Science.gov

Sample records for activating factor baff

  1. Molecular cloning, expression and bioactivity of B cell activating factor (BAFF) in African ostrich.

    PubMed

    Yang, Keli; Xiao, Ke; Huang, Haibo; Lu, Shun; Zhong, Juming; Ansari, Abdur Rahman; Khaliq, Haseeb; Song, Hui; Liu, Huazhen; Peng, Kemei

    2015-09-01

    B cell activating factor (BAFF), which belongs to the tumor necrosis factor (TNF) family, is testified to play a critical role in B cell survival, proliferation, maturation and immunoglobulin secretion. In the present study, the cDNA of open reading frame (ORF) in African ostrich (Struthio camelus) BAFF (designated OsBAFF) was cloned by reverse transcription-PCR (RT-PCR). The OsBAFF gene encodes a 288-amino acid protein containing a predicted transmembrane domain and a putative furin protease cleavage site like BAFFs from chicken (cBAFF), quail (qBAFF), duck (dBAFF), goose (gBAFF) and dove (doBAFF). RT-PCR analysis showed that the OsBAFF gene is strongly expressed in the bursa of Fabricius, thymus, spleen, and bone marrow. The soluble OsBAFF had been cloned into pET28a. SDS-PAGE and Western blotting analysis confirmed that the soluble fusion protein His-OsBAFF was efficiently expressed in Escherichia coli Rosset (DE3). In vitro, purified OsBAFF was not only able to promote the survival of African ostrich bursal lymphocytes, but also able to co-stimulate proliferation of mouse splenic B cells. The expression of OsBAFF in lymphocyte cells was higher than the control after LPS stimulation. These findings indicated that OsBAFF plays an important role in survival and proliferation of African ostrich bursal lymphocytes, which may provide valuable information for research into the immune system of African ostrich and OsBAFF may serve as a potential immunologic factor for enhancing immunological efficacy in African ostrich and any other birds. PMID:26256697

  2. Functional and clinical aspects of the B-cell-activating factor (BAFF): a narrative review.

    PubMed

    Lied, G A; Berstad, A

    2011-01-01

    B-cell-activating factor (BAFF) influences peripheral B-cell survival, maturation and immunoglobulin class-switch recombination and has a range of potential clinical implications. Biological functions of BAFF and its relevance in various clinical disorders including currently investigated BAFF-targeting therapies are reviewed and discussed based on PubMed search of relevant articles. Serum levels of BAFF are increased in autoimmune diseases including autoimmune hepatitis and primary biliary cirrhosis where BAFF concentrations are related to titres of autoantibodies and disease progression. Increased BAFF levels are found in synovial, bronchoalveolar and gut lavage fluids, suggesting local class switching and immunoglobulin production. Clinical relevance and diagnostic potential of BAFF are also noted in patients with allergic diseases, malignancies and infections including hepatitis C virus. BAFF antagonists are promising new therapeutic agents, currently being tried in B-cell-related autoimmune diseases. Serum level of BAFF may indicate disease mechanisms and the degree of activity. Determination of BAFF in different body compartments like synovium, airways and gut may also have clinical implications. Results of ongoing clinical trials with BAFF antagonists are eagerly awaited. PMID:21128997

  3. Regulation of B cell activating factor (BAFF) receptor expression by NF-κB signaling in rheumatoid arthritis B cells

    PubMed Central

    Woo, Yun-Ju; Yoon, Bo-Young; Jhun, Joo-Yeon; Oh, Hye-Jwa; Min, Sewon; Park, Sung-Hwan; Kim, Ho-Youn

    2011-01-01

    B cells play an important role in the pathogenesis of rheumatoid arthritis (RA). High levels of B cell activating factor (BAFF) are detected in autoimmune diseases. BAFF and BAFF receptor (BAFF-R) are expressed in B and T cells of RA synovium. The study was undertaken to identify the NF-κB signal pathway involved in the induction of BAFF-R in human B cells. Immunohistochemical staining of NF-κB p65, NF-κB p50, BAFF, and BAFF-R was performed on sections of synovium from severe and mild RA and osteoarthritis (OA) patients. Peripheral blood mononuclear cells (PBMCs) were isolated from control and RA patients and B cells were isolated from controls. BAFF-R was analyzed by flow cytometry, realtime PCR and confocal staining after treatment with NF-κB inhibitors. NF-κB p65, NF-κB p50, BAFF, and BAFF-R were highly expressed in severe RA synovium relative to mild RA synovium or OA synovium. BAFF-R expression was reduced by NF-κB inhibitors in PBMCs and B cells from normal controls. We also showed reduction in expression of BAFF-R via inhibition of the NF-κB pathway in PBMCs of RA patients. BAFF/BAFF-R signaling is an important mechanism of pathogenesis in RA and that BAFF-R reduction by NF-κB blocking therapy is another choice for controlling B cells in autoimmune diseases such as RA. PMID:21515993

  4. CsBAFF, a Teleost B Cell Activating Factor, Promotes Pathogen-Induced Innate Immunity and Vaccine-Induced Adaptive Immunity

    PubMed Central

    Sun, Yun; Sun, Li

    2015-01-01

    B cell activating factor (BAFF) is a member of the tumor necrosis factor family that is known to play an important role in B cell activation, proliferation, and differentiation in mammals. However, studies of BAFF in teleosts are very limited and its function, in particular that under in vivo conditions, is essentially unknown. In this study, we conducted in vivo as well as in vitro functional analyses of a BAFF homologue (CsBAFF) from the teleost fish tongue sole (Cynoglossus semilaevis). CsBAFF is composed of 261 residues and shares moderate sequence identities with known BAFFs of other teleosts. CsBAFF expression was most abundant in immune organs and was upregulated during bacterial infection. Purified recombinant CsBAFF (rCsBAFF) bound to tongue sole lymphocytes and promoted cellular proliferation and survival. The results of an in vivo study showed that CsBAFF overexpression in tongue sole significantly enhanced macrophage activation and reduced bacterial infection in fish tissues, whereas knockdown of CsBAFF expression resulted in increased bacterial dissemination and colonization in fish tissues. Furthermore, vaccination studies showed that CsBAFF enhanced the immunoprotection of a DNA vaccine and augmented the production of specific serum antibodies. Taken together, these results provide the first in vivo evidence to indicate that teleost BAFF is an immunostimulator that significantly contributes to the innate antibacterial immune response and vaccine-induced adaptive immune response. PMID:26295165

  5. The Expression of BAFF Is Controlled by IRF Transcription Factors.

    PubMed

    Sjöstrand, Maria; Johansson, Alina; Aqrawi, Lara; Olsson, Tomas; Wahren-Herlenius, Marie; Espinosa, Alexander

    2016-01-01

    Patients with systemic lupus erythematosus (SLE) and primary Sjögren's syndrome (pSS) are typically characterized by the presence of autoantibodies and an IFN-signature. The strength of the IFN-signature positively correlates with disease severity, suggesting that type I IFNs are active players in these diseases. BAFF is a cytokine critical for development and proper selection of B cells, and the targeting of BAFF has emerged as a successful treatment strategy of SLE. Previous reports have suggested that BAFF expression is directly induced by type I IFNs, but the precise mechanism for this remains unknown. In this article, we demonstrate that BAFF is a bona fide ISG and that IFN regulatory factors (IRFs) control the expression of BAFF. We identify IRF1 and IRF2 as positive regulators of BAFF transcription and IRF4 and IRF8 as potent repressors; in addition, we have mapped the precise binding site for these factors in the BAFF promoter. IFN-β injections induced BAFF expression mainly in neutrophils and monocytes, and BAFF expression in neutrophils from pSS patients strongly correlated with the strength of the IFN-signature. In summary, we show that BAFF expression is directly induced by type I IFNs via IRF1 and IRF2, whereas IRF4 and IRF8 are negative regulators of BAFF expression. These data suggest that type I IFN blockade in SLE and pSS patients will lead to downregulation of BAFF and a consequential reduction of autoreactive B cell clones and autoantibodies. PMID:26590315

  6. The Expression of BAFF Is Controlled by IRF Transcription Factors

    PubMed Central

    Sjöstrand, Maria; Johansson, Alina; Aqrawi, Lara; Olsson, Tomas; Wahren-Herlenius, Marie

    2016-01-01

    Patients with systemic lupus erythematosus (SLE) and primary Sjögren’s syndrome (pSS) are typically characterized by the presence of autoantibodies and an IFN-signature. The strength of the IFN-signature positively correlates with disease severity, suggesting that type I IFNs are active players in these diseases. BAFF is a cytokine critical for development and proper selection of B cells, and the targeting of BAFF has emerged as a successful treatment strategy of SLE. Previous reports have suggested that BAFF expression is directly induced by type I IFNs, but the precise mechanism for this remains unknown. In this article, we demonstrate that BAFF is a bona fide ISG and that IFN regulatory factors (IRFs) control the expression of BAFF. We identify IRF1 and IRF2 as positive regulators of BAFF transcription and IRF4 and IRF8 as potent repressors; in addition, we have mapped the precise binding site for these factors in the BAFF promoter. IFN-β injections induced BAFF expression mainly in neutrophils and monocytes, and BAFF expression in neutrophils from pSS patients strongly correlated with the strength of the IFN-signature. In summary, we show that BAFF expression is directly induced by type I IFNs via IRF1 and IRF2, whereas IRF4 and IRF8 are negative regulators of BAFF expression. These data suggest that type I IFN blockade in SLE and pSS patients will lead to downregulation of BAFF and a consequential reduction of autoreactive B cell clones and autoantibodies. PMID:26590315

  7. Oridonin ameliorates lupus-like symptoms of MRL(lpr/lpr) mice by inhibition of B-cell activating factor (BAFF).

    PubMed

    Zhou, Lin; Sun, Lijuan; Wu, Hongkun; Zhang, Lingzhen; Chen, Mingcang; Liu, Jianwen; Zhong, Renqian

    2013-09-01

    Oridonin, a pharmacologically safe agent extracted from Isodon Serra, has been shown to possess potent anti-inflammatory properties. However, it is not clear whether Oridonin affects B-cell activating factor (BAFF) expression, thereby exerting beneficial effects in the treatment of BAFF-associated autoimmune diseases such as systemic lupus erythematosus (SLE). Thus, the current study aimed to find the function of Oridonin in regulation of BAFF and amelioration of SLE. In vitro, we explored the effect of Oridonin on BAFF expression and production in mouse macrophages. Moreover, using a spontaneous murine SLE model, we investigated the role of Oridonin delivery in the treatment of lupus-like disease in MRL(lpr/lpr) mice, by measuring the changes in lupus symptoms, renal damage, BAFF expression, and B cell subsets. Our results showed that Oridonin significantly inhibited BAFF expression in mouse macrophages by suppressing the transcriptional activation of its promoter. And in vivo administration of Oridonin efficiently ameliorated the serological and clinical manifestations of SLE in MRL(lpr/lpr) mice, as shown by increased survival benefit, reduced proteinuria levels, diminished production of specific auto-antibodies, and attenuated renal damage, in association with down-regulation of BAFF and a lower rate of B-cell maturation and differentiation. Thus, it suggests that Oridonin will serve as a novel natural therapeutic strategy for SLE by inhibition of BAFF. PMID:23712004

  8. BAFF activation of the ERK5 MAP kinase pathway regulates B cell survival

    PubMed Central

    Jacque, Emilie; Schweighoffer, Edina; Tybulewicz, Victor L.J.

    2015-01-01

    B cell activating factor (BAFF) stimulation of the BAFF receptor (BAFF-R) is essential for the homeostatic survival of mature B cells. Earlier in vitro experiments with inhibitors that block MEK 1 and 2 suggested that activation of ERK 1 and 2 MAP kinases is required for BAFF-R to promote B cell survival. However, these inhibitors are now known to also inhibit MEK5, which activates the related MAP kinase ERK5. In the present study, we demonstrated that BAFF-induced B cell survival was actually independent of ERK1/2 activation but required ERK5 activation. Consistent with this, we showed that conditional deletion of ERK5 in B cells led to a pronounced global reduction in mature B2 B cell numbers, which correlated with impaired survival of ERK5-deficient B cells after BAFF stimulation. ERK5 was required for optimal BAFF up-regulation of Mcl1 and Bcl2a1, which are prosurvival members of the Bcl-2 family. However, ERK5 deficiency did not alter BAFF activation of the PI3-kinase–Akt or NF-κB signaling pathways, which are also important for BAFF to promote mature B cell survival. Our study reveals a critical role for the MEK5-ERK5 MAP kinase signaling pathway in BAFF-induced mature B cell survival and homeostatic maintenance of B2 cell numbers. PMID:25987726

  9. Molecular and functional characterization of BAFF from the Yangtze alligator (Alligator sinensis, Alligatoridae).

    PubMed

    Zhang, Jia-Xin; Song, Ren; Sang, Ming; Sun, Si-Qing; Ma, Lei; Zhang, Jie; Zhang, Shuang-Quan

    2015-10-01

    B-cell activating factor (BAFF) from the TNF family is critical for B-cell survival and maturation. In this study, we identified a Yangtze alligator (Alligator sinensis, Alligatoridae) BAFF cDNA, designated as asBAFF, using reverse transcription polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). The open reading frame of this cDNA encodes a 287-amino acid protein containing a predicted transmembrane domain and a furin protease cleavage site, similar to mammalian and avian BAFF. The amino acid identity between biologically soluble asBAFF (assBAFF) and csBAFF, hsBAFF, and msBAFF is 94, 76, and 71%, respectively. Real-time quantitative PCR analysis showed that the asBAFF gene is strongly expressed in the spleen. Since BAFF is always expressed as inclusion bodies in bacteria, it is difficult to purify. To enhance the soluble expression of assBAFF in Escherichia coli, we fused the extracellular region of the asBAFF gene to a small ubiquitin-related modifier gene (SUMO). Purified assBAFF was able to promote the survival of splenic lymphocytes and co-stimulate the proliferation of mouse B cells with anti-mouse IgM. These findings suggest that asBAFF plays an important role in the survival and proliferation of Yangtze alligator B cells, and because it is evolutionarily highly conserved, functional cross-reactivity exists between mammalian and Yangtze alligator BAFF. PMID:26116474

  10. VAV1 and BAFF, via NFκB pathway, are genetic risk factors for myasthenia gravis

    PubMed Central

    Avidan, Nili; Le Panse, Rozen; Harbo, Hanne F; Bernasconi, Pia; Poulas, Konstantinos; Ginzburg, Elizabeta; Cavalcante, Paola; Colleoni, Lara; Baggi, Fulvio; Antozzi, Carlo; Truffault, Frédérique; Horn-Saban, Shirley; Pöschel, Simone; Zagoriti, Zoi; Maniaol, Angelina; Lie, Benedicte A; Bernard, Isabelle; Saoudi, Abdelhadi; Illes, Zsolt; Casasnovas Pons, Carlos; Melms, Arthur; Tzartos, Socrates; Willcox, Nicholas; Kostera-Pruszczyk, Anna; Tallaksen, Chantal; Mantegazza, Renato; Berrih-Aknin, Sonia; Miller, Ariel

    2014-01-01

    Objective To identify novel genetic loci that predispose to early-onset myasthenia gravis (EOMG) applying a two-stage association study, exploration, and replication strategy. Methods Thirty-four loci and one confirmation loci, human leukocyte antigen (HLA)-DRA, were selected as candidate genes by team members of groups involved in different research aspects of MG. In the exploration step, these candidate genes were genotyped in 384 EOMG and 384 matched controls and significant difference in allele frequency were found in eight genes. In the replication step, eight candidate genes and one confirmation loci were genotyped in 1177 EOMG patients and 814 controls, from nine European centres. Results Allele frequency differences were found in four novel loci: CD86, AKAP12, VAV1, B-cell activating factor (BAFF), and tumor necrosis factor-alpha (TNF-α), and these differences were consistent in all nine cohorts. Haplotype trend test supported the differences in allele frequencies between cases and controls. In addition, allele frequency difference in female versus male patients at HLA-DRA and TNF-α loci were observed. Interpretation The genetic associations to EOMG outside the HLA complex are novel and of interest as VAV1 is a key signal transducer essential for T- and B-cell activation, and BAFF is a cytokine that plays important roles in the proliferation and differentiation of B-cells. Moreover, we noted striking epistasis between the predisposing VAV1 and BAFF haplotypes; they conferred a greater risk in combination than alone. These, and CD86, share the same signaling pathway, namely nuclear factor-kappaB (NFκB), thus implicating dysregulation of proinflammatory signaling in predisposition to EOMG. PMID:25356403

  11. The B Lymphocyte Differentiation Factor (BAFF) Is Expressed in the Airways of Children with CF and in Lungs of Mice Infected with Pseudomonas aeruginosa

    PubMed Central

    Bricio-Moreno, Laura; Fothergill, Joanne L.; Southern, Kevin W.; Winstanley, Craig; Christmas, Stephen E.; Slupsky, Joseph R.; McNamara, Paul S.; Kadioglu, Aras; Flanagan, Brian F.

    2014-01-01

    Background Chronic lung infection with Pseudomonas aeruginosa remains a major cause of mortality and morbidity among individuals with CF. Expression of mediators promoting recruitment and differentiation of B cells, or supporting antibody production is poorly understood yet could be key to controlling infection. Methods BAFF was measured in BAL from children with CF, both with and without P. aeruginosa, and controls. Mice were intra-nasally infected with P. aeruginosa strain LESB65 for up to 7 days. Cellular infiltration and expression of B cell chemoattractants and B cell differentiation factor, BAFF were measured in lung tissue. Results BAFF expression was elevated in both P. aeruginosa negative and positive CF patients and in P. aeruginosa infected mice post infection. Expression of the B cell chemoattractants CXCL13, CCL19 and CCL21 increased progressively post infection. Conclusions In a mouse model, infection with P. aeruginosa was associated with elevated expression of BAFF and other B cell chemoattractants suggesting a role for airway B cell recruitment and differentiation in the local adaptive immune response to P. aeruginosa. The paediatric CF airway, irrespective of pseudomonal infection, was found to be associated with an elevated level of BAFF implying that BAFF expression is not specific to pseudomonas infection and may be a feature of the CF airway. Despite the observed presence of a potent B cell activator, chronic colonisation is common suggesting that this response is ineffective. PMID:24847941

  12. Molecular structure, distribution, and immunology function of TNFSF13B (BAFF) in Nile tilapia (Oreochromis niloticus).

    PubMed

    Liu, Hongzhen; Zhang, Jiaxin; Li, Jianfeng; Song, Jinyun; Zhang, Shuangquan

    2016-04-01

    B cell-activating factor (BAFF)is a member of the tumor necrosis factor (TNF) family and plays roles in B cell survival and maturation. In this study, the full-length cDNA of Nile tilapia (Oreochromis niloticus) BAFF (tBAFF) was amplified from the spleen by reverse transcription PCR (RT-PCR). The open reading frame of this cDNA encodes a protein of 261 amino acids containing a predicted transmembrane domain and a furin protease cleavage site, similar to mammalian, avian, and reptile BAFF. Real-time quantitative PCR (qPCR) analysis revealed that tBAFF is present in various tissues and is predominantly expressed in the spleen. The predicted three-dimensional (3D) structure of the Nile tilapia (Oreochromis niloticus) soluble BAFF (tsBAFF) monomer was determined by (3D) structure modeling monomeranalyzed by (3D) structure mouse counterpart. Both tsBAFF and EGFP/tsBAFF were efficiently expressed in Escherichia coli BL21 (DE3), as confirmed by SDS-PAGE and Western blot analysis. After purification, the EGFP/tsBAFF fusion protein showed a fluorescence spectrum similar to that of EGFP. Laser scanning confocal microscopy showed that EGFP/tsBAFF bound to its receptor. In vitro, tsBAFF promoted the proliferation of Nile tilapia and mouse splenic B cells together with/without a priming agent (Staphylococcus aureus Cowan 1, SAC) or anti-mouse IgM. Furthermore, tsBAFF showed a similar proliferation-stimulating effect on mouse B cells compared to msBAFF. These findings indicate that tsBAFF plays an important role in the proliferation of Nile tilapia B cells and has functional cross-reactivity among Nile tilapia and mammals. Therefore, BAFF may represent a useful factor for enhancing immunological efficacy in animals. PMID:26915306

  13. Targeting the Splicing of mRNA in Autoimmune Diseases: BAFF Inhibition in Sjögren's Syndrome as a Proof of Concept

    PubMed Central

    Roescher, N.; Vosters, J.L.; Alsaleh, G.; Dreyfus, P.; Jacques, S.; Chiocchia, G.; Sibilia, J.; Tak, P.P.; Chiorini, J.A.; Mariette, X.; Gottenberg, Jacques-Eric

    2014-01-01

    BAFF (B-cell–activating factor of the tumor necrosis factor family), a pivotal cytokine for B-cell activation, is overexpressed by salivary gland (SG) epithelial cells in primary Sjogren's syndrome (pSS). ΔBAFF, a physiological inhibitor of BAFF, is a minor alternative splice variant of BAFF. A U7 RNA was reengineered to deliver antisense sequences targeting BAFF splice regions. A major decrease of BAFF messenger RNA (mRNA) and protein secretion, concomitantly with the increase of ΔBAFF mRNA, was observed in vitro. In vivo, SG retrograd instillation of nonobese diabetic mice by the modified U7 cloned into an adeno-associated virus vector significantly decreased BAFF protein expression and lymphocytic infiltrates and improved salivary flow. This study offers a rationale for localized therapeutic BAFF inhibition in pSS and represents a proof of concept of the interest of exon skipping in autoimmune diseases. PMID:24304965

  14. Expression of BAFF and BR3 in patients with systemic lupus erythematosus

    PubMed Central

    Duan, J.H.; Jiang, Y.; Mu, H.; Tang, Z.Q.

    2016-01-01

    The objective of this study was to examine the relationship between the expression of B cell activating factor (BAFF) and BAFF receptor in patients with disease activity of systemic lupus erythematosus (SLE). Real-time RT-PCR was used to examine BAFF mRNA expression in peripheral blood monocytes of active and stable SLE patients and healthy controls. The percentage of BAFF receptor 3 (BR3) on B lymphocytes was measured by flow cytometry. Soluble BAFF levels in serum were assayed by ELISA. Microalbumin levels were assayed by an automatic immune analysis machine. BAFF mRNA and soluble BAFF levels were highest in the active SLE group, followed by the stable SLE group, and controls (P<0.01). The percentage of BR3 on B lymphocytes was downregulated in the active SLE group compared with the stable SLE group and controls (P<0.01). BAFF mRNA levels and soluble BAFF levels were higher in patients who were positive for proteinuria than in those who were negative (P<0.01). The percentage of BR3 on B lymphocytes was lower in patients who were positive for proteinuria than in those who were negative (P<0.01). The BAFF/BR3 axis may be over-activated in SLE patients. BAFF and BR3 levels may be useful parameters for evaluating treatment. PMID:26840704

  15. BAFF Is Increased in Renal Transplant Patients Following Treatment with Alemtuzumab

    PubMed Central

    Bloom, D.; Chang, Z.; Pauly, K.; Kwun, J.; Fechner, J.; Hayes, C.; Samaniego, M.; Knechtle, S.

    2016-01-01

    Alemtuzumab is a monoclonal antibody that depletes T and B cells and is used as induction therapy for renal transplant recipients. Without long-term calcineurin inhibitor (CNI) therapy, alemtuzumab-treated patients have a propensity to develop alloantibody and may undergo antibody-mediated rejection (AMR). In pursuit of a mechanistic explanation, we analyzed peripheral B cells and serum of these patients for BAFF (Blys) and BAFF-R, factors known to be integral for B-cell activation, survival, and homeostasis. Serum BAFF levels of 22/24 alemtuzumab-treated patients were above normal range, with average levels of 1967 pg/mL compared to 775 pg/mL in healthy controls (p = 0.006). BAFF remained elevated 2 years posttransplant in 78% of these patients. BAFF-R on CD19+ B cells was significantly downregulated, suggesting ligand/receptor engagement. BAFF mRNA expression was increased 2–7-fold in CD14+ cells of depleted patients, possibly linking monocytes to the BAFF dysregulation. Addition of recombinant BAFF to mixed lymphocyte cultures increased B-cell activation to alloantigen, as measured by CD25 and CD69 coexpression on CD19+ cells. Of note, addition of sirolimus (SRL) augmented BAFF-enhanced B-cell activation whereas CNIs blocked it. These data suggest associations between BAFF/BAFF-R and AMR in alemtuzumab-treated patients. PMID:19522878

  16. First BAFF gene cloned from an aquatic mammal.

    PubMed

    You, Fengtao; Ren, Wenhua; Gu, Shasha; Wang, Wenqian; Zhou, Lidan; Zhang, Yijun; Gan, Weifeng; Chen, Mingxing

    2012-08-01

    The finless porpoise (Neophocaena phocaenoides) is one of the smallest cetacean species. Research into the immune system of the finless porpoise is essential to the protection of this species, but, to date, no genes coding for proteins from the tumor necrosis factor family (TNF family) have yet been reported from finless porpoises. The TNF B cell activating factor (BAFF) is critical to B cell survival, proliferation, maturation, and immunoglobulin secretion and to T cell activation. It acts through its three receptors, BAFF-R, BCMA, and TACI. In the present study, the full-length cDNA of BAFF (designated NpBAFF) from the finless porpoise was cloned using RT-PCR and rapid amplification of cDNA ends (RACE) techniques, and its biological activities have been characterized. To our knowledge, this is the first report of any BAFF gene being cloned from an aquatic mammal. The full-length cDNA of NpBAFF consists of 1502 bases including an 852 bp open reading frame encoding 283 amino acids. This protein was found to contain a predicted transmembrane domain, a putative furin protease cleavage site, and a typical TNF homology domain corresponding to other, known BAFF homologues. Sequence comparison indicated that the amino acid sequence of NpBAFF was very similar to its bovine (87.68%), porcine (76.33%), hircine (87.68%) and canine (82.19%) counterparts. The predicted three-dimensional (3D) structure of the NpsBAFF monomer, analyzed by comparative protein modeling, revealed that it was very similar to its human counterpart. Phylogenetic analysis indicated that NpBAFF showed a notable homology with Artiodactyla BAFFs. The SUMO-NpsBAFF was efficiently expressed in Escherichia coli BL21 (DE3) and confirmed by SDS-PAGE and Western blot analysis. Laser scanning confocal microscopy analysis showed that NpsBAFF could bind to its receptors on B cells. In vitro, MTT assays indicated that SUMO-NpsBAFF could promote the survival or proliferation of mouse splenic B cells grown with anti

  17. IL-2, IL-4, IFN-γ or TNF-α enhances BAFF-stimulated cell viability and survival by activating Erk1/2 and S6K1 pathways in neoplastic B-lymphoid cells.

    PubMed

    Gui, Lin; Zeng, Qingyu; Xu, Zhigang; Zhang, Hai; Qin, Shanshan; Liu, Chunxiao; Xu, Chong; Qian, Zhou; Zhang, Shuangquan; Huang, Shile; Chen, Long

    2016-08-01

    B-cell activating factor of the TNF family (BAFF) has been documented to act as a critical factor in the development of aggressive B lymphocytes and autoimmune diseases. However, the effect of various cytokines on BAFF-elicited neoplastic B-lymphoid cells is not known. In this study, we exhibited that administration of human soluble BAFF (hsBAFF), IL-2, IL-4, IFN-γ, or TNF-α alone increased cell viability and survival in Raji cells concentration-dependently, yet a more robust viability/survival was seen in the cells co-treatment of IL-2, IL-4, IFN-γ, or TNF-α with hsBAFF, respectively. Further research revealed that both Erk1/2 and S6K1 signaling pathways were essential for IL-2, IL-4, IFN-γ, or TNF-α enhancement of the viability/survival in the hsBAFF-stimulated cells, as inhibition of Erk1/2 with U0126 or down-regulation of Erk1/2, or blockage of S6K1 with rapamycin or silencing S6K1, or silencing S6K1/Erk1/2, respectively, reduced the cell viability/survival in the cells treated with/without hsBAFF±IL-2, IL-4, IFN-γ, or TNF-α. These findings indicate that IL-2, IL-4, IFN-γ or TNF-α enhances BAFF-stimulated cell viability/survival by activating Erk1/2 and S6K1 signaling in neoplastic B-lymphoid cells. Our data suggest that modulation of IL-2, IL-4, IFN-γ and/or TNF-α levels, or inhibitors of Erk1/2 or S6K1 may be a new approach to prevent BAFF-induced aggressive B-cell malignancies. PMID:27235588

  18. BAFF induces spleen CD4{sup +} T cell proliferation by down-regulating phosphorylation of FOXO3A and activates cyclin D2 and D3 expression

    SciTech Connect

    Ji, Fang; Chen, Rongjing; Liu, Baojun; Zhang, Xiaoping; Han, Junli; Wang, Haining; Shen, Gang; Tao, Jiang

    2012-09-07

    Highlights: Black-Right-Pointing-Pointer Firstly analyze the mechanism of BAFF and anti-CD3 co-stimulation on purified mouse splenic CD4{sup +} T cells. Black-Right-Pointing-Pointer Carrying out siRNA technology to study FOXO3A protein function. Black-Right-Pointing-Pointer Helpful to understand the T cell especially CD4{sup +} T cell's role in immunological reaction. -- Abstract: The TNF ligand family member 'B cell-activating factor belonging to the TNF family' (BAFF, also called BLyS, TALL-1, zTNF-4, and THANK) is an important survival factor for B and T cells. In this study, we show that BAFF is able to induce CD4{sup +} spleen T cell proliferation when co-stimulated with anti-CD3. Expression of phosphorylated FOXO3A was notably down-regulated and cyclins D2 and D3 were up-regulated and higher in the CD4{sup +} T cells when treated with BAFF and anti-CD3, as assessed by Western blotting. Furthermore, after FOXO3A was knocked down, expression of cyclin D1 was unchanged, compared with control group levels, but the expression of cyclins D2 and D3 increased, compared with the control group. In conclusion, our results suggest that BAFF induced CD4{sup +} spleen T cell proliferation by down-regulating the phosphorylation of FOXO3A and then activating cyclin D2 and D3 expression, leading to CD4{sup +} T cell proliferation.

  19. The relationship between the presence of autoantibodies, indicators of local and systemic inflammation, the serum concentration of B-cell activating factor (BAFF) and the intensity of salivary gland infiltration in patients with primary Sjögren's syndrome – a preliminary study

    PubMed Central

    Kontny, Ewa; Kwiatkowska, Brygida

    2016-01-01

    Objectives The aim of this study was to find markers related to activation of B cells, which show a correlation with the systemic inflammation markers – erythrocyte sedimentation rate and C-reactive protein and with the intensity of in situ inflammation. Material and methods Forty-one primary Sjögren's syndrome (pSS) patients (33 female, 8 male) of the mean age 52.9 ±15 years were included. A group of 20 healthy volunteers was applied as a control. Erythrocyte sedimentation rate (ESR), concentration of gamma-globulins, C-reactive protein (CRP) and rheumatoid factor (RF) were measured by routine laboratory tests. Titres of antinuclear antibodies (ANAs) were determined by the indirect immunofluorescence method, while anti-SS-A/SS-B antibodies were detected by both the dot-blot method and an enzyme immunoassay. The concentrations of BAFF in sera were measured by sandwich ELISA. Biopsies of minor salivary glands were taken and the focus score (FS) was calculated. Correlations between quantitative variables were assessed using the Spearman correlation coefficient (r). Results Serum concentrations of BAFF was significantly higher in the pSS patients than in the control group. The study revealed a statistically significant correlation between ANAs titre and the FS (r = 0.421). Anti-SS-A/Ro and anti-SS-B/La antibodies positively correlated with ESR. There was also a positive correlation between the gamma globulin level and the titres of all tested autoantibodies. Conclusions The positive correlation between ANAs and FS confirms the importance of these autoantibodies in the local inflammatory process. The positive correlation between anti-SS-A/SS-B antibodies and ESR suggests involvement of these antibodies in generalization of the inflammatory response. In the pSS group serum concentrations of BAFF were statistically significantly higher than healthy volunteers. All presented results confirm the role of activity of B cells in the course of pSS.

  20. BAFF upregulates CD28/B7 and CD40/CD154 expression and promotes mouse T and B cell interaction in vitro via BAFF receptor

    PubMed Central

    Zhang, Feng; Song, Shan-shan; Shu, Jin-ling; Li, Ying; Wu, Yu-jing; Wang, Qing-tong; Chen, Jing-yu; Chang, Yan; Wu, Hua-xun; Zhang, Ling-ling; Wei, Wei

    2016-01-01

    Aim: B cell-activating factor belonging to the TNF family (BAFF) is a member of TNF family and required for peripheral B cell survival and homeostasis. BAFF has been shown to promote the proliferation of T and B cells. In this study we examined whether and how BAFF mediated the interaction between mouse T and B cells in vitro. Methods: BAFF-stimulated B or T cells were co-cultured with T or B cells. The interactions between T and B cells were analyzed by measuring the expression of co-stimulatory molecules (CD28/CD80 or CD40/CD154), the proliferation and secretion of T and B cells and other factors. Two siRNAs against the transmembrane activator and calcium modulator and cyclophilin ligand interactor (TACI) and BAFF receptor (BAFF-R) were used to identify the receptors responsible for the actions of BAFF. Results: BAFF-stimulated B cells significantly promoted the proliferation and activity of co-cultured T cells, and increased the percentages of CD4+CD28+ and CD4+CD154+ T cells. Similarly, BAFF-stimulated T cells significantly promoted the proliferation and activity of co-cultured B cells, and increased CD19+CD80+ and CD19+CD40+B cell subpopulations. BAFF-R siRNA-silenced B cells showed significantly lower expression of CD40 and CD80 than the control B cells. When the BAFF-R siRNA-silenced B cells were stimulated with BAFF, then co-cultured with T cells, the expression of CD28 and CD154 on T cells was not increased. TACI siRNA-silenced B cells exhibited higher expression of CD40 and CD80 than the control B cells. When the TACI siRNA-silenced B cells were stimulated with BAFF, then co-cultured with T cells, the expression of CD28 and CD154 on T cells was significantly increased. Conclusion: BAFF upregulates CD28/B7 and CD40/CD154 expression, and promotes the interactions between T and B cells in a BAFF-R-dependent manner. PMID:27180986

  1. Serum BAFF levels, Methypredsinolone therapy, Epstein-Barr Virus and Mycobacterium avium subsp. paratuberculosis infection in Multiple Sclerosis patients

    PubMed Central

    Mameli, Giuseppe; Cocco, Eleonora; Frau, Jessica; Arru, Giannina; Caggiu, Elisa; Marrosu, Maria Giovanna; Sechi, Leonardo A.

    2016-01-01

    Elevated B lymphocyte activating factor BAFF levels have been reported in multiple sclerosis (MS) patients; moreover, disease-modifying treatments (DMT) have shown to influence blood BAFF levels in MS patients, although the significance of these changes is still controversial. In addition, BAFF levels were reported increased during infectious diseases. In our study, we wanted to investigate on the serum BAFF concentrations correlated to the antibody response against Mycobacterium avium subspecies paratuberculosis (MAP), Epstein-Barr virus (EBV) and their human homologous epitopes in MS and in patients affected with other neurological diseases (OND), divided in Inflammatory Neurological Diseases (IND), Non Inflammatory Neurological Diseases (NIND) and Undetermined Neurological Diseases (UND), in comparison to healthy controls (HCs). Our results confirmed a statistically significant high BAFF levels in MS and IND patients in comparison to HCs but not NIND and UND patients. Interestingly, BAFF levels were inversely proportional to antibodies level against EBV and MAP peptides and the BAFF levels significantly decreased in MS patients after methylprednisolone therapy. These results implicate that lower circulating BAFF concentrations were present in MS patients with humoral response against MAP and EBV. In conclusion MS patients with no IgGs against EBV and MAP may support the hypothesis that elevated blood BAFF levels could be associated with a more stable disease. PMID:27383531

  2. Serum BAFF levels, Methypredsinolone therapy, Epstein-Barr Virus and Mycobacterium avium subsp. paratuberculosis infection in Multiple Sclerosis patients.

    PubMed

    Mameli, Giuseppe; Cocco, Eleonora; Frau, Jessica; Arru, Giannina; Caggiu, Elisa; Marrosu, Maria Giovanna; Sechi, Leonardo A

    2016-01-01

    Elevated B lymphocyte activating factor BAFF levels have been reported in multiple sclerosis (MS) patients; moreover, disease-modifying treatments (DMT) have shown to influence blood BAFF levels in MS patients, although the significance of these changes is still controversial. In addition, BAFF levels were reported increased during infectious diseases. In our study, we wanted to investigate on the serum BAFF concentrations correlated to the antibody response against Mycobacterium avium subspecies paratuberculosis (MAP), Epstein-Barr virus (EBV) and their human homologous epitopes in MS and in patients affected with other neurological diseases (OND), divided in Inflammatory Neurological Diseases (IND), Non Inflammatory Neurological Diseases (NIND) and Undetermined Neurological Diseases (UND), in comparison to healthy controls (HCs). Our results confirmed a statistically significant high BAFF levels in MS and IND patients in comparison to HCs but not NIND and UND patients. Interestingly, BAFF levels were inversely proportional to antibodies level against EBV and MAP peptides and the BAFF levels significantly decreased in MS patients after methylprednisolone therapy. These results implicate that lower circulating BAFF concentrations were present in MS patients with humoral response against MAP and EBV. In conclusion MS patients with no IgGs against EBV and MAP may support the hypothesis that elevated blood BAFF levels could be associated with a more stable disease. PMID:27383531

  3. BAFF is decreased in the cerebrospinal fluid of multiple sclerosis at clinical onset.

    PubMed

    Puthenparampil, M; Miante, S; Federle, L; Zanetta, C; Toffanin, E; Ruggero, S; Rinaldi, F; Gallo, P

    2016-08-15

    B-cells are thought to play a relevant role in multiple sclerosis (MS) pathology. BAFF (B cell activating factor of the TNF family) is a B-cell survival factor constitutively produced inside the CNS by astrocytes. We studied the intrathecal synthesis of BAFF in MS at clinical onset. Paired serum and cerebrospinal fluid (CSF) specimens from 40 clinically isolated syndromes (CIS) suggestive of MS or early relapse-onset MS (eRRMS) and from 18 healthy controls (HC) were analysed. Patients were classified based on the detection of oligoclonal IgG bands in the CSF (IgGOB+ and IgGOB-). BAFF was detected by highly sensitive ELISA and its ratio (CSF-BAFF/serum-BAFF, QBAFF) and Index (QBAFF/QAlb, BAFF-Index) were calculated. IgGOB+ presented lower CSF concentrations of BAFF compared to both HC and IgGOB- (p<0.05). BAFF Index was significantly lower in IgGOB+ compared to both HC and IgGOB- (p<0.01). A significant inverse correlation between QIgG and QBAFF (r: -0.4, p<0.05) and between BAFF index and IgGIF (r: -0.4, p<0.05) or IgG Index (r: -0.4, p=0.05) was found in IgGOB+. The decreased CSF levels of BAFF in IgGOB+ at clinical onset suggest the absorption of this factor by intrathecally recruited B cells since the early disease phases. PMID:27397077

  4. B-cell-activating factor inhibits CD20-mediated and B-cell receptor-mediated apoptosis in human B cells

    PubMed Central

    Saito, Yohei; Miyagawa, Yoshitaka; Onda, Keiko; Nakajima, Hideki; Sato, Ban; Horiuchi, Yasuomi; Okita, Hajime; Katagiri, Yohko U; Saito, Masahiro; Shimizu, Toshiaki; Fujimoto, Junichiro; Kiyokawa, Nobutaka

    2008-01-01

    B-cell-activating factor (BAFF) is a survival and maturation factor for B cells belonging to the tumour necrosis factor superfamily. Among three identified functional receptors, the BAFF receptor (BAFF-R) is thought to be responsible for the effect of BAFF on B cells though details of how remain unclear. We determined that a hairy-cell leukaemia line, MLMA, expressed a relatively high level of BAFF-R and was susceptible to apoptosis mediated by either CD20 or B-cell antigen receptor (BCR). Using MLMA cells as an in vitro model of mature B cells, we found that treatment with BAFF could inhibit apoptosis mediated by both CD20 and BCR. We also observed, using immunoblot analysis and microarray analysis, that BAFF treatment induced activation of nuclear factor-κB2 following elevation of the expression level of Bcl-2, which may be involved in the molecular mechanism of BAFF-mediated inhibition of apoptosis. Interestingly, BAFF treatment was also found to induce the expression of a series of genes, such as that for CD40, related to cell survival, suggesting the involvement of a multiple mechanism in the BAFF-mediated anti-apoptotic effect. MLMA cells should provide a model for investigating the molecular basis of the effect of BAFF on B cells in vitro and will help to elucidate how B cells survive in the immune system in which BAFF-mediated signalling is involved. PMID:18540961

  5. Dual functional BAFF receptor aptamers inhibit ligand-induced proliferation and deliver siRNAs to NHL cells

    PubMed Central

    Zhou, Jiehua; Tiemann, Katrin; Chomchan, Pritsana; Alluin, Jessica; Swiderski, Piotr; Burnett, John; Zhang, Xizhe; Forman, Stephen; Chen, Robert; Rossi, John

    2013-01-01

    The B-cell–activating factor (BAFF)-receptor (BAFF-R) is restrictedly expressed on B-cells and is often overexpressed in B-cell malignancies, such as non-Hodgkin’s lymphoma. On binding to its ligand BAFF, proliferation and cell survival are increased, enabling cancer cells to proliferate faster than normal B-cells. Nucleic acid aptamers can bind to target ligands with high specificity and affinity and may offer therapeutic advantages over antibody-based approaches. In this study, we isolated several 2′-F–modified RNA aptamers targeting the B-cell–specific BAFF-R with nanomolar affinity using in vitro SELEX technology. The aptamers efficiently bound to BAFF-R on the surface of B-cells, blocked BAFF-mediated B-cell proliferation and were internalized into B-cells. Furthermore, chimeric molecules between the BAFF-R aptamer and small interfering RNAs (siRNAs) were specifically delivered to BAFF-R expressing cells with a similar efficiency as the aptamer alone. We demonstrate that a signal transducer and activator of transcription 3 (STAT3) siRNA delivered by the BAFF-R aptamer was processed by Dicer and efficiently reduced levels of target mRNA and protein in Jeko-1 and Z138 human B-cell lines. Collectively, our results demonstrate that the dual-functional BAFF-R aptamer–siRNA conjugates are able to deliver siRNAs and block ligand mediated processes, suggesting it might be a promising combinatorial therapeutic agent for B-cell malignancies. PMID:23470998

  6. BAFF Blockade Prevents Anti-Drug Antibody Formation in a Mouse Model of Pompe Disease

    PubMed Central

    Doerfler, Phillip A.; Nayak, Sushrusha; Herzog, Roland W.; Morel, Laurence; Byrne, Barry J.

    2015-01-01

    Antibodies formed against the therapeutic protein are a life-threatening complication that arises during enzyme replacement therapy for Pompe disease (acid α-glucosidase deficiency; GAA). To provide an effective alternative to current practices, we investigated the capacity of anti-B-cell activating factor (BAFF) as a novel drug candidate to prevent antibody formation in a Pompe disease mouse model. A BAFF-neutralizing antibody was administered prophylactically and with maintenance doses in association with enzyme replacement therapy using recombinant human GAA in Gaa-/- mice. BAFF blockade delayed antibody production and increased GAA activity within tissues with protection from anaphylaxis. Anti-BAFF also resolved antibody formation during an immune response and precluded the maturation of antibody secreting cells from entering the bone marrow compartment. This treatment modality may therefore be a viable alternative for the clinical management of antibody formation for Pompe disease and has potential use against antibody formation in other protein replacement therapies. PMID:25842186

  7. Increased serum concentration of BAFF/APRIL and IgA2 subclass in patients with mixed connective tissue disease complicated by interstitial lung disease.

    PubMed

    Kaneko, Toshiyuki; Amano, Hirofumi; Kawano, Shinya; Minowa, Kentaro; Ando, Seiichiro; Watanabe, Takashi; Nakano, Soichiro; Suzuki, Jun; Morimoto, Shinji; Tokano, Yoshiaki; Takasaki, Yoshinari

    2014-03-01

    B cell activating factor (BAFF) and a proliferation-inducing ligand (APRIL) are known to be crucial for B cell maturation and survival, and increased expression of these factors in various autoimmune diseases has been reported. Human B cells produce two IgA subclasses: IgA1 and IgA2, the latter being abundant in the distal intestine, saliva, colostrum and bronchial fluid. We investigated these parameters in patients with mixed connective tissue disease (MCTD) complicated by interstitial lung disease (ILD+), and compared them with those in MCTD patients without ILD (ILD-). Sixty-three MCTD patients were divided into two groups: 21 ILD+ patients and 42 ILD- patients. In each patient group we analyzed soluble BAFF/APRIL using ELISA, and IgA1 and IgA2 using double immunodiffusion. Furthermore, we analyzed BAFF-APRIL receptors, BCMA, BAFF-R and TACI, using flow cytometry. The ILD+ patients had significantly higher levels of BAFF/APRIL than the ILD- patients. There were significant correlations between BAFF/APRIL, BAFF/KL-6 and APRIL/KL-6. Although there was no significant inter-group difference in the serum IgA1 level, ILD+ patients had a significantly elevated IgA2 level in comparison with ILD- patients. Moreover, although there were no significant inter-group differences in the expression of BCMA, BAFF-R and TACI on B cells, the expression of BAFF-R was significantly decreased in the ILD+ patients. In recent years, relationships between BAFF/APRIL and IgA subclass have been reported. Our results suggest that an elevated level of BAFF/APRIL drives the maturation of B cells, subsequently leading to IgA2 class switching, and possibly to the development of ILD in patients with MCTD. PMID:24252051

  8. A functional receptor for B-cell activating factor is expressed on human acute lymphoblastic leukemias

    PubMed Central

    Parameswaran, Reshmi; Muschen, Markus; Kim, Yong-mi; Groffen, John; Heisterkamp, Nora

    2010-01-01

    B-lineage acute lymphoblastic leukemia (ALL) arises by transformation of a progenitor (pre-B) cell. Cure rates in adults remain low and treatment is complicated by support provided by the microenvironment to the leukemic cells, indicating an urgent need to better understand the factors that promote their survival. B cell activating factor (BAFF) and its receptor BAFF-R are important for survival and growth of mature normal and malignant B-cells but are not expressed on pre-B cells. Unexpectedly, all cells in the primary Philadelphia-chromosome positive and negative ALL samples tested were positive for high BAFF-R cell surface expression. The BAFF-R was fully competent to bind BAFF and stimulation of the receptor activated both the classical and the non-canonical NFκB pathways. Recombinant BAFF supported survival of the ALL cells in the absence of stroma, and it significantly attenuated the rate of apoptosis caused by exposure to nilotinib, a drug used therapeutically to treat Philadelphia-chromosome positive ALLs. Surprisingly, BAFF mRNA and protein were also expressed in the same cells but BAFF was not shed into the medium. Our report is the first showing universal expression of the BAFF-R by pre-B ALL cells and opens the possibility of blocking its function as an adjuvant therapeutic strategy. PMID:20460528

  9. BAFF overexpression increases lymphocytic infiltration in Sjögren's target tissue, but only inefficiently promotes ectopic B-cell differentiation.

    PubMed

    Ding, Jian; Zhang, Wei; Haskett, Scott; Pellerin, Alex; Xu, Shanqin; Petersen, Britta; Jandreski, Luke; Hamann, Stefan; Reynolds, Taylor L; Zheng, Timothy S; Mingueneau, Michael

    2016-08-01

    B-cell activating factor (BAFF) levels are increased in rheumatoid arthritis, lupus and primary Sjögren's syndrome (pSS). However, BAFF contribution to pathogenesis is not completely understood. In pSS, immune infiltration of the salivary and lacrimal glands leads to xerostomia and xerophtalmia. Glandular B cell hyperactivation, differentiation into germinal center (GC)-like structures and plasma cell accumulation are histopathological hallmarks that were attributed to increased BAFF. Here, we experimentally tested this hypothesis by overexpressing BAFF in a mouse model of pSS. BAFF overexpression enhanced lymphocytic infiltration and MHCII expression on B cells. Increased BAFF also induced B cell differentiation into GC B cells within the autoimmune target tissue. However, even in these conditions, GC B cells only accounted for <1% of glandular B cells, demonstrating that BAFF is not efficiently promoting ectopic GC formation in pSS and warranting further investigation of therapeutics targeting both BAFF and the related TNF-family member APRIL. PMID:27352977

  10. The Effect of BAFF Inhibition on Autoreactive B-Cell Selection in Murine Systemic Lupus Erythematosus

    PubMed Central

    Boneparth, Alexis; Woods, Megan; Huang, Weiqing; Akerman, Meredith; Lesser, Martin; Davidson, Anne

    2016-01-01

    The goal of this study was to determine how B-cell–activating factor of the TNF family (BAFF) availability influences selection of the autoreactive B-cell repertoire in NZB/W and NZW/BXSB lupus-prone mice bearing the site-directed heavy-chain transgene 3H9 that encodes for anti-dsDNA and anti-cardiolipin (CL) autoantibodies. We used a bone marrow chimera system in which autoreactive 3H9 transgenic B cells were allowed to mature in competition with wild-type cells and could be identified by green fluorescent protein. The light-chain repertoire associated with the 3H9 heavy chain in naive and antigen-activated B-cell subsets was assessed using single-cell polymerase chain reaction. We found that deletion of autoreactive transgenic B cells occurred in the bone marrow of both strains regardless of BAFF availability, and there were only modest and physiologically non-relevant effects on the naive B-cell repertoire. BAFF inhibition had different effects on selection of the germinal center repertoire in the two strains. In the NZW/BXSB strain, BAFF inhibition phenocopied the loss of one TLR7 allele in that it influenced the selection of 3H9-encoded autoreactive B cells in the germinal center but did not prevent somatic mutation. In the NZB/W strain, BAFF inhibition did not alter the selection of 3H9-encoded B cells in the germinal center, but it influenced selection of a subset of germinal center cells into the plasma cell compartment. Our data underscore the complexity of regulation of the autoreactive B-cell repertoire by BAFF and may help to explain the heterogeneity of responses observed after BAFF inhibition in humans. PMID:26882090

  11. Soluble BAFF Level Is Not Correlated to Mycobacterium avium Subspecies Paratuberculosis Antibodies and Increases After Interferon-β Therapy in Multiple Sclerosis Patients.

    PubMed

    Mameli, Giuseppe; Cossu, Davide; Caggiu, Elisa; Arru, Giannina; Niegowska, Magdalena; Cocco, Eleonora; Frau, Jessica; Marrosu, Maria Giovanna; Sechi, Leonardo A

    2016-09-01

    B cells are being recognized as one of the major players in the pathogenesis of multiple sclerosis (MS). The B cell activating factor (BAFF) system plays an essential role in B cell homeostasis and function in the periphery. Mycobacterium avium subspecies paratuberculosis (MAP) has been previously associated to MS in Sardinia. Antibodies against a MAP surface protein, MAP_2694, have been found significantly associated to MS patients, and this response was modified by interferon-β therapy. Increased BAFF levels following IFN-β therapy have been also described in MS patients. In this study, we evaluated whether soluble BAFF levels are comparable in men and women affected by MS and performed a correlation of the reported BAFF increase in MS patients under IFN-β therapy with changes of humoral response against MAP_2694. For these reasons, we investigated 44 MS patients before and after IFN-β therapy. A significant difference of BAFF levels was found between men and women with MS; moreover, we confirmed that IFN-β therapy strongly induces BAFF serum levels, but this was not related to the modification of immunological response against MAP_2694. In conclusion, our study highlights that IFN-β therapy induces the potent B cell survival factor BAFF without alterations of the humoral immune response against MAP. PMID:27370541

  12. High Expression Levels of BLyS/BAFF by Blood Dendritic Cells and Granulocytes Are Associated with B-cell dysregulation in SIV-Infected Rhesus Macaques

    PubMed Central

    Chagnon-Choquet, Josiane; Burdo, Tricia; Autissier, Patrick; Oskar, Kathryn; Williams, Kenneth C.; Roger, Michel

    2015-01-01

    Dendritic cells (DCs) modulate B-cell survival and differentiation, mainly through production of growth factors such as B lymphocyte stimulator (BLyS/BAFF). In recent longitudinal studies involving HIV-1-infected individuals with different rates of disease progression, we have shown that DCs were altered in number and phenotype in the context of HIV-1 disease progression and B-cell dysregulations were associated with increased BLyS/BAFF expression in plasma and by blood myeloid DCs (mDCs) in rapid and classic progressors but not in HIV-1-elite controllers (EC). Suggesting that the extent to which HIV-1 disease progression is controlled may be linked to BLyS/BAFF expression status and the capacity to orchestrate B-cell responses. Herein, longitudinal analyses of simian immunodeficiency virus (SIV)-infected rhesus macaques also revealed increased expression of BLyS/BAFF by blood mDCs as soon as day 8 and throughout infection. Strikingly, granulocytes presented the highest BLyS/BAFF expression profile in the blood of SIV-infected macaques. BLyS/BAFF levels were also increased in plasma and correlated with viral loads. Consequently, these SIV-infected animals had plasma hyperglobulinemia and reduced blood B-cell numbers with altered population frequencies. These data underscore that BLyS/BAFF is associated with immune dysregulation in SIV-infected rhesus macaques and suggest that BLyS/BAFF is a key regulator of immune activation that is highly conserved among primates. These findings emphasize the potential importance of this SIV-infected primate model to test whether blocking excess BLyS/BAFF has an effect on the overall inflammatory burden and immune restoration. PMID:26107380

  13. The BAFF/APRIL system: emerging functions beyond B cell biology and autoimmunity.

    PubMed

    Vincent, Fabien B; Saulep-Easton, Damien; Figgett, William A; Fairfax, Kirsten A; Mackay, Fabienne

    2013-06-01

    The BAFF system plays a key role in the development of autoimmunity, especially in systemic lupus erythematosus (SLE). This often leads to the assumption that BAFF is mostly a B cell factor with a specific role in autoimmunity. Focus on BAFF and autoimmunity, driven by pharmaceutical successes with the recent approval of a novel targeted therapy Belimumab, has relegated other potential roles of BAFF to the background. Far from being SLE-specific, the BAFF system has a much broader relevance in infection, cancer and allergy. In this review, we provide the latest views on additional roles of the BAFF system in health and diseases, as well as an update on BAFF and autoimmunity, with particular focus on current clinical trials. PMID:23684423

  14. The Effects of Jieduquyuzishen Prescription-Treated Rat Serum on the BAFF/BAFF-R Signal Pathway

    PubMed Central

    Wen, Cheng-ping; Xie, Guan-qun; Ji, Jin-jun; Pan, Jie-li; Jiao, Yi-feng; Fan, Yong-sheng

    2015-01-01

    Systemic lupus erythematosus (SLE) is a chronic inflammatory disease mainly characterized by B cell hyperactivity. Glucocorticoid (GC) is widely used in SLE for its potent anti-inflammatory and immunosuppressive effects. Despite its important clinical efficacy, high-dose or long-term use of GC can cause severe side effects, such as osteoporosis, osteonecrosis, cataracts, hyperglycemia, coronary heart disease and cognitive impairment. Our early clinical studies have shown that Jieduquyuzishen prescription (JP) can effectively reduce the adverse effects and improve the curative effect of GC in the treatment of SLE. The BAFF/BAFF-R signaling pathway plays an important role in the development of SLE and has been regarded as a potential target for the therapy of SLE. In this study, we attempt to investigate the effect of JP on the BAFF/BAFF-R signaling pathway to explore the mechanism of JP in reducing the toxicity and enhancing the efficacy of GC. YAC-1 cells, isolated rat peripheral blood lymphocytes, polymorphonuclear neutrophils and spleen lymphocytes were treated with drug-containing serum. The results of RT-PCR, Western blot and dual-luciferase reporter gene assays indicate that either JP or GC can inhibit the mBAFF-induced up-regulation of BAFF, BAFF-R, Bcl-2, IL-10 and NF-κB in YAC-1 cells and WEHI-231 cells. Furthermore, MTS, flow cytometry and CFSE results reveal that the proliferation and survival of lymphocytes activated by mBAFF are suppressed by JP, GC and their combination. Contrary to GC, JP can reduce the apoptosis and raise the survival of polymorphonuclear neutrophils and can’t increase the apoptosis of the peripheral blood lymphocytes and spleen lymphocytes. Therefore, it is possible that JP can down-regulate the BAFF/BAFF-R signaling pathway as effectively as GC, which may result in the dosage reduction of GC, thus decreasing the toxicity and improving the efficacy of GC-based treatment of SLE. PMID:25689512

  15. Effector-mediated eradication of precursor B acute lymphoblastic leukemia with a novel Fc engineered monoclonal antibody targeting the BAFF-R

    PubMed Central

    Parameswaran, Reshmi; Lim, Min; Fei, Fei; Abdel-Azim, Hisham; Arutyunyan, Anna; Schiffer, Isabelle; McLaughlin, Margaret E.; Gram, Hermann; Huet, Heather; Groffen, John; Heisterkamp, Nora

    2014-01-01

    B-cell activating factor receptor (BAFF-R) is expressed on precursor B acute lymphoblastic leukemia ALL (pre-B ALL) cells but not on their pre-B normal counterparts. Thus, selective killing of ALL cells is possible by targeting this receptor. Here we have further examined therapeutic targeting of pre-B ALL based on the presence of the BAFF-R. Mouse pre-B ALL cells lacking BAFF-R function had comparable viability and proliferation to wild type cells but were more sensitive to drug treatment. Viability of human pre-B ALL cells was further reduced when antibodies to the BAFF-R were combined with other drugs, even in the presence of stromal protection. This indicates that inhibition of BAFF-R function reduces fitness of stressed pre-B ALL cells. We tested a novel humanized anti-BAFF-R monoclonal antibody optimalized for FcRγIII mediated, antibody-dependent cell killing by effector cells. Antibody binding to human ALL cells was inhibitable, in a dose-dependent manner, by recombinant human BAFF. There was no evidence for internalization of the antibodies. The antibodies significantly stimulated NK cell-mediated killing of different human patient-derived ALL cells. Moreover, incubation of such ALL cells with these antibodies stimulated phagocytosis by macrophages. When this was tested in an immunodeficient transplant model, mice that were treated with the antibody had a significantly decreased leukemia burden in bone marrow and spleen. In view of the restricted expression of the BAFF-R on normal cells and the multiple anti-pre-B ALL activities stimulated by this antibody, a further examination of its use for treatment of pre-B ALL is warranted. PMID:24825858

  16. Neutrophils Contribute to Excess Serum BAFF Levels and Promote CD4+ T Cell and B Cell Responses in Lupus-Prone Mice

    PubMed Central

    Coquery, Christine M.; Wade, Nekeithia S.; Loo, William M.; Kinchen, Jason M.; Cox, Kelly M.; Jiang, Chao; Tung, Kenneth S.; Erickson, Loren D.

    2014-01-01

    Despite increased frequencies of neutrophils found in autoimmune diseases such as systemic lupus erythematosus (SLE), how they contribute to disease pathogenesis and the mechanisms that affect the accumulation of neutrophils are poorly understood. The aim of this study was to identify factors in autoantibody-mediated autoimmunity that controls the accumulation of spleen resident neutrophils and to determine whether neutrophils contribute to abnormal B cell responses. Increased levels of the cytokine BAFF have been linked to loss of B cell tolerance in autoimmunity, but the cellular source responsible for excess BAFF is unknown. B cell maturation antigen (BCMA) is a receptor for BAFF and is critical for the survival of bone marrow plasma cells. Paradoxically, BCMA deficiency exacerbates the formation of autoantibody-secreting plasma cells in spleens of lupus-prone mice and the reasons for this effect are not understood. Here we analyzed the phenotype, localization and function of neutrophils in spleens of healthy mice and congenic lupus-prone mice, and compared mice sufficient or deficient in BCMA expression. Neutrophils were found to be significantly increased in frequency and activation status in spleens of lupus-prone mice when BCMA was absent. Furthermore, neutrophils localized within T cell zones and enhanced CD4+ T cell proliferation and IFNγ production through the production of BAFF. Reduced BAFF and IFNγ serum levels, decreased frequencies of IFNγ-producing T cells, germinal center B cells, and autoantibody production after neutrophil depletion indicated the involvement of neutrophils in these autoimmune traits. Thus, we have identified a novel role for BCMA to control excess BAFF production in murine lupus through restraining the accumulation of BAFF-producing neutrophils. Our data suggests that devising therapeutic strategies to reduce neutrophils in autoimmunity may decrease BAFF levels and ameliorate disease. PMID:25010693

  17. Increased Interleukin-17 and decreased BAFF serum levels in drug-free acute schizophrenia.

    PubMed

    El Kissi, Yousri; Samoud, Samar; Mtiraoui, Ahlem; Letaief, Leila; Hannachi, Neila; Ayachi, Mouna; Ali, Bechir Ben Hadj; Boukadida, Jalel

    2015-01-30

    Hypotheses regarding an immune-cytokine basis of schizophrenia have been postulated with controversial findings and a lack of data related to many cytokines. The aim of this study was to assess serum levels of Interferon-γ (IFN-γ), Interleukin-4 (IL-4), Transforming Growth Factor-β (TGF-β), Interleukin-17 (IL-17) and B-cell Activating Factor (BAFF) in schizophrenic patients and to determine correlations between cytokine levels and clinical parameters. Serum cytokine levels were measured with ELISA techniques in 60 neuroleptic-free patients on acute phase of the disease (BPRS≥40) and 28 healthy controls matched for age and sex. Current symptoms were assessed with Brief Psychiatric Rating Scale (BPRS), Positive and Negative Syndrome Scale (PANSS), Scale for the Assessment of Positive Symptoms (SAPS) and Scale for the Assessment of Negative Symptoms (SANS). No significant difference was found between patients and controls regarding IFN-γ serum levels. IL-4 was not detected in both groups. Patients exhibited significantly higher IL-17 and lower BAFF serum levels. IL-17 and BAFF levels were negatively correlated in schizophrenic patients. SANS global score was negatively correlated with IL-17 and positively correlated with IFN-γ serum levels. These results argue against the involvement of Th1 or Th2 population cells in schizophrenia. IL-17 and BAFF could be valuable markers for schizophrenia. PMID:25453636

  18. B lymphocytes and B-cell activating factor promote collagen and profibrotic markers expression by dermal fibroblasts in systemic sclerosis

    PubMed Central

    2013-01-01

    Introduction B lymphocytes might play a pathogenic role in dermal fibrosis in systemic sclerosis (SSc). B-cell activating factor (BAFF), a key cytokine for B-cell activation, is increased in the serum and the skin of patients with SSc. However, the ability of B cells directly to stimulate dermal fibroblasts and the role of BAFF are not fully understood. We therefore investigated the involvement of B cells and BAFF in the expression of collagen and profibrotic markers by dermal fibroblasts. Methods Cocultures of blood B cells from healthy blood donors and normal or SSc dermal fibroblasts stimulated with anti-IgM and BAFF were performed. Alpha-SMA, TIMP1, MMP9, COL1A1, COL1A2, and COL3A1 mRNA expression were determined by quantitative RT-PCR. Soluble collagen, BAFF, IL-6, IL-1β, TGF-β1, and CCL2 protein secretion were assessed. Results Coculture of blood B cells and dermal fibroblasts isolated from SSc patients induced IL-6, TGF-β1, CCL2, and collagen secretion, as well as Alpha-SMA, TIMP1, and MMP9 expression in dermal fibroblasts. Transwell assays demonstrated that this induction was dependent on cell-cell contact. Addition of anti-IgM and BAFF to the coculture increased IL-6, CCL2, TGF-β1, and collagen secretion. B cell- and BAFF-induced collagen secretion was highly reduced by anti-TGF-β1 antibodies. Conclusions Our results showed for the first time a direct role of B cells on the production of collagen by dermal fibroblasts, which is further enhanced by BAFF. Thus, these results demonstrate a new pathogenic role of B cells and BAFF in fibrosis and systemic sclerosis. PMID:24289101

  19. BAFF/BLyS inhibitors: A new prospect for treatment of systemic lupus erythematosus.

    PubMed

    Fairfax, Kirsten; Mackay, Ian R; Mackay, Fabienne

    2012-07-01

    In November 2009, Human Genome Sciences and Glaxo-Smith Kline [HGS (Rockville, Maryland) and GSK, respectively] announced that Belimumab, a neutralizing antibody to the tumour necrosis factor (TNF)-like ligand, B-cell activating factor (BAFF belonging to the TNF family, also named BLyS), met the primary endpoints in two phase III clinical trials in systemic lupus erythematosus (SLE, lupus). In March 2011, Belimumab was approved by the US Federal Drug Agency for treatment of SLE patients; this was followed in May with approval by the European Medicines Agency for use in the European Union. This is an exciting development as it is the first successful late-stage clinical trial in SLE in over 40 years. In the light of this breakthrough, we review the key data and research outcomes and examine how blocking BAFF in patients with SLE significantly improves clinical outcomes. PMID:22641424

  20. Precursor B Cells Increase in the Lung during Airway Allergic Inflammation: A Role for B Cell-Activating Factor

    PubMed Central

    Malmhäll, Carina; Rådinger, Madeleine; Ramos-Ramirez, Patricia; Lu, You; Deák, Tünde; Semitekolou, Maria; Gaga, Mina; Sjöstrand, Margareta; Lötvall, Jan; Bossios, Apostolos

    2016-01-01

    Background B cells, key cells in allergic inflammation, differentiate in the bone marrow and their precursors include pro-B, pre-B and immature B cells. Eosinophil progenitor cells increase in the lung after allergen exposure. However, the existence and possible role of B cell precursors in the lung during allergic inflammation remains elusive. Methods A BALB/c mouse model of allergic airway inflammation was utilized to perform phenotypic and quantification analyses of pro-B and pre-B cells in the lung by flow cytometry. B cell maturation factors IL-7 and B cell-activating factor (BAFF) and their receptors (CD127 and BAFFR, BCMA, TACI, respectively) were also evaluated in the lung and serum. The effect of anti-BAFF treatment was investigated both in vivo (i.p. administration of BAFF-R-Ig fusion protein) and in vitro (colony forming cell assay). Finally, BAFF levels were examined in the bronchoalveolar lavage (BAL) of asthmatic patients and healthy controls. Results Precursor pro and pre-B cells increase in the lung after allergen exposure, proliferate in the lung tissue in vivo, express markers of chemotaxis (CCR10 and CXCR4) and co-stimulation (CD40, CD86) and are resistant to apoptosis (Bax). Precursor B cells express receptors for BAFF at baseline, while after allergen challenge both their ligand BAFF and the BCMA receptor expression increases in B cell precursors. Blocking BAFFR in the lung in vivo decreases eosinophils and proliferating precursor B cells. Blocking BAFFR in bone marrow cultures in vitro reduces pre-B colony formation units. BAFF is increased in the BAL of severe asthmatics. Conclusion Our data support the concept of a BAFF-mediated role for B cell precursors in allergic airway inflammation. PMID:27513955

  1. Macrophage-derived BAFF induces AID expression through the p38MAPK/CREB and JNK/AP-1 pathways.

    PubMed

    Kim, Hyun-A; Seo, Goo-Young; Kim, Pyeung-Hyeun

    2011-03-01

    BAFF is expressed primarily by macrophages and DCs. BAFF stimulates the differentiation and survival of B cells and induces Ig production. We have demonstrated previously that murine macrophages treated with TGF-β1 or IFN-γ express membrane-bound and soluble forms of BAFF. The ability of these two forms of BAFF to induce expression of AID, which plays a critical role in Ig CSR in B cells, was investigated. Both forms of BAFF, derived from macrophages activated by IFN-γ or TGF-β1, can increase AID expression. Subsequent analysis of BAFF signaling suggested that BAFF induces AID through BCMA, a BAFF-receptor, and p38MAPK and CREB act as intermediates in AID expression. In addition, JNK and AP-1 have similar activities. Our findings suggest that macrophage-derived BAFF stimulates B cells to express AID through BCMA and at least two different pathways, including the p38MAPK/CREB and the JNK/AP-1 pathways. PMID:21169521

  2. Genetic variation in BAFF and asthma exacerbations among African American individuals

    PubMed Central

    Kumar, Rajesh; Williams, L. Keoki; Kato, Atsushi; Peterson, Edward L.; Favoreto, Silvio; Hulse, Katie; Wang, Deli; Beckman, Kenneth; Thyne, Shannon; LeNoir, Michael; Meade, Kelley; Lanfear, David E.; Levin, Albert M.; Favro, David; Yang, James J.; Weiss, Kevin; Boushey, Homer A.; Grammer, Leslie; Avila, Pedro C; Burchard, Esteban G.; Schleimer, Robert

    2012-01-01

    Capsule Summary A BAFF polymorphism is associated with asthma exacerbations and serum BAFF levels. BAFF expression in vivo increases in natural rhinovirus infection. BAFF may play a role in airway antiviral immunity and impact asthma exacerbation rates. PMID:22728080

  3. Analysis of Associations of Human BAFF Gene Polymorphisms with Autoimmune Thyroid Diseases

    PubMed Central

    Lin, Jiunn-Diann; Yang, Shun-Fa; Wang, Yuan-Hung; Fang, Wen-Fang; Lin, Ying-Chin; Lin, Yuh-Feng; Tang, Kam-Tsun; Wu, Mei-Yi; Cheng, Chao-Wen

    2016-01-01

    Background The B-lymphocyte-activating factor (BAFF) is associated with B-cell functions, and gene polymorphisms of the BAFF have been linked to autoimmune diseases (AIDs). In this study, we explored possible associations of two BAFF single-nucleotide polymorphisms (SNPs), rs1041569 and rs2893321, with autoimmune thyroid diseases (AITDs) in an ethnic Chinese population. Material and Methods In total, 319 Graves’ disease (GD), 83 Hashimoto’s thyroiditis (HT) patients, and 369 healthy controls were enrolled. Polymerase chain reaction-restriction fragment length polymorphism and direct sequencing were used to genotype rs2893321 and rs1041569. Results There was a significant difference in frequencies of the G allele and AG+GG genotype of rs2893321 between the GD and control groups (p = 0.013, odds ratio (OR) = 0.76, and p = 0.017, OR = 0.68, respectively) and between the AITD and control groups (p = 0.009, OR = 0.76, and, p = 0.014, OR = 0.69, respectively). The AA genotype of rs2893321 was associated with low titers of the thyroid-stimulating hormone receptor antibody (TSHRAb) (p = 0.015) in males but not in females. The AA genotype of rs2893321 was associated with the presence of two different types of thyroid autoantibody (TAb) (TSHRAb and Hashimoto’s autoantibody (anti-thyroglobulin or anti-microsomal antibody)) in females and with that of one type in males. Conclusions rs2893321 may be a susceptible genetic variant for the development of GD and AITDs. Associations of rs2893321 with susceptibility to GD and AITDs and the correlation between rs2893321 and TAb exhibit a dimorphic pattern. Additional studies with larger sample sizes are required to confirm our findings. PMID:27136204

  4. Effect of Treatment With Tabalumab, a B Cell-Activating Factor Inhibitor, on Highly Sensitized Patients With End-Stage Renal Disease Awaiting Transplantation.

    PubMed

    Mujtaba, M A; Komocsar, W J; Nantz, E; Samaniego, M D; Henson, S L; Hague, J A; Lobashevsky, A L; Higgins, N G; Czader, M; Book, B K; Anderson, M D; Pescovitz, M D; Taber, T E

    2016-04-01

    B cell-activation factor (BAFF) is critical for B cell maturation. Inhibition of BAFF represents an appealing target for desensitization of sensitized end-stage renal disease (ESRD) patients. We conducted a Phase 2a, single-arm, open-label exploratory study investigating the effect of tabalumab (BAFF inhibitor) in patients with ESRD and calculated panel reactive antibodies (cPRAs) >50%. The treatment period duration was 24 weeks. Eighteen patients received tabalumab, at doses of 240-mg subcutaneous (SC) at Week 0 followed by 120-mg SC monthly for 5 additional months. Patients were followed for an additional 52 weeks. Immunopharmacologic effects were characterized through analysis of blood for HLA antibodies, BAFF concentrations, immunoglobulins, T and B cell subsets, as well as pre- and posttreatment tonsil and bone marrow biopsies. Significant reductions in cPRAs were observed at Weeks 16 (p = 0.043) and 36 (p = 0.004); however, absolute reductions were small (<5%). Expected pharmacologic changes in B cell subsets and immunoglobulin reductions were observed. Two tabalumab-related serious adverse events occurred (pneumonia, worsening of peripheral neuropathy), while the most common other adverse events were injection-site pain and hypotension. Three patients received matched deceased donor transplants during follow-up. Treatment with a BAFF inhibitor resulted in statistically significant, but not clinically meaningful reduction in the cPRA from baseline (NCT01200290, Clinicaltrials.gov). PMID:26780484

  5. BAFF regulates T follicular helper cells and affects accumulation and IFNγ production in autoimmunity

    PubMed Central

    Coquery, Christine M.; Loo, William M.; Wade, Nekeithia S.; Bederman, Annelise G.; Tung, Kenneth S.; Lewis, Janet E.; Hess, Henry; Erickson, Loren D.

    2014-01-01

    Objective T follicular helper (TFH) cells are critical for the development of protective antibodies via germinal center (GC) B-cell responses; however, uncontrolled TFH cell expansion activates autoreactive B-cells to produce antibodies that cause autoimmunity. The mechanisms that control TFH cell homeostasis remains largely unknown. The aim of this study was to determine the contribution of BAFF to TFH cell responses in autoimmunity. Methods We analyzed the properties of TFH cells in lupus-prone mice, sufficient or deficient in B-cell maturation antigen (BCMA). Adoptive transfer studies and mixed bone marrow chimeras were used to test BCMA signaling in T cells. We assessed BAFF stimulation of TFH cells through in vitro cell cocultures and in vivo depletion studies using flow cytometry. Results In Nba2 mice, TFH cells expressed the BAFF receptors BCMA and BR3, and accumulated in the spleen when BCMA was absent. BCMA deficiency in T cells promoted the expansion of TFH cells, GC formation, autoantibody production, and IFNγ production by TFH cells through BR3. IFNγ-producing TFH cells increased BAFF expression in dendritic cells. Blocking BAFF or IFNγ in vivo reduced TFH cell accumulation and improved autoimmunity in BCMA-deficient animals. Moreover, circulating TFH-like cells that expressed BR3 (but not BCMA) were elevated in SLE patients, which correlated with serum BAFF and IFNγ titers. Conclusion In Nba2 mice, BCMA negatively regulates TFH cell expansion whereas BAFF signaling through BR3 promotes TFH cell accumulation. Our work suggests the balance between BCMA and BR3 signaling in TFH cells serves as a checkpoint of immune tolerance. PMID:25385309

  6. Characterisation of the TNF superfamily members CD40L and BAFF in the small-spotted catshark (Scyliorhinus canicula).

    PubMed

    Li, Ronggai; Redmond, Anthony K; Wang, Tiehui; Bird, Steve; Dooley, Helen; Secombes, Chris J

    2015-11-01

    The tumour necrosis factor superfamily (TNFSF) members CD40L and BAFF play critical roles in mammalian B cell survival, proliferation and maturation, however little is known about these key cytokines in the oldest jawed vertebrates, the cartilaginous fishes. Here we report the cloning of CD40L and BAFF orthologues (designated ScCD40L and ScBAFF) in the small-spotted catshark (Scyliorhinus canicula). As predicted both proteins are type II membrane-bound proteins with a TNF homology domain in their extracellular region and both are highly expressed in shark immune tissues. ScCD40L transcript levels correlate with those of TCRα and transcription of both genes is modulated in peripheral blood leukocytes following in vitro stimulation. Although a putative CD40L orthologue was identified in the elephant shark genome the work herein is the first molecular characterisation and transcriptional analysis of CD40L in a cartilaginous fish. ScBAFF was also cloned and its transcription characterised in an attempt to resolve the discrepancies observed between spiny dogfish BAFF and bamboo shark BAFF in previously published studies. PMID:26386192

  7. BAFF and APRIL from Activin A-Treated Dendritic Cells Upregulate the Antitumor Efficacy of Dendritic Cells In Vivo.

    PubMed

    Shurin, Michael R; Ma, Yang; Keskinov, Anton A; Zhao, Ruijing; Lokshin, Anna; Agassandian, Marianna; Shurin, Galina V

    2016-09-01

    The members of the TGFβ superfamily play a key role in regulating developmental and homeostasis programs by controlling differentiation, proliferation, polarization, and survival of different cell types. Although the role of TGFβ1 in inflammation and immunity is well evident, the contribution of other TGFβ family cytokines in the modulation of the antitumor immune response remains less documented. Here we show that activin A triggers SMAD2 and ERK1/2 pathways in dendritic cells (DC) expressing type I and II activin receptors, and upregulates production of the TNFα family cytokines BAFF (TALL-1, TNFSF13B) and APRIL (TALL-2, TNFSF13A), which is blocked by SMAD2 and ERK1/2 inhibitors, respectively. BAFF and APRIL derived from activin A-treated DCs upregulate proliferation and survival of T cells expressing the corresponding receptors, BAFF-R and TACI. In vivo, activin A-stimulated DCs demonstrate a significantly increased ability to induce tumor-specific CTLs and inhibit the growth of melanoma and lung carcinoma, which relies on DC-derived BAFF and APRIL, as knockdown of the BAFF and APRIL gene expression in activin A-treated DCs blocks augmentation of their antitumor potential. Although systemic administration of activin A, BAFF, or APRIL for the therapeutic purposes is not likely due to the pluripotent effects on malignant and nonmalignant cells, our data open a novel opportunity for improving the efficacy of DC vaccines. In fact, a significant augmentation of the antitumor activity of DC pretreated with activin A and the proven role of DC-derived BAFF and APRIL in the induction of antitumor immunity in vivo support this direction. Cancer Res; 76(17); 4959-69. ©2016 AACR. PMID:27364554

  8. Rescue of the mature B cell compartment in BAFF-deficient mice by treatment with recombinant Fc-BAFF.

    PubMed

    Swee, Lee Kim; Tardivel, Aubry; Schneider, Pascal; Rolink, Antonius

    2010-06-15

    BAFF deficiency in mice impairs B cell development beyond the transitional stage 1 in the spleen and thus severely reduces the size of follicular and marginal zone B cell compartments. Moreover, humoral immune responses in these mice are dramatically impaired. We now addressed the question whether the decrease in mature B cell numbers and the reduced humoral immune responses in BAFF-deficient mice could be overcome by the injection of recombinant BAFF. We therefore engineered a recombinant protein containing the human IgG1 Fc moiety fused to receptor-binding domain of human BAFF (Fc-BAFF). At 1 week after the second injection of this fusion protein a complete rescue of the marginal zone B cell compartment and a 50% rescue of the follicular B cell compartment was observed. Moreover these mice mounted a T cell-dependent humoral immune response indistinguishable from wild-type mice. By day 14 upon arrest of Fc-BAFF treatment mature B cell numbers in the blood dropped by 50%, indicating that the life span of mature B cells in the absence of BAFF is 14 days or less. Collectively these findings demonstrate that injection of Fc-BAFF in BAFF-deficient mice results in a temporary rescue of a functional mature B cell compartment. PMID:20350570

  9. B-cell survival factors in autoimmune rheumatic disorders

    PubMed Central

    Morais, Sandra A.; Vilas-Boas, Andreia

    2015-01-01

    Autoimmune rheumatic disorders have complex etiopathogenetic mechanisms in which B cells play a central role. The importance of factors stimulating B cells, notably the B-cell activating factor (BAFF) and A proliferation inducing ligand (APRIL) axis is now recognized. BAFF and APRIL are cytokines essential for B-cell proliferation and survival from the immature stages to the development of plasma cells. Their levels are increased in some subsets of patients with autoimmune disorders. Several recent biologic drugs have been developed to block this axis, namely belimumab [already licensed for systemic lupus erythematosus (SLE) treatment], tabalumab, atacicept and blisibimod. Many clinical trials to evaluate the safety and efficacy of these drugs in several autoimmune disorders are ongoing, or have been completed recently. This review updates the information on the use of biologic agents blocking BAFF/APRIL for patients with SLE, rheumatoid arthritis, Sjögren’s syndrome and myositis. PMID:26288664

  10. Deficiency of the B Cell-Activating Factor Receptor Results in Limited CD169+ Macrophage Function during Viral Infection

    PubMed Central

    Xu, Haifeng C.; Huang, Jun; Khairnar, Vishal; Duhan, Vikas; Pandyra, Aleksandra A.; Grusdat, Melanie; Shinde, Prashant; McIlwain, David R.; Maney, Sathish Kumar; Gommerman, Jennifer; Löhning, Max; Ohashi, Pamela S.; Mak, Tak W.; Pieper, Kathrin; Sic, Heiko; Speletas, Matthaios; Eibel, Hermann; Ware, Carl F.; Tumanov, Alexei V.; Kruglov, Andrey A.; Nedospasov, Sergei A.; Häussinger, Dieter; Recher, Mike; Lang, Karl S.

    2015-01-01

    ABSTRACT The B cell-activating factor (BAFF) is critical for B cell development and humoral immunity in mice and humans. While the role of BAFF in B cells has been widely described, its role in innate immunity remains unknown. Using BAFF receptor (BAFFR)-deficient mice, we characterized BAFFR-related innate and adaptive immune functions following infection with vesicular stomatitis virus (VSV) and lymphocytic choriomeningitis virus (LCMV). We identified a critical role for BAFFR signaling in the generation and maintenance of the CD169+ macrophage compartment. Consequently, Baffr−/− mice exhibited limited induction of innate type I interferon production after viral infection. Lack of BAFFR signaling reduced virus amplification and presentation following viral infection, resulting in highly reduced antiviral adaptive immune responses. As a consequence, BAFFR-deficient mice showed exacerbated and fatal disease after viral infection. Mechanistically, transient lack of B cells in Baffr−/− animals resulted in limited lymphotoxin expression, which is critical for maintenance of CD169+ cells. In conclusion, BAFFR signaling affects both innate and adaptive immune activation during viral infections. IMPORTANCE Viruses cause acute and chronic infections in humans resulting in millions of deaths every year. Innate immunity is critical for the outcome of a viral infection. Innate type I interferon production can limit viral replication, while adaptive immune priming by innate immune cells induces pathogen-specific immunity with long-term protection. Here, we show that BAFFR deficiency not only perturbed B cells, but also resulted in limited CD169+ macrophages. These macrophages are critical in amplifying viral particles to trigger type I interferon production and initiate adaptive immune priming. Consequently, BAFFR deficiency resulted in reduced enforced viral replication, limited type I interferon production, and reduced adaptive immunity compared to BAFFR

  11. Survival of Igα-Deficient Mature B Cells Requires BAFF-R Function.

    PubMed

    Levit-Zerdoun, Ella; Becker, Martin; Pohlmeyer, Roland; Wilhelm, Isabel; Maity, Palash Chandra; Rajewsky, Klaus; Reth, Michael; Hobeika, Elias

    2016-03-01

    Expression of a functional BCR is essential for the development of mature B cells and has been invoked in the control of their maintenance. To test this maintenance function in a new experimental setting, we used the tamoxifen-inducible mb1-CreER(T2) mouse strain to delete or truncate either the mb-1 gene encoding the BCR signaling subunit Igα or the VDJ segment of the IgH (H chain [HC]). In this system, Cre-mediated deletion of the mb-1 gene is accompanied by expression of a GFP reporter. We found that, although the Igα-deficient mature B cells survive for >20 d in vivo, the HC-deficient or Igα tail-truncated B cell population is short-lived, with the HC-deficient cells displaying signs of an unfolded protein response. We also show that Igα-deficient B cells still respond to the prosurvival factor BAFF in culture and require BAFF-R signaling for their in vivo maintenance. These results suggest that, under certain conditions, the loss of the BCR can be tolerated by mature B cells for some time, whereas HC-deficient B cells, potentially generated by aberrant somatic mutations in the germinal center, are rapidly eliminated. PMID:26843325

  12. Serum BAFF and APRIL Levels, T-Lymphocyte Subsets, and Immunoglobulins after B-Cell Depletion Using the Monoclonal Anti-CD20 Antibody Rituximab in Myalgic Encephalopathy/Chronic Fatigue Syndrome.

    PubMed

    Lunde, Sigrid; Kristoffersen, Einar K; Sapkota, Dipak; Risa, Kristin; Dahl, Olav; Bruland, Ove; Mella, Olav; Fluge, Øystein

    2016-01-01

    Myalgic Encephalopathy/Chronic Fatigue Syndrome (ME/CFS) is a disease of unknown etiology. We have previously suggested clinical benefit from B-cell depletion using the monoclonal anti-CD20 antibody rituximab in a randomized and placebo-controlled study. Prolonged responses were then demonstrated in an open-label phase-II study with maintenance rituximab treatment. Using blood samples from patients in the previous two clinical trials, we investigated quantitative changes in T-lymphocyte subsets, in immunoglobulins, and in serum levels of two B-cell regulating cytokines during follow-up. B-lymphocyte activating factor of the tumor necrosis family (BAFF) in baseline serum samples was elevated in 70 ME/CFS patients as compared to 56 healthy controls (p = 0.011). There were no significant differences in baseline serum BAFF levels between patients with mild, moderate, or severe ME/CFS, or between responders and non-responders to rituximab. A proliferation-inducing ligand (APRIL) serum levels were not significantly different in ME/CFS patients compared to healthy controls at baseline, and no changes in serum levels were seen during follow-up. Immunophenotyping of peripheral blood T-lymphocyte subsets and T-cell activation markers at multiple time points during follow-up showed no significant differences over time, between rituximab and placebo groups, or between responders and non-responders to rituximab. Baseline serum IgG levels were significantly lower in patients with subsequent response after rituximab therapy compared to non-responders (p = 0.03). In the maintenance study, slight but significant reductions in mean serum immunoglobulin levels were observed at 24 months compared to baseline; IgG 10.6-9.5 g/L, IgA 1.8-1.5 g/L, and IgM 0.97-0.70 g/L. Although no functional assays were performed, the lack of significant associations of T- and NK-cell subset numbers with B-cell depletion, as well as the lack of associations to clinical responses, suggest that B

  13. Serum BAFF and APRIL Levels, T-Lymphocyte Subsets, and Immunoglobulins after B-Cell Depletion Using the Monoclonal Anti-CD20 Antibody Rituximab in Myalgic Encephalopathy/Chronic Fatigue Syndrome

    PubMed Central

    Lunde, Sigrid; Kristoffersen, Einar K.; Sapkota, Dipak; Risa, Kristin; Dahl, Olav; Bruland, Ove; Mella, Olav; Fluge, Øystein

    2016-01-01

    Myalgic Encephalopathy/Chronic Fatigue Syndrome (ME/CFS) is a disease of unknown etiology. We have previously suggested clinical benefit from B-cell depletion using the monoclonal anti-CD20 antibody rituximab in a randomized and placebo-controlled study. Prolonged responses were then demonstrated in an open-label phase-II study with maintenance rituximab treatment. Using blood samples from patients in the previous two clinical trials, we investigated quantitative changes in T-lymphocyte subsets, in immunoglobulins, and in serum levels of two B-cell regulating cytokines during follow-up. B-lymphocyte activating factor of the tumor necrosis family (BAFF) in baseline serum samples was elevated in 70 ME/CFS patients as compared to 56 healthy controls (p = 0.011). There were no significant differences in baseline serum BAFF levels between patients with mild, moderate, or severe ME/CFS, or between responders and non-responders to rituximab. A proliferation-inducing ligand (APRIL) serum levels were not significantly different in ME/CFS patients compared to healthy controls at baseline, and no changes in serum levels were seen during follow-up. Immunophenotyping of peripheral blood T-lymphocyte subsets and T-cell activation markers at multiple time points during follow-up showed no significant differences over time, between rituximab and placebo groups, or between responders and non-responders to rituximab. Baseline serum IgG levels were significantly lower in patients with subsequent response after rituximab therapy compared to non-responders (p = 0.03). In the maintenance study, slight but significant reductions in mean serum immunoglobulin levels were observed at 24 months compared to baseline; IgG 10.6–9.5 g/L, IgA 1.8–1.5 g/L, and IgM 0.97–0.70 g/L. Although no functional assays were performed, the lack of significant associations of T- and NK-cell subset numbers with B-cell depletion, as well as the lack of associations to clinical responses, suggest that B

  14. The protein tyrosine phosphatase PTP1B is a negative regulator of CD40 and BAFF-R signaling and controls B cell autoimmunity

    PubMed Central

    Hobeika, Elias; Biesen, Robert; Kollert, Florian; Taddeo, Adriano; Voll, Reinhard E.; Hiepe, Falk

    2014-01-01

    Tyrosine phosphorylation of signaling molecules that mediate B cell activation in response to various stimuli is tightly regulated by protein tyrosine phosphatases (PTPs). PTP1B is a ubiquitously expressed tyrosine phosphatase with well-characterized functions in metabolic signaling pathways. We show here that PTP1B negatively regulates CD40, B cell activating factor receptor (BAFF-R), and TLR4 signaling in B cells. Specifically, PTP1B counteracts p38 mitogen-activated protein kinase (MAPK) activation by directly dephosphorylating Tyr182 of this kinase. Mice with a B cell–specific PTP1B deficiency show increased T cell–dependent immune responses and elevated total serum IgG. Furthermore, aged animals develop systemic autoimmunity with elevated serum anti-dsDNA, spontaneous germinal centers in the spleen, and deposition of IgG immune complexes and C3 in the kidney. In a clinical setting, we observed that B cells of rheumatoid arthritis patients have significantly reduced PTP1B expression. Our data suggest that PTP1B plays an important role in the control of B cell activation and the maintenance of immunological tolerance. PMID:24590766

  15. Factors regulating microglia activation

    PubMed Central

    Kierdorf, Katrin; Prinz, Marco

    2013-01-01

    Microglia are resident macrophages of the central nervous system (CNS) that display high functional similarities to other tissue macrophages. However, it is especially important to create and maintain an intact tissue homeostasis to support the neuronal cells, which are very sensitive even to minor changes in their environment. The transition from the “resting” but surveying microglial phenotype to an activated stage is tightly regulated by several intrinsic (e.g., Runx-1, Irf8, and Pu.1) and extrinsic factors (e.g., CD200, CX3CR1, and TREM2). Under physiological conditions, minor changes of those factors are sufficient to cause fatal dysregulation of microglial cell homeostasis and result in severe CNS pathologies. In this review, we discuss recent achievements that gave new insights into mechanisms that ensure microglia quiescence. PMID:23630462

  16. Coagulant Activity of Leukocytes. TISSUE FACTOR ACTIVITY

    PubMed Central

    Niemetz, J.

    1972-01-01

    Peritoneal leukocytes harvested from rabbits which have received two spaced doses of endotoxin have significantly greater (10-fold) coagulant activity than leukocytes from control rabbits. The coagulant activity accelerates the clotting of normal plasma and activates factor X in the presence of factor VII and calcium and is therefore regarded as tissue factor. A total of 40-80 mg tissue factor activity was obtained from the peritoneal cavity of single endotoxin-treated rabbits. In leukocyte subcellular fractions, separated by centrifugation, the specific tissue factor activity sedimented mainly at 14,500 g and above. The procoagulant activity was destroyed after heating for 10 min at 65°C but was preserved at lower temperatures. Polymyxin B, when given with the first dose of endotoxin, reduced both the number of peritoneal leukocytes and their tissue factor activity by two-thirds. When given immediately before the second dose of endotoxin, polymyxin B had no inhibitory effect. PMID:4333021

  17. Suppression of Epithelial Signal Transducer and Activator of Transcription 1 Activation by Extracts of Aspergillus fumigatus

    PubMed Central

    Bhushan, Bharat; Homma, Tetsuya; Norton, James E.; Sha, Quan; Siebert, Jason; Gupta, Dave S.; Schroeder, James W.

    2015-01-01

    Aspergillus fumigatus (AF) is often pathogenic in immune-deficient individuals and can cause life-threatening infections such as invasive aspergillosis. The pulmonary epithelial response to AF infection and the signaling pathways associated with it have not been completely studied. BEAS-2B cells or primary human bronchial epithelial cells were exposed to extracts of AF and challenged with IFN-β or the Toll-like receptor 3 agonist double-stranded RNA (dsRNA). Cytokine release (B-cell activating factor of the TNF family [BAFF], IFN-γ–induced protein-10 [IP-10], etc.) was assessed. AF extract was separated into low-molecular-weight (LMW) and high-molecular-weight (HMW) fractions using ultra 4 centrifugal force filters to characterize the activity. Real-time PCR was performed with a TaqMan method, and protein estimation was performed using ELISA techniques. Western blot was performed to assess phosphorylation of signal transducer and activator of transcription 1 (STAT1). IFN-β and dsRNA induced messenger RNA (mRNA) expression of BAFF (350- and 452-fold, respectively [n = 3]) and IP-10 (1,081- and 3,044-fold, respectively [n = 3]) in BEAS-2B cells. When cells were pretreated with AF extract for 1 hour and then stimulated with IFN-β or dsRNA for 6 hours, induction of BAFF and IP-10 mRNA was strongly suppressed relative to levels produced by IFN-β and dsRNA alone. When compared with control, soluble BAFF and IP-10 protein levels were maximally suppressed in dsRNA-stimulated wells treated with 1:320 wt/vol AF extract (P < 0.005). Upon molecular size fractionation, a LMW fraction of AF extract had no measurable suppressive effect on IP-10 mRNA expression. However, a HMW fraction of the AF extract significantly suppressed IP-10 expression in BEAS-2B cells that were stimulated with dsRNA or IFN-β. When BEAS-2B cells were pretreated with AF extract and then stimulated with IFN-β, reduced levels of pSTAT1 were observed, with maximum suppression at 4 and 6

  18. Suppression of epithelial signal transducer and activator of transcription 1 activation by extracts of Aspergillus fumigatus.

    PubMed

    Bhushan, Bharat; Homma, Tetsuya; Norton, James E; Sha, Quan; Siebert, Jason; Gupta, Dave S; Schroeder, James W; Schleimer, Robert P

    2015-07-01

    Aspergillus fumigatus (AF) is often pathogenic in immune-deficient individuals and can cause life-threatening infections such as invasive aspergillosis. The pulmonary epithelial response to AF infection and the signaling pathways associated with it have not been completely studied. BEAS-2B cells or primary human bronchial epithelial cells were exposed to extracts of AF and challenged with IFN-β or the Toll-like receptor 3 agonist double-stranded RNA (dsRNA). Cytokine release (B-cell activating factor of the TNF family [BAFF], IFN-γ-induced protein-10 [IP-10], etc.) was assessed. AF extract was separated into low-molecular-weight (LMW) and high-molecular-weight (HMW) fractions using ultra 4 centrifugal force filters to characterize the activity. Real-time PCR was performed with a TaqMan method, and protein estimation was performed using ELISA techniques. Western blot was performed to assess phosphorylation of signal transducer and activator of transcription 1 (STAT1). IFN-β and dsRNA induced messenger RNA (mRNA) expression of BAFF (350- and 452-fold, respectively [n = 3]) and IP-10 (1,081- and 3,044-fold, respectively [n = 3]) in BEAS-2B cells. When cells were pretreated with AF extract for 1 hour and then stimulated with IFN-β or dsRNA for 6 hours, induction of BAFF and IP-10 mRNA was strongly suppressed relative to levels produced by IFN-β and dsRNA alone. When compared with control, soluble BAFF and IP-10 protein levels were maximally suppressed in dsRNA-stimulated wells treated with 1:320 wt/vol AF extract (P < 0.005). Upon molecular size fractionation, a LMW fraction of AF extract had no measurable suppressive effect on IP-10 mRNA expression. However, a HMW fraction of the AF extract significantly suppressed IP-10 expression in BEAS-2B cells that were stimulated with dsRNA or IFN-β. When BEAS-2B cells were pretreated with AF extract and then stimulated with IFN-β, reduced levels of pSTAT1 were observed, with maximum suppression at 4 and 6

  19. Activation of human factor V by factor Xa and thrombin

    SciTech Connect

    Monkovic, D.D.; Tracy, P.B. )

    1990-02-06

    The activation of human factor V by factor Xa and thrombin was studied by functional assessment of cofactor activity and sodium dodecyl sulfate-polycarylamide gel electrophoresis followed by either autoradiography of {sup 125}I-labeled factor V activation products or Western blot analyses of unlabeled factor V activation products. Cofactor activity was measured by the ability of the factor V/Va peptides to support the activation of prothrombin. The factor Xa catalyzed cleavage of factor V was observed to be time, phospholipid, and calcium ion dependent, yielding a cofactor with activity equal to that of thrombin-activated factor V (factor Va). The cleavage pattern differed markedly from the one observed in the bovine system. The factor Xa activated factor V subunits expressing cofactor activity were isolated and found to consist of peptides of M{sub r} 220,000 and 105,000. Although thrombin cleaved the M{sub r} 220,000 peptide to yield peptides previously shown to be products of thrombin activation, cofactor activity did not increase. N-Terminal sequence analysis confirmed that both factor Xa and thrombin cleave factor V at the same bond to generate the M{sub r} 220,000 peptide. The factor Xa dependent functional assessment of {sup 125}I-labeled factor V coupled with densitometric analyses of the cleavage products indicated that the cofactor activity of factor Xa activated factor V closely paralleled the appearance of the M{sub r} 220,000 peptide. The data indicate that factor Xa is as efficient an enzyme toward factor V as thrombin.

  20. Chemokine/cytokine profiling after rituximab: reciprocal expression of BCA-1/CXCL13 and BAFF in childhood OMS.

    PubMed

    Pranzatelli, Michael R; Tate, Elizabeth D; Travelstead, Anna L; Verhulst, Steven J

    2011-03-01

    The aim of the study was to test the hypothesis that B-cell repopulation following rituximab (anti-CD20) therapy is orchestrated by chemokines and non-chemokine cytokines. Twenty-five children with opsoclonus-myoclonus syndrome (OMS) received rituximab with or without conventional agents. A comprehensive panel of 40 chemokines and other cytokines were measured in serum by ELISA and multiplexed fluorescent bead-based immunoassay. Serum BAFF concentration changed dramatically (even after first infusion) and inversely with B-cell depletion/repopulation and CXCL13 concentration at 1, 3, and 6 months. Negative correlations were found for BAFF concentration vs blood B cell percentage and serum CXCL13 concentration; positive correlations with serum rituximab concentrations. Six months after initiation of therapy, no significant difference in the levels of APRIL, CXCL10, IL-6, or 17 other cytokines/chemokines were detected. These data reveal a major role for BAFF in peripheral B cell repopulation following rituximab-induced B-cell depletion, and novel changes in CXCL13. ClinicalTrials.gov NCT0024436. PMID:21211990

  1. BAFF, APRIL, TWEAK, BCMA, TACI and Fn14 Proteins Are Related to Human Glioma Tumor Grade: Immunohistochemistry and Public Microarray Data Meta-Analysis

    PubMed Central

    Pelekanou, Vassiliki; Notas, George; Kampa, Marilena; Tsentelierou, Eleftheria; Stathopoulos, Efstathios N.; Tsapis, Andreas; Castanas, Elias

    2013-01-01

    Gliomas are common and lethal tumors of the central nervous system (CNS). Genetic alterations, inflammatory and angiogenic processes have been identified throughout tumor progression; however, treatment still remains palliative for most cases. Biological research on parameters influencing cell survival, invasion and tumor heterogeneity identified several cytokines interfering in CNS inflammation, oxidative stress and malignant transformation, including TNF-superfamily (TNFSF) members. In this report we performed a meta-analysis of public gene-array data on the expression of a group of TNFSF ligands (BAFF, APRIL, TWEAK) and their receptors (BAFF-R, TACI, BCMA, Fn14) in gliomas. In addition, we investigated by immunohistochemistry (IHC) the tumor cells' expression of these ligands and receptors in a series of 56 gliomas of different grade. We show that in IHC, BAFF and APRIL as well as their cognate receptors (BCMA, TACI) and Fn14 expression correlate with tumor grade. This result was not evidenced in micro-arrays meta-analysis. Finally, we detected for the first time Fn14, BAFF, BCMA and TACI in glioma-related vascular endothelium. Our data, combined with our previous report in glioma cell lines, suggest a role for these receptors and ligands in glioma biology and advance these molecules as potential markers for the classification of these tumors to the proliferative, angiogenic or stem-like molecular subtype. PMID:24376672

  2. Activity factors of the Korean exposure factors handbook.

    PubMed

    Jang, Jae-Yeon; Jo, Soo-Nam; Kim, So-Yeon; Lee, Kyung-Eun; Choi, Kyung-Ho; Kim, Young-Hee

    2014-01-01

    Exposure factors based on the Korean population are required for making appropriate risk assessment. It is expected that handbooks for exposure factors will be applied in many fields, as well as by health department risk assessors. The present article describes the development of an exposure factors handbook that specifically focuses on human activities in situations involving the possible risk of exposure to environmental contaminants. We define majour exposure factors that represent behavioral patterns for risk assessment, including time spent on routine activities, in different places, on using transportation, and engaged in activities related to water contact including swimming, bathing and washing. Duration of residence and employment are also defined. National survey data were used to identify recommended levels of exposure factors in terms of time spent on routine activities and period of residence and employment. An online survey was conducted with 2073 subjects who were selected using a stratified random sampling method in order to develop a list of exposure factors for the time spent in different places and in performing water-related activities. We provide the statistical distribution of the variables, and report reference levels of average exposure based on the reliable data in our exposure factors handbook. PMID:24570804

  3. An activation factor of liver phosphofructokinase.

    PubMed Central

    Furuya, E; Uyeda, K

    1980-01-01

    Pure phosphofructokinase (ATP:D-fructose-6-phosphate 1-phosphotransferase, EC 2.7.1.11) from liver is strongly inhibited by ATP, whereas crude phosphofructokinase is only slightly inhibited by ATP. A factor that is removed from the enzyme during purification and can prevent the inhibition of phosphofructokinase by ATP has been isolated. The factor can be resolved into three components that differ in molecular weights, as shown by gel filtration on Sephadex G-25. These factors overcome the ATP inhibition but have no effect on the catalytic activity under the optimum assay conditions. Furthermore, AMP acts syngeristically with the activation factor in reversing ATP inhibition. It is proposed that the activation of phosphofructokinase by the activation factor and AMP is sufficient to account for the glycolytic flux in the liver. PMID:6449699

  4. Activation of factor X by rat hepatocytes

    SciTech Connect

    Willingham, A.K.; Matschiner, J.T.

    1986-05-01

    Synthesis and secretion of blood coagulation factor X was studied in hepatocytes prepared by perfusion of rat livers with collagenase. Hepatocytes were incubated in the presence of vitamin K and /sup 3/H-leucine for up to 4h at 37/sup 0/C. Factor X was isolated from the incubation medium by immunochemical techniques and analyzed by SDS-PAGE. The recovered /sup 3/H-labeled proteins migrated, after reduction of disulfides, as two polypeptide chains with apparent molecular weights (M/sub r/) of approximately 42,000 and 22,000 representing the heavy and light chains of factor X respectively. The apparent M/sub r/ of the heavy chain was about 10,000 daltons lighter than seen with the heavy chain of factor X isolated from rat plasma and was more characteristic of the heavy chain of factor Xa. When the levels of factor X secreted by hepatocytes were determined by clotting assays, activity was present as factor Xa. Also, when purified plasma factor X was added to incubations of hepatocytes (>95% parenchymal cells) the added factor X was rapidly converted to factor Xa. Plasma membranes prepared from isolated hepatocytes or from liver homogenates contained an enzyme that converted factor X to factor Xa in a calcium dependent reaction. The physiological significance of a factor X activating enzyme on hepatocyte plasma membranes is not clear.

  5. Reduced Number of Transitional and Naive B Cells in Addition to Decreased BAFF Levels in Response to the T Cell Independent Immunogen Pneumovax®23

    PubMed Central

    Roth, Alena; Glaesener, Stephanie; Schütz, Katharina; Meyer-Bahlburg, Almut

    2016-01-01

    Protective immunity against T cell independent (TI) antigens such as Streptococcus pneumoniae is characterized by antibody production of B cells induced by the combined activation of T cell independent type 1 and type 2 antigens in the absence of direct T cell help. In mice, the main players in TI immune responses have been well defined as marginal zone (MZ) B cells and B-1 cells. However, the existence of human equivalents to these B cell subsets and the nature of the human B cell compartment involved in the immune reaction remain elusive. We therefore analyzed the effect of a TI antigen on the B cell compartment through immunization of healthy individuals with the pneumococcal polysaccharide (PnPS)-based vaccine Pneumovax®23, and subsequent characterization of B cell subpopulations. Our data demonstrates a transient decrease of transitional and naïve B cells, with a concomitant increase of IgA+ but not IgM+ or IgG+ memory B cells and a predominant generation of PnPS-specific IgA+ producing plasma cells. No alterations could be detected in T cells, or proposed human B-1 and MZ B cell equivalents. Consistent with the idea of a TI immune response, antigen-specific memory responses could not be observed. Finally, BAFF, which is supposed to drive class switching to IgA, was unexpectedly found to be decreased in serum in response to Pneumovax®23. Our results demonstrate that a characteristic TI response induced by Pneumovax®23 is associated with distinct phenotypical and functional changes within the B cell compartment. Those modulations occur in the absence of any modulations of T cells and without the development of a specific memory response. PMID:27031098

  6. HIV-1 Adenoviral Vector Vaccines Expressing Multi-Trimeric BAFF and 4-1BBL Enhance T Cell Mediated Anti-Viral Immunity

    PubMed Central

    Gupta, Sachin; Raffa, Francesca N.; Fuller, Katherine A.; Rivas, Yaelis; Philip, Sakhi; Kornbluth, Richard S.; Stone, Geoffrey W.

    2014-01-01

    Adenoviral vectored vaccines have shown considerable promise but could be improved by molecular adjuvants. Ligands in the TNF superfamily (TNFSF) are potential adjuvants for adenoviral vector (Ad5) vaccines based on their central role in adaptive immunity. Many TNFSF ligands require aggregation beyond the trimeric state (multi-trimerization) for optimal biological function. Here we describe Ad5 vaccines for HIV-1 Gag antigen (Ad5-Gag) adjuvanted with the TNFSF ligands 4-1BBL, BAFF, GITRL and CD27L constructed as soluble multi-trimeric proteins via fusion to Surfactant Protein D (SP-D) as a multimerization scaffold. Mice were vaccinated with Ad5-Gag combined with Ad5 expressing one of the SP-D-TNFSF constructs or single-chain IL-12p70 as adjuvant. To evaluate vaccine-induced protection, mice were challenged with vaccinia virus expressing Gag (vaccinia-Gag) which is known to target the female genital tract, a major route of sexually acquired HIV-1 infection. In this system, SP-D-4-1BBL or SP-D-BAFF led to significantly reduced vaccinia-Gag replication when compared to Ad5-Gag alone. In contrast, IL-12p70, SP-D-CD27L and SP-D-GITRL were not protective. Histological examination following vaccinia-Gag challenge showed a dramatic lymphocytic infiltration into the uterus and ovaries of SP-D-4-1BBL and SP-D-BAFF-treated animals. By day 5 post challenge, proinflammatory cytokines in the tissue were reduced, consistent with the enhanced control over viral replication. Splenocytes had no specific immune markers that correlated with protection induced by SP-D-4-1BBL and SP-D-BAFF versus other groups. IL-12p70, despite lack of anti-viral efficacy, increased the total numbers of splenic dextramer positive CD8+ T cells, effector memory T cells, and effector Gag-specific CD8+ T cells, suggesting that these markers are poor predictors of anti-viral immunity in this model. In conclusion, soluble multi-trimeric 4-1BBL and BAFF adjuvants led to strong protection from vaccinia

  7. BAFF-secreting neutrophils drive plasma cell responses during emergency granulopoiesis.

    PubMed

    Parsa, Roham; Lund, Harald; Georgoudaki, Anna-Maria; Zhang, Xing-Mei; Ortlieb Guerreiro-Cacais, André; Grommisch, David; Warnecke, Andreas; Croxford, Andrew L; Jagodic, Maja; Becher, Burkhard; Karlsson, Mikael C I; Harris, Robert A

    2016-07-25

    Prolonged infections or adjuvant usage can trigger emergency granulopoiesis (EG), leading to dysregulation in neutrophil blood counts. However, the impact of EG on T and B cell function remains largely unknown. In this study, to address this question, we used a mouse model of neutropenia and studied immune activation after adjuvant administration. The initial neutropenic state fostered an environment of increased dendritic cell activation and T cell-derived IL-17 production. Interestingly, neutropenic lysozyme 2-diphtheria toxin A mice exhibited striking EG and amplified neutrophil recruitment to the lymph nodes (LNs) that was dependent on IL-17-induced prostaglandin activity. The recruited neutrophils secreted a B cell-activating factor that highly accelerated plasma cell generation and antigen-specific antibody production. Reduction of neutrophil functions via granulocyte colony-stimulating factor neutralization significantly diminished plasma cell formation, directly linking EG with the humoral immune response. We conclude that neutrophils are capable of directly regulating T cell-dependent B cell responses in the LN. PMID:27432941

  8. Complement activation induced by rabbit rheumatoid factor.

    PubMed Central

    Meyer, R R; Brown, J C

    1980-01-01

    Rabbit rheumatoid factor produced in animals by hyperimmunized with group C streptococcal vaccine activated guinea pig complement. Anti-streptococcal serum was fractionated by Sephacryl S-200 chromatography into excluded (19S) and included (7S) material and examined for hemolytic activity in a sensitive homologous hemolytic assay system. In the presence of complement, both 19S and 7S antistreptococcal serum fractions induced lysis of bovine (ox) erythrocytes coated with mildly reduced and carboxymethylated rabbit anti-erythrocyte immunoglobulin G. That rabbit rheumatoid factor was responsible for the observed hemolytic activity was substantiated by hemolytic inhibition assays. Significant inhibition of hemolysis was effected when antistreptococcal serum fractions were incubated in the presence of human immunoglobulin G, rabbit immunoglobulin G, and Fc, whereas, no inhibition was detected when the same fractions were tested in the presence of rabbit Fab or F(ab')2 fragments. Deaggregation of inhibitor preparations revealed a preferential reactivity of rheumatoid factor for rabbit immunoglobulin G. In addition to the rheumatoid factor-dependent hemolytic activity observed in humoral preparations, immunoglobulin G-specific antibody-forming cells in spleen and peripheral blood lymphocyte isolates were enumerated by plaque-forming cell assay. PMID:7399707

  9. Factors Associated with Evaluating Public Relations Activities.

    ERIC Educational Resources Information Center

    McElreath, Mark P.

    More than 150 public relations practitioners responded to a survey designed to identify and clarify factors associated with evaluative research in public relations. Responses indicated that (1) no more than half the practitioners formally evaluate their public relations activities on a regular basis; (2) the majority of evaluation is done…

  10. Activating transcription factor 2 in mesenchymal tumors.

    PubMed

    Endo, Makoto; Su, Le; Nielsen, Torsten O

    2014-02-01

    Activating transcription factor 2 (ATF2) is a member of activator protein 1 superfamily, which can heterodimerize with other transcription factors regulating cell differentiation and survival. ATF2 assembles into a complex with the synovial sarcoma translocation, chromosome 18 (SS18)-synovial sarcoma, X breakpoint (SSX) fusion oncoprotein, and the transducin-like enhancer of split 1 (TLE1) corepressor, driving oncogenesis in synovial sarcoma. The fusion oncoproteins in many other translocation-associated sarcomas incorporate transcription factors from the ATF/cAMP response element binding or E26 families, which potentially form heterodimers with ATF2 to regulate transcription. ATF2 may therefore play an important role in the oncogenesis of many mesenchymal tumors, but as yet, little is known about its protein expression in patient specimens. Herein we perform immunohistochemical analyses using a validated specific antibody for ATF2 expression and intracellular localization on a cohort of 594 malignant and 207 benign mesenchymal tumors representing 47 diagnostic entities. Melanoma served as a positive control for nuclear and cytoplasmic staining. High nuclear ATF2 expression was mainly observed in translocation-associated and/or spindle cell sarcomas including synovial sarcoma, desmoplastic small round cell tumor, endometrial stromal sarcoma, gastrointestinal stromal tumor, malignant peripheral nerve sheath tumor, and solitary fibrous tumor. Cytoplasmic ATF2 expression was less frequently seen than nuclear expression in malignant mesenchymal tumors. Benign mesenchymal tumors mostly showed much lower nuclear and cytoplasmic ATF2 expression. PMID:24289970

  11. Platelet activating factor activity in the phospholipids of bovine spermatozoa

    SciTech Connect

    Parks, J.E.; Hough, S.; Elrod, C. )

    1990-11-01

    Platelet activating factor (PAF) has been detected in sperm from several mammalian species and can affect sperm motility and fertilization. Because bovine sperm contain a high percentage of ether-linked phospholipid precursors required for PAF synthesis, a study was undertaken to determine the PAF activity of bovine sperm phospholipids. Total lipids of washed, ejaculated bull sperm were extracted, and phospholipids were fractionated by thin-layer chromatography. Individual phospholipid fractions were assayed for PAF activity on the basis of (3H)serotonin release from equine platelets. PAF activity was detected in the PAF fraction (1.84 pmol/mumol total phospholipid) and in serine/inositol (PS/PI), choline (CP), and ethanolamine phosphoglyceride (EP) and cardiolipin (CA) fractions. Activity was highest in the CP fraction (8.05 pmol/mumol total phospholipid). Incomplete resolution of PAF and neutral lipids may have contributed to the activity in the PS/PI and CA fractions, respectively. Phospholipids from nonsperm sources did not stimulate serotonin release. Platelet activation by purified PAF and by sperm phospholipid fractions was inhibited by the receptor antagonist SRI 63-675. These results indicate that bovine sperm contain PAF and that other sperm phospholipids, especially CP and EP, which are high in glycerylether components, are capable of receptor-mediated platelet activation.

  12. Particle emission factors during cooking activities

    NASA Astrophysics Data System (ADS)

    Buonanno, G.; Morawska, L.; Stabile, L.

    Exposure to particles emitted by cooking activities may be responsible for a variety of respiratory health effects. However, the relationship between these exposures and their subsequent effects on health cannot be evaluated without understanding the properties of the emitted aerosol or the main parameters that influence particle emissions during cooking. Whilst traffic-related emissions, stack emissions and concentrations of ultrafine particles (UFPs, diameter < 100 nm) in urban ambient air have been widely investigated for many years, indoor exposure to UFPs is a relatively new field and in order to evaluate indoor UFP emissions accurately, it is vital to improve scientific understanding of the main parameters that influence particle number, surface area and mass emissions. The main purpose of this study was to characterise the particle emissions produced during grilling and frying as a function of the food, source, cooking temperature and type of oil. Emission factors, along with particle number concentrations and size distributions were determined in the size range 0.006-20 μm using a Scanning Mobility Particle Sizer (SMPS) and an Aerodynamic Particle Sizer (APS). An infrared camera was used to measure the temperature field. Overall, increased emission factors were observed to be a function of increased cooking temperatures. Cooking fatty foods also produced higher particle emission factors than vegetables, mainly in terms of mass concentration, and particle emission factors also varied significantly according to the type of oil used.

  13. Mechanisms of Specificity for Hox Factor Activity

    PubMed Central

    Zandvakili, Arya; Gebelein, Brian

    2016-01-01

    Metazoans encode clusters of paralogous Hox genes that are critical for proper development of the body plan. However, there are a number of unresolved issues regarding how paralogous Hox factors achieve specificity to control distinct cell fates. First, how do Hox paralogs, which have very similar DNA binding preferences in vitro, drive different transcriptional programs in vivo? Second, the number of potential Hox binding sites within the genome is vast compared to the number of sites bound. Hence, what determines where in the genome Hox factors bind? Third, what determines whether a Hox factor will activate or repress a specific target gene? Here, we review the current evidence that is beginning to shed light onto these questions. In particular, we highlight how cooperative interactions with other transcription factors (especially PBC and HMP proteins) and the sequences of cis-regulatory modules provide a basis for the mechanisms of Hox specificity. We conclude by integrating a number of the concepts described throughout the review in a case study of a highly interrogated Drosophila cis-regulatory module named “The Distal-less Conserved Regulatory Element” (DCRE). PMID:27583210

  14. Complement activating factor(s) of Trypanosoma lewisi: some physiochemical characteristics of the active components.

    PubMed Central

    Nielsen, K; Sheppard, J; Tizard, I; Holmes, W

    1978-01-01

    Of the complement activating factors present in Trypanosoma lewisi, the major component, a carbohydrate containing substance was further investigated. This component was found to have a lag time of complete activation of 2 CH50 units of bovine complement of approximately 15 minutes while 1% trypsin (a known activator of complement, used as a control system) was capable of instant consumption of a similar quantity of complement. In addition, the complement activating factor of trypanosomes was observed to be stable at 100 degrees C for 15 minutes and over a pH range of 3.0 to 11.0. Thin layer chromatography studies suggested that at least part of the active component contained lipid, perhaps indicating that it may be glycolipid in nature. PMID:25701

  15. Cleavage and activation of human factor IX by serine proteases

    SciTech Connect

    Enfield, D.L.; Thompson, A.R.

    1984-10-01

    Human factor IX circulates as a single-chain glycoprotein. Upon activation in vitro, it is cleaved into disulfide-linked light and heavy chains and an activation peptide. After reduction of activated /sup 125/I-factor IX, the heavy and light chains are readily identified by gel electrophoresis. A direct, immunoradiometric assay for factor IXa was developed to assess activation of factor IX for proteases that cleaved it. The assay utilized radiolabeled antithrombin III with heparin to identify the active site and antibodies to distinguish factor IX. After cleavage of factor IX by factor XIa, factor VIIa-tissue thromboplastin complex, or the factor X-activating enzyme from Russell's viper venom, antithrombin III bound readily to factor IXa. Cleavage of /sup 125/I-factor IX by trypsin, chymotrypsin, and granulocyte elastase in the presence of calcium yielded major polypeptide fragments of the sizes of the factor XIa-generated light and heavy chains. When the immunoradiometric assay was used to assess trypsin-cleaved factor IX, the product bound antithrombin III, but not maximally. After digesting with insolubilized trypsin, clotting activity confirmed activation. In evaluating activation of factor IX, physical evidence of activation cleavages does not necessarily correlate with generation of an active site.

  16. Characterization of the clotting activities of structurally different forms of activated factor IX. Enzymatic properties of normal human factor IXa alpha, factor IXa beta, and activated factor IX Chapel Hill.

    PubMed Central

    Griffith, M J; Breitkreutz, L; Trapp, H; Briet, E; Noyes, C M; Lundblad, R L; Roberts, H R

    1985-01-01

    Two structurally different forms of activated human Factor IX (Factor IXa alpha and IXa beta) have been previously reported to have essentially identical clotting activity in vitro. Although it has been shown that activated Factor IX Chapel Hill, an abnormal Factor IX isolated from the plasma of a patient with mild hemophilia B, and normal Factor IXa alpha are structurally very similar, the clotting activity of activated Factor IX Chapel Hill is much lower (approximately fivefold) than that of normal Factor IXa beta. In the present study we have prepared activated Factor IX by incubating human Factor IX with calcium and Russell's viper venom covalently bound to agarose. Fractionation of the activated Factor IX by high-performance liquid chromatography demonstrated the presence of both Factors IXa alpha and IXa beta. On the basis of active site concentration, determined by titration with antithrombin III, the clotting activities of activated Factor IX Chapel Hill and IXa alpha were similar, but both activities were less than 20% of the clotting activity of Factor IXa beta. Activated Factor IX activity was also measured in the absence of calcium, phospholipid, and Factor VIII, by determination of the rate of Factor X activation in the presence of polylysine. In the presence of polylysine, the rates of Factor X activation by activated Factor IX Chapel Hill, Factor IXa alpha, and Factor IXa beta were essentially identical. We conclude that the clotting activity of activated Factor IX Chapel Hill is reduced when compared with that of Factor IXa beta but essentially normal when compared with that of Factor IXa alpha. PMID:3871202

  17. Factors Influencing Cypriot Children's Physical Activity Levels

    ERIC Educational Resources Information Center

    Loucaides, Constantinos A.; Chedzoy, Sue M.

    2005-01-01

    The purpose of this paper is to present selected findings from a larger study, which set out to examine the physical activity levels of Cypriot primary school children and determinants of their activity. Twenty parents of children who obtained high and low activity scores based on pedometer counts and self-reports scores were interviewed. By…

  18. Co-factor activated recombinant adenovirus proteinases

    DOEpatents

    Anderson, Carl W.; Mangel, Walter F.

    1996-08-06

    This application describes methods and expression constructs for producing activatable recombinant adenovirus proteinases. Purified activatable recombinant adenovirus proteinases and methods of purification are described. Activated adenovirus proteinases and methods for obtaining activated adenovirus proteinases are further included. Isolated peptide cofactors of adenovirus proteinase activity, methods of purifying and identifying said peptide cofactors are also described. Antibodies immunoreactive with adenovirus proteinases, immunospecific antibodies, and methods for preparing them are also described. Other related methods and materials are also described.

  19. Co-factor activated recombinant adenovirus proteinases

    DOEpatents

    Anderson, C.W.; Mangel, W.F.

    1996-08-06

    This application describes methods and expression constructs for producing activatable recombinant adenovirus proteinases. Purified activatable recombinant adenovirus proteinases and methods of purification are described. Activated adenovirus proteinases and methods for obtaining activated adenovirus proteinases are further included. Isolated peptide cofactors of adenovirus proteinase activity, methods of purifying and identifying the peptide cofactors are also described. Antibodies immunoreactive with adenovirus proteinases, immunospecific antibodies, and methods for preparing them are also described. Other related methods and materials are also described. 29 figs.

  20. Virulence Factor-activity Relationships: Workshop Summary

    EPA Science Inventory

    The concept or notion of virulence factor–activity relationships (VFAR) is an approach for identifying an analogous process to the use of qualitative structure–activity relationships (QSAR) for identifying new microbial contaminants. In QSAR, it is hypothesized that, for new chem...

  1. Prolylcarboxypeptidase Independently Activates Plasma Prekallikrein (Fletcher Factor)

    PubMed Central

    Wang, J.; Matafonov, A.; Madkhali, H.; Mahdi, F.; Watson, D.; Schmaier, A.H.; Gailani, D.; Shariat-Madar, Z.

    2015-01-01

    Prolylcarboxypeptidase isoform 1 (PRCP1) is capable of regulating numerous autocrines and hormones, such as angiotensin II, angiotensin III, αMSH1-13, and DesArg9 bradykinin. It does so by cleaving a C-terminal PRO-X bond. Recent work also indicates that the human PRCP1 activates plasma prekallikrein (PK) to kallikrein on endothelial cells through an uncharacterized mechanism. This study aims to identify PRCP1 binding interaction and cleavage site on PK. Recently, a cDNA encoding a novel splice variant of the human PRCP1 was identified. This isoform differed only in the N-terminal region of the deduced amino acid sequence. Using structural and functional studies, a combination of peptide mapping and site-directed mutagenesis approaches were employed to investigate the interaction of PRCP1 with PK. Three PRCP peptides, in decreasing order of potency, from 1) the N-terminus of the secreted protein, 2) spanning the opening of the active site pocket, and 3) in the dimerization region inhibit PRCP activation of PK on endothelial cells. Investigations also tested the hypothesis that PRCP cleavage site on PK is between its C-terminal Pro 637 (P637) and Ala 638 (A638). Recombinant forms of PK with C-terminal alanine mutagenesis or a stop codon is activated equally as wild type PK by PRCP. In conclusion, PRCP1 interacts with PK at multiple sites for PK activation. PRCP1 also enhances FXIIa activation of PK, suggesting that its activation site on PK is not identical to that of FXIIa. PMID:25324000

  2. Postbiotic activities of lactobacilli-derived factors.

    PubMed

    Cicenia, Alessia; Scirocco, Annunziata; Carabotti, Marilia; Pallotta, Lucia; Marignani, Massimo; Severi, Carola

    2014-01-01

    Probiotics are alive nonpathogenic microorganisms present in the gut microbiota that confer benefits to the host for his health. They act through molecular and cellular mechanisms that contrast pathogen bacteria adhesion, enhance innate immunity, decrease pathogen-induced inflammation, and promote intestinal epithelial cell survival, barrier function, and protective responses. Some of these beneficial effects result to be determined by secreted probiotic-derived factors that recently have been identified as "postbiotic" mediators. They have been reported for several probiotic strains but most available literature concerns Lactobacilli. In this review, we focus on the reported actions of several secretory products of different Lactobacillus species highlighting the available mechanistic data. The identification of soluble factors mediating the beneficial effects of probiotics may present an opportunity not only to understand their fine mechanisms of action, but also to develop effective pharmacological strategies that could integrate the action of treatments with live bacteria. PMID:25291118

  3. Learning Risk Factors for Suicide: A Scenario-Based Activity

    ERIC Educational Resources Information Center

    Madson, Laura; Vas, Corey J.

    2003-01-01

    We created a classroom activity to illustrate factors that may predict suicide. In the activity, students rank 4 fictional individuals in terms of their relative risk for attempting or committing suicide. Students described the activity as "eye-opening," and students who participated in the activity learned more about the warning signs of an…

  4. Posttranslational modifications and activity of natural and recombinant tissue factor

    PubMed Central

    Butenas, Saulius; Krudysz-Amblo, Jolanta; Mann, Kenneth G

    2010-01-01

    Tissue factor is a membrane protein, which in a complex with factor VIIa initiates in vivo blood coagulation. Due to the scarcity of natural tissue factor protein, most studies have relied upon recombinant tissue factor forms. However, there have been only cursory experimental comparisons of natural and recombinant tissue factor proteins. Our preliminary data suggested that placental tissue factor in a complex with factor VIIa was more efficient activator of factor X than the recombinant protein. After deglycosylation, both forms of tissue factor showed almost an identical activity in the extrinsic factor Xase. Analyses using tryptic digestion and mass-spectrometry revealed that the levels of glycosylation and the composition of carbohydrates present in natural placental tissue factor were different than those in its recombinant counterpart. These data indicate that natural and recombinant tissue factor proteins differ in their posttranslational modifications and that these differences translate into different cofactor activity. Thus the use of recombinant tissue factor proteins for the quantitation of natural tissue factor is misleading. PMID:20138335

  5. Reduction of salivary tissue factor (thromboplastin) activity by warfarin therapy.

    PubMed

    Zacharski, L R; Rosenstein, R

    1979-03-01

    The coagulant of normal human saliva has been identified as tissue factor (thromboplastin, TF) by virtue of its ability to cause rapid coagulation in plasmas deficient in first-stage coagulation factors and to activate factor x in the presence of factor VII and by virtue of the fact that its activity is expressed only in the presence of factor VII and is inhibited by an antibody to TF. The TF is related to cells and cell fragments in saliva. Salivary TF activity has been found to be significantly reduced in patients taking warfarin. The decline in TF activity during induction of warfarin anticoagulation occurs during the warfarin-induced decline in vitamin-K-dependent clotting factor activity, as judged by the prothrombin time. The decrease in TF activity is not related to a reduction in salivary cell count or total protein content or to a direct effect of warfarin on the assay. It is hypothesized that the mechanism by which warfarin inhibits TF activity may be related to the mechanism by which it inhibits expression of the activity of the vitamin-K-dependent clotting factors. Inhibition of the TF activity may be involved in the antithrombotic effect of warfarin. PMID:760859

  6. Influencing Factors of Thermogenic Adipose Tissue Activity

    PubMed Central

    Zhang, Guoqing; Sun, Qinghua; Liu, Cuiqing

    2016-01-01

    Obesity is an escalating public health challenge and contributes tremendously to the disease burden globally. New therapeutic strategies are required to alleviate the health impact of obesity-related metabolic dysfunction. Brown adipose tissue (BAT) is specialized for dissipating chemical energy for thermogenesis as a defense against cold environment. Intriguingly, the brown-fat like adipocytes that dispersed throughout white adipose tissue (WAT) in rodents and humans, called “brite” or “beige” adipocytes, share similar thermogenic characteristics to brown adipocytes. Recently, researchers have focused on cognition of these thermogenic adipose tissues. Some factors have been identified to regulate the development and function of thermogenic adipose tissues. Cold exposure, pharmacological conditions, and lifestyle can enhance non-shivering thermogenesis and metabolism via some mechanisms. However, environmental pollutants, such as ambient fine particulates and ozone, may impair the function of these thermogenic adipose tissues and thereby induce metabolic dysfunction. In this review, the origin, function and influencing factors of thermogenic adipose tissues were summarized and it will provide insights into identifying new therapeutic strategies for the treatment of obesity and obesity-related diseases. PMID:26903879

  7. Influencing Factors of Thermogenic Adipose Tissue Activity.

    PubMed

    Zhang, Guoqing; Sun, Qinghua; Liu, Cuiqing

    2016-01-01

    Obesity is an escalating public health challenge and contributes tremendously to the disease burden globally. New therapeutic strategies are required to alleviate the health impact of obesity-related metabolic dysfunction. Brown adipose tissue (BAT) is specialized for dissipating chemical energy for thermogenesis as a defense against cold environment. Intriguingly, the brown-fat like adipocytes that dispersed throughout white adipose tissue (WAT) in rodents and humans, called "brite" or "beige" adipocytes, share similar thermogenic characteristics to brown adipocytes. Recently, researchers have focused on cognition of these thermogenic adipose tissues. Some factors have been identified to regulate the development and function of thermogenic adipose tissues. Cold exposure, pharmacological conditions, and lifestyle can enhance non-shivering thermogenesis and metabolism via some mechanisms. However, environmental pollutants, such as ambient fine particulates and ozone, may impair the function of these thermogenic adipose tissues and thereby induce metabolic dysfunction. In this review, the origin, function and influencing factors of thermogenic adipose tissues were summarized and it will provide insights into identifying new therapeutic strategies for the treatment of obesity and obesity-related diseases. PMID:26903879

  8. Factor XI and Contact Activation as Targets for Antithrombotic Therapy

    PubMed Central

    Gailani, David; Bane, Charles E.; Gruber, Andras

    2015-01-01

    Summary The most commonly used anticoagulants produce therapeutic antithrombotic effects either by inhibiting thrombin or factor Xa, or by lowering the plasma levels of the precursors of these key enzymes, prothrombin and factor X. These drugs do not distinguish between thrombin generation contributing to thrombosis from thrombin generation required for hemostasis. Thus, anticoagulants increase bleeding risk, and many patients who would benefit from therapy go untreated because of comorbidities that place them at unacceptable risk for hemorrhage. Studies in animals demonstrate that components of the plasma contact activation system contribute to experimentally-induced thrombosis, despite playing little or no role in hemostasis. Attention has focused on factor XII, the zymogen of a protease (factor XIIa) that initiates contact activation when blood is exposed to foreign surfaces; and factor XI, the zymogen of the protease factor XIa, which links contact activation to the thrombin generation mechanism. In the case of factor XI, epidemiologic data indicate this protein contributes to stroke and venous thromboembolism, and perhaps myocardial infarction, in humans. A phase 2 trial showing that reduction of factor XI may be more effective than low-molecular-weight heparin at preventing venous thrombosis during knee replacement surgery provides proof of concept for the premise that an antithrombotic effect can be uncoupled from an anticoagulant effect in humans by targeting components of contact activation. Here we review data on the role of factor XI and factor XII in thrombosis, and results of pre-clinical and human trials for therapies targeting these proteins. PMID:25976012

  9. ANALYSIS OF ARACHIDONIC ACID METABOLITE AND PLATELET ACTIVATING FACTOR PRODUCTION

    EPA Science Inventory

    Metabolites of arachidonic acid ("eicosanoids") and platelet activating factor are important bioactive lipids that may be involved in the pathobiological alterations in animals induced by pollutant exposure. nalysis of these substances in biological tissue and fluids is important...

  10. Activation of factor XII and prekallikrein with cholesterol sulfate.

    PubMed

    Shimada, T; Kato, H; Iwanaga, S; Iwamori, M; Nagai, Y

    1985-04-01

    Cholesterol sulfate was found to display a strong ability to trigger the activation of Factor XII and prekallikrein in the presence of HMW kininogen. Other sulfate ester derivatives of testosterone, estrone, pregnenolone and dehydroepiandrosterone and cholesterol tested did not show any effect on the activation of Factor XII and prekallikrein. The activity of cholesterol acetate and sulfodeoxycholic acid was very weak. Cholesterol sulfate markedly shortened the partial thromboplastin time of normal human plasma, but not plasmas deficient in Factor XII, Factor XI and HMW kininogen. Upon prolonged incubation, the partial thromboplastin time of prekallikrein-deficient plasma was also shortened. Moreover, as well as kaolin and sulfatide, cholesterol sulfate shortened the partial thromboplastin time of plasmas from monkey, dog, rat, guinea pig, sheep, cow, hog and horse, but not from duck and chicken. Since cholesterol sulfate is distributed in erythrocytes, various organs and body fluids, it may play an important role in the activation of the intrinsic blood coagulation system. PMID:3847226

  11. The dimeric structure of factor XI and zymogen activation

    PubMed Central

    Geng, Yipeng; Verhamme, Ingrid M.; Smith, Stephen B.; Sun, Mao-fu; Matafonov, Anton; Cheng, Qiufang; Smith, Stephanie A.; Morrissey, James H.

    2013-01-01

    Factor XI (fXI) is a homodimeric zymogen that is converted to a protease with 1 (1/2-fXIa) or 2 (fXIa) active subunits by factor XIIa (fXIIa) or thrombin. It has been proposed that the dimeric structure is required for normal fXI activation. Consistent with this premise, fXI monomers do not reconstitute fXI-deficient mice in a fXIIa-dependent thrombosis model. FXI activation by fXIIa or thrombin is a slow reaction that can be accelerated by polyanions. Phosphate polymers released from platelets (poly-P) can enhance fXI activation by thrombin and promote fXI autoactivation. Poly-P increased initial rates of fXI activation 30- and 3000-fold for fXIIa and thrombin, respectively. FXI monomers were activated more slowly than dimers by fXIIa in the presence of poly-P. However, this defect was not observed when thrombin was the activating protease, nor during fXI autoactivation. The data suggest that fXIIa and thrombin activate fXI by different mechanisms. FXIIa may activate fXI through a trans-activation mechanism in which the protease binds to 1 subunit of the dimer, while activating the other subunit. For activation by thrombin, or during autoactivation, the data support a cis-activation mechanism in which the activating protease binds to and activates the same fXI subunit. PMID:23515926

  12. Differential proteolytic activation of factor VIII-von Willebrand factor complex by thrombin

    SciTech Connect

    Hill-Eubanks, D.C.; Parker, C.G.; Lollar, P. )

    1989-09-01

    Blood coagulation factor VIII (fVIII) is a plasma protein that is decreased or absent in hemophilia A. It is isolated as a mixture of heterodimers that contain a variably sized heavy chain and a common light chain. Thrombin catalyzes the activation of fVIII in a reaction that is associated with cleavages in both types of chain. The authors isolated a serine protease from Bothrops jararacussu snake venom that catalyzes thrombin-like heavy-chain cleavage but not light-chain cleavage in porcine fVIII as judged by NaDodSO{sub 4}/PAGE and N-terminal sequence analysis. Using a plasma-free assay of the ability of activated {sup 125}I-fVIII to function as a cofactor in the activation of factor X by factor IXa, they found that fVIII is activated by the venom enzyme. The venom enzyme-activated fVIII was isolated in stable form by cation-exchange HPLC. von Willebrand factor inhibited venom enzyme-activated fVIII but not thrombin-activated fVIII. These results suggest that the binding of fVIII to von Willebrand factor depends on the presence of an intact light chain and that activated fVIII must dissociate from von Willebrand factor to exert its cofactor effect. Thus, proteolytic activation of fVIII-von Willebrand factor complex appears to be differentially regulated by light-chain cleavage to dissociate the complex and heavy-chain cleavage to activate the cofactor function.

  13. Potential Role of Activating Transcription Factor 5 during Osteogenesis.

    PubMed

    Vicari, Luisa; Calabrese, Giovanna; Forte, Stefano; Giuffrida, Raffaella; Colarossi, Cristina; Parrinello, Nunziatina Laura; Memeo, Lorenzo

    2016-01-01

    Human adipose-derived stem cells are an abundant population of stem cells readily isolated from human adipose tissue that can differentiate into connective tissue lineages including bone, cartilage, fat, and muscle. Activating transcription factor 5 is a transcription factor of the ATF/cAMP response element-binding protein (CREB) family. It is transcribed in two types of mRNAs (activating transcription factor 5 isoform 1 and activating transcription factor 5 isoform 2), encoding the same single 30-kDa protein. Although it is well demonstrated that it regulates the proliferation, differentiation, and apoptosis, little is known about its potential role in osteogenic differentiation. The aim of this study was to evaluate the expression levels of the two isoforms and protein during osteogenic differentiation of human adipose-derived stem cells. Our data indicate that activating transcription factor 5 is differentially expressed reaching a peak of expression at the stage of bone mineralization. These findings suggest that activating transcription factor 5 could play an interesting regulatory role during osteogenesis, which would provide a powerful tool to study bone physiology. PMID:26770207

  14. Mesenchymal stem cells inhibit complement activation by secreting factor H.

    PubMed

    Tu, Zhidan; Li, Qing; Bu, Hong; Lin, Feng

    2010-11-01

    Mesenchymal stem cells (MSCs) possess potent and broad immunosuppressive capabilities, and have shown promise in clinical trials treating many inflammatory diseases. Previous studies have found that MSCs inhibit dendritic cell, T-cell, and B-cell activities in the adaptive immunity; however, whether MSCs inhibit complement in the innate immunity, and if so, by which mechanism, have not been established. In this report, we found that MSCs constitutively secrete factor H, which potently inhibits complement activation. Depletion of factor H in the MSC-conditioned serum-free media abolishes their complement inhibitory activities. In addition, production of factor H by MSCs is augmented by inflammatory cytokines TNF-α and interferon-γ (IFN-γ) in dose- and time-dependent manners, while IL-6 does not have a significant effect. Furthermore, the factor H production from MSCs is significantly suppressed by the prostaglandin E2 (PGE2) synthesis inhibitor indomethacin and the indoleamine 2,3-dioxygenase (IDO) inhibitor 1-methyl-d-tryptophan (1-MT), both of which inhibitors are known to efficiently dampen MSCs immunosuppressive activity. These results indicate that MSCs inhibit complement activation by producing factor H, which could be another mechanism underlying MSCs broad immunosuppressive capabilities. PMID:20163251

  15. Formation of tissue factor activity following incubation of recombinant human tissue factor apoprotein with plasma lipoproteins

    SciTech Connect

    Sakai, T.; Kisiel, W. )

    1990-11-01

    Incubation of recombinant human tissue factor apoprotein (Apo-TF) with human plasma decreased the recalcified clotting time of this plasma in a time-and dose-dependent manner suggesting relipidation of the Apo-TF by plasma lipoproteins. Incubation of Apo-TF with purified preparations of human very low density, low density and high density lipoproteins resulted in tissue factor activity in a clotting assay. The order of effectiveness was VLDL greater than LDL much greater than HDL. Tissue factor activity generated by incubation of a fixed amount of Apo-TF with plasma lipoproteins was lipoprotein concentration-dependent and saturable. The association of Apo-TF with lipoprotein particles was supported by gel filtration studies in which {sup 125}I-Apo-TF coeluted with the plasma lipoprotein in the void volume of a Superose 6 column in the presence and absence of calcium ions. In addition, void-volume Apo-TF-lipoprotein fractions exhibited tissue factor activity. These results suggest that the factor VIII-bypassing activity of bovine Apo-TF observed in a canine hemophilic model may be due, in part, to its association with plasma lipoproteins and expression of functional tissue factor activity.

  16. Changes in CVD risk factors in the activity counseling trial

    PubMed Central

    Baruth, Meghan; Wilcox, Sara; Sallis, James F; King, Abby C; Marcus, Bess H; Blair, Steven N

    2011-01-01

    Primary care facilities may be a natural setting for delivering interventions that focus on behaviors that improve cardiovascular disease (CVD) risk factors. The purpose of this study was to examine the 24-month effects of the Activity Counseling Trial (ACT) on CVD risk factors, to examine whether changes in CVD risk factors differed according to baseline risk factor status, and to examine whether changes in fitness were associated with changes in CVD risk factors. ACT was a 24-month multicenter randomized controlled trial to increase physical activity. Participants were 874 inactive men and women aged 35–74 years. Participants were randomly assigned to one of three arms that varied by level of counseling, intensity, and resource requirements. Because there were no significant differences in change over time between arms on any of the CVD risk factors examined, all arms were combined, and the effects of time, independent of arm, were examined separately for men and women. Time × Baseline risk factor status interactions examined whether changes in CVD risk factors differed according to baseline risk factor status. Significant improvements in total cholesterol, high-density lipoprotein cholesterol (HDL-C) and low-density lipoprotein cholesterol, the ratio of total cholesterol to HDL-C, and triglycerides were seen in both men and women who had high (or low for HDL-C) baseline levels of risk factors, whereas significant improvements in diastolic blood pressure were seen only in those men with high baseline levels. There were no improvements in any risk factors among participants with normal baseline levels. Changes in fitness were associated with changes in a number of CVD risk factors. However, most relationships disappeared after controlling for changes in body weight. Improvements in lipids from the ACT interventions could reduce the risk of coronary heart disease in people with already high levels of lipids by 16%–26% in men and 11%–16% in women

  17. Reduced serum inhibition of platelet-activating factor activity in preeclampsia.

    PubMed

    Benedetto, C; Massobrio, M; Bertini, E; Abbondanza, M; Enrieu, N; Tetta, C

    1989-01-01

    We determined in normal nonpregnant (group 1) women, normal pregnant (group 2) women, and patients with preeclampsia (group 3) the serum inhibition of platelet-activating factor activity, the presence of detectable amounts of platelet-activating factor in the blood, and platelet responsiveness in vitro to platelet-activating factor, and to other agonists (adenosine diphosphate, collagen, and ristocetin), and prostacyclin (prostaglandin I2). In patients with preeclampsia (group 3) the serum inhibition of platelet-activating factor activity was significantly lower than that in groups 1 and 2. However, no detectable amounts of platelet-activating factor were observed. The mean values of platelet aggregation induced by platelet-activating factor, adenosine diphosphate, collagen and ristocetin, and the prostaglandin I2-inhibitory concentration of 50% which is inversely correlated with platelet sensitivity to prostaglandin I2, were not significantly different between groups 2 and 3. It is suggested that in preeclampsia the defect in serum inhibitory potential of platelet-activating factor--induced platelet aggregation may contribute to the disturbance in the homeostatic balance between proaggregant and antiaggregant substances. PMID:2912073

  18. In vivo activation and functions of the protease factor XII.

    PubMed

    Björkqvist, Jenny; Nickel, Katrin F; Stavrou, Evi; Renné, Thomas

    2014-11-01

    Combinations of proinflammatory and procoagulant reactions are the unifying principle for a variety of disorders affecting the cardiovascular system. Factor XII (FXII, Hageman factor) is a plasma protease that initiates the contact system. The biochemistry of the contact system in vitro is well understood; however, its in vivo functions are just beginning to emerge. The current review concentrates on activators and functions of the FXII-driven contact system in vivo. Elucidating its physiologic activities offers the exciting opportunity to develop strategies for the safe interference with both thrombotic and inflammatory diseases. PMID:25187064

  19. Protease-induced immunoregulatory activity of platelet factor 4.

    PubMed Central

    Katz, I R; Thorbecke, G J; Bell, M K; Yin, J Z; Clarke, D; Zucker, M B

    1986-01-01

    Intravenous injection of human or mouse serum or platelet material secreted from appropriately stimulated platelets ("releasate") together with antigen alleviates the immunosuppression in SJL/J mice induced by injection of irradiated lymphoma cells or in (CB6)F1 mice induced by injection of concanavalin A. We now report that injection of releasate from 10(6) human platelets restores plaque-forming cells to the unsuppressed number; greater amounts increase responses further. Immunoregulatory activity is released from platelets exposed to thrombin in parallel with other alpha-granule components. Heparin-agarose absorbs activity. Purified platelet factor 4 (PF4) has activity; beta-thromboglobulin and platelet-derived growth factor have little or none. Activity in serum is neutralized by goat anti-human PF4. An enzymatic step is necessary for production of immunoregulatory activity. Releasates boiled immediately after platelet aggregation with 250 nM A23187 or those produced by adding A23187 in the presence of 100 microM serine protease inhibitor (p-amidinophenyl)methanesulfonyl fluoride (APMSF) are ineffective, whereas releasates boiled or mixed with APMSF after incubation for 60 min are active. Activity is generated by incubating a mixture of heparin-absorbed releasate (as enzyme source) and heparin-agarose eluate of releasate made in the presence of APMSF (as substrate source). The enzymatic step does not alter the heparin-neutralizing activity of PF4. Apparently a secreted platelet protease converts PF4 to a form with immunoregulatory activity. PMID:3517862

  20. Activated factor XI increases the procoagulant activity of the extrinsic pathway by inactivating tissue factor pathway inhibitor

    PubMed Central

    Tucker, Erik I.; Matafonov, Anton; Cheng, Qiufang; Zientek, Keith D.; Gailani, Dave; Gruber, András; McCarty, Owen J. T.

    2015-01-01

    Activation of coagulation factor XI (FXI) may play a role in hemostasis. The primary substrate of activated FXI (FXIa) is FIX, leading to FX activation (FXa) and thrombin generation. However, recent studies suggest the hemostatic role of FXI may not be restricted to the activation of FIX. We explored whether FXI could interact with and inhibit the activity of tissue factor pathway inhibitor (TFPI). TFPI is an essential reversible inhibitor of activated factor X (FXa) and also inhibits the FVIIa-TF complex. We found that FXIa neutralized both endothelium- and platelet-derived TFPI by cleaving the protein between the Kunitz (K) 1 and K2 domains (Lys86/Thr87) and at the active sites of the K2 (Arg107/Gly108) and K3 (Arg199/Ala200) domains. Addition of FXIa to plasma was able to reverse the ability of TFPI to prolong TF-initiated clotting times in FXI- or FIX-deficient plasma, as well as FXa-initiated clotting times in FX-deficient plasma. Treatment of cultured endothelial cells with FXIa increased the generation of FXa and promoted TF-dependent fibrin formation in recalcified plasma. Together, these results suggest that the hemostatic role of FXIa may be attributed not only to activation of FIX but also to promoting the extrinsic pathway of thrombin generation through inactivation of TFPI. PMID:25587039

  1. Activated factor XI increases the procoagulant activity of the extrinsic pathway by inactivating tissue factor pathway inhibitor.

    PubMed

    Puy, Cristina; Tucker, Erik I; Matafonov, Anton; Cheng, Qiufang; Zientek, Keith D; Gailani, Dave; Gruber, András; McCarty, Owen J T

    2015-02-26

    Activation of coagulation factor XI (FXI) may play a role in hemostasis. The primary substrate of activated FXI (FXIa) is FIX, leading to FX activation (FXa) and thrombin generation. However, recent studies suggest the hemostatic role of FXI may not be restricted to the activation of FIX. We explored whether FXI could interact with and inhibit the activity of tissue factor pathway inhibitor (TFPI). TFPI is an essential reversible inhibitor of activated factor X (FXa) and also inhibits the FVIIa-TF complex. We found that FXIa neutralized both endothelium- and platelet-derived TFPI by cleaving the protein between the Kunitz (K) 1 and K2 domains (Lys86/Thr87) and at the active sites of the K2 (Arg107/Gly108) and K3 (Arg199/Ala200) domains. Addition of FXIa to plasma was able to reverse the ability of TFPI to prolong TF-initiated clotting times in FXI- or FIX-deficient plasma, as well as FXa-initiated clotting times in FX-deficient plasma. Treatment of cultured endothelial cells with FXIa increased the generation of FXa and promoted TF-dependent fibrin formation in recalcified plasma. Together, these results suggest that the hemostatic role of FXIa may be attributed not only to activation of FIX but also to promoting the extrinsic pathway of thrombin generation through inactivation of TFPI. PMID:25587039

  2. Factors limiting microbial activity in volcanic tuff at Yucca Mountain

    SciTech Connect

    Kieft, T.L.; Kovacik, W.P.; Taylor, J.

    1996-09-01

    Samples of tuff aseptically collected from 10 locations in the Exploratory Shaft Facility at the site of the proposed high-level nuclear waste repository at Yucca Mountain, Nevada Test Site were analyzed for microbiological populations, activities, and factors limiting microbial activity. Radiotracer assays ({sup 14}C-labeled organic substrate mineralization), direct microscopic counts, and plate counts were used. Radiolabeled substrates were glucose, acetate, and glutamate. Radiotracer experiments were carried out with and without moisture and inorganic nutrient amendments to determine factors limiting to microbial activities. Nearly all samples showed the presence of microorganisms with the potential to mineralize organic substrates. Addition of inorganic nutrients stimulated activities in a small number of samples. The presence of viable microbial communities within the tuff has implications for transport of contaminants.

  3. mTOR-Dependent and Independent Survival Signaling by PI3K in B Lymphocytes

    PubMed Central

    Kaileh, Mary; Vazquez, Estefania; MacFarlane, Alexander W.; Campbell, Kerry; Kurosaki, Tomohiro; Siebenlist, Ulrich; Sen, Ranjan

    2016-01-01

    Peripheral B lymphocyte survival requires the B cell receptor (BCR) and B cell activating factor (BAFF) binding to its receptor (BAFF-R). Deletion of the BCR, or its signal transducing chaperone Igβ, leads to rapid loss of mature B cells, indicating that signals initiated at the BCR are crucial for B cell survival. BAFF or BAFF-R deficiency also significantly reduces the numbers of mature B cells despite normal BCR expression. Together, these observations indicate that continued BCR and BAFF-R signaling are essential for the survival of mature resting B cells in the periphery. Here we demonstrate that tonic BCR signals up-regulate p100 (Nfkb2) as well as Mcl-1 protein expression at a post-transcriptional level via a PI3K-dependent pathway. p100 expression is mTOR-independent, whereas Mcl-1 expression is mTOR-dependent. BAFF treatment further elevated Mcl-1 levels by an mTOR-independent pathway, while consuming p100. Accordingly, Mcl-1 induction by BAFF is abrogated in Nfkb2-/- B cells. We propose that the cumulative effects of the BCR and BAFF-R signaling pathways increase Mcl-1 levels beyond the threshold required for B cell survival. PMID:26785352

  4. Surface-Energy Dependent Contact Activation of Blood Factor XII

    PubMed Central

    Golas, Avantika; Parhi, Purnendu; Dimachkie, Ziad O.; Siedlecki, Christopher A.; Vogler, Erwin A.

    2009-01-01

    Contact activation of blood factor XII (FXII, Hageman factor) in neat-buffer solution exhibits a parabolic profile when scaled as a function of silanized-glass-particle activator surface energy (measured as advancing water adhesion tension τao=γlvocosθ in dyne/cm, where γlvo is water interfacial tension in dyne/cm and θ is the advancing contact angle). Nearly equal activation is observed at the extremes of activator water-wetting properties −36<τao<72 dyne/cm (0° ≤ θ < 120°), falling sharply through a broad minimum within the 20<τao<40 dyne/cm (55° < θ < 75°) range over which activation yield (putatively FXIIa) rises just above detection limits. Activation is very rapid upon contact with all activators tested and did not significantly vary over 30 minutes of continuous FXII-procoagulant contact. Results suggest that materials falling within the 20<τao<40 dyne/cm surface-energy range should exhibit minimal activation of blood-plasma coagulation through the intrinsic pathway. Surface chemistries falling within this range are, however, a perplexingly difficult target for surface engineering because of the critical balance that must be struck between hydrophobicity and hydrophilicity. Results are interpreted within the context of blood plasma coagulation and the role of water and proteins at procoagulant surfaces. PMID:19892397

  5. Factors Influencing Teachers' Engagement in Informal Learning Activities

    ERIC Educational Resources Information Center

    Lohman, Margaret C.

    2006-01-01

    Purpose: The purpose of this study is to examine factors influencing the engagement of public school teachers in informal learning activities. Design/methodology/approach: This study used a survey research design. Findings: Analysis of the data found that teachers rely to a greater degree on interactive than on independent informal learning…

  6. Total Chemical Synthesis of Biologically Active Vascular Endothelial Growth Factor

    SciTech Connect

    Mandal, Kalyaneswar; Kent, Stephen B.H.

    2011-09-15

    The 204-residue covalent-dimer vascular endothelial growth factor (VEGF, see picture) with full mitogenic activity was prepared from three unprotected peptide segments by one-pot native chemical ligations. The covalent structure of the synthetic VEGF was confirmed by precise mass measurement, and the three-dimensional structure of the synthetic protein was determined by high-resolution X-ray crystallography.

  7. Factors Influencing Active Learning in Small Enterprises. Working Paper.

    ERIC Educational Resources Information Center

    Hawke, Geof

    The factors influencing active learning in small enterprises were examined. Data from earlier Australian studies were examined in an attempt to provide a framework that might inform the relationship between educational systems and small enterprises. Special attention was paid to a 1988 study of systematic differences between small businesses that…

  8. Characterization and estrogen regulation of uterine growth factor activity

    SciTech Connect

    Beck, C.A.

    1988-01-01

    Acid extracts of rat, bovine and rabbit uterus stimulated glucose transport, measured by phosphorylation of 2-deoxyglucose and DNA synthesis, measured by {sup 3}H-thymidne incorporation, in uterine tumor cells and in primary cultures of rat uterine cells. The stimulation of glucose transport was of the same magnitude and followed the same time course as estradiol stimulation in vivo. Uteri from estradiol-treated rat uteri contained 4 times more glucose transport-stimulating activity as control uteri. DNA synthetic activity in rat uterine homogenates was elevated 3-fold within 18-24 h after estradiol injection. Gel filtration showed molecular weight heterogeneity with activity eluting between 10-30 kDA. Both activities were acid and heat stable, were reduced by trypsin but not by dextran-coated charcoal. The effect of purified growth factors on DNA synthesis in primary cultures of rat uterine cells was examined. Epidermal growth factor (EGF), basic fibroblasts growth factor (bFGF), and transforming growth factor-{beta} (TGF{beta}) had no effect on {sup 3}H-thymidine incorporation.

  9. The Relevant Factors in Promoting Reading Activities in Elementary Schools

    ERIC Educational Resources Information Center

    Huang, Han-Chen; Tsai, Yao-Hsu; Huang, Shih-Hsiang

    2015-01-01

    In order to help students absorb knowledge, schools often conduct reading activities. Thorough planning and strategies, however, are needed to insure the effect of reading promotions, and make them a deeply-rooted part of life. This study adopted the analytic hierarchy process (AHP) to discuss the relevant factors in promoting reading activities…

  10. Platelet activating factor: regulation by mast cells and aspirin.

    PubMed

    Denburg, J A; Williams, D B; Kinlough-Rathbone, R L; Cazenave, J P; Bienenstock, J

    1984-02-01

    We have investigated some aspects of the regulation of production of rat platelet activating factor (PAF)2 in vitro. Suspensions of unseparated (PLC1), mast cell-depleted (PLC2), or mast cell (MC)-enriched rat peritoneal lavage cells (PLC) were analyzed for PAF content by extraction at alkaline pH. PAF activity extracted from PLC1 varied inversely with viable cell concentration: at 1 X 10(6) cells/ml, 32 +/- 9.3 PAF units, decreasing to 11.2 +/- 9.5 units at 10 X 10(6) cells/ml, and no activity at higher concentrations. Incubation of PLC1 in Tyrode's buffer or acetylsalicylic acid (ASA), but not salicylate, resulted in a time-dependent loss of PAF activity. Mean PAF activity of PLC2 was similar to that in PLC1, while no PAF activity was extractable from MC. Co-incubation with MC extracts inhibited PAF activity of PLC1 extracts in a dose-dependent fashion. Ultracentrifugation of PAF-containing samples led to a loss of all PAF activity in PLC1 extracts, suggesting the association of PAF activity with subcellular components. PAF appears to be derived from a non-MC population of rat PLC, is not extractable from rat PLC in the presence of ASA and is inhibited by MC extracts. These studies suggest that ASA regulates PAF availability unrelated to its effect on cyclooxygenase and that MC membrane products directly inhibit PAF activity from rat PLC. PMID:6711391

  11. Psychosocial Factors and Theory in Physical Activity Studies in Minorities

    PubMed Central

    Mama, Scherezade K.; McNeill, Lorna H.; McCurdy, Sheryl A.; Evans, Alexandra E.; Diamond, Pamela M.; Adamus-Leach, Heather J.; Lee, Rebecca E.

    2015-01-01

    Objectives To summarize the effectiveness of interventions targeting psychosocial factors to increase physical activity (PA) among ethnic minority adults and explore theory use in PA interventions. Methods Studies (N = 11) were identified through a systematic review and targeted African American/Hispanic adults, specific psychosocial factors, and PA. Data were extracted using a standard code sheet and the Theory Coding Scheme. Results Social support was the most common psychosocial factor reported, followed by motivational readiness, and self-efficacy, as being associated with increased PA. Only 7 studies explicitly reported using a theoretical framework. Conclusions Future efforts should explore theory use in PA interventions and how integration of theoretical constructs, including psychosocial factors, increases PA. PMID:25290599

  12. LPS-inducible factor(s) from activated macrophages mediates cytolysis of Naegleria fowleri amoebae

    SciTech Connect

    Cleary, S.F.; Marciano-Cabral, F.

    1986-03-01

    Soluble cytolytic factors of macrophage origin have previously been described with respect to their tumoricidal activity. The purpose of this study was to investigate the mechanism and possible factor(s) responsible for cytolysis of the amoeba Naegleria fowleri by activated peritoneal macrophages from B6C3F1 mice. Macrophages or conditioned medium (CM) from macrophage cultures were incubated with /sup 3/H-Uridine labeled amoebae. Percent specific release of label served as an index of cytolysis. Bacille Calmette-Guerin (BCG) and Corynebacterium parvum macrophages demonstrated significant cytolysis of amoebae at 24 h with an effector to target ratio of 10:1. Treatment of macrophages with inhibitors of RNA or protein synthesis blocked amoebicidal activity. Interposition of a 1 ..mu..m pore membrane between macrophages and amoebae inhibited killing. Inhibition in the presence of the membrane was overcome by stimulating the macrophages with LPS. CM from SPS-stimulated, but not unstimulated, cultures of activated macrophages was cytotoxic for amoebae. The activity was heat sensitive and was recovered from ammonium sulfate precipitation of the CM. Results indicate that amoebicidal activity is mediated by a protein(s) of macrophage origin induced by target cell contact or stimulation with LPS.

  13. Factors affecting daily activities of patients with cerebral infarction

    PubMed Central

    Liu, Peng; Zhou, Cheng-ye; Zhang, Ying; Wang, Yun-feng; Zou, Chang-lin

    2010-01-01

    BACKGROUND: Stroke is the leading cause of death and long-term disability. This study was undertaken to investigate the factors influencing daily activities of patients with cerebral infarction so as to take interventional measures earlier to improve their daily activities. METHODS: A total of 149 patients with first-episode cerebral infarction were recruited into this prospective study. They were admitted to the Encephalopathy Center, Department of Neurology, the First Affiliated Hospital of Wenzhou Medical College in Zhejiang Province from August 2008 to December 2008. The baseline characteristics of the patients and cerebral infarction risk factors on the first day of admission were recorded. White blood cell (WBC) count, plasma glucose (PG), and many others of laboratory targets were collected in the next morning. Barthel index (BI) was calculated at 2 weeks and 3 months respectively after onset of the disease at the outpatient clinic or by telephone call. Lung infection, urinary tract infection and atrial fibrillation if any were recorded on admission. The National Institute of Health Stroke Scale (NIHSS) scores and the GCS scores were recorded within 24 hours on and after admission, at the second week, and at the third month after the onset of cerebral infarction respectively. RESULTS: The factors of BI at 2 weeks and 3 months after onset were the initial PG level, WBC count and initial NIHSS scores. Besides, urinary tract infection on admission was also the factor for BI at 3 months. CONCLUSION: Active measures should be taken to control these factors to improve the daily activities of patients with cerebral infarction. PMID:25214953

  14. Blood B Lymphocyte Stimulator (BLyS)/BAFF levels may reflect natural immunity to HIV in highly exposed uninfected Beninese Commercial Sex Workers

    PubMed Central

    Sabourin-Poirier, Catherine; Fourcade, Lyvia; Chagnon-Choquet, Josiane; Labbé, Annie-Claude; Alary, Michel; Guédou, Fernand; Poudrier, Johanne; Roger, Michel

    2016-01-01

    We have previously shown that excess B lymphocyte Stimulator (BLyS)/BAFF in plasma and on surface of blood dendritic cells (DC) of HIV-infected progressors coincides with B-cell dysregulations and increased frequencies of “precursor” innate marginal zone (MZ)-like B-cells. In contrast, both blood BLyS levels and frequencies of this population remained unaltered in HIV elite-controllers. Based on these observations, we hypothesized that control of BLyS and innate B-cell status could be associated with natural immunity against HIV infection. Therefore, we assessed blood BLyS levels and B-cell status in HIV highly-exposed commercial sex workers (CSWs) from Benin. We found blood BLyS levels of HIV-uninfected CSWs were lower than those observed in both HIV-infected CSW and HIV-uninfected non-CSW groups. Furthermore, levels of BLyS expression on blood T-cells and monocytes were lower in HIV-uninfected CSWs when compared to HIV-infected CSWs, but higher than those observed for HIV-uninfected non-CSWs. Concomitantly, HIV-infected CSWs presented a dysregulated blood B-cell compartment, characterized by increased total IgG1, increased frequencies of populations presenting immature and/or innate profiles and a higher ratio of IgG+/IgA+ plasmablasts. In contrast, relatively low levels of BLyS in the blood of HIV-uninfected CSWs coincided with a rather preserved B-cell compartment. PMID:27561453

  15. Blood B Lymphocyte Stimulator (BLyS)/BAFF levels may reflect natural immunity to HIV in highly exposed uninfected Beninese Commercial Sex Workers.

    PubMed

    Sabourin-Poirier, Catherine; Fourcade, Lyvia; Chagnon-Choquet, Josiane; Labbé, Annie-Claude; Alary, Michel; Guédou, Fernand; Poudrier, Johanne; Roger, Michel

    2016-01-01

    We have previously shown that excess B lymphocyte Stimulator (BLyS)/BAFF in plasma and on surface of blood dendritic cells (DC) of HIV-infected progressors coincides with B-cell dysregulations and increased frequencies of "precursor" innate marginal zone (MZ)-like B-cells. In contrast, both blood BLyS levels and frequencies of this population remained unaltered in HIV elite-controllers. Based on these observations, we hypothesized that control of BLyS and innate B-cell status could be associated with natural immunity against HIV infection. Therefore, we assessed blood BLyS levels and B-cell status in HIV highly-exposed commercial sex workers (CSWs) from Benin. We found blood BLyS levels of HIV-uninfected CSWs were lower than those observed in both HIV-infected CSW and HIV-uninfected non-CSW groups. Furthermore, levels of BLyS expression on blood T-cells and monocytes were lower in HIV-uninfected CSWs when compared to HIV-infected CSWs, but higher than those observed for HIV-uninfected non-CSWs. Concomitantly, HIV-infected CSWs presented a dysregulated blood B-cell compartment, characterized by increased total IgG1, increased frequencies of populations presenting immature and/or innate profiles and a higher ratio of IgG(+)/IgA(+) plasmablasts. In contrast, relatively low levels of BLyS in the blood of HIV-uninfected CSWs coincided with a rather preserved B-cell compartment. PMID:27561453

  16. Biosynthesis of nitric oxide activates iron regulatory factor in macrophages.

    PubMed Central

    Drapier, J C; Hirling, H; Wietzerbin, J; Kaldy, P; Kühn, L C

    1993-01-01

    Biosynthesis of nitric oxide (NO) from L-arginine modulates activity of iron-dependent enzymes, including mitochondrial acontiase, an [Fe-S] protein. We examined the effect of NO on the activity of iron regulatory factor (IRF), a cytoplasmic protein which modulates both ferritin mRNA translation and transferrin receptor mRNA stability by binding to specific mRNA sequences called iron responsive elements (IREs). Murine macrophages were activated with interferon-gamma and lipopolysaccharide to induce NO synthase activity and cultured in the presence or absence of NG-substituted analogues of L-arginine which served as selective inhibitors of NO synthesis. Measurement of the nitrite concentration in the culture medium was taken as an index of NO production. Mitochondria-free cytosols were then prepared and aconitase activity as well as IRE binding activity and induction of IRE binding activity were correlated and depended on NO synthesis after IFN-gamma and/or LPS stimulation. Authentic NO gas as well as the NO-generating compound 3-morpholinosydnonimine (SIN-1) also conversely modulated aconitase and IRE binding activities of purified recombinant IRF. These results provide evidence that endogenously produced NO may modulate the post-transcriptional regulation of genes involved in iron homeostasis and support the hypothesis that the [Fe-S] cluster of IRF mediates iron-dependent regulation. Images PMID:7504626

  17. BAFF Receptor mAb Treatment Ameliorates Development and Progression of Atherosclerosis in Hyperlipidemic ApoE−/− Mice

    PubMed Central

    Kyaw, Tin; Cui, Peng; Tay, Christopher; Kanellakis, Peter; Hosseini, Hamid; Liu, Edgar; Rolink, Antonius G.; Tipping, Peter

    2013-01-01

    Aims Option to attenuate atherosclerosis by depleting B2 cells is currently limited to anti-CD20 antibodies which deplete all B-cell subtypes. In the present study we evaluated the capacity of a monoclonal antibody to B cell activating factor-receptor (BAFFR) to selectively deplete atherogenic B2 cells to prevent both development and progression of atherosclerosis in the ApoE−/− mouse. Methods and Results To determine whether the BAFFR antibody prevents atherosclerosis development, we treated ApoE−/− mice with the antibody while feeding them a high fat diet (HFD) for 8 weeks. Mature CD93− CD19+ B2 cells were reduced by treatment, spleen B-cell zones disrupted and spleen CD20 mRNA expression decreased while B1a cells and non-B cells were spared. Atherosclerosis was ameliorated in the hyperlipidemic mice and CD19+ B cells, CD4+ and CD8+ T cells were reduced in atherosclerotic lesions. Expressions of proinflammatory cytokines, IL1β, TNFα, and IFNγ in the lesions were also reduced, while MCP1, MIF and VCAM-1 expressions were unaffected. Plasma immunoglobulins were reduced, but MDA-oxLDL specific antibodies were unaffected. To determine whether anti-BAFFR antibody ameliorates progression of atherosclerosis, we first fed ApoE−/− mice a HFD for 6 weeks, and then instigated anti-BAFFR antibody treatment for a further 6 week-HFD. CD93− CD19+ B2 cells were selectively decreased and atherosclerotic lesions were reduced by this treatment. Conclusion Anti-BAFFR monoclonal antibody selectively depletes mature B2 cells while sparing B1a cells, disrupts spleen B-cell zones and ameliorates atherosclerosis development and progression in hyperlipidemic ApoE−/− mice. Our findings have potential for clinical translation to manage atherosclerosis-based cardiovascular diseases. PMID:23560095

  18. Losac, the First Hemolin that Exhibits Procogulant Activity through Selective Factor X Proteolytic Activation*

    PubMed Central

    Alvarez-Flores, Miryam Paola; Furlin, Daniel; Ramos, Oscar H. P.; Balan, Andrea; Konno, Katsuhiro; Chudzinski-Tavassi, Ana Marisa

    2011-01-01

    Envenoming by the contact of human skin with Lonomia obliqua caterpillars promotes a hemorrhagic syndrome characterized by a consumptive coagulopathy. Losac (Lonomia obliqua Stuart factor activator) is a component of the bristle of L. obliqua that is probably partially responsible for the observed syndrome because it activates factor X and is recognized by an effective antilonomic serum. Here we unveil the proteolytic activity of Losac and demonstrate the feasibility of its recombinant production. On the other hand, Losac has no homology to known proteases, but it can be inhibited by PMSF, a serine protease inhibitor. Instead, it shows closer homology to members of the hemolin family of proteins, a group of cell adhesion molecules. The recombinant protein (rLosac) shortened the coagulation time of normal and deficient plasmas, whereas it was ineffective in factor X-deficient plasma unless reconstituted with this protein. rLosac was able to activate factor X in a dose- and time-dependent manner but not γ-carboxyglutamic acid domainless factor X. Moreover, phospholipids and calcium ions increased rLosac activity. Also, rLosac had no effect on fibrin or fibrinogen, indicating its specificity for blood coagulation activation. Linear double reciprocal plots indicate that rLosac follows a Michaelis-Menten kinetics. Cleavage of factor X by rLosac resulted in fragments that are compatible with those generated by RVV-X (a well known factor X activator). Together, our results validate Losac as the first protein from the hemolin family exhibiting procoagulant activity through selective proteolysis on coagulation factor X. PMID:21177860

  19. Selective Activation of Transcription by a Novel CCAAT Binding Factor

    NASA Astrophysics Data System (ADS)

    Maity, Sankar N.; Golumbek, Paul T.; Karsenty, Gerard; de Crombrugghe, Benoit

    1988-07-01

    A novel CCAAT binding factor (CBF) composed of two different subunits has been extensively purified from rat liver. Both subunits are needed for specific binding to DNA. Addition of this purified protein to nuclear extracts of NIH 3T3 fibroblasts stimulates transcription from several promoters including the α 2(I) collagen, the α 1(I) collagen, the Rous sarcoma virus long terminal repeat (RSV-LTR), and the adenovirus major late promoter. Point mutations in the CCAAT motif that show either no binding or a decreased binding of CBF likewise abolish or reduce activation of transcription by CBF. Activation of transcription requires, therefore, the specific binding of CBF to its recognition sites.

  20. Factors affecting the behavior of unburned carbon upon steam activation

    NASA Astrophysics Data System (ADS)

    Lu, Zhe

    The main objective of this study is to investigate the factors that could affect the behavior of unburned carbon samples upon steam activation. Through this work, the relationships among the factors that could influence the carbon-steam reaction with the surface area of the produced activated carbon were explored. Statistical analysis was used to relate the chemical and physical properties of the unburned carbon to the surface area of the activated carbon. Six unburned carbons were selected as feedstocks for activated carbon, and marked as UCA through UCF. The unburned carbons were activated using steam at 850°C for 90 minutes, and the surface areas of their activated counterparts were measured using N2 adsorption isotherms at 77K. The activated carbons produced from different unburned carbon precursors presented different surface areas at similar carbon burn-off levels. Moreover, in different carbon burn-off regions, the sequences for surface area of activated carbons from different unburned carbon samples were different. The factors that may affect the carbon-steam gasification reactions, including the concentration of carbon active sites, the crystallite size of the carbon, the intrinsic porous structure of carbon, and the inorganic impurities, were investigated. All unburned carbons investigated in this study were similar in that they showed the very broad (002) and (10 ) carbon peaks, which are characteristic of highly disordered carbonaceous materials. In this study, the unburned carbon samples contained about 17--48% of inorganic impurities. Compared to coals, the unburned carbon samples contain a larger amount of inorganic impurities as a result of the burn-off, or at lease part, of the carbon during the combustion process. These inorganic particles were divided into two groups in terms of the way they are associated with carbon particles: free single particles, and particles combined with carbon particles. As indicated from the present work, unburned

  1. The dust covering factor in active galactic nuclei

    NASA Astrophysics Data System (ADS)

    Stalevski, Marko; Ricci, Claudio; Ueda, Yoshihiro; Lira, Paulina; Fritz, Jacopo; Baes, Maarten

    2016-05-01

    The primary source of emission of active galactic nuclei (AGNs), the accretion disc, is surrounded by an optically and geometrically thick dusty structure (`the so-called dusty torus'). The infrared radiation emitted by the dust is nothing but a reprocessed fraction of the accretion disc emission, so the ratio of the torus to the AGN luminosity (Ltorus/LAGN) should corresponds to the fraction of the sky obscured by dust, i.e. the covering factor. We undertook a critical investigation of the Ltorus/LAGN as the dust covering factor proxy. Using state-of-the-art 3D Monte Carlo radiative transfer code, we calculated a grid of spectral energy distributions (SEDs) emitted by the clumpy two-phase dusty structure. With this grid of SEDs, we studied the relation between Ltorus/LAGN and the dust covering factor for different parameters of the torus. We found that in the case of type 1 AGNs the torus anisotropy makes Ltorus/LAGN underestimate low covering factors and overestimate high covering factors. In type 2 AGNs Ltorus/LAGN always underestimates covering factors. Our results provide a novel easy-to-use method to account for anisotropy and obtain correct covering factors. Using two samples from the literature, we demonstrated the importance of our result for inferring the obscured AGN fraction. We found that after the anisotropy is properly accounted for, the dust covering factors show very weak dependence on LAGN, with values in the range of ≈0.6-0.7. Our results also suggest a higher fraction of obscured AGNs at high luminosities than those found by X-ray surveys, in part owing to the presence of a Compton-thick AGN population predicted by population synthesis models.

  2. Immunoregulatory activity of peptides related to platelet factor 4.

    PubMed Central

    Zucker, M B; Katz, I R; Thorbecke, G J; Milot, D C; Holt, J

    1989-01-01

    Platelet factor 4 (PF4), a secreted platelet protein, alleviates concanavalin A-induced immunosuppression in mice. We now find that activity also resides in (i) the C-terminal tridecapeptide of PF4 (P13S), (ii) an analog of this in which arginine replaces the lysine residues and in which the last two amino acids are absent, (iii) the C-terminal 18 amino acids of low-affinity platelet factor 4, which is very similar to P13S, and (iv) peptide fragments of P13S that contain only 5-9 amino acids. P13S treated with fluorescamine to derivatize the free amino groups retained immunoregulatory activity but did not bind to heparin-agarose. The N-terminal and middle portions of PF4, polylysine, protamine, and three unrelated peptides were inactive in this assay. PMID:2678107

  3. Reliable and Affordable Control Systems Active Combustor Pattern Factor Control

    NASA Technical Reports Server (NTRS)

    McCarty, Bob; Tomondi, Chris; McGinley, Ray

    2004-01-01

    Active, closed-loop control of combustor pattern factor is a cooperative effort between Honeywell (formerly AlliedSignal) Engines and Systems and the NASA Glenn Research Center to reduce emissions and turbine-stator vane temperature variations, thereby enhancing engine performance and life, and reducing direct operating costs. Total fuel flow supplied to the engine is established by the speed/power control, but the distribution to individual atomizers will be controlled by the Active Combustor Pattern Factor Control (ACPFC). This system consist of three major components: multiple, thin-film sensors located on the turbine-stator vanes; fuel-flow modulators for individual atomizers; and control logic and algorithms within the electronic control.

  4. Stellar Activity and CMEs: Important Factors of Planetary Evolution

    NASA Astrophysics Data System (ADS)

    Khodachenko, Maxim L.

    CME activity of the Sun is known to be an important impacting factor for the magnetospheres, atmospheres, and surfaces of solar system planets. Following an idea of a solar-stellar analogy, CME phenomena are expected on other stars as well. The main planetary impact factors of the stellar CMEs include the associated interplanetary shocks, plasma density and velocity disturbances, energetic particles accelerated in the shock regions, as well as distortions of the magnetic field direction and modulus. All these factors should be properly taken into account during the study of evolutionary processes on exoplanets and their atmospheric and plasma environments. The planetary impact of the stellar CME activity may vary depending on stellar age, stellar spectral type and the orbital distance of a planet. Because of the relatively short range of propagation of the majority of CMEs, they affect most strongly the magnetospheres and atmospheres of close-orbit ( < 0.1 AU) exoplanets. In this chapter we discuss an issue of the stellar CME activity in the context of several actual problems of modern exoplanetology, including planetary atmosphere mass loss, planet survival at close orbits, and definition of a criterion for habitability.

  5. A role for factor XIIa–mediated factor XI activation in thrombus formation in vivo

    PubMed Central

    Cheng, Qiufang; Tucker, Erik I.; Pine, Meghann S.; Sisler, India; Matafonov, Anton; Sun, Mao-fu; White-Adams, Tara C.; Smith, Stephanie A.; Hanson, Stephen R.; McCarty, Owen J. T.; Renné, Thomas; Gruber, András

    2010-01-01

    Mice lacking factor XII (fXII) or factor XI (fXI) are resistant to experimentally–induced thrombosis, suggesting fXIIa activation of fXI contributes to thrombus formation in vivo. It is not clear whether this reaction has relevance for thrombosis in pri mates. In 2 carotid artery injury models (FeCl3 and Rose Bengal/laser), fXII-deficient mice are more resistant to thrombosis than fXI- or factor IX (fIX)–deficient mice, raising the possibility that fXII and fXI function in distinct pathways. Antibody 14E11 binds fXI from a variety of mammals and interferes with fXI activation by fXIIa in vitro. In mice, 14E11 prevented arterial occlusion induced by FeCl3 to a similar degree to total fXI deficiency. 14E11 also had a modest beneficial effect in a tissue factor–induced pulmonary embolism model, indicating fXI and fXII contribute to thrombus formation even when factor VIIa/tissue factor initiates thrombosis. In baboons, 14E11 reduced platelet-rich thrombus growth in collagen-coated grafts inserted into an arteriovenous shunt. These data support the hypothesis that fXIIa-mediated fXI activation contributes to thrombus formation in rodents and primates. Since fXII deficiency does not impair hemostasis, targeted inhibition of fXI activation by fXIIa may be a useful antithrombotic strategy associated with a low risk of bleeding complications. PMID:20634381

  6. Activating transcription factor 6 derepression mediates neuroprotection in Huntington disease

    PubMed Central

    Naranjo, José R.; Zhang, Hongyu; Villar, Diego; González, Paz; Dopazo, Xose M.; Morón-Oset, Javier; Higueras, Elena; Oliveros, Juan C.; Arrabal, María D.; Prieto, Angela; Cercós, Pilar; González, Teresa; De la Cruz, Alicia; Casado-Vela, Juan; Rábano, Alberto; Valenzuela, Carmen; Gutierrez-Rodriguez, Marta; Li, Jia-Yi; Mellström, Britt

    2016-01-01

    Deregulated protein and Ca2+ homeostasis underlie synaptic dysfunction and neurodegeneration in Huntington disease (HD); however, the factors that disrupt homeostasis are not fully understood. Here, we determined that expression of downstream regulatory element antagonist modulator (DREAM), a multifunctional Ca2+-binding protein, is reduced in murine in vivo and in vitro HD models and in HD patients. DREAM downregulation was observed early after birth and was associated with endogenous neuroprotection. In the R6/2 mouse HD model, induced DREAM haplodeficiency or blockade of DREAM activity by chronic administration of the drug repaglinide delayed onset of motor dysfunction, reduced striatal atrophy, and prolonged life span. DREAM-related neuroprotection was linked to an interaction between DREAM and the unfolded protein response (UPR) sensor activating transcription factor 6 (ATF6). Repaglinide blocked this interaction and enhanced ATF6 processing and nuclear accumulation of transcriptionally active ATF6, improving prosurvival UPR function in striatal neurons. Together, our results identify a role for DREAM silencing in the activation of ATF6 signaling, which promotes early neuroprotection in HD. PMID:26752648

  7. Parental Factors in Children’s Active Transport to School

    PubMed Central

    Henne, Heather M.; Tandon, Pooja S.; Frank, Larry D.; Saelens, Brian E.

    2014-01-01

    Objective Identify non-distance factors related to children’s active transport (AT) to school, including parental, home, and environment characteristics. Understanding the factors related to children’s AT to school, beyond distance to school, could inform interventions to increase AT and children’s overall physical activity. Study Design Participants were in the Neighborhood Impact on Kids Study, a longitudinal, observational cohort study of children aged 6 - 11 and their parents in King County, WA and San Diego County, CA between 2007-2009. Parents reported frequency and mode of child transport to school, perceived neighborhood, home and family environments, parental travel behaviors, and sociodemographics. Methods Children living less than a 20 minute walk to school were in this analysis. Children classified as active transporters (walked/bicycled to or from school at least once per week) were compared with those not using AT as often. Results Children using AT were older and had parents who reported themselves using active transport. Having a family rule that restricts the child to stay within sight of the parent or home and more parent working hours was related to lower odds of a child using AT. Conclusions Children’s AT to school is associated with parental AT to work and other locations. Interventions should be considered that enable whole family AT, ameliorate safety concerns and decrease the need for parental supervision, such as walking school buses. PMID:24999161

  8. Activating transcription factor 6 derepression mediates neuroprotection in Huntington disease.

    PubMed

    Naranjo, José R; Zhang, Hongyu; Villar, Diego; González, Paz; Dopazo, Xose M; Morón-Oset, Javier; Higueras, Elena; Oliveros, Juan C; Arrabal, María D; Prieto, Angela; Cercós, Pilar; González, Teresa; De la Cruz, Alicia; Casado-Vela, Juan; Rábano, Alberto; Valenzuela, Carmen; Gutierrez-Rodriguez, Marta; Li, Jia-Yi; Mellström, Britt

    2016-02-01

    Deregulated protein and Ca2+ homeostasis underlie synaptic dysfunction and neurodegeneration in Huntington disease (HD); however, the factors that disrupt homeostasis are not fully understood. Here, we determined that expression of downstream regulatory element antagonist modulator (DREAM), a multifunctional Ca2+-binding protein, is reduced in murine in vivo and in vitro HD models and in HD patients. DREAM downregulation was observed early after birth and was associated with endogenous neuroprotection. In the R6/2 mouse HD model, induced DREAM haplodeficiency or blockade of DREAM activity by chronic administration of the drug repaglinide delayed onset of motor dysfunction, reduced striatal atrophy, and prolonged life span. DREAM-related neuroprotection was linked to an interaction between DREAM and the unfolded protein response (UPR) sensor activating transcription factor 6 (ATF6). Repaglinide blocked this interaction and enhanced ATF6 processing and nuclear accumulation of transcriptionally active ATF6, improving prosurvival UPR function in striatal neurons. Together, our results identify a role for DREAM silencing in the activation of ATF6 signaling, which promotes early neuroprotection in HD. PMID:26752648

  9. Transcriptional activation in yeast cells lacking transcription factor IIA.

    PubMed Central

    Chou, S; Chatterjee, S; Lee, M; Struhl, K

    1999-01-01

    The general transcription factor IIA (TFIIA) forms a complex with TFIID at the TATA promoter element, and it inhibits the function of several negative regulators of the TATA-binding protein (TBP) subunit of TFIID. Biochemical experiments suggest that TFIIA is important in the response to transcriptional activators because activation domains can interact with TFIIA, increase recruitment of TFIID and TFIIA to the promoter, and promote isomerization of the TFIID-TFIIA-TATA complex. Here, we describe a double-shut-off approach to deplete yeast cells of Toa1, the large subunit of TFIIA, to <1% of the wild-type level. Interestingly, such TFIIA-depleted cells are essentially unaffected for activation by heat shock factor, Ace1, and Gal4-VP16. However, depletion of TFIIA causes a general two- to threefold decrease of transcription from most yeast promoters and a specific cell-cycle arrest at the G2-M boundary. These results indicate that transcriptional activation in vivo can occur in the absence of TFIIA. PMID:10581267

  10. Macrophage Migration Inhibitory Factor (MIF) Enzymatic Activity and Lung Cancer

    PubMed Central

    Mawhinney, Leona; Armstrong, Michelle E; O’ Reilly, Ciaran; Bucala, Richard; Leng, Lin; Fingerle-Rowson, Gunter; Fayne, Darren; Keane, Michael P; Tynan, Aisling; Maher, Lewena; Cooke, Gordon; Lloyd, David; Conroy, Helen; Donnelly, Seamas C

    2014-01-01

    The cytokine macrophage migration inhibitory factor (MIF) possesses unique tautomerase enzymatic activity, which contributes to the biological functional activity of MIF. In this study, we investigated the effects of blocking the hydrophobic active site of the tautomerase activity of MIF in the pathogenesis of lung cancer. To address this, we initially established a Lewis lung carcinoma (LLC) murine model in Mif-KO and wild-type (WT) mice and compared tumor growth in a knock-in mouse model expressing a mutant MIF lacking enzymatic activity (Mif P1G). Primary tumor growth was significantly attenuated in both Mif-KO and Mif P1G mice compared with WT mice. We subsequently undertook a structure-based, virtual screen to identify putative small molecular weight inhibitors specific for the tautomerase enzymatic active site of MIF. From primary and secondary screens, the inhibitor SCD-19 was identified, which significantly attenuated the tautomerase enzymatic activity of MIF in vitro and in biological functional screens. In the LLC murine model, SCD-19, given intraperitoneally at the time of tumor inoculation, was found to significantly reduce primary tumor volume by 90% (p < 0.001) compared with the control treatment. To better replicate the human disease scenario, SCD-19 was given when the tumor was palpable (at d 7 after tumor inoculation) and, again, treatment was found to significantly reduce tumor volume by 81% (p < 0.001) compared with the control treatment. In this report, we identify a novel inhibitor that blocks the hydrophobic pocket of MIF, which houses its specific tautomerase enzymatic activity, and demonstrate that targeting this unique active site significantly attenuates lung cancer growth in in vitro and in vivo systems. PMID:25826675

  11. Time-activity relationships to VOC personal exposure factors

    NASA Astrophysics Data System (ADS)

    Edwards, Rufus D.; Schweizer, Christian; Llacqua, Vito; Lai, Hak Kan; Jantunen, Matti; Bayer-Oglesby, Lucy; Künzli, Nino

    Social and demographic factors have been found to play a significant role in differences between time-activity patterns of population subgroups. Since time-activity patterns largely influence personal exposure to compounds as individuals move across microenvironments, exposure subgroups within the population may be defined by factors that influence daily activity patterns. Socio-demographic and environmental factors that define time-activity subgroups also define quantifiable differences in VOC personal exposures to different sources and individual compounds in the Expolis study. Significant differences in exposures to traffic-related compounds ethylbenzene, m- and p-xylene and o-xylene were observed in relation to gender, number of children and living alone. Categorization of exposures further indicated time exposed to traffic at work and time in a car as important determinants. Increased exposures to decane, nonane and undecane were observed for males, housewives and self-employed. Categorization of exposures indicated exposure subgroups related to workshop use and living downtown. Higher exposures to 3-carene and α-pinene commonly found in household cleaning products and fragrances were associated with more children, while exposures to traffic compounds ethylbenzene, m- and p-xylene and o-xylene were reduced with more children. Considerable unexplained variation remained in categorization of exposures associated with home product use and fragrances, due to individual behavior and product choice. More targeted data collection methods in VOC exposure studies for these sources should be used. Living alone was associated with decreased exposures to 2-methyl-1-propanol and 1-butanol, and traffic-related compounds. Identification of these subgroups may help to reduce the large amount of unexplained variation in VOC exposure studies. Further they may help in assessing impacts of urban planning that result in changes in behavior of individuals, resulting in shifts in

  12. Transcription Factor Arabidopsis Activating Factor1 Integrates Carbon Starvation Responses with Trehalose Metabolism1[OPEN

    PubMed Central

    Garapati, Prashanth; Feil, Regina; Lunn, John Edward; Van Dijck, Patrick; Balazadeh, Salma; Mueller-Roeber, Bernd

    2015-01-01

    Plants respond to low carbon supply by massive reprogramming of the transcriptome and metabolome. We show here that the carbon starvation-induced NAC (for NO APICAL MERISTEM/ARABIDOPSIS TRANSCRIPTION ACTIVATION FACTOR/CUP-SHAPED COTYLEDON) transcription factor Arabidopsis (Arabidopsis thaliana) Transcription Activation Factor1 (ATAF1) plays an important role in this physiological process. We identified TREHALASE1, the only trehalase-encoding gene in Arabidopsis, as a direct downstream target of ATAF1. Overexpression of ATAF1 activates TREHALASE1 expression and leads to reduced trehalose-6-phosphate levels and a sugar starvation metabolome. In accordance with changes in expression of starch biosynthesis- and breakdown-related genes, starch levels are generally reduced in ATAF1 overexpressors but elevated in ataf1 knockout plants. At the global transcriptome level, genes affected by ATAF1 are broadly associated with energy and carbon starvation responses. Furthermore, transcriptional responses triggered by ATAF1 largely overlap with expression patterns observed in plants starved for carbon or energy supply. Collectively, our data highlight the existence of a positively acting feedforward loop between ATAF1 expression, which is induced by carbon starvation, and the depletion of cellular carbon/energy pools that is triggered by the transcriptional regulation of downstream gene regulatory networks by ATAF1. PMID:26149570

  13. Transcription Factor Arabidopsis Activating Factor1 Integrates Carbon Starvation Responses with Trehalose Metabolism.

    PubMed

    Garapati, Prashanth; Feil, Regina; Lunn, John Edward; Van Dijck, Patrick; Balazadeh, Salma; Mueller-Roeber, Bernd

    2015-09-01

    Plants respond to low carbon supply by massive reprogramming of the transcriptome and metabolome. We show here that the carbon starvation-induced NAC (for NO APICAL MERISTEM/ARABIDOPSIS TRANSCRIPTION ACTIVATION FACTOR/CUP-SHAPED COTYLEDON) transcription factor Arabidopsis (Arabidopsis thaliana) Transcription Activation Factor1 (ATAF1) plays an important role in this physiological process. We identified TREHALASE1, the only trehalase-encoding gene in Arabidopsis, as a direct downstream target of ATAF1. Overexpression of ATAF1 activates TREHALASE1 expression and leads to reduced trehalose-6-phosphate levels and a sugar starvation metabolome. In accordance with changes in expression of starch biosynthesis- and breakdown-related genes, starch levels are generally reduced in ATAF1 overexpressors but elevated in ataf1 knockout plants. At the global transcriptome level, genes affected by ATAF1 are broadly associated with energy and carbon starvation responses. Furthermore, transcriptional responses triggered by ATAF1 largely overlap with expression patterns observed in plants starved for carbon or energy supply. Collectively, our data highlight the existence of a positively acting feedforward loop between ATAF1 expression, which is induced by carbon starvation, and the depletion of cellular carbon/energy pools that is triggered by the transcriptional regulation of downstream gene regulatory networks by ATAF1. PMID:26149570

  14. Absence of in vitro Procoagulant Activity in Immunoglobulin Preparations due to Activated Coagulation Factors

    PubMed Central

    Oviedo, Adriana E.; Bernardi, María E.; Guglielmone, Hugo A.; Vitali, María S.

    2015-01-01

    Summary Background Immunoglobulin (IG) products, including intravenous (IVIG) or subcutaneous (SCIG) immunoglobulins are considered safe and effective for medical therapy; however, a sudden and unexpected increase in thromboembolic events (TE) after administration of certain batches of IVIG products has been attributed to the presence of activated coagulation factors, mainly factor XIa. Our aims were to examine the presence of enduring procoagulant activity during the manufacturing process of IGs, with special focus on monitoring factor XIa, and to evaluate the presence of in vitro procoagulant activity attributed to coagulation factors in different lots of IVIG and SCIG. Methods Samples of different steps of IG purification, 19 lots of IVIG and 9 of SCIG were analyzed and compared with 1 commercial preparation of IVIG and 2 of SCIG, respectively. Factors II, VII, IX, XI and XIa and non-activated partial thromboplastin time (NAPTT) were assayed. Results The levels of factors II, VII, IX, X and XI were non-quantifiable once fraction II had been re-dissolved and in all analyzed lots of IVIG and SCIG. The level of factor XIa at that point was under the detection limits of the assay, and NAPTT yielded values greater than the control during the purification process. In SCIG, we detected higher concentrations of factor XIa in the commercial products, which reached values up to 5 times higher than the average amounts found in the 9 batches produced by UNC-Hemoderivados. Factor XIa in commercial IVIG reached levels slightly higher than those of the 19 batches produced by UNC-Hemoderivados. Conclusion IVIG and SCIG manufactured by UNC-Hemoderivados showed a lack of thrombogenic potential, as demonstrated not only by the laboratory data obtained in this study but also by the absence of any reports of TE registered by the post marketing pharmacovigilance department. PMID:26733772

  15. Factors associated with active commuting to work among women.

    PubMed

    Bopp, Melissa; Child, Stephanie; Campbell, Matthew

    2014-01-01

    Active commuting (AC), the act of walking or biking to work, has notable health benefits though rates of AC remain low among women. This study used a social-ecological framework to examine the factors associated with AC among women. A convenience sample of employed, working women (n = 709) completed an online survey about their mode of travel to work. Individual, interpersonal, institutional, community, and environmental influences were assessed. Basic descriptive statistics and frequencies described the sample. Simple logistic regression models examined associations with the independent variables with AC participation and multiple logistic regression analysis determined the relative influence of social ecological factors on AC participation. The sample was primarily middle-aged (44.09±11.38 years) and non-Hispanic White (92%). Univariate analyses revealed several individual, interpersonal, institutional, community and environmental factors significantly associated with AC. The multivariable logistic regression analysis results indicated that significant factors associated with AC included number of children, income, perceived behavioral control, coworker AC, coworker AC normative beliefs, employer and community supports for AC, and traffic. The results of this study contribute to the limited body of knowledge on AC participation for women and may help to inform gender-tailored interventions to enhance AC behavior and improve health. PMID:24512572

  16. Global gene expression changes of in vitro stimulated human transformed germinal centre B cells as surrogate for oncogenic pathway activation in individual aggressive B cell lymphomas

    PubMed Central

    2012-01-01

    Background Aggressive Non-Hodgkin lymphomas (NHL) are a group of lymphomas derived from germinal centre B cells which display a heterogeneous pattern of oncogenic pathway activation. We postulate that specific immune response associated signalling, affecting gene transcription networks, may be associated with the activation of different oncogenic pathways in aggressive Non-Hodgkin lymphomas (NHL). Methodology The B cell receptor (BCR), CD40, B-cell activating factor (BAFF)-receptors and Interleukin (IL) 21 receptor and Toll like receptor 4 (TLR4) were stimulated in human transformed germinal centre B cells by treatment with anti IgM F(ab)2-fragments, CD40L, BAFF, IL21 and LPS respectively. The changes in gene expression following the activation of Jak/STAT, NF-кB, MAPK, Ca2+ and PI3K signalling triggered by these stimuli was assessed using microarray analysis. The expression of top 100 genes which had a change in gene expression following stimulation was investigated in gene expression profiles of patients with Aggressive non-Hodgkin Lymphoma (NHL). Results αIgM stimulation led to the largest number of changes in gene expression, affecting overall 6596 genes. While CD40L stimulation changed the expression of 1194 genes and IL21 stimulation affected 902 genes, only 283 and 129 genes were modulated by lipopolysaccharide or BAFF receptor stimulation, respectively. Interestingly, genes associated with a Burkitt-like phenotype, such as MYC, BCL6 or LEF1, were affected by αIgM. Unique and shared gene expression was delineated. NHL-patients were sorted according to their similarity in the expression of TOP100 affected genes to stimulated transformed germinal centre B cells The αIgM gene module discriminated individual DLBCL in a similar manner to CD40L or IL21 gene modules. DLBCLs with low module activation often carry chromosomal MYC aberrations. DLBCLs with high module activation show strong expression of genes involved in cell-cell communication, immune responses

  17. Secretion of platelet-activating factor by periovulatory ovine follicles

    SciTech Connect

    Alexander, B.M.; Van Kirk, E.A.; Murdoch, W.J. )

    1990-01-01

    Secretion of platelet-activating factor (PAF) in vitro by ovine follicles and ovarian interstitium obtained at various times before, during and after the endogenous preovulatory surge of luteinizing hormone (LH) and ovulation was quantified by radioimmunoassay. Release of PAF by the preovulatory follicle increased within 2 h after initiation of the surge of LH. Capacity for secretion of PAF was greatest at the time of ovulation, then declined thereafter. Production of PAF by ovarian interstitium throughout the periovulatory period was relatively low and did not change with time. It appears that PAF could act as an intrafollicular mediator in the mechanisms of ovulation and(or) luteinization.

  18. Platelet-Activating Factor-Receptor and Tumor Immunity

    PubMed Central

    Sahu, Ravi P; Konger, Raymond L.; Travers, Jeffrey B.

    2016-01-01

    First described in 1972 by Benveniste and colleagues, platelet-activating factor (PAF) remains one of the potent phospholipid known to date. The role of PAF produced enzymatically in mediating diverse biological and pathophysiological processes including inflammatory and allergic diseases and cancers in response to various stimuli has been extensively studied. However, little is known about the role of non-enzymatically-generated PAF-like lipids produced in response to pro-oxidative stressors, particularly in modulating the host immune responses to tumor immunity, which is the focus of this review.

  19. Activation of vascular endothelial growth factor gene transcription by hypoxia-inducible factor 1.

    PubMed Central

    Forsythe, J A; Jiang, B H; Iyer, N V; Agani, F; Leung, S W; Koos, R D; Semenza, G L

    1996-01-01

    Expression of vascular endothelial growth factor (VEGF) is induced in cells exposed to hypoxia or ischemia. Neovascularization stimulated by VEGF occurs in several important clinical contexts, including myocardial ischemia, retinal disease, and tumor growth. Hypoxia-inducible factor 1 (HIF-1) is a heterodimeric basic helix-loop-helix protein that activates transcription of the human erythropoietin gene in hypoxic cells. Here we demonstrate the involvement of HIF-1 in the activation of VEGF transcription. VEGF 5'-flanking sequences mediated transcriptional activation of reporter gene expression in hypoxic Hep3B cells. A 47-bp sequence located 985 to 939 bp 5' to the VEGF transcription initiation site mediated hypoxia-inducible reporter gene expression directed by a simian virus 40 promoter element that was otherwise minimally responsive to hypoxia. When reporters containing VEGF sequences, in the context of the native VEGF or heterologous simian virus 40 promoter, were cotransfected with expression vectors encoding HIF-1alpha and HIF-1beta (ARNT [aryl hydrocarbon receptor nuclear translocator]), reporter gene transcription was much greater in both hypoxic and nonhypoxic cells than in cells transfected with the reporter alone. A HIF-1 binding site was demonstrated in the 47-bp hypoxia response element, and a 3-bp substitution eliminated the ability of the element to bind HIF-1 and to activate transcription in response to hypoxia and/or recombinant HIF-1. Cotransfection of cells with an expression vector encoding a dominant negative form of HIF-1alpha inhibited the activation of reporter transcription in hypoxic cells in a dose-dependent manner. VEGF mRNA was not induced by hypoxia in mutant cells that do not express the HIF-1beta (ARNT) subunit. These findings implicate HIF-1 in the activation of VEGF transcription in hypoxic cells. PMID:8756616

  20. Nuclear factor Y regulates ancient budgerigar hepadnavirus core promoter activity.

    PubMed

    Shen, Zhongliang; Liu, Yanfeng; Luo, Mengjun; Wang, Wei; Liu, Jing; Liu, Wei; Pan, Shaokun; Xie, Youhua

    2016-09-16

    Endogenous viral elements (EVE) in animal genomes are the fossil records of ancient viruses and provide invaluable information on the origin and evolution of extant viruses. Extant hepadnaviruses include avihepadnaviruses of birds and orthohepadnaviruses of mammals. The core promoter (Cp) of hepadnaviruses is vital for viral gene expression and replication. We previously identified in the budgerigar genome two EVEs that contain the full-length genome of an ancient budgerigar hepadnavirus (eBHBV1 and eBHBV2). Here, we found eBHBV1 Cp and eBHBV2 Cp were active in several human and chicken cell lines. A region from nt -85 to -11 in eBHBV1 Cp was critical for the promoter activity. Bioinformatic analysis revealed a putative binding site of nuclear factor Y (NF-Y), a ubiquitous transcription factor, at nt -64 to -50 in eBHBV1 Cp. The NF-Y core binding site (ATTGG, nt -58 to -54) was essential for eBHBV1 Cp activity. The same results were obtained with eBHBV2 Cp and duck hepatitis B virus Cp. The subunit A of NF-Y (NF-YA) was recruited via the NF-Y core binding site to eBHBV1 Cp and upregulated the promoter activity. Finally, the NF-Y core binding site is conserved in the Cps of all the extant avihepadnaviruses but not of orthohepadnaviruses. Interestingly, a putative and functionally important NF-Y core binding site is located at nt -21 to -17 in the Cp of human hepatitis B virus. In conclusion, our findings have pinpointed an evolutionary conserved and functionally critical NF-Y binding element in the Cps of avihepadnaviruses. PMID:27501758

  1. Combinatorial influence of environmental parameters on transcription factor activity

    PubMed Central

    Knijnenburg, T.A.; Wessels, L.F.A.; Reinders, M.J.T.

    2008-01-01

    Motivation: Cells receive a wide variety of environmental signals, which are often processed combinatorially to generate specific genetic responses. Changes in transcript levels, as observed across different environmental conditions, can, to a large extent, be attributed to changes in the activity of transcription factors (TFs). However, in unraveling these transcription regulation networks, the actual environmental signals are often not incorporated into the model, simply because they have not been measured. The unquantified heterogeneity of the environmental parameters across microarray experiments frustrates regulatory network inference. Results: We propose an inference algorithm that models the influence of environmental parameters on gene expression. The approach is based on a yeast microarray compendium of chemostat steady-state experiments. Chemostat cultivation enables the accurate control and measurement of many of the key cultivation parameters, such as nutrient concentrations, growth rate and temperature. The observed transcript levels are explained by inferring the activity of TFs in response to combinations of cultivation parameters. The interplay between activated enhancers and repressors that bind a gene promoter determine the possible up- or downregulation of the gene. The model is translated into a linear integer optimization problem. The resulting regulatory network identifies the combinatorial effects of environmental parameters on TF activity and gene expression. Availability: The Matlab code is available from the authors upon request. Contact: t.a.knijnenburg@tudelft.nl Supplementary information: Supplementary data are available at Bioinformatics online. PMID:18586711

  2. Epidermal Platelet-activating Factor Receptor Activation and Ultraviolet B Radiation Result in Synergistic Tumor Necrosis Factor-alpha Production

    PubMed Central

    Wolverton, Jay E.; Al-Hassani, Mohammed; Yao, Yongxue; Zhang, Qiwei; Travers, Jeffrey B.

    2010-01-01

    Ultraviolet B radiation (UVB) is a potent stimulator of epidermal cytokine production which has been implicated in photoaggravated dermatoses. In addition to cytokines such as tumor necrosis factor-α (TNF-α), UVB generates bioactive lipids including platelet-activating factor (PAF). Our previous studies have demonstrated that UVB-mediated production of keratinocyte TNF-α is in part due to PAF. The current studies use a human PAF-receptor (PAF-R) negative epithelial cell line transduced with PAF-Rs and PAF–R-deficient mice to demonstrate that activation of the epidermal PAF-R along with UVB irradiation results in a synergistic production of TNF-α. It should be noted that PAF-R effects are mimicked by the protein kinase C (PKC) agonist phorbol myristic acetate, and are inhibited by pharmacological antagonists of the PKC gamma isoenzyme. These studies suggest that concomitant PAF-R activation and UVB irradiation results in a synergistic production of the cytokine TNF-α which is mediated in part via PKC. These studies provide a novel potential mechanism for photosensitivity responses. PMID:19769579

  3. Thyroid Transcription Factor 1 Reprograms Angiogenic Activities of Secretome

    PubMed Central

    Wood, Lauren W.; Cox, Nicole I.; Phelps, Cody A.; Lai, Shao-Chiang; Poddar, Arjun; Talbot, Conover; Mu, David

    2016-01-01

    Through both gain- and loss-of-TTF-1 expression strategies, we show that TTF-1 positively regulates vascular endothelial growth factor (VEGF) and that the VEGF promoter element contains multiple TTF-1-responsive sequences. The major signaling receptor for VEGF, i.e VEGFR2, also appears to be under a direct and positive regulation of TTF-1. The TTF-1-dependent upregulation of VEGF was moderately sensitive to rapamycin, implicating a partial involvement of mammalian target of rapamycin (mTOR). However, hypoxia did not further increase the secreted VEGF level of the TTF-1+ lung cancer cells. The TTF-1-induced VEGF upregulation occurs in both compartments (exosomes and exosome-depleted media (EDM)) of the conditioned media. Surprisingly, the EDM of TTF-1+ lung cancer cells (designated EDM-TTF-1+) displayed an anti-angiogenic activity in the endothelial cell tube formation assay. Mechanistic studies suggest that the increased granulocyte-macrophage colony-stimulating factor (GM-CSF) level in the EDM-TTF-1+ conferred the antiangiogenic activities. In human lung cancer, the expression of TTF-1 and GM-CSF exhibits a statistically significant and positive correlation. In summary, this study provides evidence that TTF-1 may reprogram lung cancer secreted proteome into an antiangiogenic state, offering a novel basis to account for the long-standing observation of favorable prognosis associated with TTF-1+ lung adenocarcinomas. PMID:26912193

  4. Thyroid Transcription Factor 1 Reprograms Angiogenic Activities of Secretome.

    PubMed

    Wood, Lauren W; Cox, Nicole I; Phelps, Cody A; Lai, Shao-Chiang; Poddar, Arjun; Talbot, Conover; Mu, David

    2016-01-01

    Through both gain- and loss-of-TTF-1 expression strategies, we show that TTF-1 positively regulates vascular endothelial growth factor (VEGF) and that the VEGF promoter element contains multiple TTF-1-responsive sequences. The major signaling receptor for VEGF, i.e VEGFR2, also appears to be under a direct and positive regulation of TTF-1. The TTF-1-dependent upregulation of VEGF was moderately sensitive to rapamycin, implicating a partial involvement of mammalian target of rapamycin (mTOR). However, hypoxia did not further increase the secreted VEGF level of the TTF-1(+) lung cancer cells. The TTF-1-induced VEGF upregulation occurs in both compartments (exosomes and exosome-depleted media (EDM)) of the conditioned media. Surprisingly, the EDM of TTF-1(+) lung cancer cells (designated EDM-TTF-1(+)) displayed an anti-angiogenic activity in the endothelial cell tube formation assay. Mechanistic studies suggest that the increased granulocyte-macrophage colony-stimulating factor (GM-CSF) level in the EDM-TTF-1(+) conferred the antiangiogenic activities. In human lung cancer, the expression of TTF-1 and GM-CSF exhibits a statistically significant and positive correlation. In summary, this study provides evidence that TTF-1 may reprogram lung cancer secreted proteome into an antiangiogenic state, offering a novel basis to account for the long-standing observation of favorable prognosis associated with TTF-1(+) lung adenocarcinomas. PMID:26912193

  5. Selective activation of human dendritic cells by OM-85 through a NF-kB and MAPK dependent pathway.

    PubMed

    Parola, Carmen; Salogni, Laura; Vaira, Xenia; Scutera, Sara; Somma, Paolo; Salvi, Valentina; Musso, Tiziana; Tabbia, Giuseppe; Bardessono, Marco; Pasquali, Christian; Mantovani, Alberto; Sozzani, Silvano; Bosisio, Daniela

    2013-01-01

    OM-85 (Broncho-Vaxom®, Broncho-Munal®, Ommunal®, Paxoral®, Vaxoral®), a product made of the water soluble fractions of 21 inactivated bacterial strain patterns responsible for respiratory tract infections, is used for the prevention of recurrent upper respiratory tract infections and acute exacerbations in chronic obstructive pulmonary disease patients. OM-85 is able to potentiate both innate and adaptive immune responses. However, the molecular mechanisms responsible for OM-85 activation are still largely unknown. Purpose of this study was to investigate the impact of OM-85 stimulation on human dendritic cell functions. We show that OM-85 selectively induced NF-kB and MAPK activation in human DC with no detectable action on the interferon regulatory factor (IRF) pathway. As a consequence, chemokines (i.e. CXCL8, CXCL6, CCL3, CCL20, CCL22) and B-cell activating cytokines (i.e. IL-6, BAFF and IL-10) were strongly upregulated. OM-85 also synergized with the action of classical pro-inflammatory stimuli used at suboptimal concentrations. Peripheral blood mononuclear cells from patients with COPD, a pathological condition often associated with altered PRR expression pattern, fully retained the capability to respond to OM-85. These results provide new insights on the molecular mechanisms of OM-85 activation of the immune response and strengthen the rational for its use in clinical settings. PMID:24386121

  6. Selective Activation of Human Dendritic Cells by OM-85 through a NF-kB and MAPK Dependent Pathway

    PubMed Central

    Scutera, Sara; Somma, Paolo; Salvi, Valentina; Musso, Tiziana; Tabbia, Giuseppe; Bardessono, Marco; Pasquali, Christian; Mantovani, Alberto; Sozzani, Silvano; Bosisio, Daniela

    2013-01-01

    OM-85 (Broncho-Vaxom®, Broncho-Munal®, Ommunal®, Paxoral®, Vaxoral®), a product made of the water soluble fractions of 21 inactivated bacterial strain patterns responsible for respiratory tract infections, is used for the prevention of recurrent upper respiratory tract infections and acute exacerbations in chronic obstructive pulmonary disease patients. OM-85 is able to potentiate both innate and adaptive immune responses. However, the molecular mechanisms responsible for OM-85 activation are still largely unknown. Purpose of this study was to investigate the impact of OM-85 stimulation on human dendritic cell functions. We show that OM-85 selectively induced NF-kB and MAPK activation in human DC with no detectable action on the interferon regulatory factor (IRF) pathway. As a consequence, chemokines (i.e. CXCL8, CXCL6, CCL3, CCL20, CCL22) and B-cell activating cytokines (i.e. IL-6, BAFF and IL-10) were strongly upregulated. OM-85 also synergized with the action of classical pro-inflammatory stimuli used at suboptimal concentrations. Peripheral blood mononuclear cells from patients with COPD, a pathological condition often associated with altered PRR expression pattern, fully retained the capability to respond to OM-85. These results provide new insights on the molecular mechanisms of OM-85 activation of the immune response and strengthen the rational for its use in clinical settings. PMID:24386121

  7. The photospheric filling factor of the active binary II Pegasi

    NASA Astrophysics Data System (ADS)

    Marino, G.; Rodonó, M.; Leto, G.; Cutispoto, G.

    1999-12-01

    UBV and JHK photometry of the active single-lined binary II Peg, we performed in 1995, is presented. A method to determine the fraction of the photosphere covered by spots (filling factor) and to check the accuracy of generally assumed values of photospheric parameters has been developed. The procedure is based on the comparison between multiband fluxes and low resolution synthetic spectra weighted on the base of the spot filling factor and scaled with the ratio between the star radius and distance (R/d), so that we can also estimate the R/d ratio. A chi 2 fit has been performed for II Peg observations close to the light maximum and minimum by assuming reliable values of the photospheric parameters. Although a unique solution cannot be reached, we found clear indication for a spot filling factor at light maximum >= 40%. We find that the same set of parameters that gives us the best fit solutions at light maximum also provides the best fit at light minimum. The resulting solutions are consistent with the observed amplitude of the photometric wave, and with the commonly accepted value of R, unspotted V magnitude and spectral classification for II Pegasi.

  8. Loop Dynamics of the Extracellular Domain of Human Tissue Factor and Activation of Factor VIIa

    PubMed Central

    Minazzo, Agnese S.; Darlington, Reuben C.; Ross, J.B. Alexander

    2009-01-01

    Abstract In the crystal structure of the complex between the soluble extracellular domain of tissue factor (sTF) and active-site-inhibited VIIa, residues 91 and 92 in the Pro79-Pro92 loop of sTF interact with the catalytic domain of VIIa. It is not known, however, whether this loop has a role in allosteric activation of VIIa. Time-resolved fluorescence anisotropy measurements of probes covalently bound to sTF mutants E84C and T121C show that binding uninhibited Factor VIIa affects segmental motions in sTF. Glu84 resides in the Pro79-Pro92 loop, and Thr121 resides in the turn between the first and second antiparallel β-strands of the sTF subdomain that interacts with the Gla and EGF1 domains of VIIa; neither Glu84 nor Thr121 makes direct contact with VIIa. Probes bound to T121C report limited segmental flexibility in free sTF, which is lost after VIIa binding. Probes bound to E84C report substantial segmental flexibility in the Pro79-Pro92 loop in free sTF, which is greatly reduced after VIIa binding. Thus, VIIa binding reduces dynamic motions in sTF. In particular, the decrease in the Pro79-Pro92 loop motions indicates that loop entropy has a role in the thermodynamics of the protein-protein interactions involved in allosteric control of VIIa activation. PMID:19167313

  9. Purification of human plasma platelet-activating factor acetylhydrolase

    SciTech Connect

    Stafforini, D.M.; Prescott, S.M.; McIntyre, T.M.

    1986-05-01

    Platelet-activating factor (PAF;1-0-alkyl-2-acetyl-sn-glycero-3-phosphocholine is synthesized by a variety of cells. It induces hypotension, and activates platelets, neutrophils, and macrophages at nanomolar concentrations. Removal of the acetate abolishes biological activity, and is catalyzed by a specific PAF acetylhydrolase present in plasma and tissues. The authors developed a rapid assay, based on separation of (/sup 3/H)acetate from (/sup 3/H-acetyl)PAF by reversed-phase chromatography. In human plasma the enzyme exhibits an apparent Km of 5.7..mu..M, with a Vmax of 0.027..mu..mol/h/mg. Ultracentrifugation in density gradients showed that 30% of the activity is associated with high density lipoproteins (HDL) and 70% with low density lipoproteins (LDL). The enzyme was purified from LDL by precipitation with Na phosphotungstate and MgCl/sub 2/, solubilization with Tween 20, column chromatography and electrophoresis. This procedure resulted in a preparation that was 21,000-fold purified from plasma (spec. act. 575..mu..mol/h/mg) with a recovery of 10%. The purified enzyme has a molecular weight of about 43,000, a broad pH optimum (peak 7.5-8.0), and a pl of 4.6. It has greater activity when PAF is in a micellar, as compared to monomeric, and exhibits surface dilution kinetics, which may be important in vivo. The purification and characterization of this enzyme will allow detailed studies of its role in PAF metabolism.

  10. Crystal Structure of Human Plasma Platelet-Activating Factor Acetylhydrolase

    SciTech Connect

    Samanta, U.; Bahnson, B

    2008-01-01

    Human plasma platelet-activating factor (PAF) acetylhydrolase functions by reducing PAF levels as a general anti-inflammatory scavenger and is linked to anaphylactic shock, asthma, and allergic reactions. The enzyme has also been implicated in hydrolytic activities of other pro-inflammatory agents, such as sn-2 oxidatively fragmented phospholipids. This plasma enzyme is tightly bound to low and high density lipoprotein particles and is also referred to as lipoprotein-associated phospholipase A{sub 2}. The crystal structure of this enzyme has been solved from x-ray diffraction data collected to a resolution of 1.5{angstrom}. It has a classic lipase {alpha}/{beta}-hydrolase fold, and it contains a catalytic triad of Ser{sup 273}, His{sup 351}, and Asp{sup 296}. Two clusters of hydrophobic residues define the probable interface-binding region, and a prediction is given of how the enzyme is bound to lipoproteins. Additionally, an acidic patch of 10 carboxylate residues and a neighboring basic patch of three residues are suggested to play a role in high density lipoprotein/low density lipoprotein partitioning. A crystal structure is also presented of PAF acetylhydrolase reacted with the organophosphate compound paraoxon via its active site Ser{sup 273}. The resulting diethyl phosphoryl complex was used to model the tetrahedral intermediate of the substrate PAF to the active site. The model of interface binding begins to explain the known specificity of lipoprotein-bound substrates and how the active site can be both close to the hydrophobic-hydrophilic interface and at the same time be accessible to the aqueous phase.

  11. Deficiency of platelet-activating factor acetylhydrolase is a severity factor for asthma

    PubMed Central

    Stafforini, Diana M.; Numao, Toshio; Tsodikov, Alexander; Vaitkus, Darius; Fukuda, Takeshi; Watanabe, Naoto; Fueki, Naoto; McIntyre, Thomas M.; Zimmerman, Guy A.; Makino, Sohei; Prescott, Stephen M.

    1999-01-01

    Asthma, a family of airway disorders characterized by airway inflammation, has an increasing incidence worldwide. Platelet-activating factor (PAF) may play a role in the pathophysiology of asthma. Its proinflammatory actions are antagonized by PAF acetylhydrolase. A missense mutation (V279F) in the PAF acetylhydrolase gene results in the complete loss of activity, which occurs in 4% of the Japanese population. We asked if PAF acetylhydrolase deficiency correlates with the incidence and severity of asthma in Japan. We found that the prevalence of PAF acetylhydrolase deficiency is higher in Japanese asthmatics than healthy subjects and that the severity of this syndrome is highest in homozygous-deficient subjects. We conclude that the PAF acetylhydrolase gene is a modulating locus for the severity of asthma. PMID:10194471

  12. Associations between Socio-Motivational Factors, Physical Education Activity Levels and Physical Activity Behavior among Youth

    ERIC Educational Resources Information Center

    Ning, Weihong; Gao, Zan; Lodewyk, Ken

    2012-01-01

    This study examined the relationships between established socio-motivational factors and children's physical activity levels daily and during physical education classes. A total of 307 middle school students (149 boys, 158 girls) from a suburban public school in the Southern United States participated in this study. Participants completed…

  13. Atrial natriuretic factor-like activity in rat posterior pituitary

    SciTech Connect

    Gutkowska, J.; Debinski, W.; Racz, K.; Thibault, G.; Garcia, R.; Kuchel, O.; Genest, J.; Cantin, M.

    1986-03-05

    The presence of a biologically active peptide: Atrial Natriuretic Factor (ANF) has been demonstrated in rat and human circulation and ANF is considered now as a new hormone. ANF may be involved in body fluid regulation. A very sensitive radioimmunoassay for rat ANF allowed the authors to search for immunoreactive ANF (IR-ANF) in rat posterior pituitary. Serial dilutions of homogenates of rat posterior pituitary showed a good parallelism with a reference curve in a radioimmunoassay system. The IR-ANF was extracted from rat posterior pituitary homogenates by activated Vycor glass beads. The lyophilized extract was purified by HPLC on C/sub 18/ ..mu.. Bondapak column. The HPLC yielded two IR-ANF peaks. Both isolated ANF-like material showed biological activity. The IR-ANF eluted with 33% acetonitrile, inhibited ACTH-stimulated aldosterone secretion with a similar potency as synthetic (Arg 101 - Tyr 126) ANF (0.7 x 10/sup -10/M). A much less potent ANF-like material was found in the second peak eluted with 36% acetonitrile. They conclude that ANF-like material is present in rat posterior pituitary and this suggest a possible role in ANF on AVP secretion directly in situ.

  14. Human factors in remote control engineering development activities

    SciTech Connect

    Clarke, M.M.; Hamel, W.R.; Draper, J.V.

    1983-01-01

    Human factors engineering, which is an integral part of the advanced remote control development activities at the Oak Ridge National Laboratory, is described. First, work at the Remote Systems Development Facility (RSDF) has shown that operators can perform a wide variety of tasks, some of which were not specifically designed for remote systems, with a dextrous electronic force-reflecting servomanipulator and good television remote viewing capabilities. Second, the data collected during mock-up remote maintenance experiments at the RSDF have been analyzed to provide guidelines for the design of human interfaces with an integrated advanced remote maintenance system currently under development. Guidelines have been provided for task allocation between operators, remote viewing systems, and operator controls. 6 references, 5 figures, 2 tables.

  15. Platelet activating factor as a mediator of equine cell locomotion.

    PubMed

    Dawson, J; Lees, P; Sedgwick, A D

    1988-01-01

    Equine polymorphonuclear (PMN) and mononuclear (MN) leucocytes were separated on Percoll gradients and used to study the chemoattractant properties of the polar ether-linked phospholipid, platelet activating factor (PAF). Six concentrations of PAF ranging from 1 ng/ml to 100 micrograms/ml were studied in each of two in vitro assay systems, the agarose microdroplet and a microfilter technique. Very significant (p less than 0.01) increases in the movement of both PMN and MN cells were obtained with most concentrations of PAF. In two instances there was no apparent concentration-response relationship, although the action of PAF was approximately bell-shaped in two others. The possible significance of these findings for equine inflammatory conditions is discussed. PMID:3188378

  16. Phylogenomics of caspase-activated DNA fragmentation factor

    SciTech Connect

    Eckhart, Leopold . E-mail: leopold.eckhart@meduniwien.ac.at; Fischer, Heinz; Tschachler, Erwin

    2007-04-27

    The degradation of nuclear DNA by DNA fragmentation factor (DFF) is a key step in apoptosis of mammalian cells. Using comparative genomics, we have here determined the evolutionary history of the genes encoding the two DFF subunits, DFFA (also known as ICAD) and DFFB (CAD). Orthologs of DFFA and DFFB were identified in Nematostella vectensis, a representative of the primitive metazoan clade cnidarians, and in various vertebrates and insects, but not in representatives of urochordates, echinoderms, and nematodes. The domains mediating the interaction of DFFA and DFFB, a caspase cleavage site in DFFA, and the amino acid residues critical for endonuclease activity of DFFB were conserved in Nematostella. These findings suggest that DFF has been a part of the primordial apoptosis system of the eumetazoan common ancestor and that the ancient cell death machinery has degenerated in several evolutionary lineages, including the one leading to the prototypical apoptosis model, Caenorhabditis elegans.

  17. The Regulatory Role of Activating Transcription Factor 2 in Inflammation

    PubMed Central

    Yu, Tao; Li, Yong Jun; Bian, Ai Hong; Zuo, Hui Bin; Zhu, Ti Wen; Ji, Sheng Xiang; Kong, Fanming; Yin, De Qing; Wang, Chuan Bao; Wang, Zi Fu; Wang, Hong Qun; Yang, Yanyan; Yoo, Byong Chul

    2014-01-01

    Activating transcription factor 2 (ATF2) is a member of the leucine zipper family of DNA-binding proteins and is widely distributed in tissues including the liver, lung, spleen, and kidney. Like c-Jun and c-Fos, ATF2 responds to stress-related stimuli and may thereby influence cell proliferation, inflammation, apoptosis, oncogenesis, neurological development and function, and skeletal remodeling. Recent studies clarify the regulatory role of ATF2 in inflammation and describe potential inhibitors of this protein. In this paper, we summarize the properties and functions of ATF2 and explore potential applications of ATF2 inhibitors as tools for research and for the development of immunosuppressive and anti-inflammatory drugs. PMID:25049453

  18. Control of mechanically activated polymersome fusion: Factors affecting fusion

    DOE PAGESBeta

    Henderson, Ian M.; Paxton, Walter F.

    2014-12-15

    Previously we have studied the mechanically-activated fusion of extruded (200 nm) polymer vesicles into giant polymersomes using agitation in the presence of salt. In this study we have investigated several factors contributing to this phenomenon, including the effects of (i) polymer vesicle concentration, (ii) agitation speed and duration, and iii) variation of the salt and its concentration. It was found that increasing the concentration of the polymer dramatically increases the production of giant vesicles through the increased collisions of polymersomes. Our investigations also found that increasing the frequency of agitation increased the efficiency of fusion, though ultimately limited the sizemore » of vesicle which could be produced due to the high shear involved. Finally it was determined that salt-mediation of the fusion process was not limited to NaCl, but is instead a general effect facilitated by the presence of solvated ionic compounds, albeit with different salts initiating fusion at different concentration.« less

  19. Control of mechanically activated polymersome fusion: Factors affecting fusion

    SciTech Connect

    Henderson, Ian M.; Paxton, Walter F.

    2014-12-15

    Previously we have studied the mechanically-activated fusion of extruded (200 nm) polymer vesicles into giant polymersomes using agitation in the presence of salt. In this study we have investigated several factors contributing to this phenomenon, including the effects of (i) polymer vesicle concentration, (ii) agitation speed and duration, and iii) variation of the salt and its concentration. It was found that increasing the concentration of the polymer dramatically increases the production of giant vesicles through the increased collisions of polymersomes. Our investigations also found that increasing the frequency of agitation increased the efficiency of fusion, though ultimately limited the size of vesicle which could be produced due to the high shear involved. Finally it was determined that salt-mediation of the fusion process was not limited to NaCl, but is instead a general effect facilitated by the presence of solvated ionic compounds, albeit with different salts initiating fusion at different concentration.

  20. Cooperative Regulation of the Activity of Factor Xa within Prothrombinase by Discrete Amino Acid Regions from Factor Va Heavy Chain†

    PubMed Central

    2008-01-01

    The prothrombinase complex catalyzes the activation of prothrombin to α-thrombin. We have repetitively shown that amino acid region 695DYDY698 from the COOH terminus of the heavy chain of factor Va regulates the rate of cleavage of prothrombin at Arg271 by prothrombinase. We have also recently demonstrated that amino acid region 334DY335 is required for the optimal activity of prothrombinase. To assess the effect of these six amino acid residues on cofactor activity, we created recombinant factor Va molecules combining mutations at amino acid regions 334–335 and 695−698 as follows: factor V3K (334DY335 → KF and 695DYDY698 → KFKF), factor VKF/4A (334DY335 → KF and 695DYDY698 → AAAA), and factor V6A (334DY335 → AA and 695DYDY698 → AAAA). The recombinant factor V molecules were expressed and purified to homogeneity. Factor Va3K, factor VaK4/4A, and factor Va6A had reduced affinity for factor Xa, when compared to the affinity of the wild-type molecule (factor VaWt) for the enzyme. Prothrombinase assembled with saturating concentrations of factor Va3K had a 6-fold reduced second-order rate constant for prothrombin activation compared to the value obtained with prothrombinase assembled with factor VaWt, while prothrombinase assembled with saturating concentrations of factor VaKF/4A and factor Va6A had approximately 1.5-fold reduced second-order rate constants. Overall, the data demonstrate that amino acid region 334–335 together with amino acid region 695−698 from factor Va heavy chain are part of a cooperative mechanism within prothrombinase regulating cleavage and activation of prothrombin by factor Xa. PMID:18991406

  1. Transcription factor PIF4 controls the thermosensory activation of flowering.

    PubMed

    Kumar, S Vinod; Lucyshyn, Doris; Jaeger, Katja E; Alós, Enriqueta; Alvey, Elizabeth; Harberd, Nicholas P; Wigge, Philip A

    2012-04-12

    Plant growth and development are strongly affected by small differences in temperature. Current climate change has already altered global plant phenology and distribution, and projected increases in temperature pose a significant challenge to agriculture. Despite the important role of temperature on plant development, the underlying pathways are unknown. It has previously been shown that thermal acceleration of flowering is dependent on the florigen, FLOWERING LOCUS T (FT). How this occurs is, however, not understood, because the major pathway known to upregulate FT, the photoperiod pathway, is not required for thermal acceleration of flowering. Here we demonstrate a direct mechanism by which increasing temperature causes the bHLH transcription factor PHYTOCHROME INTERACTING FACTOR4 (PIF4) to activate FT. Our findings provide a new understanding of how plants control their timing of reproduction in response to temperature. Flowering time is an important trait in crops as well as affecting the life cycles of pollinator species. A molecular understanding of how temperature affects flowering will be important for mitigating the effects of climate change. PMID:22437497

  2. Allosteric activation of ADAMTS13 by von Willebrand factor

    PubMed Central

    Muia, Joshua; Zhu, Jian; Gupta, Garima; Haberichter, Sandra L.; Friedman, Kenneth D.; Feys, Hendrik B.; Deforche, Louis; Vanhoorelbeke, Karen; Westfield, Lisa A.; Roth, Robyn; Tolia, Niraj Harish; Heuser, John E.

    2014-01-01

    The metalloprotease ADAMTS13 cleaves von Willebrand factor (VWF) within endovascular platelet aggregates, and ADAMTS13 deficiency causes fatal microvascular thrombosis. The proximal metalloprotease (M), disintegrin-like (D), thrombospondin-1 (T), Cys-rich (C), and spacer (S) domains of ADAMTS13 recognize a cryptic site in VWF that is exposed by tensile force. Another seven T and two complement C1r/C1s, sea urchin epidermal growth factor, and bone morphogenetic protein (CUB) domains of uncertain function are C-terminal to the MDTCS domains. We find that the distal T8-CUB2 domains markedly inhibit substrate cleavage, and binding of VWF or monoclonal antibodies to distal ADAMTS13 domains relieves this autoinhibition. Small angle X-ray scattering data indicate that distal T-CUB domains interact with proximal MDTCS domains. Thus, ADAMTS13 is regulated by substrate-induced allosteric activation, which may optimize VWF cleavage under fluid shear stress in vivo. Distal domains of other ADAMTS proteases may have similar allosteric properties. PMID:25512528

  3. Increased activity of coagulation factor XII (Hageman factor) causes hereditary angioedema type III.

    PubMed

    Cichon, Sven; Martin, Ludovic; Hennies, Hans Christian; Müller, Felicitas; Van Driessche, Karen; Karpushova, Anna; Stevens, Wim; Colombo, Roberto; Renné, Thomas; Drouet, Christian; Bork, Konrad; Nöthen, Markus M

    2006-12-01

    Hereditary angioedema (HAE) is characterized clinically by recurrent acute skin swelling, abdominal pain, and potentially life-threatening laryngeal edema. Three forms of HAE have been described. The classic forms, HAE types I and II, occur as a consequence of mutations in the C1-inhibitor gene. In contrast to HAE types I and II, HAE type III has been observed exclusively in women, where it appears to be correlated with conditions of high estrogen levels--for example, pregnancy or the use of oral contraceptives. A recent report proposed two missense mutations (c.1032C-->A and c.1032C-->G) in F12, the gene encoding human coagulation factor XII (FXII, or Hageman factor) as a possible cause of HAE type III. Here, we report the occurrence of the c.1032C-->A (p.Thr328Lys) mutation in an HAE type III-affected family of French origin. Investigation of the F12 gene in a large German family did not reveal a coding mutation. Haplotype analysis with use of microsatellite markers is compatible with locus heterogeneity in HAE type III. To shed more light on the pathogenic relevance of the HAE type III-associated p.Thr328Lys mutation, we compared FXII activity and plasma levels in patients carrying the mutation with that of healthy control individuals. Our data strongly suggest that p.Thr328Lys is a gain-of-function mutation that markedly increases FXII amidolytic activity but that does not alter FXII plasma levels. We conclude that enhanced FXII enzymatic plasma activity in female mutation carriers leads to enhanced kinin production, which results in angioedema. Transcription of F12 is positively regulated by estrogens, which may explain why only women are affected with HAE type III. The results of our study represent an important step toward an understanding of the molecular processes involved in HAE type III and provide diagnostic and possibly new therapeutic opportunities. PMID:17186468

  4. Grazing by protozoa as selection factor for activated sludge bacteria.

    PubMed

    Güde, H

    1979-09-01

    In continuous culture enrichments that were inoculated with activated sludge and were fed with polymeric substrates, freely dispersed single-celled bacteria belonging to theCytophaga group dominated among the initial populations, irrespective of the activated sludge source. These populations were grazed by flagellated protozoa which after several days reached high cell densities. Other morphologic bacterial groups such as spiral-shaped or filamentous bacteria then became dominant. In defined mixed culture experiments with bacterial isolates from the enrichment cultures, it was shown that a "grazing-resistant"Microcyclus strain outgrew aCytophaga strain in the presence of grazing protozoa. In contrast, theCytophaga strain competed successfully with theMicrocyclus strain and with other "grazing-resistant" strains under protozoa-free conditions. Furthermore, it was demonstrated that assumed grazing resistance factors such as floccing or filamentous growth were lost by some of the strains when they were grown for several generations in continuous culture under the same conditions, but in the absence of protozoa. PMID:24232496

  5. Radiation therapy generates platelet-activating factor agonists

    PubMed Central

    Sahu, Ravi P.; Harrison, Kathleen A.; Weyerbacher, Jonathan; Murphy, Robert C.; Konger, Raymond L.; Garrett, Joy Elizabeth; Chin-Sinex, Helen Jan; Johnston, Michael Edward; Dynlacht, Joseph R.; Mendonca, Marc; McMullen, Kevin; Li, Gengxin; Spandau, Dan F.; Travers, Jeffrey B.

    2016-01-01

    Pro-oxidative stressors can suppress host immunity due to their ability to generate oxidized lipid agonists of the platelet-activating factor-receptor (PAF-R). As radiation therapy also induces reactive oxygen species, the present studies were designed to define whether ionizing radiation could generate PAF-R agonists and if these lipids could subvert host immunity. We demonstrate that radiation exposure of multiple tumor cell lines in-vitro, tumors in-vivo, and human subjects undergoing radiation therapy for skin tumors all generate PAF-R agonists. Structural characterization of radiation-induced PAF-R agonistic activity revealed PAF and multiple oxidized glycerophosphocholines that are produced non-enzymatically. In a murine melanoma tumor model, irradiation of one tumor augmented the growth of the other (non-treated) tumor in a PAF-R-dependent process blocked by a cyclooxygenase-2 inhibitor. These results indicate a novel pathway by which PAF-R agonists produced as a byproduct of radiation therapy could result in tumor treatment failure, and offer important insights into potential therapeutic strategies that could improve the overall antitumor effectiveness of radiation therapy regimens. PMID:26959112

  6. Radiation therapy generates platelet-activating factor agonists.

    PubMed

    Sahu, Ravi P; Harrison, Kathleen A; Weyerbacher, Jonathan; Murphy, Robert C; Konger, Raymond L; Garrett, Joy Elizabeth; Chin-Sinex, Helen Jan; Johnston, Michael Edward; Dynlacht, Joseph R; Mendonca, Marc; McMullen, Kevin; Li, Gengxin; Spandau, Dan F; Travers, Jeffrey B

    2016-04-12

    Pro-oxidative stressors can suppress host immunity due to their ability to generate oxidized lipid agonists of the platelet-activating factor-receptor (PAF-R). As radiation therapy also induces reactive oxygen species, the present studies were designed to define whether ionizing radiation could generate PAF-R agonists and if these lipids could subvert host immunity. We demonstrate that radiation exposure of multiple tumor cell lines in-vitro, tumors in-vivo, and human subjects undergoing radiation therapy for skin tumors all generate PAF-R agonists. Structural characterization of radiation-induced PAF-R agonistic activity revealed PAF and multiple oxidized glycerophosphocholines that are produced non-enzymatically. In a murine melanoma tumor model, irradiation of one tumor augmented the growth of the other (non-treated) tumor in a PAF-R-dependent process blocked by a cyclooxygenase-2 inhibitor. These results indicate a novel pathway by which PAF-R agonists produced as a byproduct of radiation therapy could result in tumor treatment failure, and offer important insights into potential therapeutic strategies that could improve the overall antitumor effectiveness of radiation therapy regimens. PMID:26959112

  7. Hemophilia as a defect of the tissue factor pathway of blood coagulation: Effect of factors VIII and IX on factor X activation in a continuous-flow reactor

    SciTech Connect

    Repke, D.; Gemmell, C.H.; Guha, A.; Turitto, V.T.; Nemerson, Y. ); Broze, G.J. Jr. )

    1990-10-01

    The effect of factors VIII and IX on the ability of the tissue factor-factor VIIa complex to activate factor X was studied in a continuous-flow tubular enzyme reactor. Tissue factor immobilized in a phospholipid bilayer on the inner surface of the tube was exposed to a perfusate containing factors VIIa, VIII, IX, and X flowing at a wall shear rate of 57, 300, or 1130 sec{sup {minus}1}. The addition of factors VIII and IX at their respective plasma concentrations resulted in a further 2{endash}-to 3{endash}fold increase. The direct activation of factor X by tissue factor-factor VIIa could be virtually eliminated by the lipoprotein-associated coagulation inhibitor. These results suggest that the tissue factor pathway, mediated through factors VIII and IX, produces significant levels of factor Xa even in the presence of an inhibitor of the tissue factor-factor VIIa complex; moreover, the activation is dependent on local shear conditions. These findings are consistent both with a model of blood coagulation in which initiation of the system results from tissue factor and with the bleeding observed in hemophilia.

  8. Prediction of Pathway Activation by Xenobiotic-Responsive Transcription Factors in the Mouse Liver

    EPA Science Inventory

    Many drugs and environmentally-relevant chemicals activate xenobioticresponsive transcription factors (TF). Identification of target genes of these factors would be useful in predicting pathway activation in in vitro chemical screening. Starting with a large compendium of Affymet...

  9. Fibrinogen blocks the autoactivation and thrombin-mediated activation of factor XI on dextran sulfate.

    PubMed Central

    Scott, C F; Colman, R W

    1992-01-01

    The intrinsic pathway of blood coagulation is activated when factor XIa, one of the three contact-system enzymes, is generated and then activates factor IX. Factor XI has been shown to be efficiently activated in vitro by surface-bound factor XIIa after factor XI is transported to the surface by its cofactor, high molecular weight kininogen (HK). However, individuals lacking any of the three contact-system proteins--namely, factor XII, prekallikrein, and HK--do not suffer from bleeding abnormalities. This mystery has led several investigators to search for an "alternate" activation pathway for factor XI. Recently, factor XI has been reported to be autoactivated on the soluble "surface" dextran sulfate, and thrombin was shown to accelerate the autoactivation. However, it was also reported that HK, the cofactor for factor XIIa-mediated activation of factor XI, actually diminishes the thrombin-catalyzed activation rate of factor XI. Nonetheless, it was suggested that thrombin was a more efficient activator than factor XIIa. In this report we investigated the effect of fibrinogen, the major coagulation protein in plasma, on the activation rate of factor XI. Fibrinogen, the preferred substrate for thrombin in plasma, virtually prevented autoactivation of factor XI as well as the thrombin-mediated activation of factor XI, while having no effect on factor XIIa-catalyzed activation. HK dramatically curtailed the autoactivation of factor XI in addition to the thrombin-mediated activation. These data indicate that factor XI would not be autoactivated in a plasma environment, and thrombin would, therefore, be unlikely to potentiate the activation. We believe that the "missing pathway" for factor XI activation remains an enigma that warrants further investigation. PMID:1454798

  10. Determination of factor X activator in the venom of the saw-scaled viper (Echis carinatus).

    PubMed

    Stocker, K; Fischer, H; Brogli, M

    1986-01-01

    Factor X activator in Echis carinatus venom was determined by incubating the zymogen 'factor X' with venom, interrupting the activation process by ethylenediaminetetraacetic acid and measuring the generated proteinase 'factor Xa' by means of a synthetic chromogenic substrate. A comparison of factor X- and prothrombin-activating potencies in E. carinatus venoms of five different geographic origins revealed no correlation between these two procoagulant activities. PMID:3715901

  11. Water Activity Limits the Hygroscopic Growth Factor of Organic Aerosols

    NASA Astrophysics Data System (ADS)

    Rodriguez, L. I.; Cabrera, J. A.; Golden, D.; Tabazadeh, A.

    2007-12-01

    In this work we study the hygroscopic behavior of organic aerosols, which has important implications for Earth's climate. The hygroscopic growth factor (HGF) is defined as the ratio of the diameter of a spherical particle when it is exposed to dry conditions to that at humid conditions. We present a new formulation to express the HGF of an aerosol particle as a function of water activity (aw) in the aqueous phase. This new formulation matches reported HGFs for common inorganic salts and water-miscible organic particles that are known to deliquesce into aqueous drops at high relative humidities (RH). Many studies use tandem differential mobility analyzers (TDMA) to determine the HGF of organic aerosols. For example, Brooks et al. used a TDMA to measure a HGF of 1.2 for 2 μm phthalic acid (PA) particles at 90% RH (aw= 0.9). However, water activity limits the growth of a particle that can be attributed to water uptake. We have assembled a vapor pressure apparatus to measure aw of aqueous solutions at room temperature. Measured water activities for PA, used in our growth formulation, yield a HGF of ~ 1.0005 for 2 μm PA particles at 90% RH. Comparing our results against Brooks et al. suggests that TDMA experiments may grossly overestimate the HGF of PA particles since water activity limits this growth to below 1.0005. Alternatively, we suggest that the adsorption of a negligible mass of water by a highly porous PA particle can lead to an apparent growth in particle size by changing its morphology. Other studies also use TDMAs to measure HGFs of secondary organic aerosols (SOAs). HGFs reported for SOAs are very similar to PA, suggesting that the observed growth may be due to morphological changes in particle size rather than water uptake as commonly assumed. We built a smog chamber where an organic precursor, such as d-limonene, reacts with nitrogen oxides under UV radiation to produce SOAs. We compare the HGFs for SOAs obtained with our method to those obtained with

  12. Biochemistry of platelet-activating factor: A unique class of biologically active phospholipids

    SciTech Connect

    Snyder, F. )

    1989-01-01

    This brief overview describes the chemical features of this unique bioactive phospholipid that possesses biologic properties identical to platelet-activating factor (PAF) and an antihypertensive polar renal lipid (APRL). The current understanding of PAF metabolism and its regulation are emphasized, particularly in the context of explaining the enzymatic source of PAF in physiologic vs pharmacologic processes. Also included are brief accounts of the biologic properties, structural-functional relationships, antagonists, receptors and mode of action of PAF.

  13. Non-redundant and complementary functions of adaptor proteins TRAF2 and TRAF3 in a ubiquitination cascade that activates NIK-dependent alternative NF-κB signaling

    PubMed Central

    Vallabhapurapu, Sivakumar; Matsuzawa, Atsushi; Zhang, WeiZhou; Tseng, Ping-Hui; Keats, Jonathan J.; Wang, Haopeng; Vignali, Dario A. A.; Bergsagel, P. Leif; Karin, Michael

    2009-01-01

    The adaptor and signaling proteins TRAF2, TRAF3 and cIAP1 and cIAP2 were suggested to inhibit alternative nuclear factor kappa B (NF-κB) signaling in resting cells by targeting NF-κB inducing kinase (NIK) to ubiquitin-dependent degradation, thus preventing processing of the NF-κB2 precursor protein p100 to release p52. However, the respective functions of TRAF2 and TRAF3 in NIK degradation and activation of alternative NF-κB signaling has remained elusive. We now show that CD40 or BAFF receptor activation resulted in TRAF3 degradation in a cIAP1-cIAP2- and TRAF2- dependent way due to enhanced cIAP1, cIAP2 TRAF3-directed ubiquitin ligase activity. Receptor-induced activation of cIAP1 and cIAP2 correlated with their K63-linked ubiquitination by TRAF2. Degradation of TRAF3 prevented association of NIK with the cIAP1-cIAP2-TRAF2 ubiquitin ligase complex, which resulted in NIK stabilization and NF-κB2-p100 processing. Constitutive activation of this pathway causes perinatal lethality and lymphoid defects. PMID:18997792

  14. Platelet-activating factor and laser trauma of the iris

    SciTech Connect

    Verbey, N.L.; Van Delft, J.L.; Van Haeringen, N.J.; Braquet, P.

    1989-06-01

    Local application of platelet-activating factor (PAF) on the rabbit eye caused a dose-dependent significant increase in intraocular pressure (IOP). After laser irradiation of the iris the IOP showed a hypertensive phase of about 3 hr. Prophylactic treatment with the PAF antagonist BN 52021 but not with indomethacin abolished the hypertensive phase. Elevated levels of protein (10.6 +/- 0.9 g/l) and prostaglandin E2 (PGE2, 1.7 +/- 0.2 ng/ml) were measured in the aqueous humor 2 hr after laser irradiation of the iris. Prophylactic treatment with BN 52021 showed lower levels of protein (6.1 +/- 0.7) and PGE2 (1.1 +/- 0.02); with indomethacin pretreatment the level of protein was 3.4 +/- 0.7 g/l and of PGE2 0.10 +/- 0.02 ng/ml. A role of PAF as a mediator in ocular inflammatory response is suggested.

  15. Formaldehyde activation factor, tetrahydromethanopterin, a coenzyme of methanogenesis

    SciTech Connect

    Escalante-Semerena, J.C.; Leigh, J.A.; Rinehart, K.L. Jr.; Wolfe, R.S.

    1984-04-01

    An oxygen-labile formaldehyde activation factor (FAF) was isolated in highly purified form by use of anoxic fractionation procedures. The molecular weight of FAF was determined to be 776 and that of methanopterin (MPT) 772 by fast-atom-bombardment mass spectrometry (FABMS). High-resolution FABMS measurements on MPT and FAF indicated molecular formulas of C/sub 30/H/sub 41/N/sub 6/O/sub 16/P and C/sub 30/H/sub 45/N/sub 6/O/sub 16/P, respectively. The presence of phosphorus was confirmed by 100-MHz /sup 31/P NMR. The 360-MHz /sup 1/H NMR spectrum of FAF in deuterium oxide was similar to that of MPT. A functional relationship between MPT and FAF was documented; both compounds stimulated the reductive demethylation of 2-(methylthio)ethanesulfonic acid (CH/sub 3/-S-CoM) to CH/sub 4/ when formaldehyde oxidation provided a source of electrons, and FAF replaced MPT in the CH/sub 3/-S-CoM-stimulated conversion of CO/sub 2/ to CH/sub 4/ under H/sub 2/ (the RPG effect). MPT was enzymically converted to FAF during the reduction of CH/sub 3/-S-CoM, and HCHO to CH/sub 4/ under H/sub 2/. Evidence indicates that FAF is tetrahydromethanopterin. 14 references, 8 figures.

  16. Recombinant activated factor VII in post partum haemorrhage

    PubMed Central

    Magon, Navneet; Babu, K. M.; Kapur, Krishan; Chopra, Sanjiv; Joneja, Gurdarshan Singh

    2013-01-01

    Post-partum haemorrhage (PPH) is a life-threatening obstetric complication and the leading cause of maternal death. Any bleeding that results in or could result in haemodynamic instability, if untreated, must be considered as PPH. There is no controversy about the need for prevention and treatment of PPH. The keystone of management of PPH entails first, non-invasive and nonsurgical methods and then invasive and surgical methods. However, mortality remains high. Therefore, new advancements in the treatment are most crucial. One such advancement has been the use of recombinant activated factor VII (rFVIIa) in PPH. First used 12 years back in PPH, this universal haemostatic agent has been effectively used in controlling PPH. The best available indicator of rFVIIa efficacy is the arrest of haemorrhage, which is judged by visual evidence and haemodynamic stabilization. It also reduces costs of therapy and the use of blood components in massive PPH. In cases of intractable PPH with no other obvious indications for hysterectomy, administration of rFVIIa should be considered before surgery. We share our experience in a series of cases of PPH, successfully managed using rFVIIa. PMID:24403703

  17. Regulating the regulators: modulators of transcription factor activity.

    PubMed

    Everett, Logan; Hansen, Matthew; Hannenhalli, Sridhar

    2010-01-01

    Gene transcription is largely regulated by DNA-binding transcription factors (TFs). However, the TF activity itself is modulated via, among other things, post-translational modifications (PTMs) by specific modification enzymes in response to cellular stimuli. TF-PTMs thus serve as "molecular switchboards" that map upstream signaling events to the downstream transcriptional events. An important long-term goal is to obtain a genome-wide map of "regulatory triplets" consisting of a TF, target gene, and a modulator gene that specifically modulates the regulation of the target gene by the TF. A variety of genome-wide data sets can be exploited by computational methods to obtain a rough map of regulatory triplets, which can guide directed experiments. However, a prerequisite to developing such computational tools is a systematic catalog of known instances of regulatory triplets. We first describe PTM-Switchboard, a recent database that stores triplets of genes such that the ability of one gene (the TF) to regulate a target gene is dependent on one or more PTMs catalyzed by a third gene, the modifying enzyme. We also review current computational approaches to infer regulatory triplets from genome-wide data sets and conclude with a discussion of potential future research. PTM-Switchboard is accessible at http://cagr.pcbi.upenn.edu/PTMswitchboard / PMID:20827600

  18. Influence of Environmental Factors on Feammox Activity in Soil Environments

    NASA Astrophysics Data System (ADS)

    Huang, S.; Jaffe, P. R.

    2015-12-01

    The oxidation of ammonium (NH4+) under iron reducing conditions, referred to as Feammox, has been described in recent years by several investigators. The environmental characteristics in which the Feammox process occurs need to be understood in order to determine its contribution to the nitrogen cycle. In this study, a total of 66 locations were selected covering 4 different types of soils/sediments: wetland soils (W), river sediments (R), forest soils (F), and paddy soils (P) from several locations in central New Jersey, at Tims Branch at Savannah River in South Carolina, both in the Unities States, and at several locations in the Guangdong province in China. Though soil chemical analyses, serial culturing experiments, analysis of microbial communities, and using a canonical correspondence analysis, the occurrence of the Feammox reaction and the presence of Acidimicrobiaceae bacterium A6, which plays a key role in the Feammox process(1), were found in 17 samples. Analyses showed that the soil pH, as well as its Fe(III) and NH4+ content were the most important factors controlling the distribution of these Feammox microorganisms. Based on the results, soils in the subtropical forests and soils that are near agricultural areas could be Feammox hotspot. Under the conditions that favor the presence and activity of Feammox microorganisms and their oxidation of NH4+, denitrification bacteria were also active. However, the presence of nitrous oxide (N2O) reducers was limited under these conditions, implying that at locations where the Feammox process is active, conditions are favoring a higher ratio of N2O: N2 as the nitrogen (N) end products. Incubations of soils where the presence of Acidimicrobiaceae bacterium A6 was detected, were conducted for 120 days under two different DO levels (DO < 0.02 mg/L and DO = 0.8~1.0 mg/L) showing comparable amounts of NH4+ oxidation. In the incubations with DO < 0.02 mg/L, the proportion of Acidimicrobiaceae bacteria increased and

  19. Hepatocyte growth factor, hepatocyte growth factor activator and arginine in a rat fulminant colitis model

    PubMed Central

    Zwintscher, Nathan P.; Shah, Puja M.; Salgar, Shashikumar K.; Newton, Christopher R.; Maykel, Justin A.; Samy, Ahmed; Jabir, Murad; Steele, Scott R.

    2016-01-01

    Introduction Dextran sodium sulfate (DSS) is commonly used to induce a murine fulminant colitis model. Hepatocyte growth factor (HGF) has been shown to decrease the symptoms of inflammatory bowel disease (IBD) but the effect of its activator, HGFA, is not well characterized. Arginine reduces effects of oxidative stress but its effect on IBD is not well known. The primary aim is to determine whether HGF and HGFA, or arginine will decrease IBD symptoms such as pain and diarrhea in a DSS-induced fulminant colitis murine model. Methods A severe colitis was induced in young, male Fischer 344 rats with 4% (w/v) DSS oral solution for seven days; rats were sacrificed on day 10. Rats were divided into five groups of 8 animals: control, HGF (700 mcg/kg/dose), HGF and HGFA (10 mcg/dose), HGF and arginine, and high dose HGF (2800 mcg/kg/dose). Main clinical outcomes were pain, diarrhea and weight loss. Blinded pathologists scored the terminal ileum and distal colon. Results DSS reliably induced severe active colitis in 90% of animals (n = 36/40). There were no differences in injury scores between control and treatment animals. HGF led to 1.38 fewer days in pain (p = 0.036), while arginine led to 1.88 fewer days of diarrhea (P = 0.017) compared to controls. 88% of HGFA-treated rats started regaining weight (P < 0.001). Discussion/Conclusion Although treatment was unable to reverse fulminant disease, HGF and arginine were associated with decreased days of pain and diarrhea. These clinical interventions may reduce associated symptoms for severe IBD patients, even when urgent surgical intervention remains the only viable option. PMID:27144006

  20. The molecular biology and nomenclature of the activating transcription factor/cAMP responsive element binding family of transcription factors: activating transcription factor proteins and homeostasis.

    PubMed

    Hai, T; Hartman, M G

    2001-07-25

    The mammalian ATF/CREB family of transcription factors represents a large group of basic region-leucine zipper (bZip) proteins which was originally defined in the late 1980s by their ability to bind to the consensus ATF/CRE site 'TGACGTCA'. Over the past decade, cDNA clones encoding identical or homologous proteins have been isolated by different laboratories and given different names. These proteins can be grouped into subgroups according to their amino acid similarity. In this review, we will briefly describe the classification of these proteins with a historical perspective of their nomenclature. We will then review three members of the ATF/CREB family of proteins: ATF3, ATF4 and ATF6. We will address four issues for each protein: (a) homologous proteins and alternative names, (b) dimer formation with other bZip proteins, (c) transcriptional activity, and (d) potential physiological functions. Although the name Activating Transcription Factor (ATF) implies that they are transcriptional activators, some of these proteins are transcriptional repressors. ATF3 homodimer is a transcriptional repressor and ATF4 has been reported to be either an activator or a repressor. We will review the reports on the transcriptional activities of ATF4, and propose potential explanations for the discrepancy. Although the physiological functions of these proteins are not well understood, some clues can be gained from studies with different approaches. When the data are available, we will address the following questions. (a) How is the expression (at the mRNA level or protein level) regulated? (b) How are the transcriptional activities regulated? (c) What are the interacting proteins (other than bZip partners)? (d) What are the consequences of ectopically expressing the gene (gain-of-function) or deleting the gene (loss-of-function)? Although answers to these questions are far from being complete, together they provide clues to the functions of these ATF proteins. Despite the

  1. Mobilization of hepatic calcium pools by platelet activating factor

    SciTech Connect

    Lapointe, D.S.; Hanahan, D.J.; Olson, M.S.

    1987-03-24

    In the perfused rat liver, platelet activating factor, 1-O-hexadecyl-2-acetyl-sn-glycero-3-phosphocholine (AGEPC), infusion produces an extensive but transient glycogenolytic response which at low AGEPC concentrations is markedly dependent upon the perfusate calcium levels. The role of calcium in the glycogenolytic response of the liver to AGEPC was investigated by assessing the effect of AGEPC on various calcium pools in the intact liver. Livers from fed rats were equilibrated with /sup 45/Ca/sup 2 +/, and the kinetics of /sup 45/Ca/sup 2 +/ efflux were determined in control, AGEPC-stimulated, and phenylephrine-stimulated livers during steady-state washout of /sup 45/Ca/sup 2 +/. AGEPC treatment had only a slight if any effect on the pattern of steady-state calcium efflux from the liver, as opposed to major perturbations in the pattern of calcium efflux effected by the ..cap alpha..-adrenergic agonist phenylephrine. Infusion of short pulses of AGEPC during the washout of /sup 45/Ca/sup 2 +/ from labeled livers caused a transient release of /sup 45/Ca/sup 2 +/ which was not abolished at low calcium concentrations in the perfusate. Infusion of latex beads, which are removed by the reticuloendothelial cells, caused the release of hepatic /sup 45/Ca/sup 2 +/ in a fashion similar to the case with AGEPC. The findings indicate that AGEPC does not perturb a major pool of calcium within the liver as occurs upon ..cap alpha..-adrenergic stimulation; it is likely that AGEPC mobilizes calcium from a smaller yet very important pool, very possibly from nonparenchymal cells in the liver.

  2. Activation of G Proteins by Guanine Nucleotide Exchange Factors Relies on GTPase Activity

    PubMed Central

    Stanley, Rob J.; Thomas, Geraint M. H.

    2016-01-01

    G proteins are an important family of signalling molecules controlled by guanine nucleotide exchange and GTPase activity in what is commonly called an ‘activation/inactivation cycle’. The molecular mechanism by which guanine nucleotide exchange factors (GEFs) catalyse the activation of monomeric G proteins is well-established, however the complete reversibility of this mechanism is often overlooked. Here, we use a theoretical approach to prove that GEFs are unable to positively control G protein systems at steady-state in the absence of GTPase activity. Instead, positive regulation of G proteins must be seen as a product of the competition between guanine nucleotide exchange and GTPase activity—emphasising a central role for GTPase activity beyond merely signal termination. We conclude that a more accurate description of the regulation of G proteins via these processes is as a ‘balance/imbalance’ mechanism. This result has implications for the understanding of intracellular signalling processes, and for experimental strategies that rely on modulating G protein systems. PMID:26986850

  3. Regulation of platelet activating factor receptor coupled phosphoinositide-specific phospholipase C activity

    SciTech Connect

    Morrison, W.J.

    1988-01-01

    The major objectives of this study were two-fold. The first was to establish whether binding of platelet activating factor (PAF) to its receptor was integral to the stimulation of polyphosphoinositide-specific phospholipase C (PLC) in rabbit platelets. The second was to determine regulatory features of this receptor-coupled mechanism. ({sup 3}H)PAF binding demonstrated two binding sites, a high affinity site with a inhibitory constant (Ki) of 2.65 nM and a low affinity site with a Ki of 0.80 {mu}M. PAF receptor coupled activation of phosphoinositide-specific PLC was studied in platelets which were made refractory, by short term pretreatments, to either PAF or thrombin. Saponin-permeabilized rabbit platelets continue to regulate the mechanism(s) coupling PAF receptors to PLC stimulation. However, TRP{gamma}S and GDP{beta}S, which affect guanine nucleotide regulatory protein functions, were unable to modulate the PLC activity to any appreciable extent as compared to PAF. The possible involvement of protein kinase C (PKC) activation in regulating PAF-stimulated PLC activity was studied in rabbit platelets pretreated with staurosporine followed by pretreatments with PAF or phorbol 12-myristate 13-acetate (PMA).

  4. Influence of factor VIII:C and factor IX activity in plasmas of haemophilic dogs on the activated partial thromboplastin time measured with two commercial reagents.

    PubMed

    Mischke, R

    2000-05-01

    The present study is based on 145 plasma samples with a reduced activity of factor VIII:C (range: 0.009-0.62 IU mL-1) and 28 samples with a reduced factor IX activity (range: 0.035-0.55 IU mL-1). The samples were collected from dogs with haemophilia A (n=22) or haemophilia B (n=3), some of these during substitution therapy. For all samples the activated partial thromboplastin time (APTT) was measured with two commercial reagents containing kaolin as a contact activator. In each case, the deficiency of factor VIII:C or IX was reflected in abnormal results of the APTT. This was true for both reagents. A significant correlation (P < 0.001) was found between factor VIII:C activity and APTT (reagent 1, Pathromtin(R); Spearman's rank correlation coefficient, rS=-0.731, reagent 2, PTT-Reagenz; rS=-0.875) as well as between factor IX activity and APTT (reagent 1, rS=-0.819; reagent 2, rS=-0.955]. In each case, the relationship between coagulation factor activity and APTT could be proven most precisely by geometric regression. The results of this study illustrate the applicability of commercial APTT test kits as a sensitive screening test of factor VIII:C and IX deficiencies in canine plasma. PMID:10792470

  5. Adolescent Sexual Activity: An Ecological, Risk-Factor Approach.

    ERIC Educational Resources Information Center

    Small, Stephen A.; Luster, Tom

    1994-01-01

    Examined relationship between adolescent sexual intercourse and history of physical abuse, neighborhood monitoring, and adolescent's attachment to school. Findings from 2,108 adolescents suggest that there are many significant risk factors related to whether adolescents are sexually experienced and that importance of some factors vary by gender.…

  6. The nuclear factor SPBP contains different functional domains and stimulates the activity of various transcriptional activators.

    PubMed

    Rekdal, C; Sjøttem, E; Johansen, T

    2000-12-22

    SPBP (stromelysin-1 platelet-derived growth factor-responsive element binding protein) was originally cloned from a cDNA expression library by virtue of its ability to bind to a platelet-derived growth factor-responsive element in the human stromelysin-1 promoter. A 937-amino acid-long protein was deduced from a 3995-nucleotide murine cDNA sequence. By analyses of both human and murine cDNAs, we now show that SPBP is twice as large as originally found. The human SPBP gene contains six exons and is located on chromosome 22q13.1-13.3. Two isoforms differing in their C termini are expressed due to alternative splicing. PCR analyses of multitissue cDNA panels showed that SPBP is expressed in most tissues except for ovary and prostate. Functional mapping revealed that SPBP is a nuclear, multidomain protein containing an N-terminal region with transactivating ability, a novel type of DNA-binding domain containing an AT hook motif, and a bipartite nuclear localization signal as well as a C-terminal zinc finger domain. This type of zinc finger domain is also found in the trithorax family of chromatin-based transcriptional regulator proteins. Using cotransfection experiments, we find that SPBP enhances the transcriptional activity of various transcription factors such as c-Jun, Ets1, Sp1, and Pax6. Hence, SPBP seems to act as a transcriptional coactivator. PMID:10995766

  7. Alternative pathways of thromboplastin-dependent activation of human factor X in plasma

    SciTech Connect

    Marlar, R.A.; Griffin, J.H.

    1981-01-01

    To determine the interrelationships of the major coagulation pathways, the activation of 3H-labeled factor X in normal and various deficient human plasmas was evaluated when clotting was triggered by dilute rabbit or human thromboplastin. Various dilutions of thromboplastin and calcium were added to plasma samples containing 3H-factor X, and the time course of factor X activation was determined. At a 1/250 dilution of rabbit brain thromboplastin, the rate of factor X activation in plasmas deficient in factor VIII or factor IX was 10% of the activation rate of normal plasma or of factor XI deficient plasma. Reconstitution of the deficient plasmas with factors VIII or IX, respectively, reconstituted normal factor X activation. Similar results were obtained when various dilutions of human thromboplastin replaced the rabbit thromboplastin. From these plasma experiments, it is inferred that the dilute thromboplastin-dependent activation of factor X requires factors VII, IX, and VIII. An alternative extrinsic pathway that involves factors IX and VIII may be the physiologic extrinsic pathway and hence help to explain the consistent clinical observations of bleeding diatheses in patients deficient in factors IX or VIII.

  8. The immunological generation of a platelet-activating factor and a platet-lytic factor in the rat.

    PubMed Central

    Valone, F H; Whitmer, D I; Pickett, W C; Austen, K F; Goetzl, E J

    1979-01-01

    Antigen challenge of the rat peritoneal cavity which had been prepared with IgGa-rich antiserum generated activities which released [14C]-serotonin from pre-labelled human platelets. After adsorption of these activities onto Amberlite XAD-8 and elution in 80% ethanol, two factors of differing polarity were resolved by chromatography on diethylaminoethyl cellulose in organic solvents. The activity eluting in the 7:1 chloroform:methanol solvent contained a platelet-lytic factor (PLF) assessed by the parallel release of lactic acid dehydrogenase and [14C]-serotonin; the cytotoxicity of this fraction was confirmed by phase-contrast microscopy examination which demonstrated fragmentation of the exposed platelets. The activity eluting in the 1:1 methanol: aqueous 1.0 M ammonium carbonate solvent was a platelet-activating factor (PAF) as defined by release of [14C]-serotonin without lactic acid dehydrogenase. Both the lytic and the activating principles were separable from slow reacting substance of anaphylaxis and polymorphonuclear leucocyte chemotactic activity, and each presented a single activity peak of differing mobility when chromatographed on silica gel H plates. Human eosinophil phospholipase D inactivated the lytic factor by more than 85% in 2 h at 37 degrees without affecting the activity of the activating factor. The release of [14C]-serotonin induced by the PAF was not affected by the absence of calcium from the medium or by elevations in the platelet concentrations of cyclic AMP or cyclic GMP that resulted from pre-incubation of platelets with prostaglandin D2 or sodium ascorbate, respectively. PMID:227784

  9. Factors Shaping Students' Opportunities to Engage in Argumentative Activity

    ERIC Educational Resources Information Center

    Ayalon, Michal; Even, Ruhama

    2016-01-01

    This study examines how students' opportunities to engage in argumentative activity are shaped by the teacher, the class, and the mathematical topic. It compares the argumentative activity between two classes taught by the same teacher using the same textbook and across two beginning algebra topics--investigating algebraic expressions and…

  10. Social and Environmental Factors Associated with Preschoolers' Nonsedentary Physical Activity

    ERIC Educational Resources Information Center

    Brown, William H.; Pfeiffer, Karin A.; McIver, Kerry L.; Dowda, Marsha; Addy, Cheryl L.; Pate, Russell R.

    2009-01-01

    The twofold purposes of the investigation were (a) to describe with direct observation data the physical activity behaviors and the accompanying social and environmental events of those behaviors for children in preschools and (b) to determine which contextual conditions were predictors of moderate to vigorous physical activity (MVPA) and…

  11. Physical Activity among Older People and Related Factors

    ERIC Educational Resources Information Center

    Persson, Ann; While, Alison

    2012-01-01

    Objective: To investigate the duration, intensity and type of physical activity undertaken by people aged 60 years and over in relation to their reported levels of participation in social activities and their perceptions of their neighbourhood. Design: A cross-sectional questionnaire survey of older people attending two luncheon and eight social…

  12. Factors That Motivate Faculty to Participate in Professional Development Activities

    ERIC Educational Resources Information Center

    Lian, Xiaoyu

    2014-01-01

    Research has found that effective FPD activities improve faculty's instructional practices and pedagogy, technology skills, and knowledge and that the impact last over time (Rutz, Condon, Iverson, Manduca, & Willett, 2012). FPD activities also reduce job burnout and increase a sense of belonging and morale among faculty (Thomas, 2012).…

  13. Awareness and Habit: Important Factors in Physical Activity in Children

    ERIC Educational Resources Information Center

    Kremers, Stef P. J.; Dijkman, Marieke A. M.; de Meij, Judith S. B.; Jurg, Merlin E.; Brug, Johannes

    2008-01-01

    Purpose: The purpose of this paper is to gain insight into the extent to which Dutch children are aware of their own physical activity level, and to what extent children's physical activity is habitual. Special attention was paid to the potential moderating effect of "awareness" and "habit strength" on the association between psychosocial factors…

  14. Freeze-dried activated substrate for factor VIII assays.

    PubMed

    Margolis, J

    1987-01-01

    Factor VIII-deficient plasma (natural or artificial) mixed with kaolin and phospholipid can be lyophilized to provide ready-to-use substrate which is stable for months at 4 degrees C and usable after many weeks at room temperature. Factor VIII assays are much simplified and more reproducible using this reagent and can be quantified with the aid of a programmable calculator according to the equation (formula; see text) as % of standard and X, S and B are clotting times of test, standard and blank samples respectively. The slope of the log/log function (k) is approximately--6.5. PMID:3111909

  15. Biochemical characterization of a factor X activator protein purified from Walterinnesia aegyptia venom.

    PubMed

    Khan, Sami U; Al-Saleh, Saad S

    2015-10-01

    Factor X of blood coagulation cascade can be activated by both intrinsic and extrinsic activating complex, trypsin and some kind of snake venom. A factor X activator protein is reported in Elapidae snake venom. The aim of this study was to evaluate biochemical properties of factor X activator protein because of its prospective application in biochemical research and therapeutics. Crude venom was fractionated on a HPLC system Gold 126/1667 using a combination of Protein PAK 125 and Protein PAK 60 Columns. Molecular weight was determined using SDS-PAGE. Walterinnesia aegyptia venom was fractionated into several protein peaks, but procoagulant and factor X activation activity coexisted into peak no.6. It appeared as single band on native PAGE and molecular weight was 60,000 ± 3. Purified up to 37-fold over crude venom. It shortened recalcification time, effect was dose-dependent and strictly Ca(2++)-dependent. Factor X activator seems to be able to activate factor X specifically because it showed no activation activity on human prothrombin, plasminogen, or protein C. It did not hydrolyze factor Xa substrate S-2222, thrombin substrate S-2238, plasmin substrate S-2251 or S-2302 and kalikrein substrate S-2266. It did not hydrolyze synthetic ester benzoyl arginine ethyl ester. Procoagulant activity was completely inhibited by irreversible serine protease inhibitors phenylmethylsulphonyl fluoride and N-p-tosylphenylalanine chloromethyl ketone. This study illustrates that factor X activator from W. aegyptia is though different in many aspects from factor X activators of Viperidae and Crotalidae venoms, but shows several properties identical to factor X activators from Elapidae venoms. PMID:26407136

  16. Coexpression of heparanase activity, cathepsin L, tissue factor, tissue factor pathway inhibitor, and MMP-9 in proliferative diabetic retinopathy

    PubMed Central

    Siddiquei, Mohammad Mairaj; Nawaz, Mohd Imtiaz; De Hertogh, Gert; Mohammad, Ghulam; Alam, Kaiser; Mousa, Ahmed; Opdenakker, Ghislain

    2016-01-01

    Purpose Heparanase cleaves heparan sulfate side chains of heparan sulfate proteoglycans, activity that is implicated in angiogenesis. Proteolytic cleavage of proheparanase by cathepsin L leads to the formation of catalytically active heparanase. We investigated the expression levels of heparanase enzymatic activity and correlated these with the levels of cathepsin L, the angiogenic factors tissue factor (TF) and matrix metalloproteinase-9 (MMP-9), and the angiostatic factor tissue factor pathway inhibitor (TFPI) in proliferative diabetic retinopathy (PDR). Methods Vitreous samples from 25 patients with PDR and 20 nondiabetic patients and epiretinal membranes from 12 patients with PDR were studied with enzyme-linked immunosorbent assay, western blot analysis, and immunohistochemistry. Results We observed a significant increase in the expression of heparanase activity in vitreous samples from patients with PDR compared to the nondiabetic controls (p=0.027). Significant positive correlations were found between the levels of heparanase activity and the levels of cathepsin L (r=0.51; p=0.001), TF (r=0.6; p<0.0001), and TFPI (r=0.49; p=0.001). The expression levels of cathepsin L (p=0.019), TF (p<0.0001), TFPI (p<0.0001), and MMP-9 (p=0.029) were significantly higher in the vitreous samples with detected heparanase activity compared to the vitreous samples with undetected heparanase activity. Western blot analysis demonstrated proteolytic cleavage of TFPI in the vitreous samples from patients with PDR. In the epiretinal membranes, cathepsin L, TF, and TFPI were expressed in vascular endothelial cells and CD45-expressing leukocytes. Significant positive correlations were detected between the number of blood vessels that expressed CD31 and the number of blood vessels that expressed TF (r=0.9; p<0.0001) and TFPI (r=0.81; p=0.001). Conclusions The coexpression of these angiogenesis regulatory factors suggests cross-talk between these factors and pathogenesis of PDR

  17. Factors Affecting Teachers' Participation in Professional Development Activities in Turkey

    ERIC Educational Resources Information Center

    Bayar, Adem

    2013-01-01

    The purpose of this study was to examine the relationship between factors (internal [personal] and external [environmental]) and teachers' participation in professional development (PD) programs in Turkey. The researcher employed a survey design, using a multiple-stage sampling method, selecting 30 out of 66 elementary schools in the Center…

  18. Apixaban, an oral, direct inhibitor of activated Factor Xa.

    PubMed

    Shantsila, Eduard; Lip, Gregory Y H

    2008-09-01

    Apixaban is an oral, direct Factor Xa inhibitor that is being developed by Bristol-Myers Squibb Co and Pfizer Inc. Apixaban is currently undergoing phase III clinical trials for cerebrovascular ischemia, deep vein thrombosis and lung embolism, and phase II clinical trials for coronary artery disease. PMID:18729009

  19. EGF activates TTP expression by activation of ELK-1 and EGR-1 transcription factors

    PubMed Central

    2012-01-01

    Background Tristetraprolin (TTP) is a key mediator of processes such as inflammation resolution, the inhibition of autoimmunity and in cancer. It carries out this role by the binding and degradation of mRNA transcripts, thereby decreasing their half-life. Transcripts modulated by TTP encode proteins such as cytokines, pro-inflammatory agents and immediate-early response proteins. TTP can also modulate neoplastic phenotypes in many cancers. TTP is induced and functionally regulated by a spectrum of both pro- and anti-inflammatory cytokines, mitogens and drugs in a MAPK-dependent manner. So far the contribution of p38 MAPK to the regulation of TTP expression and function has been best described. Results Our results demonstrate the induction of the gene coding TTP (ZFP36) by EGF through the ERK1/2-dependent pathway and implicates the transcription factor ELK-1 in this process. We show that ELK-1 regulates ZFP36 expression by two mechanisms: by binding the ZFP36 promoter directly through ETS-binding site (+ 883 to +905 bp) and by inducing expression of EGR-1, which in turn increases ZFP36 expression through sequences located between -111 and -103 bp. Conclusions EGF activates TTP expression via ELK-1 and EGR-1 transcription factors. PMID:22433566

  20. Regulation of platelet-activating factor receptor gene expression in vivo by endotoxin, platelet-activating factor and endogenous tumour necrosis factor.

    PubMed Central

    Wang, H; Tan, X; Chang, H; Gonzalez-Crussi, F; Remick, D G; Hsueh, W

    1997-01-01

    A competitive PCR assay was developed to quantify platelet-activating factor (PAF) receptor (PAF-R) transcripts in rat tissues using a synthetic RNA as a competitor. We found PAF-R mRNA constitutively expressed in the eight organs tested, with the ileum containing the highest concentration [(3.49+/-0.15) x 10(7) molecules/microg of RNA]. Significant but lower levels were also detected in the jejunum, spleen, lungs, kidneys, heart, stomach and liver. Furthermore we defined the regulatory role of inflammatory mediators in ileal PAF-R gene expression using a rat model of intestinal injury induced by PAF or lipopolysaccharide (LPS). Injection of LPS or low-dose PAF resulted in a marked increase in ileal PAF-R mRNA within 30 min. The up-regulation on PAF-R elicited by PAF was biphasic, peaking first at 90 min, then again at 6 h. In contrast, LPS elicited a weak monophasic response. The second phase of PAF-R mRNA increase after PAF administration was completely abolished by WEB 2170, a PAF antagonist, and partially inhibited by antitumour necrosis factor (TNF) antibody. These observations indicate the involvement of endogenous PAF and TNF in this event. In conclusion, we found: (a) preferential PAF-R expression in the ileum, suggesting a role for PAF in intestinal inflammation; (b) induction of PAF-R expression in vivo by its own agonist; (c) a complex regulation of PAR-R gene expression in vivo involving a network of various pro-inflammatory mediators. PMID:9065783

  1. FACTORS AFFECTING TIME-ACTIVITY BUDGETS OF BUFFLEHEAD WINTERING IN NARRAGANSETT, BAY, RI

    EPA Science Inventory

    Daily activities of wintering waterfowl can be influenced by the physical environment and by habitat factors such as prey abundance and availability. We examined variability in diurnal activity budgets of Bufflehead (Bucephala albeola) wintering at seven locations within Narragan...

  2. ANALYSIS OF DISCRIMINATING FACTORS IN HUMAN ACTIVITIES THAT AFFECT EXPOSURE

    EPA Science Inventory

    Accurately modeling exposure to particulate matter (PM) and other pollutants ultimately involves the utilization of human location-activity databases to assist in understanding the potential variability of microenvironmental exposures. This paper critically considers and stati...

  3. Alternative complement pathway and factor B activities in rats with altered blood levels of thyroid hormone

    PubMed Central

    Bitencourt, C.S.; Duarte, C.G.; Azzolini, A.E.C.S.; Assis-Pandochi, A.I.

    2012-01-01

    Evaluating the activity of the complement system under conditions of altered thyroid hormone levels might help elucidate the role of complement in triggering autoimmune processes. Here, we investigated alternative pathway (AP) activity in male Wistar rats (180 ± 10 g) after altering their thyroid hormone levels by treatment with triiodothyronine (T3), propylthiouracil (PTU) or thyroidectomy. T3 and thyroxine (T4) levels were determined by chemiluminescence assays. Hemolytic assays were performed to evaluate the lytic activity of the AP. Factor B activity was evaluated using factor B-deficient serum. An anti-human factor B antibody was used to measure factor B levels in serum by radial immunodiffusion. T3 measurements in thyroidectomized animals or animals treated with PTU demonstrated a significant reduction in hormone levels compared to control. The results showed a reduction in AP lytic activity in rats treated with increasing amounts of T3 (1, 10, or 50 µg). Factor B activity was also decreased in the sera of hyperthyroid rats treated with 1 to 50 µg T3. Additionally, treating rats with 25 µg T3 significantly increased factor B levels in their sera (P < 0.01). In contrast, increased factor B concentration and activity (32%) were observed in hypothyroid rats. We conclude that alterations in thyroid hormone levels affect the activity of the AP and factor B, which may in turn affect the roles of AP and factor B in antibody production. PMID:22370704

  4. Harnessing endogenous growth factor activity modulates stem cell behavior

    PubMed Central

    Hudalla, Gregory A.; Kouris, Nicholas A.; Koepsel, Justin T.; Ogle, Brenda M.; Murphy, William L.

    2014-01-01

    The influence of specific serum-borne biomolecules (e.g. heparin) on growth factor-dependent cell behavior is often difficult to elucidate in traditional cell culture due to the random, non-specific nature of biomolecule adsorption from serum. We hypothesized that chemically well-defined cell culture substrates could be used to study the influence of sequestered heparin on human mesenchymal stem cell (hMSC) behavior. Specifically, we used bio-inert self-assembled monolayers (SAMs) chemically modified with a bioinspired heparin-binding peptide (termed “HEPpep”) and an integrin-binding peptide (RGDSP) as stem cell culture substrates. Our results demonstrate that purified heparin binds to HEPpep SAMs in a dose-dependent manner, and serum-borne heparin binds specifically and in a dose-dependent manner to HEPpep SAMs. These heparin-sequestering SAMs enhance hMSC proliferation by amplifying endogenous fibroblast growth factor (FGF) signaling, and enhance hMSC osteogenic differentiation by amplifying endogenous bone morphogenetic protein (BMP) signaling. The effects of heparin-sequestering are similar to the effects of supraphysiologic concentrations of recombinant FGF-2. hMSC phenotype is maintained over multiple population doublings on heparin-sequestering substrates in growth medium, while hMSC osteogenic differentiation is enhanced in a bone morphogenetic protein-dependent manner on the same substrates during culture in osteogenic induction medium. Together, these observations demonstrate that the influence of the substrate on stem cell phenotype is sensitive to the culture medium formulation. Our results also demonstrate that enhanced hMSC proliferation can be spatially localized by patterning the location of HEPpep on the substrate. Importantly, the use of chemically well-defined SAMs in this study eliminated the confounding factor of random, non-specific biomolecule adsorption, and identified serum-borne heparin as a key mediator of hMSC response to endogenous

  5. Angiotensin peptides attenuate platelet-activating factor-induced inflammatory activity in rats.

    PubMed

    Sato, Akira; Yokoyama, Izumi; Ebina, Keiichi

    2015-11-01

    Angiotensin (Ang)--a peptide that is part of the renin-angiotensin system-induces vasoconstriction and a subsequent increase in blood pressure; Ang peptides, especially AngII, can also act as potent pro-inflammatory mediators. Platelet-activating factor (PAF) is a potent phospholipid mediator that is implicated in many inflammatory diseases. In this study, we investigated the effects of Ang peptides (AngII, AngIII, and AngIV) on PAF-induced inflammatory activity. In experiments using a rat hind-paw oedema model, AngII markedly and dose-dependently attenuated the paw oedema induced by PAF. The inhibitory effects of AngIII and AngIV on PAF-induced paw oedema were lower than that of AngII. Two Ang receptors, the AT1 and AT2 receptors, did not affect the AngII-mediated attenuation of PAF-induced paw oedema. Moreover, intrinsic tyrosine fluorescence studies demonstrated that AngII, AngIII, and AngIV interact with PAF, and that their affinities were closely correlated with their inhibitory effects on PAF-induced rat paw oedema. Also, AngII interacted with metabolite/precursor of PAF (lyso-PAF), and an oxidized phospholipid, 1-palmitoyl-2-(5'-oxo-valeroyl)-sn-glycero-3-phosphocholine (POVPC), which bears a marked structural resemblance to PAF. Furthermore, POVPC dose-dependently inhibited AngII-mediated attenuation of PAF-induced paw oedema. These results suggest that Ang peptides can attenuate PAF-induced inflammatory activity through binding to PAF and lyso-PAF in rats. Therefore, Ang peptides may be closely involved in the regulation of many inflammatory diseases caused by PAF. PMID:26348270

  6. Preparation of factor VII concentrate using CNBr-activated Sepharose 4B immunoaffinity chromatography

    PubMed Central

    Mousavi Hosseini, Kamran; Nasiri, Saleh

    2015-01-01

    Background: Factor VII concentrates are used in patients with congenital or acquired factor VII deficiency or treatment of hemophilia patients with inhibitors. In this research, immunoaffinity chromatography was used to purify factor VII from prothrombin complex (Prothrombin- Proconvertin-Stuart Factor-Antihemophilic Factor B or PPSB) which contains coagulation factors II, VII, IX and X. The aim of this study was to improve purity, safety and tolerability as a highly purified factor VII concentrate. Methods: PPSB was prepared using DEAE-Sephadex and was used as the starting material for purification of coagulation factor VII. Prothrombin complex was treated by solvent/detergent at 24°C for 6 h with constant stirring. The mixture of PPSB in the PBS buffer was filtered and then chromatographed using CNBr-activated Sepharose 4B coupled with specific antibody. Factors II, IX, VII, X and VIIa were assayed on the fractions. Fractions of 48-50 were pooled and lyophilized as a factor VII concentrate. Agarose gel electrophoresis was performed and Tween 80 was measured in the factor VII concentrate. Results: Specific activity of factor VII concentrate increased from 0.16 to 55.6 with a purificationfold of 347.5 and the amount of activated factor VII (FVIIa) was found higher than PPSB (4.4-fold). Results of electrophoresis on agarose gel indicated higher purity of Factor VII compared to PPSB; these finding revealed that factor VII migrated as alpha-2 proteins. In order to improve viral safety, solvent-detergent treatment was applied prior to further purification and nearly complete elimination of tween 80 (2 μg/ml). Conclusion: It was concluded that immuonoaffinity chromatography using CNBr-activated Sepharose 4B can be a suitable choice for large-scale production of factor VII concentrate with higher purity, safety and activated factor VII. PMID:26034723

  7. Insights into the Interferon Regulatory Factor Activation from the Crystal Structure of Dimeric IRF5

    SciTech Connect

    Chen, W.; Lam, S; Srinath, H; Jiang, Z; Correia, J; Schiffer, C; Fitzgerald, K; Lin, K; Royer, Jr., W

    2008-01-01

    The interferon regulatory factors (IRFs) are involved in the innate immune response and are activated by phosphorylation. The structure of a pseudophosphorylated IRF5 activation domain now reveals structural changes in the activated form that would turn an autoinhibitory region into a dimerization interface. In vivo analysis supports the relevance of such a dimer to transcriptional activation.

  8. Transcription factors of Lotus: regulation of isoflavonoid biosynthesis requires coordinated changes in transcription factor activity.

    PubMed

    Shelton, Dale; Stranne, Maria; Mikkelsen, Lisbeth; Pakseresht, Nima; Welham, Tracey; Hiraka, Hideki; Tabata, Satoshi; Sato, Shusei; Paquette, Suzanne; Wang, Trevor L; Martin, Cathie; Bailey, Paul

    2012-06-01

    Isoflavonoids are a class of phenylpropanoids made by legumes, and consumption of dietary isoflavonoids confers benefits to human health. Our aim is to understand the regulation of isoflavonoid biosynthesis. Many studies have shown the importance of transcription factors in regulating the transcription of one or more genes encoding enzymes in phenylpropanoid metabolism. In this study, we coupled bioinformatics and coexpression analysis to identify candidate genes encoding transcription factors involved in regulating isoflavonoid biosynthesis in Lotus (Lotus japonicus). Genes encoding proteins belonging to 39 of the main transcription factor families were examined by microarray analysis of RNA from leaf tissue that had been elicited with glutathione. Phylogenetic analyses of each transcription factor family were used to identify subgroups of proteins that were specific to L. japonicus or closely related to known regulators of the phenylpropanoid pathway in other species. R2R3MYB subgroup 2 genes showed increased expression after treatment with glutathione. One member of this subgroup, LjMYB14, was constitutively overexpressed in L. japonicus and induced the expression of at least 12 genes that encoded enzymes in the general phenylpropanoid and isoflavonoid pathways. A distinct set of six R2R3MYB subgroup 2-like genes was identified. We suggest that these subgroup 2 sister group proteins and those belonging to the main subgroup 2 have roles in inducing isoflavonoid biosynthesis. The induction of isoflavonoid production in L. japonicus also involves the coordinated down-regulation of competing biosynthetic pathways by changing the expression of other transcription factors. PMID:22529285

  9. Mapping neural circuits with activity-dependent nuclear import of a transcription factor.

    PubMed

    Masuyama, Kaoru; Zhang, Yi; Rao, Yi; Wang, Jing W

    2012-03-01

    Abstract: Nuclear factor of activated T cells (NFAT) is a calcium-responsive transcription factor. We describe here an NFAT-based neural tracing method-CaLexA (calcium-dependent nuclear import of LexA)-for labeling active neurons in behaving animals. In this system, sustained neural activity induces nuclear import of the chimeric transcription factor LexA-VP16-NFAT, which in turn drives green fluorescent protein (GFP) reporter expression only in active neurons. We tested this system in Drosophila and found that volatile sex pheromones excite specific neurons in the olfactory circuit. Furthermore, complex courtship behavior associated with multi-modal sensory inputs activated neurons in the ventral nerve cord. This method harnessing the mechanism of activity-dependent nuclear import of a transcription factor can be used to identify active neurons in specific neuronal population in behaving animals. PMID:22236090

  10. Factors Associated with Physical Activity Literacy among Foster Parents

    ERIC Educational Resources Information Center

    Dominick, Gregory M.; Friedman, Daniela B.; Saunders, Ruth P.; Hussey, Jim R.; Watkins, Ken W.; W.

    2012-01-01

    Objectives: To explore associations between physical activity (PA) literacy and psychosocial constructs for providing instrumental social support for youth PA. Methods: Ninety-one foster parents completed surveys assessing PA literacy (overall and specific), perceptions of child PA, coordination, PA enjoyment, psychosocial variables:…

  11. On factors controlling activity of submonolayer bimetallic catalysts: Nitrogen desorption

    SciTech Connect

    Guo, Wei; Vlachos, Dionisios G.

    2014-01-07

    We model N{sub 2} desorption on submonolayer bimetallic surfaces consisting of Co clusters on Pt(111) via first-principles density functional theory-based kinetic Monte Carlo simulations. We find that submonolayer structures are essential to rationalize the high activity of these bimetallics in ammonia decomposition. We show that the N{sub 2} desorption temperature on Co/Pt(111) is about 100 K higher than that on Ni/Pt(111), despite Co/Pt(111) binding N weaker at low N coverages. Co/Pt(111) has substantially different lateral interactions than single metals and Ni/Pt. The lateral interactions are rationalized with the d-band center theory. The activity of bimetallic catalysts is the result of heterogeneity of binding energies and reaction barriers among sites, and the most active site can differ on various bimetallics. Our results are in excellent agreement with experimental data and demonstrate for the first time that the zero-coverage descriptor, used until now, for catalyst activity is inadequate due not only to lacking lateral interactions but importantly to presence of multiple sites and a complex interplay of thermodynamics (binding energies, occupation) and kinetics (association barriers) on those sites.

  12. Factors Influencing Physical Activity among Postpartum Iranian Women

    ERIC Educational Resources Information Center

    Roozbahani, Nasrin; Ghofranipour, Fazlollah; Eftekhar Ardabili, Hassan; Hajizadeh, Ebrahim

    2014-01-01

    Background: Postpartum women are a population at risk for sedentary living. Physical activity (PA) prior to pregnancy may be effective in predicting similar behaviour in the postpartum period. Objective: To test a composite version of the extended transtheoretical model (TTM) by adding "past behaviour" in order to predict PA behaviour…

  13. Factors Related to the Participation of Pennsylvania Agricultural Education Teachers in Professional Development Activities. Final Report.

    ERIC Educational Resources Information Center

    Hall, David E.

    A study examined factors related to the participation of Pennsylvania agricultural education teachers in professional development activities. Specifically, it sought to describe the relationship or differences between participation in professional development activities, professional attitude, and 22 selected demographic factors. A questionnaire…

  14. Role of Individual and School Factors in Physical Activity Patterns of Secondary-Level Spanish Students

    ERIC Educational Resources Information Center

    Juan, Francisco Ruiz; Bengoechea, Enrique Garcia; Montes, Maria Elena Garcia; Bush, Paula Louise

    2010-01-01

    Background: While the importance of individual and school factors as correlates of overall youth physical activity has been demonstrated by previous research, less is known about the relationship of these factors with specific patterns of physical activity during adolescence. Thus, the purpose of this study was to examine the association of…

  15. An auxiliary peptide required for the function of two activation domains in upstream stimulatory factor 2 (USF2) transcription factor.

    PubMed

    Gourdon, L; Lefrançois-Martinez, A M; Viollet, B; Martinez, A; Kahn, A; Raymondjean, M

    1997-04-01

    Ubiquitous upstream stimulatory factors (USF1, USF2a and USF2b) are members of the basic-helix-loop-helix-leucine-zipper family of transcription factors that have been shown to be involved in the transcriptional response of the L-type pyruvate kinase (L-PK) gene to glucose. To understand the mechanisms of action of the USF2 isoforms, we initiated a series of co-transfection assays with deletion mutants and Ga14-USF2 fusions. The transactivating efficiency of the different native and mutant factors was determined at similar DNA binding activity. We found that: (i) exons 3- and 5-encoded regions are activation domains, (ii) a modulator domain encoded by exon 4 could be necessary to their additive action, (iii) a hexapeptide encoded by the first 5' codons of exon 6 is indispensable for transmitting activation due to both exon 3- and exon 5-encoded domains to the transcriptional machinery. Therefore, USF2 presents a modular structure and mediates transcriptional activation thanks to two non-autonomous activation domains dependent on an auxiliary peptide for expressing their activating potential. PMID:9680311

  16. Factors affecting the adsorption of chromium (VI) on activated carbon

    SciTech Connect

    Yavuz, R.; Orbak, I.; Karatepe, N.

    2006-09-15

    The aim of this investigation was to determine the adsorption behavior of chromium (VI) on two different activated carbon samples produced from Tuncbilek lignite. The effects of the initial chromium (VI) concentration (250-1000 mg/L), temperature (297-323 K) and pH (2.0-9.5) on adsorption were investigated systematically. The effectiveness of the parameters on chromium adsorption was found to be in the order of pH, the initial Cr(VI) concentration and the temperature. Increasing the pH from 2.0 to 9.5 caused a decrease in adsorption. However, the adsorption was increased by increasing the initial Cr(VI) concentration and temperature. The multilinear mathematical model was also developed to predict the Cr(VI) adsorption on activated carbon samples within the experimental conditions.

  17. Factors affecting the adsorption of xenon on activated carbon

    SciTech Connect

    Underhill, D.W.; DiCello, D.C.; Scaglia, L.A.; Watson, J.A.

    1986-08-01

    The presence of water vapor was found to interfere strongly with the dynamic adsorption of /sup 133/Xe on coconut-base activated charcoal. The percent loss in the xenon adsorption coefficient was similar to values reported earlier for the adsorption of krypton on humidified charcoal. Attempts to increase the adsorption of xenon by (a) using a petroleum-based adsorbent with an extremely high surface area and (b) by impregnation of the adsorbent with iodine were not successful.

  18. The Positive Transcription Elongation Factor b Is an Essential Cofactor for the Activation of Transcription by Myocyte Enhancer Factor 2

    PubMed Central

    Nojima, Masanori; Huang, Yehong; Tyagi, Mudit; Kao, Hung-Ying; Fujinaga, Koh

    2014-01-01

    The positive transcription elongation factor b (P-TEFb), composed of cyclin-dependent kinase 9 and cyclin T1, stimulates the elongation of transcription by hyperphosphorylating the C-terminal region of RNA polymerase II. Aberrant activation of P-TEFb results in manifestations of cardiac hypertrophy in mice, suggesting that P-TEFb is an essential factor for cardiac myocyte function and development. Here, we present evidence that P-TEFb selectively activates transcription mediated by the myocyte enhancer factor 2 (MEF2) family of transcription factors, key regulatory factors for myocyte development. Knockdown of endogenous cyclin T1 in murine C2C12 cells abolishes MEF2-dependent reporter gene expression as well as transcription of endogenous MEF2 target genes, whereas overexpression of P-TEFb enhances MEF2-dependent transcription. P-TEFb interacts with MEF2 both in vitro and in vivo. Activation of MEF2-dependent transcription induced by serum starvation is mediated by a rapid dissociation of P-TEFb from its inhibitory subunit, HEXIM1, and a subsequent recruitment of P-TEFb to MEF2 binding sites in the promoter region of MEF2 target genes. These results indicate that recruitment of P-TEFb is a critical step for stimulation of MEF2-dependent transcription, therefore providing a fundamentally important regulatory mechanism underlying the transcriptional program in muscle cells. PMID:18662700

  19. Glioma-secreted soluble factors stimulate microglial activation: The role of interleukin-1β and tumor necrosis factor-α.

    PubMed

    Hwang, Ji-Sun; Jung, Eun-Hye; Kwon, Mi-Youn; Han, Inn-Oc

    2016-09-15

    We aimed to elucidate the effect of soluble factors secreted by glioma on microglial activation. Conditioned medium (CM) from glioma cells, CRT-MG and C6, significantly induced nitric oxide (NO) production and stimulated the mRNA expression of inducible NO synthase (iNOS), interleukin (IL)-1beta, IL-6, tumor necrosis factor-alpha (TNF-α) and cyclooxygenase 2 (COX-2) in BV2 cells. Glioma CM stimulated p38 mitogen-activated protein kinase (MAPK) phosphorylation, and a p38 MAPK inhibitor, SB203580, suppressed CM-induced NO production in BV2 cells. In addition, CM stimulated nuclear factor-kappaB (NF-κB) DNA binding and transcriptional activity, which was repressed by SB203580. Gliomas displayed higher mRNA expression and release of TNF-α and IL-1β than primary astrocyte cells. Neutralization of TNF-α and IL-1β in C6-CM using a neutralizing antibody inhibited NO/iNOS expression in BV-2 cells. These results indicate potential contribution of diffusible tumor-derived factors to regulate microglial activation and subsequent tumor microenvironment. PMID:27609291

  20. Stimulation of protein phosphatase activity by insulin and growth factors in 3T3 cells

    SciTech Connect

    Chan, C.P.; McNall, S.J.; Krebs, E.G.; Fischer, E.H. )

    1988-09-01

    Incubation of Swiss mouse 3T3-D1 cells with physiological concentrations of insulin resulted in a rapid and transient activation of protein phosphatase activity as measure by using ({sup 32}P)phosphorylase {alpha} as substrate. Activation reached a maximum level (140% of control value) within 5 min of addition and returned to control levels within 20 min. The effect of insulin was dose-dependent with half-maximal activation occurring at {approx}5 nM insulin. This activity could be completely inhibited by addition of the heat-stable protein inhibitor 2, which suggests the presence of an activated type-1 phosphatase. Similar effects on phosphatase activity were seen when epidermal growth factor and platelet-derived growth factor were tested. These results suggest that some of the intracellular effects caused by insulin and growth factors are mediated through the activation of a protein phosphatase.

  1. Biological effects of the orally active platelet activating factor receptor antagonist SDZ 64-412.

    PubMed

    Handley, D A; Van Valen, R G; Melden, M K; Houlihan, W J; Saunders, R N

    1988-11-01

    SDZ 64-412 is a trimethoxyphenylethylphenyl imidazo[2,1-a] isoquinoline molecule that displays marked in vitro inhibition of platelet activating factor (PAF)-induced human platelet aggregation (IC50 = 60 nM) but is without inhibition (at 100 microM) of epinephrine-, ADP- or collagen-induced aggregation. SDZ 64-412 antagonized receptor binding of radiolabeled PAF to human platelet membranes with an IC50 = 60 nM. In the rat, SDZ 64-412 inhibited 100 ng kg-1 PAF-induced hypotension when given i.v. (ED50 = 0.23 mg kg-1) or p.o. (ED50 = 13 mg kg-1). In the guinea pig, SDZ 64-412 inhibited 50 ng kg-1 PAF-induced bronchoconstriction (ED50 = 4.2 mg kg-1 p.o.) and hemoconcentration (ED50 = 5.0 mg kg-1 p.o.). SDZ 64-412 exhibited oral activity in the dog against 1.5 micrograms kg-1 PAF-induced hypotension (ED50 = 5.1 mg kg-1 p.o.) and hemoconcentration (ED50 = 4.9 mg kg-1) and 3.5 micrograms kg-1 PAF-induced hemoconcentration in the cebus primate (ED50 = 12.8 mg kg-1 p.o.). SDZ 64-412 protected in a dose-dependent manner against PAF-induced lethality (LD75 = 75 micrograms kg-1 i.v.) in mice, where 20 mg kg-1 p.o. improved survival from 25 +/- 4% to 77 +/- 8%. SDZ 64-412 afforded complete protection against endotoxin-induced lethality (LD90 = 7.5 mg kg-1 endotoxin i.v.) where the ED50 was 45 mg kg-1 twice predose.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:3183958

  2. Activation of factor XII-dependent pathways in human plasma by hematin and protoporphyrin.

    PubMed Central

    Becker, C G; Wagner, M; Kaplan, A P; Silverberg, M; Grady, R W; Liem, H; Muller-Eberhard, U

    1985-01-01

    Intravenous administration of hematin is effective in the treatment of acute exacerbations of the inducible porphyrias. In the course of such treatment, coagulopathies have occurred that are characterized by prolongation of prothrombin time, partial thromboplastin time, and formation of fibrin split products. In experiments in vitro with normal human plasma, we observed that hematin and protoporphyrin activated Factor XII-dependent pathways of coagulation and fibrinolysis, and that they generated kallikrein activity. Incubation of protoporphyrin with purified Factor XII resulted in activation as measured by amidolysis of a chromogenic substrate. Neither coproporphyrin, uroporphyrin, delta-aminolevulinic acid, porphobilinogen, or bilirubin activated Factor XII-dependent pathways. Exposure of serum containing added uroporphyrin, coproporphyrin, and protoporphyrin, but not hematin, to ultraviolet light (405 nm) resulted in activation of the classical pathway of the complement system. On the other hand, exposure of plasma containing uroporphyrin or coproporphyrin to ultraviolet light did not result in activation of Factor XII-dependent pathways. PMID:4031058

  3. [Active periodontitis as a potential risk factor of preferm delivery].

    PubMed

    Bilińska, Maria; Osmola, Krzysztof

    2014-05-01

    The influence of active periodontitis on the incidence of preterm delivery has been widely described in numerous scientific papers. Studies suggest that an implementation of a periodontal treatment during pregnancy is not only safe for both, the mother and the child, but it also has a beneficial effect on the pregnancy and embryo-fetal development, consequently reducing morbidity and mortality among premature infants. Therefore, mandatory dental examinations in pregnant women may facilitate early implementation of periodontal treatment and reduce the rates of preterm delivery PMID:25011221

  4. Antagonistic activity of etizolam on platelet-activating factor in vivo experiments.

    PubMed

    Terasawa, M; Mikashima, H; Tahara, T; Maruyama, Y

    1987-08-01

    The ability of etizolam, 6-(o-chlorophenyl)-8-ethyl-1-methyl-4H-s-triazolo[3,4-c]thieno[2,3-e] [1,4]diazepine (Y-7131), an anti-anxiety drug, to inhibit platelet-activating factor (PAF)-induced reactions was investigated in experimental animals in vivo. Etizolam (0.01-0.3 mg/kg, i.v.) dose dependently inhibited PAF (0.3 microgram/kg, i.v.)-induced bronchoconstriction (Konzett and Rössler's method) in guinea pigs, but even at doses as large as 3 mg/kg, i.v., it had no effect on bronchoconstriction induced by histamine, serotonin, acetylcholine, arachidonic acid, bradykinin, angiotensin l or leukotriene D4. Etizolam (0.1-1 mg/kg, i.v.) also dose-dependently reversed PAF (1 microgram/kg, i.v.)-induced hypotension in anesthetized rats. Injection of PAF into the tail veins of mice produced lethal shock within 10-30 min. Etizolam (0.1-3 mg/kg, i.v. and 1-10 mg/kg, p.o.) protected against the lethal effect of PAF (75 micrograms/kg, i.v.) in a dose-dependent manner. These results indicate that etizolam specifically inhibits the action of PAF in vivo. PMID:3682404

  5. Confirmatory Factor Analysis of Project Spectrum Activities. A Second-Order "g" Factor or Multiple Intelligences?

    ERIC Educational Resources Information Center

    Castejon, Juan L.; Perez, Antonio M.; Gilar, Raquel

    2010-01-01

    This paper compares different theoretical models of the structure of intelligence, based on the analysis of data obtained in a series of measured abilities corresponding to the Spectrum assessment activities (Gardner, Feldman & Krechevsky, 1998) in a sample of 393 children enrolled in kindergarten and first grade. The data were analyzed using…

  6. Variable Glutamine-Rich Repeats Modulate Transcription Factor Activity

    PubMed Central

    Gemayel, Rita; Chavali, Sreenivas; Pougach, Ksenia; Legendre, Matthieu; Zhu, Bo; Boeynaems, Steven; van der Zande, Elisa; Gevaert, Kris; Rousseau, Frederic; Schymkowitz, Joost; Babu, M. Madan; Verstrepen, Kevin J.

    2015-01-01

    Summary Excessive expansions of glutamine (Q)-rich repeats in various human proteins are known to result in severe neurodegenerative disorders such as Huntington’s disease and several ataxias. However, the physiological role of these repeats and the consequences of more moderate repeat variation remain unknown. Here, we demonstrate that Q-rich domains are highly enriched in eukaryotic transcription factors where they act as functional modulators. Incremental changes in the number of repeats in the yeast transcriptional regulator Ssn6 (Cyc8) result in systematic, repeat-length-dependent variation in expression of target genes that result in direct phenotypic changes. The function of Ssn6 increases with its repeat number until a certain threshold where further expansion leads to aggregation. Quantitative proteomic analysis reveals that the Ssn6 repeats affect its solubility and interactions with Tup1 and other regulators. Thus, Q-rich repeats are dynamic functional domains that modulate a regulator’s innate function, with the inherent risk of pathogenic repeat expansions. PMID:26257283

  7. [Risk factors in police activities: operational criticism in surveillance programs].

    PubMed

    Ciprani, Fabrizio; Moroni, Maria; Conte, Giovanni

    2014-01-01

    The planning of specific health surveillance programs for police officers is extremely complex due to difficulty in predictability and variety of occupational hazards. Even in the case of conventional occupational risk factors clearly identified by current regulations, particular working conditions may require specific assessment to effectively identify and quantify the risk of occupational exposure. An extensive program of health surveillance, aimed at promoting overall health and effectiveness of the operators, would be really desirable, in order to help better address a number of risks that cannot be easily predicted. The progressive increase in the average age of the working population and the increasing prevalence of chronic degenerative diseases, may also suggest the need for health surveillance procedures designed to verify continued unqualified suitability to police service, providing for the identification of diversified suitability profiles in relation to age and state of health: accordingly, in regard to our field of interest, there is a close link between medico-legal eligibility and occupational medicine. PMID:25558742

  8. Evidence for a prevalent dimorphism in the activation peptide of human coagulation factor IX.

    PubMed Central

    McGraw, R A; Davis, L M; Noyes, C M; Lundblad, R L; Roberts, H R; Graham, J B; Stafford, D W

    1985-01-01

    We have independently isolated and characterized cDNA and genomic clones for the human coagulation factor IX. Sequence analysis in both cases indicates that threonine is encoded by the triplet ACT as the third residue of the activation peptide. This is in agreement with some earlier reports but in disagreement with others that show the alanine triplet GCT at this position. The discrepancy can thus be accounted for by natural variation of a single nucleotide in the normal population. Amino acid sequence analyses of activated factor IX from plasma samples of four individuals yielded two cases of alanine and two cases of threonine at the third position of the activation peptide. In factor IX from pooled plasma and in factor IX from a heterozygous individual, however, both alanine and threonine were found. Taken together, the findings show that a prevalent nondeleterious dimorphism exists in the activation peptide of human coagulation factor IX. PMID:3857619

  9. Evaluation of Potential Clinical Surrogate Markers of a Trauma Induced Alteration of Clotting Factor Activities

    PubMed Central

    Payas, Arzu; Schoeneberg, Carsten; Wegner, Alexander; Kauther, Max Daniel; Lendemans, Sven

    2016-01-01

    Objective. The aim of this study was to identify routinely available clinical surrogate markers for potential clotting factor alterations following multiple trauma. Methods. In 68 patients admitted directly from the scene of the accident, all soluble clotting factors were analyzed and clinical data was collected prospectively. Ten healthy subjects served as control group. Results. Patients showed reduced activities of clotting factors II, V, VII, and X and calcium levels (all P < 0.0001 to 0.01). Levels of hemoglobin and base deficit correlated moderately to highly with the activities of a number of clotting factors. Nonsurvivors and patients who needed preclinical intubation or hemostatic therapy showed significantly reduced factor activities at admission. In contrast, factor VIII activity was markedly elevated after injury in general (P < 0.0001), but reduced in nonsurvivors (P < 0.05). Conclusions. Multiple trauma causes an early reduction of the activities of nearly all soluble clotting factors in general. Initial hemoglobin and, with certain qualifications, base deficit levels demonstrated a potential value in detecting those underlying clotting factor deficiencies. Nevertheless, their role as triggers of a hemostatic therapy as well as the observed response of factor VIII to multiple trauma and also its potential prognostic value needs further evaluation. PMID:27433474

  10. Lung cancer chemotherapy agents increase procoagulant activity via protein disulfide isomerase-dependent tissue factor decryption.

    PubMed

    Lysov, Zakhar; Swystun, Laura L; Kuruvilla, Sara; Arnold, Andrew; Liaw, Patricia C

    2015-01-01

    Lung cancer patients undergoing chemotherapy have an elevated risk for thrombosis. However, the mechanisms by which chemotherapy agents increase the risk for thrombosis remains unclear. The aim of this study was to determine the mechanism(s) by which lung cancer chemotherapy agents cisplatin, carboplatin, gemcitabine, and paclitaxel elicit increased tissue factor activity on endothelial cells, A549 cells, and monocytes. Tissue factor activity, tissue factor antigen, and phosphatidylserine exposure were measured on chemotherapy-treated human umbilical vein endothelial cells (HUVEC), A549 cells, and monocytes. Cell surface protein disulfide isomerase (PDI) and cell surface free thiol levels were measured on HUVEC and A549 non-small cell lung carcinoma cells. Treatment of HUVECs, A549 cells, and monocytes with lung cancer chemotherapy significantly increased cell surface tissue factor activity. However, elevated tissue factor antigen levels were observed only on cisplatin-treated and gemcitabine-treated monocytes. Cell surface levels of phosphatidylserine were increased on HUVEC and monocytes treated with cisplatin/gemcitabine combination therapy. Chemotherapy also resulted in increased cell surface levels of PDI and reduced cell surface free thiol levels. Glutathione treatment and PDI inhibition, but not phosphatidylserine inhibition, attenuated tissue factor activity. Furthermore, increased tissue factor activity was reversed by reducing cysteines with dithiothreitol. These studies are the first to demonstrate that lung cancer chemotherapy agents increase procoagulant activity on endothelial cells and A549 cells by tissue factor decryption through a disulfide bond formation in a PDI-dependent mechanism. PMID:24911456

  11. The evolution of clot-promoting and amidolytic activities in mixtures of Hageman factor (factor XII) and ellagic acid.

    PubMed

    Ratnoff, O D; Saito, H

    1982-08-01

    Ellagic acid (4,4',5,5',6,6'-hexahydroxydiphenic acid 2,6,2',6'-dilactone) can substitute for negatively charged surfaces as a stimulus to reactions of the intrinsic pathway. Incubation of solutions of 4 X 10(-6)M ellagic acid with purified HF (factor XII) induced clot-promoting and amidolytic activity. Clot-promoting activity tested on a substrate of HF-deficient plasma evolved much more rapidly than amidolytic activity. Clot-promoting activity generated in mixtures of HF and ellagic acid alone, but amidolytic activity was observed only if additional proteins such as albumin were also present. Treatment of purified HF with DFP or filtration of HF through columns of SBTI bound to agarose did not prevent its subsequent activation by ellagic acid. Solutions of SBTI, at high concentration, partly inhibited the generation of amidolytic activity,wheras popcorn inhibitor and a crude IgG fraction of anti-HF inhibited the amidolytic activity that had been generated in a mixture of HF and ellagic acid. Generation of clotting and amidolytic properties was accompanied by scission of HF within an internal disulfide loop and by cleavage of HF into fragments with approximate MWs of 50,000 and 30,000; cleavage was completely blocked by popcorn inhibitor and partially blocked by high concentrations of SBTI. These experiments demonstrate that ellagic acid can activate HF in a manner analogous to negatively charged solids such as glass or kaolin. PMID:7097109

  12. Factors Predicting Behavioral Response to a Physical Activity Intervention among Adolescent Females

    ERIC Educational Resources Information Center

    Dunton, Genevieve Fridlund; Schneider, Margaret; Cooper, Dan M.

    2007-01-01

    Objective: To determine whether individual factors influenced rates of physical activity change in response to a school-based intervention. Methods: Sedentary adolescent females (N = 63) participated in a 9-month physical activity program. Weekly levels of leisure-time physical activity were reported using an interactive website. Results: Change…

  13. Exploring Contextual Factors and Patient Activation: Evidence from a Nationally Representative Sample of Patients with Depression

    ERIC Educational Resources Information Center

    Chen, Jie; Mortensen, Karoline; Bloodworth, Robin

    2014-01-01

    Patient activation has been considered as a "blockbuster drug of the century." Patients with mental disorders are less activated compared to patients with other chronic diseases. Low activation due to mental disorders can affect the efficiency of treatment of other comorbidities. Contextual factors are significantly associated with…

  14. A human factors evaluation of Extravehicular Activity gloves

    NASA Technical Reports Server (NTRS)

    O'Hara, John M.; Briganti, Michael; Cleland, John; Winfield, Dan

    1989-01-01

    One of the major problems faced in Extravehicular Activity (EVA) glove development has been the absence of concise and reliable methods to measure the effects of EVA gloves on human-hand capabilities. NASA has sponsored a program to develop a standardized set of tests designed to assess EVA-gloved hand capabilities in six performance domains: Range of Motion, Strength, Tactile Perception, Dexterity, Fatigue, and Comfort. Based upon an assessment of general human-hand functioning and EVA task requirements, several tests within each performance domain were developed to provide a comprehensive evaluation. All tests were designed to be conducted in a glove box with the bare hand, an EVA glove without pressure, an EVA glove at operation pressure. Thus, the differential effect on performance of the glove with and without pressure was tested. Bare hand performance was used to 'calibrate' the effects. Ten subjects participated in the test setup as a repeated-measures experimental design. The paper will report the results of the test program.

  15. Free radical activity of industrial fibers: role of iron in oxidative stress and activation of transcription factors.

    PubMed Central

    Gilmour, P S; Brown, D M; Beswick, P H; MacNee, W; Rahman, I; Donaldson, K

    1997-01-01

    We studied asbestos, vitreous fiber (MMVF10), and refractory ceramic fiber (RCF1) from the Thermal Insulation Manufacturers' Association fiber repository regarding the following: free radical damage to plasmid DNA, iron release, ability to deplete glutathione (GSH), and activate redox-sensitive transcription factors in macrophages. Asbestos had much more free radical activity than any of the man-made vitreous fibers. More Fe3+ was released than Fe2+ and more of both was released at pH 4.5 than at pH 7.2. Release of iron from the different fibers was generally not a good correlate of ability to cause free radical injury to the plasmid DNA. All fiber types caused some degree of oxidative stress, as revealed by depletion of intracellular GSH. Amosite asbestos upregulated nuclear binding of activator protein 1 transcription factor to a greater level than MMVF10 and RCF1; long-fiber amosite was the only fiber to enhance activation of the transcription factor nuclear factor kappa B (NF kappa B). The use of cysteine methyl ester and buthionine sulfoximine to modulate GSH suggested that GSH homeostasis was important in leading to activation of transcription factors. We conclude that the intrinsic free radical activity is the major determinant of transcription factor activation and therefore gene expression in alveolar macrophages. Although this was not related to iron release or ability to deplete macrophage GSH at 4 hr, GSH does play a role in activation of NF kappa B. Images Figure 1. Figure 5. A Figure 5. B Figure 6. A Figure 6. B PMID:9400744

  16. The restricted promoter activity of the liver transcription factor hepatocyte nuclear factor 3 beta involves a cell-specific factor and positive autoactivation.

    PubMed Central

    Pani, L; Quian, X B; Clevidence, D; Costa, R H

    1992-01-01

    The transcription factor hepatocyte nuclear factor 3 (HNF-3) is involved in the coordinate expression of several liver genes. HNF-3 DNA binding activity is composed of three different liver proteins which recognize the same DNA site. The HNF-3 proteins (designated alpha, beta, and gamma) possess homology in the DNA binding domain and in several additional regions. To understand the cell-type-specific expression of HNF-3 beta, we have defined the regulatory sequences that elicit hepatoma-specific expression. Promoter activity requires -134 bp of HNF-3 beta proximal sequences and binds four nuclear proteins, including two ubiquitous factors. One of these promoter sites interacts with a novel cell-specific factor, LF-H3 beta, whose binding activity correlates with the HNF-3 beta tissue expression pattern. Furthermore, there is a binding site for the HNF-3 protein within its own promoter, suggesting that an autoactivation mechanism is involved in the establishment of HNF-3 beta expression. We propose that both the LF-H3 beta and HNF-3 sites play an important role in the cell-type-specific expression of the HNF-3 beta transcription factor. Images PMID:1732730

  17. Immobilisation of homogeneous olefin polymerisation catalysts. Factors influencing activity and stability.

    PubMed

    Severn, John R; Chadwick, John C

    2013-07-01

    The activity and stability of homogeneous olefin polymerisation catalysts, when immobilised on a support, are dependent on both chemical and physical effects. Chemical factors affecting catalyst activity include the ease of formation of the active species, which is strongly dependent on the transition metal. Catalyst productivity is dependent on the balance between activity and stability. Immobilisation can lead to a lower proportion of active species and therefore lower initial polymerisation activity, but nevertheless give higher polymer yields in cases where increased catalyst stability is obtained. Important physical factors are support porosity and the ability of a support to undergo progressive fragmentation during polymerisation, facilitating monomer diffusion through the growing catalyst/polymer particle. This article illustrates the importance of these factors in olefin polymerisation with both early- and late-transition metal catalysts, with particular reference to the use of silica and magnesium chloride supports as well as to effects of immobilisation on polymer structure and properties. PMID:23467461

  18. Stimulation of hormone-responsive adenylate cyclase activity by a factor present in the cell cytosol.

    PubMed Central

    MacNeil, S; Crawford, A; Amirrasooli, H; Johnson, S; Pollock, A; Ollis, C; Tomlinson, S

    1980-01-01

    1. Homogenates of whole tissues were shown to contain both intracellular and extracellular factors that affected particulate adenylate cyclase activity in vitro. Factors present in the extracellular fluids produced an inhibition of basal, hormone- and fluoride-stimulated enzyme activity but factors present in the cell cytosol increased hormone-stimulated activity with relatively little effect on basal or fluoride-stimulated enzyme activity. 2. The existence of this cytosol factor or factors was investigated using freshly isolated human platelets, freshly isolated rat hepatocytes, and cultured cells derived from rat osteogenic sarcoma, rat calvaria, mouse melanoma, pig aortic endothelium, human articular cartilage chondrocytes and human bronchial carcinoma (BEN) cells. 3. The stimulation of the hormone response by the cytosol factor ranged from 60 to 890% depending on the tissue of origin of the adenylate cyclase. 4. In each case the behaviour of the factor was similar to the action of GTP on that particular adenylate cyclase preparation. 5. No evidence of tissue or species specificity was found, as cytosols stimulated adenylate cyclase from their own and unrelated tissues to the same degree. 6. In the human platelet, the inclusion of the cytosol in the assay of adenylate cyclase increased the rate of enzyme activity in response to stimulation by prostaglandin E1 without affecting the amount of prostaglandin E1 required for half-maximal stimulation or the characteristics of enzyme activation by prostaglandin E. PMID:7396869

  19. Production and functional activity of a recombinant von Willebrand factor-A domain from human complement factor B.

    PubMed Central

    Williams, S C; Hinshelwood, J; Perkins, S J; Sim, R B

    1999-01-01

    Factor B is a five-domain 90 kDa serine protease proenzyme which is part of the human serum complement system. It binds to other complement proteins C3b and properdin, and is activated by the protease factor D. The fourth domain of factor B is homologous to the type A domain of von Willebrand Factor (vWF-A). A full-length human factor B cDNA clone was used to amplify the region encoding the vWF-A domain (amino acids 229-444 of factor B). A fusion protein expression system was then used to generate it in high yield in Escherichia coli, where thrombin cleavage was used to separate the vWF-A domain from its fusion protein partner. A second vWF-A domain with improved stability and solubility was created using a Cys(267)-->Ser mutation and a four-residue C-terminal extension of the first vWF-A domain. The recombinant domains were investigated by analytical gel filtration, sucrose density centrifugation and analytical ultracentrifugation, in order to show that both domains were monomeric and possessed compact structures that were consistent with known vWF-A crystal structures. This expression system and its characterization permitted the first investigation of the function of the isolated vWF-A domain. It was able to inhibit substantially the binding of (125)I-labelled factor B to immobilized C3b. This demonstrated both the presence of a C3b binding site in this portion of factor B and a ligand-binding property of the vWF-A domain. The site at which factor D cleaves factor B is close to the N-terminus of both recombinant vWF-A domains. Factor D was shown to cleave the vWF-A domain in the presence or absence of C3b, whereas the cleavage of intact factor B under the same conditions occurs only in the presence of C3b. PMID:10477273

  20. Phosphoinositide 3-Kinases Upregulate System xc− via Eukaryotic Initiation Factor 2α and Activating Transcription Factor 4 – A Pathway Active in Glioblastomas and Epilepsy

    PubMed Central

    Baxter, Paul; Kassubek, Rebecca; Albrecht, Philipp; Van Liefferinge, Joeri; Westhoff, Mike-Andrew; Halatsch, Marc-Eric; Karpel-Massler, Georg; Meakin, Paul J.; Hayes, John D.; Aronica, Eleonora; Smolders, Ilse; Ludolph, Albert C.; Methner, Axel; Conrad, Marcus; Massie, Ann; Hardingham, Giles E.

    2014-01-01

    Abstract Aims: Phosphoinositide 3-kinases (PI3Ks) relay growth factor signaling and mediate cytoprotection and cell growth. The cystine/glutamate antiporter system xc− imports cystine while exporting glutamate, thereby promoting glutathione synthesis while increasing extracellular cerebral glutamate. The aim of this study was to analyze the pathway through which growth factor and PI3K signaling induce the cystine/glutamate antiporter system xc− and to demonstrate its biological significance for neuroprotection, cell growth, and epilepsy. Results: PI3Ks induce system xc− through glycogen synthase kinase 3β (GSK-3β) inhibition, general control non-derepressible-2-mediated eukaryotic initiation factor 2α phosphorylation, and the subsequent translational up-regulation of activating transcription factor 4. This pathway is essential for PI3Ks to modulate oxidative stress resistance of nerve cells and insulin-induced growth in fibroblasts. Moreover, the pathway is active in human glioblastoma cells. In addition, it is induced in primary cortical neurons in response to robust neuronal activity and in hippocampi from patients with temporal lobe epilepsy. Innovation: Our findings further extend the concepts of how growth factors and PI3Ks induce neuroprotection and cell growth by adding a new branch to the signaling network downstream of GSK-3β, which, ultimately, leads to the induction of the cystine/glutamate antiporter system xc−. Importantly, the induction of this pathway by neuronal activity and in epileptic hippocampi points to a potential role in epilepsy. Conclusion: PI3K-regulated system xc− activity is not only involved in the stress resistance of neuronal cells and in cell growth by increasing the cysteine supply and glutathione synthesis, but also plays a role in the pathophysiology of tumor- and non-tumor-associated epilepsy by up-regulating extracellular cerebral glutamate. Antioxid. Redox Signal. 20: 2907–2922. PMID:24219064

  1. A correction factor to f-chart predictions of active solar fraction in active-passive heating systems

    NASA Astrophysics Data System (ADS)

    Evans, B. L.; Beckman, W. A.; Duffie, J. A.; Mitchell, J. W.; Klein, S. A.

    1983-11-01

    The extent to which a passive system degrades the performance of an active solar space heating system was investigated, and a correction factor to account for these interactions was developed. The transient system simulation program TRNSYS is used to simulate the hour-by-hour performance of combined active-passive (hybrid) space heating systems in order to compare the active system performance with simplified design method predictions. The TRNSYS simulations were compared to results obtained using the simplified design calculations of the f-Chart method. Comparisons of TRNSYS and f-Chart were used to establish the accuracy of the f-Charts for active systems. A correlation was then developed to correct the monthly loads input into the f-Chart method to account for controller deadbands in both hybrid and active only buildings. A general correction factor was generated to be applied to the f-Chart method to produce more accurate and useful results for hybrid systems.

  2. Active heterotrophic biomass and sludge retention time (SRT) as determining factors for biodegradation kinetics of pharmaceuticals in activated sludge.

    PubMed

    Majewsky, Marius; Gallé, Tom; Yargeau, Viviane; Fischer, Klaus

    2011-08-01

    The present study investigates the biodegradation of pharmaceutically active compounds (PhACs) by active biomass in activated sludge. Active heterotrophs (X(bh)) which are known to govern COD removal are suggested as a determining factor for biological PhAC removal as well. Biodegradation kinetics of five polar PhACs were determined in activated sludge of two wastewater treatment plants which differed in size, layout and sludge retention time (SRT). Results showed that active fractions of the total suspended solids (TSS) differed significantly between the two sludges, indicating that TSS does not reveal information about heterotrophic activity. Furthermore, PhAC removal was significantly faster in the presence of high numbers of heterotrophs and a low SRT. Pseudo first-order kinetics were modified to include X(bh) and used to describe decreasing PhAC elimination with increasing SRT. PMID:21652206

  3. A Novel Mitogen-Activated Protein Kinase Is Responsive to Raf and Mediates Growth Factor Specificity

    PubMed Central

    Janulis, Mark; Trakul, Nicholas; Greene, Geoffrey; Schaefer, Erik M.; Lee, J. D.; Rosner, Marsha Rich

    2001-01-01

    The proto-oncogene Raf is a major regulator of growth and differentiation. Previous studies from a number of laboratories indicate that Raf activates a signaling pathway that is independent of the classic MEK1,2-ERK1,2 cascade. However, no other signaling cascade downstream of Raf has been identified. We describe a new member of the mitogen-activated protein kinase family, p97, an ERK5-related kinase that is activated and Raf associated when cells are stimulated by Raf. Furthermore, p97 is selectively responsive to different growth factors, providing a mechanism for specificity in cellular signaling. Thus, p97 is activated by the neurogenic factor fibroblast growth factor (FGF) but not the mitogenic factor epidermal growth factor (EGF) in neuronal cells. Conversely, the related kinase ERK5 is activated by EGF but not FGF. p97 phosphorylates transcription factors such as Elk-1 and Ets-2 but not MEF2C at transactivating sites, whereas ERK5 phosphorylates MEF2C but not Elk-1 or Ets-2. Finally, p97 is expressed in a number of cell types including primary neural and NIH 3T3 cells. Taken together, these results identify a new signaling pathway that is distinct from the classic Raf-MEK1,2-ERK1,2 kinase cascade and can be selectively stimulated by growth factors that produce discrete biological outcomes. PMID:11238956

  4. Risk Factors for Clinically Significant Intimate Partner Violence among Active-Duty Members

    ERIC Educational Resources Information Center

    Smith Slep, Amy M.; Foran, Heather M.; Heyman, Richard E.; Snarr, Jeffery D.

    2011-01-01

    Hypothesized risk factors for men's and women's clinically significant intimate partner violence (CS-IPV) from four ecological levels (i.e., individual, family, workplace, community) were tested in a representative sample of active-duty U.S. Air Force members (N = 42,744). When considered together, we expected only individual and family factors to…

  5. Factors Influencing Entering Teacher Candidates' Preferences for Instructional Activities: A Glimpse into Their Orientations towards Teaching

    ERIC Educational Resources Information Center

    Talanquer, Vicente; Novodvorsky, Ingrid; Tomanek, Debra

    2010-01-01

    The present study was designed to identify and characterize the major factors that influence entering science teacher candidates' preferences for different types of instructional activities, and to analyze what these factors suggest about teacher candidates' orientations towards science teaching. The study involved prospective teachers enrolled in…

  6. Social Cognitive Factors Associated with Physical Activity in Elementary School Girls

    ERIC Educational Resources Information Center

    Bean, Melanie K.; Miller, Sara; Mazzeo, Suzanne E.; Fries, Elizabeth A.

    2012-01-01

    Objective: To examine social cognitive factors associated with physical activity (PA) among preadolescent girls. Method: Social cognitive theory was used to examine PA in girls (N = 90; 71% African American) participating in Girls on the Run. Multiple regressions explored factors associated with PA at posttesting and 3-month follow-up. Results:…

  7. The Fn14 cytoplasmic tail binds tumour-necrosis-factor-receptor-associated factors 1, 2, 3 and 5 and mediates nuclear factor-kappaB activation.

    PubMed Central

    Brown, Sharron A N; Richards, Christine M; Hanscom, Heather N; Feng, Sheau-Line Y; Winkles, Jeffrey A

    2003-01-01

    Fn14 is a growth-factor-inducible immediate-early-response gene encoding a 102-amino-acid type I transmembrane protein. The human Fn14 protein was recently identified as a cell-surface receptor for the tumour necrosis factor (TNF) superfamily member named TWEAK (TNF-like weak inducer of apoptosis). In the present paper, we report that the human TWEAK extracellular domain can also bind the murine Fn14 protein. Furthermore, site-specific mutagenesis and directed yeast two-hybrid interaction assays revealed that the TNFR-associated factor (TRAF) 1, 2, 3 and 5 adaptor molecules bind the murine Fn14 cytoplasmic tail at an overlapping, but non-identical, amino acid sequence motif. We also found that TWEAK treatment of quiescent NIH 3T3 cells stimulates inhibitory kappaBalpha phosphorylation and transcriptional activation of a nuclear factor-kappaB (NF-kappaB) enhancer/luciferase reporter construct. Fn14 overexpression in transiently transfected NIH 3T3 cells also promotes NF-kappaB activation, and this cellular response requires an intact TRAF binding site. These results indicate that Fn14 is a functional TWEAK receptor that can associate with four distinct TRAF family members and stimulate the NF-kappaB transcription factor signalling pathway. PMID:12529173

  8. Nonenzymatic anticoagulant activity of the mutant serine protease Ser360Ala-activated protein C mediated by factor Va.

    PubMed Central

    Gale, A. J.; Sun, X.; Heeb, M. J.; Griffin, J. H.

    1997-01-01

    The human plasma serine protease, activated protein C (APC), primarily exerts its anticoagulant function by proteolytic inactivation of the blood coagulation cofactors Va and VIIIa. A recombinant active site Ser 360 to Ala mutation of protein C was prepared, and the mutant protein was expressed in human 293 kidney cells and purified. The activation peptide of the mutant protein C zymogen was cleaved by a snake venom activator, Protac C, but the "activated" S360A APC did not have amidolytic activity. However, it did exhibit significant anticoagulant activity both in clotting assays and in a purified protein assay system that measured prothrombinase activity. The S360A APC was compared to plasma-derived and wild-type recombinant APC. The anticoagulant activity of the mutant, but not native APC, was resistant to diisopropyl fluorophosphate, whereas all APCs were inhibited by monoclonal antibodies against APC. In contrast to native APC, S360A APC was not inactivated by serine protease inhibitors in plasma and did not bind to the highly reactive mutant protease inhibitor M358R alpha 1 antitrypsin. Since plasma serpins provide the major mechanism for inactivating APC in vivo, this suggests that S360A APC would have a long half-life in vivo, with potential therapeutic advantages. S360A APC rapidly inhibited factor Va in a nonenzymatic manner since it apparently did not proteolyze factor Va. These data suggest that native APC may exhibit rapid nonenzymatic anticoagulant activity followed by enzymatic irreversible proteolysis of factor Va. The results of clotting assays and prothrombinase assays showed that S360A APC could not inhibit the variant Gln 506-FVa compared with normal Arg 506-FVa, suggesting that the active site of S360A APC binds to FVa at or near Arg 506. PMID:9007985

  9. The suppression of fibroblast growth factor 2/fibroblast growth factor 4-dependent tumour angiogenesis and growth by the anti-growth factor activity of dextran derivative (CMDB7).

    PubMed Central

    Bagheri-Yarmand, R.; Kourbali, Y.; Mabilat, C.; Morère, J. F.; Martin, A.; Lu, H.; Soria, C.; Jozefonvicz, J.; Crépin, M.

    1998-01-01

    Our previous studies showed that carboxymethyl benzylamide dextran (CMDB7) blocks basic fibroblast growth factor (FGF-2)-dependent cell proliferation of a human breast epithelial line (HBL100), suggesting its potential role as a potent antiangiogenic substance. The derived cell line (HH9), which was transformed with the hst/FGF4 gene, has been shown to be highly proliferative in vitro and to induce angiogenic tumours in nude mice. We show here that CMDB7 inhibits the mitogenic activities of the conditioned media from HBL 100 and HH9 cells in a dose-dependent manner. When HH9 cells were injected s.c. into nude mice, CMDB7 treatment (300 mg kg(-1) week(-1)) suppressed the tumour take and the tumour growth by about 50% and 80% respectively. Immunohistochemical analysis showed a highly significant decrease, by more than threefold, in the endothelial density of viable tumour regions, together with a significant increase in the necrosis area. This antiangiogenic activity of CMDB7 was further demonstrated by direct inhibition of calf pulmonary artery (CPAE) and human umbilical vein (HUVEC) endothelial cell proliferation and migration in vitro. In addition, we showed that CMDB7 inhibits specifically the mitogenic effects of the growth factors that bind to heparin such as FGF-2, FGF-4, platelet-derived growth factor (PDGF-BB) and transforming growth factor (TGF-beta1), but not those of epidermal growth factor (EGF) and insulin-like growth factor (IGF-1). These results demonstrate that CMDB7 inhibits FGF-2/FGF-4-dependent tumour growth and angiogenesis, most likely by disrupting the autocrine and paracrine effects of growth factors released from the tumour cells. Images Figure 4 PMID:9662260

  10. Association of the interferon signature metric with serological disease manifestations but not global activity scores in multiple cohorts of patients with SLE

    PubMed Central

    Kennedy, William P; Maciuca, Romeo; Wolslegel, Kristen; Tew, Wei; Abbas, Alexander R; Chaivorapol, Christina; Morimoto, Alyssa; McBride, Jacqueline M; Brunetta, Paul; Richardson, Bruce C; Davis, John C; Behrens, Timothy W; Townsend, Michael J

    2015-01-01

    Objectives The interferon (IFN) signature (IS) in patients with systemic lupus erythematosus (SLE) includes over 100 genes induced by type I IFN pathway activation. We developed a method to quantify the IS using three genes—the IS metric (ISM)—and characterised the clinical characteristics of patients with SLE with different ISM status from multiple clinical trials. Methods Blood microarray expression data from a training cohort of patients with SLE confirmed the presence of the IS and identified surrogate genes. We assayed these genes in a quantitative PCR (qPCR) assay, yielding an ISM from the IS. The association of ISM status with clinical disease characteristics was assessed in patients with extrarenal lupus and lupus nephritis from four clinical trials. Results Three genes, HERC5, EPSTI and CMPK2, correlated well with the IS (p>0.96), and composed the ISM qPCR assay. Using the 95th centile for healthy control data, patients with SLE from different studies were classified into two ISM subsets—ISM-Low and ISM-High—that are longitudinally stable over 36 weeks. Significant associations were identified between ISM-High status and higher titres of anti-dsDNA antibodies, presence of anti extractable nuclear antigen autoantibodies, elevated serum B cell activating factor of the tumour necrosis factor family (BAFF) levels, and hypocomplementaemia. However, measures of overall clinical disease activity were similar for ISM-High and ISM-Low groups. Conclusions The ISM is an IS biomarker that divides patients with SLE into two subpopulations—ISM-High and ISM-Low—with differing serological manifestations. The ISM does not distinguish between high and low disease activity, but may have utility in identifying patients more likely to respond to treatment(s) targeting IFN-α. Clinicaltrials.gov registration number NCT00962832. PMID:25861459

  11. Peripheral brain-derived neurotrophic factor is related to cardiovascular risk factors in active and inactive elderly men.

    PubMed

    Zembron-Lacny, A; Dziubek, W; Rynkiewicz, M; Morawin, B; Woźniewski, M

    2016-06-20

    Regular exercise plays an important preventive and therapeutic role in heart and vascular diseases, and beneficially affects brain function. In blood, the effects of exercise appear to be very complex and could include protection of vascular endothelial cells via neurotrophic factors and decreased oxidative stress. The purpose of this study was to identify the age-related changes in peripheral brain-derived neurotrophic factor (BDNF) and its relationship to oxidative damage and conventional cardiovascular disease (CVD) biomarkers, such as atherogenic index, C-reactive protein (hsCRP) and oxidized LDL (oxLDL), in active and inactive men. Seventeen elderly males (61-80 years) and 17 young males (20-24 years) participated in this study. According to the 6-min Åstrand-Rhyming bike test, the subjects were classified into active and inactive groups. The young and elderly active men had a significantly better lipoprotein profile and antioxidant status, as well as reduced oxidative damage and inflammatory state. The active young and elderly men had significantly higher plasma BDNF levels compared to their inactive peers. BDNF was correlated with VO2max (r=0.765, P<0.001). In addition, we observed a significant inverse correlation of BDNF with atherogenic index (TC/HDL), hsCRP and oxLDL. The findings demonstrate that a high level of cardiorespiratory fitness reflected in VO2max was associated with a higher level of circulating BDNF, which in turn was related to common CVD risk factors and oxidative damage markers in young and elderly men. PMID:27332774

  12. Peripheral brain-derived neurotrophic factor is related to cardiovascular risk factors in active and inactive elderly men

    PubMed Central

    Zembron-Lacny, A.; Dziubek, W.; Rynkiewicz, M.; Morawin, B.; Woźniewski, M.

    2016-01-01

    Regular exercise plays an important preventive and therapeutic role in heart and vascular diseases, and beneficially affects brain function. In blood, the effects of exercise appear to be very complex and could include protection of vascular endothelial cells via neurotrophic factors and decreased oxidative stress. The purpose of this study was to identify the age-related changes in peripheral brain-derived neurotrophic factor (BDNF) and its relationship to oxidative damage and conventional cardiovascular disease (CVD) biomarkers, such as atherogenic index, C-reactive protein (hsCRP) and oxidized LDL (oxLDL), in active and inactive men. Seventeen elderly males (61-80 years) and 17 young males (20-24 years) participated in this study. According to the 6-min Åstrand-Rhyming bike test, the subjects were classified into active and inactive groups. The young and elderly active men had a significantly better lipoprotein profile and antioxidant status, as well as reduced oxidative damage and inflammatory state. The active young and elderly men had significantly higher plasma BDNF levels compared to their inactive peers. BDNF was correlated with VO2max (r=0.765, P<0.001). In addition, we observed a significant inverse correlation of BDNF with atherogenic index (TC/HDL), hsCRP and oxLDL. The findings demonstrate that a high level of cardiorespiratory fitness reflected in VO2max was associated with a higher level of circulating BDNF, which in turn was related to common CVD risk factors and oxidative damage markers in young and elderly men. PMID:27332774

  13. Association between Social and Environmental Factors and Physical Activity Opportunities in Middle Schools

    ERIC Educational Resources Information Center

    Xu, Furong; Chepyator-Thomson, Jepkorir; Liu, Wenhao; Schmidlein, Robert

    2010-01-01

    School-based physical activity (PA) interventions impact children's PA involvement and thus opportunities and associated factors for the promotion of physical activity in children need to be examined. The purpose of this study was to examine physical education teachers' perceptions of PA opportunities available to students at the middle school…

  14. Testing the Youth Physical Activity Promotion Model: Fatness and Fitness as Enabling Factors

    ERIC Educational Resources Information Center

    Chen, Senlin; Welk, Gregory J.; Joens-Matre, Roxane R.

    2014-01-01

    As the prevalence of childhood obesity increases, it is important to examine possible differences in psychosocial correlates of physical activity between normal weight and overweight children. The study examined fatness (weight status) and (aerobic) fitness as Enabling factors related to youth physical activity within the Youth Physical Activity…

  15. Exploring Socio-Ecological Factors Influencing Active and Inactive Spanish Students in Years 12 and 13

    ERIC Educational Resources Information Center

    Devís-Devís, José; Beltrán-Carrillo, Vicente J.; Peiró-Velert, Carmen

    2015-01-01

    This paper explores socio-ecological factors and their interplay that emerge from a qualitative study and influence adolescents' physical activity and sport participation. A total of 13 boys and 7 girls active and inactive adolescents, from years 12 and 13 and different types of school (state and private), participated in semi-structured…

  16. Factors Associated with Sexual Activity among High-School Students in Nairobi, Kenya

    ERIC Educational Resources Information Center

    Kabiru, Caroline W.; Orpinas, Pamela

    2009-01-01

    The high level of HIV infection in sub-Saharan Africa has led to an increased interest in understanding the determinants of sexual activity among young people, who are at high risk of sexually transmitted infections. The present study examined sociodemographic, behavioral, and psychosocial factors associated with heterosexual activity among a…

  17. Factors Associated with Leisure Activity among Young Adults with Developmental Disabilities

    ERIC Educational Resources Information Center

    Van Naarden Braun, Kim; Yeargin-Allsopp, Marshalyn; Lollar, Donald

    2006-01-01

    The framework of the International Classification of Functioning, Disability, and Health (ICF) was applied to examine the factors associated with childhood impairment and leisure activity. Information on leisure activity was obtained using a structured questionnaire from a population-based cohort of young adults with childhood impairment. The…

  18. MULTI-FACTOR POTENCY SCHEME FOR COMPARING THE CARCINOGENIC ACTIVITY OF CHEMICALS

    EPA Science Inventory

    A scheme for ranking the quantitative activity `of chemical carcinogens is described. his activity scheme uses as its base, dose potency measured as TD50, which after conversion into an inverse log scale, a decile scale, is adjusted by weighing factors that describe other paramet...

  19. Interpersonal and Intrapersonal Factors Associated with Autonomous Motivation in Adolescents' After-School Activities

    ERIC Educational Resources Information Center

    Beiswenger, Krista L.; Grolnick, Wendy S.

    2010-01-01

    This study explored interpersonal and intrapersonal factors associated with the level of autonomous motivation adolescents experience for their after-school activities. A total of 142 seventh-grade adolescents completed measures of peer relatedness, autonomy within friendships, mother and father autonomy support, perceived activity competence,…

  20. Associations of Weight Status, Social Factors, and Active Travel among College Students

    ERIC Educational Resources Information Center

    Bopp, Melissa; Behrens, Timothy K.; Velecina, Rachel

    2014-01-01

    Background: Active travel (AT) is associated with various health benefits and may help prevent the decline in physical activity during college years. Purpose: The purpose of this study was to examine the relationship of several factors with AT to campus by weight status. Methods: Students at a large northeastern US campus completed an online…

  1. Arabidopsis Sigma Factor Binding Proteins Are Activators of the WRKY33 Transcription Factor in Plant Defense[W

    PubMed Central

    Lai, Zhibing; Li, Ying; Wang, Fei; Cheng, Yuan; Fan, Baofang; Yu, Jing-Quan; Chen, Zhixiang

    2011-01-01

    Necrotrophic pathogens are important plant pathogens that cause many devastating plant diseases. Despite their impact, our understanding of the plant defense response to necrotrophic pathogens is limited. The WRKY33 transcription factor is important for plant resistance to necrotrophic pathogens; therefore, elucidation of its functions will enhance our understanding of plant immunity to necrotrophic pathogens. Here, we report the identification of two WRKY33-interacting proteins, nuclear-encoded SIGMA FACTOR BINDING PROTEIN1 (SIB1) and SIB2, which also interact with plastid-encoded plastid RNA polymerase SIGMA FACTOR1. Both SIB1 and SIB2 contain an N-terminal chloroplast targeting signal and a putative nuclear localization signal, suggesting that they are dual targeted. Bimolecular fluorescence complementation indicates that WRKY33 interacts with SIBs in the nucleus of plant cells. Both SIB1 and SIB2 contain a short VQ motif that is important for interaction with WRKY33. The two VQ motif–containing proteins recognize the C-terminal WRKY domain and stimulate the DNA binding activity of WRKY33. Like WRKY33, both SIB1 and SIB2 are rapidly and strongly induced by the necrotrophic pathogen Botrytis cinerea. Resistance to B. cinerea is compromised in the sib1 and sib2 mutants but enhanced in SIB1-overexpressing transgenic plants. These results suggest that dual-targeted SIB1 and SIB2 function as activators of WRKY33 in plant defense against necrotrophic pathogens. PMID:21990940

  2. Interleukin 10 inhibits macrophage microbicidal activity by blocking the endogenous production of tumor necrosis factor alpha required as a costimulatory factor for interferon gamma-induced activation.

    PubMed Central

    Oswald, I P; Wynn, T A; Sher, A; James, S L

    1992-01-01

    Interleukin 10 (IL-10) inhibits interferon gamma-induced macrophage activation for cytotoxicity against larvae of the human parasite Schistosoma mansoni by suppressing production of the toxic effector molecule nitric oxide (NO). In this study, the mechanism of IL-10 action was identified as inhibition of endogenous tumor necrosis factor alpha (TNF-alpha) production by interferon gamma-activated macrophages. TNF-alpha appears to serve as a cofactor for interferon gamma-mediated activation, since both schistosomulum killing and NO production were inhibited by anti-TNF-alpha antibody, whereas TNF-alpha alone was unable to stimulate these macrophage functions. IL-10 blocked TNF-alpha production by interferon gamma-treated macrophages at the levels of both protein and mRNA synthesis. Addition of exogenous TNF-alpha reversed IL-10-mediated suppression of macrophage cytotoxic activity as well as NO production. Likewise, addition of a macrophage-triggering agent (bacterial lipopolysaccharide or muramyl dipeptide), which induced the production of TNF-alpha, also reversed the suppressive effect of IL-10 on cytotoxic function. In contrast to IL-10, two other cytokines, IL-4 and transforming growth factor beta, which also inhibit macrophage activation for schistosomulum killing and NO production, did not substantially suppress endogenous TNF-alpha production. These results, therefore, describe a separate pathway by which macrophage microbicidal function is inhibited by the down-regulatory cytokine IL-10. Images PMID:1528880

  3. Encoding four gene expression programs in the activation dynamics of a single transcription factor.

    PubMed

    Hansen, Anders S; O'Shea, Erin K

    2016-04-01

    Cellular signaling response pathways often exhibit a bow-tie topology [1,2]: multiple upstream stress signals converge on a single shared transcription factor, which is thought to induce different downstream gene expression programs (Figure 1A). However, if several different signals activate the same transcription factor, can each signal then induce a specific gene expression response? A growing body of literature supports a temporal coding theory where information about environmental signals can be encoded, at least partially, in the temporal dynamics of the shared transcription factor [1,2]. For example, in the case of the budding yeast transcription factor Msn2, different stresses induce distinct Msn2 activation dynamics: Msn2 shows pulsatile nuclear activation with dose-dependent frequency under glucose limitation, but sustained nuclear activation with dose-dependent amplitude under oxidative stress [3]. These dynamic patterns can then lead to differential gene expression responses [3-5], but it is not known how much specificity can be obtained. Thus, a major question of this temporal coding theory is how many gene response programs or cellular functions can be robustly encoded by dynamic control of a single transcription factor. Here we provide the first direct evidence that, simply by regulating the activation dynamics of a single transcription factor, it is possible to preferentially induce four distinct gene expression programs. PMID:27046808

  4. Helix-loop-helix transcription factors mediate activation and repression of the p75LNGFR gene.

    PubMed Central

    Chiaramello, A; Neuman, K; Palm, K; Metsis, M; Neuman, T

    1995-01-01

    Sequence analysis of rat and human low-affinity nerve growth factor receptor p75LNGFR gene promoter regions revealed a single E-box cis-acting element, located upstream of the major transcription start sites. Deletion analysis of the E-box sequence demonstrated that it significantly contributes to p75LNGFR promoter activity. This E box has a dual function; it mediates either activation or repression of the p75LNGFR promoter activity, depending on the interacting transcription factors. We showed that the two isoforms of the class A basic helix-loop-helix (bHLH) transcription factor ME1 (ME1a and ME1b), the murine homolog of the human HEB transcription factor, specifically repress p75LNGFR promoter activity. This repression can be released by coexpression of the HLH Id2 transcriptional regulator. In vitro analyses demonstrated that ME1a forms a stable complex with the p75LNGFR E box and likely competes with activating E-box-binding proteins. By using ME1a-overexpressing PC12 cells, we showed that the endogenous p75LNGFR gene is a target of ME1a repression. Together, these data demonstrate that the p75LNGFR E box and the interacting bHLH transcription factors are involved in the regulation of p75LNGFR gene expression. These results also show that class A bHLH transcription factors can repress and Id-like negative regulators can stimulate gene expression. PMID:7565756

  5. Factors that influence physical activity for pregnant and postpartum women and implications for primary care.

    PubMed

    Doran, Frances; Davis, Kierrynn

    2011-01-01

    Many pregnant women and women of child-bearing age do not engage in the recommended levels of physical activity despite the well known benefits. Pregnancy and the postpartum period can be a time when inactivity actually increases. Women who experience gestational diabetes mellitus (GDM) during their pregnancy are often advised to become more active in order to ameliorate their increased risk of developing type 2 diabetes. Health professionals have an influential role in promoting physical activity, which would be enhanced with an understanding of the factors that positively and negatively influence women's participation in physical activity during pregnancy and in the postpartum period. This research sought to explore these factors with pregnant and postpartum women including those who had experienced GDM and the attention given to physical activity during pregnancy. A survey was developed after a critical review of factors identified from previous studies. Women were recruited from the antenatal clinic, community health centres and the local media. Results from 72 women are reported from a predominately well educated, Caucasian population. Overall, the results were confirmatory of factors previously identified. Lack of child care, time constraints, no time and feeling unwell during pregnancy hindered activity and factors that facilitated activity included family support, enjoyment of activity and to prevent later health problems. It was also found that non-GDM women are given minimal advice about exercise during pregnancy. A checklist has been developed for health professionals, in partnership with women, to direct attention to the factors that enable and hinder participation in physical activity during and after pregnancy. PMID:21616029

  6. Activation of transcription factors STAT1 and STAT5 in the mouse median eminence after systemic ciliary neurotrophic factor administration.

    PubMed

    Severi, Ilenia; Senzacqua, Martina; Mondini, Eleonora; Fazioli, Francesca; Cinti, Saverio; Giordano, Antonio

    2015-10-01

    Exogenously administered ciliary neurotrophic factor (CNTF) causes weight loss in obese rodents and humans through leptin-like activation of the Jak-STAT3 signaling pathway in hypothalamic arcuate neurons. Here we report for the first time that 40min after acute systemic treatment, rat recombinant CNTF (intraperitoneal injection of 0.3mg/kg of body weight) induced nuclear translocation of the tyrosine-phosphorylated forms of STAT1 and STAT5 in the mouse median eminence and other circumventricular organs, including the vascular organ of the lamina terminalis and the subfornical organ. In the tuberal hypothalamus of treated mice, specific nuclear immunostaining for phospo-STAT1 and phospho-STAT5 was detected in ependymal cells bordering the third ventricle floor and lateral recesses, and in median eminence cells. Co-localization studies documented STAT1 and STAT5 activation in median eminence β-tanycytes and underlying radial glia-like cells. A few astrocytes in the arcuate nucleus responded to CNTF by STAT5 activation. The vast majority of median eminence tanycytes and radial glia-like cells showing phospho-STAT1 and phospho-STAT5 immunoreactivity were also positive for phospho-STAT3. In contrast, STAT3 was the sole STAT isoform activated by CNTF in arcuate nucleus and median eminence neurons. Finally, immunohistochemical evaluation of STAT activation 20, 40, 80, and 120min from the injection demonstrated that cell activation was accompanied by c-Fos expression. Collectively, our findings show that CNTF activates STAT3, STAT1, and STAT5 in vivo. The distinctive activation pattern of these STAT isoforms in the median eminence may disclose novel targets and pathways through which CNTF regulates food intake. PMID:26133794

  7. Motivational factors and stages of change for physical activity among college students in Amman, Jordan.

    PubMed

    Madanat, Hala; Merrill, Ray M

    2006-01-01

    The purpose of this study was to investigate physical activity levels across the five stages of change for physical activity and to identify motivational factors for physical activity according to these stages of change among college students in Amman, Jordan. Analyses were based on a cross-sectional survey of 431 students, with a mean age of 21.1 (SD=0.16) and 67.5% female. Based on the recommendation that physical activity requires at least 30 minutes of physical activity 3 or more days per week, men were more likely than women to classify themselves in later stages: 7.3% vs. 9.5% in the precontemplation stage, 17.4% vs. 14.7% in the contemplation stage, 50.0% vs. 63.5% in the preparation stage, 9.4% vs. 5.6% in the action stage, and 15.9% vs. 6.7% in the maintenance stage [X2(4) = 14.04, p = 0.0072]. Seven potential motivational items for physical activity were assessed using factor analysis: experience better self-worth, prevent chronic disease, relieve stress, stay in shape, longevity, recreation/fun, and social benefits. Two factor groupings were identified from these items. The first factor included the first five items, labeled as "Physical and Mental". The second factor included the last two items, labeled as "Social and Recreational." "Physical and Mental" items compared with "Social and Recreational" items were most likely to motivate physical activity across the stages of change for physical activity. The strongest motivator of physical activity was to stay in shape. The weakest motivator of physical activity was for social reasons. The influence of the intermediate motivational factors was slightly affected by the students' stage of change for physical activity. Motivators for physical activity did not differ according to sex. These results provide important information about the motivational factors for physical activity for college-aged students in Jordan that can be useful in developing effective physical activity intervention programs. PMID

  8. Tissue Factor Activity in Lymphocyte Cultures from Normal Individuals and Patients with Hemophilia A

    PubMed Central

    Rickles, Frederick R.; Hardin, John A.; Pitlick, Frances A.; Hoyer, Leon W.; Conrad, Marcel E.

    1973-01-01

    The procoagulant material of lymphocytes has been characterized as tissue factor. Lymphocytes stimulated with phytohemagglutinin or the purified protein derivative of the tubercle bacillus developed procoagulant activity with incubation in tissue culture. While this material corrected the prolonged clotting time of factor VIII (AHF) deficient plasma, we have shown, utilizing a sensitive radioimmunoassay, that no AHF antigen was present in the cell cultures. Further, we have demonstrated this material to be tissue factor by coagulation techniques and immunological cross-reactivity. The published data regarding factor VIII synthesis is reviewed in light of these observations and comments are made regarding the role of the lymphocyte procoagulant. PMID:4634046

  9. Factor analysis shows that female rat behaviour is characterized primarily by activity, male rats are driven by sex and anxiety.

    PubMed

    Fernandes, C; González, M I; Wilson, C A; File, S E

    1999-12-01

    This experiment explored sex differences in behaviour using factor analysis to describe the relationship between different behavioral variables. A principal component solution with an orthogonal rotation of the factor matrix was used, ensuring that the extracted factors are independent of one another, and thus reflect separate processes. In the elevated plus-maze test of anxiety, in male rats factor 1 accounted for 75% of the variance and reflected anxiety, factor 2 represented activity, and accounted for 24% of the variance. This contrasted with the finding in female rats in which factor 1 was activity, accounting for 57% of the variance, with the anxiety factor accounting for only 34% of the variance. When behaviour in both the plus-maze and holeboard were analysed, a similar sex difference was found with anxiety emerging as factor 1 in males and holeboard activity as factor 1 in females. Locomotor activity in the inner portion of the holeboard loaded on the anxiety factor for males, but on activity for females. When behaviours in the plus-maze and sexual orientation tests were analysed, anxiety emerged as factor 1 in males, sexual preferences factor 2, and activity factor 3. In females, activity was factor 1, sexual preference factor 2, anxiety factor 3, and social interest factor 4. These results suggest caution should be exercised in interpreting the results from female rats in tests validated on males because the primary controlling factor may be different. PMID:10593196

  10. Gender Similarities and Differences in Factors Associated with Adolescent Moderate-Vigorous Physical Activity

    PubMed Central

    Wenthe, Phyllis J.; Janz, Kathleen F; Levy, Stephen M.

    2010-01-01

    This study investigated the relationship between predisposing, reinforcing, and enabling factors conceptualized within the Youth Physical Activity Promotion Model (YPAP) and moderate to vigorous physical activity (MVPA) of adolescent males and females. Specifically, self-efficacy to overcome barriers, enjoyment of physical activity; family support, peer support, perceived school climate, neighborhood safety and access to physical activity were examined. The Physical Activity Questionnaire for Adolescents (PAQ-A) and the Actigraph 7164 were used to obtain three different measures of MVPA in 205 adolescents (102 males, 103 females). Family support emerged as the most significant and consistent factor associated with the MVPA of both adolescent males and females. This relationship was noted even when different methods of measuring MVPA were employed. These findings should increase the confidence of public health officials that family support has the potential to positively alter the physical activity behavior of adolescents. PMID:19827453

  11. Tissue factor activity. A marker of alveolar macrophage maturation in rabbits. Effects of granulomatous pneumonitis.

    PubMed Central

    Rothberger, H; McGee, M P; Lee, T K

    1984-01-01

    Experiments were carried out to examine relationships between alveolar macrophage maturity and amounts of tissue factor (Clotting Factor III) in these cells under physiologic conditions and during immunologically induced pneumonitis. Using discontinuous density gradient centrifugation, alveolar macrophages from healthy rabbits were rapidly isolated into five subpopulations at different stages of maturation, as demonstrated by morphologic and morphometric evaluation. Very large amounts of tissue factor activity were found in fully mature cells that were purified in the lowest density subpopulation and assayed without preliminary in vitro stimulation or culture. In the remaining four subpopulations of increasing density, amounts of tissue factor were found to progressively diminish in direct correlation with declines of cell maturity. These differences at mean levels were as great as 35-fold. In addition, blood monocytes had less than 1/219 and less than 1/6 of the activity of the fully mature and the least mature subpopulations, respectively. After 16 h culture of the five isolated subpopulations in the absence of lymphokines or of significant numbers of lymphocytes, tissue factor activity increased in inverse correlation with the preincubation stage of cell maturity (2,387 and 109% in the least mature and most mature subpopulations, respectively). These increases required protein synthesis and were accompanied by morphologic and morphometric changes which indicated cellular maturation during the period of tissue factor activity generation in vitro, thus further demonstrating relationships between macrophage maturity and tissue factor content. In additional experiments, direct correlations between cell maturity and tissue factor activity content were also found in activated alveolar macrophage populations from rabbits with Bacillus Calmette Guering (BCG)-induced granulomatous pneumonitis. However, as compared with controls, the BCG populations had increased total

  12. Acute cholesterol depletion impairs functional expression of tissue factor in fibroblasts: modulation of tissue factor activity by membrane cholesterol

    PubMed Central

    Mandal, Samir K.; Iakhiaev, Alexei; Pendurthi, Usha R.; Mohan Rao, L. Vijaya

    2010-01-01

    Cholesterol, in addition to providing rigidity to the fluid membrane, plays a critical role in receptor function, endocytosis, recycling, and signal transduction. In the present study, we examined the effect of membrane cholesterol on functional expression of tissue factor (TF), a cellular receptor for clotting factor VIIa. Depletion of cholesterol in human fibroblasts (WI-38) with methyl-β-cyclodextrin–reduced TF activity at the cell surface. Binding studies with radiolabeled VIIa and TF monoclonal antibody (mAB) revealed that reduced TF activity in cholesterol-depleted cells stems from the impairment of VIIa interaction with TF rather than the loss of TF receptors at the cell surface. Repletion of cholesterol-depleted cells with cholesterol restored TF function. Loss of caveolar structure on cholesterol removal is not responsible for reduced TF activity. Solubilization of cellular TF in different detergents indicated that a substantial portion of TF in fibroblasts is associated with noncaveolar lipid rafts. Cholesterol depletion studies showed that the TF association with these rafts is cholesterol dependent. Overall, the data presented herein suggest that membrane cholesterol functions as a positive regulator of TF function by maintaining TF receptors, probably in noncaveolar lipid rafts, in a high-affinity state for VIIa binding. PMID:15328160

  13. The hypoxia-inducible factor-1α activates ectopic production of fibroblast growth factor 23 in tumor-induced osteomalacia

    PubMed Central

    Zhang, Qian; Doucet, Michele; Tomlinson, Ryan E; Han, Xiaobin; Quarles, L Darryl; Collins, Michael T; Clemens, Thomas L

    2016-01-01

    Tumor-induced osteomalacia (TIO) is a rare paraneoplastic syndrome in which ectopic production of fibroblast growth factor 23 (FGF23) by non-malignant mesenchymal tumors causes phosphate wasting and bone fractures. Recent studies have implicated the hypoxia-inducible factor-1α (HIF-1α) in other phosphate wasting disorders caused by elevated FGF23, including X-linked hypophosphatemic rickets and autosomal dominant hypophosphatemia. Here we provide evidence that HIF-1α mediates aberrant FGF23 in TIO by transcriptionally activating its promoter. Immunohistochemical studies in phosphaturic mesenchymal tumors resected from patients with documented TIO showed that HIF-1α and FGF23 were co-localized in spindle-shaped cells adjacent to blood vessels. Cultured tumor tissue produced high levels of intact FGF23 and demonstrated increased expression of HIF-1α protein. Transfection of MC3T3-E1 and Saos-2 cells with a HIF-1α expression construct induced the activity of a FGF23 reporter construct. Prior treatment of tumor organ cultures with HIF-1α inhibitors decreased HIF-1α and FGF23 protein accumulation and inhibited HIF-1α-induced luciferase reporter activity in transfected cells. Chromatin immunoprecipitation assays confirmed binding to a HIF-1α consensus sequence within the proximal FGF23 promoter, which was eliminated by treatment with a HIF-1α inhibitor. These results show for the first time that HIF-1α is a direct transcriptional activator of FGF23 and suggest that upregulation of HIF-1α activity in TIO contributes to the aberrant FGF23 production in these patients. PMID:27468359

  14. Factor Xa stimulates fibroblast procollagen production, proliferation, and calcium signaling via PAR{sub 1} activation

    SciTech Connect

    Blanc-Brude, Olivier P. . E-mail: olivier.blanc-brude@larib.inserm.fr; Archer, Fabienne; Leoni, Patricia; Derian, Claudia; Bolsover, Steven; Laurent, Geoffrey J.; Chambers, Rachel C.

    2005-03-10

    Fibroblast proliferation and procollagen production are central features of tissue repair and fibrosis. In addition to its role in blood clotting, the coagulation cascade proteinase thrombin can contribute to tissue repair by stimulating fibroblasts via proteolytic activation of proteinase-activated receptor-1 (PAR{sub 1}). During hemostasis, the coagulation cascade proteinase factor X is converted into factor Xa. We have previously shown that factor Xa upregulates fibroblast proliferation via production of autocrine PDGF. In this study, we further examined the effects of factor Xa on fibroblast function and aimed to identify its signaling receptor. We showed that factor Xa stimulates procollagen promoter activity and protein production by human and mouse fibroblasts. This effect was independent of PDGF and thrombin production, but dependent on factor Xa proteolytic activity. We also showed that PAR{sub 1}-deficient mouse fibroblasts did not upregulate procollagen production, mobilize cytosolic calcium, or proliferate in response to factor Xa. Desensitization techniques and PAR{sub 1}-specific agonists and inhibitors were used to demonstrate that PAR{sub 1} mediates factor Xa signaling in human fibroblasts. This is the first report that factor Xa stimulates extracellular matrix production. In contrast with endothelial cells and vascular smooth muscle cells, fibroblasts appear to be the only cell type in which the effects of factor Xa are mediated mainly via PAR{sub 1} and not PAR{sub 2}. These findings are critical for our understanding of tissue repair and fibrotic mechanisms, and for the design of novel approaches to inhibit the profibrotic effects of the coagulation cascade without compromising blood hemostasis.

  15. Multiple steps in the regulation of transcription-factor level and activity.

    PubMed Central

    Calkhoven, C F; Ab, G

    1996-01-01

    This review focuses on the regulation of transcription factors, many of which are DNA-binding proteins that recognize cis-regulatory elements of target genes and are the most direct regulators of gene transcription. Transcription factors serve as integration centres of the different signal-transduction pathways affecting a given gene. It is obvious that the regulation of these regulators themselves is of crucial importance for differential gene expression during development and in terminally differentiated cells. Transcription factors can be regulated at two, principally different, levels, namely concentration and activity, each of which can be modulated in a variety of ways. The concentrations of transcription factors, as of intracellular proteins in general, may be regulated at any of the steps leading from DNA to protein, including transcription, RNA processing, mRNA degradation and translation. The activity of a transcription factor is often regulated by (de) phosphorylation, which may affect different functions, e.g. nuclear localization DNA binding and trans-activation. Ligand binding is another mode of transcription-factor activation. It is typical for the large super-family of nuclear hormone receptors. Heterodimerization between transcription factors adds another dimension to the regulatory diversity and signal integration. Finally, non-DNA-binding (accessory) factors may mediate a diverse range of functions, e.g. serving as a bridge between the transcription factor and the basal transcription machinery, stabilizing the DNA-binding complex or changing the specificity of the target sequence recognition. The present review presents an overview of different modes of transcription-factor regulation, each illustrated by typical examples. PMID:8713055

  16. Agreement between two cutoff points for physical activity and associated factors in young individuals☆

    PubMed Central

    Coledam, Diogo Henrique Constantino; Ferraiol, Philippe Fanelli; Pires, Raymundo; Ribeiro, Edinéia Aparecida Gomes; Ferreira, Marco Antonio Cabral; de Oliveira, Arli Ramos

    2014-01-01

    Objective: To analyze the agreement between two cutoff points for physical activity (300 and 420 minutes/week) and associated factors in youth. Methods: The study enrolled 738 adolescents of Londrina city, Paraná, Southern Brazil. The following variables were collected by a self report questionnaire: presence of moderate to vigorous physical activity, gender, age, father and mother education level, with whom the adolescent lives, number of siblings, physical activity perception, participation in Physical Education classes, facilities available to physical activity practice and sedentary behavior. Prevalence of physical activity between criterions were compared using McNemar test and the agreement was analysed by Kappa index. Multivariate analysis was performed using Poisson regression with robust variance adjustment was applied. Results: The prevalence for physical activity was significantly different: 22,3% for 300 minutes/week and 12,8% for 420 minutes/week (p<0,05), but the agreement was strong (k=0,82, p<0,001). The variables gender, father education, physical activity perception and sedentary behavior were associated to physical activity in both analyzed criteria. Participation in Physical Education class and facilities available to physical activity practice were associated to physical activity only with 300 minutes/week cutoff point. Conclusion: Caution is suggested regarding cutoffs use for physical activity in epidemiological studies, considering they can result in differences in prevalence of physical activity and its associated factors. PMID:25479852

  17. Activation of the alternative pathway by gluten. A possible aetiological factor in dermatitis herpetiformis.

    PubMed

    Massey, A; Capner, P M; Mowbray, J F

    1977-09-01

    Gluten fractions are shown to activate the alternative pathway of complement when added to normal human serum. Breakdown of C3 and Factor B occur in a manner analogous to that when activated by zymosan, in the presence of MgEGTA and in serum devoid of classical pathway activity. The suggestion is made that bypass activation may be the primary event when gluten enters the serum across a damaged gut mucosa. Immune complexes containing non-complement fixing IgA antigluten antibody are carried to the skin where it is proposed that complexed gluten activates C3 and initiates an inflammatory reaction. PMID:908582

  18. Temporal variations in plasma vitamin K and lipid concentrations and clotting factor activity in humans.

    PubMed

    Kamali, F; Edwards, C; Wood, P; Wynne, H A; Kesteven, P

    2001-11-01

    There is no information available on temporal variability in plasma vitamin K concentrations and its relationship to coagulation processes. We investigated the possible existence of temporal changes in plasma vitamin K and lipid concentrations and activity of clotting factors II, VII, IX, and X and relationships between these variables. Plasma vitamin K and lipid concentrations and clotting factor activity were measured at four-hour intervals for 28 hours in a group of healthy volunteers. Temporal variations existed in plasma vitamin K concentrations, with a mean maximum at 22:00 hr and a mean minimum (32% of the maximum) at 10:00 hr. Plasma triglycerol concentrations mirrored the changes in vitamin K concentrations. Mean factor VII activity was positively correlated with mean total plasma cholesterol concentrations (r = 0.714; P < 0.0001) and with mean plasma low density lipoprotein (LDL) cholesterol concentrations (r = 0.461; P < 0.0001). No distinct correlations were found between plasma vitamin K concentrations and either high density lipoprotein (HDL) or LDL cholesterol concentrations, or between triglycerol, HDL, or LDL cholesterol concentrations and functional activity of factors II, IX, and X. Plasma vitamin K concentrations did not correlate with the functional activity of any of the clotting factors. The presence of a correlation between plasma cholesterol concentrations and factor VII activity for blood samples collected at four-hour intervals suggests that plasma cholesterol concentrations may have a more acute effect on factor VII activity. Temporal variations in plasma vitamin K concentrations indicate that a single time point measurement may be an inappropriate method of establishing vitamin K status in an individual. PMID:11754396

  19. Measurement of microparticle tissue factor activity in clinical samples: A summary of two tissue factor-dependent FXa generation assays.

    PubMed

    Hisada, Yohei; Alexander, Wyeth; Kasthuri, Raj; Voorhees, Peter; Mobarrez, Fariborz; Taylor, Angela; McNamara, Coleen; Wallen, Hakan; Witkowski, Marco; Key, Nigel S; Rauch, Ursula; Mackman, Nigel

    2016-03-01

    Thrombosis is a leading cause of morbidity and mortality. Detection of a prothrombotic state using biomarkers would be of great benefit to identify patients at risk of thrombosis that would benefit from thromboprophylaxis. Tissue factor (TF) is a highly procoagulant protein that under normal conditions is not present in the blood. However, increased levels of TF in the blood in the form of microparticles (MPs) (also called extracellular vesicles) are observed under various pathological conditions. In this review, we will discuss studies that have measured MP-TF activity in a variety of diseases using two similar FXa generation assay. One of the most robust signals for MP-TF activity (16-26 fold higher than healthy controls) is observed in pancreatic cancer patients with venous thromboembolism. In this case, the TF+ MPs appear to be derived from the cancer cells. Surprisingly, cirrhosis and acute liver injury are associated with 17-fold and 38-fold increases in MP-TF activity, respectively. Based on mouse models, we speculate that the TF+ MPs are derived from hepatocytes. More modest increases are observed in patients with urinary tract infections (6-fold) and in a human endotoxemia model (9-fold) where monocytes are the likely source of the TF+ MPs. Finally, there is no increase in MP-TF activity in the majority of cardiovascular disease patients. These studies indicate that MP-TF activity may be a useful biomarker to identify patients with particular diseases that have an increased risk of thrombosis. PMID:26916302

  20. Inactivation of factor XII active fragment in normal plasma. Predominant role of C-1-inhibitor.

    PubMed

    de Agostini, A; Lijnen, H R; Pixley, R A; Colman, R W; Schapira, M

    1984-06-01

    To define the factors responsible for the inactivation of the active fragment derived from Factor XII (Factor XIIf ) in plasma, we studied the inactivation kinetics of Factor XIIf in various purified and plasma mixtures. We also analyzed the formation of 125I-Factor XIIf -inhibitor complexes by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). In purified systems, the bimolecular rate constants for the reactions of Factor XIIf with C-1-inhibitor, alpha 2-antiplasmin, and antithrombin III were 18.5, 0.91, and 0.32 X 10(4) M-1 min-1, respectively. Furthermore, SDS-PAGE analysis revealed that 1:1 stoichiometric complexes were formed between 125I-Factor XIIf and each of these three inhibitors. In contrast, kinetic and SDS-PAGE studies indicated that Factor XIIf did not react with alpha 1-antitrypsin or alpha 2-macroglobulin. The inactivation rate constant of Factor XIIf by prekallikrein-deficient plasma was 14.4 X 10(-2) min-1, a value that was essentially identical to the value predicted from the studies in purified systems (15.5 X 10(-2) min-1). This constant was reduced to 1.8 X 10(-2) min-1 when Factor XIIf was inactivated by prekallikrein-deficient plasma that had been immunodepleted (less than 5%) of C-1-inhibitor. In addition, after inactivation in normal plasma, 74% of the active 125I-Factor XIIf was found to form a complex with C-1-inhibitor, whereas 26% of the enzyme formed complexes with alpha 2-antiplasmin and antithrombin III. Furthermore, 42% of the labeled enzyme was still complexed with C-1-inhibitor when 125I-Factor XII was inactivated in hereditary angioedema plasma that contained 32% of functional C-1-inhibitor. This study quantitatively demonstrates the dominant role of C-1-inhibitor in the inactivation of Factor XIIf in the plasma milieu. PMID:6725552

  1. Activation of p38 mitogen-activated protein kinase and nuclear factor-kappaB in tumour necrosis factor-induced eotaxin release of human eosinophils

    PubMed Central

    WONG, C K; ZHANG, J P; IP, W K; LAM, C W K

    2002-01-01

    The CC chemokine eotaxin is a potent eosinophil-specific chemoattractant that is crucial for allergic inflammation. Allergen-induced tumour necrosis factor (TNF) has been shown to induce eotaxin synthesis in eosinophils. Nuclear factor-kappaB (NF-κB) and mitogen-activated protein kinases (MAPK) have been found to play an essential role for the eotaxin-mediated eosinophilia. We investigated the modulation of NF-κB and MAPK activation in TNF-induced eotaxin release of human eosinophils. Human blood eosinophils were purified from fresh buffy coat using magnetic cell sorting. NF-κB pathway-related genes were evaluated by cDNA expression array system. Degradation of IκBα and phosphorylation of MAPK were detected by Western blot. Activation of NF-κB was determined by electrophoretic mobility shift assay. Eotaxin released into the eosinophil culture medium was measured by ELISA. TNF was found to up-regulate the gene expression of NF-κB and IκBα in eosinophils. TNF-induced IκBα degradation was inhibited by the proteasome inhibitor N-cbz-Leu-Leu-leucinal (MG-132) and a non-steroidal anti-inflammatory drug sodium salicylate (NaSal). Using EMSA, both MG-132 and NaSal were found to suppress the TNF-induced NF-κB activation in eosinophils. Furthermore, TNF was shown to induce phosphorylation of p38 MAPK time-dependently but not extracellular signal-regulated kinases (ERK). Inhibition of NF-κB activation and p38 MAPK activity decreased the TNF-induced release of eotaxin from eosinophils. These results indicate that NF-κB and p38 MAPK play an important role in TNF-activated signalling pathway regulating eotaxin release by eosinophils. They have also provided a biochemical basis for the potential of using specific inhibitors of NF-κB and p38 MAPK for treating allergic inflammation. PMID:12067303

  2. Epidermal Growth Factor Receptor and PTEN Modulate Tissue Factor Expression in Glioblastoma through JunD/Activator Protein-1 Transcriptional Activity

    PubMed Central

    Rong, Yuan; Belozerov, Vladimir E.; Tucker-Burden, Carol; Chen, Gang; Durden, Donald L.; Olson, Jeffrey J.; Van Meir, Erwin G.; Mackman, Nigel; Brat, Daniel J.

    2009-01-01

    Hypoxia and necrosis are fundamental features of glioblastoma (GBM) and their emergence is critical for the rapid biological progression of this fatal tumor; yet, underlying mechanisms are poorly understood. We have suggested that vaso-occlusion following intravascular thrombosis could initiate or propagate hypoxia and necrosis in GBM. Tissue factor (TF), the main cellular initiator of coagulation, is overexpressed in GBMs and likely favors a thrombotic microenvironment. Epidermal growth factor receptor (EGFR) amplification and PTEN loss are two common genetic alterations seen in GBM but not in lower-grade astrocytomas that could be responsible for TF up-regulation. The most frequent EGFR mutation in GBM involves deletion of exons 2 to 7, resulting in the expression of a constitutively active receptor, EGFRvIII. Here, we show that overexpression of EGFR or EGFRvIII in human glioma cells causes increased basal TF expression and that stimulation of EGFR by its ligand, EGF, leads to a marked dose-dependent up-regulation of TF. In all cases, increased TF expression led to accelerated plasma coagulation in vitro. EGFR-mediated TF expression depended most strongly on activator protein-1 (AP-1) transcriptional activity and was associated with c-Jun NH2-terminal kinase (JNK) and JunD activation. Restoration of PTEN expression in PTEN-deficient GBM cells diminished EGFR-induced TF expression by inhibiting JunD/AP-1 transcriptional activity. PTEN mediated this effect by antagonizing phosphatidylinositol 3-kinase activity, which in turn attenuated both Akt and JNK activities. These mechanisms are likely at work in vivo, as EGFR expression was highly correlated with TF expression in human high-grade astrocytoma specimens. PMID:19276385

  3. The secret struggle of the active girl: a qualitative synthesis of interpersonal factors that influence physical activity in adolescent girls.

    PubMed

    Standiford, Anne

    2013-10-01

    The author conducted a systematic review of 19 international, multidisciplinary, qualitative studies of interpersonal factors that influence physical activity in adolescent girls. Themes were deductively generated based on reported findings, and were organized according to frequency of occurrence. Themes were further organized according to a theoretical model to illustrate how interpersonal, perceptual, and situational influences affect physical activity in adolescent girls. The three most frequently discovered themes follow: (a) ability comparison and competition; (b) family, peer, and teacher influence; and (c) appearance concerns. It is important to consider the influence of gender role conflict on physical activity. PMID:23790150

  4. Gastrointestinal growth factors and hormones have divergent effects on Akt activation

    PubMed Central

    Berna, Marc J.; Tapia, Jose A.; Sancho, Veronica; Thill, Michelle; Pace, Andrea; Hoffmann, K. Martin; Gonzalez-Fernandez, Lauro; Jensen, Robert T.

    2009-01-01

    Akt is a central regulator of apoptosis, cell growth and survival. Growth factors and some G-protein-coupled receptors (GPCR) regulate Akt. Whereas growth-factor activation of Akt has been extensively studied, the regulation of Akt by GPCR's, especially gastrointestinal hormones/neurotransmitters, remains unclear. To address this area, in this study the effects of GI growth factors and hormones/neurotransmitters were investigate in rat pancreatic acinar cells which are high responsive to these agents. Pancreatic acini expressed Akt and 5 of 7 known pancreatic growth-factors stimulate Akt phosphorylation (T308, S473) and translocation. These effects are mediated by p85 phosphorylation and activation of PI3K. GI hormones increasing intracellular cAMP had similar effects. However, GI-hormones/neurotransmitters[CCK, bombesin,carbachol] activating phospholipase C (PLC) inhibited basal and growth-factor-stimulated Akt activation. Detailed studies with CCK, which has both physiological and pathophysiological effects on pancreatic acinar cells at different concentrations, demonstrated CCK has a biphasic effect: at low concentrations(pM) stimulating Akt by a Src-dependent mechanism and at higher concentrations(nM) inhibited basal and stimulated Akt translocation, phosphorylation and activation, by de-phosphorylating p85 resulting in decreasing PI3K activity. This effect required activation of both limbs of the PLC-pathway and a protein tyrosine phosphatase, but was not mediated by p44/42 MAPK, Src or activation of a serine phosphatase. Akt inhibition by CCK was also found in vivo and in Panc-1 cancer cells where it inhibited serum-mediated rescue from apoptosis. These results demonstrate that GI growth factors as well as gastrointestinal hormones/neurotransmitters with different cellular basis of action can all regulate Akt phosphorylation in pancreatic acinar cells. This regulation is complex with phospholipase C agents such as CCK, because both stimulatory and inhibitory

  5. Lonomia obliqua caterpillar spicules trigger human blood coagulation via activation of factor X and prothrombin.

    PubMed

    Donato, J L; Moreno, R A; Hyslop, S; Duarte, A; Antunes, E; Le Bonniec, B F; Rendu, F; de Nucci, G

    1998-03-01

    In southern Brazil, envenomation by larvae of the moth Lonomia obliqua (Walker) may result in blood clotting factor depletion, leading to disseminated intravascular coagulation with subsequent haemorrhage and acute renal failure which may prove fatal. We have examined the effect of a crude extract of spicules from these caterpillars on in vitro hemostasis. The extract alone did not aggregate platelets and had no detectable effect on purified fibrinogen, suggesting that extract induces clot formation by triggering activation of the clotting cascade. In agreement with the presence of thrombin-mediated activity, hirudin prevented clot formation. The extract was found to activate both prothrombin and factor X, suggesting that the depletion of blood clotting factors results from the steady activation of factor X and prothrombin. Heating and diisopropylfluorophosphate abolished the procoagulant activity of the extract, indicating that the active component involved is a protein that may belong to the serine protease family of enzymes. The ability of hirudin to inhibit this coagulant activity suggests that this inhibitor could be beneficial in the treatment of patients envenomed by L. obliqua caterpillars. PMID:9531036

  6. The factor VII-activating protease (FSAP) enhances the activity of bone morphogenetic protein-2 (BMP-2).

    PubMed

    Roedel, Elfie Kathrin; Schwarz, Elisabeth; Kanse, Sandip Madhav

    2013-03-01

    Factor VII-activating protease (FSAP) is a circulating protease involved in the pathogenesis of atherosclerosis, calcification, and fibrotic processes. To understand how FSAP controls the balance of local growth factors, we have investigated its effect on the regulation of bone morphogenetic proteins (BMPs). BMP-2 is produced as a large pro-form and secreted as a mature heparin-binding growth factor after intracellular processing by pro-protein convertases (PCs). In this study, we discovered that FSAP enhances the biological activity of mature BMP-2 as well as its pro-form, as shown by osteogenic differentiation of C2C12 myoblasts. These findings were complemented by knockdown of FSAP in hepatocytes, which revealed BMP-2 processing by endogenous FSAP. N-terminal sequencing indicated that pro-BMP-2 was cleaved by FSAP at the canonical PC cleavage site, giving rise to mature BMP-2 (Arg(282)↓Gln(283)), as well as in the N-terminal heparin binding region of mature BMP-2, generating a truncated mature BMP-2 peptide (Arg(289)↓Lys(290)). Similarly, mature BMP-2 was also cleaved to a truncated peptide within its N-terminal region (Arg(289)↓Lys(290)). Plasmin exhibited a similar activity, but it was weaker compared with FSAP. Thrombin, Factor VIIa, Factor Xa, and activated protein C were not effective. These results were further supported by the observation that the mutation of the heparin binding region of BMP-2 inhibited the processing by FSAP but not by PC. Thus, the proteolysis and activation of pro-BMP-2 and mature BMP-2 by FSAP can regulate cell differentiation and calcification in vasculature and may explain why polymorphisms in the gene encoding for FSAP are related to vascular diseases. PMID:23341458

  7. Using avian radar to examine relationships among avian activity, bird strikes, and meteorological factors

    USGS Publications Warehouse

    Coates, Peter S.; Casazza, Michael L.; Halstead, Brian J.; Fleskes, Joseph P.; Laughlin, James A.

    2011-01-01

    Radar systems designed to detect avian activity at airfields are useful in understanding factors that influence the risk of bird and aircraft collisions (bird strikes). We used an avian radar system to measure avian activity at Beale Air Force Base, California, USA, during 2008 and 2009. We conducted a 2-part analysis to examine relationships among avian activity, bird strikes, and meteorological and time-dependent factors. We found that avian activity around the airfield was greater at times when bird strikes occurred than on average using a permutation resampling technique. Second, we developed generalized linear mixed models of an avian activity index (AAI). Variation in AAI was first explained by seasons that were based on average migration dates of birds at the study area. We then modeled AAI by those seasons to further explain variation by meteorological factors and daily light levels within a 24-hour period. In general, avian activity increased with decreased temperature, wind, visibility, precipitation, and increased humidity and cloud cover. These effects differed by season. For example, during the spring bird migration period, most avian activity occurred before sunrise at twilight hours on clear days with low winds, whereas during fall migration, substantial activity occurred after sunrise, and birds generally were more active at lower temperatures. We report parameter estimates (i.e., constants and coefficients) averaged across models and a relatively simple calculation for safety officers and wildlife managers to predict AAI and the relative risk of bird strike based on time, date, and meteorological values. We validated model predictability and assessed model fit. These analyses will be useful for general inference of avian activity and risk assessment efforts. Further investigation and ongoing data collection will refine these inference models and improve our understanding of factors that influence avian activity, which is necessary to inform

  8. Sex differences in social cognitive factors and physical activity in Korean college students

    PubMed Central

    Choi, Jin Yi; Chang, Ae Kyung; Choi, Eun-Ju

    2015-01-01

    [Purpose] This study examined sex differences in physical activity and social cognitive theory factors in Korean college students. [Subjects and Methods] A cross-sectional survey of 688 college students (285 men and 403 women) in Korea was conducted using a self-reported questionnaire. [Results] There was a significant difference in the level of physical activity between male and female students. The significant predictors of physical activity for male students were physical activity goals, physical activity self-efficacy, and sitting time. Meanwhile, those for female students were perceived weight, physical activity goal, physical activity outcome expectations, and sitting time. [Conclusion] Sex differences should be considered when developing interventions to increase physical activity. PMID:26180293

  9. Transcription factor activation following exposure of an intact lung preparation to metallic particulate matter.

    PubMed Central

    Samet, James M; Silbajoris, Robert; Huang, Tony; Jaspers, Ilona

    2002-01-01

    Metallic constituents contained in ambient particulate matter have been associated with adverse effects in a number of epidemiologic, in vitro, and in vivo studies. Residual oil fly ash (ROFA) is a metallic by-product of the combustion of fossil fuel oil, which has been shown to induce a variety of proinflammatory responses in lung cells. We have examined signaling pathways activated in response to ROFA exposure and recently reported that ROFA treatment activates multiple mitogen-activated protein (MAP) kinases in the rat lung. In the present study we extended our investigations on the mechanism of toxicity of ROFA to include transcription factors whose activities are regulated by MAP kinases as well as possible effectors of transcriptional changes that mediate the effects of ROFA. We applied immunohistochemical methods to detect ROFA-induced activation of nuclear factor-kappa B (NF kappa B), activating transcription factor-2 (ATF-2), c-Jun, and cAMP response element binding protein (CREB) in intact lung tissue and confirmed and characterized their functional activation using DNA binding assays. We performed these studies using a perfused rabbit lung model that is devoid of blood elements in order to distinguish between intrinsic lung cell effects and effects that are secondary to inflammatory cell influx. We report here that exposure to ROFA results in a rapid activation of all of the transcription factors studied by exerting direct effects on lung cells. These findings validate the use of immunohistochemistry to detect transcription factor activation in vivo and demonstrate the utility of studying signaling changes in response to environmental exposures. PMID:12361922

  10. Impact of detector-element active-area shape and fill factor on super-resolution

    NASA Astrophysics Data System (ADS)

    Hardie, Russell; Droege, Douglas; Dapore, Alexander; Greiner, Mark

    2015-05-01

    In many undersampled imaging systems, spatial integration from the individual detector elements is the dominant component of the system point spread function (PSF). Conventional focal plane arrays (FPAs) utilize square detector elements with a nearly 100% fill factor, where fill factor is defined as the fraction of the detector element area that is active in light detection. A large fill factor is generally considered to be desirable because more photons are collected for a given pitch, and this leads to a higher signal-to-noise-ratio (SNR). However, the large active area works against super-resolution (SR) image restoration by acting as an additional low pass filter in the overall PSF when modeled on the SR sampling grid. A high fill factor also tends to increase blurring from pixel cross-talk. In this paper, we study the impact of FPA detector-element shape and fill factor on SR. A detailed modulation transfer function analysis is provided along with a number of experimental results with both simulated data and real data acquired with a midwave infrared (MWIR) imaging system. We demonstrate the potential advantage of low fill factor detector elements when combined with SR image restoration. Our results suggest that low fill factor circular detector elements may be the best choice. New video results are presented using robust adaptive Wiener filter SR processing applied to data from a commercial MWIR imaging system with both high and low detector element fill factors.

  11. Induction of endothelial cell proliferation by angiogenic factors released by activated monocytes

    SciTech Connect

    Pakala, Rajbabu; Watanabe, Takuya; Benedict, Claude R

    2002-06-01

    Introduction: Cell-cell interaction is an essential component of atherosclerotic plaque development. Activated monocytes appear to play a central role in the development of atherosclerosis, not only through foam cell formation but also via the production of various growth factors that induce proliferation of different cell types that are involved in the plaque development. Using serum free co-culture method, we determined the effect of monocytes on endothelial cell proliferation. Methods: Endothelial cell proliferation is determined by the amount of [{sup 3}H]thymidine incorporated in to the DNA. Basic fibroblast growth factor (b-FGF), vascular endothelial growth factor (VEGF) and interleukin-8 (IL-8) levels in the conditioned medium were determined by ELISA. Results: Conditioned medium from unactivated monocytes partially inhibited endothelial cell proliferation, whereas conditioned medium from activated monocytes promoted endothelial cell proliferation. The mitogenic effect of conditioned medium derived from activated monocytes is due to the presence of b-FGF, VEGF and IL-8. Neutralizing antibodies against b-FGF, VEGF and IL-8 partially reversed the mitogenic effect of conditioned medium derived from activated monocytes. When b-FGF, VEGF and IL-8 were immunoprecipitated from conditioned medium derived from activated monocytes, it is less mitogenic to endothelial cells. Conclusion: Activated monocytes may play an important role in the development of atherosclerotic plaque by producing endothelial cell growth factors.

  12. Factors Influencing Entering Teacher Candidates' Preferences for Instructional Activities: A glimpse into their orientations towards teaching

    NASA Astrophysics Data System (ADS)

    Talanquer, Vicente; Novodvorsky, Ingrid; Tomanek, Debra

    2010-07-01

    The present study was designed to identify and characterize the major factors that influence entering science teacher candidates' preferences for different types of instructional activities, and to analyze what these factors suggest about teacher candidates' orientations towards science teaching. The study involved prospective teachers enrolled in the introductory science teaching course in an undergraduate science teacher preparation program. Our analysis was based on data collected using a teaching and learning beliefs questionnaire, together with structured interviews. Our results indicate that entering science teacher candidates have strong preferences for a few activity types. The most influential factors driving entering science teacher candidates' selections were the potential of the instructional activities to motivate students, be relevant to students' personal lives, result in transfer of skills to non-science situations, actively involve students in goal-directed learning, and implement curriculum that represents what students need to know. This set of influencing factors suggests that entering science teacher candidates' orientations towards teaching are likely driven by one or more of these three central teaching goals: (1) motivating students, (2) developing science process skills, and (3) engaging students in structured science activities. These goals, and the associated beliefs about students, teaching, and learning, can be expected to favor the development or enactment of three major orientations towards teaching in this population of future science teachers: "motivating students," "process," and "activity-driven."

  13. Cooperative activation of Xenopus rhodopsin transcription by paired-like transcription factors

    PubMed Central

    2014-01-01

    Background In vertebrates, rod photoreceptor-specific gene expression is regulated by the large Maf and Pax-like transcription factors, Nrl/LNrl and Crx/Otx5. The ubiquitous occurrence of their target DNA binding sites throughout rod-specific gene promoters suggests that multiple transcription factor interactions within the promoter are functionally important. Cooperative action by these transcription factors activates rod-specific genes such as rhodopsin. However, a quantitative mechanistic explanation of transcriptional rate determinants is lacking. Results We investigated the contributions of various paired-like transcription factors and their cognate cis-elements to rhodopsin gene activation using cultured cells to quantify activity. The Xenopus rhodopsin promoter (XOP) has a bipartite structure, with ~200 bp proximal to the start site (RPP) coordinating cooperative activation by Nrl/LNrl-Crx/Otx5 and the adjacent 5300 bp upstream sequence increasing the overall expression level. The synergistic activation by Nrl/LNrl-Crx/Otx5 also occurred when XOP was stably integrated into the genome. We determined that Crx/Otx5 synergistically activated transcription independently and additively through the two Pax-like cis-elements, BAT1 and Ret4, but not through Ret1. Other Pax-like family members, Rax1 and Rax2, do not synergistically activate XOP transcription with Nrl/LNrl and/or Crx/Otx5; rather they act as co-activators via the Ret1 cis-element. Conclusions We have provided a quantitative model of cooperative transcriptional activation of the rhodopsin promoter through interaction of Crx/Otx5 with Nrl/LNrl at two paired-like cis-elements proximal to the NRE and TATA binding site. Further, we have shown that Rax genes act in cooperation with Crx/Otx5 with Nrl/LNrl as co-activators of rhodopsin transcription. PMID:24499263

  14. Factors Associated with Physical Activity among Macedonian Adolescents in Albanian Ethnic Community

    PubMed Central

    GONTAREV, Seryozha; KALAC, Ruzdija; AMETI, Vullnet; REDJEPI, Agim

    2016-01-01

    Background: The purpose of this study was to determine the relationship of demographic, psychological, social and environmental factors with physical activity and to determine whether indicators of physical activity differ by gender among Macedonian adolescents from Albanian ethnic community from 11 to 14 yr (N = 886). Methods: Research were conducted in 2014 in several primary schools randomly selected from Tetovo and Gostivar region of the R. Macedonia. Students completed a questionnaire which examined their level of participation in physical activity and sedentary behavior along with a number of potential correlates. Hierarchical regression was used to explore the relationship between hypothesised factors and physical activity. Results: The boys unlike the girls showed significantly higher levels of physical activity (P=0.001). Respondents of both genders who perceive greater benefits from the physical activity (P=0.010). They have more confidence in their abilities (P=0.001), enjoy more in the physical activities (P=0.016), perceive greater social support from friends (P=0.008) and parents (P=0.001) and have higher levels of physical activity. Conclusions: The results indicate the importance of developing a national plan and program to promote physical activity in order to help young people to change unhealthy lifestyle habits and increase the physical activity, thus improving their health. PMID:27252917

  15. Factors Associated with Nursing Activities in Humanitarian Aid and Disaster Relief

    PubMed Central

    Noguchi, Norihito; Inoue, Satoshi; Shimanoe, Chisato; Shibayama, Kaoru; Shinchi, Koichi

    2016-01-01

    Background Although nurses play an important role in humanitarian aid and disaster relief (HA/DR), little is known about the nursing activities that are performed in HA/DR. We aimed to clarify the nursing activities performed by Japanese nurses in HA/DR and to examine the factors associated with the frequency of nursing activities. Methods A self-administered questionnaire survey was completed by 147 nurses with HA/DR experience. The survey extracted information on demographic characteristics, past experience (e.g., disaster medical training experience, HA/DR experience), circumstances surrounding their dispatched to HA/DR (e.g., team size, disaster type, post-disaster phase, mission term), and the frequency of nursing activities performed under HA/DR. The frequency of nursing activities was rated on a 5-point Likert scale. Evaluation of nursing activities was conducted based on the “nursing activity score”, which represents the frequency of each nursing activity. Factors related to the nursing activity score were evaluated by multiple logistic regression analysis. Results Nurses were involved in 27 nursing activities in HA/DR, 10 of which were performed frequently. On analysis, factors significantly associated with nursing activity score were nursing license as a registered nurse (OR 7.79, 95% CI 2.95–20.57), two or more experiences with disaster medical training (OR 2.90 95%, CI 1.12–7.49) and a post-disaster phase of three weeks or longer (OR 8.77, 95% CI 2.59–29.67). Conclusions These results will contribute to the design of evidence-based disaster medical training that improves the quality of nursing activities. PMID:26959351

  16. Fas-Induced Apoptosis Increases Hepatocyte Tissue Factor Procoagulant Activity In Vitro and In Vivo

    PubMed Central

    Lopez, Michelle; Kopec, Anna K.; Joshi, Nikita; Geddings, Julia E.; Cline, Holly; Towery, Keara L.; Rockwell, Cheryl E.; Mackman, Nigel; Luyendyk, James P.

    2014-01-01

    Hepatocyte (HPC) apoptosis occurs in association with hepatotoxic responses and chronic liver disease, and is coupled to activation of the blood coagulation cascade. HPCs have been shown to express tissue factor (TF), the primary activator of blood coagulation, in a form that lacks procoagulant activity. In this study, we determined the effect of inducing HPC apoptosis on the procoagulant activity of TF. Treatment of primary mouse HPCs with the Fas death receptor agonist (anti-CD95 antibody, Jo2) triggered apoptosis as shown by cleavage of caspase-3, increased caspase-3 proteolytic activity, and cell surface exposure of phosphatidylserine (PS). Jo2-induced apoptosis significantly increased TF-dependent factor Xa generation by HPCs. Moreover, Jo2 treatment was associated with increased levels of microparticle-associated TF procoagulant activity in the culture medium. Pretreatment with a caspase-3 inhibitor significantly reduced Jo2-induced HPC TF activity and prevented the increase in microparticle-associated TF procoagulant activity. Application of the high-affinity PS-binding protein lactadherin inhibited TF-dependent factor Xa generation by Jo2-treated HPCs and dramatically reduced microparticle-associated TF procoagulant activity. Treatment of wild-type mice with a sublethal dose of Jo2 was associated with a robust increase in the activation of coagulation as measured by plasma thrombin-antithrombin (TAT) levels; whereas mice with liver-specific TF deficiency had significantly lower TAT levels. Overall, the results indicate that Fas-initiated, caspase-3-dependent HPC apoptosis increases TF procoagulant activity through a mechanism involving PS externalization. This suggests that activation of liver TF likely contributes to the procoagulant state associated with HPC apoptosis in liver toxicity and disease. PMID:25015658

  17. Coagulation Factor X Activates Innate Immunity to Human Species C Adenovirus

    PubMed Central

    Doronin, Konstantin; Flatt, Justin W.; Di Paolo, Nelson C.; Khare, Reeti; Kalyuzhniy, Oleksandr; Acchione, Mauro; Sumida, John P.; Ohto, Umeharu; Shimizu, Toshiyuki; Akashi-Takamura, Sachiko; Miyake, Kensuke; MacDonald, James W.; Bammler, Theo K.; Beyer, Richard P.; Farin, Frederico M.; Stewart, Phoebe L.; Shayakhmetov, Dmitry M.

    2016-01-01

    Although coagulation factors play a role in host defense for “living fossils” such as horseshoe crabs, the role of the coagulation system in immunity in higher organisms remains unclear. We modeled the interface of human species C adenovirus (HAdv) interaction with coagulation factor X (FX) and introduced a mutation that abrogated formation of the HAdv-FX complex. In vivo genome-wide transcriptional profiling revealed that FX-binding–ablated virus failed to activate a distinct network of nuclear factor κB–dependent early-response genes that are activated by HAdv-FX complex downstream of TLR4/MyD88/TRIF/TRAF6 signaling. Our study implicates host factor “decoration” of the virus as a mechanism to trigger an innate immune sensor that responds to a misplacement of coagulation FX from the blood into intracellular macrophage compartments upon virus entry into the cell. PMID:23019612

  18. Coagulation factor X activates innate immunity to human species C adenovirus.

    PubMed

    Doronin, Konstantin; Flatt, Justin W; Di Paolo, Nelson C; Khare, Reeti; Kalyuzhniy, Oleksandr; Acchione, Mauro; Sumida, John P; Ohto, Umeharu; Shimizu, Toshiyuki; Akashi-Takamura, Sachiko; Miyake, Kensuke; MacDonald, James W; Bammler, Theo K; Beyer, Richard P; Farin, Frederico M; Stewart, Phoebe L; Shayakhmetov, Dmitry M

    2012-11-01

    Although coagulation factors play a role in host defense for "living fossils" such as horseshoe crabs, the role of the coagulation system in immunity in higher organisms remains unclear. We modeled the interface of human species C adenovirus (HAdv) interaction with coagulation factor X (FX) and introduced a mutation that abrogated formation of the HAdv-FX complex. In vivo genome-wide transcriptional profiling revealed that FX-binding-ablated virus failed to activate a distinct network of nuclear factor κB-dependent early-response genes that are activated by HAdv-FX complex downstream of TLR4/MyD88/TRIF/TRAF6 signaling. Our study implicates host factor "decoration" of the virus as a mechanism to trigger an innate immune sensor that responds to a misplacement of coagulation FX from the blood into intracellular macrophage compartments upon virus entry into the cell. PMID:23019612

  19. Overexpression of gankyrin in mouse hepatocytes induces hemangioma by suppressing factor inhibiting hypoxia-inducible factor-1 (FIH-1) and activating hypoxia-inducible factor-1.

    PubMed

    Liu, Yu; Higashitsuji, Hiroaki; Higashitsuji, Hisako; Itoh, Katsuhiko; Sakurai, Toshiharu; Koike, Kazuhiko; Hirota, Kiichi; Fukumoto, Manabu; Fujita, Jun

    2013-03-01

    Gankyrin (also called p28 or PSMD10) is an oncoprotein commonly overexpressed in hepatocellular carcinomas. It consists of 7 ankyrin repeats and interacts with multiple proteins including Rb, Cdk4, MDM2 and NF-κB. To assess the oncogenic activity in vivo, we produced transgenic mice that overexpress gankyrin specifically in the hepatocytes. Unexpectedly, 5 of 7 F2 transgenic mice overexpressing hepatitis B virus X protein (HBX) promoter-driven gankyrin, and one of 3 founder mice overexpressing serum amyloid P component (SAP) promoter-driven gankyrin developed hepatic vascular neoplasms (hemangioma/hemangiosarcomas) whereas none of the wild-type mice did. Endothelial overgrowth was more frequent in the livers of diethylnitrosamine-treated transgenic mice than wild-type mice. Mouse hepatoma Hepa1-6 cells overexpressing gankyrin formed tumors with more vascularity than parental Hepa1-6 cells in the transplanted mouse skin. We found that gankyrin binds to and sequester factor inhibiting hypoxia-inducible factor-1 (FIH-1), which results in decreased interaction between FIH-1 and hypoxia-inducible factor-1α (HIF-1α) and increased activity of HIF-1 to promote VEGF production. The effects of gankyrin were more prominent under 3% O2 than 1% or 20% O2 conditions. Thus, the present study clarified, at least partly, mechanisms of vascular tumorigenesis, and suggests that gankyrin might play a physiological role in hypoxic responses besides its roles as an oncoprotein. PMID:23376718

  20. Membrane-To-Nucleus Signaling Links Insulin-Like Growth Factor-1- and Stem Cell Factor-Activated Pathways

    PubMed Central

    Hayashi, Yujiro; Asuzu, David T.; Gibbons, Simon J.; Aarsvold, Kirsten H.; Bardsley, Michael R.; Lomberk, Gwen A.; Mathison, Angela J.; Kendrick, Michael L.; Shen, K. Robert; Taguchi, Takahiro; Gupta, Anu; Rubin, Brian P.; Fletcher, Jonathan A.; Farrugia, Gianrico; Urrutia, Raul A.; Ordog, Tamas

    2013-01-01

    Stem cell factor (mouse: Kitl, human: KITLG) and insulin-like growth factor-1 (IGF1), acting via KIT and IGF1 receptor (IGF1R), respectively, are critical for the development and integrity of several tissues. Autocrine/paracrine KITLG-KIT and IGF1-IGF1R signaling are also activated in several cancers including gastrointestinal stromal tumors (GIST), the most common sarcoma. In murine gastric muscles, IGF1 promotes Kitl-dependent development of interstitial cells of Cajal (ICC), the non-neoplastic counterpart of GIST, suggesting cooperation between these pathways. Here, we report a novel mechanism linking IGF1-IGF1R and KITLG-KIT signaling in both normal and neoplastic cells. In murine gastric muscles, the microenvironment for ICC and GIST, human hepatic stellate cells (LX-2), a model for cancer niches, and GIST cells, IGF1 stimulated Kitl/KITLG protein and mRNA expression and promoter activity by activating several signaling pathways including AKT-mediated glycogen synthase kinase-3β inhibition (GSK3i). GSK3i alone also stimulated Kitl/KITLG expression without activating mitogenic pathways. Both IGF1 and GSK3i induced chromatin-level changes favoring transcriptional activation at the Kitl promoter including increased histone H3/H4 acetylation and H3 lysine (K) 4 methylation, reduced H3K9 and H3K27 methylation and reduced occupancy by the H3K27 methyltransferase EZH2. By pharmacological or RNA interference-mediated inhibition of chromatin modifiers we demonstrated that these changes have the predicted impact on KITLG expression. KITLG knock-down and immunoneutralization inhibited the proliferation of GIST cells expressing wild-type KIT, signifying oncogenic autocrine/paracrine KITLG-KIT signaling. We conclude that membrane-to-nucleus signaling involving GSK3i establishes a previously unrecognized link between the IGF1-IGF1R and KITLG-KIT pathways, which is active in both physiologic and oncogenic contexts and can be exploited for therapeutic purposes. PMID:24116170

  1. Sociodemographic and behavioral factors associated with physical activity in Brazilian adolescents

    PubMed Central

    2014-01-01

    Background Physical activity in adolescents is associated with short- and long-term health benefits. Physical activity can occur in various domains and is influenced by a complex network of factors. The aims of this study are 1) to describe the physical activity of Brazilian adolescents in physical education classes, during leisure time, and during active commuting and 2) to investigate the socio-demographic and behavioral factors associated with physical activity. Methods The representative sample included 109,104 Brazilian students in the final year of elementary school from 2,842 schools. The weekly frequency and duration of physical activity were assessed. A variety of socio-demographic and behavioral factors were studied. A multiple Poisson regression analysis was used to test for associations between physical activity and the socio-demographic and behavioral variables. Results Most of the students (97.0%) engaged in physical activity in at least one of the domains studied, especially physical education at school (81.7%) and leisure time physical activity (67.5%). However, only 29% of the adolescents reached the recommended level of physical activity. Among the adolescents who reached the minimum recommended time for physical activity, the various domains contributed the following proportions to total physical activity: leisure time physical activity (PR 12.5; 95% CI 11.17-13.97), active commuting (PR 1.63; 95% CI 1.59-1.67), and physical education at school (PR 1.36; 95% CI 1.29-1.44). The weekly frequency of all activities was greater among boys than among girls. Moreover, nearly two-thirds (61.8%) of students spent more than two hours per day engaging in sedentary behaviors; the prevalence of sedentary behaviors was similar between boys and girls (59.0 and 64.5%, respectively). Total level of physical activity, leisure time physical activity, and active commuting were associated with higher nutritional scores. Conclusions Physical activity is important in

  2. A human factors analysis of ADL activities: a capability-demand approach.

    PubMed

    Czaja, S J; Weber, R A; Nair, S N

    1993-09-01

    Older adults frequently encounter difficulties performing daily living activities. Often times these difficulties arise because environmental demands create barriers which hinder task performance. Currently, there is little empirical data that relate environmental demands to functional capabilities of older adults. The concepts and methods of Human Factors Engineering can be used to accomplish this goal. Human Factors views task performance within a systems context and maintains that successful task performance is dependent on a match between task demands and human capabilities. This article will discuss how Human Factors methodologies can be used to analyze problems encountered by older adults performing routine activities. Data from a study concerned with identifying physiological demands associated with personal and instrumental activities of daily living will be used to demonstrate the utility of using this approach. PMID:8409240

  3. An Archaeal Homolog of Proteasome Assembly Factor Functions as a Proteasome Activator

    PubMed Central

    Kumoi, Kentaro; Satoh, Tadashi; Murata, Kazuyoshi; Hiromoto, Takeshi; Mizushima, Tsunehiro; Kamiya, Yukiko; Noda, Masanori; Uchiyama, Susumu; Yagi, Hirokazu; Kato, Koichi

    2013-01-01

    Assembly of the eukaryotic 20S proteasome is an ordered process involving several proteins operating as proteasome assembly factors including PAC1-PAC2 but archaeal 20S proteasome subunits can spontaneously assemble into an active cylindrical architecture. Recent bioinformatic analysis identified archaeal PAC1-PAC2 homologs PbaA and PbaB. However, it remains unclear whether such assembly factor-like proteins play an indispensable role in orchestration of proteasome subunits in archaea. We revealed that PbaB forms a homotetramer and exerts a dual function as an ATP-independent proteasome activator and a molecular chaperone through its tentacle-like C-terminal segments. Our findings provide insights into molecular evolution relationships between proteasome activators and assembly factors. PMID:23555947

  4. [Conception for permanent activation of nuclear factor kbeta as molecular basis for metabolic syndrom pathogenesis].

    PubMed

    Kaidashev, I P

    2013-01-01

    The analysis of new data concerning the development of pathology due to the community of evolutionary new pathological factors was done. Author provides the comparison of well-known and new definition for "metabolic syndrome" and diagnostic criteria of this pathology. The conception for permanent activation of nuclear factor kbeta as possible typic pathological process was discussed. Suppose that NF-kbeta is the possible key molecule in the initiation and formation of "vicious circle"--insulinresistance--inflammation--atherosclerosis. PMID:24340624

  5. Human factors activities in teleoperator development at the Oak Ridge National Laboratory

    SciTech Connect

    Draper, J.V.; Herndon, J.N.

    1986-01-01

    The Consolidated Fuel Reprocessing Program (CFRP) at the Oak Ridge National Laboratory is developing advanced teleoperator systems for maintenance of future nuclear reprocessing facilities. Remote maintenance systems developed by the CFRP emphasize man-in-the-loop teleoperation. Consequently, human factors issues which affect teleoperator performance must be addressed. This papers surveys research and development activities carried out by the human factors group within the Remote Control Engineering Task of the CFRP.

  6. Involvement of activator protein 1 complexes in the epithelium-specific activation of the laminin gamma2-chain gene promoter by hepatocyte growth factor (scatter factor).

    PubMed Central

    Olsen, J; Lefebvre, O; Fritsch, C; Troelsen, J T; Orian-Rousseau, V; Kedinger, M; Simon-Assmann, P

    2000-01-01

    Laminin-5 is a trimer of laminin alpha3, beta3 and gamma2 chains that is found in the intestinal basement membrane. Deposition of the laminin gamma2 chain at the basement membrane is of great interest because it undergoes a developmental shift in its cellular expression. Here we study the regulatory elements that control basal and cytokine-activated transcriptional expression of the LAMC2 gene, which encodes the laminin gamma2 chain. By using transient transfection experiments we demonstrated the presence of constitutive and cytokine-responsive cis-elements. Comparison of the transcriptional activity of the LAMC2 promoter in the epithelial HT29mtx cells with that in small-intestinal fibroblastic cells (C20 cells) led us to conclude that two regions with constitutive epithelium-specific activity are present between positions -1.2 and -0.12 kb. This was further validated by transfections of primary foetal intestinal endoderm and mesenchyme. A 2.5 kb portion of the LAMC2 5' flanking region was equally responsive to PMA and hepatocyte growth factor (HGF), whereas it was less responsive to transforming growth factor beta1. A minimal promoter limited to the initial 120 bp upstream of the transcriptional start site maintained inducibility by PMA and HGF. This short promoter fragment contains two activator protein 1 (AP-1) elements and the 5'-most of these is a composite AP-1/Sp1 element. The 5'AP-1 element is crucial to the HGF-mediated activity of the promoter; analysis of interacting nuclear proteins demonstrated that AP-1 proteins containing JunD mediate the response to HGF. PMID:10749670

  7. RNA helicase A activity is inhibited by oncogenic transcription factor EWS-FLI1

    PubMed Central

    Erkizan, Hayriye Verda; Schneider, Jeffrey A.; Sajwan, Kamal; Graham, Garrett T.; Griffin, Brittany; Chasovskikh, Sergey; Youbi, Sarah E.; Kallarakal, Abraham; Chruszcz, Maksymilian; Padmanabhan, Radhakrishnan; Casey, John L.; Üren, Aykut; Toretsky, Jeffrey A.

    2015-01-01

    RNA helicases impact RNA structure and metabolism from transcription through translation, in part through protein interactions with transcription factors. However, there is limited knowledge on the role of transcription factor influence upon helicase activity. RNA helicase A (RHA) is a DExH-box RNA helicase that plays multiple roles in cellular biology, some functions requiring its activity as a helicase while others as a protein scaffold. The oncogenic transcription factor EWS-FLI1 requires RHA to enable Ewing sarcoma (ES) oncogenesis and growth; a small molecule, YK-4-279 disrupts this complex in cells. Our current study investigates the effect of EWS-FLI1 upon RHA helicase activity. We found that EWS-FLI1 reduces RHA helicase activity in a dose-dependent manner without affecting intrinsic ATPase activity; however, the RHA kinetics indicated a complex model. Using separated enantiomers, only (S)-YK-4-279 reverses the EWS-FLI1 inhibition of RHA helicase activity. We report a novel RNA binding property of EWS-FLI1 leading us to discover that YK-4-279 inhibition of RHA binding to EWS-FLI1 altered the RNA binding profile of both proteins. We conclude that EWS-FLI1 modulates RHA helicase activity causing changes in overall transcriptome processing. These findings could lead to both enhanced understanding of oncogenesis and provide targets for therapy. PMID:25564528

  8. Impaired Macrophage Migration Inhibitory Factor (MIF)-AMPK Activation and Ischemic Recovery in the Senescent Heart

    PubMed Central

    Ma, Heng; Wang, Jingying; Thomas, D Paul; Tong, Chao; Leng, Lin; Wang, Wenkui; Merk, Melanie; Zierow, Swen; Bernhagen, Jürgen; Ren, Jun; Bucala, Richard; Li, Ji

    2010-01-01

    Background Elderly patients are more sensitive to myocardial ischemia, which results in higher mortality. We investigated how aging impacts the cardioprotective AMP-activated protein kinase (AMPK) signaling pathway. Methods and Results Ischemic AMPK activation was impaired in aged compared to young murine hearts. The expression and secretion of the AMPK upstream regulator, macrophage migration inhibitory factor (MIF), were lower in aged compared to young adult hearts. Additionally, the levels of hypoxia-inducible factor 1α (HIF-1α), a known transcriptional activator of MIF, were reduced in aged compared to young hearts. Ischemia-induced AMPK activation in MIF knock-out (MIF KO) mice was blunted, leading to greater contractile dysfunction in MIF-deficient than in wild type (WT) hearts. Furthermore, intra-myocardial injection of adenovirus encoding MIF (Adv-MIF) in aged mice increased MIF expression and ischemic AMPK activation, and reduced infarct size. Conclusions An impaired MIF-AMPK activation response in senescence thus may be attributed to an aging-associated defect in the transcription factor for MIF, HIF-1α. In the clinical setting, impaired cardiac HIF-1α activation and consequent reduced MIF expression may play an important role in the increased susceptibility to myocardial ischemia observed in older cardiac patients. PMID:20606117

  9. Inhibition by CāINH of Hageman Factor Fragment Activation of Coagulation, Fibrinolysis, and Kinin Generation

    PubMed Central

    Schreiber, Alan D.; Kaplan, Allen P.; Austen, K. Frank

    1973-01-01

    Highly purified inhibitor of the first component of complement (CāINH) was shown to inhibit the capacity of active Hageman factor fragments to initiate kinin generation, fibrinolysis, and coagulation. The inhibition of prealbumin Hageman factor fragments observed was dependent upon the time of interaction of the fragments with CāINH and not to an effect upon kallikrein or plasmin generated. The inhibition of the coagulant activity of the intermediate sized Hageman factor fragment by CāINH was not due to an effect on PTA or other clotting factors. The inhibition by CāINH of both the prealbumin and intermediate sized Hageman factor fragments occurred in a dose response fashion. The CāINH did not appear to be consumed when the activity of the Hageman factor fragments was blocked, although the fragments themselves could no longer be recovered functionally or as a protein on alkaline disc gel electrophoretic analysis. These results suggest that the CāINH may have an enzymatic effect on the fragments or that an additional site on CāINH is involved in Cā inactivation. Images PMID:4703226

  10. Choline Acetyltransferase Activity in Striatum of Neonatal Rats Increased by Nerve Growth Factor

    NASA Astrophysics Data System (ADS)

    Mobley, William C.; Rutkowski, J. Lynn; Tennekoon, Gihan I.; Buchanan, Karen; Johnston, Michael V.

    1985-07-01

    Some neurodegenerative disorders may be caused by abnormal synthesis or utilization of trophic molecules required to support neuronal survival. A test of this hypothesis requires that trophic agents specific for the affected neurons be identified. Cholinergic neurons in the corpus striatum of neonatal rats were found to respond to intracerebroventricular administration of nerve growth factor with prominent, dose-dependent, selective increases in choline acetyltransferase activity. Cholinergic neurons in the basal forebrain also respond to nerve growth factor in this way. These actions of nerve growth factor may indicate its involvement in the normal function of forebrain cholinergic neurons as well as in neurodegenerative disorders involving such cells.

  11. Influence of liver disease and environmental factors on hepatic monooxygenase activity in vitro.

    PubMed

    Brodie, M J; Boobis, A R; Bulpitt, C J; Davies, D S

    1981-01-01

    The effects of liver disease and environmental factors on hepatic microsomal cytochrome P-450 content, NADPH-cytochrome c reductase (reductase) activity and aryl hydrocarbon hydroxylase (AHH) activity have been simultaneously investigated in 70 patients undergoing diagnostic liver biopsy. The activity of reductase was not significantly affected by the presence of liver disease or any of the environmental factors studied. Cytochrome P-450 content decreased with increasing severity of liver disease whereas AHH activity was only significantly reduced in biopsies showing hepatocellular destruction. None of the parameters of monooxygenase activity varied significantly with the age or sex of the patients. Alcohol excess was associated with decreased cytochrome P-450 content and AHH activity and this effect was independent of the histological status of the biopsy. Both high caffeine intake and cigarette smoking increased AHH activity in the absence of any change in cytochrome P-450 content. There was a positive correlation between the number of meat meals eaten per week and cytochrome P-450 content. Chronic treatment with enzyme-inducing anticonvulsants appeared to increase both cytochrome P-450 content and AHH activity. Despite differential effects of liver disease and environmental influences on cytochrome P-450 content and AHH activity there was a highly significant correlation between the two parameters. The results of the present study correlate well with the known effects of disease and environment on drug metabolism in vivo. PMID:7308271

  12. Tumour necrosis factor (TNF) as a mediator of macrophage helminthotoxic activity.

    PubMed

    James, S L; Glaven, J; Goldenberg, S; Meltzer, M S; Pearce, E

    1990-01-01

    Lymphokine-activated macrophages are cytotoxic for larvae of the helminth parasite Schistosoma mansoni. That soluble secreted factors may mediate this cytotoxicity was suggested by the observation that culture supernatant fluids from stimulated macrophages also exhibited larvacidal activity. These fluids contain the monokine tumour necrosis factor (TNF). Several observations indicated that TNF is directly toxic to schistosome larvae. Cytotoxic sera taken from BCG- or S. mansoni-immunized mice after endotoxin challenge killed schistosomula in vitro, and upon gel filtration the larvacidal factor(s) in the sera co-eluted with the tumoricidal activity defined as TNF. Recombinant-derived TNF exhibited direct toxicity to schistosomula at high concentrations, or at lower concentrations in the presence of IFN gamma. The larvacidal activity of macrophage supernatant fluids was abrogated by addition of either anti-TNF antisera or Zn+2, which has been shown to inhibit TNF-induced damage of tumour cells. Anti-TNF and Zn+2 likewise suppressed schistosomulum killing by lymphokine-activated peritoneal macrophages or the IC-21 macrophage line, indicating that TNF also plays a role in the effector mechanism of larval killing by whole cells. PMID:2314921

  13. Nuclear Factor of Activated T-cells (NFAT) plays a role in SV40 infection

    PubMed Central

    Manley, Kate; O’Hara, Bethany A; Atwood, Walter J

    2008-01-01

    Recent evidence highlighted a role for the transcription factor, Nuclear Factor of Activated T-cells (NFAT), in the transcription of the human polyomavirus JCV. Here we show that NFAT is also important in the transcriptional control of the related polyomavirus, Simian Virus 40 (SV40). Inhibition of NFAT activity reduced SV40 infection of Vero, 293A and HeLa cells, and this block occurred at the stage of viral transcription. Both NFAT3 and NFAT4 bound to the SV40 promoter through κB sites located within the 72bp repeated enhancer region. In Vero cells NFAT was involved in late transcription, but in HeLa and 293A cells both early and late viral transcription required NFAT activity. SV40 large T-Ag was found to increase NFAT activity and provided a positive feedback loop to transactivate the SV40 promoter. PMID:18031784

  14. Nuclear factor of activated T-cells (NFAT) plays a role in SV40 infection

    SciTech Connect

    Manley, Kate; O'Hara, Bethany A.; Atwood, Walter J.

    2008-03-01

    Recent evidence highlighted a role for the transcription factor, nuclear factor of activated T-cells (NFAT), in the transcription of the human polyomavirus JCV. Here we show that NFAT is also important in the transcriptional control of the related polyomavirus, Simian Virus 40 (SV40). Inhibition of NFAT activity reduced SV40 infection of Vero, 293A, and HeLa cells, and this block occurred at the stage of viral transcription. Both NFAT3 and NFAT4 bound to the SV40 promoter through {kappa}B sites located within the 72 bp repeated enhancer region. In Vero cells, NFAT was involved in late transcription, but in HeLa and 293A cells both early and late viral transcription required NFAT activity. SV40 large T-Ag was found to increase NFAT activity and provided a positive feedback loop to transactivate the SV40 promoter.

  15. Analysis of the restricting factors of laser countermeasure active detection technology

    NASA Astrophysics Data System (ADS)

    Zhang, Yufa; Sun, Xiaoquan

    2016-07-01

    The detection effect of laser active detection system is affected by various kinds of factors. In view of the application requirement of laser active detection, the influence factors for laser active detection are analyzed. The mathematical model of cat eye target detection distance has been built, influence of the parameters of laser detection system and the environment on detection range and the detection efficiency are analyzed. Various parameters constraint detection performance is simulated. The results show that the discovery distance of laser active detection is affected by the laser divergence angle, the incident angle and the visibility of the atmosphere. For a given detection range, the laser divergence angle and the detection efficiency are mutually restricted. Therefore, in view of specific application environment, it is necessary to select appropriate laser detection parameters to achieve optimal detection effect.

  16. Activation of AMP-activated kinase modulates sensitivity of glioma cells against epidermal growth factor receptor inhibition.

    PubMed

    Hartel, Ines; Ronellenfitsch, Michael; Wanka, Christina; Wolking, Stefan; Steinbach, Joachim P; Rieger, Johannes

    2016-07-01

    The epidermal growth factor (EGFR) pathway is frequently activated in glioblastoma but the clinical efficacy of EGFR inhibitors in malignant glioma has been disappointing. The reasons for the failure of the mechanisms of resistance of these inhibitors are unclear, but may involve factors of the tumor microenvironment such as limited glucose availability and hypoxia. It was therefore examined whether glucose and oxygen influenced the response of glioma cells to EGFR inhibition. Decreased levels of glucose and oxygen led to resistance against the EGFR inhibitor PD153035, whereas high glucose amounts and normoxia sensitised glioma cells towards the inhibitor. Low levels of glucose and oxygen stimulated AMP-activated kinase (AMPK) in glioma cells. 2DG, an inhibitor of glycolysis, and the AMPK activator A769662 reduced glucose consumption, induced phosphorylation of AMPK and mimicked the effects of low glucose availability on the toxicity of PD153035. Similarly, 2DG reduced toxicity of imatinib in K562 leukemia cells. In contrast, inhibition of AMPK by compound C or by short-hairpin (sh)-mediated gene suppression increased cell death induced by the EGFR inhibitor and reverted the protective effects of 2DG and A769662. In conclusion, cytotoxicity of EGFR inhibition can be diminished by AMPK activation in glioma cells. These results may provide one explanation for the low activity of EGFR inhibitors in clinical trials and suggest antagonism of AMPK or of AMPK-regulated metabolic alterations as a promising approach to enhance their therapeutic efficacy. PMID:27121290

  17. Competitive-Protein Adsorption in Contact Activation of Blood Factor XII

    PubMed Central

    Zhuo, Rui; Siedlecki, Christopher A.; Vogler, Erwin A.

    2009-01-01

    Contact activation of blood factor XII (FXII, Hageman factor) is moderated by the protein composition of the fluid phase in which FXII is dissolved. Solution yield of FXIIa arising from FXII contact with hydrophilic activating particles (fully-water-wettable glass) suspended in a protein cocktail is shown to be significantly greater than that obtained under corresponding activation conditions in buffer solutions containing only FXII. By contrast, solution yield of FXIIa arising from FXII contact with hydrophobic particles (silanized glass) suspended in protein cocktail is sharply lower than obtained in buffer. This confirms that contact activation is not specific to anionic hydrophilic surfaces as proposed by the accepted biochemistry of surface activation. Rather, contact activation in the presence of proteins unrelated to the plasma coagulation cascade leads to an apparent specificity for hydrophilic surfaces that is actually due to a relative diminution of activation at hydrophobic surfaces and an enhancement at hydrophilic surfaces. Furthermore, the rate of FXIIa accumulation in whole-plasma and buffer solution is found to decrease with time in the continuous presence of activating surfaces, leading to a steady-state FXIIa yield dependent on the initial FXII solution concentration for both hydrophilic and hydrophobic procoagulant particles suspended in either plasma, protein cocktail, or buffer. These results strongly suggest that activation competes with an autoinhibition reaction in which FXIIa itself inhibits FXII→FXIIa. Experimental results are modeled using a reaction scheme invoking FXII activation and autoinhibition linked to protein adsorption to procoagulant surfaces, where FXII activation is presumed to proceed by either autoactivation ( FXII→surfaceFXIIa) and autohydrolysis ( FXII→FXIIa2FXIIa) in buffer solution or autoactivation and reciprocal activation (kallikrein mediated hydrolysis) in plasma. FXII adsorption competition with other

  18. Specific induction of endogenous viral restriction factors using CRISPR/Cas-derived transcriptional activators

    PubMed Central

    Bogerd, Hal P.; Kornepati, Anand V. R.; Marshall, Joy B.; Kennedy, Edward M.; Cullen, Bryan R.

    2015-01-01

    Whereas several mammalian proteins can restrict the replication of HIV-1 and other viruses, these are often not expressed in relevant target cells. A potential method to inhibit viral replication might therefore be to use synthetic transcription factors to induce restriction factor expression. In particular, mutants of the RNA-guided DNA binding protein Cas9 that have lost their DNA cleavage activity could be used to recruit transcription activation domains to specific promoters. However, initial experiments revealed only weak activation unless multiple promoter-specific single guide RNAs (sgRNAs) were used. Recently, the recruitment of multiple transcription activation domains by a single sgRNA, modified to contain MS2-derived stem loops that recruit fusion proteins consisting of the MS2 coat protein linked to transcription activation domains, was reported to induce otherwise silent cellular genes. Here, we demonstrate that such “synergistic activation mediators” can induce the expression of two restriction factors, APOBEC3G (A3G) and APOBEC3B (A3B), in human cells that normally lack these proteins. We observed modest activation of endogenous A3G or A3B expression using single sgRNAs but high expression when two sgRNAs were used. Whereas the induced A3G and A3B proteins both blocked infection by an HIV-1 variant lacking a functional vif gene by inducing extensive dC-to-dU editing, only the induced A3B protein inhibited wild-type HIV-1. These data demonstrate that Cas9-derived transcriptional activators have the potential to be used for screens for endogenous genes that affect virus replication and raise the possibility that synthetic transcription factors might prove clinically useful if efficient delivery mechanisms could be developed. PMID:26668372

  19. Specific induction of endogenous viral restriction factors using CRISPR/Cas-derived transcriptional activators.

    PubMed

    Bogerd, Hal P; Kornepati, Anand V R; Marshall, Joy B; Kennedy, Edward M; Cullen, Bryan R

    2015-12-29

    Whereas several mammalian proteins can restrict the replication of HIV-1 and other viruses, these are often not expressed in relevant target cells. A potential method to inhibit viral replication might therefore be to use synthetic transcription factors to induce restriction factor expression. In particular, mutants of the RNA-guided DNA binding protein Cas9 that have lost their DNA cleavage activity could be used to recruit transcription activation domains to specific promoters. However, initial experiments revealed only weak activation unless multiple promoter-specific single guide RNAs (sgRNAs) were used. Recently, the recruitment of multiple transcription activation domains by a single sgRNA, modified to contain MS2-derived stem loops that recruit fusion proteins consisting of the MS2 coat protein linked to transcription activation domains, was reported to induce otherwise silent cellular genes. Here, we demonstrate that such "synergistic activation mediators" can induce the expression of two restriction factors, APOBEC3G (A3G) and APOBEC3B (A3B), in human cells that normally lack these proteins. We observed modest activation of endogenous A3G or A3B expression using single sgRNAs but high expression when two sgRNAs were used. Whereas the induced A3G and A3B proteins both blocked infection by an HIV-1 variant lacking a functional vif gene by inducing extensive dC-to-dU editing, only the induced A3B protein inhibited wild-type HIV-1. These data demonstrate that Cas9-derived transcriptional activators have the potential to be used for screens for endogenous genes that affect virus replication and raise the possibility that synthetic transcription factors might prove clinically useful if efficient delivery mechanisms could be developed. PMID:26668372

  20. The environment and physical activity: The influence of psychosocial, perceived and built environmental factors

    PubMed Central

    Maddison, Ralph; Hoorn, Steven Vander; Jiang, Yannan; Mhurchu, Cliona Ni; Exeter, Daniel; Dorey, Enid; Bullen, Chris; Utter, Jennifer; Schaaf, David; Turley, Maria

    2009-01-01

    This study sought to integrate perceived and built environmental and individual factors into the Theory of Planned Behavior (TPB) model to better understand adolescents' physical activity. Participants (n = 110) aged 12 to 17 years (M = 14.6 ± 1.55) were recruited from two large metropolitan high schools in Auckland, New Zealand, were included in the analysis. Participants completed measures of the revised TPB and the perceived environment. Individual factors such as ethnicity and level of deprivation were also collected. Geographical Information Systems (GIS) software was used to measure the physical environment (walkability, access to physical activity facilities). Physical activity was assessed using the ActiGraph accelerometer and the Physical Activity Questionnaire for Adolescents (PAQ-A). Data from the various sources were combined to develop an integrated model integrated for statistical analysis using structural equation modeling. The TPB model variables (intention and perceived behavioral control) explained 43% of the variance of PAQ-A. Unique and individual contributions were made by intention and PBC and home ownership of home equipment. The model explained 13% of time spent in moderate and vigorous physical activity (Actigraph). Unique and individual contribution was made by intention. Social cognitive variables were better predictors of both subjective and objective physical activity compared to perceived environmental and built environment factors. Implications of these findings are discussed. PMID:19331652

  1. [Factors Affecting the Dynamics of Circadian Activity of Frit Flies Meromyza saltatrix (L) (Diptera: Chloropidae)].

    PubMed

    Safonkin, A F; Triselyova, T A; Yazchuk, A A; Akent'eva, N A

    2015-01-01

    The dynamics of circadian activity in adult frit flies of the Holarctic species Meromyza saltatrix (L) from Mongolian, Moscow, and Polish populations was studied. Synchronous peaks of activity were revealed with the periodicity multiple of three-four hours, which may depend on the level of light. The direct effect of temperature and humidity on the activity of flies outside the optimal values of these factors was found. It was detected that the peak of adult emergence falls on the beginning of a general increase in the abundance of flies, which indicates constant rejuvenation of the population. The sex ratio is close to 1, but the emergence of males and females is in antiphase. The synchronization of peaks of circadian activity in the populations from different regions confirms the presence of a circadian rhythm of activity. The rhythm synchronizing the reproductive activity of adults was found to be modified by the photoperiod under the optimum conditions of temperature and humidity. PMID:26852486

  2. Dynamic transcription factor activity networks in response to independently altered mechanical and adhesive microenvironmental cues.

    PubMed

    Peñalver Bernabé, Beatriz; Shin, Seungjin; Rios, Peter D; Broadbelt, Linda J; Shea, Lonnie D; Seidlits, Stephanie K

    2016-08-01

    Multiple aspects of the local extracellular environment profoundly affect cell phenotype and function. Physical and chemical cues in the environment trigger intracellular signaling cascades that ultimately activate transcription factors (TFs) - powerful regulators of the cell phenotype. TRACER (TRanscriptional Activity CEll aRrays) was employed for large-scale, dynamic quantification of TF activity in human fibroblasts cultured on hydrogels with a controlled elastic modulus and integrin ligand density. We identified three groups of TFs: responders to alterations in ligand density alone, substrate stiffness or both. Dynamic networks of regulatory TFs were constructed computationally and revealed distinct TF activity levels, directionality (i.e., activation or inhibition), and dynamics for adhesive and mechanical cues. Moreover, TRACER networks predicted conserved hubs of TF activity across multiple cell types, which are significantly altered in clinical fibrotic tissues. Our approach captures the distinct and overlapping effects of adhesive and mechanical stimuli, identifying conserved signaling mechanisms in normal and disease states. PMID:27470442

  3. Arginase activity in mitochondria - An interfering factor in nitric oxide synthase activity assays

    SciTech Connect

    Venkatakrishnan, Priya; Nakayasu, Ernesto S.; Almeida, Igor C.; Miller, R.T.

    2010-04-09

    Previously, in tightly controlled studies, using three independent, yet complementary techniques, we refuted the claim that a mitochondrial nitric oxide synthase (mtNOS) isoform exists within pure, rat liver mitochondria (MT). Of those techniques, the NOS-catalyzed [{sup 14}C]-L-arginine to [{sup 14}C]-L-citrulline conversion assay (NOS assay) with MT samples indicated a weak, radioactive signal that was NOS-independent . Aliquots of samples from the NOS assays were then extracted with acetone, separated by high performance thin-layer chromatography (HPTLC) and exposed to autoradiography. Results obtained from these samples showed no radioactive band for L-citrulline. However, a fast-migrating, diffuse, radioactive band was observed in the TLC lanes loaded with MT samples. In this manuscript, we identify and confirm that this radioactive signal in MT samples is due to the arginase-catalyzed conversion of [{sup 14}C]-L-arginine to [{sup 14}C]-urea. The current results, in addition to reconfirming the absence of NOS activity in rat liver MT, also show the need to include arginase inhibitors in studies using MT samples in order to avoid confounding results when using NOS activity assays.

  4. Control of Viremia Enables Acquisition of Resting Memory B Cells with Age and Normalization of Activated B Cell Phenotypes in HIV-Infected Children.

    PubMed

    Muema, Daniel M; Macharia, Gladys N; Hassan, Amin S; Mwaringa, Shalton M; Fegan, Greg W; Berkley, James A; Nduati, Eunice W; Urban, Britta C

    2015-08-01

    HIV affects the function of all lymphocyte populations, including B cells. Phenotypic and functional defects of B cells in HIV-infected adults have been well characterized, but defects in children have not been studied to the same extent. We determined the proportion of B cell subsets and frequencies of Ag-specific memory B cells in peripheral blood from HIV-infected children and healthy controls, using flow cytometry and B cell ELISPOT, respectively. In addition, we measured the quantities and avidities of plasma Abs against various Ags by ELISA. We also determined plasma levels of BAFF and expression of BAFF receptors on B cells. Children with high HIV viremia had increased proportions of activated mature B cells, tissue-like memory B cells and plasmablasts, and low proportions of naive B cells when compared with community controls and children with low HIV viremia, similar to adults infected with HIV. HIV-infected groups had lower proportions of resting memory B cells than did community controls. Notably, high HIV viremia prevented the age-dependent accumulation of class-switched resting memory B cells. HIV-infected children, regardless of the level of viremia, showed lower quantities and avidities of IgG and lower frequencies of memory B cells against Expanded Program on Immunization vaccines. The HIV-infected children had an altered BAFF profile that could have affected their B cell compartment. Therefore, B cell defects in HIV-infected children are similar to those seen in HIV-infected adults. However, control of HIV viremia is associated with normalization of activated B cell subsets and allows age-dependent accumulation of resting memory B cells. PMID:26116511

  5. Control of Viremia Enables Acquisition of Resting Memory B Cells with Age and Normalization of Activated B Cell Phenotypes in HIV-Infected Children

    PubMed Central

    Muema, Daniel M.; Macharia, Gladys N.; Hassan, Amin S.; Mwaringa, Shalton M.; Fegan, Greg W.; Berkley, James A.; Urban, Britta C.

    2015-01-01

    HIV affects the function of all lymphocyte populations, including B cells. Phenotypic and functional defects of B cells in HIV-infected adults have been well characterized, but defects in children have not been studied to the same extent. We determined the proportion of B cell subsets and frequencies of Ag-specific memory B cells in peripheral blood from HIV-infected children and healthy controls, using flow cytometry and B cell ELISPOT, respectively. In addition, we measured the quantities and avidities of plasma Abs against various Ags by ELISA. We also determined plasma levels of BAFF and expression of BAFF receptors on B cells. Children with high HIV viremia had increased proportions of activated mature B cells, tissue-like memory B cells and plasmablasts, and low proportions of naive B cells when compared with community controls and children with low HIV viremia, similar to adults infected with HIV. HIV-infected groups had lower proportions of resting memory B cells than did community controls. Notably, high HIV viremia prevented the age-dependent accumulation of class-switched resting memory B cells. HIV-infected children, regardless of the level of viremia, showed lower quantities and avidities of IgG and lower frequencies of memory B cells against Expanded Program on Immunization vaccines. The HIV-infected children had an altered BAFF profile that could have affected their B cell compartment. Therefore, B cell defects in HIV-infected children are similar to those seen in HIV-infected adults. However, control of HIV viremia is associated with normalization of activated B cell subsets and allows age-dependent accumulation of resting memory B cells. PMID:26116511

  6. Interferon regulatory factor 7 is activated by a viral oncoprotein through RIP-dependent ubiquitination.

    PubMed

    Huye, Leslie E; Ning, Shunbin; Kelliher, Michelle; Pagano, Joseph S

    2007-04-01

    As a key mediator of type I interferon (IFN) (IFN-alpha/beta) responses, IFN regulatory factor 7 (IRF7) is essential to host immune defenses. Activation of IRF7 generally requires virus-induced C-terminal phosphorylation, which leads to its nuclear accumulation and activation of target genes. Here we use the Epstein-Barr virus (EBV) oncoprotein LMP1, which activates IRF7, to identify factors involved in IRF7 activation. We demonstrate for the first time that RIP activates IRF7 and that RIP and IRF7 interact under physiological conditions in EBV-positive Burkitt's lymphoma cells. We provide evidence that both RIP and IRF7 are ubiquitinated in these cells and that IRF7 preferentially interacts with ubiquitinated RIP. RIP is required for full activation of IRF7 by LMP1, with LMP1 stimulating the ubiquitination of RIP and its interaction with IRF7. Moreover, LMP1 stimulates RIP-dependent K63-linked ubiquitination of IRF7, which regulates protein function rather than proteasomal degradation of proteins. We suggest that RIP may serve as a general activator of IRF7, responding to and transmitting the signals from various stimuli, and that ubiquitination may be a general mechanism for enhancing the activity of IRF7. PMID:17296724

  7. Effects of Light Intensity Activity on CVD Risk Factors: A Systematic Review of Intervention Studies

    PubMed Central

    Batacan, Romeo B.; Duncan, Mitch J.; Dalbo, Vincent J.; Tucker, Patrick S.; Fenning, Andrew S.

    2015-01-01

    The effects of light intensity physical activity (LIPA) on cardiovascular disease (CVD) risk factors remain to be established. This review summarizes the effects of LIPA on CVD risk factors and CVD-related markers in adults. A systematic search of four electronic databases (PubMed, Academic Search Complete, SPORTDiscus, and CINAHL) examining LIPA and CVD risk factors (body composition, blood pressure, glucose, insulin, glycosylated hemoglobin, and lipid profile) and CVD-related markers (maximal oxygen uptake, heart rate, C-reactive protein, interleukin-6, tumor necrosis factor-alpha, and tumor necrosis factor receptors 1 and 2) published between 1970 and 2015 was performed on 15 March 2015. A total of 33 intervention studies examining the effect of LIPA on CVD risk factors and markers were included in this review. Results indicated that LIPA did not improve CVD risk factors and CVD-related markers in healthy individuals. LIPA was found to improve systolic and diastolic blood pressure in physically inactive populations with a medical condition. Reviewed studies show little support for the role of LIPA to reduce CVD risk factors. Many of the included studies were of low to fair study quality and used low doses of LIPA. Further studies are needed to establish the value of LIPA in reducing CVD risk. PMID:26543862

  8. Effects of Light Intensity Activity on CVD Risk Factors: A Systematic Review of Intervention Studies.

    PubMed

    Batacan, Romeo B; Duncan, Mitch J; Dalbo, Vincent J; Tucker, Patrick S; Fenning, Andrew S

    2015-01-01

    The effects of light intensity physical activity (LIPA) on cardiovascular disease (CVD) risk factors remain to be established. This review summarizes the effects of LIPA on CVD risk factors and CVD-related markers in adults. A systematic search of four electronic databases (PubMed, Academic Search Complete, SPORTDiscus, and CINAHL) examining LIPA and CVD risk factors (body composition, blood pressure, glucose, insulin, glycosylated hemoglobin, and lipid profile) and CVD-related markers (maximal oxygen uptake, heart rate, C-reactive protein, interleukin-6, tumor necrosis factor-alpha, and tumor necrosis factor receptors 1 and 2) published between 1970 and 2015 was performed on 15 March 2015. A total of 33 intervention studies examining the effect of LIPA on CVD risk factors and markers were included in this review. Results indicated that LIPA did not improve CVD risk factors and CVD-related markers in healthy individuals. LIPA was found to improve systolic and diastolic blood pressure in physically inactive populations with a medical condition. Reviewed studies show little support for the role of LIPA to reduce CVD risk factors. Many of the included studies were of low to fair study quality and used low doses of LIPA. Further studies are needed to establish the value of LIPA in reducing CVD risk. PMID:26543862

  9. Activation of transcription factor AP-1 and mitogen-activated protein kinases in aniline-induced splenic toxicity

    SciTech Connect

    Khan, M. Firoze . E-mail: mfkhan@utmb.edu; Kannan, Subburaj; Wang Jianling

    2006-01-15

    Signaling mechanisms in aniline-induced fibrogenic and/or tumorigenic response in the spleen are not known. Previous studies have shown that aniline exposure leads to iron accumulation and oxidative stress in the spleen, which may cause activation of redox-sensitive transcription factors and regulate the transcription of genes involved in fibrosis and/or tumorigenesis. To test this, male SD rats were treated with 0.5 mmol/kg/day aniline via drinking water for 30 days, and activation of transcription factor AP-1 was determined in the splenocyte nuclear extracts (NEs). AP-1 DNA-binding activity in the NEs of freshly isolated splenocytes from aniline-treated rats increased in comparison to the controls, as determined by electrophoretic mobility shift assay (EMSA). AP-1 binding was also determined in the NEs of cultured splenocytes (2 h and 24 h), which showed even a greater increase in binding activity at 2 h. The specificity of AP-1 binding for relevant DNA motifs was confirmed by competition EMSA and by supershift EMSA using antibodies specific to c-Jun and c-Fos. To further explore the signaling mechanisms in the AP-1 activation, phosphorylation patterns of mitogen-activated protein kinases (MAPKs) were pursued. Aniline exposure induced increases in the phosphorylation of the three classes of MAPKs: extracellular-signal-regulated kinase (ERK 1/2), c-Jun N-terminal kinase (JNK 1/2), and p38 MAPKs. Furthermore, TGF-{beta}1 mRNA expression showed a 3-fold increase in the spleens of aniline-treated rats. These observations suggest a strong association among MAPK phosphorylation, AP-1 activation, and enhanced TGF-{beta}1 gene expression. The observed sequence of events subsequent to aniline exposure could regulate genes that lead to fibrogenic and/or tumorigenic response in the spleen.

  10. Immunocytochemical Localization of Latent Transforming Growth Factor-B1 Activation by Stimulated Macrophages

    SciTech Connect

    Chong, Hyonkyong; Vodovotz, Yoram; Cox, G.W.; Barcellos-Hoff, M.H.

    1998-09-22

    Transforming growth factor-{beta}1 (TGF-{beta}) is secreted in a latent form consisting of mature TGF-{beta} noncovalently associated with its amino-terminal propeptide, which is called latency associated peptide (LAP). Biological activity depends upon the release of TGF-{beta} from the latent complex following extracellular activation, which appears to be the key regulatory mechanism controlling TGF-{beta} action. We have identified two events associated with latent TGF-{beta} (LTGF-{beta}) activation in vivo: increased immunoreactivity of certain antibodies that specifically detect TGF-{beta} concomitant with decreased immunoreactivity of antibodies to LAP. Macrophages stimulated in vitro with interferon-{gamma} and lipopolysaccharide reportedly activate LTGF-{beta} via cell membrane-bound protease activity. We show through dual immunostaining of paraformaldehyde-fixed macrophages that such physiological TGF-{beta} activation is accompanied by a loss of LAP immunoreactivity with concomitant revelation of TGF-{beta} epitopes. The induction of TGF-{beta} immunoreactivity colocalized with immunoreactive betaglycan/RIII in activated macrophages, suggesting that LTGF-{beta} activation occurs on the cell surface. Confocal microscopy of metabolically active macrophages incubated with antibodies to TGF-{beta} and betaglycan/RIII prior to fixation supported the localization of activation to the cell surface. The ability to specifically detect and localize LTGF-{beta} activation provides an important tool for studies of its regulation.

  11. Immunocytochemical localization of latent transforming growth factor-beta1 activation by stimulated macrophages

    NASA Technical Reports Server (NTRS)

    Chong, H.; Vodovotz, Y.; Cox, G. W.; Barcellos-Hoff, M. H.; Chatterjee, A. (Principal Investigator)

    1999-01-01

    Transforming growth factor-beta1 (TGF-beta) is secreted in a latent form consisting of mature TGF-beta noncovalently associated with its amino-terminal propeptide, which is called latency associated peptide (LAP). Biological activity depends upon the release of TGF-beta from the latent complex following extracellular activation, which appears to be the key regulatory mechanism controlling TGF-beta action. We have identified two events associated with latent TGF-beta (LTGF-beta) activation in vivo: increased immunoreactivity of certain antibodies that specifically detect TGF-beta concomitant with decreased immunoreactivity of antibodies to LAP. Macrophages stimulated in vitro with interferon-gamma and lipopolysaccharide reportedly activate LTGF-beta via cell membrane-bound protease activity. We show through dual immunostaining of paraformaldehyde-fixed macrophages that such physiological TGF-beta activation is accompanied by a loss of LAP immunoreactivity with concomitant revelation of TGF-beta epitopes. The induction of TGF-beta immunoreactivity colocalized with immunoreactive betaglycan/RIII in activated macrophages, suggesting that LTGF-beta activation occurs on the cell surface. Confocal microscopy of metabolically active macrophages incubated with antibodies to TGF-beta and betaglycan/RIII prior to fixation supported the localization of activation to the cell surface. The ability to specifically detect and localize LTGF-beta activation provides an important tool for studies of its regulation.

  12. Microglial activation induced by factor(s) contained in sera from Alzheimer-related ApoE genotypes.

    PubMed

    Lombardi, V R; García, M; Cacabelos, R

    1998-11-15

    Several factors that increase the likelihood of developing Alzheimer's disease (AD) have already been identified. A correct evaluation of these may contribute to a better understanding of the etiology of the disease. The risk of developing AD definitely increases with (a) age, (b) head injuries, (c) family history of AD or Down syndrome, (d) sex (higher prevalence of AD in women), (e) vascular disease, (f) exposure to environmental toxins, (g) infectious processes, or (h) changes in immune function, and recent advances in molecular genetics have suggested that genetic predisposition (i) can be considered one of the most important risk factors in the development of AD. A significant increase in the number of amyloid plaques in AD patients with an apolipoprotein E4 (ApoE) allele has been observed and the results of several genetic studies indicate that the etiology of this neurodegenerative disease is associated with the presence of the allele E4 of ApoE. A potential source of damage in the AD brain is an altered response triggered by microglial activation, which is associated with amyloid plaques. It has become evident that a dysregulation of cytokine release appears within lesions of many types of brain disorders including infection, trauma, stroke, and neurodegenerative diseases. Many studies have shown that microglia secrete both cytokines and cytotoxins and since reactive microglia appears in nearly every type of brain damage, it is likely that their secreted products ultimately help to determine the rate of damaged brain tissue. In this study, in vitro cell cultures were established to investigate the effect of different concentrations of human sera (2.5% and 10%) with specific ApoE genotypes from Alzheimer's and non-Alzheimer's subjects on ameboid and flat microglial cells obtained from neonatal rat hippocampi. Results show that a modulation in the proliferation and activation of microglial cells was obtained and that AD sera, mainly in the ApoE 3/4 and 4

  13. Physical activity and associated factors among young adults in Malaysia: an online exploratory survey.

    PubMed

    Sreeramareddy, C T; Majeed Kutty, N A; Razzaq Jabbar, M A; Boo, N Y

    2012-06-01

    The burden of non-communicable diseases is increasing in Malaysia. Insufficient Physical Activity, which is an important risk factor for non-communicable diseases, is less researched in Malaysia. We aimed to assess the level of physical activity and identify its correlates. An online survey was carried out during October, 2011 in the University Tunku Abdul Rahman by the opinion poll research committee. Young adults answered the Short International Physical Activity Questionnaire and a questionnaire about factors according to a socio-ecological model which was adapted from published studies. Metabolic equivalent (MET)-hours and MET-minutes were calculated. Physical activity was classified as sufficient when MET-minutes were > 840. The mean age of the 474 participants was 22.4 years (S.D. = 4.7), and 253 (53.4%) were females. Their mean and median of MET-hours of PA done during the previous seven days were 31.36 (S.D., 52.19) and 14.7 (IQR, 5.77-32.07), respectively. Physical activity done was sufficient among 242 (51.1%) participants. Using univariate analysis, being male, good self-rated health, positive intention, self-efficacy, perceived benefits, social support, and availability of facilities were associated with sufficient physical activity. Using multivariate analysis sufficient physical activity was associated with participants' intention (OR 0.75, 95% CIs 0.64, 0.88), self-efficacy (OR 0.91, 95% CIs 0.85, 0.97) and facility availability (OR 0.81, 95% CIs 0.73, 0.91). The proportion of participants with sufficient physical activity was low. Positive intention and self-efficacy associated with sufficient physical activity should be supported by availability of facilities and a safely-built environment. A nationwide survey about physical and associated socialecological factors is needed to design rational health promotion strategies. PMID:22890157

  14. Relationships between tumour necrosis factor, eicosanoids and platelet-activating factor as mediators of endotoxin-induced shock in mice.

    PubMed Central

    Myers, A. K.; Robey, J. W.; Price, R. M.

    1990-01-01

    1. The toxicity of intravenous recombinant human tumour necrosis factor (rhTNF), a TNF fragment (TNF114-130), endotoxin and combinations of rhTNF or TNF114-130 were tested in mice. Neither rhTNF nor TNF114-130 was lethal alone, but when combined with a non-lethal dose of endotoxin, rhTNF provoked dose-dependent mortality, as did higher doses of endotoxin alone. 2. Both the toxicity and the vasopermeability changes induced by endotoxin alone were blocked by the platelet-activating factor (PAF) antagonist BN52021, indomethacin or the dual cyclo-oxygenase/lipoxygenase inhibitor BW755C. 3. The lethality of the combined low dose endotoxin/rhTNF challenge was unaffected by pretreatment with BN52021, indomethacin or BW755C, or by treatment at 6 h intervals with BN52021 or BW755C. 4. The results of these studies suggest that TNF, a putative, early mediator of septic or endotoxin shock, cannot by itself mimic all of the effects of bacterial endotoxin in the model used in this study. Apparently, TNF works synergistically with other mediators whose release is stimulated by endotoxin. 5. The results also suggest that the mechanism of shock production by the rhTNF/endotoxin combination in mice is not dependent on the early stimulation of eicosanoid or PAF synthesis by rhTNF. PMID:2110016

  15. Engineering Students' Perceptions of Academic Activities and Support Services: Factors that Influence Their Academic Performance

    ERIC Educational Resources Information Center

    Amenkhienan, Charlotte A.; Kogan, Lori R.

    2004-01-01

    The present study, through the use of focus groups, identified the academic activities and support services perceived by engineering students as having a positive impact on their academic performance. The results suggest three primary factors: (a) individual effort and involvement, (b) peer interaction, and (c) faculty contact. Differences in…

  16. Factors Influencing Attitudes toward Sexual Activity among Early Adolescents in Japan

    ERIC Educational Resources Information Center

    Nagamatsu, Miyuki; Yamawaki, Niwako; Sato, Takeshi; Nakagawa, Aki; Saito, Hisako

    2013-01-01

    The purpose of this study was to examine factors influencing attitudes toward sexual activity among early adolescents in Japan. A total of 1,551 students aged 12 to 14 years at 4 junior high schools were divided into either a conservative or liberal group. Results of chi-square tests showed that the liberal group had higher percentages of students…

  17. DIETARY PROTEIN AND LACTOSE INCREASE TRANSLATION INITIATION FACTOR ACTIVATION AND TISSUE PROTEIN SYNTHESIS IN NEONATAL PIGS

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Protein synthesis and eukaryotic initiation factor (eIF) activation are increased in muscle and liver of pigs parenterally infused with amino acids and insulin. To examine the effects of enteral protein and carbohydrate on protein synthesis, pigs (n = 42, 1.7 kg body wt) were fed isocaloric milk die...

  18. EFFECT OF PHOTOPERIOD ON PLATELET-ACTIVATING FACTOR CONCENTRATION IN BOAR SPERMATOZOA

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Platelet-activating factor (PAF, 1-0-alkyl-2-acetyl-sn-glycero-3-phosphocholine) is an important phospholipid mediator shown to be involved in fertilization. We recently reported that boars with a 70% or higher fertility history have a higher concentration of PAF in their spermatozoa. In addition,...

  19. Are There Gender-Specific Risk Factors for Suicidal Activity among Patients with Schizophrenia and Depression?

    ERIC Educational Resources Information Center

    Kaplan, Kalman J.; Harrow, Martin; Faull, Robert N.

    2012-01-01

    Are there gender-specific risk factors for suicidal activity among patients with schizophrenia and depression? A total of 74 schizophrenia patients (51 men, 23 women) and 77 unipolar nonpsychotic depressed patients (26 men, 51 women) from the Chicago Follow-up Study were studied prospectively at 2 years posthospitalization and again at 7.5 years.…

  20. A Comparison of Motivational Factors and Barriers to Physical Activity among Traditional versus Nontraditional College Students

    ERIC Educational Resources Information Center

    Kulavic, Kimberly; Hultquist, Cherilyn N.; McLester, John R.

    2013-01-01

    Objective: To investigate the motivational factors and the barriers to physical activity (PA) in traditional college students (TS) and nontraditional college students (NTS) and determine if differences exist between these 2 groups. Participants: A total of 746 college students; 628 were TS (19.1 [plus-minus] 1.2 years), and 118 were NTS (31.2…

  1. Parent Perceptions of Factors Influencing After-School Physical Activity of Children with Autism Spectrum Disorders

    ERIC Educational Resources Information Center

    Obrusnikova, Iva; Miccinello, Dannielle L.

    2012-01-01

    The study assessed parental perceptions of the benefits of physical activity (PA) and the factors that influence participation of children with autism spectrum disorders in PA after school. Data were collected from 103 parents using an online open-ended questionnaire and focus-group interviews. Data were analyzed using a socioecological model.…

  2. Associations between Physical Activity and Health-Related Factors in a National Sample of College Students

    ERIC Educational Resources Information Center

    Dinger, Mary K.; Brittain, Danielle R.; Hutchinson, Susan R.

    2014-01-01

    Objective: To examine associations between meeting the current moderate to vigorous physical activity (MVPA) recommendation and health-related factors in a national sample of college students. Participants: Participants (N = 67,861) completed the National College Health Assessment II during the Fall 2008/Spring 2009 academic year. Methods:…

  3. Structured and Dynamic Disordered Domains Regulate the Activity of a Multifunctional Anti-σ Factor

    PubMed Central

    Herrou, Julien; Willett, Jonathan W.

    2015-01-01

    ABSTRACT The anti-σ factor NepR plays a central role in regulation of the general stress response (GSR) in alphaproteobacteria. This small protein has two known interaction partners: its cognate extracytoplasmic function (ECF) σ factor and the anti-anti-σ factor, PhyR. Stress-dependent phosphorylation of PhyR initiates a protein partner switch that promotes phospho-PhyR binding to NepR, which frees ECF σ to activate transcription of genes required for cell survival under adverse or fluctuating conditions. We have defined key functional roles for structured and intrinsically disordered domains of Caulobacter crescentus NepR in partner binding and activation of GSR transcription. We further demonstrate that NepR strongly stimulates the rate of PhyR phosphorylation in vitro and that this effect requires the structured and disordered domains of NepR. This result provides evidence for an additional layer of GSR regulation in which NepR directly influences activation of its binding partner, PhyR, as an anti-anti-σ factor. We conclude that structured and intrinsically disordered domains of NepR coordinately control multiple functions in the GSR signaling pathway, including core protein partner switch interactions and pathway activation by phosphorylation. PMID:26220965

  4. Factors of Participants and Blogs That Predict Blogging Activeness during Teaching Practice and Induction Year

    ERIC Educational Resources Information Center

    Luik, Piret; Taimalu, Merle

    2016-01-01

    The blog as a type of social software has been used in education for several years, and its positive effect in the field has been asserted in many studies. This study presents the factors of participants and blogs that predict blogging activeness during teaching practice and induction year. During the teaching practice and induction year all…

  5. The Association between Socio-Ecological Factors and Having an After-School Physical Activity Program

    ERIC Educational Resources Information Center

    Van Acker, Ragnar; De Bourdeaudhuij, Ilse; De Martelaer, Kristine; Seghers, Jan; De Cocker, Katrien; Cardon, Greet

    2012-01-01

    Background: After-school physical activity (PA) programs promote PA among youth. Few studies have used socio-ecological health models to identify barriers and facilitators of after-school PA programs. This study examined which socio-ecological factors are associated with having an after-school PA program. Methods: A questionnaire was administered…

  6. Adolescents Engaging in Risky Sexual Behavior: Sexual Activity and Associated Behavioral Risk Factors in Bolivian Adolescents

    ERIC Educational Resources Information Center

    Novilla, M. Lelinneth B.; Dearden, Kirk A.; Crookston, Benjamin T.; De La Cruz, Natalie; Hill, Susan; Torres, Scott B.

    2006-01-01

    This study describes the prevalence of risky sexual activities among Bolivian adolescents within the context of other behavioral factors that contribute to compromised health outcomes, unintended pregnancies, and sexually transmitted infections including HIV/AIDS. Data was collected from 576 adolescents, 13-18 years of age, from six schools in La…

  7. School Administrators' Perceptions of Factors that Influence Children's Active Travel to School

    ERIC Educational Resources Information Center

    Price, Anna E.; Pluto, Delores M.; Ogoussan, Olga; Banda, Jorge A.

    2011-01-01

    Background: Increasing children's active travel to school may be 1 strategy for addressing the growing prevalence of obesity among school age children. Using the School Travel Survey, we examined South Carolina school district leaders' perceptions of factors that influence elementary and middle school students walking to school. Methods: Frequency…

  8. Increasing Children's Physical Activity: Individual, Social, and Environmental Factors Associated with Walking to and from School

    ERIC Educational Resources Information Center

    Trapp, Georgina S. A.; Giles-Corti, Billie; Christian, Hayley E.; Bulsara, Max; Timperio, Anna F.; McCormack, Gavin R.; Villaneuva, Karen P.

    2012-01-01

    Background. Efforts to increase the prevalence of children's active school transport require evidence to inform the development of comprehensive interventions. This study used a multilevel ecological framework to investigate individual, social, and environmental factors associated with walking to and from school among elementary school-aged…

  9. Factors Affecting Instructional Development Activities of Selected K-12 Media Professionals.

    ERIC Educational Resources Information Center

    Turner, Philip M.; Martin, Nina N.

    The goal of this study was to establish relationships and/or determine differences between various factors and the extent of instructional development activity. Subjects were 43 graduates of a masters program in library education, currently employed as school media professionals at the K-12 level, who responded to a mailed questionnaire. Forty…

  10. Regulation of the yeast metabolic cycle by transcription factors with periodic activities

    PubMed Central

    2011-01-01

    Background When growing budding yeast under continuous, nutrient-limited conditions, over half of yeast genes exhibit periodic expression patterns. Periodicity can also be observed in respiration, in the timing of cell division, as well as in various metabolite levels. Knowing the transcription factors involved in the yeast metabolic cycle is helpful for determining the cascade of regulatory events that cause these patterns. Results Transcription factor activities were estimated by linear regression using time series and genome-wide transcription factor binding data. Time-translation matrices were estimated using least squares and were used to model the interactions between the most significant transcription factors. The top transcription factors have functions involving respiration, cell cycle events, amino acid metabolism and glycolysis. Key regulators of transitions between phases of the yeast metabolic cycle appear to be Hap1, Hap4, Gcn4, Msn4, Swi6 and Adr1. Conclusions Analysis of the phases at which transcription factor activities peak supports previous findings suggesting that the various cellular functions occur during specific phases of the yeast metabolic cycle. PMID:21992532

  11. Asynchronous combinatorial action of four regulatory factors activates Bcl11b for T cell commitment.

    PubMed

    Kueh, Hao Yuan; Yui, Mary A; Ng, Kenneth K H; Pease, Shirley S; Zhang, Jingli A; Damle, Sagar S; Freedman, George; Siu, Sharmayne; Bernstein, Irwin D; Elowitz, Michael B; Rothenberg, Ellen V

    2016-08-01

    During T cell development, multipotent progenitors relinquish competence for other fates and commit to the T cell lineage by turning on Bcl11b, which encodes a transcription factor. To clarify lineage commitment mechanisms, we followed developing T cells at the single-cell level using Bcl11b knock-in fluorescent reporter mice. Notch signaling and Notch-activated transcription factors collaborate to activate Bcl11b expression irrespectively of Notch-dependent proliferation. These inputs work via three distinct, asynchronous mechanisms: an early locus 'poising' function dependent on TCF-1 and GATA-3, a stochastic-permissivity function dependent on Notch signaling, and a separate amplitude-control function dependent on Runx1, a factor already present in multipotent progenitors. Despite their necessity for Bcl11b expression, these inputs act in a stage-specific manner, providing a multitiered mechanism for developmental gene regulation. PMID:27376470

  12. Influence of Environmental Factors on the Active Substance Production and Antioxidant Activity in Potentilla fruticosa L. and Its Quality Assessment.

    PubMed

    Liu, Wei; Yin, Dongxue; Li, Na; Hou, Xiaogai; Wang, Dongmei; Li, Dengwu; Liu, Jianjun

    2016-01-01

    Environmental factors may influence types and contents of active substances. This study investigated the influence of environmental factors on the active substance contents and antioxidant activity of Potentilla fruticosa L. from different regions of China. Also, HPLC fingerprint similarity analysis (SA) coupled with hierarchical cluster analysis (HCA) and discriminant analysis (DA) were further introduced for the accurate classification and quality assessment of P. fruticosa. The results showed that altitude was significantly and negatively correlated to the content of tannin (P < 0.05). Annual sunshine duration and altitude were significantly and positively correlated to the flavonoids content, rutin content and antioxidant activity (P < 0.05). Annual mean temperature was significantly and negatively correlated to the content of total phenolics, while altitude was significantly and positively correlated to the content of total phenolics (P < 0.05). Eight samples were unambiguously separated into three groups. Two types of discriminant functions with a 100% discrimination ratio were constructed. All data consistently supported the conclusion that P. fruticosa produced from Kangding, Sichuan Province had high quality among all samples, therefore, Kangding in Sichuan Province with favorable environmental conditions is recommended as a preferable production location. PMID:27373366

  13. Activation of nuclear factor-kappaB and not activator protein-1 in cellular response to nickel compounds.

    PubMed Central

    Huang, Yi; Davidson, Gerard; Li, Jingxia; Yan, Yan; Chen, Fei; Costa, Max; Chen, Lung Chi; Huang, Chuanshu

    2002-01-01

    The predominant exposure route for nickel compounds is by inhalation, and several studies have indicated the correlation between nickel exposure and respiratory cancers. The tumor-promoting effects of nickel compounds are thought to be associated with their transactivation of transcription factors. We have investigated the possible activation of activator protein-1 (AP-1) and nuclear factor KB (NF-kappaB) in mouse C141 epidermal cells and fibroblasts 3T3 and B82, and human bronchoepithelial BEAS-2B cells in response to nickel compound exposure. Our results show that NF-kappaB activity is induced by nickel exposure in 3T3 and BEAS-2B cells. Conversely, similar nickel treatment of these cells did not induce AP-1 activity, suggesting that nickel tumorigenesis occurs through NF-kappaB and not AP-1. We also investigated the role of NF-kappaB in the induction of Cap43 by nickel compounds using dominant negative mutant Ikappabeta kinase b-KM BEAS-2B transfectants. PMID:12426142

  14. Influence of Environmental Factors on the Active Substance Production and Antioxidant Activity in Potentilla fruticosa L. and Its Quality Assessment

    PubMed Central

    Liu, Wei; Yin, Dongxue; Li, Na; Hou, Xiaogai; Wang, Dongmei; Li, Dengwu; Liu, Jianjun

    2016-01-01

    Environmental factors may influence types and contents of active substances. This study investigated the influence of environmental factors on the active substance contents and antioxidant activity of Potentilla fruticosa L. from different regions of China. Also, HPLC fingerprint similarity analysis (SA) coupled with hierarchical cluster analysis (HCA) and discriminant analysis (DA) were further introduced for the accurate classification and quality assessment of P. fruticosa. The results showed that altitude was significantly and negatively correlated to the content of tannin (P < 0.05). Annual sunshine duration and altitude were significantly and positively correlated to the flavonoids content, rutin content and antioxidant activity (P < 0.05). Annual mean temperature was significantly and negatively correlated to the content of total phenolics, while altitude was significantly and positively correlated to the content of total phenolics (P < 0.05). Eight samples were unambiguously separated into three groups. Two types of discriminant functions with a 100% discrimination ratio were constructed. All data consistently supported the conclusion that P. fruticosa produced from Kangding, Sichuan Province had high quality among all samples, therefore, Kangding in Sichuan Province with favorable environmental conditions is recommended as a preferable production location. PMID:27373366

  15. Aberrant activation of nuclear factor of activated T cell 2 in lamina propria mononuclear cells in ulcerative colitis

    PubMed Central

    Shih, Tsung-Chieh; Hsieh, Sen-Yung; Hsieh, Yi-Yueh; Chen, Tse-Chin; Yeh, Chien-Yu; Lin, Chun-Jung; Lin, Deng-Yn; Chiu, Cheng-Tang

    2008-01-01

    AIM: To investigate the role of nuclear factor of activated T cell 2 (NFAT2), the major NFAT protein in peripheral T cells, in sustained T cell activation and intractable inflammation in human ulcerative colitis (UC). METHODS: We used two-dimensional gel-electrophoresis, immunohistochemistry, double immunohistochemical staining, and confocal microscopy to inspect the expression of NFAT2 in 107, 15, 48 and 5 cases of UC, Crohn’s disease (CD), non-specific colitis, and 5 healthy individuals, respectively. RESULTS: Up-regulation with profound nucleo-translocation/activation of NFAT2 of lamina propria mononuclear cells (LPMC) of colonic mucosa was found specifically in the affected colonic mucosa from patients with UC, as compared to CD or NC (P < 0.001, Kruskal-Wallis test). Nucleo-translocation/activation of NFAT2 primarily occurred in CD8+T, but was less prominent in CD4+ T cells or CD20+B cells. It was strongly associated with the disease activity, including endoscopic stage (τ = 0.2145, P = 0.0281) and histologic grade (τ = 0.4167, P < 0.001). CONCLUSION: We disclose for the first time the nucleo-translocation/activatin of NFAT2 in lamina propria mononuclear cells in ulcerative colitis. Activation of NFAT2 was specific for ulcerative colitis and highly associated with disease activity. Since activation of NFAT2 is implicated in an auto-regulatory positive feedback loop of sustained T-cell activation and NFAT proteins play key roles in the calcium/calcineurin signaling pathways, our results not only provide new insights into the mechanism for sustained intractable inflammation, but also suggest the calcium-calcineurin/NFAT pathway as a new therapeutic target for ulcerative colitis. PMID:18350607

  16. HSP90 inhibitors enhance differentiation and MITF (microphthalmia transcription factor) activity in osteoclast progenitors.

    PubMed

    van der Kraan, A Gabrielle J; Chai, Ryan C C; Singh, Preetinder P; Lang, Benjamin J; Xu, Jiake; Gillespie, Matthew T; Price, John T; Quinn, Julian M W

    2013-04-15

    The HSP90 (heat-shock protein 90) inhibitor 17-AAG (17-allylamino-demethoxygeldanamycin) increases osteoclast formation both in vitro and in vivo, an action that can enhance cancer invasion and growth in the bone microenvironment. The cellular mechanisms through which 17-AAG exerts this action are not understood. Thus we sought to clarify the actions of 17-AAG on osteoclasts and determine whether other HSP90 inhibitors had similar properties. We determined that 17-AAG and the structurally unrelated HSP90 inhibitors CCT018159 and NVP-AUY922 dose-dependently increased RANKL [receptor activator of NF-κB (nuclear factor κB) ligand]-stimulated osteoclastogenesis in mouse bone marrow and pre-osteoclastic RAW264.7 cell cultures. Moreover, 17-AAG also enhanced RANKL- and TNF (tumour necrosis factor)-elicited osteoclastogenesis, but did not affect RANKL-induced osteoclast survival, suggesting that only differentiation mechanisms are targeted. 17-AAG affected the later stages of progenitor maturation (after 3 days of incubation), whereas the osteoclast formation enhancer TGFβ (transforming growth factor β) acted prior to this, suggesting different mechanisms of action. In studies of RANKL-elicited intracellular signalling, 17-AAG treatment did not increase c-Fos or NFAT (nuclear factor of activated T-cells) c1 protein levels nor did 17-AAG increase activity in luciferase-based NF-κB- and NFAT-response assays. In contrast, 17-AAG treatment (and RANKL treatment) increased both MITF (microphthalmia-associated transcription factor) protein levels and MITF-dependent vATPase-d2 (V-type proton ATPase subunit d2) gene promoter activity. These results indicate that HSP90 inhibitors enhance osteoclast differentiation in an NFATc1-independent manner that involves elevated MITF levels and activity. PMID:23379601

  17. Development of scaling factors for the activated concrete of the KRR-2.

    PubMed

    Hong, Sang-Bum; Kang, Mun-Ja; Lee, Ki-Won; Chung, Un-Soo

    2009-01-01

    The biological shielding concrete of KRR-2 was activated by a thermal neutron reaction during the operation of the reactor, thus a variety of radionuclides were generated in the concrete. In order to verify the radioactivity for the final disposal of waste and to achieve a more efficient cutting of the concrete, the radioactivity inventories and distributions of the activated concrete were evaluated. The activity of gamma-emitting radionuclides was measured by using an HPGe detector. The beta-emitting radionuclides were measured by an oxidation/combustion method for (3)H and (14)C and a combined method of an extraction chromatography and a liquid scintillation for (55)Fe and (63)Ni. The dominant radioactive nuclides in the activated concrete were (3)H, (14)C, (55)Fe and (60)Co, and the maximum gamma activity was 105Bq/g at the surface around the thermal column. The specific activities of all the nuclides were found to decrease almost linearly on a logarithmic scale along the depth from the inner surface of the concrete. Equations for scaling factors were obtained by a linear regression of logarithms from the radioactivity data of (3)H/(60)Co, (14)C/(60)Co and (55)Fe/(60)Co nuclide pairs of the activated concrete. The scaling factors can be utilized for the estimation of beta radioactivity without the time consuming separation processes of the nuclides. PMID:19303787

  18. Genetic and environmental factors associated with plasma paraoxonase activity in healthy Chinese.

    PubMed

    Wang, Xiaoling; Huang, Jianfeng; Fan, Zhongjie; Su, Shaoyong; Zhao, Jiangong; Shen, Yan; Qiang, Boqin; Gu, Dongfeng

    2004-03-01

    To characterize factors associated with plasma paraoxonase 1 (PON1) activity in healthy Chinese Han population, we carried out the present study, not only taking into account the total set of frequent polymorphisms present in PON1 gene in the Chinese Han population, but also some environmental factors. The -107T/C polymorphism as well as drinking and smoking were independently associated with plasma PON1 activity, determined by rates of phenylacetate hydrolysis. The -107T/C polymorphism had the predominant effect and accounted for 16% of the observed variability in plasma PON1 activity. Alcohol consumption can modulate the effects of cigarette smoking on PON1 activity, and smoking only decreases PON1 activity in non-drinkers. The increase of PON1 activity by drinking or the inhibition of PON1 activity by smoking varies according to PON1 -107T/C genotypes, and the associations were only observed in -107T allele carriers. The results illustrate the complexity of polymorphism-phenotype associations. The observed interactions constitute concrete examples of gene-environment and environment-environment interactions. PMID:14767577

  19. MiT/TFE transcription factors are activated during mitophagy downstream of Parkin and Atg5

    PubMed Central

    Nezich, Catherine L.; Wang, Chunxin; Fogel, Adam I.

    2015-01-01

    The kinase PINK1 and ubiquitin ligase Parkin can regulate the selective elimination of damaged mitochondria through autophagy (mitophagy). Because of the demand on lysosomal function by mitophagy, we investigated a role for the transcription factor EB (TFEB), a master regulator of lysosomal biogenesis, in this process. We show that during mitophagy TFEB translocates to the nucleus and displays transcriptional activity in a PINK1- and Parkin-dependent manner. MITF and TFE3, homologues of TFEB belonging to the same microphthalmia/transcription factor E (MiT/TFE) family, are similarly regulated during mitophagy. Unlike TFEB translocation after starvation-induced mammalian target of rapamycin complex 1 inhibition, Parkin-mediated TFEB relocalization required Atg9A and Atg5 activity. However, constitutively active Rag guanosine triphosphatases prevented TFEB translocation during mitophagy, suggesting cross talk between these two MiT/TFE activation pathways. Analysis of clustered regularly interspaced short palindromic repeats–generated TFEB/MITF/TFE3/TFEC single, double, and triple knockout cell lines revealed that these proteins partly facilitate Parkin-mediated mitochondrial clearance. These results illuminate a pathway leading to MiT/TFE transcription factor activation, distinct from starvation-induced autophagy, which occurs during mitophagy. PMID:26240184

  20. Activation of the orphan nuclear receptor steroidogenic factor 1 by oxysterols

    PubMed Central

    Lala, Deepak S.; Syka, Peter M.; Lazarchik, Steven B.; Mangelsdorf, David J.; Parker, Keith L.; Heyman, Richard A.

    1997-01-01

    Steroidogenic factor 1 (SF-1), an orphan member of the intracellular receptor superfamily, plays an essential role in the development and function of multiple endocrine organs. It is expressed in all steroidogenic tissues where it regulates the P450 steroidogenic genes to generate physiologically active steroids. Although many of the functions of SF-1 in vivo have been defined, an unresolved question is whether a ligand modulates its transcriptional activity. Here, we show that 25-, 26-, or 27-hydroxycholesterol, known suppressors of cholesterol biosynthesis, enhance SF-1-dependent transcriptional activity. This activation is dependent upon the SF-1 activation function domain, and, is specific for SF-1 as several other receptors do not respond to these molecules. The oxysterols activate at concentrations comparable to those previously shown to inhibit cholesterol biosynthesis, and, can be derived from cholesterol by P450c27, an enzyme expressed within steroidogenic tissues. Recent studies have shown that the nuclear receptor LXR also is activated by oxysterols. We demonstrate that different oxysterols differ in their rank order potency for these two receptors, with 25-hydroxycholesterol preferentially activating SF-1 and 22(R)-hydroxycholesterol preferentially activating LXR. These results suggest that specific oxysterols may mediate transcriptional activation via different intracellular receptors. Finally, ligand-dependent transactivation of SF-1 by oxysterols may play an important role in enhancing steroidogenesis in vivo. PMID:9144161

  1. Platelet-derived growth factor (PDGF) stimulates glycogen synthase activity in 3T3 cells

    SciTech Connect

    Chan, C.P.; Bowen-Pope, D.F.; Ross, R.; Krebs, E.G.

    1986-05-01

    Hormonal regulation of glycogen synthase, an enzyme that can be phosphorylated on multiple sites, is often associated with changes in its phosphorylation state. Enzyme activation is conventionally monitored by determining the synthase activity ratio ((activity in the absence of glucose 6-P)/(activity in the presence of glucose 6-P)). Insulin causes an activation of glycogen synthase with a concomitant decrease in its phosphate content. In a previous report, the authors showed that epidermal growth factor (EGF) increases the glycogen synthase activity ratio in Swiss 3T3 cells. The time and dose-dependency of this response was similar to that of insulin. Their recent results indicate that PDGF also stimulates glycogen synthase activity. Enzyme activation was maximal after 30 min. of incubation with PDGF; the time course observed was very similar to that with insulin and EGF. At 1 ng/ml (0.03nM), PDGF caused a maximal stimulation of 4-fold in synthase activity ratio. Half-maximal stimulation was observed at 0.2 ng/ml (6 pM). The time course of changes in enzyme activity ratio closely followed that of /sup 125/I-PDGF binding. The authors data suggest that PDGF, as well as EFG and insulin, may be important in regulating glycogen synthesis through phosphorylation/dephosphorylation mechanisms.

  2. Differential Activation of Insulin Receptor Substrates 1 and 2 by Insulin-Like Growth Factor-Activated Insulin Receptors▿

    PubMed Central

    Denley, Adam; Carroll, Julie M.; Brierley, Gemma V.; Cosgrove, Leah; Wallace, John; Forbes, Briony; Roberts, Charles T.

    2007-01-01

    The insulin-like growth factors (insulin-like growth factor I [IGF-I] and IGF-II) exert important effects on growth, development, and differentiation through the IGF-I receptor (IGF-IR) transmembrane tyrosine kinase. The insulin receptor (IR) is structurally related to the IGF-IR, and at high concentrations, the IGFs can also activate the IR, in spite of their generally low affinity for the latter. Two mechanisms that facilitate cross talk between the IGF ligands and the IR at physiological concentrations have been described. The first of these is the existence of an alternatively spliced IR variant that exhibits high affinity for IGF-II as well as for insulin. A second phenomenon is the ability of hybrid receptors comprised of IGF-IR and IR hemireceptors to bind IGFs, but not insulin. To date, however, direct activation of an IR holoreceptor by IGF-I at physiological levels has not been demonstrated. We have now found that IGF-I can function through both splice variants of the IR, in spite of low affinity, to specifically activate IRS-2 to levels similar to those seen with equivalent concentrations of insulin or IGF-II. The specific activation of IRS-2 by IGF-I through the IR does not result in activation of the extracellular signal-regulated kinase pathway but does induce delayed low-level activation of the phosphatidylinositol 3-kinase pathway and biological effects such as enhanced cell viability and protection from apoptosis. These findings suggest that IGF-I can function directly through the IR and that the observed effects of IGF-I on insulin sensitivity may be the result of direct facilitation of insulin action by IGF-I costimulation of the IR in insulin target tissues. PMID:17325037

  3. Stable inhibitory activity of regulatory T cells requires the transcription factor Helios.

    PubMed

    Kim, Hye-Jung; Barnitz, R Anthony; Kreslavsky, Taras; Brown, Flavian D; Moffett, Howell; Lemieux, Madeleine E; Kaygusuz, Yasemin; Meissner, Torsten; Holderried, Tobias A W; Chan, Susan; Kastner, Philippe; Haining, W Nicholas; Cantor, Harvey

    2015-10-16

    The maintenance of immune homeostasis requires regulatory T cells (T(regs)). Given their intrinsic self-reactivity, T(regs) must stably maintain a suppressive phenotype to avoid autoimmunity. We report that impaired expression of the transcription factor (TF) Helios by FoxP3(+) CD4 and Qa-1-restricted CD8 T(regs) results in defective regulatory activity and autoimmunity in mice. Helios-deficient T(regs) develop an unstable phenotype during inflammatory responses characterized by reduced FoxP3 expression and increased effector cytokine expression secondary to diminished activation of the STAT5 pathway. CD8 T(regs) also require Helios-dependent STAT5 activation for survival and to prevent terminal T cell differentiation. The definition of Helios as a key transcription factor that stabilizes T(regs) in the face of inflammatory responses provides a genetic explanation for a core property of T(regs). PMID:26472910

  4. Transgenic songbirds with suppressed or enhanced activity of CREB transcription factor.

    PubMed

    Abe, Kentaro; Matsui, Sumiko; Watanabe, Dai

    2015-06-16

    Songbirds postnatally develop their skill to utter and to perceive a vocal signal for communication. How genetic and environmental influences act in concert to regulate the development of such skill is not fully understood. Here, we report the phenotype of transgenic songbirds with altered intrinsic activity of cAMP response element-binding protein (CREB) transcription factor. By viral vector-mediated modification of genomic DNA, we established germ line-transmitted lines of zebra finches, which exhibited enhanced or suppressed activity of CREB. Although intrinsically acquired vocalizations or their hearing ability were not affected, the transgenic birds showed reduced vocal learning quality of their own songs and impaired audio-memory formation against conspecific songs. These results thus demonstrate that appropriate activity of CREB is necessary for the postnatal acquisition of learned behavior in songbirds, and the CREB transgenic birds offer a unique opportunity to separately manipulate both genetic and environmental factors that impinge on the postnatal song learning. PMID:26048905

  5. Cohesion Establishment Factors Stimulate Endonuclease Activity of hFen1 Independently and Cooperatively.

    PubMed

    Kim, Do-Hyung; Kim, Jeong-Hoon; Park, Byoung Chul; Cho, Sayeon; Park, Sung Goo

    2015-10-01

    Human Fen1 protein (hFen1) plays an important role in Okazaki fragment processing by cleaving the flap structure at the junction between single-stranded (ss) DNA and doublestranded (ds) DNA, an intermediate formed during Okazaki fragment processing, resulting in ligatable nicked dsDNA. It was reported that hChlR1, a member of the cohesion establishment factor family, stimulates hFen1 nuclease activity regardless of its ATPase activity. In this study, we found that cohesion establishment factors cooperatively stimulate endonuclease activity of hFen1 in in vivo mimic condition, including replication protein-A-coated DNA and high salt. Our findings are helpful to explain how a DNA replication machinery larger than the cohesion complex goes through the cohesin ring structure on DNA during S phase in the cell cycle. PMID:26032365

  6. Conformationally restricted elongation factor G retains GTPase activity but is inactive in translocation on the ribosome.

    PubMed

    Peske, F; Matassova, N B; Savelsbergh, A; Rodnina, M V; Wintermeyer, W

    2000-08-01

    Elongation factor G (EF-G) from Escherichia coli is a large, five-domain GTPase that promotes tRNA translocation on the ribosome. Full activity requires GTP hydrolysis, suggesting that a conformational change of the factor is important for function. To restrict the intramolecular mobility, two cysteine residues were engineered into domains 1 and 5 of EF-G that spontaneously formed a disulfide cross-link. Cross-linked EF-G retained GTPase activity on the ribosome, whereas it was inactive in translocation as well as in turnover. Both activities were restored when the cross-link was reversed by reduction. These results strongly argue against a GTPase switch-type model of EF-G function and demonstrate that conformational mobility is an absolute requirement for EF-G function on the ribosome. PMID:10983996

  7. Seizure-Precipitating Factors in Relation to medical Recommendations: Especially Those Limiting Physical Activity.

    PubMed

    Stanuszek, Agnieszka; Wnękowicz, Emilia; Kuźniar, Ewelina; Krakowska, Karolina; Gergont, Aleksandra; Kaciński, Marek

    2015-10-01

    Identification of factors precipitating epileptic seizures should always have practical implications and should always result in special recommendations given to patients. The purpose of our study is to analyze the relation between seizure-triggering factors and restrictive recommendations involving limitation of physical activity in particular. The research group consisted of 407 children hospitalized due to seizures. Their precipitants were identified in 27.5% of the patients. The most common included infection/fever, stress, and flashing lights. Although sport was documented as a precipitant in only 3.4% of all children, 8.1% of the investigated group were recommended to limit physical activity. As some episodes of epileptic seizures are reported to be provoked by sport, multiple restrictions are imposed on children. In the light of the worldwide academic literature and the present study, the recommendation of limiting sports activity is no longer supported. PMID:25808459

  8. Sexual Activity as a Risk Factor for the Spontaneous Rupture of Cerebral Aneurysms.

    PubMed

    Blanke-Roeser, Constantin; Matschke, Jakob; Püschel, Klaus

    2016-06-01

    Subarachnoid hemorrhages from ruptured cerebral aneurysms have a high clinical relevance and often lead to death. Approximately 2% to 5% of the people worldwide, even of younger age, are said to have aneurysms at cerebral arteries. In many cases, they remain clinically unapparent for decades. However, there are numerous risk factors for the rupture of an aneurysm, including temporary raises of the blood pressure. Such changes of the blood pressure can be induced even by several everyday behaviors. For example, any sort of sexual activities may cause extensive raises of the blood pressure because of several physical and psychological factors. The term "sexual activity" covers sexual intercourse as well as masturbation. In this article, the remarkable case of a 24-year-old woman with a ruptured cerebral aneurysm in the context of masturbation is presented. It is discussed with respect to the possible pathophysiological effects of sexual activity on cerebral aneurysms. PMID:27043460

  9. Changes in nonnutritional factors and antioxidant activity during germination of nonconventional legumes.

    PubMed

    Aguilera, Yolanda; Díaz, María Felicia; Jiménez, Tania; Benítez, Vanesa; Herrera, Teresa; Cuadrado, Carmen; Martín-Pedrosa, Mercedes; Martín-Cabrejas, María A

    2013-08-28

    The present study describes the effects of germination on nonnutritional factors and antioxidant activity in the nonconventional legumes Vigna unguiculata (cowpea), Canavalia ensiformis (jack bean), Lablab purpureus (dolichos), and Stizolobium niveum (mucuna). Protease inhibitors and lectins were detected in raw legumes and were significantly decreased during the germination. Regarding total and individual inositol phosphates (IP5-IP3), important reductions of IP6 and high increases in the rest of inositol phosphates were also detected during this process. In addition, total phenols, catechins, and proanthocyanidins increased, accompanied by an overall rise of antioxidant activity (79.6 μmol of Trolox/g of DW in the case of mucuna). Germination has been shown to be a very effective process to reduce nonnutritional factors and increase bioactive phenolic compounds and antioxidant activities of these nonconventional legumes. For this reason, they could be used as ingredients to obtain high-value legume flours for food formulation. PMID:23909570

  10. Tumour necrosis factor-alpha and interferon-gamma synergistically activate the RANTES promoter through nuclear factor kappaB and interferon regulatory factor 1 (IRF-1) transcription factors.

    PubMed

    Lee, A H; Hong, J H; Seo, Y S

    2000-08-15

    Inflammatory cytokines such as tumour necrosis factor-alpha (TNF-alpha) and interferon-gamma (IFN-gamma) synergistically activate expression of the RANTES (regulated upon activation, normal T-cell expressed and secreted) gene, which plays a crucial role in the chemoattraction of leukocytes during the inflammatory response. To understand at the molecular level the mechanism by which the two cytokines activate RANTES gene expression, we determined the requirement of cis-acting elements in the RANTES promoter and trans-acting factors. The murine RANTES promoter contained one putative interferon regulatory factor, IRF, and three putative nuclear factor kappaB (NF-kappaB) binding sites. Specific destruction of the IRF binding site and one of the three NF-kappaB binding sites abolished the inducibility of promoter activity by IFN-gamma and TNF-alpha, respectively. In contrast, mutation of the other two putative NF-kappaB binding sites did not affect RANTES promoter activity significantly. In addition, the RANTES promoter was stimulated by co-transfection of plasmids that expressed either p65, an NF-kappaB family protein, or the IRF-1 transcription factor. RANTES promoters with mutations in the NF-kappaB or IRF binding sites were not stimulated by p65 or IRF-1 expression, respectively. In electrophoretic mobility-shift and immunologic assays, we showed that IRF-1 was induced after cells were treated with IFN-gamma and that NF-kappaB was activated by TNF-alpha treatment. These results demonstrate that both NF-kappaB and IRF-1 transcription factors mediate the induction of RANTES expression via their cognate cis-acting elements when cells are stimulated by TNF-alpha and IFN-gamma. PMID:10926836

  11. Environmental and policy factors related to physical activity in rural white women.

    PubMed

    Eyler, Amy A; Vest, Joshua R

    2002-01-01

    Physical activity is an important aspect of health promotion and disease prevention. However, women often have lower rates of physical activity than men. The purpose of this study was to identify environmental and policy determinants to physical activity among rural white women. Six focus groups were conducted with women aged 20-50 years who were not currently regular exercisers. Women reported that the social environment had a strong impact on physical activity level. Factors of the social environment included guilt, family responsibility, and social support. Environmental and policy barriers such as lack of access to places to exercise and safety concerns were also discussed. Intervention suggestions included family exercise and work-site programs. Information gained from this study can be used to fuel further research and inform future physical activity interventions. PMID:12487144

  12. Silodosin Inhibits Noradrenaline-Activated Transcription Factors Elk1 and SRF in Human Prostate Smooth Muscle

    PubMed Central

    Hennenberg, Martin; Strittmatter, Frank; Beckmann, Christer; Rutz, Beata; Füllhase, Claudius; Waidelich, Raphaela; Montorsi, Francesco; Hedlund, Petter; Andersson, Karl-Erik; Stief, Christian G.; Gratzke, Christian

    2012-01-01

    Background The transcription factors Elk1 and serum response factor (SRF) are central regulators of cell cycle and phenotype in various cell types. Elk1 is activated by phosphorylation (serine-383), while activation of SRF requires its co-factor, myocardin. Activation of Elk1 and SRF results in binding to specific DNA sequences in promoter regions, and may be induced by adrenergic receptor activation in different organs. Objective To examine the effects of adrenergic stimulation on Elk1 and SRF in the human prostate and the ability of the highly selective α1A-adrenoceptor antagonist, silodosin, on transcription factor activation. Methods Prostate tissue was obtained from patients undergoing radical prostatectomy. Expression of Elk1, SRF, and myocardin was estimated by Western blot and immunohistochemistry. Colocalizations were studied by double immunofluorescence staining. Noradrenaline- (NA-) and phenylephrine- (PE-) induced phosphorylation of Elk1 was assessed by Western blot analysis using a phospho-specific antibody. NA-induced activation of Elk1 and SRF was investigated by electrophoretic mobility shift assay (EMSA). Results Immunoreactivity for Elk1, SRF, and myocardin was observed in stromal cells of tissues from each patient. In fluorescence stainings, SRF colocalized with myocardin and α-smooth muscle actin (αSMA). Stimulation of prostate tissues with PE (10 µM) or NA (30 µM) increased the phosphorylation of Elk1 at serine-383. NA-induced Elk1 activation was confirmed by EMSA, where a NA-induced binding of Elk1 to the DNA sequence TTTGCAAAATGCAGGAATTGTTTTCACAGT was observed. Similarly, NA caused SRF binding to the SRF-specific DNA sequence CCATATTAGGCCATATTAGG. Application of silodosin (3 µM) to prostate tissues reduced the activity of Elk1 and SRF in NA-stimulated tissues. Conclusions Silodosin blocks the activation of the two transcription factors, Elk1 and SRF, which is induced by noradrenaline in the human prostate. A role of α1-adrenoceptors

  13. Stimulation of LDL receptor activity in Hep-G2 cells by a serum factor(s)

    SciTech Connect

    Ellsworth, J.L.; Brown, C.; Cooper, A.D.

    1988-05-01

    The regulation of low-density lipoprotein (LDL) receptor activity in the human hepatoma cell line Hep-G2 by serum components was examined. Incubation of dense monolayers of Hep-G2 cells with fresh medium containing 10% fetal calf serum (FM) produced a time-dependent increase in LDL receptor activity. Uptake and degradation of 125I-LDL was stimulated two- to four-fold, as compared with that of Hep-G2 cells cultured in the same media in which they had been grown to confluence (CM); the maximal 125I-LDL uptake plus degradation increased from 0.2 microgram/mg cell protein/4 h to 0.8 microgram/mg cell protein/4 h. In addition, a two-fold increase in cell surface binding of 125I-LDL to Hep-G2 cells was observed when binding was measured at 4 degrees C. There was no change in the apparent Kd. The stimulation of LDL receptor activity was suppressed in a concentration-dependent manner by the addition of cholesterol, as LDL, to the cell medium. In contrast to the stimulation of LDL receptor activity, FM did not affect the uptake or degradation of 125I-asialoorosomucoid. Addition of FM increased the protein content per dish, and DNA synthesis was stimulated approximately five-fold, as measured by (3H)thymidine incorporation into DNA; however, the cell number did not change. Cellular cholesterol biosynthesis was also stimulated by FM; (14C)acetate incorporation into unesterified and esterified cholesterol was increased approximately five-fold. Incubation of Hep-G2 cells with high-density lipoproteins (200 micrograms protein/ml) or albumin (8.0 mg/ml) in the absence of the serum factor did not significantly increase the total processed 125I-LDL. Stimulation of LDL receptor activity was dependent on a heat-stable, nondialyzable serum component that eluted in the inclusion volume of a Sephadex G-75 column.

  14. Contribution of Amino Acid Region 659−663 of Factor Va Heavy Chain to the Activity of Factor Xa within Prothrombinase†,‡

    PubMed Central

    2010-01-01

    Factor Va, the cofactor of prothrombinase, is composed of heavy and light chains associated noncovalently in the presence of divalent metal ions. The COOH-terminal region of the heavy chain contains acidic amino acid clusters that are important for cofactor activity. In this work, we have investigated the role of amino acid region 659−663, which contains five consecutive acidic amino acid residues, by site-directed mutagenesis. We have generated factor V molecules in which all residues were mutated to either lysine (factor V5K) or alanine (factor V5A). We have also constructed a mutant molecule with this region deleted (factor VΔ659−663). The recombinant molecules along with wild-type factor V (factor VWT) were transiently expressed in mammalian cells, purified, and assessed for cofactor activity. Two-stage clotting assays revealed that the mutant molecules had reduced clotting activities compared to that of factor VaWT. Kinetic analyses of prothrombinase assembled with the mutant molecules demonstrated diminished kcat values, while the affinity of all mutant molecules for factor Xa was similar to that for factor VaWT. Gel electrophoresis analyses of plasma-derived and recombinant mutant prothrombin activation demonstrated delayed cleavage of prothrombin at both Arg320 and Arg271 by prothrombinase assembled with the mutant molecules, resulting in meizothrombin lingering throughout the activation process. These results were confirmed after analysis of the cleavage of FPR-meizothrombin. Our findings provide new insights into the structural contribution of the acidic COOH-terminal region of factor Va heavy chain to factor Xa activity within prothrombinase and demonstrate that amino acid region 659−663 from the heavy chain of the cofactor contributes to the regulation of the rate of cleavage of prothrombin by prothrombinase. PMID:20722419

  15. Adherence to Physical Activity Recommendations and Its Associated Factors: An Interregional Population-Based Study

    PubMed Central

    Alkerwi, Ala’a; Schuh, Barbara; Sauvageot, Nicolas; Zannad, Faiez; Olivier, Arnaud; Guillaume, Michèle; Albert, Adelin; Larsson, Charlotte A.

    2015-01-01

    Background Though the influence of physical activity in preventing cardiovascular diseases is well documented, only a few comparative studies have determined the degree of adherence to physical activity recommendations among populations and identified the demographic, socioeco-nomic, behavioural and health-related factors associated with good compliance. Design and methods Cross-sectional interregional NESCaV survey of 3133 subjects compared three populations, Luxembourg, Lorraine (France) and Wallonia (Belgium), by using the International Physical Activity Questionnaire. Age and gender prevalence rates of physical activity were standardized to the European population. Results The likelihood to meet the recommendations was higher in Luxembourg, after adjustment for age, gender, education, employment, weight status, morbidity score, health perception and level of importance attributed to the practice of physical activity (P<0.0001). The odds for meeting the recommendations were significantly higher among those with secondary than tertiary education. Compared to good self-health perception, subjects with poor or fair self-perceived health were less likely to meet the recommendations; this also applied to those attributing little or enough importance to physical activity compared with great importance. Conclusions Region, education, self-perceived health and perception of importance of physical activity were emerged as independent determinants of meeting the recommendations. Awareness of the positive health effects of physical activity might thus be crucial for motivating the people to become more active. Further research is needed to explore potential region-specific factors which might explain the difference in population behaviours with respect to physical activity. Significance for public health This manuscript describes the prevalence of physical activity level of adult population from three European regions, Luxembourg, Wallonia and Lorraine, based on the

  16. Reduction of contact activation related fibrinolytic activity in factor XII deficient patients. Further evidence for the role of the contact system in fibrinolysis in vivo.

    PubMed Central

    Levi, M; Hack, C E; de Boer, J P; Brandjes, D P; Büller, H R; ten Cate, J W

    1991-01-01

    In this study the contribution of activation of the contact system to activation of the fibrinolytic system in vivo was investigated in healthy volunteers and in factor XII deficient patients. The plasminogen activating activity in plasma from healthy volunteers after infusion of desamino D-arginine vasopressin (DDAVP) was only partially blocked (for 77%) with specific antibodies to tissue-type plasminogen activator and urokinase type plasminogen activator. The residual activity could be quenched by a monoclonal antibody that inhibits factor XII activity and was not present in patients with a factor XII deficiency. The formation of plasmin upon the DDAVP stimulus as reflected by circulating plasmin-alpha 2-antiplasmin complexes was lower in factor XII deficient patients than in healthy volunteers. Activation of the contact system occurred after DDAVP infusion in healthy volunteers and was absent in factor XII deficient patients. These results indicate that DDAVP induces a plasminogen activating activity that is partially dependent on activation of the contact system and that contributes to the overall fibrinolytic activity as indicated by the formation of plasmin-alpha 2-antiplasmin complexes. This fibrinolytic activity is impaired in factor XII deficient patients which may explain the occurrence of thromboembolic complications in these patients. Images PMID:1833421

  17. On involvement of transcription factors nuclear factor kappa-light-chain-enhancer of activated B cells, activator protein-1 and signal transducer and activator of transcription-3 in photodynamic therapy-induced death of crayfish neurons and satellite glial cells.

    PubMed

    Berezhnaya, Elena; Neginskaya, Marya; Kovaleva, Vera; Sharifulina, Svetlana; Ischenko, Irina; Komandirov, Maxim; Rudkovskii, Mikhail; Uzdensky, Anatoly B

    2015-07-01

    Photodynamic therapy (PDT) is currently used in the treatment of brain tumors. However, not only malignant cells but also neighboring normal neurons and glial cells are damaged during PDT. In order to study the potential role of transcription factors-nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB), activator protein (AP-1), and signal transducer and activator of transcription-3 (STAT-3)-in photodynamic injury of normal neurons and glia, we photosensitized the isolated crayfish mechanoreceptor consisting of a single sensory neuron enveloped by glial cells. Application of different inhibitors and activators showed that transcription factors NF-κB (inhibitors caffeic acid phenethyl ester and parthenolide, activator betulinic acid), AP-1 (inhibitor SR11302), and STAT-3 (inhibitors stattic and cucurbitacine) influenced PDT-induced death and survival of neurons and glial cells in different ways. These experiments indicated involvement of NF-κB in PDT-induced necrosis of neurons and apoptosis of glial cells. However, in glial cells, it played the antinecrotic role. AP-1 was not involved in PDT-induced necrosis of neurons and glia, but mediated glial apoptosis. STAT-3 was involved in PDT-induced apoptosis of glial cells and necrosis of neurons and glia. Therefore, signaling pathways that regulate cell death and survival in neurons and glial cells are different. Using various inhibitors or activators of transcription factors, one can differently influence the sensitivity and resistance of neurons and glial cells to PDT. PMID:26160345

  18. On involvement of transcription factors nuclear factor kappa-light-chain-enhancer of activated B cells, activator protein-1 and signal transducer and activator of transcription-3 in photodynamic therapy-induced death of crayfish neurons and satellite glial cells

    NASA Astrophysics Data System (ADS)

    Berezhnaya, Elena; Neginskaya, Marya; Kovaleva, Vera; Sharifulina, Svetlana; Ischenko, Irina; Komandirov, Maxim; Rudkovskii, Mikhail; Uzdensky, Anatoly B.

    2015-07-01

    Photodynamic therapy (PDT) is currently used in the treatment of brain tumors. However, not only malignant cells but also neighboring normal neurons and glial cells are damaged during PDT. In order to study the potential role of transcription factors-nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB), activator protein (AP-1), and signal transducer and activator of transcription-3 (STAT-3)-in photodynamic injury of normal neurons and glia, we photosensitized the isolated crayfish mechanoreceptor consisting of a single sensory neuron enveloped by glial cells. Application of different inhibitors and activators showed that transcription factors NF-κB (inhibitors caffeic acid phenethyl ester and parthenolide, activator betulinic acid), AP-1 (inhibitor SR11302), and STAT-3 (inhibitors stattic and cucurbitacine) influenced PDT-induced death and survival of neurons and glial cells in different ways. These experiments indicated involvement of NF-κB in PDT-induced necrosis of neurons and apoptosis of glial cells. However, in glial cells, it played the antinecrotic role. AP-1 was not involved in PDT-induced necrosis of neurons and glia, but mediated glial apoptosis. STAT-3 was involved in PDT-induced apoptosis of glial cells and necrosis of neurons and glia. Therefore, signaling pathways that regulate cell death and survival in neurons and glial cells are different. Using various inhibitors or activators of transcription factors, one can differently influence the sensitivity and resistance of neurons and glial cells to PDT.

  19. SUMOylation can regulate the activity of ETS-like transcription factor 4.

    PubMed

    Kaikkonen, Sanna; Makkonen, Harri; Rytinki, Miia; Palvimo, Jorma J

    2010-08-01

    ETS-like transcription factor 4 (ELK4) (a.k.a. serum response factor accessory protein 1) belongs to the ternary complex factor (TCF) subfamily of E twenty-six (ETS) domain transcription factors. Compared to the other TCF subfamily members, ELK1 and ELK3 (NET), there is limited information of the mechanisms regulating the ELK4 activity. Here, we show that the ELK4 can be covalently modified (SUMOylated) by small ubiquitin-related modifier (SUMO) 1 protein, an important regulator of signaling and transcription. SUMOylation of ELK4 was reversed by SUMO-specific proteases (SENP) 1 and 2 and stimulated by SUMO E3 ligase PIAS3. Conserved lysine residue 167 that is located in the NET inhibitory domain of ELK4 was identified as the main site of SUMO-1 conjugation. Interestingly, mutation of the K167 disrupting the SUMOylation markedly enhanced the transcriptional activity of the ELK4, but weakened its repressive function on c-fos promoter. In conclusion, our results suggest that covalent modification by SUMO-1 can regulate the activity of ELK4, contributing to the transcriptional repression by the ELK4. PMID:20637912

  20. Mutational analysis of acute-phase response factor/Stat3 activation and dimerization.

    PubMed Central

    Sasse, J; Hemmann, U; Schwartz, C; Schniertshauer, U; Heesel, B; Landgraf, C; Schneider-Mergener, J; Heinrich, P C; Horn, F

    1997-01-01

    Signal transducer and transcription (STAT) factors are activated by tyrosine phosphorylation in response to a variety of cytokines, growth factors, and hormones. Tyrosine phosphorylation triggers dimerization and nuclear translocation of these transcription factors. In this study, the functional role of carboxy-terminal portions of the STAT family member acute-phase response factor/Stat3 in activation, dimerization, and transactivating potential was analyzed. We demonstrate that truncation of 55 carboxy-terminal amino acids causes constitutive activation of Stat3 in COS-7 cells, as is known for the Stat3 isoform Stat3beta. By the use of deletion and point mutants, it is shown that both carboxy- and amino-terminal portions of Stat3 are involved in this phenomenon. Dimerization of Stat3 was blocked by point mutations affecting residues both in the vicinity of the tyrosine phosphorylation site (Y705) and more distant from this site, suggesting that multiple interactions are involved in dimer formation. Furthermore, by reporter gene assays we demonstrate that carboxy-terminally truncated Stat3 proteins are incapable of transactivating an interleukin-6-responsive promoter in COS-7 cells. In HepG2 hepatoma cells, however, these truncated Stat3 forms transmit signals from the interleukin-6 signal transducer gp130 equally well as does full-length Stat3. We conclude that, dependent on the cell type, different mechanisms allow Stat3 to regulate target gene transcription either with or without involvement of its putative carboxy-terminal transactivation domain. PMID:9234724

  1. The yeast Hot1 transcription factor is critical for activating a single target gene, STL1

    PubMed Central

    Bai, Chen; Tesker, Masha; Engelberg, David

    2015-01-01

    Transcription factors are commonly activated by signal transduction cascades and induce expression of many genes. They therefore play critical roles in determining the cell's fate. The yeast Hog1 MAP kinase pathway is believed to control the transcription of hundreds of genes via several transcription factors. To identify the bona fide target genes of Hog1, we inducibly expressed the spontaneously active variant Hog1D170A+F318L in cells lacking the Hog1 activator Pbs2. This system allowed monitoring the effects of Hog1 by itself. Expression of Hog1D170A+F318L in pbs2∆ cells imposed induction of just 105 and suppression of only 26 transcripts by at least twofold. We looked for the Hog1-responsive element within the promoter of the most highly induced gene, STL1 (88-fold). A novel Hog1 responsive element (HoRE) was identified and shown to be the direct target of the transcription factor Hot1. Unexpectedly, we could not find this HoRE in any other yeast promoter. In addition, the only gene whose expression was abolished in hot1∆ cells was STL1. Thus Hot1 is essential for transcription of just one gene, STL1. Hot1 may represent a class of transcription factors that are essential for transcription of a very few genes or even just one. PMID:25904326

  2. RNA Helicase Important for Listeria monocytogenes Hemolytic Activity and Virulence Factor Expression

    PubMed Central

    Netterling, Sakura; Bäreclev, Caroline; Vaitkevicius, Karolis

    2015-01-01

    RNA helicases have been shown to be important for the function of RNA molecules at several levels, although their putative involvement in microbial pathogenesis has remained elusive. We have previously shown that Listeria monocytogenes DExD-box RNA helicases are important for bacterial growth, motility, ribosomal maturation, and rRNA processing. We assessed the importance of the RNA helicase Lmo0866 (here named CshA) for expression of virulence traits. We observed a reduction in hemolytic activity in a strain lacking CshA compared to the wild type. This phenomenon was less evident in strains lacking other RNA helicases. The reduced hemolysis was accompanied by lower expression of major listerial virulence factors in the ΔcshA strain, mainly listeriolysin O, but also to some degree the actin polymerizing factor ActA. Reduced expression of these virulence factors in the strain lacking CshA did not, however, correlate with a decreased level of the virulence regulator PrfA. When combining the ΔcshA knockout with a mutation creating a constitutively active PrfA protein (PrfA*), the effect of the ΔcshA knockout on LLO expression was negated. These data suggest a role for the RNA helicase CshA in posttranslational activation of PrfA. Surprisingly, although the expression of several virulence factors was reduced, the ΔcshA strain did not demonstrate any reduced ability to infect nonphagocytic cells compared to the wild-type strain. PMID:26483402

  3. Neuroprotective effects of physical activity on the brain: a closer look at trophic factor signaling

    PubMed Central

    Phillips, Cristy; Baktir, Mehmet Akif; Srivatsan, Malathi; Salehi, Ahmad

    2014-01-01

    While the relationship between increased physical activity and cognitive ability has been conjectured for centuries, only recently have the mechanisms underlying this relationship began to emerge. Convergent evidence suggests that physical activity offers an affordable and effective method to improve cognitive function in all ages, particularly the elderly who are most vulnerable to neurodegenerative disorders. In addition to improving cardiac and immune function, physical activity alters trophic factor signaling and, in turn, neuronal function and structure in areas critical for cognition. Sustained exercise plays a role in modulating anti-inflammatory effects and may play a role in preserving cognitive function in aging and neuropathological conditions. Moreover, recent evidence suggests that myokines released by exercising muscles affect the expression of brain-derived neurotrophic factor synthesis in the dentate gyrus of the hippocampus, a finding that could lead to the identification of new and therapeutically important mediating factors. Given the growing number of individuals with cognitive impairments worldwide, a better understanding of how these factors contribute to cognition is imperative, and constitutes an important first step toward developing non-pharmacological therapeutic strategies to improve cognition in vulnerable populations. PMID:24999318

  4. Transcription factor expression in lipopolysaccharide-activated peripheral-blood-derived mononuclear cells

    PubMed Central

    Roach, Jared C.; Smith, Kelly D.; Strobe, Katie L.; Nissen, Stephanie M.; Haudenschild, Christian D.; Zhou, Daixing; Vasicek, Thomas J.; Held, G. A.; Stolovitzky, Gustavo A.; Hood, Leroy E.; Aderem, Alan

    2007-01-01

    Transcription factors play a key role in integrating and modulating biological information. In this study, we comprehensively measured the changing abundances of mRNAs over a time course of activation of human peripheral-blood-derived mononuclear cells (“macrophages”) with lipopolysaccharide. Global and dynamic analysis of transcription factors in response to a physiological stimulus has yet to be achieved in a human system, and our efforts significantly advanced this goal. We used multiple global high-throughput technologies for measuring mRNA levels, including massively parallel signature sequencing and GeneChip microarrays. We identified 92 of 1,288 known human transcription factors as having significantly measurable changes during our 24-h time course. At least 42 of these changes were previously unidentified in this system. Our data demonstrate that some transcription factors operate in a functional range below 10 transcripts per cell, whereas others operate in a range three orders of magnitude greater. The highly reproducible response of many mRNAs indicates feedback control. A broad range of activation kinetics was observed; thus, combinatorial regulation by small subsets of transcription factors would permit almost any timing input to cis-regulatory elements controlling gene transcription. PMID:17913878

  5. Glypican-1 nanoliposomes for potentiating growth factor activity in therapeutic angiogenesis.

    PubMed

    Monteforte, Anthony J; Lam, Brian; Das, Subhamoy; Mukhopadhyay, Somshuvra; Wright, Catherine S; Martin, Patricia E; Dunn, Andrew K; Baker, Aaron B

    2016-07-01

    Therapeutic angiogenesis is a highly appealing concept for treating tissues that become ischemic due to vascular disease. A major barrier to the clinical translation of angiogenic therapies is that the patients that are in the greatest need of these treatments often have long term disease states and co-morbidities, such as diabetes and obesity, that make them resistant to angiogenic stimuli. In this study, we identified that human patients with type 2 diabetes have reduced levels of glypican-1 in the blood vessels of their skin. The lack of this key co-receptor in the tissue may make the application of exogenous angiogenic growth factors or cell therapies ineffective. We created a novel therapeutic enhancer for growth factor activity consisting of glypican-1 delivered in a nanoliposomal carrier (a "glypisome"). Here, we demonstrate that glypisomes enhance FGF-2 mediated endothelial cell proliferation, migration and tube formation. In addition, glypisomes enhance FGF-2 trafficking by increasing both uptake and endosomal processing. We encapsulated FGF-2 or FGF-2 with glypisomes in alginate beads and used these to deliver localized growth factor therapy in a murine hind limb ischemia model. Co-delivery of glypisomes with FGF-2 markedly increased the recovery of perfusion and vessel formation in ischemic hind limbs of wild type and diabetic mice in comparison to mice treated with FGF-2 alone. Together, our findings support that glypisomes are effective means for enhancing growth factor activity and may improve the response to local angiogenic growth factor therapies for ischemia. PMID:27101205

  6. Novel Risk Factors of Cardiovascular Disease and Their Associations Between Obesity, Physical Activity And Physical Fitness

    PubMed Central

    Buchan, Duncan S.; Thomas, Non E.; Baker, Julien S.

    2012-01-01

    The prevalence of cardiovascular disease (CVD) is increasing around the globe and is the leading cause of death around the world. Though once thought of as an adult problem, it is now recognised that the early manifestations of disease may occur during childhood. Numerous risk factors have been linked to CVD with much of the research focusing on understanding the prevalence and relationship of traditional risk factors such as dyslipidemia, smoking, diabetes mellitus, hypertension, obesity, psychosocial stress, poor diet, physical inactivity and alcohol consumption to the early etiology of disease. While this line of investigation has greatly enhanced our understanding of the relationship between these risk factors and disease, they do not fully explain all cardiovascular events. To enhance our understanding and help with the management of CVD, investigations that involve the measurement of traditional as well as novel risk factors may be necessary. Public health strategies that aim to reduce the prevalence of obesity and overweight encourage youth to increase their physical activity levels as a means of protecting against poor cardiometabolic profiles. Interventions that increase physical activity levels and improve cardiorespiratory fitness cause a reduction in certain CVD risk factors but the lack of agreement between findings makes it impossible to give precise recommendations that will ensure CVD risk reduction. Yet it is important that research continues in order to establish the most appropriate means of improving the health and well-being of those at most risk of future CVD. PMID:25170447

  7. Trajectories of Organized Activity Participation Among Urban Adolescents: An Analysis of Predisposing Factors.

    PubMed

    Eisman, Andria B; Stoddard, Sarah A; Bauermeister, José A; Caldwell, Cleopatra H; Zimmerman, Marc A

    2016-01-01

    Organized activity participation provides important opportunities for adolescents to develop assets and resources related to positive youth development. Predisposing factors, in addition to sociodemographics and self-selection factors, may influence how youth participate over time. In this study, we used growth mixture modeling with longitudinal data from African American adolescents attending urban high schools in Flint, MI to identify subgroups of participation trajectories (Wave 1 N = 681, mean age at Wave 1 = 14.86 years, 51% female). We measured activity participation using psychological and behavioral engagement across multiple contexts over the 4 years of high school. We examined how predisposing risk and promotive factors were related to these trajectories, accounting for sociodemographic and self-selection factors. The results indicated three participation trajectories: a low group decreasing over time (74%), a moderate, consistent participation group (21%) and a moderate, increasing group (5%). More substance use was associated with lower odds of being in the moderate/consistent versus low/decreasing participation group. More parental support was associated with lower odds of being in the moderate/increasing versus the moderate/consistent group. Our results suggest that addressing predisposing factors such as substance use may help facilitate participation over time. PMID:25735866

  8. Activated STAT1 Transcription Factors Conduct Distinct Saltatory Movements in the Cell Nucleus

    PubMed Central

    Speil, Jasmin; Baumgart, Eugen; Siebrasse, Jan-Peter; Veith, Roman; Vinkemeier, Uwe; Kubitscheck, Ulrich

    2011-01-01

    The activation of STAT transcription factors is a critical determinant of their subcellular distribution and their ability to regulate gene expression. Yet, it is not known how activation affects the behavior of individual STAT molecules in the cytoplasm and nucleus. To investigate this issue, we injected fluorescently labeled STAT1 in living HeLa cells and traced them by single-molecule microscopy. We determined that STAT1 moved stochastically in the cytoplasm and nucleus with very short residence times (<0.03 s) before activation. Upon activation, STAT1 mobility in the cytoplasm decreased ∼2.5-fold, indicating reduced movement of STAT1/importinα/β complexes to the nucleus. In the nucleus, activated STAT1 displayed a distinct saltatory mobility, with residence times of up to 5 s and intermittent diffusive motion. In this manner, activated STAT1 factors can occupy their putative chromatin target sites within ∼2 s. These results provide a better understanding of the timescales on which cellular signaling and regulated gene transcription operate at the single-molecule level. PMID:22261046

  9. Activation of Hypoxia Inducible Factor 1 Is a General Phenomenon in Infections with Human Pathogens

    PubMed Central

    Werth, Nadine; Beerlage, Christiane; Rosenberger, Christian; Yazdi, Amir S.; Edelmann, Markus; Amr, Amro; Bernhardt, Wanja; von Eiff, Christof; Becker, Karsten; Schäfer, Andrea; Peschel, Andreas; Kempf, Volkhard A. J.

    2010-01-01

    Background Hypoxia inducible factor (HIF)-1 is the key transcriptional factor involved in the adaptation process of cells and organisms to hypoxia. Recent findings suggest that HIF-1 plays also a crucial role in inflammatory and infectious diseases. Methodology/Principal Findings Using patient skin biopsies, cell culture and murine infection models, HIF-1 activation was determined by immunohistochemistry, immunoblotting and reporter gene assays and was linked to cellular oxygen consumption. The course of a S. aureus peritonitis was determined upon pharmacological HIF-1 inhibition. Activation of HIF-1 was detectable (i) in all ex vivo in biopsies of patients suffering from skin infections, (ii) in vitro using cell culture infection models and (iii) in vivo using murine intravenous and peritoneal S. aureus infection models. HIF-1 activation by human pathogens was induced by oxygen-dependent mechanisms. Small colony variants (SCVs) of S. aureus known to cause chronic infections did not result in cellular hypoxia nor in HIF-1 activation. Pharmaceutical inhibition of HIF-1 activation resulted in increased survival rates of mice suffering from a S. aureus peritonitis. Conclusions/Significance Activation of HIF-1 is a general phenomenon in infections with human pathogenic bacteria, viruses, fungi and protozoa. HIF-1-regulated pathways might be an attractive target to modulate the course of life-threatening infections. PMID:20644645

  10. Selective constraints on the activation domain of transcription factor Pit-1.

    PubMed Central

    Majumdar, S; Irwin, D M; Elsholtz, H P

    1996-01-01

    The POU transcription factor Pit-1 activates members of the prolactin/growth hormone gene family in specific endocrine cell types of the pituitary gland. Although Pit-1 is structurally conserved among vertebrate species, evolutionary changes in the pattern of Pit-1 RNA splicing have led to a notable "contraction" of the transactivation domain in the mammalian lineage, relative to Pit-1 in salmonid fish. By site-directed mutagenesis we demonstrate that two splice insertions in salmon Pit-1, called beta (29 aa) and gamma (33 aa), are critical for cooperative activation of the salmon prolactin gene. Paradoxically, Pit-1-dependent activation of the prolactin gene in rat is enhanced in the absence of the homologous beta-insert sequence. This apparent divergence in the mechanism of activation of prolactin genes by Pit-1 is target gene specific, as activation of rat and salmon growth hormone genes by Pit-1 splice variants is entirely conserved. Our data suggest that efficient activation of the prolactin gene in the vertebrate pituitary has significantly constrained the pattern of splicing within the Pit-1 transactivation domain. Rapid evolutionary divergence of prolactin gene function may have demanded changes in Pit-1/protein interactions to accommodate new patterns of transcriptional control by developmental or physiological factors. Images Fig. 2 Fig. 3 Fig. 4 PMID:8816787

  11. Platelet-Activating Factor Induces Epigenetic Modifications in Human Mast Cells.

    PubMed

    Damiani, Elisabetta; Puebla-Osorio, Nahum; Gorbea, Enrique; Ullrich, Stephen E

    2015-12-01

    UV radiation-induced systemic immune suppression is a major risk factor for skin cancer induction. The migration of dermal mast cells from the skin to the draining lymph nodes has a prominent role in activating systemic immune suppression. UV-induced keratinocyte-derived platelet-activating factor (PAF) activates mast cell migration, in part by upregulating the expression of CXCR4 on the surface of mast cells. Others have indicated that epigenetic mechanisms regulate CXCR4 expression; therefore, we asked whether PAF activates epigenetic mechanisms in mast cells. Human mast cells were treated with PAF, and the effect on DNA methylation and/or acetylation was measured. PAF suppressed the expression of DNA methyltransferase (DNMT) 1 and 3b. On the other hand, PAF increased p300 histone acetyltransferase expression, and the acetylation of histone H3, which coincided with a decreased expression of the histone deacetylase HDAC2. Chromatin immunoprecipitation assays indicated that PAF treatment activated the acetylation of the CXCR4 promoter. Finally, inhibiting histone acetylation blocked p300 upregulation and suppressed PAF-induced surface expression of CXCR4. Our findings suggest a novel molecular mechanism for PAF, activation of epigenetic modifications. We suggest that PAF may serve as an endogenous molecular mediator that links the environment (UV radiation) with the epigenome. PMID:26316070

  12. Platelet-Activating Factor Induces Epigenetic Modifications in Human Mast Cells

    PubMed Central

    Gorbea, Enrique; Ullrich, Stephen E.

    2015-01-01

    Ultraviolet (UV) radiation-induced systemic immune suppression is a major risk factor for skin cancer induction. The migration of dermal mast cells from the skin to the draining lymph nodes plays a prominent role in activating systemic immune suppression. UV-induced keratinocyte-derived platelet-activating factor (PAF) activates mast cell migration, in part by up regulating the expression of CXCR4 on the surface of mast cells. Others have indicated that epigenetic mechanisms regulate CXCR4 expression, so we asked whether PAF activates epigenetic mechanisms in mast cells. Human mast cells were treated with PAF and the effect on DNA methylation and/or acetylation was measured. PAF suppressed the expression of DNA methyltransferase (DNMT) 1 and 3b. On the other hand, PAF increased p300 histone acetyltransferase expression, and the acetylation of histone H3, which coincided with a decreased expression of the histone deacetylase HDAC2. Chromatin immunoprecipitation assays indicated that PAF-treatment activated the acetylation of the CXCR4 promoter. Finally, inhibiting histone acetylation blocked p300 up-regulation and suppressed PAF-induced surface expression of CXCR4. Our findings suggest a novel molecular mechanism for PAF, activation of epigenetic modifications. We suggest that PAF may serve as an endogenous molecular mediator that links the environment (UV radiation) with the epigenome. PMID:26316070

  13. New Insights into Butyrylcholinesterase Activity Assay: Serum Dilution Factor as a Crucial Parameter

    PubMed Central

    Jońca, Joanna; Żuk, Monika; Wasąg, Bartosz; Janaszak-Jasiecka, Anna; Lewandowski, Krzysztof; Wielgomas, Bartosz; Waleron, Krzysztof; Jasiecki, Jacek

    2015-01-01

    Butyrylcholinesterase (BChE) activity assay and inhibitor phenotyping can help to identify patients at risk of prolonged paralysis following the administration of neuromuscular blocking agents. The assay plays an important role in clinical chemistry as a good diagnostic marker for intoxication with pesticides and nerve agents. Furthermore, the assay is also commonly used for in vitro characterization of cholinesterases, their toxins and drugs. There is still lack of standardized procedure for measurement of BChE activity and many laboratories use different substrates at various concentrations. The purpose of this study was to validate the BChE activity assay to determine the best dilution of human serum and the most optimal concentration of substrates and inhibitors. Serum BChE activity was measured using modified Ellman’s method applicable for a microplate reader. We present our experience and new insights into the protocol for high-throughput routine assays of human plasma cholinesterase activities adapted to a microplate reader. During our routine assays used for the determination of BChE activity, we have observed that serum dilution factor influences the results obtained. We show that a 400-fold dilution of serum and 5mM S-butyrylthiocholine iodide can be successfully used for the accurate measurement of BChE activity in human serum. We also discuss usage of various concentrations of dibucaine and fluoride in BChE phenotyping. This study indicates that some factors of such a multicomponent clinical material like serum can influence kinetic parameters of the BChE. The observed inhibitory effect is dependent on serum dilution factor used in the assay. PMID:26444431

  14. New Insights into Butyrylcholinesterase Activity Assay: Serum Dilution Factor as a Crucial Parameter.

    PubMed

    Jońca, Joanna; Żuk, Monika; Wasąg, Bartosz; Janaszak-Jasiecka, Anna; Lewandowski, Krzysztof; Wielgomas, Bartosz; Waleron, Krzysztof; Jasiecki, Jacek

    2015-01-01

    Butyrylcholinesterase (BChE) activity assay and inhibitor phenotyping can help to identify patients at risk of prolonged paralysis following the administration of neuromuscular blocking agents. The assay plays an important role in clinical chemistry as a good diagnostic marker for intoxication with pesticides and nerve agents. Furthermore, the assay is also commonly used for in vitro characterization of cholinesterases, their toxins and drugs. There is still lack of standardized procedure for measurement of BChE activity and many laboratories use different substrates at various concentrations. The purpose of this study was to validate the BChE activity assay to determine the best dilution of human serum and the most optimal concentration of substrates and inhibitors. Serum BChE activity was measured using modified Ellman's method applicable for a microplate reader. We present our experience and new insights into the protocol for high-throughput routine assays of human plasma cholinesterase activities adapted to a microplate reader. During our routine assays used for the determination of BChE activity, we have observed that serum dilution factor influences the results obtained. We show that a 400-fold dilution of serum and 5mM S-butyrylthiocholine iodide can be successfully used for the accurate measurement of BChE activity in human serum. We also discuss usage of various concentrations of dibucaine and fluoride in BChE phenotyping. This study indicates that some factors of such a multicomponent clinical material like serum can influence kinetic parameters of the BChE. The observed inhibitory effect is dependent on serum dilution factor used in the assay. PMID:26444431

  15. Weight-activity associations with cardiometabolic risk factors among U.S. youth.

    PubMed

    Loprinzi, Paul D; Tudor-Locke, Catrine

    2015-10-01

    Research among adult populations suggests that underweight is associated with worse cardiometabolic health and that adequate engagement in moderate-to-vigorous physical activity (MVPA) may help to counteract the cardiometabolic consequences of overweight/obesity. Whether these findings are also true in children and adolescents (hereafter 'youth') is unknown. Therefore, the purpose of this study was to determine whether underweight and overweight/obese youth who engage in relatively more MVPA have better or similar cardiometabolic risk factors than normal weight youth who engage in relatively less MVPA. Data were extracted from the 2003-2006 National Health and Nutrition Examination Survey (N=2268). Four cardiometabolic risk factors assessed included C-reactive protein, mean arterial pressure, total cholesterol, and high-density lipoprotein (HDL) cholesterol. Weight status was assessed via dual energy X-ray absorptiometry. MVPA was assessed via accelerometry. Six weight-activity groups were created: 1) Underweight and Inactive; 2) Normal Weight and Inactive; 3) Overweight/Obese and Inactive; 4) Underweight and Active; 5) Normal Weight and Active; and, 6) Overweight/Obese and Active. An overall cardiometabolic risk score was calculated by summing the frequency with which each individual participant scored in the worst quartile for each of the 4 cardiometabolic parameters. Compared to those who were Normal Weight and Inactive, youth who were Underweight and Active (β=-0.05, p=0.78) had a similar overall cardiometabolic risk score. In contrast, Overweight/Obese and Active youth (β=1.1, p<0.001) had a higher overall cardiometabolic risk score when compared to Normal Weight and Inactive youth. These cross-sectional findings suggest that MVPA may not fully counteract the cardiometabolic consequences of overweight/obesity in youth. Rather, maintaining a normal weight may be of a more important factor related to cardiometabolic risk in youth. PMID:26056077

  16. Activation of archaeal transcription mediated by recruitment of transcription factor B.

    PubMed

    Ochs, Simon M; Thumann, Sybille; Richau, Renate; Weirauch, Matt T; Lowe, Todd M; Thomm, Michael; Hausner, Winfried

    2012-05-25

    Archaeal promoters consist of a TATA box and a purine-rich adjacent upstream sequence (transcription factor B (TFB)-responsive element (BRE)), which are bound by the transcription factors TATA box-binding protein (TBP) and TFB. Currently, only a few activators of archaeal transcription have been experimentally characterized. The best studied activator, Ptr2, mediates activation by recruitment of TBP. Here, we present a detailed biochemical analysis of an archaeal transcriptional activator, PF1088, which was identified in Pyrococcus furiosus by a bioinformatic approach. Operon predictions suggested that an upstream gene, pf1089, is polycistronically transcribed with pf1088. We demonstrate that PF1088 stimulates in vitro transcription by up to 7-fold when the pf1089 promoter is used as a template. By DNase I and hydroxyl radical footprinting experiments, we show that the binding site of PF1088 is located directly upstream of the BRE of pf1089. Mutational analysis indicated that activation requires the presence of the binding site for PF1088. Furthermore, we show that activation of transcription by PF1088 is dependent upon the presence of an imperfect BRE and is abolished when the pf1089 BRE is replaced with a BRE from a strong archaeal promoter. Gel shift experiments showed that TFB recruitment to the pf1089 operon is stimulated by PF1088, and TFB seems to stabilize PF1088 operator binding even in the absence of TBP. Taken together, these results represent the first biochemical evidence for a transcriptional activator working as a TFB recruitment factor in Archaea, for which the designation TFB-RF1 is suggested. PMID:22496454

  17. Salicylates Inhibit Flavivirus Replication Independently of Blocking Nuclear Factor Kappa B Activation

    PubMed Central

    Liao, Ching-Len; Lin, Yi-Ling; Wu, Bi-Ching; Tsao, Chang-Huei; Wang, Mei-Chuan; Liu, Chiu-I; Huang, Yue-Ling; Chen, Jui-Hui; Wang, Jia-Pey; Chen, Li-Kuang

    2001-01-01

    Flaviviruses comprise a positive-sense RNA genome that replicates exclusively in the cytoplasm of infected cells. Whether flaviviruses require an activated nuclear factor(s) to complete their life cycle and trigger apoptosis in infected cells remains elusive. Flavivirus infections quickly activate nuclear factor kappa B (NF-κB), and salicylates have been shown to inhibit NF-κB activation. In this study, we investigated whether salicylates suppress flavivirus replication and virus-induced apoptosis in cultured cells. In a dose-dependent inhibition, we found salicylates within a range of 1 to 5 mM not only restricted flavivirus replication but also abrogated flavivirus-triggered apoptosis. However, flavivirus replication was not affected by a specific NF-κB peptide inhibitor, SN50, and a proteosome inhibitor, lactacystin. Flaviviruses also replicated and triggered apoptosis in cells stably expressing IκBα-ΔN, a dominant-negative mutant that antagonizes NF-κB activation, as readily as in wild-type BHK-21 cells, suggesting that NF-κB activation is not essential for either flavivirus replication or flavivirus-induced apoptosis. Salicylates still diminished flavivirus replication and blocked apoptosis in the same IκBα-ΔN cells. This inhibition of flaviviruses by salicylates could be partially reversed by a specific p38 mitogen-activated protein (MAP) kinase inhibitor, SB203580. Together, these results show that the mechanism by which salicylates suppress flavivirus infection may involve p38 MAP kinase activity but is independent of blocking the NF-κB pathway. PMID:11483726

  18. Aldosterone Activates Transcription Factor Nrf2 in Kidney Cells Both In Vitro and In Vivo

    PubMed Central

    Oteiza, Patricia I.; Link, Samuel; Hey, Valentin; Stopper, Helga; Schupp, Nicole

    2014-01-01

    Abstract Aims: An increased kidney cancer risk was found in hypertensive patients, who frequently exhibit hyperaldosteronism, known to contribute to kidney injury, with oxidative stress playing an important role. The capacity of kidney cells to up-regulate transcription factor nuclear factor-erythroid-2-related factor 2 (Nrf2), a key regulator of the cellular antioxidative defense, as a prevention of aldosterone-induced oxidative damage was investigated both in vitro and in vivo. Results: Aldosterone activated Nrf2 and increased the expression of enzymes involved in glutathione (GSH) synthesis and detoxification. This activation depended on the mineralocorticoid receptor (MR) and oxidative stress. In vitro, Nrf2 activation, GSH amounts, and target gene levels decreased after 24 h, while oxidant levels remained high. Nrf2 activation could not protect cells against oxidative DNA damage, as aldosterone-induced double-strand breaks and 7,8-dihydro-8-oxo-guanine (8-oxodG) lesions steadily rose. The Nrf2 activator sulforaphane enhanced the Nrf2 response both in vitro and in vivo, thereby preventing aldosterone-induced DNA damage. In vivo, Nrf2 activation further had beneficial effects on the aldosterone-caused blood pressure increase and loss of kidney function. Innovation: This is the first study showing the activation of Nrf2 by aldosterone. Moreover, the results identify sulforaphane as a substance that is capable of preventing aldosterone-induced damage both in vivo and in vitro. Conclusion: Aldosterone-induced Nrf2 adaptive response cannot neutralize oxidative actions of chronically increased aldosterone, which, therefore could be causally involved in the increased cancer incidence of hypertensive individuals. Enhancing the cellular antioxidative defense with sulforaphane might exhibit beneficial effects. Antioxid. Redox Signal. 21, 2126–2142. PMID:24512358

  19. Lipoteichoic Acid-Induced Nitric Oxide Production Depends on the Activation of Platelet-Activating Factor Receptor and Jak21

    PubMed Central

    Han, Seung Hyun; Kim, Je Hak; Seo, Ho Seong; Martin, Michael H.; Chung, Gook-Hyun; Michalek, Suzanne M.; Nahm, Moon H.

    2006-01-01

    NO production by macrophages in response to lipoteichoic acid (LTA) and a synthetic lipopeptide (Pam3CSK4) was investigated. LTA and Pam3CSK4 induced the production of both TNF-α and NO. Inhibitors of platelet-activating factor receptor (PAFR) blocked LTA- or Pam3CSK4-induced production of NO but not TNF-α. Jak2 tyrosine kinase blocked LTA-induced production of NO but not TNF-α. PAFR inhibition blocked phosphorylation of Jak2 and STAT1, a key factor for expressing inducible NO synthase. In addition, LTA did not induce IFN-β expression, and p38 mitogen-activated protein serine kinase was necessary for LTA-induced NO production but not for TNF-α production. These findings suggest that Gram-positive bacteria induce NO production using a PAFR signaling pathway to activate STAT1 via Jak2. This PAFR/Jak2/STAT1 signaling pathway resembles the IFN-β, type I IFNR/Jak/STAT1 pathway described for LPS. Consequently, Gram-positive and Gram-negative bacteria appear to have different but analogous mechanisms for NO production. PMID:16365452

  20. Synthesis and characterization of (18)F-labeled active site inhibited factor VII (ASIS).

    PubMed

    Erlandsson, Maria; Nielsen, Carsten H; Jeppesen, Troels E; Kristensen, Jesper B; Petersen, Lars C; Madsen, Jacob; Kjaer, Andreas

    2015-05-15

    Activated factor VII blocked in the active site with Phe-Phe-Arg-chloromethyl ketone (active site inhibited factor VII (ASIS)) is a 50-kDa protein that binds with high affinity to its receptor, tissue factor (TF). TF is a transmembrane glycoprotein that plays an important role in, for example, thrombosis, metastasis, tumor growth, and tumor angiogenesis. The aim of this study was to develop an (18)F-labeled ASIS derivative to assess TF expression in tumors. Active site inhibited factor VII was labeled using N-succinimidyl-4-[(18)F]fluorobenzoate, and the [(18)F]ASIS was purified on a PD-10 desalting column. The radiochemical yield was 25 ± 6%, the radiochemical purity was >97%, and the pseudospecific radioactivity was 35 ± 9 GBq/µmol. The binding efficacy was evaluated in pull-down experiments, which monitored the binding of unlabeled ASIS and [(18)F]ASIS to TF and to a specific anti-factor VII antibody (F1A2-mAb). No significant difference in binding efficacy between [(18)F]ASIS and ASIS could be detected. Furthermore, [(18)F]ASIS was relatively stable in vitro and in vivo in mice. In conclusion, [(18)F]ASIS has for the first time been successfully synthesized as a possible positron emission tomography tracer to image TF expression levels. In vivo positron emission tomography studies to evaluate the full potential of [(18)F]ASIS are in progress. PMID:25820758

  1. A frequent human coagulation Factor VII mutation (A294V, c152) in loop 140s affects the interaction with activators, tissue factor and substrates.

    PubMed Central

    Toso, Raffaella; Pinotti, Mirko; High, Katherine A; Pollak, Eleanor S; Bernardi, Francesco

    2002-01-01

    Activated Factor VII (FVIIa) is a vitamin-K-dependent serine protease that initiates blood clotting after interacting with its cofactor tissue factor (TF). The complex FVIIa-TF is responsible for the activation of Factor IX (FIX) and Factor X (FX), leading ultimately to the formation of a stable fibrin clot. Activated FX (FXa), a product of FVIIa enzymic activity, is also the most efficient activator of zymogen FVII. Interactions of FVII/FVIIa with its activators, cofactor and substrates have been investigated extensively to define contact regions and residues involved in the formation of the complexes. Site-directed mutagenesis and inhibition assays led to the identification of sites removed from the FVIIa active site that influence binding specificity and affinity of the enzyme. In this study we report the characterization of a frequent naturally occurring human FVII mutant, A294V (residue 152 in the chymotrypsin numbering system), located in loop 140s. This region undergoes major rearrangements after FVII activation and is relevant to the development of substrate specificity. FVII A294V shows delayed activation by FXa as well as reduced activity towards peptidyl and macromolecular substrates without impairing the catalytic efficiency of the triad. Also, the interaction of this FVII variant with TF was altered, suggesting that this residue, and more likely loop 140s, plays a pivotal role not only in the recognition of FX by the FVIIa-TF complex, but also in the interaction of FVII with both its activators and cofactor TF. PMID:11931672

  2. The hepatocyte growth factor isoform NK2 activates motogenesis and survival but not proliferation due to lack of Akt activation.

    PubMed

    Mungunsukh, Ognoon; Lee, Young H; Bottaro, Donald P; Day, Regina M

    2016-08-01

    Hepatocyte growth factor (HGF) is a pleiotrophic factor involved in cellular proliferation, migration and morphogenesis. HGF is required for normal tissue and organ development during embryogenesis, but in the adult HGF has been demonstrated to drive normal tissue repair and inhibit fibrotic remodeling. HGF has two naturally occurring human isoforms as a result of alternative splicing, NK1 and NK2. While NK1 has been defined as an agonist for HGF receptor, Met, NK2 is defined as a partial Met antagonist. Furthermore, under conditions of fibrotic remodeling, NK2 is still expressed while full length HGF is suppressed. Furthermore, the mechanism by which NK2 partially signals through Met is not completely understood. Here, we investigated the mitogenic, motogenic, and anti-apoptotic activities of NK2 compared with full length HGF in primary human bronchial epithelial cells (BEpC) and bovine pulmonary artery endothelial cells (PAEC). In human BEpC, NK2 partial activated Met, inducing Met phosphorylation at Y1234/1235 in the tyrosine-kinase domain but not at Y1349 site in the multifunctional docking domain. Partial phosphorylation of Met by NK2 resulted in activation of MAPK and STAT3, but not AKT. This correlated with motogenesis and survival in a MAPK-dependent manner, but not cell proliferation. Overexpression of a constitutively active AKT complemented NK2 signaling, allowing NK2 to induce cell proliferation. These data indicate that NK2 and HGF drive motogenic and anti-apoptotic signaling but only HGF drives cell proliferation by activating AKT-pathway signaling. These results have implications for the biological consequences of differential regulation of the two isoforms under pro-fibrotic conditions. PMID:27224506

  3. Glucosamine suppresses platelet-activating factor-induced activation of microglia through inhibition of store-operated calcium influx.

    PubMed

    Park, Jae-Hyung; Kim, Jeong-Nam; Jang, Byeong-Churl; Im, Seung-Soon; Song, Dae-Kyu; Bae, Jae-Hoon

    2016-03-01

    Microglia activation and subsequent release of inflammatory mediators are implicated in the pathophysiology of neurodegenerative diseases. Platelet-activating factor (PAF), a potent lipid mediator synthesized by microglia, is known to stimulate microglia functional responses. In this study, we determined that endogenous PAF exert autocrine effects on microglia activation, as well as the underlying mechanism involved. We also investigated the effect of D-glucosamine (GlcN) on PAF-induced cellular activation in human HMO6 microglial cells. PAF induced sustained intracellular Ca(2+) ([Ca(2+)]i) increase through store-operated Ca(2+) channels (SOC) and reactive oxygen species (ROS) generation. PAF also induced pro-inflammatory markers through NFκB/COX-2 signaling. GlcN significantly inhibited PAF-induced Ca(2+) influx and ROS generation without significant cytotoxicity. GlcN downregulated excessive expression of pro-inflammatory markers and promoted filopodia formation through NFκB/COX-2 inhibition in PAF-stimulated HMO6 cells. Taken together, these data suggest that GlcN may offer substantial therapeutic potential for treating inflammatory and neurodegenerative diseases accompanied by microglial activation. PMID:26745504

  4. Protein kinase A-dependent phosphorylation modulates DNA-binding activity of hepatocyte nuclear factor 4.

    PubMed

    Viollet, B; Kahn, A; Raymondjean, M

    1997-08-01

    Hepatocyte nuclear factor 4 (HNF4), a liver-enriched transcription factor of the nuclear receptor superfamily, is critical for development and liver-specific gene expression. Here, we demonstrate that its DNA-binding activity is modulated posttranslationally by phosphorylation in vivo, ex vivo, and in vitro. In vivo, HNF4 DNA-binding activity is reduced by fasting and by inducers of intracellular cyclic AMP (cAMP) accumulation. A consensus protein kinase A (PKA) phosphorylation site located within the A box of its DNA-binding domain has been identified, and its role in phosphorylation-dependent inhibition of HNF4 DNA-binding activity has been investigated. Mutants of HNF4 in which two potentially phosphorylatable serines have been replaced by either neutral or charged amino acids were able to bind DNA in vitro with affinity similar to that of the wild-type protein. However, phosphorylation by PKA strongly repressed the binding affinity of the wild-type factor but not that of HNF4 mutants. Accordingly, in transfection assays, expression vectors for the mutated HNF4 proteins activated transcription more efficiently than that for the wild-type protein-when cotransfected with the PKA catalytic subunit expression vector. Therefore, HNF4 is a direct target of PKA which might be involved in the transcriptional inhibition of liver genes by cAMP inducers. PMID:9234678

  5. Protein kinase A-dependent phosphorylation modulates DNA-binding activity of hepatocyte nuclear factor 4.

    PubMed Central

    Viollet, B; Kahn, A; Raymondjean, M

    1997-01-01

    Hepatocyte nuclear factor 4 (HNF4), a liver-enriched transcription factor of the nuclear receptor superfamily, is critical for development and liver-specific gene expression. Here, we demonstrate that its DNA-binding activity is modulated posttranslationally by phosphorylation in vivo, ex vivo, and in vitro. In vivo, HNF4 DNA-binding activity is reduced by fasting and by inducers of intracellular cyclic AMP (cAMP) accumulation. A consensus protein kinase A (PKA) phosphorylation site located within the A box of its DNA-binding domain has been identified, and its role in phosphorylation-dependent inhibition of HNF4 DNA-binding activity has been investigated. Mutants of HNF4 in which two potentially phosphorylatable serines have been replaced by either neutral or charged amino acids were able to bind DNA in vitro with affinity similar to that of the wild-type protein. However, phosphorylation by PKA strongly repressed the binding affinity of the wild-type factor but not that of HNF4 mutants. Accordingly, in transfection assays, expression vectors for the mutated HNF4 proteins activated transcription more efficiently than that for the wild-type protein-when cotransfected with the PKA catalytic subunit expression vector. Therefore, HNF4 is a direct target of PKA which might be involved in the transcriptional inhibition of liver genes by cAMP inducers. PMID:9234678

  6. Structure-activity relationships for substrate-based inhibitors of human complement factor B.

    PubMed

    Ruiz-Gómez, Gloria; Lim, Junxian; Halili, Maria A; Le, Giang T; Madala, Praveen K; Abbenante, Giovanni; Fairlie, David P

    2009-10-01

    Human complement is a cascading network of plasma proteins important in immune defense, cooperatively effecting recognition, opsonization, destruction, and removal of pathogens and infected/damaged cells. Overstimulated or unregulated complement activation can result in immunoinflammatory diseases. Key serine proteases in this cascade are difficult to study due to their multiprotein composition, short lifetimes, formation on membranes, or serum circulation as inactive zymogens. Factor B is inactive at pH 7, but a catalytically active serine protease under alkaline conditions, enabling structure-activity relationship studies for 63 substrate-based peptide inhibitors with 4-7 residues and a C-terminal aldehyde. A potent factor B inhibitor was hexpeptide Ac-RLTbaLAR-H (IC(50) 250 nM, pH 9.5), which at pH 7 also blocked formation of membrane attack complex via the "alternative pathway" of complement activation and inhibited human complement mediated lysis of rabbit erythrocytes. Inhibitors of factor B may be valuable probes and drug leads for complement mediated immunity and disease. PMID:19743866

  7. In vivo bioimaging with tissue-specific transcription factor activated luciferase reporters

    PubMed Central

    Buckley, Suzanne M. K.; Delhove, Juliette M. K. M.; Perocheau, Dany P.; Karda, Rajvinder; Rahim, Ahad A.; Howe, Steven J.; Ward, Natalie J.; Birrell, Mark A.; Belvisi, Maria G.; Arbuthnot, Patrick; Johnson, Mark R.; Waddington, Simon N.; McKay, Tristan R.

    2015-01-01

    The application of transcription factor activated luciferase reporter cassettes in vitro is widespread but potential for in vivo application has not yet been realized. Bioluminescence imaging enables non-invasive tracking of gene expression in transfected tissues of living rodents. However the mature immune response limits luciferase expression when delivered in adulthood. We present a novel approach of tissue-targeted delivery of transcription factor activated luciferase reporter lentiviruses to neonatal rodents as an alternative to the existing technology of generating germline transgenic light producing rodents. At this age, neonates acquire immune tolerance to the conditionally responsive luciferase reporter. This simple and transferrable procedure permits surrogate quantitation of transcription factor activity over the lifetime of the animal. We show principal efficacy by temporally quantifying NFκB activity in the brain, liver and lungs of somatotransgenic reporter mice subjected to lipopolysaccharide (LPS)-induced inflammation. This response is ablated in Tlr4−/− mice or when co-administered with the anti-inflammatory glucocorticoid analogue dexamethasone. Furthermore, we show the malleability of this technology by quantifying NFκB-mediated luciferase expression in outbred rats. Finally, we use somatotransgenic bioimaging to longitudinally quantify LPS- and ActivinA-induced upregulation of liver specific glucocorticoid receptor and Smad2/3 reporter constructs in somatotransgenic mice, respectively. PMID:26138224

  8. Constitutively expressed ERF-VII transcription factors redundantly activate the core anaerobic response in Arabidopsis thaliana.

    PubMed

    Bui, Liem T; Giuntoli, Beatrice; Kosmacz, Monika; Parlanti, Sandro; Licausi, Francesco

    2015-07-01

    Plant adaptation to hypoxic conditions is mediated by the transcriptional activation of genes involved in the metabolic reprogramming of plant cells to cope with reduced oxygen availability. Recent studies indicated that members of the group VII of the Ethylene Responsive Transcription Factor (ERFs) family act as positive regulators of this molecular response. In the current study, the five ERF-VII transcription factors of Arabidopsis thaliana were compared to infer a hierarchy in their role with respect to the anaerobic response. When the activity of each transcription factor was tested on a set of hypoxia-responsive promoters, RAP2.2, RAP2.3 and RAP2.12 appeared to be the most powerful activators. RAP2.12 was further dissected in transactivation assays in Arabidopsis protoplasts to identify responsible regions for transcriptional activation. An ultimate C-terminal motif was identified as sufficient to drive gene transcription. Finally, using realtime RT-PCR in single and double mutants for the corresponding genes, we confirmed that RAP2.2 and RAP2.12 exert major control upon the anaerobic response. PMID:26025519

  9. Identifying combinations of risk and protective factors predicting physical activity change in high school students.

    PubMed

    Dunton, Genevieve Fridlund; Atienza, Audie A; Tscherne, James; Rodriguez, Daniel

    2011-02-01

    Research sought to identify combinations of risk and protective factors predicting change in physical activity (PA) over one year in high school students. Adolescents (N = 344; M = 15.7 years) participated in a longitudinal study with assessment of demographics, substance use/smoking exposure, height and weight, psychological factors, and PA in 10th and 11th grade. PA participation in 11th grade was greatest for adolescents who engaged in PA and had high sports competence (78%), and least for adolescents who did not engage in or enjoy PA (13%) in 10th grade. Identifying adolescent subgroups at risk for decreasing PA can inform the development of tailored interventions. PMID:21467595

  10. The Interplay between Stem Cells, Microenvironment Mechanics, and Growth Factor activation

    PubMed Central

    Tenney, Rebeca M.; Discher, Dennis E.

    2009-01-01

    Physicochemical features of a cell’s microenvironment can exert important effects on cell behavior and include the effects of matrix elasticity on cell differentiation processes, but molecular mechanisms are largely mysterious. Here we highlight recent reports of a mechanical dependence to growth factor activation, with a particular focus on release of TGFβ (Transforming Growth Factor β) from its large latent complex via forced unfolding. We discuss these processes and pathways in the contexts of matrix adhesion and fluid shearing as they might relate to stem cell differentiation and other mechanisms in development, disease, and repair. PMID:19615877

  11. Involvement of platelet-activating factor and tumour necrosis factor in the pathogenesis of joint inflammation in rabbits.

    PubMed Central

    Zarco, P; Maestre, C; Herrero-Beaumont, G; González, E; Garcia-Hoyo, R; Navarro, F J; Braquet, P; Egido, J

    1992-01-01

    We have studied the participation of platelet-activating factor (PAF) in antigen-induced arthritis in rabbits, as well as the possible co-operation between PAF and tumour necrosis factor (TNF) in their ability to induce joint inflammation when injected into the knees of healthy rabbits. The administration of two structurally different PAF receptor antagonists, BN52021 and Alprazolam, from 4 h before the intra-articular injection of ovalbumin in preimmunized rabbits, induced an important reduction in the synovial fluid volume, in the amount of cells infiltrating the articular cavity and the synovial membrane, as well as in the prostaglandin E2 (PGE2) concentration. Furthermore, proteoglycans of the articular cartilage, which were found diminished in animals with non-treated arthritis, were well preserved in rabbits treated with PAF antagonists. All the synovial fluids from joints with arthritis had detectable amounts of PAF. The injection of either TNF or PAF into the joints of normal rabbits induced a mild inflammation. When TNF was administered 1 h before PAF, a synergistic response was noted in the synovial fluid volume, in the accumulation of leucocytes, and in the amount of PGE2. The administration of BN50726, a hetrazepine with a potent PAF-receptor antagonist effect, induced a diminution in those parameters. Our results suggest that PAF may be an early and important mediator of joint damage, and that TNF can amplify the inflammatory response induced by PAF. PAF receptor antagonists could play some role in the treatment of inflammatory joint diseases. Images Fig. 2 Fig. 4 PMID:1315229

  12. The role of prostanoids in the production of acute acalculous cholecystitis by platelet-activating factor.

    PubMed Central

    Kaminski, D L; Andrus, C H; German, D; Deshpande, Y G

    1990-01-01

    Gallbladder tissue from patients with acute acalculous cholecystitis contains increased amounts of prostanoids when compared to normal gallbladder tissue. Platelet-activating factor (PAF) is a potent stimulus of eicosanoid formation. It has been implicated as a mediator of acute inflammatory processes and systemic responses to shock. In this study the role of PAF in acute acalculous cholecystitis was evaluated. Anesthetized cats underwent gallbladder perfusion with a physiologic buffer solution containing [14C]polyethylene glycol as a nonabsorbable tracer to quantitate mucosal water absorption. Platelet-activating factor was infused into the hepatic artery for 2 hours. Control experiments were performed when vehicle alone was infused. Experiments also were performed when indomethacin was administered intravenously and when indomethacin and PAF were administered. Gallbladder mucosal absorption/secretion and perfusate and tissue prostaglandin E (PGE) and 6 keto prostaglandin F1 alpha (6-keto PGF1 alpha) levels were evaluated. Gallbladder inflammation was evaluated by beta-glucuronidase and myeloperoxidase tissue concentrations and by a histologic scoring system. Platelet-activating factor eliminated gallbladder absorption and produced net fluid secretion associated with dose-related increases in perfusate PGE concentrations and gallbladder tissue PGE and 6 keto PGF1 alpha levels when compared to control values. Platelet-activating factor produced significant inflammation in the gallbladder with increases in the histologic score of inflammation and tissue lysosomal enzyme activities. Indomethacin significantly decreased the fluid secretion, prostanoid levels, and inflammation produced by PAF. The results suggest that PAF may induce acute gallbladder inflammation associated with systemic stress through a prostanoid-mediated mechanism. Images Fig. 2. PMID:2171443

  13. Redox-mediated activation of latent transforming growth factor-beta 1

    NASA Technical Reports Server (NTRS)

    Barcellos-Hoff, M. H.; Dix, T. A.; Chatterjee, A. (Principal Investigator)

    1996-01-01

    Transforming growth factor beta 1 (TGF beta) is a multifunctional cytokine that orchestrates response to injury via ubiquitous cell surface receptors. The biological activity of TGF beta is restrained by its secretion as a latent complex (LTGF beta) such that activation determines the extent of TGF beta activity during physiological and pathological events. TGF beta action has been implicated in a variety of reactive oxygen-mediated tissue processes, particularly inflammation, and in pathologies such as reperfusion injury, rheumatoid arthritis, and atherosclerosis. It was recently shown to be rapidly activated after in vivo radiation exposure, which also generates reactive oxygen species (ROS). In the present studies, the potential for redox-mediated LTGF beta activation was investigated using a cell-free system in which ROS were generated in solution by ionizing radiation or metal ion-catalyzed ascorbate reaction. Irradiation (100 Gray) of recombinant human LTGF beta in solution induced 26% activation compared with that elicited by standard thermal activation. Metal-catalyzed ascorbate oxidation elicited extremely efficient recombinant LTGF beta activation that matched or exceeded thermal activation. The efficiency of ascorbate activation depended on ascorbate concentrations and the presence of transition metal ions. We postulate that oxidation of specific amino acids in the latency-conferring peptide leads to a conformation change in the latent complex that allows release of TGF beta. Oxidative activation offers a novel route for the involvement of TGF beta in tissue processes in which ROS are implicated and endows LTGF beta with the ability to act as a sensor of oxidative stress and, by releasing TGF beta, to function as a signal for orchestrating the response of multiple cell types. LTGF beta redox sensitivity is presumably directed toward recovery of homeostasis; however, oxidation may also be a mechanism of LTGF beta activation that can be deleterious during

  14. Platelet surface-associated activation and secretion-mediated inhibition of coagulation factor XII.

    PubMed

    Zakharova, Natalia V; Artemenko, Elena O; Podoplelova, Nadezhda A; Sveshnikova, Anastasia N; Demina, Irina A; Ataullakhanov, Fazly I; Panteleev, Mikhail A

    2015-01-01

    Coagulation factor XII (fXII) is important for arterial thrombosis, but its physiological activation mechanisms are unclear. In this study, we elucidated the role of platelets and platelet-derived material in fXII activation. FXII activation was only observed upon potent platelet stimulation (with thrombin, collagen-related peptide, or calcium ionophore, but not ADP) accompanied by phosphatidylserine exposure and was localised to the platelet surface. Platelets from three patients with grey platelet syndrome did not activate fXII, which suggests that platelet-associated fXII-activating material might be released from α-granules. FXII was preferentially bound by phosphotidylserine-positive platelets and annexin V abrogated platelet-dependent fXII activation; however, artificial phosphotidylserine/phosphatidylcholine microvesicles did not support fXII activation under the conditions herein. Confocal microscopy using DAPI as a poly-phosphate marker did not reveal poly-phosphates associated with an activated platelet surface. Experimental data for fXII activation indicates an auto-inhibition mechanism (ki/ka = 180 molecules/platelet). Unlike surface-associated fXII activation, platelet secretion inhibited activated fXII (fXIIa), particularly due to a released C1-inhibitor. Platelet surface-associated fXIIa formation triggered contact pathway-dependent clotting in recalcified plasma. Computer modelling suggests that fXIIa inactivation was greatly decreased in thrombi under high blood flow due to inhibitor washout. Combined, the surface-associated fXII activation and its inhibition in solution herein may be regarded as a flow-sensitive regulator that can shift the balance between surface-associated clotting and plasma-dependent inhibition, which may explain the role of fXII at high shear and why fXII is important for thrombosis but negligible in haemostasis. PMID:25688860

  15. Platelet Surface-Associated Activation and Secretion-Mediated Inhibition of Coagulation Factor XII

    PubMed Central

    Zakharova, Natalia V.; Artemenko, Elena O.; Podoplelova, Nadezhda A.; Sveshnikova, Anastasia N.; Demina, Irina A.; Ataullakhanov, Fazly I.; Panteleev, Mikhail A.

    2015-01-01

    Coagulation factor XII (fXII) is important for arterial thrombosis, but its physiological activation mechanisms are unclear. In this study, we elucidated the role of platelets and platelet-derived material in fXII activation. FXII activation was only observed upon potent platelet stimulation (with thrombin, collagen-related peptide, or calcium ionophore, but not ADP) accompanied by phosphatidylserine exposure and was localised to the platelet surface. Platelets from three patients with grey platelet syndrome did not activate fXII, which suggests that platelet-associated fXII-activating material might be released from α-granules. FXII was preferentially bound by phosphotidylserine-positive platelets and annexin V abrogated platelet-dependent fXII activation; however, artificial phosphotidylserine/phosphatidylcholine microvesicles did not support fXII activation under the conditions herein. Confocal microscopy using DAPI as a poly-phosphate marker did not reveal poly-phosphates associated with an activated platelet surface. Experimental data for fXII activation indicates an auto-inhibition mechanism (ki/ka = 180 molecules/platelet). Unlike surface-associated fXII activation, platelet secretion inhibited activated fXII (fXIIa), particularly due to a released C1-inhibitor. Platelet surface-associated fXIIa formation triggered contact pathway-dependent clotting in recalcified plasma. Computer modelling suggests that fXIIa inactivation was greatly decreased in thrombi under high blood flow due to inhibitor washout. Combined, the surface-associated fXII activation and its inhibition in solution herein may be regarded as a flow-sensitive regulator that can shift the balance between surface-associated clotting and plasma-dependent inhibition, which may explain the role of fXII at high shear and why fXII is important for thrombosis but negligible in haemostasis. PMID:25688860

  16. Redox-mediated activation of latent transforming growth factor-beta 1.

    PubMed

    Barcellos-Hoff, M H; Dix, T A

    1996-09-01

    Transforming growth factor beta 1 (TGF beta) is a multifunctional cytokine that orchestrates response to injury via ubiquitous cell surface receptors. The biological activity of TGF beta is restrained by its secretion as a latent complex (LTGF beta) such that activation determines the extent of TGF beta activity during physiological and pathological events. TGF beta action has been implicated in a variety of reactive oxygen-mediated tissue processes, particularly inflammation, and in pathologies such as reperfusion injury, rheumatoid arthritis, and atherosclerosis. It was recently shown to be rapidly activated after in vivo radiation exposure, which also generates reactive oxygen species (ROS). In the present studies, the potential for redox-mediated LTGF beta activation was investigated using a cell-free system in which ROS were generated in solution by ionizing radiation or metal ion-catalyzed ascorbate reaction. Irradiation (100 Gray) of recombinant human LTGF beta in solution induced 26% activation compared with that elicited by standard thermal activation. Metal-catalyzed ascorbate oxidation elicited extremely efficient recombinant LTGF beta activation that matched or exceeded thermal activation. The efficiency of ascorbate activation depended on ascorbate concentrations and the presence of transition metal ions. We postulate that oxidation of specific amino acids in the latency-conferring peptide leads to a conformation change in the latent complex that allows release of TGF beta. Oxidative activation offers a novel route for the involvement of TGF beta in tissue processes in which ROS are implicated and endows LTGF beta with the ability to act as a sensor of oxidative stress and, by releasing TGF beta, to function as a signal for orchestrating the response of multiple cell types. LTGF beta redox sensitivity is presumably directed toward recovery of homeostasis; however, oxidation may also be a mechanism of LTGF beta activation that can be deleterious during

  17. Leisure time physical activity in the Framingham Offspring Study. Description, seasonal variation, and risk factor correlates.

    PubMed

    Dannenberg, A L; Keller, J B; Wilson, P W; Castelli, W P

    1989-01-01

    Self-reported leisure time physical activity was analyzed for 1,598 men and 1,762 women aged 20-69 years in the Framingham Offspring Cycle 2 exam in 1979-1983. Walking for pleasure was generally the most common physical activity for both sexes throughout the year. Substantial seasonal variation was noted for the most common activities: gardening, carpentry, lawn mowing, golf, and running for men; and gardening, swimming, health club exercise, dancing, and bicycling for women. Both sexes expended more kilocalories in physical activities in summer than in winter (p less than 0.001). Frequency of participation in activities sufficient to induce perspiration was associated with frequency of participation in at least one hour of conditioning (greater than or equal to 7.5 kilocal/minute) activities per week (p less than 0.001). Based on age-adjusted mean levels, higher high density lipoprotein cholesterol, lower heart rate, lower body mass index and fewer cigarettes smoked per day were consistently observed across four quartiles of increasing physical activity levels (p less than 0.01). Men who participated in at least one hour of conditioning activities per week had significantly different mean levels for these four risk factors than men who reported less than one hour of such activities per week (p less than 0.001). Results substantiate previous reports of an inverse relation between physical activity levels and cardiovascular risk, and suggest seasonal variation in activity levels should be considered in future studies which explore the relation between physical activity and cardiovascular disease. PMID:2910074

  18. Platelet-Activating Factor Receptors Mediate Excitatory Postsynaptic Hippocampal Injury in Experimental Autoimmune Encephalomyelitis

    PubMed Central

    Geathers, Jasmine S.; Allan, Kevin C.; Gelbard, Harris A.

    2016-01-01

    Gray matter degeneration contributes to progressive disability in multiple sclerosis (MS) and can occur out of proportion to measures of white matter disease. Although white matter pathology, including demyelination and axon injury, can lead to secondary gray matter changes, we hypothesized that neurons can undergo direct excitatory injury within the gray matter independent of these. We tested this using a model of experimental autoimmune encephalomyelitis (EAE) with hippocampal degeneration in C57BL/6 mice, in which immunofluorescent staining showed a 28% loss of PSD95-positive excitatory postsynaptic puncta in hippocampal area CA1 compared with sham-immunized controls, despite preservation of myelin and VGLUT1-positive excitatory axon terminals. Loss of postsynaptic structures was accompanied by appearance of PSD95-positive debris that colocalized with the processes of activated microglia at 25 d after immunization, and clearance of debris was followed by persistently reduced synaptic density at 55 d. In vitro, addition of activated BV2 microglial cells to hippocampal cultures increased neuronal vulnerability to excitotoxic dendritic damage following a burst of synaptic activity in a manner dependent on platelet-activating factor receptor (PAFR) signaling. In vivo treatment with PAFR antagonist BN52021 prevented PSD95-positive synapse loss in hippocampi of mice with EAE but did not affect development of EAE or local microglial activation. These results demonstrate that postsynaptic structures can be a primary target of injury within the gray matter in autoimmune neuroinflammatory disease, and suggest that this may occur via PAFR-mediated modulation of activity-dependent synaptic physiology downstream of microglial activation. SIGNIFICANCE STATEMENT Unraveling gray matter degeneration is critical for developing treatments for progressive disability and cognitive impairment in multiple sclerosis (MS). In a mouse model of MS, we show that neurons can undergo injury

  19. Fibroblast growth factor receptor 1 is principally responsible for fibroblast growth factor 2-induced catabolic activities in human articular chondrocytes

    PubMed Central

    2011-01-01

    Introduction Cartilage degeneration driven by catabolic stimuli is a critical pathophysiological process in osteoarthritis (OA). We have defined fibroblast growth factor 2 (FGF-2) as a degenerative mediator in adult human articular chondrocytes. Biological effects mediated by FGF-2 include inhibition of proteoglycan production, up-regulation of matrix metalloproteinase-13 (MMP-13), and stimulation of other catabolic factors. In this study, we identified the specific receptor responsible for the catabolic functions of FGF-2, and established a pathophysiological connection between the FGF-2 receptor and OA. Methods Primary human articular chondrocytes were cultured in monolayer (24 hours) or alginate beads (21 days), and stimulated with FGF-2 or FGF18, in the presence or absence of FGFR1 (FGF receptor 1) inhibitor. Proteoglycan accumulation and chondrocyte proliferation were assessed by dimethylmethylene blue (DMMB) assay and DNA assay, respectively. Expression of FGFRs (FGFR1 to FGFR4) was assessed by flow cytometry, immunoblotting, and quantitative real-time PCR (qPCR). The distinctive roles of FGFR1 and FGFR3 after stimulation with FGF-2 were evaluated using either pharmacological inhibitors or FGFR small interfering RNA (siRNA). Luciferase reporter gene assays were used to quantify the effects of FGF-2 and FGFR1 inhibitor on MMP-13 promoter activity. Results Chondrocyte proliferation was significantly enhanced in the presence of FGF-2 stimulation, which was inhibited by the pharmacological inhibitor of FGFR1. Proteoglycan accumulation was reduced by 50% in the presence of FGF-2, and this reduction was successfully rescued by FGFR1 inhibitor. FGFR1 inhibitors also fully reversed the up-regulation of MMP-13 expression and promoter activity stimulated by FGF-2. Blockade of FGFR1 signaling by either chemical inhibitors or siRNA targeting FGFR1 rather than FGFR3 abrogated the up-regulation of matrix metalloproteinases 13 (MMP-13) and a disintegrin and

  20. Factors Influencing Physical Activity in Children and Youth with Special Health Care Needs: A Pilot Study

    PubMed Central

    Feehan, Katie; O'Neil, Margaret E.; Abdalla, Diana; Fragala-Pinkham, Maria; Kondrad, Monica; Berhane, Zekarias; Turchi, Renee

    2012-01-01

    Background. Evidence suggests that children and youth with special health care needs (CYSHCN) have decreased physical activity compared to peers. This study describes weight status and physical activity in CYSHCN and identifies factors associated with physical activity and community resources to promote physical activity. Methods. Parents (n = 21) and CYSHCN (n = 23) were recruited from a pediatric clinic. The most prevalent diagnoses were autism (n = 7, 30%) and cerebral palsy (n = 3, 13%). Interviews were conducted with parents for information on physical activity and community resources. Children's height and weight were measured to calculate body mass index (BMI). Results. The majority of CYSHCN (n = 13, 59%) were obese. CYSHCN did not meet recommended levels of 60 minutes of daily physical activity and engaged in more screen time than recommended. More children with cognitive/behavioral/emotional diagnoses were obese compared to children with physical/medical diagnoses. A majority of parents (n = 16, 73%) indicated their CYSHCN need more supervision to participate in physical activity in community programs. Conclusion. The majority of CYSHCN in this study were obese and sedentary. Resources to promote physical activity are needed for this population. PMID:22611411

  1. Immunotherapy for Prostate Cancer with Gc Protein-Derived Macrophage-Activating Factor, GcMAF.

    PubMed

    Yamamoto, Nobuto; Suyama, Hirofumi; Yamamoto, Nobuyuki

    2008-07-01

    Serum Gc protein (known as vitamin D(3)-binding protein) is the precursor for the principal macrophage-activating factor (MAF). The MAF precursor activity of serum Gc protein of prostate cancer patients was lost or reduced because Gc protein was deglycosylated by serum alpha-N-acetylgalactosaminidase (Nagalase) secreted from cancerous cells. Therefore, macrophages of prostate cancer patients having deglycosylated Gc protein cannot be activated, leading to immunosuppression. Stepwise treatment of purified Gc protein with immobilized beta-galactosidase and sialidase generated the most potent MAF (termed GcMAF) ever discovered, which produces no adverse effect in humans. Macrophages activated by GcMAF develop a considerable variation of receptors that recognize the abnormality in malignant cell surface and are highly tumoricidal. Sixteen nonanemic prostate cancer patients received weekly administration of 100 ng of GcMAF. As the MAF precursor activity increased, their serum Nagalase activity decreased. Because serum Nagalase activity is proportional to tumor burden, the entire time course analysis for GcMAF therapy was monitored by measuring the serum Nagalase activity. After 14 to 25 weekly administrations of GcMAF (100 ng/week), all 16 patients had very low serum Nagalase levels equivalent to those of healthy control values, indicating that these patients are tumor-free. No recurrence occurred for 7 years. PMID:18633461

  2. Rho guanine nucleotide exchange factors: regulators of Rho GTPase activity in development and disease

    PubMed Central

    Cook, Danielle R.; Rossman, Kent L.; Der, Channing J.

    2016-01-01

    The aberrant activity of Ras homologous (Rho) family small GTPases (20 human members) has been implicated in cancer and other human diseases. However, in contrast to the direct mutational activation of Ras found in cancer and developmental disorders, Rho GTPases are activated most commonly by indirect mechanisms in disease. One prevalent mechanism involves aberrant Rho activation via the deregulated expression and/or activity of Rho family guanine nucleotide exchange factors (RhoGEFs). RhoGEFs promote formation of the active GTP-bound state of Rho GTPases. The largest family of RhoGEFs is comprised of the Dbl family RhoGEFs with 70 human members. The multitude of RhoGEFs that activate a single Rho GTPase reflect the very specific role of each RhoGEF in controlling distinct signaling mechanisms involved in Rho activation. In this review, we summarize the role of Dbl RhoGEFs in development and disease, with a focus on Ect2, Tiam1, Vav and P-Rex1/2. PMID:24037532

  3. Metallothionein gene expression is regulated by serum factors and activators of protein kinase C.

    PubMed Central

    Imbra, R J; Karin, M

    1987-01-01

    The exact physiological role of metallothionein (MT) is not clear. It has been suggested that these low-molecular-weight, highly inducible, heavy-metal-binding proteins serve in the regulation of intracellular Zn metabolism. Among the Zn-requiring systems are several enzymes involved in DNA replication and repair. Therefore, during periods of active DNA synthesis there is likely to be an increased demand for Zn, which could be met by elevated MT synthesis. For that reason, we examined whether stimulation of cellular proliferation leads to increased expression of MT. We report here that treatment of cultured mammalian cells with serum growth factors and activators of protein kinase C, all of which are known to have growth stimulatory activity, led to induction of MT mRNA. One of the required steps in the signal transduction pathways triggered by these agents, ending in MT induction, appears to be the activation of protein kinase C. Images PMID:3600629

  4. Factors Associated with Sustained Attention During an Activity Intervention in Persons with Dementia

    PubMed Central

    Kolanowski, Ann; Bossen, Ann; Hill, Nikki; Guzman-Velez, Edmarie; Litaker, Mark

    2013-01-01

    Background/Aims Are the non-cognitive factors of self-reported mood and personality related to sustained attention in nursing home residents with dementia during an activity intervention? Methods Intervention data from a randomized clinical trial were used to address the aim of this project. Subjects were 128 nursing home residents who were assessed for mood, personality, behavioral indicators of attention, time on task and number of disengagements during an activity intervention. Results More positive self-reported mood was associated with greater behavioral displays of attention during activities, greater time spent engaged in the activities and less disengagement. Conclusion To our knowledge this is the first study to report on the association of mood, personality and sustained attention in nursing home residents with dementia. While the findings are preliminary, they can be used to inform the design of future research. PMID:22652933

  5. Seasonal distribution of systemic lupus erythematosus activity and its correlation with climate factors.

    PubMed

    Yang, Jie; Lu, Yu-Wei; Pan, Hai-Feng; Tao, Jin-Hui; Zou, Yan-Feng; Bao, Wei; Ye, Dong-Qing

    2012-08-01

    Systemic lupus erythematosus (SLE) is a complex autoimmune disease with a variety of clinical manifestations. Although inter-individual variations exist with respect to susceptibility to develop SLE, no study has been carried out to determine the role of different climate conditions in predisposing the susceptible individuals to SLE. The objective of this study was to investigate the role of different seasons and climate factors on SLE activity. From 2000 to 2009, the seasonal distribution of 2,802 active SLE patients recruited from Anhui Provincial Hospital and the First Affiliated Hospital of Anhui Medical University was analyzed retrospectively. The climate data were provided by the Institute of Geographical Sciences and Resources, Chinese Academy of Sciences. The correlation between climate factors and SLE activity was also analyzed. The proportion of active SLE patients in winter, spring, summer, and autumn was 10.06, 10.31, 9.74, and 8.66‰, respectively. In autumn, the proportion was much lower than that in winter and spring (P < 0.05). The proportion among winter, spring, and summer had no statistical difference (P > 0.05). The number of active SLE patients had no correlation with air temperature (r = 0.483, P > 0.05), relative humidity (r = -0.294, P > 0.05), and sunshine percentage (r = 0.503, P > 0.05), but it had positive correlation with amount of precipitation (r = 0.601, P < 0.05), wind velocity (r = 0.713, P < 0.01), and sunshine duration (r = 0.769, P < 0.01) and negative correlation with barometric pressure (r = -0.664, P < 0.05). The disease activity of patients with SLE is affected by seasons and climate factors. PMID:21667078

  6. Sphingosine-1-phosphate mediates epidermal growth factor-induced muscle satellite cell activation

    SciTech Connect

    Nagata, Yosuke Ohashi, Kazuya; Wada, Eiji; Yuasa, Yuki; Shiozuka, Masataka; Nonomura, Yoshiaki; Matsuda, Ryoichi

    2014-08-01

    Skeletal muscle can regenerate repeatedly due to the presence of resident stem cells, called satellite cells. Because satellite cells are usually quiescent, they must be activated before participating in muscle regeneration in response to stimuli such as injury, overloading, and stretch. Although satellite cell activation is a crucial step in muscle regeneration, little is known of the molecular mechanisms controlling this process. Recent work showed that the bioactive lipid sphingosine-1-phosphate (S1P) plays crucial roles in the activation, proliferation, and differentiation of muscle satellite cells. We investigated the role of growth factors in S1P-mediated satellite cell activation. We found that epidermal growth factor (EGF) in combination with insulin induced proliferation of quiescent undifferentiated mouse myoblast C2C12 cells, which are also known as reserve cells, in serum-free conditions. Sphingosine kinase activity increased when reserve cells were stimulated with EGF. Treatment of reserve cells with the D-erythro-N,N-dimethylsphingosine, Sphingosine Kinase Inhibitor, or siRNA duplexes specific for sphingosine kinase 1, suppressed EGF-induced C2C12 activation. We also present the evidence showing the S1P receptor S1P2 is involved in EGF-induced reserve cell activation. Moreover, we demonstrated a combination of insulin and EGF promoted activation of satellite cells on single myofibers in a manner dependent on SPHK and S1P2. Taken together, our observations show that EGF-induced satellite cell activation is mediated by S1P and its receptor. - Highlights: • EGF in combination with insulin induces proliferation of quiescent C2C12 cells. • Sphingosine kinase activity increases when reserve cells are stimulated with EGF. • EGF-induced activation of reserve cells is dependent on sphingosine kinase and ERK. • The S1P receptor S1P2 is involved in EGF-induced reserve cell activation. • EGF-induced reserve cell activation is mediated by S1P and its

  7. Differential Activity-Dependent Secretion of Brain-Derived Neurotrophic Factor from Axon and Dendrite

    PubMed Central

    Matsuda, Naoto; Lu, Hui; Fukata, Yuko; Noritake, Jun; Gao, Hongfeng; Mukherjee, Sujay; Nemoto, Tomomi; Fukata, Masaki

    2009-01-01

    Brain-derived neurotrophic factor (BDNF) is essential for neuronal survival and differentiation during development and for synaptic function and plasticity in the mature brain. BDNF-containing vesicles are widely distributed and bidirectionally transported in neurons, and secreted BDNF can act on both presynaptic and postsynaptic cells. Activity-dependent BDNF secretion from neuronal cultures has been reported, but it remains unknown where the primary site of BDNF secretion is and whether neuronal activity can trigger BDNF secretion from axons and dendrites with equal efficacy. Using BDNF fused with pH-sensitive green fluorescent protein to visualize BDNF secretion, we found that BDNF-containing vesicles exhibited markedly different properties of activity-dependent exocytic fusion at the axon and dendrite of cultured hippocampal neurons. Brief spiking activity triggered a transient fusion pore opening, followed by immediate retrieval of vesicles without dilation of the fusion pore, resulting in very little BDNF secretion at the axon. On the contrary, the same brief spiking activity induced “full-collapse” vesicle fusion and substantial BDNF secretion at the dendrite. However, full vesicular fusion with BDNF secretion could occur at the axon when the neuron was stimulated by prolonged high-frequency activity, a condition neurons may encounter during epileptic discharge. Thus, activity-dependent axonal secretion of BDNF is highly restricted as a result of incomplete fusion of BDNF-containing vesicles, and normal neural activity induces BDNF secretion from dendrites, consistent with the BDNF function as a retrograde factor. Our study also revealed a novel mechanism by which differential exocytosis of BDNF-containing vesicles may regulate BDNF–TrkB signaling between connected neurons. PMID:19906967

  8. The Ebola Virus VP35 Protein Inhibits Activation of Interferon Regulatory Factor 3

    PubMed Central

    Basler, Christopher F.; Mikulasova, Andrea; Martinez-Sobrido, Luis; Paragas, Jason; Mühlberger, Elke; Bray, Mike; Klenk, Hans-Dieter; Palese, Peter; García-Sastre, Adolfo

    2003-01-01

    The Ebola virus VP35 protein was previously found to act as an interferon (IFN) antagonist which could complement growth of influenza delNS1 virus, a mutant influenza virus lacking the influenza virus IFN antagonist protein, NS1. The Ebola virus VP35 could also prevent the virus- or double-stranded RNA-mediated transcriptional activation of both the beta IFN (IFN-β) promoter and the IFN-stimulated ISG54 promoter (C. Basler et al., Proc. Natl. Acad. Sci. USA 97:12289-12294, 2000). We now show that VP35 inhibits virus infection-induced transcriptional activation of IFN regulatory factor 3 (IRF-3)-responsive mammalian promoters and that VP35 does not block signaling from the IFN-α/β receptor. The ability of VP35 to inhibit this virus-induced transcription correlates with its ability to block activation of IRF-3, a cellular transcription factor of central importance in initiating the host cell IFN response. We demonstrate that VP35 blocks the Sendai virus-induced activation of two promoters which can be directly activated by IRF-3, namely, the ISG54 promoter and the ISG56 promoter. Further, expression of VP35 prevents the IRF-3-dependent activation of the IFN-α4 promoter in response to viral infection. The inhibition of IRF-3 appears to occur through an inhibition of IRF-3 phosphorylation. VP35 blocks virus-induced IRF-3 phosphorylation and subsequent IRF-3 dimerization and nuclear translocation. Consistent with these observations, Ebola virus infection of Vero cells activated neither transcription from the ISG54 promoter nor nuclear accumulation of IRF-3. These data suggest that in Ebola virus-infected cells, VP35 inhibits the induction of antiviral genes, including the IFN-β gene, by blocking IRF-3 activation. PMID:12829834

  9. Da0324, an inhibitor of nuclear factor-κB activation, demonstrates selective antitumor activity on human gastric cancer cells

    PubMed Central

    Jin, Rong; Xia, Yiqun; Chen, Qiuxiang; Li, Wulan; Chen, Dahui; Ye, Hui; Zhao, Chengguang; Du, Xiaojing; Shi, Dengjian; Wu, Jianzhang; Liang, Guang

    2016-01-01

    Background The transcription factor nuclear factor-κB (NF-κB) is constitutively activated in a variety of human cancers, including gastric cancer. NF-κB inhibitors that selectively kill cancer cells are urgently needed for cancer treatment. Curcumin is a potent inhibitor of NF-κB activation. Unfortunately, the therapeutic potential of curcumin is limited by its relatively low potency and poor cellular bioavailability. In this study, we presented a novel NF-κB inhibitor named Da0324, a synthetic asymmetric mono-carbonyl analog of curcumin. The purpose of this study is to research the expression of NF-κB in gastric cancer and the antitumor activity and mechanism of Da0324 on human gastric cancer cells. Methods The expressions between gastric cancer tissues/cells and normal gastric tissues/cells of NF-κB were evaluated by Western blot. The inhibition viability of compounds on human gastric cancer cell lines SGC-7901, BGC-823, MGC-803, and normal gastric mucosa epithelial cell line GES-1 was assessed with the 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide assay. Absorption spectrum method and high-performance liquid chromatography method detected the stability of the compound in vitro. The compound-induced changes of inducible NF-κB activation in the SGC-7901 and BGC-823 cells were examined by Western blot analysis and immunofluorescence methods. The antitumor activity of compound was performed by clonogenic assay, matrigel invasion assay, flow cytometric analysis, Western blot analysis, and Hoechst 33258 staining assay. Results High levels of p65 were found in gastric cancer tissues and cells. Da0324 displayed higher growth inhibition against several types of gastric cancer cell lines and showed relatively low toxicity to GES-1. Moreover, Da0324 was more stable than curcumin in vitro. Western blot analysis and immunofluorescence methods showed that Da0324 blocked NF-κB activation. In addition, Da0324 significantly inhibited tumor proliferation

  10. Chronic intermittent hypoxia activates nuclear factor-{kappa}B in cardiovascular tissues in vivo

    SciTech Connect

    Greenberg, Harly; Ye Xiaobing; Wilson, David; Htoo, Aung K.; Hendersen, Todd; Liu Shufang . E-mail: sliu@lij.edu

    2006-05-05

    Obstructive sleep apnea (OSA) is an important risk factor for cardiovascular morbidity and mortality. The mechanisms through which OSA promotes the development of cardiovascular disease are poorly understood. In this study, we tested the hypotheses that chronic exposure to intermittent hypoxia and reoxygenation (CIH) is a major pathologic factor causing cardiovascular inflammation, and that CIH-induces cardiovascular inflammation and pathology by activating the NF-{kappa}B pathway. We demonstrated that exposure of mice to CIH activated NF-{kappa}B in cardiovascular tissues, and that OSA patients had markedly elevated monocyte NF-{kappa}B activity, which was significantly decreased when obstructive apneas and their resultant CIH were eliminated by nocturnal CPAP therapy. The elevated NF-{kappa}B activity induced by CIH is accompanied by and temporally correlated to the increased expression of iNOS protein, a putative and important NF-{kappa}B-dependent gene product. Thus, CIH-mediated NF-{kappa}B activation may be a molecular mechanism linking OSA and cardiovascular pathologies seen in OSA patients.

  11. Activation of initiation factor 2 by ligands and mutations for rapid docking of ribosomal subunits.

    PubMed

    Pavlov, Michael Y; Zorzet, Anna; Andersson, Dan I; Ehrenberg, Måns

    2011-01-19

    We previously identified mutations in the GTPase initiation factor 2 (IF2), located outside its tRNA-binding domain, compensating strongly (A-type) or weakly (B-type) for initiator tRNA formylation deficiency. We show here that rapid docking of 30S with 50S subunits in initiation of translation depends on switching 30S subunit-bound IF2 from its inactive to active form. Activation of wild-type IF2 requires GTP and formylated initiator tRNA (fMet-tRNA(i)). In contrast, extensive activation of A-type IF2 occurs with only GTP or with GDP and fMet-tRNA(i), implying a passive role for initiator tRNA as activator of IF2 in subunit docking. The theory of conditional switching of GTPases quantitatively accounts for all our experimental data. We find that GTP, GDP, fMet-tRNA(i) and A-type mutations multiplicatively increase the equilibrium ratio, K, between active and inactive forms of IF2 from a value of 4 × 10(-4) for wild-type apo-IF2 by factors of 300, 8, 80 and 20, respectively. Functional characterization of the A-type mutations provides keys to structural interpretation of conditional switching of IF2 and other multidomain GTPases. PMID:21151095

  12. Berbamine enhances the antineoplastic activity of gemcitabine in pancreatic cancer cells by activating transforming growth factor-β/Smad signaling.

    PubMed

    Jin, Xiaoli; Wu, Yulian

    2014-05-01

    Drug-resistance to gemcitabine chemotherapy in pancreatic cancer is still an unsolved problem. Combinations of other chemotherapy drugs with gemcitabine have been shown to increase the efficacy of gemcitabine-based treatment. In this study, the effect of berbamine on the antitumor activity of gemcitabine was evaluated in human pancreatic cancer cell lines Bxpc-3 and Panc-1, and the underlying mechanisms were explored. Our results demonstrated that berbamine exhibited a time- and dose-dependent inhibitory effect in the pancreatic cancer cell lines. Berbamine enhanced gemcitabine-induced cell growth inhibition and apoptosis in these cells. Combined treatment of berbamine and gemcitabine resulted in down-regulation of anti-apoptotic proteins (Bcl-2, Bcl-xL) and up-regulation of pro-apoptotic proteins (Bax, Bid). More importantly, berbamine treatment in combination with gemcitabine activated the transforming growth factor-β/Smad (TGF-β/Smad) signaling pathway, as a result of a decrease in Smad7 and an increase in transforming growth factor-β receptor II (TβRII) expression. Changes in downstream targets of Smad7, such as up-regulation of p21 and down-regulation of c-Myc and Cyclin D1 were also observed. Therefore, berbamine could enhance the antitumor activity of gemcitabine by inhibiting cell growth and inducing apoptosis, possibly through the regulation of the expression of apoptosis-related proteins and the activation of TGF-β/Smad signaling pathway. Our study indicates that berbamine may be a promising candidate to be used in combination with gemcitabine for pancreatic cancer treatment. PMID:24619961

  13. Membrane Binding Events in the Initiation and Propagation Phases of Tissue Factor-initiated Zymogen Activation under Flow*

    PubMed Central

    Haynes, Laura M.; Dubief, Yves C.; Mann, Kenneth G.

    2012-01-01

    This study investigates the dynamics of zymogen activation when both extrinsic tenase and prothrombinase are assembled on an appropriate membrane. Although the activation of prothrombin by surface-localized prothrombinase is clearly mediated by flow-induced dilutional effects, we find that when factor X is activated in isolation by surface-localized extrinsic tenase, it exhibits characteristics of diffusion-mediated activation in which diffusion of substrate to the catalytically active region is rate-limiting. When prothrombin and factor X are activated coincident with each other, competition for available membrane binding sites masks the diffusion-limiting effects of factor X activation. To verify the role of membrane binding in the activation of factor X by extrinsic tenase under flow conditions, we demonstrate that bovine lactadherin competes for both factor X and Xa binding sites, limiting factor X activation and forcing the release of bound factor Xa from the membrane at a venous shear rate (100 s−1). Finally, we present steady-state models of prothrombin and factor X activation under flow showing that zymogen and enzyme membrane binding events further regulate the coagulation process in an open system representative of the vasculature geometry. PMID:22187432

  14. Factors predicting health behaviors among Army Reserve, active duty Army, and civilian hospital employees.

    PubMed

    Wynd, Christine A; Ryan-Wenger, Nancy A

    2004-12-01

    This study identified health-risk and health-promoting behaviors in military and civilian personnel employed in hospitals. Intrinsic self-motivation and extrinsic organizational workplace factors were examined as predictors of health behaviors. Because reservists represent a blend of military and civilian lifestyles, descriptive analyses focused on comparing Army Reserve personnel (n = 199) with active duty Army (n = 218) and civilian employees (n = 193), for a total sample of 610. Self-motivation and social support were significant factors contributing to the adoption of health-promoting behaviors; however, organizational workplace cultures were inconsistent predictors of health among the three groups. Only the active Army subgroup identified a hierarchical culture as having an influence on health promotion, possibly because of the Army's mandatory physical fitness and weight control standards. Social support and self-motivation are essential to promoting health among employees, thus hospital commanders and chief executive officers should encourage strategies that enhance and reward these behaviors. PMID:15646182

  15. Structural Basis for Rab GTPase Activation by VPS9 Domain Exchange Factors

    SciTech Connect

    Delprato,A.; Lambright, D.

    2007-01-01

    RABEX-5 and other exchange factors with VPS9 domains regulate endocytic trafficking through activation of the Rab family GTPases RAB5, RAB21 and RAB22. Here we report the crystal structure of the RABEX-5 catalytic core in complex with nucleotide-free RAB21, a key intermediate in the exchange reaction pathway. The structure reveals how VPS9 domain exchange factors recognize Rab GTPase substrates, accelerate GDP release and stabilize the nucleotide-free conformation. We further identify an autoinhibitory element in a predicted amphipathic helix located near the C terminus of the VPS9 domain. The autoinhibitory element overlaps with the binding site for the multivalent effector RABAPTIN-5 and potently suppresses the exchange activity of RABEX-5. Autoinhibition can be partially reversed by mutation of conserved residues on the nonpolar face of the predicted amphipathic helix or by assembly of the complex with RABAPTIN-5.

  16. Comparison of endothelium-derived relaxing factor activity between nonpregnant and pregnant rats.

    PubMed

    Honda, H; Kaneko, H; Kondo, M; Kogo, H

    1996-07-01

    The tension of isolated ring preparation of aorta from nonpregnant and pregnant rats was measured isometrically to study the effect of pregnancy on endothelium-derived relaxing factor activity. Contraction in response to norepinephrine and potassium chloride was greater in aortae from nonpregnant rats than in those from pregnant rats. The endothelium-dependent relaxation that was caused by acetylcholine (10(-10)-3 x 10(-9) M) in aortae precontracted with norepinephrine was significantly enhanced in aortae from pregnant rats compared with the relaxation in those from nonpregnant rats. NG-nitro-L-arginine methyl ester (L-NAME) inhibited the endothelium-dependent relaxation in both aorta from pregnant and nonpregnant rats. L-Arginine reversed the inhibition of L-NAME. Those results suggest that the enhanced endothelium-derived relaxing factor activity in rats aortae is associated with pregnancy. PMID:8856958

  17. Building Zebrafish Neurobehavioral Phenomics: Effects of Common Environmental Factors on Anxiety and Locomotor Activity.

    PubMed

    Stewart, Adam Michael; Kaluyeva, Alexandra A; Poudel, Manoj K; Nguyen, Michael; Song, Cai; Kalueff, Allan V

    2015-10-01

    Zebrafish are emerging as an important model organism for neurobehavioral phenomics research. Given the likely variation of zebrafish behavioral phenotypes between and within laboratories, in this study, we examine the influence and variability of several common environmental modifiers on adult zebrafish anxiety and locomotor activity. Utilizing the novel tank paradigm, this study assessed the role of various laboratory factors, including experimenter/handling, testing time and days, batch, and the order of testing, on the behavior of a large population of experimentally naive control fish. Although time of the day, experimenter identity, and order of testing had little effect on zebrafish anxiety and locomotor activity levels, subtle differences were found for testing days and batches. Our study establishes how zebrafish behaviors are modulated by common environmental/laboratory factors and outlines several implications for zebrafish neurobehavioral phenomics research. PMID:26244595

  18. Immunohistochemical detection of active transforming growth factor-beta in situ using engineered tissue

    NASA Technical Reports Server (NTRS)

    Barcellos-Hoff, M. H.; Ehrhart, E. J.; Kalia, M.; Jirtle, R.; Flanders, K.; Tsang, M. L.; Chatterjee, A. (Principal Investigator)

    1995-01-01

    The biological activity of transforming growth factor-beta 1 (TGF-beta) is governed by dissociation from its latent complex. Immunohistochemical discrimination of active and latent TGF-beta could provide insight into TGF-beta activation in physiological and pathological processes. However, evaluation of immunoreactivity specificity in situ has been hindered by the lack of tissue in which TGF-beta status is known. To provide in situ analysis of antibodies to differentiate between these functional forms, we used xenografts of human tumor cells modified by transfection to overexpress latent TGF-beta or constitutively active TGF-beta. This comparison revealed that, whereas most antibodies did not differentiate between TGF-beta activation status, the immunoreactivity of some antibodies was activation dependent. Two widely used peptide antibodies to the amino-terminus of TGF-beta, LC(1-30) and CC(1-30) showed marked preferential immunoreactivity with active TGF-beta versus latent TGF-beta in cryosections. However, in formalin-fixed, paraffin-embedded tissue, discrimination of active TGF-beta by CC(1-30) was lost and immunoreactivity was distinctly extracellular, as previously reported for this antibody. Similar processing-dependent extracellular localization was found with a neutralizing antibody raised to recombinant TGF-beta. Antigen retrieval recovered cell-associated immunoreactivity of both antibodies. Two antibodies to peptides 78-109 showed mild to moderate preferential immunoreactivity with active TGF-beta only in paraffin sections. LC(1-30) was the only antibody tested that discriminated active from latent TGF-beta in both frozen and paraffin-embedded tissue. Thus, in situ discrimination of active versus latent TGF-beta depends on both the antibody and tissue preparation. We propose that tissues engineered to express a specific form of a given protein provide a physiological setting in which to evaluate antibody reactivity with specific functional forms of a

  19. "Feeling unsafe": a photovoice analysis of factors influencing physical activity behavior among Malaysian adolescents.

    PubMed

    Saimon, Rosalia; Choo, Wan Yuen; Bulgiba, Awang

    2015-03-01

    Understanding the factors influencing physical activity (PA) in the Asia-Pacific region is critical, given the high prevalence of inactivity in this area. The photovoice technique explores the types of PA and factors influencing PA among adolescents in Kuching, Sarawak. A total of 160 photographs were collected from participants (adolescents, n = 22, mean age = 14.27 ± 0.7 years, and parents, n = 8, mean age = 48 ± 6.8 years). Data analysis used constant comparison methods of a grounded theory. The Analysis Grid for Environments Linked to Obesity was used to categorize PA factors. Study findings were centered on the concept of safety, facilities, parental restriction, friends, cultural traits, media, community cohesiveness, and weather. The central theme was "feeling unsafe" when being outdoors. To promote PA behavior, provision of PA facilities needs to be supported by other programs that build on peer support, crime prevention, and traffic safety, together with other educational campaigns. PMID:23513006

  20. The decapping activator HPat a novel factor co-purifying with GW182 from Drosophila cells

    PubMed Central

    Jäger, Elisabeth; Dorner, Silke

    2011-01-01

    miRNAs post-transcriptionally regulate gene expression in many eukaryotes and thereby affect a wide range of biological processes. GW182 is a key factor in translation repression and mRNA degradation by miRNAs. In this study we investigate the potential interaction of GW182 and translation or mRNA degradation factors in Drosophila S2 cells. We have identified the decapping activator HPat as a novel factor co-purifying with GW182. Furthermore, we show that the C-terminal domain of GW182, important for gene silencing, is sufficient to form a complex with HPat. Our findings implicate a potential interaction of the miRNA effector component GW182 with the decapping machinery. PMID:20458171

  1. Antiplatelet aggregation and platelet activating factor (PAF) receptor antagonistic activities of the essential oils of five Goniothalamus species.

    PubMed

    Moharam, Bushra Abdulkarim; Jantan, Ibrahim; Ahmad, Fasihuddin bin; Jalil, Juriyati

    2010-08-01

    Nine essential oils, hydrodistilled from different parts of five Goniothalamus species (G. velutinus Airy-Shaw, G. woodii Merr., G. clemensii Ban, G. tapis Miq. and G. tapisoides Mat Salleh) were evaluated for their ability to inhibit platelet aggregation in human whole blood using an electrical impedance method and their inhibitory effects on platelet activating factor (PAF) receptor binding with rabbit platelets using 3H-PAF as a ligand. The chemical composition of the oils was analyzed by gas chromatography (GC) and gas chromatography-mass spectrometry (GC-MS). The bark oil of G. velutinus was the most effective sample as it inhibited both arachidonic acid (AA) and ADP-induced platelet aggregation with IC(50) values of 93.6 and 87.7 microg/mL, respectively. Among the studied oils, the bark oils of G. clemensii, G. woodii, G. velutinus and the root oil of G. tapis showed significant inhibitory effects on PAF receptor binding, with IC(50 )values ranging from 3.5 to 10.5 microg/mL. The strong PAF antagonistic activity of the active oils is related to their high contents of sesquiterpenes and sesquiterpenoids, and the individual components in the oils could possibly produce a synergistic effect in the overall antiplatelet activity of the oils. PMID:20714290

  2. Nerve growth factor enhances the CRE-dependent transcriptional activity activated by nobiletin in PC12 cells.

    PubMed

    Takito, Jiro; Kimura, Junko; Kajima, Koji; Uozumi, Nobuyuki; Watanabe, Makoto; Yokosuka, Akihito; Mimaki, Yoshihiro; Nakamura, Masanori; Ohizumi, Yasushi

    2016-07-01

    Prevention and treatment of Alzheimer disease are urgent problems for elderly people in developed countries. We previously reported that nobiletin, a poly-methoxylated flavone from the citrus peel, improved the symptoms in various types of animal models of memory loss and activated the cAMP responsive element (CRE)-dependent transcription in PC12 cells. Nobiletin activated the cAMP/PKA/MEK/Erk/MAPK signaling pathway without using the TrkA signaling activated by nerve growth factor (NGF). Here, we examined the effect of combination of nobiletin and NGF on the CRE-dependent transcription in PC12 cells. Although NGF alone had little effect on the CRE-dependent transcription, NGF markedly enhanced the CRE-dependent transcription induced by nobiletin. The NGF-induced enhancement was neutralized by a TrkA antagonist, K252a. This effect of NGF was effective on the early signaling event elicited by nobiletin. These results suggested that there was crosstalk between NGF and nobiletin signaling in activating the CRE-dependent transcription in PC12 cells. PMID:27128150

  3. The activation of fibroblast growth factors by heparin: synthesis, structure, and biological activity of heparin-like oligosaccharides.

    PubMed

    de Paz, J L; Angulo, J; Lassaletta, J M; Nieto, P M; Redondo-Horcajo, M; Lozano, R M; Giménez-Gallego, G; Martín-Lomas, M

    2001-09-01

    An effective strategy has been designed for the synthesis of oligosaccharides of different sizes structurally related to the regular region of heparin; this is illustrated by the preparation of hexasaccharide 1 and octasaccharide 2. This synthetic strategy provides the oligosaccharide sequence containing a D-glucosamine unit at the nonreducing end that is not available either by enzymatic or chemical degradation of heparin. It may permit, after slight modifications, the preparation of oligosaccharide fragments with different charge distribution as well. NMR spectroscopy and molecular dynamics simulations have shown that the overall structure of 1 in solution is a stable right-hand helix with four residues per turn. Hexasaccharide 1 and, most likely, octasaccharide 2 are, therefore, chemically well-defined structural models of naturally occurring heparin-like oligosaccharides for use in binding and biological activity studies. Both compounds 1 and 2 induce the mitogenic activity of acid fibroblast growth factor (FGF1), with the half-maximum activating concentration of 2 being equivalent to that of heparin. Sedimentation equilibrium analysis with compound 2 suggests that heparin-induced FGF1 dimerization is not an absolute requirement for biological activity. PMID:11828504

  4. In vivo activity of a nonspecific T cell-replacing factor.

    PubMed

    Kindred, B; Bösing-Schneider, R; Corley, R B

    1979-01-01

    Nonspecific T cell-replacing factors prepared as supernatants from mixed lymphocyte cultures or concanavalin A-stimulated spleen cells are active in vivo iv injected into nude mice at least 3 days before antigen. The supernatants appear to act by enhancing the week IgM responses that occur in untreated nudes. Secondary responses and IgG antibody were not found. PMID:153929

  5. Cardiovascular risk factors and physical activity among university students in Somaliland.

    PubMed

    Ali, Mahdi; Yusuf, Hassan Ismail; Stahmer, Jens; Rahlenbeck, Sibylle I

    2015-04-01

    Physical inactivity is a well-known risk factor for the development of cardiovascular diseases and counts as fourth leading cause of death worldwide. The study aimed to elucidate to what extent cardiovascular risk factors exist in university students in Somaliland. In a cross-sectional survey, self-administered questionnaires were used to elucidate existence of cardiovascular risk factors in 173 university students (117 male, 56 female) in Hargeisa, Somaliland. Information elucidated included socio-economic and demographic data in addition to questions on coffee intake, on physical activity behavior, type of sport/activity and intensity and duration. Height and weight were taken, as was blood pressure (BP). Median age was 23 years in male and 20 years in female students. Mean BMI was 19.7 in male and 21.8 in female students. The prevalence rates of elevated BP and overweight (BMI ≥ 25) in female and male students were, 0 versus 9 and 14 versus 7 %, respectively. Coffee consumption was reported by 39 % of students. None of the female students reported smoking cigarettes, while 5.1 % of the male students did. Physical inactivity was reported by 52 % of the female students and 27 % of the male students (p = 0.01). Overall, male students reported a higher degree and intensity of physical activity. The prevalence of cardiovascular risk factors is low in female and male university students in Somaliland. However, the results demonstrate a high degree of physical inactivity and overweight might become a problem in the future. This issue should be addressed by increasing the motivation and opportunities for physical activity in students. PMID:25179818

  6. Activation of BPV-1 replication in vitro by the transcription factor E2

    NASA Astrophysics Data System (ADS)

    Yang, Liu; Li, Rong; Mohr, Ian J.; Clark, Robin; Botchan, Michael R.

    1991-10-01

    Soluble extracts from uninfected murine cells supplemented with purified viral E1 and E2 proteins support the replication of exogenously added papilloma virus DNA. The E2 transactivator stimulates the binding of the E1 replication protein to the minimal origin of replication and activates DNA replication. These results support the concept that transcription factors have a direct role in the initiation of DNA replication in eukaryotes by participating in the assembly of a complex at the origin of replication.

  7. Expression and activation of erbB-2 and epidermal growth factor receptor in lung adenocarcinomas.

    PubMed Central

    Rachwal, W. J.; Bongiorno, P. F.; Orringer, M. B.; Whyte, R. I.; Ethier, S. P.; Beer, D. G.

    1995-01-01

    ErbB-2 and EGFR (epidermal growth factor receptor) are expressed in lung adenocarcinomas and associated with a poor prognosis. Immunocytochemical analysis revealed erbB-2 and EGFR coexperession as a characteristic feature of most lung adenocarcinomas, and at levels of receptor expression present in bronchial epithelial cells. In primary lung tumours and cell lines, erbB-2 detected using Western blot analysis demonstrated low-level phosphotyrosine staining of the 185 kDa band, as compared with breast cancer cell lines. A549 and A427 lung adenocarcinoma cells treated with neu differentiation factor (NDF) showed increased erbB-2 phosphotyrosine staining, but to a much lesser extent than breast cancer cells. The lung cells were examined for expression of the potential autocrine growth factors NDF and transforming growth factor alpha (TGF-alpha) by Northern blot analysis. Both NDF and TFG-alpha mRNA were abundantly expressed in the A549 cells. NDF mRNA was highest during active cell proliferation and decreased in confluent cells or after treatment with the growth-inhibitory steroid dexamethasone. Primary tumours and cell lines expressed EGFR, showing higher basal level phosphotyrosine staining than erbB-2. Treatment with NDF and EGF (epidermal growth factor) stimulated cell growth, and in A549 cells the presence of both factors provided an additive increase in cell growth. The growth stimulus that ligand-activated erbB-2 and EGFR provides to lung adenocarcinoma cells may establish a background of continued cell proliferation over which other critical transforming events may occur. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 PMID:7599067

  8. Krüppel-like Factor 4 activates HBG gene expression in primary erythroid cells

    PubMed Central

    Kalra, Inderdeep S.; Alam, Md M.; Choudhary, Pankaj K.; Pace, Betty S.

    2014-01-01

    Summary The SP1/Krüppel-like Factor (SP1/KLF) family of transcription factors plays a role in diverse cellular processes, including proliferation, differentiation and control of gene transcription. The discovery of KLF1 (EKLF), a key regulator of HBB (β-globin) gene expression, expanded our understanding of the role of KLFs in erythropoiesis. In this study, we investigated a mechanism of HBG (γ-globin) regulation by KLF4. siRNA-mediated gene silencing and enforced expression of KLF4 in K562 cells substantiated the ability of KLF4 to positively regulate endogenous HBG gene transcription. The physiological significance of this finding was confirmed in primary erythroid cells, where KLF4 knockdown at day 11 significantly attenuated HBG mRNA levels and enforced expression at day 28 stimulated the silenced HBG genes. In vitro binding characterization using the γ-CACCC and β-CACCC probes demonstrated KLF4 preferentially binds the endogenous γ-CACCC, while CREB binding protein (CREBBP) binding was not selective. Co-immunoprecipitation studies confirmed protein-protein interaction between KLF4 and CREBBP. Furthermore, sequential chromatin immunoprecipitation assays showed co-localization of both factors in the γ-CACCC region. Subsequent luciferase reporter studies demonstrated that KLF4 trans-activated HBG promoter activity and that CREBBP enforced expression resulted in gene repression. Our data supports a model of antagonistic interaction of KLF4/CREBBP trans-factors in HBG regulation. PMID:21539536

  9. Leishmania parasites possess a platelet-activating factor acetylhydrolase important for virulence

    PubMed Central

    Pawlowic, Mattie C.; Zhang, Kai

    2012-01-01

    Leishmania parasites are intracellular protozoans capable of salvaging and remodeling lipids from the host. To understand the role of lipid metabolism in Leishmania virulence, it is necessary to characterize the enzymes involved in the uptake and turnover of phospholipids. This study focuses on a putative phospholipase A2 (PLA2)/platelet-activating factor acetylhydrolase (PAF-AH) in L. major. In mammals, PAF-AH is a subgroup of PLA2 catalyzing the hydrolysis/inactivation of platelet-activating factor (PAF), a potent mediator of many leukocyte functions. By immunofluorescence microscopy, L. major PLA2/PAF-AH is predominantly localized in the ER. While wild type L. major parasites are able to hydrolyze PAF, this activity is completely absent in the PLA2/PAF-AH-null mutants. Meanwhile, deletion of PLA2/PAF-AH had no significant effect on the turnover of common glycerophospholipids such as phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, and phosphatidylglycerol. PLA2/PAF-AH is not required for the growth of L. major parasites in culture, or the production of GPI-anchored virulence factors. Nonetheless, it does play a key role in the mammalian host as the PLA2/PAF-AH null mutants exhibit attenuated virulence in BALB/c mice. In conclusion, these data suggest that Leishmania parasites possess a functional PAF-AH and the degradation of PAF or PAF-like lipids is an important step in infection. PMID:22954769

  10. Circadian variation of tissue plasminogen activator and its inhibitor, von Willebrand factor antigen, and prostacyclin stimulating factor in men with ischaemic heart disease.

    PubMed Central

    Bridges, A B; McLaren, M; Scott, N A; Pringle, T H; McNeill, G P; Belch, J J

    1993-01-01

    OBJECTIVES--To determine whether plasma concentrations of tissue plasminogen activator antigen, von Willebrand factor antigen, and prostacyclin stimulating factor and plasminogen activator inhibitor activity show circadian variation in men with ischaemic heart disease. DESIGN--Blood samples were obtained every four hours for 24 hours from 10 men with ischaemic heart disease. The men were ambulant from 08:10 until 00:00 when they went to bed and they remained in bed until 08:00 the following morning. PATIENTS--Ten men with positive diagnostic exercise tolerance tests with no significant past history, who were not regularly taking any medical treatment except for glyceryl trinitrate. RESULTS--There was significant circadian variation in plasminogen activator inhibitor activity (p = 0.001) (peak value 04:00 and trough value 20:00), but not in plasma concentrations of tissue plasminogen activator antigen, von Willebrand factor, or prostacyclin stimulating factor. CONCLUSION--Men with ischaemic heart disease showed a significant circadian variation in fibrinolysis. The combination of peak values of plasminogen activator inhibitor activity and failure of plasma concentrations of tissue plasminogen activator antigen to increase in the early morning must predispose to thrombosis at this time. The circadian variation in fibrinolysis may contribute to the increased incidence of myocardial infarction in the morning. PMID:8435236

  11. Cytotoxic Necrotizing Factor-Y Boosts Yersinia Effector Translocation by Activating Rac Protein*

    PubMed Central

    Wolters, Manuel; Boyle, Erin C.; Lardong, Kerstin; Trülzsch, Konrad; Steffen, Anika; Rottner, Klemens; Ruckdeschel, Klaus; Aepfelbacher, Martin

    2013-01-01

    Pathogenic Yersinia spp. translocate the effectors YopT, YopE, and YopO/YpkA into target cells to inactivate Rho family GTP-binding proteins and block immune responses. Some Yersinia spp. also secrete the Rho protein activator cytotoxic necrotizing factor-Y (CNF-Y), but it has been unclear how the bacteria may benefit from Rho protein activation. We show here that CNF-Y increases Yop translocation in Yersinia enterocolitica-infected cells up to 5-fold. CNF-Y strongly activated RhoA and also delayed in time Rac1 and Cdc42, but when individually expressed, constitutively active mutants of Rac1, but not of RhoA, increased Yop translocation. Consistently, knock-out or knockdown of Rac1 but not of RhoA, -B, or -C inhibited Yersinia effector translocation in CNF-Y-treated and control cells. Activation or knockdown of Cdc42 also affected Yop translocation but much less efficiently than Rac. The increase in Yop translocation induced by CNF-Y was essentially independent of the presence of YopE, YopT, or YopO in the infecting Yersinia strain, indicating that none of the Yops reported to inhibit translocation could reverse the CNF-Y effect. In summary, the CNF-Y activity of Yersinia strongly enhances Yop translocation through activation of Rac. PMID:23803609

  12. Lithogenic activity as a factor to consider in the metabolic evaluation of patients with calcium lithiasis.

    PubMed

    Arrabal-Polo, Miguel Angel; Cano-Garcia, Maria Del Carmen; Arrabal-Martin, Miguel

    2015-11-01

    Metabolic evaluation is important in high-risk patients with a history of urinary calculi, in order to prevent recurrence. This study aimed to compare patients with calcium calculi and mild lithogenic activity with those with moderate to severe lithogenic activity. Patients with moderate to severe activity had higher levels of urinary calcium level (271.9 mg/24h versus 172.1 mg/24 h, P < .001), uric acid (612.3 mg/24 h versus 528.9 mg/24h, P = .008), and fasting calcium-creatinine ratio (0.16 versus 0.12, P = .001) compared to those with mild lithogenic activity. No association was observed between lithogenic factors in 24-hour urine and mild lithogenic activity in multivariable analysis. We initially thought that in patients who develop recurrent calculi after 5 years or who have mild lithogenic activity, complete metabolic evaluation would not be necessary. However, based on our study findings, it may be important to conduct further studies assessing the lithogenic activity. PMID:26552354

  13. Phosphatidylinositol kinase is activated in membranes derived from cells treated with epidermal growth factor.

    PubMed Central

    Walker, D H; Pike, L J

    1987-01-01

    The ability of epidermal growth factor (EGF) to stimulate phosphatidylinositol (PtdIns) kinase activity in A431 cells was examined. The incorporation of 32P from [gamma-32P]ATP into PtdIns by A431 membranes was increased in membranes prepared from cells that had been pretreated with EGF. Demonstration of a stimulation of the PtdIns kinase activity by EGF required the use of subconfluent cultures and was dependent on the inclusion of protease inhibitors in the buffers used to prepare the membranes. Stimulation of the PtdIns kinase activity was rapid. The activation peaked 2 min after the addition of EGF and declined slowly thereafter. Half-maximal stimulation of the PtdIns kinase occurred at 7 nM EGF. Kinetic analyses of the reaction indicated that treatment of the cells with EGF resulted in a decrease in the Km for PtdIns with no change in the Vmax. The kinetic parameters for the utilization of ATP were unchanged in the EGF-treated membranes compared to the control membranes. Pretreatment of the cells with the phorbol ester phorbol 12-myristate 13-acetate blocked the ability of EGF to stimulate PtdIns kinase activity. These findings demonstrate that a PtdIns kinase activity in A431 cells is regulated by EGF and provide a good system for examining the mechanism by which EGF stimulates the activity of this intracellular enzyme. PMID:2823265

  14. Effects of two types of cobra venom factor on porcine complement activation and pulmonary artery pressure.

    PubMed Central

    Cheung, A K; Parker, C J; Wilcox, L

    1989-01-01

    Autologous porcine plasma that has been incubated with cuprophan haemodialysis membranes causes pulmonary hypertension and peripheral leucopenia following reinfusion into swine. These effects appear to be mediated by biologically active fragments of C3 and C5 that are generated as a consequence of ex vivo activation of complement. Putatively, C5a induces the leucopenia; however, the specific contributions of products of C3 and C5 activation to the pulmonary vasoconstriction have not been elucidated. In the present study, the effects of in vivo infusion of two different types of cobra venom factor (CVF) on peripheral leucocyte count and pulmonary artery pressure in the swine are reported. The CVF from Naja n. naja (CVF(TN)) was shown to activate both porcine C3 and C5, whereas the CVF from Naja h. haje (CVF(NH)) activated only C3. Both types of CVF produced pulmonary hypertension. Significant peripheral leucopenia, however, was observed only with CVF(TN). These results suggest that activation products of C3 contribute to the pulmonary hypertension but not to the peripheral leucopenia observed during haemodialysis using dialysis membranes that activate complement. PMID:12412765

  15. Novel aspects of blood coagulation factor XIII. I. Structure, distribution, activation, and function

    SciTech Connect

    Muszbek, L.; Adany, R.; Mikkola, H.

    1996-10-01

    Blood coagulation factor XIII (FXIII) is a protransglutaminase that becomes activated by the concerted action of thrombin and Ca{sup 2+} in the final stage of the clotting cascade. In addition to plasma, FXIII also occurs in platelets, monocytes, and monocyte-derived macrophages. While the plasma factor is a heterotetramer consisting of paired A and B subunits (A{sub 2}B{sub 2}), its cellular counterpart lacks the B subunits and is a homodimer of potentially active A subunits (A{sub 2}). The gene coding for the A and B subunits has been localized to chromosomes 6p24-25 and 1q31-32.1, respectively. The genomic as well as the primary protein structure of both subunits has been established. Plasma FXIII circulates in association with its substrate precursor, fibrinogen. Fibrin(ogen) has an important regulatory role in the activation of plasma FXIII, for instance the proteolytic removal of activation peptide by thrombin, the dissociation of subunits A and B, and the exposure of the originally buried active site on the free A subunits. The end result of this process is the formation of an active transglutaminase, which crosslinks peptide chains through {epsilon}({gamma}-glutamyl)lysyl isopeptide bonds. The protein substrates of activated FXIII include components of the clotting-fibrinolytic system, adhesive and contractile proteins. The main physiological function of plasma FXIII is to cross-link fibrin and protect it from the fibrinolytic enzyme plasmin. The latter effect is achieved mainly by covalently linking {alpha}{sub 2} antiplasmin, the most potent physiological inhibitor of plasmin, to fibrin. Plasma FXIII seems to be involved in wound healing and tissue repair, and it is essential to maintaining pregnancy. Cellular FXIII, if exposed to the surface of the cells, might support or perhaps take over the hemostatic functions of plasma FXIII; however, its intracellular role has remained mostly unexplored. 328 refs., 4 figs.

  16. Complement-activating ability of leucocytes from patients with complement factor I deficiency.

    PubMed Central

    Marquart, H V; Rasmussen, J M; Leslie, R G

    1997-01-01

    Previous studies from this laboratory have shown that normal peripheral blood B cells are capable of activating complement via the alternative pathway (AP), that the activation is associated with complement receptor type 2 (CR2) expression, and that erythrocytes at normal blood levels partially inhibit the activation. The purpose of the present study was to investigate whether factor I (FI) deficiency, which leads to continued formation of the AP convertase (C3bBb) resulting in the consumption of factor B and C3 and large scale generation of C3b fragments, affects the phenotype and/or function of the patients' B cells. Using flow cytometry, peripheral blood leucocytes (PBL) from two FI-deficient patients were investigated for expression of complement receptors and complement regulatory proteins, in vivo-deposited C3 fragments and in vitro complement-activating ability. CR1 levels on B cells were significantly lower in FI-deficient patients than in normal individuals, whereas CR2 levels were found to be reduced, although not to a significant extent. CR1 levels on monocytes and polymorphonuclear leucocytes (PMN) were found to be normal or slightly raised. All leucocyte subpopulations were found to be covered in vivo with C3b fragments. AP activation on B cells from FI-deficient patients in homologous serum was significantly reduced compared with that for normal individuals, whereas no in vitro activation was seen in autologous serum. In addition, the in vivo-bound C3b fragments were degraded to C3d,g when the patients' PBL were incubated in homologous serum containing EDTA. Finally, the patients, erythrocytes failed to exert any inhibition on AP activation in homologous serum. PMID:9301541

  17. Matriptase activation connects tissue factor-dependent coagulation initiation to epithelial proteolysis and signaling.

    PubMed

    Le Gall, Sylvain M; Szabo, Roman; Lee, Melody; Kirchhofer, Daniel; Craik, Charles S; Bugge, Thomas H; Camerer, Eric

    2016-06-23

    The coagulation cascade is designed to sense tissue injury by physical separation of the membrane-anchored cofactor tissue factor (TF) from inactive precursors of coagulation proteases circulating in plasma. Once TF on epithelial and other extravascular cells is exposed to plasma, sequential activation of coagulation proteases coordinates hemostasis and contributes to host defense and tissue repair. Membrane-anchored serine proteases (MASPs) play critical roles in the development and homeostasis of epithelial barrier tissues; how MASPs are activated in mature epithelia is unknown. We here report that proteases of the extrinsic pathway of blood coagulation transactivate the MASP matriptase, thus connecting coagulation initiation to epithelial proteolysis and signaling. Exposure of TF-expressing cells to factors (F) VIIa and Xa triggered the conversion of latent pro-matriptase to an active protease, which in turn cleaved the pericellular substrates protease-activated receptor-2 (PAR2) and pro-urokinase. An activation pathway-selective PAR2 mutant resistant to direct cleavage by TF:FVIIa and FXa was activated by these proteases when cells co-expressed pro-matriptase, and matriptase transactivation was necessary for efficient cleavage and activation of wild-type PAR2 by physiological concentrations of TF:FVIIa and FXa. The coagulation initiation complex induced rapid and prolonged enhancement of the barrier function of epithelial monolayers that was dependent on matriptase transactivation and PAR2 signaling. These observations suggest that the coagulation cascade engages matriptase to help coordinate epithelial defense and repair programs after injury or infection, and that matriptase may contribute to TF-driven pathogenesis in cancer and inflammation. PMID:27114461

  18. The role of carrier number on the procoagulant activity of tissue factor in blood and plasma

    NASA Astrophysics Data System (ADS)

    Tormoen, G. W.; Rugonyi, S.; Gruber, A.; McCarty, O. J. T.

    2011-12-01

    Tissue factor (TF) is a transmembrane glycoprotein cofactor of activated blood coagulation factor VII (FVIIa) that is required for hemostatic thrombin generation at sites of blood vessel injury. Membrane-associated TF detected in circulating blood of healthy subjects, referred to as intravascular or circulating TF has been shown to contribute to experimental thrombus propagation at sites of localized vessel injury. Certain disease states, such as metastatic cancer, are associated with increased levels of intravascular TF and an elevated risk of venous thromboembolism. However, the physiological relevance of circulating TF to hemostasis or thrombosis, as well as cancer metastasis, is ill-defined. This study was designed to assess whether the spatial separation of intravascular TF carriers in blood, demonstrated with TF-inducible human monocytic cell line U937 or TF-coated polymer microspheres, affected procoagulant activity and hence thrombogenic potential. Experiments were performed to characterize the effects of TF-carrier number on the kinetics of clot formation in both open and closed systems. The procoagulant activity of TF carriers was found to correlate with spatial separation in both closed, well-mixed systems and open, flowing systems. TF carriers enhanced the amidolytic activity of FVIIa toward the chromogenic substrate, S-2366, as a function of carrier count. These results suggest that TF-initiated coagulation by circulating TF is kinetically limited by mass transport of TF-dependent coagulation factors to the TF-bearing surface, a constraint that may be unique to circulating TF. Spatial separation of circulating TF carriers is therefore a critical determinant of the procoagulant activity of circulating TF.

  19. Bortezomib induces canonical nuclear factor-kappaB activation in multiple myeloma cells.

    PubMed

    Hideshima, Teru; Ikeda, Hiroshi; Chauhan, Dharminder; Okawa, Yutaka; Raje, Noopur; Podar, Klaus; Mitsiades, Constantine; Munshi, Nikhil C; Richardson, Paul G; Carrasco, Ruben D; Anderson, Kenneth C

    2009-07-30

    Bortezomib is a proteasome inhibitor with remarkable preclinical and clinical antitumor activity in multiple myeloma (MM) patients. The initial rationale for its use in MM was inhibition of nuclear factor (NF)-kappaB activity by blocking proteasomal degradation of inhibitor of kappaBalpha (IkappaBalpha). Bortezomib inhibits inducible NF-kappaB activity; however, its impact on constitutive NF-kappaB activity in MM cells has not yet been defined. In this study, we demonstrate that bortezomib significantly down-regulated IkappaBalpha expression and triggered NF-kappaB activation in MM cell lines and primary tumor cells from MM patients. Importantly, no inhibition of p65 (RelA) nuclear translocation was recognized after bortezomib treatment in a murine xenograft model bearing human MM cells. Bortezomib-induced NF-kappaB activation was mediated via the canonical pathway. Moreover, other classes of proteasome inhibitors also induced IkappaBalpha down-regulation associated with NF-kappaB activation. Molecular mechanisms whereby bortezomib induced IkappaBalpha down-regulation were further examined. Bortezomib triggered phosphorylation of IkappaB kinase (IKKbeta) and its upstream receptor-interacting protein 2, whereas IKKbeta inhibitor MLN120B blocked bortezomib-induced IkappaBalpha down-regulation and NF-kappaB activation, indicating receptor-interacting protein 2/IKKbeta signaling plays crucial role in bortezomib-induced NF-kappaB activation. Moreover, IKKbeta inhibitors enhanced bortezomib-induced cytotoxicity. Our studies therefore suggest that bortezomib-induced cytotoxicity cannot be fully attributed to inhibition of canonical NF-kappaB activity in MM cells. PMID:19436050

  20. Factor IX Amagasaki: A new mutation in the catalytic domain resulting in the loss of both coagulant and esterase activities

    SciTech Connect

    Miyata, Toshiyuki; Iwanaga, Sadaaki ); Sakai, Toshiyuki; Sugimoto, Mitsuhiko; Naka, Hiroyuki; Yamamoto, Kazukuni; Yoshioka, Akira; Fukui, Hiromu ); Mitsui, Kotoko; Kamiya, Kensyu; Umeyama, Hideaki )

    1991-11-26

    Factor IX Amagasaki (AMG) is a naturally occurring mutant of factor IX having essentially no coagulant activity, even though normal levels of antigen are detected in plasma. Factor IX AMG was purified from the patient's plasma by immunoaffinity chromatography with an anti-factor IX monoclonal antibody column. Factor IX AMG was cleaved normally by factor VIIa-tissue factor complex, yielding a two-chain factor IXa. Amino acid composition and sequence analysis of one of the tryptic peptides isolated from factor IX AMG revealed that Gly-311 had been replaced by Glu. The authors identified a one-base substitution of guanine to adenine in exon VIII by amplifying exon VIII using the polymerase chain reaction method and sequencing the product. This base mutation also supported the replacement of Gly-311 by Glu. In the purified system, factor IXa AMG did not activate for factor X in the presence of factor VIII, phospholipids, and Ca{sup 2+}, and no esterase activity toward Z-Arg-p-nitrobenzyl ester was observed. The model building of the serine protease domain of factor IXa suggests that the Gly-311 {yields} Glu exchange would disrupt the specific conformational state in the active site environment, resulting in the substrate binding site not forming properly. This is the first report to show the experimental evidence for importance of a highly conserved Gly-142 (chymotrypsinogen numbering) located in the catalytic site of mammalian serine proteases so far known.

  1. Lorentz factor distribution of blazars from the optical Fundamental Plane of black hole activity

    NASA Astrophysics Data System (ADS)

    Saikia, Payaswini; Körding, Elmar; Falcke, Heino

    2016-09-01

    Blazar radiation is dominated by a relativistic jet which can be modelled at first approximation using just two intrinsic parameters - the Lorentz factor Γ and the viewing angle θ. Blazar jet observations are often beamed due to relativistic effects, complicating the understanding of these intrinsic properties. The most common way to estimate blazar Lorentz factors needs the estimation of apparent jet speeds and Doppler beaming factors. We present a new and independent method of constructing the blazar Lorentz factor distribution, using the optical Fundamental Plane of black hole activity. The optical Fundamental Plane is a plane stretched out by both the supermassive black holes and the X-ray binaries, in the 3D space provided by their [O III] line luminosity, radio luminosity and black hole mass. We use the intrinsic radio luminosity obtained from the optical Fundamental Plane to constrain the boosting parameters of the VLBA Imaging and Polarimetry Survey blazar sample. We find a blazar bulk Lorentz factor distribution in the form of a power law as N(Γ) ∝ Γ-2.1 ± 0.4 for the Γ range of 1-40. We also discuss the viewing angle distribution of the blazars and the dependence of our results on the input parameters.

  2. Root Hair Deformation Activity of Nodulation Factors and Their Fate on Vicia sativa.

    PubMed Central

    Heidstra, R.; Geurts, R.; Franssen, H.; Spaink, H. P.; Van Kammen, A.; Bisseling, T.

    1994-01-01

    We used a semiquantitative root hair deformation assay for Vicia sativa (vetch) to study the activity of Rhizobium leguminosarum bv viciae nodulation (Nod) factors. Five to 10 min of Nod factor-root interaction appears to be sufficient to induce root hair deformation. The first deformation is visible within 1 h, and after 3 h about 80% of the root hairs in a small susceptible zone of the root are deformed. This zone encompasses root hairs that have almost reached their maximal size. The Nod factor accumulates preferentially to epidermal cells of the young part of the root, but is not restricted to the susceptible zone. In the interaction with roots, the glucosamine backbone of Nod factors is shortened, presumably by chitinases. NodRlv-IV(C18:4,Ac) is more stable than NodRlv-V(C18:4,Ac). No correlation was found between Nod factor degradation and susceptibility. Degradation occurs both in the susceptible zone and in the mature zone. Moreover, degradation is not affected by NH4NO3 and is similar in vetch and in the nonhost alfalfa (Medicago sativa). PMID:12232242

  3. Lorentz factor distribution of blazars from the optical Fundamental plane of black hole activity

    NASA Astrophysics Data System (ADS)

    Saikia, Payaswini; Körding, Elmar; Falcke, Heino

    2016-06-01

    Blazar radiation is dominated by a relativistic jet which can be modeled at first approximation using just two intrinsic parameters - the Lorentz factor Γ and the viewing angle θ. Blazar jet observations are often beamed due to relativistic effects, complicating the understanding of these intrinsic properties. The most common way to estimate blazar Lorentz factors needs the estimation of apparent jet speeds and Doppler beaming factors. We present a new and independent method of constructing the blazar Lorentz factor distribution, using the optical fundamental plane of black hole activity. The optical fundamental plane is a plane stretched out by both the supermassive black holes and the X-ray binaries, in the 3D space provided by their [OIII] line luminosity, radio luminosity and black hole mass. We use the intrinsic radio luminosity obtained from the optical fundamental plane to constrain the boosting parameters of the VLBA Imaging and Polarimetry Survey (VIPS) blazar sample. We find a blazar bulk Lorentz factor distribution in the form of a power law as N(Γ)∝Γ-2.1 ± 0.4 for the Γ range of 1 to 40. We also discuss the viewing angle distribution of the blazars and the dependence of our results on the input parameters.

  4. Tissue Factor Pathway Inhibitor: Multiple Anticoagulant Activities for a Single Protein.

    PubMed

    Mast, Alan E

    2016-01-01

    Tissue factor (TF) pathway inhibitor (TFPI) is an anticoagulant protein that inhibits early phases of the procoagulant response. Alternatively spliced isoforms of TFPI are differentially expressed by endothelial cells and human platelets and plasma. The TFPIβ isoform localizes to the endothelium surface where it is a potent inhibitor of TF-factor VIIa complexes that initiate blood coagulation. The TFPIα isoform is present in platelets. TFPIα contains a stretch of 9 amino acids nearly identical to those found in the B-domain of factor V that are well conserved in mammals. These amino acids provide exosite binding to activated factor V, which allows for TFPIα to inhibit prothrombinase during the initiation phase of blood coagulation. Endogenous inhibition at this point in the coagulation cascade was only recently recognized and has provided a biochemical rationale to explain the pathophysiological mechanisms underlying several clinical disorders. These include the east Texas bleeding disorder that is caused by production of an altered form of factor V with high affinity for TFPI and a paradoxical procoagulant effect of heparins. In addition, these findings have led to ideas for pharmacological targeting of TFPI that may reduce bleeding in hemophilia patients. PMID:26603155

  5. Saccharomyces cerevisiae a-Factor Mutants Reveal Residues Critical for Processing, Activity, and Export