr, Ian J.; Clark, Robin; Botchan, Michael R.

    1991-10-01

    Soluble extracts from uninfected murine cells supplemented with purified viral E1 and E2 proteins support the replication of exogenously added papilloma virus DNA. The E2 transactivator stimulates the binding of the E1 replication protein to the minimal origin of replication and activates DNA replication. These results support the concept that transcription factors have a direct role in the initiation of DNA replication in eukaryotes by participating in the assembly of a complex at the origin of replication.

  2. Free radical activity of industrial fibers: role of iron in oxidative stress and activation of transcription factors.

    PubMed Central

    Gilmour, P S; Brown, D M; Beswick, P H; MacNee, W; Rahman, I; Donaldson, K

    1997-01-01

    We studied asbestos, vitreous fiber (MMVF10), and refractory ceramic fiber (RCF1) from the Thermal Insulation Manufacturers' Association fiber repository regarding the following: free radical damage to plasmid DNA, iron release, ability to deplete glutathione (GSH), and activate redox-sensitive transcription factors in macrophages. Asbestos had much more free radical activity than any of the man-made vitreous fibers. More Fe3+ was released than Fe2+ and more of both was released at pH 4.5 than at pH 7.2. Release of iron from the different fibers was generally not a good correlate of ability to cause free radical injury to the plasmid DNA. All fiber types caused some degree of oxidative stress, as revealed by depletion of intracellular GSH. Amosite asbestos upregulated nuclear binding of activator protein 1 transcription factor to a greater level than MMVF10 and RCF1; long-fiber amosite was the only fiber to enhance activation of the transcription factor nuclear factor kappa B (NF kappa B). The use of cysteine methyl ester and buthionine sulfoximine to modulate GSH suggested that GSH homeostasis was important in leading to activation of transcription factors. We conclude that the intrinsic free radical activity is the major determinant of transcription factor activation and therefore gene expression in alveolar macrophages. Although this was not related to iron release or ability to deplete macrophage GSH at 4 hr, GSH does play a role in activation of NF kappa B. Images Figure 1. Figure 5. A Figure 5. B Figure 6. A Figure 6. B PMID:9400744

  3. MYRF is a membrane-associated transcription factor that autoproteolytically cleaves to directly activate myelin genes.

    PubMed

    Bujalka, Helena; Koenning, Matthias; Jackson, Stacey; Perreau, Victoria M; Pope, Bernard; Hay, Curtis M; Mitew, Stanlislaw; Hill, Andrew F; Lu, Q Richard; Wegner, Michael; Srinivasan, Rajini; Svaren, John; Willingham, Melanie; Barres, Ben A; Emery, Ben

    2013-01-01

    The myelination of axons is a crucial step during vertebrate central nervous system (CNS) development, allowing for rapid and energy efficient saltatory conduction of nerve impulses. Accordingly, the differentiation of oligodendrocytes, the myelinating cells of the CNS, and their expression of myelin genes are under tight transcriptional control. We previously identified a putative transcription factor, Myelin Regulatory Factor (Myrf), as being vital for CNS myelination. Myrf is required for the generation of CNS myelination during development and also for its maintenance in the adult. It has been controversial, however, whether Myrf directly regulates transcription, with reports of a transmembrane domain and lack of nuclear localization. Here we show that Myrf is a membrane-associated transcription factor that undergoes an activating proteolytic cleavage to separate its transmembrane domain-containing C-terminal region from a nuclear-targeted N-terminal region. Unexpectedly, this cleavage event occurs via a protein domain related to the autoproteolytic intramolecular chaperone domain of the bacteriophage tail spike proteins, the first time this domain has been found to play a role in eukaryotic proteins. Using ChIP-Seq we show that the N-terminal cleavage product directly binds the enhancer regions of oligodendrocyte-specific and myelin genes. This binding occurs via a defined DNA-binding consensus sequence and strongly promotes the expression of target genes. These findings identify Myrf as a novel example of a membrane-associated transcription factor and provide a direct molecular mechanism for its regulation of oligodendrocyte differentiation and CNS myelination. PMID:23966833

  4. SENSITIVE TO PROTON RHIZOTOXICITY1, CALMODULIN BINDING TRANSCRIPTION ACTIVATOR2, and Other Transcription Factors Are Involved in ALUMINUM-ACTIVATED MALATE TRANSPORTER1 Expression1[OPEN

    PubMed Central

    Tokizawa, Mutsutomo; Kobayashi, Yuriko; Saito, Tatsunori; Kobayashi, Masatomo; Iuchi, Satoshi; Nomoto, Mika; Tada, Yasuomi; Yamamoto, Yoshiharu Y.; Koyama, Hiroyuki

    2015-01-01

    In Arabidopsis (Arabidopsis thaliana) the root apex is protected from aluminum (Al) rhizotoxicity by excretion of malate, an Al chelator, by ALUMINUM-ACTIVATED MALATE TRANSPORTER1 (AtALMT1). AtALMT1 expression is fundamentally regulated by the SENSITIVE TO PROTON RHIZOTOXICITY1 (STOP1) zinc finger protein, but other transcription factors have roles that enable Al-inducible expression with a broad dynamic range. In this study, we characterized multiple cis-elements in the AtALMT1 promoter that interact with transcription factors. In planta complementation assays of AtALMT1 driven by 5′ truncated promoters of different lengths showed that the promoter region between –540 and 0 (the first ATG) restored the Al-sensitive phenotype of atalm1 and thus contains cis-elements essential for AtALMT1 expression for Al tolerance. Computation of overrepresented octamers showed that eight regions in this promoter region contained potential cis-elements involved in Al induction and STOP1 regulation. Mutation in a position around –297 from the first ATG completely inactivated AtALMT1 expression and Al response. In vitro binding assays showed that this region contained the STOP1 binding site, which accounted for the recognition by four zinc finger domains of the protein. Other positions were characterized as cis-elements that regulated expression by repressors and activators and a transcription factor that determines root tip expression of AtALMT1. From the consensus of known cis-elements, we identified CALMODULIN-BINDING TRANSCRIPTION ACTIVATOR2 to be an activator of AtALMT1 expression. Al-inducible expression of AtALMT1 changed transcription starting sites, which increased the abundance of transcripts with a shortened 5′ untranslated region. The present analyses identified multiple mechanisms that regulate AtALMT1 expression. PMID:25627216

  5. Transcriptional Control by A-Factor of strR, the Pathway-Specific Transcriptional Activator for Streptomycin Biosynthesis in Streptomyces griseus

    PubMed Central

    Tomono, Ayami; Tsai, Yisan; Yamazaki, Haruka; Ohnishi, Yasuo; Horinouchi, Sueharu

    2005-01-01

    A-factor (2-isocapryloyl-3R-hydroxymethyl-γ-butyrolactone) triggers streptomycin production by inducing the transcription of strR, encoding the pathway-specific transcriptional activator, through signal transduction in the A-factor regulatory cascade in Streptomyces griseus. AdpA, one of the key transcriptional activators in the cascade, bound two upstream activation sites, approximately at nucleotide positions −270 and −50 with respect to the transcriptional start point of strR, as determined by gel mobility shift assays and DNase I footprinting. Transcriptional analysis of the strR promoter with mutated AdpA-binding sites showed that both sites were required for full transcriptional activation of strR by AdpA. Potassium permanganate footprinting showed that AdpA assisted RNA polymerase in forming an open complex at an appropriate position for transcriptional initiation of strR. Nine transcriptional units within the streptomycin biosynthesis gene cluster, including the strR-aphD operon, depended on StrR, indicating that StrR is the pathway-specific transcriptional activator for the whole gene cluster. Consistent with this, expression of strR under the control of a constitutively expressed promoter in an adpA null mutant caused the host to produce streptomycin. PMID:16077104

  6. Silodosin Inhibits Noradrenaline-Activated Transcription Factors Elk1 and SRF in Human Prostate Smooth Muscle

    PubMed Central

    Hennenberg, Martin; Strittmatter, Frank; Beckmann, Christer; Rutz, Beata; Füllhase, Claudius; Waidelich, Raphaela; Montorsi, Francesco; Hedlund, Petter; Andersson, Karl-Erik; Stief, Christian G.; Gratzke, Christian

    2012-01-01

    Background The transcription factors Elk1 and serum response factor (SRF) are central regulators of cell cycle and phenotype in various cell types. Elk1 is activated by phosphorylation (serine-383), while activation of SRF requires its co-factor, myocardin. Activation of Elk1 and SRF results in binding to specific DNA sequences in promoter regions, and may be induced by adrenergic receptor activation in different organs. Objective To examine the effects of adrenergic stimulation on Elk1 and SRF in the human prostate and the ability of the highly selective α1A-adrenoceptor antagonist, silodosin, on transcription factor activation. Methods Prostate tissue was obtained from patients undergoing radical prostatectomy. Expression of Elk1, SRF, and myocardin was estimated by Western blot and immunohistochemistry. Colocalizations were studied by double immunofluorescence staining. Noradrenaline- (NA-) and phenylephrine- (PE-) induced phosphorylation of Elk1 was assessed by Western blot analysis using a phospho-specific antibody. NA-induced activation of Elk1 and SRF was investigated by electrophoretic mobility shift assay (EMSA). Results Immunoreactivity for Elk1, SRF, and myocardin was observed in stromal cells of tissues from each patient. In fluorescence stainings, SRF colocalized with myocardin and α-smooth muscle actin (αSMA). Stimulation of prostate tissues with PE (10 µM) or NA (30 µM) increased the phosphorylation of Elk1 at serine-383. NA-induced Elk1 activation was confirmed by EMSA, where a NA-induced binding of Elk1 to the DNA sequence TTTGCAAAATGCAGGAATTGTTTTCACAGT was observed. Similarly, NA caused SRF binding to the SRF-specific DNA sequence CCATATTAGGCCATATTAGG. Application of silodosin (3 µM) to prostate tissues reduced the activity of Elk1 and SRF in NA-stimulated tissues. Conclusions Silodosin blocks the activation of the two transcription factors, Elk1 and SRF, which is induced by noradrenaline in the human prostate. A role of α1-adrenoceptors

  7. Molecular genetic analysis of activation-tagged transcription factors thought to be involved in photomorphogenesis

    SciTech Connect

    Neff, Michael M.

    2011-06-23

    This is a final report for Department of Energy Grant No. DE-FG02-08ER15927 entitled “Molecular Genetic Analysis of Activation-Tagged Transcription Factors Thought to be Involved in Photomorphogenesis”. Based on our preliminary photobiological and genetic analysis of the sob1-D mutant, we hypothesized that OBP3 is a transcription factor involved in both phytochrome and cryptochrome-mediated signal transduction. In addition, we hypothesized that OBP3 is involved in auxin signaling and root development. Based on our preliminary photobiological and genetic analysis of the sob2-D mutant, we also hypothesized that a related gene, LEP, is involved in hormone signaling and seedling development.

  8. Mitochondrial dysfunction induces SESN2 gene expression through Activating Transcription Factor 4.

    PubMed

    Garaeva, Alisa A; Kovaleva, Irina E; Chumakov, Peter M; Evstafieva, Alexandra G

    2016-01-01

    We found that inhibitors of mitochondrial respiratory chain complexes III (myxothiazol) and I (piericidin A) in some epithelial carcinoma cell lines induce transcription of the p53-responsive SESN2 gene that plays an important role in stress response and homeostatic regulation. However, the effect did not depend on p53 because i) there was no induction of p53 after the treatment with piericidin A; ii) after the treatment with myxothiazol the peak of SESN2 gene upregulation occurred as early as 5h, before the onset of p53 activation (13h); iii) a supplementation with uridine that abolishes the p53 activation in response to myxothiazol did not abrogate the induction of SESN2 transcripts; iv) in the p53 negative HCT116 p53 -/- cells SESN2 transcription could be also induced by myxothiazol. In response to the respiratory chain inhibitors we observed an induction of ATF4, the key transcription factor of the integrated stress response (ISR). We found that the induction of SESN2 transcripts could be prevented by the ISR inhibitory small molecule ISRIB. Also, by inhibiting or overexpressing ATF4 with specific shRNA or ATF4-expressing constructs, respectively, we have confirmed the role of ATF4 in the SESN2 gene upregulation induced by mitochondrial dysfunction. At a distance of 228 bp upstream from the SESN2 transcription start site we found a candidate sequence for the ATF4 binding site and confirmed its requirement for the induction of SESN2 in luciferase reporter experiments. We suggest that the upregulation of SESN2 by mitochondrial dysfunction provides a homeostatic feedback that attenuates biosynthetic processes during temporal losses of energy supply from mitochondria thereby assisting better adaptation and viability of cells in hostile environments. PMID:26771712

  9. Multiple phosphorylation events control chicken ovalbumin upstream promoter transcription factor I orphan nuclear receptor activity.

    PubMed

    Gay, Frédérique; Baráth, Peter; Desbois-Le Péron, Christine; Métivier, Raphaël; Le Guével, Rémy; Birse, Darcy; Salbert, Gilles

    2002-06-01

    Chicken ovalbumin upstream promoter transcription factor I (COUP-TFI) is an orphan member of the nuclear hormone receptor superfamily that comprises key regulators of many biological functions, such as embryonic development, metabolism, homeostasis, and reproduction. Although COUP-TFI can both actively silence gene transcription and antagonize the functions of various other nuclear receptors, the COUP-TFI orphan receptor also acts as a transcriptional activator in certain contexts. Moreover, COUP-TFI has recently been shown to serve as an accessory factor for some ligand-bound nuclear receptors, suggesting that it may modulate, both negatively and positively, a wide range of hormonal responses. In the absence of any identified cognate ligand, the mechanisms involved in the regulation of COUP-TFI activity remain unclear. The elucidation of several putative phosphorylation sites for MAPKs, PKC, and casein kinase II within the sequence of this orphan receptor led us to investigate phosphorylation events regulating the various COUP-TFI functions. After showing that COUP-TFI is phosphorylated in vivo, we provide evidence that in vivo inhibition of either MAPK or PKC signaling pathway leads to a specific and pronounced decrease in COUP-TFI-dependent transcriptional activation of the vitronectin gene promoter. Focusing on the molecular mechanisms underlying the MAPK- and PKC-mediated regulation of COUP-TFI activity, we show that COUP-TFI can be directly targeted by PKC and MAPK. These phosphorylation events differentially modulate COUP-TFI functions: PKC-mediated phosphorylation enhances COUP-TFI affinity for DNA and MAPK-mediated phosphorylation positively regulates the transactivation function of COUP-TFI, possibly through enhancing specific coactivator recruitment. These data provide evidence that COUP-TFI is likely to integrate distinct signaling pathways and raise the possibility that multiple extracellular signals influence biological processes controlled by COUP

  10. The metal-responsive transcription factor-1 contributes to HIF-1 activation during hypoxic stress

    SciTech Connect

    Murphy, Brian J. . E-mail: brian.murphy@sri.com; Sato, Barbara G.; Dalton, Timothy P.; Laderoute, Keith R.

    2005-11-25

    Hypoxia-inducible factor-1 (HIF-1), the major transcriptional regulator of the mammalian cellular response to low oxygen (hypoxia), is embedded within a complex network of signaling pathways. We have been investigating the importance of another stress-responsive transcription factor, MTF-1, for the adaptation of cells to hypoxia. This article reports that MTF-1 plays a central role in hypoxic cells by contributing to HIF-1 activity. Loss of MTF-1 in transformed Mtf1 null mouse embryonic fibroblasts (MEFs) results in an attenuation of nuclear HIF-1{alpha} protein accumulation, HIF-1 transcriptional activity, and expression of an established HIF-1 target gene, glucose transporter-1 (Glut1). Mtf1 null (Mtf1 KO) MEFs also have constitutively higher levels of both glutathione (GSH) and the rate-limiting enzyme involved in GSH synthesis-glutamate cysteine ligase catalytic subunit-than wild type cells. The altered cellular redox state arising from increased GSH may perturb oxygen-sensing mechanisms in hypoxic Mtf1 KO cells and decrease the accumulation of HIF-1{alpha} protein. Together, these novel findings define a role for MTF-1 in the regulation of HIF-1 activity.

  11. A Modified Reverse One-Hybrid Screen Identifies Transcriptional Activation Domains in PHYTOCHROME-INTERACTING FACTOR 3

    PubMed Central

    Dalton, Jutta C.; Bätz, Ulrike; Liu, Jason; Curie, Gemma L.; Quail, Peter H.

    2016-01-01

    Transcriptional activation domains (TADs) are difficult to predict and identify, since they are not conserved and have little consensus. Here, we describe a yeast-based screening method that is able to identify individual amino acid residues involved in transcriptional activation in a high throughput manner. A plant transcriptional activator, PIF3 (phytochrome interacting factor 3), was fused to the yeast GAL4-DNA-binding Domain (BD), driving expression of the URA3 (Orotidine 5′-phosphate decarboxylase) reporter, and used for negative selection on 5-fluroorotic acid (5FOA). Randomly mutagenized variants of PIF3 were then selected for a loss or reduction in transcriptional activation activity by survival on FOA. In the process, we developed a strategy to eliminate false positives from negative selection that can be used for both reverse-1- and 2-hybrid screens. With this method we were able to identify two distinct regions in PIF3 with transcriptional activation activity, both of which are functionally conserved in PIF1, PIF4, and PIF5. Both are collectively necessary for full PIF3 transcriptional activity, but neither is sufficient to induce transcription autonomously. We also found that the TAD appear to overlap physically with other PIF3 functions, such as phyB binding activity and consequent phosphorylation. Our protocol should provide a valuable tool for identifying, analyzing and characterizing novel TADs in eukaryotic transcription factors, and thus potentially contribute to the unraveling of the mechanism underlying transcriptional activation. PMID:27379152

  12. Acetylation-deacetylation of the transcription factor Nrf2 (nuclear factor erythroid 2-related factor 2) regulates its transcriptional activity and nucleocytoplasmic localization.

    PubMed

    Kawai, Yumiko; Garduño, Lakisha; Theodore, Melanie; Yang, Jianqi; Arinze, Ifeanyi J

    2011-03-01

    Activation of Nrf2 by covalent modifications that release it from its inhibitor protein Keap1 has been extensively documented. In contrast, covalent modifications that may regulate its action after its release from Keap1 have received little attention. Here we show that CREB-binding protein induced acetylation of Nrf2, increased binding of Nrf2 to its cognate response element in a target gene promoter, and increased Nrf2-dependent transcription from target gene promoters. Heterologous sirtuin 1 (SIRT1) decreased acetylation of Nrf2 as well as Nrf2-dependent gene transcription, and its effects were overridden by dominant negative SIRT1 (SIRT1-H355A). The SIRT1-selective inhibitors EX-527 and nicotinamide stimulated Nrf2-dependent gene transcription, whereas resveratrol, a putative activator of SIRT1, was inhibitory, mimicking the effect of SIRT1. Mutating lysine to alanine or to arginine at Lys(588) and Lys(591) of Nrf2 resulted in decreased Nrf2-dependent gene transcription and abrogated the transcription-activating effect of CREB-binding protein. Furthermore, SIRT1 had no effect on transcription induced by these mutants, indicating that these sites are acetylation sites. Microscope imaging of GFP-Nrf2 in HepG2 cells as well as immunoblotting for Nrf2 showed that acetylation conditions resulted in increased nuclear localization of Nrf2, whereas deacetylation conditions enhanced its cytoplasmic rather than its nuclear localization. We posit that Nrf2 in the nucleus undergoes acetylation, resulting in binding, with basic-region leucine zipper protein(s), to the antioxidant response element and consequently in gene transcription, whereas deacetylation disengages it from the antioxidant response element, thereby resulting in transcriptional termination and subsequently in its nuclear export. PMID:21196497

  13. Genetic factors affecting gene transcription and catalytic activity of UDP-glucuronosyltransferases in human liver

    PubMed Central

    Liu, Wanqing; Ramírez, Jacqueline; Gamazon, Eric R.; Mirkov, Snezana; Chen, Peixian; Wu, Kehua; Sun, Chang; Cox, Nancy J.; Cook, Edwin; Das, Soma; Ratain, Mark J.

    2014-01-01

    The aim of this study was to discover cis- and trans-acting factors significantly affecting mRNA expression and catalytic activity of human hepatic UDP-glucuronosyltransferases (UGTs). Transcription levels of five major hepatic UGT1A (UGT1A1, UGT1A3, UGT1A4, UGT1A6 and UGT1A9) and five UGT2B (UGT2B4, UGT2B7, UGT2B10, UGT2B15 and UGT2B17) genes were quantified in human liver tissue samples (n = 125) using real-time PCR. Glucuronidation activities of 14 substrates were measured in 47 livers. We genotyped 167 tagSNPs (single-nucleotide polymorphisms) in UGT1A (n = 43) and UGT2B (n = 124), as well as the known functional UGT1A1*28 and UGT2B17 CNV (copy number variation) polymorphisms. Transcription levels of 15 transcription factors (TFs) known to regulate these UGTs were quantified. We found that UGT expression and activity were highly variable among the livers (median and range of coefficient of variations: 135%, 74–217% and 52%, 39–105%, respectively). CAR, PXR and ESR1 were found to be the most important trans-regulators of UGT transcription (median and range of correlation coefficients: 46%, 6–58%; 47%, 9–58%; and 52%, 24–75%, respectively). Hepatic UGT activities were mainly determined by UGT gene transcription levels. Twenty-one polymorphisms were significantly (FDR-adjusted P < 0.05) associated with mRNA expression and/or activities of UGT1A1, UGT1A3 and UGT2B17. We found novel SNPs in the UGT2B17 CNV region accounting for variability in UGT2B17 gene transcription and testosterone glucuronidation rate, in addition to that attributable to the UGT2B17 CNV. Our study discovered novel pharmacogenetic markers and provided detailed insight into the genetic network regulating hepatic UGTs. PMID:24879639

  14. Activated STAT1 Transcription Factors Conduct Distinct Saltatory Movements in the Cell Nucleus

    PubMed Central

    Speil, Jasmin; Baumgart, Eugen; Siebrasse, Jan-Peter; Veith, Roman; Vinkemeier, Uwe; Kubitscheck, Ulrich

    2011-01-01

    The activation of STAT transcription factors is a critical determinant of their subcellular distribution and their ability to regulate gene expression. Yet, it is not known how activation affects the behavior of individual STAT molecules in the cytoplasm and nucleus. To investigate this issue, we injected fluorescently labeled STAT1 in living HeLa cells and traced them by single-molecule microscopy. We determined that STAT1 moved stochastically in the cytoplasm and nucleus with very short residence times (<0.03 s) before activation. Upon activation, STAT1 mobility in the cytoplasm decreased ∼2.5-fold, indicating reduced movement of STAT1/importinα/β complexes to the nucleus. In the nucleus, activated STAT1 displayed a distinct saltatory mobility, with residence times of up to 5 s and intermittent diffusive motion. In this manner, activated STAT1 factors can occupy their putative chromatin target sites within ∼2 s. These results provide a better understanding of the timescales on which cellular signaling and regulated gene transcription operate at the single-molecule level. PMID:22261046

  15. Selective constraints on the activation domain of transcription factor Pit-1.

    PubMed Central

    Majumdar, S; Irwin, D M; Elsholtz, H P

    1996-01-01

    The POU transcription factor Pit-1 activates members of the prolactin/growth hormone gene family in specific endocrine cell types of the pituitary gland. Although Pit-1 is structurally conserved among vertebrate species, evolutionary changes in the pattern of Pit-1 RNA splicing have led to a notable "contraction" of the transactivation domain in the mammalian lineage, relative to Pit-1 in salmonid fish. By site-directed mutagenesis we demonstrate that two splice insertions in salmon Pit-1, called beta (29 aa) and gamma (33 aa), are critical for cooperative activation of the salmon prolactin gene. Paradoxically, Pit-1-dependent activation of the prolactin gene in rat is enhanced in the absence of the homologous beta-insert sequence. This apparent divergence in the mechanism of activation of prolactin genes by Pit-1 is target gene specific, as activation of rat and salmon growth hormone genes by Pit-1 splice variants is entirely conserved. Our data suggest that efficient activation of the prolactin gene in the vertebrate pituitary has significantly constrained the pattern of splicing within the Pit-1 transactivation domain. Rapid evolutionary divergence of prolactin gene function may have demanded changes in Pit-1/protein interactions to accommodate new patterns of transcriptional control by developmental or physiological factors. Images Fig. 2 Fig. 3 Fig. 4 PMID:8816787

  16. Prolyl 4-hydroxylase activity-responsive transcription factors: From hydroxylation to gene expression and neuroprotection

    PubMed Central

    Siddiq, Ambreena; Aminova, Leila R; Ratan, Rajiv R

    2008-01-01

    Most homeostatic processes including gene transcription occur as a result of deviations in physiological tone that threatens the survival of the organism. A prototypical homeostatic stress response includes changes in gene expression following alterations in oxygen, iron or 2-oxoglutarate levels. Each of these cofactors plays an important role in cellular metabolism. Accordingly, a family of enzymes known as the Prolyl 4-hydroxylase (PHD) enzymes are a group of dioxygenases that have evolved to sense changes in 2-oxoglutarate, oxygen and iron via changes in enzyme activity. Indeed, PHDs are a part of an established oxygen sensor system that regulates transcriptional regulation of hypoxia/stress-regulated genes and thus are an important component of events leading to cellular rescue from oxygen, iron or 2-oxoglutarate deprivations. The ability of PHD activity to regulate homeostatic responses to oxygen, iron or 2-oxoglutarate metabolism has led to the development of small molecule inhibitors of the PHDs as a strategy for activating or augmenting cellular stress responses. These small molecules are proving effective in preclinical models of stroke and Parkinson's disease. However the precise protective pathways engaged by PHD inhibition are only beginning to be defined. In the current review, we summarize the role of iron, 2-oxoglutarate and oxygen in the PHD catalyzed hydroxylation reaction and provide a brief discussion of some of the transcription factors that play an effective role in neuroprotection against oxidative stress as a result of changes in PHD activity. PMID:17981760

  17. Thioredoxin-interacting protein inhibits hypoxia-inducible factor transcriptional activity.

    PubMed

    Farrell, Michael R; Rogers, Lynette K; Liu, Yusen; Welty, Stephen E; Tipple, Trent E

    2010-11-15

    Vascular endothelial growth factor (VEGF) is required for proper lung development and is transcriptionally regulated in alveolar epithelial cells by hypoxia-inducible factor (HIF). Previous findings in a newborn mouse model of bronchopulmonary dysplasia (BPD) suggest that thioredoxin-interacting protein (Txnip) is a novel regulator of VEGF expression. The present studies were designed to test the hypothesis that Txnip negatively regulates VEGF through effects on HIF-mediated gene expression. To test this hypothesis, we first examined the levels of VEGF and Txnip protein in the lungs of 1-day-old newborn mice and E19 embryos and detected a significant inverse correlation. To elucidate the mechanisms underlying this relationship, we studied the effects of Txnip overexpression on HIF-mediated transcription using murine lung epithelial (MLE-12) cells. Overexpression of Txnip inhibited HIF-mediated reporter activity in both hypoxia and room air. Suppression of HIF activity by Txnip seemed to be independent of the ability of Txnip to bind to thioredoxin. Thus, our studies support a model in which Txnip is a potentially critical regulator of HIF-mediated gene transcription in the murine lung. Alterations in Txnip expression could alter lung VEGF expression in prematurely born human infants and contribute to the development of BPD. PMID:20692333

  18. Src tyrosine kinase signaling antagonizes nuclear localization of FOXO and inhibits its transcription factor activity.

    PubMed

    Bülow, Margret H; Bülow, Torsten R; Hoch, Michael; Pankratz, Michael J; Jünger, Martin A

    2014-01-01

    Biochemical experiments in mammalian cells have linked Src family kinase activity to the insulin signaling pathway. To explore the physiological link between Src and a central insulin pathway effector, we investigated the effect of different Src signaling levels on the Drosophila transcription factor dFOXO in vivo. Ectopic activation of Src42A in the starved larval fatbody was sufficient to drive dFOXO out of the nucleus. When Src signaling levels were lowered by means of loss-of-function mutations or pharmacological inhibition, dFOXO localization was shifted to the nucleus in growing animals, and transcription of the dFOXO target genes d4E-BP and dInR was induced. dFOXO loss-of-function mutations rescued the induction of dFOXO target gene expression and the body size reduction of Src42A mutant larvae, establishing dFOXO as a critical downstream effector of Src signaling. Furthermore, we provide evidence that the regulation of FOXO transcription factors by Src is evolutionarily conserved in mammalian cells. PMID:24513978

  19. HEMERA Couples the Proteolysis and Transcriptional Activity of PHYTOCHROME INTERACTING FACTORs in Arabidopsis Photomorphogenesis

    PubMed Central

    Qiu, Yongjian; Li, Meina; Pasoreck, Elise K.; Long, Lingyun; Shi, Yiting; Galvão, Rafaelo M.; Chou, Conrad L.; Wang, He; Sun, Amanda Y.; Zhang, Yiyin C.; Jiang, Anna; Chen, Meng

    2015-01-01

    Phytochromes (phys) are red and far-red photoreceptors that control plant development and growth by promoting the proteolysis of a family of antagonistically acting basic helix-loop-helix transcription factors, the PHYTOCHROME-INTERACTING FACTORs (PIFs). We have previously shown that the degradation of PIF1 and PIF3 requires HEMERA (HMR). However, the biochemical function of HMR and the mechanism by which it mediates PIF degradation remain unclear. Here, we provide genetic evidence that HMR acts upstream of PIFs in regulating hypocotyl growth. Surprisingly, genome-wide analysis of HMR- and PIF-dependent genes reveals that HMR is also required for the transactivation of a subset of PIF direct-target genes. We show that HMR interacts with all PIFs. The HMR-PIF interaction is mediated mainly by HMR’s N-terminal half and PIFs’ conserved active-phytochrome B binding motif. In addition, HMR possesses an acidic nine-amino-acid transcriptional activation domain (9aaTAD) and a loss-of-function mutation in this 9aaTAD impairs the expression of PIF target genes and the destruction of PIF1 and PIF3. Together, these in vivo results support a regulatory mechanism for PIFs in which HMR is a transcriptional coactivator binding directly to PIFs and the 9aaTAD of HMR couples the degradation of PIF1 and PIF3 with the transactivation of PIF target genes. PMID:25944101

  20. Molecular genetics of blood-fleshed peach reveals activation of anthocyanin biosynthesis by NAC transcription factors.

    PubMed

    Zhou, Hui; Lin-Wang, Kui; Wang, Huiliang; Gu, Chao; Dare, Andrew P; Espley, Richard V; He, Huaping; Allan, Andrew C; Han, Yuepeng

    2015-04-01

    Anthocyanin pigmentation is an important consumer trait in peach (Prunus persica). In this study, the genetic basis of the blood-flesh trait was investigated using the cultivar Dahongpao, which shows high levels of cyanidin-3-glucoside in the mesocarp. Elevation of anthocyanin levels in the flesh was correlated with the expression of an R2R3 MYB transcription factor, PpMYB10.1. However, PpMYB10.1 did not co-segregate with the blood-flesh trait. The blood-flesh trait was mapped to a 200-kb interval on peach linkage group (LG) 5. Within this interval, a gene encoding a NAC domain transcription factor (TF) was found to be highly up-regulated in blood-fleshed peaches when compared with non-red-fleshed peaches. This NAC TF, designated blood (BL), acts as a heterodimer with PpNAC1 which shows high levels of expression in fruit at late developmental stages. We show that the heterodimer of BL and PpNAC1 can activate the transcription of PpMYB10.1, resulting in anthocyanin pigmentation in tobacco. Furthermore, silencing the BL gene reduces anthocyanin pigmentation in blood-fleshed peaches. The transactivation activity of the BL-PpNAC1 heterodimer is repressed by a SQUAMOSA promoter-binding protein-like TF, PpSPL1. Low levels of PpMYB10.1 expression in fruit at early developmental stages is probably attributable to lower levels of expression of PpNAC1 plus the presence of high levels of repressors such as PpSPL1. We present a mechanism whereby BL is the key gene for the blood-flesh trait in peach via its activation of PpMYB10.1 in maturing fruit. Partner TFs such as basic helix-loop-helix proteins and NAC1 are required, as is the removal of transcriptional repressors. PMID:25688923

  1. Upstream Anti-sense Promoters are Hubs of Transcription Factor Binding and Active Histone Modifications

    PubMed Central

    Scruggs, Benjamin S.; Gilchrist, Daniel A.; Nechaev, Sergei; Muse, Ginger W.; Burkholder, Adam; Fargo, David C.; Adelman, Karen

    2015-01-01

    SUMMARY Anti-sense transcription originating upstream of mammalian protein-coding genes is a well-documented phenomenon, but remarkably little is known about the regulation or function of anti-sense promoters and the non-coding RNAs they generate. Here we define at nucleotide resolution the divergent transcription start sites (TSSs) near mouse mRNA genes. We find that coupled sense and anti-sense TSSs precisely define the boundaries of a nucleosome-depleted region (NDR) that is highly enriched in transcription factor (TF) motifs. Notably, as the distance between sense and anti-sense TSSs increases, so does the size of the NDR, the level of signal-dependent TF binding and gene activation. We further discover a group of anti-sense TSSs in macrophages with an enhancer-like chromatin signature. Interestingly, this signature identifies divergent promoters that are activated during immune challenge. We propose that anti-sense promoters serve as platforms for TF binding and establishment of active chromatin to further regulate or enhance sense-strand mRNA expression. PMID:26028540

  2. Binding of basal transcription factor TFIIH to the acidic activation domains of VP16 and p53.

    PubMed Central

    Xiao, H; Pearson, A; Coulombe, B; Truant, R; Zhang, S; Regier, J L; Triezenberg, S J; Reinberg, D; Flores, O; Ingles, C J

    1994-01-01

    Acidic transcriptional activation domains function well in both yeast and mammalian cells, and some have been shown to bind the general transcription factors TFIID and TFIIB. We now show that two acidic transactivators, herpes simplex virus VP16 and human p53, directly interact with the multisubunit human general transcription factor TFIIH and its Saccharomyces cerevisiae counterpart, factor b. The VP16- and p53-binding domains in these factors lie in the p62 subunit of TFIIH and in the homologous subunit, TFB1, of factor b. Point mutations in VP16 that reduce its transactivation activity in both yeast and mammalian cells weaken its binding to both yeast and human TFIIH. This suggests that binding of activation domains to TFIIH is an important aspect of transcriptional activation. Images PMID:7935417

  3. Transgenic songbirds with suppressed or enhanced activity of CREB transcription factor.

    PubMed

    Abe, Kentaro; Matsui, Sumiko; Watanabe, Dai

    2015-06-16

    Songbirds postnatally develop their skill to utter and to perceive a vocal signal for communication. How genetic and environmental influences act in concert to regulate the development of such skill is not fully understood. Here, we report the phenotype of transgenic songbirds with altered intrinsic activity of cAMP response element-binding protein (CREB) transcription factor. By viral vector-mediated modification of genomic DNA, we established germ line-transmitted lines of zebra finches, which exhibited enhanced or suppressed activity of CREB. Although intrinsically acquired vocalizations or their hearing ability were not affected, the transgenic birds showed reduced vocal learning quality of their own songs and impaired audio-memory formation against conspecific songs. These results thus demonstrate that appropriate activity of CREB is necessary for the postnatal acquisition of learned behavior in songbirds, and the CREB transgenic birds offer a unique opportunity to separately manipulate both genetic and environmental factors that impinge on the postnatal song learning. PMID:26048905

  4. WRKY6 Transcription Factor Restricts Arsenate Uptake and Transposon Activation in Arabidopsis[W

    PubMed Central

    Castrillo, Gabriel; Sánchez-Bermejo, Eduardo; de Lorenzo, Laura; Crevillén, Pedro; Fraile-Escanciano, Ana; TC, Mohan; Mouriz, Alfonso; Catarecha, Pablo; Sobrino-Plata, Juan; Olsson, Sanna; Leo del Puerto, Yolanda; Mateos, Isabel; Rojo, Enrique; Hernández, Luis E.; Jarillo, Jose A.; Piñeiro, Manuel; Paz-Ares, Javier; Leyva, Antonio

    2013-01-01

    Stress constantly challenges plant adaptation to the environment. Of all stress types, arsenic was a major threat during the early evolution of plants. The most prevalent chemical form of arsenic is arsenate, whose similarity to phosphate renders it easily incorporated into cells via the phosphate transporters. Here, we found that arsenate stress provokes a notable transposon burst in plants, in coordination with arsenate/phosphate transporter repression, which immediately restricts arsenate uptake. This repression was accompanied by delocalization of the phosphate transporter from the plasma membrane. When arsenate was removed, the system rapidly restored transcriptional expression and membrane localization of the transporter. We identify WRKY6 as an arsenate-responsive transcription factor that mediates arsenate/phosphate transporter gene expression and restricts arsenate-induced transposon activation. Plants therefore have a dual WRKY-dependent signaling mechanism that modulates arsenate uptake and transposon expression, providing a coordinated strategy for arsenate tolerance and transposon gene silencing. PMID:23922208

  5. Reciprocal Activation of Transcription Factors Underlies the Dichotomy between Proliferation and Invasion of Glioma Cells

    PubMed Central

    Dhruv, Harshil D.; McDonough Winslow, Wendy S.; Armstrong, Brock; Tuncali, Serdar; Eschbacher, Jenny; Kislin, Kerri; Loftus, Joseph C.; Tran, Nhan L.; Berens, Michael E.

    2013-01-01

    Histology of malignant glioma depicts dense proliferative areas rich in angiogenesis as well as dissemination of neoplastic cells into adjacent brain tissue. Although the mechanisms that trigger transition from proliferative to invasive phenotypes are complex, the dichotomy of cell proliferation and migration, the “Go or Grow” hypothesis, argues for specific and coordinated regulation of these phenotypes. We investigated transcriptional elements that accompany the phenotypes of migration and proliferation, and consider the therapeutic significance of the “Go or Grow” hypothesis. Interrogation of matched core and rim regions from human glioblastoma biopsy specimens in situ (n = 44) revealed higher proliferation (Ki67 labeling index) in cells residing at the core compared to the rim. Profiling activated transcription factors in a panel of migration-activated versus migration-restricted GBM cells portrayed strong NF-κB activity in the migratory cell population. In contrast, increased c-Myc activity was found in migration-restricted proliferative cells. Validation of transcriptional activity by NF-κB- or c-Myc-driven GFP or RFP, respectively, showed an increased NF-κB activity in the active migrating cells, whereas the proliferative, migration restricted cells displayed increased c-Myc activity. Immunohistochemistry on clinical specimens validated a robust phosphorylated c-Myc staining in tumor cells at the core, whereas increased phosphorylated NF-κB staining was detected in the invasive tumor cells at the rim. Functional genomics revealed that depletion of c-Myc expression by siRNA oligonucleotides reduced cell proliferation in vitro, but surprisingly, cell migration was enhanced significantly. Conversely, inhibition of NF-κB by pharmacological inhibitors, SN50 or BAY-11, decreased both cell migration in vitro and invasion ex vivo. Notably, inhibition of NF-κB was found to have no effect on the proliferation rate of glioma cells. These findings

  6. Nerve growth factor enhances the CRE-dependent transcriptional activity activated by nobiletin in PC12 cells.

    PubMed

    Takito, Jiro; Kimura, Junko; Kajima, Koji; Uozumi, Nobuyuki; Watanabe, Makoto; Yokosuka, Akihito; Mimaki, Yoshihiro; Nakamura, Masanori; Ohizumi, Yasushi

    2016-07-01

    Prevention and treatment of Alzheimer disease are urgent problems for elderly people in developed countries. We previously reported that nobiletin, a poly-methoxylated flavone from the citrus peel, improved the symptoms in various types of animal models of memory loss and activated the cAMP responsive element (CRE)-dependent transcription in PC12 cells. Nobiletin activated the cAMP/PKA/MEK/Erk/MAPK signaling pathway without using the TrkA signaling activated by nerve growth factor (NGF). Here, we examined the effect of combination of nobiletin and NGF on the CRE-dependent transcription in PC12 cells. Although NGF alone had little effect on the CRE-dependent transcription, NGF markedly enhanced the CRE-dependent transcription induced by nobiletin. The NGF-induced enhancement was neutralized by a TrkA antagonist, K252a. This effect of NGF was effective on the early signaling event elicited by nobiletin. These results suggested that there was crosstalk between NGF and nobiletin signaling in activating the CRE-dependent transcription in PC12 cells. PMID:27128150

  7. Activating Transcription Factor 6 Is Necessary and Sufficient for Alcoholic Fatty Liver Disease in Zebrafish

    PubMed Central

    Howarth, Deanna L.; Lindtner, Claudia; Vacaru, Ana M.; Sachidanandam, Ravi; Tsedensodnom, Orkhontuya; Vasilkova, Taisa; Buettner, Christoph; Sadler, Kirsten C.

    2014-01-01

    Fatty liver disease (FLD) is characterized by lipid accumulation in hepatocytes and is accompanied by secretory pathway dysfunction, resulting in induction of the unfolded protein response (UPR). Activating transcription factor 6 (ATF6), one of three main UPR sensors, functions to both promote FLD during acute stress and reduce FLD during chronic stress. There is little mechanistic understanding of how ATF6, or any other UPR factor, regulates hepatic lipid metabolism to cause disease. We addressed this using zebrafish genetics and biochemical analyses and demonstrate that Atf6 is necessary and sufficient for FLD. atf6 transcription is significantly upregulated in the liver of zebrafish with alcoholic FLD and morpholino-mediated atf6 depletion significantly reduced steatosis incidence caused by alcohol. Moreover, overexpression of active, nuclear Atf6 (nAtf6) in hepatocytes caused FLD in the absence of stress. mRNA-Seq and qPCR analyses of livers from five day old nAtf6 transgenic larvae revealed upregulation of genes promoting glyceroneogenesis and fatty acid elongation, including fatty acid synthase (fasn), and nAtf6 overexpression in both zebrafish larvae and human hepatoma cells increased the incorporation of 14C-acetate into lipids. Srebp transcription factors are key regulators of lipogenic enzymes, but reducing Srebp activation by scap morpholino injection neither prevented FLD in nAtf6 transgenics nor synergized with atf6 knockdown to reduce alcohol-induced FLD. In contrast, fasn morpholino injection reduced FLD in nAtf6 transgenic larvae and synergistically interacted with atf6 to reduce alcoholic FLD. Thus, our data demonstrate that Atf6 is required for alcoholic FLD and epistatically interacts with fasn to cause this disease, suggesting triglyceride biogenesis as the mechanism of UPR induced FLD. PMID:24874946

  8. Molecular Genetic Analysis of Activation-tagged Transcription Factors Thought to be Involved in Photomorphogenesis

    SciTech Connect

    Neff, Michael

    2011-06-23

    Plants utilize light as a source of information via families of photoreceptors such as the red/far-red absorbing phytochromes (PHY) and the blue/UVA absorbing cryptochromes (CRY). The main goal of the Neff lab is to use molecular-genetic mutant screens to elucidate signaling components downstream of these photoreceptors. Activation-tagging mutagenesis led to the identification of two putative transcription factors that may be involved in both photomorphogenesis and hormone signaling pathways. sob1-D (suppressor of phyB-dominant) mutant phenotypes are caused by the over-expression of a Dof transcription factor previously named OBP3. Our previous studies indicate that OBP3 is a negative regulator of light-mediated cotyledon expansion and may be involved in modulating responsiveness to the growth-regulating hormone auxin. The sob2-D mutant uncovers a role for LEP, a putative AP2/EREBP-like transcription factor, in seed germination, hypocotyl elongation and responsiveness to the hormone abscisic acid. Based on photobiological and genetic analysis of OBP3-knockdown and LEP-null mutations, we hypothesize that these transcription factors are involved in both light-mediated seedling development and hormone signaling. To examine the role that these genes play in photomorphogenesis we will: 1) Further explore the genetic role of OBP3 in cotyledon/leaf expansion and other photomorphogenic processes as well as examine potential physical interactions between OBP3 and CRY1 or other signaling components that genetically interact with this transcription factor 2) Test the hypothesis that OBP3 is genetically involved in auxin signaling and root development as well as examine the affects of this hormone and light on OBP3 protein accumulation. 3) Test the hypothesis that LEP is involved in seed germination, seedling photomorphogenesis and hormone signaling. Together these experiments will lead to a greater understanding of the complexity of interactions between photoreceptors and DNA

  9. On involvement of transcription factors nuclear factor kappa-light-chain-enhancer of activated B cells, activator protein-1 and signal transducer and activator of transcription-3 in photodynamic therapy-induced death of crayfish neurons and satellite glial cells.

    PubMed

    Berezhnaya, Elena; Neginskaya, Marya; Kovaleva, Vera; Sharifulina, Svetlana; Ischenko, Irina; Komandirov, Maxim; Rudkovskii, Mikhail; Uzdensky, Anatoly B

    2015-07-01

    Photodynamic therapy (PDT) is currently used in the treatment of brain tumors. However, not only malignant cells but also neighboring normal neurons and glial cells are damaged during PDT. In order to study the potential role of transcription factors-nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB), activator protein (AP-1), and signal transducer and activator of transcription-3 (STAT-3)-in photodynamic injury of normal neurons and glia, we photosensitized the isolated crayfish mechanoreceptor consisting of a single sensory neuron enveloped by glial cells. Application of different inhibitors and activators showed that transcription factors NF-κB (inhibitors caffeic acid phenethyl ester and parthenolide, activator betulinic acid), AP-1 (inhibitor SR11302), and STAT-3 (inhibitors stattic and cucurbitacine) influenced PDT-induced death and survival of neurons and glial cells in different ways. These experiments indicated involvement of NF-κB in PDT-induced necrosis of neurons and apoptosis of glial cells. However, in glial cells, it played the antinecrotic role. AP-1 was not involved in PDT-induced necrosis of neurons and glia, but mediated glial apoptosis. STAT-3 was involved in PDT-induced apoptosis of glial cells and necrosis of neurons and glia. Therefore, signaling pathways that regulate cell death and survival in neurons and glial cells are different. Using various inhibitors or activators of transcription factors, one can differently influence the sensitivity and resistance of neurons and glial cells to PDT. PMID:26160345

  10. On involvement of transcription factors nuclear factor kappa-light-chain-enhancer of activated B cells, activator protein-1 and signal transducer and activator of transcription-3 in photodynamic therapy-induced death of crayfish neurons and satellite glial cells

    NASA Astrophysics Data System (ADS)

    Berezhnaya, Elena; Neginskaya, Marya; Kovaleva, Vera; Sharifulina, Svetlana; Ischenko, Irina; Komandirov, Maxim; Rudkovskii, Mikhail; Uzdensky, Anatoly B.

    2015-07-01

    Photodynamic therapy (PDT) is currently used in the treatment of brain tumors. However, not only malignant cells but also neighboring normal neurons and glial cells are damaged during PDT. In order to study the potential role of transcription factors-nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB), activator protein (AP-1), and signal transducer and activator of transcription-3 (STAT-3)-in photodynamic injury of normal neurons and glia, we photosensitized the isolated crayfish mechanoreceptor consisting of a single sensory neuron enveloped by glial cells. Application of different inhibitors and activators showed that transcription factors NF-κB (inhibitors caffeic acid phenethyl ester and parthenolide, activator betulinic acid), AP-1 (inhibitor SR11302), and STAT-3 (inhibitors stattic and cucurbitacine) influenced PDT-induced death and survival of neurons and glial cells in different ways. These experiments indicated involvement of NF-κB in PDT-induced necrosis of neurons and apoptosis of glial cells. However, in glial cells, it played the antinecrotic role. AP-1 was not involved in PDT-induced necrosis of neurons and glia, but mediated glial apoptosis. STAT-3 was involved in PDT-induced apoptosis of glial cells and necrosis of neurons and glia. Therefore, signaling pathways that regulate cell death and survival in neurons and glial cells are different. Using various inhibitors or activators of transcription factors, one can differently influence the sensitivity and resistance of neurons and glial cells to PDT.

  11. The Activating Transcription Factor 3 Protein Suppresses the Oncogenic Function of Mutant p53 Proteins*

    PubMed Central

    Wei, Saisai; Wang, Hongbo; Lu, Chunwan; Malmut, Sarah; Zhang, Jianqiao; Ren, Shumei; Yu, Guohua; Wang, Wei; Tang, Dale D.; Yan, Chunhong

    2014-01-01

    Mutant p53 proteins (mutp53) often acquire oncogenic activities, conferring drug resistance and/or promoting cancer cell migration and invasion. Although it has been well established that such a gain of function is mainly achieved through interaction with transcriptional regulators, thereby modulating cancer-associated gene expression, how the mutp53 function is regulated remains elusive. Here we report that activating transcription factor 3 (ATF3) bound common mutp53 (e.g. R175H and R273H) and, subsequently, suppressed their oncogenic activities. ATF3 repressed mutp53-induced NFKB2 expression and sensitized R175H-expressing cancer cells to cisplatin and etoposide treatments. Moreover, ATF3 appeared to suppress R175H- and R273H-mediated cancer cell migration and invasion as a consequence of preventing the transcription factor p63 from inactivation by mutp53. Accordingly, ATF3 promoted the expression of the metastasis suppressor SHARP1 in mutp53-expressing cells. An ATF3 mutant devoid of the mutp53-binding domain failed to disrupt the mutp53-p63 binding and, thus, lost the activity to suppress mutp53-mediated migration, suggesting that ATF3 binds to mutp53 to suppress its oncogenic function. In line with these results, we found that down-regulation of ATF3 expression correlated with lymph node metastasis in TP53-mutated human lung cancer. We conclude that ATF3 can suppress mutp53 oncogenic function, thereby contributing to tumor suppression in TP53-mutated cancer. PMID:24554706

  12. The Transcriptional Activator Krüppel-like Factor-6 Is Required for CNS Myelination

    PubMed Central

    Mariani, John N.; Zhang, Jingya; Liu, Jia; Sawai, Setsu; Chapouly, Candice; Horng, Sam; Kramer, Elisabeth G.; Loo, Hannah; Burlant, Natalie; Nudelman, German; Lee, Young-Min; Braun, David A.; Lu, Q. Richard; Narla, Goutham; Raine, Cedric S.; Friedman, Scott L.; Casaccia, Patrizia; John, Gareth R.

    2016-01-01

    Growth factors of the gp130 family promote oligodendrocyte differentiation, and viability, and myelination, but their mechanisms of action are incompletely understood. Here, we show that these effects are coordinated, in part, by the transcriptional activator Krüppel-like factor-6 (Klf6). Klf6 is rapidly induced in oligodendrocyte progenitors (OLP) by gp130 factors, and promotes differentiation. Conversely, in mice with lineage-selective Klf6 inactivation, OLP undergo maturation arrest followed by apoptosis, and CNS myelination fails. Overlapping transcriptional and chromatin occupancy analyses place Klf6 at the nexus of a novel gp130-Klf-importin axis, which promotes differentiation and viability in part via control of nuclear trafficking. Klf6 acts as a gp130-sensitive transactivator of the nuclear import factor importin-α5 (Impα5), and interfering with this mechanism interrupts step-wise differentiation. Underscoring the significance of this axis in vivo, mice with conditional inactivation of gp130 signaling display defective Klf6 and Impα5 expression, OLP maturation arrest and apoptosis, and failure of CNS myelination. PMID:27213272

  13. The Transcriptional Activator Krüppel-like Factor-6 Is Required for CNS Myelination.

    PubMed

    Laitman, Benjamin M; Asp, Linnéa; Mariani, John N; Zhang, Jingya; Liu, Jia; Sawai, Setsu; Chapouly, Candice; Horng, Sam; Kramer, Elisabeth G; Mitiku, Nesanet; Loo, Hannah; Burlant, Natalie; Pedre, Xiomara; Hara, Yuko; Nudelman, German; Zaslavsky, Elena; Lee, Young-Min; Braun, David A; Lu, Q Richard; Narla, Goutham; Raine, Cedric S; Friedman, Scott L; Casaccia, Patrizia; John, Gareth R

    2016-05-01

    Growth factors of the gp130 family promote oligodendrocyte differentiation, and viability, and myelination, but their mechanisms of action are incompletely understood. Here, we show that these effects are coordinated, in part, by the transcriptional activator Krüppel-like factor-6 (Klf6). Klf6 is rapidly induced in oligodendrocyte progenitors (OLP) by gp130 factors, and promotes differentiation. Conversely, in mice with lineage-selective Klf6 inactivation, OLP undergo maturation arrest followed by apoptosis, and CNS myelination fails. Overlapping transcriptional and chromatin occupancy analyses place Klf6 at the nexus of a novel gp130-Klf-importin axis, which promotes differentiation and viability in part via control of nuclear trafficking. Klf6 acts as a gp130-sensitive transactivator of the nuclear import factor importin-α5 (Impα5), and interfering with this mechanism interrupts step-wise differentiation. Underscoring the significance of this axis in vivo, mice with conditional inactivation of gp130 signaling display defective Klf6 and Impα5 expression, OLP maturation arrest and apoptosis, and failure of CNS myelination. PMID:27213272

  14. REACTIN: Regulatory activity inference of transcription factors underlying human diseases with application to breast cancer

    PubMed Central

    2013-01-01

    Background Genetic alterations of transcription factors (TFs) have been implicated in the tumorigenesis of cancers. In many cancers, alteration of TFs results in aberrant activity of them without changing their gene expression level. Gene expression data from microarray or RNA-seq experiments can capture the expression change of genes, however, it is still challenge to reveal the activity change of TFs. Results Here we propose a method, called REACTIN (REgulatory ACTivity INference), which integrates TF binding data with gene expression data to identify TFs with significantly differential activity between disease and normal samples. REACTIN successfully detect differential activity of estrogen receptor (ER) between ER+ and ER- samples in 10 breast cancer datasets. When applied to compare tumor and normal breast samples, it reveals TFs that are critical for carcinogenesis of breast cancer. Moreover, Reaction can be utilized to identify transcriptional programs that are predictive to patient survival time of breast cancer patients. Conclusions REACTIN provides a useful tool to investigate regulatory programs underlying a biological process providing the related case and control gene expression data. Considering the enormous amount of cancer gene expression data and the increasingly accumulating ChIP-seq data, we expect wide application of REACTIN for revealing the regulatory mechanisms of various diseases. PMID:23885756

  15. The Transcription Factor Encyclopedia

    PubMed Central

    2012-01-01

    Here we present the Transcription Factor Encyclopedia (TFe), a new web-based compendium of mini review articles on transcription factors (TFs) that is founded on the principles of open access and collaboration. Our consortium of over 100 researchers has collectively contributed over 130 mini review articles on pertinent human, mouse and rat TFs. Notable features of the TFe website include a high-quality PDF generator and web API for programmatic data retrieval. TFe aims to rapidly educate scientists about the TFs they encounter through the delivery of succinct summaries written and vetted by experts in the field. TFe is available at http://www.cisreg.ca/tfe. PMID:22458515

  16. The transcription factor encyclopedia.

    PubMed

    Yusuf, Dimas; Butland, Stefanie L; Swanson, Magdalena I; Bolotin, Eugene; Ticoll, Amy; Cheung, Warren A; Zhang, Xiao Yu Cindy; Dickman, Christopher T D; Fulton, Debra L; Lim, Jonathan S; Schnabl, Jake M; Ramos, Oscar H P; Vasseur-Cognet, Mireille; de Leeuw, Charles N; Simpson, Elizabeth M; Ryffel, Gerhart U; Lam, Eric W-F; Kist, Ralf; Wilson, Miranda S C; Marco-Ferreres, Raquel; Brosens, Jan J; Beccari, Leonardo L; Bovolenta, Paola; Benayoun, Bérénice A; Monteiro, Lara J; Schwenen, Helma D C; Grontved, Lars; Wederell, Elizabeth; Mandrup, Susanne; Veitia, Reiner A; Chakravarthy, Harini; Hoodless, Pamela A; Mancarelli, M Michela; Torbett, Bruce E; Banham, Alison H; Reddy, Sekhar P; Cullum, Rebecca L; Liedtke, Michaela; Tschan, Mario P; Vaz, Michelle; Rizzino, Angie; Zannini, Mariastella; Frietze, Seth; Farnham, Peggy J; Eijkelenboom, Astrid; Brown, Philip J; Laperrière, David; Leprince, Dominique; de Cristofaro, Tiziana; Prince, Kelly L; Putker, Marrit; del Peso, Luis; Camenisch, Gieri; Wenger, Roland H; Mikula, Michal; Rozendaal, Marieke; Mader, Sylvie; Ostrowski, Jerzy; Rhodes, Simon J; Van Rechem, Capucine; Boulay, Gaylor; Olechnowicz, Sam W Z; Breslin, Mary B; Lan, Michael S; Nanan, Kyster K; Wegner, Michael; Hou, Juan; Mullen, Rachel D; Colvin, Stephanie C; Noy, Peter John; Webb, Carol F; Witek, Matthew E; Ferrell, Scott; Daniel, Juliet M; Park, Jason; Waldman, Scott A; Peet, Daniel J; Taggart, Michael; Jayaraman, Padma-Sheela; Karrich, Julien J; Blom, Bianca; Vesuna, Farhad; O'Geen, Henriette; Sun, Yunfu; Gronostajski, Richard M; Woodcroft, Mark W; Hough, Margaret R; Chen, Edwin; Europe-Finner, G Nicholas; Karolczak-Bayatti, Magdalena; Bailey, Jarrod; Hankinson, Oliver; Raman, Venu; LeBrun, David P; Biswal, Shyam; Harvey, Christopher J; DeBruyne, Jason P; Hogenesch, John B; Hevner, Robert F; Héligon, Christophe; Luo, Xin M; Blank, Marissa Cathleen; Millen, Kathleen Joyce; Sharlin, David S; Forrest, Douglas; Dahlman-Wright, Karin; Zhao, Chunyan; Mishima, Yuriko; Sinha, Satrajit; Chakrabarti, Rumela; Portales-Casamar, Elodie; Sladek, Frances M; Bradley, Philip H; Wasserman, Wyeth W

    2012-01-01

    Here we present the Transcription Factor Encyclopedia (TFe), a new web-based compendium of mini review articles on transcription factors (TFs) that is founded on the principles of open access and collaboration. Our consortium of over 100 researchers has collectively contributed over 130 mini review articles on pertinent human, mouse and rat TFs. Notable features of the TFe website include a high-quality PDF generator and web API for programmatic data retrieval. TFe aims to rapidly educate scientists about the TFs they encounter through the delivery of succinct summaries written and vetted by experts in the field. TFe is available at http://www.cisreg.ca/tfe. PMID:22458515

  17. Conserved and Diverged Functions of the Calcineurin-Activated Prz1 Transcription Factor in Fission Yeast.

    PubMed

    Chatfield-Reed, Kate; Vachon, Lianne; Kwon, Eun-Joo Gina; Chua, Gordon

    2016-04-01

    Gene regulation in response to intracellular calcium is mediated by the calcineurin-activated transcription factor Prz1 in the fission yeastSchizosaccharomyces pombe Genome-wide studies of theCrz1and CrzA fungal orthologs have uncovered numerous target genes involved in conserved and species-specific cellular processes. In contrast, very few target genes of Prz1 have been published. This article identifies an extensive list of genes using transcriptome and ChIP-chip analyses under inducing conditions of Prz1, including CaCl2and tunicamycin treatment, as well as a∆pmr1genetic background. We identified 165 upregulated putative target genes of Prz1 in which the majority contained a calcium-dependent response element in their promoters, similar to that of theSaccharomyces cerevisiaeorthologCrz1 These genes were functionally enriched forCrz1-conserved processes such as cell-wall biosynthesis. Overexpression ofprz1(+)increased resistance to the cell-wall degradation enzyme zymolyase, likely from upregulation of theO-mannosyltransferase encoding geneomh1(+) Loss ofomh1(+)abrogates this phenotype. We uncovered a novel inhibitory role in flocculation for Prz1. Loss ofprz1(+)resulted in constitutive flocculation and upregulation of genes encoding the flocculins Gsf2 and Pfl3, as well as the transcription factor Cbf12. The constitutive flocculation of the∆prz1strain was abrogated by the loss ofgsf2(+)orcbf12(+) This study reveals that Prz1 functions as a positive and negative transcriptional regulator of genes involved in cell-wall biosynthesis and flocculation, respectively. Moreover, comparison of target genes betweenCrz1/CrzA and Prz1 indicate some conservation in DNA-binding specificity, but also substantial rewiring of the calcineurin-mediated transcriptional regulatory network. PMID:26896331

  18. Conserved and Diverged Functions of the Calcineurin-Activated Prz1 Transcription Factor in Fission Yeast

    PubMed Central

    Chatfield-Reed, Kate; Vachon, Lianne; Kwon, Eun-Joo Gina; Chua, Gordon

    2016-01-01

    Gene regulation in response to intracellular calcium is mediated by the calcineurin-activated transcription factor Prz1 in the fission yeast Schizosaccharomyces pombe. Genome-wide studies of the Crz1 and CrzA fungal orthologs have uncovered numerous target genes involved in conserved and species-specific cellular processes. In contrast, very few target genes of Prz1 have been published. This article identifies an extensive list of genes using transcriptome and ChIP-chip analyses under inducing conditions of Prz1, including CaCl2 and tunicamycin treatment, as well as a ∆pmr1 genetic background. We identified 165 upregulated putative target genes of Prz1 in which the majority contained a calcium-dependent response element in their promoters, similar to that of the Saccharomyces cerevisiae ortholog Crz1. These genes were functionally enriched for Crz1-conserved processes such as cell-wall biosynthesis. Overexpression of prz1+ increased resistance to the cell-wall degradation enzyme zymolyase, likely from upregulation of the O-mannosyltransferase encoding gene omh1+. Loss of omh1+ abrogates this phenotype. We uncovered a novel inhibitory role in flocculation for Prz1. Loss of prz1+ resulted in constitutive flocculation and upregulation of genes encoding the flocculins Gsf2 and Pfl3, as well as the transcription factor Cbf12. The constitutive flocculation of the ∆prz1 strain was abrogated by the loss of gsf2+ or cbf12+. This study reveals that Prz1 functions as a positive and negative transcriptional regulator of genes involved in cell-wall biosynthesis and flocculation, respectively. Moreover, comparison of target genes between Crz1/CrzA and Prz1 indicate some conservation in DNA-binding specificity, but also substantial rewiring of the calcineurin-mediated transcriptional regulatory network. PMID:26896331

  19. The oncoprotein HBXIP upregulates PDGFB via activating transcription factor Sp1 to promote the proliferation of breast cancer cells

    SciTech Connect

    Zhang, Yingyi; Zhao, Yu; Li, Leilei; Shen, Yu; Cai, Xiaoli; Zhang, Xiaodong; Ye, Lihong

    2013-05-03

    Highlights: •HBXIP is able to upregulate the expression of PDGFB in breast cancer cells. •HBXIP serves as a coactivator of activating transcription factor Sp1. •HBXIP stimulates the PDGFB promoter via activating transcription factor Sp1. •HBXIP promotes the proliferation of breast cancer cell via upregulating PDGFB. -- Abstract: We have reported that the oncoprotein hepatitis B virus X-interacting protein (HBXIP) acts as a novel transcriptional coactivator to promote proliferation and migration of breast cancer cells. Previously, we showed that HBXIP was able to activate nuclear factor-κB (NF-κB) in breast cancer cells. As an oncogene, the platelet-derived growth factor beta polypeptide (PDGFB) plays crucial roles in carcinogenesis. In the present study, we found that both HBXIP and PDGFB were highly expressed in breast cancer cell lines. Interestingly, HBXIP was able to increase transcriptional activity of NF-κB through PDGFB, suggesting that HBXIP is associated with PDGFB in the cells. Moreover, HBXIP was able to upregulate PDGFB at the levels of mRNA, protein and promoter in the cells. Then, we identified that HBXIP stimulated the promoter of PDGFB through activating transcription factor Sp1. In function, HBXIP enhanced the proliferation of breast cancer cells through PDGFB in vitro. Thus, we conclude that HBXIP upregulates PDGFB via activating transcription factor Sp1 to promote proliferation of breast cancer cells.

  20. A modified reverse one-hybrid screen identifies transcriptional activation in Phyochrome-Interacting Factor 3

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Transcriptional activation domains (TAD) are difficult to predict and identify, since they are not conserved and have little consensus. Here, we describe a yeast-based screening method that is able to identify individual amino acid residues involved in transcriptional activation in a high throughput...

  1. Regulation of WRKY46 Transcription Factor Function by Mitogen-Activated Protein Kinases in Arabidopsis thaliana.

    PubMed

    Sheikh, Arsheed H; Eschen-Lippold, Lennart; Pecher, Pascal; Hoehenwarter, Wolfgang; Sinha, Alok K; Scheel, Dierk; Lee, Justin

    2016-01-01

    Mitogen-activated protein kinase (MAPK) cascades are central signaling pathways activated in plants after sensing internal developmental and external stress cues. Knowledge about the downstream substrate proteins of MAPKs is still limited in plants. We screened Arabidopsis WRKY transcription factors as potential targets downstream of MAPKs, and concentrated on characterizing WRKY46 as a substrate of the MAPK, MPK3. Mass spectrometry revealed in vitro phosphorylation of WRKY46 at amino acid position S168 by MPK3. However, mutagenesis studies showed that a second phosphosite, S250, can also be phosphorylated. Elicitation with pathogen-associated molecular patterns (PAMPs), such as the bacterial flagellin-derived flg22 peptide led to in vivo destabilization of WRKY46 in Arabidopsis protoplasts. Mutation of either phosphorylation site reduced the PAMP-induced degradation of WRKY46. Furthermore, the protein for the double phosphosite mutant is expressed at higher levels compared to wild-type proteins or single phosphosite mutants. In line with its nuclear localization and predicted function as a transcriptional activator, overexpression of WRKY46 in protoplasts raised basal plant defense as reflected by the increase in promoter activity of the PAMP-responsive gene, NHL10, in a MAPK-dependent manner. Thus, MAPK-mediated regulation of WRKY46 is a mechanism to control plant defense. PMID:26870073

  2. Regulation of WRKY46 Transcription Factor Function by Mitogen-Activated Protein Kinases in Arabidopsis thaliana

    PubMed Central

    Sheikh, Arsheed H.; Eschen-Lippold, Lennart; Pecher, Pascal; Hoehenwarter, Wolfgang; Sinha, Alok K.; Scheel, Dierk; Lee, Justin

    2016-01-01

    Mitogen-activated protein kinase (MAPK) cascades are central signaling pathways activated in plants after sensing internal developmental and external stress cues. Knowledge about the downstream substrate proteins of MAPKs is still limited in plants. We screened Arabidopsis WRKY transcription factors as potential targets downstream of MAPKs, and concentrated on characterizing WRKY46 as a substrate of the MAPK, MPK3. Mass spectrometry revealed in vitro phosphorylation of WRKY46 at amino acid position S168 by MPK3. However, mutagenesis studies showed that a second phosphosite, S250, can also be phosphorylated. Elicitation with pathogen-associated molecular patterns (PAMPs), such as the bacterial flagellin-derived flg22 peptide led to in vivo destabilization of WRKY46 in Arabidopsis protoplasts. Mutation of either phosphorylation site reduced the PAMP-induced degradation of WRKY46. Furthermore, the protein for the double phosphosite mutant is expressed at higher levels compared to wild-type proteins or single phosphosite mutants. In line with its nuclear localization and predicted function as a transcriptional activator, overexpression of WRKY46 in protoplasts raised basal plant defense as reflected by the increase in promoter activity of the PAMP-responsive gene, NHL10, in a MAPK-dependent manner. Thus, MAPK-mediated regulation of WRKY46 is a mechanism to control plant defense. PMID:26870073

  3. Arrest of spermatogenesis in mice expressing an active heat shock transcription factor 1

    PubMed Central

    Nakai, Akira; Suzuki, Misao; Tanabe, Masako

    2000-01-01

    In mammals, testicular temperature is lower than core body temperature, and the vulnerable nature of spermatogenesis to thermal insult has been known for a century. However, the primary target affected by increases in temperature is not yet clear. We report here that male mice expressing an active form of heat shock transcription factor 1 (HSF1) in the testis are infertile due to a block in spermatogenesis. The germ cells entered meiotic prophase and were arrested at pachytene stage, and there was a significant increase in the number of apoptotic germ cells in these mice. In wild-type mice, a single heat exposure caused the activation of HSF1 and similar histological changes such as a stage-specific apoptosis of pachytene sperm– atocytes. These results suggest that male infertility caused by thermal insult is at least partly due to the activation of HSF1, which induces the primary spermatocytes to undergo apoptosis. PMID:10747023

  4. Nuclear Factor 90(NF90) targeted to TAR RNA inhibits transcriptional activation of HIV-1

    PubMed Central

    Agbottah, Emmanuel T; Traviss, Christine; McArdle, James; Karki, Sambhav; St Laurent, Georges C; Kumar, Ajit

    2007-01-01

    Background Examination of host cell-based inhibitors of HIV-1 transcription may be important for attenuating viral replication. We describe properties of a cellular double-stranded RNA binding protein with intrinsic affinity for HIV-1 TAR RNA that interferes with Tat/TAR interaction and inhibits viral gene expression. Results Utilizing TAR affinity fractionation, North-Western blotting, and mobility-shift assays, we show that the C-terminal variant of nuclear factor 90 (NF90ctv) with strong affinity for the TAR RNA, competes with Tat/TAR interaction in vitro. Analysis of the effect of NF90ctv-TAR RNA interaction in vivo showed significant inhibition of Tat-transactivation of HIV-1 LTR in cells expressing NF90ctv, as well as changes in histone H3 lysine-4 and lysine-9 methylation of HIV chromatin that are consistent with the epigenetic changes in transcriptionally repressed gene. Conclusion Structural integrity of the TAR element is crucial in HIV-1 gene expression. Our results show that perturbation Tat/TAR RNA interaction by the dsRNA binding protein is sufficient to inhibit transcriptional activation of HIV-1. PMID:17565699

  5. Centrosome movements in vivo correlate with specific neurite formation downstream of LIM homeodomain transcription factor activity.

    PubMed

    Andersen, Erica F; Halloran, Mary C

    2012-10-01

    Neurons must develop complex structure to form proper connections in the nervous system. The initiation of axons in defined locations on the cell body and their extension to synaptic targets are critical steps in neuronal morphogenesis, yet the mechanisms controlling axon formation in vivo are poorly understood. The centrosome has been implicated in multiple aspects of neuronal morphogenesis; however, its function in axon development is under debate. Conflicting results from studies of centrosome function in axonogenesis suggest that its role is context dependent and underscore the importance of studying centrosome function as neurons develop in their natural environment. Using live imaging of zebrafish Rohon-Beard (RB) sensory neurons in vivo, we discovered a spatiotemporal relationship between centrosome position and the formation of RB peripheral, but not central, axons. We tested centrosome function by laser ablation and found that centrosome disruption inhibited peripheral axon outgrowth. In addition, we show that centrosome position and motility are regulated by LIM homeodomain transcription factor activity, which is specifically required for the development of RB peripheral axons. Furthermore, we show a correlation between centrosome mislocalization and ectopic axon formation in bashful (laminin alpha 1) mutants. Thus, both intrinsic transcription factor activity and extracellular cues can influence centrosome position and axon formation in vivo. This study presents the first positive association between the centrosome and axon formation in vivo and suggests that the centrosome is important for differential neurite formation in neurons with complex axonal morphologies. PMID:22899847

  6. Contrahelicase activity of the mitochondrial transcription termination factor mtDBP

    PubMed Central

    Polosa, Paola Loguercio; Deceglie, Stefania; Roberti, Marina; Gadaleta, Maria Nicola; Cantatore, Palmiro

    2005-01-01

    The sea urchin mitochondrial D-loop binding protein (mtDBP) is a transcription termination factor that is able to arrest bidirectionally mitochondrial RNA chain elongation. The observation that the mtDBP binding site in the main non-coding region is located in correspondence of the 3′ end of the triplex structure, where the synthesis of heavy strand mitochondrial (mt) DNA is either prematurely terminated or allowed to continue, raised the question whether mtDBP could also regulate mtDNA replication. By using a helicase assay in the presence of the replicative helicase of SV40, we show that mtDBP is able to inhibit the enzyme thus acting as a contrahelicase. The impairing activity of mtDBP is bidirectional as it is independent of the orientation of the protein binding site. The inhibition is increased by the presence of the guanosine-rich sequence that flanks mtDBP binding site. Finally, a mechanism of abrogation of mtDBP contrahelicase activity is suggested that is based on the dissociation of mtDBP from DNA caused by the passage of the RNA polymerase through the protein–DNA complex. All these findings favour the view that mtDBP, besides serving as transcription termination factor, could also act as a negative regulator of mtDNA synthesis at the level of D-loop expansion. PMID:16006625

  7. Endothelial cell activation by antiphospholipid antibodies is modulated by Krüppel-like transcription factors

    PubMed Central

    Allen, Kristi L.; Hamik, Anne; Jain, Mukesh K.

    2011-01-01

    Antiphospholipid syndrome is characterized by thrombosis and/or recurrent pregnancy loss in the presence of antiphospholipid antibodies (APLAs). The majority of APLAs are directed against phospholipid-binding proteins, particularly β2-glycoprotein I (β2GPI). Anti-β2GPI antibodies activate endothelial cells in a β2GPI-dependent manner through a pathway that involves NF-κB. Krüppel-like factors (KLFs) play a critical role in regulating the endothelial response to inflammatory stimuli. We hypothesized that activation of endothelial cells by APLA/anti-β2GPI antibodies might be associated with decreased expression of KLFs, which in turn might facilitate cellular activation mediated through NF-κB. Our experimental results confirmed this hypothesis, demonstrating markedly decreased expression of KLF2 and KLF4 after incubation of cells with APLA/anti-β2GPI antibodies. Restoration of KLF2 or KLF4 levels inhibited NF-κB transcriptional activity and blocked APLA/anti-β2GPI–mediated endothelial activation despite NF-κB p65 phosphorylation. Chromatin immunoprecipitation analysis demonstrated that inhibition of NF-κB transcriptional activity by KLFs reflects sequestration of the cotranscriptional activator CBP/p300, making this cofactor unavailable to NF-κB. These findings suggest that the endothelial response to APLA/anti-β2GPI antibodies reflects competition between KLFs and NF-κB for their common cofactor, CBP/p300. Taken together, these observations are the first to implicate the KLFs as novel participants in the endothelial proinflammatory response to APLA/anti-β2GPI antibodies. PMID:21482710

  8. HSP90 inhibitors enhance differentiation and MITF (microphthalmia transcription factor) activity in osteoclast progenitors.

    PubMed

    van der Kraan, A Gabrielle J; Chai, Ryan C C; Singh, Preetinder P; Lang, Benjamin J; Xu, Jiake; Gillespie, Matthew T; Price, John T; Quinn, Julian M W

    2013-04-15

    The HSP90 (heat-shock protein 90) inhibitor 17-AAG (17-allylamino-demethoxygeldanamycin) increases osteoclast formation both in vitro and in vivo, an action that can enhance cancer invasion and growth in the bone microenvironment. The cellular mechanisms through which 17-AAG exerts this action are not understood. Thus we sought to clarify the actions of 17-AAG on osteoclasts and determine whether other HSP90 inhibitors had similar properties. We determined that 17-AAG and the structurally unrelated HSP90 inhibitors CCT018159 and NVP-AUY922 dose-dependently increased RANKL [receptor activator of NF-κB (nuclear factor κB) ligand]-stimulated osteoclastogenesis in mouse bone marrow and pre-osteoclastic RAW264.7 cell cultures. Moreover, 17-AAG also enhanced RANKL- and TNF (tumour necrosis factor)-elicited osteoclastogenesis, but did not affect RANKL-induced osteoclast survival, suggesting that only differentiation mechanisms are targeted. 17-AAG affected the later stages of progenitor maturation (after 3 days of incubation), whereas the osteoclast formation enhancer TGFβ (transforming growth factor β) acted prior to this, suggesting different mechanisms of action. In studies of RANKL-elicited intracellular signalling, 17-AAG treatment did not increase c-Fos or NFAT (nuclear factor of activated T-cells) c1 protein levels nor did 17-AAG increase activity in luciferase-based NF-κB- and NFAT-response assays. In contrast, 17-AAG treatment (and RANKL treatment) increased both MITF (microphthalmia-associated transcription factor) protein levels and MITF-dependent vATPase-d2 (V-type proton ATPase subunit d2) gene promoter activity. These results indicate that HSP90 inhibitors enhance osteoclast differentiation in an NFATc1-independent manner that involves elevated MITF levels and activity. PMID:23379601

  9. A Global Genomic and Genetic Strategy to Predict Pathway Activation of Xenobiotic Responsive Transcription Factors in the Mouse Liver

    EPA Science Inventory

    Many drugs and environmentally-relevant chemicals activate xenobiotic-responsive transcription factors(TF). Identification of target genes of these factors would be useful in predicting pathway activation in in vitro chemical screening. Starting with a large compendium of Affymet...

  10. Nε−Lysine Acetylation of a Bacterial Transcription Factor Inhibits Its DNA-Binding Activity

    PubMed Central

    Thao, Sandy; Chen, Chien-Sheng; Zhu, Heng; Escalante-Semerena, Jorge C.

    2010-01-01

    Evidence suggesting that eukaryotes and archaea use reversible Nε-lysine (Nε-Lys) acetylation to modulate gene expression has been reported, but evidence for bacterial use of Nε-Lys acetylation for this purpose is lacking. Here, we report data in support of the notion that bacteria can control gene expression by modulating the acetylation state of transcription factors (TFs). We screened the E. coli proteome for substrates of the bacterial Gcn5-like protein acetyltransferase (Pat). Pat acetylated four TFs, including the RcsB global regulatory protein, which controls cell division, and capsule and flagellum biosynthesis in many bacteria. Pat acetylated residue Lys180 of RcsB, and the NAD+-dependent Sir2 (sirtuin)-like protein deacetylase (CobB) deacetylated acetylated RcsB (RcsBAc), demonstrating that Nε-Lys acetylation of RcsB is reversible. Analysis of RcsBAc and variant RcsB proteins carrying substitutions at Lys180 provided biochemical and physiological evidence implicating Lys180 as a critical residue for RcsB DNA-binding activity. These findings further the likelihood that reversible Nε-Lys acetylation of transcription factors is a mode of regulation of gene expression used by all cells. PMID:21217812

  11. Complex domain interactions regulate stability and activity of closely related proneural transcription factors

    PubMed Central

    McDowell, Gary S.; Hardwick, Laura J.A.; Philpott, Anna

    2014-01-01

    Characterising post-translational regulation of key transcriptional activators is crucial for understanding how cell division and differentiation are coordinated in developing organisms and cycling cells. One important mode of protein post-translational control is by regulation of half-life via ubiquitin-mediated proteolysis. Two key basic Helix-Loop-Helix transcription factors, Neurogenin 2 (Ngn2) and NeuroD, play central roles in development of the central nervous system but despite their homology, Ngn2 is a highly unstable protein whilst NeuroD is, by comparison, very stable. The basis for and the consequences of the difference in stability of these two structurally and functionally related proteins has not been explored. Here we see that ubiquitylation alone does not determine Ngn2 or NeuroD stability. By making chimeric proteins, we see that the N-terminus of NeuroD in particular has a stabilising effect, whilst despite their high levels of homology, the most conserved bHLH domains of these proneural proteins alone can confer significant changes in protein stability. Despite widely differing stabilities of Ngn2, NeuroD and the chimeric proteins composed of domains of both, there is little correlation between protein half-life and ability to drive neuronal differentiation. Therefore, we conclude that despite significant homology between Ngn2 and NeuroD, the regulation of their stability differs markedly and moreover, stability/instability of the proteins is not a direct correlate of their activity. PMID:24998442

  12. Quantifying colocalization of a conditionally active transcription factor FOXP3 in three-dimensional cellular space

    NASA Astrophysics Data System (ADS)

    Abraham, Thomas; Allan, Sarah E.; Levings, Megan K.

    2009-02-01

    Biological macromolecular interactions between proteins, transcription factors, DNA and other types of biomolecules, are fundamentally important to several cellular and biological processes. 3D Multi-channel confocal microscopy and colocalization analysis of fluorescent signals have proven to be invaluable tools for detecting such molecular interactions. The aim of this work was to quantify colocalization of the FOXP3 transcription factor in 3D cellular space generated from the confocal 3D image sets. 293T cells transfected with a conditionally active form of FOXP3 were stained for nuclei with Hoechst, for FOXP3 with anti-FOXP3 conjugated to PE, and 4-hydroxytamoxifen used as protein translocation and activation agent. Since the protein signal was weak and nonspecific intensity contributions were strong, it was difficult to perform colocalization analysis and estimate colocalization quantities. We performed 3D restoration by deconvolution method on the confocal images using experimentally measured point spread functions (PSFs) and subsequently a color shift correction. The deconvolution method eliminated nonspecific intensity contributions originating from PSF imposed by optical microscopy diffraction resolution limits and noise since these factors significantly affected colocalization analysis and quantification. Visual inspection of the deconvolved 3D image suggested that the FOXP3 molecules are predominantly colocalized within the nuclei although the fluorescent signals from FOXP3 molecules were also present in the cytoplasm. A close inspection of the scatter plot (colocalization map) and correlation quantities such as the Pearsons and colocalization coefficients showed that the fluorescent signals from the FOXP3 molecules and DNA are strongly correlated. In conclusion, our colocalization quantification approach confirms the preferential association of the FOXP3 molecules with the DNA despite the presence of fluorescent signals from the former one both in the

  13. Aldosterone Activates Transcription Factor Nrf2 in Kidney Cells Both In Vitro and In Vivo

    PubMed Central

    Oteiza, Patricia I.; Link, Samuel; Hey, Valentin; Stopper, Helga; Schupp, Nicole

    2014-01-01

    Abstract Aims: An increased kidney cancer risk was found in hypertensive patients, who frequently exhibit hyperaldosteronism, known to contribute to kidney injury, with oxidative stress playing an important role. The capacity of kidney cells to up-regulate transcription factor nuclear factor-erythroid-2-related factor 2 (Nrf2), a key regulator of the cellular antioxidative defense, as a prevention of aldosterone-induced oxidative damage was investigated both in vitro and in vivo. Results: Aldosterone activated Nrf2 and increased the expression of enzymes involved in glutathione (GSH) synthesis and detoxification. This activation depended on the mineralocorticoid receptor (MR) and oxidative stress. In vitro, Nrf2 activation, GSH amounts, and target gene levels decreased after 24 h, while oxidant levels remained high. Nrf2 activation could not protect cells against oxidative DNA damage, as aldosterone-induced double-strand breaks and 7,8-dihydro-8-oxo-guanine (8-oxodG) lesions steadily rose. The Nrf2 activator sulforaphane enhanced the Nrf2 response both in vitro and in vivo, thereby preventing aldosterone-induced DNA damage. In vivo, Nrf2 activation further had beneficial effects on the aldosterone-caused blood pressure increase and loss of kidney function. Innovation: This is the first study showing the activation of Nrf2 by aldosterone. Moreover, the results identify sulforaphane as a substance that is capable of preventing aldosterone-induced damage both in vivo and in vitro. Conclusion: Aldosterone-induced Nrf2 adaptive response cannot neutralize oxidative actions of chronically increased aldosterone, which, therefore could be causally involved in the increased cancer incidence of hypertensive individuals. Enhancing the cellular antioxidative defense with sulforaphane might exhibit beneficial effects. Antioxid. Redox Signal. 21, 2126–2142. PMID:24512358

  14. The ERF11 Transcription Factor Promotes Internode Elongation by Activating Gibberellin Biosynthesis and Signaling1[OPEN

    PubMed Central

    Zhou, Xin; Zhang, Zhong-Lin; Tyler, Ludmila; Yusuke, Jikumaru; Qiu, Kai; Lumba, Shelley; Desveaux, Darrell; McCourt, Peter; Sun, Tai-ping

    2016-01-01

    The phytohormone gibberellin (GA) plays a key role in promoting stem elongation in plants. Previous studies show that GA activates its signaling pathway by inducing rapid degradation of DELLA proteins, GA signaling repressors. Using an activation-tagging screen in a reduced-GA mutant ga1-6 background, we identified AtERF11 to be a novel positive regulator of both GA biosynthesis and GA signaling for internode elongation. Overexpression of AtERF11 partially rescued the dwarf phenotype of ga1-6. AtERF11 is a member of the ERF (ETHYLENE RESPONSE FACTOR) subfamily VIII-B-1a of ERF/AP2 transcription factors in Arabidopsis (Arabidopsis thaliana). Overexpression of AtERF11 resulted in elevated bioactive GA levels by up-regulating expression of GA3ox1 and GA20ox genes. Hypocotyl elongation assays further showed that overexpression of AtERF11 conferred elevated GA response, whereas loss-of-function erf11 and erf11 erf4 mutants displayed reduced GA response. In addition, yeast two-hybrid, coimmunoprecipitation, and transient expression assays showed that AtERF11 enhances GA signaling by antagonizing the function of DELLA proteins via direct protein-protein interaction. Interestingly, AtERF11 overexpression also caused a reduction in the levels of another phytohormone ethylene in the growing stem, consistent with recent finding showing that AtERF11 represses transcription of ethylene biosynthesis ACS genes. The effect of AtERF11 on promoting GA biosynthesis gene expression is likely via its repressive function on ethylene biosynthesis. These results suggest that AtERF11 plays a dual role in promoting internode elongation by inhibiting ethylene biosynthesis and activating GA biosynthesis and signaling pathways. PMID:27255484

  15. The ERF11 Transcription Factor Promotes Internode Elongation by Activating Gibberellin Biosynthesis and Signaling.

    PubMed

    Zhou, Xin; Zhang, Zhong-Lin; Park, Jeongmoo; Tyler, Ludmila; Yusuke, Jikumaru; Qiu, Kai; Nam, Edward A; Lumba, Shelley; Desveaux, Darrell; McCourt, Peter; Kamiya, Yuji; Sun, Tai-Ping

    2016-08-01

    The phytohormone gibberellin (GA) plays a key role in promoting stem elongation in plants. Previous studies show that GA activates its signaling pathway by inducing rapid degradation of DELLA proteins, GA signaling repressors. Using an activation-tagging screen in a reduced-GA mutant ga1-6 background, we identified AtERF11 to be a novel positive regulator of both GA biosynthesis and GA signaling for internode elongation. Overexpression of AtERF11 partially rescued the dwarf phenotype of ga1-6 AtERF11 is a member of the ERF (ETHYLENE RESPONSE FACTOR) subfamily VIII-B-1a of ERF/AP2 transcription factors in Arabidopsis (Arabidopsis thaliana). Overexpression of AtERF11 resulted in elevated bioactive GA levels by up-regulating expression of GA3ox1 and GA20ox genes. Hypocotyl elongation assays further showed that overexpression of AtERF11 conferred elevated GA response, whereas loss-of-function erf11 and erf11 erf4 mutants displayed reduced GA response. In addition, yeast two-hybrid, coimmunoprecipitation, and transient expression assays showed that AtERF11 enhances GA signaling by antagonizing the function of DELLA proteins via direct protein-protein interaction. Interestingly, AtERF11 overexpression also caused a reduction in the levels of another phytohormone ethylene in the growing stem, consistent with recent finding showing that AtERF11 represses transcription of ethylene biosynthesis ACS genes. The effect of AtERF11 on promoting GA biosynthesis gene expression is likely via its repressive function on ethylene biosynthesis. These results suggest that AtERF11 plays a dual role in promoting internode elongation by inhibiting ethylene biosynthesis and activating GA biosynthesis and signaling pathways. PMID:27255484

  16. Regulation of selected genome loci using de novo-engineered transcription activator-like effector (TALE)-type transcription factors

    PubMed Central

    Morbitzer, Robert; Römer, Patrick; Boch, Jens; Lahaye, Thomas

    2010-01-01

    Proteins that can be tailored to bind desired DNA sequences are key tools for molecular biology. Previous studies suggested that DNA-binding specificity of transcription activator-like effectors (TALEs) from the bacterial genus Xanthomonas is defined by repeat-variable diresidues (RVDs) of tandem-arranged 34/35-amino acid repeat units. We have studied chimeras of two TALEs differing in RVDs and non-RVDs and found that, in contrast to the critical contributions by RVDs, non-RVDs had no major effect on the DNA-binding specificity of the chimeras. This finding suggests that one needs only to modify the RVDs to generate designer TALEs (dTALEs) to activate transcription of user-defined target genes. We used the scaffold of the TALE AvrBs3 and changed its RVDs to match either the tomato Bs4, the Arabidopsis EGL3, or the Arabidopsis KNAT1 promoter. All three dTALEs transcriptionally activated the desired promoters in a sequence-specific manner as mutations within the targeted DNA sequences abolished promoter activation. This study is unique in showing that chromosomal loci can be targeted specifically by dTALEs. We also engineered two AvrBs3 derivatives with four additional repeat units activating specifically either the pepper Bs3 or UPA20 promoter. Because AvrBs3 activates both promoters, our data show that addition of repeat units facilitates TALE-specificity fine-tuning. Finally, we demonstrate that the RVD NK mediates specific interaction with G nucleotides that thus far could not be targeted specifically by any known RVD type. In summary, our data demonstrate that the TALE scaffold can be tailored to target user-defined DNA sequences in whole genomes. PMID:21106758

  17. Transcription factor-based biosensor

    SciTech Connect

    Dietrich, Jeffrey A; Keasling, Jay D

    2013-10-08

    The present invention provides for a system comprising a BmoR transcription factor, a .sigma..sup.54-RNA polymerase, and a pBMO promoter operatively linked to a reporter gene, wherein the pBMO promoter is capable of expression of the reporter gene with an activated form of the BmoR and the .sigma..sup.54-RNA polymerase.

  18. Dnmt1/Transcription Factor Interactions

    PubMed Central

    Hervouet, Eric; Vallette, François M.; Cartron, Pierre-François

    2010-01-01

    DNA methylation inheritance is the process of copying, via the DNA methyltransferase 1 (Dnmt1), the pre-existing methylation patterns onto the new DNA strand during DNA replication. Experiments of chromatin immunoprecipitation, measurement of maintenance methyltransferase activity, proximity ligation in situ assays (P-LISA, Duolink/Olink), and transcription factor arrays demonstrate that Dnmt1 interacts with transcription factors to promote site-specific DNA methylation inheritance, while the Dnmt1-PCNA-UHRF1 complex promotes the DNA methylation inheritance without site preference. We also show that the Dnmt1-PCNA-UHRF1 and Dnmt1/transcription factor complexes methylate DNA by acting as a single player or in cooperation. Thus, our data establish that the copying of the pre-existing methylation pattern is governed by the orchestration of the untargeted and the targeted mechanisms of DNA methylation inheritance, which are themselves dictated by the partners of Dnmt1. PMID:21779454

  19. Inhibition of Phosphatase Activity Follows Decline in Sulfatase Activity and Leads to Transcriptional Effects through Sustained Phosphorylation of Transcription Factor MITF

    PubMed Central

    Bhattacharyya, Sumit; Feferman, Leo; Tobacman, Joanne K.

    2016-01-01

    Arylsulfatase B (B-acetylgalactosamine 4-sulfatase; ARSB) is the enzyme that removes 4-sulfate groups from the non-reducing end of the glycosaminoglycans chondroitin 4-sulfate and dermatan sulfate. Decline in ARSB has been shown in malignant prostate, colonic, and mammary cells and tissues, and decline in ARSB leads to transcriptional events mediated by galectin-3 with AP-1 and Sp1. Increased mRNA expression of GPNMB (transmembrane glycoprotein NMB) in HepG2 cells and in hepatic tissue from ARSB-deficient mice followed decline in expression of ARSB and was mediated by the microphthalmia-associated transcription factor (MITF), but was unaffected by silencing galectin-3. Since GPNMB is increased in multiple malignancies, studies were performed to determine how decline in ARSB increased GPNMB expression. The mechanism by which decline in ARSB increased nuclear phospho-MITF was due to reduced activity of SHP2, a protein tyrosine phosphatase with Src homology (SH2) domains that regulates multiple cellular processes. SHP2 activity declined due to increased binding with chondroitin 4-sulfate when ARSB was reduced. When SHP2 activity was inhibited, phosphorylations of p38 mitogen-associated phosphokinase (MAPK) and of MITF increased, leading to GPNMB promoter activation. A dominant negative SHP2 construct, the SHP2 inhibitor PHSP1, and silencing of ARSB increased phospho-p38, nuclear MITF, and GPNMB. In contrast, constitutively active SHP2 and overexpression of ARSB inhibited GPNMB expression. The interaction between chondroitin 4-sulfate and SHP2 is a novel intersection between sulfation and phosphorylation, by which decline in ARSB and increased chondroitin 4-sulfation can inhibit SHP2, thereby regulating downstream tyrosine phosphorylations by sustained phosphorylations with associated activation of signaling and transcriptional events. PMID:27078017

  20. Intermedin/adrenomedullin 2 is a stress-inducible gene controlled by activating transcription factor 4.

    PubMed

    Kovaleva, Irina E; Garaeva, Alisa A; Chumakov, Peter M; Evstafieva, Alexandra G

    2016-09-15

    Intermedin or adrenomedullin 2 is a set of calcitonin-related peptides with a putative tumor angiogenesis promoting activity that are formed by proteolytic processing of the ADM2 gene product. It has been proposed that the ADM2 gene is regulated by the estrogen response element (ERE) and hypoxia response elements (HRE) found within its promoter region. In the present study we reveal a functional mechanism by which ADM2 participates in the unfolded protein response (UPR) and in responses to the mitochondrial respiration chain inhibition. We show that the ADM2 gene is controlled by activating transcription factor 4 (ATF4), the principal regulator of the integrated stress response (ISR). The upregulation of ADM2 mRNA could be prevented by the pharmacological ISR inhibitor ISRIB and by the downregulation of ATF4 with specific shRNA, while ectopic expression of ATF4 cDNA resulted in a notable increase in ADM2 gene transcription. A potential ATF4-binding site was identified in the coding region of the ADM2 gene and the requirement of this site during the ATF4-mediated ADM2 gene promoter activation was validated by the luciferase reporter assay. Mutagenesis of the putative ATF4-response element prevented the induction of luciferase activity in response to ATF4 overproduction, as well as in response to mitochondrial electron transfer chain inhibition by piericidin A and ER stress induction by tunicamycin and brefeldin A. Since ADM2 was shown to inhibit ATF4 expression during myocardial ER stress, a feedback mechanism could be proposed for the ADM2 regulation under ER stress conditions. PMID:27328454

  1. Activating transcription factor 4 promotes angiogenesis of breast cancer through enhanced macrophage recruitment.

    PubMed

    Liu, Chen; Li, Zongjin; Wang, Lina; Tong, Lingling; He, Ningning; Chen, Yanan; Liu, Yanhua; Wu, Zhongjun; Sun, Peiqing; Xiang, Rong; Ren, Guosheng; Su, Weijun

    2015-01-01

    Angiogenesis plays an important role in the progression of tumor. Besides being regulated by tumor cells per se, tumor angiogenesis is also influenced by stromal cells in tumor microenvironment (TME), for example, tumor associated macrophages (TAMs). Activating transcription factor 4 (ATF4), a member of the ATF/CREB family, has been reported to be related to tumor angiogenesis. In this study, we found that exogenous overexpression of ATF4 in mouse breast cancer cells promotes tumor growth via increasing tumor microvascular density. However, ATF4 overexpression failed to increase the expression level of a series of proangiogenic factors including vascular endothelial growth factor A (VEGFA) in tumor cells in this model. Thus, we further investigated the infiltration of proangiogenic macrophages in tumor tissues and found that ATF4-overexpressing tumors could recruit more macrophages via secretion of macrophage colony stimulating factor (M-CSF). Overall, we concluded that exogenous overexpression of ATF4 in breast cancer cells may facilitate the recruitment of macrophages into tumor tissues and promote tumor angiogenesis and tumor growth indirectly. PMID:25883982

  2. Structural basis for S-adenosylmethionine binding and methyltransferase activity by mitochondrial transcription factor B1.

    PubMed

    Guja, Kip E; Venkataraman, Krithika; Yakubovskaya, Elena; Shi, Hui; Mejia, Edison; Hambardjieva, Elena; Karzai, A Wali; Garcia-Diaz, Miguel

    2013-09-01

    Eukaryotic transcription factor B (TFB) proteins are homologous to KsgA/Dim1 ribosomal RNA (rRNA) methyltransferases. The mammalian TFB1, mitochondrial (TFB1M) factor is an essential protein necessary for mitochondrial gene expression. TFB1M mediates an rRNA modification in the small ribosomal subunit and thus plays a role analogous to KsgA/Dim1 proteins. This modification has been linked to mitochondrial dysfunctions leading to maternally inherited deafness, aminoglycoside sensitivity and diabetes. Here, we present the first structural characterization of the mammalian TFB1 factor. We have solved two X-ray crystallographic structures of TFB1M with (2.1 Å) and without (2.0 Å) its cofactor S-adenosyl-L-methionine. These structures reveal that TFB1M shares a conserved methyltransferase core with other KsgA/Dim1 methyltransferases and shed light on the structural basis of S-adenosyl-L-methionine binding and methyltransferase activity. Together with mutagenesis studies, these data suggest a model for substrate binding and provide insight into the mechanism of methyl transfer, clarifying the role of this factor in an essential process for mitochondrial function. PMID:23804760

  3. DNA binding and transcription activation by chicken interferon regulatory factor-3 (chIRF-3)

    PubMed Central

    Grant, Caroline E.; May, Donna L.; Deeley, Roger G.

    2000-01-01

    Interferon regulatory factors (IRFs) are a family of transcription factors involved in the cellular response to interferons and viral infection. Previously we isolated an IRF from a chicken embryonic liver cDNA library. Using a PCR-based binding site selection assay, we have characterised the binding specificity of chIRF-3. The optimal binding site (OBS) fits within the consensus interferon-stimulated response element (ISRE) but the specificity of chIRF-3 binding allows less variation in nucleotides outside the core IRF-binding sequence. A comparison of IRF-1 and chIRF-3 binding to ISREs in electrophoretic mobility shift assays confirmed that the binding specificity of chIRF-3 was clearly distinguishable from IRF-1. The selection assay also showed that chIRF-3 is capable of binding an inverted repeat of two half OBSs separated by 10–13 nt. ChIRF-3 appears to bind both the OBS and inverted repeat sites as a dimer with the protein–protein interaction requiring a domain between amino acids 117 and 311. In transfection experiments expression of chIRF-3 strongly activated a promoter containing the OBS. The activation domain was mapped to between amino acids 138 and 221 and a domain inhibitory to activation was also mapped to the C-terminal portion of chIRF-3. PMID:11095692

  4. Sequence-independent induction of Sp1 transcription factor activity by phosphorothioate oligodeoxynucleotides.

    PubMed Central

    Perez, J R; Li, Y; Stein, C A; Majumder, S; van Oorschot, A; Narayanan, R

    1994-01-01

    Modified analogues of antisense oligodeoxynucleotides (ODNs), particularly phosphorothioates ([S]ODNs), have been extensively used to inhibit gene expression. The potential sequence specificity of antisense oligomers makes them attractive as molecular drugs for human diseases. The use of antisense [S]ODNs to inhibit gene expression has been complicated by frequent nonspecific effects. In this study we show in diverse cell types that [S]ODNs, independent of their base sequence, mediated the induction of an Sp1 nuclear transcription factor. The [S]ODN-mediated Sp1 induction was rapid and was associated with elevated levels of Sp1 protein. This induction was dependent on NF-kappa B activity, since inhibition of NF-kappa B activity abolished the [S]ODN-induced Sp1 activity. [S]ODN-induced Sp1 activity was seen in mouse spleen cells following in vivo administration. Sp1 activity induced by [S]ODNs required the tyrosine kinase pathway and did not have transactivating potential. These results may help to explain some of the non-specific effects often seen with [S]ODNs. Images PMID:8016096

  5. Activation of transcription factor AP-1 and mitogen-activated protein kinases in aniline-induced splenic toxicity

    SciTech Connect

    Khan, M. Firoze . E-mail: mfkhan@utmb.edu; Kannan, Subburaj; Wang Jianling

    2006-01-15

    Signaling mechanisms in aniline-induced fibrogenic and/or tumorigenic response in the spleen are not known. Previous studies have shown that aniline exposure leads to iron accumulation and oxidative stress in the spleen, which may cause activation of redox-sensitive transcription factors and regulate the transcription of genes involved in fibrosis and/or tumorigenesis. To test this, male SD rats were treated with 0.5 mmol/kg/day aniline via drinking water for 30 days, and activation of transcription factor AP-1 was determined in the splenocyte nuclear extracts (NEs). AP-1 DNA-binding activity in the NEs of freshly isolated splenocytes from aniline-treated rats increased in comparison to the controls, as determined by electrophoretic mobility shift assay (EMSA). AP-1 binding was also determined in the NEs of cultured splenocytes (2 h and 24 h), which showed even a greater increase in binding activity at 2 h. The specificity of AP-1 binding for relevant DNA motifs was confirmed by competition EMSA and by supershift EMSA using antibodies specific to c-Jun and c-Fos. To further explore the signaling mechanisms in the AP-1 activation, phosphorylation patterns of mitogen-activated protein kinases (MAPKs) were pursued. Aniline exposure induced increases in the phosphorylation of the three classes of MAPKs: extracellular-signal-regulated kinase (ERK 1/2), c-Jun N-terminal kinase (JNK 1/2), and p38 MAPKs. Furthermore, TGF-{beta}1 mRNA expression showed a 3-fold increase in the spleens of aniline-treated rats. These observations suggest a strong association among MAPK phosphorylation, AP-1 activation, and enhanced TGF-{beta}1 gene expression. The observed sequence of events subsequent to aniline exposure could regulate genes that lead to fibrogenic and/or tumorigenic response in the spleen.

  6. GATA Transcription Factors and Cancer

    PubMed Central

    Zheng, Rena; Blobel, Gerd A.

    2010-01-01

    It has been almost a quarter century since it was first appreciated that a class of oncogenes contained in rapidly transforming avian retroviruses encoded DNA-binding transcription factors. As with other oncogenes, genetic recombination with the viral genome led to their overexpression or functional alteration. In the years that followed, alterations of numerous transcription factors were shown to be causatively involved in various cancers in human patients and model organisms. Depending on their normal cellular functions, these factors were subsequently categorized as proto-oncogenes or tumor suppressor genes. This review focuses on the role of GATA transcription factors in carcinogenesis. GATA factors are zinc finger DNA binding proteins that control the development of diverse tissues by activating or repressing transcription. GATA factors thus coordinate cellular maturation with proliferation arrest and cell survival. Therefore, a role of this family of genes in human cancers is not surprising. Prominent examples include structural mutations in GATA1 that are found in almost all megakaryoblastic leukemias in patients with Down syndrome; loss of GATA3 expression in aggressive, dedifferentiated breast cancers; and silencing of GATA4 and GATA5 expression in colorectal and lung cancers. Here, we discuss possible mechanisms of carcinogenesis vis-à-vis the normal functions of GATA factors as they pertain to human patients and mouse models of cancer. PMID:21779441

  7. The AP-1 transcription factor homolog Pf-AP-1 activates transcription of multiple biomineral proteins and potentially participates in Pinctada fucata biomineralization

    PubMed Central

    Zheng, Xiangnan; Cheng, Minzhang; Xiang, Liang; Liang, Jian; Xie, Liping; Zhang, Rongqing

    2015-01-01

    Activator protein-1 (AP-1) is an important bZIP transcription factor that regulates a series of physiological processes by specifically activating transcription of several genes, and one of its well-chartered functions in mammals is participating in bone mineralization. We isolated and cloned the complete cDNA of a Jun/AP-1 homolog from Pinctada fucata and called it Pf-AP-1. Pf-AP-1 had a highly conserved bZIP region and phosphorylation sites compared with those from mammals. A tissue distribution analysis showed that Pf-AP-1 was ubiquitously expressed in P. fucata and the mRNA level of Pf-AP-1 is extremely high in mantle. Pf-AP-1 expression was positively associated with multiple biomineral proteins in the mantle. The luciferase reporter assay in a mammalian cell line showed that Pf-AP-1 significantly up-regulates the transcriptional activity of the promoters of KRMP, Pearlin, and Prisilkin39. Inhibiting the activity of Pf-AP-1 depressed the expression of multiple matrix proteins. Pf-AP-1 showed a unique expression pattern during shell regeneration and pearl sac development, which was similar to the pattern observed for biomineral proteins. These results suggest that the Pf-AP-1 AP-1 homolog is an important transcription factor that regulates transcription of several biomineral proteins simultaneously and plays a role in P. fucata biomineralization, particularly during pearl and shell formation. PMID:26404494

  8. RAI1 Transcription Factor Activity Is Impaired in Mutants Associated with Smith-Magenis Syndrome

    PubMed Central

    Carmona-Mora, Paulina; Canales, Cesar P.; Cao, Lei; Perez, Irene C.; Srivastava, Anand K.; Young, Juan I.; Walz, Katherina

    2012-01-01

    Smith-Magenis Syndrome (SMS) is a complex genomic disorder mostly caused by the haploinsufficiency of the Retinoic Acid Induced 1 gene (RAI1), located in the chromosomal region 17p11.2. In a subset of SMS patients, heterozygous mutations in RAI1 are found. Here we investigate the molecular properties of these mutated forms and their relationship with the resulting phenotype. We compared the clinical phenotype of SMS patients carrying a mutation in RAI1 coding region either in the N-terminal or the C-terminal half of the protein and no significant differences were found. In order to study the molecular mechanism related to these two groups of RAI1 mutations first we analyzed those mutations that result in the truncated protein corresponding to the N-terminal half of RAI1 finding that they have cytoplasmic localization (in contrast to full length RAI1) and no ability to activate the transcription through an endogenous target: the BDNF enhancer. Similar results were found in lymphoblastoid cells derived from a SMS patient carrying RAI1 c.3103insC, where both mutant and wild type products of RAI1 were detected. The wild type form of RAI1 was found in the chromatin bound and nuclear matrix subcellular fractions while the mutant product was mainly cytoplasmic. In addition, missense mutations at the C-terminal half of RAI1 presented a correct nuclear localization but no activation of the endogenous target. Our results showed for the first time a correlation between RAI1 mutations and abnormal protein function plus they suggest that a reduction of total RAI1 transcription factor activity is at the heart of the SMS clinical presentation. PMID:23028815

  9. Protolichesterinic acid derivatives: α-methylene-γ-lactones as potent dual activators of PPARγ and Nrf2 transcriptional factors.

    PubMed

    Le Lamer, Anne-Cécile; Authier, Hélène; Rouaud, Isabelle; Coste, Agnès; Boustie, Joël; Pipy, Bernard; Gouault, Nicolas

    2014-08-15

    PPARγ and Nrf2 are important transcriptional factors involved in many signaling pathways, especially in the anti-infectious response of macrophages. Compounds bearing a Michael acceptor moiety are well known to activate such transcriptional factors, we thus evaluated the potency of α,β-unsaturated lactones synthesized using fluorous phase organic synthesis. Compounds were first screened for their cytotoxicity in order to select lactones for PPARγ and Nrf2 activation evaluation. Among them, two α-methylene-γ-lactones were identified as potent dual activators of PPARγ and Nrf2 in macrophages. PMID:25027935

  10. In Vitro Anticancer Activity of Phlorofucofuroeckol A via Upregulation of Activating Transcription Factor 3 against Human Colorectal Cancer Cells

    PubMed Central

    Eo, Hyun Ji; Kwon, Tae-Hyung; Park, Gwang Hun; Song, Hun Min; Lee, Su-Jin; Park, Nyun-Ho; Jeong, Jin Boo

    2016-01-01

    Phlorofucofuroeckol A (PFF-A), one of the phlorotannins found in brown algae, has been reported to exert anti-cancer property. However, the molecular mechanism for the anti-cancer effect of PFF-A has not been known. Activating transcription factor 3 (ATF3) has been reported to be associated with apoptosis in colorectal cancer. The present study was performed to investigate the molecular mechanism by which PFF-A stimulates ATF3 expression and apoptosis in human colorectal cancer cells. PFF-A decreased cell viability through apoptosis of human colorectal cancer cells. PFF-A increased ATF3 expression through regulating transcriptional activity. The responsible cis-element for ATF3 transcriptional activation by PFF-A was cAMP response element binding protein (CREB), located between positions −147 and −85 of the ATF3 promoter. Inhibition of p38, c-Jun N-terminal kinases (JNK), glycogen synthase kinase (GSK) 3β, and IκB kinase (IKK)-α blocked PFF-A-mediated ATF3 expression. ATF3 knockdown by ATF3 siRNA attenuated the cleavage of poly (ADP-ribose) polymerase (PARP) by PFF-A, while ATF3 overexpression increased PFF-A-mediated cleaved PARP. These results suggest that PFF-A may exert anti-cancer property through inducing apoptosis via the ATF3-mediated pathway in human colorectal cancer cells. PMID:27043582

  11. Transcription factor NFAT1 controls allergic contact hypersensitivity through regulation of activation induced cell death program

    PubMed Central

    Kwon, Ho-Keun; Kim, Gi-Cheon; Hwang, Ji Sun; Kim, Young; Chae, Chang-Suk; Nam, Jong Hee; Jun, Chang-Duk; Rudra, Dipayan; Surh, Charles D.; Im, Sin-Hyeog

    2016-01-01

    Allergic contact hypersensitivity (CHS) is an inflammatory skin disease mediated by allergen specific T cells. In this study, we investigated the role of transcription factor NFAT1 in the pathogenesis of contact hypersensitivity. NFAT1 knock out (KO) mice spontaneously developed CHS-like skin inflammation in old age. Healthy young NFAT1 KO mice displayed enhanced susceptibility to hapten-induced CHS. Both CD4+ and CD8+ T cells from NFAT1 KO mice displayed hyper-activated properties and produced significantly enhanced levels of inflammatory T helper 1(Th1)/Th17 type cytokines. NFAT1 KO T cells were more resistant to activation induced cell death (AICD), and regulatory T cells derived from these mice showed a partial defect in their suppressor activity. NFAT1 KO T cells displayed a reduced expression of apoptosis associated BCL-2/BH3 family members. Ectopic expression of NFAT1 restored the AICD defect in NFAT1 KO T cells and increased AICD in normal T cells. Recipient Rag2−/− mice transferred with NFAT1 KO T cells showed more severe CHS sensitivity due to a defect in activation induced hapten-reactive T cell apoptosis. Collectively, our results suggest the NFAT1 plays a pivotal role as a genetic switch in CD4+/CD8+ T cell tolerance by regulating AICD process in the T cell mediated skin inflammation. PMID:26777750

  12. Dynamic Transcription Factor Activity Profiles Reveal Key Regulatory Interactions During Megakaryocytic and Erythroid Differentiation

    PubMed Central

    Duncan, Mark T.; Shin, Seungjin; Wu, Jia J.; Mays, Zachary; Weng, Stanley; Bagheri, Neda; Miller, William M.; Shea, Lonnie D.

    2014-01-01

    The directed differentiation toward erythroid (E) or megakaryocytic (MK) lineages by the MK-E progenitor (MEP) could enhance the ex vivo generation of red blood cells and platelets for therapeutic transfusions. The lineage choice at the MEP bifurcation is controlled in large part by activity within the intracellular signal transduction network, the output of which determines the activity of transcription factors (TFs) and ultimately gene expression. Although many TFs have been implicated, E or MK differentiation is a complex process requiring multiple days, and the dynamics of TF activities during commitment and terminal maturation are relatively unexplored. Herein, we applied a living cell array for the large-scale, dynamic quantification of TF activities during MEP bifurcation. A panel of hematopoietic TFs (GATA-1, GATA-2, SCL/TAL1, FLI-1, NF-E2, PU.1, c-Myb) was characterized during E and MK differentiation of bipotent K562 cells. Dynamic TF activity profiles associated with differentiation towards each lineage were identified, and validated with previous reports. From these activity profiles, we show that GATA-1 is an important hub during early hemin- and PMA-induced differentiation, and reveal several characteristic TF interactions for E and MK differentiation that confirm regulatory mechanisms documented in the literature. Additionally, we highlight several novel TF interactions at various stages of E and MK differentiation. Furthermore, we investigated the mechanism by which nicotinamide (NIC) promoted terminal MK maturation using an MK-committed cell line, CHRF-288-11 (CHRF). Concomitant with its enhancement of ploidy, NIC strongly enhanced the activity of three TFs with known involvement in terminal MK maturation: FLI-1, NF-E2, and p53. Dynamic profiling of TF activity represents a novel tool to complement traditional assays focused on mRNA and protein expression levels to understand progenitor cell differentiation. PMID:24853077

  13. Dynamic transcription factor activity profiles reveal key regulatory interactions during megakaryocytic and erythroid differentiation.

    PubMed

    Duncan, Mark T; Shin, Seungjin; Wu, Jia J; Mays, Zachary; Weng, Stanley; Bagheri, Neda; Miller, William M; Shea, Lonnie D

    2014-10-01

    The directed differentiation toward erythroid (E) or megakaryocytic (MK) lineages by the MK-E progenitor (MEP) could enhance the ex vivo generation of red blood cells and platelets for therapeutic transfusions. The lineage choice at the MEP bifurcation is controlled in large part by activity within the intracellular signal transduction network, the output of which determines the activity of transcription factors (TFs) and ultimately gene expression. Although many TFs have been implicated, E or MK differentiation is a complex process requiring multiple days, and the dynamics of TF activities during commitment and terminal maturation are relatively unexplored. Herein, we applied a living cell array for the large-scale, dynamic quantification of TF activities during MEP bifurcation. A panel of hematopoietic TFs (GATA-1, GATA-2, SCL/TAL1, FLI-1, NF-E2, PU.1, c-Myb) was characterized during E and MK differentiation of bipotent K562 cells. Dynamic TF activity profiles associated with differentiation towards each lineage were identified, and validated with previous reports. From these activity profiles, we show that GATA-1 is an important hub during early hemin- and PMA-induced differentiation, and reveal several characteristic TF interactions for E and MK differentiation that confirm regulatory mechanisms documented in the literature. Additionally, we highlight several novel TF interactions at various stages of E and MK differentiation. Furthermore, we investigated the mechanism by which nicotinamide (NIC) promoted terminal MK maturation using an MK-committed cell line, CHRF-288-11 (CHRF). Concomitant with its enhancement of ploidy, NIC strongly enhanced the activity of three TFs with known involvement in terminal MK maturation: FLI-1, NF-E2, and p53. Dynamic profiling of TF activity represents a novel tool to complement traditional assays focused on mRNA and protein expression levels to understand progenitor cell differentiation. PMID:24853077

  14. Hepatitis B virus X protein activates transcription factor NF-kappa B without a requirement for protein kinase C.

    PubMed Central

    Lucito, R; Schneider, R J

    1992-01-01

    The hepatitis B virus X protein stimulates transcription from a variety of promoter elements, including those activated by transcription factor NF-kappa B. A diverse group of extra- and intracellular agents, including growth factors and the human immunodeficiency virus tat protein, have been shown to require a functional protein kinase C (PKC) system to achieve activation of NF-kappa B. In this study we have investigated the molecular mechanism by which X protein activates NF-kappa B. We demonstrate that in hepatocytes, X protein induces a maximal activation of NF-kappa B corresponding to the sequestered pool of factor, which is also activated by phorbol esters. To determine whether X protein requires activation of PKC to stimulate transcription by NF-kappa B, we attempted to prevent transactivation by X protein in the presence of the PKC inhibitors calphostin C and H7. We show that PKC inhibitors do not block X protein activation of NF-kappa B, whereas they largely impair activation by phorbol esters. In addition, activation of PKC is correlated with its translocation from the cytoplasm to the plasma membrane. The subcellular distribution of PKC was investigated by introducing X protein from a replication-defective adenovirus vector, followed by immunochemical detection of PKC in cell fractions. These data also indicate that X protein stimulates transcription by NF-kappa B without the activation and translocation of PKC. Images PMID:1309924

  15. KLF4 and SOX9 Transcription Factors Antagonize β-Catenin and Inhibit TCF-Activity In Cancer Cells

    PubMed Central

    Sellak, Hassan; Wu, Songwei; Lincoln, Thomas M

    2013-01-01

    The transcriptional activator β-catenin is a key mediator of the canonical Wnt signaling pathway. β-catenin itself does not bind DNA but functions via interaction with T-cell factor (TCF)/ lymphoid-enhancing factor (LEF) transcription factors. Thus, in the case of active Wnt signaling, β-catenin, in cooperation with TCF/LEF proteins family, activates the expression of a wide variety of genes. To date, the list of established β-catenin interacting targets is far from complete. In this study, we aimed to establish the interaction between β-catenin and transcription factors that might affect TCF activity. We took advantage of EMSA, using TCF as a probe, to screen oligonucleotides known to bind specific transcription factors that might dislodge or antagonize β-catenin/TCF binding. We found that Sox9 and KLF4 antagonize β-catenin/TCF binding in HEK293, A549, SW480, and T47D cells. This inhibition of TCF binding was concentration-dependent and correlated to the in vitro TCF-luciferase functional assays. Overexpression of Sox9 and KLF4 transcription factors in cancer cells show a concentration-dependent reduction of TCF-luciferase as well as the TCF-binding activities. In addition, we demonstrated that both Sox9 and KLF4 interact with β-catenin in an immunoprecipitation assay and reduce its binding to TCF4. Together, these results demonstrate that Sox9 and KLF4 transcription factors antagonize β-catenin/TCF in cancer cells. PMID:22766303

  16. Activating Transcription Factor 4 and X Box Binding Protein 1 of Litopenaeus vannamei Transcriptional Regulated White Spot Syndrome Virus Genes Wsv023 and Wsv083

    PubMed Central

    Li, Xiao-Yun; Pang, Li-Ran; Chen, Yong-Gui; Weng, Shao-Ping; Yue, Hai-Tao; Zhang, Ze-Zhi; Chen, Yi-Hong; He, Jian-Guo

    2013-01-01

    In response to endoplasmic reticulum (ER) stress, the signaling pathway termed unfolded protein response (UPR) is activated. To investigate the role of UPR in Litopenaeus vannamei immunity, the activating transcription factor 4 (designated as LvATF4) which belonged to a branch of the UPR, the [protein kinase RNA (PKR)-like ER kinase, (PERK)]-[eukaryotic initiation factor 2 subunit alpha (eIF2α)] pathway, was identified and characterized. The full-length cDNA of LvATF4 was 1972 bp long, with an open reading frame of 1299 bp long that encoded a 432 amino acid protein. LvATF4 was highly expressed in gills, intestines and stomach. For the white spot syndrome virus (WSSV) challenge, LvATF4 was upregulated in the gills after 3 hpi and increased by 1.9-fold (96 hpi) compared to the mock-treated group. The LvATF4 knock-down by RNA interference resulted in a lower cumulative mortality of L. vannamei under WSSV infection. Reporter gene assays show that LvATF4 could upregulate the expression of the WSSV gene wsv023 based on the activating transcription factor/cyclic adenosine 3′, 5′-monophosphate response element (ATF/CRE). Another transcription factor of L. vannamei, X box binding protein 1 (designated as LvXBP1), has a significant function in [inositol-requiring enzyme-1(IRE1) – (XBP1)] pathway. This transcription factor upregulated the expression of the WSSV gene wsv083 based on the UPR element (UPRE). These results suggest that in L. vannamei UPR signaling pathway transcription factors are important for WSSV and might facilitate WSSV infection. PMID:23638122

  17. Role of hypoxia-inducible factor-1 in transcriptional activation of ceruloplasmin by iron deficiency

    NASA Technical Reports Server (NTRS)

    Mukhopadhyay, C. K.; Mazumder, B.; Fox, P. L.

    2000-01-01

    A role of the copper protein ceruloplasmin (Cp) in iron metabolism is suggested by its ferroxidase activity and by the tissue iron overload in hereditary Cp deficiency patients. In addition, plasma Cp increases markedly in several conditions of anemia, e.g. iron deficiency, hemorrhage, renal failure, sickle cell disease, pregnancy, and inflammation. However, little is known about the cellular and molecular mechanism(s) involved. We have reported that iron chelators increase Cp mRNA expression and protein synthesis in human hepatocarcinoma HepG2 cells. Furthermore, we have shown that the increase in Cp mRNA is due to increased rate of transcription. We here report the results of new studies designed to elucidate the molecular mechanism underlying transcriptional activation of Cp by iron deficiency. The 5'-flanking region of the Cp gene was cloned from a human genomic library. A 4774-base pair segment of the Cp promoter/enhancer driving a luciferase reporter was transfected into HepG2 or Hep3B cells. Iron deficiency or hypoxia increased luciferase activity by 5-10-fold compared with untreated cells. Examination of the sequence showed three pairs of consensus hypoxia-responsive elements (HREs). Deletion and mutation analysis showed that a single HRE was necessary and sufficient for gene activation. The involvement of hypoxia-inducible factor-1 (HIF-1) was shown by gel-shift and supershift experiments that showed HIF-1alpha and HIF-1beta binding to a radiolabeled oligonucleotide containing the Cp promoter HRE. Furthermore, iron deficiency (and hypoxia) did not activate Cp gene expression in Hepa c4 hepatoma cells deficient in HIF-1beta, as shown functionally by the inactivity of a transfected Cp promoter-luciferase construct and by the failure of HIF-1 to bind the Cp HRE in nuclear extracts from these cells. These results are consistent with in vivo findings that iron deficiency increases plasma Cp and provides a molecular mechanism that may help to understand these

  18. Enhanced oxidative stress resistance through activation of a zinc deficiency transcription factor in Brachypodium distachyon.

    PubMed

    Glover-Cutter, Kira M; Alderman, Stephen; Dombrowski, James E; Martin, Ruth C

    2014-11-01

    Identification of viable strategies to increase stress resistance of crops will become increasingly important for the goal of global food security as our population increases and our climate changes. Considering that resistance to oxidative stress is oftentimes an indicator of health and longevity in animal systems, characterizing conserved pathways known to increase oxidative stress resistance could prove fruitful for crop improvement strategies. This report argues for the usefulness and practicality of the model organism Brachypodium distachyon for identifying and validating stress resistance factors. Specifically, we focus on a zinc deficiency B. distachyon basic leucine zipper transcription factor, BdbZIP10, and its role in oxidative stress in the model organism B. distachyon. When overexpressed, BdbZIP10 protects plants and callus tissue from oxidative stress insults, most likely through distinct and direct activation of protective oxidative stress genes. Increased oxidative stress resistance and cell viability through the overexpression of BdbZIP10 highlight the utility of investigating conserved stress responses between plant and animal systems. PMID:25228396

  19. Identification and characterization a novel transcription factor activator protein-1 in the sea cucumber Apostichopus japonicus.

    PubMed

    Yang, Limeng; Li, Chenghua; Chang, Yaqing; Gao, Yinxue; Wang, Yi; Wei, Jing; Song, Jian; Sun, Ping

    2015-08-01

    The transcription factor activator protein-1 (AP-1) is an important gene expression regulator with typical Jun and region-leucine zipper (bZIP) domains and can respond to a plethora of physiological and pathological stimulus. In this study, we identified a novel AP-1 gene in Apostichopus japonicus by transcriptome sequencing and RACE approaches (designated as AjAP-1). The full-length of AjAP-1 was of 2944 bp including a 5' untranslated region (UTR) of 201 bp, a 3' UTR of 1753 bp and a putative open reading frame of 990 bp encoding a polypeptide of 329 amino acid residues. Two representative domains of Jun and bZIP as well as two nuclear localization signals (NLSs) were also detected in deduced amino acid of AjAP-1. Spatial distribution expression indicated that AjAP-1 was ubiquitously expressed in all examined tissues with predominant expression in the body wall, moderate in the tube feet, respiratory tree and colemocytes and slightly weak in the intestine and longitudinal muscle. Time-course expression analysis in intestine and coelomocytes revealed that AjAP-1 both reached its peak expression at 4 h after Vibrio splendidus challenge with a 2.6 and 8.2-fold increase compared to their control groups, respectively. Taken together, all these results suggested that AjAP-1 was a novel immune factor and might be involved in the processes of anti-bacteria response in sea cucumber. PMID:26093208

  20. Arabidopsis Sigma Factor Binding Proteins Are Activators of the WRKY33 Transcription Factor in Plant Defense[W

    PubMed Central

    Lai, Zhibing; Li, Ying; Wang, Fei; Cheng, Yuan; Fan, Baofang; Yu, Jing-Quan; Chen, Zhixiang

    2011-01-01

    Necrotrophic pathogens are important plant pathogens that cause many devastating plant diseases. Despite their impact, our understanding of the plant defense response to necrotrophic pathogens is limited. The WRKY33 transcription factor is important for plant resistance to necrotrophic pathogens; therefore, elucidation of its functions will enhance our understanding of plant immunity to necrotrophic pathogens. Here, we report the identification of two WRKY33-interacting proteins, nuclear-encoded SIGMA FACTOR BINDING PROTEIN1 (SIB1) and SIB2, which also interact with plastid-encoded plastid RNA polymerase SIGMA FACTOR1. Both SIB1 and SIB2 contain an N-terminal chloroplast targeting signal and a putative nuclear localization signal, suggesting that they are dual targeted. Bimolecular fluorescence complementation indicates that WRKY33 interacts with SIBs in the nucleus of plant cells. Both SIB1 and SIB2 contain a short VQ motif that is important for interaction with WRKY33. The two VQ motif–containing proteins recognize the C-terminal WRKY domain and stimulate the DNA binding activity of WRKY33. Like WRKY33, both SIB1 and SIB2 are rapidly and strongly induced by the necrotrophic pathogen Botrytis cinerea. Resistance to B. cinerea is compromised in the sib1 and sib2 mutants but enhanced in SIB1-overexpressing transgenic plants. These results suggest that dual-targeted SIB1 and SIB2 function as activators of WRKY33 in plant defense against necrotrophic pathogens. PMID:21990940

  1. Mutational Analysis of AREA, a Transcriptional Activator Mediating Nitrogen Metabolite Repression in Aspergillus nidulans and a Member of the “Streetwise” GATA Family of Transcription Factors

    PubMed Central

    Wilson, Richard A.; Arst, Herbert N.

    1998-01-01

    Summary: The transcriptional activator AREA is a member of the GATA family of transcription factors and mediates nitrogen metabolite repression in the fungus Aspergillus nidulans. The nutritional versatility of A. nidulans and its amenability to classical and reverse genetic manipulations make the AREA DNA binding domain (DBD) a useful model for analyzing GATA family DBDs, particularly as structures of two AREA-DNA complexes have been determined. The 109 extant mutant forms of the AREA DBD surveyed here constitute one of the highest totals of eukaryotic transcription factor DBD mutants, are discussed in light of the roles of individual residues, and are compared to corresponding mutant sequence changes in other fungal GATA factor DBDs. Other topics include delineation of the DBD using both homology and mutational truncation, use of frameshift reversion to detect regions of tolerance to mutational change, the finding that duplication of the DBD can apparently enhance AREA function, and use of the AREA system to analyze a vertebrate GATA factor DBD. Some major points to emerge from work on the AREA DBD are (i) tolerance to sequence change (with retention of function) is surprisingly great, (ii) mutational changes in a transcription factor can have widely differing, even opposing, effects on expression of different structural genes so that monitoring expression of one or even several structural genes can be insufficient and possibly misleading, and (iii) a mutational change altering local hydrophobic packing and DNA binding target specificity can markedly influence the behavior of mutational changes elsewhere in the DBD. PMID:9729601

  2. Lycopene activates antioxidant enzymes and nuclear transcription factor systems in heat-stressed broilers.

    PubMed

    Sahin, K; Orhan, C; Tuzcu, M; Sahin, N; Hayirli, A; Bilgili, S; Kucuk, O

    2016-05-01

    This study was conducted to evaluate the effects of dietary lycopene supplementation on growth performance, antioxidant status, and muscle nuclear transcription factor [Kelch like-ECH-associated protein 1 (Keap1) and (erythroid-derived 2)-like 2 (Nrf2)] expressions in broiler chickens exposed to heat stress (HS). A total of 180 one-day-old male broiler chicks (Ross 308) were assigned randomly to one of 2×3 factorially arranged treatments: two housing temperatures (22°C for 24 h/d; thermoneutral, TN or 34°C for 8 h/d HS) and three dietary lycopene levels (0, 200, or 400 mg/kg). Each treatment consisted of three replicates of 10 birds. Birds were reared to 42 d of age. Heat stress caused reductions in feed intake and weight gain by 12.2 and 20.7% and increased feed efficiency by 10.8% (P<0.0001 for all). Increasing dietary lycopene level improved performance in both environments. Birds reared under the HS environment had lower serum and muscle lycopene concentration (0.34 vs. 0.50 μg/mL and 2.80 vs. 2.13 μg/g), activities of superoxide dismutase (151 vs. 126 U/mL and 131 vs. 155 U/mg protein), glutathione peroxidase (184 vs. 154 U/mL and 1.39 vs. 1.74 U/mg protein), and higher malondialdehyde (MDA) concentration (0.53 vs. 0.83 μg/mL and 0.78 vs. 0.45 μg/ mg protein) than birds reared under the TN environment. Changes in levels of lycopene and MDA and activities of enzymes in serum and muscle varied by the environmental temperature as dietary lycopene level increased. Moreover, increasing dietary lycopene level suppressed muscle Keap1 expression and enhanced muscle Nrf2 expression, which had increased by 150% and decreased by 40%, respectively in response to HS. In conclusion, lycopene supplementation alleviates adverse effects of HS on performance through modulating expressions of stress-related nuclear transcription factors. PMID:26936958

  3. AMP-activated Protein Kinase Directly Phosphorylates and Destabilizes Hedgehog Pathway Transcription Factor GLI1 in Medulloblastoma

    PubMed Central

    Li, Yen-Hsing; Luo, Jia; Mosley, Yung-Yi C.; Hedrick, Victoria E.; Paul, Lake N.; Chang, Julia; Zhang, GuangJun; Wang, Yu-Kuo; Banko, Max R.; Brunet, Anne; Kuang, Shihuan; Wu, Jen-Leih; Chang, Chun-Ju; Scott, Matthew P.; Yang, Jer-Yen

    2015-01-01

    Summary The Hedgehog (Hh) pathway regulates cell differentiation and proliferation during development by controlling the Gli transcription factors. Cell fate decisions and progression toward organ and tissue maturity must be coordinated and how energy sensor regulates Hh pathway is not clear. AMP-activated Protein Kinase (AMPK) is an important sensor of energy stores that controls protein synthesis and other energy-intensive processes. AMPK is directly responsive to intracellular AMP levels, inhibiting a wide range of cell activities if ATP is low and AMP is high. Thus, AMPK can affect development by influencing protein synthesis and other processes needed for growth and differentiation. Activation of AMPK reduces GLI1 protein levels and stability, thus blocking Sonic hedgehog-induced transcriptional activity. AMPK phosphorylates GLI1 at serines 102 and 408 and threonine 1074. Mutation of these three sites into alanine prevents phosphorylation by AMPK. This in turn leads to increased GLI1 protein stability, transcriptional activity, and oncogenic potency. PMID:26190112

  4. Phagocytosis Enhances Lysosomal and Bactericidal Properties by Activating the Transcription Factor TFEB.

    PubMed

    Gray, Matthew A; Choy, Christopher H; Dayam, Roya M; Ospina-Escobar, Erika; Somerville, Alexander; Xiao, Xuan; Ferguson, Shawn M; Botelho, Roberto J

    2016-08-01

    Macrophages internalize pathogens through phagocytosis, entrapping them into organelles called phagosomes. Phagosomes then fuse with lysosomes to mature into phagolysosomes, acquiring an acidic and hydrolytic lumen that kills the pathogens. During an ongoing infection, macrophages can internalize dozens of bacteria. Thus, we hypothesized that an initial round of phagocytosis might boost lysosome function and bactericidal ability to cope with subsequent rounds of phagocytosis. To test this hypothesis, we employed Fcγ-receptor-mediated phagocytosis and endocytosis, which internalize immunoglobulin G (IgG)-opsonized particles and polyvalent IgG immune complexes, respectively. We report that Fcγ receptor activation in macrophages enhances lysosome-based proteolysis and killing of subsequently phagocytosed E. coli compared to naive macrophages. Importantly, we show that Fcγ receptor activation causes nuclear translocation of TFEB, a transcription factor that boosts expression of lysosome genes. Indeed, Fc receptor activation is accompanied by increased expression of specific lysosomal proteins. Remarkably, TFEB silencing represses the Fcγ-receptor-mediated enhancements in degradation and bacterial killing. In addition, nuclear translocation of TFEB requires phagosome completion and fails to occur in cells silenced for MCOLN1, a lysosomal Ca(2+) channel, suggesting that lysosomal Ca(2+) released during phagosome maturation activates TFEB. Finally, we demonstrate that non-opsonic phagocytosis of E. coli also enhances lysosomal degradation in a TFEB-dependent manner, suggesting that this phenomenon is not limited to Fcγ receptors. Overall, we show that macrophages become better killers after one round of phagocytosis and suggest that phagosomes and lysosomes are capable of bi-directional signaling. PMID:27397893

  5. Structure-Function Analysis of the Drosophila melanogaster Caudal Transcription Factor Provides Insights into Core Promoter-preferential Activation.

    PubMed

    Shir-Shapira, Hila; Sharabany, Julia; Filderman, Matan; Ideses, Diana; Ovadia-Shochat, Avital; Mannervik, Mattias; Juven-Gershon, Tamar

    2015-07-10

    Regulation of RNA polymerase II transcription is critical for the proper development, differentiation, and growth of an organism. The RNA polymerase II core promoter is the ultimate target of a multitude of transcription factors that control transcription initiation. Core promoters encompass the RNA start site and consist of functional elements such as the TATA box, initiator, and downstream core promoter element (DPE), which confer specific properties to the core promoter. We have previously discovered that Drosophila Caudal, which is a master regulator of genes involved in development and differentiation, is a DPE-specific transcriptional activator. Here, we show that the mouse Caudal-related homeobox (Cdx) proteins (mCdx1, mCdx2, and mCdx4) are also preferential core promoter transcriptional activators. To elucidate the mechanism that enables Caudal to preferentially activate DPE transcription, we performed structure-function analysis. Using a systematic series of deletion mutants (all containing the intact DNA-binding homeodomain) we discovered that the C-terminal region of Caudal contributes to the preferential activation of the fushi tarazu (ftz) Caudal target gene. Furthermore, the region containing both the homeodomain and the C terminus of Caudal was sufficient to confer core promoter-preferential activation to the heterologous GAL4 DNA-binding domain. Importantly, we discovered that Drosophila CREB-binding protein (dCBP) is a co-activator for Caudal-regulated activation of ftz. Strikingly, dCBP conferred the ability to preferentially activate the DPE-dependent ftz reporter to mini-Caudal proteins that were unable to preferentially activate ftz transcription themselves. Taken together, it is the unique combination of dCBP and Caudal that enables the co-activation of ftz in a core promoter-preferential manner. PMID:26018075

  6. Activating Transcription Factor 3 Expression as a Marker of Response to the Histone Deacetylase Inhibitor Pracinostat.

    PubMed

    Sooraj, Dhanya; Xu, Dakang; Cain, Jason E; Gold, Daniel P; Williams, Bryan R G

    2016-07-01

    Improved treatment strategies are required for bladder cancer due to frequent recurrence of low-grade tumors and poor survival rate from high-grade tumors with current therapies. Histone deacetylase inhibitors (HDACi), approved as single agents for specific lymphomas, have shown promising preclinical results in solid tumors but could benefit from identification of biomarkers for response. Loss of activating transcription factor 3 (ATF3) expression is a feature of bladder tumor progression and correlates with poor survival. We investigated the utility of measuring ATF3 expression as a marker of response to the HDACi pracinostat in bladder cancer models. Pracinostat treatment of bladder cancer cell lines reactivated the expression of ATF3, correlating with significant alteration in proliferative, migratory, and anchorage-dependent growth capacities. Pracinostat also induced growth arrest at the G0-G1 cell-cycle phase, coincident with the activation of tumor suppressor genes. In mouse xenograft bladder cancer models, pracinostat treatment significantly reduced tumor volumes compared with controls, accompanied by reexpression of ATF3 in nonproliferating cells from early to late stage of therapy and in parallel induced antiangiogenesis and apoptosis. Importantly, cells in which ATF3 expression was depleted were less sensitive to pracinostat treatment in vitro, exhibiting significantly higher proliferative and migratory properties. In vivo, control xenograft tumors were significantly more responsive to treatment than ATF3 knockdown xenografts. Thus, reactivation of ATF3 is an important factor in determining sensitivity to pracinostat treatment, both in vitro and in vivo, and could serve as a potential biomarker of response and provide a rationale for therapeutic utility in HDACi-mediated treatments for bladder cancer. Mol Cancer Ther; 15(7); 1726-39. ©2016 AACR. PMID:27196751

  7. Activation of the Ig Iα1 promoter by the transcription factor Ets-1 triggers Ig Iα1-Cα1 germline transcription in epithelial cancer cells.

    PubMed

    Duan, Zhi; Zheng, Hui; Xu, San; Jiang, Yiqun; Liu, Haidan; Li, Ming; Hu, Duosha; Li, Wei; Bode, Ann M; Dong, Zigang; Cao, Ya

    2014-03-01

    Immunoglobulins (Igs) are known to be synthesized and secreted only by B lymphocytes. Class switch recombination (CSR) is a key event that enables B cells to express Igs, and one of the crucial steps for CSR initiation is the germline transcription of Ig genes. Surprisingly, recent studies have demonstrated that the Ig genes are also expressed in some epithelial cancer cells; however, the mechanisms underlying how cancer cells initiate CSR and express Igs are still unknown. In this study, we confirmed that the Ig Iα1 promoter in cancer cell lines was activated by the Ets-1 transcription factor, and the activity of the Ig Iα1 promoter and Ig Iα1-Cα1 germline transcription were attenuated after knockdown of Ets-1 by specific small interfering RNAs (siRNA). Furthermore, the expression of Ets-1 and Igα heavy chain in cancer cells was dose dependently upregulated by TGF-β1. These results indicate that activation of the Ig Iα1 promoter by the transcription factor Ets-1 is a critical pathway and provides a novel mechanism for Ig expression in non-B cell cancers. PMID:24185710

  8. Association of transcription factor YY1 with the high molecular weight Notch complex suppresses the transactivation activity of Notch.

    PubMed

    Yeh, Tien-Shun; Lin, Yu-Min; Hsieh, Rong-Hong; Tseng, Min-Jen

    2003-10-24

    Notch receptors are evolutionarily conserved from Drosophila to human and play important roles in cell fate decisions. After ligand binding, Notch receptors are cleaved to release their intracellular domains. The intracellular domains, the activated form of Notch receptors, are then translocated into the nucleus where they interact with other transcriptional machinery to regulate the expression of cellular genes. To dissect the molecular mechanisms of Notch signaling, the cellular targets that interact with Notch1 receptor intracellular domain (N1IC) were screened. In this study, we found that endogenous transcription factor Ying Yang 1 (YY1) was associated with exogenous N1IC in human K562 erythroleukemic cells. The ankyrin (ANK) domain of N1IC and zinc finger domains of YY1 were essential for the association of N1IC and YY1 according to the pull-down assay of glutathione S-transferase fusion proteins. Furthermore, both YY1 and N1IC were present in a large complex of the nucleus to suppress the luciferase reporter activity transactivated by Notch signaling. The transcription factor YY1 indirectly regulated the transcriptional activity of the wild-type CBF1-response elements via the direct interaction of N1IC and CBF1. We also demonstrated the association between endogenous N1IC and intrinsic YY1 in human acute T-cell lymphoblastic leukemia cell lines. Taken together, these results indicate that transcription factor YY1 may modulate Notch signaling via association with the high molecular weight Notch complex. PMID:12913000

  9. Transcription factors GAF and HSF act at distinct regulatory steps to modulate stress-induced gene activation

    PubMed Central

    Fuda, Nicholas J.; Mahat, Dig B.; Core, Leighton J.; Guertin, Michael J.

    2016-01-01

    The coordinated regulation of gene expression at the transcriptional level is fundamental to development and homeostasis. Inducible systems are invaluable when studying transcription because the regulatory process can be triggered instantaneously, allowing the tracking of ordered mechanistic events. Here, we use precision run-on sequencing (PRO-seq) to examine the genome-wide heat shock (HS) response in Drosophila and the function of two key transcription factors on the immediate transcription activation or repression of all genes regulated by HS. We identify the primary HS response genes and the rate-limiting steps in the transcription cycle that GAGA-associated factor (GAF) and HS factor (HSF) regulate. We demonstrate that GAF acts upstream of promoter-proximally paused RNA polymerase II (Pol II) formation (likely at the step of chromatin opening) and that GAF-facilitated Pol II pausing is critical for HS activation. In contrast, HSF is dispensable for establishing or maintaining Pol II pausing but is critical for the release of paused Pol II into the gene body at a subset of highly activated genes. Additionally, HSF has no detectable role in the rapid HS repression of thousands of genes. PMID:27492368

  10. Band-pass processing in a GPCR signaling pathway selects for NFAT transcription factor activation.

    PubMed

    Sumit, M; Neubig, R R; Takayama, S; Linderman, J J

    2015-11-01

    Many biological processes are rhythmic and proper timing is increasingly appreciated as being critical for development and maintenance of physiological functions. To understand how temporal modulation of an input signal influences downstream responses, we employ microfluidic pulsatile stimulation of a G-protein coupled receptor, the muscarinic M3 receptor, in single cells with simultaneous real-time imaging of both intracellular calcium and NFAT nuclear localization. Interestingly, we find that reduced stimulation with pulses of ligand can give more efficient transcription factor activation, if stimuli are timed appropriately. Our experiments and computational analyses show that M3 receptor-induced calcium oscillations form a low pass filter while calcium-induced NFAT translocation forms a high pass filter. The combination acts as a band-pass filter optimized for intermediate frequencies of stimulation. We demonstrate that receptor desensitization and NFAT translocation rates determine critical features of the band-pass filter and that the band-pass may be shifted for different receptors or NFAT dynamics. As an example, we show that the two NFAT isoforms (NFAT4 and NFAT1) have shifted band-pass windows for the same receptor. While we focus specifically on the M3 muscarinic receptor and NFAT translocation, band-pass processing is expected to be a general theme that applies to multiple signaling pathways. PMID:26374065

  11. Limits on information transduction through amplitude and frequency regulation of transcription factor activity

    PubMed Central

    Hansen, Anders S; O'Shea, Erin K

    2015-01-01

    Signaling pathways often transmit multiple signals through a single shared transcription factor (TF) and encode signal information by differentially regulating TF dynamics. However, signal information will be lost unless it can be reliably decoded by downstream genes. To understand the limits on dynamic information transduction, we apply information theory to quantify how much gene expression information the yeast TF Msn2 can transduce to target genes in the amplitude or frequency of its activation dynamics. We find that although the amount of information transmitted by Msn2 to single target genes is limited, information transduction can be increased by modulating promoter cis-elements or by integrating information from multiple genes. By correcting for extrinsic noise, we estimate an upper bound on information transduction. Overall, we find that information transduction through amplitude and frequency regulation of Msn2 is limited to error-free transduction of signal identity, but not signal intensity information. DOI: http://dx.doi.org/10.7554/eLife.06559.001 PMID:25985085

  12. Stimulation of ribosomal RNA gene promoter by transcription factor Sp1 involves active DNA demethylation by Gadd45-NER pathway.

    PubMed

    Rajput, Pallavi; Pandey, Vijaya; Kumar, Vijay

    2016-08-01

    The well-studied Pol II transcription factor Sp1 has not been investigated for its regulatory role in rDNA transcription. Here, we show that Sp1 bound to specific sites on rDNA and localized into the nucleoli during the G1 phase of cell cycle to activate rDNA transcription. It facilitated the recruitment of Pol I pre-initiation complex and impeded the binding of nucleolar remodeling complex (NoRC) to rDNA resulting in the formation of euchromatin active state. More importantly, Sp1 also orchestrated the site-specific binding of Gadd45a-nucleotide excision repair (NER) complex resulting in active demethylation and transcriptional activation of rDNA. Interestingly, knockdown of Sp1 impaired rDNA transcription due to reduced engagement of the Gadd45a-NER complex and hypermethylation of rDNA. Thus, the present study unveils a novel role of Sp1 in rDNA transcription involving promoter demethylation. PMID:27156884

  13. Hepatitis B virus X protein inhibits p53 sequence-specific DNA binding, transcriptional activity, and association with transcription factor ERCC3.

    PubMed Central

    Wang, X W; Forrester, K; Yeh, H; Feitelson, M A; Gu, J R; Harris, C C

    1994-01-01

    Chronic active hepatitis caused by infection with hepatitis B virus, a DNA virus, is a major risk factor for human hepatocellular carcinoma. Since the oncogenicity of several DNA viruses is dependent on the interaction of their viral oncoproteins with cellular tumor-suppressor gene products, we investigated the interaction between hepatitis B virus X protein (HBX) and human wild-type p53 protein. HBX complexes with the wild-type p53 protein and inhibits its sequence-specific DNA binding in vitro. HBX expression also inhibits p53-mediated transcriptional activation in vivo and the in vitro association of p53 and ERCC3, a general transcription factor involved in nucleotide excision repair. Therefore, HBX may affect a wide range of p53 functions and contribute to the molecular pathogenesis of human hepatocellular carcinoma. Images PMID:8134379

  14. Transcription Factors Bind Thousands of Active and InactiveRegions in the Drosophila Blastoderm

    SciTech Connect

    Li, Xiao-Yong; MacArthur, Stewart; Bourgon, Richard; Nix, David; Pollard, Daniel A.; Iyer, Venky N.; Hechmer, Aaron; Simirenko, Lisa; Stapleton, Mark; Luengo Hendriks, Cris L.; Chu, Hou Cheng; Ogawa, Nobuo; Inwood, William; Sementchenko, Victor; Beaton, Amy; Weiszmann, Richard; Celniker, Susan E.; Knowles, David W.; Gingeras, Tom; Speed, Terence P.; Eisen, Michael B.; Biggin, Mark D.

    2008-01-10

    Identifying the genomic regions bound by sequence-specific regulatory factors is central both to deciphering the complex DNA cis-regulatory code that controls transcription in metazoans and to determining the range of genes that shape animal morphogenesis. Here, we use whole-genome tiling arrays to map sequences bound in Drosophila melanogaster embryos by the six maternal and gap transcription factors that initiate anterior-posterior patterning. We find that these sequence-specific DNA binding proteins bind with quantitatively different specificities to highly overlapping sets of several thousand genomic regions in blastoderm embryos. Specific high- and moderate-affinity in vitro recognition sequences for each factor are enriched in bound regions. This enrichment, however, is not sufficient to explain the pattern of binding in vivo and varies in a context-dependent manner, demonstrating that higher-order rules must govern targeting of transcription factors. The more highly bound regions include all of the over forty well-characterized enhancers known to respond to these factors as well as several hundred putative new cis-regulatory modules clustered near developmental regulators and other genes with patterned expression at this stage of embryogenesis. The new targets include most of the microRNAs (miRNAs) transcribed in the blastoderm, as well as all major zygotically transcribed dorsal-ventral patterning genes, whose expression we show to be quantitatively modulated by anterior-posterior factors. In addition to these highly bound regions, there are several thousand regions that are reproducibly bound at lower levels. However, these poorly bound regions are, collectively, far more distant from genes transcribed in the blastoderm than highly bound regions; are preferentially found in protein-coding sequences; and are less conserved than highly bound regions. Together these observations suggest that many of these poorly-bound regions are not involved in early

  15. Simulated binding of transcription factors to active and inactive regions folds human chromosomes into loops, rosettes and topological domains.

    PubMed

    Brackley, Chris A; Johnson, James; Kelly, Steven; Cook, Peter R; Marenduzzo, Davide

    2016-05-01

    Biophysicists are modeling conformations of interphase chromosomes, often basing the strengths of interactions between segments distant on the genetic map on contact frequencies determined experimentally. Here, instead, we develop a fitting-free, minimal model: bivalent or multivalent red and green 'transcription factors' bind to cognate sites in strings of beads ('chromatin') to form molecular bridges stabilizing loops. In the absence of additional explicit forces, molecular dynamic simulations reveal that bound factors spontaneously cluster-red with red, green with green, but rarely red with green-to give structures reminiscent of transcription factories. Binding of just two transcription factors (or proteins) to active and inactive regions of human chromosomes yields rosettes, topological domains and contact maps much like those seen experimentally. This emergent 'bridging-induced attraction' proves to be a robust, simple and generic force able to organize interphase chromosomes at all scales. PMID:27060145

  16. Characterization of a novel transcriptionally active domain in the transforming growth factor beta-regulated Smad3 protein.

    PubMed

    Prokova, Vassiliki; Mavridou, Sofia; Papakosta, Paraskevi; Kardassis, Dimitris

    2005-01-01

    Transforming growth factor beta (TGFbeta) regulates transcriptional responses via activation of cytoplasmic effector proteins termed Smads. Following their phosphorylation by the type I TGFbeta receptor, Smads form oligomers and translocate to the nucleus where they activate the transcription of TGFbeta target genes in cooperation with nuclear cofactors and coactivators. In the present study, we have undertaken a deletion analysis of human Smad3 protein in order to characterize domains that are essential for transcriptional activation in mammalian cells. With this analysis, we showed that Smad3 contains two domains with transcriptional activation function: the MH2 domain and a second middle domain that includes the linker region and the first two beta strands of the MH2 domain. Using a protein-protein interaction assay based on biotinylation in vivo, we were able to show that a Smad3 protein bearing an internal deletion in the middle transactivation domain is characterized by normal oligomerization and receptor activation properties. However, this mutant has reduced transactivation capacity on synthetic or natural promoters and is unable to interact physically and functionally with the histone acetyltransferase p/CAF. The loss of interaction with p/CAF or other coactivators could account, at least in part, for the reduced transactivation capacity of this Smad3 mutant. Our data support an essential role of the previously uncharacterized middle region of Smad3 for nuclear functions, such as transcriptional activation and interaction with coactivators. PMID:15994459

  17. Transcription factor activating protein 2 beta (TFAP2B) mediates noradrenergic neuronal differentiation in neuroblastoma.

    PubMed

    Ikram, Fakhera; Ackermann, Sandra; Kahlert, Yvonne; Volland, Ruth; Roels, Frederik; Engesser, Anne; Hertwig, Falk; Kocak, Hayriye; Hero, Barbara; Dreidax, Daniel; Henrich, Kai-Oliver; Berthold, Frank; Nürnberg, Peter; Westermann, Frank; Fischer, Matthias

    2016-02-01

    Neuroblastoma is an embryonal pediatric tumor that originates from the developing sympathetic nervous system and shows a broad range of clinical behavior, ranging from fatal progression to differentiation into benign ganglioneuroma. In experimental neuroblastoma systems, retinoic acid (RA) effectively induces neuronal differentiation, and RA treatment has been therefore integrated in current therapies. However, the molecular mechanisms underlying differentiation are still poorly understood. We here investigated the role of transcription factor activating protein 2 beta (TFAP2B), a key factor in sympathetic nervous system development, in neuroblastoma pathogenesis and differentiation. Microarray analyses of primary neuroblastomas (n = 649) demonstrated that low TFAP2B expression was significantly associated with unfavorable prognostic markers as well as adverse patient outcome. We also found that low TFAP2B expression was strongly associated with CpG methylation of the TFAP2B locus in primary neuroblastomas (n = 105) and demethylation with 5-aza-2'-deoxycytidine resulted in induction of TFAP2B expression in vitro, suggesting that TFAP2B is silenced by genomic methylation. Tetracycline inducible re-expression of TFAP2B in IMR-32 and SH-EP neuroblastoma cells significantly impaired proliferation and cell cycle progression. In IMR-32 cells, TFAP2B induced neuronal differentiation, which was accompanied by up-regulation of the catecholamine biosynthesizing enzyme genes DBH and TH, and down-regulation of MYCN and REST, a master repressor of neuronal genes. By contrast, knockdown of TFAP2B by lentiviral transduction of shRNAs abrogated RA-induced neuronal differentiation of SH-SY5Y and SK-N-BE(2)c neuroblastoma cells almost completely. Taken together, our results suggest that TFAP2B is playing a vital role in retaining RA responsiveness and mediating noradrenergic neuronal differentiation in neuroblastoma. PMID:26598443

  18. Human general transcription factor TFIIA: characterization of a cDNA encoding the small subunit and requirement for basal and activated transcription.

    PubMed Central

    DeJong, J; Bernstein, R; Roeder, R G

    1995-01-01

    The human general transcription factor TFIIA is one of several factors involved in specific transcription by RNA polymerase II, possibly by regulating the activity of the TATA-binding subunit (TBP) of TFIID. TFIIA purified from HeLa extracts consists of 35-, 19-, and 12-kDa subunits. Here we describe the isolation of a cDNA clone (hTFIIA gamma) encoding the 12-kDa subunit. Using expression constructs derived from hTFIIA gamma and TFIIA alpha/beta (which encodes a 55-kDa precursor to the alpha and beta subunits of natural TFIIA), we have constructed a synthetic TFIIA with a polypeptide composition similar to that of natural TFIIA. The recombinant complex supports the formation of a DNA-TBP-TFIIA complex and mediates both basal and Gal4-VP16-activated transcription by RNA polymerase II in TFIIA-depleted nuclear extracts. In contrast, TFIIA has no effect on tRNA and 5S RNA transcription by RNA polymerase III in this system. We also present evidence that both the p55 and p12 recombinant subunits interact with TBP and that the basic region of TBP is critical for the TFIIA-dependent function of TBP in nuclear extracts. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 Fig. 6 PMID:7724559

  19. The transcription factor NFAT promotes exhaustion of activated CD8⁺ T cells.

    PubMed

    Martinez, Gustavo J; Pereira, Renata M; Äijö, Tarmo; Kim, Edward Y; Marangoni, Francesco; Pipkin, Matthew E; Togher, Susan; Heissmeyer, Vigo; Zhang, Yi Chen; Crotty, Shane; Lamperti, Edward D; Ansel, K Mark; Mempel, Thorsten R; Lähdesmäki, Harri; Hogan, Patrick G; Rao, Anjana

    2015-02-17

    During persistent antigen stimulation, CD8(+) T cells show a gradual decrease in effector function, referred to as exhaustion, which impairs responses in the setting of tumors and infections. Here we demonstrate that the transcription factor NFAT controls the program of T cell exhaustion. When expressed in cells, an engineered form of NFAT1 unable to interact with AP-1 transcription factors diminished T cell receptor (TCR) signaling, increased the expression of inhibitory cell surface receptors, and interfered with the ability of CD8(+) T cells to protect against Listeria infection and attenuate tumor growth in vivo. We defined the genomic regions occupied by endogenous and engineered NFAT1 in primary CD8(+) T cells and showed that genes directly induced by the engineered NFAT1 overlapped with genes expressed in exhausted CD8(+) T cells in vivo. Our data show that NFAT promotes T cell anergy and exhaustion by binding at sites that do not require cooperation with AP-1. PMID:25680272

  20. A consensus insulin response element is activated by an Ets-related transcription factor.

    PubMed

    Jacob, K K; Ouyang, L; Stanley, F M

    1995-11-17

    Insulin increases expression of somatostatin-chloramphenicol acetyltransferase (CAT) constructs 10-fold and thymidine kinase-CAT constructs 5-fold in GH4 cells. These responses are similar to our previously reported data on insulin-increased prolactin-CAT expression. They are also observed in HeLa cells and are thus not cell type specific. The evidence suggests that the insulin responsiveness of these genes is mediated by an Ets-related transcription factor. First, linker-scanning mutations and/or deletions of the prolactin, somatostatin, and thymidine kinase promoters suggest that their insulin responsiveness is mediated by the sequence CGGA. This sequence is identical with the response element of the Ets-related transcription factors. Second, CGGA-containing sequences placed at -88 in the delta MTV-CAT reporter plasmid conferred insulin responsiveness to the mammary tumor virus promoter. Third, expression of the DNA-binding domain of c-Ets-2, which acts by blocking effects mediated by Ets-related transcription factors, inhibits the response of these promoters to insulin. Finally, the Ets-related proteins Sap and Elk-1 bind to the prolactin, somatostatin, and thymidine kinase insulin-response elements. An Ets-like element was found in all insulin-sensitive promoters examined and may serve a similar function in those promoters. PMID:7499246

  1. Activation of Aro80 transcription factor by heat-induced aromatic amino acid influx in Saccharomyces cerevisiae.

    PubMed

    Lee, Kyusung; Sung, Changmin; Kim, Byung-Gee; Hahn, Ji-Sook

    2013-08-16

    In Saccharomyces cerevisiae, transcription of ARO9 and ARO10 genes, involved in the catabolism of aromatic amino acids, is activated by Aro80 transcription factor in response to aromatic amino acids. Here we show that the transcription of ARO9 and ARO10 is also induced by heat shock in an Aro80-dependent manner. However, heat shock-related signaling pathways including PKA, PKC, and HOG pathways are not involved in the heat shock activation of Aro80. We elucidate that heat-induced increase in aromatic amino acid influx can lead to the inducer-dependent activation of Aro80 upon heat shock. Known aromatic amino acid permeases play an insignificant role in the heat-induced expression of ARO9 and ARO10, suggesting that an increase in plasma membrane fluidity might be responsible for the influx of aromatic amino acids during heat shock stress. PMID:23860270

  2. Occupancy by key transcription factors is a more accurate predictor of enhancer activity than histone modifications or chromatin accessibility

    SciTech Connect

    Dogan, Nergiz; Wu, Weisheng; Morrissey, Christapher S.; Chen, Kuan-Bei; Stonestrom, Aaron; Long, Maria; Keller, Cheryl A.; Cheng, Yong; Jain, Deepti; Visel, Axel; Pennacchio, Len A.; Weiss, Mitchell J.; Blobel, Gerd A.; Hardison, Ross C.

    2015-04-23

    Regulated gene expression controls organismal development, and variation in regulatory patterns has been implicated in complex traits. Thus accurate prediction of enhancers is important for further understanding of these processes. Genome-wide measurement of epigenetic features, such as histone modifications and occupancy by transcription factors, is improving enhancer predictions, but the contribution of these features to prediction accuracy is not known. Given the importance of the hematopoietic transcription factor TAL1 for erythroid gene activation, we predicted candidate enhancers based on genomic occupancy by TAL1 and measured their activity. Contributions of multiple features to enhancer prediction were evaluated based on the results of these and other studies. Results: TAL1-bound DNA segments were active enhancers at a high rate both in transient transfections of cultured cells (39 of 79, or 56%) and transgenic mice (43 of 66, or 65%). The level of binding signal for TAL1 or GATA1 did not help distinguish TAL1-bound DNA segments as active versus inactive enhancers, nor did the density of regulation-related histone modifications. A meta-analysis of results from this and other studies (273 tested predicted enhancers) showed that the presence of TAL1, GATA1, EP300, SMAD1, H3K4 methylation, H3K27ac, and CAGE tags at DNase hypersensitive sites gave the most accurate predictors of enhancer activity, with a success rate over 80% and a median threefold increase in activity. Chromatin accessibility assays and the histone modifications H3K4me1 and H3K27ac were sensitive for finding enhancers, but they have high false positive rates unless transcription factor occupancy is also included. Conclusions: Occupancy by key transcription factors such as TAL1, GATA1, SMAD1, and EP300, along with evidence of transcription, improves the accuracy of enhancer predictions based on epigenetic features.

  3. Occupancy by key transcription factors is a more accurate predictor of enhancer activity than histone modifications or chromatin accessibility

    DOE PAGESBeta

    Dogan, Nergiz; Wu, Weisheng; Morrissey, Christapher S.; Chen, Kuan-Bei; Stonestrom, Aaron; Long, Maria; Keller, Cheryl A.; Cheng, Yong; Jain, Deepti; Visel, Axel; et al

    2015-04-23

    Regulated gene expression controls organismal development, and variation in regulatory patterns has been implicated in complex traits. Thus accurate prediction of enhancers is important for further understanding of these processes. Genome-wide measurement of epigenetic features, such as histone modifications and occupancy by transcription factors, is improving enhancer predictions, but the contribution of these features to prediction accuracy is not known. Given the importance of the hematopoietic transcription factor TAL1 for erythroid gene activation, we predicted candidate enhancers based on genomic occupancy by TAL1 and measured their activity. Contributions of multiple features to enhancer prediction were evaluated based on the resultsmore » of these and other studies. Results: TAL1-bound DNA segments were active enhancers at a high rate both in transient transfections of cultured cells (39 of 79, or 56%) and transgenic mice (43 of 66, or 65%). The level of binding signal for TAL1 or GATA1 did not help distinguish TAL1-bound DNA segments as active versus inactive enhancers, nor did the density of regulation-related histone modifications. A meta-analysis of results from this and other studies (273 tested predicted enhancers) showed that the presence of TAL1, GATA1, EP300, SMAD1, H3K4 methylation, H3K27ac, and CAGE tags at DNase hypersensitive sites gave the most accurate predictors of enhancer activity, with a success rate over 80% and a median threefold increase in activity. Chromatin accessibility assays and the histone modifications H3K4me1 and H3K27ac were sensitive for finding enhancers, but they have high false positive rates unless transcription factor occupancy is also included. Conclusions: Occupancy by key transcription factors such as TAL1, GATA1, SMAD1, and EP300, along with evidence of transcription, improves the accuracy of enhancer predictions based on epigenetic features.« less

  4. The restricted promoter activity of the liver transcription factor hepatocyte nuclear factor 3 beta involves a cell-specific factor and positive autoactivation.

    PubMed Central

    Pani, L; Quian, X B; Clevidence, D; Costa, R H

    1992-01-01

    The transcription factor hepatocyte nuclear factor 3 (HNF-3) is involved in the coordinate expression of several liver genes. HNF-3 DNA binding activity is composed of three different liver proteins which recognize the same DNA site. The HNF-3 proteins (designated alpha, beta, and gamma) possess homology in the DNA binding domain and in several additional regions. To understand the cell-type-specific expression of HNF-3 beta, we have defined the regulatory sequences that elicit hepatoma-specific expression. Promoter activity requires -134 bp of HNF-3 beta proximal sequences and binds four nuclear proteins, including two ubiquitous factors. One of these promoter sites interacts with a novel cell-specific factor, LF-H3 beta, whose binding activity correlates with the HNF-3 beta tissue expression pattern. Furthermore, there is a binding site for the HNF-3 protein within its own promoter, suggesting that an autoactivation mechanism is involved in the establishment of HNF-3 beta expression. We propose that both the LF-H3 beta and HNF-3 sites play an important role in the cell-type-specific expression of the HNF-3 beta transcription factor. Images PMID:1732730

  5. A Global Genomic and Genetic Strategy to Identify, Validate and Use Gene Signatures of Xenobiotic-Responsive Transcription Factors in Prediction of Pathway Activation in the Mouse Liver

    EPA Science Inventory

    Many drugs and environmentally-relevant chemicals activate xenobiotic-responsive transcription factors. Identification of target genes of these factors would be useful in predicting pathway activation in in vitro chemical screening as well as their involvement in disease states. ...

  6. Trps1 activates a network of secreted Wnt inhibitors and transcription factors crucial to vibrissa follicle morphogenesis

    PubMed Central

    Fantauzzo, Katherine A.; Christiano, Angela M.

    2012-01-01

    Mutations in TRPS1 cause trichorhinophalangeal syndrome types I and III, which are characterized by sparse scalp hair in addition to craniofacial and skeletal abnormalities. Trps1 is a vertebrate transcription factor that contains nine zinc-finger domains, including a GATA-type zinc finger through which it binds DNA. Mice in which the GATA domain of Trps1 has been deleted (Trps1Δgt/Δgt) have a reduced number of pelage follicles and lack vibrissae follicles postnatally. To identify the transcriptional targets of Trps1 in the developing vibrissa follicle, we performed microarray hybridization analysis, comparing expression patterns in the whisker pads of wild-type versus Trps1Δgt/Δgt embryos. We identified a number of transcription factors and Wnt inhibitors among transcripts downregulated in the mutant embryos and several extracellular matrix proteins that were upregulated in the mutant samples, and demonstrated that target gene expression levels were altered in vivo in Trps1Δgt/Δgt vibrissae. Unexpectedly, we discovered that Trps1 can directly bind the promoters of its target genes to activate transcription, expanding upon its established role as a transcriptional repressor. Our findings identify Trps1 as a novel regulator of the Wnt signaling pathway and of early hair follicle progenitors in the developing vibrissa follicle. PMID:22115758

  7. Biliverdin reductase, a novel regulator for induction of activating transcription factor-2 and heme oxygenase-1.

    PubMed

    Kravets, Anatoliy; Hu, Zhenbo; Miralem, Tihomir; Torno, Michael D; Maines, Mahin D

    2004-05-01

    Biliverdin IXalpha reductase (BVR) catalyzes reduction of the HO activity product, biliverdin, to bilirubin. hBVR is a serine/threonine kinase that contains a bZip domain. Presently, regulation of gene expression by hBVR was examined. 293A cells were infected with adenovirus-doxycycline (Ad-Dox)-inducible hBVR cDNA. High level expression of hBVR was determined at mRNA, protein, and activity levels 8 h after induction. Cell signal transduction microarray analysis of cells infected with expression or with the control Ad-inverted (INV)-hBVR vector identified ATF-2 among several up-regulated genes. ATF-2 is a bZip transcription factor for activation of cAMP response element (CRE) and a dimeric partner to c-jun in MAPK pathway that regulates the stress protein, HO-1, expression. Northern and Western blot analyses showed increases of approximately 10-fold in ATF-2 mRNA and protein at 16 and 24 h after Dox addition. Ad-INV-hBVR did not effect ATF-2 expression. In hBVR-infected cells, levels of HO-1 mRNA and protein were increased. In vitro translated hBVR and nuclear extract containing hBVR in gel mobility-shift assay bound to AP-1 sites in the ATF-2 promoter region and to an oligonucleotide containing the CRE site. Both bindings could be competed out by excess unlabeled probe; in the presence of hBVR antibody, they displayed shifted bands. Co-transfection of hBVR with ATF-2 or c-jun promoters caused a severalfold increase in luciferase activity. hBVR modulation of ATF-2 and HO-1 expression suggests it has a potential role in regulation of AP-1 and cAMP-regulated genes and a role in cell signaling. We propose that increased expression of the protein can be used to alter the gene expression profile in the cell. PMID:14988408

  8. Simulated binding of transcription factors to active and inactive regions folds human chromosomes into loops, rosettes and topological domains

    PubMed Central

    Brackley, Chris A.; Johnson, James; Kelly, Steven; Cook, Peter R.; Marenduzzo, Davide

    2016-01-01

    Biophysicists are modeling conformations of interphase chromosomes, often basing the strengths of interactions between segments distant on the genetic map on contact frequencies determined experimentally. Here, instead, we develop a fitting-free, minimal model: bivalent or multivalent red and green ‘transcription factors’ bind to cognate sites in strings of beads (‘chromatin’) to form molecular bridges stabilizing loops. In the absence of additional explicit forces, molecular dynamic simulations reveal that bound factors spontaneously cluster—red with red, green with green, but rarely red with green—to give structures reminiscent of transcription factories. Binding of just two transcription factors (or proteins) to active and inactive regions of human chromosomes yields rosettes, topological domains and contact maps much like those seen experimentally. This emergent ‘bridging-induced attraction’ proves to be a robust, simple and generic force able to organize interphase chromosomes at all scales. PMID:27060145

  9. Fungal-specific transcription factor AbPf2 activates pathogenicity in Alternaria brassicicola

    SciTech Connect

    Cho, Yangrae; Ohm, Robin A.; Grigoriev, Igor V.; Srivastava, Akhil

    2012-12-03

    Alternaria brassicicola is a successful saprophyte and necrotrophic plant pathogen. To identify molecular determinants of pathogenicity, we created non-pathogenic mutants of a transcription factor-encoding gene, AbPf2. The frequency and timing of germination and appressorium formation on host plants were similar between the non-pathogenic abpf2 mutants and wild-type A. brassicicola. The mutants were also similar in vitro to wild-type A. brassicicola in terms of vegetative growth, conidium production, and responses to a phytoalexin, reactive oxygen species and osmolites. The hyphae of the mutants grew slowly but did not cause disease symptoms on the surface of host plants. Transcripts of the AbPf2 gene increased exponentially soon after wild-type conidia contacted their host plants . A small amount of AbPf2 protein, as monitored using GFP fusions, was present in young, mature conidia. The protein level decreased during saprophytic growth, but increased and was located primarily in fungal nuclei during pathogenesis. Levels of the proteins and transcripts sharply decreased following colonization of host tissues beyond the initial infection site. When expression of the transcription factor was induced in the wild-type during early pathogenesis, 106 fungal genes were also induced in the wild-type but not in the abpf2 mutants. Notably, 33 of the 106 genes encoded secreted proteins, including eight putative effector proteins. Plants inoculated with abpf2 mutants expressed higher levels of genes associated with photosynthesis, the pentose phosphate pathway and primary metabolism, but lower levels of defense-related genes. Our results suggest that AbPf2 is an important regulator of pathogenesis, but does not affect other cellular processes in A. brassicicola.

  10. Activating Transcription Factor 3-mediated Chemo-intervention with Cancer Chemokines in a Noncanonical Pathway under Endoplasmic Reticulum Stress*

    PubMed Central

    Park, Seong-Hwan; Kim, Juil; Do, Kee Hun; Park, Jiyeon; Oh, Chang Gyu; Choi, Hye Jin; Song, Bo Gyoung; Lee, Seung Joon; Kim, Yong Sik; Moon, Yuseok

    2014-01-01

    The cell-protective features of the endoplasmic reticulum (ER) stress response are chronically activated in vigorously growing malignant tumor cells, which provide cellular growth advantages over the adverse microenvironment including chemotherapy. As an intervention with ER stress responses in the intestinal cancer cells, preventive exposure to flavone apigenin potentiated superinduction of a regulatory transcription factor, activating transcription factor 3 (ATF3), which is also known to be an integral player coordinating ER stress response-related gene expression. ATF3 superinduction was due to increased turnover of ATF3 transcript via stabilization with HuR protein in the cancer cells under ER stress. Moreover, enhanced ATF3 caused inhibitory action against ER stress-induced cancer chemokines that are potent mediators determining the survival and metastatic potential of epithelial cancer cells. Although enhanced ATF3 was a negative regulator of the well known proinflammatory transcription factor NF-κB, blocking of NF-κB signaling did not affect ER stress-induced chemokine expression. Instead, immediately expressed transcription factor early growth response protein 1 (EGR-1) was positively involved in cancer chemokine induction by ER stressors. ER stress-induced EGR-1 and subsequent chemokine production were repressed by ATF3. Mechanistically, ATF3 directly interacted with and recruited HDAC1 protein, which led to epigenetic suppression of EGR-1 expression and subsequent chemokine production. Conclusively, superinduced ATF3 attenuated ER stress-induced cancer chemokine expression by epigenetically interfering with induction of EGR-1, a transcriptional modulator crucial to cancer chemokine production. Thus, these results suggest a potent therapeutic intervention of ER stress response-related cancer-favoring events by ATF3. PMID:25122760

  11. Direct activation of human and mouse Oct4 genes using engineered TALE and Cas9 transcription factors.

    PubMed

    Hu, Jiabiao; Lei, Yong; Wong, Wing-Ki; Liu, Senquan; Lee, Kai-Chuen; He, Xiangjun; You, Wenxing; Zhou, Rui; Guo, Jun-Tao; Chen, Xiongfong; Peng, Xianlu; Sun, Hao; Huang, He; Zhao, Hui; Feng, Bo

    2014-04-01

    The newly developed transcription activator-like effector protein (TALE) and clustered regularly interspaced short palindromic repeats/Cas9 transcription factors (TF) offered a powerful and precise approach for modulating gene expression. In this article, we systematically investigated the potential of these new tools in activating the stringently silenced pluripotency gene Oct4 (Pou5f1) in mouse and human somatic cells. First, with a number of TALEs and sgRNAs targeting various regions in the mouse and human Oct4 promoters, we found that the most efficient TALE-VP64s bound around -120 to -80 bp, while highly effective sgRNAs targeted from -147 to -89-bp upstream of the transcription start sites to induce high activity of luciferase reporters. In addition, we observed significant transcriptional synergy when multiple TFs were applied simultaneously. Although individual TFs exhibited marginal activity to up-regulate endogenous gene expression, optimized combinations of TALE-VP64s could enhance endogenous Oct4 transcription up to 30-fold in mouse NIH3T3 cells and 20-fold in human HEK293T cells. More importantly, the enhancement of OCT4 transcription ultimately generated OCT4 proteins. Furthermore, examination of different epigenetic modifiers showed that histone acetyltransferase p300 could enhance both TALE-VP64 and sgRNA/dCas9-VP64 induced transcription of endogenous OCT4. Taken together, our study suggested that engineered TALE-TF and dCas9-TF are useful tools for modulating gene expression in mammalian cells. PMID:24500196

  12. Tcf1 and Lef1 transcription factors establish CD8(+) T cell identity through intrinsic HDAC activity.

    PubMed

    Xing, Shaojun; Li, Fengyin; Zeng, Zhouhao; Zhao, Yunjie; Yu, Shuyang; Shan, Qiang; Li, Yalan; Phillips, Farrah C; Maina, Peterson K; Qi, Hank H; Liu, Chengyu; Zhu, Jun; Pope, R Marshall; Musselman, Catherine A; Zeng, Chen; Peng, Weiqun; Xue, Hai-Hui

    2016-06-01

    The CD4(+) and CD8(+) T cell dichotomy is essential for effective cellular immunity. How individual T cell identity is established remains poorly understood. Here we show that the high-mobility group (HMG) transcription factors Tcf1 and Lef1 are essential for repressing CD4(+) lineage-associated genes including Cd4, Foxp3 and Rorc in CD8(+) T cells. Tcf1- and Lef1-deficient CD8(+) T cells exhibit histone hyperacetylation, which can be ascribed to intrinsic histone deacetylase (HDAC) activity in Tcf1 and Lef1. Mutation of five conserved amino acids in the Tcf1 HDAC domain diminishes HDAC activity and the ability to suppress CD4(+) lineage genes in CD8(+) T cells. These findings reveal that sequence-specific transcription factors can utilize intrinsic HDAC activity to guard cell identity by repressing lineage-inappropriate genes. PMID:27111144

  13. ATP-dependent motor activity of the transcription termination factor Rho from Mycobacterium tuberculosis

    PubMed Central

    D'Heygère, François; Schwartz, Annie; Coste, Franck; Castaing, Bertrand; Boudvillain, Marc

    2015-01-01

    The bacterial transcription termination factor Rho—a ring-shaped molecular motor displaying directional, ATP-dependent RNA helicase/translocase activity—is an interesting therapeutic target. Recently, Rho from Mycobacterium tuberculosis (MtbRho) has been proposed to operate by a mechanism uncoupled from molecular motor action, suggesting that the manner used by Rho to dissociate transcriptional complexes is not conserved throughout the bacterial kingdom. Here, however, we demonstrate that MtbRho is a bona fide molecular motor and directional helicase which requires a catalytic site competent for ATP hydrolysis to disrupt RNA duplexes or transcription elongation complexes. Moreover, we show that idiosyncratic features of the MtbRho enzyme are conferred by a large, hydrophilic insertion in its N-terminal ‘RNA binding’ domain and by a non-canonical R-loop residue in its C-terminal ‘motor’ domain. We also show that the ‘motor’ domain of MtbRho has a low apparent affinity for the Rho inhibitor bicyclomycin, thereby contributing to explain why M. tuberculosis is resistant to this drug. Overall, our findings support that, in spite of adjustments of the Rho motor to specific traits of its hosting bacterium, the basic principles of Rho action are conserved across species and could thus constitute pertinent screening criteria in high-throughput searches of new Rho inhibitors. PMID:25999346

  14. Release of Positive Transcription Elongation Factor b (P-TEFb) from 7SK Small Nuclear Ribonucleoprotein (snRNP) Activates Hexamethylene Bisacetamide-inducible Protein (HEXIM1) Transcription*

    PubMed Central

    Liu, Pingyang; Xiang, Yanhui; Fujinaga, Koh; Bartholomeeusen, Koen; Nilson, Kyle A.; Price, David H.; Peterlin, B. Matija

    2014-01-01

    By phosphorylating negative elongation factors and the C-terminal domain of RNA polymerase II (RNAPII), positive transcription elongation factor b (P-TEFb), which is composed of CycT1 or CycT2 and CDK9, activates eukaryotic transcription elongation. In growing cells, it is found in active and inactive forms. In the former, free P-TEFb is a potent transcriptional coactivator. In the latter, it is inhibited by HEXIM1 or HEXIM2 in the 7SK small nuclear ribonucleoprotein (snRNP), which contains, additionally, 7SK snRNA, methyl phosphate-capping enzyme (MePCE), and La-related protein 7 (LARP7). This P-TEFb equilibrium determines the state of growth and proliferation of the cell. In this study, the release of P-TEFb from the 7SK snRNP led to increased synthesis of HEXIM1 but not HEXIM2 in HeLa cells, and this occurred only from an unannotated, proximal promoter. ChIP with sequencing revealed P-TEFb-sensitive poised RNA polymerase II at this proximal but not the previously annotated distal HEXIM1 promoter. Its immediate upstream sequences were fused to luciferase reporters and were found to be responsive to many P-TEFb-releasing compounds. The superelongation complex subunits AF4/FMR2 family member 4 (AFF4) and elongation factor RNA polymerase II 2 (ELL2) were recruited to this proximal promoter after P-TEFb release and were required for its transcriptional effects. Thus, P-TEFb regulates its own equilibrium in cells, most likely to maintain optimal cellular homeostasis. PMID:24515107

  15. Thanatos-associated protein 7 associates with template activating factor-Ibeta and inhibits histone acetylation to repress transcription.

    PubMed

    Macfarlan, Todd; Parker, J Brandon; Nagata, Kyosuke; Chakravarti, Debabrata

    2006-02-01

    The posttranslational modifications of histones on chromatin or a lack thereof is critical in transcriptional regulation. Emerging studies indicate a role for histone-binding proteins in transcriptional activation and repression. We have previously identified template-activating factor-Ibeta (TAF-Ibeta, also called PHAPII, SET, and I(2)(pp2A)) as a component of a cellular complex called inhibitor of acetyltransferases (INHAT) that masks histone acetylation in vitro and blocks histone acetyltransferase (HAT)-dependent transcription in living cells. TAF-Ibeta has also been shown to associate with transcription factors, including nuclear receptors, to regulate their activities. To identify novel interactors of TAF-Ibeta, we employed a yeast two-hybrid screen and identified a previously uncharacterized human protein called thanatos-associated protein-7 (THAP7), a member of a large family of THAP domain-containing putative DNA-binding proteins. In this study we demonstrate that THAP7 associates with TAF-Ibeta in vitro and map their association domains to a C-terminal predicted coiled-coil motif on THAP7 and the central region of TAF-Ibeta. Similarly, stably transfected THAP7 associates with endogenous TAF-Ibeta in intact cells. Like TAF-Ibeta, THAP7 associates with histone H3 and histone H4 and inhibits histone acetylation. The histone-interacting domain of THAP7 is sufficient for this activity in vitro. Promoter-targeted THAP7 can also recruit TAF-Ibeta and silencing mediator of retinoid and thyroid receptors/nuclear hormone receptor corepressor (NCoR) proteins to promoters, and knockdown of TAF-Ibeta by small interfering RNA relieves THAP7-mediated repression, indicating that, like nuclear hormone receptors, THAP7 may represent a novel class of transcription factor that uses TAF-Ibeta as a corepressor to maintain histones in a hypoacetylated, repressed state. PMID:16195249

  16. Post-translational Control of the Temporal Dynamics of Transcription Factor Activity Regulates Neurogenesis.

    PubMed

    Quan, Xiao-Jiang; Yuan, Liqun; Tiberi, Luca; Claeys, Annelies; De Geest, Natalie; Yan, Jiekun; van der Kant, Rob; Xie, Wei R; Klisch, Tiemo J; Shymkowitz, Joost; Rousseau, Frederic; Bollen, Mathieu; Beullens, Monique; Zoghbi, Huda Y; Vanderhaeghen, Pierre; Hassan, Bassem A

    2016-01-28

    Neurogenesis is initiated by the transient expression of the highly conserved proneural proteins, bHLH transcriptional regulators. Here, we discover a conserved post-translational switch governing the duration of proneural protein activity that is required for proper neuronal development. Phosphorylation of a single Serine at the same position in Scute and Atonal proneural proteins governs the transition from active to inactive forms by regulating DNA binding. The equivalent Neurogenin2 Threonine also regulates DNA binding and proneural activity in the developing mammalian neocortex. Using genome editing in Drosophila, we show that Atonal outlives its mRNA but is inactivated by phosphorylation. Inhibiting the phosphorylation of the conserved proneural Serine causes quantitative changes in expression dynamics and target gene expression resulting in neuronal number and fate defects. Strikingly, even a subtle change from Serine to Threonine appears to shift the duration of Atonal activity in vivo, resulting in neuronal fate defects. PMID:26824657

  17. Interferon Regulatory Factor 3 and CREB-Binding Protein/p300 Are Subunits of Double-Stranded RNA-Activated Transcription Factor DRAF1

    PubMed Central

    Weaver, Brian K.; Kumar, K. Prasanna; Reich, Nancy C.

    1998-01-01

    Cells respond to viral infection or double-stranded RNA with the transcriptional induction of a subset of alpha/beta interferon-stimulated genes by a pathway distinct from the interferon signal pathway. The transcriptional induction is mediated through a DNA sequence containing the alpha/beta interferon-stimulated response element (ISRE). We previously identified a novel transcription factor, designated double-stranded RNA-activated factor 1 (DRAF1), that recognizes this response element. The DNA-binding specificity of DRAF1 correlates with transcriptional induction, thereby distinguishing it as a positive regulator of alpha/beta interferon-stimulated genes. Two of the components of DRAF1 have now been identified as interferon regulatory factor 3 (IRF-3) and the transcriptional coactivator CREB-binding protein (CBP)/p300. We demonstrate that IRF-3 preexists in the cytoplasm of uninfected cells and translocates to the nucleus following viral infection. Translocation of IRF-3 is accompanied by an increase in serine and threonine phosphorylation. Coimmunoprecipitation analyses of endogenous proteins demonstrate an association of IRF-3 with the transcriptional coactivators CBP and p300 only subsequent to infection. In addition, antibodies to the IRF-3, CBP, and p300 molecules react with DRAF1 bound to the ISRE target site of induced genes. The cellular response that leads to DRAF1 activation and specific gene expression may serve to increase host survival during viral infection. PMID:9488451

  18. Deregulated transcription factors in leukemia.

    PubMed

    Shima, Yutaka; Kitabayashi, Issay

    2011-08-01

    Specific chromosomal translocations and other mutations associated with acute myeloblastic leukemia (AML) often involve transcription factors and transcriptional coactivators. Such target genes include AML1, C/EBPα, RARα, MOZ, p300/CBP, and MLL, all of which are important in the regulation of hematopoiesis. The resultant fusion or mutant proteins deregulate the transcription of the affected genes and disrupt their essential role in hematopoiesis, causing differentiation block and abnormal proliferation and/or survival. This review focuses on such transcription factors and coactivators, and describes their roles in leukemogenesis and hematopoiesis. PMID:21823042

  19. Ubiquitination of the Transcription Factor IRF-3 Activates RIPA, the Apoptotic Pathway that Protects Mice from Viral Pathogenesis.

    PubMed

    Chattopadhyay, Saurabh; Kuzmanovic, Teodora; Zhang, Ying; Wetzel, Jaime L; Sen, Ganes C

    2016-05-17

    The transcription factor IRF-3 mediates cellular antiviral response by inducing the expression of interferon and other antiviral proteins. In RNA-virus infected cells, IRF-3's transcriptional activation is triggered primarily by RIG-I-like receptors (RLR), which can also activate the RLR-induced IRF-3-mediated pathway of apoptosis (RIPA). Here, we have reported that the pathway of IRF-3 activation in RIPA was independent of and distinct from the known pathway of transcriptional activation of IRF-3. It required linear polyubiquitination of two specific lysine residues of IRF-3 by LUBAC, the linear polyubiquitinating enzyme complex, which bound IRF-3 in signal-dependent fashion. To evaluate the role of RIPA in viral pathogenesis, we engineered a genetically targeted mouse, which expressed a mutant IRF-3 that was RIPA-competent but transcriptionally inert; this single-action IRF-3 could protect mice from lethal viral infection. Our observations indicated that IRF-3-mediated apoptosis of virus-infected cells could be an effective antiviral mechanism, without expression of the interferon-stimulated genes. PMID:27178468

  20. Runt-related transcription factor 2 attenuates the transcriptional activity as well as DNA damage-mediated induction of pro-apoptotic TAp73 to regulate chemosensitivity

    PubMed Central

    Ozaki, Toshinori; Sugimoto, Hirokazu; Nakamura, Mizuyo; Hiraoka, Kiriko; Yoda, Hiroyuki; Sang, Meixiang; Fujiwara, Kyoko; Nagase, Hiroki

    2015-01-01

    Although runt-related transcription factor 2 (RUNX2) is known to be an essential key transcription factor for osteoblast differentiation and bone formation, RUNX2 also plays a pivotal role in the regulation of p53-dependent DNA damage response. In the present study, we report that, in addition to p53, RUNX2 downregulates pro-apoptotic TAp73 during DNA damage-dependent cell death. Upon adriamycin (ADR) exposure, human osteosarcoma-derived U2OS cells underwent cell death in association with an upregulation of TAp73 and various p53/TAp73-target gene products together with RUNX2. Small interfering RNA-mediated silencing of p73 resulted in a marked reduction in ADR-induced p53/TAp73-target gene expression, suggesting that TAp73 is responsible for the ADR-dependent DNA damage response. Immunoprecipitation and transient transfection experiments demonstrated that RUNX2 forms a complex with TAp73 and impairs its transcriptional activity. Notably, knockdown of RUNX2 stimulated ADR-induced cell death accompanied by a massive induction of TAp73 expression, indicating that RUNX2 downregulates TAp73 expression. Consistent with this notion, the overexpression of RUNX2 suppressed ADR-dependent cell death, which was associated with a remarkable downregulation of TAp73 and p53/TAp73-target gene expression. Collectively, our present findings strongly suggest that RUNX2 attenuates the transcriptional activity and ADR-mediated induction of TAp73, and may provide novel insights into understanding the molecular basis behind the development and/or maintenance of chemoresistance. Thus, we propose that the silencing of RUNX2 might be an attractive strategy for improving the chemosensitivity of malignant cancers. Structured digital abstract p73andRUNX2colocalizefluorescence microscopy(View interaction) RUNX2physically interactswithp73byanti bait coip(1,2) PMID:25331851

  1. Protein intrinsic disorder in Arabidopsis NAC transcription factors: transcriptional activation by ANAC013 and ANAC046 and their interactions with RCD1.

    PubMed

    O'Shea, Charlotte; Kryger, Mikael; Stender, Emil G P; Kragelund, Birthe B; Willemoës, Martin; Skriver, Karen

    2015-01-15

    Protein ID (intrinsic disorder) plays a significant, yet relatively unexplored role in transcription factors (TFs). In the present paper, analysis of the transcription regulatory domains (TRDs) of six phylogenetically representative, plant-specific NAC [no apical meristem, ATAF (Arabidopsis transcription activation factor), cup-shaped cotyledon] TFs shows that the domains are present in similar average pre-molten or molten globule-like states, but have different patterns of order/disorder and MoRFs (molecular recognition features). ANAC046 (Arabidopsis NAC 046) was selected for further studies because of its simple MoRF pattern and its ability to interact with RCD1 (radical-induced cell death 1). Experiments in yeast and thermodynamic characterization suggest that its single MoRF region is sufficient for both transcriptional activation and interaction with RCD1. The remainder of the large regulatory domain is unlikely to contribute to the interaction, since the domain and truncations thereof have similar affinities for RCD1, which are also similar for ANAC013-RCD1 interactions. However, different enthalpic and entropic contributions to binding were revealed for ANAC046 and ANAC013, suggestive of differences in binding mechanisms. Although substitution of both hydrophobic and acidic residues of the ANAC046 MoRF region abolished binding, substitution of other residues, even with α-helix-breaking proline, was less disruptive. Together, the biophysical analyses suggest that RCD1-ANAC046 complex formation does not involve folding-upon-binding, but rather fuzziness or an unknown structure in ANAC046. We suggest that the ANAC046 regulatory domain functions as an entropic chain with a terminal hot spot interacting with RCD1. RCD1, a cellular hub, may be able to interact with many different TFs by exploiting their ID-based flexibility, as demonstrated for its interactions with ANAC046 and ANAC013. PMID:25348421

  2. Induction of metallothionein I by phenolic antioxidants requires metal-activated transcription factor 1 (MTF-1) and zinc.

    PubMed Central

    Bi, Yongyi; Palmiter, Richard D; Wood, Kristi M; Ma, Qiang

    2004-01-01

    Phenolic antioxidants, such as tBHQ [2,5-di-(t-butyl)-1,4-hydroquinone], induce Mt1 (metallothionein 1) gene expression and accumulation of MT protein. Induction of Mt1 mRNA does not depend on protein synthesis, and correlates with oxidation-reduction functions of the antioxidants. In the present study, we analysed the biochemical pathway of the induction. Induction depends on the presence of MTF-1 (metal-activated transcription factor 1), a transcription factor that is required for metal-induced transcription of Mt1, but does not require nuclear factor erythroid 2-related factor 2, a tBHQ-activated CNC bZip (cap 'n' collar basic leucine zipper) protein, that is responsible for regulating genes encoding phase II drug-metabolizing enzymes. Moreover, tBHQ induces the expression of MRE-beta Geo, a reporter gene driven by five metal response elements that constitute an optimal MTF-1 binding site. Reconstitution of Mtf1 -null cells with MTF-1 restores induction by both zinc and tBHQ. Unlike activation of phase II genes by tBHQ, induction of Mt1 expression does not occur in the presence of EDTA, when cells are cultured in zinc-depleted medium, or in cells with reduced intracellular 'free' zinc due to overexpression of ZnT1, a zinc-efflux transporter, indicating that induction requires zinc. In addition, fluorescence imaging reveals that tBHQ increases cytoplasmic free zinc concentration by mobilizing intracellular zinc pools. These findings establish that phenolic antioxidants activate Mt1 transcription by a zinc-dependent mechanism, which involves MTF-1 binding to metal regulator elements in the Mt1 gene promoter. PMID:14998373

  3. Association of Transcription Factor IIA with TATA Binding Protein Is Required for Transcriptional Activation of a Subset of Promoters and Cell Cycle Progression in Saccharomyces cerevisiae

    PubMed Central

    Ozer, Josef; Lezina, Larissa E.; Ewing, Joshua; Audi, Salma; Lieberman, Paul M.

    1998-01-01

    The general transcription factor IIA (TFIIA) interacts with the TATA binding protein (TBP) and promoter DNA to mediate transcription activation in vitro. To determine if this interaction is generally required for activation of all class II genes in vivo, we have constructed substitution mutations in yeast TFIIA which compromise its ability to bind TBP. Substitution mutations in the small subunit of TFIIA (Toa2) at residue Y69 or W76 significantly impaired the ability of TFIIA to stimulate TBP-promoter binding in vitro. Gene replacement of wild-type TOA2 with a W76E or Y69A/W76A mutant was lethal in Saccharomyces cerevisiae, while the Y69F/W76F mutant exhibited extremely slow growth at 30°C. Both the Y69A and W76A mutants were conditionally lethal at higher temperatures. Light microscopy indicated that viable toa2 mutant strains accumulate as equal-size dumbbells and multibudded clumps. Transcription of the cell cycle-regulatory genes CLB1, CLB2, CLN1, and CTS1 was significantly reduced in the toa2 mutant strains, while the noncycling genes PMA1 and ENO2 were only modestly affected, suggesting that these toa2 mutant alleles disrupt cell cycle progression. The differential effect of these toa2 mutants on gene transcription was examined for a number of other genes. toa2 mutant strains supported high levels of CUP1, PHO5, TRP3, and GAL1 gene activation, but the constitutive expression of DED1 was significantly reduced. Activator-induced start site expression for HIS3, GAL80, URA1, and URA3 promoters was defective in toa2 mutant strains, suggesting that the TFIIA-TBP complex is important for promoters which require an activator-dependent start site selection from constitutive to regulated expression. We present evidence to indicate that transcription defects in toa2 mutants can be both activator and promoter dependent. These results suggest that the association of TFIIA with TBP regulates activator-induced start site selection and cell cycle progression in S

  4. Egr3, a synaptic activity regulated transcription factor that is essential for learning and memory

    PubMed Central

    Li, Lin; Yun, Sung Hwan; Keblesh, James; Trommer, Barbara L.; Xiong, Huangui; Radulovic, Jelena; Tourtellotte, Warren G.

    2009-01-01

    Learning and memory depend upon poorly defined synaptic and intracellular modifications that occur in activated neurons. Mitogen activated protein kinase-extracellular regulated kinase (MAPK-ERK) signaling and de novo protein synthesis are essential aspects of enduring memory formation, but the precise effector molecules of MAPK-ERK signaling in neurons are not well defined. Early growth response (Egr) transcriptional regulators are examples of MAPK-ERK regulated genes and Egr1 (zif268) has been widely recognized as essential for some aspects of learning and memory. Here we show that Egr3, a transcriptional regulator closely related to Egr1, is essential for normal hippocampal long-term potentiation (LTP) and for hippocampal and amygdala dependent learning and memory. In the absence of Egr3, the defects in learning and memory appear to be independent of Egr1 since Egr1 protein levels are not altered in amygdala, hippocampus or cortex. Moreover, unlike Egr1-deficient mice which have impairments in late phase hippocampal LTP and consolidation of some forms of long-term hippocampus- and amygdala-dependent memory, Egr3-deficient mice have profound defects in early- and late-phase hippocampal LTP, as well as short-term and long-term hippocampus- and amygdala-dependent learning and memory. Thus, Egr3 has an essential role in learning and memory processing that appears to be partly distinct from the role of Egr1. PMID:17350282

  5. Cell Fate Determination by Transcription Factors.

    PubMed

    Gurdon, John B

    2016-01-01

    Transcription factors fulfill a key role in the formation and maintenance of different cell-types during development. It is known that transcription factors largely dissociate from chromosomes during mitosis. We found, previously, that mitosis is also a time when somatic nuclei can be far more easily reprogrammed after nuclear transfer than the nuclei of interphase cells. We refer to this as a mitotic advantage. Here, the rate of exchange of a transcription factor on its designated DNA-binding site is discussed. It is proposed that the Xenopus oocyte could serve as an experimental system in which the duration of binding site occupancy could be usefully analyzed. In particular, the Xenopus oocyte has several characteristics which make it possible to determine accurately the concentration and duration of transcription factor binding. It is proposed that the concentration and time are the key variables which govern the action of transcription factors when they activate genes needed for cell lineage determination. PMID:26970633

  6. Cocaine induces cell death and activates the transcription nuclear factor kappa-B in PC12 cells.

    PubMed

    Lepsch, Lucilia B; Munhoz, Carolina D; Kawamoto, Elisa M; Yshii, Lidia M; Lima, Larissa S; Curi-Boaventura, Maria F; Salgado, Thais M L; Curi, Rui; Planeta, Cleopatra S; Scavone, Cristoforo

    2009-01-01

    Cocaine is a worldwide used drug and its abuse is associated with physical, psychiatric and social problems. The mechanism by which cocaine causes neurological damage is very complex and involves several neurotransmitter systems. For example, cocaine increases extracellular levels of dopamine and free radicals, and modulates several transcription factors. NF-kappaB is a transcription factor that regulates gene expression involved in cellular death. Our aim was to investigate the toxicity and modulation of NF-kappaB activity by cocaine in PC 12 cells. Treatment with cocaine (1 mM) for 24 hours induced DNA fragmentation, cellular membrane rupture and reduction of mitochondrial activity. A decrease in Bcl-2 protein and mRNA levels, and an increase in caspase 3 activity and cleavage were also observed. In addition, cocaine (after 6 hours treatment) activated the p50/p65 subunit of NF-kappaB complex and the pretreatment of the cells with SCH 23390, a D1 receptor antagonist, attenuated the NF-kappaB activation. Inhibition of NF-kappaB activity by using PDTC and Sodium Salicilate increased cell death caused by cocaine. These results suggest that cocaine induces cell death (apoptosis and necrosis) and activates NF-kappaB in PC12 cells. This activation occurs, at least partially, due to activation of D1 receptors and seems to have an anti-apoptotic effect on these cells. PMID:19183502

  7. Epidermal Growth Factor Receptor and PTEN Modulate Tissue Factor Expression in Glioblastoma through JunD/Activator Protein-1 Transcriptional Activity

    PubMed Central

    Rong, Yuan; Belozerov, Vladimir E.; Tucker-Burden, Carol; Chen, Gang; Durden, Donald L.; Olson, Jeffrey J.; Van Meir, Erwin G.; Mackman, Nigel; Brat, Daniel J.

    2009-01-01

    Hypoxia and necrosis are fundamental features of glioblastoma (GBM) and their emergence is critical for the rapid biological progression of this fatal tumor; yet, underlying mechanisms are poorly understood. We have suggested that vaso-occlusion following intravascular thrombosis could initiate or propagate hypoxia and necrosis in GBM. Tissue factor (TF), the main cellular initiator of coagulation, is overexpressed in GBMs and likely favors a thrombotic microenvironment. Epidermal growth factor receptor (EGFR) amplification and PTEN loss are two common genetic alterations seen in GBM but not in lower-grade astrocytomas that could be responsible for TF up-regulation. The most frequent EGFR mutation in GBM involves deletion of exons 2 to 7, resulting in the expression of a constitutively active receptor, EGFRvIII. Here, we show that overexpression of EGFR or EGFRvIII in human glioma cells causes increased basal TF expression and that stimulation of EGFR by its ligand, EGF, leads to a marked dose-dependent up-regulation of TF. In all cases, increased TF expression led to accelerated plasma coagulation in vitro. EGFR-mediated TF expression depended most strongly on activator protein-1 (AP-1) transcriptional activity and was associated with c-Jun NH2-terminal kinase (JNK) and JunD activation. Restoration of PTEN expression in PTEN-deficient GBM cells diminished EGFR-induced TF expression by inhibiting JunD/AP-1 transcriptional activity. PTEN mediated this effect by antagonizing phosphatidylinositol 3-kinase activity, which in turn attenuated both Akt and JNK activities. These mechanisms are likely at work in vivo, as EGFR expression was highly correlated with TF expression in human high-grade astrocytoma specimens. PMID:19276385

  8. Apple EIN3 BINDING F-box 1 inhibits the activity of three apple EIN3-like transcription factors

    PubMed Central

    Tacken, Emma J.; Ireland, Hilary S.; Wang, Yen-Yi; Putterill, Jo; Schaffer, Robert J.

    2012-01-01

    Background and aims Fruit ripening in Malus× domestica (apple) is controlled by ethylene. Work in model species has shown that following the detection of ethylene, the ETHYLENE INSENSITIVE 3 (EIN3) transcription factor is stabilized, leading to an increase in transcript accumulation of ethylene-responsive genes, such as POLYGALACTURONASE1 (PG1). In the absence of ethylene, the EIN3 BINDING F-box (EBF) proteins rapidly degrade EIN3 via the ubiquitination/SCF (Skp, Cullin, F-Box) proteasome pathway. In this study, we aim to identify and characterize the apple EBF genes, and test their activity against apple EIN3-like proteins (EILs). Methodology The apple genome sequence was mined for EBF-like genes. The expression of EBF-like genes was measured during fruit development. Using a transient assay in Nicotiana benthamiana leaves, the activity of three apple EILs was tested against the PG1 promoter, with and without ethylene and EBF1. Principal results Four EBF-like genes in apple were identified and grouped into two sub-clades. Sub-clade I genes had constant expression over fruit development while sub-clade II genes increased in expression at ripening. EBF1 was shown to reduce the transactivation of the apple PG1 promoter by the EIL1, EIL2 and EIL3 transcription factors in the presence of ethylene. Conclusions The apple EBF1 gene identified here is likely to be a functionally conserved EBF orthologue, modulating EIL activity in apples. The activity of EBF1 suggests that it is not specific to a single EIL, instead acting as a global regulator of apple EIL transcription factors. PMID:23585922

  9. Reconstitution of glucotoxic HIT-T15 cells with somatostatin transcription factor-1 partially restores insulin promoter activity.

    PubMed

    Harmon, J S; Tanaka, Y; Olson, L K; Robertson, R P

    1998-06-01

    We have reported that chronic culture of HIT-T15 cells in medium containing supraphysiologic glucose concentrations (11.1 mmol/l) causes a decrease in insulin mRNA levels, insulin content, and insulin release. Furthermore, decreases in insulin gene transcription and binding activity of two essential beta-cell transcription factors, somatostatin transcription factor-1 (STF-1; also known as GSTF, IDX-1, IPF-1, PDX-1, and GSF) and RIPE-3b1 activator, are associated with this glucotoxic effect. In this study, we observed that the loss of RIPE-3b1 occurs much earlier (79% decrease at passage [p]81) than the loss of STF-1 (65% decrease at p104), with abolishment of both factors by p122. Since the STF-1, but not the RIPE-3b1 activator, gene has been cloned, we examined its restorative effects on insulin gene promoter activity after reconstitution with STF-1 cDNA. Basal insulin promoter activities normalized to early (p71-74) passage cells (1.000 +/- 0.069) were 0.4066 +/- 0.093 and 0.142 +/- 0.034 for intermediate (p102-106) and late (p118-122) passage cells, respectively. Early, intermediate, and late passage cells, all chronically cultured in medium containing 11.1 mmol/l glucose, were transfected with STF-1 alone or cotransfected with E2-5, an E-box factor known to be synergistically associated with STF-1. Compared with basal levels, we observed a trend toward an increase in insulin promoter activity in intermediate passage cells with STF-1 transfection (1.43-fold) that became a significant increase when E2-5 was cotransfected (1.78-fold). In late passage cells, transfection of STF-1 alone significantly stimulated a 2.2-fold increase in the insulin promoter activity. Cotransfection of STF-1 and E2-5 in late passage cells stimulated insulin promoter activity 2.8-fold, which was 40% of the activity observed in early passage cells. Control studies in glucotoxic betaTC-6 cells deficient in RIPE-3b1 activator but not STF-1 did not demonstrate an increase in insulin promoter

  10. LIM homeobox transcription factor Lhx2 inhibits skeletal muscle differentiation in part via transcriptional activation of Msx1 and Msx2.

    PubMed

    Kodaka, Yusaku; Tanaka, Kiyoko; Kitajima, Kenji; Tanegashima, Kosuke; Matsuda, Ryoichi; Hara, Takahiko

    2015-02-15

    LIM homeobox transcription factor Lhx2 is known to be an important regulator of neuronal development, homeostasis of hair follicle stem cells, and self-renewal of hematopoietic stem cells; however, its function in skeletal muscle development is poorly understood. In this study, we found that overexpression of Lhx2 completely inhibits the myotube-forming capacity of C2C12 cells and primary myoblasts. The muscle dedifferentiation factors Msx1 and Msx2 were strongly induced by the Lhx2 overexpression. Short interfering RNA-mediated knockdown of Lhx2 in the developing limb buds of mouse embryos resulted in a reduction in Msx1 and Msx2 mRNA levels, suggesting that they are downstream target genes of Lhx2. We found two Lhx2 consensus-binding sites in the -2097 to -1189 genomic region of Msx1 and two additional sites in the -536 to +73 genomic region of Msx2. These sequences were shown by luciferase reporter assay to be essential for Lhx2-mediated transcriptional activation. Moreover, electrophoretic mobility shift assays and chromatin immunoprecipitation assays showed that Lhx2 is present in chromatin DNA complexes bound to the enhancer regions of the Msx1 and Msx2 genes. These data demonstrate that Msx1 and Msx2 are direct transcriptional targets of Lhx2. In addition, overexpression of Lhx2 significantly enhanced the mRNA levels of bone morphogenetic protein 4 and transforming growth factor beta family genes. We propose that Lhx2 is involved in the early stage of skeletal muscle development by inducing multiple differentiation inhibitory factors. PMID:25460335

  11. Iro/IRX transcription factors negatively regulate Dpp/TGF-β pathway activity during intestinal tumorigenesis

    PubMed Central

    Martorell, Òscar; Barriga, Francisco M; Merlos-Suárez, Anna; Stephan-Otto Attolini, Camille; Casanova, Jordi; Batlle, Eduard; Sancho, Elena; Casali, Andreu

    2014-01-01

    Activating mutations in Wnt and EGFR/Ras signaling pathways are common in colorectal cancer (CRC). Remarkably, clonal co-activation of these pathways in the adult Drosophila midgut induces “tumor-like” overgrowths. Here, we show that, in these clones and in CRC cell lines, Dpp/TGF-β acts as a tumor suppressor. Moreover, we discover that the Iroquois/IRX-family-protein Mirror downregulates the transcription of core components of the Dpp pathway, reducing its tumor suppressor activity. We also show that this genetic interaction is conserved in human CRC cells, where the Iro/IRX proteins IRX3 and IRX5 diminish the response to TGF-β. IRX3 and IRX5 are upregulated in human adenomas, and their levels correlate inversely with the gene expression signature of response to TGF-β. In addition, Irx5 expression confers a growth advantage in the presence of TGF-β, but is selected against in its absence. Together, our results identify a set of Iro/IRX proteins as conserved negative regulators of Dpp/TGF-β activity. We propose that during the characteristic adenoma-to-carcinoma transition of human CRC, the activity of IRX proteins could reduce the sensitivity to the cytostatic effect of TGF-β, conferring a growth advantage to tumor cells prior to the acquisition of mutations in TGF-β pathway components. PMID:25296644

  12. Generation of serrated and wavy petals by inhibition of the activity of TCP transcription factors in Arabidopsis thaliana

    PubMed Central

    Ohme-Takagi, Masaru; Sato, Fumihiko

    2011-01-01

    The final shape of shoot lateral organs, namely, leaves and flowers, is determined by coordinated growth after the initiation of primordia from shoot meristems in seed plants. This coordination is achieved by the complex action of many transcription factors, which include the TEOSINTE BRANCHED1, CYCLOIDEA and PCF (TCP) family. We have recently reported that CINCINNATA-like (CIN-like) TCP genes act dose-dependently to regulate the flat and smooth morphology of leaves in Arabidopsis thaliana. In contrast, the roles of CIN-like TCP genes in flower development are poorly understood. In this report, using multiple tcp mutants and transgenic plants in which the activity of CIN-like TCP transcription factors is dominantly inhibited, we found that these TCPs regulate the smooth and flat morphology of petals. Based on these findings, we discuss a possible strategy to generate a fringed morphology in floricultural plants. PMID:21455021

  13. New role for Kruppel-like factor 14 as a transcriptional activator involved in the generation of signaling lipids.

    PubMed

    de Assuncao, Thiago M; Lomberk, Gwen; Cao, Sheng; Yaqoob, Usman; Mathison, Angela; Simonetto, Douglas A; Huebert, Robert C; Urrutia, Raul A; Shah, Vijay H

    2014-05-30

    Sphingosine kinase 1 (SK1) is an FGF-inducible gene responsible for generation of sphingosine-1-phosphate, a critical lipid signaling molecule implicated in diverse endothelial cell functions. In this study, we identified SK1 as a target of the canonical FGF2/FGF receptor 1 activation pathway in endothelial cells and sought to identify novel transcriptional pathways that mediate lipid signaling. Studies using the 1.9-kb SK1 promoter and deletion mutants revealed that basal and FGF2-stimulated promoter activity occurred through two GC-rich regions located within 633 bp of the transcription start site. Screening for GC-rich binding transcription factors that could activate this site demonstrated that KLF14, a gene implicated in obesity and the metabolic syndrome, binds to this region. Congruently, overexpression of KLF14 increased basal and FGF2-stimulated SK1 promoter activity by 3-fold, and this effect was abrogated after mutation of the GC-rich sites. In addition, KLF14 siRNA transfection decreased SK1 mRNA and protein levels by 3-fold. Congruently, SK1 mRNA and protein levels were decreased in livers from KLF14 knock-out mice. Combined, luciferase, gel shift, and chromatin immunoprecipitation assays showed that KLF14 couples to p300 to increase the levels of histone marks associated with transcriptional activation (H4K8ac and H3K14ac), while decreasing repressive marks (H3K9me3 and H3K27me3). Collectively, the results demonstrate a novel mechanism whereby SK1 lipid signaling is regulated by epigenetic modifications conferred by KLF14 and p300. Thus, this is the first description of the activity and mechanisms underlying the function of KLF14 as an activator protein and novel regulator of lipid signaling. PMID:24759103

  14. New Role for Kruppel-like Factor 14 as a Transcriptional Activator Involved in the Generation of Signaling Lipids*

    PubMed Central

    de Assuncao, Thiago M.; Lomberk, Gwen; Cao, Sheng; Yaqoob, Usman; Mathison, Angela; Simonetto, Douglas A.; Huebert, Robert C.; Urrutia, Raul A.; Shah, Vijay H.

    2014-01-01

    Sphingosine kinase 1 (SK1) is an FGF-inducible gene responsible for generation of sphingosine-1-phosphate, a critical lipid signaling molecule implicated in diverse endothelial cell functions. In this study, we identified SK1 as a target of the canonical FGF2/FGF receptor 1 activation pathway in endothelial cells and sought to identify novel transcriptional pathways that mediate lipid signaling. Studies using the 1.9-kb SK1 promoter and deletion mutants revealed that basal and FGF2-stimulated promoter activity occurred through two GC-rich regions located within 633 bp of the transcription start site. Screening for GC-rich binding transcription factors that could activate this site demonstrated that KLF14, a gene implicated in obesity and the metabolic syndrome, binds to this region. Congruently, overexpression of KLF14 increased basal and FGF2-stimulated SK1 promoter activity by 3-fold, and this effect was abrogated after mutation of the GC-rich sites. In addition, KLF14 siRNA transfection decreased SK1 mRNA and protein levels by 3-fold. Congruently, SK1 mRNA and protein levels were decreased in livers from KLF14 knock-out mice. Combined, luciferase, gel shift, and chromatin immunoprecipitation assays showed that KLF14 couples to p300 to increase the levels of histone marks associated with transcriptional activation (H4K8ac and H3K14ac), while decreasing repressive marks (H3K9me3 and H3K27me3). Collectively, the results demonstrate a novel mechanism whereby SK1 lipid signaling is regulated by epigenetic modifications conferred by KLF14 and p300. Thus, this is the first description of the activity and mechanisms underlying the function of KLF14 as an activator protein and novel regulator of lipid signaling. PMID:24759103

  15. The Transcriptional Repressor Polycomb Group Factor 6, PCGF6, Negatively Regulates Dendritic Cell Activation and Promotes Quiescence.

    PubMed

    Boukhaled, Giselle M; Cordeiro, Brendan; Deblois, Genevieve; Dimitrov, Vassil; Bailey, Swneke D; Holowka, Thomas; Domi, Anisa; Guak, Hannah; Chiu, Huai-Hsuan Clare; Everts, Bart; Pearce, Edward J; Lupien, Mathieu; White, John H; Krawczyk, Connie M

    2016-08-16

    Pro-inflammatory signals provided by the microenvironment are critical to activate dendritic cells (DCs), components of the innate immune system that shape both innate and adaptive immunity. However, to prevent inappropriate immune activation, mechanisms must be in place to restrain DC activation to ensure DCs are activated only once sufficient stimuli have been received. Here, we report that DC activation and immunogenicity are regulated by the transcriptional repressor Polycomb group factor 6 (PCGF6). Pcgf6 is rapidly downregulated upon stimulation, and this downregulation is necessary to permit full DC activation. Silencing PCGF6 expression enhanced both spontaneous and stimulated DC activation. We show that PCGF6 associates with the H3K4me3 demethylase JARID1c, and together, they negatively regulate H3K4me3 levels in DCs. Our results identify two key regulators, PCGF6 and JARID1c that temper DC activation and implicate active transcriptional silencing via histone demethylation as a previously unappreciated mechanism for regulating DC activation and quiescence. PMID:27498878

  16. Cynaropicrin from Cynara scolymus L. suppresses photoaging of skin by inhibiting the transcription activity of nuclear factor-kappa B.

    PubMed

    Tanaka, Yuka Tsuda; Tanaka, Kiyotaka; Kojima, Hiroyuki; Hamada, Tomoji; Masutani, Teruaki; Tsuboi, Makoto; Akao, Yukihiro

    2013-01-15

    Aging of skin is characterized by skin wrinkling, laxity, and pigmentation induced by several environmental stress factors. Histological changes during the photoaging of skin include hyperproliferation of keratinocytes and melanocytes causing skin wrinkles and pigmentation. Nuclear factor kappa B (NF-κB) is one of the representative transcription factors active in conjunction with inflammation. NF-κB is activated by stimulation such as ultraviolet rays and inflammatory cytokines and induces the expression of various genes such as those of basic fibroblast growth factor (bFGF) and matrix metalloprotease-1 (MMP-1). We screened several plant extracts for their possible inhibitory effect on the transcriptional activity of NF-κB. One of them, an extract from Cynara scolymus L., showed a greatest effect on the suppression of NF-κB transactivation. As a result, we found that cynaropicrin, which is a sesquiterpene lactone, inhibited the NF-κB-mediated transactivation of bFGF and MMP-1. Furthermore, it was confirmed that in an in vivo mouse model cynaropicrin prevented skin photoaging processes leading to the hyperproliferation of keratinocytes and melanocytes. These findings taken together indicate that cynaropicrin is an effective antiphotoaging agent that acts by inhibiting NF-κB-mediated transactivation. PMID:23232059

  17. Fisetin stimulates autophagic degradation of phosphorylated tau via the activation of TFEB and Nrf2 transcription factors

    PubMed Central

    Kim, Sunhyo; Choi, Ki Ju; Cho, Sun-Jung; Yun, Sang-Moon; Jeon, Jae-Pil; Koh, Young Ho; Song, Jihyun; Johnson, Gail V. W.; Jo, Chulman

    2016-01-01

    The neuronal accumulation of phosphorylated tau plays a critical role in the pathogenesis of Alzheimer’s disease (AD). Here, we examined the effect of fisetin, a flavonol, on tau levels. Treatment of cortical cells or primary neurons with fisetin resulted in significant decreases in the levels of phosphorylated tau. In addition, fisetin decreased the levels of sarkosyl-insoluble tau in an active GSK-3β-induced tau aggregation model. However, there was no difference in activities of tau kinases and phosphatases such as protein phosphatase 2A, irrespective of fisetin treatment. Fisetin activated autophagy together with the activation of transcription factor EB (TFEB) and Nrf2 transcriptional factors. The activation of autophagy including TFEB is likely due to fisetin-mediated mammalian target of rapamycin complex 1 (mTORC1) inhibition, since the phosphorylation levels of p70S6 kinase and 4E-BP1 were decreased in the presence of fisetin. Indeed, fisetin-induced phosphorylated tau degradation was attenuated by chemical inhibitors of the autophagy-lysosome pathway. Together the results indicate that fisetin reduces levels of phosphorylated tau through the autophagy pathway activated by TFEB and Nrf2. Our result suggests fisetin should be evaluated further as a potential preventive and therapeutic drug candidate for AD. PMID:27112200

  18. Phosphoinositide 3-Kinases Upregulate System xc− via Eukaryotic Initiation Factor 2α and Activating Transcription Factor 4 – A Pathway Active in Glioblastomas and Epilepsy

    PubMed Central

    Baxter, Paul; Kassubek, Rebecca; Albrecht, Philipp; Van Liefferinge, Joeri; Westhoff, Mike-Andrew; Halatsch, Marc-Eric; Karpel-Massler, Georg; Meakin, Paul J.; Hayes, John D.; Aronica, Eleonora; Smolders, Ilse; Ludolph, Albert C.; Methner, Axel; Conrad, Marcus; Massie, Ann; Hardingham, Giles E.

    2014-01-01

    Abstract Aims: Phosphoinositide 3-kinases (PI3Ks) relay growth factor signaling and mediate cytoprotection and cell growth. The cystine/glutamate antiporter system xc− imports cystine while exporting glutamate, thereby promoting glutathione synthesis while increasing extracellular cerebral glutamate. The aim of this study was to analyze the pathway through which growth factor and PI3K signaling induce the cystine/glutamate antiporter system xc− and to demonstrate its biological significance for neuroprotection, cell growth, and epilepsy. Results: PI3Ks induce system xc− through glycogen synthase kinase 3β (GSK-3β) inhibition, general control non-derepressible-2-mediated eukaryotic initiation factor 2α phosphorylation, and the subsequent translational up-regulation of activating transcription factor 4. This pathway is essential for PI3Ks to modulate oxidative stress resistance of nerve cells and insulin-induced growth in fibroblasts. Moreover, the pathway is active in human glioblastoma cells. In addition, it is induced in primary cortical neurons in response to robust neuronal activity and in hippocampi from patients with temporal lobe epilepsy. Innovation: Our findings further extend the concepts of how growth factors and PI3Ks induce neuroprotection and cell growth by adding a new branch to the signaling network downstream of GSK-3β, which, ultimately, leads to the induction of the cystine/glutamate antiporter system xc−. Importantly, the induction of this pathway by neuronal activity and in epileptic hippocampi points to a potential role in epilepsy. Conclusion: PI3K-regulated system xc− activity is not only involved in the stress resistance of neuronal cells and in cell growth by increasing the cysteine supply and glutathione synthesis, but also plays a role in the pathophysiology of tumor- and non-tumor-associated epilepsy by up-regulating extracellular cerebral glutamate. Antioxid. Redox Signal. 20: 2907–2922. PMID:24219064

  19. Myocardin-related transcription factor-A controls myofibroblast activation and fibrosis in response to myocardial infarction

    PubMed Central

    Small, Eric M.; Thatcher, Jeffrey E.; Sutherland, Lillian B.; Kinoshita, Hideyuki; Gerard, Robert D.; Richardson, James A.; DiMaio, J. Michael; Sadek, Hesham; Kuwahara, Koichiro; Olson, Eric N.

    2010-01-01

    Rationale Myocardial infarction (MI) results in loss of cardiac myocytes in the ischemic zone of the heart followed by fibrosis and scar formation, which diminish cardiac contractility and impede angiogenesis and repair. Myofibroblasts, a specialized cell type that switches from a fibroblast-like state to a contractile, smooth muscle-like state, are believed to be primarily responsible for fibrosis of the injured heart and other tissues, although the transcriptional mediators of fibrosis and myofibroblast activation remain poorly defined. Myocardin-related transcription factors (MRTFs) are SRF co-factors that promote a smooth muscle phenotype and are emerging as components of stress-responsive signaling. Objective We aimed to examine the effect of MRTF-A on cardiac remodeling and fibrosis. Methods and Results Here we show that MRTF-A controls the expression of a fibrotic gene program that includes genes involved in extracellular matrix production and smooth muscle cell differentiation in the heart. In MRTF-A null mice, fibrosis and scar formation following MI or Angiotensin (Ang) II treatment are dramatically diminished compared with wild-type littermates. This protective effect of MRTF-A deletion is associated with a reduction in expression of fibrosis-associated genes, including collagen 1a2, a direct transcriptional target of SRF/MRTF-A. Conclusions We conclude that MRTF-A regulates myofibroblast activation and fibrosis in response to the renin-angiotensin system and post-MI remodeling. PMID:20558820

  20. Role of activating transcription factor 3 in the synthesis of latency-associated transcript and maintenance of herpes simplex virus 1 in latent state in ganglia

    PubMed Central

    Shu, Minfeng; Du, Te; Zhou, Grace; Roizman, Bernard

    2015-01-01

    A key property of herpes simplex viruses (HSVs) is their ability to establish latent infection in sensory or autonomic ganglia and to reactivate on physical, hormonal, or emotional stress. In latently infected ganglia, HSVs express a long noncoding RNA, a latency-associated transcript (LAT), which plays a key role in maintaining latently infected neurons, but not viral proteins. To investigate the events leading to reactivation, we examined the use of ganglionic organ cultures that enable rapid reactivation in medium containing antibody to nerve growth factor (NGF) or delayed reactivation in medium containing NGF and epidermal growth factor (EGF). Here we report the discovery that activating transcription factor 3 (ATF3), a stress response protein, profoundly affects the interaction of HSV with its host. Specifically, (i) ATF3 is induced by stress, such as inhibition of protein synthesis or infection; (ii) in infected cells, ATF3 enhances the accumulation of LAT by acting on the response elements in the promoter of the LAT precursor RNA; (iii) ATF3 is induced nearly 100-fold in ganglionic organ cultures; and (iv) ATF3 plays a key role in the maintenance of the latent state, inasmuch as expression of ATF3 bereft of the C-terminal activation domain acts as a dominant negative factor, inducing HSV gene expression in ganglionic organ cultures harboring latent virus and incubated in medium containing NGF and EGF. Thus, ATF3 is a component of a cluster of cellular proteins that together with LAT maintain the integrity of the neurons harboring latent virus. PMID:26305977

  1. High throughput assays for analyzing transcription factors.

    PubMed

    Li, Xianqiang; Jiang, Xin; Yaoi, Takuro

    2006-06-01

    Transcription factors are a group of proteins that modulate the expression of genes involved in many biological processes, such as cell growth and differentiation. Alterations in transcription factor function are associated with many human diseases, and therefore these proteins are attractive potential drug targets. A key issue in the development of such therapeutics is the generation of effective tools that can be used for high throughput discovery of the critical transcription factors involved in human diseases, and the measurement of their activities in a variety of disease or compound-treated samples. Here, a number of innovative arrays and 96-well format assays for profiling and measuring the activities of transcription factors will be discussed. PMID:16834538

  2. Drosophila melanogaster Activating Transcription Factor 4 Regulates Glycolysis During Endoplasmic Reticulum Stress

    PubMed Central

    Lee, Ji Eun; Oney, McKenna; Frizzell, Kimberly; Phadnis, Nitin; Hollien, Julie

    2015-01-01

    Endoplasmic reticulum (ER) stress results from an imbalance between the load of proteins entering the secretory pathway and the ability of the ER to fold and process them. The response to ER stress is mediated by a collection of signaling pathways termed the unfolded protein response, which plays important roles in development and disease. Here we show that in Drosophila melanogaster S2 cells, ER stress induces a coordinated change in the expression of genes involved in carbon metabolism. Genes encoding enzymes that carry out glycolysis were up-regulated, whereas genes encoding proteins in the tricarboxylic acid cycle and respiratory chain complexes were down-regulated. The unfolded protein response transcription factor Atf4 was necessary for the up-regulation of glycolytic enzymes and Lactate dehydrogenase (Ldh). Furthermore, Atf4 binding motifs in promoters for these genes could partially account for their regulation during ER stress. Finally, flies up-regulated Ldh and produced more lactate when subjected to ER stress. Together, these results suggest that Atf4 mediates a shift from a metabolism based on oxidative phosphorylation to one more heavily reliant on glycolysis, reminiscent of aerobic glycolysis or the Warburg effect observed in cancer and other proliferative cells. PMID:25681259

  3. Lipotoxic brain microvascular injury is mediated by activating transcription factor 3-dependent inflammatory and oxidative stress pathways.

    PubMed

    Aung, Hnin Hnin; Altman, Robin; Nyunt, Tun; Kim, Jeffrey; Nuthikattu, Saivageethi; Budamagunta, Madhu; Voss, John C; Wilson, Dennis; Rutledge, John C; Villablanca, Amparo C

    2016-06-01

    Dysfunction of the cerebrovasculature plays an important role in vascular cognitive impairment (VCI). Lipotoxic injury of the systemic endothelium in response to hydrolyzed triglyceride-rich lipoproteins (TGRLs; TGRL lipolysis products) or a high-fat Western diet (WD) suggests similar mechanisms may be present in brain microvascular endothelium. We investigated the hypothesis that TGRL lipolysis products cause lipotoxic injury to brain microvascular endothelium by generating increased mitochondrial superoxide radical generation, upregulation of activating transcription factor 3 (ATF3)-dependent inflammatory pathways, and activation of cellular oxidative stress and apoptotic pathways. Human brain microvascular endothelial cells were treated with human TGRL lipolysis products that induced intracellular lipid droplet formation, mitochondrial superoxide generation, ATF3-dependent transcription of proinflammatory, stress response, and oxidative stress genes, as well as activation of proapoptotic cascades. Male apoE knockout mice were fed a high-fat/high-cholesterol WD for 2 months, and brain microvessels were isolated by laser capture microdissection. ATF3 gene transcription was elevated 8-fold in the hippocampus and cerebellar brain region of the WD-fed animals compared with chow-fed control animals. The microvascular injury phenotypes observed in vitro and in vivo were similar. ATF3 plays an important role in mediating brain microvascular responses to acute and chronic lipotoxic injury and may be an important preventative and therapeutic target for endothelial dysfunction in VCI. PMID:27087439

  4. The ubiquitin-conjugating enzyme UBE2E3 and its import receptor importin-11 regulate the localization and activity of the antioxidant transcription factor NRF2

    PubMed Central

    Plafker, Kendra S.; Plafker, Scott M.

    2015-01-01

    The transcription factor NF-E2 p45–related factor (Nrf2) induces the expression of cytoprotective proteins that maintain and restore redox homeostasis. Nrf2 levels and activity are tightly regulated, and three subcellular populations of the transcription factor have been identified. During homeostasis, the majority of Nrf2 is degraded in the cytoplasm by ubiquitin (Ub)-mediated degradation. A second population is transcriptionally active in the nucleus, and a third population localizes to the outer mitochondrial membrane. Still unresolved are the mechanisms and factors that govern Nrf2 distribution between its subcellular locales. We show here that the Ub-conjugating enzyme UBE2E3 and its nuclear import receptor importin 11 (Imp-11) regulate Nrf2 distribution and activity. Knockdown of UBE2E3 reduces nuclear Nrf2, decreases Nrf2 target gene expression, and relocalizes the transcription factor to a perinuclear cluster of mitochondria. In a complementary manner, Imp-11 functions to restrict KEAP1, the major suppressor of Nrf2, from prematurely extracting the transcription factor off of a subset of target gene promoters. These findings identify a novel pathway of Nrf2 modulation during homeostasis and support a model in which UBE2E3 and Imp-11 promote Nrf2 transcriptional activity by restricting the transcription factor from partitioning to the mitochondria and limiting the repressive activity of nuclear KEAP1. PMID:25378586

  5. Signal transducers and activators of transcription 3 (STAT3) inhibits transcription of the inducible nitric oxide synthase gene by interacting with nuclear factor kappaB.

    PubMed Central

    Yu, Zhiyuan; Zhang, Wenzheng; Kone, Bruce C

    2002-01-01

    Prolific generation of NO by inducible nitric oxide synthase (iNOS) can cause unintended injury to host cells during glomerulonephritis and other inflammatory diseases. While much is known about the mechanisms of iNOS induction, few transcriptional repressors have been found. We explored the role of signal transducers and activators of transcription 3 (STAT3) proteins in interleukin (IL)-1beta- and lipopolysaccharide (LPS)+interferon (IFN)-gamma-mediated iNOS induction in murine mesangial cells. Both stimuli induced rapid phosphorylation of STAT3 and sequence-specific STAT3 DNA-binding activity. Supershift assays with a STAT3 element probe demonstrated that nuclear factor kappaB (NF-kappaB) p65 and p50 complexed with STAT3 in the DNA-protein complex. The direct interaction of STAT3 and NF-kappaB p65 was verified in vivo by co-immunoprecipitation and in vitro by pull-down assays with glutathione S-transferase-NF-kappaB p65 fusion protein and in vitro -translated STAT3alpha. Overexpression of STAT3 dramatically inhibited IL-1beta- or LPS+IFN-gamma-mediated induction of iNOS promoter-luciferase constructs that contained the wild-type iNOS promoter or ones harbouring mutated STAT-binding elements. In tests of indirect inhibitory effects of STAT3, overexpression of STAT3 dramatically inhibited the activity of an NF-kappaB-dependent promoter devoid of STAT-binding elements without affecting NF-kappaB DNA-binding activity. Thus STAT3, via direct interactions with NF-kappaB p65, serves as a dominant-negative inhibitor of NF-kappaB activity to suppress indirectly cytokine induction of the iNOS promoter in mesangial cells. These results provide a new model for the termination of NO production by activated iNOS following exposure to pro-inflammatory stimuli. PMID:12057007

  6. CD45 Phosphatase Inhibits STAT3 Transcription Factor Activity in Myeloid Cells and Promotes Tumor-Associated Macrophage Differentiation.

    PubMed

    Kumar, Vinit; Cheng, Pingyan; Condamine, Thomas; Mony, Sridevi; Languino, Lucia R; McCaffrey, Judith C; Hockstein, Neil; Guarino, Michael; Masters, Gregory; Penman, Emily; Denstman, Fred; Xu, Xiaowei; Altieri, Dario C; Du, Hong; Yan, Cong; Gabrilovich, Dmitry I

    2016-02-16

    Recruitment of monocytic myeloid-derived suppressor cells (MDSCs) and differentiation of tumor-associated macrophages (TAMs) are the major factors contributing to tumor progression and metastasis. We demonstrated that differentiation of TAMs in tumor site from monocytic precursors was controlled by downregulation of the activity of the transcription factor STAT3. Decreased STAT3 activity was caused by hypoxia and affected all myeloid cells but was not observed in tumor cells. Upregulation of CD45 tyrosine phosphatase activity in MDSCs exposed to hypoxia in tumor site was responsible for downregulation of STAT3. This effect was mediated by the disruption of CD45 protein dimerization regulated by sialic acid. Thus, STAT3 has a unique function in the tumor environment in controlling the differentiation of MDSC into TAM, and its regulatory pathway could be a potential target for therapy. PMID:26885857

  7. Functional characterization of NAC55 transcription factor from oilseed rape (Brassica napus L.) as a novel transcriptional activator modulating reactive oxygen species accumulation and cell death.

    PubMed

    Niu, Fangfang; Wang, Chen; Yan, Jingli; Guo, Xiaohua; Wu, Feifei; Yang, Bo; Deyholos, Michael K; Jiang, Yuan-Qing

    2016-09-01

    NAC transcription factors (TFs) are plant-specific and play important roles in development, responses to biotic and abiotic cues and hormone signaling. So far, only a few NAC genes have been reported to regulate cell death. In this study, we identified and characterized a NAC55 gene isolated from oilseed rape (Brassica napus L.). BnaNAC55 responds to multiple stresses, including cold, heat, abscisic acid (ABA), jasmonic acid (JA) and a necrotrophic fungal pathogen Sclerotinia sclerotiorum. BnaNAC55 has transactivation activity and is located in the nucleus. BnaNAC55 is able to form homodimers in planta. Unlike ANAC055, full-length BnaNAC55, but not either the N-terminal NAC domain or C-terminal regulatory domain, induces ROS accumulation and hypersensitive response (HR)-like cell death when expressed both in oilseed rape protoplasts and Nicotiana benthamiana. Furthermore, BnaNAC55 expression causes obvious nuclear DNA fragmentation. Moreover, quantitative reverse transcription PCR (qRT-PCR) analysis identified that the expression levels of multiple genes regulating ROS production and scavenging, defense response as well as senescence are significantly induced. Using a dual luciferase reporter assay, we further confirm that BnaNAC55 could activate the expression of a few ROS and defense-related gene expression. Taken together, our work has identified a novel NAC TF from oilseed rape that modulates ROS accumulation and cell death. PMID:27312204

  8. Activation of c-Jun transcription factor by substitution of a charged residue in its N-terminal domain.

    PubMed Central

    Hoeffler, W K; Levinson, A D; Bauer, E A

    1994-01-01

    C-Jun is a cellular transcription factor that can control gene expression in response to treatment of cells with phorbol esters, growth factors, and expression of some oncogenes. The ability of c-Jun to catalyze the transcription of certain genes is controlled, in part, by changes in the phosphorylation state of specific amino acids in c-Jun. One of the major sites that is phosphorylated during signal response is Ser73. Here we show that substitution of a negatively charged aspartic acid residue at 73 constitutively increased transcriptional activity of c-Jun. The Asp73 substitution also enhanced its availability to bind to DNA in a whole cell extract without altering its intrinsic DNA binding activity since the intrinsic activity was unaltered for the c-Jun mutant proteins expressed in a bacterial system. The negatively charged Asp substitution may mimic the negative charge of a phosphorylated serine at 73. The substitution of an uncharged alanine at 73 resulted in lowered activities. The N-terminal end of c-Jun containing these substitutions was fused to the DNA-binding region of the bovine papilloma virus E2 protein, and was able to confer the same activation properties to the fusion protein at the heterologous E2 DNA-binding site. Ser73 lies in a region of c-Jun previously proposed to bind an uncharacterized inhibitor, perhaps related to a protein of approximately 17.5 kD that coprecipitates along with our c-Jun or the JunE2 fusion products. Images PMID:8165146

  9. The Zinc Finger Transcription Factor ZXDC Activates CCL2 Gene Expression by Opposing BCL6-mediated Repression

    PubMed Central

    Ramsey, Jon E.; Fontes, Joseph D.

    2013-01-01

    The zinc finger X-linked duplicated (ZXD) family of transcription factors has been implicated in regulating transcription of major histocompatibility complex class II genes in antigen presenting cells; roles beyond this function are not yet known. The expression of one gene in this family, ZXD family zinc finger C (ZXDC), is enriched in myeloid lineages and therefore we hypothesized that ZXDC may regulate myeloid-specific gene expression. Here we demonstrate that ZXDC regulates genes involved in myeloid cell differentiation and inflammation. Overexpression of the larger isoform of ZXDC, ZXDC1, activates expression of monocyte-specific markers of differentiation and synergizes with phorbol 12-myristate 13-acetate (which causes differentiation) in the human leukemic monoblast cell line U937. To identify additional gene targets of ZXDC1, we performed gene expression profiling which revealed multiple inflammatory gene clusters regulated by ZXDC1. Using a combination of approaches we show that ZXDC1 activates transcription of a gene within one of the regulated clusters, chemokine (C-C motif) ligand 2 (CCL2; monocyte chemoattractant protein 1; MCP1) via a previously defined distal regulatory element. Further, ZXDC1-dependent up-regulation of the gene involves eviction of the transcriptional repressor B-cell CLL/lymphoma 6 (BCL6), a factor known to be important in resolving inflammatory responses, from this region of the promoter. Collectively, our data show that ZXDC1 is a regulator in the process of myeloid function and that ZXDC1 is responsible for Ccl2 gene de-repression by BCL6. PMID:23954399

  10. Development of a fluorescent microsphere-based multiplexed high-throughput assay system for profiling of transcription factor activation.

    PubMed

    Yaoi, Takuro; Jiang, Xin; Li, Xianqiang

    2006-06-01

    Transcription factors (TFs), which play crucial roles in the regulation of gene expression in the human genome, are highly regulated by a variety of mechanisms. A single extracellular stimulus can trigger multiple signaling pathways, and these in turn can activate multiple TFs to mediate the inducible expression of target genes. Alterations in the activities of TFs are often associated with human diseases, such as altered activating factor 1, estrogen receptor, and p53 function in cancer, nuclear factor kappaB in inflammatory diseases, and peroxisome proliferator-activated receptor gamma in obesity. A systematic assay for profiling the activation of TFs will aid in elucidating the mechanisms of TF activation, reveal altered TFs associated with human diseases, and aid in developing assays for drug discovery. Here, we developed a 24-plex fluorescent microsphere-based TF activation assay system with a 96-well plate format. The assay system enabled high-throughput profiling of the DNA binding activity of TFs in multiple samples with high sensitivity. PMID:16834534

  11. Homologous pairs of regulatory proteins control activity of Bacillus subtilis transcription factor sigma(b) in response to environmental stress.

    PubMed Central

    Kang, C M; Brody, M S; Akbar, S; Yang, X; Price, C W

    1996-01-01

    In Bacillus subtilis, activity of the general stress transcription factor sigma B is controlled posttranslationally by a regulatory network that transmits signals of environmental and metabolic stress. These signals include heat, ethanol, or osmotic challenge, or a sharp decrease in cellular energy levels, and all ultimately control sigma B activity by influencing the binding decision of the RsbW anti-sigma factor. In the absence of stress, RsbW binds to sigma B and prevents its association with RNA polymerase core enzyme. However, following stress, RsbW binds instead to the RsbV anti-anti-sigma factor, thereby releasing sigma B to direct transcription of its target genes. These two principal regulators of sigmaB activity are encoded in the eight-gene sigB operon, which has the gene order rsbR-rsbS-rsbT-rsbU-rsbV-rsbW-sig B-rsbX (where rsb stands for regulator of sigma B). Notably, the predicted rsbS product has significant amino acid identity to the RsbV anti-anti-sigma factor and the predicted rsbT product resembles the RsbW anti-sigma factor. To determine the roles of rsbS and rsbT, null or missense mutations were constructed in the chromosomal copies or each and tested for their effects on expression of a sigma B-dependent reporter fusion. On the basis of this genetic analysis, our principal conclusions are that (i) the rsbS product is a negative regulator of or" activity, (ii) the rsbT product is a positive regulator, (iii) RsbS requires RsbT for function, and (iv) the RsbS-RsbT and RsbV-RsbW pairs act hierarchically by a common mechanism in which key protein-protein interactions are controlled by phosphorylation events. PMID:8682789

  12. The splicing regulator PTBP1 controls the activity of the transcription factor Pbx1 during neuronal differentiation

    PubMed Central

    Linares, Anthony J; Lin, Chia-Ho; Damianov, Andrey; Adams, Katrina L; Novitch, Bennett G; Black, Douglas L

    2015-01-01

    The RNA-binding proteins PTBP1 and PTBP2 control programs of alternative splicing during neuronal development. PTBP2 was found to maintain embryonic splicing patterns of many synaptic and cytoskeletal proteins during differentiation of neuronal progenitor cells (NPCs) into early neurons. However, the role of the earlier PTBP1 program in embryonic stem cells (ESCs) and NPCs was not clear. We show that PTBP1 controls a program of neuronal gene expression that includes the transcription factor Pbx1. We identify exons specifically regulated by PTBP1 and not PTBP2 as mouse ESCs differentiate into NPCs. We find that PTBP1 represses Pbx1 exon 7 and the expression of the neuronal Pbx1a isoform in ESCs. Using CRISPR-Cas9 to delete regulatory elements for exon 7, we induce Pbx1a expression in ESCs, finding that this activates transcription of neuronal genes. Thus, PTBP1 controls the activity of Pbx1 to suppress its neuronal transcriptional program prior to induction of NPC development. DOI: http://dx.doi.org/10.7554/eLife.09268.001 PMID:26705333

  13. Activation and Cellular Localization of the Cyclosporine A-sensitive Transcription Factor NF-AT in Skeletal Muscle Cells

    PubMed Central

    Abbott, Karen L.; Friday, Bret B.; Thaloor, Deepa; Murphy, T.J.; Pavlath, Grace K.

    1998-01-01

    The widely used immunosuppressant cyclosporine A (CSA) blocks nuclear translocation of the transcription factor, NF-AT (nuclear factor of activated T cells), preventing its activity. mRNA for several NF-AT isoforms has been shown to exist in cells outside of the immune system, suggesting a possible mechanism for side effects associated with CSA treatment. In this study, we demonstrate that CSA inhibits biochemical and morphological differentiation of skeletal muscle cells while having a minimal effect on proliferation. Furthermore, in vivo treatment with CSA inhibits muscle regeneration after induced trauma in mice. These results suggest a role for NF-AT–mediated transcription outside of the immune system. In subsequent experiments, we examined the activation and cellular localization of NF-AT in skeletal muscle cells in vitro. Known pharmacological inducers of NF-AT in lymphoid cells also stimulate transcription from an NF-AT–responsive reporter gene in muscle cells. Three isoforms of NF-AT (NF-ATp, c, and 4/x/c3) are present in the cytoplasm of muscle cells at all stages of myogenesis tested. However, each isoform undergoes calcium-induced nuclear translocation from the cytoplasm at specific stages of muscle differentiation, suggesting specificity among NF-AT isoforms in gene regulation. Strikingly, one isoform (NF-ATc) can preferentially translocate to a subset of nuclei within a single multinucleated myotube. These results demonstrate that skeletal muscle cells express functionally active NF-AT proteins and that the nuclear translocation of individual NF-AT isoforms, which is essential for the ability to coordinate gene expression, is influenced markedly by the differentiation state of the muscle cell. PMID:9763451

  14. Activating transcription factor 3 represses inflammatory responses by binding to the p65 subunit of NF-κB

    PubMed Central

    Kwon, Ji-Woong; Kwon, Hyuk-Kwon; Shin, Hyeon-Jun; Choi, Yong-Min; Anwar, Muhammad Ayaz; Choi, Sangdun

    2015-01-01

    Activating transcription factor 3 (ATF3) is induced by inflammatory responses, cell death, cytokines, and oxidative stress conditions. ATF3 is a negative regulator in the Toll-like receptor 4 signalling pathway. The principal molecule in this pathway is nuclear factor κB (NF-κB) that translocates into the nucleus to initiate the transcription of inflammatory mediators. However, scarce data are available regarding the interaction of ATF3 and p65, a part of the NF-κB dimer. Therefore, we studied the mechanism of regulation of p65 by ATF3 in RAW 264.7 cells. First, LPS-mediated NF-κB activation was confirmed, and then the direct interaction of ATF3 and p65 was observed through immunoprecipitation (IP). The presence of histone deacetylase 1 (HDAC1) was also detected in the complex. In ATF3 deficient cells, NF-κB activity was up-regulated and HDAC1 was not detected by IP. These observations suggest that p65 is attenuated by ATF3 such that ATF3 recruits HDAC1 to the ATF3/p65 complex and facilitates the deacetylation of p65. Likewise, inflammatory response genes were induced by translocated NF-κB in ATF3-deficient cells. Cumulatively, we uncovered a novel mechanism for the negative regulation of NF-κB by ATF3 via direct interaction with p65. PMID:26412238

  15. Erythroid Krüppel-like factor (EKLF) contains a multifunctional transcriptional activation domain important for inter- and intramolecular interactions.

    PubMed Central

    Chen, X; Bieker, J J

    1996-01-01

    Erythroid Krüppel-like factor (EKLF) is a red cell-restricted transcriptional activator that plays a dominant role in establishing high levels of beta-globin gene expression during erythroid ontogeny. Although its DNA binding domain belongs to the well-studied class of Krüppel-like zinc fingers, its proline-rich activation region has not been thoroughly examined. We have analyzed this region by monitoring the functional effects of its mutagenesis upon EKLF activity in vivo and in vitro. First, using co-transfection assays, we find that the transactivation region contains discrete stimulatory and inhibitory subdomains. Second, in vitro binding assays indicate that the inhibitory domain exerts its effect in cis by interfering with DNA binding. Third, in vivo competition assays demonstrate that EKLF interacts with a positive-acting cellular factor, and that the domain responsible for this trans interaction lies within a 40 amino acid sequence that is coincident with the EKLF minimal transactivation domain. Finally, site-directed mutagenesis of this domain implies that conformation and/or phosphorylation status of its central core may be critical for such interactions. These results point towards post-translational steric and/or allosteric control of EKLF function that may be important not just for its DNA binding ability, but also for its potential to interact with other proteins that fully establish the correct stereospecific array leading to efficient switching of beta-globin transcription during development. Images PMID:8918466

  16. The transcriptional regulator megakaryoblastic leukemia-1 mediates serum response factor-independent activation of tenascin-C transcription by mechanical stress.

    PubMed

    Asparuhova, Maria B; Ferralli, Jacqueline; Chiquet, Matthias; Chiquet-Ehrismann, Ruth

    2011-10-01

    The extracellular matrix protein tenascin-C (TNC) is up-regulated in processes influenced by mechanical stress, such as inflammation, tissue remodeling, wound healing, and tumorigenesis. Cyclic strain-induced TNC expression depends on RhoA-actin signaling, the pathway that regulates transcriptional activity of serum response factor (SRF) by its coactivator megakaryoblastic leukemia-1 (MKL1). Therefore, we tested whether MKL1 controls TNC transcription. We demonstrate that overexpression of MKL1 strongly induces TNC expression in mouse NIH3T3 fibroblasts and normal HC11 and transformed 4T1 mammary epithelial cells. Part of the induction was dependant on SRF and a newly identified atypical CArG box in the TNC promoter. Another part was independent of SRF but required the SAP domain of MKL1. An MKL1 mutant incapable of binding to SRF still strongly induced TNC, while induction of the SRF target c-fos was abolished. Cyclic strain failed to induce TNC in MKL1-deficient but not in SRF-deficient fibroblasts, and strain-induced TNC expression strongly depended on the SAP domain of MKL1. Promoter-reporter and chromatin immunoprecipitation experiments unraveled a SAP-dependent, SRF-independent interaction of MKL1 with the proximal promoter region of TNC, attributing for the first time a functional role to the SAP domain of MKL1 in regulating gene expression. PMID:21705668

  17. Cooperative interaction of hypoxia-inducible factor-2alpha (HIF-2alpha ) and Ets-1 in the transcriptional activation of vascular endothelial growth factor receptor-2 (Flk-1).

    PubMed

    Elvert, Gerd; Kappel, Andreas; Heidenreich, Regina; Englmeier, Ursula; Lanz, Stephan; Acker, Till; Rauter, Manuel; Plate, Karl; Sieweke, Michael; Breier, Georg; Flamme, Ingo

    2003-02-28

    Interactions between Ets family members and a variety of other transcription factors serve important functions during development and differentiation processes, e.g. in the hematopoietic system. Here we show that the endothelial basic helix-loop-helix PAS domain transcription factor, hypoxia-inducible factor-2alpha (HIF-2alpha) (but not its close relative HIF-1alpha), cooperates with Ets-1 in activating transcription of the vascular endothelial growth factor receptor-2 (VEGF-2) gene (Flk-1). The receptor tyrosine kinase Flk-1 is indispensable for angiogenesis, and its expression is closely regulated during development. Consistent with the hypothesis that HIF-2alpha controls the expression of Flk-1 in vivo, we show here that HIF-2alpha and Flk-1 are co-regulated in postnatal mouse brain capillaries. A tandem HIF-2alpha/Ets binding site was identified within the Flk-1 promoter that acted as a strong enhancer element. Based on the analysis of transgenic mouse embryos, these motifs are essential for endothelial cell-specific reporter gene expression. A single HIF-2alpha/Ets element conferred strong cooperative induction by HIF-2alpha and Ets-1 when fused to a heterologous promoter and was most active in endothelial cells. The physical interaction of HIF-2alpha with Ets-1 was demonstrated and localized to the HIF-2alpha carboxyl terminus and the autoinhibitory exon VII domain of Ets-1, respectively. The deletion of the DNA binding and carboxyl-terminal transactivation domains of HIF-2alpha, respectively, created dominant negative mutants that suppressed transactivation by the wild type protein and failed to synergize with Ets-1. These results suggest that the interaction between HIF-2alpha and endothelial Ets factors is required for the full transcriptional activation of Flk-1 in endothelial cells and may therefore represent a future target for the manipulation of angiogenesis. PMID:12464608

  18. Optogenetic Inhibitor of the Transcription Factor CREB.

    PubMed

    Ali, Ahmed M; Reis, Jakeb M; Xia, Yan; Rashid, Asim J; Mercaldo, Valentina; Walters, Brandon J; Brechun, Katherine E; Borisenko, Vitali; Josselyn, Sheena A; Karanicolas, John; Woolley, G Andrew

    2015-11-19

    Current approaches for optogenetic control of transcription do not mimic the activity of endogenous transcription factors, which act at numerous sites in the genome in a complex interplay with other factors. Optogenetic control of dominant negative versions of endogenous transcription factors provides a mechanism for mimicking the natural regulation of gene expression. Here we describe opto-DN-CREB, a blue-light-controlled inhibitor of the transcription factor CREB created by fusing the dominant negative inhibitor A-CREB to photoactive yellow protein (PYP). A light-driven conformational change in PYP prevents coiled-coil formation between A-CREB and CREB, thereby activating CREB. Optogenetic control of CREB function was characterized in vitro, in HEK293T cells, and in neurons where blue light enabled control of expression of the CREB targets NR4A2 and c-Fos. Dominant negative inhibitors exist for numerous transcription factors; linking these to optogenetic domains offers a general approach for spatiotemporal control of native transcriptional events. PMID:26590638

  19. Overexpression of the Transcription Factor Sp1 Activates the OAS-RNAse L-RIG-I Pathway

    PubMed Central

    Dupuis-Maurin, Valéryane; Brinza, Lilia; Baguet, Joël; Plantamura, Emilie; Schicklin, Stéphane; Chambion, Solène; Macari, Claire; Tomkowiak, Martine; Deniaud, Emmanuelle; Leverrier, Yann

    2015-01-01

    Deregulated expression of oncogenes or transcription factors such as specificity protein 1 (Sp1) is observed in many human cancers and plays a role in tumor maintenance. Paradoxically in untransformed cells, Sp1 overexpression induces late apoptosis but the early intrinsic response is poorly characterized. In the present work, we studied increased Sp1 level consequences in untransformed cells and showed that it turns on an early innate immune transcriptome. Sp1 overexpression does not activate known cellular stress pathways such as DNA damage response or endoplasmic reticulum stress, but induces the activation of the OAS-RNase L pathway and the generation of small self-RNAs, leading to the upregulation of genes of the antiviral RIG-I pathway at the transcriptional and translational levels. Finally, Sp1-induced intrinsic innate immune response leads to the production of the chemokine CXCL4 and to the recruitment of inflammatory cells in vitro and in vivo. Altogether our results showed that increased Sp1 level in untransformed cells constitutes a novel danger signal sensed by the OAS-RNase L axis leading to the activation of the RIG-I pathway. These results suggested that the OAS-RNase L-RIG-I pathway may be activated in sterile condition in absence of pathogen. PMID:25738304

  20. Signals leading to the activation of NF-kappa B transcription factor are stronger in neonatal than adult T lymphocytes.

    PubMed

    Kilpinen, S; Henttinen, T; Lahdenpohja, N; Hulkkonen, J; Hurme, M

    1996-07-01

    The molecular background of the defects in the immune reactivity of human neonates has not been fully elucidated. As the NF-kappa B transcription factor has a central role in the control of transcription of several genes involved in immune and inflammatory responses, the authors have analysed the activation of NF-kappa B in human umbilical cord T lymphocytes. The activity was tested by quantitating the nuclear proteins binding to an oligonucleotide containing the consensus kappa B binding sequence (electrophoretic mobility shift assay). The data obtained demonstrate that phorbol dibutyrate/calcium ionophore A23187 (PDBu/iono) combination induced a clearly higher nuclear translocation of NF-kappa B in neonatal than adult T cells. This higher NF-kappa B activity was restricted to the CD4+ T-cell subset. Analysis of the nuclear extracts with antibodies directed against the major components of NF-kappa B the p50 and RelA (p65) proteins, indicated that the composition of NF-kappa B was similar in neonatal and adult cells. These results suggest that neonatal T cells are exposed to oxidative stress-inducing signals during delivery and/or are inherently more sensitive to NF-kappa B activating signals than adult T cells. PMID:8693296

  1. Arabidopsis GARP transcriptional activators interact with the Pro-rich activation domain shared by G-box-binding bZIP factors.

    PubMed

    Tamai, Hiroki; Iwabuchi, Masaki; Meshi, Tetsuo

    2002-01-01

    The Pro-rich regions, found in a subset of plant bZIP transcription factors, including G-box-binding factors (GBFs) of Arabidopsis thaliana, are thought to be deeply involved in transcriptional regulation. However, the molecular mechanisms of the Pro-rich region-mediated transcriptional regulation are still largely unknown. Here we report evidence showing that two closely related Arabidopsis proteins, designated GPRI1 and GPRI2, containing a GARP DNA-binding domain, are likely partners of one or more GBFs. The results of yeast two-hybrid assays and in vitro binding assays indicated that GPRI1 can interact with the Pro-rich regions of GBF1 and GBF3. GPRI2 interacted with the Pro-rich region of GBF1. GPRI1 and GPRI2 transactivated transcription in yeast. In GPRI1 the region responsible for this activation was mapped in the N-terminal third of the protein. Transient assays showed that in Arabidopsis cells not only the N-terminal but also the C-terminal regions of GPRI1 can function as a separable activation domain. GPRI1 and GPRI2 may function in some promoters in concert with a GBF through interaction with its Pro-rich region to enhance the transcriptional level of the corresponding genes. PMID:11828027

  2. Yeast DEAD box protein Mss116p is a transcription elongation factor that modulates the activity of mitochondrial RNA polymerase.

    PubMed

    Markov, Dmitriy A; Wojtas, Ireneusz D; Tessitore, Kassandra; Henderson, Simmone; McAllister, William T

    2014-07-01

    DEAD box proteins have been widely implicated in regulation of gene expression. Here, we show that the yeast Saccharomyces cerevisiae DEAD box protein Mss116p, previously known as a mitochondrial splicing factor, also acts as a transcription factor that modulates the activity of the single-subunit mitochondrial RNA polymerase encoded by RPO41. Binding of Mss116p stabilizes paused mitochondrial RNA polymerase elongation complexes in vitro and favors the posttranslocated state of the enzyme, resulting in a lower concentration of nucleotide substrate required to escape the pause; this mechanism of action is similar to that of elongation factors that enhance the processivity of multisubunit RNA polymerases. In a yeast strain in which the RNA splicing-related functions of Mss116p are dispensable, overexpression of RPO41 or MSS116 increases cell survival from colonies that were exposed to low temperature, suggesting a role for Mss116p in enhancing the efficiency of mitochondrial transcription under stress conditions. PMID:24732805

  3. Regulation of human hepatic hydroxysteroid sulfotransferase gene expression by the peroxisome proliferator-activated receptor alpha transcription factor.

    PubMed

    Fang, Hai-Lin; Strom, Stephen C; Cai, Hongbo; Falany, Charles N; Kocarek, Thomas A; Runge-Morris, Melissa

    2005-04-01

    Human hydroxysteroid sulfotransferase or (HUMAN)SULT2A1 catalyzes the sulfonation of procarcinogen xenobiotics, hydroxysteroids, and bile acids and plays a dynamic role in hepatic cholesterol homeostasis. The treatment of primary cultured human hepatocytes with a peroxisome proliferator-activated receptor alpha (PPARalpha)-activating concentration of ciprofibrate (10(-) (4) M) increased (HUMAN)SULT2A1 mRNA, immunoreactive protein, and enzymatic activity levels by approximately 2-fold. By contrast, expression of (RAT)SULT2A3, the rat counterpart to (HUMAN)SULT2A1, was induced by treatment of primary hepatocyte cultures with an activator of the pregnane X receptor, but not PPARalpha. In HepG2 cells, transient transfection analyses of luciferase reporter constructs containing upstream regions of the (HUMAN)SULT2A1 gene implicated a candidate peroxisome proliferator response element (PPRE) at nucleotides (nt) -5949 to -5929 relative to the transcription start site. Site-directed mutagenesis and electrophoretic mobility shift assay studies confirmed that this distal PPRE (dPPRE), a direct repeat nuclear receptor motif containing one intervening nt, represented a functional PPRE. Chromatin immunoprecipitation analysis indicated that the (HUMAN)SULT2A1 dPPRE was also a functional element in the context of the human genome. These data support a major role for the PPARalpha transcription factor in the regulation of hepatic (HUMAN)SULT2A1. Results also indicate that important species differences govern the transactivation of SULT2A gene transcription by nuclear receptors. PMID:15635043

  4. Indirubin derivatives alter DNA binding activity of the transcription factor NF-Y and inhibit MDR1 gene promoter.

    PubMed

    Tanaka, Toru; Ohashi, Sachiyo; Saito, Hiroaki; Higuchi, Takashi; Tabata, Keiichi; Kosuge, Yasuhiro; Suzuki, Takashi; Miyairi, Shinichi; Kobayashi, Shunsuke

    2014-10-15

    Indirubin derivatives exert antitumor activity. However, their effects on the expression of multidrug resistance gene 1 (MDR1) have not been investigated. Here we found three derivatives that inhibit the MDR1 gene promoter. To investigate the effects of indirubins on the DNA binding of NF-Y, a major MDR1 gene transcription factor that recognizes an inverted CCAAT element in the promoter, gel mobility shift assay was performed using the element as a probe with nuclear extracts from NG108-15, MCF7, HepG2, C2C12, and SK-N-SH cells. Among 17 compounds, 5-methoxyindirubin inhibited the DNA binding of NF-Y significantly, whereas indirubin-3'-oxime and 7-methoxyindirubin 3'-oxime increased the binding considerably. After evaluating a suitable concentration of each compound for transcription analysis using living tumor cells, we performed a reporter gene assay using a reporter DNA plasmid containing EGFP cDNA fused to the MDR1 gene promoter region. Indirubin-3'-oxime exerted a significant inhibitory effect on the MDR1 promoter activity in MCF7 and HepG2 cells, and 5-methoxyindirubin inhibited the activity only in MCF7 cells; 7-methoxyindirubin 3'-oxime suppressed the activity in all of the cell lines. We further confirmed that the compounds reduced endogenous MDR1 transcription without any inhibitory effect on NF-Y expression. Moreover, each compound increased the doxorubicin sensitivity of MCF7 cells. These results indicate that each indirubin derivative acts on the DNA binding of NF-Y and represses the MDR1 gene promoter with tumor cell-type specificity. PMID:25066113

  5. Activation of the Transcription Factor NF-[Kappa]B by Retrieval Is Required for Long-Term Memory Reconsolidation

    ERIC Educational Resources Information Center

    Maldonado, Hector; Romano, Arturo; Merlo, Emiliano; Freudenthal, Ramiro

    2005-01-01

    Several studies support that stored memories undergo a new period of consolidation after retrieval. It is not known whether this process, termed reconsolidation, requires the same transcriptional mechanisms involved in consolidation. Increasing evidence supports the participation of the transcription factor NF-[Kappa]B in memory. This was…

  6. Multifaceted contribution of the TLR4-activated IRF5 transcription factor in systemic sclerosis.

    PubMed

    Saigusa, Ryosuke; Asano, Yoshihide; Taniguchi, Takashi; Yamashita, Takashi; Ichimura, Yohei; Takahashi, Takehiro; Toyama, Tetsuo; Yoshizaki, Ayumi; Sugawara, Koji; Tsuruta, Daisuke; Taniguchi, Tadatsugu; Sato, Shinichi

    2015-12-01

    Systemic sclerosis (SSc) is a multisystem autoimmune disorder with clinical manifestations resulting from tissue fibrosis and extensive vasculopathy. A potential disease susceptibility gene for SSc is IFN regulatory factor 5 (IRF5), whose SNP is associated with milder clinical manifestations; however, the underlying mechanisms of this association remain elusive. In this study we examined IRF5-deficient (Irf5(-/-)) mice in the bleomycin-treated SSc murine model. We show that dermal and pulmonary fibrosis induced by bleomycin is attenuated in Irf5(-/-) mice. Interestingly, we find that multiple SSc-associated events, such as fibroblast activation, inflammatory cell infiltration, endothelial-to-mesenchymal transition, vascular destabilization, Th2/Th17 skewed immune polarization, and B-cell activation, are suppressed in these mice. We further provide evidence that IRF5, activated by Toll-like receptor 4 (TLR4), binds to the promoters of various key genes involved in SSc disease pathology. These observations are congruent with the high level of expression of IRF5, TLR4, and potential endogenous TLR4 ligands in SSc skin lesions. Our study sheds light on the TLR4-IRF5 pathway in the pathology of SSc with clinical implications of targeting the IRF5 pathways in the suppression of disease development. PMID:26598674

  7. Multifaceted contribution of the TLR4-activated IRF5 transcription factor in systemic sclerosis

    PubMed Central

    Saigusa, Ryosuke; Asano, Yoshihide; Taniguchi, Takashi; Yamashita, Takashi; Ichimura, Yohei; Takahashi, Takehiro; Toyama, Tetsuo; Yoshizaki, Ayumi; Sugawara, Koji; Tsuruta, Daisuke; Taniguchi, Tadatsugu; Sato, Shinichi

    2015-01-01

    Systemic sclerosis (SSc) is a multisystem autoimmune disorder with clinical manifestations resulting from tissue fibrosis and extensive vasculopathy. A potential disease susceptibility gene for SSc is IFN regulatory factor 5 (IRF5), whose SNP is associated with milder clinical manifestations; however, the underlying mechanisms of this association remain elusive. In this study we examined IRF5-deficient (Irf5−/−) mice in the bleomycin-treated SSc murine model. We show that dermal and pulmonary fibrosis induced by bleomycin is attenuated in Irf5−/− mice. Interestingly, we find that multiple SSc-associated events, such as fibroblast activation, inflammatory cell infiltration, endothelial-to-mesenchymal transition, vascular destabilization, Th2/Th17 skewed immune polarization, and B-cell activation, are suppressed in these mice. We further provide evidence that IRF5, activated by Toll-like receptor 4 (TLR4), binds to the promoters of various key genes involved in SSc disease pathology. These observations are congruent with the high level of expression of IRF5, TLR4, and potential endogenous TLR4 ligands in SSc skin lesions. Our study sheds light on the TLR4-IRF5 pathway in the pathology of SSc with clinical implications of targeting the IRF5 pathways in the suppression of disease development. PMID:26598674

  8. Transcription Factors in Xylem Development. Final report

    SciTech Connect

    Sederoff, Ronald; Whetten, Ross; O'Malley, David; Campbell, Malcolm

    1999-07-01

    Answers to the following questions are answered in this report. do the two pine Byb proteins previously identified as candidate transcription factors bind to DNA and activate transcription? In what cell types are tehse Myb proteins expressed? Are these proteins localized to the nucleus? Do other proteins in pine xylem interact with these Myb proteins? Does altered expression of these genes have an impact on xylogenesis, specifically the expression of monolignol biosynthetic genes?

  9. The Intracellular Domain of Teneurin-1 Induces the Activity of Microphthalmia-associated Transcription Factor (MITF) by Binding to Transcriptional Repressor HINT1

    PubMed Central

    Schöler, Jonas; Ferralli, Jacqueline; Thiry, Stéphane; Chiquet-Ehrismann, Ruth

    2015-01-01

    Teneurins are large type II transmembrane proteins that are necessary for the normal development of the CNS. Although many studies highlight the significance of teneurins, especially during development, there is only limited information known about the molecular mechanisms of function. Previous studies have shown that the N-terminal intracellular domain (ICD) of teneurins can be cleaved at the membrane and subsequently translocates to the nucleus, where it can influence gene transcription. Because teneurin ICDs do not contain any intrinsic DNA binding sequences, interaction partners are required to affect transcription. Here, we identified histidine triad nucleotide binding protein 1 (HINT1) as a human teneurin-1 ICD interaction partner in a yeast two-hybrid screen. This interaction was confirmed in human cells, where HINT1 is known to inhibit the transcription of target genes by directly binding to transcription factors at the promoter. In a whole transcriptome analysis of BS149 glioblastoma cells overexpressing the teneurin-1 ICD, several microphthalmia-associated transcription factor (MITF) target genes were found to be up-regulated. Directly comparing the transcriptomes of MITF versus TEN1-ICD-overexpressing BS149 cells revealed 42 co-regulated genes, including glycoprotein non-metastatic b (GPNMB). Using real-time quantitative PCR to detect endogenous GPNMB expression upon overexpression of MITF and HINT1 as well as promoter reporter assays using GPNMB promoter constructs, we could demonstrate that the teneurin-1 ICD binds HINT1, thus switching on MITF-dependent transcription of GPNMB. PMID:25648896

  10. The intracellular domain of teneurin-1 induces the activity of microphthalmia-associated transcription factor (MITF) by binding to transcriptional repressor HINT1.

    PubMed

    Schöler, Jonas; Ferralli, Jacqueline; Thiry, Stéphane; Chiquet-Ehrismann, Ruth

    2015-03-27

    Teneurins are large type II transmembrane proteins that are necessary for the normal development of the CNS. Although many studies highlight the significance of teneurins, especially during development, there is only limited information known about the molecular mechanisms of function. Previous studies have shown that the N-terminal intracellular domain (ICD) of teneurins can be cleaved at the membrane and subsequently translocates to the nucleus, where it can influence gene transcription. Because teneurin ICDs do not contain any intrinsic DNA binding sequences, interaction partners are required to affect transcription. Here, we identified histidine triad nucleotide binding protein 1 (HINT1) as a human teneurin-1 ICD interaction partner in a yeast two-hybrid screen. This interaction was confirmed in human cells, where HINT1 is known to inhibit the transcription of target genes by directly binding to transcription factors at the promoter. In a whole transcriptome analysis of BS149 glioblastoma cells overexpressing the teneurin-1 ICD, several microphthalmia-associated transcription factor (MITF) target genes were found to be up-regulated. Directly comparing the transcriptomes of MITF versus TEN1-ICD-overexpressing BS149 cells revealed 42 co-regulated genes, including glycoprotein non-metastatic b (GPNMB). Using real-time quantitative PCR to detect endogenous GPNMB expression upon overexpression of MITF and HINT1 as well as promoter reporter assays using GPNMB promoter constructs, we could demonstrate that the teneurin-1 ICD binds HINT1, thus switching on MITF-dependent transcription of GPNMB. PMID:25648896

  11. Dissection of the wheat transcription factor HBP-1a(17) reveals a modular structure for the activation domain.

    PubMed

    Nakayama, T; Okanami, M; Meshi, T; Iwabuchi, M

    1997-02-20

    The wheat bZIP protein HBP-1a(17) is a putative transcription factor regulating histone gene expression. To delineate the functional domain(s) of this factor, we made a series of effector constructs expressing fusion proteins, in which various portions of HBP-1a(17) are fused to the DNA-binding domain of the yeast transcriptional activator GAL4, in plant cells. When the beta-glucuronidase (GUS) reporter gene, driven by the wheat histone H3 core promoter harboring the GAL4-binding sequence, was co-transfected with such effector genes into tobacco protoplasts, several portions of HBP-1a(17) influenced reporter gene expression. The N-terminal one-third of HBP-1a(17), termed the P region (residues 1-118) due to its Pro content, did not activate the reporter gene, in contrast to the corresponding Pro-rich region of Arabidopsis GBF1 (residues 1-110), which functions as an activation domain. When the P region was divided into two, however, both its N-terminal (1-56; termed NP) and C-terminal (58-118; termed PC) halves were able to enhance expression of the reporter gene. When the NP region was further divided into NP(5-30) and NP(30-56), both regions still retained activating ability. These results suggest that the P region of HBP-1a(17) is composed of several modules each having activating function, and modification and/or conformational changes of the P region might influence its function. PMID:9065688

  12. Transcriptional activation of cyclooxygenase-2 by tumor suppressor p53 requires nuclear factor-kappaB.

    PubMed

    Benoit, V; de Moraes, E; Dar, N A; Taranchon, E; Bours, V; Hautefeuille, A; Tanière, P; Chariot, A; Scoazec, J-Y; de Moura Gallo, C V; Merville, M-P; Hainaut, P

    2006-09-21

    Overexpression of cyclooxygenase-2 (Cox-2) is thought to exert antiapoptotic effects in cancer. Here we show that the tumor suppressor p53 upregulated Cox-2 in esophageal and colon cancer cell lines by inducing the binding of nuclear factor-kappaB (NF-kappaB) to its response element in the COX-2 promoter. Inhibition of NF-kappaB prevented p53 induction of Cox-2 expression. Cooperation between p53 and NF-kappaB was required for activation of COX-2 promoter in response to daunomycin, a DNA-damaging agent. Pharmacological inhibition of Cox-2 enhanced apoptosis in response to daunomycin, in particular in cells containing active p53. In esophageal cancer, there was a correlation between Cox-2 expression and wild-type TP53 in Barrett's esophagus (BE) and in adenocarcinoma, but not in squamous cell carcinoma (P<0.01). These results suggest that p53 and NF-kappaB cooperate in upregulating Cox-2 expression, promoting cell survival in inflammatory precursor lesions such as BE. PMID:16682957

  13. Functional Analysis of Transcription Factors in Arabidopsis

    PubMed Central

    Mitsuda, Nobutaka; Ohme-Takagi, Masaru

    2009-01-01

    Transcription factors (TFs) regulate the expression of genes at the transcriptional level. Modification of TF activity dynamically alters the transcriptome, which leads to metabolic and phenotypic changes. Thus, functional analysis of TFs using ‘omics-based’ methodologies is one of the most important areas of the post-genome era. In this mini-review, we present an overview of Arabidopsis TFs and introduce strategies for the functional analysis of plant TFs, which include both traditional and recently developed technologies. These strategies can be assigned to five categories: bioinformatic analysis; analysis of molecular function; expression analysis; phenotype analysis; and network analysis for the description of entire transcriptional regulatory networks. PMID:19478073

  14. Increased proteolytic processing of full-length Gli2 transcription factor reduces the Hedgehog pathway activity in vivo

    PubMed Central

    Li, Juan; Wang, Chengbing; Pan, Yong; Bai, Zengliang; Wang, Baolin

    2011-01-01

    The proteolytic processing of Gli2 and Gli3 full-length transcription factors into repressors is a key step of the regulation in Hedgehog (Hh) signaling. The differential Gli2 and Gli3 processing is controlled by the processing determinant domain or PDD, but its significance is not clear. We generated a Gli2 mutant allele, Gli23PDD, in which the Gli3PDD substitutes for the Gli2PDD. As expected, Gli23PDD is processed more efficiently and at the different position as compared to Gli2, indicating that PDD also determines the extent and site of Gli2 and Gli3 processing in vivo. The increase in levels of the Gli2 repressor in Gli23PDD mutant reduces the Hh pathway activity. Gli23PDD processing is still regulated by Hh signaling. These results indicate that the proper balance between the Gli2 full-length activator and repressor is essential for Hh signaling. PMID:21337666

  15. Common and distinct DNA-binding and regulatory activities of the BEN-solo transcription factor family

    PubMed Central

    Dai, Qi; Ren, Aiming; Westholm, Jakub O.; Duan, Hong; Patel, Dinshaw J.

    2015-01-01

    Recently, the BEN (BANP, E5R, and NAC1) domain was recognized as a new class of conserved DNA-binding domain. The fly genome encodes three proteins that bear only a single BEN domain (“BEN-solo” factors); namely, Insensitive (Insv), Bsg25A (Elba1), and CG9883 (Elba2). Insv homodimers preferentially bind CCAATTGG palindromes throughout the genome to mediate transcriptional repression, whereas Bsg25A and Elba2 heterotrimerize with their obligate adaptor, Elba3 (i.e., the ELBA complex), to recognize a CCAATAAG motif in the Fab-7 insulator. While these data suggest distinct DNA-binding properties of BEN-solo proteins, we performed reporter assays that indicate that both Bsg25A and Elba2 can individually recognize Insv consensus sites efficiently. We confirmed this by solving the structure of Bsg25A complexed to the Insv site, which showed that key aspects of the BEN:DNA recognition strategy are similar between these proteins. We next show that both Insv and ELBA proteins are competent to mediate transcriptional repression via Insv consensus sequences but that the ELBA complex appears to be selective for the ELBA site. Reciprocally, genome-wide analysis reveals that Insv exhibits significant cobinding to class I insulator elements, indicating that it may also contribute to insulator function. Indeed, we observed abundant Insv binding within the Hox complexes with substantial overlaps with class I insulators, many of which bear Insv consensus sites. Moreover, Insv coimmunoprecipitates with the class I insulator factor CP190. Finally, we observed that Insv harbors exclusive activity among fly BEN-solo factors with respect to regulation of Notch-mediated cell fate choices in the peripheral nervous system. This in vivo activity is recapitulated by BEND6, a mammalian BEN-solo factor that conserves the Notch corepressor function of Insv but not its capacity to bind Insv consensus sites. Altogether, our data define an array of common and distinct biochemical and functional

  16. Common and distinct DNA-binding and regulatory activities of the BEN-solo transcription factor family.

    PubMed

    Dai, Qi; Ren, Aiming; Westholm, Jakub O; Duan, Hong; Patel, Dinshaw J; Lai, Eric C

    2015-01-01

    Recently, the BEN (BANP, E5R, and NAC1) domain was recognized as a new class of conserved DNA-binding domain. The fly genome encodes three proteins that bear only a single BEN domain ("BEN-solo" factors); namely, Insensitive (Insv), Bsg25A (Elba1), and CG9883 (Elba2). Insv homodimers preferentially bind CCAATTGG palindromes throughout the genome to mediate transcriptional repression, whereas Bsg25A and Elba2 heterotrimerize with their obligate adaptor, Elba3 (i.e., the ELBA complex), to recognize a CCAATAAG motif in the Fab-7 insulator. While these data suggest distinct DNA-binding properties of BEN-solo proteins, we performed reporter assays that indicate that both Bsg25A and Elba2 can individually recognize Insv consensus sites efficiently. We confirmed this by solving the structure of Bsg25A complexed to the Insv site, which showed that key aspects of the BEN:DNA recognition strategy are similar between these proteins. We next show that both Insv and ELBA proteins are competent to mediate transcriptional repression via Insv consensus sequences but that the ELBA complex appears to be selective for the ELBA site. Reciprocally, genome-wide analysis reveals that Insv exhibits significant cobinding to class I insulator elements, indicating that it may also contribute to insulator function. Indeed, we observed abundant Insv binding within the Hox complexes with substantial overlaps with class I insulators, many of which bear Insv consensus sites. Moreover, Insv coimmunoprecipitates with the class I insulator factor CP190. Finally, we observed that Insv harbors exclusive activity among fly BEN-solo factors with respect to regulation of Notch-mediated cell fate choices in the peripheral nervous system. This in vivo activity is recapitulated by BEND6, a mammalian BEN-solo factor that conserves the Notch corepressor function of Insv but not its capacity to bind Insv consensus sites. Altogether, our data define an array of common and distinct biochemical and functional

  17. Diphenylarsinic Acid Induced Activation of Cultured Rat Cerebellar Astrocytes: Phosphorylation of Mitogen-Activated Protein Kinases, Upregulation of Transcription Factors, and Release of Brain-Active Cytokines.

    PubMed

    Negishi, Takayuki; Matsumoto, Mami; Kojima, Mikiya; Asai, Ryota; Kanehira, Tomoko; Sakaguchi, Fumika; Takahata, Kazuaki; Arakaki, Rina; Aoyama, Yohei; Yoshida, Hikari; Yoshida, Kenji; Yukawa, Kazunori; Tashiro, Tomoko; Hirano, Seishiro

    2016-03-01

    Diphenylarsinic acid (DPAA) was detected as the primary compound responsible for the arsenic poisoning that occurred in Kamisu, Ibaraki, Japan, where people using water from a well that was contaminated with a high level of arsenic developed neurological (mostly cerebellar) symptoms and dysregulation of regional cerebral blood flow. To understand the underlying molecular mechanism of DPAA-induced cerebellar symptoms, we focused on astrocytes, which have a brain-protective function. Incubation with 10 µM DPAA for 96 h promoted cell proliferation, increased the expression of antioxidative stress proteins (heme oxygenase-1 and heat shock protein 70), and induced the release of cytokines (MCP-1, adrenomedullin, FGF2, CXCL1, and IL-6). Furthermore, DPAA overpoweringly increased the phosphorylation of three major mitogen-activated protein kinases (MAPKs) (ERK1/2, p38MAPK, and SAPK/JNK), which indicated MAPK activation, and subsequently induced expression and/or phosphorylation of transcription factors (Nrf2, CREB, c-Jun, and c-Fos) in cultured rat cerebellar astrocytes. Structure-activity relationship analyses of DPAA and other related pentavalent organic arsenicals revealed that DPAA at 10 µM activated astrocytes most effective among organic arsenicals tested at the same dose. These results suggest that in a cerebellum exposed to DPAA, abnormal activation of the MAPK-transcription factor pathway and irregular secretion of these neuroactive, glioactive, and/or vasoactive cytokines in astrocytes can be the direct/indirect cause of functional abnormalities in surrounding neurons, glial cells, and vascular cells: This in turn might lead to the onset of cerebellar symptoms and disruption of cerebral blood flow. PMID:26645585

  18. A Homeodomain Transcription Factor Gene, PfMSX, Activates Expression of Pif Gene in the Pearl Oyster Pinctada fucata

    PubMed Central

    Zhao, Mi; He, Maoxian; Huang, Xiande; Wang, Qi

    2014-01-01

    We reported pearl oyster Pinctada fucata cDNA and genomic characterization of a new homeobox-containing protein, PfMSX. The PfMSX gene encodes a transcription factor that was localized to the nucleus. Analyses of PfMSX mRNA in tissues and developmental stages showed high expressions in mantle or D-shaped larvae. In electrophoretic mobility shift assays (EMSAs) PfMSX binded to MSX consensus binding sites in the 5′ flanking region of the Pif promoter. In co-transfection experiment PfMSX transactivated reporter constructs containing Pif promoter sequences, and mutation of the MSX-binding sites attenuated transactivation. A knockdown experiment using PfMSX dsRNA showed decreased Pif mRNA and unregular crystallization of the nacreous layer using scanning electron microscopy. Our results suggested that PfMSX was a conserved homeodomain transcription factor gene, which can activate Pif gene expression through MSX binding site, and was then involved in the mineralization process in pearl oyster Pinctada fucata. Our data provided important clues about mechanisms regulating biomineralization in pearl oyster. PMID:25099698

  19. RNA helicase HEL-1 promotes longevity by specifically activating DAF-16/FOXO transcription factor signaling in Caenorhabditis elegans

    PubMed Central

    Seo, Mihwa; Seo, Keunhee; Hwang, Wooseon; Koo, Hee Jung; Hahm, Jeong-Hoon; Yang, Jae-Seong; Han, Seong Kyu; Hwang, Daehee; Kim, Sanguk; Jang, Sung Key; Lee, Yoontae; Nam, Hong Gil; Lee, Seung-Jae V.

    2015-01-01

    The homeostatic maintenance of the genomic DNA is crucial for regulating aging processes. However, the role of RNA homeostasis in aging processes remains unknown. RNA helicases are a large family of enzymes that regulate the biogenesis and homeostasis of RNA. However, the functional significance of RNA helicases in aging has not been explored. Here, we report that a large fraction of RNA helicases regulate the lifespan of Caenorhabditis elegans. In particular, we show that a DEAD-box RNA helicase, helicase 1 (HEL-1), promotes longevity by specifically activating the DAF-16/forkhead box O (FOXO) transcription factor signaling pathway. We find that HEL-1 is required for the longevity conferred by reduced insulin/insulin-like growth factor 1 (IGF-1) signaling (IIS) and is sufficient for extending lifespan. We further show that the expression of HEL-1 in the intestine and neurons contributes to longevity. HEL-1 enhances the induction of a large fraction of DAF-16 target genes. Thus, the RNA helicase HEL-1 appears to promote longevity in response to decreased IIS as a transcription coregulator of DAF-16. Because HEL-1 and IIS are evolutionarily well conserved, a similar mechanism for longevity regulation via an RNA helicase-dependent regulation of FOXO signaling may operate in mammals, including humans. PMID:26195740

  20. Epstein-Barr virus induces cellular transcription factors to allow active expression of EBER genes by RNA polymerase III.

    PubMed

    Felton-Edkins, Zoë A; Kondrashov, Alexander; Karali, Dimitra; Fairley, Jennifer A; Dawson, Christopher W; Arrand, John R; Young, Lawrence S; White, Robert J

    2006-11-10

    The EBER genes of Epstein-Barr virus (EBV) are transcribed by RNA polymerase (pol) III to produce untranslated RNAs that are implicated in oncogenesis. These EBER transcripts are the most highly expressed viral gene products in EBV-transformed cells. We have identified changes to the cellular transcription machinery that may contribute to the high levels of EBER RNA. These include phosphorylation of ATF2, which interacts with EBER promoters. A second is induction of TFIIIC, a pol III-specific factor that activates EBER genes; all five subunits of TFIIIC are overexpressed in EBV-positive cells. In addition, EBV induces BDP1, a subunit of the pol III-specific factor TFIIIB. Although BDP1 is the only TFIIIB subunit induced by EBV, its induction is sufficient to stimulate EBER expression in vivo, implying a limiting function. The elevated levels of BDP1 and TFIIIC in EBV-positive cells stimulate production of tRNA, 7SL, and 5S rRNA. Abnormally high expression of these cellular pol III products may contribute to the ability of EBV to enhance growth potential. PMID:16956891

  1. RNA helicase HEL-1 promotes longevity by specifically activating DAF-16/FOXO transcription factor signaling in Caenorhabditis elegans.

    PubMed

    Seo, Mihwa; Seo, Keunhee; Hwang, Wooseon; Koo, Hee Jung; Hahm, Jeong-Hoon; Yang, Jae-Seong; Han, Seong Kyu; Hwang, Daehee; Kim, Sanguk; Jang, Sung Key; Lee, Yoontae; Nam, Hong Gil; Lee, Seung-Jae V

    2015-08-01

    The homeostatic maintenance of the genomic DNA is crucial for regulating aging processes. However, the role of RNA homeostasis in aging processes remains unknown. RNA helicases are a large family of enzymes that regulate the biogenesis and homeostasis of RNA. However, the functional significance of RNA helicases in aging has not been explored. Here, we report that a large fraction of RNA helicases regulate the lifespan of Caenorhabditis elegans. In particular, we show that a DEAD-box RNA helicase, helicase 1 (HEL-1), promotes longevity by specifically activating the DAF-16/forkhead box O (FOXO) transcription factor signaling pathway. We find that HEL-1 is required for the longevity conferred by reduced insulin/insulin-like growth factor 1 (IGF-1) signaling (IIS) and is sufficient for extending lifespan. We further show that the expression of HEL-1 in the intestine and neurons contributes to longevity. HEL-1 enhances the induction of a large fraction of DAF-16 target genes. Thus, the RNA helicase HEL-1 appears to promote longevity in response to decreased IIS as a transcription coregulator of DAF-16. Because HEL-1 and IIS are evolutionarily well conserved, a similar mechanism for longevity regulation via an RNA helicase-dependent regulation of FOXO signaling may operate in mammals, including humans. PMID:26195740

  2. Characterization of evolutionarily conserved motifs involved in activity and regulation of the ABA-INSENSITIVE (ABI) 4 transcription factor.

    PubMed

    Gregorio, Josefat; Hernández-Bernal, Alma Fabiola; Cordoba, Elizabeth; León, Patricia

    2014-02-01

    In recent years, the transcription factor ABI4 has emerged as an important node of integration for external and internal signals such as nutrient status and hormone signaling that modulates critical transitions during the growth and development of plants. For this reason, understanding the mechanism of action and regulation of this protein represents an important step towards the elucidation of crosstalk mechanisms in plants. However, this understanding has been hindered due to the negligible levels of this protein as a result of multiple posttranscriptional regulations. To better understand the function and regulation of the ABI4 protein in this work, we performed a functional analysis of several evolutionarily conserved motifs. Based on these conserved motifs, we identified ortholog genes of ABI4 in different plant species. The functionality of the putative ortholog from Theobroma cacao was demonstrated in transient expression assays and in complementation studies in plants. The function of the highly conserved motifs was analyzed after their deletion or mutagenesis in the Arabidopsis ABI4 sequence using mesophyll protoplasts. This approach permitted us to immunologically detect the ABI4 protein and identify some of the mechanisms involved in its regulation. We identified sequences required for the nuclear localization (AP2-associated motif) as well as those for transcriptional activation function (LRP motif). Moreover, this approach showed that the protein stability of this transcription factor is controlled through protein degradation and subcellular localization and involves the AP2-associated and the PEST motifs. We demonstrated that the degradation of ABI4 protein through the PEST motif is mediated by the 26S proteasome in response to changes in the sugar levels. PMID:24046063

  3. Angiotensin II and canonical transient receptor potential-6 activation stimulate release of a signal transducer and activator of transcription 3-activating factor from mouse podocytes.

    PubMed

    Abkhezr, Mousa; Dryer, Stuart E

    2014-08-01

    Previous studies have shown that the transcription factor signal transducer and activator of transcription-3 (STAT3) in podocytes plays an important role in progression of HIV nephropathy and in collapsing forms of glomerulonephritis. Here, we have observed that application of 100 nM angiotensin II (Ang II) to cultured podocytes for 6-24 hours causes a marked increase in the phosphorylation of STAT3 on tyrosine Y705 but has no effect on phosphorylation at serine S727. By contrast, Ang II treatment of short periods (20-60 minutes) caused a small but consistent suppression of tyrosine phosphylation of STAT3. A similar biphasic effect was seen after treatment with the diacylglycerol analog 1-oleoyl-2-acetyl-sn-glycerol (OAG), an agent that causes activation of Ca(2+)-permeable canonical transient receptor potential-6 (TRPC6) channels in podocytes. The stimulatory effects of Ang II on STAT3 phosphorylation were abolished by small-interfering RNA knockdown of TRPC6 and also by inhibitors of the Ca(2+)-dependent downstream enzymes calcineurin and Ca(2+)-calmodulin-dependent protein kinase II. The stimulatory effects of Ang II appear to be mediated by secretion and accumulation of an unknown factor into the surrounding medium, as they are no longer detected when medium is replaced every 2 hours even if Ang II is continuously present. By contrast, the inhibitory effect of Ang II on STAT3 phosphorylation persists with frequent medium changes. Experiments with neutralizing and inhibitory antibodies suggest that the STAT3 stimulatory factor secreted from podocytes is not interleukin-6, but also suggest that this factor exerts its actions through a receptor system that requires glycoprotein 130. PMID:24850910

  4. Sympathetic outflow activates the venom gland of the snake Bothrops jararaca by regulating the activation of transcription factors and the synthesis of venom gland proteins.

    PubMed

    Luna, Milene S A; Hortencio, Thiago M A; Ferreira, Zulma S; Yamanouye, Norma

    2009-05-01

    The venom gland of viperid snakes has a central lumen where the venom produced by secretory cells is stored. When the venom is lost from the gland, the secretory cells are activated and new venom is produced. The production of new venom is triggered by the action of noradrenaline on both alpha(1)- and beta-adrenoceptors in the venom gland. In this study, we show that venom removal leads to the activation of transcription factors NFkappaB and AP-1 in the venom gland. In dispersed secretory cells, noradrenaline activated both NFkappaB and AP-1. Activation of NFkappaB and AP-1 depended on phospholipase C and protein kinase A. Activation of NFkappaB also depended on protein kinase C. Isoprenaline activated both NFkappaB and AP-1, and phenylephrine activated NFkappaB and later AP-1. We also show that the protein composition of the venom gland changes during the venom production cycle. Striking changes occurred 4 and 7 days after venom removal in female and male snakes, respectively. Reserpine blocks this change, and the administration of alpha(1)- and beta-adrenoceptor agonists to reserpine-treated snakes largely restores the protein composition of the venom gland. However, the protein composition of the venom from reserpinized snakes treated with alpha(1)- or beta-adrenoceptor agonists appears normal, judging from SDS-PAGE electrophoresis. A sexual dimorphism in activating transcription factors and activating venom gland was observed. Our data suggest that the release of noradrenaline after biting is necessary to activate the venom gland by regulating the activation of transcription factors and consequently regulating the synthesis of proteins in the venom gland for venom production. PMID:19411547

  5. Double-stranded DNA translocase activity of transcription factor TFIIH and the mechanism of RNA polymerase II open complex formation

    PubMed Central

    Fishburn, James; Tomko, Eric; Galburt, Eric; Hahn, Steven

    2015-01-01

    Formation of the RNA polymerase II (Pol II) open complex (OC) requires DNA unwinding mediated by the transcription factor TFIIH helicase-related subunit XPB/Ssl2. Because XPB/Ssl2 binds DNA downstream from the location of DNA unwinding, it cannot function using a conventional helicase mechanism. Here we show that yeast TFIIH contains an Ssl2-dependent double-stranded DNA translocase activity. Ssl2 tracks along one DNA strand in the 5′ → 3′ direction, implying it uses the nontemplate promoter strand to reel downstream DNA into the Pol II cleft, creating torsional strain and leading to DNA unwinding. Analysis of the Ssl2 and DNA-dependent ATPase activity of TFIIH suggests that Ssl2 has a processivity of approximately one DNA turn, consistent with the length of DNA unwound during transcription initiation. Our results can explain why maintaining the OC requires continuous ATP hydrolysis and the function of TFIIH in promoter escape. Our results also suggest that XPB/Ssl2 uses this translocase mechanism during DNA repair rather than physically wedging open damaged DNA. PMID:25775526

  6. The heteromeric transcription factor GABP activates the ITGAM/CD11b promoter and induces myeloid differentiation.

    PubMed

    Ripperger, Tim; Manukjan, Georgi; Meyer, Johann; Wolter, Sabine; Schambach, Axel; Bohne, Jens; Modlich, Ute; Li, Zhixiong; Skawran, Britta; Schlegelberger, Brigitte; Steinemann, Doris

    2015-09-01

    The heteromeric transcription factor GA-binding protein (GABP) consists of two subunits, the alpha subunit (GABPA) carrying the DNA-binding ETS domain, and the beta subunit (GABPB1) harbouring the transcriptional activation domain. GABP is involved in haematopoietic stem cell maintenance and differentiation of myeloid and lymphoid lineages in mice. To elucidate the molecular function of GABP in human haematopoiesis, the present study addressed effects of ectopic overexpression of GABP focussing on the myeloid compartment. Combined overexpression of GABPA and GABPB1 caused a proliferation block in cell lines and drastically reduced the colony-forming capacity of murine lineage-negative cells. Impaired proliferation resulted from perturbed cellular cycling and induction of myeloid differentiation shown by surface markers and myelomonocytic morphology of U937 cells. Depending on the dosage and functional integrity of GABP, ITGAM expression was induced. ITGAM encodes CD11b, the alpha subunit of integrin Mac-1, whose beta subunit, ITGB2/CD18, was already described to be regulated by GABP. Finally, Shield1-dependent proteotuning, luciferase reporter assays and chromatin immunoprecipitation showed that GABP activates the ITGAM/CD11b promoter via three binding sites close to the translational start site. In conclusion, the present study supports the crucial role of GABP in myeloid cell differentiation and identified ITGAM/CD11b as a novel GABP target gene. PMID:26170143

  7. The HMG-box transcription factor SoxNeuro acts with Tcf to control Wg/Wnt signaling activity.

    PubMed

    Chao, Anna T; Jones, Whitney M; Bejsovec, Amy

    2007-03-01

    Wnt signaling specifies cell fates in many tissues during vertebrate and invertebrate embryogenesis. To understand better how Wnt signaling is regulated during development, we have performed genetic screens to isolate mutations that suppress or enhance mutations in the fly Wnt homolog, wingless (wg). We find that loss-of-function mutations in the neural determinant SoxNeuro (also known as Sox-neuro, SoxN) partially suppress wg mutant pattern defects. SoxN encodes a HMG-box-containing protein related to the vertebrate Sox1, Sox2 and Sox3 proteins, which have been implicated in patterning events in the early mouse embryo. In Drosophila, SoxN has previously been shown to specify neural progenitors in the embryonic central nervous system. Here, we show that SoxN negatively regulates Wg pathway activity in the embryonic epidermis. Loss of SoxN function hyperactivates the Wg pathway, whereas its overexpression represses pathway activity. Epistasis analysis with other components of the Wg pathway places SoxN at the level of the transcription factor Pan (also known as Lef, Tcf) in regulating target gene expression. In human cell culture assays, SoxN represses Tcf-responsive reporter expression, indicating that the fly gene product can interact with mammalian Wnt pathway components. In both flies and in human cells, SoxN repression is potentiated by adding ectopic Tcf, suggesting that SoxN interacts with the repressor form of Tcf to influence Wg/Wnt target gene transcription. PMID:17267442

  8. Design and synthesis of new hybrid molecules that activate the transcription factor Nrf2 and simultaneously release carbon monoxide.

    PubMed

    Wilson, Jayne Louise; Fayad Kobeissi, Sarah; Oudir, Souhila; Haas, Benjamin; Michel, Brian; Dubois Randé, Jean-Luc; Ollivier, Anthony; Martens, Thierry; Rivard, Michael; Motterlini, Roberto; Foresti, Roberta

    2014-11-01

    The transcription factor Nrf2 and its downstream target heme oxygenase-1 (HO-1) are essential protective systems against oxidative stress and inflammation. The products of HO-1 enzymatic activity, biliverdin and carbon monoxide (CO), actively contribute to this protection, suggesting that exploitation of these cellular systems may offer new therapeutic avenues in a variety of diseases. Starting from a CO-releasing compound and a chemical scaffold exhibiting electrophilic characteristics (esters of fumaric acid), we report the synthesis of hybrid molecules that simultaneously activate Nrf2 and liberate CO. These hybrid compounds, which we termed "HYCOs", release CO to myoglobin and activate the CO-sensitive fluorescent probe COP-1, while also potently inducing nuclear accumulation of Nrf2 and HO-1 expression and activity in different cell types. Thus, we provide here the first example of a new class of pharmacologically active molecules that target the HO-1 pathway by combining an Nrf2 activator coordinated to a CO-releasing group. PMID:25224540

  9. Upregulation of heat shock factor 1 transcription activity is associated with hepatocellular carcinoma progression

    PubMed Central

    LI, SHULIAN; MA, WANLI; FEI, TENG; LOU, QIANG; ZHANG, YAQIN; CUI, XIUKUN; QIN, XIAOMING; ZHANG, JUN; LIU, GUANGCHAO; DONG, ZHENG; MA, YUANFANG; SONG, ZHENGSHUN; HU, YANZHONG

    2014-01-01

    Heat shock factor 1 (HSF1) is associated with tissue-specific tumorigenesis in a number of mouse models, and has been used a as prognostic marker of cancer types, including breast and prostatic cancer. However, its role in human hepatocellular carcinoma (HCC) is not well understood. Using immunoblotting and immunohistochemical staining, it was identified that HSF1 and its serine (S) 326 phosphorylation, a biomarker of HSF1 activation, are significantly upregulated in human HCC tissues and HCC cell lines compared with their normal counterparts. Cohort analyses indicated that upregulation of the expression of HSF1 and its phospho-S326 is significantly correlated with HCC progression, invasion and patient survival prognosis (P<0.001); however, not in the presence of a hepatitis B virus infection and the expression of alpha-fetoprotein and carcinoembryonic antigen. Knockdown of HSF1 with shRNA induced the protein expression of tumor suppressor retinoblastoma protein, resulting in attenuated plc/prf5 cell growth and colony formation in vitro. Taken together, these data markedly support that HSF1 is a potential prognostic marker and therapeutic target for the treatment of HCC. PMID:25199534

  10. Reconstructing genome-wide regulatory network of E. coli using transcriptome data and predicted transcription factor activities

    PubMed Central

    2011-01-01

    Background Gene regulatory networks play essential roles in living organisms to control growth, keep internal metabolism running and respond to external environmental changes. Understanding the connections and the activity levels of regulators is important for the research of gene regulatory networks. While relevance score based algorithms that reconstruct gene regulatory networks from transcriptome data can infer genome-wide gene regulatory networks, they are unfortunately prone to false positive results. Transcription factor activities (TFAs) quantitatively reflect the ability of the transcription factor to regulate target genes. However, classic relevance score based gene regulatory network reconstruction algorithms use models do not include the TFA layer, thus missing a key regulatory element. Results This work integrates TFA prediction algorithms with relevance score based network reconstruction algorithms to reconstruct gene regulatory networks with improved accuracy over classic relevance score based algorithms. This method is called Gene expression and Transcription factor activity based Relevance Network (GTRNetwork). Different combinations of TFA prediction algorithms and relevance score functions have been applied to find the most efficient combination. When the integrated GTRNetwork method was applied to E. coli data, the reconstructed genome-wide gene regulatory network predicted 381 new regulatory links. This reconstructed gene regulatory network including the predicted new regulatory links show promising biological significances. Many of the new links are verified by known TF binding site information, and many other links can be verified from the literature and databases such as EcoCyc. The reconstructed gene regulatory network is applied to a recent transcriptome analysis of E. coli during isobutanol stress. In addition to the 16 significantly changed TFAs detected in the original paper, another 7 significantly changed TFAs have been detected by

  11. Activation of transcription factors STAT1 and STAT5 in the mouse median eminence after systemic ciliary neurotrophic factor administration.

    PubMed

    Severi, Ilenia; Senzacqua, Martina; Mondini, Eleonora; Fazioli, Francesca; Cinti, Saverio; Giordano, Antonio

    2015-10-01

    Exogenously administered ciliary neurotrophic factor (CNTF) causes weight loss in obese rodents and humans through leptin-like activation of the Jak-STAT3 signaling pathway in hypothalamic arcuate neurons. Here we report for the first time that 40min after acute systemic treatment, rat recombinant CNTF (intraperitoneal injection of 0.3mg/kg of body weight) induced nuclear translocation of the tyrosine-phosphorylated forms of STAT1 and STAT5 in the mouse median eminence and other circumventricular organs, including the vascular organ of the lamina terminalis and the subfornical organ. In the tuberal hypothalamus of treated mice, specific nuclear immunostaining for phospo-STAT1 and phospho-STAT5 was detected in ependymal cells bordering the third ventricle floor and lateral recesses, and in median eminence cells. Co-localization studies documented STAT1 and STAT5 activation in median eminence β-tanycytes and underlying radial glia-like cells. A few astrocytes in the arcuate nucleus responded to CNTF by STAT5 activation. The vast majority of median eminence tanycytes and radial glia-like cells showing phospho-STAT1 and phospho-STAT5 immunoreactivity were also positive for phospho-STAT3. In contrast, STAT3 was the sole STAT isoform activated by CNTF in arcuate nucleus and median eminence neurons. Finally, immunohistochemical evaluation of STAT activation 20, 40, 80, and 120min from the injection demonstrated that cell activation was accompanied by c-Fos expression. Collectively, our findings show that CNTF activates STAT3, STAT1, and STAT5 in vivo. The distinctive activation pattern of these STAT isoforms in the median eminence may disclose novel targets and pathways through which CNTF regulates food intake. PMID:26133794

  12. Grass carp (Ctenopharyngodon idella) ATF6 (activating transcription factor 6) modulates the transcriptional level of GRP78 and GRP94 in CIK cells.

    PubMed

    Wang, Xiangqin; Zhang, Tao; Mao, Huiling; Mi, Yichuan; Zhong, Bin; Wei, Lili; Liu, Xiancheng; Hu, Chengyu

    2016-05-01

    ATF transcription factors are stress proteins containing alkaline area-leucine zipper and play an important role in endoplasmic reticulum stress. ATF6 is a protective protein which regulates the adaptation of cells to ER stress by modulating the transcription of UPR (Unfolded Protein Response) target genes, including GRP78 and GRP94. In the present study, a grass carp (Ctenopharyngodon idella) ATF6 full-length cDNA (named CiATF6, KT279356) has been cloned and identified. CiATF6 is 4176 bp in length, comprising 159 nucleotides of 5'-untranslated sequence, a 1947 nucleotides open reading frame and 2170 nucleotides of 3'-untranslated sequences. The largest open reading frame of CiATF6 translates into 648 aa with a typical DNA binding domain (BRLZ domain) and shares significant homology to the known ATF6 counterparts. Phylogenetic reconstruction confirmed its closer evolutionary relationship with other fish counterparts, especially with Zebrafish ATF6. RT-PCR showed that CiATF6 was ubiquitously expressed and significantly up-regulated after stimulation with thermal stress in all tested grass carp tissues. In order to know more about the role of CiATF6 in ER stress, recombinant CiATF6N with His-tag was over-expressed in Rosetta Escherichia coli, and the expressed protein was purified by affinity chromatography with Ni-NTA His-Bind Resin. In vitro, gel mobility shift assays were employed to analyze the interaction of CiATF6 protein with the promoters of grass carp GRP78 and GRP94, respectively. The result has shown that CiATF6 could bind to these promoters with high affinity by means of its BRLZ mainly. To further study the transcriptional regulatory mechanism of CiATF6, Dual-luciferase reporter assays were applied. Recombinant plasmids of pGL3-GRP78P and pGL3-CiGRP94P were constructed and transiently co-transfected with pcDNA3.1-CiATF6 (pcDN3.1-CiATF6-nBRLZ, respectively) into C. idella kidney (CIK) cells. The result has shown that CiATF6 could activate CiGRP78 and

  13. Dual regulation of heat-shock transcription factor (HSF) activation and DNA-binding activity by H2O2: role of thioredoxin.

    PubMed Central

    Jacquier-Sarlin, M R; Polla, B S

    1996-01-01

    The heat-shock (HS) response is a ubiquitous cellular response to stress, involving the transcriptional activation of HS genes. Reactive oxygen species (ROS) have been shown to regulate the activity of a number of transcription factors. We investigated the redox regulation of the stress response and report here that in the human pre-monocytic line U937 cells, H2O2 induced a concentration-dependent transactivation and DNA-binding activity of heat-shock factor-1 (HSF-1). DNA-binding activity was, however, lower with H2O2 than with HS. We thus hypothesized a dual regulation of HSF by oxidants. We found that oxidizing agents, such as H2O2 and diamide, as well as alkylating agents, such as iodoacetic acid, abolished, in vitro, the HSF-DNA-binding activity induced by HS in vivo. The effects of H2O2 in vitro were reversed by the sulphydryl reducing agent dithiothreitol and the endogenous reductor thioredoxin (TRX), while the effects of iodoacetic acid were irreversible. In addition, TRX also restored the DNA-binding activity of HSF oxidized in vivo, while it was found to be itself induced in vivo by both HS and H2O2. Thus, H2O2 exerts dual effects on the activation and the DNA-binding activity of HSF: on the one hand, H2O2 favours the nuclear translocation of HSF, while on the other, it alters HSF-DNA-binding activity, most likely by oxidizing critical cysteine residues within the DNA-binding domain. HSF thus belongs to the group of ROS-modulated transcription factors. We propose that the time required for TRX induction, which may restore the DNA-binding activity of oxidized HSF, provides an explanation for the delay in heat-shock protein synthesis upon exposure of cells to ROS. PMID:8761470

  14. Modulation of Cytokine Production and Transcription Factors Activities in Human Jurkat T Cells by Thymol and Carvacrol

    PubMed Central

    Gholijani, Nasser; Gharagozloo, Marjan; Kalantar, Fathollah; Ramezani, Amin; Amirghofran, Zahra

    2015-01-01

    Purpose: Thymol and carvacrol, two main components of thyme, have shown anti-inflammatory effects. The aim of this study was to assess the effects of these components on Jurkat leukemia cells as an in vitro T cell model and their molecular mechanisms of activity. Methods: Cells were cultured in the presence of components and subsequently stimulated with phorbol-12-myristate-13-acetate (PMA)/calcium ionophore for evaluating interleukin (IL)-2 and interferon (IFN)-γ production. The activation of T cell transcription factors that included nuclear factors of activated T cells (NFATs), activator protein-1 (AP-1; c-Jun/c-Fos), and nuclear factor (NF)-κB were examined by Western blot analysis. Results: Thymol and carvacrol at 25 µg/ml significantly reduced IL-2 levels from 119.4 ± 8pg/ml in control cells treated only with PMA/Calcium ionophore and the solvent to 66.9 ± 6.4pg/ml (thymol) and 32.3 ± 3.6pg/ml (carvacrol) and IFN-γ from 423.7 ± 19.7pg/ml in control cells to 311.9 ± 11.6pg/ml (thymol) and 293.5 ± 16.7pg/ml (carvacrol). Western blot analyses of nuclear extracts showed that the same concentrations of components significantly reduced NFAT-2 to 44.2 ± 2.7% (thymol) and 91.4 ± 2.3% (carvacrol) of the control (p<0.05), and c-Fos to 31.2 ± 6.2% (thymol) and 27.6 ± 3.1% (carvacrol) of the control (p<0.01). No effects on NFAT-1, c-Jun and phospho-NF-κBp65 levels were observed. Conclusion: Thymol and carvacrol could contribute to modulation of T cell activity by reducing IL-2 and IFN-γ production possibly through down regulation of AP-1 and NFAT-2 transcription factors suggesting their potential usefulness for reduction of T cell overactivity in immune-mediated diseases. PMID:26793612

  15. Granulin epithelin precursor: a bone morphogenic protein 2-inducible growth factor that activates Erk1/2 signaling and JunB transcription factor in chondrogenesis

    PubMed Central

    Feng, Jian Q.; Guo, Feng-Jin; Jiang, Bai-Chun; Zhang, Yan; Frenkel, Sally; Wang, Da-Wei; Tang, Wei; Xie, Yixia; Liu, Chuan-Ju

    2010-01-01

    Granulin epithelin precursor (GEP) has been implicated in development, tissue regeneration, tumorigenesis, and inflammation. Herein we report that GEP stimulates chondrocyte differentiation from mesenchymal stem cells in vitro and endochondral ossification ex vivo, and GEP-knockdown mice display skeleton defects. Similar to bone morphogenic protein (BMP) 2, application of the recombinant GEP accelerates rabbit cartilage repair in vivo. GEP is a key downstream molecule of BMP2, and it is required for BMP2-mediated chondrocyte differentiation. We also show that GEP activates chondrocyte differentiation through Erk1/2 signaling and that JunB transcription factor is one of key downstream molecules of GEP in chondrocyte differentiation. Collectively, these findings reveal a novel critical role of GEP growth factor in chondrocyte differentiation and the molecular events both in vivo and in vitro.—Feng, J. Q., Guo, F.-J., Jiang, B.-C., Zhang, Y., Frenkel, S., Wang, D.-W., Tang, W., Xie, Y., Liu, C.-J. Granulin epithelin precursor: a bone morphogenic protein 2-inducible growth factor that activates Erk1/2 signaling and JunB transcription factor in chondrogenesis. PMID:20124436

  16. Linking Smads and transcriptional activation.

    PubMed

    Inman, Gareth J

    2005-02-15

    TGF-beta1 (transforming growth factor-beta1) is the prototypical member of a large family of pleiotropic cytokines that regulate diverse biological processes during development and adult tissue homoeostasis. TGF-beta signals via membrane bound serine/threonine kinase receptors which transmit their signals via the intracellular signalling molecules Smad2, Smad3 and Smad4. These Smads contain conserved MH1 and MH2 domains separated by a flexible linker domain. Smad2 and Smad3 act as kinase substrates for the receptors, and, following phosphorylation, they form complexes with Smad4 and translocate to the nucleus. These Smad complexes regulate gene expression and ultimately determine the biological response to TGF-beta. In this issue of the Biochemical Journal, Wang et al. have shown that, like Smad4, the linker domain of Smad3 contains a Smad transcriptional activation domain. This is capable of recruiting the p300 transcriptional co-activator and is required for Smad3-dependent transcriptional activation. This study raises interesting questions about the nature and regulation of Smad-regulated gene activation and elevates the status of the linker domain to rival that of the much-lauded MH1 and MH2 domains. PMID:15702493

  17. Berberine regulates peroxisome proliferator-activated receptors and positive transcription elongation factor b expression in diabetic adipocytes.

    PubMed

    Zhou, Jiyin; Zhou, Shiwen

    2010-12-15

    Berberine has hypoglycemic and hypolipidemic effects on diabetic rats. This study investigated the relationship between hypoglycemic and hypolipidemic effects of berberine and peroxisome proliferator-activated receptors (PPARs) and positive transcription elongation factor b (P-TEFb) (including cyclin-dependent kinase 9 (CDK9) and cyclin T1) in white adipose tissue of diabetic rats and RNA interference-treated 3T3-L1 cells. Berberine promoted differentiation and inhibited lipid accumulation of 3T3-L1 cells, further decreased PPARα/δ/γ, CDK9 and cyclin T1 mRNA and protein expression and decreased tumor necrosis factor α content in supernatants of both control and RNA interference-treated 3T3-L1 cells. After a 16-week induction with 35 mg/kg streptozotocin (i.p.) and high-carbohydrate/high-fat diet, diabetic rats were treated with 75, 150 and 300 mg/kg berberine and 100 mg/kg fenofibrate or 4 mg/kg rosiglitazone for another 16 weeks. Berberine decreased white adipose tissue to body weight ratio and adipocyte size and increased adipocyte number. Berberine upregulated PPARα/δ/γ, CDK9 and cyclin T1 mRNA and protein expression in adipose tissue, decreased tumor necrosis factor α and free fatty acid content and increased lipoprotein lipase activity in serum and adipose tissue. Berberine modulated metabolic related PPARs expression and differentiation related P-TEFb expression in adipocytes, which are associated with its hypoglycemic and hypolipidemic effects. PMID:20868663

  18. A critical role for alternative polyadenylation factor CPSF6 in targeting HIV-1 integration to transcriptionally active chromatin.

    PubMed

    Sowd, Gregory A; Serrao, Erik; Wang, Hao; Wang, Weifeng; Fadel, Hind J; Poeschla, Eric M; Engelman, Alan N

    2016-02-23

    Integration is vital to retroviral replication and influences the establishment of the latent HIV reservoir. HIV-1 integration favors active genes, which is in part determined by the interaction between integrase and lens epithelium-derived growth factor (LEDGF)/p75. Because gene targeting remains significantly enriched, relative to random in LEDGF/p75 deficient cells, other host factors likely contribute to gene-tropic integration. Nucleoporins 153 and 358, which bind HIV-1 capsid, play comparatively minor roles in integration targeting, but the influence of another capsid binding protein, cleavage and polyadenylation specificity factor 6 (CPSF6), has not been reported. In this study we knocked down or knocked out CPSF6 in parallel or in tandem with LEDGF/p75. CPSF6 knockout changed viral infectivity kinetics, decreased proviral formation, and preferentially decreased integration into transcriptionally active genes, spliced genes, and regions of chromatin enriched in genes and activating histone modifications. LEDGF/p75 depletion by contrast preferentially altered positional integration targeting within gene bodies. Dual factor knockout reduced integration into genes to below the levels observed with either single knockout and revealed that CPSF6 played a more dominant role than LEDGF/p75 in directing integration to euchromatin. CPSF6 complementation rescued HIV-1 integration site distribution in CPSF6 knockout cells, but complementation with a capsid binding mutant of CPSF6 did not. We conclude that integration targeting proceeds via two distinct mechanisms: capsid-CPSF6 binding directs HIV-1 to actively transcribed euchromatin, where the integrase-LEDGF/p75 interaction drives integration into gene bodies. PMID:26858452

  19. Tailor-Made Zinc-Finger Transcription Factors Activate FLO11 Gene Expression with Phenotypic Consequences in the Yeast Saccharomyces cerevisiae

    PubMed Central

    Shieh, Jia-Ching; Cheng, Yu-Che; Su, Mao-Chang; Moore, Michael; Choo, Yen; Klug, Aaron

    2007-01-01

    Cys2His2 zinc fingers are eukaryotic DNA-binding motifs, capable of distinguishing different DNA sequences, and are suitable for engineering artificial transcription factors. In this work, we used the budding yeast Saccharomyces cerevisiae to study the ability of tailor-made zinc finger proteins to activate the expression of the FLO11 gene, with phenotypic consequences. Two three-finger peptides were identified, recognizing sites from the 5′ UTR of the FLO11 gene with nanomolar DNA-binding affinity. The three-finger domains and their combined six-finger motif, recognizing an 18-bp site, were fused to the activation domain of VP16 or VP64. These transcription factor constructs retained their DNA-binding ability, with the six-finger ones being the highest in affinity. However, when expressed in haploid yeast cells, only one three-finger recombinant transcription factor was able to activate the expression of FLO11 efficiently. Unlike in the wild-type, cells with such transcriptional activation displayed invasive growth and biofilm formation, without any requirement for glucose depletion. The VP16 and VP64 domains appeared to act equally well in the activation of FLO11 expression, with comparable effects in phenotypic alteration. We conclude that the functional activity of tailor-made transcription factors in cells is not easily predicted by the in vitro DNA-binding activity. PMID:17710146

  20. Unbiased identification of signal-activated transcription factors by barcoded synthetic tandem repeat promoter screening (BC-STAR-PROM).

    PubMed

    Gosselin, Pauline; Rando, Gianpaolo; Fleury-Olela, Fabienne; Schibler, Ueli

    2016-08-15

    The discovery of transcription factors (TFs) controlling pathways in health and disease is of paramount interest. We designed a widely applicable method, dubbed barcorded synthetic tandem repeat promoter screening (BC-STAR-PROM), to identify signal-activated TFs without any a priori knowledge about their properties. The BC-STAR-PROM library consists of ∼3000 luciferase expression vectors, each harboring a promoter (composed of six tandem repeats of synthetic random DNA) and an associated barcode of 20 base pairs (bp) within the 3' untranslated mRNA region. Together, the promoter sequences encompass >400,000 bp of random DNA, a sequence complexity sufficient to capture most TFs. Cells transfected with the library are exposed to a signal, and the mRNAs that it encodes are counted by next-generation sequencing of the barcodes. This allows the simultaneous activity tracking of each of the ∼3000 synthetic promoters in a single experiment. Here we establish proof of concept for BC-STAR-PROM by applying it to the identification of TFs induced by drugs affecting actin and tubulin cytoskeleton dynamics. BC-STAR-PROM revealed that serum response factor (SRF) is the only immediate early TF induced by both actin polymerization and microtubule depolymerization. Such changes in cytoskeleton dynamics are known to occur during the cell division cycle, and real-time bioluminescence microscopy indeed revealed cell-autonomous SRF-myocardin-related TF (MRTF) activity bouts in proliferating cells. PMID:27601530

  1. Transcription Factor ZBED6 Mediates IGF2 Gene Expression by Regulating Promoter Activity and DNA Methylation in Myoblasts

    NASA Astrophysics Data System (ADS)

    Huang, Yong-Zhen; Zhang, Liang-Zhi; Lai, Xin-Sheng; Li, Ming-Xun; Sun, Yu-Jia; Li, Cong-Jun; Lan, Xian-Yong; Lei, Chu-Zhao; Zhang, Chun-Lei; Zhao, Xin; Chen, Hong

    2014-04-01

    Zinc finger, BED-type containing 6 (ZBED6) is an important transcription factor in placental mammals, affecting development, cell proliferation and growth. In this study, we found that the expression of the ZBED6 and IGF2 were upregulated during C2C12 differentiation. The IGF2 expression levels were negatively associated with the methylation status in beef cattle (P < 0.05). A luciferase assay for the IGF2 intron 3 and P3 promoter showed that the mutant-type 439 A-SNP-pGL3 in driving reporter gene transcription is significantly higher than that of the wild-type 439 G-SNP-pGL3 construct (P < 0.05). An over-expression assay revealed that ZBED6 regulate IGF2 expression and promote myoblast differentiation. Furthermore, knockdown of ZBED6 led to IGF2 expression change in vitro. Taken together, these results suggest that ZBED6 inhibits IGF2 activity and expression via a G to A transition disrupts the interaction. Thus, we propose that ZBED6 plays a critical role in myogenic differentiation.

  2. Endoplasmic Reticulum Stress-Activated Transcription Factor ATF6α Requires the Disulfide Isomerase PDIA5 To Modulate Chemoresistance

    PubMed Central

    Higa, Arisa; Taouji, Said; Lhomond, Stéphanie; Jensen, Devon; Fernandez-Zapico, Martin E.; Simpson, Jeremy C.; Pasquet, Jean-Max; Schekman, Randy

    2014-01-01

    ATF6α, a membrane-anchored transcription factor from the endoplasmic reticulum (ER) that modulates the cellular response to stress as an effector of the unfolded-protein response (UPR), is a key player in the development of tumors of different origin. ATF6α activation has been linked to oncogenic transformation and tumor maintenance; however, the mechanism(s) underlying this phenomenon remains elusive. Here, using a phenotypic small interfering RNA (siRNA) screening, we identified a novel role for ATF6α in chemoresistance and defined the protein disulfide isomerase A5 (PDIA5) as necessary for ATF6α activation upon ER stress. PDIA5 contributed to disulfide bond rearrangement in ATF6α under stress conditions, thereby leading to ATF6α export from the ER and activation of its target genes. Further analysis of the mechanism demonstrated that PDIA5 promotes ATF6α packaging into coat protein complex II (COPII) vesicles and that the PDIA5/ATF6α activation loop is essential to confer chemoresistance on cancer cells. Genetic and pharmacological inhibition of the PDIA5/ATF6α axis restored sensitivity to the drug treatment. This work defines the mechanisms underlying the role of ATF6α activation in carcinogenesis and chemoresistance; furthermore, it identifies PDIA5 as a key regulator ATF6α-mediated cellular functions in cancer. PMID:24636989

  3. Polyphenol Compound as a Transcription Factor Inhibitor.

    PubMed

    Park, Seyeon

    2015-11-01

    A target-based approach has been used to develop novel drugs in many therapeutic fields. In the final stage of intracellular signaling, transcription factor-DNA interactions are central to most biological processes and therefore represent a large and important class of targets for human therapeutics. Thus, we focused on the idea that the disruption of protein dimers and cognate DNA complexes could impair the transcriptional activation and cell transformation regulated by these proteins. Historically, natural products have been regarded as providing the primary leading compounds capable of modulating protein-protein or protein-DNA interactions. Although their mechanism of action is not fully defined, polyphenols including flavonoids were found to act mostly as site-directed small molecule inhibitors on signaling. There are many reports in the literature of screening initiatives suggesting improved drugs that can modulate the transcription factor interactions responsible for disease. In this review, we focus on polyphenol compound inhibitors against dimeric forms of transcription factor components of intracellular signaling pathways (for instance, c-jun/c-fos (Activator Protein-1; AP-1), c-myc/max, Nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) and β-catenin/T cell factor (Tcf)). PMID:26529010

  4. Postmitotic diversification of olfactory neuron types is mediated by differential activities of the HMG-box transcription factor SOX-2.

    PubMed

    Alqadah, Amel; Hsieh, Yi-Wen; Vidal, Berta; Chang, Chieh; Hobert, Oliver; Chuang, Chiou-Fen

    2015-10-14

    Diversification of neuron classes is essential for functions of the olfactory system, but the underlying mechanisms that generate individual olfactory neuron types are only beginning to be understood. Here we describe a role of the highly conserved HMG-box transcription factor SOX-2 in postmitotic specification and alternative differentiation of the Caenorhabditis elegans AWC and AWB olfactory neurons. We show that SOX-2 partners with different transcription factors to diversify postmitotic olfactory cell types. SOX-2 functions cooperatively with the OTX/OTD transcription factor CEH-36 to specify an AWC "ground state," and functions with the LIM homeodomain factor LIM-4 to suppress this ground state and drive an AWB identity instead. Our findings provide novel insights into combinatorial codes that drive terminal differentiation programs in the nervous system and reveal a biological function of the deeply conserved Sox2 protein that goes beyond its well-known role in stem cell biology. PMID:26341465

  5. The transcription factor FOXF1 promotes prostate cancer by stimulating the mitogen-activated protein kinase ERK5.

    PubMed

    Fulford, Logan; Milewski, David; Ustiyan, Vladimir; Ravishankar, Navin; Cai, Yuqi; Le, Tien; Masineni, Sreeharsha; Kasper, Susan; Aronow, Bruce; Kalinichenko, Vladimir V; Kalin, Tanya V

    2016-01-01

    Forkhead box F1 (FOXF1) is a stromal transcription factor that is not expressed in epithelial cells of normal prostate tissue. The role of FOXF1 in cancer is conflicting; its loss in some cancers suggests a tumor suppressive function, but its abundance in others is associated with protumorigenic and metastatic traits. Extracellular signal-regulated kinase 5 (ERK5) is associated with advanced-stage prostate adenocarcinoma (PCa) in patients. We detected a population of FOXF1-positive tumor cells in aggressive mouse and human PCa. Using two murine orthotopic models of PCa, we found that overexpression of FOXF1 in Myc-CaP and TRAMP prostate tumor cells induced tumor growth in the prostate and progression to peritoneal metastasis. Increased growth of FOXF1-positive prostate tumors was associated with increased phosphorylation of ERK5, a member of the mitogen-activated protein kinase (MAPK) family. FOXF1 transcriptionally induced and directly bound to promoter regions of genes encoding the kinases MAP3K2 and WNK1, which promoted the phosphorylation and activation of ERK5. Knockdown of ERK5 or both MAP3K2 and WNK1 in FOXF1-overexpressing PCa cells reduced cell proliferation in culture and suppressed tumor growth and tumor metastasis when implanted into mice. In human tumors, FOXF1 expression correlated positively with that of MAP3K2 and WNK1 Thus, in contrast to some tumors where FOXF1 may function as a tumor suppressor, FOXF1 promotes prostate tumor growth and progression by activating ERK5 signaling. Our results also indicate that ERK5 may be a new therapeutic target in patients with FOXF1-positive PCa. PMID:27165781

  6. Hepatitis C virus nonstructural protein-5A activates sterol regulatory element-binding protein-1c through transcription factor Sp1

    SciTech Connect

    Xiang, Zhonghua; Qiao, Ling; Zhou, Yan; Babiuk, Lorne A.; Liu, Qiang

    2010-11-19

    Research highlights: {yields} A chimeric subgenomic HCV replicon expresses HCV-3a NS5A in an HCV-1b backbone. {yields} HCV-3a NS5A increases mature SREBP-1c protein level. {yields} HCV-3a NS5A activates SREBP-1c transcription. {yields} Domain II of HCV-3a NS5A is more effective in SREBP-1c promoter activation. {yields} Transcription factor Sp1 is required for SREBP-1c activation by HCV-3a NS5A. -- Abstract: Steatosis is an important clinical manifestation of hepatitis C virus (HCV) infection. The molecular mechanisms of HCV-associated steatosis are not well understood. Sterol regulatory element-binding protein-1c (SREBP-1c) is a key transcription factor which activates the transcription of lipogenic genes. Here we showed that the nuclear, mature SREBP-1c level increases in the nucleus of replicon cells expressing HCV-3a nonstructural protein-5A (NS5A). We further showed that HCV-3a NS5A up-regulates SREBP-1c transcription. Additional analysis showed that transcriptional factor Sp1 is involved in SREBP-1c activation by HCV-3a NS5A because inhibition of Sp1 activity by mithramycin A or a dominant-negative Sp1 construct abrogated SREBP-1c promoter activation by HCV-3a NS5A. In addition, chromatin immunoprecipitation (ChIP) assay demonstrated enhanced binding of Sp1 on the SREBP-1c promoter in HCV-3a NS5A replicon cells. These results showed that HCV-3a NS5A activates SREBP-1c transcription through Sp1. Taken together, our results suggest that HCV-3a NS5A is a contributing factor for steatosis caused by HCV-3a infection.

  7. Use of green fluorescent fusion protein to track activation of the transcription factor osterix during early osteoblast differentiation

    SciTech Connect

    Tai Guangping; Christodoulou, Ioannis; Bishop, Anne E.; Polak, Julia M. . E-mail: julia.polak@imperial.ac.uk

    2005-08-12

    Osterix (Osx) is a transcription factor required for the differentiation of preosteoblasts into fully functioning osteoblasts. However, the pattern of Osx activation during preosteoblast differentiation and maturation has not been clearly defined. Our aim was to study Osx activation during these processes in osteoblasts differentiating from murine and human embryonic stem cells (ESC). To do this, we constructed an Osx-GFP fusion protein reporter system to track Osx translocation within the cells. The distribution of Osx-GFP at representative stages of differentiation was also investigated by screening primary osteoblasts, mesenchymal stem cells, synoviocytes, and pre-adipocytes. Our experiments revealed that Osx-GFP protein was detectable in the cytoplasm of cultured, differentiated ESC 4 days after plating of enzymatically dispersed embryoid bodies. Osterix-GFP protein became translocated into the nucleus on day 7 following transfer of differentiated ESC to osteogenic medium. After 14 days of differentiation, cells showing nuclear translocation of Osx-GFP formed rudimentary bone nodules that continued to increase in number over the following weeks (through day 21). We also found that Osx translocated into the nuclei of mesenchymal stem cells (C3H10T1/2) and pre-osteoblasts (MC3T3-E1) and showed partial activation in pre-adipocytes (MC3T3-L1). These data suggest that Osx activation occurs at a very early point in the differentiation of the mesenchymal-osteoblastic lineage.

  8. TATA-binding protein and transcription factor IIB induce transcript slipping during early transcription by RNA polymerase II.

    PubMed

    Gilman, Benjamin; Drullinger, Linda F; Kugel, Jennifer F; Goodrich, James A

    2009-04-01

    To better understand the mechanism of steps in early transcription by RNA polymerase II (pol II), we investigated the molecular determinants of transcript slipping within complexes assembled on promoters containing a pre-melted transcription bubble from -9 to +3. Transcript slippage occurs when an RNA transcript contains a repetitive sequence that allows the transcript to slip back and pair with the template strand of the DNA at a new register before transcription continues. We established the contributions of individual transcription factors, DNA elements, and RNA length to slipping on a heteroduplex template using a highly purified human pol II transcription system. We found that transcripts slip at a very defined point in the transcription reaction, after pol II completes phosphodiester bond synthesis at register +5. This point is set by the position of the polymerase active site on the DNA template, as opposed to the length of the transcript, as well as by a repetitive CUCU sequence that must occur from +2 to +5. Interestingly, slipping at this juncture is induced by TATA-binding protein and transcription factor IIB and requires a TATA box but not a transcription factor IIB recognition sequence. We propose a model in which transcribing complexes, upon completing phosphodiester bond synthesis at register +5, enter one of two branches in which they either complete productive synthesis of the transcript or undergo multiple rounds of transcript slipping. PMID:19193635

  9. Activation of nuclear transcription factor-kappaB in mouse brain induced by a simulated microgravity environment

    NASA Technical Reports Server (NTRS)

    Wise, Kimberly C.; Manna, Sunil K.; Yamauchi, Keiko; Ramesh, Vani; Wilson, Bobby L.; Thomas, Renard L.; Sarkar, Shubhashish; Kulkarni, Anil D.; Pellis, Neil R.; Ramesh, Govindarajan T.

    2005-01-01

    Microgravity induces inflammatory responses and modulates immune functions that may increase oxidative stress. Exposure to a microgravity environment induces adverse neurological effects; however, there is little research exploring the etiology of these effects resulting from exposure to such an environment. It is also known that spaceflight is associated with increase in oxidative stress; however, this phenomenon has not been reproduced in land-based simulated microgravity models. In this study, an attempt has been made to show the induction of reactive oxygen species (ROS) in mice brain, using ground-based microgravity simulator. Increased ROS was observed in brain stem and frontal cortex with concomitant decrease in glutathione, on exposing mice to simulated microgravity for 7 d. Oxidative stress-induced activation of nuclear factor-kappaB was observed in all the regions of the brain. Moreover, mitogen-activated protein kinase kinase was phosphorylated equally in all regions of the brain exposed to simulated microgravity. These results suggest that exposure of brain to simulated microgravity can induce expression of certain transcription factors, and these have been earlier argued to be oxidative stress dependent.

  10. Activation of nuclear transcription factor-kappaB in mouse brain induced by a simulated microgravity environment.

    PubMed

    Wise, Kimberly C; Manna, Sunil K; Yamauchi, Keiko; Ramesh, Vani; Wilson, Bobby L; Thomas, Renard L; Sarkar, Shubhashish; Kulkarni, Anil D; Pellis, Neil R; Ramesh, Govindarajan T

    2005-01-01

    Microgravity induces inflammatory responses and modulates immune functions that may increase oxidative stress. Exposure to a microgravity environment induces adverse neurological effects; however, there is little research exploring the etiology of these effects resulting from exposure to such an environment. It is also known that spaceflight is associated with increase in oxidative stress; however, this phenomenon has not been reproduced in land-based simulated microgravity models. In this study, an attempt has been made to show the induction of reactive oxygen species (ROS) in mice brain, using ground-based microgravity simulator. Increased ROS was observed in brain stem and frontal cortex with concomitant decrease in glutathione, on exposing mice to simulated microgravity for 7 d. Oxidative stress-induced activation of nuclear factor-kappaB was observed in all the regions of the brain. Moreover, mitogen-activated protein kinase kinase was phosphorylated equally in all regions of the brain exposed to simulated microgravity. These results suggest that exposure of brain to simulated microgravity can induce expression of certain transcription factors, and these have been earlier argued to be oxidative stress dependent. PMID:16029073

  11. An RNA polymerase II transcription factor has an associated DNA-dependent ATPase (dATPase) activity strongly stimulated by the TATA region of promoters.

    PubMed Central

    Conaway, R C; Conaway, J W

    1989-01-01

    A transcription factor required for synthesis of accurately initiated run-off transcripts by RNA polymerase II has been purified and shown to have an associated DNA-dependent ATPase (dATPase) activity that is strongly stimulated by the TATA region of promoters. This transcription factor, designated delta, was purified more than 3000-fold from extracts of crude rat liver nuclei and has a native molecular mass of approximately 230 kDa. DNA-dependent ATPase (dATPase) and transcription activities copurify when delta is analyzed by hydrophobic interaction and ion-exchange HPLC, arguing that transcription factor delta possesses an ATPase (dATPase) activity. ATPase (dATPase) is specific for adenine nucleotides; ATP and dATP, but not CTP, UTP, or GTP, are hydrolyzed. ATPase (dATPase) is stimulated by both double-stranded and single-stranded DNAs, including pUC18, ssM13, and poly(dT); however, DNA fragments containing the TATA region of either the adenovirus 2 major late or mouse interleukin 3 promoters stimulate ATPase as much as 10-fold more effectively than DNA fragments containing nonpromoter sequences. These data suggest the intriguing possibility that delta plays a critical role in the ATP (dATP)-dependent activation of run-off transcription through a direct interaction with the TATA region of promoters. Images PMID:2552440

  12. Polyphenol Compound as a Transcription Factor Inhibitor

    PubMed Central

    Park, Seyeon

    2015-01-01

    A target-based approach has been used to develop novel drugs in many therapeutic fields. In the final stage of intracellular signaling, transcription factor–DNA interactions are central to most biological processes and therefore represent a large and important class of targets for human therapeutics. Thus, we focused on the idea that the disruption of protein dimers and cognate DNA complexes could impair the transcriptional activation and cell transformation regulated by these proteins. Historically, natural products have been regarded as providing the primary leading compounds capable of modulating protein–protein or protein-DNA interactions. Although their mechanism of action is not fully defined, polyphenols including flavonoids were found to act mostly as site-directed small molecule inhibitors on signaling. There are many reports in the literature of screening initiatives suggesting improved drugs that can modulate the transcription factor interactions responsible for disease. In this review, we focus on polyphenol compound inhibitors against dimeric forms of transcription factor components of intracellular signaling pathways (for instance, c-jun/c-fos (Activator Protein-1; AP-1), c-myc/max, Nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) and β-catenin/T cell factor (Tcf)). PMID:26529010

  13. Profiling of histone H3 lysine 9 trimethylation levels predicts transcription factor activity and survival in acute myeloid leukemia

    PubMed Central

    Klein, Hans-Ulrich; Hascher, Antje; Isken, Fabienne; Tickenbrock, Lara; Thoennissen, Nils; Agrawal-Singh, Shuchi; Tschanter, Petra; Disselhoff, Christine; Wang, Yipeng; Becker, Anke; Thiede, Christian; Ehninger, Gerhard; zur Stadt, Udo; Koschmieder, Steffen; Seidl, Matthias; Müller, Frank U.; Schmitz, Wilhelm; Schlenke, Peter; McClelland, Michael; Berdel, Wolfgang E.; Dugas, Martin; Serve, Hubert

    2010-01-01

    Acute myeloid leukemia (AML) is commonly associated with alterations in transcription factors because of altered expression or gene mutations. These changes might induce leukemia-specific patterns of histone modifications. We used chromatin-immunoprecipitation on microarray to analyze histone 3 lysine 9 trimethylation (H3K9me3) patterns in primary AML (n = 108), acute lymphoid leukemia (n = 28), CD34+ cells (n = 21) and white blood cells (n = 15) specimens. Hundreds of promoter regions in AML showed significant alterations in H3K9me3 levels. H3K9me3 deregulation in AML occurred preferentially as a decrease in H3K9me3 levels at core promoter regions. The altered genomic regions showed an overrepresentation of cis-binding sites for ETS and cyclic adenosine monophosphate response elements (CREs) for transcription factors of the CREB/CREM/ATF1 family. The decrease in H3K9me3 levels at CREs was associated with increased CRE-driven promoter activity in AML blasts in vivo. AML-specific H3K9me3 patterns were not associated with known cytogenetic abnormalities. But a signature derived from H3K9me3 patterns predicted event-free survival in AML patients. When the H3K9me3 signature was combined with established clinical prognostic markers, it outperformed prognosis prediction based on clinical parameters alone. These findings demonstrate widespread changes of H3K9me3 levels at gene promoters in AML. Signatures of histone modification patterns are associated with patient prognosis in AML. PMID:20498303

  14. A Measurable Activation of the bZIP Transcription Factor Atf1 in a Fission Yeast Strain Devoid of Stress-activated and Cell Integrity Mitogen-activated Protein Kinase (MAPK) Activities*

    PubMed Central

    Zhou, Xin; Ma, Yan; Kato, Toshiaki; Kuno, Takayoshi

    2012-01-01

    In Schizosaccharomyces pombe, the stress-activated Sty1 MAPK pathway is essential for cell survival under stress conditions. The Sty1 MAPK regulates Atf1 transcription factor to elicit stress responses in extreme conditions of osmolarity and reactive oxygen species-generating agents such as hydrogen peroxide, heat, low glucose, and heavy metal. Herein, using a newly developed Renilla luciferase reporter assay with enhanced detection sensitivity and accuracy, we show that distinct signaling pathways respond to cadmium and other reactive oxygen species-generating agents for the activation of Atf1. Also, surprisingly, a measurable activation of Atf1 transcription factor was still observed devoid of Sty1 MAPK activity. Further genetic and biological analyses revealed that the residual activation is caused by the activation of the cell wall integrity Pmk1 MAPK pathway and a redox-mediated activation of Atf1. PMID:22661707

  15. HIGH-DIMENSIONAL PROFILING OF TRANSCRIPTION FACTOR ACTIVITY DIFFERENTIATES TOXCAST CHEMICAL GROUPS

    EPA Science Inventory

    The ToxCast™ project at the U.S. EPA uses a diverse battery of high throughput screening assays and informatics models to rapidly characterize the activity of chemicals. A central goal of the project is to provide empirical evidence to aid in the prioritization of chemicals for a...

  16. Transcription factor network downstream of protease activated receptors (PARs) modulating mouse bladder inflammation

    PubMed Central

    Saban, Ricardo; Simpson, Cindy; Davis, Carole A; Dozmorov, Igor; Maier, Julie; Fowler, Ben; Ihnat, Michael A; Hurst, Robert E; Wershil, Barry K; Saban, Marcia R

    2007-01-01

    Background All four PARs are present in the urinary bladder, and their expression is altered during inflammation. In order to search for therapeutic targets other than the receptors themselves, we set forth to determine TFs downstream of PAR activation in the C57BL/6 urinary bladders. Methods For this purpose, we used a protein/DNA combo array containing 345 different TF consensus sequences. Next, the TF selected was validated by EMSA and IHC. As mast cells seem to play a fundamental role in bladder inflammation, we determined whether c-kit receptor deficient (Kitw/Kitw-v) mice have an abrogated response to PAR stimulation. Finally, TFEB antibody was used for CHIP/Q-PCR assay and revealed up-regulation of genes known to be downstream of TFEB. Results TFEB, a member of the MiTF family of basic helix-loop-helix leucine zipper, was the only TF commonly up-regulated by all PAR-APs. IHC results confirm a correlation between inflammation and TFEB expression in C57BL/6 mice. In contrast, Kitw/Kitw-v mice did not exhibit inflammation in response to PAR activation. EMSA results confirmed the increased TFEB binding activity in C57BL/6 but not in Kitw/Kitw-v mice. Conclusion This is the first report describing the increased expression of TFEB in bladder inflammation in response to PAR activation. As TFEB belongs to a family of TFs essential for mast cell survival, our findings suggest that this molecule may influence the participation of mast cells in PAR-mediated inflammation and that targeting TFEB/MiTF activity may be a novel approach for the treatment of bladder inflammatory disorders. PMID:17705868

  17. S6K-STING interaction regulates cytosolic DNA-mediated activation of the transcription factor IRF3.

    PubMed

    Wang, Fuan; Alain, Tommy; Szretter, Kristy J; Stephenson, Kyle; Pol, Jonathan G; Atherton, Matthew J; Hoang, Huy-Dung; Fonseca, Bruno D; Zakaria, Chadi; Chen, Lan; Rangwala, Zainab; Hesch, Adam; Chan, Eva Sin Yan; Tuinman, Carly; Suthar, Mehul S; Jiang, Zhaozhao; Ashkar, Ali A; Thomas, George; Kozma, Sara C; Gale, Michael; Fitzgerald, Katherine A; Diamond, Michael S; Mossman, Karen; Sonenberg, Nahum; Wan, Yonghong; Lichty, Brian D

    2016-05-01

    Cytosolic DNA-mediated activation of the transcription factor IRF3 is a key event in host antiviral responses. Here we found that infection with DNA viruses induced interaction of the metabolic checkpoint kinase mTOR downstream effector and kinase S6K1 and the signaling adaptor STING in a manner dependent on the DNA sensor cGAS. We further demonstrated that the kinase domain, but not the kinase function, of S6K1 was required for the S6K1-STING interaction and that the TBK1 critically promoted this process. The formation of a tripartite S6K1-STING-TBK1 complex was necessary for the activation of IRF3, and disruption of this signaling axis impaired the early-phase expression of IRF3 target genes and the induction of T cell responses and mucosal antiviral immunity. Thus, our results have uncovered a fundamental regulatory mechanism for the activation of IRF3 in the cytosolic DNA pathway. PMID:27043414

  18. Dipeptidyl peptidase-4 inhibition in diabetic rats leads to activation of the transcription factor CREB in β-cells.

    PubMed

    Pugazhenthi, Subbiah; Qin, LiMei; Bouchard, Ron

    2015-05-15

    Incretin therapies are effective in controlling blood glucose levels in type 2 diabetic patients by improving the survival and function of β-cells. They include dipeptidyl peptidase-4 (DPP-4) inhibitors and long-acting glucagon-like peptide-1 (GLP-1) analogs. We have previously reported that GLP-1 enhances the survival of cultured human islets by activation of the transcription factor CREB. To test the in vivo relevance of these findings, we examined the effects of alogliptin, a DPP-4 inhibitor, in Zucker Diabetic rats, a model for type 2 diabetes. The plasma levels of GLP-1 increased in alogliptin-treated diabetic rats leading to normoglycemia. Pancreatic islets of untreated diabetic rats were characterized by decreased immunostaining for insulin and PDX-1. Elevation of GLP-1 in treated diabetic rats resulted in the improved survival of β-cells. Dual immunofluorescent staining showed phosphorylation/activation of CREB in insulin-positive β-cells of islets. This led to increases in the levels of CREB targets including Bcl-2, an antiapoptotic mitochondrial protein, BIRC3, a caspase inhibitor and IRS-2, an adapter protein needed for insulin signaling. Findings from this study suggest potential activation of cytoprotective CREB by GLP-1 in pancreatic β-cells of diabetic patients undergoing incretin-based therapies. PMID:25720341

  19. Hey bHLH transcription factors.

    PubMed

    Weber, David; Wiese, Cornelia; Gessler, Manfred

    2014-01-01

    Hey bHLH transcription factors are direct targets of canonical Notch signaling. The three mammalian Hey proteins are closely related to Hes proteins and they primarily repress target genes by either directly binding to core promoters or by inhibiting other transcriptional activators. Individual candidate gene approaches and systematic screens identified a number of Hey target genes, which often encode other transcription factors involved in various developmental processes. Here, we review data on interaction partners and target genes and conclude with a model for Hey target gene regulation. Furthermore, we discuss how expression of Hey proteins affects processes like cell fate decisions and differentiation, e.g., in cardiovascular, skeletal, and neural development or oncogenesis and how this relates to the observed developmental defects and phenotypes observed in various knockout mice. PMID:25248480

  20. The antiproliferative activity of kinase inhibitors in chronic myeloid leukemia cells is mediated by FOXO transcription factors.

    PubMed

    Pellicano, Francesca; Scott, Mary T; Helgason, G Vignir; Hopcroft, Lisa E M; Allan, Elaine K; Aspinall-O'Dea, Mark; Copland, Mhairi; Pierce, Andrew; Huntly, Brian J P; Whetton, Anthony D; Holyoake, Tessa L

    2014-09-01

    Chronic myeloid leukemia (CML) is initiated and maintained by the tyrosine kinase BCR-ABL which activates a number of signal transduction pathways, including PI3K/AKT signaling and consequently inactivates FOXO transcription factors. ABL-specific tyrosine kinase inhibitors (TKIs) induce minimal apoptosis in CML progenitor cells, yet exert potent antiproliferative effects, through as yet poorly understood mechanisms. Here, we demonstrate that in CD34+ CML cells, FOXO1 and 3a are inactivated and relocalized to the cytoplasm by BCR-ABL activity. TKIs caused a decrease in phosphorylation of FOXOs, leading to their relocalization from cytoplasm (inactive) to nucleus (active), where they modulated the expression of key FOXO target genes, such as Cyclin D1, ATM, CDKN1C, and BCL6 and induced G1 arrest. Activation of FOXO1 and 3a and a decreased expression of their target gene Cyclin D1 were also observed after 6 days of in vivo treatment with dasatinib in a CML transgenic mouse model. The over-expression of FOXO3a in CML cells combined with TKIs to reduce proliferation, with similar results seen for inhibitors of PI3K/AKT/mTOR signaling. While stable expression of an active FOXO3a mutant induced a similar level of quiescence to TKIs alone, shRNA-mediated knockdown of FOXO3a drove CML cells into cell cycle and potentiated TKI-induced apoptosis. These data demonstrate that TKI-induced G1 arrest in CML cells is mediated through inhibition of the PI3K/AKT pathway and reactivation of FOXOs. This enhanced understanding of TKI activity and induced progenitor cell quiescence suggests that new therapeutic strategies for CML should focus on manipulation of this signaling network. PMID:24806995

  1. Calcium-independent phospholipase A2γ enhances activation of the ATF6 transcription factor during endoplasmic reticulum stress.

    PubMed

    Elimam, Hanan; Papillon, Joan; Takano, Tomoko; Cybulsky, Andrey V

    2015-01-30

    Injury of visceral glomerular epithelial cells (GECs) causes proteinuria in many glomerular diseases. We reported previously that calcium-independent phospholipase A2γ (iPLA2γ) is cytoprotective against complement-mediated GEC injury. Because iPLA2γ is localized at the endoplasmic reticulum (ER), this study addressed whether the cytoprotective effect of iPLA2γ involves the ER stress unfolded protein response (UPR). In cultured rat GECs, overexpression of the full-length iPLA2γ, but not a mutant iPLA2γ that fails to associate with the ER, augmented tunicamycin-induced activation of activating transcription factor-6 (ATF6) and induction of the ER chaperones, glucose-regulated protein 94 (GRP94) and glucose-regulated protein 78 (GRP78). Augmented responses were inhibited by the iPLA2γ inhibitor, (R)-bromoenol lactone, but not by the cyclooxygenase inhibitor, indomethacin. Tunicamycin-induced cytotoxicity was reduced in GECs expressing iPLA2γ, and the cytoprotection was reversed by dominant-negative ATF6. GECs from iPLA2γ knock-out mice showed blunted ATF6 activation and chaperone up-regulation in response to tunicamycin. Unlike ATF6, the two other UPR pathways, i.e. inositol-requiring enzyme 1α and protein kinase RNA-like ER kinase pathways, were not affected by iPLA2γ. Thus, in GECs, iPLA2γ amplified activation of the ATF6 pathway of the UPR, resulting in up-regulation of ER chaperones and cytoprotection. These effects were dependent on iPLA2γ catalytic activity and association with the ER but not on prostanoids. Modulating iPLA2γ activity may provide opportunities for pharmacological intervention in glomerular diseases associated with ER stress. PMID:25492867

  2. Transcriptional Activity of Erythroid Kruppel-like Factor (EKLF/KLF1) Modulated by PIAS3 (Protein Inhibitor of Activated STAT3)*

    PubMed Central

    Siatecka, Miroslawa; Soni, Shefali; Planutis, Antanas; Bieker, James J.

    2015-01-01

    Erythroid Kruppel-like factor (EKLF or KLF1) is a transcription factor crucial for red cell development that is directly involved in regulation of a large number of erythroid genes. EKLF serves mostly as an activator of expression of these genes; however, it can act also as a repressor. Here, we present evidence that EKLF interacts with proteins from the PIAS (protein inhibitor of activated STAT) family that convey repressive activity to EKLF in the absence of sumoylation. Our studies identify PIAS3 as a transcriptional corepressor of EKLF for at least a subset of its target genes during erythropoiesis (e.g. β-globin, α-hemoglobin stabilizing protein). We demonstrate an interaction between EKLF and PIAS proteins confirmed by in vivo coimmunoprecipitation assays with both exogenous and endogenous proteins. We identified an LXXLL signature motif located near the N terminus of PIAS proteins that, although not involved in the EKLF-PIAS3 interaction, is required for the transrepression activity. Knockdown of endogenous PIAS3 accelerates differentiation of both murine erythroleukemia cells, as well as fetal liver cells, whereas an increase in PIAS3 levels inhibits this increase. Using chromatin immunoprecipitation assays, we show that PIAS3 preferentially occupies the β-globin promoter in undifferentiated murine erythroleukemia cells. Together these results demonstrate that an interaction between EKLF and PIAS3 provides a novel mode of regulation of EKLF activity in the absence of sumolylation and furthermore shows an important involvement of PIAS proteins in erythropoiesis. PMID:25713074

  3. Enhanced Oxidative Stress Resistance through Activation of a Zinc Deficiency Transcription Factor in Brachypodium distachyon1[W][OPEN

    PubMed Central

    Glover-Cutter, Kira M.; Alderman, Stephen; Dombrowski, James E.; Martin, Ruth C.

    2014-01-01

    Identification of viable strategies to increase stress resistance of crops will become increasingly important for the goal of global food security as our population increases and our climate changes. Considering that resistance to oxidative stress is oftentimes an indicator of health and longevity in animal systems, characterizing conserved pathways known to increase oxidative stress resistance could prove fruitful for crop improvement strategies. This report argues for the usefulness and practicality of the model organism Brachypodium distachyon for identifying and validating stress resistance factors. Specifically, we focus on a zinc deficiency B. distachyon basic leucine zipper transcription factor, BdbZIP10, and its role in oxidative stress in the model organism B. distachyon. When overexpressed, BdbZIP10 protects plants and callus tissue from oxidative stress insults, most likely through distinct and direct activation of protective oxidative stress genes. Increased oxidative stress resistance and cell viability through the overexpression of BdbZIP10 highlight the utility of investigating conserved stress responses between plant and animal systems. PMID:25228396

  4. Tumor suppressor p53 inhibits transcriptional activation of invasion gene thromboxane synthase mediated by the proto-oncogenic factor ets-1.

    PubMed

    Kim, Ella; Günther, Willy; Yoshizato, Kimio; Meissner, Hildegard; Zapf, Srenja; Nüsing, Rolf M; Yamamoto, Hirotaka; Van Meir, Erwin G; Deppert, Wolfgang; Giese, Alf

    2003-10-30

    Cancer formation and progression is a complex process determined by several mechanisms that promote cell growth, invasiveness, neo-angiogenesis, and render neoplastic cells resistant to apoptosis. The tumor suppressor p53 and the proto-oncogenic factor ets-1 are important regulators of such mechanisms. While it is well established that p53 and ets-1 influence various aspects of cell behavior by regulating the transcription of specific genes, little is known about the functional relationship between these transcription factors. We found that the gene encoding thromboxane synthase (TXSA), which we recently identified as a factor promoting invasion and resistance to apoptosis in gliomas, is a novel target gene for both p53 and ets-1. We demonstrate that p53 and ets-1 coregulate TXSA in an antagonistic and inter-related manner, with ets-1 being a potent transcriptional activator and p53 inhibiting ets-1-dependent transcription. Negative interference with ets-1 transcription requires functional p53 and is lost in mutant p53 proteins. We show that ets-1 and p53 associate physically in vitro and in vivo and that their interaction, rather than a direct binding of p53 to the TXSA promoter, is required for transcriptional repression of TXSA by wild-type p53. An important implication of our findings is that the loss of p53-mediated negative control over ets-1-dependent transcription may lead to the acquisition of an invasive phenotype in tumor cells. PMID:14586398

  5. Testosterone activates mitogen-activated protein kinase and the cAMP response element binding protein transcription factor in Sertoli cells

    PubMed Central

    Fix, Charity; Jordan, Cynthia; Cano, Patricia; Walker, William H.

    2004-01-01

    The androgen testosterone is essential for the Sertoli cell to support the maturation of male germ cells and the production of spermatozoa (spermatogenesis). In the classical view of androgen action, binding of androgen to the intracellular androgen receptor (AR) produces a conformational change in AR such that the receptor–steroid complex has high affinity for specific DNA regulatory elements and is able to stimulate gene transcription. Here, we demonstrate that testosterone can act by means of an alternative, rapid, and sustainable mechanism in Sertoli cells that is independent of AR–DNA interactions. Specifically, the addition of physiological levels of testosterone to Sertoli cells stimulates the mitogen-activated protein kinase signaling pathway and causes phosphorylation of the cAMP response element binding protein transcription factor on serine 133, a modification known to be required for Sertoli cells to support spermatogenesis. Androgen-mediated activation of mitogen-activated protein kinase and cAMP response element binding protein occurs within 1 min, extends for at least 12 h and requires AR. Furthermore, androgen induces endogenous cAMP response element binding protein-mediated transcription in Sertoli cells. These newly identified mechanisms of androgen action in Sertoli cells suggest new targets for developing male contraceptive agents. PMID:15263086

  6. Lipid metabolism enzyme 5-LOX and its metabolite LTB4 are capable of activating transcription factor NF-{kappa}B in hepatoma cells

    SciTech Connect

    Zhao, Yu; Wang, Wenhui; Wang, Qi; Zhang, Xiaodong; Ye, Lihong

    2012-02-24

    Highlights: Black-Right-Pointing-Pointer 5-LOX is able to upregulate expression of NF-{kappa}B p65. Black-Right-Pointing-Pointer 5-LOX enhances nuclear translocation of NF-{kappa}B p65 via increasing p-I{kappa}B-{alpha} level. Black-Right-Pointing-Pointer 5-LOX stimulates transcriptional activity of NF-{kappa}B in hepatoma cells. Black-Right-Pointing-Pointer LTB4 activates transcriptional activity of NF-{kappa}B in hepatoma cells. -- Abstract: The issue that lipid metabolism enzyme and its metabolites regulate transcription factors in cancer cell is not fully understood. In this study, we first report that the lipid metabolism enzyme 5-Lipoxygenase (5-LOX) and its metabolite leukotriene B4 (LTB4) are capable of activating nuclear factor-{kappa}B (NF-{kappa}B) in hepatoma cells. We found that the treatment of MK886 (an inhibitor of 5-LOX) or knockdown of 5-LOX was able to downregulate the expression of NF-{kappa}B p65 at the mRNA level and decreased the phosphorylation level of inhibitor {kappa}B{alpha} (I{kappa}B{alpha}) in the cytoplasm of hepatoma HepG2 or H7402 cells, which resulted in the decrease of the level of nuclear NF-{kappa}B p65. These were confirmed by immunofluorescence staining in HepG2 cell. Moreover, the above treatments were able to decrease the transcriptional activity of NF-{kappa}B in the cells. The LTB4, one of metabolites of 5-LOX, is responsible for 5-LOX-activated NF-{kappa}B in a dose-dependent manner. Thus, we conclude that the lipid metabolism enzyme 5-LOX and its metabolite LTB4 are capable of activating transcription factor NF-{kappa}B in hepatoma cells. Our finding provides new insight into the significance of lipid metabolism in activation of transcription factors in cancer.

  7. Targeting Transcription Factors in Cancer

    PubMed Central

    Bhagwat, Anand S.; Vakoc, Christopher R.

    2015-01-01

    Transcription factors (TFs) are commonly deregulated in the pathogenesis of human cancer and are a major class of cancer cell dependencies. Consequently, targeting of TFs can be highly effective in treating particular malignancies, as highlighted by the clinical efficacy of agents that target nuclear hormone receptors. In this review we discuss recent advances in our understanding of TFs as drug targets in oncology, with an emphasis on the emerging chemical approaches to modulate TF function. The remarkable diversity and potency of TFs as drivers of cell transformation justifies a continued pursuit of TFs as therapeutic targets for drug discovery. PMID:26645049

  8. E sub 1 BF is an essential RNA polymerase I transcription factor with an intrinsic protein kinase activity that can modulate rRNA gene transcription

    SciTech Connect

    Ji Zhang; Huifeng Niu; Jacob, S.T. )

    1991-10-01

    The authors previously described the purification and characterization of E{sub 1}BF, a rat rRNA gene core promoter-binding factor that consists of two polypeptides of 89 and 79 kDa. When this factor was incubated in the absence of any exogenous protein kinase under conditions optimal for protein phosphorylation, the 79-kDa polypeptide of E{sub 1}BF was selectively phosphorylated. The labeled phosphate could be removed from the E{sub 1}BF polypeptide by treatment with calf intestinal alkaline phosphatase or potato acid phosphatase. Elution of the protein from the E{sub 1}BF-promoter complex formed in an electrophoretic mobility-shift assay followed by incubation of the concentrated eluent with ({gamma}-{sup 32}P)ATP resulted in the selective labeling o the 79-kDa band. The E{sub 1}BF-associated protein kinase did not phosphorylate casein or histone H1. These data demonstrate that (1) polymerase I promoter-binding factor E{sub 1}BF contains an intrinsic substrate-specific protein kinase and (2) E{sub 1}BF is an essential polymerase I transcription factor that can modulate rRNA gene transcription by protein phosphorylation. Further, these studies have provided a direct means to identify a protein kinase or any other enzyme that can interact with a specific DNA sequence.

  9. Transcription factor ZBED6 mediates IGF2 gene expression by regulating promoter activity and DNA methylation in myoblasts

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Zinc finger, BED-type containing 6 (ZBED6) is an important transcription factor in placental mammals, affecting development, cell proliferation and growth. In this study, we found that the expression of the ZBED6 and IGF2 were up regulated during C2C12 differentiation. The IGF2 expression levels wer...

  10. The transcription factor GATA3 actively represses RUNX3 protein-regulated production of interferon-gamma

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The transcription factor GATA3 is crucial for the differentiation of naive CD4+ T cells into T helper 2 (Th2) cells. Here, we show that deletion of Gata3 allowed the appearance of interferon-g (IFN-g)-producing cells in the absence of interleukin-12 (IL-12) and IFN-g. Such IFN-g production was tra...

  11. Transcription factor AP-1 in esophageal squamous cell carcinoma: Alterations in activity and expression during Human Papillomavirus infection

    PubMed Central

    2009-01-01

    Background Esophageal squamous cell carcinoma (ESCC) is a leading cause of cancer-related deaths in Jammu and Kashmir (J&K) region of India. A substantial proportion of esophageal carcinoma is associated with infection of high-risk HPV type 16 and HPV18, the oncogenic expression of which is controlled by host cell transcription factor Activator Protein-1 (AP-1). We, therefore, have investigated the role of DNA binding and expression pattern of AP-1 in esophageal cancer with or without HPV infection. Methods Seventy five histopathologically-confirmed esophageal cancer and an equal number of corresponding adjacent normal tissue biopsies from Kashmir were analyzed for HPV infection, DNA binding activity and expression of AP-1 family of proteins by PCR, gel shift assay and immunoblotting respectively. Results A high DNA binding activity and elevated expression of AP-1 proteins were observed in esophageal cancer, which differed between HPV positive (19%) and HPV negative (81%) carcinomas. While JunB, c-Fos and Fra-1 were the major contributors to AP-1 binding activity in HPV negative cases, Fra-1 was completely absent in HPV16 positive cancers. Comparison of AP-1 family proteins demonstrated high expression of JunD and c-Fos in HPV positive tumors, but interestingly, Fra-1 expression was extremely low or nil in these tumor tissues. Conclusion Differential AP-1 binding activity and expression of its specific proteins between HPV - positive and HPV - negative cases indicate that AP-1 may play an important role during HPV-induced esophageal carcinogenesis. PMID:19758438

  12. Heat Stress- and Heat Shock Transcription Factor-Dependent Expression and Activity of Ascorbate Peroxidase in Arabidopsis1

    PubMed Central

    Panchuk, Irina I.; Volkov, Roman A.; Schöffl, Friedrich

    2002-01-01

    To find evidence for a connection between heat stress response, oxidative stress, and common stress tolerance, we studied the effects of elevated growth temperatures and heat stress on the activity and expression of ascorbate peroxidase (APX). We compared wild-type Arabidopsis with transgenic plants overexpressing heat shock transcription factor 3 (HSF3), which synthesize heat shock proteins and are improved in basal thermotolerance. Following heat stress, APX activity was positively affected in transgenic plants and correlated with a new thermostable isoform, APXS. This enzyme was present in addition to thermolabile cytosolic APX1, the prevalent isoform in unstressed cells. In HSF3-transgenic plants, APXS activity was detectable at normal temperature and persisted after severe heat stress at 44°C. In nontransgenic plants, APXS was undetectable at normal temperature, but could be induced by moderate heat stress. The mRNA expression profiles of known and three new Apx genes were determined using real-time PCR. Apx1 and Apx2 genes encoding cytosolic APX were heat stress and HSF dependently expressed, but only the representations of Apx2 mRNA met the criteria that suggest identity between APXS and APX2: not expressed at normal temperature in wild type, strong induction by heat stress, and HSF3-dependent expression in transgenic plants. Our data suggest that Apx2 is a novel heat shock gene and that the enzymatic activity of APX2/APXS is required to compensate heat stress-dependent decline of APX1 activity in the cytosol. The functional roles of modulations of APX expression and the interdependence of heat stress and oxidative stress response and signaling mechanisms are discussed. PMID:12068123

  13. FGF coordinates air sac development by activation of the EGF ligand Vein through the transcription factor PntP2

    PubMed Central

    Cruz, Josefa; Bota-Rabassedas, Neus; Franch-Marro, Xavier

    2015-01-01

    How several signaling pathways are coordinated to generate complex organs through regulation of tissue growth and patterning is a fundamental question in developmental biology. The larval trachea of Drosophila is composed of differentiated functional cells and groups of imaginal tracheoblasts that build the adult trachea during metamorphosis. Air sac primordium cells (ASP) are tracheal imaginal cells that form the dorsal air sacs that supply oxygen to the flight muscles of the Drosophila adult. The ASP emerges from the tracheal branch that connects to the wing disc by the activation of both Bnl-FGF/Btl and EGFR signaling pathways. Together, these pathways promote cell migration and proliferation. In this study we demonstrate that Vein (vn) is the EGF ligand responsible for the activation of the EGFR pathway in the ASP. We also find that the Bnl-FGF/Btl pathway regulates the expression of vn through the transcription factor PointedP2 (PntP2). Furthermore, we show that the FGF target gene escargot (esg) attenuates EGFR signaling at the tip cells of the developing ASP, reducing their mitotic rate to allow proper migration. Altogether, our results reveal a link between Bnl-FGF/Btl and EGFR signaling and provide novel insight into how the crosstalk of these pathways regulates migration and growth. PMID:26632449

  14. Arabidopsis IRE1 catalyses unconventional splicing of bZIP60 mRNA to produce the active transcription factor

    PubMed Central

    Nagashima, Yukihiro; Mishiba, Kei-ichiro; Suzuki, Eiji; Shimada, Yukihisa; Iwata, Yuji; Koizumi, Nozomu

    2011-01-01

    IRE1 plays an essential role in the endoplasmic reticulum (ER) stress response in yeast and mammals. We found that a double mutant of Arabidopsis IRE1A and IRE1B (ire1a/ire1b) is more sensitive to the ER stress inducer tunicamycin than the wild-type. Transcriptome analysis revealed that genes whose induction was reduced in ire1a/ire1b largely overlapped those in the bzip60 mutant. We observed that the active form of bZIP60 protein detected in the wild-type was missing in ire1a/ire1b. We further demonstrated that bZIP60 mRNA is spliced by ER stress, removing 23 ribonucleotides and therefore causing a frameshift that replaces the C-terminal region of bZIP60 including the transmembrane domain (TMD) with a shorter region without a TMD. This splicing was detected in ire1a and ire1b single mutants, but not in the ire1a/ire1b double mutant. We conclude that IRE1A and IRE1B catalyse unconventional splicing of bZIP60 mRNA to produce the active transcription factor. PMID:22355548

  15. Impact of Short-Term Systemic Hypoxia on Phagocytosis, Cytokine Production, and Transcription Factor Activation in Peripheral Blood Cells

    PubMed Central

    Fritzenwanger, Michael; Jung, Christian; Goebel, Bjoern; Lauten, Alexander; Figulla, Hans R.

    2011-01-01

    Hypoxia frequently associated with certain physiologic and pathologic conditions influences numerous cellular functions. Because the effects of short-term hypoxia are incompletely understood, we examined phagocytosis and cytokine production as well as the activation of the transcription factors HIF-1 and NFκB in peripheral blood cells of healthy volunteers exposed to an oxygen concentration equivalent to that found at a height of 5500 m. Furthermore, we analysed plasma HIF-1 and serum concentrations of various HIF-1-dependent genes. Results showed that short-term hypoxia increased phagocytosis in neutrophils without affecting monocyte phagocytosis. Hypoxia decreased basal TNFα concentration in monocytes and basal interferon γ concentration in CD4+ T lymphocytes. In contrast, plasma HIF and serum VEGF concentrations were not affected by hypoxia, although serum EPO concentration was raised. In PBMC, hypoxia increased cytosolic HIF-1 concentration without affecting nuclear HIF-1 concentration and led to a rise in the nuclear NFκB in PBMC. Our results show that short-term hypoxia affects immune functions in healthy individuals. Furthermore, we speculate that the effects of hypoxia are not due to HIF-1, but are caused by the activation of NFκB . PMID:21765619

  16. FGF coordinates air sac development by activation of the EGF ligand Vein through the transcription factor PntP2.

    PubMed

    Cruz, Josefa; Bota-Rabassedas, Neus; Franch-Marro, Xavier

    2015-01-01

    How several signaling pathways are coordinated to generate complex organs through regulation of tissue growth and patterning is a fundamental question in developmental biology. The larval trachea of Drosophila is composed of differentiated functional cells and groups of imaginal tracheoblasts that build the adult trachea during metamorphosis. Air sac primordium cells (ASP) are tracheal imaginal cells that form the dorsal air sacs that supply oxygen to the flight muscles of the Drosophila adult. The ASP emerges from the tracheal branch that connects to the wing disc by the activation of both Bnl-FGF/Btl and EGFR signaling pathways. Together, these pathways promote cell migration and proliferation. In this study we demonstrate that Vein (vn) is the EGF ligand responsible for the activation of the EGFR pathway in the ASP. We also find that the Bnl-FGF/Btl pathway regulates the expression of vn through the transcription factor PointedP2 (PntP2). Furthermore, we show that the FGF target gene escargot (esg) attenuates EGFR signaling at the tip cells of the developing ASP, reducing their mitotic rate to allow proper migration. Altogether, our results reveal a link between Bnl-FGF/Btl and EGFR signaling and provide novel insight into how the crosstalk of these pathways regulates migration and growth. PMID:26632449

  17. Regulation of the Interferon regulatory factor-8 (IRF-8) Tumor Suppressor Gene by the Signal Transducer and Activator of Transcription 5 (STAT5) Transcription Factor in Chronic Myeloid Leukemia*

    PubMed Central

    Waight, Jeremy D.; Banik, Debarati; Griffiths, Elizabeth A.; Nemeth, Michael J.; Abrams, Scott I.

    2014-01-01

    Tyrosine kinase inhibitors such as imatinib can effectively target the BCR-ABL oncoprotein in a majority of patients with chronic myeloid leukemia (CML). Unfortunately, some patients are resistant primarily to imatinib and others develop drug resistance, prompting interest in the discovery of new drug targets. Although much of this resistance can be explained by the presence of mutations within the tyrosine kinase domain of BCR-ABL, such mutations are not universally identified. Interferon regulatory factor-8 (IRF-8) is a transcription factor that is essential for myelopoiesis. Depressed IRF-8 levels are observed in a majority of CML patients and Irf-8−/− mice exhibit a CML-like disease. The underlying mechanisms of IRF-8 loss in CML are unknown. We hypothesized that BCR-ABL suppresses transcription of IRF-8 through STAT5, a proximal BCR-ABL target. Treatment of primary cells from newly diagnosed CML patients in chronic phase as well as BCR-ABL+ cell lines with imatinib increased IRF-8 transcription. Furthermore, IRF-8 expression in cell line models was necessary for imatinib-induced antitumor responses. We have demonstrated that IRF-8 is a direct target of STAT5 and that silencing of STAT5 induced IRF-8 expression. Conversely, activating STAT5 suppressed IRF-8 transcription. Finally, we showed that STAT5 blockade using a recently discovered antagonist increased IRF-8 expression in patient samples. These data reveal a previously unrecognized BCR-ABL-STAT5-IRF-8 network, which widens the repertoire of potentially new anti-CML targets. PMID:24753251

  18. Effects of Cigarette Smoke on the Activation of Oxidative Stress-Related Transcription Factors in Female A/J Mouse Lung

    PubMed Central

    Tharappel, Job C.; Cholewa, Jill; Espandiari, Parvaneh; Spear, Brett T.; Gairola, C. Gary; Glauert, Howard P.

    2010-01-01

    Cigarette smoke contains a high concentration of free radicals and induces oxidative stress in the lung and other tissues. Several transcription factors are known to be activated by oxidative stress, including nuclear factor-κB (NF-κB), activator protein-1 (AP-1), and hypoxia-inducible factor (HIF). Studies were therefore undertaken to examine if cigarette smoke could activate these transcription factors, as well as other transcription factors that may be important in lung carcinogenesis. Female A/J mice were exposed to cigarette smoke for 2, 5, 10, 15, 20, 42, or 56 days (6 hr/day, 5 days/wk). Cigarette smoke did not increase NF-κB activation at any of these times, but NF-κB DNA binding activity was lower after 15 days and 56 days of smoke exposure. The DNA binding activity of AP-1 was lower after 10 days and 56 days but was not changed after 42 days of smoke exposure. The DNA binding activity of HIF was quantitatively increased after 42 days of smoke exposure but decreased after 56 days. Whether the activation of other transcription factors in the lung could be altered after exposure to cigarette smoke was subsequently examined. The DNA binding activities of FoxF2, myc-CF1, RORE, and p53 were examined after 10 days of smoke exposure. The DNA binding activities of FoxF2 and p53 were quantitatively increased, but those of myc-CF1 and RORE were unaffected. These studies show that cigarette smoke exposure leads to quantitative increases in DNA binding activities of FoxF2 and p53, while the activations of NF-κB, AP-1, and HIF are largely unaffected or reduced. PMID:20711931

  19. Structural basis of transcription activation.

    PubMed

    Feng, Yu; Zhang, Yu; Ebright, Richard H

    2016-06-10

    Class II transcription activators function by binding to a DNA site overlapping a core promoter and stimulating isomerization of an initial RNA polymerase (RNAP)-promoter closed complex into a catalytically competent RNAP-promoter open complex. Here, we report a 4.4 angstrom crystal structure of an intact bacterial class II transcription activation complex. The structure comprises Thermus thermophilus transcription activator protein TTHB099 (TAP) [homolog of Escherichia coli catabolite activator protein (CAP)], T. thermophilus RNAP σ(A) holoenzyme, a class II TAP-dependent promoter, and a ribotetranucleotide primer. The structure reveals the interactions between RNAP holoenzyme and DNA responsible for transcription initiation and reveals the interactions between TAP and RNAP holoenzyme responsible for transcription activation. The structure indicates that TAP stimulates isomerization through simple, adhesive, stabilizing protein-protein interactions with RNAP holoenzyme. PMID:27284196

  20. Tumour necrosis factor-alpha and interferon-gamma synergistically activate the RANTES promoter through nuclear factor kappaB and interferon regulatory factor 1 (IRF-1) transcription factors.

    PubMed

    Lee, A H; Hong, J H; Seo, Y S

    2000-08-15

    Inflammatory cytokines such as tumour necrosis factor-alpha (TNF-alpha) and interferon-gamma (IFN-gamma) synergistically activate expression of the RANTES (regulated upon activation, normal T-cell expressed and secreted) gene, which plays a crucial role in the chemoattraction of leukocytes during the inflammatory response. To understand at the molecular level the mechanism by which the two cytokines activate RANTES gene expression, we determined the requirement of cis-acting elements in the RANTES promoter and trans-acting factors. The murine RANTES promoter contained one putative interferon regulatory factor, IRF, and three putative nuclear factor kappaB (NF-kappaB) binding sites. Specific destruction of the IRF binding site and one of the three NF-kappaB binding sites abolished the inducibility of promoter activity by IFN-gamma and TNF-alpha, respectively. In contrast, mutation of the other two putative NF-kappaB binding sites did not affect RANTES promoter activity significantly. In addition, the RANTES promoter was stimulated by co-transfection of plasmids that expressed either p65, an NF-kappaB family protein, or the IRF-1 transcription factor. RANTES promoters with mutations in the NF-kappaB or IRF binding sites were not stimulated by p65 or IRF-1 expression, respectively. In electrophoretic mobility-shift and immunologic assays, we showed that IRF-1 was induced after cells were treated with IFN-gamma and that NF-kappaB was activated by TNF-alpha treatment. These results demonstrate that both NF-kappaB and IRF-1 transcription factors mediate the induction of RANTES expression via their cognate cis-acting elements when cells are stimulated by TNF-alpha and IFN-gamma. PMID:10926836

  1. Distinct roles of activating transcription factor 6 (ATF6) and double-stranded RNA-activated protein kinase-like endoplasmic reticulum kinase (PERK) in transcription during the mammalian unfolded protein response.

    PubMed Central

    Okada, Tetsuya; Yoshida, Hiderou; Akazawa, Rieko; Negishi, Manabu; Mori, Kazutoshi

    2002-01-01

    In response to accumulation of unfolded proteins in the endoplasmic reticulum (ER), a homoeostatic response, termed the unfolded protein response (UPR), is activated in all eukaryotic cells. The UPR involves only transcriptional regulation in yeast, and approx. 6% of all yeast genes, encoding not only proteins to augment the folding capacity in the ER, but also proteins working at various stages of secretion, are induced by ER stress [Travers, Patil, Wodicka, Lockhart, Weissman and Walter (2000) Cell (Cambridge, Mass.) 101, 249-258]. In the present study, we conducted microarray analysis of HeLa cells, although our analysis covered only a small fraction of the human genome. A great majority of human ER stress-inducible genes (approx. 1% of 1800 genes examined) were classified into two groups. One group consisted of genes encoding ER-resident molecular chaperones and folding enzymes, and these genes were directly regulated by the ER-membrane-bound transcription factor activating transcription factor (ATF) 6. The ER-membrane-bound protein kinase double-stranded RNA-activated protein kinase-like ER kinase (PERK)-mediated signalling pathway appeared to be responsible for induction of the remaining genes, which are not involved in secretion, but may be important after cellular recovery from ER stress. In higher eukaryotes, the PERK-mediated translational-attenuation system is known to operate in concert with the transcriptional-induction system. Thus we propose that mammalian cells have evolved a strategy to cope with ER stress different from that of yeast cells. PMID:12014989

  2. Selective activation of the transcription factor ATF6 mediates endoplasmic reticulum proliferation triggered by a membrane protein.

    PubMed

    Maiuolo, Jessica; Bulotta, Stefania; Verderio, Claudia; Benfante, Roberta; Borgese, Nica

    2011-05-10

    It is well known that the endoplasmic reticulum (ER) is capable of expanding its surface area in response both to cargo load and to increased expression of resident membrane proteins. Although the response to increased cargo load, known as the unfolded protein response (UPR), is well characterized, the mechanism of the response to membrane protein load has been unclear. As a model system to investigate this phenomenon, we have used a HeLa-TetOff cell line inducibly expressing a tail-anchored construct consisting of an N-terminal cytosolic GFP moiety anchored to the ER membrane by the tail of cytochrome b5 [GFP-b(5)tail]. After removal of doxycycline, GFP-b(5)tail is expressed at moderate levels (1-2% of total ER protein) that, nevertheless, induce ER proliferation, as assessed both by EM and by a three- to fourfold increase in phosphatidylcholine synthesis. We investigated possible participation of each of the three arms of the UPR and found that only the activating transcription factor 6 (ATF6) arm was selectively activated after induction of GFP-b(5)tail expression; peak ATF6α activation preceded the increase in phosphatidylcholine synthesis. Surprisingly, up-regulation of known ATF6 target genes was not observed under these conditions. Silencing of ATF6α abolished the ER proliferation response, whereas knockdown of Ire1 was without effect. Because GFP-b(5)tail lacks a luminal domain, the response we observe is unlikely to originate from the ER lumen. Instead, we propose that a sensing mechanism operates within the lipid bilayer to trigger the selective activation of ATF6. PMID:21521793

  3. Rac1/p21-activated kinase pathway controls retinoblastoma protein phosphorylation and E2F transcription factor activation in B lymphocytes.

    PubMed

    Zaldua, Natalia; Llavero, Francisco; Artaso, Alain; Gálvez, Patricia; Lacerda, Hadriano M; Parada, Luis A; Zugaza, José L

    2016-02-01

    Small GTPases of the Ras superfamily are capable of activating E2F-dependent transcription leading to cell proliferation, but the molecular mechanisms are poorly understood. In this study, using immortalized chicken DT40 B cell lines to investigate the role of the Vav/Rac signalling cascade on B cell proliferation, it is shown that the proliferative response triggered by B cell receptor activation is dramatically reduced in the absence of Vav3 expression. Analysis of this proliferative defect shows that in the absence of Vav3 expression, retinoblastoma protein (RB) phosphorylation and the subsequent E2F activation do not take place. By combining pharmacological and genetic approaches, phosphatidylinositol-3-kinase and phospholipase Cγ2 (PLCγ2) were identified as the key regulatory signalling molecules upstream of the Vav3/Rac pathway leading to RB phosphorylation and E2F transcription factor activation. Additionally, vav3(-/-) and plcγ2(-/-) DT40 B cells were not able to activate the RB-E2F complex wild-type phenotype when these genetically modified cells were transfected with constitutively active forms of RhoA or Cdc42. However, when these knockout cells were transfected with different constitutively active versions of PLCγ, Vav or Rac1, not only activation of the RB-E2F complex wild-type phenotype was recovered but also the cellular proliferation. Furthermore, by evaluating the effect of two known effector mutants of Rac1 (Rac1(Q61L/F37A) and Rac1(Q61L/Y40C) ), the RB-E2F complex activation dependency on p21-activated kinase (PAK) and protein kinase Cε (PKCε) activities was established, being independent of both actin cytoskeleton reorganization and Ras activity. These results suggest that PAK1 and PKCε may be potential therapeutic targets to stop uncontrolled B cell proliferation mediated by the Vav/Rac pathway. PMID:26663827

  4. Chronic Hypoxia-Inducible Transcription Factor-2 Activation Stably Transforms Juxtaglomerular Renin Cells into Fibroblast-Like Cells In Vivo

    PubMed Central

    Gerl, Katharina; Karger, Christian; Schwarzensteiner, Ilona; Kurtz, Armin

    2015-01-01

    On the basis of previous observations that deletion of the von Hippel–Lindau protein (pVHL) in juxtaglomerular (JG) cells of the kidney suppresses renin and induces erythropoietin expression, this study aimed to characterize the events underlying this striking change of hormone expression. We found that renin cell-specific deletion of pVHL in mice leads to a phenotype switch in JG cells, from a cuboid and multiple vesicle-containing form into a flat and elongated form without vesicles. This shift of cell phenotype was accompanied by the disappearance of marker proteins for renin cells (e.g., aldo-keto reductase family 1, member 7 and connexin 40) and by the appearance of markers of fibroblast-like cells (e.g., collagen I, ecto-5′-nucleotidase, and PDGF receptor-β). Furthermore, hypoxia-inducible transcription factor-2α (HIF-2α) protein constitutively accumulated in these transformed cells. Codeletion of pVHL and HIF-2α in JG cells completely prevented the phenotypic changes. Similar to renin expression in normal JG cells, angiotensin II negatively regulated erythropoietin expression in the transformed cells. In summary, chronic activation of HIF-2 in renal JG cells leads to a reprogramming of the cells into fibroblast-like cells resembling native erythropoietin-producing cells located in the tubulointerstitium. PMID:25071089

  5. Transcription factor (TF)-like nuclear regulator, the 250-kDa form of Homo sapiens TFIIIB", is an essential component of human TFIIIC1 activity.

    PubMed

    Weser, Stephan; Gruber, Christin; Hafner, Heike M; Teichmann, Martin; Roeder, Robert G; Seifart, Klaus H; Meissner, Wolfgang

    2004-06-25

    The general human RNA polymerase III transcription factor (TF) IIIC1 has hitherto been ill defined with respect to the polypeptides required for reconstitution of its activity. Here we identify Homo sapiens TFIIIB" (HsBdp1) as an essential component of hTFIIIC1 and hTFIIIC1-like activities. Several forms of HsBdp1 are described. The 250-kDa form of HsBdp1, also designated the "transcription factor-like nuclear regulator," strictly co-eluted with TFIIIC1 activity over multiple chromatographic purification steps as revealed by Western blot with anti-HsBdp1 antibodies and by MALDI-TOF analysis. In addition, TFIIIC1 activity could be depleted from partially purified fractions with anti-HsBdp1 antibodies but not with control antibodies. Moreover, highly purified recombinant HsBdp1 could replace TFIIIC1 activity in reconstituted transcription of the VAI gene in vitro. Furthermore, smaller proteins of approximately 90-150 kDa that were recognized by anti-HsBdp1 antibodies co-eluted with TFIIIC1-like activity. Finally, cytoplasmic extracts from differentiated mouse F9 fibroblast cells that lacked TFIIIC1 activity could be made competent for transcription of the VA1 gene by the addition of TFIIIC1, TFIIIC1-like, or recombinant HsBdp1. These results suggest that HsBdp1 proteins represent essential components of TFIIIC1 and TFIIIC1-like activities. PMID:15096501

  6. Elevated SP-1 transcription factor expression and activity drives basal and hypoxia-induced vascular endothelial growth factor (VEGF) expression in non-small cell lung cancer.

    PubMed

    Deacon, Karl; Onion, David; Kumari, Rajendra; Watson, Susan A; Knox, Alan J

    2012-11-16

    VEGF plays a central role in angiogenesis in cancer. Non-small cell lung cancer (NSCLC) tumors have increased microvascular density, localized hypoxia, and high VEGF expression levels; however, there is a lack of understanding of how oncogenic and tumor microenvironment changes such as hypoxia lead to greater VEGF expression in lung and other cancers. We show that NSCLC cells secreted higher levels of VEGF than normal airway epithelial cells. Actinomycin D inhibited all NSCLC VEGF secretion, and VEGF minimal promoter-luciferase reporter constructs were constitutively active until the last 85 base pairs before the transcription start site containing three SP-1 transcription factor-binding sites; mutation of these VEGF promoter SP-1-binding sites eliminated VEGF promoter activity. Furthermore, dominant negative SP-1, mithramycin A, and SP-1 shRNA decreased VEGF promoter activity, whereas overexpression of SP-1 increased VEGF promoter activity. Chromatin immunoprecipitation assays demonstrated SP-1, p300, and PCA/F histone acetyltransferase binding and histone H4 hyperacetylation at the VEGF promoter in NSCLC cells. Cultured NSCLC cells expressed higher levels of SP-1 protein than normal airway epithelial cells, and double-fluorescence immunohistochemistry showed a strong correlation between SP-1 and VEGF in human NSCLC tumors. In addition, hypoxia-driven VEGF expression in NSCLC cells was SP-1-dependent, with hypoxia increasing SP-1 activity and binding to the VEGF promoter. These studies are the first to demonstrate that overexpression of SP-1 plays a central role in hypoxia-induced VEGF secretion. PMID:22992725

  7. β-Catenin-Independent Activation of TCF1/LEF1 in Human Hematopoietic Tumor Cells through Interaction with ATF2 Transcription Factors

    PubMed Central

    Grumolato, Luca; Liu, Guizhong; Haremaki, Tomomi; Mungamuri, Sathish Kumar; Mong, Phyllus; Akiri, Gal; Lopez-Bergami, Pablo; Arita, Adriana; Anouar, Youssef; Mlodzik, Marek; Ronai, Ze'ev A.; Brody, Joshua; Weinstein, Daniel C.; Aaronson, Stuart A.

    2013-01-01

    The role of Wnt signaling in embryonic development and stem cell maintenance is well established and aberrations leading to the constitutive up-regulation of this pathway are frequent in several types of human cancers. Upon ligand-mediated activation, Wnt receptors promote the stabilization of β-catenin, which translocates to the nucleus and binds to the T-cell factor/lymphoid enhancer factor (TCF/LEF) family of transcription factors to regulate the expression of Wnt target genes. When not bound to β-catenin, the TCF/LEF proteins are believed to act as transcriptional repressors. Using a specific lentiviral reporter, we identified hematopoietic tumor cells displaying constitutive TCF/LEF transcriptional activation in the absence of β-catenin stabilization. Suppression of TCF/LEF activity in these cells mediated by an inducible dominant-negative TCF4 (DN-TCF4) inhibited both cell growth and the expression of Wnt target genes. Further, expression of TCF1 and LEF1, but not TCF4, stimulated TCF/LEF reporter activity in certain human cell lines independently of β-catenin. By a complementary approach in vivo, TCF1 mutants, which lacked the ability to bind to β-catenin, induced Xenopus embryo axis duplication, a hallmark of Wnt activation, and the expression of the Wnt target gene Xnr3. Through generation of different TCF1-TCF4 fusion proteins, we identified three distinct TCF1 domains that participate in the β-catenin-independent activity of this transcription factor. TCF1 and LEF1 physically interacted and functionally synergized with members of the activating transcription factor 2 (ATF2) family of transcription factors. Moreover, knockdown of ATF2 expression in lymphoma cells phenocopied the inhibitory effects of DN-TCF4 on the expression of target genes associated with the Wnt pathway and on cell growth. Together, our findings indicate that, through interaction with ATF2 factors, TCF1/LEF1 promote the growth of hematopoietic malignancies in the absence of

  8. The Unfolded Protein Response and the Phosphorylations of Activating Transcription Factor 2 in the trans-Activation of il23a Promoter Produced by β-Glucans*

    PubMed Central

    Rodríguez, Mario; Domingo, Esther; Alonso, Sara; Frade, Javier García; Eiros, José; Crespo, Mariano Sánchez; Fernández, Nieves

    2014-01-01

    Current views on the control of IL-23 production focus on the regulation of il23a, the gene encoding IL-23 p19, by NF-κB in combination with other transcription factors. C/EBP homologous protein (CHOP), X2-Box-binding protein 1 (XBP1), activator protein 1 (AP1), SMAD, CCAAT/enhancer-binding protein (C/EBPβ), and cAMP-response element-binding protein (CREB) have been involved in response to LPS, but no data are available regarding the mechanism triggered by the fungal mimic and β-glucan-containing stimulus zymosan, which produces IL-23 and to a low extent the related cytokine IL-12 p70. Zymosan induced the mobilization of CHOP from the nuclear fractions to phagocytic vesicles. Hypha-forming Candida also induced the nuclear disappearance of CHOP. Assay of transcription factor binding to the il23a promoter showed an increase of Thr(P)-71–Thr(P)-69-activating transcription factor 2 (ATF2) binding in response to zymosan. PKC and PKA/mitogen- and stress-activated kinase inhibitors down-regulated Thr(P)-71–ATF2 binding to the il23a promoter and il23a mRNA expression. Consistent with the current concept of complementary phosphorylations on N-terminal Thr-71 and Thr-69 of ATF2 by ERK and p38 MAPK, MEK, and p38 MAPK inhibitors blunted Thr(P)-69–ATF2 binding. Knockdown of atf2 mRNA with siRNA correlated with inhibition of il23a mRNA, but it did not affect the expression of il12/23b and il10 mRNA. These data indicate the following: (i) zymosan decreases nuclear proapoptotic CHOP, most likely by promoting its accumulation in phagocytic vesicles; (ii) zymosan-induced il23a mRNA expression is best explained through coordinated κB- and ATF2-dependent transcription; and (iii) il23a expression relies on complementary phosphorylation of ATF2 on Thr-69 and Thr-71 dependent on PKC and MAPK activities. PMID:24982422

  9. Heterogeneous nuclear ribonucleoprotein K and nucleolin as transcriptional activators of the vascular endothelial growth factor promoter through interaction with secondary DNA structures

    PubMed Central

    Uribe, Diana J.; Guo, Kexiao; Shin, Yoon-Joo; Sun, Daekyu

    2011-01-01

    The human vascular endothelial growth factor (VEGF) promoter contains a polypurine/polypyrimidine (pPu/pPy) tract that is known to play a critical role in its transcriptional regulation. This pPu/pPy tract undergoes a conformational transition between B-DNA, single stranded DNA and atypical secondary DNA structures such as G-quadruplexes and i-motifs. We studied the interaction of the cytosine-rich (C-rich) and guanine-rich (G-rich) strands of this tract with transcription factors heterogeneous nuclear ribonucleoprotein (hnRNP) K and nucleolin, respectively, both in vitro and in vivo and their potential role in the transcriptional control of VEGF. Using chromatin immunoprecipitation (ChIP) assay for our in vivo studies and electrophoretic mobility shift assay (EMSA) for our in vitro studies, we demonstrated that both nucleolin and hnRNP K bind selectively to the G- and C-rich sequences, respectively, in the pPu/pPy tract of the VEGF promoter. The small interfering RNA (siRNA)-mediated silencing of either nucleolin or hnRNP K resulted in the down-regulation of basal VEGF gene, suggesting that they act as activators of VEGF transcription. Taken together, the identification of transcription factors that can recognize and bind to atypical DNA structures within the pPu/pPy tract will provide new insight into mechanisms of transcriptional regulation of the VEGF gene. PMID:21466159

  10. DIFFERENTIAL TRANSCRIPTION FACTOR ACTIVATION AD GENE EXPRESSION PROFILES IN HUMAN VASCULAR ENDOTHELIAL CELLS ON EXPOSURE TO RESIDUAL OIL FLY ASH (ROFA) AND VANADIUM

    EPA Science Inventory


    Differential transcription factor activation and gene expression profiles in human vascular endothelial cells on exposure to residual oil fly ash (ROFA) and vanadium.
    Srikanth S. Nadadur and Daniel L. Costa, US EPA, ORD, NHEERL (ETD, Pulmonary Toxicology Branch), Research ...

  11. Protein–energy malnutrition increases activation of the transcription factor, nuclear factor κB, in the gerbil hippocampus following global ischemia☆

    PubMed Central

    Ji, Liang; Nazarali, Adil J.; Paterson, Phyllis G.

    2013-01-01

    Protein–energy malnutrition (PEM) exacerbates functional impairment caused by brain ischemia. This is correlated with reactive gliosis, which suggests an increased inflammatory response. The objective of the current study was to investigate if PEM increases hippocampal activation of nuclear factor κB (NFκB), a transcription factor that amplifies the inflammatory response involved in ischemic brain injury. Mongolian gerbils (11–12 weeks old) were randomly assigned to control diet (12.5% protein) or protein-deficient diet (2%) for 4 weeks. The 2% protein group had a 15% decrease in voluntary food intake (P<.001; unpaired t test), resulting in PEM. Body weight after 4 weeks was 20% lower in the PEM group (P<.001). Gerbils were then exposed to sham surgery or global ischemia induced by 5-min bilateral common carotid artery occlusion. PEM independently increased hippocampal NFκB activation detected by electrophoretic mobility shift assay at 6 h after surgery (P=.014; 2-factor ANOVA). Ischemia did not significantly affect NFκB activation nor was there interaction between diet and ischemia. Serum glucose and cortisol concentrations at 6 h postischemia were unaltered by diet or ischemia. A second experiment using gerbils of the same age and feeding paradigm demonstrated that PEM also increases hippocampal NFκB activation in the absence of surgery. These findings suggest that PEM, which exists in 16% of elderly patients at admission for stroke, may worsen outcome by increasing activation of NFκB. Since PEM increased NFκB activation independent of ischemia or surgery, the data also have implications for the inflammatory response of the many individuals affected globally by PEM. PMID:18430555

  12. Transcription factor activity of estrogen receptor α activation upon nonylphenol or bisphenol A treatment enhances the in vitro proliferation, invasion, and migration of neuroblastoma cells

    PubMed Central

    Ma, Hongda; Yao, Yao; Wang, Changli; Zhang, Liyu; Cheng, Long; Wang, Yiren; Wang, Tao; Liang, Erguang; Jia, Hui; Ye, Qinong; Hou, Mingxiao; Feng, Fan

    2016-01-01

    Many kinds of endocrine-disrupting chemicals (EDCs), for example, the environmental estrogens bisphenol A and nonylphenol, may regulate the activity of estrogen receptor α (ERα) and therefore induce potential disruption of normal endocrine function. However, the involvement of EDCs in human cancers, especially in endocrine-related cancer neuroblastoma regulation, is not very clear. In this work, results showed that upon bisphenol A or nonylphenol treatment, the transcription factor activity of ERα was significantly increased in neuroblastoma cell line SH-SY5Y. Bisphenol A and nonylphenol could enhance ERα activity via recruiting it to the target gene promoter. Furthermore, treatment of bisphenol A and nonylphenol enhanced the in vitro proliferation, invasion, and migration ability of neuroblastoma cells. By investigating the role of EDC-induced ERα upregulation, our data extend the understanding of the function of EDCs and further suggest that ERα might be a potential therapeutic target in human neuroblastoma treatment. PMID:27366082

  13. STAT3 transcription factor is constitutively activated and is oncogenic in nasal-type NK/T-cell lymphoma

    PubMed Central

    Coppo, Paul; Gouilleux-Gruart, Valérie; Huang, Yenlin; Bouhlal, Hicham; Bouamar, Hakim; Bouchet, Sandrine; Perrot, Christine; Vieillard, Vincent; Dartigues, Peggy; Gaulard, Philippe; Agbalika, Félix; Douay, Luc; Lassoued, Kaiss; Gorin, Norbert-Claude

    2009-01-01

    Nasal-type natural killer (NK) cell lymphoma is an infrequent aggressive malignant disease with very poor prognosis. We aimed to explore the possible role of the transcription factor STAT3 in the pathophysiology of this malignancy, as it was involved in oncogenesis and chemoresistance. For this, we established and characterized a continuous interleukin 2-dependent NK cell line (MEC04) from a patient with a fatal nasal-type NK cell lymphoma. Cells harbored poor cytotoxic activity against K562 cells, and spontaneously secreted interferon-γ, IL-10 and vascular-endothelium growth factor in vitro. STAT3 was phosphorylated in Y705 dimerization residue in MEC04 cells and restricted to the nucleus. Y705 STAT3 phosphorylation involved JAK2, since exposure of cells to AG490 inhibitor inhibited Y705 STAT3 phosphorylation. By using recombinant transducible TAT-STAT3β (βisoform), TAT-STAT3Y705F (a STAT3 protein mutated on Y705 residue which prevents STAT3 dimerization), and peptides inhibiting specifically STAT3 dimerization, we inhibited STAT3 phosphorylation and cell growth, with cell death induction. Finally, STAT3 was phosphorylated in Y705 residue in the nuclei of lymphoma cells in 8/9 patients with nasal-type NK/T cell lymphoma and in YT, another NK cell line. Our results suggest that STAT3 protein has a major role in the oncogenic process of nasal-type NK cell lymphomas, and may represent a promising therapeutical target. PMID:19421230

  14. ATF4 (activating transcription factor 4) from grass carp (Ctenopharyngodon idella) modulates the transcription initiation of GRP78 and GRP94 in CIK cells.

    PubMed

    Fan, Qidi; Mao, Huiling; Wu, Chuxin; Liu, Yong; Hu, Yousheng; Zhong, Bin; Mi, Yichuan; Hu, Chengyu

    2014-05-01

    GRP78 and GRP94, belong to GRP (glucose-regulated protein) family of endoplasmatic reticulum (ER) chaperone superfamily, are essential for cell survival under ER stress. ATF4 is a protective protein which regulates the adaptation of cells to ER stress by modulating the transcription of UPR (Unfolded Protein Response) target genes, including GRP78 and GRP94. To understand the molecular mechanism of ATF4 modulates the transcription initiation of CiGRP78 and CiGRP94, we cloned ATF4 ORF cDNA sequences (CiATF4) by homologous cloning techniques. The expression trend of CiATF4 was similar to CiGRP78 and CiGRP94 did under 37 °C thermal stress, namely, the expression of CiATF4 was up-regulated twice at 2 h post-thermal stress and at 18 h post recovery from thermal stress. In this paper, CiATF4 was expressed in BL21 Escherichia coli, and the expressed protein was purified by affinity chromatography with the Ni-NTA His-Bind Resin. On the basis of the cloned CiGRP78 and CiGRP94 cDNA in our laboratory previously, we cloned their promoter sequences by genomic walking approach. In vitro, gel mobility shift assays revealed that CiATF4 could bind to CiGRP78 and CiGRP94 promoter with high affinity. Subsequently, the recombinant plasmid of pGL3-CiGRPs and pcDNA3.1-CiATF4 were constructed and transiently co-transfected into Ctenopharyngodon idella kidney (CIK) cells. The impact of CiATF4 on CiGRP promoter sequences were measured by luciferase assays. These results demonstrated that CiATF4 could activate the transcription of CiGRP78 and CiGRP94. What's more, for better understanding the molecular mechanism of CiATF4 modulate the transcription initiation of CiGRP, three mutant fragments of CiGRP78 promoter recombinant plasmids (called CARE-mut/LUC, CRE1-mut/LUC and CRE2-mut/LUC) were constructed and transiently co-transfected with CiATF4 into CIK cells. The results indicated that CRE or CARE elements were the regulatory element for transcription initiation of CiGRP78. Between them, CRE

  15. Cloning and characterization of a novel human hepatocyte transcription factor, hB1F, which binds and activates enhancer II of hepatitis B virus.

    PubMed

    Li, M; Xie, Y H; Kong, Y Y; Wu, X; Zhu, L; Wang, Y

    1998-10-30

    Enhancer II (ENII) of hepatitis B virus (HBV) is one of the essential cis-elements for the transcriptional regulation of HBV gene expression. Its function is highly liver-specific, suggesting that liver-enriched transcriptional factors play critical roles in regulating the activity of ENII. In this report, a novel hepatocyte transcription factor, which binds specifically to the B1 region (AACGACCGACCTTGAG) within the major functional unit (B unit) of ENII, has been cloned from a human liver cDNA library by yeast one-hybrid screening, and demonstrated to trans-activate ENII via the B1 region. We named this factor hB1F, for human B1-binding factor. Amino acid analysis revealed this factor structurally belongs to nuclear receptor superfamily. Based on the sequence similarities, hB1F is characterized to be a novel human homolog of the orphan receptor fushi tarazu factor I (FTZ-F1). Using reverse transcription-polymerase chain reaction, a splicing isoform of hB1F (hB1F-2) was identified, which has an extra 46 amino acid residues in the A/B region. Examination of the tissue distribution has revealed an abundant 5.2-kilobase transcript of hB1F is present specifically in human pancreas and liver. Interestingly, an additional transcript of 3.8 kilobases was found to be present in hepatoma cells HepG2. Fluorescent in situ hybridization has mapped the gene locus of hB1F to the region q31-32.1 of human chromosome 1. Altogether, this study provides the first report that a novel human homolog of FTZ-F1 binds and regulates ENII of HBV. The potential roles of this FTZ-F1 homolog in tissue-specific gene regulation, in embryonic development, as well as in liver carcinogenesis are discussed. PMID:9786908

  16. The rolB gene activates secondary metabolism in Arabidopsis calli via selective activation of genes encoding MYB and bHLH transcription factors.

    PubMed

    Bulgakov, Victor P; Veremeichik, Galina N; Grigorchuk, Valeria P; Rybin, Viacheslav G; Shkryl, Yuri N

    2016-05-01

    It is known that the rolB gene of Agrobacterium rhizogenes increases the production of secondary metabolites in transformed plant cells, but its mechanism of action remains unclear. In this report, we demonstrate that rolB expression in Arabidopsis thaliana calli led to the activation of most genes encoding secondary metabolism-specific MYB and bHLH transcription factors (TFs), such as MYB11, MYB12, MYB28, MYB76, MYB34, MYB51, MYB122, TT2 and TT8. Accordingly, a higher transcript abundance of main biosynthetic genes related to these factors was detected. The rolB-transformed calli produced 3-fold higher levels of indolic glucosinolates (GSs) compared with normal calli but did not produce secondary metabolites from other groups. Enhanced accumulation of indolic GSs was caused by activation of MYB34, MYB51 and MYB122, and the absence of aliphatic GSs in transformed calli was caused by the inability of rolB to induce MYB29. The inability of rolB-calli to produce flavonoids was caused by the lack of MYB111 expression, induced by the rolB-mediated conversion of MYB expression from cotyledon-specific to root-specific patterns. The high specificity of rolB on secondary metabolism-specific TFs was demonstrated for the first time. PMID:26913794

  17. The Forkhead Transcription Factor FOXK2 Promotes AP-1-Mediated Transcriptional Regulation

    PubMed Central

    Ji, Zongling; Donaldson, Ian J.; Liu, Jingru; Hayes, Andrew; Zeef, Leo A. H.

    2012-01-01

    The transcriptional control circuitry in eukaryotic cells is complex and is orchestrated by combinatorially acting transcription factors. Forkhead transcription factors often function in concert with heterotypic transcription factors to specify distinct transcriptional programs. Here, we demonstrate that FOXK2 participates in combinatorial transcriptional control with the AP-1 transcription factor. FOXK2 binding regions are widespread throughout the genome and are often coassociated with AP-1 binding motifs. FOXK2 acts to promote AP-1-dependent gene expression changes in response to activation of the AP-1 pathway. In this context, FOXK2 is required for the efficient recruitment of AP-1 to chromatin. Thus, we have uncovered an important new molecular mechanism that controls AP-1-dependent gene expression. PMID:22083952

  18. The activation of peroxisome proliferator-activated receptor γ is regulated by Krüppel-like transcription factors 6 & 9 under steatotic conditions

    SciTech Connect

    Escalona-Nandez, Ivonne; Guerrero-Escalera, Dafne; Estanes-Hernández, Alma; Ortíz-Ortega, Victor; Tovar, Armando R.; Pérez-Monter, Carlos

    2015-03-20

    Liver steatosis is characterised by lipid droplet deposition in hepatocytes that can leads to an inflammatory and fibrotic phenotype. Peroxisome proliferator-activated receptors (PPARs) play key roles in energetic homeostasis by regulating lipid metabolism in hepatic tissue. In adipose tissue PPARγ regulates the adipocyte differentiation by promoting the expression of lipid-associated genes. Within the liver PPARγ is up-regulated under steatotic conditions; however, which transcription factors participate in its expression is not completely understood. Krüppel-like transcription factors (KLFs) regulate various cellular mechanisms, such as cell proliferation and differentiation. KLFs are key components of adipogenesis by regulating the expression of PPARγ and other proteins such as the C-terminal enhancer binding protein (C/EBP). Here, we demonstrate that the transcript levels of Klf6, Klf9 and Pparγ are increased in response to a steatotic insult in vitro. Chromatin immunoprecipitation (ChIp) experiments showed that klf6 and klf9 are actively recruited to the Pparγ promoter region under these conditions. Accordingly, the loss-of-function experiments reduced cytoplasmic triglyceride accumulation. Here, we demonstrated that KLF6 and KLF9 proteins directly regulate PPARγ expression under steatotic conditions. - Highlights: • Palmitic acid promotes expression of KlF6 & KLF9 in HepG2 cells. • KLF6 and KLF9 promote the expression of PPARγ in response to palmitic acid. • Binding of KLF6 and KLF9 to the PPARγ promoter promotes steatosis in HepG2 cells. • KLF6 and KLF9 loss-of function diminishes the steatosis in HepG2 cells.

  19. Mutations in the pho2 (bas2) transcription factor that differentially affect activation with its partner proteins bas1, pho4, and swi5.

    PubMed

    Bhoite, Leena T; Allen, Jason M; Garcia, Emily; Thomas, Lance R; Gregory, I David; Voth, Warren P; Whelihan, Kristen; Rolfes, Ronda J; Stillman, David J

    2002-10-01

    The yeast PHO2 gene encodes a homeodomain protein that exemplifies combinatorial control in transcriptional activation. Pho2 alone binds DNA in vitro with low affinity, but in vivo it activates transcription with at least three disparate DNA-binding proteins: the zinc finger protein Swi5, the helix-loop-helix factor Pho4, and Bas1, an myb-like activator. Pho2 + Swi5 activates HO, Pho2 + Pho4 activates PHO5, and Pho2 + Bas1 activates genes in the purine and histidine biosynthesis pathways. We have conducted a genetic screen and identified 23 single amino acid substitutions in Pho2 that differentially affect its ability to activate its specific target genes. Analysis of the mutations suggests that the central portion of Pho2 serves as protein-protein interactive surface, with a requirement for distinct amino acids for each partner protein. PMID:12145299

  20. RNA Polymerase I-Specific Subunit CAST/hPAF49 Has a Role in the Activation of Transcription by Upstream Binding Factor

    PubMed Central

    Panov, Kostya I.; Panova, Tatiana B.; Gadal, Olivier; Nishiyama, Kaori; Saito, Takashi; Russell, Jackie; Zomerdijk, Joost C. B. M.

    2006-01-01

    Eukaryotic RNA polymerases are large complexes, 12 subunits of which are structurally or functionally homologous across the three polymerase classes. Each class has a set of specific subunits, likely targets of their cognate transcription factors. We have identified and characterized a human RNA polymerase I (Pol I)-specific subunit, previously identified as ASE-1 (antisense of ERCC1) and as CD3ɛ-associated signal transducer (CAST), and here termed CAST or human Pol I-associated factor of 49 kDa (hPAF49), after mouse orthologue PAF49. We provide evidence for growth-regulated Tyr phosphorylation of CAST/hPAF49, specifically in initiation-competent Pol Iβ complexes in HeLa cells, at a conserved residue also known to be important for signaling during T-cell activation. CAST/hPAF49 can interact with activator upstream binding factor (UBF) and, weakly, with selectivity factor 1 (SL1) at the rDNA (ribosomal DNA repeat sequence encoding the 18S, 5.8S, and 28S rRNA genes) promoter. CAST/hPAF49-specific antibodies and excess CAST/hPAF49 protein, which have no effect on basal Pol I transcription, inhibit UBF-activated transcription following functional SL1-Pol I-rDNA complex assembly and disrupt the interaction of UBF with CAST/hPAF49, suggesting that interaction of this Pol I-specific subunit with UBF is crucial for activation. Drawing on parallels between mammalian and Saccharomyces cerevisiae Pol I transcription machineries, we advance one model for CAST/hPAF49 function in which the network of interactions of Pol I-specific subunits with UBF facilitates conformational changes of the polymerase, leading to stabilization of the Pol I-template complex and, thereby, activation of transcription. PMID:16809778

  1. Protein-DNA array-based identification of transcription factor activities differentially regulated in skeletal muscle of normal and dystrophin-deficient mdx mice.

    PubMed

    Dogra, Charu; Srivastava, Daya Shankar; Kumar, Ashok

    2008-05-01

    Inactivation of dystrophin gene is the primary cause of Duchenne muscular dystrophy (DMD) in humans and mdx mice. However, the underpinning mechanisms, which govern the pathogenesis of dystrophin-deficient skeletal muscle, remain poorly understood. We have previously reported activation of mitogen-activated protein kinases (MAPK), nuclear factor-kappa B (NF-kappaB), and phosphatidyl-inositol 3-kinase/Akt (PI3K/Akt) signaling pathways in diaphragm muscle of mdx mice. In this study, using a protein-DNA array-based approach, we have investigated the activation of 345 transcription factors in diaphragm muscle of 6-week old normal and dystrophin-deficient mdx mice. Our data demonstrate increased activation of a number nuclear transcription factors including AP1, HFH-3, PPARalpha, c.myb BP, ETF, Fra-1/JUN, kBF-A, N-rasBP, lactoferrin BP, Myb(2), EBP40_45, EKLF(1), p53(2), TFEB, Myc-Max; c-Rel; E2, ISRE; NF-kB; Stat1 p84/p91, Antioxidant RE, EVI-1, Stat3, AP3, p53, Stat4, AP4, HFH-1, FAST-1, Pax-5, and Beta-RE in the diaphragm muscle of mdx mice compared to corresponding normal mice. The level of activation for p53 was highest among all the transcription factors studied. Furthermore, higher activation of p53 in diaphragm muscle of mdx mice was associated with its increased phosphorylation and nuclear translocation. Collectively, our data suggest that the primary deficiency of dystrophin leads to the aberrant activation of nuclear transcription factors which might further contribute to muscle pathogenesis in mdx mice. PMID:18278580

  2. Transcriptional factors, Mafs and their biological roles

    PubMed Central

    Tsuchiya, Mariko; Misaka, Ryoichi; Nitta, Kosaku; Tsuchiya, Ken

    2015-01-01

    The Maf family of transcription factors is characterized by a typical bZip structure; these transcription factors act as important regulators of the development and differentiation of many organs and tissues, including the kidney. The Maf family consists of two subgroups that are characterized according to their structure: large Maf transcription factors and small Maf transcription factors. The large Maf subgroup consists of four proteins, designated as MAFA, MAFB, c-MAF and neural retina-specific leucine zipper. In particular, MAFA is a distinct molecule that has been attracting the attention of researchers because it acts as a strong transactivator of insulin, suggesting that Maf transcription factors are likely to be involved in systemic energy homeostasis. In this review, we focused on the regulation of glucose/energy balance by Maf transcription factors in various organs. PMID:25685288

  3. Forcing FAK into Transcriptional Activity.

    PubMed

    Lietha, Daniel

    2016-08-01

    Focal adhesion kinase (FAK) has known signaling roles in cytoplasmic adhesion structures, but was recently shown to act as a transcriptional regulator in the nucleus. In this issue of Structure, Cardoso et al. (2016) report that mechanical forces translocate FAK to the nucleus of cardiomyocytes, and provide structural insights into how FAK interacts with the MEF2 transcription factor to control cardiac hypertrophy. PMID:27486913

  4. Pioneer transcription factors, chromatin dynamics, and cell fate control.

    PubMed

    Zaret, Kenneth S; Mango, Susan E

    2016-04-01

    Among the diverse transcription factors that are necessary to elicit changes in cell fate, both in embryonic development and in cellular reprogramming, a subset of factors are capable of binding to their target sequences on nucleosomal DNA and initiating regulatory events in silent chromatin. Such 'pioneer transcription factors' initiate cooperative interactions with other regulatory proteins to elicit changes in local chromatin structure. As a consequence of pioneer factor binding, the local chromatin can either become open and competent for activation, closed and repressed, or transcriptionally active. Understanding how pioneer factors initiate chromatin dynamics and how such can be blocked at heterochromatic sites provides insights into controlling cell fate transitions at will. PMID:26826681

  5. Bovine papillomavirus type 1 DNA replication: the transcriptional activator E2 acts in vitro as a specificity factor.

    PubMed Central

    Bonne-Andréa, C; Tillier, F; McShan, G D; Wilson, V G; Clertant, P

    1997-01-01

    We previously devised cell-free conditions supporting efficient replication of bovine papillomavirus type 1 (BPV1) DNA (C. Bonne-Andréa, S. Santucci, and P. Clertant, J. Virol. 69:3201-3205, 1995): the use of highly active preparations of viral initiator protein E1, together with extract from a particular cell source, allowed the synthesis of complete DNA circles through successive rounds of replication; this occurred in the absence of the viral transcriptional activator E2, required in vivo for the replication of viral genomes. We now report that adding E2 to cell-free assays produced only slight effects both on the yield of E1-dependent DNA synthesis and on the quality of newly made DNA molecules when a template carrying a wild-type BPV1 replication origin (ori) was used. The performance of mouse cell extracts, unable to sustain efficient BPV1 DNA replication in the presence of E1 only, was likewise not improved by the addition of E2. In a proper in vitro environment, E1 is thus fully capable of efficiently initiating viral DNA synthesis by itself, an activity which is not enhanced by interaction with E2. An important effect, however, was detected: E2 totally suppressed the nonspecific replication of ori-defective DNA templates, otherwise observed in high E1 concentrations. We examined the requirements for building a minimal DNA sequence behaving in vitro as a specific ori sequence under stringent recognition conditions, i.e., in the presence of both E1 and E2. Only two elements, the 18-bp E1 binding palindrome and an AT-rich sequence, were required in cis to allow specific cell-free DNA replication; there seemed to be no need for an E2 binding site to ensure discrimination between specific ori templates and other DNA molecules, even in the presence of E2. This suggests that during the initiation of BPV1 DNA replication, at least in vitro, E2 acts as a specificity factor restricting the action of E1 to a defined ori sequence; this function, likely not demanding

  6. Lysophosphatidic Acid Mediates Activating Transcription Factor 3 Expression Which Is a Target for Post-Transcriptional Silencing by miR-30c-2-3p

    PubMed Central

    Nguyen, Ha T.; Jia, Wei; Beedle, Aaron M.; Kennedy, Eileen J.; Murph, Mandi M.

    2015-01-01

    Although microRNAs (miRNAs) are small, non-protein-coding entities, they have important roles in post-transcriptional regulation of most of the human genome. These small entities generate fine-tuning adjustments in the expression of mRNA, which can mildly or massively affect the abundance of proteins. Previously, we found that the expression of miR-30c-2-3p is induced by lysophosphatidic acid and has an important role in the regulation of cell proliferation in ovarian cancer cells. The goal here is to confirm that ATF3 mRNA is a target of miR-30c-2-3p silencing, thereby further establishing the functional role of miR-30c-2-3p. Using a combination of bioinformatics, qRT-PCR, immunoblotting and luciferase assays, we uncovered a regulatory pathway between miR-30c-2-3p and the expression of the transcription factor, ATF3. Lysophosphatidic acids triggers the expression of both miR-30c-2-3p and ATF3, which peak at 1 h and are absent 8 h post stimulation in SKOV-3 and OVCAR-3 serous ovarian cancer cells. The 3´-untranslated region (3´-UTR) of ATF3 was a predicted, putative target for miR-30c-2-3p, which we confirmed as a bona-fide interaction using a luciferase reporter assay. Specific mutations introduced into the predicted site of interaction between miR-30c-2-3p and the 3´-UTR of ATF3 alleviated the suppression of the luciferase signal. Furthermore, the presence of anti-miR-30c-2-3p enhanced ATF3 mRNA and protein after lysophosphatidic acid stimulation. Thus, the data suggest that after the expression of ATF3 and miR-30c-2-3p are elicited by lysophosphatidic acid, subsequently miR-30c-2-3p negatively regulates the expression of ATF3 through post-transcriptional silencing, which prevents further ATF3-related outcomes as a consequence of lysophosphatidic acid signaling. PMID:26418018

  7. Identification of the G13 (cAMP-response-element-binding protein-related protein) gene product related to activating transcription factor 6 as a transcriptional activator of the mammalian unfolded protein response.

    PubMed Central

    Haze, K; Okada, T; Yoshida, H; Yanagi, H; Yura, T; Negishi, M; Mori, K

    2001-01-01

    Eukaryotic cells control the levels of molecular chaperones and folding enzymes in the endoplasmic reticulum (ER) by a transcriptional induction process termed the unfolded protein response (UPR). The mammalian UPR is mediated by the cis-acting ER stress response element consisting of 19 nt (CCAATN(9)CCACG), the CCACG part of which is considered to provide specificity. We recently identified the basic leucine zipper (bZIP) protein ATF6 as a mammalian UPR-specific transcription factor; ATF6 is activated by ER stress-induced proteolysis and binds directly to CCACG. Here we report that eukaryotic cells express another bZIP protein closely related to ATF6 in both structure and function. This protein encoded by the G13 (cAMP response element binding protein-related protein) gene is constitutively synthesized as a type II transmembrane glycoprotein anchored in the ER membrane and processed into a soluble form upon ER stress as occurs with ATF6. The proteolytic processing of ATF6 and the G13 gene product is accompanied by their relocation from the ER to the nucleus; their basic regions seem to function as a nuclear localization signal. Overexpression of the soluble form of the G13 product constitutively activates the UPR, whereas overexpression of a mutant lacking the activation domain exhibits a strong dominant-negative effect. Furthermore, the soluble forms of ATF6 and the G13 gene product are unable to bind to several point mutants of the cis-acting ER stress response element in vitro that hardly respond to ER stress in vivo. We thus concluded that the two related bZIP proteins are crucial transcriptional regulators of the mammalian UPR, and propose calling the ATF6 gene product ATF6alpha and the G13 gene product ATF6beta. PMID:11256944

  8. Sp1 and the ets-related transcription factor complex GABP alpha/beta functionally cooperate to activate the utrophin promoter.

    PubMed

    Gyrd-Hansen, Mads; Krag, Thomas O B; Rosmarin, Alan G; Khurana, Tejvir S

    2002-05-15

    Duchenne muscular dystrophy (DMD) is a fatal neuromuscular disease caused by the absence of dystrophin. Utrophin is the autosomal homolog of dystrophin and capable of compensating for the absence of dystrophin, when overexpressed. In skeletal muscle, utrophin plays an important role in the formation of neuromuscular junctions. This selective enrichment occurs, in part by transcriptional regulation of the utrophin gene at the sub-synaptic nuclei in muscle. Utrophin's complex transcriptional regulation is not yet fully understood, however, GABP alpha / beta has recently been shown to bind the N box and activate the utrophin promoter in response to heregulin. In this study, we show that the transcription factor Sp1 binds and activates the utrophin promoter in Drosophila S2 cells as well as define a Sp1 response element. We demonstrate that heregulin treatment of cultured muscle cells activates the ERK pathway and phosphorylates serine residue(s) in the consensus ERK recognition site of Sp1. Finally, Sp1 is shown to functionally cooperate with GABP alpha / beta and cause a 58-fold increase of de novo utrophin promoter transcription. Taken together, these findings help define mechanisms used for transcriptional regulation of utrophin expression as well as identify new targets for achieving potentially therapeutic upregulation of utrophin in DMD. PMID:11997063

  9. Activation of transcription factor AP-2 mediates UVA radiation- and singlet oxygen-induced expression of the human intercellular adhesion molecule 1 gene

    SciTech Connect

    Grether-Beck, S.; Olaizola-Horn, S.; Schmitt, H.; Grewe, M.

    1996-12-10

    UVA radiation is the major component of the UV solar spectrum that reaches the earth, and the therapeutic application of UVA radiation is increasing in medicine. Analysis of the cellular effects of UVA radiation has revealed that exposure of human cells to UVA radiation at physiological doses leads to increased gene expression and that this UVA response is primarily mediated through the generation of singlet oxygen. In this study, the mechanisms by which UVA radiation induces transcriptional activation of the human intercellular adhesion molecule 1 (ICAM-1) were examined. UVA radiation was capable of inducing activation of the human ICAM-1 promoter and increasing OCAM-1 mRNA and protein expression. These UVA radiation effects were inhibited by singlet oxygen quenchers, augmented by enhancement of singlet oxygen life-time, and mimicked in unirradiated cells by a singlet oxygen-generating system. UVA radiation as well as singlet oxygen-induced ICAM-1 promoter activation required activation of the transcription factor AP-2. Accordingly, both stimuli activated AP-2, and deletion of the putative AP-2-binding site abrogated ICAM-1 promoter activation in this system. This study identified the AP-2 site as the UVA radiation- and singlet oxygen-responsive element of the human ICAM-1 gene. The capacity of UVA radiation and/or singlet oxygen to induce human gene expression through activation of AP-2 indicates a previously unrecognized role of this transcription factor in the mammalian stress response. 38 refs., 3 figs., 3 tabs.

  10. The transcription of the human fructose-bisphosphate aldolase C gene is activated by nerve-growth-factor-induced B factor in human neuroblastoma cells.

    PubMed Central

    Buono, P; Conciliis, L D; Izzo, P; Salvatore, F

    1997-01-01

    A DNA region located at around -200 bp in the 5' flanking region (region D) of the human brain-type fructose-bisphosphate aldolase (aldolase C) gene has been analysed. We show by transient transfection assay and electrophoretic-mobility-shift assay (EMSA) that the binding of transcriptional activators to region D is much more efficient (80% versus 30%) in human neuroblastoma cells (SKNBE) than in the non-neuronal cell line A1251, which contains low levels of aldolase C mRNA. The sequence of region D, CAAGGTCA, is very similar to the AAAGGTCA motif present in the mouse steroid 21-hydroxylase gene; the latter motif binds nerve-growth-factor-induced B factor (NGFI-B), which is a member of the thyroid/steroid/retinoid nuclear receptor gene family. Competition experiments in EMSA and antibody-directed supershift experiments showed that NGFI-B is involved in the binding to region D of the human aldolase C gene. Furthermore, the regulation of the aldolase C gene (which is the second known target of NGFI-B) expression during development parallels that of NGFI-B. PMID:9173889

  11. Bone Morphogenetic Protein-2 (BMP-2) Activates NFATc1 Transcription Factor via an Autoregulatory Loop Involving Smad/Akt/Ca2+ Signaling.

    PubMed

    Mandal, Chandi C; Das, Falguni; Ganapathy, Suthakar; Harris, Stephen E; Choudhury, Goutam Ghosh; Ghosh-Choudhury, Nandini

    2016-01-15

    Bone remodeling is controlled by dual actions of osteoclasts (OCs) and osteoblasts (OBs). The calcium-sensitive nuclear factor of activated T cells (NFAT) c1 transcription factor, as an OC signature gene, regulates differentiation of OCs downstream of bone morphogenetic protein-2 (BMP-2)-stimulated osteoblast-coded factors. To analyze a functional link between BMP-2 and NFATc1, we analyzed bones from OB-specific BMP-2 knock-out mice for NFATc1 expression by immunohistochemical staining and found significant reduction in NFATc1 expression. This indicated a requirement of BMP-2 for NFATc1 expression in OBs. We showed that BMP-2, via the receptor-specific Smad pathway, regulates expression of NFATc1 in OBs. Phosphatidylinositol 3-kinase/Akt signaling acting downstream of BMP-2 also drives NFATc1 expression and transcriptional activation. Under the basal condition, NFATc1 is phosphorylated. Activation of NFAT requires dephosphorylation by the calcium-dependent serine/threonine phosphatase calcineurin. We examined the role of calcium in BMP-2-stimulated regulation of NFATc1 in osteoblasts. 1,2Bis(2aminophenoxy)ethaneN,N,N',N'-tetraacetic acid acetoxymethyl ester, an inhibitor of intracellular calcium abundance, blocked BMP-2-induced transcription of NFATc1. Interestingly, BMP-2 induced calcium release from intracellular stores and increased calcineurin phosphatase activity, resulting in NFATc1 nuclear translocation. Cyclosporin A, which inhibits calcineurin upstream of NFATc1, blocked BMP-2-induced NFATc1 mRNA and protein expression. Expression of NFATc1 directly increased its transcription and VIVIT peptide, an inhibitor of NFATc1, suppressed BMP-2-stimulated NFATc1 transcription, confirming its autoregulation. Together, these data show a role of NFATc1 downstream of BMP-2 in mouse bone development and provide novel evidence for the presence of a cross-talk among Smad, phosphatidylinositol 3-kinase/Akt, and Ca(2+) signaling for BMP-2-induced NFATc1 expression through

  12. Fast Retrograde Signaling in Response to High Light Involves Metabolite Export, MITOGEN-ACTIVATED PROTEIN KINASE6, and AP2/ERF Transcription Factors in Arabidopsis[C][W

    PubMed Central

    Vogel, Marc Oliver; Moore, Marten; König, Katharina; Pecher, Pascal; Alsharafa, Khalid; Lee, Justin; Dietz, Karl-Josef

    2014-01-01

    Regulation of the expression of nuclear genes encoding chloroplast proteins allows for metabolic adjustment in response to changing environmental conditions. This regulation is linked to retrograde signals that transmit information on the metabolic state of the chloroplast to the nucleus. Transcripts of several APETALA2/ETHYLENE RESPONSE FACTOR transcription factors (AP2/ERF-TFs) were found to respond within 10 min after transfer of low-light-acclimated Arabidopsis thaliana plants to high light. Initiation of this transcriptional response was completed within 1 min after transfer to high light. The fast responses of four AP2/ERF genes, ERF6, RRTF1, ERF104, and ERF105, were entirely deregulated in triose phosphate/phosphate translocator (tpt) mutants. Similarly, activation of MITOGEN-ACTIVATED PROTEIN KINASE6 (MPK6) was upregulated after 1 min in the wild type but not in the tpt mutant. Based on this, together with altered transcript regulation in mpk6 and erf6 mutants, a retrograde signal transmission model is proposed starting with metabolite export through the triose phosphate/phosphate translocator with subsequent MPK6 activation leading to initiation of AP2/ERF-TF gene expression and other downstream gene targets. The results show that operational retrograde signaling in response to high light involves a metabolite-linked pathway in addition to previously described redox and hormonal pathways. PMID:24668746

  13. Proteasome activity or expression is not altered by activation of the heat shock transcription factor Hsf1 in cultured fibroblasts or myoblasts.

    PubMed

    Taylor, David M; Kabashi, Edor; Agar, Jeffrey N; Minotti, Sandra; Durham, Heather D

    2005-01-01

    Heat shock proteins (Hsps) with chaperoning function work together with the ubiquitin-proteasome pathway to prevent the accumulation of misfolded, potentially toxic proteins, as well as to control catabolism of the bulk of cytoplasmic, cellular protein. There is evidence for the involvement of both systems in neurodegenerative disease, and a therapeutic target is the heat shock transcription factor, Hsf1, which mediates upregulation of Hsps in response to cellular stress. The mechanisms regulating expression of proteasomal proteins in mammalian cells are less well defined. To assess any direct effect of Hsf1 on expression of proteasomal subunits and activity in mammalian cells, a plasmid encoding a constitutively active form of Hsf1 (Hsf1act) was expressed in mouse embryonic fibroblasts lacking Hsf1 and in cultured human myoblasts. Plasmid encoding an inactivatible form of Hsf1 (Hsf1inact) served as control. In cultures transfected with plasmid hsf1act, robust expression of the major stress-inducible Hsp, Hsp70, occurred but not in cultures transfected with hsf1inact. No significant changes in the level of expression of representative proteasomal proteins (structural [20Salpha], a nonpeptidase beta subunit [20Sbeta3], or 2 regulatory subunits [19S subunit 6b, 11 Salpha]) or in chymotrypsin-, trypsin-, and caspaselike activities of the proteasome were measured. Thus, stress-induced or pharmacological activation of Hsf1 in mammalian cells would upregulate Hsps but not directly affect expression or activity of proteasomes. PMID:16184768

  14. Mechanism of Activation for Transcription Factor PhoB Suggested by Different Modes of Dimerization in the Inactive and Active States

    PubMed Central

    Bachhawat, Priti; Swapna, GVT; Stock, Ann M

    2013-01-01

    Summary Response regulators (RRs), which undergo phosphorylation/dephosphorylation at aspartate residues, are highly prevalent in bacterial signal transduction. RRs typically contain an N-terminal receiver domain that regulates the activities of a C-terminal DNA-binding domain in a phosphorylation-dependent manner. We present crystallography and solution NMR data for the receiver domain of Escherichia coli PhoB, which show distinct two-fold symmetric dimers in the inactive and active states, providing the first such pair within the OmpR/PhoB subfamily, the largest group of RRs. These structures together with the previously determined structure of the C-terminal domain of PhoB bound to DNA, define the conformation of the active transcription factor, and provide a model for the mechanism of activation in this subfamily. In the active state, the receiver domains dimerize with two-fold rotational symmetry using their α4-β5-α5 faces, while the effector domains bind to DNA direct repeats with tandem symmetry, implying a loss of intramolecular interactions. PMID:16154092

  15. Oncogenic Transcription Factors: Cornerstones of Inflammation-Linked Pancreatic Carcinogenesis

    PubMed Central

    Baumgart, Sandra; Ellenrieder, Volker; Fernandez-Zapico, Martin E.

    2012-01-01

    Transcription factors are proteins that regulate gene expression by modulating the synthesis of messenger RNA. Since this process is frequently one dominant control point in the production of many proteins, transcription factors represent the key regulators of numerous cellular functions, including proliferation, differentiation, and apoptosis. Pancreatic cancer progression is characterized by the activation of inflammatory signaling pathways converging on a limited set of transcription factors that fine-tune gene expression patterns contributing to the growth and maintenance of these tumors. Thus, strategies targeting these transcriptional networks activated in pancreatic cancer cells could block the effects of upstream inflammatory responses participating in pancreatic tumorigenesis. In this article we review this field of research and summarize current strategies to target oncogenic transcription factors and their activating signaling networks in the treatment of pancreatic cancer. PMID:21997559

  16. RNA Activation of the Vascular Endothelial Growth Factor Gene (VEGF) Promoter by Double-Stranded RNA and Hypoxia: Role of Noncoding VEGF Promoter Transcripts.

    PubMed

    Lopez, Pascal; Wagner, Kay-Dietrich; Hofman, Paul; Van Obberghen, Emmanuel

    2016-05-15

    RNA activation (RNAa) is a gene regulation process in which promoter-targeted short double-stranded RNAs (dsRNAs) or microRNAs (miRs) induce target gene expression at the transcriptional level. Here, we investigate the presence of cryptic promoter transcripts within the VEGF promoter. Single-strand sense and antisense noncoding vascular endothelial growth factor (NcVEGF) promoter transcripts are identified, and their respective expression is studied in cells transfected with a VEGF promoter targeted dsRNA, namely, dsVEGF706, in hypoxic cells and in human malignant lung tissues. Interestingly, in dsVEGF706-transfected, as well as in hypoxic cells, NcVEGF expression levels increase coordinately with coding VEGF expression. Ago2 interaction with both sense and antisense NcVEGFs is increased in hypoxic cells, whereas in dsVEGF706-transfected cells, Ago2 and the antisense strand of the dsRNA interact specifically with the sense NcVEGF transcript. Furthermore, both dsVEGF706 and ectopic NcVEGF transcripts are able to activate the VEGF promoter endogenously present or in a reporter construct. Finally, using small interfering RNA targeting Ago2, we show that RNAa plays a role in the maintenance of increased VEGF and NcVEGF expression after hypoxia. Given the central role of VEGF in major human diseases, including cancer, this novel molecular mechanism is poised to reveal promising possibilities for therapeutic interventions. PMID:26976645

  17. ZIP4 Regulates Pancreatic Cancer Cell Growth by Activating IL-6/STAT3 Pathway via Zinc Finger Transcription Factor CREB

    PubMed Central

    Zhang, Yuqing; Bharadwaj, Uddalak; Logsdon, Craig D.; Chen, Changyi; Yao, Qizhi; Li, Min

    2010-01-01

    Purpose Recent studies indicate a strong correlation of zinc transporter ZIP4 and pancreatic cancer progression; however, the underlying mechanisms are unclear. We have recently found that ZIP4 is overexpressed in pancreatic cancer. In this study, we investigated the signaling pathway through which ZIP4 regulates pancreatic cancer growth. Experimental Design The expression of cyclin D1, IL-6, and STAT3 in pancreatic cancer xenografts and cells were examined by real time PCR, Bio-Plex cytokine assay, and Western blot, respectively. The activity of CREB is examined by a promoter activity assay. Results Cyclin D1 was significantly increased in the ZIP4 overexpressing MIA PaCa-2 cells (MIA-ZIP4)-injected orthotopic xenografts and was downregulated in the ZIP4 silenced ASPC-1 (ASPC-shZIP4) group. The phosphorylation of signal transducer and activator of transcription 3 (STAT3), an upstream activator of cyclin D1, was increased in MIA-ZIP4 cells, and decreased in ASPC-shZIP4 cells. IL-6, a known upstream activator for STAT3, was also found to be significantly increased in the MIA-ZIP4 cells and xenografts, and decreased in the ASPC-shZIP4 group. Overexpression of ZIP4 led to a 75% increase of IL-6 promoter activity, and caused increased phosphorylation of cAMP response element binding protein (CREB). Conclusions Our study suggest that ZIP4 overexpression causes increased IL-6 transcription via CREB, which in turn activates STAT3, and leads to increased cyclin D1 expression, resulting in increased cell proliferation and tumor progression in pancreatic cancer. These results elucidated a novel pathway in ZIP4-mediated pancreatic cancer growth, and suggest new therapeutic targets including ZIP4, IL-6, and STAT3 in pancreatic cancer treatment. PMID:20160059

  18. Prunus transcription factors: breeding perspectives.

    PubMed

    Bianchi, Valmor J; Rubio, Manuel; Trainotti, Livio; Verde, Ignazio; Bonghi, Claudio; Martínez-Gómez, Pedro

    2015-01-01

    Many plant processes depend on differential gene expression, which is generally controlled by complex proteins called transcription factors (TFs). In peach, 1533 TFs have been identified, accounting for about 5.5% of the 27,852 protein-coding genes. These TFs are the reference for the rest of the Prunus species. TF studies in Prunus have been performed on the gene expression analysis of different agronomic traits, including control of the flowering process, fruit quality, and biotic and abiotic stress resistance. These studies, using quantitative RT-PCR, have mainly been performed in peach, and to a lesser extent in other species, including almond, apricot, black cherry, Fuji cherry, Japanese apricot, plum, and sour and sweet cherry. Other tools have also been used in TF studies, including cDNA-AFLP, LC-ESI-MS, RNA, and DNA blotting or mapping. More recently, new tools assayed include microarray and high-throughput DNA sequencing (DNA-Seq) and RNA sequencing (RNA-Seq). New functional genomics opportunities include genome resequencing and the well-known synteny among Prunus genomes and transcriptomes. These new functional studies should be applied in breeding programs in the development of molecular markers. With the genome sequences available, some strategies that have been used in model systems (such as SNP genotyping assays and genotyping-by-sequencing) may be applicable in the functional analysis of Prunus TFs as well. In addition, the knowledge of the gene functions and position in the peach reference genome of the TFs represents an additional advantage. These facts could greatly facilitate the isolation of genes via QTL (quantitative trait loci) map-based cloning in the different Prunus species, following the association of these TFs with the identified QTLs using the peach reference genome. PMID:26124770

  19. Prunus transcription factors: breeding perspectives

    PubMed Central

    Bianchi, Valmor J.; Rubio, Manuel; Trainotti, Livio; Verde, Ignazio; Bonghi, Claudio; Martínez-Gómez, Pedro

    2015-01-01

    Many plant processes depend on differential gene expression, which is generally controlled by complex proteins called transcription factors (TFs). In peach, 1533 TFs have been identified, accounting for about 5.5% of the 27,852 protein-coding genes. These TFs are the reference for the rest of the Prunus species. TF studies in Prunus have been performed on the gene expression analysis of different agronomic traits, including control of the flowering process, fruit quality, and biotic and abiotic stress resistance. These studies, using quantitative RT-PCR, have mainly been performed in peach, and to a lesser extent in other species, including almond, apricot, black cherry, Fuji cherry, Japanese apricot, plum, and sour and sweet cherry. Other tools have also been used in TF studies, including cDNA-AFLP, LC-ESI-MS, RNA, and DNA blotting or mapping. More recently, new tools assayed include microarray and high-throughput DNA sequencing (DNA-Seq) and RNA sequencing (RNA-Seq). New functional genomics opportunities include genome resequencing and the well-known synteny among Prunus genomes and transcriptomes. These new functional studies should be applied in breeding programs in the development of molecular markers. With the genome sequences available, some strategies that have been used in model systems (such as SNP genotyping assays and genotyping-by-sequencing) may be applicable in the functional analysis of Prunus TFs as well. In addition, the knowledge of the gene functions and position in the peach reference genome of the TFs represents an additional advantage. These facts could greatly facilitate the isolation of genes via QTL (quantitative trait loci) map-based cloning in the different Prunus species, following the association of these TFs with the identified QTLs using the peach reference genome. PMID:26124770

  20. The Mediator Complex MED15 Subunit Mediates Activation of Downstream Lipid-Related Genes by the WRINKLED1 Transcription Factor1[OPEN

    PubMed Central

    Kim, Mi Jung

    2016-01-01

    The Mediator complex is known to be a master coordinator of transcription by RNA polymerase II, and this complex is recruited by transcription factors (TFs) to target promoters for gene activation or repression. The plant-specific TF WRINKLED1 (WRI1) activates glycolysis-related and fatty acid biosynthetic genes during embryogenesis. However, no Mediator subunit has yet been identified that mediates WRI1 transcriptional activity. Promoter-β-glucuronidase fusion experiments showed that MEDIATOR15 (MED15) is expressed in the same cells in the embryo as WRI1. We found that the Arabidopsis (Arabidopsis thaliana) MED15 subunit of the Mediator complex interacts directly with WRI1 in the nucleus. Overexpression of MED15 or WRI1 increased transcript levels of WRI1 target genes involved in glycolysis and fatty acid biosynthesis; these genes were down-regulated in wild-type or WRI1-overexpressing plants by silencing of MED15. However, overexpression of MED15 in the wri1 mutant also increased transcript levels of WRI1 target genes, suggesting that MED15 also may act with other TFs to activate downstream lipid-related genes. Chromatin immunoprecipitation assays confirmed the association of MED15 with six WRI1 target gene promoters. Additionally, silencing of MED15 resulted in reduced fatty acid content in seedlings and mature seeds, whereas MED15 overexpression increased fatty acid content in both developmental stages. Similar results were found in wri1 mutant and WRI1 overexpression lines. Together, our results indicate that the WRI1/MED15 complex transcriptionally regulates glycolysis-related and fatty acid biosynthetic genes during embryogenesis. PMID:27246098

  1. The Papaya Transcription Factor CpNAC1 Modulates Carotenoid Biosynthesis through Activating Phytoene Desaturase Genes CpPDS2/4 during Fruit Ripening.

    PubMed

    Fu, Chang-Chun; Han, Yan-Chao; Fan, Zhong-Qi; Chen, Jian-Ye; Chen, Wei-Xin; Lu, Wang-Jin; Kuang, Jian-Fei

    2016-07-13

    Papaya fruits accumulate carotenoids during fruit ripening. Although many papaya carotenoid biosynthesis pathway genes have been identified, the transcriptional regulators of these genes have not been characterized. In this study, a NAC transcription factor, designated as CpNAC1, was characterized from papaya fruit. CpNAC1 was localized exclusively in nucleus and possessed transcriptional activation activity. Expression of carotenoid biosynthesis genes phytoene desaturases (CpPDSs) and CpNAC1 was increased during fruit ripening and by propylene treatment, which correlates well with the elevated carotenoid content in papaya. The gel mobility shift assays and transient expression analyses demonstrated that CpNAC1 directly binds to the NAC binding site (NACBS) motifs in CpPDS2/4 promoters and activates them. Collectively, these data suggest that CpNAC1 may act as a positive regulator of carotenoid biosynthesis during papaya fruit ripening possibly via transcriptional activation of CpPDSs such as CpPDS2/4. PMID:27327494

  2. Focal adhesion kinase regulates the activity of the osmosensitive transcription factor TonEBP/NFAT5 under hypertonic conditions

    PubMed Central

    Neuhofer, Wolfgang; Küper, Christoph; Lichtnekert, Julia; Holzapfel, Konstantin; Rupanagudi, Khader V.; Fraek, Maria-Luisa; Bartels, Helmut; Beck, Franz-Xaver

    2014-01-01

    TonEBP/NFAT5 is a major regulator of the urinary concentrating process and is essential for the osmoadaptation of renal medullary cells. Focal adhesion kinase (FAK) is a mechanosensitive non-receptor protein tyrosine kinase expressed abundantly in the renal medulla. Since osmotic stress causes cell shrinkage, the present study investigated the contribution of FAK on TonEBP/NFAT5 activation. Osmotic stress induced time-dependent activation of FAK as evidenced by phosphorylation at Tyr-397, and furosemide reduces FAK Tyr-397 phosphorylation in the rat renal medulla. Both pharmacological inhibition of FAK and siRNA-mediated knockdown of FAK drastically reduced TonEBP/NFAT5 transcriptional activity and target gene expression in HEK293 cells. This effect was not mediated by impaired nuclear translocation or by reduced transactivating activity of TonEBP/NFAT5. However, TonEBP/NFAT5 abundance under hypertonic conditions was diminished by 50% by FAK inhibition or siRNA knockdown of FAK. FAK inhibition only marginally reduced transcription of the TonEBP/NFAT5 gene. Rather, TonEBP/NFAT5 mRNA stability was diminished significantly by FAK inhibition, which correlated with reduced reporter activity of the TonEBP/NFAT5 mRNA 3′ untranslated region (3′-UTR). In conclusion, FAK is a major regulator of TonEBP/NFAT5 activity by increasing its abundance via stabilization of the mRNA. This in turn, depends on the presence of the TonEBP/NFAT5 3′-UTR. PMID:24772088

  3. Activation of AP-1 and nuclear factor-kappaB transcription factors is involved in hydrogen peroxide-induced apoptotic cell death of oligodendrocytes.

    PubMed

    Vollgraf, U; Wegner, M; Richter-Landsberg, C

    1999-12-01

    H2O2-induced onset and execution of programmed cell death in mature rat brain oligodendrocytes in culture is accompanied by the induction and nuclear translocation of the transcription factors AP-1 and nuclear factor-kappaB (NF-kappaB), both of which have been discussed as regulators of cell death and survival. Supershift analysis of nuclear extracts indicated that the AP-1 complex consists of c-Jun, c-Fos, JunD, and possibly JunB proteins, and that the NF-kappaB complex contains p50, p65, and c-Rel proteins. The first signs of DNA fragmentation were seen already during the first hour after the treatment. DNA fragmentation could be prevented by the antioxidants pyrrolidine dithiocarbamate and vitamin E, by the nuclease inhibitor aurintricarboxylic acid, and by preincubation with the iron chelator deferoxamine (DFO). Additionally, DFO protected oligodendrocytes from H2O2-induced cytotoxic effects as assessed by the MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay, and suppressed the formation of free radicals. DFO alone led to a slight increase and in combination with H2O2 synergistically induced DNA-binding activities of AP-1 and NF-kappaB in oligodendrocytes. Our data suggest that although low levels of H2O2 directly activate AP-1 and NF-kappaB and might contribute to signal transduction pathways promoting cell survival, the formation and action of hydroxyl radicals promote cell death mechanisms that can be attenuated by the iron chelator DFO. PMID:10582611

  4. The signalling pathways of interleukin-6 and gamma interferon converge by the activation of different transcription factors which bind to common responsive DNA elements.

    PubMed Central

    Yuan, J; Wegenka, U M; Lütticken, C; Buschmann, J; Decker, T; Schindler, C; Heinrich, P C; Horn, F

    1994-01-01

    Interleukin-6 (IL-6) and gamma interferon (IFN-gamma) induce a partially overlapping set of genes, including the genes for interferon regulatory factor 1 (IRF-1), intercellular adhesion molecule 1 (ICAM-1), and the acute-phase protein alpha 2-macroglobulin. We report here that the rat alpha 2-macroglobulin promoter is activated by IFN-gamma in human hepatoma (HepG2) cells and that the IFN-gamma response element maps to the same site previously defined as the acute-phase response element (APRE), which binds the IL-6-activated transcription factor APRF (acute-phase response factor). As was reported for fibroblasts, the IFN-gamma-regulated transcription factor GAF is phosphorylated at tyrosine after IFN-gamma treatment of HepG2 cells. IFN-gamma posttranslationally activates a protein which specifically binds to the alpha 2-macroglobulin APRE. This protein is shown to be identical or closely related to GAF. Although APRF and GAF are shown to represent different proteins, their binding sequence specificities are very similar. APRF and GAF bind equally well to the APRE sequences of various acute-phase protein genes as well as to the IFN-gamma response elements of the IRF-1, ICAM-1, and other IFN-gamma-inducible genes. Transient transfection analysis revealed that the IFN-gamma response elements of the IRF-1 and ICAM-1 promoters are able to confer responsiveness to both IFN-gamma and IL-6 onto a heterologous promoter. Therefore, APRF and GAF are likely to be involved in the transcriptional induction of these immediate-early genes by IL-6 and IFN-gamma, respectively. Taken together, these results demonstrate that two functionally distinct hormones, IL-6 and IFN-gamma, act through common regulatory elements to which different transcription factors sharing almost the same sequence specificity bind. Images PMID:7509445

  5. Molecular architecture of transcription factor hotspots in early adipogenesis.

    PubMed

    Siersbæk, Rasmus; Baek, Songjoon; Rabiee, Atefeh; Nielsen, Ronni; Traynor, Sofie; Clark, Nicholas; Sandelin, Albin; Jensen, Ole N; Sung, Myong-Hee; Hager, Gordon L; Mandrup, Susanne

    2014-06-12

    Transcription factors have recently been shown to colocalize in hotspot regions of the genome, which are further clustered into super-enhancers. However, the detailed molecular organization of transcription factors at hotspot regions is poorly defined. Here, we have used digital genomic footprinting to precisely define factor localization at a genome-wide level during the early phase of 3T3-L1 adipocyte differentiation, which allows us to obtain detailed molecular insight into how transcription factors target hotspots. We demonstrate the formation of ATF-C/EBP heterodimers at a composite motif on chromatin, and we suggest that this may be a general mechanism for integrating external signals on chromatin. Furthermore, we find evidence of extensive recruitment of transcription factors to hotspots through alternative mechanisms not involving their known motifs and demonstrate that these alternative binding events are functionally important for hotspot formation and activity. Taken together, these findings provide a framework for understanding transcription factor cooperativity in hotspots. PMID:24857666

  6. Id-1 is induced in MDCK epithelial cells by activated Erk/MAPK pathway in response to expression of the Snail and E47 transcription factors

    SciTech Connect

    Jorda, Mireia; Vinyals, Antonia; Marazuela, Anna; Cubillo, Eva; Olmeda, David; Valero, Eva; Cano, Amparo; Fabra, Angels . E-mail: afabra@idibell.org

    2007-07-01

    Id-1, a member of the helix-loop-helix transcription factor family has been shown to be involved in cell proliferation, angiogenesis and invasion of many types of human cancers. We have previously shown that stable expression of E47 and Snail repressors of the E-cadherin promoter in MDCK epithelial cell line triggers epithelial mesenchymal transition (EMT) concomitantly with changes in gene expression. We show here that both factors activate the Id-1 gene promoter and induce Id-1 mRNA and protein. The upregulation of the Id-1 gene occurs through the transactivation of the promoter by the Erk/MAPK signaling pathway. Moreover, oncogenic Ras is also able to activate Id-1 promoter in MDCK cells in the absence of both E47 and Snail transcription factors. Several transcriptionally active regulatory elements have been identified in the proximal promoter, including AP-1, Sp1 and four putative E-boxes. By EMSA, we only detected an increased binding to Sp1 and AP-1 elements in E47- and Snail-expressing cells. Binding is affected by the treatment of cells with PD 98059 MEK inhibitor, suggesting that MAPK/Erk contributes to the recruitment or assembly of proteins to Id-1 promoter. Small interfering RNA directed against Sp1 reduced Id-1 expression and the upregulation of the promoter, indicating that Sp1 is required for Id-1 induction in E47- and Snail-expressing cells. Our results provide new insights into how some target genes are activated during and/or as a consequence of the EMT triggered by both E47 and Snail transcription factors.

  7. ETS transcription factor ESE1/ELF3 orchestrates a positive feedback loop that constitutively activates NF-κB and drives prostate cancer progression.

    PubMed

    Longoni, Nicole; Sarti, Manuela; Albino, Domenico; Civenni, Gianluca; Malek, Anastasia; Ortelli, Erica; Pinton, Sandra; Mello-Grand, Maurizia; Ostano, Paola; D'Ambrosio, Gioacchino; Sessa, Fausto; Garcia-Escudero, Ramon; Thalmann, George N; Chiorino, Giovanna; Catapano, Carlo V; Carbone, Giuseppina M

    2013-07-15

    Chromosomal translocations leading to deregulated expression of ETS transcription factors are frequent in prostate tumors. Here, we report a novel mechanism leading to oncogenic activation of the ETS factor ESE1/ELF3 in prostate tumors. ESE1/ELF3 was overexpressed in human primary and metastatic tumors. It mediated transforming phenotypes in vitro and in vivo and induced an inflammatory transcriptome with changes in relevant oncogenic pathways. ESE1/ELF3 was induced by interleukin (IL)-1β through NF-κB and was a crucial mediator of the phenotypic and transcriptional changes induced by IL-1β in prostate cancer cells. This linkage was mediated by interaction of ESE1/ELF3 with the NF-κB subunits p65 and p50, acting by enhancing their nuclear translocation and transcriptional activity and by inducing p50 transcription. Supporting these findings, gene expression profiling revealed an enrichment of NF-κB effector functions in prostate cancer cells or tumors expressing high levels of ESE1/ELF3. We observed concordant upregulation of ESE1/ELF3 and NF-κB in human prostate tumors that was associated with adverse prognosis. Collectively, our results define an important new mechanistic link between inflammatory signaling and the progression of prostate cancer. PMID:23687337

  8. NF-Y and USF1 transcription factor binding to CCAAT box and E-box elements activates the CP27 promoter

    PubMed Central

    Ito, Yoshihiro; Zhang, Youbin; Dangaria, Smit; Luan, Xianghong; Diekwisch, Thomas G.H.

    2010-01-01

    The maintenance and differentiation of embryonic stem cells (ES cells) depends on the regulation of gene expression through the coordinated binding of transcription factors to regulatory promoter elements. One of the genes involved in embryonic development is the chromatin factor CP27. Previously, we have shown that NF-Y interacted with the CP27 proximal promoter CCAAT-box. Here we report that CP27 gene expression in mouse ES cells is controlled by CCAAT and E-box cis-acting regulatory elements and their corresponding transcription factors NF-Y and USF1. Specifically, USF1 interacts with the E-box of the CP27 proximal promoter and NF-Y interacts with the CCAAT box. NF-Y and USF1 also interacted with each other and activated the CP27 promoter in a synergistic fashion. Together, these studies demonstrate that gene expression of the chromatin factor CP27 is regulated through the interaction of the transcription factors NF-Y and USF1 with the CP27 proximal promoter. PMID:21078375

  9. Creating small transcription activating RNAs.

    PubMed

    Chappell, James; Takahashi, Melissa K; Lucks, Julius B

    2015-03-01

    We expanded the mechanistic capability of small RNAs by creating an entirely synthetic mode of regulation: small transcription activating RNAs (STARs). Using two strategies, we engineered synthetic STAR regulators to disrupt the formation of an intrinsic transcription terminator placed upstream of a gene in Escherichia coli. This resulted in a group of four highly orthogonal STARs that had up to 94-fold activation. By systematically modifying sequence features of this group, we derived design principles for STAR function, which we then used to forward engineer a STAR that targets a terminator found in the Escherichia coli genome. Finally, we showed that STARs could be combined in tandem to create previously unattainable RNA-only transcriptional logic gates. STARs provide a new mechanism of regulation that will expand our ability to use small RNAs to construct synthetic gene networks that precisely control gene expression. PMID:25643173

  10. Regulation of endochondral ossification by transcription factors.

    PubMed

    Nishimura, Riko; Hata, Kenji; Ono, Koichiro; Amano, Katsuhiko; Takigawa, Yoko; Wakabayashi, Makoto; Takashima, Rikako; Yoneda, Toshiyuki

    2012-01-01

    Endochondral ossification is very unique and complex biological event which is associated with skeletal development and tissue partnering. Genetic studies and gene-targeting approaches identified several transcription factors that play important roles in endochondral ossification. These transcription factors sequentially and harmoniously regulate each step of endochondral ossification, and consequently maintain the spatio-temporal control of the program. Importantly, these transcription factors form large protein complex to control chromatin remodeling, histone modification, transcription and splicing steps during endochondral ossification. It is also important to understand how these transcription factors regulate expression of their target genes. Biochemical and molecular cloning techniques largely contributed to identification of the components of the transcriptional complex and the target genes. Most recently, importance of endoplasmic reticulum (ER) stress in endochondral ossification has been reported. A transcription factor, BBF2H7, functions as an ER stress sensor in chondrocytes through regulation of appropriate secretion of chondrogenic matrices. We would like to discuss how the transcription factors regulate endochondral ossification. PMID:22652803

  11. Promoter of CaZF, a Chickpea Gene That Positively Regulates Growth and Stress Tolerance, Is Activated by an AP2-Family Transcription Factor CAP2

    PubMed Central

    Jain, Deepti; Chattopadhyay, Debasis

    2013-01-01

    Plants respond to different forms of stresses by inducing transcription of a common and distinct set of genes by concerted actions of a cascade of transcription regulators. We previously reported that a gene, CaZF encoding a C2H2-zinc finger family protein from chickpea (Cicer arietinum) imparted high salinity tolerance when expressed in tobacco plants. We report here that in addition to promoting tolerance against dehydration, salinity and high temperature, the CaZF overexpressing plants exhibited similar phenotype of growth and development like the plants overexpressing CAP2, encoding an AP2-family transcription factor from chickpea. To investigate any relationship between these two genes, we performed gene expression analysis in the overexpressing plants, promoter-reporter analysis and chromatin immunoprecipitation. A number of transcripts that exhibited enhanced accumulation upon expression of CAP2 or CaZF in tobacco plants were found common. Transient expression of CAP2 in chickpea leaves resulted in increased accumulation of CaZF transcript. Gel mobility shift and transient promoter-reporter assays suggested that CAP2 activates CaZF promoter by interacting with C-repeat elements (CRTs) in CaZF promoter. Chromatin immunoprecipitation (ChIP) assay demonstrated an in vivo interaction of CAP2 protein with CaZF promoter. PMID:23418595

  12. Divergent transcriptional activities determine limb identity

    PubMed Central

    Ouimette, Jean-François; Jolin, Marisol Lavertu; L'honoré, Aurore; Gifuni, Anthony; Drouin, Jacques

    2010-01-01

    Limbs develop using a common genetic programme despite widely differing morphologies. This programme is modulated by limb-restricted regulators such as hindlimb (HL) transcription factors Pitx1 and Tbx4 and the forelimb (FL) Tbx5. Both Tbx factors have been implicated in limb patterning and growth, but their relative activities and underlying mechanisms remain unclear. In this paper, we show that Tbx4 and Tbx5 harbour conserved and divergent transcriptional regulatory domains that account for their roles in limb development. In particular, both factors share an activator domain and the ability to stimulate limb growth. However, we find that Tbx4 is the primary effector of HL identity for both skeletal and muscle development; this activity relies on a repressor domain that is inactivated by a human TBX4 small-patella syndrome mutation. We propose that limb identity is largely achieved by default in FL, whereas a specific repressor activity unique to Tbx4 determines HL identity. PMID:20975709

  13. PAX transcription factors in neural crest development.

    PubMed

    Monsoro-Burq, Anne H

    2015-08-01

    The nine vertebrate PAX transcription factors (PAX1-PAX9) play essential roles during early development and organogenesis. Pax genes were identified in vertebrates using their homology with the Drosophila melanogaster paired gene DNA-binding domain. PAX1-9 functions are largely conserved throughout vertebrate evolution, in particular during central nervous system and neural crest development. The neural crest is a vertebrate invention, which gives rise to numerous derivatives during organogenesis, including neurons and glia of the peripheral nervous system, craniofacial skeleton and mesenchyme, the heart outflow tract, endocrine and pigment cells. Human and mouse spontaneous mutations as well as experimental analyses have evidenced the critical and diverse functions of PAX factors during neural crest development. Recent studies have highlighted the role of PAX3 and PAX7 in neural crest induction. Additionally, several PAX proteins - PAX1, 3, 7, 9 - regulate cell proliferation, migration and determination in multiple neural crest-derived lineages, such as cardiac, sensory, and enteric neural crest, pigment cells, glia, craniofacial skeleton and teeth, or in organs developing in close relationship with the neural crest such as the thymus and parathyroids. The diverse PAX molecular functions during neural crest formation rely on fine-tuned modulations of their transcriptional transactivation properties. These modulations are generated by multiple means, such as different roles for the various isoforms (formed by alternative splicing), or posttranslational modifications which alter protein-DNA binding, or carefully orchestrated protein-protein interactions with various co-factors which control PAX proteins activity. Understanding these regulations is the key to decipher the versatile roles of PAX transcription factors in neural crest development, differentiation and disease. PMID:26410165

  14. ortho-Carboranylphenoxyacetanilides as inhibitors of hypoxia-inducible factor (HIF)-1 transcriptional activity and heat shock protein (HSP) 60 chaperon activity.

    PubMed

    Li, Guangzhe; Azuma, Soyoko; Sato, Shinichi; Minegishi, Hidemitsu; Nakamura, Hiroyuki

    2015-07-01

    ortho-Carboranylphenoxy derivatives were synthesized and evaluated for their ability to inhibit hypoxia-induced HIF-1 transcriptional activity using a cell-based reporter gene assay. Among the compounds synthesized, compound 1d showed the most significant inhibition of hypoxia-induced HIF-1 transcriptional activity with the IC50 of 0.53μM. Furthermore, compound 1h was found to possess the most significant inhibition of heat shock protein (HSP) 60 chaperon activity among the reported inhibitors: the IC50 toward the porcine heart malate dehydrogenase (MDH) refolding assay was 0.35μM. PMID:25981686

  15. Yeast GAL11 protein is a distinctive type transcription factor that enhances basal transcription in vitro.

    PubMed Central

    Sakurai, H; Hiraoka, Y; Fukasawa, T

    1993-01-01

    The yeast auxiliary transcription factor GAL11, a candidate for the coactivator, was partially purified from yeast cells, and its function was characterized in a cell-free transcription system. The partially purified GAL11 protein stimulated basal transcription from the CYC1 core promoter by a factor of 4-5 at the step of preinitiation complex formation. GAL11 protein also enhanced transcription activated by general regulatory factor 1, GAL4-AH, or GAL4-VP16 to the same extent as the basal transcription. Therefore, the apparent potentiation of the activators by GAL11 was attributable to the stimulation of basal transcription. The wild-type GAL11 protein (but not a mutant-type protein) produced in bacteria stimulated transcription as effectively as GAL11 from yeast. These results suggest that GAL11 functions as a positive cofactor of basal and activator-induced transcription in a cell-free transcription system. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:8378310

  16. Protein oxidation mediated by heme-induced active site conversion specific for heme-regulated transcription factor, iron response regulator

    PubMed Central

    Kitatsuji, Chihiro; Izumi, Kozue; Nambu, Shusuke; Kurogochi, Masaki; Uchida, Takeshi; Nishimura, Shin-Ichiro; Iwai, Kazuhiro; O’Brian, Mark R.; Ikeda-Saito, Masao; Ishimori, Koichiro

    2016-01-01

    The Bradyrhizobium japonicum transcriptional regulator Irr (iron response regulator) is a key regulator of the iron homeostasis, which is degraded in response to heme binding via a mechanism that involves oxidative modification of the protein. Here, we show that heme-bound Irr activates O2 to form highly reactive oxygen species (ROS) with the “active site conversion” from heme iron to non-heme iron to degrade itself. In the presence of heme and reductant, the ROS scavenging experiments show that Irr generates H2O2 from O2 as found for other hemoproteins, but H2O2 is less effective in oxidizing the peptide, and further activation of H2O2 is suggested. Interestingly, we find a time-dependent decrease of the intensity of the Soret band and appearance of the characteristic EPR signal at g = 4.3 during the oxidation, showing the heme degradation and the successive formation of a non-heme iron site. Together with the mutational studies, we here propose a novel “two-step self-oxidative modification” mechanism, during which O2 is activated to form H2O2 at the heme regulatory motif (HRM) site and the generated H2O2 is further converted into more reactive species such as ·OH at the non-heme iron site in the His-cluster region formed by the active site conversion. PMID:26729068

  17. Determination of Acetylation of the Gli Transcription Factors.

    PubMed

    Coni, Sonia; Di Magno, Laura; Canettieri, Gianluca

    2015-01-01

    The Gli transcription factors (Gli1, Gli2, and Gli3) are the final effectors of the Hedgehog (Hh) signaling and play a key role in development and cancer. The activity of the Gli proteins is finely regulated by covalent modifications, such as phosphorylation, ubiquitination, and acetylation. Both Gli1 and Gli2 are acetylated at a conserved lysine, and this modification causes the inhibition of their transcriptional activity. Thus, the acetylation status of these proteins represents a useful marker to monitor Hh activation in pathophysiological conditions. Herein we describe the techniques utilized to detect in vitro and intracellular acetylation of the Gli transcription factors. PMID:26179046

  18. Inhibition of cytochrome P450 2E1 and activation of transcription factor Nrf2 are renoprotective in myoglobinuric acute kidney injury.

    PubMed

    Wang, Zhe; Shah, Sudhir V; Liu, Hua; Baliga, Radhakrishna

    2014-08-01

    Rhabdomyolysis accounts for ∼10% of acute kidney injuries. In glycerol-induced myoglobinuric acute kidney injury, we found an increase in the nuclear factor erythroid 2-related factor 2 (Nrf2) nuclear protein, a key redox-sensitive transcription factor, and Nrf2-regulated genes and proteins including upregulation of heme oxygenase-1. In in vitro studies, pretreatment of LLC-PK1 cells with an activator of Nrf2 before myoglobin exposure significantly decreased oxidant generation and cytotoxicity, whereas Nrf2 inhibition and gene silencing exacerbated the injury. Chlormethiazole, a specific CYP2E1 transcription inhibitor, prevented an increase in catalytic iron in the kidneys, decreased oxidative stress, blocked nuclear translocation of the Nrf2 protein, decreased heme oxygenase-1 upregulation, and provided functional and histological protection against acute kidney injury. CYP2E1 inhibitors and gene silencing in renal tubular epithelial cells significantly decreased reactive oxygen species generation and provided marked protection against myoglobin-induced cytotoxicity. Thus, during CYP2E1-induced oxidative stress, the transcription factor Nrf2 has a pivotal role in the early adaptive response. Inhibition of CYP2E1 coupled with the prior induction of Nrf2 may be a valuable tool to reduce CYP2E1-mediated rhabdomyolysis-induced acute kidney injury. PMID:24717297

  19. Inhibitors of Histone Deacetylase and DNA Methyltransferase Synergistically Activate the Methylated Metallothionein I Promoter by Activating the Transcription Factor MTF-1 and Forming an Open Chromatin Structure

    PubMed Central

    Ghoshal, Kalpana; Datta, Jharna; Majumder, Sarmila; Bai, Shoumei; Dong, Xiaocheng; Parthun, Mark; Jacob, Samson T.

    2002-01-01

    Inhibitors of DNA methyltransferase (Dnmt) and histone deacetylases (HDAC) synergistically activate the methylated metallothionein I gene (MT-I) promoter in mouse lymphosarcoma cells. The cooperative effect of these two classes of inhibitors on MT-I promoter activity was robust following demethylation of only a few CpG dinucleotides by brief exposure to 5-azacytidine (5-AzaC) but persisted even after prolonged treatment with the nucleoside analog. HDAC inhibitors (trichostatin A [TSA] and depsipeptide) either alone or in combination with 5-AzaC did not facilitate demethylation of the MT-I promoter. Treatment of cells with HDAC inhibitors increased accumulation of multiply acetylated forms of H3 and H4 histones that remained unaffected after treatment with 5-AzaC. Chromatin immunoprecipitation (ChIP) assay showed increased association of acetylated histone H4 and lysine 9 (K9)-acetyl H3 with the MT-I promoter after treatment with TSA, which was not affected following treatment with 5-AzaC. In contrast, the association of K9-methyl histone H3 with the MT-I promoter decreased significantly after treatment with 5-AzaC and TSA. ChIP assay with antibodies specific for methyl-CpG binding proteins (MBDs) demonstrated that only methyl-CpG binding protein 2 (MeCP2) was associated with the MT-I promoter, which was significantly enhanced after TSA treatment. Association of histone deacetylase 1 (HDAC1) with the promoter decreased after treatment with TSA or 5-AzaC and was abolished after treatment with both inhibitors. Among the DNA methyltransferases, both Dnmt1 and Dnmt3a were associated with the MT-I promoter in the lymphosarcoma cells, and association of Dnmt1 decreased with time after treatment with 5-AzaC. Treatment of these cells with HDAC inhibitors also increased expression of the MTF-1 (metal transcription factor-1) gene as well as its DNA binding activity. In vivo genomic footprinting studies demonstrated increased occupancy of MTF-1 to metal response elements of

  20. An Estrogen Receptor-α/p300 Complex Activates the BRCA-1 Promoter at an AP-1 Site That Binds Jun/Fos Transcription Factors: Repressive Effects of p53 on BRCA-1 Transcription1

    PubMed Central

    Jeffy, Brandon D; Hockings, Jennifer K; Kemp, Michael Q; Morgan, Sherif S; Hager, Jill A; Beliakoff, Jason; Whitesell, Luke J; Bowden, G. Timothy; Romagnolo, Donato F

    2005-01-01

    Abstract One of the puzzles in cancer predisposition is that women carrying BRCA-1 mutations preferentially develop tumors in epithelial tissues of the breast and ovary. Moreover, sporadic breast tumors contain lower levels of BRCA-1 in the absence of mutations in the BRCA-1 gene. The problem of tissue specificity requires analysis of factors that are unique to tissues of the breast. For example, the expression of estrogen receptor-α (ERα) is inversely correlated with breast cancer risk, and 90% of BRCA-1 tumors are negative for ERα. Here, we show that estrogen stimulates BRCA-1 promoter activity in transfected cells and the recruitment of ERα and its cofactor p300 to an AP-1 site that binds Jun/Fos transcription factors. The recruitment of ERα/p300 coincides with accumulation in the S-phase of the cell cycle and is antagonized by the antiestrogen tamoxifen. Conversely, we document that overexpression of wild-type p53 prevents the recruitment of ERα to the AP-1 site and represses BRCA-1 promoter activity. Taken together, our findings support a model in which an ERα/AP-1 complex modulates BRCA-1 transcription under conditions of estrogen stimulation. Conversely, the formation of this transcription complex is abrogated in cells overexpressing p53. PMID:16229810

  1. Phylogenetic and Transcription Analysis of Chrysanthemum WRKY Transcription Factors

    PubMed Central

    Song, Aiping; Li, Peiling; Jiang, Jiafu; Chen, Sumei; Li, Huiyun; Zeng, Jun; Shao, Yafeng; Zhu, Lu; Zhang, Zhaohe; Chen, Fadi

    2014-01-01

    WRKY transcription factors are known to function in a number of plant processes. Here we have characterized 15 WRKY family genes of the important ornamental species chrysanthemum (Chrysanthemum morifolium). A total of 15 distinct sequences were isolated; initially internal fragments were amplified based on transcriptomic sequence, and then the full length cDNAs were obtained using RACE (rapid amplification of cDNA ends) PCR. The transcription of these 15 genes in response to a variety of phytohormone treatments and both biotic and abiotic stresses was characterized. Some of the genes behaved as would be predicted based on their homology with Arabidopsis thaliana WRKY genes, but others showed divergent behavior. PMID:25196345

  2. A cluster region of AP-1 responsive elements is required for transcriptional activity of mouse ODC gene by hepatocyte growth factor.

    PubMed

    Bianchi, Laura; Tacchini, Lorenza; Matteucci, Emanuela; Desiderio, Maria Alfonsina

    2002-05-01

    Ornithine decarboxylase (ODC) activity is regulated by a variety of mechanisms including transcription, translation, and RNA and protein half-life. Since in mouse B16-F1 melanoma cells an early and remarkable (about 6-fold) increase in steady state mRNA levels was observed after hepatocyte growth factor (HGF) treatment, we investigated the transcriptional regulation of mouse ODC promoter. Transient transfection of various ODC-luciferase promoter constructs into the B16-Fl cells in combination with electrophoretic mobility shift assays identified the HGF-responsive element as a cluster of three AP-1 binding sites (-1660 to -1572). Even if each site differs from the canonical TPA responsive element for one nucleotide, only the first two AP-1 consensus sequences seemed to be functional since allowed DNA-binding activity of nuclear proteins after HGF treatment. Comparison of the results of transfection assays with the pOD2.5-luc (2.5 kb gene fragment) and with the construct deprived of the AP-1 cluster pOD-B-luc showed that this 50 bp region was required for ODC transactivating activity in response to HGF. Since in B16-F1 cells HGF increased AP-1 activity and the mRNA expression of various AP-1 subunits, we may conclude that HGF-induced transcription of mouse ODC was largely due to triggering of AP-1 pathway. PMID:12054494

  3. Redox-Active Sensing by Bacterial DksA Transcription Factors Is Determined by Cysteine and Zinc Content

    PubMed Central

    Crawford, Matthew A.; Tapscott, Timothy; Fitzsimmons, Liam F.; Liu, Lin; Reyes, Aníbal M.; Libby, Stephen J.; Trujillo, Madia; Fang, Ferric C.; Radi, Rafael

    2016-01-01

    ABSTRACT The four-cysteine zinc finger motif of the bacterial RNA polymerase regulator DksA is essential for protein structure, canonical control of the stringent response to nutritional limitation, and thiol-based sensing of oxidative and nitrosative stress. This interdependent relationship has limited our understanding of DksA-mediated functions in bacterial pathogenesis. Here, we have addressed this challenge by complementing ΔdksA Salmonella with Pseudomonas aeruginosa dksA paralogues that encode proteins differing in cysteine and zinc content. We find that four-cysteine, zinc-bound (C4) and two-cysteine, zinc-free (C2) DksA proteins are able to mediate appropriate stringent control in Salmonella and that thiol-based sensing of reactive species is conserved among C2 and C4 orthologues. However, variations in cysteine and zinc content determine the threshold at which individual DksA proteins sense and respond to reactive species. In particular, zinc acts as an antioxidant, dampening cysteine reactivity and raising the threshold of posttranslational thiol modification with reactive species. Consequently, C2 DksA triggers transcriptional responses in Salmonella at levels of oxidative or nitrosative stress normally tolerated by Salmonella expressing C4 orthologues. Inappropriate transcriptional regulation by C2 DksA increases the susceptibility of Salmonella to the antimicrobial effects of hydrogen peroxide and nitric oxide, and attenuates virulence in macrophages and mice. Our findings suggest that the redox-active sensory function of DksA proteins is finely tuned to optimize bacterial fitness according to the levels of oxidative and nitrosative stress encountered by bacterial species in their natural and host environments. PMID:27094335

  4. Methamphetamine activates nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) and induces human immunodeficiency virus (HIV) transcription in human microglial cells

    PubMed Central

    Wires, Emily S.; Alvarez, David; Dobrowolski, Curtis; Wang, Yun; Morales, Marisela; Karn, Jonathan; Harvey, Brandon K.

    2012-01-01

    Human immunodeficiency virus (HIV) primarily infects glial cells in the central nervous system (CNS). Recent evidence suggests that HIV-infected individuals who abuse drugs such as methamphetamine (METH) have higher viral loads and experience more severe neurological complications than HIV-infected individuals who do not abuse drugs. The aim of this study was to determine the effect of METH on HIV expression from the HIV long terminal repeats (LTR) promoter and on an HIV integrated provirus in microglial cells, the primary host cells for HIV in the CNS. Primary human microglial cells immortalized with SV40 T-antigen (CHME-5 cells) were co-transfected with an HIV LTR reporter and the HIV Tat gene, a key regulator of viral replication and gene expression, and exposed to METH. Our results demonstrate that METH treatment induced LTR activation, an effect potentiated in the presence of Tat. We also found that METH increased the nuclear translocation of the nuclear factor kappa B (NF-κB), a key cellular transcriptional regulator of the LTR promoter, and the activity of an NF-κB-specific reporter plasmid in CHME-5 cells. The presence of a dominant-negative regulator of NF-κB blocked METH-related activation of the HIV LTR. Furthermore, treatment of HIV-latently infected CHME-5 (CHME-5/HIV) cells with METH induced HIV expression in a dose-dependent manner, and nuclear translocation of the p65 subunit of NF-κB. These results suggest that METH can stimulate HIV gene expression in microglia cells through activation of the NF-κB signaling pathway. This mechanism may outline the initial biochemical events leading to the observed increased neurodegeneration in HIV-positive individuals who use METH. PMID:22618514

  5. In vivo identification of promoter elements and transcription factors mediating activation of hepatic HMG-CoA reductase by T{sub 3}

    SciTech Connect

    Boone, Lindsey R.; Niesen, Melissa I.; Jaroszeski, Mark; Ness, Gene C.

    2009-07-31

    The promoter elements and transcription factors necessary for triiodothyronine (T{sub 3}) induction of hepatic HMG-CoA reductase (HMGR) were investigated by transfecting rat livers with wild type and mutant HMGR promoter-luciferase constructs using in vivo electroporation. Mutations in the sterol response element (SRE), nuclear factor-y (NF-Y) site, and the newly identified upstream transcription factor-2 (USF-2) site essentially abolished the T{sub 3} response. Chromatin immunoprecipitation (ChIP) analysis demonstrated that T{sub 3} treatment caused a 4-fold increase in in vivo binding of USF-2 to the HMGR promoter. Co-transfection of the wild type HMGR promoter with siRNAs to USF-2, SREBP-2, or NF-Y nearly abolished the T{sub 3} induction, as measured by promoter activity. These data provide in vivo evidence for functional roles for USF-2, SREBP-2, and NF-Y in mediating the T{sub 3}-induction of hepatic HMGR transcription.

  6. Urokinase-type Plasminogen Activator (uPA) Promotes Angiogenesis by Attenuating Proline-rich Homeodomain Protein (PRH) Transcription Factor Activity and De-repressing Vascular Endothelial Growth Factor (VEGF) Receptor Expression.

    PubMed

    Stepanova, Victoria; Jayaraman, Padma-Sheela; Zaitsev, Sergei V; Lebedeva, Tatiana; Bdeir, Khalil; Kershaw, Rachael; Holman, Kelci R; Parfyonova, Yelena V; Semina, Ekaterina V; Beloglazova, Irina B; Tkachuk, Vsevolod A; Cines, Douglas B

    2016-07-15

    Urokinase-type plasminogen activator (uPA) regulates angiogenesis and vascular permeability through proteolytic degradation of extracellular matrix and intracellular signaling initiated upon its binding to uPAR/CD87 and other cell surface receptors. Here, we describe an additional mechanism by which uPA regulates angiogenesis. Ex vivo VEGF-induced vascular sprouting from Matrigel-embedded aortic rings isolated from uPA knock-out (uPA(-/-)) mice was impaired compared with vessels emanating from wild-type mice. Endothelial cells isolated from uPA(-/-) mice show less proliferation and migration in response to VEGF than their wild type counterparts or uPA(-/-) endothelial cells in which expression of wild type uPA had been restored. We reported previously that uPA is transported from cell surface receptors to nuclei through a mechanism that requires its kringle domain. Intranuclear uPA modulates gene transcription by binding to a subset of transcription factors. Here we report that wild type single-chain uPA, but not uPA variants incapable of nuclear transport, increases the expression of cell surface VEGF receptor 1 (VEGFR1) and VEGF receptor 2 (VEGFR2) by translocating to the nuclei of ECs. Intranuclear single-chain uPA binds directly to and interferes with the function of the transcription factor hematopoietically expressed homeodomain protein or proline-rich homeodomain protein (HHEX/PRH), which thereby lose their physiologic capacity to repress the activity of vehgr1 and vegfr2 gene promoters. These studies identify uPA-dependent de-repression of vegfr1 and vegfr2 gene transcription through binding to HHEX/PRH as a novel mechanism by which uPA mediates the pro-angiogenic effects of VEGF and identifies a potential new target for control of pathologic angiogenesis. PMID:27151212

  7. How Intrinsic Molecular Dynamics Control Intramolecular Communication in Signal Transducers and Activators of Transcription Factor STAT5

    PubMed Central

    Langenfeld, Florent; Guarracino, Yann; Arock, Michel; Trouvé, Alain; Tchertanov, Luba

    2015-01-01

    Signal Transducer and Activator of Transcription STAT5 is a key mediator of cell proliferation, differentiation and survival. While STAT5 activity is tightly regulated in normal cells, its constitutive activation directly contributes to oncogenesis and is associated with a broad range of hematological and solid tumor cancers. Therefore the development of compounds able to modulate pathogenic activation of this protein is a very challenging endeavor. A crucial step of drug design is the understanding of the protein conformational features and the definition of putative binding site(s) for such modulators. Currently, there is no structural data available for human STAT5 and our study is the first footprint towards the description of structure and dynamics of this protein. We investigated structural and dynamical features of the two STAT5 isoforms, STAT5a and STAT5b, taken into account their phosphorylation status. The study was based on the exploration of molecular dynamics simulations by different analytical methods. Despite the overall folding similarity of STAT5 proteins, the MD conformations display specific structural and dynamical features for each protein, indicating first, sequence-encoded structural properties and second, phosphorylation-induced effects which contribute to local and long-distance structural rearrangements interpreted as allosteric event. Further examination of the dynamical coupling between distant sites provides evidence for alternative profiles of the communication pathways inside and between the STAT5 domains. These results add a new insight to the understanding of the crucial role of intrinsic molecular dynamics in mediating intramolecular signaling in STAT5. Two pockets, localized in close proximity to the phosphotyrosine-binding site and adjacent to the channel for communication pathways across STAT5, may constitute valid targets to develop inhibitors able to modulate the function-related communication properties of this signaling

  8. Prostaglandin F2a activates stress response signaling and induces expression of activating transcription factor 3 (ATF3) in bovine large luteal cells

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The pulsatile uterine secretion of prostaglandin F2 alpha (PGF) triggers the regression of the corpus luteum (CL). Recent studies have explored global changes in gene expression in response to PGF that may contribute to structural and functional regression of the CL. Activating transcription facto...

  9. Phosphorylation at threonine-235 by a ras-dependent mitogen-activated protein kinase cascade is essential for transcription factor NF-IL6.

    PubMed Central

    Nakajima, T; Kinoshita, S; Sasagawa, T; Sasaki, K; Naruto, M; Kishimoto, T; Akira, S

    1993-01-01

    NF-IL6, a member of the basic leucine zipper (bZIP) family transcription factors, is involved in expression of inducible genes involved in immune and inflammatory responses. We observed that coexpression of oncogenic p21ras stimulated the transactivating activity of NF-IL6 and induced phosphorylation of Thr-235 located just N-terminal to the DNA binding domain of NF-IL6. Recently, mitogen-activated protein (MAP) kinases have been shown to be implicated in the cellular response to activated ras. Purified MAP kinases specifically phosphorylated Thr-235 of NF-IL6 in vitro. Mutation of Thr-235 abolished the ras-dependent activation of NF-IL6. From these results, we conclude that NF-IL6 is regulated through phosphorylation by MAP kinases in response to activated ras. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 PMID:8384717

  10. trans activation of the simian virus 40 late promoter by large T antigen requires binding sites for the cellular transcription factor TEF-1.

    PubMed Central

    Casaz, P; Sundseth, R; Hansen, U

    1991-01-01

    Simian virus 40 (SV40) T antigen stimulates the level of transcription from several RNA polymerase II promoters, including the SV40 late promoter. The mechanism of trans activation appears to be indirect since binding of T antigen to specific DNA sequences is not required. However, specific promoter elements that respond to T antigen have not previously been defined. We identified DNA sequences from the SV40 late promoter whose ability to stimulate transcription is induced by the expression of T antigen. In particular, the Sph I + II motifs of the SV40 enhancer can confer T-antigen inducibility to the normally uninducible herpes simplex virus thymidine kinase gene promoter when multiple copies of the sequence are inserted 5' of the transcription initiation site and TATA sequence. Binding sites for the cellular transcription factor TEF-1 and octamer binding proteins are contained within the Sph I + II motifs, as well as at other positions in the SV40 promoter. To study the role of individual protein-binding sites in trans activation by T antigen, mutations were constructed in various TEF-1 and octamer protein-binding sites of the SV40 late promoter. These mutations did not significantly affect basal promoter activity. However, mutation of all three TEF-1 sites prevented detectable activation by T antigen. DNase I footprinting of the mutated promoters with purified proteins demonstrated that inducibility by T antigen correlated with binding affinity of TEF-1 for the DNA and not with binding affinity of an octamer binding protein. Images PMID:1658359

  11. The Arabidopsis GRAS Protein SCL14 Interacts with Class II TGA Transcription Factors and Is Essential for the Activation of Stress-Inducible Promoters[C][W

    PubMed Central

    Fode, Benjamin; Siemsen, Tanja; Thurow, Corinna; Weigel, Ralf; Gatz, Christiane

    2008-01-01

    The plant signaling molecule salicylic acid (SA) and/or xenobiotic chemicals like the auxin mimic 2,4-D induce transcriptional activation of defense- and stress-related genes that contain activation sequence-1 (as-1)–like cis-elements in their promoters. as-1–like sequences are recognized by basic/leucine zipper transcription factors of the TGA family. Expression of genes related to the SA-dependent defense program systemic acquired resistance requires the TGA-interacting protein NPR1. However, a number of as-1–containing promoters can be activated independently from NPR1. Here, we report the identification of Arabidopsis thaliana SCARECROW-like 14 (SCL14), a member of the GRAS family of regulatory proteins, as a TGA-interacting protein that is required for the activation of TGA-dependent but NPR1-independent SA- and 2,4-D–inducible promoters. Chromatin immunoprecipitation experiments revealed that class II TGA factors TGA2, TGA5, and/or TGA6 are needed to recruit SCL14 to promoters of selected SCL14 target genes identified by whole-genome transcript profiling experiments. The coding regions and the expression profiles of the SCL14-dependent genes imply that they might be involved in the detoxification of xenobiotics and possibly endogenous harmful metabolites. Consistently, plants ectopically expressing SCL14 showed increased tolerance to toxic doses of the chemicals isonicotinic acid and 2,4,6-triiodobenzoic acid, whereas the scl14 and the tga2 tga5 tga6 mutants were more susceptible. Hence, the TGA/SCL14 complex seems to be involved in the activation of a general broad-spectrum detoxification network upon challenge of plants with xenobiotics. PMID:18984675

  12. Krüppel-like Factor 6 Is a Co-activator of NF-κB That Mediates p65-dependent Transcription of Selected Downstream Genes*

    PubMed Central

    Zhang, Yu; Lei, Cao-Qi; Hu, Yun-Hong; Xia, Tian; Li, Mi; Zhong, Bo; Shu, Hong-Bing

    2014-01-01

    The transcription factor NF-κB plays a pivotal role in a broad range of physiological and pathological processes, including development, inflammation, and immunity. How NF-κB integrates activating signals to expression of specific sets of target genes is of great interest. Here, we identified Krüppel-like factor 6 (KLF6) as a co-activator of NF-κB after TNFα and IL-1β stimulation. Overexpression of KLF6 enhanced TNFα- and IL-1β-induced activation of NF-κB and transcription of a subset of downstream genes, whereas knockdown of KLF6 had opposite effects. KLF6 interacted with p65 in the nucleus and bound to the promoters of target genes. Upon IL-1β stimulation, KLF6 was recruited to promoters of a subset of NF-κB target genes in a p65-dependent manner, which was in turn required for the optimal binding of p65 to the target gene promoters. Our findings thus identified KLF6 as a previously unknown but essential co-activator of NF-κB and provided new insight into the molecular regulation of p65-dependent gene expression. PMID:24634218

  13. ACE1, a copper-dependent transcription factor, activates expression of the yeast copper, zinc superoxide dismutase gene.

    PubMed Central

    Gralla, E B; Thiele, D J; Silar, P; Valentine, J S

    1991-01-01

    Copper, zinc superoxide dismutase (SOD1 gene product) (superoxide:superoxide oxidoreductase, EC 1.15.1.1) is a copper-containing enzyme that functions to prevent oxygen toxicity. In the yeast Saccharomyces cerevisiae, copper levels exert some control over the level of SOD1 expression. We show that the ACE1 transcriptional activator protein, which is responsible for the induction of yeast metallothionein (CUP1) in response to copper, also controls the SOD1 response to copper. A single binding site for ACE1 is present in the SOD1 promoter region, as demonstrated by DNase I protection and methylation interference experiments, and is highly homologous to a high-affinity ACE1 binding site in the CUP1 promoter. The functional importance of this DNA-protein interaction is demonstrated by the facts that (i) copper induction of SOD1 mRNA does not occur in a strain lacking ACE1 and (ii) it does not occur in a strain containing a genetically engineered SOD1 promoter that lacks a functional ACE1 binding site. Images PMID:1924315

  14. Beyond microarrays: Finding key transcription factors controlling signal transduction pathways

    PubMed Central

    Kel, Alexdander; Voss, Nico; Jauregui, Ruy; Kel-Margoulis, Olga; Wingender, Edgar

    2006-01-01

    Background Massive gene expression changes in different cellular states measured by microarrays, in fact, reflect just an "echo" of real molecular processes in the cells. Transcription factors constitute a class of the regulatory molecules that typically require posttranscriptional modifications or ligand binding in order to exert their function. Therefore, such important functional changes of transcription factors are not directly visible in the microarray experiments. Results We developed a novel approach to find key transcription factors that may explain concerted expression changes of specific components of the signal transduction network. The approach aims at revealing evidence of positive feedback loops in the signal transduction circuits through activation of pathway-specific transcription factors. We demonstrate that promoters of genes encoding components of many known signal transduction pathways are enriched by binding sites of those transcription factors that are endpoints of the considered pathways. Application of the approach to the microarray gene expression data on TNF-alpha stimulated primary human endothelial cells helped to reveal novel key transcription factors potentially involved in the regulation of the signal transduction pathways of the cells. Conclusion We developed a novel computational approach for revealing key transcription factors by knowledge-based analysis of gene expression data with the help of databases on gene regulatory networks (TRANSFAC® and TRANSPATH®). The corresponding software and databases are available at . PMID:17118134

  15. The human papillomavirus type 16 E7 gene product interacts with and trans-activates the AP1 family of transcription factors.

    PubMed Central

    Antinore, M J; Birrer, M J; Patel, D; Nader, L; McCance, D J

    1996-01-01

    The E7 gene product of human papillomavirus type 16 (HPV16) binds to the retinoblastoma gene product (pRb) and dissociates pRb-E2F complexes. However, the observation that the ability of E7 to bind pRb is not required for the HPV16-induced immortalization of primary keratinocytes prompted a search for other cellular factors bound by E7. Using a glutathione-S-transferase (GST) fusion protein system, we show that E7 complexes with AP1 transcription factors including c-Jun, JunB, JunD and c-Fos. The ability of E7 to complex with c-Jun in vivo is demonstrated by co-immunoprecipitation and the yeast two-hybrid system. An analysis of E7 point mutants in the GST system indicates that the E7 zinc-finger motif, but not the pRb binding domain, is involved in these interactions. Using c-Jun deletion mutants, E7 binding maps between amino acids 224 and 286 of c-Jun. E7 trans-activates c-Jun-induced transcription from a Jun responsive promoter, and this activity correlates with the ability of E7 mutants to bind Jun proteins. Finally, a transcriptionally inactive c-Jun deletion, which can bind E7, interferes with the E7-induced transformation of rat embryo fibroblasts in cooperation with an activated ras, indicating that the Jun-E7 interaction is physiologically relevant and that Jun factors may be targeted in the E7 transformation pathway. Images PMID:8617242

  16. Induction of Fibronectin Adhesins in Quinolone-Resistant Staphylococcus aureus by Subinhibitory Levels of Ciprofloxacin or by Sigma B Transcription Factor Activity Is Mediated by Two Separate Pathways

    PubMed Central

    Li, Dongmei; Renzoni, Adriana; Estoppey, Tristan; Bisognano, Carmelo; Francois, Patrice; Kelley, William L.; Lew, Daniel P.; Schrenzel, Jacques; Vaudaux, Pierre

    2005-01-01

    We recently reported on the involvement of a RecA-LexA-dependent pathway in the ciprofloxacin-triggered upregulation of fibronectin-binding proteins (FnBPs) by fluoroquinolone-resistant Staphylococcus aureus. The potential additional contribution of the transcription factor sigma B (SigB) to the ciprofloxacin-triggered upregulation of FnBPs was studied in isogenic mutants of fluoroquinolone-resistant strain RA1 (a topoisomerase IV gyrase double mutant of S. aureus NCTC strain 8325), which exhibited widely different levels of SigB activity, as assessed by quantitative reverse transcription-PCR of their respective sigB and SigB-dependent asp23 transcript levels. These mutants were Tn551 insertion sigB strain TE1 and rsbU+ complemented strain TE2, which exhibited a wild-type SigB operon. Levels of FnBP surface display and fibronectin-mediated adhesion were lower in sigB mutant TE1 or higher in the rsbU+-restored strain TE2 compared to their sigB+ but rsbU parent, strain RA1, exhibiting low levels of SigB activity. Steady-state fnbA and fnbB transcripts levels were similar in strains TE1 and RA1 but increased by 4- and 12-fold, respectively, in strain TE2 compared to those in strain RA1. In contrast, fibronectin-mediated adhesion of strains TE1, RA1, and TE2 was similarly enhanced by growth in the presence of one-eighth the MIC of ciprofloxacin, which led to a significantly higher increase in their fnbB transcript levels compared to the increase in their fnbA transcript levels. Increased SigB levels led to a significant reduction in agr RNAIII; in contrast, it led to a slight increase in sarA transcript levels. In conclusion, upregulation of FnBPs by increased SigB levels and ciprofloxacin exposure in fluoroquinolone-resistant S. aureus occurs via independent pathways whose concerted actions may significantly promote bacterial adhesion and colonization. PMID:15728884

  17. Modulation of the activity of Sp transcription factors by mithramycin analogues as a new strategy for treatment of metastatic prostate cancer.

    PubMed

    Malek, Anastasia; Núñez, Luz-Elena; Magistri, Marco; Brambilla, Lara; Jovic, Sandra; Carbone, Giuseppina M; Morís, Francisco; Catapano, Carlo V

    2012-01-01

    Deregulated activity of transcription factors (TFs) of the Sp/KLF family, like Sp1, Sp3 and Sp4, and consequent over-expression of Sp-regulated genes occur frequently in human cancers. This provides the rationale for development of inhibitors of Sp TFs as cancer therapeutics. Mithramycin A (MTM-A) is a natural polyketide that binds GC-rich DNA sequences, inhibits activity of Sp TFs and exhibits potent antitumor activity in experimental systems. However, clinical use of MTM-A is limited by the severe toxicity of the compound. Here, we studied two MTM-A analogues, which had been generated by genetically engineering of the MTM-A biosynthetic pathway, and evaluated their activity in human prostate cancer in cell cultures and mouse models. The compounds, named MTM-SDK and MTM-SK, were highly effective in vitro inhibiting proliferation of prostate cancer cells and transcription of Sp-regulated genes by blocking binding of Sp proteins to the gene promoters. When administered to mice, both compounds were well tolerated with maximum tolerated doses of MTM-SDK and MTM-SK, respectively, 4- and 32- fold higher than MTM-A. After systemic administration, both compounds were cleared rapidly from the bloodstream but maintained plasma levels well above the active concentrations required in vitro for inhibition of Sp TF activity and cell proliferation. Consistently, MTM-SDK and MTM-SK inhibited transcription of Sp-regulated genes in prostate tumor xenografts and exhibited potent antitumor activity in subcutaneous and metastatic tumor xenograft models with no or minimal toxicity. Taken together, these data indicate that MTM-SDK and MTM-SK possess significantly improved pharmacological and toxicological properties compared to MTM-A and represent promising drugs for treatment of advanced prostate cancer. PMID:22545098

  18. The Activity of the Pseudomonas aeruginosa Virulence Regulator σ(VreI) Is Modulated by the Anti-σ Factor VreR and the Transcription Factor PhoB.

    PubMed

    Quesada, Jose M; Otero-Asman, Joaquín R; Bastiaansen, Karlijn C; Civantos, Cristina; Llamas, María A

    2016-01-01

    Gene regulation in bacteria is primarily controlled at the level of transcription initiation by modifying the affinity of the RNA polymerase (RNAP) for the promoter. This control often occurs through the substitution of the RNAP sigma (σ) subunit. Next to the primary σ factor, most bacteria contain a variable number of alternative σ factors of which the extracytoplasmic function group (σ(ECF)) is predominant. Pseudomonas aeruginosa contains nineteen σ(ECF), including the virulence regulator σ(VreI). σ(VreI) is encoded by the vreAIR operon, which also encodes a receptor-like protein (VreA) and an anti-σ factor (VreR). These three proteins form a signal transduction pathway known as PUMA3, which controls expression of P. aeruginosa virulence functions. Expression of the vreAIR operon occurs under inorganic phosphate (Pi) limitation and requires the PhoB transcription factor. Intriguingly, the genes of the σ(VreI) regulon are also expressed in low Pi despite the fact that the σ(VreI) repressor, the anti-σ factor VreR, is also produced in this condition. Here we show that although σ(VreI) is partially active under Pi starvation, maximal transcription of the σ(VreI) regulon genes requires the removal of VreR. This strongly suggests that an extra signal, probably host-derived, is required in vivo for full σ(VreI) activation. Furthermore, we demonstrate that the activity of σ(VreI) is modulated not only by VreR but also by the transcription factor PhoB. Presence of this regulator is an absolute requirement for σ(VreI) to complex the DNA and initiate transcription of the PUMA3 regulon. The potential DNA binding sites of these two proteins, which include a pho box and -10 and -35 elements, are proposed. PMID:27536271

  19. The Activity of the Pseudomonas aeruginosa Virulence Regulator σVreI Is Modulated by the Anti-σ Factor VreR and the Transcription Factor PhoB

    PubMed Central

    Quesada, Jose M.; Otero-Asman, Joaquín R.; Bastiaansen, Karlijn C.; Civantos, Cristina; Llamas, María A.

    2016-01-01

    Gene regulation in bacteria is primarily controlled at the level of transcription initiation by modifying the affinity of the RNA polymerase (RNAP) for the promoter. This control often occurs through the substitution of the RNAP sigma (σ) subunit. Next to the primary σ factor, most bacteria contain a variable number of alternative σ factors of which the extracytoplasmic function group (σECF) is predominant. Pseudomonas aeruginosa contains nineteen σECF, including the virulence regulator σVreI. σVreI is encoded by the vreAIR operon, which also encodes a receptor-like protein (VreA) and an anti-σ factor (VreR). These three proteins form a signal transduction pathway known as PUMA3, which controls expression of P. aeruginosa virulence functions. Expression of the vreAIR operon occurs under inorganic phosphate (Pi) limitation and requires the PhoB transcription factor. Intriguingly, the genes of the σVreI regulon are also expressed in low Pi despite the fact that the σVreI repressor, the anti-σ factor VreR, is also produced in this condition. Here we show that although σVreI is partially active under Pi starvation, maximal transcription of the σVreI regulon genes requires the removal of VreR. This strongly suggests that an extra signal, probably host-derived, is required in vivo for full σVreI activation. Furthermore, we demonstrate that the activity of σVreI is modulated not only by VreR but also by the transcription factor PhoB. Presence of this regulator is an absolute requirement for σVreI to complex the DNA and initiate transcription of the PUMA3 regulon. The potential DNA binding sites of these two proteins, which include a pho box and −10 and −35 elements, are proposed. PMID:27536271

  20. Role of transcription factors in peripheral nerve regeneration.

    PubMed

    Patodia, Smriti; Raivich, Gennadij

    2012-01-01

    Following axotomy, the activation of multiple intracellular signaling cascades causes the expression of a cocktail of regeneration-associated transcription factors which interact with each other to determine the fate of the injured neurons. The nerve injury response is channeled through manifold and parallel pathways, integrating diverse inputs, and controlling a complex transcriptional output. Transcription factors form a vital link in the chain of regeneration, converting injury-induced stress signals into downstream protein expression via gene regulation. They can regulate the intrinsic ability of axons to grow, by controlling expression of whole cassettes of gene targets. In this review, we have investigated the functional roles of a number of different transcription factors - c-Jun, activating transcription factor 3, cAMP response element binding protein, signal transducer, and activator of transcription-3, CCAAT/enhancer binding proteins β and δ, Oct-6, Sox11, p53, nuclear factor kappa-light-chain-enhancer of activated B cell, and ELK3 - in peripheral nerve regeneration. Studies involving use of conditional mutants, microarrays, promoter region mapping, and different injury paradigms, have enabled us to understand their distinct as well as overlapping roles in achieving anatomical and functional regeneration after peripheral nerve injury. PMID:22363260

  1. Chicken ovalbumin upstream-promoter transcription factor (COUP-TF) could act as a transcriptional activator or repressor of the mitochondrial 3-hydroxy-3-methylglutaryl-CoA synthase gene.

    PubMed Central

    Rodríguez, J C; Ortiz, J A; Hegardt, F G; Haro, D

    1997-01-01

    The chicken ovalbumin upstream-promoter transcription factor (COUP-TF) has a dual effect on the regulation of the mitochondrial 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA) synthase gene. COUP-TF could act as a transcriptional activator or repressor of this gene through different DNA sequences. COUP-TF induces expression of a reporter gene linked to the mitochondrial HMG-CoA synthase gene promoter in human hepatoma HepG2 cells, but represses it in a Leydig tumour cell line (R2C); in both these cell lines the expression of the mitochondrial HMG-CoA synthase gene mimics that of liver and testis. The activation is promoted by a fragment of the gene from coordinates -62 to +28, which contains a GC box and a TATA box, and where no COUP-TF binding site was observed by in vitro DNA binding studies. On the other hand, the COUP-TF inhibitory effect is mainly due to repression of peroxisome-proliferator-activated receptor-dependent activation of the gene, interacting with the region from -104 to -92. To our knowledge this work represents the second example of a target gene for COUP-TF I that could be either activated or repressed by the action of this receptor through different DNA sequences of the same gene. PMID:9291136

  2. A factor that positively regulates cell division by activating transcription of the major cluster of essential cell division genes of Escherichia coli.

    PubMed Central

    Wang, X D; de Boer, P A; Rothfield, L I

    1991-01-01

    Cell division in Escherichia coli requires the products of the ftsQ, ftsA and ftsZ genes. It is not known how the cell regulates the cellular concentrations of these essential elements of the division system. We describe here a factor that activates cell division by specifically increasing transcription from one of the two promoters that lie immediately upstream of the ftsQAZ gene cluster. The trans-acting factor is the product of the sdiA gene, which was isolated on the basis of its ability to suppress the division inhibitory effect of the MinC/MinD division inhibitor. In addition, the sdiA gene product suppressed the action of other chromosomally encoded division inhibitors, induced minicell formation in wild type cells, and restored division activity to an ftsZ temperature-sensitive mutant grown under nonpermissive conditions. All of these properties were explained by the ability of the sdiA gene product specifically to increase transcription of the ftsQAZ gene cluster, resulting in an increase in cellular concentration of the FtsZ protein. The sdiA gene product is the first factor thus far identified that specifically regulates expression of this key group of cell division genes. Images PMID:1915297

  3. The Chromatin Regulator DMAP1 Modulates Activity of the Nuclear Factor κB (NF-κB) Transcription Factor Relish in the Drosophila Innate Immune Response*

    PubMed Central

    Goto, Akira; Fukuyama, Hidehiro; Imler, Jean-Luc; Hoffmann, Jules A.

    2014-01-01

    The host defense of the model organism Drosophila is under the control of two major signaling cascades controlling transcription factors of the NF-κB family, the Toll and the immune deficiency (IMD) pathways. The latter shares extensive similarities with the mammalian TNF-R pathway and was initially discovered for its role in anti-Gram-negative bacterial reactions. A previous interactome study from this laboratory reported that an unexpectedly large number of proteins are binding to the canonical components of the IMD pathway. Here, we focus on DNA methyltransferase-associated protein 1 (DMAP1), which this study identified as an interactant of Relish, a Drosophila transcription factor reminiscent of the mammalian p105 NF-κB protein. We show that silencing of DMAP1 expression both in S2 cells and in flies results in a significant reduction of Escherichia coli-induced expression of antimicrobial peptides. Epistatic analysis indicates that DMAP1 acts in parallel or downstream of Relish. Co-immunoprecipitation experiments further reveal that, in addition to Relish, DMAP1 also interacts with Akirin and the Brahma-associated protein 55 kDa (BAP55). Taken together, these results reveal that DMAP1 is a novel nuclear modulator of the IMD pathway, possibly acting at the level of chromatin remodeling. PMID:24947515

  4. The chromatin regulator DMAP1 modulates activity of the nuclear factor B (NF-B) transcription factor Relish in the Drosophila innate immune response.

    PubMed

    Goto, Akira; Fukuyama, Hidehiro; Imler, Jean-Luc; Hoffmann, Jules A

    2014-07-25

    The host defense of the model organism Drosophila is under the control of two major signaling cascades controlling transcription factors of the NF-B family, the Toll and the immune deficiency (IMD) pathways. The latter shares extensive similarities with the mammalian TNF-R pathway and was initially discovered for its role in anti-Gram-negative bacterial reactions. A previous interactome study from this laboratory reported that an unexpectedly large number of proteins are binding to the canonical components of the IMD pathway. Here, we focus on DNA methyltransferase-associated protein 1 (DMAP1), which this study identified as an interactant of Relish, a Drosophila transcription factor reminiscent of the mammalian p105 NF-B protein. We show that silencing of DMAP1 expression both in S2 cells and in flies results in a significant reduction of Escherichia coli-induced expression of antimicrobial peptides. Epistatic analysis indicates that DMAP1 acts in parallel or downstream of Relish. Co-immunoprecipitation experiments further reveal that, in addition to Relish, DMAP1 also interacts with Akirin and the Brahma-associated protein 55 kDa (BAP55). Taken together, these results reveal that DMAP1 is a novel nuclear modulator of the IMD pathway, possibly acting at the level of chromatin remodeling. PMID:24947515

  5. The transcriptional corepressor DSP1 inhibits activated transcription by disrupting TFIIA-TBP complex formation.

    PubMed Central

    Kirov, N C; Lieberman, P M; Rushlow, C

    1996-01-01

    Transcriptional repression of eukaryotic genes is essential for many cellular and developmental processes, yet the precise mechanisms of repression remain poorly understood. The Dorsal Switch Protein (DSP1) was identified in a genetic screen for activities which convert Dorsal into a transcriptional repressor. DSP1 shares structural homology with the HMG-1/2 family and inhibits activation by the rel transcription factors Dorsal and NF-kappaB in transfection studies. Here we investigate the mechanism of transcriptional repression by DSP1. We found that DSP1 protein can act as a potent transcriptional repressor for multiple activator families in vitro and in transfection studies. DSP1 bound directly to the TATA binding protein (TBP), and formed a stable ternary complex with TBP bound to DNA. DSP1 preferentially disrupted the DNA binding of TBP complexes containing TFIIA and displaced TFIIA from binding to TBP. Consistent with the inhibition of TFIIA-bound complexes, DSP1 was shown to inhibit activated but not basal transcription reactions in vitro. The ability of DSP1 to interact with TBP and to repress transcription was mapped to the carboxy-terminal domain which contains two HMG boxes. Our results support the model that DSP1 represses activated transcription by interfering with the binding of TFIIA, a general transcription factor implicated in activated transcription pathways. Images PMID:9003783

  6. Effect of Target Therapy on the Content of Transcription and Growth Factors, Protein Kinase TOR, and Activity of Intracellular Proteases in Patients with Metastatic Renal Cell Carcinoma.

    PubMed

    Spirina, L V; Usynin, E A; Kondakova, I V; Yurmazov, Z A; Slonimskaya, E M

    2016-04-01

    We analyzed the dynamics of the expression of transcription factors, VEGF and its receptor VEGFR2, serine-threonine protein kinase mTOR and activity of proteasome and calpain in patients with metastatic renal cancer during therapy with tyrosine kinase inhibitor Votrient and mTOR blocker Afinitor. The expression of hypoxic nuclear factor HIF-1α in the tumor tissue decreased during therapy with the target preparations. The decrease of VEGF and its receptor VEGFR2 was observed only in patients treated with mTOR inhibitor. The increase in calpain activity in the tumor tissue was observed in both groups. These findings extend our understanding of the mechanism of action of target anticancer preparations as allow considering the studied markers as predictors in choosing optimal therapy. PMID:27165064

  7. Discovery of Orally Available Runt-Related Transcription Factor 3 (RUNX3) Modulators for Anticancer Chemotherapy by Epigenetic Activation and Protein Stabilization.

    PubMed

    Yang, Jee Sun; Lee, Chulho; Cho, Misun; Kim, Hyuntae; Kim, Jae Hyun; Choi, Seonghwi; Oh, Soo Jin; Kang, Jong Soon; Jeong, Jin-Hyun; Kim, Hyun-Jung; Han, Gyoonhee

    2015-04-23

    Recently, we identified a novel strategy for anticancer chemotherapy by restoring runt-related transcription factor 3 (RUNX3) levels via lactam-based histone deacetylase (HDAC) inhibitors that stabilize RUNX3. Described here are the synthesis, biological evaluation, and pharmacokinetic evaluation of new synthetic small molecules based on pyridone-based HDAC inhibitors that specifically stabilize RUNX3 by acetylation and regulate its function. Many of the newly synthesized compounds showed favorable RUNX activities, HDAC inhibitory activities, and inhibitory activities on the growth of human cancer cell lines. Notably, one of these new derivatives, (E)-N-hydroxy-3-(2-oxo-1-(quinolin-2-ylmethyl)-1,2-dihydropyridin-3-yl)acrylamide (4l), significantly restored RUNX3 in a dose-dependent manner and showed high metabolic stability, a good pharmacokinetic profile with high oral bioavailability and long half-life, and strong antitumor activity. This study suggests that pyridone-based analogues modulate RUNX3 activity through epigenetic regulation as well as strong transcriptional and post-translational regulation of RUNX3 and could be potential clinical candidates as orally available RUNX3 modulators for the treatment of cancer. PMID:25811792

  8. BjMYB1, a transcription factor implicated in plant defence through activating BjCHI1 chitinase expression by binding to a W-box-like element.

    PubMed

    Gao, Ying; Jia, Shuangwei; Wang, Chunlian; Wang, Fujun; Wang, Fajun; Zhao, Kaijun

    2016-08-01

    We previously identified the W-box-like-4 (Wbl-4) element (GTAGTGACTCAT), one of six Wbl elements in the BjC-P promoter of the unusual chitinase gene BjCHI1 from Brassica juncea, as the core element responsive to fungal infection. Here, we report the isolation and characterization of the cognate transcription factor interacting with the Wbl-4 element. Using Wbl-4 as a target, we performed yeast one-hybrid screening of a B. juncea cDNA library and isolated an R2R3-MYB transcription factor designated as BjMYB1. BjMYB1 was localized in the nucleus of plant cells. EMSA assays confirmed that BjMYB1 binds to the Wbl-4 element. Transiently expressed BjMYB1 up-regulated the activity of the BjC-P promoter through its binding to the Wbl-4 element in tobacco (Nicotiana benthamiana) leaves. In B. juncea, BjMYB1 displayed a similar induced expression pattern as that of BjCHI1 upon infection by the fungus Botrytis cinerea Moreover, heterogeneous overexpression of BjMYB1 significantly elevated the resistance of transgenic Arabidopsis thaliana to the fungus B. cinerea These results suggest that BjMYB1 is potentially involved in host defence against fungal attack through activating the expression of BjCHI1 by binding to the Wbl-4 element in the BjC-P promoter. This finding demonstrates a novel DNA target of plant MYB transcription factors. PMID:27353280

  9. Interactions of purified transcription factors: binding of yeast MAT alpha 1 and PRTF to cell type-specific, upstream activating sequences.

    PubMed Central

    Tan, S; Ammerer, G; Richmond, T J

    1988-01-01

    Pheromone receptor transcription factor (PRTF) and MAT alpha 1 are protein transcription factors that are involved in the regulation of the alpha-specific genes in Saccharomyces cerevisiae. We have expressed MAT alpha 1 as a fusion protein in Escherichia coli and purified it from inclusion bodies in milligram quantities. The MAT alpha 1 protein was obtained after specific cleavage of the fusion protein. Quantitative band shift electrophoresis was used to determine the equilibrium dissociation constants that describe the multicomponent binding equilibrium between the PRTF and MAT alpha 1 proteins, and alpha-specific STE3 upstream activating sequence (UAS) DNA. The dissociation constant for the complex of PRTF and the a-specific UAS of STE2 was also measured and found to be 5.9 X 10(-11) M, only three times less than that for the PRTF-STE3 UAS complex. Analyses of these complexes by DNase I footprinting demonstrate that the PRTF binding site is confined to the palindromic P-box sequence in the case of the STE3 UAS, but extends symmetrically from this central region to cover 28 bp for the STE2 UAS. When MAT alpha 1 is bound to the PRTF-STE3 complex, the region of DNA protected is enlarged to that seen for the PRTF-STE2 complex. Our results using these two purified factors in vitro suggest that PRTF has nearly the same affinity for a- and alpha-specific UAS elements and that transcriptional activation requires a particular conformational state for the PRTF-DNA complex which occurs in the PRTF-STE2 and MAT alpha 1-PRTF-STE3 complexes, but not in the PRTF-STE3 complex. Images PMID:2854061

  10. BjMYB1, a transcription factor implicated in plant defence through activating BjCHI1 chitinase expression by binding to a W-box-like element

    PubMed Central

    Gao, Ying; Jia, Shuangwei; Wang, Chunlian; Wang, Fujun; Wang, Fajun; Zhao, Kaijun

    2016-01-01

    We previously identified the W-box-like-4 (Wbl-4) element (GTAGTGACTCAT), one of six Wbl elements in the BjC-P promoter of the unusual chitinase gene BjCHI1 from Brassica juncea, as the core element responsive to fungal infection. Here, we report the isolation and characterization of the cognate transcription factor interacting with the Wbl-4 element. Using Wbl-4 as a target, we performed yeast one-hybrid screening of a B. juncea cDNA library and isolated an R2R3-MYB transcription factor designated as BjMYB1. BjMYB1 was localized in the nucleus of plant cells. EMSA assays confirmed that BjMYB1 binds to the Wbl-4 element. Transiently expressed BjMYB1 up-regulated the activity of the BjC-P promoter through its binding to the Wbl-4 element in tobacco (Nicotiana benthamiana) leaves. In B. juncea, BjMYB1 displayed a similar induced expression pattern as that of BjCHI1 upon infection by the fungus Botrytis cinerea. Moreover, heterogeneous overexpression of BjMYB1 significantly elevated the resistance of transgenic Arabidopsis thaliana to the fungus B. cinerea. These results suggest that BjMYB1 is potentially involved in host defence against fungal attack through activating the expression of BjCHI1 by binding to the Wbl-4 element in the BjC-P promoter. This finding demonstrates a novel DNA target of plant MYB transcription factors. PMID:27353280

  11. Melanin biosynthesis in the maize pathogen Cochliobolus heterostrophus depends on two mitogen-activated protein kinases, Chk1 and Mps1, and the transcription factor Cmr1.

    PubMed

    Eliahu, Noa; Igbaria, Aeid; Rose, Mark S; Horwitz, Benjamin A; Lev, Sophie

    2007-03-01

    The maize pathogen Cochliobolus heterostrophus requires two mitogen-activated protein kinases (MAPKs), Chk1 and Mps1, to produce normal pigmentation. Young colonies of mps1 and chk1 deletion mutants have a white and autolytic appearance, which was partially rescued by a hyperosmotic environment. We isolated the transcription factor Cmr1, an ortholog of Colletotrichum lagenarium Cmr1 and Magnaporthe grisea Pig1, which regulates melanin biosynthesis in C. heterostrophus. Deletion of CMR1 in C. heterostrophus resulted in mutants that lacked dark pigmentation and acquired an orange-pink color. In cmr1 deletion strains the expression of putative scytalone dehydratase (SCD1) and hydroxynaphthalene reductase (BRN1 and BRN2) genes involved in melanin biosynthesis was undetectable, whereas expression of PKS18, encoding a polyketide synthase, was only moderately reduced. In chk1 and mps1 mutants expression of PKS18, SCD1, BRN1, BRN2, and the transcription factor CMR1 itself was very low in young colonies, slightly up-regulated in aging colonies, and significantly induced in hyperosmotic conditions, compared to invariably high expression in the wild type. These findings indicate that two MAPKs, Chk1 and Mps1, affect Cmr1 at the transcriptional level and this influence is partially overridden in stress conditions including aging culture and hyperosmotic environment. Surprisingly, we found that the CMR1 gene was transcribed in both sense and antisense directions, apparently producing mRNA as well as a long noncoding RNA transcript. Expression of the antisense CMR1 was also Chk1 and Mps1 dependent. Analysis of chromosomal location of the melanin biosynthesis genes in C. heterostrophus resulted in identification of a small gene cluster comprising BRN1, CMR1, and PKS18. Since expression of all three genes depends on Chk1 and Mps1 MAPKs, we suggest their possible epigenetic regulation. PMID:17237364

  12. Targeting transcription factor STAT3 for cancer prevention and therapy.

    PubMed

    Chai, Edna Zhi Pei; Shanmugam, Muthu K; Arfuso, Frank; Dharmarajan, Arunasalam; Wang, Chao; Kumar, Alan Prem; Samy, Ramar Perumal; Lim, Lina H K; Wang, Lingzhi; Goh, Boon Cher; Ahn, Kwang Seok; Hui, Kam Man; Sethi, Gautam

    2016-06-01

    Signal Transducers and Activators of Transcription (STATs) comprise an important class of transcription factors that have been implicated in a wide variety of essential cellular functions related to proliferation, survival, and angiogenesis. Among various STAT members, STAT3 is frequently overexpressed in tumor cells as well as tissue samples, and regulates the expression of numerous oncogenic genes controlling the growth and metastasis of tumor cells. The current review briefly discusses the importance of STAT3 as a potential target for cancer therapy and also provides novel insights into various classes of existing pharmacological inhibitors of this transcription factor that can be potentially developed as anti-cancer drugs. PMID:26478441

  13. Ab Initio Prediction of Transcription Factor Targets Using Structural Knowledge

    PubMed Central

    Kaplan, Tommy; Friedman, Nir; Margalit, Hanah

    2005-01-01

    Current approaches for identification and detection of transcription factor binding sites rely on an extensive set of known target genes. Here we describe a novel structure-based approach applicable to transcription factors with no prior binding data. Our approach combines sequence data and structural information to infer context-specific amino acid–nucleotide recognition preferences. These are used to predict binding sites for novel transcription factors from the same structural family. We demonstrate our approach on the Cys2His2 Zinc Finger protein family, and show that the learned DNA-recognition preferences are compatible with experimental results. We use these preferences to perform a genome-wide scan for direct targets of Drosophila melanogaster Cys2His2 transcription factors. By analyzing the predicted targets along with gene annotation and expression data we infer the function and activity of these proteins. PMID:16103898

  14. 2-Methoxystypandrone inhibits signal transducer and activator of transcription 3 and nuclear factor-κB signaling by inhibiting Janus kinase 2 and IκB kinase.

    PubMed

    Kuang, Shan; Qi, Chunting; Liu, Jiawei; Sun, Xiaoxiao; Zhang, Qing; Sima, Zhenhua; Liu, Jingli; Li, Wuguo; Yu, Qiang

    2014-04-01

    Constitutive activation of the signal transducer and activator of transcription 3 (STAT3) or the nuclear factor-κB (NF-κB) pathway occurs frequently in cancer cells and contributes to oncogenesis. The activation of Janus kinase 2 (JAK2) and IκB kinase (IKK) are key events in STAT3 and NF-κB signaling, respectively. We have identified 2-methoxystypandrone (2-MS) from a traditional Chinese medicinal herb Polygonum cuspidatum as a novel dual inhibitor of JAK2 and IKK. 2-MS inhibits both interleukin-6-induced and constitutively-activated STAT3, as well as tumor necrosis factor-α-induced NF-κB activation. 2-MS specifically inhibits JAK and IKKβ kinase activities but has little effect on activities of other kinases tested. The inhibitory effects of 2-MS on STAT3 and NF-κB signaling can be eliminated by DTT or glutathione and can last for 4 h after a pulse treatment. Furthermore, 2-MS inhibits growth and induces death of tumor cells, particularly those with constitutively-activated STAT3 or NF-κB signaling. We propose that the natural compound 2-MS, as a potent dual inhibitor of STAT3 and NF-κB pathways, is a promising anticancer drug candidate. PMID:24450414

  15. Cell fate control by pioneer transcription factors.

    PubMed

    Iwafuchi-Doi, Makiko; Zaret, Kenneth S

    2016-06-01

    Distinct combinations of transcription factors are necessary to elicit cell fate changes in embryonic development. Yet within each group of fate-changing transcription factors, a subset called 'pioneer factors' are dominant in their ability to engage silent, unmarked chromatin and initiate the recruitment of other factors, thereby imparting new function to regulatory DNA sequences. Recent studies have shown that pioneer factors are also crucial for cellular reprogramming and that they are implicated in the marked changes in gene regulatory networks that occur in various cancers. Here, we provide an overview of the contexts in which pioneer factors function, how they can target silent genes, and their limitations at regions of heterochromatin. Understanding how pioneer factors regulate gene expression greatly enhances our understanding of how specific developmental lineages are established as well as how cell fates can be manipulated. PMID:27246709

  16. Activator- and repressor-type MYB transcription factors are involved in chilling injury induced flesh lignification in loquat via their interactions with the phenylpropanoid pathway.

    PubMed

    Xu, Qian; Yin, Xue-ren; Zeng, Jiao-ke; Ge, Hang; Song, Min; Xu, Chang-Jie; Li, Xian; Ferguson, Ian B; Chen, Kun-song

    2014-08-01

    Lignin biosynthesis and its transcriptional regulatory networks have been studied in model plants and woody trees. However, lignification also occurs in some fleshy fruit and has rarely been considered in this way. Loquat ( Eriobotrya japonica ) is one such convenient tissue for exploring the transcription factors involved in regulating fruit flesh lignification. Firmness and lignin content of 'Luoyangqing' loquat were fund to increase during low-temperature storage as a typical symptom of chilling injury, while heat treatment (HT) and low-temperature conditioning (LTC) effectively alleviated them. Two novel EjMYB genes, EjMYB1 and EjMYB2, were isolated and were found to be localized in the nucleus. These genes responded differently to low temperature, with EjMYB1 induced and EjMYB2 inhibited at 0 °C. They also showed different temperature responses under HT and LTC conditions, and may be responsible for different regulation of flesh lignification at the transcriptional level. Transactivation assays indicated that EjMYB1 and EjMYB2 are a transcriptional activator and repressor, respectively. EjMYB1 activated promoters of both Arabidopsis and loquat lignin biosynthesis genes, while EjMYB2 countered the inductive effects of EjMYB1. This finding was also supported by transient overexpression in tobacco. Regulation of lignification by EjMYB1 and EjMYB2 is likely to be achieved via their competitive interaction with AC elements in the promoter region of lignin biosynthesis genes such as Ej4CL1. PMID:24860186

  17. Identification of the cAMP response element that controls transcriptional activation of the insulin-like growth factor-I gene by prostaglandin E2 in osteoblasts

    NASA Technical Reports Server (NTRS)

    Thomas, M. J.; Umayahara, Y.; Shu, H.; Centrella, M.; Rotwein, P.; McCarthy, T. L.

    1996-01-01

    Insulin-like growth factor-I (IGF-I), a multifunctional growth factor, plays a key role in skeletal growth and can enhance bone cell replication and differentiation. We previously showed that prostaglandin E2 (PGE2) and other agents that increase cAMP activated IGF-I gene transcription in primary rat osteoblast cultures through promoter 1 (P1), the major IGF-I promoter, and found that transcriptional induction was mediated by protein kinase A. We now have identified a short segment of P1 that is essential for full hormonal regulation and have characterized inducible DNA-protein interactions involving this site. Transient transfections of IGF-I P1 reporter genes into primary rat osteoblasts showed that the 328-base pair untranslated region of exon 1 was required for a full 5.3-fold response to PGE2; mutation in a previously footprinted site, HS3D (base pairs +193 to +215), reduced induction by 65%. PGE2 stimulated nuclear protein binding to HS3D. Binding, as determined by gel mobility shift assay, was not seen in nuclear extracts from untreated osteoblast cultures, was detected within 2 h of PGE2 treatment, and was maximal by 4 h. This DNA-protein interaction was not observed in cytoplasmic extracts from PGE2-treated cultures, indicating nuclear localization of the protein kinase A-activated factor(s). Activation of this factor was not blocked by cycloheximide (Chx), and Chx did not impair stimulation of IGF-I gene expression by PGE2. In contrast, binding to a consensus cAMP response element (CRE; 5'-TGACGTCA-3') from the rat somatostatin gene was not modulated by PGE2 or Chx. Competition gel mobility shift analysis using mutated DNA probes identified 5'-CGCAATCG-3' as the minimal sequence needed for inducible binding. All modified IGF-I P1 promoterreporter genes with mutations within this CRE sequence also showed a diminished functional response to PGE2. These results identify the CRE within the 5'-untranslated region of IGF-I exon 1 that is required for hormonal

  18. The Histone Variant MacroH2A1.2 is Necessary for the Activation of Muscle Enhancers and Recruitment of the Transcription Factor Pbx1

    PubMed Central

    Dell’Orso, Stefania; Wang, A. Hongjun; Shih, Han-Yu; Saso, Kayoko; Berghella, Libera; Gutierrez-Cruz, Gustavo; Ladurner, Andreas G.; O’Shea, John J.; Sartorelli, Vittorio; Zare, Hossein

    2016-01-01

    SUMMARY Histone variants complement and integrate histone post-translational modifications in regulating transcription. The histone variant macroH2A1 (mH2A1) is almost three times the size of its canonical H2A counterpart due to the presence of a ~25kDa evolutionarily conserved non-histone macro domain. Strikingly, mH2A1 can mediate both gene repression and activation. However, the molecular determinants conferring these alternative functions remain elusive. Here, we report that mH2A1.2 is required for the activation of the myogenic gene regulatory network and muscle cell differentiation. H3K27 acetylation at prospective enhancers is exquisitely sensitive to mH2A1.2, indicating a role of mH2A1.2 in imparting enhancer activation. Both H3K27 acetylation and recruitment of the transcription factor Pbx1 at prospective enhancers are regulated by mH2A1.2. Overall, our findings indicate a role of mH2A1.2 in marking regulatory regions for activation. PMID:26832413

  19. PI3 Kinase and FOXO1 Transcription Factor Activity Differentially Control B Cells in the Germinal Center Light and Dark Zones.

    PubMed

    Sander, Sandrine; Chu, Van Trung; Yasuda, Tomoharu; Franklin, Andrew; Graf, Robin; Calado, Dinis Pedro; Li, Shuang; Imami, Koshi; Selbach, Matthias; Di Virgilio, Michela; Bullinger, Lars; Rajewsky, Klaus

    2015-12-15

    Phosphatidylinositol 3' OH kinase (PI3K) signaling and FOXO transcription factors play opposing roles at several B cell developmental stages. We show here abundant nuclear FOXO1 expression in the proliferative compartment of the germinal center (GC), its dark zone (DZ), and PI3K activity, downregulating FOXO1, in the light zone (LZ), where cells are selected for further differentiation. In the LZ, however, FOXO1 was expressed in a fraction of cells destined for DZ reentry. Upon FOXO1 ablation or induction of PI3K activity, GCs lost their DZ, owing at least partly to downregulation of the chemokine receptor CXCR4. Although this prevented proper cyclic selection of cells in GCs, somatic hypermutation and proliferation were maintained. Class switch recombination was partly lost due to a failure of switch region targeting by activation-induced deaminase (AID). PMID:26620760

  20. The NAD-Dependent Deacetylase Sirtuin-1 Regulates the Expression of Osteogenic Transcriptional Activator Runt-Related Transcription Factor 2 (Runx2) and Production of Matrix Metalloproteinase (MMP)-13 in Chondrocytes in Osteoarthritis

    PubMed Central

    Terauchi, Koh; Kobayashi, Hajime; Yatabe, Kanaka; Yui, Naoko; Fujiya, Hiroto; Niki, Hisateru; Musha, Haruki; Yudoh, Kazuo

    2016-01-01

    Aging is one of the major pathologic factors associated with osteoarthritis (OA). Recently, numerous reports have demonstrated the impact of sirtuin-1 (Sirt1), which is the NAD-dependent deacetylase, on human aging. It has been demonstrated that Sirt1 induces osteogenic and chondrogenic differentiation of mesenchymal stem cells. However, the role of Sirt1 in the OA chondrocytes still remains unknown. We postulated that Sirt1 regulates a hypertrophic chondrocyte lineage and degeneration of articular cartilage through the activation of osteogenic transcriptional activator Runx2 and matrix metalloproteinase (MMP)-13 in OA chondrocytes. To verify whether sirtuin-1 (Sirt1) regulates chondrocyte activity in OA, we studied expressions of Sirt1, Runx2 and production of MMP-13, and their associations in human OA chondrocytes. The expression of Sirt1 was ubiquitously observed in osteoarthritic chondrocytes; in contrast, Runx2 expressed in the osteophyte region in patients with OA and OA model mice. OA relating catabolic factor IL-1βincreased the expression of Runx2 in OA chondrocytes. OA chondrocytes, which were pretreated with Sirt1 inhibitor, inhibited the IL-1β-induced expression of Runx2 compared to the control. Since the Runx2 is a promotor of MMP-13 expression, Sirt1 inactivation may inhibit the Runx2 expression and the resultant down-regulation of MMP-13 production in chondrocytes. Our findings suggest thatSirt1 may regulate the expression of Runx2, which is the osteogenic transcription factor, and the production of MMP-13 from chondrocytes in OA. Since Sirt1 activity is known to be affected by several stresses, including inflammation and oxidative stress, as well as aging, SIRT may be involved in the development of OA. PMID:27367673

  1. Lower expression of activating transcription factors 3 and 4 correlates with shorter progression-free survival in multiple myeloma patients receiving bortezomib plus dexamethasone therapy

    PubMed Central

    Narita, T; Ri, M; Masaki, A; Mori, F; Ito, A; Kusumoto, S; Ishida, T; Komatsu, H; Iida, S

    2015-01-01

    Bortezomib (BTZ), a proteasome inhibitor, is widely used in the treatment of multiple myeloma (MM), but a fraction of patients respond poorly to this agent. To identify factors predicting the duration of progression-free survival (PFS) of MM patients on BTZ treatment, the expression of proteasome and endoplasmic reticulum (ER) stress-related genes was quantified in primary samples from patients receiving a combination of BTZ and dexamethasone (BD). Fifty-six MM patients were stratified into a group with PFS<6 months (n=33) and a second group with PFS⩾6 months (n=23). Of the 15 genes analyzed, the expression of activating transcription factor 3 (ATF3) and ATF4 was significantly lower in patients with shorter PFS (P=0.0157 and P=0.0085, respectively). Chromatin immunoprecipitation analysis showed that these ATFs bind each other and transactivate genes encoding the pro-apoptotic transcription factors, CHOP and Noxa, which promote ER stress-associated apoptosis. When either ATF3 or ATF4 expression was silenced, MM cells partially lost sensitivity to BTZ treatment. This was accompanied by lower levels of Noxa, CHOP and DR5. Thus low basal expression of ATF3 and ATF4 may attenuate BTZ-induced apoptosis. Hence, ATF3 and ATF4 could potentially be used as biomarkers to predict efficacy of BD therapy in patients with MM. PMID:26636288

  2. Advanced glycation end-products induce heparanase expression in endothelial cells by the receptor for advanced glycation end products and through activation of the FOXO4 transcription factor.

    PubMed

    An, Xiao-Fei; Zhou, Lei; Jiang, Peng-Jun; Yan, Ming; Huang, Yu-Jun; Zhang, Su-Na; Niu, Yun-Fei; Ten, Shi-Chao; Yu, Jiang-Yi

    2011-08-01

    As an endo-β (1-4)-D: -glucuronidase, heparanase can specifically cleave carbohydrate chains of heparan sulfate (HS) and has been implicated in development of endothelial cells dsyfunction. The advanced glycation end products (AGEs) play a pivotal role in the pathology of diabetic complications. In the present study, we investigated the effect of AGE-bovine serum albumin (AGE-BSA) on heparanase expression in human microvascular endothelial cells (HMVECs) and the underlying molecular mechanisms. The results indicated that in vitro direct exposure of HMVECs to AGE-BSA (300, 1000, and 3000 μg/ml) could increase heparanase mRNA and protein expression in a dose and time-dependent manner. The effect of 1000 μg/ml AGE-BSA could be abolished by neutralization with antibody of the receptor for advanced glycation end products (RAGE). Moreover, pretreatment with inhibitors of nuclear factor-κB (NF-κB) or PI3-kinase did not affect heparanase expression induced by AGE-BSA. Nevertheless, small interference RNA (siRNA) for transcriptional factor FOXO4 could reduce the increase of heparanase expression in HMVECs induced by 1000 μg/ml AGE-BSA. These results suggest that AGEs could induce heparanase expression in HMVECs by RAGE and predominantly through activation of the FOXO4 transcription factor. PMID:21461610

  3. Transcriptional activity of the islet β cell factor Pdx1 is augmented by lysine methylation catalyzed by the methyltransferase Set7/9.

    PubMed

    Maganti, Aarthi V; Maier, Bernhard; Tersey, Sarah A; Sampley, Megan L; Mosley, Amber L; Özcan, Sabire; Pachaiyappan, Boobalan; Woster, Patrick M; Hunter, Chad S; Stein, Roland; Mirmira, Raghavendra G

    2015-04-10

    The transcription factor Pdx1 is crucial to islet β cell function and regulates target genes in part through interaction with coregulatory factors. Set7/9 is a Lys methyltransferase that interacts with Pdx1. Here we tested the hypothesis that Lys methylation of Pdx1 by Set7/9 augments Pdx1 transcriptional activity. Using mass spectrometry and mutational analysis of purified proteins, we found that Set7/9 methylates the N-terminal residues Lys-123 and Lys-131 of Pdx1. Methylation of these residues occurred only in the context of intact, full-length Pdx1, suggesting a specific requirement of secondary and/or tertiary structural elements for catalysis by Set7/9. Immunoprecipitation assays and mass spectrometric analysis using β cells verified Lys methylation of endogenous Pdx1. Cell-based luciferase reporter assays using wild-type and mutant transgenes revealed a requirement of Pdx1 residue Lys-131, but not Lys-123, for transcriptional augmentation by Set7/9. Lys-131 was not required for high-affinity interactions with DNA in vitro, suggesting that its methylation likely enhances post-DNA binding events. To define the role of Set7/9 in β cell function, we generated mutant mice in which the gene encoding Set7/9 was conditionally deleted in β cells (Set(Δ)β). Set(Δ)β mice exhibited glucose intolerance similar to Pdx1-deficient mice, and their isolated islets showed impaired glucose-stimulated insulin secretion with reductions in expression of Pdx1 target genes. Our results suggest a previously unappreciated role for Set7/9-mediated methylation in the maintenance of Pdx1 activity and β cell function. PMID:25713082

  4. Transcriptional Activity of the Islet β Cell Factor Pdx1 Is Augmented by Lysine Methylation Catalyzed by the Methyltransferase Set7/9*

    PubMed Central

    Maganti, Aarthi V.; Maier, Bernhard; Tersey, Sarah A.; Sampley, Megan L.; Mosley, Amber L.; Özcan, Sabire; Pachaiyappan, Boobalan; Woster, Patrick M.; Hunter, Chad S.; Stein, Roland; Mirmira, Raghavendra G.

    2015-01-01

    The transcription factor Pdx1 is crucial to islet β cell function and regulates target genes in part through interaction with coregulatory factors. Set7/9 is a Lys methyltransferase that interacts with Pdx1. Here we tested the hypothesis that Lys methylation of Pdx1 by Set7/9 augments Pdx1 transcriptional activity. Using mass spectrometry and mutational analysis of purified proteins, we found that Set7/9 methylates the N-terminal residues Lys-123 and Lys-131 of Pdx1. Methylation of these residues occurred only in the context of intact, full-length Pdx1, suggesting a specific requirement of secondary and/or tertiary structural elements for catalysis by Set7/9. Immunoprecipitation assays and mass spectrometric analysis using β cells verified Lys methylation of endogenous Pdx1. Cell-based luciferase reporter assays using wild-type and mutant transgenes revealed a requirement of Pdx1 residue Lys-131, but not Lys-123, for transcriptional augmentation by Set7/9. Lys-131 was not required for high-affinity interactions with DNA in vitro, suggesting that its methylation likely enhances post-DNA binding events. To define the role of Set7/9 in β cell function, we generated mutant mice in which the gene encoding Set7/9 was conditionally deleted in β cells (SetΔβ). SetΔβ mice exhibited glucose intolerance similar to Pdx1-deficient mice, and their isolated islets showed impaired glucose-stimulated insulin secretion with reductions in expression of Pdx1 target genes. Our results suggest a previously unappreciated role for Set7/9-mediated methylation in the maintenance of Pdx1 activity and β cell function. PMID:25713082

  5. Distinct roles of transcription factors TFIIIB and TFIIIC in RNA polymerase III transcription reinitiation.

    PubMed

    Ferrari, Roberto; Rivetti, Claudio; Acker, Joël; Dieci, Giorgio

    2004-09-14

    Eukaryotic RNA polymerase (Pol) III is recruited to target promoters by a stable preinitiation complex containing transcription factors TFIIIC and TFIIIB. After the first transcription cycle, reinitiation proceeds through facilitated recycling, a process by which the terminating Pol III rapidly reloads onto the same transcription unit. Here, we show that Pol III is repeatedly recaptured in vitro by the first transcribed gene, even in the presence of a juxtaposed competitor promoter complex, thus suggesting that facilitated recycling is not merely due to a stochastic reassociation process favored by the small size of class III genes. The transcription factor requirements for facilitated reinitiation were investigated by taking advantage of Pol III templates that support both TFIIIC-dependent and TFIIIC-independent transcription. A TFIIIC-less transcription system, in which TFIIIB was reconstituted from recombinant TATA box-binding protein and Brf1 proteins and a crude fraction containing the Bdp1 component, was sufficient to direct efficient Pol III recycling on short ( approximately 100 bp) class III genes. Unexpectedly, however, on longer (>300 bp) transcription units, reinitiation in the presence of TFIIIB alone was compromised, and TFIIIC was further required to reestablish a high reinitiation rate. Transcription reinitiation was also severely impaired when recombinant Bdp1 protein replaced the corresponding crude fraction in reconstituted TFIIIB. The data reveal an unexpected complexity in the Pol III reinitiation mechanism and suggest the existence of a handing-back network between Pol III, TFIIIC, and TFIIIB on actively transcribed class III genes. PMID:15347814

  6. Filamin A interacts with the coactivator MKL1 to promote the activity of the transcription factor SRF and cell migration.

    PubMed

    Kircher, Philipp; Hermanns, Constanze; Nossek, Maximilian; Drexler, Maria Katharina; Grosse, Robert; Fischer, Maximilian; Sarikas, Antonio; Penkava, Josef; Lewis, Thera; Prywes, Ron; Gudermann, Thomas; Muehlich, Susanne

    2015-11-10

    Megakaryoblastic leukemia 1 (MKL1) is a coactivator of serum response factor (SRF) that promotes the expression of genes associated with cell proliferation, motility, adhesion, and differentiation-processes that also involve dynamic cytoskeletal changes in the cell. MKL1 is inactive when bound to monomeric globular actin (G-actin), but signals that activate the small guanosine triphosphatase RhoA cause actin polymerization and MKL1 dissociation from G-actin. We found a new mechanism of MKL1 activation that is mediated through its binding to filamin A (FLNA), a protein that binds filamentous actin (F-actin). The interaction of FLNA and MKL1 was required for the expression of MKL1 target genes in primary fibroblasts, melanoma, mammary and hepatocellular carcinoma cells. We identified the regions of interaction between MKL1 and FLNA, and cells expressing an MKL1 mutant that was unable to bind FLNA exhibited impaired cell migration and reduced expression of MKL1-SRF target genes. Induction and repression of MKL1-SRF target genes correlated with increased or decreased MKL1-FLNA interaction, respectively. Lysophosphatidic acid-induced RhoA activation in primary human fibroblasts promoted the association of endogenous MKL1 with FLNA, whereas exposure to an actin polymerization inhibitor dissociated MKL1 from FLNA and decreased MKL1-SRF target gene expression in melanoma cells. Thus, FLNA functions as a positive cellular transducer linking actin polymerization to MKL1-SRF activity, counteracting the known repressive complex of MKL1 and monomeric G-actin. PMID:26554816

  7. A position-dependent transcription-activating domain in TFIIIA.

    PubMed

    Mao, X; Darby, M K

    1993-12-01

    Transcription of the Xenopus 5S RNA gene by RNA polymerase III requires the gene-specific factor TFIIIA. To identify domains within TFIIIA that are essential for transcriptional activation, we have expressed C-terminal deletion, substitution, and insertion mutants of TFIIIA in bacteria as fusions with maltose-binding protein (MBP). The MBP-TFIIIA fusion protein specifically binds to the 5S RNA gene internal control region and complements transcription in a TFIIIA-depleted oocyte nuclear extract. Random, cassette-mediated mutagenesis of the carboxyl region of TFIIIA, which is not required for promoter binding, has defined a 14-amino-acid region that is critical for transcriptional activation. In contrast to activators of RNA polymerase II, the activity of the TFIIIA activation domain is strikingly sensitive to its position relative to the DNA-binding domain. When the eight amino acids that separate the transcription-activating domain from the last zinc finger are deleted, transcriptional activity is lost. Surprisingly, diverse amino acids can replace these eight amino acids with restoration of full transcriptional activity, suggesting that the length and not the sequence of this region is important. Insertion of amino acids between the zinc finger region and the transcription-activating domain causes a reduction in transcription proportional to the number of amino acids introduced. We propose that to function, the transcription-activating domain of TFIIIA must be correctly positioned at a minimum distance from the DNA-binding domain. PMID:8246967

  8. Activation of an AP1-Like Transcription Factor of the Maize Pathogen Cochliobolus heterostrophus in Response to Oxidative Stress and Plant Signals

    SciTech Connect

    Lev, Sophie; hadar, Ruthi; Amedeo, Paolo; Baker, Scott E.; Yoder, Olen; Horwitz, Benjamin A.

    2005-02-01

    Redox sensing is a ubiquitous mechanism regulating cellular activity. Fungal pathogens face reactive oxygen species produced by the host plant's oxidative burst in addition to endogenous reactive oxygen species produced during aerobic metabolism. An array of preformed and induced detoxifying enzymes, including superoxide dismutase, catalases, and peroxidases, could allow fungi to infect plants despite the oxidative burst. We isolated a gene (CHAP1) encoding a redox-regulated transcription factor in Cochliobolus heterostrophus, a fungal pathogen of maize. CHAP1 is a bZIP protein that possesses two cysteine-rich domains structurally and functionally related to Saccharomyces cerevisiae YAP1. Deletion of CHAP1 in C. heterostrophus resulted in decreased resistance to oxidative stress caused by hydrogen peroxide and menadione, but the virulence of chap1 mutants was unaffected. Upon activation by oxidizing agents or plant signals, a green fluorescent protein (GFP)-CHAP1 fusion protein became localized in the nucleus. Expression of genes encoding antioxidant proteins was induced in the wild type but not in chap1 mutants. Activation of CHAP1 occurred from the earliest stage of plant infection, in conidial germ tubes on the leaf surface, and persisted during infection. Late in the course of infection, after extensive necrotic lesions were formed, GFP-CHAP1 redistributed to the cytosol in hyphae growing on the leaf surface. Localization of CHAP1 to the nucleus may, through changes in the redox state of the cell, provide a mechanism linking extracellular cues to transcriptional regulation during the plant-pathogen interaction.

  9. Functional analysis of the promoter of the mitochondrial phosphate carrier human gene: identification of activator and repressor elements and their transcription factors

    PubMed Central

    2005-01-01

    The phosphate carrier (PiC) catalyses the import of phosphate into mitochondria where it is needed for ATP synthesis. We have analysed the 5′-flanking region of the human PiC gene and found that it has a single transcriptional initiation site and lacks a TATA box. Through deletion analysis of the −1213/−25 nt region, we identified an activation domain (−223/−25) and an inhibition domain (−1017/−814). The most effective promoter activity in transfected HeLa cells corresponded to the region containing putative binding sites for Sp1 (−163/−142; where Sp1 stands for stimulating protein-1) and CREB (−138/−116; where CREB stands for cAMP-response-element-binding protein). These DNA sequences were active in gel-shift assays in the presence of HeLa cell nuclear extracts or recombinant Sp1 and CREB respectively. Forskolin increased PiC promoter activity via the CREB site. Both footprinting and transfection of deletion constructs of the inhibition region (−1017/−814) showed that PiC silencer activity extends over 25 nt (−943/−919), which specifically binds two proteins present in HeLa cell nuclear extracts. These transcription factors were purified by DNA affinity, analysed by MS and identified as p54nrb/NonO (nuclear RNA binding protein) and PSF (protein-associated splicing factor). The PiC silencer region cloned in front of the ferritin promoter conferred a strong inhibition to the heterologous promoter. These findings may provide insight into control of PiC gene expression in different cell types and under different growth conditions. To our knowledge, this is the first study to analyse the regulation of the PiC gene expression in any cell. PMID:15984930

  10. Cigarette smoke condensate activates nuclear transcription factor-kappaB through phosphorylation and degradation of IkappaB(alpha): correlation with induction of cyclooxygenase-2.

    PubMed

    Anto, Ruby John; Mukhopadhyay, Asok; Shishodia, Shishir; Gairola, C Gary; Aggarwal, Bharat B

    2002-09-01

    Cigarette smoke (CS) contains several carcinogens known to initiate and promote tumorigenesis and metastasis. Because various genes that mediate carcinogenesis and tumorigenesis are regulated by nuclear factor-kappaB (NF-kappaB), we postulated that the effects of CS must be mediated through activation of this transcription factor. Therefore, in the present report we investigated whether cigarette smoke condensate (CSC) activates NF-kappaB, and whether the pathway employed for activation is similar to that of TNF, one of the potent activators of NF-kappaB. Our results show that the treatment of human histiocytic lymphoma U-937 cells with CSC activated NF-kappaB in a dose- and time-dependent manner. The kinetics of NF-kappaB activation by CSC was comparable with that of TNF. CSC-induced NF-kappaB activation was not cell type-specific, as it also activated NF-kappaB in T cells (Jurkat), lung cells (H1299), and head and neck squamous cell lines (1483 and 14B). Activation of NF-kappaB by CSC correlated with time-dependent degradation of IkappaB(alpha), an inhibitor of NF-kappaB. Further studies revealed that CSC induced phosphorylation of the serine residue at position 32 in IkappaB(alpha). In vitro immunocomplex kinase assays showed that CSC activated IkappaB(alpha) kinase (IKK). The suppression of CSC-activated NF-kappaB-dependent reporter gene expression by dominant negative form of IkappaB(alpha), TRAF2, NIK and IKK suggests a similarity to the TNF-induced pathway for NF-kappaB. CSC also induced the expression of cyclooxygenase-2, an NF-kappaB regulated gene product. Overall, our results indicate that through phosphorylation and degradation of IkappaB(alpha), CSC can activate NF-kappaB in a wide a variety of cells, and this may play a role in CS-induced carcinogenesis. PMID:12189195

  11. Triptolide inhibits B7-H1 expression on proinflammatory factor activated renal tubular epithelial cells by decreasing NF-kappaB transcription.

    PubMed

    Chen, Yongwen; Zhang, Jingbo; Li, Jingyi; Zhao, Tingting; Zou, Liyun; Tang, Yan; Zhang, Xiaoping; Wu, Yuzhang

    2006-03-01

    Triptolide has been used extensively in China for the treatment of autoimmune diseases and tumor for many centuries. Nevertheless, little is known about its exact immunosuppressive and anti-inflammatory properties. Increasing recognition of the importance of renal tubular epithelial cells (TECs) in renal diseases raises the question whether triptolide can regulate TEC activity. In this study, various cultured human and murine TECs were exposed to tumor necrotic factor-alpha (TNF-alpha) and triptolide, followed to examine the expression of B7-H1 and B7-DC. Flow cytometric analysis revealed that B7-H1 but not B7-DC constitutively expresses on TECs, and the B7-H1 protein expression was profoundly up-regulated by the stimulation of TNF-alpha with a dose-dependent manner. However, triptolide under non-cytotoxic concentration could down-regulate B7-H1 expression on activated TECs at both mRNA and protein level. This effect was transcription factor NF-kappaB dependent. Interestingly, the significant damping effect of triptolide on B7-H1 signal could promote interleukin-2 production by T cell hybridoma (C10) after antigen presentation and enhance cytokine (IFN-gamma and IL-2) secretion by anti-CD3 activated T cells. Our results indicated that triptolide could regulate TEC activity via B7-H1, in addition to previously reported it directly affects the production of some inflammatory factors by T cells, tumor cells and peripheral blood mononuclear cells. PMID:16129490

  12. Inhibition of nuclear factor κB transcription activity drives a synergistic effect of cisplatin and oridonin on HepG2 human hepatocellular carcinoma cells.

    PubMed

    Dong, Xinjun; Liu, Feiyan; Li, Mianli

    2016-04-01

    Activation of nuclear factor κB (NF-κB) by cisplatin and other chemotherapeutics is responsible, at least in part, for the development of drug resistance in the treatment of hepatocellular carcinoma. Therefore, a combination of chemotherapeutics with NF-κB inhibitors could overcome resistance of cancer cells. Oridonin is a diterpenoid isolated from Rabdosia rubescens that can block the NF-κB signaling cascades. In this study, we investigated the synergistic effect of oridonin and cisplatin on human hepatocellular carcinoma HepG2 cells. Cell apoptosis and mitochondrial membrane potential loss were examined using Hoechst 33258 and rhodamine-123 staining, followed by flow cytometry, respectively. The expression of apoptosis-related proteins and NF-κB subunits was detected by real-time PCR and western blot. The activity of caspase 3 and 9 was measured using the Caspase Activity Kit. Electrophoretic mobility shift assay and the enzyme-linked immunosorbent assay-based kit were used to assess the DNA-binding activity of NF-κB. We found a synergistic antitumor effect between cisplatin and oridonin on HepG2 cells both in vitro and in vivo. In addition, the combination of cisplatin and oridonin synergistically induces apoptosis and regulates the expression and activity of several key apoptosis-related proteins. Furthermore, the combination treatment not only downregulates nuclear translocation of p50 and p65, but more significantly, decreases the transcription activity of all NF-κB subunits to a greater degree than either agent alone. Our results suggest that the synergistic effect between both agents is likely to be driven by the inhibition of transcription activity of NF-κB and the resulting increased apoptosis. PMID:26704389

  13. Activin A enhances MMP-7 activity via the transcription factor AP-1 in an esophageal squamous cell carcinoma cell line.

    PubMed

    Yoshinaga, Keiji; Mimori, Koshi; Inoue, Hiroshi; Kamohara, Yukio; Yamashita, Keishi; Tanaka, Fumiaki; Mori, Masaki

    2008-09-01

    Activin A, a member of the transforming growth factor beta (TGF-beta) superfamily, is often overexpressed in solid carcinomas. We have previously reported that the expression of activin A is associated with lymph node metastasis in esophageal cancer. In the current study, our goal was to clarify the molecular mechanisms underlying the aggressive behavior of tumors expressing high levels of activin A. Using cDNA microarrays, the gene expression profile of a human esophageal carcinoma cell line (KYSE170) stably transfected with activin betaA (Act-betaA, a subunit of activin A) was compared with those of control human esophageal carcinoma cell lines. We found that expression of MMP-7 was higher in the Act-betaA transfectants than in the control cells. To reveal the mechanism of expression of MMP-7 mediated by activin A, we evaluated mRNA expression of MMP-7 and Act-betaA with or without activin A neutralizing antibody, using real-time PCR and Northern blot analysis. We also performed promoter analysis of the MMP-7 promoter and assessed c-Jun and Smad2/3 expression. MMP-7 expression in the transfectants was correlated with the level of Act-betaA expression and was reduced by activin A neutralizing antibody. The Act-betaA transfectants had higher MMP-7 promoter activity than control cells. MMP-7 promoter activity was not affected by mutation in the Smad binding site, while mutation of the AP-1 binding site did reduce activity. Moreover, the expression of c-Jun was increased in Act-betaA transfectants. These results indicate that activin A may modulate the expression of MMP-7 via AP-1 and not through Smad2/3. PMID:18695873

  14. Keap1 silencing boosts lipopolysaccharide-induced transcription of interleukin 6 via activation of nuclear factor κB in macrophages

    SciTech Connect

    Lv, Peng; Xue, Peng; Dong, Jian; Peng, Hui; Clewell, Rebecca; Wang, Aiping; Wang, Yue; Peng, Shuangqing; Qu, Weidong; Zhang, Qiang; Andersen, Melvin E.; Pi, Jingbo

    2013-11-01

    Interleukin-6 (IL6) is a multifunctional cytokine that regulates immune and inflammatory responses. Multiple transcription factors, including nuclear factor κB (NF-κB) and nuclear factor E2-related factor 2 (Nrf2), regulate IL6 transcription. Kelch-like ECH-associated protein 1 (Keap1) is a substrate adaptor protein for the Cullin 3-dependent E3 ubiquitin ligase complex, which regulates the degradation of many proteins, including Nrf2 and IκB kinase β (IKKβ). Here, we found that stable knockdown of Keap1 (Keap1-KD) in RAW 264.7 (RAW) mouse macrophages and human monocyte THP-1 cells significantly increased expression of Il6, and Nrf2-target genes, under basal and lipopolysaccharide (LPS, 0.001–0.1 μg/ml)-challenged conditions. However, Nrf2 activation alone, by tert-butylhydroquinone treatment of RAW cells, did not increase expression of Il6. Compared to cells transduced with scrambled non-target negative control shRNA, Keap1-KD RAW cells showed enhanced protein levels of IKKβ and increased expression and phosphorylation of NF-κB p65 under non-stressed and LPS-treated conditions. Because the expression of Il6 in Keap1-KD RAW cells was significantly attenuated by silencing of Ikkβ, but not Nrf2, it appears that stabilized IKKβ is responsible for the enhanced transactivation of Il6 in Keap1-KD cells. This study demonstrated that silencing of Keap1 in macrophages boosts LPS-induced transcription of Il6 via NF-κB activation. Given the importance of IL6 in the inflammatory response, the Keap1–IKKβ–NF-κB pathway may be a novel target for treatment and prevention of inflammation and associated disorders. - Highlights: • Knockdown of Keap1 increases expression of Il6 in macrophages. • Silencing of Keap1 results in protein accumulation of IKKβ and NF-κB p65. • Induction of Il6 resulting from Keap1 silencing is attributed to NF-κB activation.

  15. Loss of Interdependent Binding by the FoxO1 and FoxA1/A2 Forkhead Transcription Factors Culminates in Perturbation of Active Chromatin Marks and Binding of Transcriptional Regulators at Insulin-sensitive Genes.

    PubMed

    Yalley, Akua; Schill, Daniel; Hatta, Mitsutoki; Johnson, Nicole; Cirillo, Lisa Ann

    2016-04-15

    FoxO1 binds to insulin response elements located in the promoters of insulin-like growth factor-binding protein 1 (IGFBP1) and glucose-6-phosphatase (G6Pase), activating their expression. Insulin-mediated phosphorylation of FoxO1 promotes cytoplasmic translocation, inhibiting FoxO1-mediated transactivation. We have previously demonstrated that FoxO1 opens and remodels chromatin assembled from the IGFBP1 promoter via a highly conserved winged helix motif. This finding, which established FoxO1 as a "pioneer" factor, suggested a model whereby FoxO1 chromatin remodeling at regulatory targets facilitates binding and recruitment of additional regulatory factors. However, the impact of FoxO1 phosphorylation on its ability to bind chromatin and the effect of FoxO1 loss on recruitment of neighboring transcription factors at its regulatory targets in liver chromatin is unknown. In this study, we demonstrate that an amino acid substitution that mimics insulin-mediated phosphorylation of a serine in the winged helix DNA binding motif curtails FoxO1 nucleosome binding. We also demonstrate that shRNA-mediated loss of FoxO1 binding to the IGFBP1 and G6Pase promoters in HepG2 cells significantly reduces binding of RNA polymerase II and the pioneer factors FoxA1/A2. Knockdown of FoxA1 similarly reduced binding of RNA polymerase II and FoxO1. Reduction in acetylation of histone H3 Lys-27 accompanies loss of FoxO1 and FoxA1/A2 binding. Interdependent binding of FoxO1 and FoxA1/A2 possibly entails cooperative binding because FoxO1 and FoxA1/A2 facilitate one another's binding to IGFPB1 promoter DNA. These results illustrate how transcription factors can nucleate transcriptional events in chromatin in response to signaling events and suggest a model for regulation of hepatic glucose metabolism through interdependent FoxO/FoxA binding. PMID:26929406

  16. CCAAT/enhancer-binding protein delta activates insulin-like growth factor-I gene transcription in osteoblasts. Identification of a novel cyclic AMP signaling pathway in bone

    NASA Technical Reports Server (NTRS)

    Umayahara, Y.; Ji, C.; Centrella, M.; Rotwein, P.; McCarthy, T. L.

    1997-01-01

    Insulin-like growth factor-I (IGF-I) plays a key role in skeletal growth by stimulating bone cell replication and differentiation. We previously showed that prostaglandin E2 (PGE2) and other cAMP-activating agents enhanced IGF-I gene transcription in cultured primary rat osteoblasts through promoter 1, the major IGF-I promoter, and identified a short segment of the promoter, termed HS3D, that was essential for hormonal regulation of IGF-I gene expression. We now demonstrate that CCAAT/enhancer-binding protein (C/EBP) delta is a major component of a PGE2-stimulated DNA-protein complex involving HS3D and find that C/EBPdelta transactivates IGF-I promoter 1 through this site. Competition gel shift studies first indicated that a core C/EBP half-site (GCAAT) was required for binding of a labeled HS3D oligomer to osteoblast nuclear proteins. Southwestern blotting and UV-cross-linking studies showed that the HS3D probe recognized a approximately 35-kDa nuclear protein, and antibody supershift assays indicated that C/EBPdelta comprised most of the PGE2-activated gel-shifted complex. C/EBPdelta was detected by Western immunoblotting in osteoblast nuclear extracts after treatment of cells with PGE2. An HS3D oligonucleotide competed effectively with a high affinity C/EBP site from the rat albumin gene for binding to osteoblast nuclear proteins. Co-transfection of osteoblast cell cultures with a C/EBPdelta expression plasmid enhanced basal and PGE2-activated IGF-I promoter 1-luciferase activity but did not stimulate a reporter gene lacking an HS3D site. By contrast, an expression plasmid for the related protein, C/EBPbeta, did not alter basal IGF-I gene activity but did increase the response to PGE2. In osteoblasts and in COS-7 cells, C/EBPdelta, but not C/EBPbeta, transactivated a reporter gene containing four tandem copies of HS3D fused to a minimal promoter; neither transcription factor stimulated a gene with four copies of an HS3D mutant that was unable to bind osteoblast

  17. Dopamine receptor regulating factor, DRRF: a zinc finger transcription factor.

    PubMed

    Hwang, C K; D'Souza, U M; Eisch, A J; Yajima, S; Lammers, C H; Yang, Y; Lee, S H; Kim, Y M; Nestler, E J; Mouradian, M M

    2001-06-19

    Dopamine receptor genes are under complex transcription control, determining their unique regional distribution in the brain. We describe here a zinc finger type transcription factor, designated dopamine receptor regulating factor (DRRF), which binds to GC and GT boxes in the D1A and D2 dopamine receptor promoters and effectively displaces Sp1 and Sp3 from these sequences. Consequently, DRRF can modulate the activity of these dopamine receptor promoters. Highest DRRF mRNA levels are found in brain with a specific regional distribution including olfactory bulb and tubercle, nucleus accumbens, striatum, hippocampus, amygdala, and frontal cortex. Many of these brain regions also express abundant levels of various dopamine receptors. In vivo, DRRF itself can be regulated by manipulations of dopaminergic transmission. Mice treated with drugs that increase extracellular striatal dopamine levels (cocaine), block dopamine receptors (haloperidol), or destroy dopamine terminals (1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine) show significant alterations in DRRF mRNA. The latter observations provide a basis for dopamine receptor regulation after these manipulations. We conclude that DRRF is important for modulating dopaminergic transmission in the brain. PMID:11390978

  18. [Development genes encoding transcription factors and dysmorphology].

    PubMed

    Lacombe, Didier

    2009-04-01

    Studies of children with developmental abnormalities of genetic origin are necessary for accurate diagnosis, prognostication, patient management, and genetic counseling. Such studies can also help to identify genes involved in normal and abnormal morphogenesis, which often act as patterning genes and are also potential oncogenes. Many encode transcription factors that regulate other genes during embryonic development. PMID:20120282

  19. Regulons of global transcription factors in Corynebacterium glutamicum.

    PubMed

    Toyoda, Koichi; Inui, Masayuki

    2016-01-01

    Corynebacterium glutamicum, a high GC content gram-positive soil bacterium in Actinobacteria, has been used for the industrial production of amino acids and engineered to produce various compounds, including polymer building blocks and biofuels. Since its genome sequence was first published, its versatile metabolic pathways and their genetic components and regulatory mechanisms have been extensively studied. Previous studies on transcriptional factors, including two-component systems and σ factors, in the bacterium have revealed transcriptional regulatory links among the metabolic pathways and those among the stress response systems, forming a complex transcriptional regulatory network. The regulatory links are based on knowledge of the transcription factors, such as their target genes (regulons), DNA sequence motifs for recognition, and effector molecules controlling their activities, all of which are fundamental for understanding their physiological functions. Recent advances in chromatin immunoprecipitation (ChIP)-based genome-wide analyses provide an opportunity to comprehensively identify the transcription factor regulon, composed of its direct target genes, and its precise consensus binding motif. A common feature among the regulon constituents may provide clues to identify an effector molecule targeting the factor. In this mini-review, we summarize the current knowledge of the regulons of the C. glutamicum transcription factors that have been analyzed via ChIP-based technologies. The regulons consisting of direct target genes revealed new physiological roles of the transcription factors and new regulatory interactions, contributing to refinement and expansion of the transcriptional regulatory network and the development of guidelines and genetic tools for metabolic engineering of C. glutamicum. PMID:26496920

  20. ZCT1 and ZCT2 transcription factors repress the activity of a gene promoter from the methyl erythritol phosphate pathway in Madagascar periwinkle cells.

    PubMed

    Chebbi, Mouadh; Ginis, Olivia; Courdavault, Vincent; Glévarec, Gaëlle; Lanoue, Arnaud; Clastre, Marc; Papon, Nicolas; Gaillard, Cécile; Atanassova, Rossitza; St-Pierre, Benoit; Giglioli-Guivarc'h, Nathalie; Courtois, Martine; Oudin, Audrey

    2014-10-15

    In Catharanthus roseus, accumulating data highlighted the existence of a coordinated transcriptional regulation of structural genes that takes place within the secoiridoid biosynthetic branch, including the methyl erythritol phosphate (MEP) pathway and the following steps leading to secologanin. To identify transcription factors acting in these pathways, we performed a yeast one-hybrid screening using as bait a promoter region of the hydroxymethylbutenyl 4-diphosphate synthase (HDS) gene involved in the responsiveness of C. roseus cells to hormonal signals inducing monoterpene indole alkaloid (MIA) production. We identified that ZCT2, one of the three members of the zinc finger Catharanthus protein (ZCT) family, can bind to a HDS promoter region involved in hormonal responsiveness. By trans-activation assays, we demonstrated that ZCT1 and ZCT2 but not ZCT3 repress the HDS promoter activity. Gene expression analyses in C. roseus cells exposed to methyljasmonate revealed a persistence of induction of ZCT2 gene expression suggesting the existence of feed-back regulatory events acting on HDS gene expression in correlation with the MIA production. PMID:25108262

  1. Activating transcription factor 4 mediates a multidrug resistance phenotype of esophageal squamous cell carcinoma cells through transactivation of STAT3 expression.

    PubMed

    Zhu, Hongwu; Chen, Xiong; Chen, Bin; Chen, Bei; Fan, Jianyong; Song, Weibing; Xie, Ziying; Jiang, Dan; Li, Qiuqiong; Zhou, Meihua; Sun, Dayong; Zhao, Yagang

    2014-11-01

    Multidrug resistance (MDR) is a major challenge to the clinical treatment of esophageal cancer. The stress response gene activating transcription factor 4 (ATF4) is involved in homeostasis and cellular protection. However, relatively little is known about the expression and function of ATF4 in esophageal squamous cell carcinoma (ESCC) MDR. In this study, we investigate the potential role and mechanisms of ATF4 in ESCC MDR. We demonstrated that overexpression of ATF4 promotes the MDR phenotype in ESCC cells, while depletion of ATF4 in the MDR ESCC cell line induces drug re-sensitization. We also demonstrated that ATF4 transactivates STAT3 expression by directly binding to the signal transducers and activators of transcription 3 (STAT3) promoter, resulting in MDR in ESCC cells. Significantly, inhibition of STAT3 by small interfering RNA (siRNA) or a selective inhibitor (JSI-124) reintroduces therapeutic sensitivity. In addition, increased Bcl-2, survivin, and MRP1 expression levels were observed in ATF4-overexpressing cells. In conclusion, ATF4 may promote MDR in ESCC cells through the up-regulation of STAT3 expression, and thus is an attractive therapeutic target to combat therapeutic resistance in ESCC. PMID:25130172

  2. The cocaine- and amphetamine-regulated transcript mediates ligand-independent activation of ERα, and is an independent prognostic factor in node-negative breast cancer.

    PubMed

    Brennan, D J; O'Connor, D P; Laursen, H; McGee, S F; McCarthy, S; Zagozdzon, R; Rexhepaj, E; Culhane, A C; Martin, F M; Duffy, M J; Landberg, G; Ryden, L; Hewitt, S M; Kuhar, M J; Bernards, R; Millikan, R C; Crown, J P; Jirström, K; Gallagher, W M

    2012-07-26

    Personalized medicine requires the identification of unambiguous prognostic and predictive biomarkers to inform therapeutic decisions. Within this context, the management of lymph node-negative breast cancer is the subject of much debate with particular emphasis on the requirement for adjuvant chemotherapy. The identification of prognostic and predictive biomarkers in this group of patients is crucial. Here, we demonstrate by tissue microarray and automated image analysis that the cocaine- and amphetamine-regulated transcript (CART) is expressed in primary and metastatic breast cancer and is an independent poor prognostic factor in estrogen receptor (ER)-positive, lymph node-negative tumors in two separate breast cancer cohorts (n=690; P=0.002, 0.013). We also show that CART increases the transcriptional activity of ERα in a ligand-independent manner via the mitogen-activated protein kinase pathway and that CART stimulates an autocrine/paracrine loop within tumor cells to amplify the CART signal. Additionally, we demonstrate that CART expression in ER-positive breast cancer cell lines protects against tamoxifen-mediated cell death and that high CART expression predicts disease outcome in tamoxifen-treated patients in vivo in three independent breast cancer cohorts. We believe that CART profiling will help facilitate stratification of lymph node-negative breast cancer patients into high- and low-risk categories and allow for the personalization of therapy. PMID:22139072

  3. In silico Analysis of Transcription Factor Repertoire and Prediction of Stress Responsive Transcription Factors in Soybean

    PubMed Central

    Mochida, Keiichi; Yoshida, Takuhiro; Sakurai, Tetsuya; Yamaguchi-Shinozaki, Kazuko; Shinozaki, Kazuo; Tran, Lam-Son Phan

    2009-01-01

    Sequence-specific DNA-binding transcription factors (TFs) are often termed as ‘master regulators’ which bind to DNA and either activate or repress gene transcription. We have computationally analysed the soybean genome sequence data and constructed a proper set of TFs based on the Hidden Markov Model profiles of DNA-binding domain families. Within the soybean genome, we identified 4342 loci encoding 5035 TF models which grouped into 61 families. We constructed a database named SoybeanTFDB (http://soybeantfdb.psc.riken.jp) containing the full compilation of soybean TFs and significant information such as: functional motifs, full-length cDNAs, domain alignments, promoter regions, genomic organization and putative regulatory functions based on annotations of gene ontology (GO) inferred by comparative analysis with Arabidopsis. With particular interest in abiotic stress signalling, we analysed the promoter regions for all of the TF encoding genes as a means to identify abiotic stress responsive cis-elements as well as all types of cis-motifs provided by the PLACE database. SoybeanTFDB enables scientists to easily access cis-element and GO annotations to aid in the prediction of TF function and selection of TFs with functions of interest. This study provides a basic framework and an important user-friendly public information resource which enables analyses of transcriptional regulation in soybean. PMID:19884168