Science.gov

Sample records for activating factor maf

  1. Immunotherapy for Prostate Cancer with Gc Protein-Derived Macrophage-Activating Factor, GcMAF.

    PubMed

    Yamamoto, Nobuto; Suyama, Hirofumi; Yamamoto, Nobuyuki

    2008-07-01

    Serum Gc protein (known as vitamin D(3)-binding protein) is the precursor for the principal macrophage-activating factor (MAF). The MAF precursor activity of serum Gc protein of prostate cancer patients was lost or reduced because Gc protein was deglycosylated by serum alpha-N-acetylgalactosaminidase (Nagalase) secreted from cancerous cells. Therefore, macrophages of prostate cancer patients having deglycosylated Gc protein cannot be activated, leading to immunosuppression. Stepwise treatment of purified Gc protein with immobilized beta-galactosidase and sialidase generated the most potent MAF (termed GcMAF) ever discovered, which produces no adverse effect in humans. Macrophages activated by GcMAF develop a considerable variation of receptors that recognize the abnormality in malignant cell surface and are highly tumoricidal. Sixteen nonanemic prostate cancer patients received weekly administration of 100 ng of GcMAF. As the MAF precursor activity increased, their serum Nagalase activity decreased. Because serum Nagalase activity is proportional to tumor burden, the entire time course analysis for GcMAF therapy was monitored by measuring the serum Nagalase activity. After 14 to 25 weekly administrations of GcMAF (100 ng/week), all 16 patients had very low serum Nagalase levels equivalent to those of healthy control values, indicating that these patients are tumor-free. No recurrence occurred for 7 years. PMID:18633461

  2. Immunotherapy for Prostate Cancer with Gc Protein-Derived Macrophage-Activating Factor, GcMAF1

    PubMed Central

    Yamamoto, Nobuto; Suyama, Hirofumi; Yamamoto, Nobuyuki

    2008-01-01

    Serum Gc protein (known as vitamin D3-binding protein) is the precursor for the principal macrophage-activating factor (MAF). The MAF precursor activity of serum Gc protein of prostate cancer patients was lost or reduced because Gc protein was deglycosylated by serum α-N-acetylgalactosaminidase (Nagalase) secreted from cancerous cells. Therefore, macrophages of prostate cancer patients having deglycosylated Gc protein cannot be activated, leading to immunosuppression. Stepwise treatment of purified Gc protein with immobilized β-galactosidase and sialidase generated the most potent MAF (termed GcMAF) ever discovered, which produces no adverse effect in humans. Macrophages activated by GcMAF develop a considerable variation of receptors that recognize the abnormality in malignant cell surface and are highly tumoricidal. Sixteen nonanemic prostate cancer patients received weekly administration of 100 ng of GcMAF. As the MAF precursor activity increased, their serum Nagalase activity decreased. Because serum Nagalase activity is proportional to tumor burden, the entire time course analysis for GcMAF therapy was monitored by measuring the serum Nagalase activity. After 14 to 25 weekly administrations of GcMAF (100 ng/week), all 16 patients had very low serum Nagalase levels equivalent to those of healthy control values, indicating that these patients are tumor-free. No recurrence occurred for 7 years. PMID:18633461

  3. Immunotherapy of metastatic colorectal cancer with vitamin D-binding protein-derived macrophage-activating factor, GcMAF.

    PubMed

    Yamamoto, Nobuto; Suyama, Hirofumi; Nakazato, Hiroaki; Yamamoto, Nobuyuki; Koga, Yoshihiko

    2008-07-01

    Serum vitamin D binding protein (Gc protein) is the precursor for the principal macrophage-activating factor (MAF). The MAF precursor activity of serum Gc protein of colorectal cancer patients was lost or reduced because Gc protein is deglycosylated by serum alpha-N-acetylgalactosaminidase (Nagalase) secreted from cancerous cells. Deglycosylated Gc protein cannot be converted to MAF, leading to immunosuppression. Stepwise treatment of purified Gc protein with immobilized beta-galactosidase and sialidase generated the most potent macrophage-activating factor (GcMAF) ever discovered, but it produces no side effect in humans. Macrophages treated with GcMAF (100 microg/ml) develop an enormous variation of receptors and are highly tumoricidal to a variety of cancers indiscriminately. Administration of 100 nanogram (ng)/ human maximally activates systemic macrophages that can kill cancerous cells. Since the half-life of the activated macrophages is approximately 6 days, 100 ng GcMAF was administered weekly to eight nonanemic colorectal cancer patients who had previously received tumor-resection but still carried significant amounts of metastatic tumor cells. As GcMAF therapy progressed, the MAF precursor activities of all patients increased and conversely their serum Nagalase activities decreased. Since serum Nagalase is proportional to tumor burden, serum Nagalase activity was used as a prognostic index for time course analysis of GcMAF therapy. After 32-50 weekly administrations of 100 ng GcMAF, all colorectal cancer patients exhibited healthy control levels of the serum Nagalase activity, indicating eradication of metastatic tumor cells. During 7 years after the completion of GcMAF therapy, their serum Nagalase activity did not increase, indicating no recurrence of cancer, which was also supported by the annual CT scans of these patients. PMID:18058096

  4. Immunotherapy of metastatic breast cancer patients with vitamin D-binding protein-derived macrophage activating factor (GcMAF).

    PubMed

    Yamamoto, Nobuto; Suyama, Hirofumi; Yamamoto, Nobuyuki; Ushijima, Naofumi

    2008-01-15

    Serum vitamin D3-binding protein (Gc protein) is the precursor for the principal macrophage activating factor (MAF). The MAF precursor activity of serum Gc protein of breast cancer patients was lost or reduced because Gc protein was deglycosylated by serum alpha-N-acetylgalactosaminidase (Nagalase) secreted from cancerous cells. Patient serum Nagalase activity is proportional to tumor burden. The deglycosylated Gc protein cannot be converted to MAF, resulting in no macrophage activation and immunosuppression. Stepwise incubation of purified Gc protein with immobilized beta-galactosidase and sialidase generated probably the most potent macrophage activating factor (termed GcMAF) ever discovered, which produces no adverse effect in humans. Macrophages treated in vitro with GcMAF (100 pg/ml) are highly tumoricidal to mammary adenocarcinomas. Efficacy of GcMAF for treatment of metastatic breast cancer was investigated with 16 nonanemic patients who received weekly administration of GcMAF (100 ng). As GcMAF therapy progresses, the MAF precursor activity of patient Gc protein increased with a concomitant decrease in serum Nagalase. Because of proportionality of serum Nagalase activity to tumor burden, the time course progress of GcMAF therapy was assessed by serum Nagalase activity as a prognostic index. These patients had the initial Nagalase activities ranging from 2.32 to 6.28 nmole/min/mg protein. After about 16-22 administrations (approximately 3.5-5 months) of GcMAF, these patients had insignificantly low serum enzyme levels equivalent to healthy control enzyme levels, ranging from 0.38 to 0.63 nmole/min/mg protein, indicating eradication of the tumors. This therapeutic procedure resulted in no recurrence for more than 4 years. PMID:17935130

  5. Transcriptional factors, Mafs and their biological roles

    PubMed Central

    Tsuchiya, Mariko; Misaka, Ryoichi; Nitta, Kosaku; Tsuchiya, Ken

    2015-01-01

    The Maf family of transcription factors is characterized by a typical bZip structure; these transcription factors act as important regulators of the development and differentiation of many organs and tissues, including the kidney. The Maf family consists of two subgroups that are characterized according to their structure: large Maf transcription factors and small Maf transcription factors. The large Maf subgroup consists of four proteins, designated as MAFA, MAFB, c-MAF and neural retina-specific leucine zipper. In particular, MAFA is a distinct molecule that has been attracting the attention of researchers because it acts as a strong transactivator of insulin, suggesting that Maf transcription factors are likely to be involved in systemic energy homeostasis. In this review, we focused on the regulation of glucose/energy balance by Maf transcription factors in various organs. PMID:25685288

  6. Immunotherapy of HIV-infected patients with Gc protein-derived macrophage activating factor (GcMAF).

    PubMed

    Yamamoto, Nobuto; Ushijima, Naofumi; Koga, Yoshihiko

    2009-01-01

    Serum Gc protein (known as vitamin D3-binding protein) is the precursor for the principal macrophage activating factor (MAF). The MAF precursor activity of serum Gc protein of HIV-infected patients was lost or reduced because Gc protein is deglycosylated by alpha-N-acetylgalactosaminidase (Nagalase) secreted from HIV-infected cells. Therefore, macrophages of HIV-infected patients having deglycosylated Gc protein cannot be activated, leading to immunosuppression. Since Nagalase is the intrinsic component of the envelope protein gp120, serum Nagalase activity is the sum of enzyme activities carried by both HIV virions and envelope proteins. These Nagalase carriers were already complexed with anti-HIV immunoglobulin G (IgG) but retained Nagalase activity that is required for infectivity. Stepwise treatment of purified Gc protein with immobilized beta-galactosidase and sialidase generated the most potent macrophage activating factor (termed GcMAF), which produces no side effects in humans. Macrophages activated by administration of 100 ng GcMAF develop a large amount of Fc-receptors as well as an enormous variation of receptors that recognize IgG-bound and unbound HIV virions. Since latently HIV-infected cells are unstable and constantly release HIV virions, the activated macrophages rapidly intercept the released HIV virions to prevent reinfection resulting in exhaustion of infected cells. After less than 18 weekly administrations of 100 ng GcMAF for nonanemic patients, they exhibited low serum Nagalase activities equivalent to healthy controls, indicating eradication of HIV-infection, which was also confirmed by no infectious center formation by provirus inducing agent-treated patient PBMCs. No recurrence occurred and their healthy CD + cell counts were maintained for 7 years. PMID:19031451

  7. The toothless osteopetrotic rat has a normal vitamin D-binding protein-macrophage activating factor (DBP-MAF) cascade and chondrodysplasia resistant to treatments with colony stimulating factor-1 (CSF-1) and/or DBP-MAF.

    PubMed

    Odgren, P R; Popoff, S N; Safadi, F F; MacKay, C A; Mason-Savas, A; Seifert, M F; Marks, S C

    1999-08-01

    The osteopetrotic rat mutation toothless (tl) is characterized by little or no bone resorption, few osteoclasts and macrophages, and chondrodysplasia at the growth plates. Short-term treatment of tl rats with colony-stimulating factor-1 (CSF-1) has been shown to increase the number of osteoclasts and macrophages, producing dramatic resolution of skeletal sclerosis at some, but not all, sites. Defects in production of vitamin D-binding protein-macrophage activating factor (DBP-MAF) have been identified in two other independent osteopetrotic mutations of the rat (op and ia), and two in the mouse (op and mi), in which macrophages and osteoclasts can be activated by the administration of exogenous DBP-MAF. The present studies were undertaken to examine the histology and residual growth defects in tl rats following longer CSF-1 treatments, to investigate the possibility that exogenous DBP-MAF might act synergistically with CSF-1 to improve the tl phenotype, and to assess the integrity of the endogenous DBP-MAF pathway in this mutation. CSF-1 treatment-with or without DBP-MAF-induced resorption of metaphyseal bone to the growth plate on the marrow side, improved slightly but did not normalize long bone growth, and caused no improvement in the abnormal histology of the growth plate. Injections of lysophosphatidylcholine (lyso-Pc) to prime macrophage activation via the DBP-MAF pathway raised superoxide production to similar levels in peritoneal macrophages from both normal and mutant animals, indicating no defect in the DBP-MAF pathway in tl rats. Interestingly, pretreatments with CSF-1 alone also increased superoxide production, although the mechanism for this remains unknown. In summary, we find that, unlike other osteopetrotic mutations investigated to date, the DBP-MAF pathway does not appear to be defective in the tl rat; that additional DBP-MAF does not augment the beneficial skeletal effects seen with CSF-1 alone; and that the growth plate chondrodystrophy seen in

  8. MafG Sumoylation Is Required for Active Transcriptional Repression

    PubMed Central

    Motohashi, Hozumi; Katsuoka, Fumiki; Miyoshi, Chika; Uchimura, Yasuhiro; Saitoh, Hisato; Francastel, Claire; Engel, James Douglas; Yamamoto, Masayuki

    2006-01-01

    A straightforward mechanism for eliciting transcriptional repression would be to simply block the DNA binding site for activators. Such passive repression is often mediated by transcription factors that lack an intrinsic repressor activity. MafG is a bidirectional regulator of transcription, a repressor in its homodimeric state but an activator when heterodimerized with p45. Here, we report that MafG is conjugated to SUMO-2/3 in vivo. To clarify the possible physiological role(s) for sumoylation in regulating MafG activity, we evaluated mutant and wild-type MafG in transgenic mice and cultured cells. Whereas sumoylation-deficient MafG activated p45-dependent transcription normally and did not affect heterodimer activity, repression by the sumoylation-deficient MafG mutant was severely compromised in vivo. Furthermore, the SUMO-dependent repression activity of MafG was sensitive to histone deacetylase inhibition. Thus, repression by MafG is not achieved through simple passive repression by competing for the activator binding site but requires sumoylation, which then mediates transcriptional repression through recruitment of a repressor complex containing histone deacetylase activity. PMID:16738329

  9. Is chondroitin sulfate responsible for the biological effects attributed to the GC protein-derived Macrophage Activating Factor (GcMAF)?

    PubMed

    Ruggiero, Marco; Reinwald, Heinz; Pacini, Stefania

    2016-09-01

    We hypothesize that a plasma glycosaminoglycan, chondroitin sulfate, may be responsible for the biological and clinical effects attributed to the Gc protein-derived Macrophage Activating Factor (GcMAF), a protein that is extracted from human blood. Thus, Gc protein binds chondroitin sulfate on the cell surface and such an interaction may occur also in blood, colostrum and milk. This interpretation would solve the inconsistencies encountered in explaining the effects of GcMAF in vitro and in vivo. According to our model, the Gc protein or the GcMAF bind to chondroitin sulfate both on the cell surface and in bodily fluids, and the resulting multimolecular complexes, under the form of oligomers trigger a transmembrane signal or, alternatively, are internalized and convey the signal directly to the nucleus thus eliciting the diverse biological effects observed for both GcMAF and chondroitin sulfate. PMID:27515218

  10. Baculovirus-expressed vitamin D-binding protein-macrophage activating factor (DBP-maf) activates osteoclasts and binding of 25-hydroxyvitamin D(3) does not influence this activity.

    PubMed

    Swamy, N; Ghosh, S; Schneider, G B; Ray, R

    2001-01-01

    Vitamin D-binding protein (DBP) is a multi-functional serum protein that is converted to vitamin D-binding protein-macrophage activating factor (DBP-maf) by post-translational modification. DBP-maf is a new cytokine that mediates bone resorption by activating osteoclasts, which are responsible for resorption of bone. Defective osteoclast activation leads to disorders like osteopetrosis, characterized by excessive accumulation of bone mass. Previous studies demonstrated that two nonallelic mutations in the rat with osteopetrosis have independent defects in the cascade involved in the conversion of DBP to DBP-maf. The skeletal defects associated with osteopetrosis are corrected in these mutants with in vivo DBP-maf treatment. This study evaluates the effects of various forms of DBP-maf (native, recombinant, and 25-hydroxyvitamin D(3) bound) on osteoclast function in vitro in order to determine some of the structural requirements of this protein that relate to bone resorbing activities. Osteoclast activity was determined by evaluating pit formation using osteoclasts, isolated from the long bones of newborn rats, incubated on calcium phosphate coated, thin film, Ostologic MultiTest Slides. Incubation of osteoclasts with ex vivo generated native DBP-maf resulted in a dose dependent, statistically significant, activation of the osteoclasts. The activation was similar whether or not the vitamin D binding site of the DBP-maf was occupied. The level of activity in response to DBP-maf was greater than that elicited by optimal doses of other known stimulators (PTH and 1,25(OH(2)D(3)) of osteoclast function. Furthermore, another potent macrophage activating factor, interferon--gamma, had no effect on osteoclast activity. The activated form of a full length recombinant DBP, expressed in E. coli showed no activity in the in vitro assay. Contrary to this finding, baculovirus-expressed recombinant DBP-maf demonstrated significant osteoclast activating activity. The normal

  11. Effects of vitamin D binding protein-macrophage activating factor (DBP-MAF) infusion on bone resorption in two osteopetrotic mutations.

    PubMed

    Schneider, G B; Benis, K A; Flay, N W; Ireland, R A; Popoff, S N

    1995-06-01

    Osteopetrosis is a heterogeneous group of bone diseases characterized by an excess accumulation of bone and a variety of immune defects. Osteopetrosis (op) and incisors absent (ia) are two nonallelic mutations in the rat which demonstrated these skeletal defects as a result of reduced bone resorption. Osteopetrotic (op) rats have severe sclerosis as a result of reduced numbers of osteoclasts which are structurally abnormal. The sclerosis in ia rats is not as severe as in op mutants; they have elevated numbers of osteoclasts, but they are also morphologically abnormal, lacking a ruffled border. Both of these mutations have defects in the inflammation-primed activation of macrophages. They demonstrate independent defects in the cascade involved in the conversion of vitamin D binding protein (DBP) to a potent macrophage activating factor (DBP-MAF). Because this factor may also play a role in the pathogenesis of osteoclastic dysfunction, the effects of ex vivo-generated DBP-MAF were evaluated on the skeletal system of these two mutations. Newborn ia and op rats and normal littermate controls were injected with DBP-MAF or vehicle once every 4 days from birth until 2 weeks of age, at which time bone samples were collected to evaluate a number of skeletal parameters. DBP-MAF treated op rats had an increased number of osteoclasts and the majority of them exhibited normal structure. There was also reduced bone volume in the treated op animals and an associated increased cellularity of the marrow spaces. The skeletal sclerosis was also corrected in the ia rats; the bone marrow cavity size was significantly enlarged and the majority of the osteoclasts appeared normal with extensive ruffled borders. PMID:7669443

  12. Small Maf proteins (MafF, MafG, MafK): History, structure and function.

    PubMed

    Katsuoka, Fumiki; Yamamoto, Masayuki

    2016-07-25

    The small Maf proteins (sMafs) are basic region leucine zipper (bZIP)-type transcription factors. The basic region of the Maf family is unique among the bZIP factors, and it contributes to the distinct DNA-binding mode of this class of proteins. MafF, MafG and MafK are the three vertebrate sMafs, and no functional differences have been observed among them in terms of their bZIP structures. sMafs form homodimers by themselves, and they form heterodimers with cap 'n' collar (CNC) proteins (p45 NF-E2, Nrf1, Nrf2, and Nrf3) and also with Bach proteins (Bach1 and Bach2). Because CNC and Bach proteins cannot bind to DNA as monomers, sMafs are indispensable partners that are required by CNC and Bach proteins to exert their functions. sMafs lack the transcriptional activation domain; hence, their homodimers act as transcriptional repressors. In contrast, sMafs participate in transcriptional activation or repression depending on their heterodimeric partner molecules and context. Mouse genetic analyses have revealed that various biological pathways are under the regulation of CNC-sMaf heterodimers. In this review, we summarize the history and current progress of sMaf studies in relation to their partners. PMID:27058431

  13. Gc protein-derived macrophage-activating factor (GcMAF) stimulates cAMP formation in human mononuclear cells and inhibits angiogenesis in chick embryo chorionallantoic membrane assay.

    PubMed

    Pacini, Stefania; Morucci, Gabriele; Punzi, Tiziana; Gulisano, Massimo; Ruggiero, Marco

    2011-04-01

    The effects of Gc protein-derived macrophage-activating factor (GcMAF) have been studied in cancer and other conditions where angiogenesis is deregulated. In this study, we demonstrate for the first time that the mitogenic response of human peripheral blood mononuclear cells (PBMCs) to GcMAF was associated with 3'-5'-cyclic adenosine monophosphate (cAMP) formation. The effect was dose dependent, and maximal stimulation was achieved using 0.1 ng/ml. Heparin inhibited the stimulatory effect of GcMAF on PBMCs. In addition, we demonstrate that GcMAF (1 ng/ml) inhibited prostaglandin E(1)- and human breast cancer cell-stimulated angiogenesis in chick embryo chorionallantoic membrane (CAM) assay. Finally, we tested different GcMAF preparations on CAM, and the assay proved to be a reliable, reproducible and inexpensive method to determine the relative potencies of different preparations and their stability; we observed that storage at room temperature for 15 days decreased GcMAF potency by about 50%. These data could prove useful for upcoming clinical trials on GcMAF. PMID:21170647

  14. Vitamin D binding protein-macrophage activating factor (DBP-maf) inhibits angiogenesis and tumor growth in mice.

    PubMed

    Kisker, Oliver; Onizuka, Shinya; Becker, Christian M; Fannon, Michael; Flynn, Evelyn; D'Amato, Robert; Zetter, Bruce; Folkman, Judah; Ray, Rahul; Swamy, Narasimha; Pirie-Shepherd, Steven

    2003-01-01

    We have isolated a selectively deglycosylated form of vitamin D binding protein (DBP-maf) generated from systemically available DBP by a human pancreatic cancer cell line. DBP-maf is antiproliferative for endothelial cells and antiangiogenic in the chorioallantoic membrane assay. DBP-maf administered daily was able to potently inhibit the growth of human pancreatic cancer in immune compromised mice (T/C=0.09). At higher doses, DBP-maf caused tumor regression. Histological examination revealed that treated tumors had a higher number of infiltrating macrophages as well as reduced microvessel density, and increased levels of apoptosis relative to untreated tumors. Taken together, these data suggest that DBP-maf is an antiangiogenic molecule that can act directly on endothelium as well as stimulate macrophages to attack both the endothelial and tumor cell compartment of a growing malignancy. PMID:12659668

  15. Vitamin D Binding Protein-Macrophage Activating Factor (DBP-maf) Inhibits Angiogenesis and Tumor Growth in Mice1

    PubMed Central

    Kisker, Oliver; Onizuka, Shinya; Becker, Christian M; Fannon, Michael; Flynn, Evelyn; D'Amato, Robert; Zetter, Bruce; Folkman, Judah; Ray, Rahul; Swamy, Narasimha; Pirie-Shepherd, Steven

    2003-01-01

    Abstract We have isolated a selectively deglycosylated form of vitamin D binding protein (DBP-maf) generated from systemically available DBP by a human pancreatic cancer cell line. DBP-maf is antiproliferative for endothelial cells and antiangiogenic in the chorioallantoic membrane assay. DBP-maf administered daily was able to potently inhibit the growth of human pancreatic cancer in immune compromised mice (T/C=0.09). At higher doses, DBP-maf caused tumor regression. Histological examination revealed that treated tumors had a higher number of infiltrating macrophages as well as reduced microvessel density, and increased levels of apoptosis relative to untreated tumors. Taken together, these data suggest that DBP-maf is an antiangiogenic molecule that can act directly on endothelium as well as stimulate macrophages to attack both the endothelial and tumor cell compartment of a growing malignancy. PMID:12659668

  16. The anabolic effects of vitamin D-binding protein-macrophage activating factor (DBP-MAF) and a novel small peptide on bone.

    PubMed

    Schneider, Gary B; Grecco, Kristina J; Safadi, Fayez F; Popoff, Steven N

    2003-01-01

    Vitamin D-binding protein-macrophage activating factor (DBP-MAF) has previously been shown to stimulate bone resorption and correct the skeletal defects associated with osteopetrosis in two nonallelic mutations in rats. This same protein and a small fragment of the protein have now been shown to demonstrate an anabolic effect on the skeleton of both newborn and young adult, intact rats. The novel peptide fragment was synthetically produced based on the human amino acid sequence at the site of glycosylation in the third domain of the native protein (DBP). The peptide tested is 14 amino acids in length and demonstrates no homologies other than to that region of DBP. Newborn rats were injected i.p. with saline, peptide (0.4 ng/g body wt.) or DBP-MAF (2 ng/g body wt.) every other day from birth to 14 days of age. On day 16 the rats were euthanized and the long bones collected for bone densitometry by pQCT. After 2 weeks of treatment with either the whole protein (DBP-MAF) or the small peptide, bone density was significantly increased in the treated animals compared to the saline controls. Young adult female rats (180 grams) were given s.c. injections of saline or peptide (0.4 ng/g body wt. or 5 ng/g body wt.) every other day for 2 weeks; 2 days after the final injections, the rats were euthanized and the femurs and tibias collected for bone densitometry. Both doses of the peptide resulted in significant increases in bone density as determined by pQCT. Young adult rats were injected locally with a single dose of the peptide (1 microg) or saline into the marrow cavity of the distal femur. One week after the single injection, the bones were collected for radiographic and histological evaluation. The saline controls showed no evidence of new bone formation, whereas the peptide-treated animals demonstrated osteoinduction in the marrow cavity and osteogenesis of surrounding cortical and metaphyseal bone. These data suggest that DBP-MAF and the synthetic peptide represent

  17. Transcription Factor MafB Coordinates Epidermal Keratinocyte Differentiation.

    PubMed

    Miyai, Masashi; Hamada, Michito; Moriguchi, Takashi; Hiruma, Junichiro; Kamitani-Kawamoto, Akiyo; Watanabe, Hajime; Hara-Chikuma, Mariko; Takahashi, Kenzo; Takahashi, Satoru; Kataoka, Kohsuke

    2016-09-01

    Mammalian epidermis is a stratified epithelium composed of distinct layers of keratinocytes. The outermost cornified layer is a primary barrier that consists of a cornified envelope, an insoluble structure assembled by cross-linked scaffold proteins, and a surrounding mixture of lipids. Skin keratinocytes undergo a multistep differentiation process, but the mechanism underlying this process is not fully understood. We demonstrate that the transcription factor MafB is expressed in differentiating keratinocytes in mice and is transcriptionally upregulated upon human keratinocyte differentiation in vitro. In MafB-deficient mice, epidermal differentiation was partially impaired and the cornified layer was thinner than in wild-type mice. On the basis of transcriptional profiling, we detected reduced expression levels of a subset of cornified envelope genes, for example, filaggrin and repetin, in the MafB(-/-) epidermis. By contrast, the expression levels of lipid metabolism-related genes, such as Alox12e and Smpd3, increased. The upregulated genes in the MafB(-/-) epidermis were enriched for putative target genes of the transcription factors Gata3, Grhl3, and Klf4. Immunohistochemical analysis of skin biopsy samples revealed that the expression levels of filaggrin and MafB were significantly reduced in patients with human atopic dermatitis and psoriasis vulgaris. Our results indicate that MafB is a component of the gene expression program that regulates epidermal keratinocyte differentiation. PMID:27208706

  18. Mitogen-activated protein kinase pathway mediates DBP-maf-induced apoptosis in RAW 264.7 macrophages.

    PubMed

    Gumireddy, Kiranmai; Reddy, C Damodar; Swamy, Narasimha

    2003-09-01

    Vitamin D-binding protein-macrophage-activating factor (DBP-maf) is derived from serum vitamin D binding protein (DBP) by selective deglycosylation during inflammation. In the present study, we investigated the effect of DBP-maf on RAW 264.7 macrophages and the underlying intracellular signal transduction pathways. DBP-maf increased proapoptotic caspase-3, -8, and -9 activities and induced apoptosis in RAW 264.7 cells. However, DBP, the precursor to DBP-maf did not induce apoptosis in these cells. Cell cycle analysis of DBP-maf-treated RAW 264.7 cells revealed growth arrest with accumulation of cells in sub-G(0)/G(1) phase. We also investigated the role of mitogen-activated protein kinase (MAPK) pathways in the DBP-maf-induced apoptosis of RAW264.7 cells. DBP-maf increased the phosphorylation of p38 and JNK1/2, while it decreased the ERK1/2 phosphorylation. Treatment with the p38 MAPK inhibitor, SB202190, attenuated DBP-maf-induced apoptosis. PD98059, a MEK specific inhibitor, did not show a significant inhibition of apoptosis induced by DBP-maf. Taken together, these results suggest that the p38 MAPK pathway plays a crucial role in DBP-maf-mediated apoptosis of macrophages. Our studies indicate that, during inflammation DBP-maf may function positively by causing death of the macrophages when activated macrophages are no longer needed at the site of inflammation. In summary, we report for the first time that DBP-maf induces apoptosis in macrophages via p38 and JNK1/2 pathway. PMID:12938159

  19. Inhibition of human insulin gene transcription and MafA transcriptional activity by the dual leucine zipper kinase

    PubMed Central

    Stahnke, Marie-Jeannette; Dickel, Corinna; Schröder, Sabine; Kaiser, Diana; Blume, Roland; Stein, Roland; Pouponnot, Celio; Oetjen, Elke

    2016-01-01

    Insulin biosynthesis is an essential β-cell function and inappropriate insulin secretion and biosynthesis contribute to the pathogenesis of diabetes mellitus type 2. Previous studies showed that the dual leucine zipper kinase (DLK) induces β-cell apoptosis. Since β-cell dysfunction precedes β-cell loss, in the present study the effect of DLK on insulin gene transcription was investigated in the HIT-T15 β-cell line. Downregulation of endogenous DLK increased whereas overexpression of DLK decreased human insulin gene transcription. 5′- and 3′-deletion human insulin promoter analyses resulted in the identification of a DLK responsive element that mapped to the DNA binding-site for the β-cell specific transcription factor MafA. Overexpression of DLK wild-type but not its kinase-dead mutant inhibited MafA transcriptional activity conferred by its transactivation domain. Furthermore, in the non-β-cell line JEG DLK inhibited MafA overexpression-induced human insulin promoter activity. Overexpression of MafA and DLK or its kinase-dead mutant into JEG cells revealed that DLK but not its mutant reduced MafA protein content. Inhibition of the down-stream DLK kinase c-Jun N-terminal kinase (JNK) by SP600125 attenuated DLK-induced MafA loss. Furthermore, mutation of the serine 65 to alanine, shown to confer MafA protein stability, increased MafA-dependent insulin gene transcription and prevented DLK-induced MafA loss in JEG cells. These data suggest that DLK by activating JNK triggers the phosphorylation and degradation of MafA thereby attenuating insulin gene transcription. Given the importance of MafA for β-cell function, the inhibition of DLK might preserve β-cell function and ultimately retard the development of diabetes mellitus type 2. PMID:24726898

  20. Inhibition of human insulin gene transcription and MafA transcriptional activity by the dual leucine zipper kinase.

    PubMed

    Stahnke, Marie-Jeannette; Dickel, Corinna; Schröder, Sabine; Kaiser, Diana; Blume, Roland; Stein, Roland; Pouponnot, Celio; Oetjen, Elke

    2014-09-01

    Insulin biosynthesis is an essential β-cell function and inappropriate insulin secretion and biosynthesis contribute to the pathogenesis of diabetes mellitus type 2. Previous studies showed that the dual leucine zipper kinase (DLK) induces β-cell apoptosis. Since β-cell dysfunction precedes β-cell loss, in the present study the effect of DLK on insulin gene transcription was investigated in the HIT-T15 β-cell line. Downregulation of endogenous DLK increased whereas overexpression of DLK decreased human insulin gene transcription. 5'- and 3'-deletion human insulin promoter analyses resulted in the identification of a DLK responsive element that mapped to the DNA binding-site for the β-cell specific transcription factor MafA. Overexpression of DLK wild-type but not its kinase-dead mutant inhibited MafA transcriptional activity conferred by its transactivation domain. Furthermore, in the non-β-cell line JEG DLK inhibited MafA overexpression-induced human insulin promoter activity. Overexpression of MafA and DLK or its kinase-dead mutant into JEG cells revealed that DLK but not its mutant reduced MafA protein content. Inhibition of the down-stream DLK kinase c-Jun N-terminal kinase (JNK) by SP600125 attenuated DLK-induced MafA loss. Furthermore, mutation of the serine 65 to alanine, shown to confer MafA protein stability, increased MafA-dependent insulin gene transcription and prevented DLK-induced MafA loss in JEG cells. These data suggest that DLK by activating JNK triggers the phosphorylation and degradation of MafA thereby attenuating insulin gene transcription. Given the importance of MafA for β-cell function, the inhibition of DLK might preserve β-cell function and ultimately retard the development of diabetes mellitus type 2. PMID:24726898

  1. Inhibition of angiogenesis by vitamin D-binding protein: characterization of anti-endothelial activity of DBP-maf.

    PubMed

    Kalkunte, Satyan; Brard, Laurent; Granai, Cornelius O; Swamy, Narasimha

    2005-01-01

    Angiogenesis is a complex process involving coordinated steps of endothelial cell activation, proliferation, migration, tube formation and capillary sprouting with participation of intracellular signaling pathways. Regulation of angiogenesis carries tremendous potential for cancer therapy. Our earlier studies showed that vitamin D-binding protein-macrophage activating factor (DBP-maf) acts as a potent anti-angiogenic factor and inhibits tumor growth in vivo. The goal of this investigation was to understand the effect of DBP-maf on human endothelial cell (HEC) and the mechanism of angiogenesis inhibition. DBP-maf inhibited human endothelial cell (HEC) proliferation by inhibiting DNA synthesis (IC(50) = 7.8 +/- 0.15 microg/ml). DBP-maf significantly induced S- and G0/G1-phase arrest in HEC in 72 h. DBP-maf potently blocked VEGF-induced migration, tube-formation of HEC in a dose dependent manner. In addition, DBP-maf inhibited growth factor-induced microvessel sprouting in rat aortic ring assay. Moreover, DBP-maf inhibited VEGF signaling by decreasing VEGF-mediated phosphorylation of VEGFR-2 and ERK1/2, a downstream target of VEGF signaling cascade. However, Akt activation was not affected. These studies collectively demonstrate that DBP-maf inhibits angiogenesis by blocking critical steps such as HEC proliferation, migration, tube formation and microvessel sprouting. DBP-maf exerts its effect by inhibiting VEGR-2 and ERK1/2 signaling cascades. Understanding the cellular and molecular mechanisms of anti-endothelial activity of DBP-maf will allow us to develop it as an angiogenesis targeting novel drug for tumor therapy. PMID:16400520

  2. Synergistic Transcription Activation by Maf and Sox and Their Subnuclear Localization Are Disrupted by a Mutation in Maf That Causes Cataract

    PubMed Central

    Rajaram, Nirmala; Kerppola, Tom K.

    2004-01-01

    Crystallin genes are selectively expressed during lens development. Maf and Sox family proteins synergistically enhanced γF-crystallin promoter activity in a lens cell line. Mutational analysis of the γF-crystallin promoter identified a composite regulatory element containing nonconsensus Maf and Sox recognition sequences. Mutations in these recognition sequences or changes in their spacing eliminated synergistic transcription activation. The transcriptional synergy was also affected by changes in the orientation of the Maf recognition sequence that had no detectable effect on binding affinity. The interaction between Maf and Sox proteins was visualized in living cells by bimolecular fluorescence complementation analysis. The N-terminal region of Maf mediated the interaction with Sox proteins in cells. Synergistic transcription activation required the N-terminal region of Maf as well as the ancillary DNA binding domain and the unique portion of the basic region that mediate specific recognition of the γF-crystallin promoter element. A mutation in the ancillary DNA binding domain of Maf (R288P) that has been shown to cause cataract eliminated the transcriptional activity of Maf but had no detectable effect on DNA binding in vitro. Whereas wild-type Maf was uniformly distributed in the nucleoplasm, R288P Maf was enriched in nuclear foci. Cajal bodies and gemini of coiled bodies were closely associated with the foci occupied by R288P Maf. Wild-type Maf formed complexes with Sox proteins in the nucleoplasm, whereas R288P Maf recruited Sox proteins as well as other interaction partners to the nuclear foci. The mislocalization of normal cellular proteins to these foci provides a potential explanation for the dominant disease phenotype of the R288P mutation in Maf. PMID:15199128

  3. The transcription factor Lc-Maf participates in Col27a1 regulation during chondrocyte maturation

    SciTech Connect

    Mayo, Jaime L.; Holden, Devin N.; Barrow, Jeffery R.; Bridgewater, Laura C.

    2009-08-01

    The transcription factor Lc-Maf, which is a splice variant of c-Maf, is expressed in cartilage undergoing endochondral ossification and participates in the regulation of type II collagen through a cartilage-specific Col2a1 enhancer element. Type XXVII and type XI collagens are also expressed in cartilage during endochondral ossification, and so enhancer/reporter assays were used to determine whether Lc-Maf could regulate cartilage-specific enhancers from the Col27a1 and Col11a2 genes. The Col27a1 enhancer was upregulated over 4-fold by Lc-Maf, while the Col11a2 enhancer was downregulated slightly. To confirm the results of these reporter assays, rat chondrosarcoma (RCS) cells were transiently transfected with an Lc-Maf expression plasmid, and quantitative RT-PCR was performed to measure the expression of endogenous Col27a1 and Col11a2 genes. Endogenous Col27a1 was upregulated 6-fold by Lc-Maf overexpression, while endogenous Col11a2 was unchanged. Finally, in situ hybridization and immunohistochemistry were performed in the radius and ulna of embryonic day 17 mouse forelimbs undergoing endochondral ossification. Results demonstrated that Lc-Maf and Col27a1 mRNAs are coexpressed in proliferating and prehypertrophic regions, as would be predicted if Lc-Maf regulates Col27a1 expression. Type XXVII collagen protein was also most abundant in prehypertrophic and proliferating chondrocytes. Others have shown that mice that are null for Lc-Maf and c-Maf have expanded hypertrophic regions with reduced ossification and delayed vascularization. Separate studies have indicated that Col27a1 may serve as a scaffold for ossification and vascularization. The work presented here suggests that Lc-Maf may affect the process of endochondral ossification by participating in the regulation of Col27a1 expression.

  4. A Novel DNA Binding Mechanism for maf Basic Region-Leucine Zipper Factors Inferred from a MafA-DNA Complex Structure and Binding Specificities

    SciTech Connect

    Lu, Xun; Guanga, Gerald P; Wan, Cheng; Rose, Robert B

    2012-11-13

    MafA is a proto-oncoprotein and is critical for insulin gene expression in pancreatic β-cells. Maf proteins belong to the AP1 superfamily of basic region-leucine zipper (bZIP) transcription factors. Residues in the basic helix and an ancillary N-terminal domain, the Extended Homology Region (EHR), endow maf proteins with unique DNA binding properties: binding a 13 bp consensus site consisting of a core AP1 site (TGACTCA) flanked by TGC sequences and binding DNA stably as monomers. To further characterize maf DNA binding, we determined the structure of a MafA–DNA complex. MafA forms base-specific hydrogen bonds with the flanking G–5C–4 and central C0/G0 bases, but not with the core-TGA bases. However, in vitro binding studies utilizing a pulse–chase electrophoretic mobility shift assay protocol revealed that mutating either the core-TGA or flanking-TGC bases dramatically increases the binding off rate. Comparing the known maf structures, we propose that DNA binding specificity results from positioning the basic helix through unique phosphate contacts. The EHR does not contact DNA directly but stabilizes DNA binding by contacting the basic helix. Collectively, these results suggest a novel multistep DNA binding process involving a conformational change from contacting the core-TGA to contacting the flanking-TGC bases.

  5. The recombinant expression and activity detection of MAF-1 fusion protein

    PubMed Central

    Fu, Ping; Wu, Jianwei; Gao, Song; Guo, Guo; Zhang, Yong; Liu, Jian

    2015-01-01

    This study establishes the recombinant expression system of MAF-1 (Musca domestica antifungal peptide-1) and demonstrates the antifungal activity of the expression product and shows the relationship between biological activity and structure. The gene segments on mature peptide part of MAF-1 were cloned, based on the primers designed according to the cDNA sequence of MAF-1. We constructed the recombinant prokaryotic expression plasmid using prokaryotic expression vector (pET-28a(+)) and converted it to the competent cell of BL21(DE3) to gain recombinant MAF-1 fusion protein with His tag sequence through purifying affinity chromatographic column of Ni-NTA. To conduct the Western Blotting test, recombinant MAF-1 fusion protein was used to produce the polyclonal antibody of rat. The antifungal activity of the expression product was detected using Candida albicans (ATCC10231) as the indicator. The MAF-1 recombinant fusion protein was purified to exhibit obvious antifungal activity, which lays the foundation for the further study of MAF-1 biological activity, the relationship between structure and function, as well as control of gene expression. PMID:26423137

  6. Role of large MAF transcription factors in the mouse endocrine pancreas

    PubMed Central

    ABDELLATIF, Ahmed M.; OGATA, Kiyohito; KUDO, Takashi; XIAFUKAITI, Gulibaikelamu; CHANG, Yu-Hsin; KATOH, Megumi C.; EL-MORSY, Salah E.; OISHI, Hisashi; TAKAHASHI, Satoru

    2015-01-01

    The members of the MAF family of transcription factors are homologs of v-Maf –the oncogenic component of the avian retrovirus AS42. The MAF family is subdivided into 2 groups, small and large MAFs. To elucidate the role of the large MAF transcription factors in the endocrine pancreas, we analyzed large MAF gene knockout mice. It has been shown that Mafa−/− mice develop phenotypes including abnormal islet structure soon after birth. This study revealed that Ins1 and Ins2 transcripts and the protein contents were significantly reduced in Mafa−/− mice at embryonic day 18.5. In addition, Mafa−/−;Mafb−/− mice contained less than 10% of the insulin transcript and protein of those of wild-type mice, suggesting that Mafa and Mafb cooperate to maintain insulin levels at the embryonic stage. On the other hand, the number of insulin-positive cells in Mafa−/− mice was comparable to that of wild-type mice, and even under a Mafb-deficient background the number of insulin-positive cells was not decreased, suggesting that Mafb plays a dominant role in embryonic β-cell development. We also found that at 20 weeks of age Mafa−/−;Mafb+/− mice showed a higher fasting blood glucose level than single Mafa−/− mice. In summary, our results indicate that Mafa is necessary for the maintenance of normal insulin levels even in embryos and that Mafb is important for the maintenance of fasting blood glucose levels in the Mafa-deficient background in adults. PMID:25912440

  7. Gc protein (vitamin D-binding protein): Gc genotyping and GcMAF precursor activity.

    PubMed

    Nagasawa, Hideko; Uto, Yoshihiro; Sasaki, Hideyuki; Okamura, Natsuko; Murakami, Aya; Kubo, Shinichi; Kirk, Kenneth L; Hori, Hitoshi

    2005-01-01

    The Gc protein (human group-specific component (Gc), a vitamin D-binding protein or Gc globulin), has important physiological functions that include involvement in vitamin D transport and storage, scavenging of extracellular G-actin, enhancement of the chemotactic activity of C5a for neutrophils in inflammation and macrophage activation (mediated by a GalNAc-modified Gc protein (GcMAF)). In this review, the structure and function of the Gc protein is focused on especially with regard to Gc genotyping and GcMAF precursor activity. A discussion of the research strategy "GcMAF as a target for drug discovery" is included, based on our own research. PMID:16302727

  8. The in vitro GcMAF effects on endocannabinoid system transcriptionomics, receptor formation, and cell activity of autism-derived macrophages

    PubMed Central

    2014-01-01

    Background Immune system dysregulation is well-recognized in autism and thought to be part of the etiology of this disorder. The endocannabinoid system is a key regulator of the immune system via the cannabinoid receptor type 2 (CB2R) which is highly expressed on macrophages and microglial cells. We have previously published significant differences in peripheral blood mononuclear cell CB2R gene expression in the autism population. The use of the Gc protein-derived Macrophage Activating Factor (GcMAF), an endogenous glycosylated vitamin D binding protein responsible for macrophage cell activation has demonstrated positive effects in the treatment of autistic children. In this current study, we investigated the in vitro effects of GcMAF treatment on the endocannabinoid system gene expression, as well as cellular activation in blood monocyte-derived macrophages (BMDMs) from autistic patients compared to age-matched healthy developing controls. Methods To achieve these goals, we used biomolecular, biochemical and immunocytochemical methods. Results GcMAF treatment was able to normalize the observed differences in dysregulated gene expression of the endocannabinoid system of the autism group. GcMAF also down-regulated the over-activation of BMDMs from autistic children. Conclusions This study presents the first observations of GcMAF effects on the transcriptionomics of the endocannabinoid system and expression of CB2R protein. These data point to a potential nexus between endocannabinoids, vitamin D and its transporter proteins, and the immune dysregulations observed with autism. PMID:24739187

  9. A designed glycoprotein analogue of Gc-MAF exhibits native-like phagocytic activity.

    PubMed

    Bogani, Federica; McConnell, Elizabeth; Joshi, Lokesh; Chang, Yung; Ghirlanda, Giovanna

    2006-06-01

    Rational protein design has been successfully used to create mimics of natural proteins that retain native activity. In the present work, de novo protein engineering is explored to develop a mini-protein analogue of Gc-MAF, a glycoprotein involved in the immune system activation that has shown anticancer activity in mice. Gc-MAF is derived in vivo from vitamin D binding protein (VDBP) via enzymatic processing of its glycosaccharide to leave a single GalNAc residue located on an exposed loop. We used molecular modeling tools in conjunction with structural analysis to splice the glycosylated loop onto a stable three-helix bundle (alpha3W, PDB entry 1LQ7). The resulting 69-residue model peptide, MM1, has been successfully synthesized by solid-phase synthesis both in the aglycosylated and the glycosylated (GalNAc-MM1) form. Circular dichroism spectroscopy confirmed the expected alpha-helical secondary structure. The thermodynamic stability as evaluated from chemical and thermal denaturation is comparable with that of the scaffold protein, alpha3W, indicating that the insertion of the exogenous loop of Gc-MAF did not significantly perturb the overall structure. GalNAc-MM1 retains the macrophage stimulation activity of natural Gc-MAF; in vitro tests show an identical enhancement of Fc-receptor-mediated phagocytosis in primary macrophages. GalNAc-MM1 provides a framework for the development of mutants with increased activity that could be used in place of Gc-MAF as an immunomodulatory agent in therapy. PMID:16734450

  10. Tumor cell alpha-N-acetylgalactosaminidase activity and its involvement in GcMAF-related macrophage activation.

    PubMed

    Mohamad, Saharuddin B; Nagasawa, Hideko; Uto, Yoshihiro; Hori, Hitoshi

    2002-05-01

    Alpha-N-acetyl galactosaminidase (alpha-NaGalase) has been reported to accumulate in serum of cancer patients and be responsible for deglycosylation of Gc protein, which is a precursor of GcMAF-mediated macrophage activation cascade, finally leading to immunosuppression in advanced cancer patients. We studied the biochemical characterization of alpha-NaGalase from several human tumor cell lines. We also examined its effect on the potency of GcMAF to activate mouse peritoneal macrophage to produce superoxide in GcMAF-mediated macrophage activation cascade. The specific activity of alpha-NaGalases from human colon tumor cell line HCT116, human hepatoma cell line HepG2, and normal human liver cells (Chang liver cell line) were evaluated using two types of substrates; GalNAc-alpha-PNP (exo-type substrate) and Gal-beta-GalNAc-alpha-PNP (endo-type substrate). Tumor-derived alpha-NaGalase having higher activity than normal alpha-NaGalase, had higher substrate specificity to the exo-type substrate than to the endo-type substrate, and still maintained its activity at pH 7. GcMAF enhance superoxide production in mouse macrophage, and pre-treatment of GcMAF with tumor cell lysate reduce the activity. We conclude that tumor-derived alpha-NaGalase is different in biochemical characterization compared to normal alpha-NaGalase from normal Chang liver cells. In addition, tumor cell-derived alpha-NaGalase decreases the potency of GcMAF on macrophage activation. PMID:12062184

  11. Epidermal differentiation gene regulatory networks controlled by MAF and MAFB.

    PubMed

    Labott, Andrew T; Lopez-Pajares, Vanessa

    2016-06-01

    Numerous regulatory factors in epidermal differentiation and their role in regulating different cell states have been identified in recent years. However, the genetic interactions between these regulators over the dynamic course of differentiation have not been studied. In this Extra-View article, we review recent work by Lopez-Pajares et al. that explores a new regulatory network in epidermal differentiation. They analyze the changing transcriptome throughout epidermal regeneration to identify 3 separate gene sets enriched in the progenitor, early and late differentiation states. Using expression module mapping, MAF along with MAFB, are identified as transcription factors essential for epidermal differentiation. Through double knock-down of MAF:MAFB using siRNA and CRISPR/Cas9-mediated knockout, epidermal differentiation was shown to be impaired both in-vitro and in-vivo, confirming MAF:MAFB's role to activate genes that drive differentiation. Lopez-Pajares and collaborators integrated 42 published regulator gene sets and the MAF:MAFB gene set into the dynamic differentiation gene expression landscape and found that lncRNAs TINCR and ANCR act as upstream regulators of MAF:MAFB. Furthermore, ChIP-seq analysis of MAF:MAFB identified key transcription factor genes linked to epidermal differentiation as downstream effectors. Combined, these findings illustrate a dynamically regulated network with MAF:MAFB as a crucial link for progenitor gene repression and differentiation gene activation. PMID:27097296

  12. Proper activation of MafA is required for optimal differentiation and maturation of pancreatic β-cells.

    PubMed

    El Khattabi, Ilham; Sharma, Arun

    2015-12-01

    A key therapeutic approach for the treatment of Type 1 diabetes (T1D) is transplantation of functional islet β-cells. Despite recent advances in generating stem cell-derived glucose-responsive insulin(+) cells, their further maturation to fully functional adult β-cells still remains a daunting task. Conquering this hurdle will require a better understanding of the mechanisms driving maturation of embryonic insulin(+) cells into adult β-cells, and the implementation of that knowledge to improve current differentiation protocols. Here, we will review our current understanding of β-cell maturation, and discuss the contribution of key β-cell transcription factor MafA, to this process. The fundamental importance of MafA in regulating adult β-cell maturation and function indicates that enhancing MafA expression may improve the generation of definitive β-cells for transplantation. Additionally, we suggest that the temporal control of MafA induction at a specific stage of β-cell differentiation will be the next critical challenge for achieving optimum maturation of β-cells. PMID:26696512

  13. Preventing p38 MAPK-mediated MafA degradation ameliorates β-cell dysfunction under oxidative stress.

    PubMed

    El Khattabi, Ilham; Sharma, Arun

    2013-07-01

    The reduction in the expression of glucose-responsive insulin gene transcription factor MafA accompanies the development of β-cell dysfunction under oxidative stress/diabetic milieu. Humans with type 2 diabetes have reduced MafA expression, and thus preventing this reduction could overcome β-cell dysfunction and diabetes. We previously showed that p38 MAPK, but not glycogen synthase kinase 3 (GSK3), is a major regulator of MafA degradation under oxidative stress. Here, we examined the mechanisms of this degradation and whether preventing MafA degradation under oxidative stress will overcome β-cell dysfunction. We show that under oxidative and nonoxidative conditions p38 MAPK directly binds to MafA and triggers MafA degradation via ubiquitin proteasomal pathway. However, unlike nonoxidative conditions, MafA degradation under oxidative stress depended on p38 MAPK-mediated phosphorylation at threonine (T) 134, and not T57. Furthermore the expression of alanine (A) 134-MafA, but not A57-MafA, reduced the oxidative stress-mediated loss of glucose-stimulated insulin secretion, which was independent of p38 MAPK action on protein kinase D, a regulator of insulin secretion. Interestingly, the expression of proteasomal activator PA28γ that degrades GSK3-phosphorylated (including T57) MafA was reduced under oxidative stress, explaining the dominance of p38 MAPK over the GSK3 pathway in regulating MafA stability under oxidative stress. These results identify two distinct pathways mediating p38 MAPK-dependent MafA degradation under oxidative and nonoxidative conditions and show that inhibiting MafA degradation under oxidative stress ameliorates β-cell dysfunction and could lead to novel therapies for diabetes. PMID:23660596

  14. Cobalt induces heme oxygenase-1 expression by a hypoxia-inducible factor-independent mechanism in Chinese hamster ovary cells: regulation by Nrf2 and MafG transcription factors.

    PubMed

    Gong, P; Hu, B; Stewart, D; Ellerbe, M; Figueroa, Y G; Blank, V; Beckman, B S; Alam, J

    2001-07-20

    We have shown previously that activation of the heme oxygenase-1 (ho-1) gene by hypoxia in aortic smooth muscle cells is mediated by hypoxia-inducible factor-1 (HIF-1). In mutant (Ka13) Chinese hamster ovary cells lacking HIF activity, accumulation of ho-1 mRNA in response to hypoxia and the hypoxia-mimetic CoCl(2) was similar to that observed in wild type (K1) cells. These results support the existence of HIF-dependent and HIF-independent mechanisms for ho-1 gene activation by hypoxia and CoCl(2). In Ka13 cells, CoCl(2) stimulated expression of a luciferase reporter gene under the control of a 15-kilobase pair mouse ho-1 promoter (pHO15luc). Mutation analyses identified the cobalt-responsive sequences as the stress-response elements (StREs). In electrophoretic mobility shift assays, two specific StRE-protein complexes were observed using extracts from Ka13 cells. In response to cobalt, the level of the slower migrating complex X increased, whereas that of complex Y decreased, in a time-dependent manner. Members of the AP-1 superfamily of basic-leucine zipper factors bind to the StRE. Antibody supershift electrophoretic mobility shift assays did not detect Jun, Fos, or ATF/CREB proteins but identified Nrf2 and the small Maf protein, MafG, as components of complex X. Furthermore, dominant-negative mutants of Nrf2 and small Maf, but not of other bZIP factors, attenuated cobalt-mediated gene activation. Additional experiments demonstrated that induction by cobalt does not result from increased expression of MafG or regulated nuclear translocation of Nrf2 but is dependent on cellular oxidative stress. Unlike cobalt, hypoxia did not stimulate pHO15luc expression and did not increase StRE binding activity, indicating distinct mechanisms for ho-1 gene activation by cobalt and hypoxia in Chinese hamster ovary cells. PMID:11356853

  15. MafB promotes atherosclerosis by inhibiting foam-cell apoptosis

    NASA Astrophysics Data System (ADS)

    Hamada, Michito; Nakamura, Megumi; Tran, Mai Thi Nhu; Moriguchi, Takashi; Hong, Cynthia; Ohsumi, Takayuki; Dinh, Tra Thi Huong; Kusakabe, Manabu; Hattori, Motochika; Katsumata, Tokio; Arai, Satoko; Nakashima, Katsuhiko; Kudo, Takashi; Kuroda, Etsushi; Wu, Chien-Hui; Kao, Pei-Han; Sakai, Masaharu; Shimano, Hitoshi; Miyazaki, Toru; Tontonoz, Peter; Takahashi, Satoru

    2014-01-01

    MafB is a transcription factor that induces myelomonocytic differentiation. However, the precise role of MafB in the pathogenic function of macrophages has never been clarified. Here we demonstrate that MafB promotes hyperlipidemic atherosclerosis by suppressing foam-cell apoptosis. Our data show that MafB is predominantly expressed in foam cells found within atherosclerotic lesions, where MafB mediates the oxidized LDL-activated LXR/RXR-induced expression of apoptosis inhibitor of macrophages (AIM). In the absence of MafB, activated LXR/RXR fails to induce the expression of AIM, a protein that is normally responsible for protecting macrophages from apoptosis; thus, Mafb-deficient macrophages are prone to apoptosis. Haematopoietic reconstitution with Mafb-deficient fetal liver cells in recipient LDL receptor-deficient hyperlipidemic mice revealed accelerated foam-cell apoptosis, which subsequently led to the attenuation of the early atherogenic lesion. These findings represent the first evidence that the macrophage-affiliated MafB transcription factor participates in the acceleration of atherogenesis.

  16. Differential expression patterns of MafB and c-Maf in macrophages in vivo and in vitro.

    PubMed

    Daassi, Dhouha; Hamada, Michito; Jeon, Hyojung; Imamura, Yuki; Nhu Tran, Mai Thi; Takahashi, Satoru

    2016-04-22

    The large Maf transcription factors c-Maf and MafB are expressed in macrophage-lineage hematopoietic cells, but the expression patterns of MafB and c-Maf in macrophage subtypes and tissue-resident macrophages have not been fully analyzed. First, we analyzed MafB and c-Maf protein expression in tissue-resident macrophages. Mouse lymph nodes, spleens, lungs, and kidneys were subjected to immunohistochemistry using anti-MafB and anti-c-Maf. Both MafB and c-Maf signals were observed in lymph node macrophages. In the splenic macrophages the MafB signal was detected by anti-MafB, but the c-Maf signal was not detected. No expression of c-Maf or MafB was detected in macrophages in the lung and kidney. Flow cytometry analysis revealed a similar pattern of GFP expression in Mafb/GFP knock-in heterozygous mice. To analyze these different expression patterns in greater detail, we examined the expression of MafB and c-Maf by quantitative RT-PCR in different cytokine- or LPS-induced macrophages in vitro. MafB expression was induced by IL-10 or IL-4 with IL-13 and was reduced by LPS or GM-CSF. By contrast, c-Maf expression was induced by IL-10 and reduced by IL-4 with IL-13 or GM-CSF. These results indicate that MafB and c-Maf have different expression patterns in macrophages, suggesting differences in function. PMID:26996125

  17. MafA has strong cell transforming ability but is a weak transactivator.

    PubMed

    Nishizawa, Makoto; Kataoka, Kohsuke; Vogt, Peter K

    2003-09-11

    The maf oncogene of the avian oncogenic retrovirus AS42 encodes a nuclear bZip protein, v-Maf, that recognizes sequences related to the AP-1 target site. The corresponding cellular protein, c-Maf belongs to a family of related bZip proteins together with MafA and MafB. In this paper, we compare the transactivation and cell transforming abilities of MafA and MafB along with two forms of the c-Maf protein. These proteins induce cellular transformation when expressed in chicken embryo fibroblasts. In reporter assays, MafA is a much less effective transactivator than the other Maf proteins, but unexpectedly shows the strongest activity in cell transformation. Chimeras of MafA and MafB correlate the strong cell transforming ability of MafA with its DNA-binding domain. The DNA-binding domain of MafA is also correlated with weak transactivation. Additional mutagenesis experiments show that transactivation and transformation by MafA are also controlled by phosphorylation of two conserved serine residues in the transactivation domain. Finally, we constructed MafA-estrogen receptor fusion molecules that show tightly hormone-dependent cell transforming ability. These regulatable constructs permit a kinetic characterization of target gene responses and facilitate discrimination between direct and indirect targets. PMID:12970735

  18. Oxidative stress-mediated, post-translational loss of MafA protein as a contributing mechanism to loss of insulin gene expression in glucotoxic beta cells.

    PubMed

    Harmon, Jamie S; Stein, Roland; Robertson, R Paul

    2005-03-25

    Glucose toxicity in pancreatic islet beta cells causes loss of insulin gene expression, content, and secretion due to loss of binding of transcription factors, most notably PDX-1 and RIPE-3b1 activator, to the promoter region of the insulin gene. Recently, RIPE-3b1 activator was cloned and identified as the mammalian homologue of avian MafA/Maf-L (MafA). This enabled us to carry out more extensive studies of the role of MafA in glucotoxicity than were hitherto possible. Northern analysis of glucotoxic HIT-T15 cells revealed normal amounts of MafA mRNA, but Western analysis demonstrated a 97 +/- 1% reduction in MafA protein (p < 0.0001). The proteasome is a likely site for MafA degradation as lactacystin, an irreversible proteasome inhibitor, caused an accumulation of MafA protein. Antioxidants have previously been shown to prevent the adverse effects of glucose toxicity on beta cell function both in vivo and in vitro. In the current study, chronic culturing of HIT-T15 cells with the antioxidant N-acetylcysteine (NAC) prevented loss of MafA protein (late passage = 18.9 +/- 10.4% of early passage, p < 0.001; late passage with NAC = 68.7 +/- 19.7% of early passage, p = not significant) and loss of DNA binding (late passage = 63.7 +/- 9% of early passage, p < 0.02; late passage with NAC = 116 +/- 10% of early passage, p = not significant). Additionally, transient transfection of PDX-1 or MafA cDNA into glucotoxic cells increased PDX-1 and MafA protein levels and individually increased insulin promoter activity (untreated = 34%, PDX-1 = 70%, MafA = 78%; percentage of activity of early passage cells), whereas the combined transfection of MafA and PDX-1 completely restored insulin promoter activity. This recovery of promoter activity following transient transfection had no effect on endogenous insulin mRNA. However, adenoviral infection of MafA and PDX-1 significantly increased endogenous insulin mRNA levels by 93% (121 +/- 9 versus 233 +/- 18 density light units; n = 5

  19. MafA is a Key Molecule in Glucose and Energy Balance in the Central Nervous System and Peripheral Organs

    PubMed Central

    Tsuchiya, Mariko; Tsuchiya, Ken; Yasuda, Kazuki; Fujita, Mikiko; Takinishi, Akira; Furukawa, Maiko; Nitta, Kosaku; Maeda, Atsushi

    2011-01-01

    MafA is a strong transactivator of insulin in pancreatic β cells. Elucidating the profile of MafA action in organs other than the pancreas is essential. We established an mRNA interference technique that modifies the level of target mRNAs in mice in vivo. After rapidly injecting MafA-siRNA, the resulting changes in the gene profile were analyzed using a microarray system. Significant suppression of the MafA mRNA levels was observed in the pancreas, liver, adipose tissue, and brain of siRNA-injected mice. As we reported previously, the down-regulation of insulin mRNA and adipocytokines was observed in the pancreas, and MafA siRNA caused alterations in the expressions of genes related to lipid metabolism and cell growth in the liver, and the attenuation of cell differentiation in cultured adipocytes. In addition to the effects on these organs, MafA expression was immunohistochemically detected in the brain in our preliminary data, and the expression level in siRNA-treated mice was significantly suppressed. The expressions of the affected genes were distinct, including growth hormone, vasopressin, hypocretin, and pro-melanin-concentrating hormone, were almost completely down-regulated (to ~1/100). These results suggested that MafA is likely involved in the regulation of hormonal systems related to glucose metabolism, and MafA is likely positioned near the beginning of the cascade or may influence the expressions of the above-mentioned genes in coordination with other factors in brain tissue. Taken together, the findings in this study suggested that MafA functions as a transcription factor with distinct activities in each organ and is cross-linked in several organs. PMID:23675216

  20. MafB antagonizes phenotypic alteration induced by GM-CSF in microglia

    SciTech Connect

    Koshida, Ryusuke Oishi, Hisashi Hamada, Michito; Takahashi, Satoru

    2015-07-17

    Microglia are tissue-resident macrophages which are distributed throughout the central nervous system (CNS). Recent studies suggest that microglia are a unique myeloid population distinct from peripheral macrophages in terms of origin and gene expression signature. Granulocyte-macrophage colony-stimulating factor (GM-CSF), a pleiotropic cytokine regulating myeloid development, has been shown to stimulate proliferation and alter phenotype of microglia in vitro. However, how its signaling is modulated in microglia is poorly characterized. MafB, a bZip transcriptional factor, is highly expressed in monocyte-macrophage lineage cells including microglia, although its role in microglia is largely unknown. We investigated the crosstalk between GM-CSF signaling and MafB by analyzing primary microglia. We found that Mafb-deficient microglia grew more rapidly than wild-type microglia in response to GM-CSF. Moreover, the expression of genes associated with microglial differentiation was more downregulated in Mafb-deficient microglia cultured with GM-CSF. Notably, such differences between the genotypes were not observed in the presence of M-CSF. In addition, we found that Mafb-deficient microglia cultured with GM-CSF barely extended their membrane protrusions, probably due to abnormal activation of RhoA, a key regulator of cytoskeletal remodeling. Altogether, our study reveals that MafB is a negative regulator of GM-CSF signaling in microglia. These findings could provide new insight into the modulation of cytokine signaling by transcription factors in microglia. - Highlights: • GM-CSF alters the phenotype of microglia in vitro more potently than M-CSF. • Transcription factor MafB antagonizes the effect of GM-CSF on microglia in vitro. • MafB deficiency leads to RhoA activation in microglia in response to GM-CSF. • We show for the first time the function of MafB in microglia.

  1. Antitumor effect of vitamin D-binding protein-derived macrophage activating factor on Ehrlich ascites tumor-bearing mice.

    PubMed

    Koga, Y; Naraparaju, V R; Yamamoto, N

    1999-01-01

    Cancerous cells secrete alpha-N-acetylgalactosaminidase (NaGalase) into the blood stream, resulting in deglycosylation of serum vitamin D3-binding protein (known as Gc protein), which is a precursor for macrophage activating factor (MAF). Incubation of Gc protein with immobilized beta-galactosidase and sialidase generates the most potent macrophage activating factor (designated GcMAF). Administration of GcMAF to cancer-bearing hosts can bypass the inactivated MAF precursor and act directly on macrophages for efficient activation. Therapeutic effects of GcMAF on Ehrlich ascites tumor-bearing mice were assessed by survival time and serum NaGalase activity, because serum NaGalase activity was proportional to tumor burden. A single administration of GcMAF (100 pg/mouse) to eight mice on the same day after transplantation of the tumor (5 x 10(5) cells) showed a mean survival time of 21 +/- 3 days for seven mice, with one mouse surviving more than 60 days, whereas tumor-bearing controls had a mean survival time of 13 +/- 2 days. Six of the eight mice that received two GcMAF administrations, at Day 0 and Day 4 after transplantation, survived up to 31 +/- 4 days whereas, the remaining two mice survived for more than 60 days. Further, six of the eight mice that received three GcMAF administrations with 4-day intervals showed an extended survival of at least 60 days, and serum NaGalase levels were as low as those of control mice throughout the survival period. The cure with subthreshold GcMAF-treatments (administered once or twice) of tumor-bearing mice appeared to be a consequence of sustained macrophage activation by inflammation resulting from the macrophage-mediated tumoricidal process. Therefore, a protracted macrophage activation induced by a few administrations of minute amounts of GcMAF eradicated the murine ascites tumor. PMID:9893164

  2. GC protein-derived macrophage-activating factor decreases α-N-acetylgalactosaminidase levels in advanced cancer patients

    PubMed Central

    Thyer, Lynda; Ward, Emma; Smith, Rodney; Branca, Jacopo JV; Morucci, Gabriele; Gulisano, Massimo; Noakes, David; Eslinger, Robert; Pacini, Stefania

    2013-01-01

    α-N-acetylgalactosaminidase (nagalase) accumulates in the serum of cancer patients and its activity correlates with tumor burden, aggressiveness and clinical disease progression. The administration of GC protein-derived macrophage-activating factor (GcMAF) to cancer patients with elevated levels of nagalase has been associated with a decrease of serum nagalase activity and with significant clinical benefits. Here, we report the results of the administration of GcMAF to a heterogeneous cohort of patients with histologically diverse, advanced neoplasms, generally considered as “incurable” diseases. In most cases, GcMAF therapy was initiated at late stages of tumor progression. As this is an open-label, non-controlled, retrospective analysis, caution must be employed when establishing cause-effect relationships between the administration GcMAF and disease outcome. However, the response to GcMAF was generally robust and some trends emerged. All patients (n = 20) presented with elevated serum nagalase activity, well above normal values. All patients but one showed a significant decrease of serum nagalase activity upon weekly GcMAF injections. Decreased nagalase activity was associated with improved clinical conditions and no adverse side effects were reported. The observations reported here confirm and extend previous results and pave the way to further studies aimed at assessing the precise role and indications for GcMAF-based anticancer immunotherapy. PMID:24179708

  3. GC protein-derived macrophage-activating factor decreases α-N-acetylgalactosaminidase levels in advanced cancer patients.

    PubMed

    Thyer, Lynda; Ward, Emma; Smith, Rodney; Branca, Jacopo Jv; Morucci, Gabriele; Gulisano, Massimo; Noakes, David; Eslinger, Robert; Pacini, Stefania

    2013-08-01

    α-N-acetylgalactosaminidase (nagalase) accumulates in the serum of cancer patients and its activity correlates with tumor burden, aggressiveness and clinical disease progression. The administration of GC protein-derived macrophage-activating factor (GcMAF) to cancer patients with elevated levels of nagalase has been associated with a decrease of serum nagalase activity and with significant clinical benefits. Here, we report the results of the administration of GcMAF to a heterogeneous cohort of patients with histologically diverse, advanced neoplasms, generally considered as "incurable" diseases. In most cases, GcMAF therapy was initiated at late stages of tumor progression. As this is an open-label, non-controlled, retrospective analysis, caution must be employed when establishing cause-effect relationships between the administration GcMAF and disease outcome. However, the response to GcMAF was generally robust and some trends emerged. All patients (n = 20) presented with elevated serum nagalase activity, well above normal values. All patients but one showed a significant decrease of serum nagalase activity upon weekly GcMAF injections. Decreased nagalase activity was associated with improved clinical conditions and no adverse side effects were reported. The observations reported here confirm and extend previous results and pave the way to further studies aimed at assessing the precise role and indications for GcMAF-based anticancer immunotherapy. PMID:24179708

  4. Reprogramming of Pancreatic Exocrine Cells AR42J Into Insulin-producing Cells Using mRNAs for Pdx1, Ngn3, and MafA Transcription Factors.

    PubMed

    Koblas, Tomas; Leontovyc, Ivan; Loukotova, Sarka; Kosinova, Lucie; Saudek, Frantisek

    2016-01-01

    Direct reprogramming of pancreatic nonendocrine cells into insulin-producing β-cells represents a promising approach for the treatment of insulin-dependent diabetes. However, its clinical application is limited by the potential for insertional mutagenesis associated with the viral vectors currently used for cell reprogramming. With the aim of developing a nonintegrative reprogramming strategy for derivation of insulin-producing cells, here, we evaluated a new approach utilizing synthetic messenger RNAs encoding reprogramming transcription factors. Administration of synthetic mRNAs encoding three key transcription regulators of β-cell differentiation-Pdx1, Neurogenin3, and MafA-efficiently reprogrammed the pancreatic exocrine cells into insulin-producing cells. In addition to the insulin genes expression, the synthetic mRNAs also induced the expressions of genes important for proper pancreatic β-cell function, including Sur1, Kir6.2, Pcsk1, and Pcsk2. Pretreating cells with the chromatin-modifying agent 5-Aza-2'-deoxycytidine further enhanced reprogramming efficiency, increasing the proportion of insulin-producing cells from 3.5 ± 0.9 to 14.3 ± 1.9% (n = 4). Moreover, 5-Aza-2'-deoxycytidine pretreatment enabled the reprogrammed cells to respond to glucose challenge with increased insulin secretion. In conclusion, our results support that the reprogramming of pancreatic exocrine cells into insulin-producing cells, induced by synthetic mRNAs encoding pancreatic transcription factors, represents a promising approach for cell-based diabetes therapy. PMID:27187823

  5. Protection and governance of MPEG-21 music player MAF contents using MPEG-21 IPMP tools

    NASA Astrophysics Data System (ADS)

    Hendry; Kim, Munchurl

    2006-02-01

    MPEG (Moving Picture Experts Groups) is currently standardizing Multimedia Application Format (MAF) which targets to provide simple but practical multimedia applications to the industry. One of the interesting and on-going working items of MAF activity is the so-called Music Player MAF which combines MPEG-1/2 layer III (MP3), JPEG image, and metadata into a standard format. In this paper, we propose a protection and governance mechanism to the Music Player MAF by incorporating other MPEG technology, MPEG-21 IPMP (Intellectual Property Management and Protection). We show, in this paper, use-case of the distribution and consumption of this Music Player contents, requirements, and how this protection and governance can be implemented in conjunction with the current Music Player MAF architecture and file system. With the use of MPEG-21 IPMP, the protection and governance to the content of Music Player MAF fulfils flexibility, extensibility, and granular in protection requirements.

  6. Mammalian Maf1 is a negative regulator of transcription by all three nuclear RNA polymerases.

    PubMed

    Johnson, Sandra S; Zhang, Cheng; Fromm, Jody; Willis, Ian M; Johnson, Deborah L

    2007-05-11

    Most eukaryotic transcriptional regulators act in an RNA polymerase (Pol)-selective manner. Here we show that the human Maf1 protein negatively regulates transcription by all three nuclear Pols. Changes in Maf1 expression affect Pol I- and Pol III-dependent transcription in human glioblastoma lines. These effects are mediated, in part, through the ability of Maf1 to repress transcription of the TATA binding protein, TBP. Maf1 targets an Elk-1-binding site in the TBP promoter, and its occupancy of this region is reciprocal with that of Elk-1. Similarly, Maf1 occupancy of Pol III genes is inversely correlated with that of the initiation factor TFIIIB and Pol III. The phenotypic consequences of reducing Maf1 expression include changes in cell morphology and the accumulation of actin stress fibers, whereas Maf1 overexpression suppresses anchorage-independent growth. Together with the ability of Maf1 to reduce biosynthetic capacity, these findings support the idea that Maf1 regulates the transformation state of cells. PMID:17499043

  7. The MAFB transcription factor impacts islet α-cell function in rodents and represents a unique signature of primate islet β-cells.

    PubMed

    Conrad, Elizabeth; Dai, Chunhua; Spaeth, Jason; Guo, Min; Cyphert, Holly A; Scoville, David; Carroll, Julie; Yu, Wei-Ming; Goodrich, Lisa V; Harlan, David M; Grove, Kevin L; Roberts, Charles T; Powers, Alvin C; Gu, Guoqiang; Stein, Roland

    2016-01-01

    Analysis of MafB(-/-) mice has suggested that the MAFB transcription factor was essential to islet α- and β-cell formation during development, although the postnatal physiological impact could not be studied here because these mutants died due to problems in neural development. Pancreas-wide mutant mice were generated to compare the postnatal significance of MafB (MafB(Δpanc)) and MafA/B (MafAB(Δpanc)) with deficiencies associated with the related β-cell-enriched MafA mutant (MafA(Δpanc)). Insulin(+) cell production and β-cell activity were merely delayed in MafB(Δpanc) islets until MafA was comprehensively expressed in this cell population. We propose that MafA compensates for the absence of MafB in MafB(Δpanc) mice, which is supported by the death of MafAB(Δpanc) mice soon after birth from hyperglycemia. However, glucose-induced glucagon secretion was compromised in adult MafB(Δpanc) islet α-cells. Based upon these results, we conclude that MafB is only essential to islet α-cell activity and not β-cell. Interestingly, a notable difference between mice and humans is that MAFB is coexpressed with MAFA in adult human islet β-cells. Here, we show that nonhuman primate (NHP) islet α- and β-cells also produce MAFB, implying that MAFB represents a unique signature and likely important regulator of the primate islet β-cell. PMID:26554594

  8. Structurally well-defined macrophage activating factor derived from vitamin D3-binding protein has a potent adjuvant activity for immunization.

    PubMed

    Yamamoto, N; Naraparaju, V R

    1998-06-01

    Freund's adjuvant produced severe inflammation that augments development of antibodies. Thus, mixed administration of antigens with adjuvant was not required as long as inflammation was induced in the hosts. Since macrophage activation for phagocytosis and antigen processing is the first step of antibody development, inflammation-primed macrophage activation plays a major role in immune development. Therefore, macrophage activating factor should act as an adjuvant for immunization. The inflammation-primed macrophage activation process is the major macrophage activating cascade that requires participation of serum vitamin D3-binding protein (DBP; human DBP is known as Gc protein) and glycosidases of B and T lymphocytes. Stepwise incubation of Gc protein with immobilized beta-galactosidase and sialidase efficiently generated the most potent macrophage activating factor (designated GcMAF) we have ever encountered. Administration of GcMAF (20 or 100 pg/mouse) resulted in stimulation of the progenitor cells for extensive mitogenesis and activation of macrophages. Administration of GcMAF (100 pg/mouse) along with immunization of mice with sheep red blood cells (SRBC) produced a large number of anti-SRBC antibody secreting splenic cells in 2-4 days. Thus, GcMAF has a potent adjuvant activity for immunization. Although malignant tumours are poorly immunogenic, 4 days after GcMAF-primed immunization of mice with heat-killed Ehrlich ascites tumour cells, the ascites tumour was no longer transplantable in these mice. PMID:9682967

  9. Vitamin D Binding Protein-Macrophage Activating Factor Directly Inhibits Proliferation, Migration, and uPAR Expression of Prostate Cancer Cells

    PubMed Central

    Bielenberg, Diane R.; Dridi, Sami; Wu, Jason; Jiang, Weihua; Huang, Bin; Pirie-Shepherd, Steven; Fannon, Michael

    2010-01-01

    Background Vitamin D binding protein-macrophage activating factor (DBP-maf) is a potent inhibitor of tumor growth. Its activity, however, has been attributed to indirect mechanisms such as boosting the immune response by activating macrophages and inhibiting the blood vessel growth necessary for the growth of tumors. Methods and Findings In this study we show for the first time that DBP-maf exhibits a direct and potent effect on prostate tumor cells in the absence of macrophages. DBP-maf demonstrated inhibitory activity in proliferation studies of both LNCaP and PC3 prostate cancer cell lines as well as metastatic clones of these cells. Flow cytometry studies with annexin V and propidium iodide showed that this inhibitory activity is not due to apoptosis or cell death. DBP-maf also had the ability to inhibit migration of prostate cancer cells in vitro. Finally, DBP-maf was shown to cause a reduction in urokinase plasminogen activator receptor (uPAR) expression in prostate tumor cells. There is evidence that activation of this receptor correlates with tumor metastasis. Conclusions These studies show strong inhibitory activity of DBP-maf on prostate tumor cells independent of its macrophage activation. PMID:20976141

  10. Enhanced MAF Oncogene Expression and Breast Cancer Bone Metastasis

    PubMed Central

    Pavlovic, Milica; Arnal-Estapé, Anna; Rojo, Federico; Bellmunt, Anna; Tarragona, Maria; Guiu, Marc; Planet, Evarist; Garcia-Albéniz, Xabier; Morales, Mónica; Urosevic, Jelena; Gawrzak, Sylwia; Rovira, Ana; Prat, Aleix; Nonell, Lara; Lluch, Ana; Jean-Mairet, Joël; Coleman, Robert; Albanell, Joan

    2015-01-01

    Background: There are currently no biomarkers for early breast cancer patient populations at risk of bone metastasis. Identification of mediators of bone metastasis could be of clinical interest. Methods: A de novo unbiased screening approach based on selection of highly bone metastatic breast cancer cells in vivo was used to determine copy number aberrations (CNAs) associated with bone metastasis. The CNAs associated with bone metastasis were examined in independent primary breast cancer datasets with annotated clinical follow-up. The MAF gene encoded within the CNA associated with bone metastasis was subjected to gain and loss of function validation in breast cancer cells (MCF7, T47D, ZR-75, and 4T1), its downstream mechanism validated, and tested in clinical samples. A multivariable Cox cause-specific hazard model with competing events (death) was used to test the association between 16q23 or MAF and bone metastasis. All statistical tests were two-sided. Results: 16q23 gain CNA encoding the transcription factor MAF mediates breast cancer bone metastasis through the control of PTHrP. 16q23 gain (hazard ratio (HR) for bone metastasis = 14.5, 95% confidence interval (CI) = 6.4 to 32.9, P < .001) as well as MAF overexpression (HR for bone metastasis = 2.5, 95% CI = 1.7 to 3.8, P < .001) in primary breast tumors were specifically associated with risk of metastasis to bone but not to other organs. Conclusions: These results suggest that MAF is a mediator of breast cancer bone metastasis. 16q23 gain or MAF protein overexpression in tumors may help to select patients at risk of bone relapse. PMID:26376684

  11. c-Maf Regulates IL-10 Expression during Th17 Polarization1

    PubMed Central

    Xu, Jiangnan; Yang, Yu; Qiu, Guixing; Lal, Girdhari; Wu, Zhihong; Levy, David E.; Ochando, Jordi C.; Bromberg, Jonathan S.; Ding, Yaozhong

    2010-01-01

    IL-10 production by Th17 cells is critical for limiting autoimmunity and inflammatory responses. Gene array analysis on Stat6 and T-bet double-deficient Th17 cells identified the Th2 transcription factor c-Maf to be synergistically up-regulated by IL-6 plus TGFβ and associated with Th17 IL-10 production. Both c-Maf and IL-10 induction during Th17 polarization depended on Stat3, but not Stat6 or Stat1, and mechanistically differed from IL-10 regulation by Th2 or IL-27 signals. TGFβ was also synergistic with IL-27 to induce c-Maf, and it induced Stat1-independent IL-10 expression in contrast to IL-27 alone. Retroviral transduction of c-Maf was able to induce IL-10 expression in Stat6-deficient CD4 and CD8 T cells, and c-Maf directly transactivated IL-10 gene expression through binding to a MARE (Maf recognition element) motif in the IL-10 promoter. Taken together, these data reveal a novel role for c-Maf in regulating T effector development, and they suggest that TGFβ may antagonize Th17 immunity by IL-10 production through c-Maf induction. PMID:19414776

  12. The effects of vitamin D binding protein-macrophage activating factor and colony-stimulating factor-1 on hematopoietic cells in normal and osteopetrotic rats.

    PubMed

    Benis, K A; Schneider, G B

    1996-10-15

    Osteopetrosis is a heterogeneous group of bone disorders characterized by the failure of osteoclasts to resorb bone and by several immunological defects including macrophage dysfunction. Two compounds, colony-stimulating factor-1 (CSF-1) and vitamin D-binding protein-macrophage activating factor (DBP-MAF) were used in the present study to evaluate their effects on the peritoneal population of cells and on cells within the bone marrow microenvironment in normal and incisors absent (ia) osteopetrotic rats. Previous studies in this laboratory have demonstrated that administration of DBP-MAF to newborn ia animals results in a substantial increase in bone marrow cavity size due to upregulated osteoclast function. To study the effects of these compounds on the macrophage/osteoclast precursors, DBP-MAF, CSF-1, and the combination of these compounds were given to newborn ia and normal littermate animals. Both the normal and mutant phenotypes responded similarly when treated with these compounds. Rats exhibited a profound shift toward the macrophage lineage from the neutrophil lineage when compared with vehicle-treated control animals after treatment with these compounds. In the in vivo peritoneal lavage study, animals received injections of CSF-1, DBP-MAF or DBP-MAF/CSF-1 over a 4-week period. The various types of cells in the peritoneal cavity were then enumerated. The in vitro study consisted of cells isolated from the bone marrow microenvironment and cultured on feeder layers of CSF-1, DBP-MAF, or DBP-MAF/CSF-1 for colony enumeration. The increase in macrophage numbers at the expense of neutrophil numbers could be seen in both the in vivo and in vitro experiments. The macrophage/osteoclast and neutrophil lineages have a common precursor, the granulocyte/macrophage colony-forming cell (GM-CFC). With the addition of CSF-1, the GM-CFC precursor may be induced into the macrophage/osteoclast lineage rather than the granulocyte lineage. This increased pool of cells in the

  13. Gc-protein-derived macrophage activating factor counteracts the neuronal damage induced by oxaliplatin.

    PubMed

    Morucci, Gabriele; Branca, Jacopo J V; Gulisano, Massimo; Ruggiero, Marco; Paternostro, Ferdinando; Pacini, Alessandra; Di Cesare Mannelli, Lorenzo; Pacini, Stefania

    2015-02-01

    Oxaliplatin-based regimens are effective in metastasized advanced cancers. However, a major limitation to their widespread use is represented by neurotoxicity that leads to peripheral neuropathy. In this study we evaluated the roles of a proven immunotherapeutic agent [Gc-protein-derived macrophage activating factor (GcMAF)] in preventing or decreasing oxaliplatin-induced neuronal damage and in modulating microglia activation following oxaliplatin-induced damage. The effects of oxaliplatin and of a commercially available formula of GcMAF [oleic acid-GcMAF (OA-GcMAF)] were studied in human neurons (SH-SY5Y cells) and in human microglial cells (C13NJ). Cell density, morphology and viability, as well as production of cAMP and expression of vascular endothelial growth factor (VEGF), markers of neuron regeneration [neuromodulin or growth associated protein-43 (Gap-43)] and markers of microglia activation [ionized calcium binding adaptor molecule 1 (Iba1) and B7-2], were determined. OA-GcMAF reverted the damage inflicted by oxaliplatin on human neurons and preserved their viability. The neuroprotective effect was accompanied by increased intracellular cAMP production, as well as by increased expression of VEGF and neuromodulin. OA-GcMAF did not revert the effects of oxaliplatin on microglial cell viability. However, it increased microglial activation following oxaliplatin-induced damage, resulting in an increased expression of the markers Iba1 and B7-2 without any concomitant increase in cell number. When neurons and microglial cells were co-cultured, the presence of OA-GcMAF significantly counteracted the toxic effects of oxaliplatin. Our results demonstrate that OA-GcMAF, already used in the immunotherapy of advanced cancers, may significantly contribute to neutralizing the neurotoxicity induced by oxaliplatin, at the same time possibly concurring to an integrated anticancer effect. The association between these two powerful anticancer molecules would probably produce

  14. Immunotherapy of BALB/c mice bearing Ehrlich ascites tumor with vitamin D-binding protein-derived macrophage activating factor.

    PubMed

    Yamamoto, N; Naraparaju, V R

    1997-06-01

    Vitamin D3-binding protein (DBP; human DBP is known as Gc protein) is the precursor of macrophage activating factor (MAF). Treatment of mouse DBP with immobilized beta-galactosidase or treatment of human Gc protein with immobilized beta-galactosidase and sialidase generated a remarkably potent MAF, termed DBPMAF or GcMAF, respectively. The domain of Gc protein responsible for macrophage activation was cloned and enzymatically converted to the cloned MAF, designated CdMAF. In Ehrlich ascites tumor-bearing mice, tumor-specific serum alpha-N-acetylgalactosaminidase (NaGalase) activity increased linearly with time as the transplanted tumor cells grew in the peritoneal cavity. Therapeutic effects of DBPMAF, GcMAF, and CdMAF on mice bearing Ehrlich ascites tumor were assessed by survival time, the total tumor cell count in the peritoneal cavity, and serum NaGalase activity. Mice that received a single administration of DBPMAF or GcMAF (100 pg/mouse) on the same day after transplantation of tumor (1 x 10(5) cells) showed a mean survival time of 35 +/- 4 days, whereas tumor-bearing controls had a mean survival time of 16 +/- 2 days. When mice received the second DBPMAF or GcMAF administration at day 4, they survived more than 50 days. Mice that received two DBPMAF administrations, at days 4 and 8 after transplantation of 1 x 10(5) tumor cells, survived up to 32 +/- 4 days. At day 4 posttransplantation, the total tumor cell count in the peritoneal cavity was approximately 5 x 10(5) cells. Mice that received two DBPMAF administrations, at days 0 and 4 after transplantation of 5 x 10(5) tumor cells, also survived up to 32 +/- 4 days, while control mice that received the 5 x 10(5) ascites tumor cells only survived for 14 +/- 2 days. Four DBPMAF, GcMAF, or CdMAF administrations to mice transplanted with 5 x 10(5) Ehrlich ascites tumor cells with 4-day intervals showed an extended survival of at least 90 days and an insignificantly low serum NaGalase level between days 30 and 90

  15. Human MAF1 targets and represses active RNA polymerase III genes by preventing recruitment rather than inducing long-term transcriptional arrest

    PubMed Central

    Orioli, Andrea; Praz, Viviane; Lhôte, Philippe; Hernandez, Nouria

    2016-01-01

    RNA polymerase III (Pol III) is tightly controlled in response to environmental cues, yet a genomic-scale picture of Pol III regulation and the role played by its repressor MAF1 is lacking. Here, we describe genome-wide studies in human fibroblasts that reveal a dynamic and gene-specific adaptation of Pol III recruitment to extracellular signals in an mTORC1-dependent manner. Repression of Pol III recruitment and transcription are tightly linked to MAF1, which selectively localizes at Pol III loci, even under serum-replete conditions, and increasingly targets transcribing Pol III in response to serum starvation. Combining Pol III binding profiles with EU-labeling and high-throughput sequencing of newly synthesized small RNAs, we show that Pol III occupancy closely reflects ongoing transcription. Our results exclude the long-term, unproductive arrest of Pol III on the DNA as a major regulatory mechanism and identify previously uncharacterized, differential coordination in Pol III binding and transcription under different growth conditions. PMID:26941251

  16. Effects of oxaliplatin and oleic acid Gc-protein-derived macrophage-activating factor on murine and human microglia.

    PubMed

    Branca, Jacopo J V; Morucci, Gabriele; Malentacchi, Francesca; Gelmini, Stefania; Ruggiero, Marco; Pacini, Stefania

    2015-09-01

    The biological properties and characteristics of microglia in rodents have been widely described, but little is known about these features in human microglia. Several murine microglial cell lines are used to investigate neurodegenerative and neuroinflammatory conditions; however, the extrapolation of the results to human conditions is frequently met with criticism because of the possibility of species-specific differences. This study compares the effects of oxaliplatin and of oleic acid Gc-protein-derived macrophage-activating factor (OA-GcMAF) on two microglial cell lines, murine BV-2 cells and human C13NJ cells. Cell viability, cAMP levels, microglial activation, and vascular endothelial growth factor (VEGF) expression were evaluated. Our data demonstrate that oxaliplatin induced a significant decrease in cell viability in BV-2 and in C13NJ cells and that this effect was not reversed with OA-GcMAF treatment. The signal transduction pathway involving cAMP/VEGF was activated after treatment with oxaliplatin and/or OA-GcMAF in both cell lines. OA-GcMAF induced a significant increase in microglia activation, as evidenced by the expression of the B7-2 protein, in BV-2 as well as in C13NJ cells that was not associated with a concomitant increase in cell number. Furthermore, the effects of oxaliplatin and OA-GcMAF on coculture morphology and apoptosis were evaluated. Oxaliplatin-induced cell damage and apoptosis were nearly completely reversed by OA-GcMAF treatment in both BV-2/SH-SY5Y and C13NJ/SH-SY5Y cocultures. Our data show that murine and human microglia share common signal transduction pathways and activation mechanisms, suggesting that the murine BV-2 cell line may represent an excellent model for studying human microglia. PMID:25782915

  17. Inhibitory effect of vitamin D-binding protein-derived macrophage activating factor on DMBA-induced hamster cheek pouch carcinogenesis and its derived carcinoma cell line

    PubMed Central

    TOYOHARA, YUKIYO; HASHITANI, SUSUMU; KISHIMOTO, HIROMITSU; NOGUCHI, KAZUMA; YAMAMOTO, NOBUTO; URADE, MASAHIRO

    2011-01-01

    This study investigated the inhibitory effect of vitamin D-binding protein-derived macrophage-activating factor (GcMAF) on carcinogenesis and tumor growth, using a 9,10-dimethyl-1,2-benzanthracene (DMBA)-induced hamster cheek pouch carcinogenesis model, as well as the cytocidal effect of activated macrophages against HCPC-1, a cell line established from DMBA-induced cheek pouch carcinoma. DMBA application induced squamous cell carcinoma in all 15 hamsters of the control group at approximately 10 weeks, and all 15 hamsters died of tumor burden within 20 weeks. By contrast, 2 out of the 14 hamsters with GcMAF administration did not develop tumors and the remaining 12 hamsters showed a significant delay of tumor development for approximately 3.5 weeks. The growth of tumors formed was significantly suppressed and none of the hamsters died within the 20 weeks during which they were observed. When GcMAF administration was stopped at the 13th week of the experiment in 4 out of the 14 hamsters in the GcMAF-treated group, tumor growth was promoted, but none of the mice died within the 20-week period. On the other hand, when GcMAF administration was commenced after the 13th week in 5 out of the 15 hamsters in the control group, tumor growth was slightly suppressed and all 15 hamsters died of tumor burden. However, the mean survival time was significantly extended. GcMAF treatment activated peritoneal macrophages in vitro and in vivo, and these activated macrophages exhibited a marked cytocidal effect on HCPC-1 cells. Furthermore, the cytocidal effect of activated macrophages was enhanced by the addition of tumor-bearing hamster serum. These findings indicated that GcMAF possesses an inhibitory effect on tumor development and growth in a DMBA-induced hamster cheek pouch carcinogenesis model. PMID:22848250

  18. Inhibitory effect of vitamin D-binding protein-derived macrophage activating factor on DMBA-induced hamster cheek pouch carcinogenesis and its derived carcinoma cell line.

    PubMed

    Toyohara, Yukiyo; Hashitani, Susumu; Kishimoto, Hiromitsu; Noguchi, Kazuma; Yamamoto, Nobuto; Urade, Masahiro

    2011-07-01

    This study investigated the inhibitory effect of vitamin D-binding protein-derived macrophage-activating factor (GcMAF) on carcinogenesis and tumor growth, using a 9,10-dimethyl-1,2-benzanthracene (DMBA)-induced hamster cheek pouch carcinogenesis model, as well as the cytocidal effect of activated macrophages against HCPC-1, a cell line established from DMBA-induced cheek pouch carcinoma. DMBA application induced squamous cell carcinoma in all 15 hamsters of the control group at approximately 10 weeks, and all 15 hamsters died of tumor burden within 20 weeks. By contrast, 2 out of the 14 hamsters with GcMAF administration did not develop tumors and the remaining 12 hamsters showed a significant delay of tumor development for approximately 3.5 weeks. The growth of tumors formed was significantly suppressed and none of the hamsters died within the 20 weeks during which they were observed. When GcMAF administration was stopped at the 13th week of the experiment in 4 out of the 14 hamsters in the GcMAF-treated group, tumor growth was promoted, but none of the mice died within the 20-week period. On the other hand, when GcMAF administration was commenced after the 13th week in 5 out of the 15 hamsters in the control group, tumor growth was slightly suppressed and all 15 hamsters died of tumor burden. However, the mean survival time was significantly extended. GcMAF treatment activated peritoneal macrophages in vitro and in vivo, and these activated macrophages exhibited a marked cytocidal effect on HCPC-1 cells. Furthermore, the cytocidal effect of activated macrophages was enhanced by the addition of tumor-bearing hamster serum. These findings indicated that GcMAF possesses an inhibitory effect on tumor development and growth in a DMBA-induced hamster cheek pouch carcinogenesis model. PMID:22848250

  19. LincRNA landscape in human lymphocytes highlights regulation of T cell differentiation by linc-MAF-4

    PubMed Central

    Curti, Serena; Gruarin, Paola; Provasi, Elena; Sugliano, Elisa; Marconi, Maurizio; De Francesco, Raffaele; Geginat, Jens; Bodega, Beatrice; Abrignani, Sergio; Pagani, Massimiliano

    2014-01-01

    Long non-coding-RNAs are emerging as important regulators of cellular functions but little is known on their role in human immune system. Here we investigated long intergenic non-coding-RNAs (lincRNAs) in thirteen T and B lymphocyte subsets by RNA-seq analysis and de novo transcriptome reconstruction. Over five hundred new lincRNAs were identified and lincRNAs signatures were described. Expression of linc-MAF-4, a chromatin-associated TH1-specific lincRNA, was inversely correlated with MAF, a TH2-associated transcription factor. Linc-MAF-4 down-regulation skewed T cell differentiation toward TH2. We identified a long-distance interaction between linc-MAF-4 and MAF genomic regions, where linc-MAF-4 associates with LSD1 and EZH2, suggesting linc-MAF-4 regulated MAF transcription by recruitment of chromatin modifiers. Our results demonstrate a key role of lincRNAs in T lymphocyte differentiation. PMID:25621826

  20. Maf1, a New Player in the Regulation of Human RNA Polymerase III Transcription

    PubMed Central

    Hernandez, Nouria

    2006-01-01

    Background Human RNA polymerase III (pol III) transcription is regulated by several factors, including the tumor suppressors P53 and Rb, and the proto-oncogene c-Myc. In yeast, which lacks these proteins, a central regulator of pol III transcription, called Maf1, has been described. Maf1 is required for repression of pol III transcription in response to several signal transduction pathways and is broadly conserved in eukaryotes. Methodology/Principal Findings We show that human endogenous Maf1 can be co-immunoprecipitated with pol III and associates in vitro with two pol III subunits, the largest subunit RPC1 and the α-like subunit RPAC2. Maf1 represses pol III transcription in vitro and in vivo and is required for maximal pol III repression after exposure to MMS or rapamycin, treatments that both lead to Maf1 dephosphorylation. Conclusions/Significance These data suggest that Maf1 is a major regulator of pol III transcription in human cells. PMID:17205138

  1. A novel role for a major component of the vitamin D axis: vitamin D binding protein-derived macrophage activating factor induces human breast cancer cell apoptosis through stimulation of macrophages.

    PubMed

    Thyer, Lynda; Ward, Emma; Smith, Rodney; Fiore, Maria Giulia; Magherini, Stefano; Branca, Jacopo J V; Morucci, Gabriele; Gulisano, Massimo; Ruggiero, Marco; Pacini, Stefania

    2013-07-01

    The role of vitamin D in maintaining health appears greater than originally thought, and the concept of the vitamin D axis underlines the complexity of the biological events controlled by biologically active vitamin D (1,25(OH)(2)D3), its two binding proteins that are the vitamin D receptor (VDR) and the vitamin D-binding protein-derived macrophage activating factor (GcMAF). In this study we demonstrate that GcMAF stimulates macrophages, which in turn attack human breast cancer cells, induce their apoptosis and eventually phagocytize them. These results are consistent with the observation that macrophages infiltrated implanted tumors in mice after GcMAF injections. In addition, we hypothesize that the last 23 hydrophobic amino acids of VDR, located at the inner part of the plasma membrane, interact with the first 23 hydrophobic amino acids of the GcMAF located at the external part of the plasma membrane. This allows 1,25(OH)(2)D3 and oleic acid to become sandwiched between the two vitamin D-binding proteins, thus postulating a novel molecular mode of interaction between GcMAF and VDR. Taken together, these results support and reinforce the hypothesis that GcMAF has multiple biological activities that could be responsible for its anti-cancer effects, possibly through molecular interaction with the VDR that in turn is responsible for a multitude of non-genomic as well as genomic effects. PMID:23857228

  2. A Novel Role for a Major Component of the Vitamin D Axis: Vitamin D Binding Protein-Derived Macrophage Activating Factor Induces Human Breast Cancer Cell Apoptosis through Stimulation of Macrophages

    PubMed Central

    Thyer, Lynda; Ward, Emma; Smith, Rodney; Fiore, Maria Giulia; Magherini, Stefano; Branca, Jacopo J. V.; Morucci, Gabriele; Gulisano, Massimo; Ruggiero, Marco; Pacini, Stefania

    2013-01-01

    The role of vitamin D in maintaining health appears greater than originally thought, and the concept of the vitamin D axis underlines the complexity of the biological events controlled by biologically active vitamin D (1,25(OH)(2)D3), its two binding proteins that are the vitamin D receptor (VDR) and the vitamin D-binding protein-derived macrophage activating factor (GcMAF). In this study we demonstrate that GcMAF stimulates macrophages, which in turn attack human breast cancer cells, induce their apoptosis and eventually phagocytize them. These results are consistent with the observation that macrophages infiltrated implanted tumors in mice after GcMAF injections. In addition, we hypothesize that the last 23 hydrophobic amino acids of VDR, located at the inner part of the plasma membrane, interact with the first 23 hydrophobic amino acids of the GcMAF located at the external part of the plasma membrane. This al1ows 1,25(OH)(2)D3 and oleic acid to become sandwiched between the two vitamin D-binding proteins, thus postulating a novel molecular mode of interaction between GcMAF and VDR. Taken together, these results support and reinforce the hypothesis that GcMAF has multiple biological activities that could be responsible for its anti-cancer effects, possibly through molecular interaction with the VDR that in turn is responsible for a multitude of non-genomic as well as genomic effects. PMID:23857228

  3. The glycosylation and characterization of the candidate Gc macrophage activating factor.

    PubMed

    Ravnsborg, Tina; Olsen, Dorthe T; Thysen, Anna Hammerich; Christiansen, Maja; Houen, Gunnar; Højrup, Peter

    2010-04-01

    The vitamin D binding protein, Gc globulin, has in recent years received some attention for its role as precursor for the extremely potent macrophage activating factor (GcMAF). An O-linked trisaccharide has been allocated to the threonine residue at position 420 in two of the three most common isoforms of Gc globulin (Gc1s and Gc1f). A substitution for a lysine residue at position 420 in Gc2 prevents this isoform from being glycosylated at that position. It has been suggested that Gc globulin subjected sequentially to sialidase and galactosidase treatment generates GcMAF in the form of Gc globulin with only a single GalNAc attached to T420. In this study we confirm the location of a linear trisaccharide on T420. Furthermore, we provide the first structural evidence of the generation of the proposed GcMAF by use of glycosidase treatment and mass spectrometry. Additionally the generated GcMAF candidate was tested for its effect on cytokine release from macrophages in human whole blood. PMID:20079467

  4. FoxA2, Nkx2.2, and PDX-1 Regulate Islet β-Cell-Specific mafA Expression through Conserved Sequences Located between Base Pairs −8118 and −7750 Upstream from the Transcription Start Site

    PubMed Central

    Raum, Jeffrey C.; Gerrish, Kevin; Artner, Isabella; Henderson, Eva; Guo, Min; Sussel, Lori; Schisler, Jonathan C.; Newgard, Christopher B.; Stein, Roland

    2006-01-01

    The MafA transcription factor is both critical to islet β-cell function and has a unique pancreatic cell-type-specific expression pattern. To localize the potential transcriptional regulatory region(s) involved in directing expression to the β cell, areas of identity within the 5′ flanking region of the mouse, human, and rat mafA genes were found between nucleotides −9389 and −9194, −8426 and −8293, −8118 and −7750, −6622 and −6441, −6217 and −6031, and −250 and +56 relative to the transcription start site. The identity between species was greater than 75%, with the highest found between bp −8118 and −7750 (∼94%, termed region 3). Region 3 was the only upstream mammalian conserved region found in chicken mafA (88% identity). In addition, region 3 uniquely displayed β-cell-specific activity in cell-line-based reporter assays. Important regulators of β-cell formation and function, PDX-1, FoxA2, and Nkx2.2, were shown to specifically bind to region 3 in vivo using the chromatin immunoprecipitation assay. Mutational and functional analyses demonstrated that FoxA2 (bp −7943 to −7910), Nkx2.2 (bp −7771 to −7746), and PDX-1 (bp −8087 to −8063) mediated region 3 activation. Consistent with a role in transcription, small interfering RNA-mediated knockdown of PDX-1 led to decreased mafA mRNA production in INS-1-derived β-cell lines (832/13 and 832/3), while MafA expression was undetected in the pancreatic epithelium of Nkx2.2 null animals. These results suggest that β-cell-type-specific mafA transcription is principally controlled by region 3-acting transcription factors that are essential in the formation of functional β cells. PMID:16847327

  5. Effect of salivary gland adenocarcinoma cell-derived alpha-N-acetylgalactosaminidase on the bioactivity of macrophage activating factor.

    PubMed

    Matsuura, Takashi; Uematsu, Takashi; Yamaoka, Minoru; Furusawa, Kiyofumi

    2004-03-01

    The aim of this study was to clarify the effects of alpha-N-acetylgalactosaminidase (alpha-NaGalase) produced by human salivary gland adenocarcinoma (SGA) cells on the bioactivity of macrophage-activating factor (GcMAF). High exo-alpha-NaGalase activity was detected in the SGA cell line HSG. HSG alpha-NaGalase had both exo- and endo-enzyme activities, cleaving the Gal-GalNAc and GalNAc residues linked to Thr/Ser but not releasing the [NeuAc2-6]GalNac residue. Furthermore, GcMAF enzymatically prepared from the Gc protein enhanced the superoxide-generation capacity and phagocytic activity of monocytes/macrophages. However, GcMAF treated with purified alpha-NaGalase did not exhibit these effects. Thus, HSG possesses the capacity to produce larger quantities of alpha-NaGalase, which inactivates GcMAF produced from Gc protein, resulting in reduced phagocytic activity and superoxide-generation capacity of monocytes/macrophages. The present data strongly suggest that HSG alpha-NaGalase acts as an immunodeficiency factor in cancer patients. PMID:14767536

  6. Arsenic induces NAD(P)H-quinone oxidoreductase I by disrupting the Nrf2 x Keap1 x Cul3 complex and recruiting Nrf2 x Maf to the antioxidant response element enhancer.

    PubMed

    He, Xiaoqing; Chen, Michael G; Lin, Gary X; Ma, Qiang

    2006-08-18

    The ubiquitous toxic metalloid arsenic elicits pleiotropic adverse and adaptive responses in mammalian species. The biological targets of arsenic are largely unknown at present. We analyzed the signaling pathway for induction of detoxification gene NAD(P)H-quinone oxidoreductase (Nqo1) by arsenic. Genetic and biochemical evidence revealed that induction required cap 'n' collar basic leucine zipper transcription factor Nrf2 and the antioxidant response element (ARE) of Nqo1. Arsenic stabilized Nrf2 protein, extending the t(1/2) of Nrf2 from 21 to 200 min by inhibiting the Keap1 x Cul3-dependent ubiquitination and proteasomal turnover of Nrf2. Arsenic markedly inhibited the ubiquitination of Nrf2 but did not disrupt the Nrf2 x Keap1 x Cul3 association in the cytoplasm. In the nucleus, arsenic, but not phenolic antioxidant tert-butylhydroquinone, dissociated Nrf2 from Keap1 and Cul3 followed by dimerization of Nrf2 with a Maf protein (Maf G/Maf K). Chromatin immunoprecipitation demonstrated that Nrf2 and Maf associated with the endogenous Nqo1 ARE enhancer constitutively. Arsenic substantially increased the ARE occupancy by Nrf2 and Maf. In addition, Keap1 was shown to be ubiquitinated in the cytoplasm and deubiquitinated in the nucleus in the presence of arsenic without changing the protein level, implicating nuclear-cytoplasmic recycling of Keap1. Our data reveal that arsenic activates the Nrf2/Keap1 signaling pathway through a distinct mechanism from that by antioxidants and suggest an "on-switch" model of Nqo1 transcription in which the binding of Nrf2 x Maf to ARE controls both the basal and inducible expression of Nqo1. PMID:16785233

  7. The LSST metrics analysis framework (MAF)

    NASA Astrophysics Data System (ADS)

    Jones, R. L.; Yoachim, Peter; Chandrasekharan, Srinivasan; Connolly, Andrew J.; Cook, Kem H.; Ivezic, Željko; Krughoff, K. S.; Petry, Catherine; Ridgway, Stephen T.

    2014-07-01

    We describe the Metrics Analysis Framework (MAF), an open-source python framework developed to provide a user-friendly, customizable, easily-extensible set of tools for analyzing data sets. MAF is part of the Large Synoptic Survey Telescope (LSST) Simulations effort. Its initial goal is to provide a tool to evaluate LSST Operations Simulation (OpSim) simulated surveys to help understand the effects of telescope scheduling on survey performance, however MAF can be applied to a much wider range of datasets. The building blocks of the framework are Metrics (algorithms to analyze a given quantity of data), Slicers (subdividing the overall data set into smaller data slices as relevant for each Metric), and Database classes (to access the dataset and read data into memory). We describe how these building blocks work together, and provide an example of using MAF to evaluate different dithering strategies. We also outline how users can write their own custom Metrics and use these within the framework.

  8. The LSST Metrics Analysis Framework (MAF)

    NASA Astrophysics Data System (ADS)

    Jones, R. Lynne; Yoachim, Peter; Chandrasekharan, Srinivasan; Connolly, Andrew J.; Cook, Kem H.; Ivezic, Zeljko; Krughoff, K. Simon; Petry, Catherine E.; Ridgway, Stephen T.

    2015-01-01

    Studying potential observing strategies or cadences for the Large Synoptic Survey Telescope (LSST) is a complicated but important problem. To address this, LSST has created an Operations Simulator (OpSim) to create simulated surveys, including realistic weather and sky conditions. Analyzing the results of these simulated surveys for the wide variety of science cases to be considered for LSST is, however, difficult. We have created a Metric Analysis Framework (MAF), an open-source python framework, to be a user-friendly, customizable and easily extensible tool to help analyze the outputs of the OpSim.MAF reads the pointing history of the LSST generated by the OpSim, then enables the subdivision of these pointings based on position on the sky (RA/Dec, etc.) or the characteristics of the observations (e.g. airmass or sky brightness) and a calculation of how well these observations meet a specified science objective (or metric). An example simple metric could be the mean single visit limiting magnitude for each position in the sky; a more complex metric might be the expected astrometric precision. The output of these metrics can be generated for a full survey, for specified time intervals, or for regions of the sky, and can be easily visualized using a web interface.An important goal for MAF is to facilitate analysis of the OpSim outputs for a wide variety of science cases. A user can often write a new metric to evaluate OpSim for new science goals in less than a day once they are familiar with the framework. Some of these new metrics are illustrated in the accompanying poster, "Analyzing Simulated LSST Survey Performance With MAF".While MAF has been developed primarily for application to OpSim outputs, it can be applied to any dataset. The most obvious examples are examining pointing histories of other survey projects or telescopes, such as CFHT.

  9. Mutations Impairing GSK3-Mediated MAF Phosphorylation Cause Cataract, Deafness, Intellectual Disability, Seizures, and a Down Syndrome-like Facies

    PubMed Central

    Niceta, Marcello; Stellacci, Emilia; Gripp, Karen W.; Zampino, Giuseppe; Kousi, Maria; Anselmi, Massimiliano; Traversa, Alice; Ciolfi, Andrea; Stabley, Deborah; Bruselles, Alessandro; Caputo, Viviana; Cecchetti, Serena; Prudente, Sabrina; Fiorenza, Maria T.; Boitani, Carla; Philip, Nicole; Niyazov, Dmitriy; Leoni, Chiara; Nakane, Takaya; Keppler-Noreuil, Kim; Braddock, Stephen R.; Gillessen-Kaesbach, Gabriele; Palleschi, Antonio; Campeau, Philippe M.; Lee, Brendan H.L.; Pouponnot, Celio; Stella, Lorenzo; Bocchinfuso, Gianfranco; Katsanis, Nicholas; Sol-Church, Katia; Tartaglia, Marco

    2015-01-01

    Transcription factors operate in developmental processes to mediate inductive events and cell competence, and perturbation of their function or regulation can dramatically affect morphogenesis, organogenesis, and growth. We report that a narrow spectrum of amino-acid substitutions within the transactivation domain of the v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog (MAF), a leucine zipper-containing transcription factor of the AP1 superfamily, profoundly affect development. Seven different de novo missense mutations involving conserved residues of the four GSK3 phosphorylation motifs were identified in eight unrelated individuals. The distinctive clinical phenotype, for which we propose the eponym Aymé-Gripp syndrome, is not limited to lens and eye defects as previously reported for MAF/Maf loss of function but includes sensorineural deafness, intellectual disability, seizures, brachycephaly, distinctive flat facial appearance, skeletal anomalies, mammary gland hypoplasia, and reduced growth. Disease-causing mutations were demonstrated to impair proper MAF phosphorylation, ubiquitination and proteasomal degradation, perturbed gene expression in primary skin fibroblasts, and induced neurodevelopmental defects in an in vivo model. Our findings nosologically and clinically delineate a previously poorly understood recognizable multisystem disorder, provide evidence for MAF governing a wider range of developmental programs than previously appreciated, and describe a novel instance of protein dosage effect severely perturbing development. PMID:25865493

  10. Mutations Impairing GSK3-Mediated MAF Phosphorylation Cause Cataract, Deafness, Intellectual Disability, Seizures, and a Down Syndrome-like Facies.

    PubMed

    Niceta, Marcello; Stellacci, Emilia; Gripp, Karen W; Zampino, Giuseppe; Kousi, Maria; Anselmi, Massimiliano; Traversa, Alice; Ciolfi, Andrea; Stabley, Deborah; Bruselles, Alessandro; Caputo, Viviana; Cecchetti, Serena; Prudente, Sabrina; Fiorenza, Maria T; Boitani, Carla; Philip, Nicole; Niyazov, Dmitriy; Leoni, Chiara; Nakane, Takaya; Keppler-Noreuil, Kim; Braddock, Stephen R; Gillessen-Kaesbach, Gabriele; Palleschi, Antonio; Campeau, Philippe M; Lee, Brendan H L; Pouponnot, Celio; Stella, Lorenzo; Bocchinfuso, Gianfranco; Katsanis, Nicholas; Sol-Church, Katia; Tartaglia, Marco

    2015-05-01

    Transcription factors operate in developmental processes to mediate inductive events and cell competence, and perturbation of their function or regulation can dramatically affect morphogenesis, organogenesis, and growth. We report that a narrow spectrum of amino-acid substitutions within the transactivation domain of the v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog (MAF), a leucine zipper-containing transcription factor of the AP1 superfamily, profoundly affect development. Seven different de novo missense mutations involving conserved residues of the four GSK3 phosphorylation motifs were identified in eight unrelated individuals. The distinctive clinical phenotype, for which we propose the eponym Aymé-Gripp syndrome, is not limited to lens and eye defects as previously reported for MAF/Maf loss of function but includes sensorineural deafness, intellectual disability, seizures, brachycephaly, distinctive flat facial appearance, skeletal anomalies, mammary gland hypoplasia, and reduced growth. Disease-causing mutations were demonstrated to impair proper MAF phosphorylation, ubiquitination and proteasomal degradation, perturbed gene expression in primary skin fibroblasts, and induced neurodevelopmental defects in an in vivo model. Our findings nosologically and clinically delineate a previously poorly understood recognizable multisystem disorder, provide evidence for MAF governing a wider range of developmental programs than previously appreciated, and describe a novel instance of protein dosage effect severely perturbing development. PMID:25865493

  11. Structural definition of a potent macrophage activating factor derived from vitamin D3-binding protein with adjuvant activity for antibody production.

    PubMed

    Yamamoto, N

    1996-10-01

    Incubation of human vitamin D3-binding protein (Gc protein), with a mixture of immobilized beta-galactosidase and sialidase, efficiently generated a potent macrophage activating factor, a protein with N-acetylgalactosamine as the remaining sugar. Stepwise incubation of Gc protein with immobilized beta-galactosidase and sialidase, and isolation of the intermediates with immobilized lectins, revealed that either sequence of hydrolysis of Gc glycoprotein by these glycosidases yields the macrophage-activating factor, implying that Gc protein carries a trisaccharide composed of N-acetylgalactosamine and dibranched galactose and sialic acid termini. A 3 hr incubation of mouse peritoneal macrophages with picomolar amounts of the enzymatically generated macrophage-activating factor (GcMAF) resulted in a greatly enhanced phagocytic activity. Administration of a minute amount (10-50 pg/mouse) of GcMAF resulted in a seven- to nine-fold enhanced phagocytic activity of macrophages. Injection of sheep red blood cells (SRBC) along with GcMAF into mice produced a large number of anti-SRBC antibody secreting splenic cells in 2-4 days. PMID:9070663

  12. Transcriptional stimulation of the retina-specific QR1 gene upon growth arrest involves a Maf-related protein.

    PubMed Central

    Pouponnot, C; Nishizawa, M; Calothy, G; Pierani, A

    1995-01-01

    The avian neural retina (NR) is derived from proliferating neuroectodermal precursors which differentiate after terminal mitosis and become organized in cell strata. Proliferation of postmitotic NR cells can be induced by infection with Rous sarcoma virus (RSV) and requires the expression of a functional v-Src protein. QR1 is a retina-specific gene expressed exclusively at the stage of growth arrest and differentiation during retinal development. In NR cells infected with tsPA101, an RSV mutant conditionally defective in pp60v-src mitogenic capacity, QR1 expression is downregulated in proliferating cells at 37 degrees C and is fully restored when the cells become quiescent as a result of pp60v-src inactivation at 41 degrees C. We were able to arrest proliferation of tsPA101-infected quail NR cells expressing an active v-Src protein by serum starvation at 37 degrees C. This allowed us to investigate the role of cell growth in regulating QR1 transcription. We report that QR1 transcription is stimulated in growth-arrested cells at 37 degrees C compared with that in proliferating cells maintained at the same temperature. Growth arrest-dependent stimulation of QR1 transcription requires the integrity of the A box, a previously characterized cis-acting element responsible for QR1 transcriptional stimulation upon v-Src inactivation and during retinal differentiation. We also show that formation of the C1 complex on the A box is increased upon growth arrest by serum starvation in the presence of an active v-Src oncoprotein. Thus, the C1 complex represents an important link between cell cycle and developmental control of QR1 gene transcription during NR differentiation and RSV infection. By using antibodies directed against different Maf proteins of the leucine zipper family and competition with Maf consensus site-containing oligonucleotides in a gel shift assay, we show that the C1 complex is likely to contain a Maf-related protein. We also show that a purified bacterially

  13. Cooperation between HMGA1, PDX-1, and MafA is Essential for Glucose-Induced Insulin Transcription in Pancreatic Beta Cells

    PubMed Central

    Arcidiacono, Biagio; Iiritano, Stefania; Chiefari, Eusebio; Brunetti, Francesco S.; Gu, Guoqiang; Foti, Daniela Patrizia; Brunetti, Antonio

    2014-01-01

    The high-mobility group AT-hook 1 (HMGA1) protein is a nuclear architectural factor that can organize chromatin structures. It regulates gene expression by controlling the formation of stereospecific multiprotein complexes called “enhanceosomes” on the AT-rich regions of target gene promoters. Previously, we reported that defects in HMGA1 caused decreased insulin receptor expression and increased susceptibility to type 2 diabetes mellitus in humans and mice. Interestingly, mice with disrupted HMGA1 gene had significantly smaller islets and decreased insulin content in their pancreata, suggesting that HMGA1 may have a direct role in insulin transcription and secretion. Herein, we investigate the regulatory roles of HMGA1 in insulin transcription. We provide evidence that HMGA1 physically interacts with PDX-1 and MafA, two critical transcription factors for insulin gene expression and beta-cell function, both in vitro and in vivo. We then show that the overexpression of HMGA1 significantly improves the transactivating activity of PDX-1 and MafA on human and mouse insulin promoters, while HMGA1 knockdown considerably decreased this transactivating activity. Lastly, we demonstrate that high glucose stimulus significantly increases the binding of HMGA1 to the insulin (INS) gene promoter, suggesting that HMGA1 may act as a glucose-sensitive element controlling the transcription of the INS gene. Together, our findings provide evidence that HMGA1, by regulating PDX-1- and MafA-induced transactivation of the INS gene promoter, plays a critical role in pancreatic beta-cell function and insulin production. PMID:25628604

  14. Rapid separation of non-polar and weakly polar analytes with metal-organic framework MAF-5 coated capillary column.

    PubMed

    Tian, Jingyu; Lu, Cuiming; He, Chun-Ting; Lu, Tong-Bu; Ouyang, Gangfeng

    2016-05-15

    Metal-organic frameworks (MOFs) have attracted widespread attention due to their unique characters such as high surface area, high thermal and chemical stability, diverse structure topology and tunable pore size. The study first exploited a porous metal organic framework MAF-5 ([Zn[(eim)2], Heim=2-ethylimidazole) as stationary phase for gas chromatography by a novel dynamic coating method. The column efficiency of the 184 silicone@MAF-5 capillary column was up to 9045 platesm(-1) for benzene. The column is very promising for the rapid separation of polycyclic aromatic hydrocarbons (PAHs) and organochlorine pesticides (OCPs). And the column showed good reproducibility, retention time, peak area, high resolution, and a wide linear range. The determined thermodynamic parameters and chromatographic retention of all probe molecules on the 184 silicone@MAF-5 column showed the separation of analytes is a complex balance of thermodynamic and kinetic factors. PMID:26992522

  15. MAFCO: A Compression Tool for MAF Files

    PubMed Central

    Matos, Luís M. O.; Neves, António J. R.; Pratas, Diogo; Pinho, Armando J.

    2015-01-01

    In the last decade, the cost of genomic sequencing has been decreasing so much that researchers all over the world accumulate huge amounts of data for present and future use. These genomic data need to be efficiently stored, because storage cost is not decreasing as fast as the cost of sequencing. In order to overcome this problem, the most popular general-purpose compression tool, gzip, is usually used. However, these tools were not specifically designed to compress this kind of data, and often fall short when the intention is to reduce the data size as much as possible. There are several compression algorithms available, even for genomic data, but very few have been designed to deal with Whole Genome Alignments, containing alignments between entire genomes of several species. In this paper, we present a lossless compression tool, MAFCO, specifically designed to compress MAF (Multiple Alignment Format) files. Compared to gzip, the proposed tool attains a compression gain from 34% to 57%, depending on the data set. When compared to a recent dedicated method, which is not compatible with some data sets, the compression gain of MAFCO is about 9%. Both source-code and binaries for several operating systems are freely available for non-commercial use at: http://bioinformatics.ua.pt/software/mafco. PMID:25816229

  16. A defect in the inflammation-primed macrophage-activation cascade in osteopetrotic rats.

    PubMed

    Yamamoto, N; Lindsay, D D; Naraparaju, V R; Ireland, R A; Popoff, S N

    1994-05-15

    Macrophages were activated by administration of lysophosphatidylcholine (lyso-Pc) or dodecylglycerol (DDG) to wild-type rats but not in osteopetrotic (op) mutant rats. In vitro treatment of wild-type rat peritoneal cells with lyso-Pc or DDG efficiently activated macrophages whereas treatment of op mutant rat peritoneal cells with lyso-Pc or DDG did not activate macrophages. The inflammation-primed macrophage activation cascade in rats requires participation of B lymphocytes and vitamin D binding protein (DBP). Lyso-Pc-inducible beta-galactosidase of wild-type rat B lymphocytes can convert DBP to the macrophage-activating factor (MAF), whereas B lymphocytes of the op mutant rats were shown to be deficient in lyso-Pc-inducible beta-galactosidase. DBP is conserved among mammalian species. Treatment of human DBP (Gc1 protein) with commercial glycosidases yields an extremely high titrated MAF as assayed on mouse and rat macrophages. Because the enzymatically generated MAF (GcMAF) bypasses the role of lymphocytes in macrophage activation, the op mutant rat macrophages were efficiently activated by administration of a small quantity (100 pg/rat) of GcMAF. Likewise, in vitro treatment of op rat peritoneal cells with as little as 40 pg GcMAF/ml activated macrophages. PMID:8176226

  17. Stress resistance and lifespan are increased in C. elegans but decreased in S. cerevisiae by mafr-1/maf1 deletion

    PubMed Central

    Cai, Ying; Wei, Yue-Hua

    2016-01-01

    Maf1 is a conserved effector of the mechanistic target of rapamycin (mTOR), an aging promoting kinase. However, whether Maf1 is required for lifespan extension caused by mTOR inhibition, such as dietary restriction (DR) or calorie restriction (CR) remains elusive. Here we show that deletion of maf1 in the budding yeast S. cerevisiae but not mafr-1 in C. elegans prevents DR or CR to extend lifespan. Interestingly, mafr-1 deletion increases stress tolerance and extends lifespan. MAFR-1 is phosphorylated in a mTOR-dependent manner and mafr-1 deletion alleviates the inhibition of tRNA synthesis caused by reduced mTOR activity. We find that the opposite effect of mafr-1 deletion on lifespan is due to an enhancement of stress response, including oxidative stress response, mitochondrial unfolded protein response (UPRmt) and autophagy. mafr-1 deletion also attenuates the paralysis of a C. elegans model of Alzheimer's disease. Our study reveals distinct mechanisms of lifespan regulation by Maf1 and MAFR-1. PMID:26934328

  18. Psychometric evaluation of the Arabic version of the multidimensional assessment of fatigue scale (MAF) for use in patients with ankylosing spondylitis.

    PubMed

    Bahouq, Hanane; Rostom, Samira; Bahiri, Rachid; Hakkou, Jinane; Aissaoui, Nawal; Hajjaj-Hassouni, Najia

    2012-12-01

    Fatigue is a frequent symptom during ankylosing spondylitis (AS) often under estimated which needs to be measured properly with respect to its intensity by appropriate measures, such as the multidimensional assessment of fatigue (MAF). The aims of this study were to translate into the classic Arabic version of the MAF questionnaire and to validate its use for assessing fatigue in Moroccan patients with AS. The MAF contains 16 items with a global fatigue index (IGF). The MAF was translated and back-translated to arabic, pretested and reviewed by a committee following the Guillemin criteria (J Clin Epidemiol 46:1417-1432, 1993). It was then validate on 110 Moroccan patients with AS. Reliability for the 3-day test-retest was assessed using internal consistency by Cronbach's alpha coefficient and the intra-class correlation coefficient (ICC). External construct validity was assessed by correlation with pain, activity of disease and other keys variable. The reproducibility of the 15 items was satisfactory with a kappa statistics of agreement superior to 0.6. The ICC for IGF score reproducibility was good and reached 0.98 (IC 95%, 0.96-0.99). The internal consistency was at 0.991 with Cronbach's alpha coefficient. The construct validity showed a positive correlation between MAF and the axial (r = 0.34) and peripheral (r = 0.32) visual analogical scale, the Bath ankylosing spondylitis disease activity index (BASDAI) (r = 0.77), the first item of BASDAI (r = 0.85), the functional disability by the Bath ankylosing spondylitis functional index (r = 0.64), the erythrocyte sedimentation rate (r = 0.43) and the C reactive protein (r = 0.30) (for all P < 0.001). There was no statistical correlation between MAF and the other variables. The Arabic version of the MAF has good comprehensibility, internal consistency, reliability and validity for the evaluation of Arabic speaking patients with AS. PMID:22205382

  19. mTOR associates with TFIIIC, is found at tRNA and 5S rRNA genes, and targets their repressor Maf1.

    PubMed

    Kantidakis, Theodoros; Ramsbottom, Ben A; Birch, Joanna L; Dowding, Sarah N; White, Robert J

    2010-06-29

    Synthesis of tRNA and 5S rRNA by RNA polymerase (pol) III is regulated by the mTOR pathway in mammalian cells. The mTOR kinase localizes to tRNA and 5S rRNA genes, providing an opportunity for direct control. Its presence at these sites can be explained by interaction with TFIIIC, a DNA-binding factor that recognizes the promoters of these genes. TFIIIC contains a TOR signaling motif that facilitates its association with mTOR. Maf1, a repressor that binds and inhibits pol III, is phosphorylated in a mTOR-dependent manner both in vitro and in vivo at serine 75, a site that contributes to its function as a transcriptional inhibitor. Proximity ligation assays confirm the interaction of mTOR with Maf1 and TFIIIC in nuclei. In contrast to Maf1 regulation in yeast, no evidence is found for nuclear export of Maf1 in response to mTOR signaling in HeLa cells. We conclude that mTOR associates with TFIIIC, is recruited to pol III-transcribed genes, and relieves their repression by Maf1. PMID:20543138

  20. Factors regulating microglia activation

    PubMed Central

    Kierdorf, Katrin; Prinz, Marco

    2013-01-01

    Microglia are resident macrophages of the central nervous system (CNS) that display high functional similarities to other tissue macrophages. However, it is especially important to create and maintain an intact tissue homeostasis to support the neuronal cells, which are very sensitive even to minor changes in their environment. The transition from the “resting” but surveying microglial phenotype to an activated stage is tightly regulated by several intrinsic (e.g., Runx-1, Irf8, and Pu.1) and extrinsic factors (e.g., CD200, CX3CR1, and TREM2). Under physiological conditions, minor changes of those factors are sufficient to cause fatal dysregulation of microglial cell homeostasis and result in severe CNS pathologies. In this review, we discuss recent achievements that gave new insights into mechanisms that ensure microglia quiescence. PMID:23630462

  1. Evaluation of the microangiographic fluoroscope (MAF) using generalized system performance metrics

    PubMed Central

    Jain, Amit; Bednarek, Daniel R.; Rudin, Stephen

    2013-01-01

    detectors. This generalized analysis demonstrated that both detectors have similar imaging capabilities at lower spatial frequencies, but that the MAF has superior performance over the FPD at higher frequencies even when considering focal spot blurring and scatter. Conclusions: This generalized performance analysis demonstrates the significance of focal spot size, magnification, and scatter on the system performance metrics (GMTF, GNNPS, and GDQE). Although the ideal detector performance characteristics of the MAF are not fully realized due to these other system factors, it still retains an advantage in DQE at high spatial frequencies over the FPD. Similar studies based on the generalized linear system metrics can serve as an efficient tool to evaluate total system capabilities under different realistic conditions to enable optimal design for specific imaging tasks. PMID:23464330

  2. Evaluation of the microangiographic fluoroscope (MAF) using generalized system performance metrics

    SciTech Connect

    Jain, Amit; Bednarek, Daniel R.; Rudin, Stephen

    2013-03-15

    for both detectors. This generalized analysis demonstrated that both detectors have similar imaging capabilities at lower spatial frequencies, but that the MAF has superior performance over the FPD at higher frequencies even when considering focal spot blurring and scatter. Conclusions: This generalized performance analysis demonstrates the significance of focal spot size, magnification, and scatter on the system performance metrics (GMTF, GNNPS, and GDQE). Although the ideal detector performance characteristics of the MAF are not fully realized due to these other system factors, it still retains an advantage in DQE at high spatial frequencies over the FPD. Similar studies based on the generalized linear system metrics can serve as an efficient tool to evaluate total system capabilities under different realistic conditions to enable optimal design for specific imaging tasks.

  3. MafB deficiency accelerates the development of obesity in mice.

    PubMed

    Tran, Mai Thi Nhu; Hamada, Michito; Nakamura, Megumi; Jeon, Hyojung; Kamei, Risa; Tsunakawa, Yuki; Kulathunga, Kaushalya; Lin, Yuan-Yu; Fujisawa, Kumiko; Kudo, Takashi; Takahashi, Satoru

    2016-06-01

    MafB, a transcription factor expressed selectively in macrophages, has important roles in some macrophage-related diseases, especially in atherosclerosis. In this study, we investigated the mechanism by which hematopoietic-specific MafB deficiency induces the development of obesity. Wild-type and hematopoietic cell-specific Mafb-deficient mice were fed a high-fat diet for 10 weeks. The Mafb-deficient mice exhibited higher body weights and faster rates of body weight increase than control mice. The Mafb-deficient mice also had a higher percentage of body fat than the wild-type mice, due to increased adipocyte size and serum cholesterol levels. Reverse transcription-PCR analysis showed a reduction in apoptosis inhibitor of macrophage (AIM) in Mafb-deficient adipose tissue. AIM is known as an inhibitor of lipogenesis in adipocytes and is expressed in adipose tissue macrophages. Collectively, our data suggest that Mafb deficiency in hematopoietic cells accelerates the development of obesity. PMID:27419056

  4. Coagulant Activity of Leukocytes. TISSUE FACTOR ACTIVITY

    PubMed Central

    Niemetz, J.

    1972-01-01

    Peritoneal leukocytes harvested from rabbits which have received two spaced doses of endotoxin have significantly greater (10-fold) coagulant activity than leukocytes from control rabbits. The coagulant activity accelerates the clotting of normal plasma and activates factor X in the presence of factor VII and calcium and is therefore regarded as tissue factor. A total of 40-80 mg tissue factor activity was obtained from the peritoneal cavity of single endotoxin-treated rabbits. In leukocyte subcellular fractions, separated by centrifugation, the specific tissue factor activity sedimented mainly at 14,500 g and above. The procoagulant activity was destroyed after heating for 10 min at 65°C but was preserved at lower temperatures. Polymyxin B, when given with the first dose of endotoxin, reduced both the number of peritoneal leukocytes and their tissue factor activity by two-thirds. When given immediately before the second dose of endotoxin, polymyxin B had no inhibitory effect. PMID:4333021

  5. c-Maf regulates pluripotency genes, proliferation/self-renewal, and lineage commitment in ROS-mediated senescence of human mesenchymal stem cells

    PubMed Central

    Li, Nan-Ting; Wu, Yao-Ming; Lin, Ming-Tsan; Hung, Shih-Chieh; Yen, Men-Luh

    2015-01-01

    Mesenchymal stem cells (MSCs) are therapeutically relevant multilineage and immunomodulatory progenitors. Ex vivo expansion of these rare cells is necessary for clinical application and can result in detrimental senescent effects, with mechanisms still largely unknown. We found that vigorous ex vivo expansion of human adipose tissue-derived MSCs (hAMSCs) results in proliferative decline, cell cycle arrest, and altered differentiation capacity. This senescent phenotype was associated with reactive oxygen species (ROS) accumulation, and with increased expression of G1 cell -cycle inhibitors— p15INK4b and p16INK4a — but decreased expression of pluripotency genes—Oct-4, Sox-2, Nanog, and c-Myc—as well as c-Maf a co-factor of MSC lineage-specific transcription factor and sensitive to oxidative stress. These global changes in the transcriptional and functional programs of proliferation, differentiation, and self-renewal were all mediated by ROS-induced suppression of c-Maf, as evidenced by binding of c-Maf to promoter regions of multiple relevant genes in hAMSCs which could be reduced by exogenous ROS. Our findings implicate the strong effects of ROS on multiple stem cell functions with a central role for c-Maf in stem cell senescence. PMID:26496036

  6. Glycan structure of Gc Protein-derived Macrophage Activating Factor as revealed by mass spectrometry.

    PubMed

    Borges, Chad R; Rehder, Douglas S

    2016-09-15

    Disagreement exists regarding the O-glycan structure attached to human vitamin D binding protein (DBP). Previously reported evidence indicated that the O-glycan of the Gc1S allele product is the linear core 1 NeuNAc-Gal-GalNAc-Thr trisaccharide. Here, glycan structural evidence is provided from glycan linkage analysis and over 30 serial glycosidase-digestion experiments which were followed by analysis of the intact protein by electrospray ionization mass spectrometry (ESI-MS). Results demonstrate that the O-glycan from the Gc1F protein is the same linear trisaccharide found on the Gc1S protein and that the hexose residue is galactose. In addition, the putative anti-cancer derivative of DBP known as Gc Protein-derived Macrophage Activating Factor (GcMAF, which is formed by the combined action of β-galactosidase and neuraminidase upon DBP) was analyzed intact by ESI-MS, revealing that the activating E. coli β-galactosidase cleaves nothing from the protein-leaving the glycan structure of active GcMAF as a Gal-GalNAc-Thr disaccharide, regardless of the order in which β-galactosidase and neuraminidase are applied. Moreover, glycosidase digestion results show that α-N-Acetylgalactosamindase (nagalase) lacks endoglycosidic function and only cleaves the DBP O-glycan once it has been trimmed down to a GalNAc-Thr monosaccharide-precluding the possibility of this enzyme removing the O-glycan trisaccharide from cancer-patient DBP in vivo. PMID:27503803

  7. C-MAF oncogene dysregulation in multiple myeloma: frequency and biological relevance.

    PubMed

    Rasmussen, Thomas; Knudsen, Lene Meldgaard; Dahl, Inger Marie S; Johnsen, Hans Erik

    2003-10-01

    To investigate the frequency and possible biological consequences of c-maf dysregulation, we designed c-maf and IL-4 real-time RT-PCR assays for determination of c-maf and IL-4 mRNA levels. Using the c-maf real-time RT-PCR assay, we tested a panel of 14 B-cell lines, 135 diagnostic bone marrow (BM) samples from patients with multiple myeloma and 10 BM samples from normal donors. In B cell lines and flowsorted CD38++/CD19-/CD56++ myeloma plasma cells (N = 14) the c-maf/GAPDH and IL-4/GAPDH ratios were determined simultaneously using real time RT-PCR. All B cell lines used in the study were characterized by flow cytometry and tested for the presence of Ebstein-Barr virus (EBV). B-cell lines, that were PCR negative for EBV and had a phenotype typical for primary myeloma cells, expressed medium to high levels of c-maf mRNA. However, all EBV PCR positive cell lines, showed a more immature phenotype, lacked expression of aberrant surface markers and contained very low levels of c-maf mRNA. In 4.4% (6/135) of MM patients tested, a c-maf mRNA level comparable to the cell line RPMI 8226 containing at (16:22), translocation was found. In addition, all c-maf positive myeloma cell lines and CD38++/CD19-/CD56++ myeloma plasma cells tested were IL-4 negative. In conclusion, high levels of c-maf mRNA were observed in "true MM cell lines" and 4.4% of MM patients. Further, c-maf dysregulation in myeloma plasma cells did not cause induction of IL-4 transcription. PMID:14692531

  8. Lysis of herpesvirus-infected cells by macrophages activated with free or liposome-encapsulated lymphokine produced by a murine T cell hybridoma.

    PubMed Central

    Koff, W C; Showalter, S D; Seniff, D A; Hampar, B

    1983-01-01

    Thioglycolate-induced mouse peritoneal macrophages were activated in vitro by the lymphokine designated macrophage-activating factor (MAF) produced by a murine T cell hybridoma to lyse herpes simplex virus type 2 (HSV-2)-infected murine target cells. Comparison of uninfected BALB/c 10E2 cells with HSV-2-infected 10E2 cells showed that macrophages activated with MAF selectively destroyed HSV-2-infected cells and left uninfected cells unharmed, as measured by an 18-h 51Cr-release assay. In contrast, macrophages treated with medium were as efficient as MAF-activated macrophages in suppressing the production of HSV-2 from virus-infected cells. These findings suggest that macrophages must attain an activated state to lyse HSV-2-infected cells. Finally, incubation of macrophages with liposomes containing MAF was shown to be a highly efficient method for activation of macrophages against HSV-2 infected cells. The ability to selectively destroy herpesvirus-infected cells in vitro by macrophages activated with liposome-encapsulated MAF suggests that the therapeutic efficacy of this treatment in vivo should be evaluated. PMID:6358037

  9. Maf1 protein, repressor of RNA polymerase III, indirectly affects tRNA processing.

    PubMed

    Karkusiewicz, Iwona; Turowski, Tomasz W; Graczyk, Damian; Towpik, Joanna; Dhungel, Nripesh; Hopper, Anita K; Boguta, Magdalena

    2011-11-11

    Maf1 is negative regulator of RNA polymerase III in yeast. We observed high levels of both primary transcript and end-matured, intron-containing pre-tRNAs in the maf1Δ strain. This pre-tRNA accumulation could be overcome by transcription inhibition, arguing against a direct role of Maf1 in tRNA maturation and suggesting saturation of processing machinery by the increased amounts of primary transcripts. Saturation of the tRNA exportin, Los1, is one reason why end-matured intron-containing pre-tRNAs accumulate in maf1Δ cells. However, it is likely possible that other components of the processing pathway are also limiting when tRNA transcription is increased. According to our model, Maf1-mediated transcription control and nuclear export by Los1 are two major stages of tRNA biosynthesis that are regulated by environmental conditions in a coordinated manner. PMID:21940626

  10. Maf1 Protein, Repressor of RNA Polymerase III, Indirectly Affects tRNA Processing*

    PubMed Central

    Karkusiewicz, Iwona; Turowski, Tomasz W.; Graczyk, Damian; Towpik, Joanna; Dhungel, Nripesh; Hopper, Anita K.; Boguta, Magdalena

    2011-01-01

    Maf1 is negative regulator of RNA polymerase III in yeast. We observed high levels of both primary transcript and end-matured, intron-containing pre-tRNAs in the maf1Δ strain. This pre-tRNA accumulation could be overcome by transcription inhibition, arguing against a direct role of Maf1 in tRNA maturation and suggesting saturation of processing machinery by the increased amounts of primary transcripts. Saturation of the tRNA exportin, Los1, is one reason why end-matured intron-containing pre-tRNAs accumulate in maf1Δ cells. However, it is likely possible that other components of the processing pathway are also limiting when tRNA transcription is increased. According to our model, Maf1-mediated transcription control and nuclear export by Los1 are two major stages of tRNA biosynthesis that are regulated by environmental conditions in a coordinated manner. PMID:21940626

  11. The AT-hook/PPC domain protein TEK negatively regulates floral repressors including MAF4 and MAF5

    PubMed Central

    Xu, Yifeng; Gan, Eng-Seng; Ito, Toshiro

    2013-01-01

    Epigenetic regulations of transposable elements (TEs) and TE-like repeat sequences help to protect genomic integrity and control various developmental processes, including flowering time. This complex action of gene silencing requires the coordination of many key players including DNA methylases, histone deacetylases and histone methyltranferases. We have recently reported that an AT-hook DNA binding protein, TRANSPOSABLE ELEMENT SILENCING VIA AT-HOOK (TEK), participates in silencing TEs and TE-like sequence containing genes, such as LerFLOWERING LOCUS C (FLC) and FWA. TEK knockdown in amiTEK plants causes increased histone acetylation, reduced H3K9me2 and DNA hypomethylation in the target loci, which ultimately leads to the upregulation of FLC and FWA as well as TE reactivation. In this report, we show that, besides FLC, other FLC-like genes MADS AFFECTING FLOWERING 4 (MAF4) and MAF5 are also upregulated in amiTEK. Here we discuss the role of the nuclear matrix protein TEK in the maintenance of genome integrity and in the control of flowering. PMID:23733063

  12. Macrophage activation by OM-85 BV.

    PubMed

    Mauël, J

    1992-01-01

    Peritoneal or bone-marrow-derived murine macrophages were exposed for 24 h in vitro to dilutions of the bacterial extract OM-85 BV, in the presence or absence of other added compounds [macrophage-activating factor (MAF), recombinant murine interferon-gamma (IFN-gamma)]. Various metabolic responses and functional activities were then measured. Glucose oxidation through the hexose monophosphate shunt pathway was markedly stimulated in OM-85 BV-treated macrophages compared to control macrophages. Similarly, OM-85 BV primed macrophages for superoxide production upon triggering by phorbol myristate acetate. Both effects were further enhanced by simultaneous treatment of the cells with MAF with OM-85 BV. The bacterial extract also induced macrophages to release large amounts of nitrite (a marker of the activated state). As regards functional responses, coincubation with MAF and OM-85 BV activated macrophages to destroy target cells as well as intracellular microorganisms; in the latter case, similar results were obtained when MAF was replaced by IFN-gamma. In all these tests, the possibility that the observed effects were due to contamination of the bacterial extracts by endotoxin could be excluded. The above results indicate that OM-85 BV induces metabolic and functional properties in macrophages that are characteristic of the activated state and are important for host defence. PMID:1332156

  13. Loss of the RNA polymerase III repressor MAF1 confers obesity resistance

    PubMed Central

    Bonhoure, Nicolas; Byrnes, Ashlee; Moir, Robyn D.; Hodroj, Wassim; Preitner, Frédéric; Praz, Viviane; Marcelin, Genevieve; Chua, Streamson C.; Martinez-Lopez, Nuria; Singh, Rajat; Moullan, Norman; Auwerx, Johan; Willemin, Gilles; Shah, Hardik; Hartil, Kirsten; Vaitheesvaran, Bhavapriya; Kurland, Irwin

    2015-01-01

    MAF1 is a global repressor of RNA polymerase III transcription that regulates the expression of highly abundant noncoding RNAs in response to nutrient availability and cellular stress. Thus, MAF1 function is thought to be important for metabolic economy. Here we show that a whole-body knockout of Maf1 in mice confers resistance to diet-induced obesity and nonalcoholic fatty liver disease by reducing food intake and increasing metabolic inefficiency. Energy expenditure in Maf1−/− mice is increased by several mechanisms. Precursor tRNA synthesis was increased in multiple tissues without significant effects on mature tRNA levels, implying increased turnover in a futile tRNA cycle. Elevated futile cycling of hepatic lipids was also observed. Metabolite profiling of the liver and skeletal muscle revealed elevated levels of many amino acids and spermidine, which links the induction of autophagy in Maf1−/− mice with their extended life span. The increase in spermidine was accompanied by reduced levels of nicotinamide N-methyltransferase, which promotes polyamine synthesis, enables nicotinamide salvage to regenerate NAD+, and is associated with obesity resistance. Consistent with this, NAD+ levels were increased in muscle. The importance of MAF1 for metabolic economy reveals the potential for MAF1 modulators to protect against obesity and its harmful consequences. PMID:25934505

  14. Loss of the RNA polymerase III repressor MAF1 confers obesity resistance.

    PubMed

    Bonhoure, Nicolas; Byrnes, Ashlee; Moir, Robyn D; Hodroj, Wassim; Preitner, Frédéric; Praz, Viviane; Marcelin, Genevieve; Chua, Streamson C; Martinez-Lopez, Nuria; Singh, Rajat; Moullan, Norman; Auwerx, Johan; Willemin, Gilles; Shah, Hardik; Hartil, Kirsten; Vaitheesvaran, Bhavapriya; Kurland, Irwin; Hernandez, Nouria; Willis, Ian M

    2015-05-01

    MAF1 is a global repressor of RNA polymerase III transcription that regulates the expression of highly abundant noncoding RNAs in response to nutrient availability and cellular stress. Thus, MAF1 function is thought to be important for metabolic economy. Here we show that a whole-body knockout of Maf1 in mice confers resistance to diet-induced obesity and nonalcoholic fatty liver disease by reducing food intake and increasing metabolic inefficiency. Energy expenditure in Maf1(-/-) mice is increased by several mechanisms. Precursor tRNA synthesis was increased in multiple tissues without significant effects on mature tRNA levels, implying increased turnover in a futile tRNA cycle. Elevated futile cycling of hepatic lipids was also observed. Metabolite profiling of the liver and skeletal muscle revealed elevated levels of many amino acids and spermidine, which links the induction of autophagy in Maf1(-/-) mice with their extended life span. The increase in spermidine was accompanied by reduced levels of nicotinamide N-methyltransferase, which promotes polyamine synthesis, enables nicotinamide salvage to regenerate NAD(+), and is associated with obesity resistance. Consistent with this, NAD(+) levels were increased in muscle. The importance of MAF1 for metabolic economy reveals the potential for MAF1 modulators to protect against obesity and its harmful consequences. PMID:25934505

  15. Cooperative activation of Xenopus rhodopsin transcription by paired-like transcription factors

    PubMed Central

    2014-01-01

    Background In vertebrates, rod photoreceptor-specific gene expression is regulated by the large Maf and Pax-like transcription factors, Nrl/LNrl and Crx/Otx5. The ubiquitous occurrence of their target DNA binding sites throughout rod-specific gene promoters suggests that multiple transcription factor interactions within the promoter are functionally important. Cooperative action by these transcription factors activates rod-specific genes such as rhodopsin. However, a quantitative mechanistic explanation of transcriptional rate determinants is lacking. Results We investigated the contributions of various paired-like transcription factors and their cognate cis-elements to rhodopsin gene activation using cultured cells to quantify activity. The Xenopus rhodopsin promoter (XOP) has a bipartite structure, with ~200 bp proximal to the start site (RPP) coordinating cooperative activation by Nrl/LNrl-Crx/Otx5 and the adjacent 5300 bp upstream sequence increasing the overall expression level. The synergistic activation by Nrl/LNrl-Crx/Otx5 also occurred when XOP was stably integrated into the genome. We determined that Crx/Otx5 synergistically activated transcription independently and additively through the two Pax-like cis-elements, BAT1 and Ret4, but not through Ret1. Other Pax-like family members, Rax1 and Rax2, do not synergistically activate XOP transcription with Nrl/LNrl and/or Crx/Otx5; rather they act as co-activators via the Ret1 cis-element. Conclusions We have provided a quantitative model of cooperative transcriptional activation of the rhodopsin promoter through interaction of Crx/Otx5 with Nrl/LNrl at two paired-like cis-elements proximal to the NRE and TATA binding site. Further, we have shown that Rax genes act in cooperation with Crx/Otx5 with Nrl/LNrl as co-activators of rhodopsin transcription. PMID:24499263

  16. Global Regulation of Gene Expression by the MafR Protein of Enterococcus faecalis.

    PubMed

    Ruiz-Cruz, Sofía; Espinosa, Manuel; Goldmann, Oliver; Bravo, Alicia

    2015-01-01

    Enterococcus faecalis is a natural inhabitant of the human gastrointestinal tract. However, as an opportunistic pathogen, it is able to colonize other host niches and cause life-threatening infections. Its adaptation to new environments involves global changes in gene expression. The EF3013 gene (here named mafR) of E. faecalis strain V583 encodes a protein (MafR, 482 residues) that has sequence similarity to global response regulators of the Mga/AtxA family. The enterococcal OG1RF genome also encodes the MafR protein (gene OG1RF_12293). In this work, we have identified the promoter of the mafR gene using several in vivo approaches. Moreover, we show that MafR influences positively the transcription of many genes on a genome-wide scale. The most significant target genes encode components of PTS-type membrane transporters, components of ABC-type membrane transporters, and proteins involved in the metabolism of carbon sources. Some of these genes were previously reported to be up-regulated during the growth of E. faecalis in blood and/or in human urine. Furthermore, we show that a mafR deletion mutant strain induces a significant lower degree of inflammation in the peritoneal cavity of mice, suggesting that enterococcal cells deficient in MafR are less virulent. Our work indicates that MafR is a global transcriptional regulator. It might facilitate the adaptation of E. faecalis to particular host niches and, therefore, contribute to its potential virulence. PMID:26793169

  17. Global Regulation of Gene Expression by the MafR Protein of Enterococcus faecalis

    PubMed Central

    Ruiz-Cruz, Sofía; Espinosa, Manuel; Goldmann, Oliver; Bravo, Alicia

    2016-01-01

    Enterococcus faecalis is a natural inhabitant of the human gastrointestinal tract. However, as an opportunistic pathogen, it is able to colonize other host niches and cause life-threatening infections. Its adaptation to new environments involves global changes in gene expression. The EF3013 gene (here named mafR) of E. faecalis strain V583 encodes a protein (MafR, 482 residues) that has sequence similarity to global response regulators of the Mga/AtxA family. The enterococcal OG1RF genome also encodes the MafR protein (gene OG1RF_12293). In this work, we have identified the promoter of the mafR gene using several in vivo approaches. Moreover, we show that MafR influences positively the transcription of many genes on a genome-wide scale. The most significant target genes encode components of PTS-type membrane transporters, components of ABC-type membrane transporters, and proteins involved in the metabolism of carbon sources. Some of these genes were previously reported to be up-regulated during the growth of E. faecalis in blood and/or in human urine. Furthermore, we show that a mafR deletion mutant strain induces a significant lower degree of inflammation in the peritoneal cavity of mice, suggesting that enterococcal cells deficient in MafR are less virulent. Our work indicates that MafR is a global transcriptional regulator. It might facilitate the adaptation of E. faecalis to particular host niches and, therefore, contribute to its potential virulence. PMID:26793169

  18. Gestational Diabetes Mellitus From Inactivation of Prolactin Receptor and MafB in Islet β-Cells.

    PubMed

    Banerjee, Ronadip R; Cyphert, Holly A; Walker, Emily M; Chakravarthy, Harini; Peiris, Heshan; Gu, Xueying; Liu, Yinghua; Conrad, Elizabeth; Goodrich, Lisa; Stein, Roland W; Kim, Seung K

    2016-08-01

    β-Cell proliferation and expansion during pregnancy are crucial for maintaining euglycemia in response to increased metabolic demands placed on the mother. Prolactin and placental lactogen signal through the prolactin receptor (PRLR) and contribute to adaptive β-cell responses in pregnancy; however, the in vivo requirement for PRLR signaling specifically in maternal β-cell adaptations remains unknown. We generated a floxed allele of Prlr, allowing conditional loss of PRLR in β-cells. In this study, we show that loss of PRLR signaling in β-cells results in gestational diabetes mellitus (GDM), reduced β-cell proliferation, and failure to expand β-cell mass during pregnancy. Targeted PRLR loss in maternal β-cells in vivo impaired expression of the transcription factor Foxm1, both G1/S and G2/M cyclins, tryptophan hydroxylase 1 (Tph1), and islet serotonin production, for which synthesis requires Tph1. This conditional system also revealed that PRLR signaling is required for the transient gestational expression of the transcription factor MafB within a subset of β-cells during pregnancy. MafB deletion in maternal β-cells also produced GDM, with inadequate β-cell expansion accompanied by failure to induce PRLR-dependent target genes regulating β-cell proliferation. These results unveil molecular roles for PRLR signaling in orchestrating the physiologic expansion of maternal β-cells during pregnancy. PMID:27217483

  19. Covalent Small Ubiquitin-like Modifier (SUMO) Modification of Maf1 Protein Controls RNA Polymerase III-dependent Transcription Repression*

    PubMed Central

    Rohira, Aarti D.; Chen, Chun-Yuan; Allen, Justin R.; Johnson, Deborah L.

    2013-01-01

    RNA polymerase (pol) III transcribes genes that determine biosynthetic capacity. Induction of these genes is required for oncogenic transformation. The transcriptional repressor, Maf1, plays a central role in the repression of these and other genes that promote oncogenesis. Our studies identify an important new role for SUMOylation in repressing RNA pol III-dependent transcription. We show that a key mechanism by which this occurs is through small ubiquitin-like modifier (SUMO) modification of Maf1 by both SUMO1 and SUMO2. Mutation of each lysine residue revealed that Lys-35 is the major SUMOylation site on Maf1 and that the deSUMOylase, SENP1, is responsible for controlling Maf1K35 SUMOylation. SUMOylation of Maf1 is unaffected by rapamycin inhibition of mammalian target of rapamycin (mTOR) and mTOR-dependent Maf1 phosphorylation. By preventing SUMOylation at Lys-35, Maf1 is impaired in its ability to both repress transcription and suppress colony growth. Although SUMOylation does not alter Maf1 subcellular localization, Maf1K35R is defective in its ability to associate with RNA pol III. This impairs Maf1 recruitment to tRNA gene promoters and its ability to facilitate the dissociation of RNA pol III from these promoters. These studies identify a novel role for SUMOylation in controlling Maf1 and RNA pol III-mediated transcription. Given the emerging roles of SENP1, Maf1, and RNA pol III transcription in oncogenesis, our studies support the idea that deSUMOylation of Maf1 and induction of its gene targets play a critical role in cancer development. PMID:23673667

  20. Musical slide show MAF with protection and governance using MPEG-21 IPMP Components and REL

    NASA Astrophysics Data System (ADS)

    Sabirin, Muhammad Syah Houari; Tan, Hendry; Lim, Jeongyeon; Kim, Munchurl

    2007-02-01

    The Musical Slide Show Multimedia Application Format (MAF) which is currently being standardized by the Moving Picture Expert Group (MPEG) conveys the concept of combining several established standard technologies in a single file format. It defines the format of packing up MP3 audio data, along with JPEG images, MPEG-7 Simple Profile metadata, timed text, and MPEG-4 LASeR script. The presentation of Musical Slide Show MAF contents is made in a synchronized manner with JPEG images, timed text to MP3 audio track. Also, the rendering effect on JPEG images can be supported by the MPEG-4 LASeR script. This Musical Slide Show MAF will enrich the consumption of MP3 contents assisted with synchronized and rendered JPEG images, text as well as MPEG-7 metadata about the MP3 audio contents. However, there is no protection and governance mechanism for Musical Slide Show MAF which is the essential elements to deploy the sorts of contents. In this paper, to manage the Musical Slide Show MAF contents in a controlled manner, we present a protection and governance mechanism by using MPEG-21 Intellectual Property Management and Protection (IPMP) Components and MPEG-21 Rights Expression Language (REL) technologies We implement an authoring tool and a player tool for Musical Slide Show MAF contents and show the experimental results as well.

  1. MAF1, a novel plant protein interacting with matrix attachment region binding protein MFP1, is located at the nuclear envelope.

    PubMed Central

    Gindullis, F; Peffer, N J; Meier, I

    1999-01-01

    The interaction of chromatin with the nuclear matrix via matrix attachment region (MAR) DNA is considered to be of fundamental importance for chromatin organization in all eukaryotic cells. MAR binding filament-like protein 1 (MFP1) from tomato is a novel plant protein that specifically binds to MAR DNA. Its filament protein-like structure makes it a likely candidate for a structural component of the nuclear matrix. MFP1 is located at nuclear matrix-associated, specklelike structures at the nuclear envelope. Here, we report the identification of a novel protein that specifically interacts with MFP1 in yeast two-hybrid and in vitro binding assays. MFP1 associated factor 1 (MAF1) is a small, soluble, serine/threonine-rich protein that is ubiquitously expressed and has no similarity to known proteins. MAF1, like MFP1, is located at the nuclear periphery and is a component of the nuclear matrix. These data suggest that MFP1 and MAF1 are in vivo interaction partners and that both proteins are components of a nuclear substructure, previously undescribed in plants, that connects the nuclear envelope and the internal nuclear matrix. PMID:10488241

  2. Expedient chemical synthesis of 75mer DNA binding domain of MafA: an insight on its binding to insulin enhancer.

    PubMed

    Pellegrino, Sara; Annoni, Chiara; Contini, Alessandro; Clerici, Francesca; Gelmi, Maria Luisa

    2012-11-01

    An expedient chemical synthesis of a 75mer peptide corresponding to the DNA binding domain (DBD, 227-301) of the human MafA leucine zipper transcription factor is reported. The application of microwave-assisted solid phase peptide synthesis (MW-SPPS) with a protocol modified respect to the standard one allowed obtaining the desired 75mer peptide in a short time with high quantity and optimal purity. MW-SPPS methodology was thus demonstrated as a valuable alternative to recombinant methods to obtain protein domains. Considering that recent findings suggest an involvement of MafA in the pathogenesis of diabetes mellitus, we also performed circular dichroism studies both on DBD folding and its interaction with MafA recognition element (MARE) on insulin enhancer. From our results, it was evicted that a disorder to order transition occurs after DBD interaction with insulin MARE which is mediated by specific structural elements on the N-terminus of the DBD. PMID:22476346

  3. SU-E-I-53: Comparison of Kerma-Area-Product Between the Micro-Angiographic Fluoroscope (MAF) and a Flat Panel Detector (FPD) as Used in Neuro-Endovascular Procedures

    SciTech Connect

    Vijayan, S; Rana, V; Nagesh, S Setlur; Xiong, Z; Rudin, S; Bednarek, D

    2015-06-15

    Purpose: To determine the reduction of integral dose to the patient when using the micro-angiographic fluoroscope (MAF) compared to when using the standard flat-panel detector (FPD) for the techniques used during neurointerventional procedures. Methods: The MAF is a small field-of-view, high resolution x-ray detector which captures 1024 x 1024 pixels with an effective pixel size of 35μm and is capable of real-time imaging up to 30 frames per second. The MAF was used in neuro-interventions during those parts of the procedure when high resolution was needed and the FPD was used otherwise. The technique parameters were recorded when each detector was used and the kerma-area-product (KAP) per image frame was determined. KAP values were calculated for seven neuro interventions using premeasured calibration files of output as a function of kVp and beam filtration and included the attenuation of the patient table for the frontal projections to be more representative of integral patient dose. The air kerma at the patient entrance was multiplied by the beam area at that point to obtain the KAP values. The ranges of KAP values per frame were determined for the range of technique parameters used during the clinical procedures. To appreciate the benefit of the higher MAF resolution in the region of interventional activity, DA technique parameters were generally used with the MAF. Results: The lowest and highest values of KAP per frame for the MAF in DA mode were 4 and 50 times lower, respectively, compared to those of the FPD in pulsed fluoroscopy mode. Conclusion: The MAF was used in those parts of the clinical procedures when high resolution and image quality was essential. The integral patient dose as represented by the KAP value was substantially lower when using the MAF than when using the FPD due to the much smaller volume of tissue irradiated. This research was supported in part by Toshiba Medical Systems Corporation and NIH Grant R01EB002873.

  4. High Fractional Occupancy of a Tandem Maf Recognition Element and Its Role in Long-Range β-Globin Gene Regulation.

    PubMed

    Stees, Jared R; Hossain, Mir A; Sunose, Tomoki; Kudo, Yasushi; Pardo, Carolina E; Nabilsi, Nancy H; Darst, Russell P; Poudyal, Rosha; Igarashi, Kazuhiko; Huang, Suming; Kladde, Michael P; Bungert, Jörg

    2015-01-01

    Enhancers and promoters assemble protein complexes that ultimately regulate the recruitment and activity of RNA polymerases. Previous work has shown that at least some enhancers form stable protein complexes, leading to the formation of enhanceosomes. We analyzed protein-DNA interactions in the murine β-globin gene locus using the methyltransferase accessibility protocol for individual templates (MAPit). The data show that a tandem Maf recognition element (MARE) in locus control region (LCR) hypersensitive site 2 (HS2) reveals a remarkably high degree of occupancy during differentiation of mouse erythroleukemia cells. Most of the other transcription factor binding sites in LCR HS2 or in the adult β-globin gene promoter regions exhibit low fractional occupancy, suggesting highly dynamic protein-DNA interactions. Targeting of an artificial zinc finger DNA-binding domain (ZF-DBD) to the HS2 tandem MARE caused a reduction in the association of MARE-binding proteins and transcription complexes at LCR HS2 and the adult βmajor-globin gene promoter but did not affect expression of the βminor-globin gene. The data demonstrate that a stable MARE-associated footprint in LCR HS2 is important for the recruitment of transcription complexes to the adult βmajor-globin gene promoter during erythroid cell differentiation. PMID:26503787

  5. High Fractional Occupancy of a Tandem Maf Recognition Element and Its Role in Long-Range β-Globin Gene Regulation

    PubMed Central

    Stees, Jared R.; Hossain, Mir A.; Sunose, Tomoki; Kudo, Yasushi; Pardo, Carolina E.; Nabilsi, Nancy H.; Darst, Russell P.; Poudyal, Rosha; Igarashi, Kazuhiko; Kladde, Michael P.

    2015-01-01

    Enhancers and promoters assemble protein complexes that ultimately regulate the recruitment and activity of RNA polymerases. Previous work has shown that at least some enhancers form stable protein complexes, leading to the formation of enhanceosomes. We analyzed protein-DNA interactions in the murine β-globin gene locus using the methyltransferase accessibility protocol for individual templates (MAPit). The data show that a tandem Maf recognition element (MARE) in locus control region (LCR) hypersensitive site 2 (HS2) reveals a remarkably high degree of occupancy during differentiation of mouse erythroleukemia cells. Most of the other transcription factor binding sites in LCR HS2 or in the adult β-globin gene promoter regions exhibit low fractional occupancy, suggesting highly dynamic protein-DNA interactions. Targeting of an artificial zinc finger DNA-binding domain (ZF-DBD) to the HS2 tandem MARE caused a reduction in the association of MARE-binding proteins and transcription complexes at LCR HS2 and the adult βmajor-globin gene promoter but did not affect expression of the βminor-globin gene. The data demonstrate that a stable MARE-associated footprint in LCR HS2 is important for the recruitment of transcription complexes to the adult βmajor-globin gene promoter during erythroid cell differentiation. PMID:26503787

  6. Activation of human factor V by factor Xa and thrombin

    SciTech Connect

    Monkovic, D.D.; Tracy, P.B. )

    1990-02-06

    The activation of human factor V by factor Xa and thrombin was studied by functional assessment of cofactor activity and sodium dodecyl sulfate-polycarylamide gel electrophoresis followed by either autoradiography of {sup 125}I-labeled factor V activation products or Western blot analyses of unlabeled factor V activation products. Cofactor activity was measured by the ability of the factor V/Va peptides to support the activation of prothrombin. The factor Xa catalyzed cleavage of factor V was observed to be time, phospholipid, and calcium ion dependent, yielding a cofactor with activity equal to that of thrombin-activated factor V (factor Va). The cleavage pattern differed markedly from the one observed in the bovine system. The factor Xa activated factor V subunits expressing cofactor activity were isolated and found to consist of peptides of M{sub r} 220,000 and 105,000. Although thrombin cleaved the M{sub r} 220,000 peptide to yield peptides previously shown to be products of thrombin activation, cofactor activity did not increase. N-Terminal sequence analysis confirmed that both factor Xa and thrombin cleave factor V at the same bond to generate the M{sub r} 220,000 peptide. The factor Xa dependent functional assessment of {sup 125}I-labeled factor V coupled with densitometric analyses of the cleavage products indicated that the cofactor activity of factor Xa activated factor V closely paralleled the appearance of the M{sub r} 220,000 peptide. The data indicate that factor Xa is as efficient an enzyme toward factor V as thrombin.

  7. S-allyl cysteine protects against 6-hydroxydopamine-induced neurotoxicity in the rat striatum: involvement of Nrf2 transcription factor activation and modulation of signaling kinase cascades.

    PubMed

    Tobón-Velasco, Julio César; Vázquez-Victorio, Genaro; Macías-Silva, Marina; Cuevas, Elvis; Ali, Syed F; Maldonado, Perla D; González-Trujano, María Eva; Cuadrado, Antonio; Pedraza-Chaverrí, José; Santamaría, Abel

    2012-09-01

    Pharmacological activation at the basal ganglia of the transcription factor Nrf2, guardian of redox homeostasis, holds a strong promise for the slow progression of Parkinson's disease (PD). However, a potent Nrf2 activator in the brain still must be found. In this study, we have investigated the potential use of the antioxidant compound S-allyl cysteine (SAC) in the activation of Nrf2 in 6-hydoxydopamine (6-OHDA)-intoxicated rats. In the rat striatum, SAC by itself promoted the Nrf2 dissociation of Keap-1, its nuclear translocation, the subsequent association with small MafK protein, and further binding of the Nrf2/MafK complex to ARE sequence, as well as the up-regulation of Nrf2-dependent genes encoding the antioxidant enzymes HO-1, NQO-1, GR, and SOD-1. In vivo and in vitro experiments to identify signaling pathways activated by SAC pointed to Akt as the most likely kinase participating in Nrf2 activation by SAC. In PC12 cells, SAC stimulated the activation of Akt and ERK1/2 and inhibited JNK1/2/3 activation. In the rat striatum, the SAC-induced activation of Nrf2 is likely to contribute to inhibit the toxic effects of 6-OHDA evidenced by phase 2 antioxidant enzymes up-regulation, glutathione recovery, and attenuation of reactive oxygen species (ROS), nitric oxide (NO), and lipid peroxides formation. These early protective effects correlated with the long-term preservation of the cellular redox status, the striatal dopamine (DA) and tyrosine hydroxylase (TH) levels, and the improvement of motor skills. Therefore, this study indicates that, in addition to direct scavenging actions, the activation of Nrf2 by SAC might confer neuroprotective responses through the modulation of kinase signaling pathways in rodent models of PD, and suggests that this antioxidant molecule may have a therapeutic value in this human pathology. PMID:22781654

  8. A regulatory circuit for piwi by the large Maf gene traffic jam in Drosophila.

    PubMed

    Saito, Kuniaki; Inagaki, Sachi; Mituyama, Toutai; Kawamura, Yoshinori; Ono, Yukiteru; Sakota, Eri; Kotani, Hazuki; Asai, Kiyoshi; Siomi, Haruhiko; Siomi, Mikiko C

    2009-10-29

    PIWI-interacting RNAs (piRNAs) silence retrotransposons in Drosophila germ lines by associating with the PIWI proteins Argonaute 3 (AGO3), Aubergine (Aub) and Piwi. piRNAs in Drosophila are produced from intergenic repetitive genes and piRNA clusters by two systems: the primary processing pathway and the amplification loop. The amplification loop occurs in a Dicer-independent, PIWI-Slicer-dependent manner. However, primary piRNA processing remains elusive. Here we analysed piRNA processing in a Drosophila ovarian somatic cell line where Piwi, but not Aub or AGO3, is expressed; thus, only the primary piRNAs exist. In addition to flamenco, a Piwi-specific piRNA cluster, traffic jam (tj), a large Maf gene, was determined as a new piRNA cluster. piRNAs arising from tj correspond to the untranslated regions of tj messenger RNA and are sense-oriented. piRNA loading on to Piwi may occur in the cytoplasm. zucchini, a gene encoding a putative cytoplasmic nuclease, is required for tj-derived piRNA production. In tj and piwi mutant ovaries, somatic cells fail to intermingle with germ cells and Fasciclin III is overexpressed. Loss of tj abolishes Piwi expression in gonadal somatic cells. Thus, in gonadal somatic cells, tj gives rise simultaneously to two different molecules: the TJ protein, which activates Piwi expression, and piRNAs, which define the Piwi targets for silencing. PMID:19812547

  9. MYB controls erythroid versus megakaryocyte lineage fate decision through the miR-486-3p-mediated downregulation of MAF

    PubMed Central

    Bianchi, E; Bulgarelli, J; Ruberti, S; Rontauroli, S; Sacchi, G; Norfo, R; Pennucci, V; Zini, R; Salati, S; Prudente, Z; Ferrari, S; Manfredini, R

    2015-01-01

    The transcription factor MYB has a key role in hematopoietic progenitor cells (HPCs) lineage choice, by enhancing erythropoiesis at the expense of megakaryopoiesis. We previously demonstrated that MYB controls erythroid versus megakaryocyte lineage decision by transactivating KLF1 and LMO2 expression. To further unravel the molecular mechanisms through which MYB affects lineage fate decision, we performed the integrative analysis of miRNA and mRNA changes in MYB-silenced human primary CD34+ HPCs. Among the miRNAs with the highest number of predicted targets, we focused our studies on hsa-miR-486-3p by demonstrating that MYB controls miR-486-3p expression through the transactivation of its host gene, ankyrin-1 (ANK1) and that miR-486-3p affects HPCs commitment. Indeed, overexpression and knockdown experiments demonstrated that miR-486-3p supports the erythropoiesis while restraining the megakaryopoiesis. Of note, miR-486-3p also favors granulocyte differentiation while repressing the macrophage differentiation. To shed some light on the molecular mechanisms through which miR-486-3p affects HPCs lineage commitment, we profiled the gene expression changes upon miR-486-3p overexpression in CD34+ cells. Among the genes downregulated in miR-486-3p-overexpressing HPCs and computationally predicted to be miR-486-3p targets, we identified MAF as a miR-486-3p target by 3′UTR luciferase reporter assay. Noteworthy, MAF overexpression was able to partially reverse the effects of miR-486-3p overexpression on erythroid versus megakaryocyte lineage choice. Moreover, the MYB/MAF co-silencing constrained the skewing of erythroid versus megakaryocyte lineage commitment in MYB-silenced CD34+ cells, by restraining the expansion of megakaryocyte lineage while partially rescuing the impairment of erythropoiesis. Therefore, our data collectively demonstrate that MYB favors erythropoiesis and restrains megakaryopoiesis through the transactivation of miR-486-3p expression and the

  10. Occurrence of fenestral diaphragms and knots in renal glomerular endothelia of diabetic mutant MafA-/-MafK+ mice as revealed in embedment-free transmission electron microscopy.

    PubMed

    Chaiciwamongkol, Kowit; Toomsan, Yanyong; Arnanteerakul, Tansita; Kondo, Hisatake; Hipkaeo, Wiphawi

    2015-03-01

    Using the advantages (high contrast and transparency and efficient 3D viewing) of embedment-free section transmission electron microscopy (TEM), the occurrence of numerous fenestral diaphragms was clearly shown in 3D en-face viewing of the renal glomerular capillary endothelium of severe overt diabetes mellitus mice, which were generally MafA-deficient and simultaneously MafK-overexpressed specifically in pancreatic β-cells. This presents another example of nephritis-induced diaphragmed fenestrae in the renal glomerular endothelium. In addition, knot-/umbilicus-like structures discrete from and larger than the central knots of regular diaphragms of fenestrated endothelium were clearly demonstrated to occur randomly in the renal glomerular endothelial fenestrae of mutant mice and wild ones. The knot-structures were revealed to be protrusions of underlining basement lamina in conventional TEM by section-tilting observation. PMID:25582093

  11. Suppression of the Formation of Polygenotypic Recombinant Colonies by a maf Mutation in Mating with Hfrh

    PubMed Central

    Ou, Jonathan T.; Kuo, Li-Mei

    1979-01-01

    W3011, a Cavalli-type Hfr (HfrC), was mated with F-KY9474, maf-1, which cannot maintain F or F-like plasmids, and with F-OU9474, Maf+, a spontaneous revertant of KY9474. The recombinant colonies obtained were 100% monogenotypic from KY9474 and 90% monogenotypic from OU9474. On the other hand, in matings with OU11, a Hayes-type Hfr (HfrH), and these two F- strains, recombinant colonies derived from KY9474 showed only 22% polygenotypic recombinant colonies; whereas, those derived from OU9474 showed a high production rate (57%) of polygenotypic recombinant colonies. Among the polygenotypic recombinant colonies derived from KY9474 maf-1, 50% contained three or more recombinant types. These were probably derived from a small fraction of Maf+ revertants in the KY9474 population, as suggested by the results of mating this strain with M80, an F' strain that contains an amber mutation in traH. These results support the hypothesis that the donor DNA fragments derived from an HfrH can undergo a limited replication in the recipient to produce polygenotypic recombinant colonies, whereas those derived from HfrC cannot. PMID:395025

  12. A novel molecular mechanism involved in multiple myeloma development revealed by targeting MafB to haematopoietic progenitors

    PubMed Central

    Vicente-Dueñas, Carolina; Romero-Camarero, Isabel; González-Herrero, Inés; Alonso-Escudero, Esther; Abollo-Jiménez, Fernando; Jiang, Xiaoyu; Gutierrez, Norma C; Orfao, Alberto; Marín, Nieves; Villar, Luisa María; Criado, Ma Carmen Fernández; Pintado, Belén; Flores, Teresa; Alonso-López, Diego; De Las Rivas, Javier; Jiménez, Rafael; Criado, Francisco Javier García; Cenador, María Begoña García; Lossos, Izidore S; Cobaleda, César; Sánchez-García, Isidro

    2012-01-01

    Understanding the cellular origin of cancer can help to improve disease prevention and therapeutics. Human plasma cell neoplasias are thought to develop from either differentiated B cells or plasma cells. However, when the expression of Maf oncogenes (associated to human plasma cell neoplasias) is targeted to mouse B cells, the resulting animals fail to reproduce the human disease. Here, to explore early cellular changes that might take place in the development of plasma cell neoplasias, we engineered transgenic mice to express MafB in haematopoietic stem/progenitor cells (HS/PCs). Unexpectedly, we show that plasma cell neoplasias arise in the MafB-transgenic mice. Beyond their clinical resemblance to human disease, these neoplasias highly express genes that are known to be upregulated in human multiple myeloma. Moreover, gene expression profiling revealed that MafB-expressing HS/PCs were more similar to B cells and tumour plasma cells than to any other subset, including wild-type HS/PCs. Consistent with this, genome-scale DNA methylation profiling revealed that MafB imposes an epigenetic program in HS/PCs, and that this program is preserved in mature B cells of MafB-transgenic mice, demonstrating a novel molecular mechanism involved in tumour initiation. Our findings suggest that, mechanistically, the haematopoietic progenitor population can be the target for transformation in MafB-associated plasma cell neoplasias. PMID:22903061

  13. Activity factors of the Korean exposure factors handbook.

    PubMed

    Jang, Jae-Yeon; Jo, Soo-Nam; Kim, So-Yeon; Lee, Kyung-Eun; Choi, Kyung-Ho; Kim, Young-Hee

    2014-01-01

    Exposure factors based on the Korean population are required for making appropriate risk assessment. It is expected that handbooks for exposure factors will be applied in many fields, as well as by health department risk assessors. The present article describes the development of an exposure factors handbook that specifically focuses on human activities in situations involving the possible risk of exposure to environmental contaminants. We define majour exposure factors that represent behavioral patterns for risk assessment, including time spent on routine activities, in different places, on using transportation, and engaged in activities related to water contact including swimming, bathing and washing. Duration of residence and employment are also defined. National survey data were used to identify recommended levels of exposure factors in terms of time spent on routine activities and period of residence and employment. An online survey was conducted with 2073 subjects who were selected using a stratified random sampling method in order to develop a list of exposure factors for the time spent in different places and in performing water-related activities. We provide the statistical distribution of the variables, and report reference levels of average exposure based on the reliable data in our exposure factors handbook. PMID:24570804

  14. Pathogenic significance of alpha-N-acetylgalactosaminidase activity found in the hemagglutinin of influenza virus.

    PubMed

    Yamamoto, Nobuto; Urade, Masahiro

    2005-04-01

    Serum vitamin D3-binding protein (Gc protein) is the precursor for the principal macrophage activating factor (MAF). The precursor activity of serum Gc protein was reduced in all influenza virus-infected patients. These patient sera contained alpha-N-acetylgalactosaminidase (Nagalase) that deglycosylates Gc protein. Deglycosylated Gc protein cannot be converted to MAF, thus it loses the MAF precursor activity, leading to immunosuppression. An influenza virus stock contained a large amount of Nagalase activity. A sucrose gradient centrifugation analysis of the virus stock showed that the profile of Nagalase activity corresponds to that of hemagglutinating activity. When these gradient fractions were treated with 0.01% trypsin for 30 min, the Nagalase activity of each fraction increased significantly, suggesting that the Nagalase activity resides on an outer envelope protein of the influenza virion and is enhanced by the proteolytic process. After disruption of influenza virions with sodium deoxycholate, fractionation of the envelope proteins with mannose-specific lectin affinity column along with electrophoretic analysis of the Nagalase peak fraction revealed that Nagalase is the intrinsic component of the hemagglutinin (HA). Cloned HA protein exhibited Nagalase activity only if treated with trypsin. Since both fusion capacity and Nagalase activity of HA protein are expressed by proteolytic cleavage, Nagalase activity appears to be an enzymatic basis for the fusion process. Thus, Nagalase plays dual roles in regulating both infectivity and immunosuppression. PMID:15848273

  15. An activation factor of liver phosphofructokinase.

    PubMed Central

    Furuya, E; Uyeda, K

    1980-01-01

    Pure phosphofructokinase (ATP:D-fructose-6-phosphate 1-phosphotransferase, EC 2.7.1.11) from liver is strongly inhibited by ATP, whereas crude phosphofructokinase is only slightly inhibited by ATP. A factor that is removed from the enzyme during purification and can prevent the inhibition of phosphofructokinase by ATP has been isolated. The factor can be resolved into three components that differ in molecular weights, as shown by gel filtration on Sephadex G-25. These factors overcome the ATP inhibition but have no effect on the catalytic activity under the optimum assay conditions. Furthermore, AMP acts syngeristically with the activation factor in reversing ATP inhibition. It is proposed that the activation of phosphofructokinase by the activation factor and AMP is sufficient to account for the glycolytic flux in the liver. PMID:6449699

  16. Activation of factor X by rat hepatocytes

    SciTech Connect

    Willingham, A.K.; Matschiner, J.T.

    1986-05-01

    Synthesis and secretion of blood coagulation factor X was studied in hepatocytes prepared by perfusion of rat livers with collagenase. Hepatocytes were incubated in the presence of vitamin K and /sup 3/H-leucine for up to 4h at 37/sup 0/C. Factor X was isolated from the incubation medium by immunochemical techniques and analyzed by SDS-PAGE. The recovered /sup 3/H-labeled proteins migrated, after reduction of disulfides, as two polypeptide chains with apparent molecular weights (M/sub r/) of approximately 42,000 and 22,000 representing the heavy and light chains of factor X respectively. The apparent M/sub r/ of the heavy chain was about 10,000 daltons lighter than seen with the heavy chain of factor X isolated from rat plasma and was more characteristic of the heavy chain of factor Xa. When the levels of factor X secreted by hepatocytes were determined by clotting assays, activity was present as factor Xa. Also, when purified plasma factor X was added to incubations of hepatocytes (>95% parenchymal cells) the added factor X was rapidly converted to factor Xa. Plasma membranes prepared from isolated hepatocytes or from liver homogenates contained an enzyme that converted factor X to factor Xa in a calcium dependent reaction. The physiological significance of a factor X activating enzyme on hepatocyte plasma membranes is not clear.

  17. Generation of Functional Insulin-Producing Cells from Neonatal Porcine Liver-Derived Cells by PDX1/VP16, BETA2/NeuroD and MafA

    PubMed Central

    Ham, Dong-Sik; Shin, Juyoung; Kim, Ji-Won; Park, Heon-Seok; Cho, Jae-Hyoung; Yoon, Kun-Ho

    2013-01-01

    Surrogate β-cells derived from stem cells are needed to cure type 1 diabetes, and neonatal liver cells may be an attractive alternative to stem cells for the generation of β-cells. In this study, we attempted to generate insulin-producing cells from neonatal porcine liver-derived cells using adenoviruses carrying three genes: pancreatic and duodenal homeobox factor1 (PDX1)/VP16, BETA2/NeuroD and v-maf musculo aponeurotic fibrosarcoma oncogene homolog A (MafA), which are all known to play critical roles in pancreatic development. Isolated neonatal porcine liver-derived cells were sequentially transduced with triple adenoviruses and grown in induction medium containing a high concentration of glucose, epidermal growth factors, nicotinamide and a low concentration of serum following the induction of aggregation for further maturation. We noted that the cells displayed a number of molecular characteristics of pancreatic β-cells, including expressing several transcription factors necessary for β-cell development and function. In addition, these cells synthesized and physiologically secreted insulin. Transplanting these differentiated cells into streptozotocin-induced immunodeficient diabetic mice led to the reversal of hyperglycemia, and more than 18% of the cells in the grafts expressed insulin at 6 weeks after transplantation. These data suggested that neonatal porcine liver-derived cells can be differentiated into functional insulin-producing cells under the culture conditions presented in this report and indicated that neonatal porcine liver-derived cells (NPLCs) might be useful as a potential source of cells for β-cell replacement therapy in efforts to cure type I diabetes. PMID:24260156

  18. Maf-dependent bacterial flagellin glycosylation occurs before chaperone binding and flagellar T3SS export

    PubMed Central

    Parker, Jennifer L; Lowry, Rebecca C; Couto, Narciso A S; Wright, Phillip C; Stafford, Graham P; Shaw, Jonathan G

    2014-01-01

    Bacterial swimming is mediated by rotation of a filament that is assembled via polymerization of flagellin monomers after secretion via a dedicated flagellar Type III secretion system. Several bacteria decorate their flagellin with sialic acid related sugars that is essential for motility. Aeromonas caviae is a model organism for this process as it contains a genetically simple glycosylation system and decorates its flagellin with pseudaminic acid (Pse). The link between flagellin glycosylation and export has yet to be fully determined. We examined the role of glycosylation in the export and assembly process in a strain lacking Maf1, a protein involved in the transfer of Pse onto flagellin at the later stages of the glycosylation pathway. Immunoblotting, established that glycosylation is not required for flagellin export but is essential for filament assembly since non-glycosylated flagellin is still secreted. Maf1 interacts directly with its flagellin substrate in vivo, even in the absence of pseudaminic acid. Flagellin glycosylation in a flagellin chaperone mutant (flaJ) indicated that glycosylation occurs in the cytoplasm before chaperone binding and protein secretion. Preferential chaperone binding to glycosylated flagellin revealed its crucial role, indicating that this system has evolved to favour secretion of the polymerization competent glycosylated form. PMID:24527847

  19. Complement activation induced by rabbit rheumatoid factor.

    PubMed Central

    Meyer, R R; Brown, J C

    1980-01-01

    Rabbit rheumatoid factor produced in animals by hyperimmunized with group C streptococcal vaccine activated guinea pig complement. Anti-streptococcal serum was fractionated by Sephacryl S-200 chromatography into excluded (19S) and included (7S) material and examined for hemolytic activity in a sensitive homologous hemolytic assay system. In the presence of complement, both 19S and 7S antistreptococcal serum fractions induced lysis of bovine (ox) erythrocytes coated with mildly reduced and carboxymethylated rabbit anti-erythrocyte immunoglobulin G. That rabbit rheumatoid factor was responsible for the observed hemolytic activity was substantiated by hemolytic inhibition assays. Significant inhibition of hemolysis was effected when antistreptococcal serum fractions were incubated in the presence of human immunoglobulin G, rabbit immunoglobulin G, and Fc, whereas, no inhibition was detected when the same fractions were tested in the presence of rabbit Fab or F(ab')2 fragments. Deaggregation of inhibitor preparations revealed a preferential reactivity of rheumatoid factor for rabbit immunoglobulin G. In addition to the rheumatoid factor-dependent hemolytic activity observed in humoral preparations, immunoglobulin G-specific antibody-forming cells in spleen and peripheral blood lymphocyte isolates were enumerated by plaque-forming cell assay. PMID:7399707

  20. Factors Associated with Evaluating Public Relations Activities.

    ERIC Educational Resources Information Center

    McElreath, Mark P.

    More than 150 public relations practitioners responded to a survey designed to identify and clarify factors associated with evaluative research in public relations. Responses indicated that (1) no more than half the practitioners formally evaluate their public relations activities on a regular basis; (2) the majority of evaluation is done…

  1. An LPV Adaptive Observer for Updating a Map Applied to an MAF Sensor in a Diesel Engine

    PubMed Central

    Liu, Zhiyuan; Wang, Changhui

    2015-01-01

    In this paper, a new method for mass air flow (MAF) sensor error compensation and an online updating error map (or lookup table) due to installation and aging in a diesel engine is developed. Since the MAF sensor error is dependent on the engine operating point, the error model is represented as a two-dimensional (2D) map with two inputs, fuel mass injection quantity and engine speed. Meanwhile, the 2D map representing the MAF sensor error is described as a piecewise bilinear interpolation model, which can be written as a dot product between the regression vector and parameter vector using a membership function. With the combination of the 2D map regression model and the diesel engine air path system, an LPV adaptive observer with low computational load is designed to estimate states and parameters jointly. The convergence of the proposed algorithm is proven under the conditions of persistent excitation and given inequalities. The observer is validated against the simulation data from engine software enDYNA provided by Tesis. The results demonstrate that the operating point-dependent error of the MAF sensor can be approximated acceptably by the 2D map from the proposed method. PMID:26512675

  2. An LPV Adaptive Observer for Updating a Map Applied to an MAF Sensor in a Diesel Engine.

    PubMed

    Liu, Zhiyuan; Wang, Changhui

    2015-01-01

    In this paper, a new method for mass air flow (MAF) sensor error compensation and an online updating error map (or lookup table) due to installation and aging in a diesel engine is developed. Since the MAF sensor error is dependent on the engine operating point, the error model is represented as a two-dimensional (2D) map with two inputs, fuel mass injection quantity and engine speed. Meanwhile, the 2D map representing the MAF sensor error is described as a piecewise bilinear interpolation model, which can be written as a dot product between the regression vector and parameter vector using a membership function. With the combination of the 2D map regression model and the diesel engine air path system, an LPV adaptive observer with low computational load is designed to estimate states and parameters jointly. The convergence of the proposed algorithm is proven under the conditions of persistent excitation and given inequalities. The observer is validated against the simulation data from engine software enDYNA provided by Tesis. The results demonstrate that the operating point-dependent error of the MAF sensor can be approximated acceptably by the 2D map from the proposed method. PMID:26512675

  3. Activating transcription factor 2 in mesenchymal tumors.

    PubMed

    Endo, Makoto; Su, Le; Nielsen, Torsten O

    2014-02-01

    Activating transcription factor 2 (ATF2) is a member of activator protein 1 superfamily, which can heterodimerize with other transcription factors regulating cell differentiation and survival. ATF2 assembles into a complex with the synovial sarcoma translocation, chromosome 18 (SS18)-synovial sarcoma, X breakpoint (SSX) fusion oncoprotein, and the transducin-like enhancer of split 1 (TLE1) corepressor, driving oncogenesis in synovial sarcoma. The fusion oncoproteins in many other translocation-associated sarcomas incorporate transcription factors from the ATF/cAMP response element binding or E26 families, which potentially form heterodimers with ATF2 to regulate transcription. ATF2 may therefore play an important role in the oncogenesis of many mesenchymal tumors, but as yet, little is known about its protein expression in patient specimens. Herein we perform immunohistochemical analyses using a validated specific antibody for ATF2 expression and intracellular localization on a cohort of 594 malignant and 207 benign mesenchymal tumors representing 47 diagnostic entities. Melanoma served as a positive control for nuclear and cytoplasmic staining. High nuclear ATF2 expression was mainly observed in translocation-associated and/or spindle cell sarcomas including synovial sarcoma, desmoplastic small round cell tumor, endometrial stromal sarcoma, gastrointestinal stromal tumor, malignant peripheral nerve sheath tumor, and solitary fibrous tumor. Cytoplasmic ATF2 expression was less frequently seen than nuclear expression in malignant mesenchymal tumors. Benign mesenchymal tumors mostly showed much lower nuclear and cytoplasmic ATF2 expression. PMID:24289970

  4. Platelet activating factor activity in the phospholipids of bovine spermatozoa

    SciTech Connect

    Parks, J.E.; Hough, S.; Elrod, C. )

    1990-11-01

    Platelet activating factor (PAF) has been detected in sperm from several mammalian species and can affect sperm motility and fertilization. Because bovine sperm contain a high percentage of ether-linked phospholipid precursors required for PAF synthesis, a study was undertaken to determine the PAF activity of bovine sperm phospholipids. Total lipids of washed, ejaculated bull sperm were extracted, and phospholipids were fractionated by thin-layer chromatography. Individual phospholipid fractions were assayed for PAF activity on the basis of (3H)serotonin release from equine platelets. PAF activity was detected in the PAF fraction (1.84 pmol/mumol total phospholipid) and in serine/inositol (PS/PI), choline (CP), and ethanolamine phosphoglyceride (EP) and cardiolipin (CA) fractions. Activity was highest in the CP fraction (8.05 pmol/mumol total phospholipid). Incomplete resolution of PAF and neutral lipids may have contributed to the activity in the PS/PI and CA fractions, respectively. Phospholipids from nonsperm sources did not stimulate serotonin release. Platelet activation by purified PAF and by sperm phospholipid fractions was inhibited by the receptor antagonist SRI 63-675. These results indicate that bovine sperm contain PAF and that other sperm phospholipids, especially CP and EP, which are high in glycerylether components, are capable of receptor-mediated platelet activation.

  5. Particle emission factors during cooking activities

    NASA Astrophysics Data System (ADS)

    Buonanno, G.; Morawska, L.; Stabile, L.

    Exposure to particles emitted by cooking activities may be responsible for a variety of respiratory health effects. However, the relationship between these exposures and their subsequent effects on health cannot be evaluated without understanding the properties of the emitted aerosol or the main parameters that influence particle emissions during cooking. Whilst traffic-related emissions, stack emissions and concentrations of ultrafine particles (UFPs, diameter < 100 nm) in urban ambient air have been widely investigated for many years, indoor exposure to UFPs is a relatively new field and in order to evaluate indoor UFP emissions accurately, it is vital to improve scientific understanding of the main parameters that influence particle number, surface area and mass emissions. The main purpose of this study was to characterise the particle emissions produced during grilling and frying as a function of the food, source, cooking temperature and type of oil. Emission factors, along with particle number concentrations and size distributions were determined in the size range 0.006-20 μm using a Scanning Mobility Particle Sizer (SMPS) and an Aerodynamic Particle Sizer (APS). An infrared camera was used to measure the temperature field. Overall, increased emission factors were observed to be a function of increased cooking temperatures. Cooking fatty foods also produced higher particle emission factors than vegetables, mainly in terms of mass concentration, and particle emission factors also varied significantly according to the type of oil used.

  6. Mechanisms of Specificity for Hox Factor Activity

    PubMed Central

    Zandvakili, Arya; Gebelein, Brian

    2016-01-01

    Metazoans encode clusters of paralogous Hox genes that are critical for proper development of the body plan. However, there are a number of unresolved issues regarding how paralogous Hox factors achieve specificity to control distinct cell fates. First, how do Hox paralogs, which have very similar DNA binding preferences in vitro, drive different transcriptional programs in vivo? Second, the number of potential Hox binding sites within the genome is vast compared to the number of sites bound. Hence, what determines where in the genome Hox factors bind? Third, what determines whether a Hox factor will activate or repress a specific target gene? Here, we review the current evidence that is beginning to shed light onto these questions. In particular, we highlight how cooperative interactions with other transcription factors (especially PBC and HMP proteins) and the sequences of cis-regulatory modules provide a basis for the mechanisms of Hox specificity. We conclude by integrating a number of the concepts described throughout the review in a case study of a highly interrogated Drosophila cis-regulatory module named “The Distal-less Conserved Regulatory Element” (DCRE). PMID:27583210

  7. Complement activating factor(s) of Trypanosoma lewisi: some physiochemical characteristics of the active components.

    PubMed Central

    Nielsen, K; Sheppard, J; Tizard, I; Holmes, W

    1978-01-01

    Of the complement activating factors present in Trypanosoma lewisi, the major component, a carbohydrate containing substance was further investigated. This component was found to have a lag time of complete activation of 2 CH50 units of bovine complement of approximately 15 minutes while 1% trypsin (a known activator of complement, used as a control system) was capable of instant consumption of a similar quantity of complement. In addition, the complement activating factor of trypanosomes was observed to be stable at 100 degrees C for 15 minutes and over a pH range of 3.0 to 11.0. Thin layer chromatography studies suggested that at least part of the active component contained lipid, perhaps indicating that it may be glycolipid in nature. PMID:25701

  8. Cleavage and activation of human factor IX by serine proteases

    SciTech Connect

    Enfield, D.L.; Thompson, A.R.

    1984-10-01

    Human factor IX circulates as a single-chain glycoprotein. Upon activation in vitro, it is cleaved into disulfide-linked light and heavy chains and an activation peptide. After reduction of activated /sup 125/I-factor IX, the heavy and light chains are readily identified by gel electrophoresis. A direct, immunoradiometric assay for factor IXa was developed to assess activation of factor IX for proteases that cleaved it. The assay utilized radiolabeled antithrombin III with heparin to identify the active site and antibodies to distinguish factor IX. After cleavage of factor IX by factor XIa, factor VIIa-tissue thromboplastin complex, or the factor X-activating enzyme from Russell's viper venom, antithrombin III bound readily to factor IXa. Cleavage of /sup 125/I-factor IX by trypsin, chymotrypsin, and granulocyte elastase in the presence of calcium yielded major polypeptide fragments of the sizes of the factor XIa-generated light and heavy chains. When the immunoradiometric assay was used to assess trypsin-cleaved factor IX, the product bound antithrombin III, but not maximally. After digesting with insolubilized trypsin, clotting activity confirmed activation. In evaluating activation of factor IX, physical evidence of activation cleavages does not necessarily correlate with generation of an active site.

  9. Characterization of the clotting activities of structurally different forms of activated factor IX. Enzymatic properties of normal human factor IXa alpha, factor IXa beta, and activated factor IX Chapel Hill.

    PubMed Central

    Griffith, M J; Breitkreutz, L; Trapp, H; Briet, E; Noyes, C M; Lundblad, R L; Roberts, H R

    1985-01-01

    Two structurally different forms of activated human Factor IX (Factor IXa alpha and IXa beta) have been previously reported to have essentially identical clotting activity in vitro. Although it has been shown that activated Factor IX Chapel Hill, an abnormal Factor IX isolated from the plasma of a patient with mild hemophilia B, and normal Factor IXa alpha are structurally very similar, the clotting activity of activated Factor IX Chapel Hill is much lower (approximately fivefold) than that of normal Factor IXa beta. In the present study we have prepared activated Factor IX by incubating human Factor IX with calcium and Russell's viper venom covalently bound to agarose. Fractionation of the activated Factor IX by high-performance liquid chromatography demonstrated the presence of both Factors IXa alpha and IXa beta. On the basis of active site concentration, determined by titration with antithrombin III, the clotting activities of activated Factor IX Chapel Hill and IXa alpha were similar, but both activities were less than 20% of the clotting activity of Factor IXa beta. Activated Factor IX activity was also measured in the absence of calcium, phospholipid, and Factor VIII, by determination of the rate of Factor X activation in the presence of polylysine. In the presence of polylysine, the rates of Factor X activation by activated Factor IX Chapel Hill, Factor IXa alpha, and Factor IXa beta were essentially identical. We conclude that the clotting activity of activated Factor IX Chapel Hill is reduced when compared with that of Factor IXa beta but essentially normal when compared with that of Factor IXa alpha. PMID:3871202

  10. Factors Influencing Cypriot Children's Physical Activity Levels

    ERIC Educational Resources Information Center

    Loucaides, Constantinos A.; Chedzoy, Sue M.

    2005-01-01

    The purpose of this paper is to present selected findings from a larger study, which set out to examine the physical activity levels of Cypriot primary school children and determinants of their activity. Twenty parents of children who obtained high and low activity scores based on pedometer counts and self-reports scores were interviewed. By…

  11. Co-factor activated recombinant adenovirus proteinases

    DOEpatents

    Anderson, Carl W.; Mangel, Walter F.

    1996-08-06

    This application describes methods and expression constructs for producing activatable recombinant adenovirus proteinases. Purified activatable recombinant adenovirus proteinases and methods of purification are described. Activated adenovirus proteinases and methods for obtaining activated adenovirus proteinases are further included. Isolated peptide cofactors of adenovirus proteinase activity, methods of purifying and identifying said peptide cofactors are also described. Antibodies immunoreactive with adenovirus proteinases, immunospecific antibodies, and methods for preparing them are also described. Other related methods and materials are also described.

  12. Co-factor activated recombinant adenovirus proteinases

    DOEpatents

    Anderson, C.W.; Mangel, W.F.

    1996-08-06

    This application describes methods and expression constructs for producing activatable recombinant adenovirus proteinases. Purified activatable recombinant adenovirus proteinases and methods of purification are described. Activated adenovirus proteinases and methods for obtaining activated adenovirus proteinases are further included. Isolated peptide cofactors of adenovirus proteinase activity, methods of purifying and identifying the peptide cofactors are also described. Antibodies immunoreactive with adenovirus proteinases, immunospecific antibodies, and methods for preparing them are also described. Other related methods and materials are also described. 29 figs.

  13. Virulence Factor-activity Relationships: Workshop Summary

    EPA Science Inventory

    The concept or notion of virulence factor–activity relationships (VFAR) is an approach for identifying an analogous process to the use of qualitative structure–activity relationships (QSAR) for identifying new microbial contaminants. In QSAR, it is hypothesized that, for new chem...

  14. SATB1 packages densely-looped, transciptionally-active chromatinfor coordinated expression of cytokine genes

    SciTech Connect

    Cai, Shutao; Lee, Charles C.; Kohwi-Shigematsu, Terumi

    2006-05-23

    SATB1 is an important regulator of nuclear architecture that anchors specialized DNA sequences onto its cage-like network and recruits chromatin remodeling/modifying factors to control gene transcription. We studied the role of SATB1 in regulating the coordinated expression of Il5, Il4, and Il13 from the 200kb cytokine gene cluster region of mouse chromosome 11 during T-helper 2 (Th2)-cell activation. We show that upon cell activation, SATB1 is rapidly induced to form a unique transcriptionally-active chromatin structure that includes the cytokine gene region. Chromatin is folded into numerous small loops all anchored by SATB1, is histone H3 acetylated at lysine 9/14, and associated with Th2-specific factors, GATA3, STAT6, c-Maf, the chromatin-remodeling enzyme Brg-1, and RNA polymerase II across the 200kb region. Before activation, the chromatin displays some of these features, such as association with GATA3 and STAT6, but these were insufficient for cytokine gene expression. Using RNA interference (RNAi), we show that upon cell activation, SATB1 is not only required for chromatin folding into dense loops, but also for c-Maf induction and subsequently for Il4, Il5, and Il13 transcription. Our results show that SATB1 is an important determinant for chromatin architecture that constitutes a novel higher-order, transcriptionally-active chromatin structure upon Th2-cell activation.

  15. Prolylcarboxypeptidase Independently Activates Plasma Prekallikrein (Fletcher Factor)

    PubMed Central

    Wang, J.; Matafonov, A.; Madkhali, H.; Mahdi, F.; Watson, D.; Schmaier, A.H.; Gailani, D.; Shariat-Madar, Z.

    2015-01-01

    Prolylcarboxypeptidase isoform 1 (PRCP1) is capable of regulating numerous autocrines and hormones, such as angiotensin II, angiotensin III, αMSH1-13, and DesArg9 bradykinin. It does so by cleaving a C-terminal PRO-X bond. Recent work also indicates that the human PRCP1 activates plasma prekallikrein (PK) to kallikrein on endothelial cells through an uncharacterized mechanism. This study aims to identify PRCP1 binding interaction and cleavage site on PK. Recently, a cDNA encoding a novel splice variant of the human PRCP1 was identified. This isoform differed only in the N-terminal region of the deduced amino acid sequence. Using structural and functional studies, a combination of peptide mapping and site-directed mutagenesis approaches were employed to investigate the interaction of PRCP1 with PK. Three PRCP peptides, in decreasing order of potency, from 1) the N-terminus of the secreted protein, 2) spanning the opening of the active site pocket, and 3) in the dimerization region inhibit PRCP activation of PK on endothelial cells. Investigations also tested the hypothesis that PRCP cleavage site on PK is between its C-terminal Pro 637 (P637) and Ala 638 (A638). Recombinant forms of PK with C-terminal alanine mutagenesis or a stop codon is activated equally as wild type PK by PRCP. In conclusion, PRCP1 interacts with PK at multiple sites for PK activation. PRCP1 also enhances FXIIa activation of PK, suggesting that its activation site on PK is not identical to that of FXIIa. PMID:25324000

  16. Postbiotic activities of lactobacilli-derived factors.

    PubMed

    Cicenia, Alessia; Scirocco, Annunziata; Carabotti, Marilia; Pallotta, Lucia; Marignani, Massimo; Severi, Carola

    2014-01-01

    Probiotics are alive nonpathogenic microorganisms present in the gut microbiota that confer benefits to the host for his health. They act through molecular and cellular mechanisms that contrast pathogen bacteria adhesion, enhance innate immunity, decrease pathogen-induced inflammation, and promote intestinal epithelial cell survival, barrier function, and protective responses. Some of these beneficial effects result to be determined by secreted probiotic-derived factors that recently have been identified as "postbiotic" mediators. They have been reported for several probiotic strains but most available literature concerns Lactobacilli. In this review, we focus on the reported actions of several secretory products of different Lactobacillus species highlighting the available mechanistic data. The identification of soluble factors mediating the beneficial effects of probiotics may present an opportunity not only to understand their fine mechanisms of action, but also to develop effective pharmacological strategies that could integrate the action of treatments with live bacteria. PMID:25291118

  17. Learning Risk Factors for Suicide: A Scenario-Based Activity

    ERIC Educational Resources Information Center

    Madson, Laura; Vas, Corey J.

    2003-01-01

    We created a classroom activity to illustrate factors that may predict suicide. In the activity, students rank 4 fictional individuals in terms of their relative risk for attempting or committing suicide. Students described the activity as "eye-opening," and students who participated in the activity learned more about the warning signs of an…

  18. Posttranslational modifications and activity of natural and recombinant tissue factor

    PubMed Central

    Butenas, Saulius; Krudysz-Amblo, Jolanta; Mann, Kenneth G

    2010-01-01

    Tissue factor is a membrane protein, which in a complex with factor VIIa initiates in vivo blood coagulation. Due to the scarcity of natural tissue factor protein, most studies have relied upon recombinant tissue factor forms. However, there have been only cursory experimental comparisons of natural and recombinant tissue factor proteins. Our preliminary data suggested that placental tissue factor in a complex with factor VIIa was more efficient activator of factor X than the recombinant protein. After deglycosylation, both forms of tissue factor showed almost an identical activity in the extrinsic factor Xase. Analyses using tryptic digestion and mass-spectrometry revealed that the levels of glycosylation and the composition of carbohydrates present in natural placental tissue factor were different than those in its recombinant counterpart. These data indicate that natural and recombinant tissue factor proteins differ in their posttranslational modifications and that these differences translate into different cofactor activity. Thus the use of recombinant tissue factor proteins for the quantitation of natural tissue factor is misleading. PMID:20138335

  19. The Micro-Angiographic Fluoroscope (MAF) in High Definition (HD) Mode for Improved Contrast-to-Noise Ratio and Resolution in Fluoroscopy and Roadmapping

    PubMed Central

    Panse, Ashish; Ionita, C. N.; Wang, W.; Natarajan, S. K.; Jain, A.; Bednarek, D. R.; Rudin, S.

    2011-01-01

    During image guided interventional procedures, superior resolution and image quality is critically important. Operating the MAF in the new High Definition (HD) fluoroscopy mode provides high resolution and increased contrast-to-noise ratio. The MAF has a CCD camera and a 300 micron cesium iodide x-ray convertor phosphor coupled to a light image intensifier (LII) through a fiber-optic taper. The MAF captures 1024 × 1024 pixels with an effective pixel size of 35 microns, and is capable of real-time imaging at 30 fps. The HD mode uses the advantages of higher exposure along with a small focal spot effectively improving the contrast-to-noise ratio (CNR) and the spatial resolution. The Control Acquisition Processing and Image Display System (CAPIDS) software for the MAF controls the LII gain. The interventionalist can select either fluoroscopic or angiographic modes using the two standard foot pedals. When improved image quality is needed and the angiography footpedal is used for HD mode, the x-ray machine will operate at a preset higher exposure rate using a small focal spot, while the CAPIDS will automatically adjust the LII gain to achieve proper image brightness. HD mode fluoroscopy and roadmapping are thus achieved conveniently during the interventional procedure. For CNR and resolution evaluation we used a bar phantom with images taken in HD mode with both the MAF and a Flat Panel Detector (FPD). It was seen that the FPD could not resolve more than 2.8 lp/mm whereas the MAF could resolve more than 5 lp/mm. The CNR of the MAF was better than that of the FPD by 60% at lower frequencies and by 600% at the Nyquist frequency of the FPD. The HD mode has become the preferred mode during animal model interventions because it enables detailed features of endovascular devices such as stent struts to be visualized clearly for the first time. Clinical testing of the MAF in HD mode is imminent. PMID:21766062

  20. The Micro-Angiographic Fluoroscope (MAF) in High Definition (HD) Mode for Improved Contrast-to-Noise Ratio and Resolution in Fluoroscopy and Roadmapping.

    PubMed

    Panse, Ashish; Ionita, C N; Wang, W; Natarajan, S K; Jain, A; Bednarek, D R; Rudin, S

    2010-10-30

    During image guided interventional procedures, superior resolution and image quality is critically important. Operating the MAF in the new High Definition (HD) fluoroscopy mode provides high resolution and increased contrast-to-noise ratio. The MAF has a CCD camera and a 300 micron cesium iodide x-ray convertor phosphor coupled to a light image intensifier (LII) through a fiber-optic taper. The MAF captures 1024 × 1024 pixels with an effective pixel size of 35 microns, and is capable of real-time imaging at 30 fps. The HD mode uses the advantages of higher exposure along with a small focal spot effectively improving the contrast-to-noise ratio (CNR) and the spatial resolution. The Control Acquisition Processing and Image Display System (CAPIDS) software for the MAF controls the LII gain. The interventionalist can select either fluoroscopic or angiographic modes using the two standard foot pedals. When improved image quality is needed and the angiography footpedal is used for HD mode, the x-ray machine will operate at a preset higher exposure rate using a small focal spot, while the CAPIDS will automatically adjust the LII gain to achieve proper image brightness. HD mode fluoroscopy and roadmapping are thus achieved conveniently during the interventional procedure. For CNR and resolution evaluation we used a bar phantom with images taken in HD mode with both the MAF and a Flat Panel Detector (FPD). It was seen that the FPD could not resolve more than 2.8 lp/mm whereas the MAF could resolve more than 5 lp/mm. The CNR of the MAF was better than that of the FPD by 60% at lower frequencies and by 600% at the Nyquist frequency of the FPD. The HD mode has become the preferred mode during animal model interventions because it enables detailed features of endovascular devices such as stent struts to be visualized clearly for the first time. Clinical testing of the MAF in HD mode is imminent. PMID:21766062

  1. Mercury in air and plant specimens in herbaria: a pilot study at the MAF Herbarium in Madrid (Spain).

    PubMed

    Oyarzun, R; Higueras, P; Esbrí, J M; Pizarro, J

    2007-11-15

    We present data from a study of mercury concentrations in air and plant specimens from the MAF Herbarium in Madrid (Spain). Hg (gas) emissions from old plant collections treated with mercuric chloride (HgCl(2)) in herbaria may pose a health risk for staff working in installations of this type. This is an issue not yet properly addressed. Plants that underwent insecticide treatment with HgCl(2) at the MAF Herbarium until the mid 1970s have persistent high concentrations of Hg in the range 1093-11,967 microg g(-1), whereas untreated specimens are in the range of 1.2-4.3 microg g(-1). The first group induces high concentrations of Hg (gas) in the main herbarium room, with seasonal variations of 404-727 ng m(-3) (late winter) and 748-7797 ng m(-3) (early summer) (baseline for Hg: 8 ng m(-3)). A test survey at another herbarium in Madrid showed even higher concentrations of Hg (gas) above 40,000 ng m(-3). The World Health Organization guidelines for chronic exposure to Hg (gas) are estimated at a maximum of 1000 ng m(-3). While staff was aware of the existence of HgCl(2) treated plants (the plant specimen sheets are labelled as 'poisoned'), they had no knowledge of the presence of high Hg (gas) concentrations in the buildings, a situation that may be relatively common in herbaria. PMID:17590416

  2. Reduction of salivary tissue factor (thromboplastin) activity by warfarin therapy.

    PubMed

    Zacharski, L R; Rosenstein, R

    1979-03-01

    The coagulant of normal human saliva has been identified as tissue factor (thromboplastin, TF) by virtue of its ability to cause rapid coagulation in plasmas deficient in first-stage coagulation factors and to activate factor x in the presence of factor VII and by virtue of the fact that its activity is expressed only in the presence of factor VII and is inhibited by an antibody to TF. The TF is related to cells and cell fragments in saliva. Salivary TF activity has been found to be significantly reduced in patients taking warfarin. The decline in TF activity during induction of warfarin anticoagulation occurs during the warfarin-induced decline in vitamin-K-dependent clotting factor activity, as judged by the prothrombin time. The decrease in TF activity is not related to a reduction in salivary cell count or total protein content or to a direct effect of warfarin on the assay. It is hypothesized that the mechanism by which warfarin inhibits TF activity may be related to the mechanism by which it inhibits expression of the activity of the vitamin-K-dependent clotting factors. Inhibition of the TF activity may be involved in the antithrombotic effect of warfarin. PMID:760859

  3. Influencing Factors of Thermogenic Adipose Tissue Activity

    PubMed Central

    Zhang, Guoqing; Sun, Qinghua; Liu, Cuiqing

    2016-01-01

    Obesity is an escalating public health challenge and contributes tremendously to the disease burden globally. New therapeutic strategies are required to alleviate the health impact of obesity-related metabolic dysfunction. Brown adipose tissue (BAT) is specialized for dissipating chemical energy for thermogenesis as a defense against cold environment. Intriguingly, the brown-fat like adipocytes that dispersed throughout white adipose tissue (WAT) in rodents and humans, called “brite” or “beige” adipocytes, share similar thermogenic characteristics to brown adipocytes. Recently, researchers have focused on cognition of these thermogenic adipose tissues. Some factors have been identified to regulate the development and function of thermogenic adipose tissues. Cold exposure, pharmacological conditions, and lifestyle can enhance non-shivering thermogenesis and metabolism via some mechanisms. However, environmental pollutants, such as ambient fine particulates and ozone, may impair the function of these thermogenic adipose tissues and thereby induce metabolic dysfunction. In this review, the origin, function and influencing factors of thermogenic adipose tissues were summarized and it will provide insights into identifying new therapeutic strategies for the treatment of obesity and obesity-related diseases. PMID:26903879

  4. Influencing Factors of Thermogenic Adipose Tissue Activity.

    PubMed

    Zhang, Guoqing; Sun, Qinghua; Liu, Cuiqing

    2016-01-01

    Obesity is an escalating public health challenge and contributes tremendously to the disease burden globally. New therapeutic strategies are required to alleviate the health impact of obesity-related metabolic dysfunction. Brown adipose tissue (BAT) is specialized for dissipating chemical energy for thermogenesis as a defense against cold environment. Intriguingly, the brown-fat like adipocytes that dispersed throughout white adipose tissue (WAT) in rodents and humans, called "brite" or "beige" adipocytes, share similar thermogenic characteristics to brown adipocytes. Recently, researchers have focused on cognition of these thermogenic adipose tissues. Some factors have been identified to regulate the development and function of thermogenic adipose tissues. Cold exposure, pharmacological conditions, and lifestyle can enhance non-shivering thermogenesis and metabolism via some mechanisms. However, environmental pollutants, such as ambient fine particulates and ozone, may impair the function of these thermogenic adipose tissues and thereby induce metabolic dysfunction. In this review, the origin, function and influencing factors of thermogenic adipose tissues were summarized and it will provide insights into identifying new therapeutic strategies for the treatment of obesity and obesity-related diseases. PMID:26903879

  5. Pathogenic significance of alpha-N-acetylgalactosaminidase activity found in the envelope glycoprotein gp160 of human immunodeficiency virus Type 1.

    PubMed

    Yamamoto, Nobuto

    2006-03-01

    Serum vitamin D3-binding protein (Gc protein) is the precursor for the principal macrophage-activating factor (MAF). The precursor activity of serum Gc protein was lost or reduced in HIV-infected patients. These patient sera contained alpha-N-acetylgalactosaminidase (Nagalase), which deglycosylates serum Gc protein. Deglycosylated Gc protein cannot be converted to MAF and thus loses MAF precursor activity, leading to immunosuppression. Nagalase in the blood stream of HIV-infected patients was complexed with patient immunoglobulin G, suggesting that this enzyme is immunogenic, seemingly a viral gene product. In fact, Nagalase was inducible by treatment of cultures of HIV-infected patient peripheral blood mononuclear cells with a provirus-inducing agent. This enzyme was immunoprecipitable with polyclonal anti-HIV but not with anticellular constitutive enzyme or with antitumor Nagalase. The kinetic parameters (km value of 1.27 mM and pH optimum of 6.1), of the patient serum Nagalase were distinct from those of constitutive enzyme (km value of 4.83 mM and pH optimum of 4.3). This glycosidase should reside on an envelope protein capable of interacting with cellular membranous O-glycans. Although cloned gp160 exhibited no Nagalase activity, treatment of gp160 with trypsin expressed Nagalase activity, suggesting that proteolytic cleavage of gp160 to generate gp120 and gp41 is required for Nagalase activity. Cloned gp120 exhibited Nagalase activity while cloned gp41 showed no Nagalase activity. Since proteolytic cleavage of protein gp160 is required for expression of both fusion capacity and Nagalase activity, Nagalase seems to be an enzymatic basis for fusion in the infectious process. Therefore, Nagalase appears to play dual roles in viral infectivity and immunosuppression. PMID:16545013

  6. Factor XI and Contact Activation as Targets for Antithrombotic Therapy

    PubMed Central

    Gailani, David; Bane, Charles E.; Gruber, Andras

    2015-01-01

    Summary The most commonly used anticoagulants produce therapeutic antithrombotic effects either by inhibiting thrombin or factor Xa, or by lowering the plasma levels of the precursors of these key enzymes, prothrombin and factor X. These drugs do not distinguish between thrombin generation contributing to thrombosis from thrombin generation required for hemostasis. Thus, anticoagulants increase bleeding risk, and many patients who would benefit from therapy go untreated because of comorbidities that place them at unacceptable risk for hemorrhage. Studies in animals demonstrate that components of the plasma contact activation system contribute to experimentally-induced thrombosis, despite playing little or no role in hemostasis. Attention has focused on factor XII, the zymogen of a protease (factor XIIa) that initiates contact activation when blood is exposed to foreign surfaces; and factor XI, the zymogen of the protease factor XIa, which links contact activation to the thrombin generation mechanism. In the case of factor XI, epidemiologic data indicate this protein contributes to stroke and venous thromboembolism, and perhaps myocardial infarction, in humans. A phase 2 trial showing that reduction of factor XI may be more effective than low-molecular-weight heparin at preventing venous thrombosis during knee replacement surgery provides proof of concept for the premise that an antithrombotic effect can be uncoupled from an anticoagulant effect in humans by targeting components of contact activation. Here we review data on the role of factor XI and factor XII in thrombosis, and results of pre-clinical and human trials for therapies targeting these proteins. PMID:25976012

  7. Loss of p53 exacerbates multiple myeloma phenotype by facilitating the reprogramming of hematopoietic stem/progenitor cells to malignant plasma cells by MafB

    PubMed Central

    Vicente-Dueñas, Carolina; González-Herrero, Inés; Cenador, María Begoña García; Criado, Francisco Javier García; Sánchez-García, Isidro

    2012-01-01

    Multiple myeloma (MM) is a serious, mostly incurable human cancer of malignant plasma cells. Chromosomal translocations affecting MAFB are present in a significant percentage of multiple myeloma patients. Genetically engineered Sca1-MafB mice, in which MafB expression is limited to hematopoietic stem/progenitor cells (HS/P-Cs), display the phenotypic features of MM. Contrary to many other types of cancer, it is not yet known if the p53 gene plays any essential role in the pathogenesis of this disease. Here, we show, taking advantage of the Sca1-MafB MM mouse model, that loss of p53 does not rescue the multiple myeloma disease, but instead accelerates its development and exacerbates the MM phenotype. Therefore, the efficiency of the MafB-induced MM reprogramming of normal HS/P-Cs to terminally differentiated malignant plasma cells is enhanced by p53 deficiency, in analogy to what happens in reprogramming to pluripotency. These results raise caution about interfering with p53 function when treating multiple myeloma. PMID:22983007

  8. ANALYSIS OF ARACHIDONIC ACID METABOLITE AND PLATELET ACTIVATING FACTOR PRODUCTION

    EPA Science Inventory

    Metabolites of arachidonic acid ("eicosanoids") and platelet activating factor are important bioactive lipids that may be involved in the pathobiological alterations in animals induced by pollutant exposure. nalysis of these substances in biological tissue and fluids is important...

  9. Activation of factor XII and prekallikrein with cholesterol sulfate.

    PubMed

    Shimada, T; Kato, H; Iwanaga, S; Iwamori, M; Nagai, Y

    1985-04-01

    Cholesterol sulfate was found to display a strong ability to trigger the activation of Factor XII and prekallikrein in the presence of HMW kininogen. Other sulfate ester derivatives of testosterone, estrone, pregnenolone and dehydroepiandrosterone and cholesterol tested did not show any effect on the activation of Factor XII and prekallikrein. The activity of cholesterol acetate and sulfodeoxycholic acid was very weak. Cholesterol sulfate markedly shortened the partial thromboplastin time of normal human plasma, but not plasmas deficient in Factor XII, Factor XI and HMW kininogen. Upon prolonged incubation, the partial thromboplastin time of prekallikrein-deficient plasma was also shortened. Moreover, as well as kaolin and sulfatide, cholesterol sulfate shortened the partial thromboplastin time of plasmas from monkey, dog, rat, guinea pig, sheep, cow, hog and horse, but not from duck and chicken. Since cholesterol sulfate is distributed in erythrocytes, various organs and body fluids, it may play an important role in the activation of the intrinsic blood coagulation system. PMID:3847226

  10. The dimeric structure of factor XI and zymogen activation

    PubMed Central

    Geng, Yipeng; Verhamme, Ingrid M.; Smith, Stephen B.; Sun, Mao-fu; Matafonov, Anton; Cheng, Qiufang; Smith, Stephanie A.; Morrissey, James H.

    2013-01-01

    Factor XI (fXI) is a homodimeric zymogen that is converted to a protease with 1 (1/2-fXIa) or 2 (fXIa) active subunits by factor XIIa (fXIIa) or thrombin. It has been proposed that the dimeric structure is required for normal fXI activation. Consistent with this premise, fXI monomers do not reconstitute fXI-deficient mice in a fXIIa-dependent thrombosis model. FXI activation by fXIIa or thrombin is a slow reaction that can be accelerated by polyanions. Phosphate polymers released from platelets (poly-P) can enhance fXI activation by thrombin and promote fXI autoactivation. Poly-P increased initial rates of fXI activation 30- and 3000-fold for fXIIa and thrombin, respectively. FXI monomers were activated more slowly than dimers by fXIIa in the presence of poly-P. However, this defect was not observed when thrombin was the activating protease, nor during fXI autoactivation. The data suggest that fXIIa and thrombin activate fXI by different mechanisms. FXIIa may activate fXI through a trans-activation mechanism in which the protease binds to 1 subunit of the dimer, while activating the other subunit. For activation by thrombin, or during autoactivation, the data support a cis-activation mechanism in which the activating protease binds to and activates the same fXI subunit. PMID:23515926

  11. Differential proteolytic activation of factor VIII-von Willebrand factor complex by thrombin

    SciTech Connect

    Hill-Eubanks, D.C.; Parker, C.G.; Lollar, P. )

    1989-09-01

    Blood coagulation factor VIII (fVIII) is a plasma protein that is decreased or absent in hemophilia A. It is isolated as a mixture of heterodimers that contain a variably sized heavy chain and a common light chain. Thrombin catalyzes the activation of fVIII in a reaction that is associated with cleavages in both types of chain. The authors isolated a serine protease from Bothrops jararacussu snake venom that catalyzes thrombin-like heavy-chain cleavage but not light-chain cleavage in porcine fVIII as judged by NaDodSO{sub 4}/PAGE and N-terminal sequence analysis. Using a plasma-free assay of the ability of activated {sup 125}I-fVIII to function as a cofactor in the activation of factor X by factor IXa, they found that fVIII is activated by the venom enzyme. The venom enzyme-activated fVIII was isolated in stable form by cation-exchange HPLC. von Willebrand factor inhibited venom enzyme-activated fVIII but not thrombin-activated fVIII. These results suggest that the binding of fVIII to von Willebrand factor depends on the presence of an intact light chain and that activated fVIII must dissociate from von Willebrand factor to exert its cofactor effect. Thus, proteolytic activation of fVIII-von Willebrand factor complex appears to be differentially regulated by light-chain cleavage to dissociate the complex and heavy-chain cleavage to activate the cofactor function.

  12. Potential Role of Activating Transcription Factor 5 during Osteogenesis.

    PubMed

    Vicari, Luisa; Calabrese, Giovanna; Forte, Stefano; Giuffrida, Raffaella; Colarossi, Cristina; Parrinello, Nunziatina Laura; Memeo, Lorenzo

    2016-01-01

    Human adipose-derived stem cells are an abundant population of stem cells readily isolated from human adipose tissue that can differentiate into connective tissue lineages including bone, cartilage, fat, and muscle. Activating transcription factor 5 is a transcription factor of the ATF/cAMP response element-binding protein (CREB) family. It is transcribed in two types of mRNAs (activating transcription factor 5 isoform 1 and activating transcription factor 5 isoform 2), encoding the same single 30-kDa protein. Although it is well demonstrated that it regulates the proliferation, differentiation, and apoptosis, little is known about its potential role in osteogenic differentiation. The aim of this study was to evaluate the expression levels of the two isoforms and protein during osteogenic differentiation of human adipose-derived stem cells. Our data indicate that activating transcription factor 5 is differentially expressed reaching a peak of expression at the stage of bone mineralization. These findings suggest that activating transcription factor 5 could play an interesting regulatory role during osteogenesis, which would provide a powerful tool to study bone physiology. PMID:26770207

  13. Heme activates the heme oxygenase-1 gene in renal epithelial cells by stabilizing Nrf2.

    PubMed

    Alam, Jawed; Killeen, Erin; Gong, Pengfei; Naquin, Ryan; Hu, Bin; Stewart, Daniel; Ingelfinger, Julie R; Nath, Karl A

    2003-04-01

    The mechanism of heme oxygenase-1 gene (ho-1) activation by heme in immortalized rat proximal tubular epithelial cells was examined. Analysis of the ho-1 promoter identified the heme-responsive sequences as the stress-response element (StRE), multiple copies of which are present in two enhancer regions, E1 and E2. Electrophoretic mobility shift assays identified Nrf2, MafG, ATF3, and Jun and Fos family members as StRE-binding proteins; binding of Nrf2, MafG, and ATF3 was increased in response to heme. Dominant-negative mutants of Nrf2 and Maf, but not of c-Fos and c-Jun, inhibited basal and heme-induced expression of an E1-controlled luciferase gene. Heme did not affect the transcription activity of Nrf2, dimerization between Nrf2 and MafG, or the level of MafG, but did stimulate expression of Nrf2. Heme did not influence the level of Nrf2 mRNA but increased the half-life of Nrf2 protein from approximately 10 min to nearly 110 min. These results indicate that heme promotes stabilization of Nrf2, leading to accumulation of Nrf2. MafG dimers that bind to StREs to activate the ho-1 gene. PMID:12453873

  14. Mesenchymal stem cells inhibit complement activation by secreting factor H.

    PubMed

    Tu, Zhidan; Li, Qing; Bu, Hong; Lin, Feng

    2010-11-01

    Mesenchymal stem cells (MSCs) possess potent and broad immunosuppressive capabilities, and have shown promise in clinical trials treating many inflammatory diseases. Previous studies have found that MSCs inhibit dendritic cell, T-cell, and B-cell activities in the adaptive immunity; however, whether MSCs inhibit complement in the innate immunity, and if so, by which mechanism, have not been established. In this report, we found that MSCs constitutively secrete factor H, which potently inhibits complement activation. Depletion of factor H in the MSC-conditioned serum-free media abolishes their complement inhibitory activities. In addition, production of factor H by MSCs is augmented by inflammatory cytokines TNF-α and interferon-γ (IFN-γ) in dose- and time-dependent manners, while IL-6 does not have a significant effect. Furthermore, the factor H production from MSCs is significantly suppressed by the prostaglandin E2 (PGE2) synthesis inhibitor indomethacin and the indoleamine 2,3-dioxygenase (IDO) inhibitor 1-methyl-d-tryptophan (1-MT), both of which inhibitors are known to efficiently dampen MSCs immunosuppressive activity. These results indicate that MSCs inhibit complement activation by producing factor H, which could be another mechanism underlying MSCs broad immunosuppressive capabilities. PMID:20163251

  15. Formation of tissue factor activity following incubation of recombinant human tissue factor apoprotein with plasma lipoproteins

    SciTech Connect

    Sakai, T.; Kisiel, W. )

    1990-11-01

    Incubation of recombinant human tissue factor apoprotein (Apo-TF) with human plasma decreased the recalcified clotting time of this plasma in a time-and dose-dependent manner suggesting relipidation of the Apo-TF by plasma lipoproteins. Incubation of Apo-TF with purified preparations of human very low density, low density and high density lipoproteins resulted in tissue factor activity in a clotting assay. The order of effectiveness was VLDL greater than LDL much greater than HDL. Tissue factor activity generated by incubation of a fixed amount of Apo-TF with plasma lipoproteins was lipoprotein concentration-dependent and saturable. The association of Apo-TF with lipoprotein particles was supported by gel filtration studies in which {sup 125}I-Apo-TF coeluted with the plasma lipoprotein in the void volume of a Superose 6 column in the presence and absence of calcium ions. In addition, void-volume Apo-TF-lipoprotein fractions exhibited tissue factor activity. These results suggest that the factor VIII-bypassing activity of bovine Apo-TF observed in a canine hemophilic model may be due, in part, to its association with plasma lipoproteins and expression of functional tissue factor activity.

  16. Changes in CVD risk factors in the activity counseling trial

    PubMed Central

    Baruth, Meghan; Wilcox, Sara; Sallis, James F; King, Abby C; Marcus, Bess H; Blair, Steven N

    2011-01-01

    Primary care facilities may be a natural setting for delivering interventions that focus on behaviors that improve cardiovascular disease (CVD) risk factors. The purpose of this study was to examine the 24-month effects of the Activity Counseling Trial (ACT) on CVD risk factors, to examine whether changes in CVD risk factors differed according to baseline risk factor status, and to examine whether changes in fitness were associated with changes in CVD risk factors. ACT was a 24-month multicenter randomized controlled trial to increase physical activity. Participants were 874 inactive men and women aged 35–74 years. Participants were randomly assigned to one of three arms that varied by level of counseling, intensity, and resource requirements. Because there were no significant differences in change over time between arms on any of the CVD risk factors examined, all arms were combined, and the effects of time, independent of arm, were examined separately for men and women. Time × Baseline risk factor status interactions examined whether changes in CVD risk factors differed according to baseline risk factor status. Significant improvements in total cholesterol, high-density lipoprotein cholesterol (HDL-C) and low-density lipoprotein cholesterol, the ratio of total cholesterol to HDL-C, and triglycerides were seen in both men and women who had high (or low for HDL-C) baseline levels of risk factors, whereas significant improvements in diastolic blood pressure were seen only in those men with high baseline levels. There were no improvements in any risk factors among participants with normal baseline levels. Changes in fitness were associated with changes in a number of CVD risk factors. However, most relationships disappeared after controlling for changes in body weight. Improvements in lipids from the ACT interventions could reduce the risk of coronary heart disease in people with already high levels of lipids by 16%–26% in men and 11%–16% in women

  17. Reduced serum inhibition of platelet-activating factor activity in preeclampsia.

    PubMed

    Benedetto, C; Massobrio, M; Bertini, E; Abbondanza, M; Enrieu, N; Tetta, C

    1989-01-01

    We determined in normal nonpregnant (group 1) women, normal pregnant (group 2) women, and patients with preeclampsia (group 3) the serum inhibition of platelet-activating factor activity, the presence of detectable amounts of platelet-activating factor in the blood, and platelet responsiveness in vitro to platelet-activating factor, and to other agonists (adenosine diphosphate, collagen, and ristocetin), and prostacyclin (prostaglandin I2). In patients with preeclampsia (group 3) the serum inhibition of platelet-activating factor activity was significantly lower than that in groups 1 and 2. However, no detectable amounts of platelet-activating factor were observed. The mean values of platelet aggregation induced by platelet-activating factor, adenosine diphosphate, collagen and ristocetin, and the prostaglandin I2-inhibitory concentration of 50% which is inversely correlated with platelet sensitivity to prostaglandin I2, were not significantly different between groups 2 and 3. It is suggested that in preeclampsia the defect in serum inhibitory potential of platelet-activating factor--induced platelet aggregation may contribute to the disturbance in the homeostatic balance between proaggregant and antiaggregant substances. PMID:2912073

  18. In vivo activation and functions of the protease factor XII.

    PubMed

    Björkqvist, Jenny; Nickel, Katrin F; Stavrou, Evi; Renné, Thomas

    2014-11-01

    Combinations of proinflammatory and procoagulant reactions are the unifying principle for a variety of disorders affecting the cardiovascular system. Factor XII (FXII, Hageman factor) is a plasma protease that initiates the contact system. The biochemistry of the contact system in vitro is well understood; however, its in vivo functions are just beginning to emerge. The current review concentrates on activators and functions of the FXII-driven contact system in vivo. Elucidating its physiologic activities offers the exciting opportunity to develop strategies for the safe interference with both thrombotic and inflammatory diseases. PMID:25187064

  19. Protease-induced immunoregulatory activity of platelet factor 4.

    PubMed Central

    Katz, I R; Thorbecke, G J; Bell, M K; Yin, J Z; Clarke, D; Zucker, M B

    1986-01-01

    Intravenous injection of human or mouse serum or platelet material secreted from appropriately stimulated platelets ("releasate") together with antigen alleviates the immunosuppression in SJL/J mice induced by injection of irradiated lymphoma cells or in (CB6)F1 mice induced by injection of concanavalin A. We now report that injection of releasate from 10(6) human platelets restores plaque-forming cells to the unsuppressed number; greater amounts increase responses further. Immunoregulatory activity is released from platelets exposed to thrombin in parallel with other alpha-granule components. Heparin-agarose absorbs activity. Purified platelet factor 4 (PF4) has activity; beta-thromboglobulin and platelet-derived growth factor have little or none. Activity in serum is neutralized by goat anti-human PF4. An enzymatic step is necessary for production of immunoregulatory activity. Releasates boiled immediately after platelet aggregation with 250 nM A23187 or those produced by adding A23187 in the presence of 100 microM serine protease inhibitor (p-amidinophenyl)methanesulfonyl fluoride (APMSF) are ineffective, whereas releasates boiled or mixed with APMSF after incubation for 60 min are active. Activity is generated by incubating a mixture of heparin-absorbed releasate (as enzyme source) and heparin-agarose eluate of releasate made in the presence of APMSF (as substrate source). The enzymatic step does not alter the heparin-neutralizing activity of PF4. Apparently a secreted platelet protease converts PF4 to a form with immunoregulatory activity. PMID:3517862

  20. Activated factor XI increases the procoagulant activity of the extrinsic pathway by inactivating tissue factor pathway inhibitor

    PubMed Central

    Tucker, Erik I.; Matafonov, Anton; Cheng, Qiufang; Zientek, Keith D.; Gailani, Dave; Gruber, András; McCarty, Owen J. T.

    2015-01-01

    Activation of coagulation factor XI (FXI) may play a role in hemostasis. The primary substrate of activated FXI (FXIa) is FIX, leading to FX activation (FXa) and thrombin generation. However, recent studies suggest the hemostatic role of FXI may not be restricted to the activation of FIX. We explored whether FXI could interact with and inhibit the activity of tissue factor pathway inhibitor (TFPI). TFPI is an essential reversible inhibitor of activated factor X (FXa) and also inhibits the FVIIa-TF complex. We found that FXIa neutralized both endothelium- and platelet-derived TFPI by cleaving the protein between the Kunitz (K) 1 and K2 domains (Lys86/Thr87) and at the active sites of the K2 (Arg107/Gly108) and K3 (Arg199/Ala200) domains. Addition of FXIa to plasma was able to reverse the ability of TFPI to prolong TF-initiated clotting times in FXI- or FIX-deficient plasma, as well as FXa-initiated clotting times in FX-deficient plasma. Treatment of cultured endothelial cells with FXIa increased the generation of FXa and promoted TF-dependent fibrin formation in recalcified plasma. Together, these results suggest that the hemostatic role of FXIa may be attributed not only to activation of FIX but also to promoting the extrinsic pathway of thrombin generation through inactivation of TFPI. PMID:25587039

  1. Activated factor XI increases the procoagulant activity of the extrinsic pathway by inactivating tissue factor pathway inhibitor.

    PubMed

    Puy, Cristina; Tucker, Erik I; Matafonov, Anton; Cheng, Qiufang; Zientek, Keith D; Gailani, Dave; Gruber, András; McCarty, Owen J T

    2015-02-26

    Activation of coagulation factor XI (FXI) may play a role in hemostasis. The primary substrate of activated FXI (FXIa) is FIX, leading to FX activation (FXa) and thrombin generation. However, recent studies suggest the hemostatic role of FXI may not be restricted to the activation of FIX. We explored whether FXI could interact with and inhibit the activity of tissue factor pathway inhibitor (TFPI). TFPI is an essential reversible inhibitor of activated factor X (FXa) and also inhibits the FVIIa-TF complex. We found that FXIa neutralized both endothelium- and platelet-derived TFPI by cleaving the protein between the Kunitz (K) 1 and K2 domains (Lys86/Thr87) and at the active sites of the K2 (Arg107/Gly108) and K3 (Arg199/Ala200) domains. Addition of FXIa to plasma was able to reverse the ability of TFPI to prolong TF-initiated clotting times in FXI- or FIX-deficient plasma, as well as FXa-initiated clotting times in FX-deficient plasma. Treatment of cultured endothelial cells with FXIa increased the generation of FXa and promoted TF-dependent fibrin formation in recalcified plasma. Together, these results suggest that the hemostatic role of FXIa may be attributed not only to activation of FIX but also to promoting the extrinsic pathway of thrombin generation through inactivation of TFPI. PMID:25587039

  2. Factors limiting microbial activity in volcanic tuff at Yucca Mountain

    SciTech Connect

    Kieft, T.L.; Kovacik, W.P.; Taylor, J.

    1996-09-01

    Samples of tuff aseptically collected from 10 locations in the Exploratory Shaft Facility at the site of the proposed high-level nuclear waste repository at Yucca Mountain, Nevada Test Site were analyzed for microbiological populations, activities, and factors limiting microbial activity. Radiotracer assays ({sup 14}C-labeled organic substrate mineralization), direct microscopic counts, and plate counts were used. Radiolabeled substrates were glucose, acetate, and glutamate. Radiotracer experiments were carried out with and without moisture and inorganic nutrient amendments to determine factors limiting to microbial activities. Nearly all samples showed the presence of microorganisms with the potential to mineralize organic substrates. Addition of inorganic nutrients stimulated activities in a small number of samples. The presence of viable microbial communities within the tuff has implications for transport of contaminants.

  3. Surface-Energy Dependent Contact Activation of Blood Factor XII

    PubMed Central

    Golas, Avantika; Parhi, Purnendu; Dimachkie, Ziad O.; Siedlecki, Christopher A.; Vogler, Erwin A.

    2009-01-01

    Contact activation of blood factor XII (FXII, Hageman factor) in neat-buffer solution exhibits a parabolic profile when scaled as a function of silanized-glass-particle activator surface energy (measured as advancing water adhesion tension τao=γlvocosθ in dyne/cm, where γlvo is water interfacial tension in dyne/cm and θ is the advancing contact angle). Nearly equal activation is observed at the extremes of activator water-wetting properties −36<τao<72 dyne/cm (0° ≤ θ < 120°), falling sharply through a broad minimum within the 20<τao<40 dyne/cm (55° < θ < 75°) range over which activation yield (putatively FXIIa) rises just above detection limits. Activation is very rapid upon contact with all activators tested and did not significantly vary over 30 minutes of continuous FXII-procoagulant contact. Results suggest that materials falling within the 20<τao<40 dyne/cm surface-energy range should exhibit minimal activation of blood-plasma coagulation through the intrinsic pathway. Surface chemistries falling within this range are, however, a perplexingly difficult target for surface engineering because of the critical balance that must be struck between hydrophobicity and hydrophilicity. Results are interpreted within the context of blood plasma coagulation and the role of water and proteins at procoagulant surfaces. PMID:19892397

  4. Factors Influencing Teachers' Engagement in Informal Learning Activities

    ERIC Educational Resources Information Center

    Lohman, Margaret C.

    2006-01-01

    Purpose: The purpose of this study is to examine factors influencing the engagement of public school teachers in informal learning activities. Design/methodology/approach: This study used a survey research design. Findings: Analysis of the data found that teachers rely to a greater degree on interactive than on independent informal learning…

  5. Total Chemical Synthesis of Biologically Active Vascular Endothelial Growth Factor

    SciTech Connect

    Mandal, Kalyaneswar; Kent, Stephen B.H.

    2011-09-15

    The 204-residue covalent-dimer vascular endothelial growth factor (VEGF, see picture) with full mitogenic activity was prepared from three unprotected peptide segments by one-pot native chemical ligations. The covalent structure of the synthetic VEGF was confirmed by precise mass measurement, and the three-dimensional structure of the synthetic protein was determined by high-resolution X-ray crystallography.

  6. Factors Influencing Active Learning in Small Enterprises. Working Paper.

    ERIC Educational Resources Information Center

    Hawke, Geof

    The factors influencing active learning in small enterprises were examined. Data from earlier Australian studies were examined in an attempt to provide a framework that might inform the relationship between educational systems and small enterprises. Special attention was paid to a 1988 study of systematic differences between small businesses that…

  7. Characterization and estrogen regulation of uterine growth factor activity

    SciTech Connect

    Beck, C.A.

    1988-01-01

    Acid extracts of rat, bovine and rabbit uterus stimulated glucose transport, measured by phosphorylation of 2-deoxyglucose and DNA synthesis, measured by {sup 3}H-thymidne incorporation, in uterine tumor cells and in primary cultures of rat uterine cells. The stimulation of glucose transport was of the same magnitude and followed the same time course as estradiol stimulation in vivo. Uteri from estradiol-treated rat uteri contained 4 times more glucose transport-stimulating activity as control uteri. DNA synthetic activity in rat uterine homogenates was elevated 3-fold within 18-24 h after estradiol injection. Gel filtration showed molecular weight heterogeneity with activity eluting between 10-30 kDA. Both activities were acid and heat stable, were reduced by trypsin but not by dextran-coated charcoal. The effect of purified growth factors on DNA synthesis in primary cultures of rat uterine cells was examined. Epidermal growth factor (EGF), basic fibroblasts growth factor (bFGF), and transforming growth factor-{beta} (TGF{beta}) had no effect on {sup 3}H-thymidine incorporation.

  8. The Relevant Factors in Promoting Reading Activities in Elementary Schools

    ERIC Educational Resources Information Center

    Huang, Han-Chen; Tsai, Yao-Hsu; Huang, Shih-Hsiang

    2015-01-01

    In order to help students absorb knowledge, schools often conduct reading activities. Thorough planning and strategies, however, are needed to insure the effect of reading promotions, and make them a deeply-rooted part of life. This study adopted the analytic hierarchy process (AHP) to discuss the relevant factors in promoting reading activities…

  9. Platelet activating factor: regulation by mast cells and aspirin.

    PubMed

    Denburg, J A; Williams, D B; Kinlough-Rathbone, R L; Cazenave, J P; Bienenstock, J

    1984-02-01

    We have investigated some aspects of the regulation of production of rat platelet activating factor (PAF)2 in vitro. Suspensions of unseparated (PLC1), mast cell-depleted (PLC2), or mast cell (MC)-enriched rat peritoneal lavage cells (PLC) were analyzed for PAF content by extraction at alkaline pH. PAF activity extracted from PLC1 varied inversely with viable cell concentration: at 1 X 10(6) cells/ml, 32 +/- 9.3 PAF units, decreasing to 11.2 +/- 9.5 units at 10 X 10(6) cells/ml, and no activity at higher concentrations. Incubation of PLC1 in Tyrode's buffer or acetylsalicylic acid (ASA), but not salicylate, resulted in a time-dependent loss of PAF activity. Mean PAF activity of PLC2 was similar to that in PLC1, while no PAF activity was extractable from MC. Co-incubation with MC extracts inhibited PAF activity of PLC1 extracts in a dose-dependent fashion. Ultracentrifugation of PAF-containing samples led to a loss of all PAF activity in PLC1 extracts, suggesting the association of PAF activity with subcellular components. PAF appears to be derived from a non-MC population of rat PLC, is not extractable from rat PLC in the presence of ASA and is inhibited by MC extracts. These studies suggest that ASA regulates PAF availability unrelated to its effect on cyclooxygenase and that MC membrane products directly inhibit PAF activity from rat PLC. PMID:6711391

  10. Psychosocial Factors and Theory in Physical Activity Studies in Minorities

    PubMed Central

    Mama, Scherezade K.; McNeill, Lorna H.; McCurdy, Sheryl A.; Evans, Alexandra E.; Diamond, Pamela M.; Adamus-Leach, Heather J.; Lee, Rebecca E.

    2015-01-01

    Objectives To summarize the effectiveness of interventions targeting psychosocial factors to increase physical activity (PA) among ethnic minority adults and explore theory use in PA interventions. Methods Studies (N = 11) were identified through a systematic review and targeted African American/Hispanic adults, specific psychosocial factors, and PA. Data were extracted using a standard code sheet and the Theory Coding Scheme. Results Social support was the most common psychosocial factor reported, followed by motivational readiness, and self-efficacy, as being associated with increased PA. Only 7 studies explicitly reported using a theoretical framework. Conclusions Future efforts should explore theory use in PA interventions and how integration of theoretical constructs, including psychosocial factors, increases PA. PMID:25290599

  11. LPS-inducible factor(s) from activated macrophages mediates cytolysis of Naegleria fowleri amoebae

    SciTech Connect

    Cleary, S.F.; Marciano-Cabral, F.

    1986-03-01

    Soluble cytolytic factors of macrophage origin have previously been described with respect to their tumoricidal activity. The purpose of this study was to investigate the mechanism and possible factor(s) responsible for cytolysis of the amoeba Naegleria fowleri by activated peritoneal macrophages from B6C3F1 mice. Macrophages or conditioned medium (CM) from macrophage cultures were incubated with /sup 3/H-Uridine labeled amoebae. Percent specific release of label served as an index of cytolysis. Bacille Calmette-Guerin (BCG) and Corynebacterium parvum macrophages demonstrated significant cytolysis of amoebae at 24 h with an effector to target ratio of 10:1. Treatment of macrophages with inhibitors of RNA or protein synthesis blocked amoebicidal activity. Interposition of a 1 ..mu..m pore membrane between macrophages and amoebae inhibited killing. Inhibition in the presence of the membrane was overcome by stimulating the macrophages with LPS. CM from SPS-stimulated, but not unstimulated, cultures of activated macrophages was cytotoxic for amoebae. The activity was heat sensitive and was recovered from ammonium sulfate precipitation of the CM. Results indicate that amoebicidal activity is mediated by a protein(s) of macrophage origin induced by target cell contact or stimulation with LPS.

  12. IL-1R/TLR2 through MyD88 Divergently Modulates Osteoclastogenesis through Regulation of Nuclear Factor of Activated T Cells c1 (NFATc1) and B Lymphocyte-induced Maturation Protein-1 (Blimp1).

    PubMed

    Chen, Zhihong; Su, Lingkai; Xu, Qingan; Katz, Jenny; Michalek, Suzanne M; Fan, Mingwen; Feng, Xu; Zhang, Ping

    2015-12-11

    Toll-like receptors (TLR) and the receptor for interleukin-1 (IL-1R) signaling play an important role in bacteria-mediated bone loss diseases including periodontitis, rheumatoid arthritis, and osteomyelitis. Recent studies have shown that TLR ligands inhibit the receptor activator of NF-κB ligand (RANKL)-induced osteoclast differentiation from un-committed osteoclast precursors, whereas IL-1 potentiates RANKL-induced osteoclast formation. However, IL-1R and TLR belong to the same IL-1R/TLR superfamily, and activate similar intracellular signaling pathways. Here, we investigate the molecular mechanisms underlying the distinct effects of IL-1 and Porphyromonas gingivalis lipopolysaccharide (LPS-PG) on RANKL-induced osteoclast formation. Our results show that LPS-PG and IL-1 differentially regulate RANKL-induced activation of osteoclast genes encoding Car2, Ctsk, MMP9, and TRAP, as well as expression of NFATc1, a master transcription factor of osteoclastogenesis. Regulation of osteoclast genes and NFATc1 by LPS-PG and IL-1 is dependent on MyD88, an important signaling adaptor for both TLR and IL-1R family members. Furthermore, LPS-PG and IL-1 differentially regulate RANKL-costimulatory receptor OSCAR (osteoclast-associated receptor) expression and Ca(2+) oscillations induced by RANKL. Moreover, LPS-PG completely abrogates RANKL-induced gene expression of B lymphocyte-induced maturation protein-1 (Blimp1), a global transcriptional repressor of anti-osteoclastogenic genes encoding Bcl6, IRF8, and MafB. However, IL-1 enhances RANKL-induced blimp1 gene expression but suppresses the gene expression of bcl6, irf8, and mafb. Our study reveals the involvement of multiple signaling molecules in the differential regulation of RANKL-induced osteoclastogenesis by TLR2 and IL-1 signaling. Understanding the signaling cross-talk among TLR, IL-1R, and RANK is critical for identifying therapeutic strategies to control bacteria-mediated bone loss. PMID:26483549

  13. Factors affecting daily activities of patients with cerebral infarction

    PubMed Central

    Liu, Peng; Zhou, Cheng-ye; Zhang, Ying; Wang, Yun-feng; Zou, Chang-lin

    2010-01-01

    BACKGROUND: Stroke is the leading cause of death and long-term disability. This study was undertaken to investigate the factors influencing daily activities of patients with cerebral infarction so as to take interventional measures earlier to improve their daily activities. METHODS: A total of 149 patients with first-episode cerebral infarction were recruited into this prospective study. They were admitted to the Encephalopathy Center, Department of Neurology, the First Affiliated Hospital of Wenzhou Medical College in Zhejiang Province from August 2008 to December 2008. The baseline characteristics of the patients and cerebral infarction risk factors on the first day of admission were recorded. White blood cell (WBC) count, plasma glucose (PG), and many others of laboratory targets were collected in the next morning. Barthel index (BI) was calculated at 2 weeks and 3 months respectively after onset of the disease at the outpatient clinic or by telephone call. Lung infection, urinary tract infection and atrial fibrillation if any were recorded on admission. The National Institute of Health Stroke Scale (NIHSS) scores and the GCS scores were recorded within 24 hours on and after admission, at the second week, and at the third month after the onset of cerebral infarction respectively. RESULTS: The factors of BI at 2 weeks and 3 months after onset were the initial PG level, WBC count and initial NIHSS scores. Besides, urinary tract infection on admission was also the factor for BI at 3 months. CONCLUSION: Active measures should be taken to control these factors to improve the daily activities of patients with cerebral infarction. PMID:25214953

  14. Biosynthesis of nitric oxide activates iron regulatory factor in macrophages.

    PubMed Central

    Drapier, J C; Hirling, H; Wietzerbin, J; Kaldy, P; Kühn, L C

    1993-01-01

    Biosynthesis of nitric oxide (NO) from L-arginine modulates activity of iron-dependent enzymes, including mitochondrial acontiase, an [Fe-S] protein. We examined the effect of NO on the activity of iron regulatory factor (IRF), a cytoplasmic protein which modulates both ferritin mRNA translation and transferrin receptor mRNA stability by binding to specific mRNA sequences called iron responsive elements (IREs). Murine macrophages were activated with interferon-gamma and lipopolysaccharide to induce NO synthase activity and cultured in the presence or absence of NG-substituted analogues of L-arginine which served as selective inhibitors of NO synthesis. Measurement of the nitrite concentration in the culture medium was taken as an index of NO production. Mitochondria-free cytosols were then prepared and aconitase activity as well as IRE binding activity and induction of IRE binding activity were correlated and depended on NO synthesis after IFN-gamma and/or LPS stimulation. Authentic NO gas as well as the NO-generating compound 3-morpholinosydnonimine (SIN-1) also conversely modulated aconitase and IRE binding activities of purified recombinant IRF. These results provide evidence that endogenously produced NO may modulate the post-transcriptional regulation of genes involved in iron homeostasis and support the hypothesis that the [Fe-S] cluster of IRF mediates iron-dependent regulation. Images PMID:7504626

  15. Losac, the First Hemolin that Exhibits Procogulant Activity through Selective Factor X Proteolytic Activation*

    PubMed Central

    Alvarez-Flores, Miryam Paola; Furlin, Daniel; Ramos, Oscar H. P.; Balan, Andrea; Konno, Katsuhiro; Chudzinski-Tavassi, Ana Marisa

    2011-01-01

    Envenoming by the contact of human skin with Lonomia obliqua caterpillars promotes a hemorrhagic syndrome characterized by a consumptive coagulopathy. Losac (Lonomia obliqua Stuart factor activator) is a component of the bristle of L. obliqua that is probably partially responsible for the observed syndrome because it activates factor X and is recognized by an effective antilonomic serum. Here we unveil the proteolytic activity of Losac and demonstrate the feasibility of its recombinant production. On the other hand, Losac has no homology to known proteases, but it can be inhibited by PMSF, a serine protease inhibitor. Instead, it shows closer homology to members of the hemolin family of proteins, a group of cell adhesion molecules. The recombinant protein (rLosac) shortened the coagulation time of normal and deficient plasmas, whereas it was ineffective in factor X-deficient plasma unless reconstituted with this protein. rLosac was able to activate factor X in a dose- and time-dependent manner but not γ-carboxyglutamic acid domainless factor X. Moreover, phospholipids and calcium ions increased rLosac activity. Also, rLosac had no effect on fibrin or fibrinogen, indicating its specificity for blood coagulation activation. Linear double reciprocal plots indicate that rLosac follows a Michaelis-Menten kinetics. Cleavage of factor X by rLosac resulted in fragments that are compatible with those generated by RVV-X (a well known factor X activator). Together, our results validate Losac as the first protein from the hemolin family exhibiting procoagulant activity through selective proteolysis on coagulation factor X. PMID:21177860

  16. Selective Activation of Transcription by a Novel CCAAT Binding Factor

    NASA Astrophysics Data System (ADS)

    Maity, Sankar N.; Golumbek, Paul T.; Karsenty, Gerard; de Crombrugghe, Benoit

    1988-07-01

    A novel CCAAT binding factor (CBF) composed of two different subunits has been extensively purified from rat liver. Both subunits are needed for specific binding to DNA. Addition of this purified protein to nuclear extracts of NIH 3T3 fibroblasts stimulates transcription from several promoters including the α 2(I) collagen, the α 1(I) collagen, the Rous sarcoma virus long terminal repeat (RSV-LTR), and the adenovirus major late promoter. Point mutations in the CCAAT motif that show either no binding or a decreased binding of CBF likewise abolish or reduce activation of transcription by CBF. Activation of transcription requires, therefore, the specific binding of CBF to its recognition sites.

  17. Factors affecting the behavior of unburned carbon upon steam activation

    NASA Astrophysics Data System (ADS)

    Lu, Zhe

    The main objective of this study is to investigate the factors that could affect the behavior of unburned carbon samples upon steam activation. Through this work, the relationships among the factors that could influence the carbon-steam reaction with the surface area of the produced activated carbon were explored. Statistical analysis was used to relate the chemical and physical properties of the unburned carbon to the surface area of the activated carbon. Six unburned carbons were selected as feedstocks for activated carbon, and marked as UCA through UCF. The unburned carbons were activated using steam at 850°C for 90 minutes, and the surface areas of their activated counterparts were measured using N2 adsorption isotherms at 77K. The activated carbons produced from different unburned carbon precursors presented different surface areas at similar carbon burn-off levels. Moreover, in different carbon burn-off regions, the sequences for surface area of activated carbons from different unburned carbon samples were different. The factors that may affect the carbon-steam gasification reactions, including the concentration of carbon active sites, the crystallite size of the carbon, the intrinsic porous structure of carbon, and the inorganic impurities, were investigated. All unburned carbons investigated in this study were similar in that they showed the very broad (002) and (10 ) carbon peaks, which are characteristic of highly disordered carbonaceous materials. In this study, the unburned carbon samples contained about 17--48% of inorganic impurities. Compared to coals, the unburned carbon samples contain a larger amount of inorganic impurities as a result of the burn-off, or at lease part, of the carbon during the combustion process. These inorganic particles were divided into two groups in terms of the way they are associated with carbon particles: free single particles, and particles combined with carbon particles. As indicated from the present work, unburned

  18. The dust covering factor in active galactic nuclei

    NASA Astrophysics Data System (ADS)

    Stalevski, Marko; Ricci, Claudio; Ueda, Yoshihiro; Lira, Paulina; Fritz, Jacopo; Baes, Maarten

    2016-05-01

    The primary source of emission of active galactic nuclei (AGNs), the accretion disc, is surrounded by an optically and geometrically thick dusty structure (`the so-called dusty torus'). The infrared radiation emitted by the dust is nothing but a reprocessed fraction of the accretion disc emission, so the ratio of the torus to the AGN luminosity (Ltorus/LAGN) should corresponds to the fraction of the sky obscured by dust, i.e. the covering factor. We undertook a critical investigation of the Ltorus/LAGN as the dust covering factor proxy. Using state-of-the-art 3D Monte Carlo radiative transfer code, we calculated a grid of spectral energy distributions (SEDs) emitted by the clumpy two-phase dusty structure. With this grid of SEDs, we studied the relation between Ltorus/LAGN and the dust covering factor for different parameters of the torus. We found that in the case of type 1 AGNs the torus anisotropy makes Ltorus/LAGN underestimate low covering factors and overestimate high covering factors. In type 2 AGNs Ltorus/LAGN always underestimates covering factors. Our results provide a novel easy-to-use method to account for anisotropy and obtain correct covering factors. Using two samples from the literature, we demonstrated the importance of our result for inferring the obscured AGN fraction. We found that after the anisotropy is properly accounted for, the dust covering factors show very weak dependence on LAGN, with values in the range of ≈0.6-0.7. Our results also suggest a higher fraction of obscured AGNs at high luminosities than those found by X-ray surveys, in part owing to the presence of a Compton-thick AGN population predicted by population synthesis models.

  19. Immunoregulatory activity of peptides related to platelet factor 4.

    PubMed Central

    Zucker, M B; Katz, I R; Thorbecke, G J; Milot, D C; Holt, J

    1989-01-01

    Platelet factor 4 (PF4), a secreted platelet protein, alleviates concanavalin A-induced immunosuppression in mice. We now find that activity also resides in (i) the C-terminal tridecapeptide of PF4 (P13S), (ii) an analog of this in which arginine replaces the lysine residues and in which the last two amino acids are absent, (iii) the C-terminal 18 amino acids of low-affinity platelet factor 4, which is very similar to P13S, and (iv) peptide fragments of P13S that contain only 5-9 amino acids. P13S treated with fluorescamine to derivatize the free amino groups retained immunoregulatory activity but did not bind to heparin-agarose. The N-terminal and middle portions of PF4, polylysine, protamine, and three unrelated peptides were inactive in this assay. PMID:2678107

  20. Reliable and Affordable Control Systems Active Combustor Pattern Factor Control

    NASA Technical Reports Server (NTRS)

    McCarty, Bob; Tomondi, Chris; McGinley, Ray

    2004-01-01

    Active, closed-loop control of combustor pattern factor is a cooperative effort between Honeywell (formerly AlliedSignal) Engines and Systems and the NASA Glenn Research Center to reduce emissions and turbine-stator vane temperature variations, thereby enhancing engine performance and life, and reducing direct operating costs. Total fuel flow supplied to the engine is established by the speed/power control, but the distribution to individual atomizers will be controlled by the Active Combustor Pattern Factor Control (ACPFC). This system consist of three major components: multiple, thin-film sensors located on the turbine-stator vanes; fuel-flow modulators for individual atomizers; and control logic and algorithms within the electronic control.

  1. Stellar Activity and CMEs: Important Factors of Planetary Evolution

    NASA Astrophysics Data System (ADS)

    Khodachenko, Maxim L.

    CME activity of the Sun is known to be an important impacting factor for the magnetospheres, atmospheres, and surfaces of solar system planets. Following an idea of a solar-stellar analogy, CME phenomena are expected on other stars as well. The main planetary impact factors of the stellar CMEs include the associated interplanetary shocks, plasma density and velocity disturbances, energetic particles accelerated in the shock regions, as well as distortions of the magnetic field direction and modulus. All these factors should be properly taken into account during the study of evolutionary processes on exoplanets and their atmospheric and plasma environments. The planetary impact of the stellar CME activity may vary depending on stellar age, stellar spectral type and the orbital distance of a planet. Because of the relatively short range of propagation of the majority of CMEs, they affect most strongly the magnetospheres and atmospheres of close-orbit ( < 0.1 AU) exoplanets. In this chapter we discuss an issue of the stellar CME activity in the context of several actual problems of modern exoplanetology, including planetary atmosphere mass loss, planet survival at close orbits, and definition of a criterion for habitability.

  2. A role for factor XIIa–mediated factor XI activation in thrombus formation in vivo

    PubMed Central

    Cheng, Qiufang; Tucker, Erik I.; Pine, Meghann S.; Sisler, India; Matafonov, Anton; Sun, Mao-fu; White-Adams, Tara C.; Smith, Stephanie A.; Hanson, Stephen R.; McCarty, Owen J. T.; Renné, Thomas; Gruber, András

    2010-01-01

    Mice lacking factor XII (fXII) or factor XI (fXI) are resistant to experimentally–induced thrombosis, suggesting fXIIa activation of fXI contributes to thrombus formation in vivo. It is not clear whether this reaction has relevance for thrombosis in pri mates. In 2 carotid artery injury models (FeCl3 and Rose Bengal/laser), fXII-deficient mice are more resistant to thrombosis than fXI- or factor IX (fIX)–deficient mice, raising the possibility that fXII and fXI function in distinct pathways. Antibody 14E11 binds fXI from a variety of mammals and interferes with fXI activation by fXIIa in vitro. In mice, 14E11 prevented arterial occlusion induced by FeCl3 to a similar degree to total fXI deficiency. 14E11 also had a modest beneficial effect in a tissue factor–induced pulmonary embolism model, indicating fXI and fXII contribute to thrombus formation even when factor VIIa/tissue factor initiates thrombosis. In baboons, 14E11 reduced platelet-rich thrombus growth in collagen-coated grafts inserted into an arteriovenous shunt. These data support the hypothesis that fXIIa-mediated fXI activation contributes to thrombus formation in rodents and primates. Since fXII deficiency does not impair hemostasis, targeted inhibition of fXI activation by fXIIa may be a useful antithrombotic strategy associated with a low risk of bleeding complications. PMID:20634381

  3. Activating transcription factor 6 derepression mediates neuroprotection in Huntington disease

    PubMed Central

    Naranjo, José R.; Zhang, Hongyu; Villar, Diego; González, Paz; Dopazo, Xose M.; Morón-Oset, Javier; Higueras, Elena; Oliveros, Juan C.; Arrabal, María D.; Prieto, Angela; Cercós, Pilar; González, Teresa; De la Cruz, Alicia; Casado-Vela, Juan; Rábano, Alberto; Valenzuela, Carmen; Gutierrez-Rodriguez, Marta; Li, Jia-Yi; Mellström, Britt

    2016-01-01

    Deregulated protein and Ca2+ homeostasis underlie synaptic dysfunction and neurodegeneration in Huntington disease (HD); however, the factors that disrupt homeostasis are not fully understood. Here, we determined that expression of downstream regulatory element antagonist modulator (DREAM), a multifunctional Ca2+-binding protein, is reduced in murine in vivo and in vitro HD models and in HD patients. DREAM downregulation was observed early after birth and was associated with endogenous neuroprotection. In the R6/2 mouse HD model, induced DREAM haplodeficiency or blockade of DREAM activity by chronic administration of the drug repaglinide delayed onset of motor dysfunction, reduced striatal atrophy, and prolonged life span. DREAM-related neuroprotection was linked to an interaction between DREAM and the unfolded protein response (UPR) sensor activating transcription factor 6 (ATF6). Repaglinide blocked this interaction and enhanced ATF6 processing and nuclear accumulation of transcriptionally active ATF6, improving prosurvival UPR function in striatal neurons. Together, our results identify a role for DREAM silencing in the activation of ATF6 signaling, which promotes early neuroprotection in HD. PMID:26752648

  4. Parental Factors in Children’s Active Transport to School

    PubMed Central

    Henne, Heather M.; Tandon, Pooja S.; Frank, Larry D.; Saelens, Brian E.

    2014-01-01

    Objective Identify non-distance factors related to children’s active transport (AT) to school, including parental, home, and environment characteristics. Understanding the factors related to children’s AT to school, beyond distance to school, could inform interventions to increase AT and children’s overall physical activity. Study Design Participants were in the Neighborhood Impact on Kids Study, a longitudinal, observational cohort study of children aged 6 - 11 and their parents in King County, WA and San Diego County, CA between 2007-2009. Parents reported frequency and mode of child transport to school, perceived neighborhood, home and family environments, parental travel behaviors, and sociodemographics. Methods Children living less than a 20 minute walk to school were in this analysis. Children classified as active transporters (walked/bicycled to or from school at least once per week) were compared with those not using AT as often. Results Children using AT were older and had parents who reported themselves using active transport. Having a family rule that restricts the child to stay within sight of the parent or home and more parent working hours was related to lower odds of a child using AT. Conclusions Children’s AT to school is associated with parental AT to work and other locations. Interventions should be considered that enable whole family AT, ameliorate safety concerns and decrease the need for parental supervision, such as walking school buses. PMID:24999161

  5. Activating transcription factor 6 derepression mediates neuroprotection in Huntington disease.

    PubMed

    Naranjo, José R; Zhang, Hongyu; Villar, Diego; González, Paz; Dopazo, Xose M; Morón-Oset, Javier; Higueras, Elena; Oliveros, Juan C; Arrabal, María D; Prieto, Angela; Cercós, Pilar; González, Teresa; De la Cruz, Alicia; Casado-Vela, Juan; Rábano, Alberto; Valenzuela, Carmen; Gutierrez-Rodriguez, Marta; Li, Jia-Yi; Mellström, Britt

    2016-02-01

    Deregulated protein and Ca2+ homeostasis underlie synaptic dysfunction and neurodegeneration in Huntington disease (HD); however, the factors that disrupt homeostasis are not fully understood. Here, we determined that expression of downstream regulatory element antagonist modulator (DREAM), a multifunctional Ca2+-binding protein, is reduced in murine in vivo and in vitro HD models and in HD patients. DREAM downregulation was observed early after birth and was associated with endogenous neuroprotection. In the R6/2 mouse HD model, induced DREAM haplodeficiency or blockade of DREAM activity by chronic administration of the drug repaglinide delayed onset of motor dysfunction, reduced striatal atrophy, and prolonged life span. DREAM-related neuroprotection was linked to an interaction between DREAM and the unfolded protein response (UPR) sensor activating transcription factor 6 (ATF6). Repaglinide blocked this interaction and enhanced ATF6 processing and nuclear accumulation of transcriptionally active ATF6, improving prosurvival UPR function in striatal neurons. Together, our results identify a role for DREAM silencing in the activation of ATF6 signaling, which promotes early neuroprotection in HD. PMID:26752648

  6. Transcriptional activation in yeast cells lacking transcription factor IIA.

    PubMed Central

    Chou, S; Chatterjee, S; Lee, M; Struhl, K

    1999-01-01

    The general transcription factor IIA (TFIIA) forms a complex with TFIID at the TATA promoter element, and it inhibits the function of several negative regulators of the TATA-binding protein (TBP) subunit of TFIID. Biochemical experiments suggest that TFIIA is important in the response to transcriptional activators because activation domains can interact with TFIIA, increase recruitment of TFIID and TFIIA to the promoter, and promote isomerization of the TFIID-TFIIA-TATA complex. Here, we describe a double-shut-off approach to deplete yeast cells of Toa1, the large subunit of TFIIA, to <1% of the wild-type level. Interestingly, such TFIIA-depleted cells are essentially unaffected for activation by heat shock factor, Ace1, and Gal4-VP16. However, depletion of TFIIA causes a general two- to threefold decrease of transcription from most yeast promoters and a specific cell-cycle arrest at the G2-M boundary. These results indicate that transcriptional activation in vivo can occur in the absence of TFIIA. PMID:10581267

  7. Macrophage Migration Inhibitory Factor (MIF) Enzymatic Activity and Lung Cancer

    PubMed Central

    Mawhinney, Leona; Armstrong, Michelle E; O’ Reilly, Ciaran; Bucala, Richard; Leng, Lin; Fingerle-Rowson, Gunter; Fayne, Darren; Keane, Michael P; Tynan, Aisling; Maher, Lewena; Cooke, Gordon; Lloyd, David; Conroy, Helen; Donnelly, Seamas C

    2014-01-01

    The cytokine macrophage migration inhibitory factor (MIF) possesses unique tautomerase enzymatic activity, which contributes to the biological functional activity of MIF. In this study, we investigated the effects of blocking the hydrophobic active site of the tautomerase activity of MIF in the pathogenesis of lung cancer. To address this, we initially established a Lewis lung carcinoma (LLC) murine model in Mif-KO and wild-type (WT) mice and compared tumor growth in a knock-in mouse model expressing a mutant MIF lacking enzymatic activity (Mif P1G). Primary tumor growth was significantly attenuated in both Mif-KO and Mif P1G mice compared with WT mice. We subsequently undertook a structure-based, virtual screen to identify putative small molecular weight inhibitors specific for the tautomerase enzymatic active site of MIF. From primary and secondary screens, the inhibitor SCD-19 was identified, which significantly attenuated the tautomerase enzymatic activity of MIF in vitro and in biological functional screens. In the LLC murine model, SCD-19, given intraperitoneally at the time of tumor inoculation, was found to significantly reduce primary tumor volume by 90% (p < 0.001) compared with the control treatment. To better replicate the human disease scenario, SCD-19 was given when the tumor was palpable (at d 7 after tumor inoculation) and, again, treatment was found to significantly reduce tumor volume by 81% (p < 0.001) compared with the control treatment. In this report, we identify a novel inhibitor that blocks the hydrophobic pocket of MIF, which houses its specific tautomerase enzymatic activity, and demonstrate that targeting this unique active site significantly attenuates lung cancer growth in in vitro and in vivo systems. PMID:25826675

  8. Time-activity relationships to VOC personal exposure factors

    NASA Astrophysics Data System (ADS)

    Edwards, Rufus D.; Schweizer, Christian; Llacqua, Vito; Lai, Hak Kan; Jantunen, Matti; Bayer-Oglesby, Lucy; Künzli, Nino

    Social and demographic factors have been found to play a significant role in differences between time-activity patterns of population subgroups. Since time-activity patterns largely influence personal exposure to compounds as individuals move across microenvironments, exposure subgroups within the population may be defined by factors that influence daily activity patterns. Socio-demographic and environmental factors that define time-activity subgroups also define quantifiable differences in VOC personal exposures to different sources and individual compounds in the Expolis study. Significant differences in exposures to traffic-related compounds ethylbenzene, m- and p-xylene and o-xylene were observed in relation to gender, number of children and living alone. Categorization of exposures further indicated time exposed to traffic at work and time in a car as important determinants. Increased exposures to decane, nonane and undecane were observed for males, housewives and self-employed. Categorization of exposures indicated exposure subgroups related to workshop use and living downtown. Higher exposures to 3-carene and α-pinene commonly found in household cleaning products and fragrances were associated with more children, while exposures to traffic compounds ethylbenzene, m- and p-xylene and o-xylene were reduced with more children. Considerable unexplained variation remained in categorization of exposures associated with home product use and fragrances, due to individual behavior and product choice. More targeted data collection methods in VOC exposure studies for these sources should be used. Living alone was associated with decreased exposures to 2-methyl-1-propanol and 1-butanol, and traffic-related compounds. Identification of these subgroups may help to reduce the large amount of unexplained variation in VOC exposure studies. Further they may help in assessing impacts of urban planning that result in changes in behavior of individuals, resulting in shifts in

  9. Transcription Factor Arabidopsis Activating Factor1 Integrates Carbon Starvation Responses with Trehalose Metabolism1[OPEN

    PubMed Central

    Garapati, Prashanth; Feil, Regina; Lunn, John Edward; Van Dijck, Patrick; Balazadeh, Salma; Mueller-Roeber, Bernd

    2015-01-01

    Plants respond to low carbon supply by massive reprogramming of the transcriptome and metabolome. We show here that the carbon starvation-induced NAC (for NO APICAL MERISTEM/ARABIDOPSIS TRANSCRIPTION ACTIVATION FACTOR/CUP-SHAPED COTYLEDON) transcription factor Arabidopsis (Arabidopsis thaliana) Transcription Activation Factor1 (ATAF1) plays an important role in this physiological process. We identified TREHALASE1, the only trehalase-encoding gene in Arabidopsis, as a direct downstream target of ATAF1. Overexpression of ATAF1 activates TREHALASE1 expression and leads to reduced trehalose-6-phosphate levels and a sugar starvation metabolome. In accordance with changes in expression of starch biosynthesis- and breakdown-related genes, starch levels are generally reduced in ATAF1 overexpressors but elevated in ataf1 knockout plants. At the global transcriptome level, genes affected by ATAF1 are broadly associated with energy and carbon starvation responses. Furthermore, transcriptional responses triggered by ATAF1 largely overlap with expression patterns observed in plants starved for carbon or energy supply. Collectively, our data highlight the existence of a positively acting feedforward loop between ATAF1 expression, which is induced by carbon starvation, and the depletion of cellular carbon/energy pools that is triggered by the transcriptional regulation of downstream gene regulatory networks by ATAF1. PMID:26149570

  10. Transcription Factor Arabidopsis Activating Factor1 Integrates Carbon Starvation Responses with Trehalose Metabolism.

    PubMed

    Garapati, Prashanth; Feil, Regina; Lunn, John Edward; Van Dijck, Patrick; Balazadeh, Salma; Mueller-Roeber, Bernd

    2015-09-01

    Plants respond to low carbon supply by massive reprogramming of the transcriptome and metabolome. We show here that the carbon starvation-induced NAC (for NO APICAL MERISTEM/ARABIDOPSIS TRANSCRIPTION ACTIVATION FACTOR/CUP-SHAPED COTYLEDON) transcription factor Arabidopsis (Arabidopsis thaliana) Transcription Activation Factor1 (ATAF1) plays an important role in this physiological process. We identified TREHALASE1, the only trehalase-encoding gene in Arabidopsis, as a direct downstream target of ATAF1. Overexpression of ATAF1 activates TREHALASE1 expression and leads to reduced trehalose-6-phosphate levels and a sugar starvation metabolome. In accordance with changes in expression of starch biosynthesis- and breakdown-related genes, starch levels are generally reduced in ATAF1 overexpressors but elevated in ataf1 knockout plants. At the global transcriptome level, genes affected by ATAF1 are broadly associated with energy and carbon starvation responses. Furthermore, transcriptional responses triggered by ATAF1 largely overlap with expression patterns observed in plants starved for carbon or energy supply. Collectively, our data highlight the existence of a positively acting feedforward loop between ATAF1 expression, which is induced by carbon starvation, and the depletion of cellular carbon/energy pools that is triggered by the transcriptional regulation of downstream gene regulatory networks by ATAF1. PMID:26149570

  11. Design considerations for a new, high resolution Micro-Angiographic Fluoroscope based on a CMOS sensor (MAF-CMOS)

    PubMed Central

    Loughran, Brendan; Swetadri Vasan, S. N.; Singh, Vivek; Ionita, Ciprian N.; Jain, Amit; Bednarek, Daniel R.; Titus, Albert; Rudin, Stephen

    2013-01-01

    The detectors that are used for endovascular image-guided interventions (EIGI), particularly for neurovascular interventions, do not provide clinicians with adequate visualization to ensure the best possible treatment outcomes. Developing an improved x-ray imaging detector requires the determination of estimated clinical x-ray entrance exposures to the detector. The range of exposures to the detector in clinical studies was found for the three modes of operation: fluoroscopic mode, high frame-rate digital angiographic mode (HD fluoroscopic mode), and DSA mode. Using these estimated detector exposure ranges and available CMOS detector technical specifications, design requirements were developed to pursue a quantum limited, high resolution, dynamic x-ray detector based on a CMOS sensor with 50 μm pixel size. For the proposed MAF-CMOS, the estimated charge collected within the full exposure range was found to be within the estimated full well capacity of the pixels. Expected instrumentation noise for the proposed detector was estimated to be 50–1,300 electrons. Adding a gain stage such as a light image intensifier would minimize the effect of the estimated instrumentation noise on total image noise but may not be necessary to ensure quantum limited detector operation at low exposure levels. A recursive temporal filter may decrease the effective total noise by 2 to 3 times, allowing for the improved signal to noise ratios at the lowest estimated exposures despite consequent loss in temporal resolution. This work can serve as a guide for further development of dynamic x-ray imaging prototypes or improvements for existing dynamic x-ray imaging systems. PMID:24353389

  12. Design considerations for a new, high resolution Micro-Angiographic Fluoroscope based on a CMOS sensor (MAF-CMOS).

    PubMed

    Loughran, Brendan; Swetadri Vasan, S N; Singh, Vivek; Ionita, Ciprian N; Jain, Amit; Bednarek, Daniel R; Titus, Albert; Rudin, Stephen

    2013-03-01

    The detectors that are used for endovascular image-guided interventions (EIGI), particularly for neurovascular interventions, do not provide clinicians with adequate visualization to ensure the best possible treatment outcomes. Developing an improved x-ray imaging detector requires the determination of estimated clinical x-ray entrance exposures to the detector. The range of exposures to the detector in clinical studies was found for the three modes of operation: fluoroscopic mode, high frame-rate digital angiographic mode (HD fluoroscopic mode), and DSA mode. Using these estimated detector exposure ranges and available CMOS detector technical specifications, design requirements were developed to pursue a quantum limited, high resolution, dynamic x-ray detector based on a CMOS sensor with 50 μm pixel size. For the proposed MAF-CMOS, the estimated charge collected within the full exposure range was found to be within the estimated full well capacity of the pixels. Expected instrumentation noise for the proposed detector was estimated to be 50-1,300 electrons. Adding a gain stage such as a light image intensifier would minimize the effect of the estimated instrumentation noise on total image noise but may not be necessary to ensure quantum limited detector operation at low exposure levels. A recursive temporal filter may decrease the effective total noise by 2 to 3 times, allowing for the improved signal to noise ratios at the lowest estimated exposures despite consequent loss in temporal resolution. This work can serve as a guide for further development of dynamic x-ray imaging prototypes or improvements for existing dynamic x-ray imaging systems. PMID:24353389

  13. Design considerations for a new high resolution Micro-Angiographic Fluoroscope based on a CMOS sensor (MAF-CMOS)

    NASA Astrophysics Data System (ADS)

    Loughran, Brendan; Swetadri Vasan, S. N.; Singh, Vivek; Ionita, Ciprian N.; Jain, Amit; Bednarek, Daniel R.; Titus, Albert H.; Rudin, Stephen

    2013-03-01

    The detectors that are used for endovascular image-guided interventions (EIGI), particularly for neurovascular interventions, do not provide clinicians with adequate visualization to ensure the best possible treatment outcomes. Developing an improved x-ray imaging detector requires the determination of estimated clinical x-ray entrance exposures to the detector. The range of exposures to the detector in clinical studies was found for the three modes of operation: fluoroscopic mode, high frame-rate digital angiographic mode (HD fluoroscopic mode), and DSA mode. Using these estimated detector exposure ranges and available CMOS detector technical specifications, design requirements were developed to pursue a quantum limited, high resolution, dynamic x-ray detector based on a CMOS sensor with 50 μm pixel size. For the proposed MAF-CMOS, the estimated charge collected within the full exposure range was found to be within the estimated full well capacity of the pixels. Expected instrumentation noise for the proposed detector was estimated to be 50-1,300 electrons. Adding a gain stage such as a light image intensifier would minimize the effect of the estimated instrumentation noise on total image noise but may not be necessary to ensure quantum limited detector operation at low exposure levels. A recursive temporal filter may decrease the effective total noise by 2 to 3 times, allowing for the improved signal to noise ratios at the lowest estimated exposures despite consequent loss in temporal resolution. This work can serve as a guide for further development of dynamic x-ray imaging prototypes or improvements for existing dynamic x-ray imaging systems.

  14. Absence of in vitro Procoagulant Activity in Immunoglobulin Preparations due to Activated Coagulation Factors

    PubMed Central

    Oviedo, Adriana E.; Bernardi, María E.; Guglielmone, Hugo A.; Vitali, María S.

    2015-01-01

    Summary Background Immunoglobulin (IG) products, including intravenous (IVIG) or subcutaneous (SCIG) immunoglobulins are considered safe and effective for medical therapy; however, a sudden and unexpected increase in thromboembolic events (TE) after administration of certain batches of IVIG products has been attributed to the presence of activated coagulation factors, mainly factor XIa. Our aims were to examine the presence of enduring procoagulant activity during the manufacturing process of IGs, with special focus on monitoring factor XIa, and to evaluate the presence of in vitro procoagulant activity attributed to coagulation factors in different lots of IVIG and SCIG. Methods Samples of different steps of IG purification, 19 lots of IVIG and 9 of SCIG were analyzed and compared with 1 commercial preparation of IVIG and 2 of SCIG, respectively. Factors II, VII, IX, XI and XIa and non-activated partial thromboplastin time (NAPTT) were assayed. Results The levels of factors II, VII, IX, X and XI were non-quantifiable once fraction II had been re-dissolved and in all analyzed lots of IVIG and SCIG. The level of factor XIa at that point was under the detection limits of the assay, and NAPTT yielded values greater than the control during the purification process. In SCIG, we detected higher concentrations of factor XIa in the commercial products, which reached values up to 5 times higher than the average amounts found in the 9 batches produced by UNC-Hemoderivados. Factor XIa in commercial IVIG reached levels slightly higher than those of the 19 batches produced by UNC-Hemoderivados. Conclusion IVIG and SCIG manufactured by UNC-Hemoderivados showed a lack of thrombogenic potential, as demonstrated not only by the laboratory data obtained in this study but also by the absence of any reports of TE registered by the post marketing pharmacovigilance department. PMID:26733772

  15. Factors associated with active commuting to work among women.

    PubMed

    Bopp, Melissa; Child, Stephanie; Campbell, Matthew

    2014-01-01

    Active commuting (AC), the act of walking or biking to work, has notable health benefits though rates of AC remain low among women. This study used a social-ecological framework to examine the factors associated with AC among women. A convenience sample of employed, working women (n = 709) completed an online survey about their mode of travel to work. Individual, interpersonal, institutional, community, and environmental influences were assessed. Basic descriptive statistics and frequencies described the sample. Simple logistic regression models examined associations with the independent variables with AC participation and multiple logistic regression analysis determined the relative influence of social ecological factors on AC participation. The sample was primarily middle-aged (44.09±11.38 years) and non-Hispanic White (92%). Univariate analyses revealed several individual, interpersonal, institutional, community and environmental factors significantly associated with AC. The multivariable logistic regression analysis results indicated that significant factors associated with AC included number of children, income, perceived behavioral control, coworker AC, coworker AC normative beliefs, employer and community supports for AC, and traffic. The results of this study contribute to the limited body of knowledge on AC participation for women and may help to inform gender-tailored interventions to enhance AC behavior and improve health. PMID:24512572

  16. Secretion of platelet-activating factor by periovulatory ovine follicles

    SciTech Connect

    Alexander, B.M.; Van Kirk, E.A.; Murdoch, W.J. )

    1990-01-01

    Secretion of platelet-activating factor (PAF) in vitro by ovine follicles and ovarian interstitium obtained at various times before, during and after the endogenous preovulatory surge of luteinizing hormone (LH) and ovulation was quantified by radioimmunoassay. Release of PAF by the preovulatory follicle increased within 2 h after initiation of the surge of LH. Capacity for secretion of PAF was greatest at the time of ovulation, then declined thereafter. Production of PAF by ovarian interstitium throughout the periovulatory period was relatively low and did not change with time. It appears that PAF could act as an intrafollicular mediator in the mechanisms of ovulation and(or) luteinization.

  17. Platelet-Activating Factor-Receptor and Tumor Immunity

    PubMed Central

    Sahu, Ravi P; Konger, Raymond L.; Travers, Jeffrey B.

    2016-01-01

    First described in 1972 by Benveniste and colleagues, platelet-activating factor (PAF) remains one of the potent phospholipid known to date. The role of PAF produced enzymatically in mediating diverse biological and pathophysiological processes including inflammatory and allergic diseases and cancers in response to various stimuli has been extensively studied. However, little is known about the role of non-enzymatically-generated PAF-like lipids produced in response to pro-oxidative stressors, particularly in modulating the host immune responses to tumor immunity, which is the focus of this review.

  18. Activation of vascular endothelial growth factor gene transcription by hypoxia-inducible factor 1.

    PubMed Central

    Forsythe, J A; Jiang, B H; Iyer, N V; Agani, F; Leung, S W; Koos, R D; Semenza, G L

    1996-01-01

    Expression of vascular endothelial growth factor (VEGF) is induced in cells exposed to hypoxia or ischemia. Neovascularization stimulated by VEGF occurs in several important clinical contexts, including myocardial ischemia, retinal disease, and tumor growth. Hypoxia-inducible factor 1 (HIF-1) is a heterodimeric basic helix-loop-helix protein that activates transcription of the human erythropoietin gene in hypoxic cells. Here we demonstrate the involvement of HIF-1 in the activation of VEGF transcription. VEGF 5'-flanking sequences mediated transcriptional activation of reporter gene expression in hypoxic Hep3B cells. A 47-bp sequence located 985 to 939 bp 5' to the VEGF transcription initiation site mediated hypoxia-inducible reporter gene expression directed by a simian virus 40 promoter element that was otherwise minimally responsive to hypoxia. When reporters containing VEGF sequences, in the context of the native VEGF or heterologous simian virus 40 promoter, were cotransfected with expression vectors encoding HIF-1alpha and HIF-1beta (ARNT [aryl hydrocarbon receptor nuclear translocator]), reporter gene transcription was much greater in both hypoxic and nonhypoxic cells than in cells transfected with the reporter alone. A HIF-1 binding site was demonstrated in the 47-bp hypoxia response element, and a 3-bp substitution eliminated the ability of the element to bind HIF-1 and to activate transcription in response to hypoxia and/or recombinant HIF-1. Cotransfection of cells with an expression vector encoding a dominant negative form of HIF-1alpha inhibited the activation of reporter transcription in hypoxic cells in a dose-dependent manner. VEGF mRNA was not induced by hypoxia in mutant cells that do not express the HIF-1beta (ARNT) subunit. These findings implicate HIF-1 in the activation of VEGF transcription in hypoxic cells. PMID:8756616

  19. Nuclear factor Y regulates ancient budgerigar hepadnavirus core promoter activity.

    PubMed

    Shen, Zhongliang; Liu, Yanfeng; Luo, Mengjun; Wang, Wei; Liu, Jing; Liu, Wei; Pan, Shaokun; Xie, Youhua

    2016-09-16

    Endogenous viral elements (EVE) in animal genomes are the fossil records of ancient viruses and provide invaluable information on the origin and evolution of extant viruses. Extant hepadnaviruses include avihepadnaviruses of birds and orthohepadnaviruses of mammals. The core promoter (Cp) of hepadnaviruses is vital for viral gene expression and replication. We previously identified in the budgerigar genome two EVEs that contain the full-length genome of an ancient budgerigar hepadnavirus (eBHBV1 and eBHBV2). Here, we found eBHBV1 Cp and eBHBV2 Cp were active in several human and chicken cell lines. A region from nt -85 to -11 in eBHBV1 Cp was critical for the promoter activity. Bioinformatic analysis revealed a putative binding site of nuclear factor Y (NF-Y), a ubiquitous transcription factor, at nt -64 to -50 in eBHBV1 Cp. The NF-Y core binding site (ATTGG, nt -58 to -54) was essential for eBHBV1 Cp activity. The same results were obtained with eBHBV2 Cp and duck hepatitis B virus Cp. The subunit A of NF-Y (NF-YA) was recruited via the NF-Y core binding site to eBHBV1 Cp and upregulated the promoter activity. Finally, the NF-Y core binding site is conserved in the Cps of all the extant avihepadnaviruses but not of orthohepadnaviruses. Interestingly, a putative and functionally important NF-Y core binding site is located at nt -21 to -17 in the Cp of human hepatitis B virus. In conclusion, our findings have pinpointed an evolutionary conserved and functionally critical NF-Y binding element in the Cps of avihepadnaviruses. PMID:27501758

  20. Islet Neogenesis Associated Protein (INGAP) induces the differentiation of an adult human pancreatic ductal cell line into insulin-expressing cells through stepwise activation of key transcription factors for embryonic beta cell development.

    PubMed

    Assouline-Thomas, Béatrice; Ellis, Daniel; Petropavlovskaia, Maria; Makhlin, Julia; Ding, Jieping; Rosenberg, Lawrence

    2015-01-01

    Regeneration of β-cells in diabetic patients is an important goal of diabetes research. Islet Neogenesis Associated Protein (INGAP) was discovered in the partially duct-obstructed hamster pancreas. Its bioactive fragment, pentadecapeptide 104-118 (INGAP-P), has been shown to reverse diabetes in animal models and to improve glucose homeostasis in patients with diabetes in clinical trials. Further development of INGAP as a therapy for diabetes requires identification of target cells in the pancreas and characterization of the mechanisms of action. We hypothesized that adult human pancreatic ductal cells retain morphogenetic plasticity and can be induced by INGAP to undergo endocrine differentiation. To test this hypothesis, we treated the normal human pancreatic ductal cell line (HPDE) with either INGAP-P or full-length recombinant protein (rINGAP) for short-term periods. Our data show that this single drug treatment induces both proliferation and transdifferentiation of HPDE cells, the latter being characterized by the rapid sequential activation of endocrine developmental transcription factors Pdx-1, Ngn3, NeuroD, IA-1, and MafA and subsequently the expression of insulin at both the mRNA and the protein levels. After 7 days, C-peptide was detected in the supernatant of INGAP-treated cells, reflecting their ability to secrete insulin. The magnitude of differentiation was enhanced by embedding the cells in Matrigel, which led to islet-like cluster formation. The islet-like clusters cells stained positive for nuclear Pdx-1 and Glut 2 proteins, and were expressing Insulin mRNA. These new data suggest that human adult pancreatic ductal cells retain morphogenetic plasticity and demonstrate that a short exposure to INGAP triggers their differentiation into insulin-expressing cells in vitro. In the context of the urgent search for a regenerative and/or cellular therapy for diabetes, these results make INGAP a promising therapeutic candidate. PMID:26558987

  1. Combinatorial influence of environmental parameters on transcription factor activity

    PubMed Central

    Knijnenburg, T.A.; Wessels, L.F.A.; Reinders, M.J.T.

    2008-01-01

    Motivation: Cells receive a wide variety of environmental signals, which are often processed combinatorially to generate specific genetic responses. Changes in transcript levels, as observed across different environmental conditions, can, to a large extent, be attributed to changes in the activity of transcription factors (TFs). However, in unraveling these transcription regulation networks, the actual environmental signals are often not incorporated into the model, simply because they have not been measured. The unquantified heterogeneity of the environmental parameters across microarray experiments frustrates regulatory network inference. Results: We propose an inference algorithm that models the influence of environmental parameters on gene expression. The approach is based on a yeast microarray compendium of chemostat steady-state experiments. Chemostat cultivation enables the accurate control and measurement of many of the key cultivation parameters, such as nutrient concentrations, growth rate and temperature. The observed transcript levels are explained by inferring the activity of TFs in response to combinations of cultivation parameters. The interplay between activated enhancers and repressors that bind a gene promoter determine the possible up- or downregulation of the gene. The model is translated into a linear integer optimization problem. The resulting regulatory network identifies the combinatorial effects of environmental parameters on TF activity and gene expression. Availability: The Matlab code is available from the authors upon request. Contact: t.a.knijnenburg@tudelft.nl Supplementary information: Supplementary data are available at Bioinformatics online. PMID:18586711

  2. Epidermal Platelet-activating Factor Receptor Activation and Ultraviolet B Radiation Result in Synergistic Tumor Necrosis Factor-alpha Production

    PubMed Central

    Wolverton, Jay E.; Al-Hassani, Mohammed; Yao, Yongxue; Zhang, Qiwei; Travers, Jeffrey B.

    2010-01-01

    Ultraviolet B radiation (UVB) is a potent stimulator of epidermal cytokine production which has been implicated in photoaggravated dermatoses. In addition to cytokines such as tumor necrosis factor-α (TNF-α), UVB generates bioactive lipids including platelet-activating factor (PAF). Our previous studies have demonstrated that UVB-mediated production of keratinocyte TNF-α is in part due to PAF. The current studies use a human PAF-receptor (PAF-R) negative epithelial cell line transduced with PAF-Rs and PAF–R-deficient mice to demonstrate that activation of the epidermal PAF-R along with UVB irradiation results in a synergistic production of TNF-α. It should be noted that PAF-R effects are mimicked by the protein kinase C (PKC) agonist phorbol myristic acetate, and are inhibited by pharmacological antagonists of the PKC gamma isoenzyme. These studies suggest that concomitant PAF-R activation and UVB irradiation results in a synergistic production of the cytokine TNF-α which is mediated in part via PKC. These studies provide a novel potential mechanism for photosensitivity responses. PMID:19769579

  3. Thyroid Transcription Factor 1 Reprograms Angiogenic Activities of Secretome

    PubMed Central

    Wood, Lauren W.; Cox, Nicole I.; Phelps, Cody A.; Lai, Shao-Chiang; Poddar, Arjun; Talbot, Conover; Mu, David

    2016-01-01

    Through both gain- and loss-of-TTF-1 expression strategies, we show that TTF-1 positively regulates vascular endothelial growth factor (VEGF) and that the VEGF promoter element contains multiple TTF-1-responsive sequences. The major signaling receptor for VEGF, i.e VEGFR2, also appears to be under a direct and positive regulation of TTF-1. The TTF-1-dependent upregulation of VEGF was moderately sensitive to rapamycin, implicating a partial involvement of mammalian target of rapamycin (mTOR). However, hypoxia did not further increase the secreted VEGF level of the TTF-1+ lung cancer cells. The TTF-1-induced VEGF upregulation occurs in both compartments (exosomes and exosome-depleted media (EDM)) of the conditioned media. Surprisingly, the EDM of TTF-1+ lung cancer cells (designated EDM-TTF-1+) displayed an anti-angiogenic activity in the endothelial cell tube formation assay. Mechanistic studies suggest that the increased granulocyte-macrophage colony-stimulating factor (GM-CSF) level in the EDM-TTF-1+ conferred the antiangiogenic activities. In human lung cancer, the expression of TTF-1 and GM-CSF exhibits a statistically significant and positive correlation. In summary, this study provides evidence that TTF-1 may reprogram lung cancer secreted proteome into an antiangiogenic state, offering a novel basis to account for the long-standing observation of favorable prognosis associated with TTF-1+ lung adenocarcinomas. PMID:26912193

  4. Thyroid Transcription Factor 1 Reprograms Angiogenic Activities of Secretome.

    PubMed

    Wood, Lauren W; Cox, Nicole I; Phelps, Cody A; Lai, Shao-Chiang; Poddar, Arjun; Talbot, Conover; Mu, David

    2016-01-01

    Through both gain- and loss-of-TTF-1 expression strategies, we show that TTF-1 positively regulates vascular endothelial growth factor (VEGF) and that the VEGF promoter element contains multiple TTF-1-responsive sequences. The major signaling receptor for VEGF, i.e VEGFR2, also appears to be under a direct and positive regulation of TTF-1. The TTF-1-dependent upregulation of VEGF was moderately sensitive to rapamycin, implicating a partial involvement of mammalian target of rapamycin (mTOR). However, hypoxia did not further increase the secreted VEGF level of the TTF-1(+) lung cancer cells. The TTF-1-induced VEGF upregulation occurs in both compartments (exosomes and exosome-depleted media (EDM)) of the conditioned media. Surprisingly, the EDM of TTF-1(+) lung cancer cells (designated EDM-TTF-1(+)) displayed an anti-angiogenic activity in the endothelial cell tube formation assay. Mechanistic studies suggest that the increased granulocyte-macrophage colony-stimulating factor (GM-CSF) level in the EDM-TTF-1(+) conferred the antiangiogenic activities. In human lung cancer, the expression of TTF-1 and GM-CSF exhibits a statistically significant and positive correlation. In summary, this study provides evidence that TTF-1 may reprogram lung cancer secreted proteome into an antiangiogenic state, offering a novel basis to account for the long-standing observation of favorable prognosis associated with TTF-1(+) lung adenocarcinomas. PMID:26912193

  5. The photospheric filling factor of the active binary II Pegasi

    NASA Astrophysics Data System (ADS)

    Marino, G.; Rodonó, M.; Leto, G.; Cutispoto, G.

    1999-12-01

    UBV and JHK photometry of the active single-lined binary II Peg, we performed in 1995, is presented. A method to determine the fraction of the photosphere covered by spots (filling factor) and to check the accuracy of generally assumed values of photospheric parameters has been developed. The procedure is based on the comparison between multiband fluxes and low resolution synthetic spectra weighted on the base of the spot filling factor and scaled with the ratio between the star radius and distance (R/d), so that we can also estimate the R/d ratio. A chi 2 fit has been performed for II Peg observations close to the light maximum and minimum by assuming reliable values of the photospheric parameters. Although a unique solution cannot be reached, we found clear indication for a spot filling factor at light maximum >= 40%. We find that the same set of parameters that gives us the best fit solutions at light maximum also provides the best fit at light minimum. The resulting solutions are consistent with the observed amplitude of the photometric wave, and with the commonly accepted value of R, unspotted V magnitude and spectral classification for II Pegasi.

  6. Loop Dynamics of the Extracellular Domain of Human Tissue Factor and Activation of Factor VIIa

    PubMed Central

    Minazzo, Agnese S.; Darlington, Reuben C.; Ross, J.B. Alexander

    2009-01-01

    Abstract In the crystal structure of the complex between the soluble extracellular domain of tissue factor (sTF) and active-site-inhibited VIIa, residues 91 and 92 in the Pro79-Pro92 loop of sTF interact with the catalytic domain of VIIa. It is not known, however, whether this loop has a role in allosteric activation of VIIa. Time-resolved fluorescence anisotropy measurements of probes covalently bound to sTF mutants E84C and T121C show that binding uninhibited Factor VIIa affects segmental motions in sTF. Glu84 resides in the Pro79-Pro92 loop, and Thr121 resides in the turn between the first and second antiparallel β-strands of the sTF subdomain that interacts with the Gla and EGF1 domains of VIIa; neither Glu84 nor Thr121 makes direct contact with VIIa. Probes bound to T121C report limited segmental flexibility in free sTF, which is lost after VIIa binding. Probes bound to E84C report substantial segmental flexibility in the Pro79-Pro92 loop in free sTF, which is greatly reduced after VIIa binding. Thus, VIIa binding reduces dynamic motions in sTF. In particular, the decrease in the Pro79-Pro92 loop motions indicates that loop entropy has a role in the thermodynamics of the protein-protein interactions involved in allosteric control of VIIa activation. PMID:19167313

  7. Purification of human plasma platelet-activating factor acetylhydrolase

    SciTech Connect

    Stafforini, D.M.; Prescott, S.M.; McIntyre, T.M.

    1986-05-01

    Platelet-activating factor (PAF;1-0-alkyl-2-acetyl-sn-glycero-3-phosphocholine is synthesized by a variety of cells. It induces hypotension, and activates platelets, neutrophils, and macrophages at nanomolar concentrations. Removal of the acetate abolishes biological activity, and is catalyzed by a specific PAF acetylhydrolase present in plasma and tissues. The authors developed a rapid assay, based on separation of (/sup 3/H)acetate from (/sup 3/H-acetyl)PAF by reversed-phase chromatography. In human plasma the enzyme exhibits an apparent Km of 5.7..mu..M, with a Vmax of 0.027..mu..mol/h/mg. Ultracentrifugation in density gradients showed that 30% of the activity is associated with high density lipoproteins (HDL) and 70% with low density lipoproteins (LDL). The enzyme was purified from LDL by precipitation with Na phosphotungstate and MgCl/sub 2/, solubilization with Tween 20, column chromatography and electrophoresis. This procedure resulted in a preparation that was 21,000-fold purified from plasma (spec. act. 575..mu..mol/h/mg) with a recovery of 10%. The purified enzyme has a molecular weight of about 43,000, a broad pH optimum (peak 7.5-8.0), and a pl of 4.6. It has greater activity when PAF is in a micellar, as compared to monomeric, and exhibits surface dilution kinetics, which may be important in vivo. The purification and characterization of this enzyme will allow detailed studies of its role in PAF metabolism.

  8. Crystal Structure of Human Plasma Platelet-Activating Factor Acetylhydrolase

    SciTech Connect

    Samanta, U.; Bahnson, B

    2008-01-01

    Human plasma platelet-activating factor (PAF) acetylhydrolase functions by reducing PAF levels as a general anti-inflammatory scavenger and is linked to anaphylactic shock, asthma, and allergic reactions. The enzyme has also been implicated in hydrolytic activities of other pro-inflammatory agents, such as sn-2 oxidatively fragmented phospholipids. This plasma enzyme is tightly bound to low and high density lipoprotein particles and is also referred to as lipoprotein-associated phospholipase A{sub 2}. The crystal structure of this enzyme has been solved from x-ray diffraction data collected to a resolution of 1.5{angstrom}. It has a classic lipase {alpha}/{beta}-hydrolase fold, and it contains a catalytic triad of Ser{sup 273}, His{sup 351}, and Asp{sup 296}. Two clusters of hydrophobic residues define the probable interface-binding region, and a prediction is given of how the enzyme is bound to lipoproteins. Additionally, an acidic patch of 10 carboxylate residues and a neighboring basic patch of three residues are suggested to play a role in high density lipoprotein/low density lipoprotein partitioning. A crystal structure is also presented of PAF acetylhydrolase reacted with the organophosphate compound paraoxon via its active site Ser{sup 273}. The resulting diethyl phosphoryl complex was used to model the tetrahedral intermediate of the substrate PAF to the active site. The model of interface binding begins to explain the known specificity of lipoprotein-bound substrates and how the active site can be both close to the hydrophobic-hydrophilic interface and at the same time be accessible to the aqueous phase.

  9. Deficiency of platelet-activating factor acetylhydrolase is a severity factor for asthma

    PubMed Central

    Stafforini, Diana M.; Numao, Toshio; Tsodikov, Alexander; Vaitkus, Darius; Fukuda, Takeshi; Watanabe, Naoto; Fueki, Naoto; McIntyre, Thomas M.; Zimmerman, Guy A.; Makino, Sohei; Prescott, Stephen M.

    1999-01-01

    Asthma, a family of airway disorders characterized by airway inflammation, has an increasing incidence worldwide. Platelet-activating factor (PAF) may play a role in the pathophysiology of asthma. Its proinflammatory actions are antagonized by PAF acetylhydrolase. A missense mutation (V279F) in the PAF acetylhydrolase gene results in the complete loss of activity, which occurs in 4% of the Japanese population. We asked if PAF acetylhydrolase deficiency correlates with the incidence and severity of asthma in Japan. We found that the prevalence of PAF acetylhydrolase deficiency is higher in Japanese asthmatics than healthy subjects and that the severity of this syndrome is highest in homozygous-deficient subjects. We conclude that the PAF acetylhydrolase gene is a modulating locus for the severity of asthma. PMID:10194471

  10. Associations between Socio-Motivational Factors, Physical Education Activity Levels and Physical Activity Behavior among Youth

    ERIC Educational Resources Information Center

    Ning, Weihong; Gao, Zan; Lodewyk, Ken

    2012-01-01

    This study examined the relationships between established socio-motivational factors and children's physical activity levels daily and during physical education classes. A total of 307 middle school students (149 boys, 158 girls) from a suburban public school in the Southern United States participated in this study. Participants completed…

  11. Atrial natriuretic factor-like activity in rat posterior pituitary

    SciTech Connect

    Gutkowska, J.; Debinski, W.; Racz, K.; Thibault, G.; Garcia, R.; Kuchel, O.; Genest, J.; Cantin, M.

    1986-03-05

    The presence of a biologically active peptide: Atrial Natriuretic Factor (ANF) has been demonstrated in rat and human circulation and ANF is considered now as a new hormone. ANF may be involved in body fluid regulation. A very sensitive radioimmunoassay for rat ANF allowed the authors to search for immunoreactive ANF (IR-ANF) in rat posterior pituitary. Serial dilutions of homogenates of rat posterior pituitary showed a good parallelism with a reference curve in a radioimmunoassay system. The IR-ANF was extracted from rat posterior pituitary homogenates by activated Vycor glass beads. The lyophilized extract was purified by HPLC on C/sub 18/ ..mu.. Bondapak column. The HPLC yielded two IR-ANF peaks. Both isolated ANF-like material showed biological activity. The IR-ANF eluted with 33% acetonitrile, inhibited ACTH-stimulated aldosterone secretion with a similar potency as synthetic (Arg 101 - Tyr 126) ANF (0.7 x 10/sup -10/M). A much less potent ANF-like material was found in the second peak eluted with 36% acetonitrile. They conclude that ANF-like material is present in rat posterior pituitary and this suggest a possible role in ANF on AVP secretion directly in situ.

  12. Human factors in remote control engineering development activities

    SciTech Connect

    Clarke, M.M.; Hamel, W.R.; Draper, J.V.

    1983-01-01

    Human factors engineering, which is an integral part of the advanced remote control development activities at the Oak Ridge National Laboratory, is described. First, work at the Remote Systems Development Facility (RSDF) has shown that operators can perform a wide variety of tasks, some of which were not specifically designed for remote systems, with a dextrous electronic force-reflecting servomanipulator and good television remote viewing capabilities. Second, the data collected during mock-up remote maintenance experiments at the RSDF have been analyzed to provide guidelines for the design of human interfaces with an integrated advanced remote maintenance system currently under development. Guidelines have been provided for task allocation between operators, remote viewing systems, and operator controls. 6 references, 5 figures, 2 tables.

  13. Platelet activating factor as a mediator of equine cell locomotion.

    PubMed

    Dawson, J; Lees, P; Sedgwick, A D

    1988-01-01

    Equine polymorphonuclear (PMN) and mononuclear (MN) leucocytes were separated on Percoll gradients and used to study the chemoattractant properties of the polar ether-linked phospholipid, platelet activating factor (PAF). Six concentrations of PAF ranging from 1 ng/ml to 100 micrograms/ml were studied in each of two in vitro assay systems, the agarose microdroplet and a microfilter technique. Very significant (p less than 0.01) increases in the movement of both PMN and MN cells were obtained with most concentrations of PAF. In two instances there was no apparent concentration-response relationship, although the action of PAF was approximately bell-shaped in two others. The possible significance of these findings for equine inflammatory conditions is discussed. PMID:3188378

  14. Phylogenomics of caspase-activated DNA fragmentation factor

    SciTech Connect

    Eckhart, Leopold . E-mail: leopold.eckhart@meduniwien.ac.at; Fischer, Heinz; Tschachler, Erwin

    2007-04-27

    The degradation of nuclear DNA by DNA fragmentation factor (DFF) is a key step in apoptosis of mammalian cells. Using comparative genomics, we have here determined the evolutionary history of the genes encoding the two DFF subunits, DFFA (also known as ICAD) and DFFB (CAD). Orthologs of DFFA and DFFB were identified in Nematostella vectensis, a representative of the primitive metazoan clade cnidarians, and in various vertebrates and insects, but not in representatives of urochordates, echinoderms, and nematodes. The domains mediating the interaction of DFFA and DFFB, a caspase cleavage site in DFFA, and the amino acid residues critical for endonuclease activity of DFFB were conserved in Nematostella. These findings suggest that DFF has been a part of the primordial apoptosis system of the eumetazoan common ancestor and that the ancient cell death machinery has degenerated in several evolutionary lineages, including the one leading to the prototypical apoptosis model, Caenorhabditis elegans.

  15. The Regulatory Role of Activating Transcription Factor 2 in Inflammation

    PubMed Central

    Yu, Tao; Li, Yong Jun; Bian, Ai Hong; Zuo, Hui Bin; Zhu, Ti Wen; Ji, Sheng Xiang; Kong, Fanming; Yin, De Qing; Wang, Chuan Bao; Wang, Zi Fu; Wang, Hong Qun; Yang, Yanyan; Yoo, Byong Chul

    2014-01-01

    Activating transcription factor 2 (ATF2) is a member of the leucine zipper family of DNA-binding proteins and is widely distributed in tissues including the liver, lung, spleen, and kidney. Like c-Jun and c-Fos, ATF2 responds to stress-related stimuli and may thereby influence cell proliferation, inflammation, apoptosis, oncogenesis, neurological development and function, and skeletal remodeling. Recent studies clarify the regulatory role of ATF2 in inflammation and describe potential inhibitors of this protein. In this paper, we summarize the properties and functions of ATF2 and explore potential applications of ATF2 inhibitors as tools for research and for the development of immunosuppressive and anti-inflammatory drugs. PMID:25049453

  16. Control of mechanically activated polymersome fusion: Factors affecting fusion

    DOE PAGESBeta

    Henderson, Ian M.; Paxton, Walter F.

    2014-12-15

    Previously we have studied the mechanically-activated fusion of extruded (200 nm) polymer vesicles into giant polymersomes using agitation in the presence of salt. In this study we have investigated several factors contributing to this phenomenon, including the effects of (i) polymer vesicle concentration, (ii) agitation speed and duration, and iii) variation of the salt and its concentration. It was found that increasing the concentration of the polymer dramatically increases the production of giant vesicles through the increased collisions of polymersomes. Our investigations also found that increasing the frequency of agitation increased the efficiency of fusion, though ultimately limited the sizemore » of vesicle which could be produced due to the high shear involved. Finally it was determined that salt-mediation of the fusion process was not limited to NaCl, but is instead a general effect facilitated by the presence of solvated ionic compounds, albeit with different salts initiating fusion at different concentration.« less

  17. Control of mechanically activated polymersome fusion: Factors affecting fusion

    SciTech Connect

    Henderson, Ian M.; Paxton, Walter F.

    2014-12-15

    Previously we have studied the mechanically-activated fusion of extruded (200 nm) polymer vesicles into giant polymersomes using agitation in the presence of salt. In this study we have investigated several factors contributing to this phenomenon, including the effects of (i) polymer vesicle concentration, (ii) agitation speed and duration, and iii) variation of the salt and its concentration. It was found that increasing the concentration of the polymer dramatically increases the production of giant vesicles through the increased collisions of polymersomes. Our investigations also found that increasing the frequency of agitation increased the efficiency of fusion, though ultimately limited the size of vesicle which could be produced due to the high shear involved. Finally it was determined that salt-mediation of the fusion process was not limited to NaCl, but is instead a general effect facilitated by the presence of solvated ionic compounds, albeit with different salts initiating fusion at different concentration.

  18. Cooperative Regulation of the Activity of Factor Xa within Prothrombinase by Discrete Amino Acid Regions from Factor Va Heavy Chain†

    PubMed Central

    2008-01-01

    The prothrombinase complex catalyzes the activation of prothrombin to α-thrombin. We have repetitively shown that amino acid region 695DYDY698 from the COOH terminus of the heavy chain of factor Va regulates the rate of cleavage of prothrombin at Arg271 by prothrombinase. We have also recently demonstrated that amino acid region 334DY335 is required for the optimal activity of prothrombinase. To assess the effect of these six amino acid residues on cofactor activity, we created recombinant factor Va molecules combining mutations at amino acid regions 334–335 and 695−698 as follows: factor V3K (334DY335 → KF and 695DYDY698 → KFKF), factor VKF/4A (334DY335 → KF and 695DYDY698 → AAAA), and factor V6A (334DY335 → AA and 695DYDY698 → AAAA). The recombinant factor V molecules were expressed and purified to homogeneity. Factor Va3K, factor VaK4/4A, and factor Va6A had reduced affinity for factor Xa, when compared to the affinity of the wild-type molecule (factor VaWt) for the enzyme. Prothrombinase assembled with saturating concentrations of factor Va3K had a 6-fold reduced second-order rate constant for prothrombin activation compared to the value obtained with prothrombinase assembled with factor VaWt, while prothrombinase assembled with saturating concentrations of factor VaKF/4A and factor Va6A had approximately 1.5-fold reduced second-order rate constants. Overall, the data demonstrate that amino acid region 334–335 together with amino acid region 695−698 from factor Va heavy chain are part of a cooperative mechanism within prothrombinase regulating cleavage and activation of prothrombin by factor Xa. PMID:18991406

  19. Transcription factor PIF4 controls the thermosensory activation of flowering.

    PubMed

    Kumar, S Vinod; Lucyshyn, Doris; Jaeger, Katja E; Alós, Enriqueta; Alvey, Elizabeth; Harberd, Nicholas P; Wigge, Philip A

    2012-04-12

    Plant growth and development are strongly affected by small differences in temperature. Current climate change has already altered global plant phenology and distribution, and projected increases in temperature pose a significant challenge to agriculture. Despite the important role of temperature on plant development, the underlying pathways are unknown. It has previously been shown that thermal acceleration of flowering is dependent on the florigen, FLOWERING LOCUS T (FT). How this occurs is, however, not understood, because the major pathway known to upregulate FT, the photoperiod pathway, is not required for thermal acceleration of flowering. Here we demonstrate a direct mechanism by which increasing temperature causes the bHLH transcription factor PHYTOCHROME INTERACTING FACTOR4 (PIF4) to activate FT. Our findings provide a new understanding of how plants control their timing of reproduction in response to temperature. Flowering time is an important trait in crops as well as affecting the life cycles of pollinator species. A molecular understanding of how temperature affects flowering will be important for mitigating the effects of climate change. PMID:22437497

  20. Allosteric activation of ADAMTS13 by von Willebrand factor

    PubMed Central

    Muia, Joshua; Zhu, Jian; Gupta, Garima; Haberichter, Sandra L.; Friedman, Kenneth D.; Feys, Hendrik B.; Deforche, Louis; Vanhoorelbeke, Karen; Westfield, Lisa A.; Roth, Robyn; Tolia, Niraj Harish; Heuser, John E.

    2014-01-01

    The metalloprotease ADAMTS13 cleaves von Willebrand factor (VWF) within endovascular platelet aggregates, and ADAMTS13 deficiency causes fatal microvascular thrombosis. The proximal metalloprotease (M), disintegrin-like (D), thrombospondin-1 (T), Cys-rich (C), and spacer (S) domains of ADAMTS13 recognize a cryptic site in VWF that is exposed by tensile force. Another seven T and two complement C1r/C1s, sea urchin epidermal growth factor, and bone morphogenetic protein (CUB) domains of uncertain function are C-terminal to the MDTCS domains. We find that the distal T8-CUB2 domains markedly inhibit substrate cleavage, and binding of VWF or monoclonal antibodies to distal ADAMTS13 domains relieves this autoinhibition. Small angle X-ray scattering data indicate that distal T-CUB domains interact with proximal MDTCS domains. Thus, ADAMTS13 is regulated by substrate-induced allosteric activation, which may optimize VWF cleavage under fluid shear stress in vivo. Distal domains of other ADAMTS proteases may have similar allosteric properties. PMID:25512528

  1. Lineage-specific enhancers activate self-renewal genes in macrophages and embryonic stem cells

    PubMed Central

    Soucie, Erinn L.; Weng, Ziming; Geirsdóttir, Laufey; Molawi, Kaaweh; Maurizio, Julien; Fenouil, Romain; Mossadegh-Keller, Noushine; Gimenez, Gregory; VanHille, Laurent; Beniazza, Meryam; Favret, Jeremy; Berruyer, Carole; Perrin, Pierre; Hacohen, Nir; Andrau, J.-C.; Ferrier, Pierre; Dubreuil, Patrice; Sidow, Arend; Sieweke, Michael H.

    2016-01-01

    Differentiated macrophages can self-renew in tissues and expand long-term in culture, but the gene regulatory mechanisms that accomplish self-renewal in the differentiated state have remained unknown. Here we show that in mice, the transcription factors MafB and c-Maf repress a macrophage-specific enhancer repertoire associated with a gene network controlling self-renewal. Single cell analysis revealed that, in vivo, proliferating resident macrophages can access this network by transient down-regulation of Maf transcription factors. The network also controls embryonic stem cell self-renewal but is associated with distinct embryonic stem cell-specific enhancers. This indicates that distinct lineage-specific enhancer platforms regulate a shared network of genes that control self-renewal potential in both stem and mature cells. PMID:26797145

  2. Increased activity of coagulation factor XII (Hageman factor) causes hereditary angioedema type III.

    PubMed

    Cichon, Sven; Martin, Ludovic; Hennies, Hans Christian; Müller, Felicitas; Van Driessche, Karen; Karpushova, Anna; Stevens, Wim; Colombo, Roberto; Renné, Thomas; Drouet, Christian; Bork, Konrad; Nöthen, Markus M

    2006-12-01

    Hereditary angioedema (HAE) is characterized clinically by recurrent acute skin swelling, abdominal pain, and potentially life-threatening laryngeal edema. Three forms of HAE have been described. The classic forms, HAE types I and II, occur as a consequence of mutations in the C1-inhibitor gene. In contrast to HAE types I and II, HAE type III has been observed exclusively in women, where it appears to be correlated with conditions of high estrogen levels--for example, pregnancy or the use of oral contraceptives. A recent report proposed two missense mutations (c.1032C-->A and c.1032C-->G) in F12, the gene encoding human coagulation factor XII (FXII, or Hageman factor) as a possible cause of HAE type III. Here, we report the occurrence of the c.1032C-->A (p.Thr328Lys) mutation in an HAE type III-affected family of French origin. Investigation of the F12 gene in a large German family did not reveal a coding mutation. Haplotype analysis with use of microsatellite markers is compatible with locus heterogeneity in HAE type III. To shed more light on the pathogenic relevance of the HAE type III-associated p.Thr328Lys mutation, we compared FXII activity and plasma levels in patients carrying the mutation with that of healthy control individuals. Our data strongly suggest that p.Thr328Lys is a gain-of-function mutation that markedly increases FXII amidolytic activity but that does not alter FXII plasma levels. We conclude that enhanced FXII enzymatic plasma activity in female mutation carriers leads to enhanced kinin production, which results in angioedema. Transcription of F12 is positively regulated by estrogens, which may explain why only women are affected with HAE type III. The results of our study represent an important step toward an understanding of the molecular processes involved in HAE type III and provide diagnostic and possibly new therapeutic opportunities. PMID:17186468

  3. Grazing by protozoa as selection factor for activated sludge bacteria.

    PubMed

    Güde, H

    1979-09-01

    In continuous culture enrichments that were inoculated with activated sludge and were fed with polymeric substrates, freely dispersed single-celled bacteria belonging to theCytophaga group dominated among the initial populations, irrespective of the activated sludge source. These populations were grazed by flagellated protozoa which after several days reached high cell densities. Other morphologic bacterial groups such as spiral-shaped or filamentous bacteria then became dominant. In defined mixed culture experiments with bacterial isolates from the enrichment cultures, it was shown that a "grazing-resistant"Microcyclus strain outgrew aCytophaga strain in the presence of grazing protozoa. In contrast, theCytophaga strain competed successfully with theMicrocyclus strain and with other "grazing-resistant" strains under protozoa-free conditions. Furthermore, it was demonstrated that assumed grazing resistance factors such as floccing or filamentous growth were lost by some of the strains when they were grown for several generations in continuous culture under the same conditions, but in the absence of protozoa. PMID:24232496

  4. Radiation therapy generates platelet-activating factor agonists

    PubMed Central

    Sahu, Ravi P.; Harrison, Kathleen A.; Weyerbacher, Jonathan; Murphy, Robert C.; Konger, Raymond L.; Garrett, Joy Elizabeth; Chin-Sinex, Helen Jan; Johnston, Michael Edward; Dynlacht, Joseph R.; Mendonca, Marc; McMullen, Kevin; Li, Gengxin; Spandau, Dan F.; Travers, Jeffrey B.

    2016-01-01

    Pro-oxidative stressors can suppress host immunity due to their ability to generate oxidized lipid agonists of the platelet-activating factor-receptor (PAF-R). As radiation therapy also induces reactive oxygen species, the present studies were designed to define whether ionizing radiation could generate PAF-R agonists and if these lipids could subvert host immunity. We demonstrate that radiation exposure of multiple tumor cell lines in-vitro, tumors in-vivo, and human subjects undergoing radiation therapy for skin tumors all generate PAF-R agonists. Structural characterization of radiation-induced PAF-R agonistic activity revealed PAF and multiple oxidized glycerophosphocholines that are produced non-enzymatically. In a murine melanoma tumor model, irradiation of one tumor augmented the growth of the other (non-treated) tumor in a PAF-R-dependent process blocked by a cyclooxygenase-2 inhibitor. These results indicate a novel pathway by which PAF-R agonists produced as a byproduct of radiation therapy could result in tumor treatment failure, and offer important insights into potential therapeutic strategies that could improve the overall antitumor effectiveness of radiation therapy regimens. PMID:26959112

  5. Radiation therapy generates platelet-activating factor agonists.

    PubMed

    Sahu, Ravi P; Harrison, Kathleen A; Weyerbacher, Jonathan; Murphy, Robert C; Konger, Raymond L; Garrett, Joy Elizabeth; Chin-Sinex, Helen Jan; Johnston, Michael Edward; Dynlacht, Joseph R; Mendonca, Marc; McMullen, Kevin; Li, Gengxin; Spandau, Dan F; Travers, Jeffrey B

    2016-04-12

    Pro-oxidative stressors can suppress host immunity due to their ability to generate oxidized lipid agonists of the platelet-activating factor-receptor (PAF-R). As radiation therapy also induces reactive oxygen species, the present studies were designed to define whether ionizing radiation could generate PAF-R agonists and if these lipids could subvert host immunity. We demonstrate that radiation exposure of multiple tumor cell lines in-vitro, tumors in-vivo, and human subjects undergoing radiation therapy for skin tumors all generate PAF-R agonists. Structural characterization of radiation-induced PAF-R agonistic activity revealed PAF and multiple oxidized glycerophosphocholines that are produced non-enzymatically. In a murine melanoma tumor model, irradiation of one tumor augmented the growth of the other (non-treated) tumor in a PAF-R-dependent process blocked by a cyclooxygenase-2 inhibitor. These results indicate a novel pathway by which PAF-R agonists produced as a byproduct of radiation therapy could result in tumor treatment failure, and offer important insights into potential therapeutic strategies that could improve the overall antitumor effectiveness of radiation therapy regimens. PMID:26959112

  6. Hemophilia as a defect of the tissue factor pathway of blood coagulation: Effect of factors VIII and IX on factor X activation in a continuous-flow reactor

    SciTech Connect

    Repke, D.; Gemmell, C.H.; Guha, A.; Turitto, V.T.; Nemerson, Y. ); Broze, G.J. Jr. )

    1990-10-01

    The effect of factors VIII and IX on the ability of the tissue factor-factor VIIa complex to activate factor X was studied in a continuous-flow tubular enzyme reactor. Tissue factor immobilized in a phospholipid bilayer on the inner surface of the tube was exposed to a perfusate containing factors VIIa, VIII, IX, and X flowing at a wall shear rate of 57, 300, or 1130 sec{sup {minus}1}. The addition of factors VIII and IX at their respective plasma concentrations resulted in a further 2{endash}-to 3{endash}fold increase. The direct activation of factor X by tissue factor-factor VIIa could be virtually eliminated by the lipoprotein-associated coagulation inhibitor. These results suggest that the tissue factor pathway, mediated through factors VIII and IX, produces significant levels of factor Xa even in the presence of an inhibitor of the tissue factor-factor VIIa complex; moreover, the activation is dependent on local shear conditions. These findings are consistent both with a model of blood coagulation in which initiation of the system results from tissue factor and with the bleeding observed in hemophilia.

  7. Prediction of Pathway Activation by Xenobiotic-Responsive Transcription Factors in the Mouse Liver

    EPA Science Inventory

    Many drugs and environmentally-relevant chemicals activate xenobioticresponsive transcription factors (TF). Identification of target genes of these factors would be useful in predicting pathway activation in in vitro chemical screening. Starting with a large compendium of Affymet...

  8. Fibrinogen blocks the autoactivation and thrombin-mediated activation of factor XI on dextran sulfate.

    PubMed Central

    Scott, C F; Colman, R W

    1992-01-01

    The intrinsic pathway of blood coagulation is activated when factor XIa, one of the three contact-system enzymes, is generated and then activates factor IX. Factor XI has been shown to be efficiently activated in vitro by surface-bound factor XIIa after factor XI is transported to the surface by its cofactor, high molecular weight kininogen (HK). However, individuals lacking any of the three contact-system proteins--namely, factor XII, prekallikrein, and HK--do not suffer from bleeding abnormalities. This mystery has led several investigators to search for an "alternate" activation pathway for factor XI. Recently, factor XI has been reported to be autoactivated on the soluble "surface" dextran sulfate, and thrombin was shown to accelerate the autoactivation. However, it was also reported that HK, the cofactor for factor XIIa-mediated activation of factor XI, actually diminishes the thrombin-catalyzed activation rate of factor XI. Nonetheless, it was suggested that thrombin was a more efficient activator than factor XIIa. In this report we investigated the effect of fibrinogen, the major coagulation protein in plasma, on the activation rate of factor XI. Fibrinogen, the preferred substrate for thrombin in plasma, virtually prevented autoactivation of factor XI as well as the thrombin-mediated activation of factor XI, while having no effect on factor XIIa-catalyzed activation. HK dramatically curtailed the autoactivation of factor XI in addition to the thrombin-mediated activation. These data indicate that factor XI would not be autoactivated in a plasma environment, and thrombin would, therefore, be unlikely to potentiate the activation. We believe that the "missing pathway" for factor XI activation remains an enigma that warrants further investigation. PMID:1454798

  9. Determination of factor X activator in the venom of the saw-scaled viper (Echis carinatus).

    PubMed

    Stocker, K; Fischer, H; Brogli, M

    1986-01-01

    Factor X activator in Echis carinatus venom was determined by incubating the zymogen 'factor X' with venom, interrupting the activation process by ethylenediaminetetraacetic acid and measuring the generated proteinase 'factor Xa' by means of a synthetic chromogenic substrate. A comparison of factor X- and prothrombin-activating potencies in E. carinatus venoms of five different geographic origins revealed no correlation between these two procoagulant activities. PMID:3715901

  10. Water Activity Limits the Hygroscopic Growth Factor of Organic Aerosols

    NASA Astrophysics Data System (ADS)

    Rodriguez, L. I.; Cabrera, J. A.; Golden, D.; Tabazadeh, A.

    2007-12-01

    In this work we study the hygroscopic behavior of organic aerosols, which has important implications for Earth's climate. The hygroscopic growth factor (HGF) is defined as the ratio of the diameter of a spherical particle when it is exposed to dry conditions to that at humid conditions. We present a new formulation to express the HGF of an aerosol particle as a function of water activity (aw) in the aqueous phase. This new formulation matches reported HGFs for common inorganic salts and water-miscible organic particles that are known to deliquesce into aqueous drops at high relative humidities (RH). Many studies use tandem differential mobility analyzers (TDMA) to determine the HGF of organic aerosols. For example, Brooks et al. used a TDMA to measure a HGF of 1.2 for 2 μm phthalic acid (PA) particles at 90% RH (aw= 0.9). However, water activity limits the growth of a particle that can be attributed to water uptake. We have assembled a vapor pressure apparatus to measure aw of aqueous solutions at room temperature. Measured water activities for PA, used in our growth formulation, yield a HGF of ~ 1.0005 for 2 μm PA particles at 90% RH. Comparing our results against Brooks et al. suggests that TDMA experiments may grossly overestimate the HGF of PA particles since water activity limits this growth to below 1.0005. Alternatively, we suggest that the adsorption of a negligible mass of water by a highly porous PA particle can lead to an apparent growth in particle size by changing its morphology. Other studies also use TDMAs to measure HGFs of secondary organic aerosols (SOAs). HGFs reported for SOAs are very similar to PA, suggesting that the observed growth may be due to morphological changes in particle size rather than water uptake as commonly assumed. We built a smog chamber where an organic precursor, such as d-limonene, reacts with nitrogen oxides under UV radiation to produce SOAs. We compare the HGFs for SOAs obtained with our method to those obtained with

  11. Biochemistry of platelet-activating factor: A unique class of biologically active phospholipids

    SciTech Connect

    Snyder, F. )

    1989-01-01

    This brief overview describes the chemical features of this unique bioactive phospholipid that possesses biologic properties identical to platelet-activating factor (PAF) and an antihypertensive polar renal lipid (APRL). The current understanding of PAF metabolism and its regulation are emphasized, particularly in the context of explaining the enzymatic source of PAF in physiologic vs pharmacologic processes. Also included are brief accounts of the biologic properties, structural-functional relationships, antagonists, receptors and mode of action of PAF.

  12. Two cell surface proteins bind the sponge Microciona prolifera aggregation factor.

    PubMed

    Varner, J A; Burger, M M; Kaufman, J F

    1988-06-15

    Two extracellular matrix cell surface proteins which bind the proteoglycan-like aggregation factor from the marine sponge Microciona prolifera (MAF) and which may function as physiological receptors for MAF were identified and characterized for the first time. By probing nitrocellulose blots of nonreducing sodium dodecyl sulfate gels containing whole sponge cell protein with iodinated MAF, a 210- and a 68-kDa protein, which have native molecular masses of approximately 200-400 and 70 kDa, were identified. MAF binding to blots is species-specific. It is also sensitive to reduction and is completely abolished by pretreatment of live cells with proteases, as was cellular aggregation, indicating that the 210- and 68-kDa proteins may be located on the cell surface. The additional observations that the 68 kDa is an endoglycosidase F-sensitive glycoprotein and that antisera against whole sponge cells or membranes can immunoprecipitate the 210 kDa when prebound to intact cells are consistent with a cell surface location. Both proteins can be isolated from sponge cell membranes and from the sponge skeleton (insoluble extracellular matrix), but the 210-kDa MAF-binding protein can also be found in the soluble extracellular matrix (buffer washes of cells and skeleton) as well. A third MAF-binding protein of molecular mass 95 kDa was also found in the sponge extracellular matrix but rarely on cells. Both of the cell-associated 210- and 68-kDa proteins are nonintegral membrane proteins, based on Triton X-114 phase separation, flotation of liposomes containing sponge membrane lysates, and their extraction from membranes by buffer washes. Both proteins bind MAF affinity resins, indicating that they each exhibit a moderate affinity for MAF under native conditions. They can also be separated from each other and from the bulk of the protein in an octylpolyoxyethylene extract of membranes by fast protein liquid chromatography Mono Q anion exchange chromatography, as assessed by native

  13. Platelet-activating factor and laser trauma of the iris

    SciTech Connect

    Verbey, N.L.; Van Delft, J.L.; Van Haeringen, N.J.; Braquet, P.

    1989-06-01

    Local application of platelet-activating factor (PAF) on the rabbit eye caused a dose-dependent significant increase in intraocular pressure (IOP). After laser irradiation of the iris the IOP showed a hypertensive phase of about 3 hr. Prophylactic treatment with the PAF antagonist BN 52021 but not with indomethacin abolished the hypertensive phase. Elevated levels of protein (10.6 +/- 0.9 g/l) and prostaglandin E2 (PGE2, 1.7 +/- 0.2 ng/ml) were measured in the aqueous humor 2 hr after laser irradiation of the iris. Prophylactic treatment with BN 52021 showed lower levels of protein (6.1 +/- 0.7) and PGE2 (1.1 +/- 0.02); with indomethacin pretreatment the level of protein was 3.4 +/- 0.7 g/l and of PGE2 0.10 +/- 0.02 ng/ml. A role of PAF as a mediator in ocular inflammatory response is suggested.

  14. Formaldehyde activation factor, tetrahydromethanopterin, a coenzyme of methanogenesis

    SciTech Connect

    Escalante-Semerena, J.C.; Leigh, J.A.; Rinehart, K.L. Jr.; Wolfe, R.S.

    1984-04-01

    An oxygen-labile formaldehyde activation factor (FAF) was isolated in highly purified form by use of anoxic fractionation procedures. The molecular weight of FAF was determined to be 776 and that of methanopterin (MPT) 772 by fast-atom-bombardment mass spectrometry (FABMS). High-resolution FABMS measurements on MPT and FAF indicated molecular formulas of C/sub 30/H/sub 41/N/sub 6/O/sub 16/P and C/sub 30/H/sub 45/N/sub 6/O/sub 16/P, respectively. The presence of phosphorus was confirmed by 100-MHz /sup 31/P NMR. The 360-MHz /sup 1/H NMR spectrum of FAF in deuterium oxide was similar to that of MPT. A functional relationship between MPT and FAF was documented; both compounds stimulated the reductive demethylation of 2-(methylthio)ethanesulfonic acid (CH/sub 3/-S-CoM) to CH/sub 4/ when formaldehyde oxidation provided a source of electrons, and FAF replaced MPT in the CH/sub 3/-S-CoM-stimulated conversion of CO/sub 2/ to CH/sub 4/ under H/sub 2/ (the RPG effect). MPT was enzymically converted to FAF during the reduction of CH/sub 3/-S-CoM, and HCHO to CH/sub 4/ under H/sub 2/. Evidence indicates that FAF is tetrahydromethanopterin. 14 references, 8 figures.

  15. Recombinant activated factor VII in post partum haemorrhage

    PubMed Central

    Magon, Navneet; Babu, K. M.; Kapur, Krishan; Chopra, Sanjiv; Joneja, Gurdarshan Singh

    2013-01-01

    Post-partum haemorrhage (PPH) is a life-threatening obstetric complication and the leading cause of maternal death. Any bleeding that results in or could result in haemodynamic instability, if untreated, must be considered as PPH. There is no controversy about the need for prevention and treatment of PPH. The keystone of management of PPH entails first, non-invasive and nonsurgical methods and then invasive and surgical methods. However, mortality remains high. Therefore, new advancements in the treatment are most crucial. One such advancement has been the use of recombinant activated factor VII (rFVIIa) in PPH. First used 12 years back in PPH, this universal haemostatic agent has been effectively used in controlling PPH. The best available indicator of rFVIIa efficacy is the arrest of haemorrhage, which is judged by visual evidence and haemodynamic stabilization. It also reduces costs of therapy and the use of blood components in massive PPH. In cases of intractable PPH with no other obvious indications for hysterectomy, administration of rFVIIa should be considered before surgery. We share our experience in a series of cases of PPH, successfully managed using rFVIIa. PMID:24403703

  16. Regulating the regulators: modulators of transcription factor activity.

    PubMed

    Everett, Logan; Hansen, Matthew; Hannenhalli, Sridhar

    2010-01-01

    Gene transcription is largely regulated by DNA-binding transcription factors (TFs). However, the TF activity itself is modulated via, among other things, post-translational modifications (PTMs) by specific modification enzymes in response to cellular stimuli. TF-PTMs thus serve as "molecular switchboards" that map upstream signaling events to the downstream transcriptional events. An important long-term goal is to obtain a genome-wide map of "regulatory triplets" consisting of a TF, target gene, and a modulator gene that specifically modulates the regulation of the target gene by the TF. A variety of genome-wide data sets can be exploited by computational methods to obtain a rough map of regulatory triplets, which can guide directed experiments. However, a prerequisite to developing such computational tools is a systematic catalog of known instances of regulatory triplets. We first describe PTM-Switchboard, a recent database that stores triplets of genes such that the ability of one gene (the TF) to regulate a target gene is dependent on one or more PTMs catalyzed by a third gene, the modifying enzyme. We also review current computational approaches to infer regulatory triplets from genome-wide data sets and conclude with a discussion of potential future research. PTM-Switchboard is accessible at http://cagr.pcbi.upenn.edu/PTMswitchboard / PMID:20827600

  17. Influence of Environmental Factors on Feammox Activity in Soil Environments

    NASA Astrophysics Data System (ADS)

    Huang, S.; Jaffe, P. R.

    2015-12-01

    The oxidation of ammonium (NH4+) under iron reducing conditions, referred to as Feammox, has been described in recent years by several investigators. The environmental characteristics in which the Feammox process occurs need to be understood in order to determine its contribution to the nitrogen cycle. In this study, a total of 66 locations were selected covering 4 different types of soils/sediments: wetland soils (W), river sediments (R), forest soils (F), and paddy soils (P) from several locations in central New Jersey, at Tims Branch at Savannah River in South Carolina, both in the Unities States, and at several locations in the Guangdong province in China. Though soil chemical analyses, serial culturing experiments, analysis of microbial communities, and using a canonical correspondence analysis, the occurrence of the Feammox reaction and the presence of Acidimicrobiaceae bacterium A6, which plays a key role in the Feammox process(1), were found in 17 samples. Analyses showed that the soil pH, as well as its Fe(III) and NH4+ content were the most important factors controlling the distribution of these Feammox microorganisms. Based on the results, soils in the subtropical forests and soils that are near agricultural areas could be Feammox hotspot. Under the conditions that favor the presence and activity of Feammox microorganisms and their oxidation of NH4+, denitrification bacteria were also active. However, the presence of nitrous oxide (N2O) reducers was limited under these conditions, implying that at locations where the Feammox process is active, conditions are favoring a higher ratio of N2O: N2 as the nitrogen (N) end products. Incubations of soils where the presence of Acidimicrobiaceae bacterium A6 was detected, were conducted for 120 days under two different DO levels (DO < 0.02 mg/L and DO = 0.8~1.0 mg/L) showing comparable amounts of NH4+ oxidation. In the incubations with DO < 0.02 mg/L, the proportion of Acidimicrobiaceae bacteria increased and

  18. Reprogramming of Various Cell Types to a Beta-Like State by Pdx1, Ngn3 and MafA

    PubMed Central

    Akinci, Ersin; Banga, Anannya; Tungatt, Katie; Segal, Joanna; Eberhard, Daniel; Dutton, James R.; Slack, Jonathan M. W.

    2013-01-01

    The three transcription factors, PDX1, NGN3 and MAFA, are very important in pancreatic development. Overexpression of these three factors can reprogram both pancreatic exocrine cells and SOX9-positive cells of the liver into cells resembling pancreatic beta cells. In this study we investigate whether other cell types can be reprogrammed. Eight cell types are compared and the results are consistent with the idea that reprogramming occurs to a greater degree for developmentally related cells (pancreas, liver) than for other types, such as fibroblasts. Using a line of mouse hepatocyte-derived cells we screened 13 compounds for the ability to increase the yield of reprogrammed cells. Three are active and when used in combination they can increase the yield of insulin-immunopositive cells by a factor of six. These results should contribute to the eventual ability to develop a new cure for diabetes based on the ability to reprogram other cells in the body to a beta cell phenotype. PMID:24312421

  19. Hepatocyte growth factor, hepatocyte growth factor activator and arginine in a rat fulminant colitis model

    PubMed Central

    Zwintscher, Nathan P.; Shah, Puja M.; Salgar, Shashikumar K.; Newton, Christopher R.; Maykel, Justin A.; Samy, Ahmed; Jabir, Murad; Steele, Scott R.

    2016-01-01

    Introduction Dextran sodium sulfate (DSS) is commonly used to induce a murine fulminant colitis model. Hepatocyte growth factor (HGF) has been shown to decrease the symptoms of inflammatory bowel disease (IBD) but the effect of its activator, HGFA, is not well characterized. Arginine reduces effects of oxidative stress but its effect on IBD is not well known. The primary aim is to determine whether HGF and HGFA, or arginine will decrease IBD symptoms such as pain and diarrhea in a DSS-induced fulminant colitis murine model. Methods A severe colitis was induced in young, male Fischer 344 rats with 4% (w/v) DSS oral solution for seven days; rats were sacrificed on day 10. Rats were divided into five groups of 8 animals: control, HGF (700 mcg/kg/dose), HGF and HGFA (10 mcg/dose), HGF and arginine, and high dose HGF (2800 mcg/kg/dose). Main clinical outcomes were pain, diarrhea and weight loss. Blinded pathologists scored the terminal ileum and distal colon. Results DSS reliably induced severe active colitis in 90% of animals (n = 36/40). There were no differences in injury scores between control and treatment animals. HGF led to 1.38 fewer days in pain (p = 0.036), while arginine led to 1.88 fewer days of diarrhea (P = 0.017) compared to controls. 88% of HGFA-treated rats started regaining weight (P < 0.001). Discussion/Conclusion Although treatment was unable to reverse fulminant disease, HGF and arginine were associated with decreased days of pain and diarrhea. These clinical interventions may reduce associated symptoms for severe IBD patients, even when urgent surgical intervention remains the only viable option. PMID:27144006

  20. The molecular biology and nomenclature of the activating transcription factor/cAMP responsive element binding family of transcription factors: activating transcription factor proteins and homeostasis.

    PubMed

    Hai, T; Hartman, M G

    2001-07-25

    The mammalian ATF/CREB family of transcription factors represents a large group of basic region-leucine zipper (bZip) proteins which was originally defined in the late 1980s by their ability to bind to the consensus ATF/CRE site 'TGACGTCA'. Over the past decade, cDNA clones encoding identical or homologous proteins have been isolated by different laboratories and given different names. These proteins can be grouped into subgroups according to their amino acid similarity. In this review, we will briefly describe the classification of these proteins with a historical perspective of their nomenclature. We will then review three members of the ATF/CREB family of proteins: ATF3, ATF4 and ATF6. We will address four issues for each protein: (a) homologous proteins and alternative names, (b) dimer formation with other bZip proteins, (c) transcriptional activity, and (d) potential physiological functions. Although the name Activating Transcription Factor (ATF) implies that they are transcriptional activators, some of these proteins are transcriptional repressors. ATF3 homodimer is a transcriptional repressor and ATF4 has been reported to be either an activator or a repressor. We will review the reports on the transcriptional activities of ATF4, and propose potential explanations for the discrepancy. Although the physiological functions of these proteins are not well understood, some clues can be gained from studies with different approaches. When the data are available, we will address the following questions. (a) How is the expression (at the mRNA level or protein level) regulated? (b) How are the transcriptional activities regulated? (c) What are the interacting proteins (other than bZip partners)? (d) What are the consequences of ectopically expressing the gene (gain-of-function) or deleting the gene (loss-of-function)? Although answers to these questions are far from being complete, together they provide clues to the functions of these ATF proteins. Despite the

  1. Mobilization of hepatic calcium pools by platelet activating factor

    SciTech Connect

    Lapointe, D.S.; Hanahan, D.J.; Olson, M.S.

    1987-03-24

    In the perfused rat liver, platelet activating factor, 1-O-hexadecyl-2-acetyl-sn-glycero-3-phosphocholine (AGEPC), infusion produces an extensive but transient glycogenolytic response which at low AGEPC concentrations is markedly dependent upon the perfusate calcium levels. The role of calcium in the glycogenolytic response of the liver to AGEPC was investigated by assessing the effect of AGEPC on various calcium pools in the intact liver. Livers from fed rats were equilibrated with /sup 45/Ca/sup 2 +/, and the kinetics of /sup 45/Ca/sup 2 +/ efflux were determined in control, AGEPC-stimulated, and phenylephrine-stimulated livers during steady-state washout of /sup 45/Ca/sup 2 +/. AGEPC treatment had only a slight if any effect on the pattern of steady-state calcium efflux from the liver, as opposed to major perturbations in the pattern of calcium efflux effected by the ..cap alpha..-adrenergic agonist phenylephrine. Infusion of short pulses of AGEPC during the washout of /sup 45/Ca/sup 2 +/ from labeled livers caused a transient release of /sup 45/Ca/sup 2 +/ which was not abolished at low calcium concentrations in the perfusate. Infusion of latex beads, which are removed by the reticuloendothelial cells, caused the release of hepatic /sup 45/Ca/sup 2 +/ in a fashion similar to the case with AGEPC. The findings indicate that AGEPC does not perturb a major pool of calcium within the liver as occurs upon ..cap alpha..-adrenergic stimulation; it is likely that AGEPC mobilizes calcium from a smaller yet very important pool, very possibly from nonparenchymal cells in the liver.

  2. Activation of G Proteins by Guanine Nucleotide Exchange Factors Relies on GTPase Activity

    PubMed Central

    Stanley, Rob J.; Thomas, Geraint M. H.

    2016-01-01

    G proteins are an important family of signalling molecules controlled by guanine nucleotide exchange and GTPase activity in what is commonly called an ‘activation/inactivation cycle’. The molecular mechanism by which guanine nucleotide exchange factors (GEFs) catalyse the activation of monomeric G proteins is well-established, however the complete reversibility of this mechanism is often overlooked. Here, we use a theoretical approach to prove that GEFs are unable to positively control G protein systems at steady-state in the absence of GTPase activity. Instead, positive regulation of G proteins must be seen as a product of the competition between guanine nucleotide exchange and GTPase activity—emphasising a central role for GTPase activity beyond merely signal termination. We conclude that a more accurate description of the regulation of G proteins via these processes is as a ‘balance/imbalance’ mechanism. This result has implications for the understanding of intracellular signalling processes, and for experimental strategies that rely on modulating G protein systems. PMID:26986850

  3. Regulation of platelet activating factor receptor coupled phosphoinositide-specific phospholipase C activity

    SciTech Connect

    Morrison, W.J.

    1988-01-01

    The major objectives of this study were two-fold. The first was to establish whether binding of platelet activating factor (PAF) to its receptor was integral to the stimulation of polyphosphoinositide-specific phospholipase C (PLC) in rabbit platelets. The second was to determine regulatory features of this receptor-coupled mechanism. ({sup 3}H)PAF binding demonstrated two binding sites, a high affinity site with a inhibitory constant (Ki) of 2.65 nM and a low affinity site with a Ki of 0.80 {mu}M. PAF receptor coupled activation of phosphoinositide-specific PLC was studied in platelets which were made refractory, by short term pretreatments, to either PAF or thrombin. Saponin-permeabilized rabbit platelets continue to regulate the mechanism(s) coupling PAF receptors to PLC stimulation. However, TRP{gamma}S and GDP{beta}S, which affect guanine nucleotide regulatory protein functions, were unable to modulate the PLC activity to any appreciable extent as compared to PAF. The possible involvement of protein kinase C (PKC) activation in regulating PAF-stimulated PLC activity was studied in rabbit platelets pretreated with staurosporine followed by pretreatments with PAF or phorbol 12-myristate 13-acetate (PMA).

  4. Influence of factor VIII:C and factor IX activity in plasmas of haemophilic dogs on the activated partial thromboplastin time measured with two commercial reagents.

    PubMed

    Mischke, R

    2000-05-01

    The present study is based on 145 plasma samples with a reduced activity of factor VIII:C (range: 0.009-0.62 IU mL-1) and 28 samples with a reduced factor IX activity (range: 0.035-0.55 IU mL-1). The samples were collected from dogs with haemophilia A (n=22) or haemophilia B (n=3), some of these during substitution therapy. For all samples the activated partial thromboplastin time (APTT) was measured with two commercial reagents containing kaolin as a contact activator. In each case, the deficiency of factor VIII:C or IX was reflected in abnormal results of the APTT. This was true for both reagents. A significant correlation (P < 0.001) was found between factor VIII:C activity and APTT (reagent 1, Pathromtin(R); Spearman's rank correlation coefficient, rS=-0.731, reagent 2, PTT-Reagenz; rS=-0.875) as well as between factor IX activity and APTT (reagent 1, rS=-0.819; reagent 2, rS=-0.955]. In each case, the relationship between coagulation factor activity and APTT could be proven most precisely by geometric regression. The results of this study illustrate the applicability of commercial APTT test kits as a sensitive screening test of factor VIII:C and IX deficiencies in canine plasma. PMID:10792470

  5. Adolescent Sexual Activity: An Ecological, Risk-Factor Approach.

    ERIC Educational Resources Information Center

    Small, Stephen A.; Luster, Tom

    1994-01-01

    Examined relationship between adolescent sexual intercourse and history of physical abuse, neighborhood monitoring, and adolescent's attachment to school. Findings from 2,108 adolescents suggest that there are many significant risk factors related to whether adolescents are sexually experienced and that importance of some factors vary by gender.…

  6. The nuclear factor SPBP contains different functional domains and stimulates the activity of various transcriptional activators.

    PubMed

    Rekdal, C; Sjøttem, E; Johansen, T

    2000-12-22

    SPBP (stromelysin-1 platelet-derived growth factor-responsive element binding protein) was originally cloned from a cDNA expression library by virtue of its ability to bind to a platelet-derived growth factor-responsive element in the human stromelysin-1 promoter. A 937-amino acid-long protein was deduced from a 3995-nucleotide murine cDNA sequence. By analyses of both human and murine cDNAs, we now show that SPBP is twice as large as originally found. The human SPBP gene contains six exons and is located on chromosome 22q13.1-13.3. Two isoforms differing in their C termini are expressed due to alternative splicing. PCR analyses of multitissue cDNA panels showed that SPBP is expressed in most tissues except for ovary and prostate. Functional mapping revealed that SPBP is a nuclear, multidomain protein containing an N-terminal region with transactivating ability, a novel type of DNA-binding domain containing an AT hook motif, and a bipartite nuclear localization signal as well as a C-terminal zinc finger domain. This type of zinc finger domain is also found in the trithorax family of chromatin-based transcriptional regulator proteins. Using cotransfection experiments, we find that SPBP enhances the transcriptional activity of various transcription factors such as c-Jun, Ets1, Sp1, and Pax6. Hence, SPBP seems to act as a transcriptional coactivator. PMID:10995766

  7. Differential Phosphorylation of RNA Polymerase III and the Initiation Factor TFIIIB in Saccharomyces cerevisiae

    PubMed Central

    Lee, Jaehoon; Moir, Robyn D.; Willis, Ian M.

    2015-01-01

    The production of ribosomes and tRNAs for protein synthesis has a high energetic cost and is under tight transcriptional control to ensure that the level of RNA synthesis is balanced with nutrient availability and the prevailing environmental conditions. In the RNA polymerase (pol) III system in yeast, nutrients and stress affect transcription through a bifurcated signaling pathway in which protein kinase A (PKA) and TORC1 activity directly or indirectly, through downstream kinases, alter the phosphorylation state and function of the Maf1 repressor and Rpc53, a TFIIF-like subunit of the polymerase. However, numerous lines of evidence suggest greater complexity in the regulatory network including the phosphoregulation of other pol III components. To address this issue, we systematically examined all 17 subunits of pol III along with the three subunits of the initiation factor TFIIIB for evidence of differential phosphorylation in response to inhibition of TORC1. A relatively high stoichiometry of phosphorylation was observed for several of these proteins and the Rpc82 subunit of the polymerase and the Bdp1 subunit of TFIIIB were found to be differentially phosphorylated. Bdp1 is phosphorylated on four major sites during exponential growth and the protein is variably dephosphorylated under conditions that inhibit tRNA gene transcription. PKA, the TORC1-regulated kinase Sch9 and protein kinase CK2 are all implicated in the phosphorylation of Bdp1. Alanine substitutions at the four phosphosites cause hyper-repression of transcription indicating that phosphorylation of Bdp1 opposes Maf1-mediated repression. The new findings suggest an integrated regulatory model for signaling events controlling pol III transcription. PMID:25970584

  8. Differential Phosphorylation of RNA Polymerase III and the Initiation Factor TFIIIB in Saccharomyces cerevisiae.

    PubMed

    Lee, Jaehoon; Moir, Robyn D; Willis, Ian M

    2015-01-01

    The production of ribosomes and tRNAs for protein synthesis has a high energetic cost and is under tight transcriptional control to ensure that the level of RNA synthesis is balanced with nutrient availability and the prevailing environmental conditions. In the RNA polymerase (pol) III system in yeast, nutrients and stress affect transcription through a bifurcated signaling pathway in which protein kinase A (PKA) and TORC1 activity directly or indirectly, through downstream kinases, alter the phosphorylation state and function of the Maf1 repressor and Rpc53, a TFIIF-like subunit of the polymerase. However, numerous lines of evidence suggest greater complexity in the regulatory network including the phosphoregulation of other pol III components. To address this issue, we systematically examined all 17 subunits of pol III along with the three subunits of the initiation factor TFIIIB for evidence of differential phosphorylation in response to inhibition of TORC1. A relatively high stoichiometry of phosphorylation was observed for several of these proteins and the Rpc82 subunit of the polymerase and the Bdp1 subunit of TFIIIB were found to be differentially phosphorylated. Bdp1 is phosphorylated on four major sites during exponential growth and the protein is variably dephosphorylated under conditions that inhibit tRNA gene transcription. PKA, the TORC1-regulated kinase Sch9 and protein kinase CK2 are all implicated in the phosphorylation of Bdp1. Alanine substitutions at the four phosphosites cause hyper-repression of transcription indicating that phosphorylation of Bdp1 opposes Maf1-mediated repression. The new findings suggest an integrated regulatory model for signaling events controlling pol III transcription. PMID:25970584

  9. Alternative pathways of thromboplastin-dependent activation of human factor X in plasma

    SciTech Connect

    Marlar, R.A.; Griffin, J.H.

    1981-01-01

    To determine the interrelationships of the major coagulation pathways, the activation of 3H-labeled factor X in normal and various deficient human plasmas was evaluated when clotting was triggered by dilute rabbit or human thromboplastin. Various dilutions of thromboplastin and calcium were added to plasma samples containing 3H-factor X, and the time course of factor X activation was determined. At a 1/250 dilution of rabbit brain thromboplastin, the rate of factor X activation in plasmas deficient in factor VIII or factor IX was 10% of the activation rate of normal plasma or of factor XI deficient plasma. Reconstitution of the deficient plasmas with factors VIII or IX, respectively, reconstituted normal factor X activation. Similar results were obtained when various dilutions of human thromboplastin replaced the rabbit thromboplastin. From these plasma experiments, it is inferred that the dilute thromboplastin-dependent activation of factor X requires factors VII, IX, and VIII. An alternative extrinsic pathway that involves factors IX and VIII may be the physiologic extrinsic pathway and hence help to explain the consistent clinical observations of bleeding diatheses in patients deficient in factors IX or VIII.

  10. The immunological generation of a platelet-activating factor and a platet-lytic factor in the rat.

    PubMed Central

    Valone, F H; Whitmer, D I; Pickett, W C; Austen, K F; Goetzl, E J

    1979-01-01

    Antigen challenge of the rat peritoneal cavity which had been prepared with IgGa-rich antiserum generated activities which released [14C]-serotonin from pre-labelled human platelets. After adsorption of these activities onto Amberlite XAD-8 and elution in 80% ethanol, two factors of differing polarity were resolved by chromatography on diethylaminoethyl cellulose in organic solvents. The activity eluting in the 7:1 chloroform:methanol solvent contained a platelet-lytic factor (PLF) assessed by the parallel release of lactic acid dehydrogenase and [14C]-serotonin; the cytotoxicity of this fraction was confirmed by phase-contrast microscopy examination which demonstrated fragmentation of the exposed platelets. The activity eluting in the 1:1 methanol: aqueous 1.0 M ammonium carbonate solvent was a platelet-activating factor (PAF) as defined by release of [14C]-serotonin without lactic acid dehydrogenase. Both the lytic and the activating principles were separable from slow reacting substance of anaphylaxis and polymorphonuclear leucocyte chemotactic activity, and each presented a single activity peak of differing mobility when chromatographed on silica gel H plates. Human eosinophil phospholipase D inactivated the lytic factor by more than 85% in 2 h at 37 degrees without affecting the activity of the activating factor. The release of [14C]-serotonin induced by the PAF was not affected by the absence of calcium from the medium or by elevations in the platelet concentrations of cyclic AMP or cyclic GMP that resulted from pre-incubation of platelets with prostaglandin D2 or sodium ascorbate, respectively. PMID:227784

  11. Power considerations for λ inflation factor in meta-analyses of genome-wide association studies.

    PubMed

    Georgiopoulos, Georgios; Evangelou, Evangelos

    2016-01-01

    The genomic control (GC) approach is extensively used to effectively control false positive signals due to population stratification in genome-wide association studies (GWAS). However, GC affects the statistical power of GWAS. The loss of power depends on the magnitude of the inflation factor (λ) that is used for GC. We simulated meta-analyses of different GWAS. Minor allele frequency (MAF) ranged from 0·001 to 0·5 and λ was sampled from two scenarios: (i) random scenario (empirically-derived distribution of real λ values) and (ii) selected scenario from simulation parameter modification. Adjustment for λ was considered under single correction (within study corrected standard errors) and double correction (additional λ corrected summary estimate). MAF was a pivotal determinant of observed power. In random λ scenario, double correction induced a symmetric power reduction in comparison to single correction. For MAF 1·2 and MAF >5%. Our results provide a quick but detailed index for power considerations of future meta-analyses of GWAS that enables a more flexible design from early steps based on the number of studies accumulated in different groups and the λ values observed in the single studies. PMID:27193946

  12. Factors Shaping Students' Opportunities to Engage in Argumentative Activity

    ERIC Educational Resources Information Center

    Ayalon, Michal; Even, Ruhama

    2016-01-01

    This study examines how students' opportunities to engage in argumentative activity are shaped by the teacher, the class, and the mathematical topic. It compares the argumentative activity between two classes taught by the same teacher using the same textbook and across two beginning algebra topics--investigating algebraic expressions and…

  13. Social and Environmental Factors Associated with Preschoolers' Nonsedentary Physical Activity

    ERIC Educational Resources Information Center

    Brown, William H.; Pfeiffer, Karin A.; McIver, Kerry L.; Dowda, Marsha; Addy, Cheryl L.; Pate, Russell R.

    2009-01-01

    The twofold purposes of the investigation were (a) to describe with direct observation data the physical activity behaviors and the accompanying social and environmental events of those behaviors for children in preschools and (b) to determine which contextual conditions were predictors of moderate to vigorous physical activity (MVPA) and…

  14. Physical Activity among Older People and Related Factors

    ERIC Educational Resources Information Center

    Persson, Ann; While, Alison

    2012-01-01

    Objective: To investigate the duration, intensity and type of physical activity undertaken by people aged 60 years and over in relation to their reported levels of participation in social activities and their perceptions of their neighbourhood. Design: A cross-sectional questionnaire survey of older people attending two luncheon and eight social…

  15. Factors That Motivate Faculty to Participate in Professional Development Activities

    ERIC Educational Resources Information Center

    Lian, Xiaoyu

    2014-01-01

    Research has found that effective FPD activities improve faculty's instructional practices and pedagogy, technology skills, and knowledge and that the impact last over time (Rutz, Condon, Iverson, Manduca, & Willett, 2012). FPD activities also reduce job burnout and increase a sense of belonging and morale among faculty (Thomas, 2012).…

  16. Awareness and Habit: Important Factors in Physical Activity in Children

    ERIC Educational Resources Information Center

    Kremers, Stef P. J.; Dijkman, Marieke A. M.; de Meij, Judith S. B.; Jurg, Merlin E.; Brug, Johannes

    2008-01-01

    Purpose: The purpose of this paper is to gain insight into the extent to which Dutch children are aware of their own physical activity level, and to what extent children's physical activity is habitual. Special attention was paid to the potential moderating effect of "awareness" and "habit strength" on the association between psychosocial factors…

  17. Freeze-dried activated substrate for factor VIII assays.

    PubMed

    Margolis, J

    1987-01-01

    Factor VIII-deficient plasma (natural or artificial) mixed with kaolin and phospholipid can be lyophilized to provide ready-to-use substrate which is stable for months at 4 degrees C and usable after many weeks at room temperature. Factor VIII assays are much simplified and more reproducible using this reagent and can be quantified with the aid of a programmable calculator according to the equation (formula; see text) as % of standard and X, S and B are clotting times of test, standard and blank samples respectively. The slope of the log/log function (k) is approximately--6.5. PMID:3111909

  18. Biochemical characterization of a factor X activator protein purified from Walterinnesia aegyptia venom.

    PubMed

    Khan, Sami U; Al-Saleh, Saad S

    2015-10-01

    Factor X of blood coagulation cascade can be activated by both intrinsic and extrinsic activating complex, trypsin and some kind of snake venom. A factor X activator protein is reported in Elapidae snake venom. The aim of this study was to evaluate biochemical properties of factor X activator protein because of its prospective application in biochemical research and therapeutics. Crude venom was fractionated on a HPLC system Gold 126/1667 using a combination of Protein PAK 125 and Protein PAK 60 Columns. Molecular weight was determined using SDS-PAGE. Walterinnesia aegyptia venom was fractionated into several protein peaks, but procoagulant and factor X activation activity coexisted into peak no.6. It appeared as single band on native PAGE and molecular weight was 60,000 ± 3. Purified up to 37-fold over crude venom. It shortened recalcification time, effect was dose-dependent and strictly Ca(2++)-dependent. Factor X activator seems to be able to activate factor X specifically because it showed no activation activity on human prothrombin, plasminogen, or protein C. It did not hydrolyze factor Xa substrate S-2222, thrombin substrate S-2238, plasmin substrate S-2251 or S-2302 and kalikrein substrate S-2266. It did not hydrolyze synthetic ester benzoyl arginine ethyl ester. Procoagulant activity was completely inhibited by irreversible serine protease inhibitors phenylmethylsulphonyl fluoride and N-p-tosylphenylalanine chloromethyl ketone. This study illustrates that factor X activator from W. aegyptia is though different in many aspects from factor X activators of Viperidae and Crotalidae venoms, but shows several properties identical to factor X activators from Elapidae venoms. PMID:26407136

  19. Coexpression of heparanase activity, cathepsin L, tissue factor, tissue factor pathway inhibitor, and MMP-9 in proliferative diabetic retinopathy

    PubMed Central

    Siddiquei, Mohammad Mairaj; Nawaz, Mohd Imtiaz; De Hertogh, Gert; Mohammad, Ghulam; Alam, Kaiser; Mousa, Ahmed; Opdenakker, Ghislain

    2016-01-01

    Purpose Heparanase cleaves heparan sulfate side chains of heparan sulfate proteoglycans, activity that is implicated in angiogenesis. Proteolytic cleavage of proheparanase by cathepsin L leads to the formation of catalytically active heparanase. We investigated the expression levels of heparanase enzymatic activity and correlated these with the levels of cathepsin L, the angiogenic factors tissue factor (TF) and matrix metalloproteinase-9 (MMP-9), and the angiostatic factor tissue factor pathway inhibitor (TFPI) in proliferative diabetic retinopathy (PDR). Methods Vitreous samples from 25 patients with PDR and 20 nondiabetic patients and epiretinal membranes from 12 patients with PDR were studied with enzyme-linked immunosorbent assay, western blot analysis, and immunohistochemistry. Results We observed a significant increase in the expression of heparanase activity in vitreous samples from patients with PDR compared to the nondiabetic controls (p=0.027). Significant positive correlations were found between the levels of heparanase activity and the levels of cathepsin L (r=0.51; p=0.001), TF (r=0.6; p<0.0001), and TFPI (r=0.49; p=0.001). The expression levels of cathepsin L (p=0.019), TF (p<0.0001), TFPI (p<0.0001), and MMP-9 (p=0.029) were significantly higher in the vitreous samples with detected heparanase activity compared to the vitreous samples with undetected heparanase activity. Western blot analysis demonstrated proteolytic cleavage of TFPI in the vitreous samples from patients with PDR. In the epiretinal membranes, cathepsin L, TF, and TFPI were expressed in vascular endothelial cells and CD45-expressing leukocytes. Significant positive correlations were detected between the number of blood vessels that expressed CD31 and the number of blood vessels that expressed TF (r=0.9; p<0.0001) and TFPI (r=0.81; p=0.001). Conclusions The coexpression of these angiogenesis regulatory factors suggests cross-talk between these factors and pathogenesis of PDR

  20. Factors Affecting Teachers' Participation in Professional Development Activities in Turkey

    ERIC Educational Resources Information Center

    Bayar, Adem

    2013-01-01

    The purpose of this study was to examine the relationship between factors (internal [personal] and external [environmental]) and teachers' participation in professional development (PD) programs in Turkey. The researcher employed a survey design, using a multiple-stage sampling method, selecting 30 out of 66 elementary schools in the Center…

  1. Apixaban, an oral, direct inhibitor of activated Factor Xa.

    PubMed

    Shantsila, Eduard; Lip, Gregory Y H

    2008-09-01

    Apixaban is an oral, direct Factor Xa inhibitor that is being developed by Bristol-Myers Squibb Co and Pfizer Inc. Apixaban is currently undergoing phase III clinical trials for cerebrovascular ischemia, deep vein thrombosis and lung embolism, and phase II clinical trials for coronary artery disease. PMID:18729009

  2. EGF activates TTP expression by activation of ELK-1 and EGR-1 transcription factors

    PubMed Central

    2012-01-01

    Background Tristetraprolin (TTP) is a key mediator of processes such as inflammation resolution, the inhibition of autoimmunity and in cancer. It carries out this role by the binding and degradation of mRNA transcripts, thereby decreasing their half-life. Transcripts modulated by TTP encode proteins such as cytokines, pro-inflammatory agents and immediate-early response proteins. TTP can also modulate neoplastic phenotypes in many cancers. TTP is induced and functionally regulated by a spectrum of both pro- and anti-inflammatory cytokines, mitogens and drugs in a MAPK-dependent manner. So far the contribution of p38 MAPK to the regulation of TTP expression and function has been best described. Results Our results demonstrate the induction of the gene coding TTP (ZFP36) by EGF through the ERK1/2-dependent pathway and implicates the transcription factor ELK-1 in this process. We show that ELK-1 regulates ZFP36 expression by two mechanisms: by binding the ZFP36 promoter directly through ETS-binding site (+ 883 to +905 bp) and by inducing expression of EGR-1, which in turn increases ZFP36 expression through sequences located between -111 and -103 bp. Conclusions EGF activates TTP expression via ELK-1 and EGR-1 transcription factors. PMID:22433566

  3. Regulation of platelet-activating factor receptor gene expression in vivo by endotoxin, platelet-activating factor and endogenous tumour necrosis factor.

    PubMed Central

    Wang, H; Tan, X; Chang, H; Gonzalez-Crussi, F; Remick, D G; Hsueh, W

    1997-01-01

    A competitive PCR assay was developed to quantify platelet-activating factor (PAF) receptor (PAF-R) transcripts in rat tissues using a synthetic RNA as a competitor. We found PAF-R mRNA constitutively expressed in the eight organs tested, with the ileum containing the highest concentration [(3.49+/-0.15) x 10(7) molecules/microg of RNA]. Significant but lower levels were also detected in the jejunum, spleen, lungs, kidneys, heart, stomach and liver. Furthermore we defined the regulatory role of inflammatory mediators in ileal PAF-R gene expression using a rat model of intestinal injury induced by PAF or lipopolysaccharide (LPS). Injection of LPS or low-dose PAF resulted in a marked increase in ileal PAF-R mRNA within 30 min. The up-regulation on PAF-R elicited by PAF was biphasic, peaking first at 90 min, then again at 6 h. In contrast, LPS elicited a weak monophasic response. The second phase of PAF-R mRNA increase after PAF administration was completely abolished by WEB 2170, a PAF antagonist, and partially inhibited by antitumour necrosis factor (TNF) antibody. These observations indicate the involvement of endogenous PAF and TNF in this event. In conclusion, we found: (a) preferential PAF-R expression in the ileum, suggesting a role for PAF in intestinal inflammation; (b) induction of PAF-R expression in vivo by its own agonist; (c) a complex regulation of PAR-R gene expression in vivo involving a network of various pro-inflammatory mediators. PMID:9065783

  4. FACTORS AFFECTING TIME-ACTIVITY BUDGETS OF BUFFLEHEAD WINTERING IN NARRAGANSETT, BAY, RI

    EPA Science Inventory

    Daily activities of wintering waterfowl can be influenced by the physical environment and by habitat factors such as prey abundance and availability. We examined variability in diurnal activity budgets of Bufflehead (Bucephala albeola) wintering at seven locations within Narragan...

  5. ANALYSIS OF DISCRIMINATING FACTORS IN HUMAN ACTIVITIES THAT AFFECT EXPOSURE

    EPA Science Inventory

    Accurately modeling exposure to particulate matter (PM) and other pollutants ultimately involves the utilization of human location-activity databases to assist in understanding the potential variability of microenvironmental exposures. This paper critically considers and stati...

  6. Alternative complement pathway and factor B activities in rats with altered blood levels of thyroid hormone

    PubMed Central

    Bitencourt, C.S.; Duarte, C.G.; Azzolini, A.E.C.S.; Assis-Pandochi, A.I.

    2012-01-01

    Evaluating the activity of the complement system under conditions of altered thyroid hormone levels might help elucidate the role of complement in triggering autoimmune processes. Here, we investigated alternative pathway (AP) activity in male Wistar rats (180 ± 10 g) after altering their thyroid hormone levels by treatment with triiodothyronine (T3), propylthiouracil (PTU) or thyroidectomy. T3 and thyroxine (T4) levels were determined by chemiluminescence assays. Hemolytic assays were performed to evaluate the lytic activity of the AP. Factor B activity was evaluated using factor B-deficient serum. An anti-human factor B antibody was used to measure factor B levels in serum by radial immunodiffusion. T3 measurements in thyroidectomized animals or animals treated with PTU demonstrated a significant reduction in hormone levels compared to control. The results showed a reduction in AP lytic activity in rats treated with increasing amounts of T3 (1, 10, or 50 µg). Factor B activity was also decreased in the sera of hyperthyroid rats treated with 1 to 50 µg T3. Additionally, treating rats with 25 µg T3 significantly increased factor B levels in their sera (P < 0.01). In contrast, increased factor B concentration and activity (32%) were observed in hypothyroid rats. We conclude that alterations in thyroid hormone levels affect the activity of the AP and factor B, which may in turn affect the roles of AP and factor B in antibody production. PMID:22370704

  7. Harnessing endogenous growth factor activity modulates stem cell behavior

    PubMed Central

    Hudalla, Gregory A.; Kouris, Nicholas A.; Koepsel, Justin T.; Ogle, Brenda M.; Murphy, William L.

    2014-01-01

    The influence of specific serum-borne biomolecules (e.g. heparin) on growth factor-dependent cell behavior is often difficult to elucidate in traditional cell culture due to the random, non-specific nature of biomolecule adsorption from serum. We hypothesized that chemically well-defined cell culture substrates could be used to study the influence of sequestered heparin on human mesenchymal stem cell (hMSC) behavior. Specifically, we used bio-inert self-assembled monolayers (SAMs) chemically modified with a bioinspired heparin-binding peptide (termed “HEPpep”) and an integrin-binding peptide (RGDSP) as stem cell culture substrates. Our results demonstrate that purified heparin binds to HEPpep SAMs in a dose-dependent manner, and serum-borne heparin binds specifically and in a dose-dependent manner to HEPpep SAMs. These heparin-sequestering SAMs enhance hMSC proliferation by amplifying endogenous fibroblast growth factor (FGF) signaling, and enhance hMSC osteogenic differentiation by amplifying endogenous bone morphogenetic protein (BMP) signaling. The effects of heparin-sequestering are similar to the effects of supraphysiologic concentrations of recombinant FGF-2. hMSC phenotype is maintained over multiple population doublings on heparin-sequestering substrates in growth medium, while hMSC osteogenic differentiation is enhanced in a bone morphogenetic protein-dependent manner on the same substrates during culture in osteogenic induction medium. Together, these observations demonstrate that the influence of the substrate on stem cell phenotype is sensitive to the culture medium formulation. Our results also demonstrate that enhanced hMSC proliferation can be spatially localized by patterning the location of HEPpep on the substrate. Importantly, the use of chemically well-defined SAMs in this study eliminated the confounding factor of random, non-specific biomolecule adsorption, and identified serum-borne heparin as a key mediator of hMSC response to endogenous

  8. Angiotensin peptides attenuate platelet-activating factor-induced inflammatory activity in rats.

    PubMed

    Sato, Akira; Yokoyama, Izumi; Ebina, Keiichi

    2015-11-01

    Angiotensin (Ang)--a peptide that is part of the renin-angiotensin system-induces vasoconstriction and a subsequent increase in blood pressure; Ang peptides, especially AngII, can also act as potent pro-inflammatory mediators. Platelet-activating factor (PAF) is a potent phospholipid mediator that is implicated in many inflammatory diseases. In this study, we investigated the effects of Ang peptides (AngII, AngIII, and AngIV) on PAF-induced inflammatory activity. In experiments using a rat hind-paw oedema model, AngII markedly and dose-dependently attenuated the paw oedema induced by PAF. The inhibitory effects of AngIII and AngIV on PAF-induced paw oedema were lower than that of AngII. Two Ang receptors, the AT1 and AT2 receptors, did not affect the AngII-mediated attenuation of PAF-induced paw oedema. Moreover, intrinsic tyrosine fluorescence studies demonstrated that AngII, AngIII, and AngIV interact with PAF, and that their affinities were closely correlated with their inhibitory effects on PAF-induced rat paw oedema. Also, AngII interacted with metabolite/precursor of PAF (lyso-PAF), and an oxidized phospholipid, 1-palmitoyl-2-(5'-oxo-valeroyl)-sn-glycero-3-phosphocholine (POVPC), which bears a marked structural resemblance to PAF. Furthermore, POVPC dose-dependently inhibited AngII-mediated attenuation of PAF-induced paw oedema. These results suggest that Ang peptides can attenuate PAF-induced inflammatory activity through binding to PAF and lyso-PAF in rats. Therefore, Ang peptides may be closely involved in the regulation of many inflammatory diseases caused by PAF. PMID:26348270

  9. Preparation of factor VII concentrate using CNBr-activated Sepharose 4B immunoaffinity chromatography

    PubMed Central

    Mousavi Hosseini, Kamran; Nasiri, Saleh

    2015-01-01

    Background: Factor VII concentrates are used in patients with congenital or acquired factor VII deficiency or treatment of hemophilia patients with inhibitors. In this research, immunoaffinity chromatography was used to purify factor VII from prothrombin complex (Prothrombin- Proconvertin-Stuart Factor-Antihemophilic Factor B or PPSB) which contains coagulation factors II, VII, IX and X. The aim of this study was to improve purity, safety and tolerability as a highly purified factor VII concentrate. Methods: PPSB was prepared using DEAE-Sephadex and was used as the starting material for purification of coagulation factor VII. Prothrombin complex was treated by solvent/detergent at 24°C for 6 h with constant stirring. The mixture of PPSB in the PBS buffer was filtered and then chromatographed using CNBr-activated Sepharose 4B coupled with specific antibody. Factors II, IX, VII, X and VIIa were assayed on the fractions. Fractions of 48-50 were pooled and lyophilized as a factor VII concentrate. Agarose gel electrophoresis was performed and Tween 80 was measured in the factor VII concentrate. Results: Specific activity of factor VII concentrate increased from 0.16 to 55.6 with a purificationfold of 347.5 and the amount of activated factor VII (FVIIa) was found higher than PPSB (4.4-fold). Results of electrophoresis on agarose gel indicated higher purity of Factor VII compared to PPSB; these finding revealed that factor VII migrated as alpha-2 proteins. In order to improve viral safety, solvent-detergent treatment was applied prior to further purification and nearly complete elimination of tween 80 (2 μg/ml). Conclusion: It was concluded that immuonoaffinity chromatography using CNBr-activated Sepharose 4B can be a suitable choice for large-scale production of factor VII concentrate with higher purity, safety and activated factor VII. PMID:26034723

  10. Insights into the Interferon Regulatory Factor Activation from the Crystal Structure of Dimeric IRF5

    SciTech Connect

    Chen, W.; Lam, S; Srinath, H; Jiang, Z; Correia, J; Schiffer, C; Fitzgerald, K; Lin, K; Royer, Jr., W

    2008-01-01

    The interferon regulatory factors (IRFs) are involved in the innate immune response and are activated by phosphorylation. The structure of a pseudophosphorylated IRF5 activation domain now reveals structural changes in the activated form that would turn an autoinhibitory region into a dimerization interface. In vivo analysis supports the relevance of such a dimer to transcriptional activation.

  11. Transcription factors of Lotus: regulation of isoflavonoid biosynthesis requires coordinated changes in transcription factor activity.

    PubMed

    Shelton, Dale; Stranne, Maria; Mikkelsen, Lisbeth; Pakseresht, Nima; Welham, Tracey; Hiraka, Hideki; Tabata, Satoshi; Sato, Shusei; Paquette, Suzanne; Wang, Trevor L; Martin, Cathie; Bailey, Paul

    2012-06-01

    Isoflavonoids are a class of phenylpropanoids made by legumes, and consumption of dietary isoflavonoids confers benefits to human health. Our aim is to understand the regulation of isoflavonoid biosynthesis. Many studies have shown the importance of transcription factors in regulating the transcription of one or more genes encoding enzymes in phenylpropanoid metabolism. In this study, we coupled bioinformatics and coexpression analysis to identify candidate genes encoding transcription factors involved in regulating isoflavonoid biosynthesis in Lotus (Lotus japonicus). Genes encoding proteins belonging to 39 of the main transcription factor families were examined by microarray analysis of RNA from leaf tissue that had been elicited with glutathione. Phylogenetic analyses of each transcription factor family were used to identify subgroups of proteins that were specific to L. japonicus or closely related to known regulators of the phenylpropanoid pathway in other species. R2R3MYB subgroup 2 genes showed increased expression after treatment with glutathione. One member of this subgroup, LjMYB14, was constitutively overexpressed in L. japonicus and induced the expression of at least 12 genes that encoded enzymes in the general phenylpropanoid and isoflavonoid pathways. A distinct set of six R2R3MYB subgroup 2-like genes was identified. We suggest that these subgroup 2 sister group proteins and those belonging to the main subgroup 2 have roles in inducing isoflavonoid biosynthesis. The induction of isoflavonoid production in L. japonicus also involves the coordinated down-regulation of competing biosynthetic pathways by changing the expression of other transcription factors. PMID:22529285

  12. Mapping neural circuits with activity-dependent nuclear import of a transcription factor.

    PubMed

    Masuyama, Kaoru; Zhang, Yi; Rao, Yi; Wang, Jing W

    2012-03-01

    Abstract: Nuclear factor of activated T cells (NFAT) is a calcium-responsive transcription factor. We describe here an NFAT-based neural tracing method-CaLexA (calcium-dependent nuclear import of LexA)-for labeling active neurons in behaving animals. In this system, sustained neural activity induces nuclear import of the chimeric transcription factor LexA-VP16-NFAT, which in turn drives green fluorescent protein (GFP) reporter expression only in active neurons. We tested this system in Drosophila and found that volatile sex pheromones excite specific neurons in the olfactory circuit. Furthermore, complex courtship behavior associated with multi-modal sensory inputs activated neurons in the ventral nerve cord. This method harnessing the mechanism of activity-dependent nuclear import of a transcription factor can be used to identify active neurons in specific neuronal population in behaving animals. PMID:22236090

  13. Factors Associated with Physical Activity Literacy among Foster Parents

    ERIC Educational Resources Information Center

    Dominick, Gregory M.; Friedman, Daniela B.; Saunders, Ruth P.; Hussey, Jim R.; Watkins, Ken W.; W.

    2012-01-01

    Objectives: To explore associations between physical activity (PA) literacy and psychosocial constructs for providing instrumental social support for youth PA. Methods: Ninety-one foster parents completed surveys assessing PA literacy (overall and specific), perceptions of child PA, coordination, PA enjoyment, psychosocial variables:…

  14. On factors controlling activity of submonolayer bimetallic catalysts: Nitrogen desorption

    SciTech Connect

    Guo, Wei; Vlachos, Dionisios G.

    2014-01-07

    We model N{sub 2} desorption on submonolayer bimetallic surfaces consisting of Co clusters on Pt(111) via first-principles density functional theory-based kinetic Monte Carlo simulations. We find that submonolayer structures are essential to rationalize the high activity of these bimetallics in ammonia decomposition. We show that the N{sub 2} desorption temperature on Co/Pt(111) is about 100 K higher than that on Ni/Pt(111), despite Co/Pt(111) binding N weaker at low N coverages. Co/Pt(111) has substantially different lateral interactions than single metals and Ni/Pt. The lateral interactions are rationalized with the d-band center theory. The activity of bimetallic catalysts is the result of heterogeneity of binding energies and reaction barriers among sites, and the most active site can differ on various bimetallics. Our results are in excellent agreement with experimental data and demonstrate for the first time that the zero-coverage descriptor, used until now, for catalyst activity is inadequate due not only to lacking lateral interactions but importantly to presence of multiple sites and a complex interplay of thermodynamics (binding energies, occupation) and kinetics (association barriers) on those sites.

  15. Factors Influencing Physical Activity among Postpartum Iranian Women

    ERIC Educational Resources Information Center

    Roozbahani, Nasrin; Ghofranipour, Fazlollah; Eftekhar Ardabili, Hassan; Hajizadeh, Ebrahim

    2014-01-01

    Background: Postpartum women are a population at risk for sedentary living. Physical activity (PA) prior to pregnancy may be effective in predicting similar behaviour in the postpartum period. Objective: To test a composite version of the extended transtheoretical model (TTM) by adding "past behaviour" in order to predict PA behaviour…

  16. Factors Related to the Participation of Pennsylvania Agricultural Education Teachers in Professional Development Activities. Final Report.

    ERIC Educational Resources Information Center

    Hall, David E.

    A study examined factors related to the participation of Pennsylvania agricultural education teachers in professional development activities. Specifically, it sought to describe the relationship or differences between participation in professional development activities, professional attitude, and 22 selected demographic factors. A questionnaire…

  17. Role of Individual and School Factors in Physical Activity Patterns of Secondary-Level Spanish Students

    ERIC Educational Resources Information Center

    Juan, Francisco Ruiz; Bengoechea, Enrique Garcia; Montes, Maria Elena Garcia; Bush, Paula Louise

    2010-01-01

    Background: While the importance of individual and school factors as correlates of overall youth physical activity has been demonstrated by previous research, less is known about the relationship of these factors with specific patterns of physical activity during adolescence. Thus, the purpose of this study was to examine the association of…

  18. An auxiliary peptide required for the function of two activation domains in upstream stimulatory factor 2 (USF2) transcription factor.

    PubMed

    Gourdon, L; Lefrançois-Martinez, A M; Viollet, B; Martinez, A; Kahn, A; Raymondjean, M

    1997-04-01

    Ubiquitous upstream stimulatory factors (USF1, USF2a and USF2b) are members of the basic-helix-loop-helix-leucine-zipper family of transcription factors that have been shown to be involved in the transcriptional response of the L-type pyruvate kinase (L-PK) gene to glucose. To understand the mechanisms of action of the USF2 isoforms, we initiated a series of co-transfection assays with deletion mutants and Ga14-USF2 fusions. The transactivating efficiency of the different native and mutant factors was determined at similar DNA binding activity. We found that: (i) exons 3- and 5-encoded regions are activation domains, (ii) a modulator domain encoded by exon 4 could be necessary to their additive action, (iii) a hexapeptide encoded by the first 5' codons of exon 6 is indispensable for transmitting activation due to both exon 3- and exon 5-encoded domains to the transcriptional machinery. Therefore, USF2 presents a modular structure and mediates transcriptional activation thanks to two non-autonomous activation domains dependent on an auxiliary peptide for expressing their activating potential. PMID:9680311

  19. Factors affecting the adsorption of chromium (VI) on activated carbon

    SciTech Connect

    Yavuz, R.; Orbak, I.; Karatepe, N.

    2006-09-15

    The aim of this investigation was to determine the adsorption behavior of chromium (VI) on two different activated carbon samples produced from Tuncbilek lignite. The effects of the initial chromium (VI) concentration (250-1000 mg/L), temperature (297-323 K) and pH (2.0-9.5) on adsorption were investigated systematically. The effectiveness of the parameters on chromium adsorption was found to be in the order of pH, the initial Cr(VI) concentration and the temperature. Increasing the pH from 2.0 to 9.5 caused a decrease in adsorption. However, the adsorption was increased by increasing the initial Cr(VI) concentration and temperature. The multilinear mathematical model was also developed to predict the Cr(VI) adsorption on activated carbon samples within the experimental conditions.

  20. Factors affecting the adsorption of xenon on activated carbon

    SciTech Connect

    Underhill, D.W.; DiCello, D.C.; Scaglia, L.A.; Watson, J.A.

    1986-08-01

    The presence of water vapor was found to interfere strongly with the dynamic adsorption of /sup 133/Xe on coconut-base activated charcoal. The percent loss in the xenon adsorption coefficient was similar to values reported earlier for the adsorption of krypton on humidified charcoal. Attempts to increase the adsorption of xenon by (a) using a petroleum-based adsorbent with an extremely high surface area and (b) by impregnation of the adsorbent with iodine were not successful.

  1. The Positive Transcription Elongation Factor b Is an Essential Cofactor for the Activation of Transcription by Myocyte Enhancer Factor 2

    PubMed Central

    Nojima, Masanori; Huang, Yehong; Tyagi, Mudit; Kao, Hung-Ying; Fujinaga, Koh

    2014-01-01

    The positive transcription elongation factor b (P-TEFb), composed of cyclin-dependent kinase 9 and cyclin T1, stimulates the elongation of transcription by hyperphosphorylating the C-terminal region of RNA polymerase II. Aberrant activation of P-TEFb results in manifestations of cardiac hypertrophy in mice, suggesting that P-TEFb is an essential factor for cardiac myocyte function and development. Here, we present evidence that P-TEFb selectively activates transcription mediated by the myocyte enhancer factor 2 (MEF2) family of transcription factors, key regulatory factors for myocyte development. Knockdown of endogenous cyclin T1 in murine C2C12 cells abolishes MEF2-dependent reporter gene expression as well as transcription of endogenous MEF2 target genes, whereas overexpression of P-TEFb enhances MEF2-dependent transcription. P-TEFb interacts with MEF2 both in vitro and in vivo. Activation of MEF2-dependent transcription induced by serum starvation is mediated by a rapid dissociation of P-TEFb from its inhibitory subunit, HEXIM1, and a subsequent recruitment of P-TEFb to MEF2 binding sites in the promoter region of MEF2 target genes. These results indicate that recruitment of P-TEFb is a critical step for stimulation of MEF2-dependent transcription, therefore providing a fundamentally important regulatory mechanism underlying the transcriptional program in muscle cells. PMID:18662700

  2. Glioma-secreted soluble factors stimulate microglial activation: The role of interleukin-1β and tumor necrosis factor-α.

    PubMed

    Hwang, Ji-Sun; Jung, Eun-Hye; Kwon, Mi-Youn; Han, Inn-Oc

    2016-09-15

    We aimed to elucidate the effect of soluble factors secreted by glioma on microglial activation. Conditioned medium (CM) from glioma cells, CRT-MG and C6, significantly induced nitric oxide (NO) production and stimulated the mRNA expression of inducible NO synthase (iNOS), interleukin (IL)-1beta, IL-6, tumor necrosis factor-alpha (TNF-α) and cyclooxygenase 2 (COX-2) in BV2 cells. Glioma CM stimulated p38 mitogen-activated protein kinase (MAPK) phosphorylation, and a p38 MAPK inhibitor, SB203580, suppressed CM-induced NO production in BV2 cells. In addition, CM stimulated nuclear factor-kappaB (NF-κB) DNA binding and transcriptional activity, which was repressed by SB203580. Gliomas displayed higher mRNA expression and release of TNF-α and IL-1β than primary astrocyte cells. Neutralization of TNF-α and IL-1β in C6-CM using a neutralizing antibody inhibited NO/iNOS expression in BV-2 cells. These results indicate potential contribution of diffusible tumor-derived factors to regulate microglial activation and subsequent tumor microenvironment. PMID:27609291

  3. Stimulation of protein phosphatase activity by insulin and growth factors in 3T3 cells

    SciTech Connect

    Chan, C.P.; McNall, S.J.; Krebs, E.G.; Fischer, E.H. )

    1988-09-01

    Incubation of Swiss mouse 3T3-D1 cells with physiological concentrations of insulin resulted in a rapid and transient activation of protein phosphatase activity as measure by using ({sup 32}P)phosphorylase {alpha} as substrate. Activation reached a maximum level (140% of control value) within 5 min of addition and returned to control levels within 20 min. The effect of insulin was dose-dependent with half-maximal activation occurring at {approx}5 nM insulin. This activity could be completely inhibited by addition of the heat-stable protein inhibitor 2, which suggests the presence of an activated type-1 phosphatase. Similar effects on phosphatase activity were seen when epidermal growth factor and platelet-derived growth factor were tested. These results suggest that some of the intracellular effects caused by insulin and growth factors are mediated through the activation of a protein phosphatase.

  4. Biological effects of the orally active platelet activating factor receptor antagonist SDZ 64-412.

    PubMed

    Handley, D A; Van Valen, R G; Melden, M K; Houlihan, W J; Saunders, R N

    1988-11-01

    SDZ 64-412 is a trimethoxyphenylethylphenyl imidazo[2,1-a] isoquinoline molecule that displays marked in vitro inhibition of platelet activating factor (PAF)-induced human platelet aggregation (IC50 = 60 nM) but is without inhibition (at 100 microM) of epinephrine-, ADP- or collagen-induced aggregation. SDZ 64-412 antagonized receptor binding of radiolabeled PAF to human platelet membranes with an IC50 = 60 nM. In the rat, SDZ 64-412 inhibited 100 ng kg-1 PAF-induced hypotension when given i.v. (ED50 = 0.23 mg kg-1) or p.o. (ED50 = 13 mg kg-1). In the guinea pig, SDZ 64-412 inhibited 50 ng kg-1 PAF-induced bronchoconstriction (ED50 = 4.2 mg kg-1 p.o.) and hemoconcentration (ED50 = 5.0 mg kg-1 p.o.). SDZ 64-412 exhibited oral activity in the dog against 1.5 micrograms kg-1 PAF-induced hypotension (ED50 = 5.1 mg kg-1 p.o.) and hemoconcentration (ED50 = 4.9 mg kg-1) and 3.5 micrograms kg-1 PAF-induced hemoconcentration in the cebus primate (ED50 = 12.8 mg kg-1 p.o.). SDZ 64-412 protected in a dose-dependent manner against PAF-induced lethality (LD75 = 75 micrograms kg-1 i.v.) in mice, where 20 mg kg-1 p.o. improved survival from 25 +/- 4% to 77 +/- 8%. SDZ 64-412 afforded complete protection against endotoxin-induced lethality (LD90 = 7.5 mg kg-1 endotoxin i.v.) where the ED50 was 45 mg kg-1 twice predose.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:3183958

  5. Activation of factor XII-dependent pathways in human plasma by hematin and protoporphyrin.

    PubMed Central

    Becker, C G; Wagner, M; Kaplan, A P; Silverberg, M; Grady, R W; Liem, H; Muller-Eberhard, U

    1985-01-01

    Intravenous administration of hematin is effective in the treatment of acute exacerbations of the inducible porphyrias. In the course of such treatment, coagulopathies have occurred that are characterized by prolongation of prothrombin time, partial thromboplastin time, and formation of fibrin split products. In experiments in vitro with normal human plasma, we observed that hematin and protoporphyrin activated Factor XII-dependent pathways of coagulation and fibrinolysis, and that they generated kallikrein activity. Incubation of protoporphyrin with purified Factor XII resulted in activation as measured by amidolysis of a chromogenic substrate. Neither coproporphyrin, uroporphyrin, delta-aminolevulinic acid, porphobilinogen, or bilirubin activated Factor XII-dependent pathways. Exposure of serum containing added uroporphyrin, coproporphyrin, and protoporphyrin, but not hematin, to ultraviolet light (405 nm) resulted in activation of the classical pathway of the complement system. On the other hand, exposure of plasma containing uroporphyrin or coproporphyrin to ultraviolet light did not result in activation of Factor XII-dependent pathways. PMID:4031058

  6. [Active periodontitis as a potential risk factor of preferm delivery].

    PubMed

    Bilińska, Maria; Osmola, Krzysztof

    2014-05-01

    The influence of active periodontitis on the incidence of preterm delivery has been widely described in numerous scientific papers. Studies suggest that an implementation of a periodontal treatment during pregnancy is not only safe for both, the mother and the child, but it also has a beneficial effect on the pregnancy and embryo-fetal development, consequently reducing morbidity and mortality among premature infants. Therefore, mandatory dental examinations in pregnant women may facilitate early implementation of periodontal treatment and reduce the rates of preterm delivery PMID:25011221

  7. Antagonistic activity of etizolam on platelet-activating factor in vivo experiments.

    PubMed

    Terasawa, M; Mikashima, H; Tahara, T; Maruyama, Y

    1987-08-01

    The ability of etizolam, 6-(o-chlorophenyl)-8-ethyl-1-methyl-4H-s-triazolo[3,4-c]thieno[2,3-e] [1,4]diazepine (Y-7131), an anti-anxiety drug, to inhibit platelet-activating factor (PAF)-induced reactions was investigated in experimental animals in vivo. Etizolam (0.01-0.3 mg/kg, i.v.) dose dependently inhibited PAF (0.3 microgram/kg, i.v.)-induced bronchoconstriction (Konzett and Rössler's method) in guinea pigs, but even at doses as large as 3 mg/kg, i.v., it had no effect on bronchoconstriction induced by histamine, serotonin, acetylcholine, arachidonic acid, bradykinin, angiotensin l or leukotriene D4. Etizolam (0.1-1 mg/kg, i.v.) also dose-dependently reversed PAF (1 microgram/kg, i.v.)-induced hypotension in anesthetized rats. Injection of PAF into the tail veins of mice produced lethal shock within 10-30 min. Etizolam (0.1-3 mg/kg, i.v. and 1-10 mg/kg, p.o.) protected against the lethal effect of PAF (75 micrograms/kg, i.v.) in a dose-dependent manner. These results indicate that etizolam specifically inhibits the action of PAF in vivo. PMID:3682404

  8. Implementation of a high-sensitivity Micro-Angiographic Fluoroscope (HS-MAF) for in-vivo endovascular image guided interventions (EIGI) and region-of-interest computed tomography (ROI-CT)

    PubMed Central

    Ionita, C N; Keleshis, C.; Patel, V.; Yadava, G.; Hoffmann, K R; Bednarek, D R; Jain, A.; Rudin, S

    2008-01-01

    New advances in catheter technology and remote actuation for minimally invasive procedures are continuously increasing the demand for better x-ray imaging technology. The new x-ray high-sensitivity Micro-Angiographic Fluoroscope (HS-MAF) detector offers high resolution and real-time image-guided capabilities which are unique when compared with commercially available detectors. This detector consists of a 300 μm CsI input phosphor coupled to a dual stage GEN2 micro-channel plate light image intensifier (LII), followed by minifying fiber-optic taper coupled to a CCD chip. The HS-MAF detector image array is 1024×1024 pixels, with a 12 bit depth capable of imaging at 30 frames per second. The detector has a round field of view with 4 cm diameter and 35 microns pixels. The LII has a large variable gain which allows usage of the detector at very low exposures characteristic of fluoroscopic ranges while maintaining very good image quality. The custom acquisition program allows real-time image display and data storage. We designed a set of in-vivo experimental interventions in which placement of specially designed endovascular stents were evaluated with the new detector and with a standard x-ray image intensifier (XII). Capabilities such fluoroscopy, angiography and ROI-CT reconstruction using rotational angiography data were implemented and verified. The images obtained during interventions under radiographic control with the HS-MAF detector were superior to those with the XII. In general, the device feature markers, the device structures, and the vessel geometry were better identified with the new detector. High-resolution detectors such as HS-MAF can vastly improve the accuracy of localization and tracking of devices such stents or catheters. PMID:18958294

  9. Implementation of a high-sensitivity micro-angiographic fluoroscope (HS-MAF) for in-vivo endovascular image guided interventions (EIGI) and region-of-interest computed tomography (ROI-CT)

    NASA Astrophysics Data System (ADS)

    Ionita, C. N.; Keleshis, C.; Patel, V.; Yadava, G.; Hoffmann, K. R.; Bednarek, D. R.; Jain, A.; Rudin, S.

    2008-03-01

    New advances in catheter technology and remote actuation for minimally invasive procedures are continuously increasing the demand for better x-ray imaging technology. The new x-ray high-sensitivity Micro-Angiographic Fluoroscope (HS-MAF) detector offers high resolution and real-time image-guided capabilities which are unique when compared with commercially available detectors. This detector consists of a 300 μm CsI input phosphor coupled to a dual stage GEN2 micro-channel plate light image intensifier (LII), followed by minifying fiber-optic taper coupled to a CCD chip. The HS-MAF detector image array is 1024X1024 pixels, with a 12 bit depth capable of imaging at 30 frames per second. The detector has a round field of view with 4 cm diameter and 35 microns pixels. The LII has a large variable gain which allows usage of the detector at very low exposures characteristic of fluoroscopic ranges while maintaining very good image quality. The custom acquisition program allows real-time image display and data storage. We designed a set of in-vivo experimental interventions in which placement of specially designed endovascular stents were evaluated with the new detector and with a standard x-ray image intensifier (XII). Capabilities such fluoroscopy, angiography and ROI-CT reconstruction using rotational angiography data were implemented and verified. The images obtained during interventions under radiographic control with the HS-MAF detector were superior to those with the XII. In general, the device feature markers, the device structures, and the vessel geometry were better identified with the new detector. High-resolution detectors such as HS-MAF can vastly improve the accuracy of localization and tracking of devices such stents or catheters.

  10. Confirmatory Factor Analysis of Project Spectrum Activities. A Second-Order "g" Factor or Multiple Intelligences?

    ERIC Educational Resources Information Center

    Castejon, Juan L.; Perez, Antonio M.; Gilar, Raquel

    2010-01-01

    This paper compares different theoretical models of the structure of intelligence, based on the analysis of data obtained in a series of measured abilities corresponding to the Spectrum assessment activities (Gardner, Feldman & Krechevsky, 1998) in a sample of 393 children enrolled in kindergarten and first grade. The data were analyzed using…

  11. Variable Glutamine-Rich Repeats Modulate Transcription Factor Activity

    PubMed Central

    Gemayel, Rita; Chavali, Sreenivas; Pougach, Ksenia; Legendre, Matthieu; Zhu, Bo; Boeynaems, Steven; van der Zande, Elisa; Gevaert, Kris; Rousseau, Frederic; Schymkowitz, Joost; Babu, M. Madan; Verstrepen, Kevin J.

    2015-01-01

    Summary Excessive expansions of glutamine (Q)-rich repeats in various human proteins are known to result in severe neurodegenerative disorders such as Huntington’s disease and several ataxias. However, the physiological role of these repeats and the consequences of more moderate repeat variation remain unknown. Here, we demonstrate that Q-rich domains are highly enriched in eukaryotic transcription factors where they act as functional modulators. Incremental changes in the number of repeats in the yeast transcriptional regulator Ssn6 (Cyc8) result in systematic, repeat-length-dependent variation in expression of target genes that result in direct phenotypic changes. The function of Ssn6 increases with its repeat number until a certain threshold where further expansion leads to aggregation. Quantitative proteomic analysis reveals that the Ssn6 repeats affect its solubility and interactions with Tup1 and other regulators. Thus, Q-rich repeats are dynamic functional domains that modulate a regulator’s innate function, with the inherent risk of pathogenic repeat expansions. PMID:26257283

  12. [Risk factors in police activities: operational criticism in surveillance programs].

    PubMed

    Ciprani, Fabrizio; Moroni, Maria; Conte, Giovanni

    2014-01-01

    The planning of specific health surveillance programs for police officers is extremely complex due to difficulty in predictability and variety of occupational hazards. Even in the case of conventional occupational risk factors clearly identified by current regulations, particular working conditions may require specific assessment to effectively identify and quantify the risk of occupational exposure. An extensive program of health surveillance, aimed at promoting overall health and effectiveness of the operators, would be really desirable, in order to help better address a number of risks that cannot be easily predicted. The progressive increase in the average age of the working population and the increasing prevalence of chronic degenerative diseases, may also suggest the need for health surveillance procedures designed to verify continued unqualified suitability to police service, providing for the identification of diversified suitability profiles in relation to age and state of health: accordingly, in regard to our field of interest, there is a close link between medico-legal eligibility and occupational medicine. PMID:25558742

  13. Evidence for a prevalent dimorphism in the activation peptide of human coagulation factor IX.

    PubMed Central

    McGraw, R A; Davis, L M; Noyes, C M; Lundblad, R L; Roberts, H R; Graham, J B; Stafford, D W

    1985-01-01

    We have independently isolated and characterized cDNA and genomic clones for the human coagulation factor IX. Sequence analysis in both cases indicates that threonine is encoded by the triplet ACT as the third residue of the activation peptide. This is in agreement with some earlier reports but in disagreement with others that show the alanine triplet GCT at this position. The discrepancy can thus be accounted for by natural variation of a single nucleotide in the normal population. Amino acid sequence analyses of activated factor IX from plasma samples of four individuals yielded two cases of alanine and two cases of threonine at the third position of the activation peptide. In factor IX from pooled plasma and in factor IX from a heterozygous individual, however, both alanine and threonine were found. Taken together, the findings show that a prevalent nondeleterious dimorphism exists in the activation peptide of human coagulation factor IX. PMID:3857619

  14. Evaluation of Potential Clinical Surrogate Markers of a Trauma Induced Alteration of Clotting Factor Activities

    PubMed Central

    Payas, Arzu; Schoeneberg, Carsten; Wegner, Alexander; Kauther, Max Daniel; Lendemans, Sven

    2016-01-01

    Objective. The aim of this study was to identify routinely available clinical surrogate markers for potential clotting factor alterations following multiple trauma. Methods. In 68 patients admitted directly from the scene of the accident, all soluble clotting factors were analyzed and clinical data was collected prospectively. Ten healthy subjects served as control group. Results. Patients showed reduced activities of clotting factors II, V, VII, and X and calcium levels (all P < 0.0001 to 0.01). Levels of hemoglobin and base deficit correlated moderately to highly with the activities of a number of clotting factors. Nonsurvivors and patients who needed preclinical intubation or hemostatic therapy showed significantly reduced factor activities at admission. In contrast, factor VIII activity was markedly elevated after injury in general (P < 0.0001), but reduced in nonsurvivors (P < 0.05). Conclusions. Multiple trauma causes an early reduction of the activities of nearly all soluble clotting factors in general. Initial hemoglobin and, with certain qualifications, base deficit levels demonstrated a potential value in detecting those underlying clotting factor deficiencies. Nevertheless, their role as triggers of a hemostatic therapy as well as the observed response of factor VIII to multiple trauma and also its potential prognostic value needs further evaluation. PMID:27433474

  15. Lung cancer chemotherapy agents increase procoagulant activity via protein disulfide isomerase-dependent tissue factor decryption.

    PubMed

    Lysov, Zakhar; Swystun, Laura L; Kuruvilla, Sara; Arnold, Andrew; Liaw, Patricia C

    2015-01-01

    Lung cancer patients undergoing chemotherapy have an elevated risk for thrombosis. However, the mechanisms by which chemotherapy agents increase the risk for thrombosis remains unclear. The aim of this study was to determine the mechanism(s) by which lung cancer chemotherapy agents cisplatin, carboplatin, gemcitabine, and paclitaxel elicit increased tissue factor activity on endothelial cells, A549 cells, and monocytes. Tissue factor activity, tissue factor antigen, and phosphatidylserine exposure were measured on chemotherapy-treated human umbilical vein endothelial cells (HUVEC), A549 cells, and monocytes. Cell surface protein disulfide isomerase (PDI) and cell surface free thiol levels were measured on HUVEC and A549 non-small cell lung carcinoma cells. Treatment of HUVECs, A549 cells, and monocytes with lung cancer chemotherapy significantly increased cell surface tissue factor activity. However, elevated tissue factor antigen levels were observed only on cisplatin-treated and gemcitabine-treated monocytes. Cell surface levels of phosphatidylserine were increased on HUVEC and monocytes treated with cisplatin/gemcitabine combination therapy. Chemotherapy also resulted in increased cell surface levels of PDI and reduced cell surface free thiol levels. Glutathione treatment and PDI inhibition, but not phosphatidylserine inhibition, attenuated tissue factor activity. Furthermore, increased tissue factor activity was reversed by reducing cysteines with dithiothreitol. These studies are the first to demonstrate that lung cancer chemotherapy agents increase procoagulant activity on endothelial cells and A549 cells by tissue factor decryption through a disulfide bond formation in a PDI-dependent mechanism. PMID:24911456

  16. The evolution of clot-promoting and amidolytic activities in mixtures of Hageman factor (factor XII) and ellagic acid.

    PubMed

    Ratnoff, O D; Saito, H

    1982-08-01

    Ellagic acid (4,4',5,5',6,6'-hexahydroxydiphenic acid 2,6,2',6'-dilactone) can substitute for negatively charged surfaces as a stimulus to reactions of the intrinsic pathway. Incubation of solutions of 4 X 10(-6)M ellagic acid with purified HF (factor XII) induced clot-promoting and amidolytic activity. Clot-promoting activity tested on a substrate of HF-deficient plasma evolved much more rapidly than amidolytic activity. Clot-promoting activity generated in mixtures of HF and ellagic acid alone, but amidolytic activity was observed only if additional proteins such as albumin were also present. Treatment of purified HF with DFP or filtration of HF through columns of SBTI bound to agarose did not prevent its subsequent activation by ellagic acid. Solutions of SBTI, at high concentration, partly inhibited the generation of amidolytic activity,wheras popcorn inhibitor and a crude IgG fraction of anti-HF inhibited the amidolytic activity that had been generated in a mixture of HF and ellagic acid. Generation of clotting and amidolytic properties was accompanied by scission of HF within an internal disulfide loop and by cleavage of HF into fragments with approximate MWs of 50,000 and 30,000; cleavage was completely blocked by popcorn inhibitor and partially blocked by high concentrations of SBTI. These experiments demonstrate that ellagic acid can activate HF in a manner analogous to negatively charged solids such as glass or kaolin. PMID:7097109

  17. Factors Predicting Behavioral Response to a Physical Activity Intervention among Adolescent Females

    ERIC Educational Resources Information Center

    Dunton, Genevieve Fridlund; Schneider, Margaret; Cooper, Dan M.

    2007-01-01

    Objective: To determine whether individual factors influenced rates of physical activity change in response to a school-based intervention. Methods: Sedentary adolescent females (N = 63) participated in a 9-month physical activity program. Weekly levels of leisure-time physical activity were reported using an interactive website. Results: Change…

  18. Exploring Contextual Factors and Patient Activation: Evidence from a Nationally Representative Sample of Patients with Depression

    ERIC Educational Resources Information Center

    Chen, Jie; Mortensen, Karoline; Bloodworth, Robin

    2014-01-01

    Patient activation has been considered as a "blockbuster drug of the century." Patients with mental disorders are less activated compared to patients with other chronic diseases. Low activation due to mental disorders can affect the efficiency of treatment of other comorbidities. Contextual factors are significantly associated with…

  19. A human factors evaluation of Extravehicular Activity gloves

    NASA Technical Reports Server (NTRS)

    O'Hara, John M.; Briganti, Michael; Cleland, John; Winfield, Dan

    1989-01-01

    One of the major problems faced in Extravehicular Activity (EVA) glove development has been the absence of concise and reliable methods to measure the effects of EVA gloves on human-hand capabilities. NASA has sponsored a program to develop a standardized set of tests designed to assess EVA-gloved hand capabilities in six performance domains: Range of Motion, Strength, Tactile Perception, Dexterity, Fatigue, and Comfort. Based upon an assessment of general human-hand functioning and EVA task requirements, several tests within each performance domain were developed to provide a comprehensive evaluation. All tests were designed to be conducted in a glove box with the bare hand, an EVA glove without pressure, an EVA glove at operation pressure. Thus, the differential effect on performance of the glove with and without pressure was tested. Bare hand performance was used to 'calibrate' the effects. Ten subjects participated in the test setup as a repeated-measures experimental design. The paper will report the results of the test program.

  20. Free radical activity of industrial fibers: role of iron in oxidative stress and activation of transcription factors.

    PubMed Central

    Gilmour, P S; Brown, D M; Beswick, P H; MacNee, W; Rahman, I; Donaldson, K

    1997-01-01

    We studied asbestos, vitreous fiber (MMVF10), and refractory ceramic fiber (RCF1) from the Thermal Insulation Manufacturers' Association fiber repository regarding the following: free radical damage to plasmid DNA, iron release, ability to deplete glutathione (GSH), and activate redox-sensitive transcription factors in macrophages. Asbestos had much more free radical activity than any of the man-made vitreous fibers. More Fe3+ was released than Fe2+ and more of both was released at pH 4.5 than at pH 7.2. Release of iron from the different fibers was generally not a good correlate of ability to cause free radical injury to the plasmid DNA. All fiber types caused some degree of oxidative stress, as revealed by depletion of intracellular GSH. Amosite asbestos upregulated nuclear binding of activator protein 1 transcription factor to a greater level than MMVF10 and RCF1; long-fiber amosite was the only fiber to enhance activation of the transcription factor nuclear factor kappa B (NF kappa B). The use of cysteine methyl ester and buthionine sulfoximine to modulate GSH suggested that GSH homeostasis was important in leading to activation of transcription factors. We conclude that the intrinsic free radical activity is the major determinant of transcription factor activation and therefore gene expression in alveolar macrophages. Although this was not related to iron release or ability to deplete macrophage GSH at 4 hr, GSH does play a role in activation of NF kappa B. Images Figure 1. Figure 5. A Figure 5. B Figure 6. A Figure 6. B PMID:9400744

  1. The restricted promoter activity of the liver transcription factor hepatocyte nuclear factor 3 beta involves a cell-specific factor and positive autoactivation.

    PubMed Central

    Pani, L; Quian, X B; Clevidence, D; Costa, R H

    1992-01-01

    The transcription factor hepatocyte nuclear factor 3 (HNF-3) is involved in the coordinate expression of several liver genes. HNF-3 DNA binding activity is composed of three different liver proteins which recognize the same DNA site. The HNF-3 proteins (designated alpha, beta, and gamma) possess homology in the DNA binding domain and in several additional regions. To understand the cell-type-specific expression of HNF-3 beta, we have defined the regulatory sequences that elicit hepatoma-specific expression. Promoter activity requires -134 bp of HNF-3 beta proximal sequences and binds four nuclear proteins, including two ubiquitous factors. One of these promoter sites interacts with a novel cell-specific factor, LF-H3 beta, whose binding activity correlates with the HNF-3 beta tissue expression pattern. Furthermore, there is a binding site for the HNF-3 protein within its own promoter, suggesting that an autoactivation mechanism is involved in the establishment of HNF-3 beta expression. We propose that both the LF-H3 beta and HNF-3 sites play an important role in the cell-type-specific expression of the HNF-3 beta transcription factor. Images PMID:1732730

  2. Immobilisation of homogeneous olefin polymerisation catalysts. Factors influencing activity and stability.

    PubMed

    Severn, John R; Chadwick, John C

    2013-07-01

    The activity and stability of homogeneous olefin polymerisation catalysts, when immobilised on a support, are dependent on both chemical and physical effects. Chemical factors affecting catalyst activity include the ease of formation of the active species, which is strongly dependent on the transition metal. Catalyst productivity is dependent on the balance between activity and stability. Immobilisation can lead to a lower proportion of active species and therefore lower initial polymerisation activity, but nevertheless give higher polymer yields in cases where increased catalyst stability is obtained. Important physical factors are support porosity and the ability of a support to undergo progressive fragmentation during polymerisation, facilitating monomer diffusion through the growing catalyst/polymer particle. This article illustrates the importance of these factors in olefin polymerisation with both early- and late-transition metal catalysts, with particular reference to the use of silica and magnesium chloride supports as well as to effects of immobilisation on polymer structure and properties. PMID:23467461

  3. Stimulation of hormone-responsive adenylate cyclase activity by a factor present in the cell cytosol.

    PubMed Central

    MacNeil, S; Crawford, A; Amirrasooli, H; Johnson, S; Pollock, A; Ollis, C; Tomlinson, S

    1980-01-01

    1. Homogenates of whole tissues were shown to contain both intracellular and extracellular factors that affected particulate adenylate cyclase activity in vitro. Factors present in the extracellular fluids produced an inhibition of basal, hormone- and fluoride-stimulated enzyme activity but factors present in the cell cytosol increased hormone-stimulated activity with relatively little effect on basal or fluoride-stimulated enzyme activity. 2. The existence of this cytosol factor or factors was investigated using freshly isolated human platelets, freshly isolated rat hepatocytes, and cultured cells derived from rat osteogenic sarcoma, rat calvaria, mouse melanoma, pig aortic endothelium, human articular cartilage chondrocytes and human bronchial carcinoma (BEN) cells. 3. The stimulation of the hormone response by the cytosol factor ranged from 60 to 890% depending on the tissue of origin of the adenylate cyclase. 4. In each case the behaviour of the factor was similar to the action of GTP on that particular adenylate cyclase preparation. 5. No evidence of tissue or species specificity was found, as cytosols stimulated adenylate cyclase from their own and unrelated tissues to the same degree. 6. In the human platelet, the inclusion of the cytosol in the assay of adenylate cyclase increased the rate of enzyme activity in response to stimulation by prostaglandin E1 without affecting the amount of prostaglandin E1 required for half-maximal stimulation or the characteristics of enzyme activation by prostaglandin E. PMID:7396869

  4. Production and functional activity of a recombinant von Willebrand factor-A domain from human complement factor B.

    PubMed Central

    Williams, S C; Hinshelwood, J; Perkins, S J; Sim, R B

    1999-01-01

    Factor B is a five-domain 90 kDa serine protease proenzyme which is part of the human serum complement system. It binds to other complement proteins C3b and properdin, and is activated by the protease factor D. The fourth domain of factor B is homologous to the type A domain of von Willebrand Factor (vWF-A). A full-length human factor B cDNA clone was used to amplify the region encoding the vWF-A domain (amino acids 229-444 of factor B). A fusion protein expression system was then used to generate it in high yield in Escherichia coli, where thrombin cleavage was used to separate the vWF-A domain from its fusion protein partner. A second vWF-A domain with improved stability and solubility was created using a Cys(267)-->Ser mutation and a four-residue C-terminal extension of the first vWF-A domain. The recombinant domains were investigated by analytical gel filtration, sucrose density centrifugation and analytical ultracentrifugation, in order to show that both domains were monomeric and possessed compact structures that were consistent with known vWF-A crystal structures. This expression system and its characterization permitted the first investigation of the function of the isolated vWF-A domain. It was able to inhibit substantially the binding of (125)I-labelled factor B to immobilized C3b. This demonstrated both the presence of a C3b binding site in this portion of factor B and a ligand-binding property of the vWF-A domain. The site at which factor D cleaves factor B is close to the N-terminus of both recombinant vWF-A domains. Factor D was shown to cleave the vWF-A domain in the presence or absence of C3b, whereas the cleavage of intact factor B under the same conditions occurs only in the presence of C3b. PMID:10477273

  5. Phosphoinositide 3-Kinases Upregulate System xc− via Eukaryotic Initiation Factor 2α and Activating Transcription Factor 4 – A Pathway Active in Glioblastomas and Epilepsy

    PubMed Central

    Baxter, Paul; Kassubek, Rebecca; Albrecht, Philipp; Van Liefferinge, Joeri; Westhoff, Mike-Andrew; Halatsch, Marc-Eric; Karpel-Massler, Georg; Meakin, Paul J.; Hayes, John D.; Aronica, Eleonora; Smolders, Ilse; Ludolph, Albert C.; Methner, Axel; Conrad, Marcus; Massie, Ann; Hardingham, Giles E.

    2014-01-01

    Abstract Aims: Phosphoinositide 3-kinases (PI3Ks) relay growth factor signaling and mediate cytoprotection and cell growth. The cystine/glutamate antiporter system xc− imports cystine while exporting glutamate, thereby promoting glutathione synthesis while increasing extracellular cerebral glutamate. The aim of this study was to analyze the pathway through which growth factor and PI3K signaling induce the cystine/glutamate antiporter system xc− and to demonstrate its biological significance for neuroprotection, cell growth, and epilepsy. Results: PI3Ks induce system xc− through glycogen synthase kinase 3β (GSK-3β) inhibition, general control non-derepressible-2-mediated eukaryotic initiation factor 2α phosphorylation, and the subsequent translational up-regulation of activating transcription factor 4. This pathway is essential for PI3Ks to modulate oxidative stress resistance of nerve cells and insulin-induced growth in fibroblasts. Moreover, the pathway is active in human glioblastoma cells. In addition, it is induced in primary cortical neurons in response to robust neuronal activity and in hippocampi from patients with temporal lobe epilepsy. Innovation: Our findings further extend the concepts of how growth factors and PI3Ks induce neuroprotection and cell growth by adding a new branch to the signaling network downstream of GSK-3β, which, ultimately, leads to the induction of the cystine/glutamate antiporter system xc−. Importantly, the induction of this pathway by neuronal activity and in epileptic hippocampi points to a potential role in epilepsy. Conclusion: PI3K-regulated system xc− activity is not only involved in the stress resistance of neuronal cells and in cell growth by increasing the cysteine supply and glutathione synthesis, but also plays a role in the pathophysiology of tumor- and non-tumor-associated epilepsy by up-regulating extracellular cerebral glutamate. Antioxid. Redox Signal. 20: 2907–2922. PMID:24219064

  6. A correction factor to f-chart predictions of active solar fraction in active-passive heating systems

    NASA Astrophysics Data System (ADS)

    Evans, B. L.; Beckman, W. A.; Duffie, J. A.; Mitchell, J. W.; Klein, S. A.

    1983-11-01

    The extent to which a passive system degrades the performance of an active solar space heating system was investigated, and a correction factor to account for these interactions was developed. The transient system simulation program TRNSYS is used to simulate the hour-by-hour performance of combined active-passive (hybrid) space heating systems in order to compare the active system performance with simplified design method predictions. The TRNSYS simulations were compared to results obtained using the simplified design calculations of the f-Chart method. Comparisons of TRNSYS and f-Chart were used to establish the accuracy of the f-Charts for active systems. A correlation was then developed to correct the monthly loads input into the f-Chart method to account for controller deadbands in both hybrid and active only buildings. A general correction factor was generated to be applied to the f-Chart method to produce more accurate and useful results for hybrid systems.

  7. Active heterotrophic biomass and sludge retention time (SRT) as determining factors for biodegradation kinetics of pharmaceuticals in activated sludge.

    PubMed

    Majewsky, Marius; Gallé, Tom; Yargeau, Viviane; Fischer, Klaus

    2011-08-01

    The present study investigates the biodegradation of pharmaceutically active compounds (PhACs) by active biomass in activated sludge. Active heterotrophs (X(bh)) which are known to govern COD removal are suggested as a determining factor for biological PhAC removal as well. Biodegradation kinetics of five polar PhACs were determined in activated sludge of two wastewater treatment plants which differed in size, layout and sludge retention time (SRT). Results showed that active fractions of the total suspended solids (TSS) differed significantly between the two sludges, indicating that TSS does not reveal information about heterotrophic activity. Furthermore, PhAC removal was significantly faster in the presence of high numbers of heterotrophs and a low SRT. Pseudo first-order kinetics were modified to include X(bh) and used to describe decreasing PhAC elimination with increasing SRT. PMID:21652206

  8. A Novel Mitogen-Activated Protein Kinase Is Responsive to Raf and Mediates Growth Factor Specificity

    PubMed Central

    Janulis, Mark; Trakul, Nicholas; Greene, Geoffrey; Schaefer, Erik M.; Lee, J. D.; Rosner, Marsha Rich

    2001-01-01

    The proto-oncogene Raf is a major regulator of growth and differentiation. Previous studies from a number of laboratories indicate that Raf activates a signaling pathway that is independent of the classic MEK1,2-ERK1,2 cascade. However, no other signaling cascade downstream of Raf has been identified. We describe a new member of the mitogen-activated protein kinase family, p97, an ERK5-related kinase that is activated and Raf associated when cells are stimulated by Raf. Furthermore, p97 is selectively responsive to different growth factors, providing a mechanism for specificity in cellular signaling. Thus, p97 is activated by the neurogenic factor fibroblast growth factor (FGF) but not the mitogenic factor epidermal growth factor (EGF) in neuronal cells. Conversely, the related kinase ERK5 is activated by EGF but not FGF. p97 phosphorylates transcription factors such as Elk-1 and Ets-2 but not MEF2C at transactivating sites, whereas ERK5 phosphorylates MEF2C but not Elk-1 or Ets-2. Finally, p97 is expressed in a number of cell types including primary neural and NIH 3T3 cells. Taken together, these results identify a new signaling pathway that is distinct from the classic Raf-MEK1,2-ERK1,2 kinase cascade and can be selectively stimulated by growth factors that produce discrete biological outcomes. PMID:11238956

  9. Risk Factors for Clinically Significant Intimate Partner Violence among Active-Duty Members

    ERIC Educational Resources Information Center

    Smith Slep, Amy M.; Foran, Heather M.; Heyman, Richard E.; Snarr, Jeffery D.

    2011-01-01

    Hypothesized risk factors for men's and women's clinically significant intimate partner violence (CS-IPV) from four ecological levels (i.e., individual, family, workplace, community) were tested in a representative sample of active-duty U.S. Air Force members (N = 42,744). When considered together, we expected only individual and family factors to…

  10. Factors Influencing Entering Teacher Candidates' Preferences for Instructional Activities: A Glimpse into Their Orientations towards Teaching

    ERIC Educational Resources Information Center

    Talanquer, Vicente; Novodvorsky, Ingrid; Tomanek, Debra

    2010-01-01

    The present study was designed to identify and characterize the major factors that influence entering science teacher candidates' preferences for different types of instructional activities, and to analyze what these factors suggest about teacher candidates' orientations towards science teaching. The study involved prospective teachers enrolled in…

  11. Social Cognitive Factors Associated with Physical Activity in Elementary School Girls

    ERIC Educational Resources Information Center

    Bean, Melanie K.; Miller, Sara; Mazzeo, Suzanne E.; Fries, Elizabeth A.

    2012-01-01

    Objective: To examine social cognitive factors associated with physical activity (PA) among preadolescent girls. Method: Social cognitive theory was used to examine PA in girls (N = 90; 71% African American) participating in Girls on the Run. Multiple regressions explored factors associated with PA at posttesting and 3-month follow-up. Results:…

  12. The Fn14 cytoplasmic tail binds tumour-necrosis-factor-receptor-associated factors 1, 2, 3 and 5 and mediates nuclear factor-kappaB activation.

    PubMed Central

    Brown, Sharron A N; Richards, Christine M; Hanscom, Heather N; Feng, Sheau-Line Y; Winkles, Jeffrey A

    2003-01-01

    Fn14 is a growth-factor-inducible immediate-early-response gene encoding a 102-amino-acid type I transmembrane protein. The human Fn14 protein was recently identified as a cell-surface receptor for the tumour necrosis factor (TNF) superfamily member named TWEAK (TNF-like weak inducer of apoptosis). In the present paper, we report that the human TWEAK extracellular domain can also bind the murine Fn14 protein. Furthermore, site-specific mutagenesis and directed yeast two-hybrid interaction assays revealed that the TNFR-associated factor (TRAF) 1, 2, 3 and 5 adaptor molecules bind the murine Fn14 cytoplasmic tail at an overlapping, but non-identical, amino acid sequence motif. We also found that TWEAK treatment of quiescent NIH 3T3 cells stimulates inhibitory kappaBalpha phosphorylation and transcriptional activation of a nuclear factor-kappaB (NF-kappaB) enhancer/luciferase reporter construct. Fn14 overexpression in transiently transfected NIH 3T3 cells also promotes NF-kappaB activation, and this cellular response requires an intact TRAF binding site. These results indicate that Fn14 is a functional TWEAK receptor that can associate with four distinct TRAF family members and stimulate the NF-kappaB transcription factor signalling pathway. PMID:12529173

  13. Nonenzymatic anticoagulant activity of the mutant serine protease Ser360Ala-activated protein C mediated by factor Va.

    PubMed Central

    Gale, A. J.; Sun, X.; Heeb, M. J.; Griffin, J. H.

    1997-01-01

    The human plasma serine protease, activated protein C (APC), primarily exerts its anticoagulant function by proteolytic inactivation of the blood coagulation cofactors Va and VIIIa. A recombinant active site Ser 360 to Ala mutation of protein C was prepared, and the mutant protein was expressed in human 293 kidney cells and purified. The activation peptide of the mutant protein C zymogen was cleaved by a snake venom activator, Protac C, but the "activated" S360A APC did not have amidolytic activity. However, it did exhibit significant anticoagulant activity both in clotting assays and in a purified protein assay system that measured prothrombinase activity. The S360A APC was compared to plasma-derived and wild-type recombinant APC. The anticoagulant activity of the mutant, but not native APC, was resistant to diisopropyl fluorophosphate, whereas all APCs were inhibited by monoclonal antibodies against APC. In contrast to native APC, S360A APC was not inactivated by serine protease inhibitors in plasma and did not bind to the highly reactive mutant protease inhibitor M358R alpha 1 antitrypsin. Since plasma serpins provide the major mechanism for inactivating APC in vivo, this suggests that S360A APC would have a long half-life in vivo, with potential therapeutic advantages. S360A APC rapidly inhibited factor Va in a nonenzymatic manner since it apparently did not proteolyze factor Va. These data suggest that native APC may exhibit rapid nonenzymatic anticoagulant activity followed by enzymatic irreversible proteolysis of factor Va. The results of clotting assays and prothrombinase assays showed that S360A APC could not inhibit the variant Gln 506-FVa compared with normal Arg 506-FVa, suggesting that the active site of S360A APC binds to FVa at or near Arg 506. PMID:9007985

  14. The suppression of fibroblast growth factor 2/fibroblast growth factor 4-dependent tumour angiogenesis and growth by the anti-growth factor activity of dextran derivative (CMDB7).

    PubMed Central

    Bagheri-Yarmand, R.; Kourbali, Y.; Mabilat, C.; Morère, J. F.; Martin, A.; Lu, H.; Soria, C.; Jozefonvicz, J.; Crépin, M.

    1998-01-01

    Our previous studies showed that carboxymethyl benzylamide dextran (CMDB7) blocks basic fibroblast growth factor (FGF-2)-dependent cell proliferation of a human breast epithelial line (HBL100), suggesting its potential role as a potent antiangiogenic substance. The derived cell line (HH9), which was transformed with the hst/FGF4 gene, has been shown to be highly proliferative in vitro and to induce angiogenic tumours in nude mice. We show here that CMDB7 inhibits the mitogenic activities of the conditioned media from HBL 100 and HH9 cells in a dose-dependent manner. When HH9 cells were injected s.c. into nude mice, CMDB7 treatment (300 mg kg(-1) week(-1)) suppressed the tumour take and the tumour growth by about 50% and 80% respectively. Immunohistochemical analysis showed a highly significant decrease, by more than threefold, in the endothelial density of viable tumour regions, together with a significant increase in the necrosis area. This antiangiogenic activity of CMDB7 was further demonstrated by direct inhibition of calf pulmonary artery (CPAE) and human umbilical vein (HUVEC) endothelial cell proliferation and migration in vitro. In addition, we showed that CMDB7 inhibits specifically the mitogenic effects of the growth factors that bind to heparin such as FGF-2, FGF-4, platelet-derived growth factor (PDGF-BB) and transforming growth factor (TGF-beta1), but not those of epidermal growth factor (EGF) and insulin-like growth factor (IGF-1). These results demonstrate that CMDB7 inhibits FGF-2/FGF-4-dependent tumour growth and angiogenesis, most likely by disrupting the autocrine and paracrine effects of growth factors released from the tumour cells. Images Figure 4 PMID:9662260

  15. Peripheral brain-derived neurotrophic factor is related to cardiovascular risk factors in active and inactive elderly men.

    PubMed

    Zembron-Lacny, A; Dziubek, W; Rynkiewicz, M; Morawin, B; Woźniewski, M

    2016-06-20

    Regular exercise plays an important preventive and therapeutic role in heart and vascular diseases, and beneficially affects brain function. In blood, the effects of exercise appear to be very complex and could include protection of vascular endothelial cells via neurotrophic factors and decreased oxidative stress. The purpose of this study was to identify the age-related changes in peripheral brain-derived neurotrophic factor (BDNF) and its relationship to oxidative damage and conventional cardiovascular disease (CVD) biomarkers, such as atherogenic index, C-reactive protein (hsCRP) and oxidized LDL (oxLDL), in active and inactive men. Seventeen elderly males (61-80 years) and 17 young males (20-24 years) participated in this study. According to the 6-min Åstrand-Rhyming bike test, the subjects were classified into active and inactive groups. The young and elderly active men had a significantly better lipoprotein profile and antioxidant status, as well as reduced oxidative damage and inflammatory state. The active young and elderly men had significantly higher plasma BDNF levels compared to their inactive peers. BDNF was correlated with VO2max (r=0.765, P<0.001). In addition, we observed a significant inverse correlation of BDNF with atherogenic index (TC/HDL), hsCRP and oxLDL. The findings demonstrate that a high level of cardiorespiratory fitness reflected in VO2max was associated with a higher level of circulating BDNF, which in turn was related to common CVD risk factors and oxidative damage markers in young and elderly men. PMID:27332774

  16. Peripheral brain-derived neurotrophic factor is related to cardiovascular risk factors in active and inactive elderly men

    PubMed Central

    Zembron-Lacny, A.; Dziubek, W.; Rynkiewicz, M.; Morawin, B.; Woźniewski, M.

    2016-01-01

    Regular exercise plays an important preventive and therapeutic role in heart and vascular diseases, and beneficially affects brain function. In blood, the effects of exercise appear to be very complex and could include protection of vascular endothelial cells via neurotrophic factors and decreased oxidative stress. The purpose of this study was to identify the age-related changes in peripheral brain-derived neurotrophic factor (BDNF) and its relationship to oxidative damage and conventional cardiovascular disease (CVD) biomarkers, such as atherogenic index, C-reactive protein (hsCRP) and oxidized LDL (oxLDL), in active and inactive men. Seventeen elderly males (61-80 years) and 17 young males (20-24 years) participated in this study. According to the 6-min Åstrand-Rhyming bike test, the subjects were classified into active and inactive groups. The young and elderly active men had a significantly better lipoprotein profile and antioxidant status, as well as reduced oxidative damage and inflammatory state. The active young and elderly men had significantly higher plasma BDNF levels compared to their inactive peers. BDNF was correlated with VO2max (r=0.765, P<0.001). In addition, we observed a significant inverse correlation of BDNF with atherogenic index (TC/HDL), hsCRP and oxLDL. The findings demonstrate that a high level of cardiorespiratory fitness reflected in VO2max was associated with a higher level of circulating BDNF, which in turn was related to common CVD risk factors and oxidative damage markers in young and elderly men. PMID:27332774

  17. Association between Social and Environmental Factors and Physical Activity Opportunities in Middle Schools

    ERIC Educational Resources Information Center

    Xu, Furong; Chepyator-Thomson, Jepkorir; Liu, Wenhao; Schmidlein, Robert

    2010-01-01

    School-based physical activity (PA) interventions impact children's PA involvement and thus opportunities and associated factors for the promotion of physical activity in children need to be examined. The purpose of this study was to examine physical education teachers' perceptions of PA opportunities available to students at the middle school…

  18. Testing the Youth Physical Activity Promotion Model: Fatness and Fitness as Enabling Factors

    ERIC Educational Resources Information Center

    Chen, Senlin; Welk, Gregory J.; Joens-Matre, Roxane R.

    2014-01-01

    As the prevalence of childhood obesity increases, it is important to examine possible differences in psychosocial correlates of physical activity between normal weight and overweight children. The study examined fatness (weight status) and (aerobic) fitness as Enabling factors related to youth physical activity within the Youth Physical Activity…

  19. Exploring Socio-Ecological Factors Influencing Active and Inactive Spanish Students in Years 12 and 13

    ERIC Educational Resources Information Center

    Devís-Devís, José; Beltrán-Carrillo, Vicente J.; Peiró-Velert, Carmen

    2015-01-01

    This paper explores socio-ecological factors and their interplay that emerge from a qualitative study and influence adolescents' physical activity and sport participation. A total of 13 boys and 7 girls active and inactive adolescents, from years 12 and 13 and different types of school (state and private), participated in semi-structured…

  20. Factors Associated with Sexual Activity among High-School Students in Nairobi, Kenya

    ERIC Educational Resources Information Center

    Kabiru, Caroline W.; Orpinas, Pamela

    2009-01-01

    The high level of HIV infection in sub-Saharan Africa has led to an increased interest in understanding the determinants of sexual activity among young people, who are at high risk of sexually transmitted infections. The present study examined sociodemographic, behavioral, and psychosocial factors associated with heterosexual activity among a…

  1. Factors Associated with Leisure Activity among Young Adults with Developmental Disabilities

    ERIC Educational Resources Information Center

    Van Naarden Braun, Kim; Yeargin-Allsopp, Marshalyn; Lollar, Donald

    2006-01-01

    The framework of the International Classification of Functioning, Disability, and Health (ICF) was applied to examine the factors associated with childhood impairment and leisure activity. Information on leisure activity was obtained using a structured questionnaire from a population-based cohort of young adults with childhood impairment. The…

  2. MULTI-FACTOR POTENCY SCHEME FOR COMPARING THE CARCINOGENIC ACTIVITY OF CHEMICALS

    EPA Science Inventory

    A scheme for ranking the quantitative activity `of chemical carcinogens is described. his activity scheme uses as its base, dose potency measured as TD50, which after conversion into an inverse log scale, a decile scale, is adjusted by weighing factors that describe other paramet...

  3. Interpersonal and Intrapersonal Factors Associated with Autonomous Motivation in Adolescents' After-School Activities

    ERIC Educational Resources Information Center

    Beiswenger, Krista L.; Grolnick, Wendy S.

    2010-01-01

    This study explored interpersonal and intrapersonal factors associated with the level of autonomous motivation adolescents experience for their after-school activities. A total of 142 seventh-grade adolescents completed measures of peer relatedness, autonomy within friendships, mother and father autonomy support, perceived activity competence,…

  4. Associations of Weight Status, Social Factors, and Active Travel among College Students

    ERIC Educational Resources Information Center

    Bopp, Melissa; Behrens, Timothy K.; Velecina, Rachel

    2014-01-01

    Background: Active travel (AT) is associated with various health benefits and may help prevent the decline in physical activity during college years. Purpose: The purpose of this study was to examine the relationship of several factors with AT to campus by weight status. Methods: Students at a large northeastern US campus completed an online…

  5. Arabidopsis Sigma Factor Binding Proteins Are Activators of the WRKY33 Transcription Factor in Plant Defense[W

    PubMed Central

    Lai, Zhibing; Li, Ying; Wang, Fei; Cheng, Yuan; Fan, Baofang; Yu, Jing-Quan; Chen, Zhixiang

    2011-01-01

    Necrotrophic pathogens are important plant pathogens that cause many devastating plant diseases. Despite their impact, our understanding of the plant defense response to necrotrophic pathogens is limited. The WRKY33 transcription factor is important for plant resistance to necrotrophic pathogens; therefore, elucidation of its functions will enhance our understanding of plant immunity to necrotrophic pathogens. Here, we report the identification of two WRKY33-interacting proteins, nuclear-encoded SIGMA FACTOR BINDING PROTEIN1 (SIB1) and SIB2, which also interact with plastid-encoded plastid RNA polymerase SIGMA FACTOR1. Both SIB1 and SIB2 contain an N-terminal chloroplast targeting signal and a putative nuclear localization signal, suggesting that they are dual targeted. Bimolecular fluorescence complementation indicates that WRKY33 interacts with SIBs in the nucleus of plant cells. Both SIB1 and SIB2 contain a short VQ motif that is important for interaction with WRKY33. The two VQ motif–containing proteins recognize the C-terminal WRKY domain and stimulate the DNA binding activity of WRKY33. Like WRKY33, both SIB1 and SIB2 are rapidly and strongly induced by the necrotrophic pathogen Botrytis cinerea. Resistance to B. cinerea is compromised in the sib1 and sib2 mutants but enhanced in SIB1-overexpressing transgenic plants. These results suggest that dual-targeted SIB1 and SIB2 function as activators of WRKY33 in plant defense against necrotrophic pathogens. PMID:21990940

  6. Interleukin 10 inhibits macrophage microbicidal activity by blocking the endogenous production of tumor necrosis factor alpha required as a costimulatory factor for interferon gamma-induced activation.

    PubMed Central

    Oswald, I P; Wynn, T A; Sher, A; James, S L

    1992-01-01

    Interleukin 10 (IL-10) inhibits interferon gamma-induced macrophage activation for cytotoxicity against larvae of the human parasite Schistosoma mansoni by suppressing production of the toxic effector molecule nitric oxide (NO). In this study, the mechanism of IL-10 action was identified as inhibition of endogenous tumor necrosis factor alpha (TNF-alpha) production by interferon gamma-activated macrophages. TNF-alpha appears to serve as a cofactor for interferon gamma-mediated activation, since both schistosomulum killing and NO production were inhibited by anti-TNF-alpha antibody, whereas TNF-alpha alone was unable to stimulate these macrophage functions. IL-10 blocked TNF-alpha production by interferon gamma-treated macrophages at the levels of both protein and mRNA synthesis. Addition of exogenous TNF-alpha reversed IL-10-mediated suppression of macrophage cytotoxic activity as well as NO production. Likewise, addition of a macrophage-triggering agent (bacterial lipopolysaccharide or muramyl dipeptide), which induced the production of TNF-alpha, also reversed the suppressive effect of IL-10 on cytotoxic function. In contrast to IL-10, two other cytokines, IL-4 and transforming growth factor beta, which also inhibit macrophage activation for schistosomulum killing and NO production, did not substantially suppress endogenous TNF-alpha production. These results, therefore, describe a separate pathway by which macrophage microbicidal function is inhibited by the down-regulatory cytokine IL-10. Images PMID:1528880

  7. Encoding four gene expression programs in the activation dynamics of a single transcription factor.

    PubMed

    Hansen, Anders S; O'Shea, Erin K

    2016-04-01

    Cellular signaling response pathways often exhibit a bow-tie topology [1,2]: multiple upstream stress signals converge on a single shared transcription factor, which is thought to induce different downstream gene expression programs (Figure 1A). However, if several different signals activate the same transcription factor, can each signal then induce a specific gene expression response? A growing body of literature supports a temporal coding theory where information about environmental signals can be encoded, at least partially, in the temporal dynamics of the shared transcription factor [1,2]. For example, in the case of the budding yeast transcription factor Msn2, different stresses induce distinct Msn2 activation dynamics: Msn2 shows pulsatile nuclear activation with dose-dependent frequency under glucose limitation, but sustained nuclear activation with dose-dependent amplitude under oxidative stress [3]. These dynamic patterns can then lead to differential gene expression responses [3-5], but it is not known how much specificity can be obtained. Thus, a major question of this temporal coding theory is how many gene response programs or cellular functions can be robustly encoded by dynamic control of a single transcription factor. Here we provide the first direct evidence that, simply by regulating the activation dynamics of a single transcription factor, it is possible to preferentially induce four distinct gene expression programs. PMID:27046808

  8. Helix-loop-helix transcription factors mediate activation and repression of the p75LNGFR gene.

    PubMed Central

    Chiaramello, A; Neuman, K; Palm, K; Metsis, M; Neuman, T

    1995-01-01

    Sequence analysis of rat and human low-affinity nerve growth factor receptor p75LNGFR gene promoter regions revealed a single E-box cis-acting element, located upstream of the major transcription start sites. Deletion analysis of the E-box sequence demonstrated that it significantly contributes to p75LNGFR promoter activity. This E box has a dual function; it mediates either activation or repression of the p75LNGFR promoter activity, depending on the interacting transcription factors. We showed that the two isoforms of the class A basic helix-loop-helix (bHLH) transcription factor ME1 (ME1a and ME1b), the murine homolog of the human HEB transcription factor, specifically repress p75LNGFR promoter activity. This repression can be released by coexpression of the HLH Id2 transcriptional regulator. In vitro analyses demonstrated that ME1a forms a stable complex with the p75LNGFR E box and likely competes with activating E-box-binding proteins. By using ME1a-overexpressing PC12 cells, we showed that the endogenous p75LNGFR gene is a target of ME1a repression. Together, these data demonstrate that the p75LNGFR E box and the interacting bHLH transcription factors are involved in the regulation of p75LNGFR gene expression. These results also show that class A bHLH transcription factors can repress and Id-like negative regulators can stimulate gene expression. PMID:7565756

  9. Factors that influence physical activity for pregnant and postpartum women and implications for primary care.

    PubMed

    Doran, Frances; Davis, Kierrynn

    2011-01-01

    Many pregnant women and women of child-bearing age do not engage in the recommended levels of physical activity despite the well known benefits. Pregnancy and the postpartum period can be a time when inactivity actually increases. Women who experience gestational diabetes mellitus (GDM) during their pregnancy are often advised to become more active in order to ameliorate their increased risk of developing type 2 diabetes. Health professionals have an influential role in promoting physical activity, which would be enhanced with an understanding of the factors that positively and negatively influence women's participation in physical activity during pregnancy and in the postpartum period. This research sought to explore these factors with pregnant and postpartum women including those who had experienced GDM and the attention given to physical activity during pregnancy. A survey was developed after a critical review of factors identified from previous studies. Women were recruited from the antenatal clinic, community health centres and the local media. Results from 72 women are reported from a predominately well educated, Caucasian population. Overall, the results were confirmatory of factors previously identified. Lack of child care, time constraints, no time and feeling unwell during pregnancy hindered activity and factors that facilitated activity included family support, enjoyment of activity and to prevent later health problems. It was also found that non-GDM women are given minimal advice about exercise during pregnancy. A checklist has been developed for health professionals, in partnership with women, to direct attention to the factors that enable and hinder participation in physical activity during and after pregnancy. PMID:21616029

  10. Activation of transcription factors STAT1 and STAT5 in the mouse median eminence after systemic ciliary neurotrophic factor administration.

    PubMed

    Severi, Ilenia; Senzacqua, Martina; Mondini, Eleonora; Fazioli, Francesca; Cinti, Saverio; Giordano, Antonio

    2015-10-01

    Exogenously administered ciliary neurotrophic factor (CNTF) causes weight loss in obese rodents and humans through leptin-like activation of the Jak-STAT3 signaling pathway in hypothalamic arcuate neurons. Here we report for the first time that 40min after acute systemic treatment, rat recombinant CNTF (intraperitoneal injection of 0.3mg/kg of body weight) induced nuclear translocation of the tyrosine-phosphorylated forms of STAT1 and STAT5 in the mouse median eminence and other circumventricular organs, including the vascular organ of the lamina terminalis and the subfornical organ. In the tuberal hypothalamus of treated mice, specific nuclear immunostaining for phospo-STAT1 and phospho-STAT5 was detected in ependymal cells bordering the third ventricle floor and lateral recesses, and in median eminence cells. Co-localization studies documented STAT1 and STAT5 activation in median eminence β-tanycytes and underlying radial glia-like cells. A few astrocytes in the arcuate nucleus responded to CNTF by STAT5 activation. The vast majority of median eminence tanycytes and radial glia-like cells showing phospho-STAT1 and phospho-STAT5 immunoreactivity were also positive for phospho-STAT3. In contrast, STAT3 was the sole STAT isoform activated by CNTF in arcuate nucleus and median eminence neurons. Finally, immunohistochemical evaluation of STAT activation 20, 40, 80, and 120min from the injection demonstrated that cell activation was accompanied by c-Fos expression. Collectively, our findings show that CNTF activates STAT3, STAT1, and STAT5 in vivo. The distinctive activation pattern of these STAT isoforms in the median eminence may disclose novel targets and pathways through which CNTF regulates food intake. PMID:26133794

  11. Motivational factors and stages of change for physical activity among college students in Amman, Jordan.

    PubMed

    Madanat, Hala; Merrill, Ray M

    2006-01-01

    The purpose of this study was to investigate physical activity levels across the five stages of change for physical activity and to identify motivational factors for physical activity according to these stages of change among college students in Amman, Jordan. Analyses were based on a cross-sectional survey of 431 students, with a mean age of 21.1 (SD=0.16) and 67.5% female. Based on the recommendation that physical activity requires at least 30 minutes of physical activity 3 or more days per week, men were more likely than women to classify themselves in later stages: 7.3% vs. 9.5% in the precontemplation stage, 17.4% vs. 14.7% in the contemplation stage, 50.0% vs. 63.5% in the preparation stage, 9.4% vs. 5.6% in the action stage, and 15.9% vs. 6.7% in the maintenance stage [X2(4) = 14.04, p = 0.0072]. Seven potential motivational items for physical activity were assessed using factor analysis: experience better self-worth, prevent chronic disease, relieve stress, stay in shape, longevity, recreation/fun, and social benefits. Two factor groupings were identified from these items. The first factor included the first five items, labeled as "Physical and Mental". The second factor included the last two items, labeled as "Social and Recreational." "Physical and Mental" items compared with "Social and Recreational" items were most likely to motivate physical activity across the stages of change for physical activity. The strongest motivator of physical activity was to stay in shape. The weakest motivator of physical activity was for social reasons. The influence of the intermediate motivational factors was slightly affected by the students' stage of change for physical activity. Motivators for physical activity did not differ according to sex. These results provide important information about the motivational factors for physical activity for college-aged students in Jordan that can be useful in developing effective physical activity intervention programs. PMID

  12. Tissue Factor Activity in Lymphocyte Cultures from Normal Individuals and Patients with Hemophilia A

    PubMed Central

    Rickles, Frederick R.; Hardin, John A.; Pitlick, Frances A.; Hoyer, Leon W.; Conrad, Marcel E.

    1973-01-01

    The procoagulant material of lymphocytes has been characterized as tissue factor. Lymphocytes stimulated with phytohemagglutinin or the purified protein derivative of the tubercle bacillus developed procoagulant activity with incubation in tissue culture. While this material corrected the prolonged clotting time of factor VIII (AHF) deficient plasma, we have shown, utilizing a sensitive radioimmunoassay, that no AHF antigen was present in the cell cultures. Further, we have demonstrated this material to be tissue factor by coagulation techniques and immunological cross-reactivity. The published data regarding factor VIII synthesis is reviewed in light of these observations and comments are made regarding the role of the lymphocyte procoagulant. PMID:4634046

  13. Factor analysis shows that female rat behaviour is characterized primarily by activity, male rats are driven by sex and anxiety.

    PubMed

    Fernandes, C; González, M I; Wilson, C A; File, S E

    1999-12-01

    This experiment explored sex differences in behaviour using factor analysis to describe the relationship between different behavioral variables. A principal component solution with an orthogonal rotation of the factor matrix was used, ensuring that the extracted factors are independent of one another, and thus reflect separate processes. In the elevated plus-maze test of anxiety, in male rats factor 1 accounted for 75% of the variance and reflected anxiety, factor 2 represented activity, and accounted for 24% of the variance. This contrasted with the finding in female rats in which factor 1 was activity, accounting for 57% of the variance, with the anxiety factor accounting for only 34% of the variance. When behaviour in both the plus-maze and holeboard were analysed, a similar sex difference was found with anxiety emerging as factor 1 in males and holeboard activity as factor 1 in females. Locomotor activity in the inner portion of the holeboard loaded on the anxiety factor for males, but on activity for females. When behaviours in the plus-maze and sexual orientation tests were analysed, anxiety emerged as factor 1 in males, sexual preferences factor 2, and activity factor 3. In females, activity was factor 1, sexual preference factor 2, anxiety factor 3, and social interest factor 4. These results suggest caution should be exercised in interpreting the results from female rats in tests validated on males because the primary controlling factor may be different. PMID:10593196

  14. Gender Similarities and Differences in Factors Associated with Adolescent Moderate-Vigorous Physical Activity

    PubMed Central

    Wenthe, Phyllis J.; Janz, Kathleen F; Levy, Stephen M.

    2010-01-01

    This study investigated the relationship between predisposing, reinforcing, and enabling factors conceptualized within the Youth Physical Activity Promotion Model (YPAP) and moderate to vigorous physical activity (MVPA) of adolescent males and females. Specifically, self-efficacy to overcome barriers, enjoyment of physical activity; family support, peer support, perceived school climate, neighborhood safety and access to physical activity were examined. The Physical Activity Questionnaire for Adolescents (PAQ-A) and the Actigraph 7164 were used to obtain three different measures of MVPA in 205 adolescents (102 males, 103 females). Family support emerged as the most significant and consistent factor associated with the MVPA of both adolescent males and females. This relationship was noted even when different methods of measuring MVPA were employed. These findings should increase the confidence of public health officials that family support has the potential to positively alter the physical activity behavior of adolescents. PMID:19827453

  15. Tissue factor activity. A marker of alveolar macrophage maturation in rabbits. Effects of granulomatous pneumonitis.

    PubMed Central

    Rothberger, H; McGee, M P; Lee, T K

    1984-01-01

    Experiments were carried out to examine relationships between alveolar macrophage maturity and amounts of tissue factor (Clotting Factor III) in these cells under physiologic conditions and during immunologically induced pneumonitis. Using discontinuous density gradient centrifugation, alveolar macrophages from healthy rabbits were rapidly isolated into five subpopulations at different stages of maturation, as demonstrated by morphologic and morphometric evaluation. Very large amounts of tissue factor activity were found in fully mature cells that were purified in the lowest density subpopulation and assayed without preliminary in vitro stimulation or culture. In the remaining four subpopulations of increasing density, amounts of tissue factor were found to progressively diminish in direct correlation with declines of cell maturity. These differences at mean levels were as great as 35-fold. In addition, blood monocytes had less than 1/219 and less than 1/6 of the activity of the fully mature and the least mature subpopulations, respectively. After 16 h culture of the five isolated subpopulations in the absence of lymphokines or of significant numbers of lymphocytes, tissue factor activity increased in inverse correlation with the preincubation stage of cell maturity (2,387 and 109% in the least mature and most mature subpopulations, respectively). These increases required protein synthesis and were accompanied by morphologic and morphometric changes which indicated cellular maturation during the period of tissue factor activity generation in vitro, thus further demonstrating relationships between macrophage maturity and tissue factor content. In additional experiments, direct correlations between cell maturity and tissue factor activity content were also found in activated alveolar macrophage populations from rabbits with Bacillus Calmette Guering (BCG)-induced granulomatous pneumonitis. However, as compared with controls, the BCG populations had increased total

  16. Acute cholesterol depletion impairs functional expression of tissue factor in fibroblasts: modulation of tissue factor activity by membrane cholesterol

    PubMed Central

    Mandal, Samir K.; Iakhiaev, Alexei; Pendurthi, Usha R.; Mohan Rao, L. Vijaya

    2010-01-01

    Cholesterol, in addition to providing rigidity to the fluid membrane, plays a critical role in receptor function, endocytosis, recycling, and signal transduction. In the present study, we examined the effect of membrane cholesterol on functional expression of tissue factor (TF), a cellular receptor for clotting factor VIIa. Depletion of cholesterol in human fibroblasts (WI-38) with methyl-β-cyclodextrin–reduced TF activity at the cell surface. Binding studies with radiolabeled VIIa and TF monoclonal antibody (mAB) revealed that reduced TF activity in cholesterol-depleted cells stems from the impairment of VIIa interaction with TF rather than the loss of TF receptors at the cell surface. Repletion of cholesterol-depleted cells with cholesterol restored TF function. Loss of caveolar structure on cholesterol removal is not responsible for reduced TF activity. Solubilization of cellular TF in different detergents indicated that a substantial portion of TF in fibroblasts is associated with noncaveolar lipid rafts. Cholesterol depletion studies showed that the TF association with these rafts is cholesterol dependent. Overall, the data presented herein suggest that membrane cholesterol functions as a positive regulator of TF function by maintaining TF receptors, probably in noncaveolar lipid rafts, in a high-affinity state for VIIa binding. PMID:15328160

  17. The hypoxia-inducible factor-1α activates ectopic production of fibroblast growth factor 23 in tumor-induced osteomalacia

    PubMed Central

    Zhang, Qian; Doucet, Michele; Tomlinson, Ryan E; Han, Xiaobin; Quarles, L Darryl; Collins, Michael T; Clemens, Thomas L

    2016-01-01

    Tumor-induced osteomalacia (TIO) is a rare paraneoplastic syndrome in which ectopic production of fibroblast growth factor 23 (FGF23) by non-malignant mesenchymal tumors causes phosphate wasting and bone fractures. Recent studies have implicated the hypoxia-inducible factor-1α (HIF-1α) in other phosphate wasting disorders caused by elevated FGF23, including X-linked hypophosphatemic rickets and autosomal dominant hypophosphatemia. Here we provide evidence that HIF-1α mediates aberrant FGF23 in TIO by transcriptionally activating its promoter. Immunohistochemical studies in phosphaturic mesenchymal tumors resected from patients with documented TIO showed that HIF-1α and FGF23 were co-localized in spindle-shaped cells adjacent to blood vessels. Cultured tumor tissue produced high levels of intact FGF23 and demonstrated increased expression of HIF-1α protein. Transfection of MC3T3-E1 and Saos-2 cells with a HIF-1α expression construct induced the activity of a FGF23 reporter construct. Prior treatment of tumor organ cultures with HIF-1α inhibitors decreased HIF-1α and FGF23 protein accumulation and inhibited HIF-1α-induced luciferase reporter activity in transfected cells. Chromatin immunoprecipitation assays confirmed binding to a HIF-1α consensus sequence within the proximal FGF23 promoter, which was eliminated by treatment with a HIF-1α inhibitor. These results show for the first time that HIF-1α is a direct transcriptional activator of FGF23 and suggest that upregulation of HIF-1α activity in TIO contributes to the aberrant FGF23 production in these patients. PMID:27468359

  18. Quantitative comparison using generalized relative object detectability (G-ROD) metrics of an amorphous selenium detector with high resolution microangiographic fluoroscopes (MAF) and standard flat panel detectors (FPD)

    NASA Astrophysics Data System (ADS)

    Russ, M.; Shankar, A.; Jain, A.; Setlur Nagesh, S. V.; Ionita, C. N.; Scott, C.; Karim, K. S.; Bednarek, D. R.; Rudin, S.

    2016-03-01

    A novel amorphous selenium (a-Se) direct detector with CMOS readout has been designed, and relative detector performance investigated. The detector features include a 25μm pixel pitch, and 1000μm thick a-Se layer operating at 10V/μm bias field. A simulated detector DQE was determined, and used in comparative calculations of the Relative Object Detectability (ROD) family of prewhitening matched-filter (PWMF) observer and non-pre-whitening matched filter (NPWMF) observer model metrics to gauge a-Se detector performance against existing high resolution micro-angiographic fluoroscopic (MAF) detectors and a standard flat panel detector (FPD). The PWMF-ROD or ROD metric compares two x-ray imaging detectors in their relative abilities in imaging a given object by taking the integral over spatial frequencies of the Fourier transform of the detector DQE weighted by an object function, divided by the comparable integral for a different detector. The generalized-ROD (G-ROD) metric incorporates clinically relevant parameters (focal- spot size, magnification, and scatter) to show the degradation in imaging performance for detectors that are part of an imaging chain. Preliminary ROD calculations using simulated spheres as the object predicted superior imaging performance by the a-Se detector as compared to existing detectors. New PWMF-G-ROD and NPWMF-G-ROD results still indicate better performance by the a-Se detector in an imaging chain over all sphere sizes for various focal spot sizes and magnifications, although a-Se performance advantages were degraded by focal spot blurring. Nevertheless, the a-Se technology has great potential to provide break- through abilities such as visualization of fine details including of neuro-vascular perforator vessels and of small vascular devices.

  19. Factor Xa stimulates fibroblast procollagen production, proliferation, and calcium signaling via PAR{sub 1} activation

    SciTech Connect

    Blanc-Brude, Olivier P. . E-mail: olivier.blanc-brude@larib.inserm.fr; Archer, Fabienne; Leoni, Patricia; Derian, Claudia; Bolsover, Steven; Laurent, Geoffrey J.; Chambers, Rachel C.

    2005-03-10

    Fibroblast proliferation and procollagen production are central features of tissue repair and fibrosis. In addition to its role in blood clotting, the coagulation cascade proteinase thrombin can contribute to tissue repair by stimulating fibroblasts via proteolytic activation of proteinase-activated receptor-1 (PAR{sub 1}). During hemostasis, the coagulation cascade proteinase factor X is converted into factor Xa. We have previously shown that factor Xa upregulates fibroblast proliferation via production of autocrine PDGF. In this study, we further examined the effects of factor Xa on fibroblast function and aimed to identify its signaling receptor. We showed that factor Xa stimulates procollagen promoter activity and protein production by human and mouse fibroblasts. This effect was independent of PDGF and thrombin production, but dependent on factor Xa proteolytic activity. We also showed that PAR{sub 1}-deficient mouse fibroblasts did not upregulate procollagen production, mobilize cytosolic calcium, or proliferate in response to factor Xa. Desensitization techniques and PAR{sub 1}-specific agonists and inhibitors were used to demonstrate that PAR{sub 1} mediates factor Xa signaling in human fibroblasts. This is the first report that factor Xa stimulates extracellular matrix production. In contrast with endothelial cells and vascular smooth muscle cells, fibroblasts appear to be the only cell type in which the effects of factor Xa are mediated mainly via PAR{sub 1} and not PAR{sub 2}. These findings are critical for our understanding of tissue repair and fibrotic mechanisms, and for the design of novel approaches to inhibit the profibrotic effects of the coagulation cascade without compromising blood hemostasis.

  20. Multiple steps in the regulation of transcription-factor level and activity.

    PubMed Central

    Calkhoven, C F; Ab, G

    1996-01-01

    This review focuses on the regulation of transcription factors, many of which are DNA-binding proteins that recognize cis-regulatory elements of target genes and are the most direct regulators of gene transcription. Transcription factors serve as integration centres of the different signal-transduction pathways affecting a given gene. It is obvious that the regulation of these regulators themselves is of crucial importance for differential gene expression during development and in terminally differentiated cells. Transcription factors can be regulated at two, principally different, levels, namely concentration and activity, each of which can be modulated in a variety of ways. The concentrations of transcription factors, as of intracellular proteins in general, may be regulated at any of the steps leading from DNA to protein, including transcription, RNA processing, mRNA degradation and translation. The activity of a transcription factor is often regulated by (de) phosphorylation, which may affect different functions, e.g. nuclear localization DNA binding and trans-activation. Ligand binding is another mode of transcription-factor activation. It is typical for the large super-family of nuclear hormone receptors. Heterodimerization between transcription factors adds another dimension to the regulatory diversity and signal integration. Finally, non-DNA-binding (accessory) factors may mediate a diverse range of functions, e.g. serving as a bridge between the transcription factor and the basal transcription machinery, stabilizing the DNA-binding complex or changing the specificity of the target sequence recognition. The present review presents an overview of different modes of transcription-factor regulation, each illustrated by typical examples. PMID:8713055

  1. Agreement between two cutoff points for physical activity and associated factors in young individuals☆

    PubMed Central

    Coledam, Diogo Henrique Constantino; Ferraiol, Philippe Fanelli; Pires, Raymundo; Ribeiro, Edinéia Aparecida Gomes; Ferreira, Marco Antonio Cabral; de Oliveira, Arli Ramos

    2014-01-01

    Objective: To analyze the agreement between two cutoff points for physical activity (300 and 420 minutes/week) and associated factors in youth. Methods: The study enrolled 738 adolescents of Londrina city, Paraná, Southern Brazil. The following variables were collected by a self report questionnaire: presence of moderate to vigorous physical activity, gender, age, father and mother education level, with whom the adolescent lives, number of siblings, physical activity perception, participation in Physical Education classes, facilities available to physical activity practice and sedentary behavior. Prevalence of physical activity between criterions were compared using McNemar test and the agreement was analysed by Kappa index. Multivariate analysis was performed using Poisson regression with robust variance adjustment was applied. Results: The prevalence for physical activity was significantly different: 22,3% for 300 minutes/week and 12,8% for 420 minutes/week (p<0,05), but the agreement was strong (k=0,82, p<0,001). The variables gender, father education, physical activity perception and sedentary behavior were associated to physical activity in both analyzed criteria. Participation in Physical Education class and facilities available to physical activity practice were associated to physical activity only with 300 minutes/week cutoff point. Conclusion: Caution is suggested regarding cutoffs use for physical activity in epidemiological studies, considering they can result in differences in prevalence of physical activity and its associated factors. PMID:25479852

  2. Activation of the alternative pathway by gluten. A possible aetiological factor in dermatitis herpetiformis.

    PubMed

    Massey, A; Capner, P M; Mowbray, J F

    1977-09-01

    Gluten fractions are shown to activate the alternative pathway of complement when added to normal human serum. Breakdown of C3 and Factor B occur in a manner analogous to that when activated by zymosan, in the presence of MgEGTA and in serum devoid of classical pathway activity. The suggestion is made that bypass activation may be the primary event when gluten enters the serum across a damaged gut mucosa. Immune complexes containing non-complement fixing IgA antigluten antibody are carried to the skin where it is proposed that complexed gluten activates C3 and initiates an inflammatory reaction. PMID:908582

  3. Temporal variations in plasma vitamin K and lipid concentrations and clotting factor activity in humans.

    PubMed

    Kamali, F; Edwards, C; Wood, P; Wynne, H A; Kesteven, P

    2001-11-01

    There is no information available on temporal variability in plasma vitamin K concentrations and its relationship to coagulation processes. We investigated the possible existence of temporal changes in plasma vitamin K and lipid concentrations and activity of clotting factors II, VII, IX, and X and relationships between these variables. Plasma vitamin K and lipid concentrations and clotting factor activity were measured at four-hour intervals for 28 hours in a group of healthy volunteers. Temporal variations existed in plasma vitamin K concentrations, with a mean maximum at 22:00 hr and a mean minimum (32% of the maximum) at 10:00 hr. Plasma triglycerol concentrations mirrored the changes in vitamin K concentrations. Mean factor VII activity was positively correlated with mean total plasma cholesterol concentrations (r = 0.714; P < 0.0001) and with mean plasma low density lipoprotein (LDL) cholesterol concentrations (r = 0.461; P < 0.0001). No distinct correlations were found between plasma vitamin K concentrations and either high density lipoprotein (HDL) or LDL cholesterol concentrations, or between triglycerol, HDL, or LDL cholesterol concentrations and functional activity of factors II, IX, and X. Plasma vitamin K concentrations did not correlate with the functional activity of any of the clotting factors. The presence of a correlation between plasma cholesterol concentrations and factor VII activity for blood samples collected at four-hour intervals suggests that plasma cholesterol concentrations may have a more acute effect on factor VII activity. Temporal variations in plasma vitamin K concentrations indicate that a single time point measurement may be an inappropriate method of establishing vitamin K status in an individual. PMID:11754396

  4. Measurement of microparticle tissue factor activity in clinical samples: A summary of two tissue factor-dependent FXa generation assays.

    PubMed

    Hisada, Yohei; Alexander, Wyeth; Kasthuri, Raj; Voorhees, Peter; Mobarrez, Fariborz; Taylor, Angela; McNamara, Coleen; Wallen, Hakan; Witkowski, Marco; Key, Nigel S; Rauch, Ursula; Mackman, Nigel

    2016-03-01

    Thrombosis is a leading cause of morbidity and mortality. Detection of a prothrombotic state using biomarkers would be of great benefit to identify patients at risk of thrombosis that would benefit from thromboprophylaxis. Tissue factor (TF) is a highly procoagulant protein that under normal conditions is not present in the blood. However, increased levels of TF in the blood in the form of microparticles (MPs) (also called extracellular vesicles) are observed under various pathological conditions. In this review, we will discuss studies that have measured MP-TF activity in a variety of diseases using two similar FXa generation assay. One of the most robust signals for MP-TF activity (16-26 fold higher than healthy controls) is observed in pancreatic cancer patients with venous thromboembolism. In this case, the TF+ MPs appear to be derived from the cancer cells. Surprisingly, cirrhosis and acute liver injury are associated with 17-fold and 38-fold increases in MP-TF activity, respectively. Based on mouse models, we speculate that the TF+ MPs are derived from hepatocytes. More modest increases are observed in patients with urinary tract infections (6-fold) and in a human endotoxemia model (9-fold) where monocytes are the likely source of the TF+ MPs. Finally, there is no increase in MP-TF activity in the majority of cardiovascular disease patients. These studies indicate that MP-TF activity may be a useful biomarker to identify patients with particular diseases that have an increased risk of thrombosis. PMID:26916302

  5. Inactivation of factor XII active fragment in normal plasma. Predominant role of C-1-inhibitor.

    PubMed

    de Agostini, A; Lijnen, H R; Pixley, R A; Colman, R W; Schapira, M

    1984-06-01

    To define the factors responsible for the inactivation of the active fragment derived from Factor XII (Factor XIIf ) in plasma, we studied the inactivation kinetics of Factor XIIf in various purified and plasma mixtures. We also analyzed the formation of 125I-Factor XIIf -inhibitor complexes by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). In purified systems, the bimolecular rate constants for the reactions of Factor XIIf with C-1-inhibitor, alpha 2-antiplasmin, and antithrombin III were 18.5, 0.91, and 0.32 X 10(4) M-1 min-1, respectively. Furthermore, SDS-PAGE analysis revealed that 1:1 stoichiometric complexes were formed between 125I-Factor XIIf and each of these three inhibitors. In contrast, kinetic and SDS-PAGE studies indicated that Factor XIIf did not react with alpha 1-antitrypsin or alpha 2-macroglobulin. The inactivation rate constant of Factor XIIf by prekallikrein-deficient plasma was 14.4 X 10(-2) min-1, a value that was essentially identical to the value predicted from the studies in purified systems (15.5 X 10(-2) min-1). This constant was reduced to 1.8 X 10(-2) min-1 when Factor XIIf was inactivated by prekallikrein-deficient plasma that had been immunodepleted (less than 5%) of C-1-inhibitor. In addition, after inactivation in normal plasma, 74% of the active 125I-Factor XIIf was found to form a complex with C-1-inhibitor, whereas 26% of the enzyme formed complexes with alpha 2-antiplasmin and antithrombin III. Furthermore, 42% of the labeled enzyme was still complexed with C-1-inhibitor when 125I-Factor XII was inactivated in hereditary angioedema plasma that contained 32% of functional C-1-inhibitor. This study quantitatively demonstrates the dominant role of C-1-inhibitor in the inactivation of Factor XIIf in the plasma milieu. PMID:6725552

  6. Activation of p38 mitogen-activated protein kinase and nuclear factor-kappaB in tumour necrosis factor-induced eotaxin release of human eosinophils

    PubMed Central

    WONG, C K; ZHANG, J P; IP, W K; LAM, C W K

    2002-01-01

    The CC chemokine eotaxin is a potent eosinophil-specific chemoattractant that is crucial for allergic inflammation. Allergen-induced tumour necrosis factor (TNF) has been shown to induce eotaxin synthesis in eosinophils. Nuclear factor-kappaB (NF-κB) and mitogen-activated protein kinases (MAPK) have been found to play an essential role for the eotaxin-mediated eosinophilia. We investigated the modulation of NF-κB and MAPK activation in TNF-induced eotaxin release of human eosinophils. Human blood eosinophils were purified from fresh buffy coat using magnetic cell sorting. NF-κB pathway-related genes were evaluated by cDNA expression array system. Degradation of IκBα and phosphorylation of MAPK were detected by Western blot. Activation of NF-κB was determined by electrophoretic mobility shift assay. Eotaxin released into the eosinophil culture medium was measured by ELISA. TNF was found to up-regulate the gene expression of NF-κB and IκBα in eosinophils. TNF-induced IκBα degradation was inhibited by the proteasome inhibitor N-cbz-Leu-Leu-leucinal (MG-132) and a non-steroidal anti-inflammatory drug sodium salicylate (NaSal). Using EMSA, both MG-132 and NaSal were found to suppress the TNF-induced NF-κB activation in eosinophils. Furthermore, TNF was shown to induce phosphorylation of p38 MAPK time-dependently but not extracellular signal-regulated kinases (ERK). Inhibition of NF-κB activation and p38 MAPK activity decreased the TNF-induced release of eotaxin from eosinophils. These results indicate that NF-κB and p38 MAPK play an important role in TNF-activated signalling pathway regulating eotaxin release by eosinophils. They have also provided a biochemical basis for the potential of using specific inhibitors of NF-κB and p38 MAPK for treating allergic inflammation. PMID:12067303

  7. Epidermal Growth Factor Receptor and PTEN Modulate Tissue Factor Expression in Glioblastoma through JunD/Activator Protein-1 Transcriptional Activity

    PubMed Central

    Rong, Yuan; Belozerov, Vladimir E.; Tucker-Burden, Carol; Chen, Gang; Durden, Donald L.; Olson, Jeffrey J.; Van Meir, Erwin G.; Mackman, Nigel; Brat, Daniel J.

    2009-01-01

    Hypoxia and necrosis are fundamental features of glioblastoma (GBM) and their emergence is critical for the rapid biological progression of this fatal tumor; yet, underlying mechanisms are poorly understood. We have suggested that vaso-occlusion following intravascular thrombosis could initiate or propagate hypoxia and necrosis in GBM. Tissue factor (TF), the main cellular initiator of coagulation, is overexpressed in GBMs and likely favors a thrombotic microenvironment. Epidermal growth factor receptor (EGFR) amplification and PTEN loss are two common genetic alterations seen in GBM but not in lower-grade astrocytomas that could be responsible for TF up-regulation. The most frequent EGFR mutation in GBM involves deletion of exons 2 to 7, resulting in the expression of a constitutively active receptor, EGFRvIII. Here, we show that overexpression of EGFR or EGFRvIII in human glioma cells causes increased basal TF expression and that stimulation of EGFR by its ligand, EGF, leads to a marked dose-dependent up-regulation of TF. In all cases, increased TF expression led to accelerated plasma coagulation in vitro. EGFR-mediated TF expression depended most strongly on activator protein-1 (AP-1) transcriptional activity and was associated with c-Jun NH2-terminal kinase (JNK) and JunD activation. Restoration of PTEN expression in PTEN-deficient GBM cells diminished EGFR-induced TF expression by inhibiting JunD/AP-1 transcriptional activity. PTEN mediated this effect by antagonizing phosphatidylinositol 3-kinase activity, which in turn attenuated both Akt and JNK activities. These mechanisms are likely at work in vivo, as EGFR expression was highly correlated with TF expression in human high-grade astrocytoma specimens. PMID:19276385

  8. The secret struggle of the active girl: a qualitative synthesis of interpersonal factors that influence physical activity in adolescent girls.

    PubMed

    Standiford, Anne

    2013-10-01

    The author conducted a systematic review of 19 international, multidisciplinary, qualitative studies of interpersonal factors that influence physical activity in adolescent girls. Themes were deductively generated based on reported findings, and were organized according to frequency of occurrence. Themes were further organized according to a theoretical model to illustrate how interpersonal, perceptual, and situational influences affect physical activity in adolescent girls. The three most frequently discovered themes follow: (a) ability comparison and competition; (b) family, peer, and teacher influence; and (c) appearance concerns. It is important to consider the influence of gender role conflict on physical activity. PMID:23790150

  9. Gastrointestinal growth factors and hormones have divergent effects on Akt activation

    PubMed Central

    Berna, Marc J.; Tapia, Jose A.; Sancho, Veronica; Thill, Michelle; Pace, Andrea; Hoffmann, K. Martin; Gonzalez-Fernandez, Lauro; Jensen, Robert T.

    2009-01-01

    Akt is a central regulator of apoptosis, cell growth and survival. Growth factors and some G-protein-coupled receptors (GPCR) regulate Akt. Whereas growth-factor activation of Akt has been extensively studied, the regulation of Akt by GPCR's, especially gastrointestinal hormones/neurotransmitters, remains unclear. To address this area, in this study the effects of GI growth factors and hormones/neurotransmitters were investigate in rat pancreatic acinar cells which are high responsive to these agents. Pancreatic acini expressed Akt and 5 of 7 known pancreatic growth-factors stimulate Akt phosphorylation (T308, S473) and translocation. These effects are mediated by p85 phosphorylation and activation of PI3K. GI hormones increasing intracellular cAMP had similar effects. However, GI-hormones/neurotransmitters[CCK, bombesin,carbachol] activating phospholipase C (PLC) inhibited basal and growth-factor-stimulated Akt activation. Detailed studies with CCK, which has both physiological and pathophysiological effects on pancreatic acinar cells at different concentrations, demonstrated CCK has a biphasic effect: at low concentrations(pM) stimulating Akt by a Src-dependent mechanism and at higher concentrations(nM) inhibited basal and stimulated Akt translocation, phosphorylation and activation, by de-phosphorylating p85 resulting in decreasing PI3K activity. This effect required activation of both limbs of the PLC-pathway and a protein tyrosine phosphatase, but was not mediated by p44/42 MAPK, Src or activation of a serine phosphatase. Akt inhibition by CCK was also found in vivo and in Panc-1 cancer cells where it inhibited serum-mediated rescue from apoptosis. These results demonstrate that GI growth factors as well as gastrointestinal hormones/neurotransmitters with different cellular basis of action can all regulate Akt phosphorylation in pancreatic acinar cells. This regulation is complex with phospholipase C agents such as CCK, because both stimulatory and inhibitory

  10. Lonomia obliqua caterpillar spicules trigger human blood coagulation via activation of factor X and prothrombin.

    PubMed

    Donato, J L; Moreno, R A; Hyslop, S; Duarte, A; Antunes, E; Le Bonniec, B F; Rendu, F; de Nucci, G

    1998-03-01

    In southern Brazil, envenomation by larvae of the moth Lonomia obliqua (Walker) may result in blood clotting factor depletion, leading to disseminated intravascular coagulation with subsequent haemorrhage and acute renal failure which may prove fatal. We have examined the effect of a crude extract of spicules from these caterpillars on in vitro hemostasis. The extract alone did not aggregate platelets and had no detectable effect on purified fibrinogen, suggesting that extract induces clot formation by triggering activation of the clotting cascade. In agreement with the presence of thrombin-mediated activity, hirudin prevented clot formation. The extract was found to activate both prothrombin and factor X, suggesting that the depletion of blood clotting factors results from the steady activation of factor X and prothrombin. Heating and diisopropylfluorophosphate abolished the procoagulant activity of the extract, indicating that the active component involved is a protein that may belong to the serine protease family of enzymes. The ability of hirudin to inhibit this coagulant activity suggests that this inhibitor could be beneficial in the treatment of patients envenomed by L. obliqua caterpillars. PMID:9531036

  11. The factor VII-activating protease (FSAP) enhances the activity of bone morphogenetic protein-2 (BMP-2).

    PubMed

    Roedel, Elfie Kathrin; Schwarz, Elisabeth; Kanse, Sandip Madhav

    2013-03-01

    Factor VII-activating protease (FSAP) is a circulating protease involved in the pathogenesis of atherosclerosis, calcification, and fibrotic processes. To understand how FSAP controls the balance of local growth factors, we have investigated its effect on the regulation of bone morphogenetic proteins (BMPs). BMP-2 is produced as a large pro-form and secreted as a mature heparin-binding growth factor after intracellular processing by pro-protein convertases (PCs). In this study, we discovered that FSAP enhances the biological activity of mature BMP-2 as well as its pro-form, as shown by osteogenic differentiation of C2C12 myoblasts. These findings were complemented by knockdown of FSAP in hepatocytes, which revealed BMP-2 processing by endogenous FSAP. N-terminal sequencing indicated that pro-BMP-2 was cleaved by FSAP at the canonical PC cleavage site, giving rise to mature BMP-2 (Arg(282)↓Gln(283)), as well as in the N-terminal heparin binding region of mature BMP-2, generating a truncated mature BMP-2 peptide (Arg(289)↓Lys(290)). Similarly, mature BMP-2 was also cleaved to a truncated peptide within its N-terminal region (Arg(289)↓Lys(290)). Plasmin exhibited a similar activity, but it was weaker compared with FSAP. Thrombin, Factor VIIa, Factor Xa, and activated protein C were not effective. These results were further supported by the observation that the mutation of the heparin binding region of BMP-2 inhibited the processing by FSAP but not by PC. Thus, the proteolysis and activation of pro-BMP-2 and mature BMP-2 by FSAP can regulate cell differentiation and calcification in vasculature and may explain why polymorphisms in the gene encoding for FSAP are related to vascular diseases. PMID:23341458

  12. Using avian radar to examine relationships among avian activity, bird strikes, and meteorological factors

    USGS Publications Warehouse

    Coates, Peter S.; Casazza, Michael L.; Halstead, Brian J.; Fleskes, Joseph P.; Laughlin, James A.

    2011-01-01

    Radar systems designed to detect avian activity at airfields are useful in understanding factors that influence the risk of bird and aircraft collisions (bird strikes). We used an avian radar system to measure avian activity at Beale Air Force Base, California, USA, during 2008 and 2009. We conducted a 2-part analysis to examine relationships among avian activity, bird strikes, and meteorological and time-dependent factors. We found that avian activity around the airfield was greater at times when bird strikes occurred than on average using a permutation resampling technique. Second, we developed generalized linear mixed models of an avian activity index (AAI). Variation in AAI was first explained by seasons that were based on average migration dates of birds at the study area. We then modeled AAI by those seasons to further explain variation by meteorological factors and daily light levels within a 24-hour period. In general, avian activity increased with decreased temperature, wind, visibility, precipitation, and increased humidity and cloud cover. These effects differed by season. For example, during the spring bird migration period, most avian activity occurred before sunrise at twilight hours on clear days with low winds, whereas during fall migration, substantial activity occurred after sunrise, and birds generally were more active at lower temperatures. We report parameter estimates (i.e., constants and coefficients) averaged across models and a relatively simple calculation for safety officers and wildlife managers to predict AAI and the relative risk of bird strike based on time, date, and meteorological values. We validated model predictability and assessed model fit. These analyses will be useful for general inference of avian activity and risk assessment efforts. Further investigation and ongoing data collection will refine these inference models and improve our understanding of factors that influence avian activity, which is necessary to inform

  13. Sex differences in social cognitive factors and physical activity in Korean college students

    PubMed Central

    Choi, Jin Yi; Chang, Ae Kyung; Choi, Eun-Ju

    2015-01-01

    [Purpose] This study examined sex differences in physical activity and social cognitive theory factors in Korean college students. [Subjects and Methods] A cross-sectional survey of 688 college students (285 men and 403 women) in Korea was conducted using a self-reported questionnaire. [Results] There was a significant difference in the level of physical activity between male and female students. The significant predictors of physical activity for male students were physical activity goals, physical activity self-efficacy, and sitting time. Meanwhile, those for female students were perceived weight, physical activity goal, physical activity outcome expectations, and sitting time. [Conclusion] Sex differences should be considered when developing interventions to increase physical activity. PMID:26180293

  14. Transcription factor activation following exposure of an intact lung preparation to metallic particulate matter.

    PubMed Central

    Samet, James M; Silbajoris, Robert; Huang, Tony; Jaspers, Ilona

    2002-01-01

    Metallic constituents contained in ambient particulate matter have been associated with adverse effects in a number of epidemiologic, in vitro, and in vivo studies. Residual oil fly ash (ROFA) is a metallic by-product of the combustion of fossil fuel oil, which has been shown to induce a variety of proinflammatory responses in lung cells. We have examined signaling pathways activated in response to ROFA exposure and recently reported that ROFA treatment activates multiple mitogen-activated protein (MAP) kinases in the rat lung. In the present study we extended our investigations on the mechanism of toxicity of ROFA to include transcription factors whose activities are regulated by MAP kinases as well as possible effectors of transcriptional changes that mediate the effects of ROFA. We applied immunohistochemical methods to detect ROFA-induced activation of nuclear factor-kappa B (NF kappa B), activating transcription factor-2 (ATF-2), c-Jun, and cAMP response element binding protein (CREB) in intact lung tissue and confirmed and characterized their functional activation using DNA binding assays. We performed these studies using a perfused rabbit lung model that is devoid of blood elements in order to distinguish between intrinsic lung cell effects and effects that are secondary to inflammatory cell influx. We report here that exposure to ROFA results in a rapid activation of all of the transcription factors studied by exerting direct effects on lung cells. These findings validate the use of immunohistochemistry to detect transcription factor activation in vivo and demonstrate the utility of studying signaling changes in response to environmental exposures. PMID:12361922

  15. Impact of detector-element active-area shape and fill factor on super-resolution

    NASA Astrophysics Data System (ADS)

    Hardie, Russell; Droege, Douglas; Dapore, Alexander; Greiner, Mark

    2015-05-01

    In many undersampled imaging systems, spatial integration from the individual detector elements is the dominant component of the system point spread function (PSF). Conventional focal plane arrays (FPAs) utilize square detector elements with a nearly 100% fill factor, where fill factor is defined as the fraction of the detector element area that is active in light detection. A large fill factor is generally considered to be desirable because more photons are collected for a given pitch, and this leads to a higher signal-to-noise-ratio (SNR). However, the large active area works against super-resolution (SR) image restoration by acting as an additional low pass filter in the overall PSF when modeled on the SR sampling grid. A high fill factor also tends to increase blurring from pixel cross-talk. In this paper, we study the impact of FPA detector-element shape and fill factor on SR. A detailed modulation transfer function analysis is provided along with a number of experimental results with both simulated data and real data acquired with a midwave infrared (MWIR) imaging system. We demonstrate the potential advantage of low fill factor detector elements when combined with SR image restoration. Our results suggest that low fill factor circular detector elements may be the best choice. New video results are presented using robust adaptive Wiener filter SR processing applied to data from a commercial MWIR imaging system with both high and low detector element fill factors.

  16. Induction of endothelial cell proliferation by angiogenic factors released by activated monocytes

    SciTech Connect

    Pakala, Rajbabu; Watanabe, Takuya; Benedict, Claude R

    2002-06-01

    Introduction: Cell-cell interaction is an essential component of atherosclerotic plaque development. Activated monocytes appear to play a central role in the development of atherosclerosis, not only through foam cell formation but also via the production of various growth factors that induce proliferation of different cell types that are involved in the plaque development. Using serum free co-culture method, we determined the effect of monocytes on endothelial cell proliferation. Methods: Endothelial cell proliferation is determined by the amount of [{sup 3}H]thymidine incorporated in to the DNA. Basic fibroblast growth factor (b-FGF), vascular endothelial growth factor (VEGF) and interleukin-8 (IL-8) levels in the conditioned medium were determined by ELISA. Results: Conditioned medium from unactivated monocytes partially inhibited endothelial cell proliferation, whereas conditioned medium from activated monocytes promoted endothelial cell proliferation. The mitogenic effect of conditioned medium derived from activated monocytes is due to the presence of b-FGF, VEGF and IL-8. Neutralizing antibodies against b-FGF, VEGF and IL-8 partially reversed the mitogenic effect of conditioned medium derived from activated monocytes. When b-FGF, VEGF and IL-8 were immunoprecipitated from conditioned medium derived from activated monocytes, it is less mitogenic to endothelial cells. Conclusion: Activated monocytes may play an important role in the development of atherosclerotic plaque by producing endothelial cell growth factors.

  17. Factors Influencing Entering Teacher Candidates' Preferences for Instructional Activities: A glimpse into their orientations towards teaching

    NASA Astrophysics Data System (ADS)

    Talanquer, Vicente; Novodvorsky, Ingrid; Tomanek, Debra

    2010-07-01

    The present study was designed to identify and characterize the major factors that influence entering science teacher candidates' preferences for different types of instructional activities, and to analyze what these factors suggest about teacher candidates' orientations towards science teaching. The study involved prospective teachers enrolled in the introductory science teaching course in an undergraduate science teacher preparation program. Our analysis was based on data collected using a teaching and learning beliefs questionnaire, together with structured interviews. Our results indicate that entering science teacher candidates have strong preferences for a few activity types. The most influential factors driving entering science teacher candidates' selections were the potential of the instructional activities to motivate students, be relevant to students' personal lives, result in transfer of skills to non-science situations, actively involve students in goal-directed learning, and implement curriculum that represents what students need to know. This set of influencing factors suggests that entering science teacher candidates' orientations towards teaching are likely driven by one or more of these three central teaching goals: (1) motivating students, (2) developing science process skills, and (3) engaging students in structured science activities. These goals, and the associated beliefs about students, teaching, and learning, can be expected to favor the development or enactment of three major orientations towards teaching in this population of future science teachers: "motivating students," "process," and "activity-driven."

  18. Factors Associated with Physical Activity among Macedonian Adolescents in Albanian Ethnic Community

    PubMed Central

    GONTAREV, Seryozha; KALAC, Ruzdija; AMETI, Vullnet; REDJEPI, Agim

    2016-01-01

    Background: The purpose of this study was to determine the relationship of demographic, psychological, social and environmental factors with physical activity and to determine whether indicators of physical activity differ by gender among Macedonian adolescents from Albanian ethnic community from 11 to 14 yr (N = 886). Methods: Research were conducted in 2014 in several primary schools randomly selected from Tetovo and Gostivar region of the R. Macedonia. Students completed a questionnaire which examined their level of participation in physical activity and sedentary behavior along with a number of potential correlates. Hierarchical regression was used to explore the relationship between hypothesised factors and physical activity. Results: The boys unlike the girls showed significantly higher levels of physical activity (P=0.001). Respondents of both genders who perceive greater benefits from the physical activity (P=0.010). They have more confidence in their abilities (P=0.001), enjoy more in the physical activities (P=0.016), perceive greater social support from friends (P=0.008) and parents (P=0.001) and have higher levels of physical activity. Conclusions: The results indicate the importance of developing a national plan and program to promote physical activity in order to help young people to change unhealthy lifestyle habits and increase the physical activity, thus improving their health. PMID:27252917

  19. Factors Associated with Nursing Activities in Humanitarian Aid and Disaster Relief

    PubMed Central

    Noguchi, Norihito; Inoue, Satoshi; Shimanoe, Chisato; Shibayama, Kaoru; Shinchi, Koichi

    2016-01-01

    Background Although nurses play an important role in humanitarian aid and disaster relief (HA/DR), little is known about the nursing activities that are performed in HA/DR. We aimed to clarify the nursing activities performed by Japanese nurses in HA/DR and to examine the factors associated with the frequency of nursing activities. Methods A self-administered questionnaire survey was completed by 147 nurses with HA/DR experience. The survey extracted information on demographic characteristics, past experience (e.g., disaster medical training experience, HA/DR experience), circumstances surrounding their dispatched to HA/DR (e.g., team size, disaster type, post-disaster phase, mission term), and the frequency of nursing activities performed under HA/DR. The frequency of nursing activities was rated on a 5-point Likert scale. Evaluation of nursing activities was conducted based on the “nursing activity score”, which represents the frequency of each nursing activity. Factors related to the nursing activity score were evaluated by multiple logistic regression analysis. Results Nurses were involved in 27 nursing activities in HA/DR, 10 of which were performed frequently. On analysis, factors significantly associated with nursing activity score were nursing license as a registered nurse (OR 7.79, 95% CI 2.95–20.57), two or more experiences with disaster medical training (OR 2.90 95%, CI 1.12–7.49) and a post-disaster phase of three weeks or longer (OR 8.77, 95% CI 2.59–29.67). Conclusions These results will contribute to the design of evidence-based disaster medical training that improves the quality of nursing activities. PMID:26959351

  20. Fas-Induced Apoptosis Increases Hepatocyte Tissue Factor Procoagulant Activity In Vitro and In Vivo

    PubMed Central

    Lopez, Michelle; Kopec, Anna K.; Joshi, Nikita; Geddings, Julia E.; Cline, Holly; Towery, Keara L.; Rockwell, Cheryl E.; Mackman, Nigel; Luyendyk, James P.

    2014-01-01

    Hepatocyte (HPC) apoptosis occurs in association with hepatotoxic responses and chronic liver disease, and is coupled to activation of the blood coagulation cascade. HPCs have been shown to express tissue factor (TF), the primary activator of blood coagulation, in a form that lacks procoagulant activity. In this study, we determined the effect of inducing HPC apoptosis on the procoagulant activity of TF. Treatment of primary mouse HPCs with the Fas death receptor agonist (anti-CD95 antibody, Jo2) triggered apoptosis as shown by cleavage of caspase-3, increased caspase-3 proteolytic activity, and cell surface exposure of phosphatidylserine (PS). Jo2-induced apoptosis significantly increased TF-dependent factor Xa generation by HPCs. Moreover, Jo2 treatment was associated with increased levels of microparticle-associated TF procoagulant activity in the culture medium. Pretreatment with a caspase-3 inhibitor significantly reduced Jo2-induced HPC TF activity and prevented the increase in microparticle-associated TF procoagulant activity. Application of the high-affinity PS-binding protein lactadherin inhibited TF-dependent factor Xa generation by Jo2-treated HPCs and dramatically reduced microparticle-associated TF procoagulant activity. Treatment of wild-type mice with a sublethal dose of Jo2 was associated with a robust increase in the activation of coagulation as measured by plasma thrombin-antithrombin (TAT) levels; whereas mice with liver-specific TF deficiency had significantly lower TAT levels. Overall, the results indicate that Fas-initiated, caspase-3-dependent HPC apoptosis increases TF procoagulant activity through a mechanism involving PS externalization. This suggests that activation of liver TF likely contributes to the procoagulant state associated with HPC apoptosis in liver toxicity and disease. PMID:25015658

  1. Coagulation Factor X Activates Innate Immunity to Human Species C Adenovirus

    PubMed Central

    Doronin, Konstantin; Flatt, Justin W.; Di Paolo, Nelson C.; Khare, Reeti; Kalyuzhniy, Oleksandr; Acchione, Mauro; Sumida, John P.; Ohto, Umeharu; Shimizu, Toshiyuki; Akashi-Takamura, Sachiko; Miyake, Kensuke; MacDonald, James W.; Bammler, Theo K.; Beyer, Richard P.; Farin, Frederico M.; Stewart, Phoebe L.; Shayakhmetov, Dmitry M.

    2016-01-01

    Although coagulation factors play a role in host defense for “living fossils” such as horseshoe crabs, the role of the coagulation system in immunity in higher organisms remains unclear. We modeled the interface of human species C adenovirus (HAdv) interaction with coagulation factor X (FX) and introduced a mutation that abrogated formation of the HAdv-FX complex. In vivo genome-wide transcriptional profiling revealed that FX-binding–ablated virus failed to activate a distinct network of nuclear factor κB–dependent early-response genes that are activated by HAdv-FX complex downstream of TLR4/MyD88/TRIF/TRAF6 signaling. Our study implicates host factor “decoration” of the virus as a mechanism to trigger an innate immune sensor that responds to a misplacement of coagulation FX from the blood into intracellular macrophage compartments upon virus entry into the cell. PMID:23019612

  2. Coagulation factor X activates innate immunity to human species C adenovirus.

    PubMed

    Doronin, Konstantin; Flatt, Justin W; Di Paolo, Nelson C; Khare, Reeti; Kalyuzhniy, Oleksandr; Acchione, Mauro; Sumida, John P; Ohto, Umeharu; Shimizu, Toshiyuki; Akashi-Takamura, Sachiko; Miyake, Kensuke; MacDonald, James W; Bammler, Theo K; Beyer, Richard P; Farin, Frederico M; Stewart, Phoebe L; Shayakhmetov, Dmitry M

    2012-11-01

    Although coagulation factors play a role in host defense for "living fossils" such as horseshoe crabs, the role of the coagulation system in immunity in higher organisms remains unclear. We modeled the interface of human species C adenovirus (HAdv) interaction with coagulation factor X (FX) and introduced a mutation that abrogated formation of the HAdv-FX complex. In vivo genome-wide transcriptional profiling revealed that FX-binding-ablated virus failed to activate a distinct network of nuclear factor κB-dependent early-response genes that are activated by HAdv-FX complex downstream of TLR4/MyD88/TRIF/TRAF6 signaling. Our study implicates host factor "decoration" of the virus as a mechanism to trigger an innate immune sensor that responds to a misplacement of coagulation FX from the blood into intracellular macrophage compartments upon virus entry into the cell. PMID:23019612

  3. Overexpression of gankyrin in mouse hepatocytes induces hemangioma by suppressing factor inhibiting hypoxia-inducible factor-1 (FIH-1) and activating hypoxia-inducible factor-1.

    PubMed

    Liu, Yu; Higashitsuji, Hiroaki; Higashitsuji, Hisako; Itoh, Katsuhiko; Sakurai, Toshiharu; Koike, Kazuhiko; Hirota, Kiichi; Fukumoto, Manabu; Fujita, Jun

    2013-03-01

    Gankyrin (also called p28 or PSMD10) is an oncoprotein commonly overexpressed in hepatocellular carcinomas. It consists of 7 ankyrin repeats and interacts with multiple proteins including Rb, Cdk4, MDM2 and NF-κB. To assess the oncogenic activity in vivo, we produced transgenic mice that overexpress gankyrin specifically in the hepatocytes. Unexpectedly, 5 of 7 F2 transgenic mice overexpressing hepatitis B virus X protein (HBX) promoter-driven gankyrin, and one of 3 founder mice overexpressing serum amyloid P component (SAP) promoter-driven gankyrin developed hepatic vascular neoplasms (hemangioma/hemangiosarcomas) whereas none of the wild-type mice did. Endothelial overgrowth was more frequent in the livers of diethylnitrosamine-treated transgenic mice than wild-type mice. Mouse hepatoma Hepa1-6 cells overexpressing gankyrin formed tumors with more vascularity than parental Hepa1-6 cells in the transplanted mouse skin. We found that gankyrin binds to and sequester factor inhibiting hypoxia-inducible factor-1 (FIH-1), which results in decreased interaction between FIH-1 and hypoxia-inducible factor-1α (HIF-1α) and increased activity of HIF-1 to promote VEGF production. The effects of gankyrin were more prominent under 3% O2 than 1% or 20% O2 conditions. Thus, the present study clarified, at least partly, mechanisms of vascular tumorigenesis, and suggests that gankyrin might play a physiological role in hypoxic responses besides its roles as an oncoprotein. PMID:23376718

  4. Membrane-To-Nucleus Signaling Links Insulin-Like Growth Factor-1- and Stem Cell Factor-Activated Pathways

    PubMed Central

    Hayashi, Yujiro; Asuzu, David T.; Gibbons, Simon J.; Aarsvold, Kirsten H.; Bardsley, Michael R.; Lomberk, Gwen A.; Mathison, Angela J.; Kendrick, Michael L.; Shen, K. Robert; Taguchi, Takahiro; Gupta, Anu; Rubin, Brian P.; Fletcher, Jonathan A.; Farrugia, Gianrico; Urrutia, Raul A.; Ordog, Tamas

    2013-01-01

    Stem cell factor (mouse: Kitl, human: KITLG) and insulin-like growth factor-1 (IGF1), acting via KIT and IGF1 receptor (IGF1R), respectively, are critical for the development and integrity of several tissues. Autocrine/paracrine KITLG-KIT and IGF1-IGF1R signaling are also activated in several cancers including gastrointestinal stromal tumors (GIST), the most common sarcoma. In murine gastric muscles, IGF1 promotes Kitl-dependent development of interstitial cells of Cajal (ICC), the non-neoplastic counterpart of GIST, suggesting cooperation between these pathways. Here, we report a novel mechanism linking IGF1-IGF1R and KITLG-KIT signaling in both normal and neoplastic cells. In murine gastric muscles, the microenvironment for ICC and GIST, human hepatic stellate cells (LX-2), a model for cancer niches, and GIST cells, IGF1 stimulated Kitl/KITLG protein and mRNA expression and promoter activity by activating several signaling pathways including AKT-mediated glycogen synthase kinase-3β inhibition (GSK3i). GSK3i alone also stimulated Kitl/KITLG expression without activating mitogenic pathways. Both IGF1 and GSK3i induced chromatin-level changes favoring transcriptional activation at the Kitl promoter including increased histone H3/H4 acetylation and H3 lysine (K) 4 methylation, reduced H3K9 and H3K27 methylation and reduced occupancy by the H3K27 methyltransferase EZH2. By pharmacological or RNA interference-mediated inhibition of chromatin modifiers we demonstrated that these changes have the predicted impact on KITLG expression. KITLG knock-down and immunoneutralization inhibited the proliferation of GIST cells expressing wild-type KIT, signifying oncogenic autocrine/paracrine KITLG-KIT signaling. We conclude that membrane-to-nucleus signaling involving GSK3i establishes a previously unrecognized link between the IGF1-IGF1R and KITLG-KIT pathways, which is active in both physiologic and oncogenic contexts and can be exploited for therapeutic purposes. PMID:24116170

  5. Sociodemographic and behavioral factors associated with physical activity in Brazilian adolescents

    PubMed Central

    2014-01-01

    Background Physical activity in adolescents is associated with short- and long-term health benefits. Physical activity can occur in various domains and is influenced by a complex network of factors. The aims of this study are 1) to describe the physical activity of Brazilian adolescents in physical education classes, during leisure time, and during active commuting and 2) to investigate the socio-demographic and behavioral factors associated with physical activity. Methods The representative sample included 109,104 Brazilian students in the final year of elementary school from 2,842 schools. The weekly frequency and duration of physical activity were assessed. A variety of socio-demographic and behavioral factors were studied. A multiple Poisson regression analysis was used to test for associations between physical activity and the socio-demographic and behavioral variables. Results Most of the students (97.0%) engaged in physical activity in at least one of the domains studied, especially physical education at school (81.7%) and leisure time physical activity (67.5%). However, only 29% of the adolescents reached the recommended level of physical activity. Among the adolescents who reached the minimum recommended time for physical activity, the various domains contributed the following proportions to total physical activity: leisure time physical activity (PR 12.5; 95% CI 11.17-13.97), active commuting (PR 1.63; 95% CI 1.59-1.67), and physical education at school (PR 1.36; 95% CI 1.29-1.44). The weekly frequency of all activities was greater among boys than among girls. Moreover, nearly two-thirds (61.8%) of students spent more than two hours per day engaging in sedentary behaviors; the prevalence of sedentary behaviors was similar between boys and girls (59.0 and 64.5%, respectively). Total level of physical activity, leisure time physical activity, and active commuting were associated with higher nutritional scores. Conclusions Physical activity is important in

  6. A human factors analysis of ADL activities: a capability-demand approach.

    PubMed

    Czaja, S J; Weber, R A; Nair, S N

    1993-09-01

    Older adults frequently encounter difficulties performing daily living activities. Often times these difficulties arise because environmental demands create barriers which hinder task performance. Currently, there is little empirical data that relate environmental demands to functional capabilities of older adults. The concepts and methods of Human Factors Engineering can be used to accomplish this goal. Human Factors views task performance within a systems context and maintains that successful task performance is dependent on a match between task demands and human capabilities. This article will discuss how Human Factors methodologies can be used to analyze problems encountered by older adults performing routine activities. Data from a study concerned with identifying physiological demands associated with personal and instrumental activities of daily living will be used to demonstrate the utility of using this approach. PMID:8409240

  7. An Archaeal Homolog of Proteasome Assembly Factor Functions as a Proteasome Activator

    PubMed Central

    Kumoi, Kentaro; Satoh, Tadashi; Murata, Kazuyoshi; Hiromoto, Takeshi; Mizushima, Tsunehiro; Kamiya, Yukiko; Noda, Masanori; Uchiyama, Susumu; Yagi, Hirokazu; Kato, Koichi

    2013-01-01

    Assembly of the eukaryotic 20S proteasome is an ordered process involving several proteins operating as proteasome assembly factors including PAC1-PAC2 but archaeal 20S proteasome subunits can spontaneously assemble into an active cylindrical architecture. Recent bioinformatic analysis identified archaeal PAC1-PAC2 homologs PbaA and PbaB. However, it remains unclear whether such assembly factor-like proteins play an indispensable role in orchestration of proteasome subunits in archaea. We revealed that PbaB forms a homotetramer and exerts a dual function as an ATP-independent proteasome activator and a molecular chaperone through its tentacle-like C-terminal segments. Our findings provide insights into molecular evolution relationships between proteasome activators and assembly factors. PMID:23555947

  8. Sequencing of LRP2 reveals multiple rare variants associated with urinary trefoil factor-3.

    PubMed

    McMahon, Gearoid M; Olden, Matthias; Garnaas, Maija; Yang, Qiong; Liu, Xuan; Hwang, Shih-Jen; Larson, Martin G; Goessling, Wolfram; Fox, Caroline S

    2014-12-01

    Novel biomarkers are being investigated to identify patients with kidney disease. We measured a panel of 13 urinary biomarkers in participants from the Offspring Cohort of the Framingham Heart Study. Using an Affymetrix chip with imputation to 2.5 M single-nucleotide polymorphisms (SNPs), we conducted a GWAS of these biomarkers (n=2640) followed by exonic sequencing and genotyping. Functional studies in zebrafish were used to investigate histologic correlation with renal function. Across all 13 biomarkers, there were 97 significant SNPs at three loci. Lead SNPs at each locus were rs6555820 (P=6.7×10(-49); minor allele frequency [MAF]=0.49) in HAVCR1 (associated with kidney injury molecule-1), rs7565788 (P=2.15×10(-16); MAF=0.22) in LRP2 (associated with trefoil factor 3 [TFF3]), and rs11048230 (P=4.77×10(-8); MAF=0.10) in an intergenic region near RASSF8 (associated with vascular endothelial growth factor). Validation in the CKDGen Consortium (n=67,093) showed that only rs7565788 at LRP2, which encodes megalin, was associated with eGFR (P=0.003). Sequencing of exons 16-72 of LRP2 in 200 unrelated individuals at extremes of urinary TFF3 levels identified 197 variants (152 rare; MAF<0.05), 31 of which (27 rare) were nonsynonymous. In aggregate testing, rare variants were associated with urinary TFF3 levels (P=0.003), and the lead GWAS signal was not explained by these variants. Knockdown of LRP2 in zebrafish did not alter the renal phenotype in static or kidney injury models. In conclusion, this study revealed common variants associated with urinary levels of TFF3, kidney injury molecule-1, and vascular endothelial growth factor and identified a cluster of rare variants independently associated with TFF3. PMID:24876117

  9. [Conception for permanent activation of nuclear factor kbeta as molecular basis for metabolic syndrom pathogenesis].

    PubMed

    Kaidashev, I P

    2013-01-01

    The analysis of new data concerning the development of pathology due to the community of evolutionary new pathological factors was done. Author provides the comparison of well-known and new definition for "metabolic syndrome" and diagnostic criteria of this pathology. The conception for permanent activation of nuclear factor kbeta as possible typic pathological process was discussed. Suppose that NF-kbeta is the possible key molecule in the initiation and formation of "vicious circle"--insulinresistance--inflammation--atherosclerosis. PMID:24340624

  10. Human factors activities in teleoperator development at the Oak Ridge National Laboratory

    SciTech Connect

    Draper, J.V.; Herndon, J.N.

    1986-01-01

    The Consolidated Fuel Reprocessing Program (CFRP) at the Oak Ridge National Laboratory is developing advanced teleoperator systems for maintenance of future nuclear reprocessing facilities. Remote maintenance systems developed by the CFRP emphasize man-in-the-loop teleoperation. Consequently, human factors issues which affect teleoperator performance must be addressed. This papers surveys research and development activities carried out by the human factors group within the Remote Control Engineering Task of the CFRP.

  11. SU-D-204-05: Quantitative Comparison of a High Resolution Micro-Angiographic Fluoroscopic (MAF) Detector with a Standard Flat Panel Detector (FPD) Using the New Metric of Generalized Measured Relative Object Detectability (GM-ROD)

    SciTech Connect

    Russ, M; Ionita, C; Bednarek, D; Rudin, S

    2015-06-15

    Purpose: In endovascular image-guided neuro-interventions, visualization of fine detail is paramount. For example, the ability of the interventionist to visualize the stent struts depends heavily on the x-ray imaging detector performance. Methods: A study to examine the relative performance of the high resolution MAF-CMOS (pixel size 75µm, Nyquist frequency 6.6 cycles/mm) and a standard Flat Panel Detector (pixel size 194µm, Nyquist frequency 2.5 cycles/mm) detectors in imaging a neuro stent was done using the Generalized Measured Relative Object Detectability (GM-ROD) metric. Low quantum noise images of a deployed stent were obtained by averaging 95 frames obtained by both detectors without changing other exposure or geometric parameters. The square of the Fourier transform of each image is taken and divided by the generalized normalized noise power spectrum to give an effective measured task-specific signal-to-noise ratio. This expression is then integrated from 0 to each of the detector’s Nyquist frequencies, and the GM-ROD value is determined by taking a ratio of the integrals for the MAF-CMOS to that of the FPD. The lower bound of integration can be varied to emphasize high frequencies in the detector comparisons. Results: The MAF-CMOS detector exhibits vastly superior performance over the FPD when integrating over all frequencies, yielding a GM-ROD value of 63.1. The lower bound of integration was stepped up in increments of 0.5 cycles/mm for higher frequency comparisons. As the lower bound increased, the GM-ROD value was augmented, reflecting the superior performance of the MAF-CMOS in the high frequency regime. Conclusion: GM-ROD is a versatile metric that can provide quantitative detector and task dependent comparisons that can be used as a basis for detector selection. Supported by NIH Grant: 2R01EB002873 and an equipment grant from Toshiba Medical Systems Corporation.

  12. Involvement of activator protein 1 complexes in the epithelium-specific activation of the laminin gamma2-chain gene promoter by hepatocyte growth factor (scatter factor).

    PubMed Central

    Olsen, J; Lefebvre, O; Fritsch, C; Troelsen, J T; Orian-Rousseau, V; Kedinger, M; Simon-Assmann, P

    2000-01-01

    Laminin-5 is a trimer of laminin alpha3, beta3 and gamma2 chains that is found in the intestinal basement membrane. Deposition of the laminin gamma2 chain at the basement membrane is of great interest because it undergoes a developmental shift in its cellular expression. Here we study the regulatory elements that control basal and cytokine-activated transcriptional expression of the LAMC2 gene, which encodes the laminin gamma2 chain. By using transient transfection experiments we demonstrated the presence of constitutive and cytokine-responsive cis-elements. Comparison of the transcriptional activity of the LAMC2 promoter in the epithelial HT29mtx cells with that in small-intestinal fibroblastic cells (C20 cells) led us to conclude that two regions with constitutive epithelium-specific activity are present between positions -1.2 and -0.12 kb. This was further validated by transfections of primary foetal intestinal endoderm and mesenchyme. A 2.5 kb portion of the LAMC2 5' flanking region was equally responsive to PMA and hepatocyte growth factor (HGF), whereas it was less responsive to transforming growth factor beta1. A minimal promoter limited to the initial 120 bp upstream of the transcriptional start site maintained inducibility by PMA and HGF. This short promoter fragment contains two activator protein 1 (AP-1) elements and the 5'-most of these is a composite AP-1/Sp1 element. The 5'AP-1 element is crucial to the HGF-mediated activity of the promoter; analysis of interacting nuclear proteins demonstrated that AP-1 proteins containing JunD mediate the response to HGF. PMID:10749670

  13. RNA helicase A activity is inhibited by oncogenic transcription factor EWS-FLI1

    PubMed Central

    Erkizan, Hayriye Verda; Schneider, Jeffrey A.; Sajwan, Kamal; Graham, Garrett T.; Griffin, Brittany; Chasovskikh, Sergey; Youbi, Sarah E.; Kallarakal, Abraham; Chruszcz, Maksymilian; Padmanabhan, Radhakrishnan; Casey, John L.; Üren, Aykut; Toretsky, Jeffrey A.

    2015-01-01

    RNA helicases impact RNA structure and metabolism from transcription through translation, in part through protein interactions with transcription factors. However, there is limited knowledge on the role of transcription factor influence upon helicase activity. RNA helicase A (RHA) is a DExH-box RNA helicase that plays multiple roles in cellular biology, some functions requiring its activity as a helicase while others as a protein scaffold. The oncogenic transcription factor EWS-FLI1 requires RHA to enable Ewing sarcoma (ES) oncogenesis and growth; a small molecule, YK-4-279 disrupts this complex in cells. Our current study investigates the effect of EWS-FLI1 upon RHA helicase activity. We found that EWS-FLI1 reduces RHA helicase activity in a dose-dependent manner without affecting intrinsic ATPase activity; however, the RHA kinetics indicated a complex model. Using separated enantiomers, only (S)-YK-4-279 reverses the EWS-FLI1 inhibition of RHA helicase activity. We report a novel RNA binding property of EWS-FLI1 leading us to discover that YK-4-279 inhibition of RHA binding to EWS-FLI1 altered the RNA binding profile of both proteins. We conclude that EWS-FLI1 modulates RHA helicase activity causing changes in overall transcriptome processing. These findings could lead to both enhanced understanding of oncogenesis and provide targets for therapy. PMID:25564528

  14. Impaired Macrophage Migration Inhibitory Factor (MIF)-AMPK Activation and Ischemic Recovery in the Senescent Heart

    PubMed Central

    Ma, Heng; Wang, Jingying; Thomas, D Paul; Tong, Chao; Leng, Lin; Wang, Wenkui; Merk, Melanie; Zierow, Swen; Bernhagen, Jürgen; Ren, Jun; Bucala, Richard; Li, Ji

    2010-01-01

    Background Elderly patients are more sensitive to myocardial ischemia, which results in higher mortality. We investigated how aging impacts the cardioprotective AMP-activated protein kinase (AMPK) signaling pathway. Methods and Results Ischemic AMPK activation was impaired in aged compared to young murine hearts. The expression and secretion of the AMPK upstream regulator, macrophage migration inhibitory factor (MIF), were lower in aged compared to young adult hearts. Additionally, the levels of hypoxia-inducible factor 1α (HIF-1α), a known transcriptional activator of MIF, were reduced in aged compared to young hearts. Ischemia-induced AMPK activation in MIF knock-out (MIF KO) mice was blunted, leading to greater contractile dysfunction in MIF-deficient than in wild type (WT) hearts. Furthermore, intra-myocardial injection of adenovirus encoding MIF (Adv-MIF) in aged mice increased MIF expression and ischemic AMPK activation, and reduced infarct size. Conclusions An impaired MIF-AMPK activation response in senescence thus may be attributed to an aging-associated defect in the transcription factor for MIF, HIF-1α. In the clinical setting, impaired cardiac HIF-1α activation and consequent reduced MIF expression may play an important role in the increased susceptibility to myocardial ischemia observed in older cardiac patients. PMID:20606117

  15. Inhibition by CāINH of Hageman Factor Fragment Activation of Coagulation, Fibrinolysis, and Kinin Generation

    PubMed Central

    Schreiber, Alan D.; Kaplan, Allen P.; Austen, K. Frank

    1973-01-01

    Highly purified inhibitor of the first component of complement (CāINH) was shown to inhibit the capacity of active Hageman factor fragments to initiate kinin generation, fibrinolysis, and coagulation. The inhibition of prealbumin Hageman factor fragments observed was dependent upon the time of interaction of the fragments with CāINH and not to an effect upon kallikrein or plasmin generated. The inhibition of the coagulant activity of the intermediate sized Hageman factor fragment by CāINH was not due to an effect on PTA or other clotting factors. The inhibition by CāINH of both the prealbumin and intermediate sized Hageman factor fragments occurred in a dose response fashion. The CāINH did not appear to be consumed when the activity of the Hageman factor fragments was blocked, although the fragments themselves could no longer be recovered functionally or as a protein on alkaline disc gel electrophoretic analysis. These results suggest that the CāINH may have an enzymatic effect on the fragments or that an additional site on CāINH is involved in Cā inactivation. Images PMID:4703226

  16. Choline Acetyltransferase Activity in Striatum of Neonatal Rats Increased by Nerve Growth Factor

    NASA Astrophysics Data System (ADS)

    Mobley, William C.; Rutkowski, J. Lynn; Tennekoon, Gihan I.; Buchanan, Karen; Johnston, Michael V.

    1985-07-01

    Some neurodegenerative disorders may be caused by abnormal synthesis or utilization of trophic molecules required to support neuronal survival. A test of this hypothesis requires that trophic agents specific for the affected neurons be identified. Cholinergic neurons in the corpus striatum of neonatal rats were found to respond to intracerebroventricular administration of nerve growth factor with prominent, dose-dependent, selective increases in choline acetyltransferase activity. Cholinergic neurons in the basal forebrain also respond to nerve growth factor in this way. These actions of nerve growth factor may indicate its involvement in the normal function of forebrain cholinergic neurons as well as in neurodegenerative disorders involving such cells.

  17. Influence of liver disease and environmental factors on hepatic monooxygenase activity in vitro.

    PubMed

    Brodie, M J; Boobis, A R; Bulpitt, C J; Davies, D S

    1981-01-01

    The effects of liver disease and environmental factors on hepatic microsomal cytochrome P-450 content, NADPH-cytochrome c reductase (reductase) activity and aryl hydrocarbon hydroxylase (AHH) activity have been simultaneously investigated in 70 patients undergoing diagnostic liver biopsy. The activity of reductase was not significantly affected by the presence of liver disease or any of the environmental factors studied. Cytochrome P-450 content decreased with increasing severity of liver disease whereas AHH activity was only significantly reduced in biopsies showing hepatocellular destruction. None of the parameters of monooxygenase activity varied significantly with the age or sex of the patients. Alcohol excess was associated with decreased cytochrome P-450 content and AHH activity and this effect was independent of the histological status of the biopsy. Both high caffeine intake and cigarette smoking increased AHH activity in the absence of any change in cytochrome P-450 content. There was a positive correlation between the number of meat meals eaten per week and cytochrome P-450 content. Chronic treatment with enzyme-inducing anticonvulsants appeared to increase both cytochrome P-450 content and AHH activity. Despite differential effects of liver disease and environmental influences on cytochrome P-450 content and AHH activity there was a highly significant correlation between the two parameters. The results of the present study correlate well with the known effects of disease and environment on drug metabolism in vivo. PMID:7308271

  18. Tumour necrosis factor (TNF) as a mediator of macrophage helminthotoxic activity.

    PubMed

    James, S L; Glaven, J; Goldenberg, S; Meltzer, M S; Pearce, E

    1990-01-01

    Lymphokine-activated macrophages are cytotoxic for larvae of the helminth parasite Schistosoma mansoni. That soluble secreted factors may mediate this cytotoxicity was suggested by the observation that culture supernatant fluids from stimulated macrophages also exhibited larvacidal activity. These fluids contain the monokine tumour necrosis factor (TNF). Several observations indicated that TNF is directly toxic to schistosome larvae. Cytotoxic sera taken from BCG- or S. mansoni-immunized mice after endotoxin challenge killed schistosomula in vitro, and upon gel filtration the larvacidal factor(s) in the sera co-eluted with the tumoricidal activity defined as TNF. Recombinant-derived TNF exhibited direct toxicity to schistosomula at high concentrations, or at lower concentrations in the presence of IFN gamma. The larvacidal activity of macrophage supernatant fluids was abrogated by addition of either anti-TNF antisera or Zn+2, which has been shown to inhibit TNF-induced damage of tumour cells. Anti-TNF and Zn+2 likewise suppressed schistosomulum killing by lymphokine-activated peritoneal macrophages or the IC-21 macrophage line, indicating that TNF also plays a role in the effector mechanism of larval killing by whole cells. PMID:2314921

  19. Nuclear Factor of Activated T-cells (NFAT) plays a role in SV40 infection

    PubMed Central

    Manley, Kate; O’Hara, Bethany A; Atwood, Walter J

    2008-01-01

    Recent evidence highlighted a role for the transcription factor, Nuclear Factor of Activated T-cells (NFAT), in the transcription of the human polyomavirus JCV. Here we show that NFAT is also important in the transcriptional control of the related polyomavirus, Simian Virus 40 (SV40). Inhibition of NFAT activity reduced SV40 infection of Vero, 293A and HeLa cells, and this block occurred at the stage of viral transcription. Both NFAT3 and NFAT4 bound to the SV40 promoter through κB sites located within the 72bp repeated enhancer region. In Vero cells NFAT was involved in late transcription, but in HeLa and 293A cells both early and late viral transcription required NFAT activity. SV40 large T-Ag was found to increase NFAT activity and provided a positive feedback loop to transactivate the SV40 promoter. PMID:18031784

  20. Nuclear factor of activated T-cells (NFAT) plays a role in SV40 infection

    SciTech Connect

    Manley, Kate; O'Hara, Bethany A.; Atwood, Walter J.

    2008-03-01

    Recent evidence highlighted a role for the transcription factor, nuclear factor of activated T-cells (NFAT), in the transcription of the human polyomavirus JCV. Here we show that NFAT is also important in the transcriptional control of the related polyomavirus, Simian Virus 40 (SV40). Inhibition of NFAT activity reduced SV40 infection of Vero, 293A, and HeLa cells, and this block occurred at the stage of viral transcription. Both NFAT3 and NFAT4 bound to the SV40 promoter through {kappa}B sites located within the 72 bp repeated enhancer region. In Vero cells, NFAT was involved in late transcription, but in HeLa and 293A cells both early and late viral transcription required NFAT activity. SV40 large T-Ag was found to increase NFAT activity and provided a positive feedback loop to transactivate the SV40 promoter.

  1. Analysis of the restricting factors of laser countermeasure active detection technology

    NASA Astrophysics Data System (ADS)

    Zhang, Yufa; Sun, Xiaoquan

    2016-07-01

    The detection effect of laser active detection system is affected by various kinds of factors. In view of the application requirement of laser active detection, the influence factors for laser active detection are analyzed. The mathematical model of cat eye target detection distance has been built, influence of the parameters of laser detection system and the environment on detection range and the detection efficiency are analyzed. Various parameters constraint detection performance is simulated. The results show that the discovery distance of laser active detection is affected by the laser divergence angle, the incident angle and the visibility of the atmosphere. For a given detection range, the laser divergence angle and the detection efficiency are mutually restricted. Therefore, in view of specific application environment, it is necessary to select appropriate laser detection parameters to achieve optimal detection effect.

  2. Activation of AMP-activated kinase modulates sensitivity of glioma cells against epidermal growth factor receptor inhibition.

    PubMed

    Hartel, Ines; Ronellenfitsch, Michael; Wanka, Christina; Wolking, Stefan; Steinbach, Joachim P; Rieger, Johannes

    2016-07-01

    The epidermal growth factor (EGFR) pathway is frequently activated in glioblastoma but the clinical efficacy of EGFR inhibitors in malignant glioma has been disappointing. The reasons for the failure of the mechanisms of resistance of these inhibitors are unclear, but may involve factors of the tumor microenvironment such as limited glucose availability and hypoxia. It was therefore examined whether glucose and oxygen influenced the response of glioma cells to EGFR inhibition. Decreased levels of glucose and oxygen led to resistance against the EGFR inhibitor PD153035, whereas high glucose amounts and normoxia sensitised glioma cells towards the inhibitor. Low levels of glucose and oxygen stimulated AMP-activated kinase (AMPK) in glioma cells. 2DG, an inhibitor of glycolysis, and the AMPK activator A769662 reduced glucose consumption, induced phosphorylation of AMPK and mimicked the effects of low glucose availability on the toxicity of PD153035. Similarly, 2DG reduced toxicity of imatinib in K562 leukemia cells. In contrast, inhibition of AMPK by compound C or by short-hairpin (sh)-mediated gene suppression increased cell death induced by the EGFR inhibitor and reverted the protective effects of 2DG and A769662. In conclusion, cytotoxicity of EGFR inhibition can be diminished by AMPK activation in glioma cells. These results may provide one explanation for the low activity of EGFR inhibitors in clinical trials and suggest antagonism of AMPK or of AMPK-regulated metabolic alterations as a promising approach to enhance their therapeutic efficacy. PMID:27121290

  3. Competitive-Protein Adsorption in Contact Activation of Blood Factor XII

    PubMed Central

    Zhuo, Rui; Siedlecki, Christopher A.; Vogler, Erwin A.

    2009-01-01

    Contact activation of blood factor XII (FXII, Hageman factor) is moderated by the protein composition of the fluid phase in which FXII is dissolved. Solution yield of FXIIa arising from FXII contact with hydrophilic activating particles (fully-water-wettable glass) suspended in a protein cocktail is shown to be significantly greater than that obtained under corresponding activation conditions in buffer solutions containing only FXII. By contrast, solution yield of FXIIa arising from FXII contact with hydrophobic particles (silanized glass) suspended in protein cocktail is sharply lower than obtained in buffer. This confirms that contact activation is not specific to anionic hydrophilic surfaces as proposed by the accepted biochemistry of surface activation. Rather, contact activation in the presence of proteins unrelated to the plasma coagulation cascade leads to an apparent specificity for hydrophilic surfaces that is actually due to a relative diminution of activation at hydrophobic surfaces and an enhancement at hydrophilic surfaces. Furthermore, the rate of FXIIa accumulation in whole-plasma and buffer solution is found to decrease with time in the continuous presence of activating surfaces, leading to a steady-state FXIIa yield dependent on the initial FXII solution concentration for both hydrophilic and hydrophobic procoagulant particles suspended in either plasma, protein cocktail, or buffer. These results strongly suggest that activation competes with an autoinhibition reaction in which FXIIa itself inhibits FXII→FXIIa. Experimental results are modeled using a reaction scheme invoking FXII activation and autoinhibition linked to protein adsorption to procoagulant surfaces, where FXII activation is presumed to proceed by either autoactivation ( FXII→surfaceFXIIa) and autohydrolysis ( FXII→FXIIa2FXIIa) in buffer solution or autoactivation and reciprocal activation (kallikrein mediated hydrolysis) in plasma. FXII adsorption competition with other

  4. Specific induction of endogenous viral restriction factors using CRISPR/Cas-derived transcriptional activators

    PubMed Central

    Bogerd, Hal P.; Kornepati, Anand V. R.; Marshall, Joy B.; Kennedy, Edward M.; Cullen, Bryan R.

    2015-01-01

    Whereas several mammalian proteins can restrict the replication of HIV-1 and other viruses, these are often not expressed in relevant target cells. A potential method to inhibit viral replication might therefore be to use synthetic transcription factors to induce restriction factor expression. In particular, mutants of the RNA-guided DNA binding protein Cas9 that have lost their DNA cleavage activity could be used to recruit transcription activation domains to specific promoters. However, initial experiments revealed only weak activation unless multiple promoter-specific single guide RNAs (sgRNAs) were used. Recently, the recruitment of multiple transcription activation domains by a single sgRNA, modified to contain MS2-derived stem loops that recruit fusion proteins consisting of the MS2 coat protein linked to transcription activation domains, was reported to induce otherwise silent cellular genes. Here, we demonstrate that such “synergistic activation mediators” can induce the expression of two restriction factors, APOBEC3G (A3G) and APOBEC3B (A3B), in human cells that normally lack these proteins. We observed modest activation of endogenous A3G or A3B expression using single sgRNAs but high expression when two sgRNAs were used. Whereas the induced A3G and A3B proteins both blocked infection by an HIV-1 variant lacking a functional vif gene by inducing extensive dC-to-dU editing, only the induced A3B protein inhibited wild-type HIV-1. These data demonstrate that Cas9-derived transcriptional activators have the potential to be used for screens for endogenous genes that affect virus replication and raise the possibility that synthetic transcription factors might prove clinically useful if efficient delivery mechanisms could be developed. PMID:26668372

  5. Specific induction of endogenous viral restriction factors using CRISPR/Cas-derived transcriptional activators.

    PubMed

    Bogerd, Hal P; Kornepati, Anand V R; Marshall, Joy B; Kennedy, Edward M; Cullen, Bryan R

    2015-12-29

    Whereas several mammalian proteins can restrict the replication of HIV-1 and other viruses, these are often not expressed in relevant target cells. A potential method to inhibit viral replication might therefore be to use synthetic transcription factors to induce restriction factor expression. In particular, mutants of the RNA-guided DNA binding protein Cas9 that have lost their DNA cleavage activity could be used to recruit transcription activation domains to specific promoters. However, initial experiments revealed only weak activation unless multiple promoter-specific single guide RNAs (sgRNAs) were used. Recently, the recruitment of multiple transcription activation domains by a single sgRNA, modified to contain MS2-derived stem loops that recruit fusion proteins consisting of the MS2 coat protein linked to transcription activation domains, was reported to induce otherwise silent cellular genes. Here, we demonstrate that such "synergistic activation mediators" can induce the expression of two restriction factors, APOBEC3G (A3G) and APOBEC3B (A3B), in human cells that normally lack these proteins. We observed modest activation of endogenous A3G or A3B expression using single sgRNAs but high expression when two sgRNAs were used. Whereas the induced A3G and A3B proteins both blocked infection by an HIV-1 variant lacking a functional vif gene by inducing extensive dC-to-dU editing, only the induced A3B protein inhibited wild-type HIV-1. These data demonstrate that Cas9-derived transcriptional activators have the potential to be used for screens for endogenous genes that affect virus replication and raise the possibility that synthetic transcription factors might prove clinically useful if efficient delivery mechanisms could be developed. PMID:26668372

  6. The environment and physical activity: The influence of psychosocial, perceived and built environmental factors

    PubMed Central

    Maddison, Ralph; Hoorn, Steven Vander; Jiang, Yannan; Mhurchu, Cliona Ni; Exeter, Daniel; Dorey, Enid; Bullen, Chris; Utter, Jennifer; Schaaf, David; Turley, Maria

    2009-01-01

    This study sought to integrate perceived and built environmental and individual factors into the Theory of Planned Behavior (TPB) model to better understand adolescents' physical activity. Participants (n = 110) aged 12 to 17 years (M = 14.6 ± 1.55) were recruited from two large metropolitan high schools in Auckland, New Zealand, were included in the analysis. Participants completed measures of the revised TPB and the perceived environment. Individual factors such as ethnicity and level of deprivation were also collected. Geographical Information Systems (GIS) software was used to measure the physical environment (walkability, access to physical activity facilities). Physical activity was assessed using the ActiGraph accelerometer and the Physical Activity Questionnaire for Adolescents (PAQ-A). Data from the various sources were combined to develop an integrated model integrated for statistical analysis using structural equation modeling. The TPB model variables (intention and perceived behavioral control) explained 43% of the variance of PAQ-A. Unique and individual contributions were made by intention and PBC and home ownership of home equipment. The model explained 13% of time spent in moderate and vigorous physical activity (Actigraph). Unique and individual contribution was made by intention. Social cognitive variables were better predictors of both subjective and objective physical activity compared to perceived environmental and built environment factors. Implications of these findings are discussed. PMID:19331652

  7. [Factors Affecting the Dynamics of Circadian Activity of Frit Flies Meromyza saltatrix (L) (Diptera: Chloropidae)].

    PubMed

    Safonkin, A F; Triselyova, T A; Yazchuk, A A; Akent'eva, N A

    2015-01-01

    The dynamics of circadian activity in adult frit flies of the Holarctic species Meromyza saltatrix (L) from Mongolian, Moscow, and Polish populations was studied. Synchronous peaks of activity were revealed with the periodicity multiple of three-four hours, which may depend on the level of light. The direct effect of temperature and humidity on the activity of flies outside the optimal values of these factors was found. It was detected that the peak of adult emergence falls on the beginning of a general increase in the abundance of flies, which indicates constant rejuvenation of the population. The sex ratio is close to 1, but the emergence of males and females is in antiphase. The synchronization of peaks of circadian activity in the populations from different regions confirms the presence of a circadian rhythm of activity. The rhythm synchronizing the reproductive activity of adults was found to be modified by the photoperiod under the optimum conditions of temperature and humidity. PMID:26852486

  8. Dynamic transcription factor activity networks in response to independently altered mechanical and adhesive microenvironmental cues.

    PubMed

    Peñalver Bernabé, Beatriz; Shin, Seungjin; Rios, Peter D; Broadbelt, Linda J; Shea, Lonnie D; Seidlits, Stephanie K

    2016-08-01

    Multiple aspects of the local extracellular environment profoundly affect cell phenotype and function. Physical and chemical cues in the environment trigger intracellular signaling cascades that ultimately activate transcription factors (TFs) - powerful regulators of the cell phenotype. TRACER (TRanscriptional Activity CEll aRrays) was employed for large-scale, dynamic quantification of TF activity in human fibroblasts cultured on hydrogels with a controlled elastic modulus and integrin ligand density. We identified three groups of TFs: responders to alterations in ligand density alone, substrate stiffness or both. Dynamic networks of regulatory TFs were constructed computationally and revealed distinct TF activity levels, directionality (i.e., activation or inhibition), and dynamics for adhesive and mechanical cues. Moreover, TRACER networks predicted conserved hubs of TF activity across multiple cell types, which are significantly altered in clinical fibrotic tissues. Our approach captures the distinct and overlapping effects of adhesive and mechanical stimuli, identifying conserved signaling mechanisms in normal and disease states. PMID:27470442

  9. Arginase activity in mitochondria - An interfering factor in nitric oxide synthase activity assays

    SciTech Connect

    Venkatakrishnan, Priya; Nakayasu, Ernesto S.; Almeida, Igor C.; Miller, R.T.

    2010-04-09

    Previously, in tightly controlled studies, using three independent, yet complementary techniques, we refuted the claim that a mitochondrial nitric oxide synthase (mtNOS) isoform exists within pure, rat liver mitochondria (MT). Of those techniques, the NOS-catalyzed [{sup 14}C]-L-arginine to [{sup 14}C]-L-citrulline conversion assay (NOS assay) with MT samples indicated a weak, radioactive signal that was NOS-independent . Aliquots of samples from the NOS assays were then extracted with acetone, separated by high performance thin-layer chromatography (HPTLC) and exposed to autoradiography. Results obtained from these samples showed no radioactive band for L-citrulline. However, a fast-migrating, diffuse, radioactive band was observed in the TLC lanes loaded with MT samples. In this manuscript, we identify and confirm that this radioactive signal in MT samples is due to the arginase-catalyzed conversion of [{sup 14}C]-L-arginine to [{sup 14}C]-urea. The current results, in addition to reconfirming the absence of NOS activity in rat liver MT, also show the need to include arginase inhibitors in studies using MT samples in order to avoid confounding results when using NOS activity assays.

  10. Regulation by Phloroglucinol of Nrf2/Maf-Mediated Expression of Antioxidant Enzymes and Inhibition of Osteoclastogenesis via the RANKL/RANK Signaling Pathway: In Silico study

    PubMed Central

    Rahim, Agus Hadian; Setiawan, Bambang; Dewi, Firli Rahmah Primula; Noor, Zairin

    2015-01-01

    Introduction: Phloroglucinol is an antioxidant compound with many positive effects on health. The purpose of this study was to determine the role of phloroglucinol in osteoclastogenesis via the RANKL/RANK signaling pathway and the activity of the transcription factor Nrf2. Material and methods: Analysis was performed in silico using the primary method of docking by the use of Hex 8.0 software and Haddock web server. Analysis of interactions was then performed to determine interactions between the ligand and its receptors by using the software LigPlus and LigandScout 3.1. Results: Results indicated that phloroglucinol compound was thought to inhibit osteoclastogenesis via three mechanisms: inhibiting RANKL−RANK interaction, sustaining the RANKL−OPG bond, and increasing the activity of the transcription factor Nrf2. PMID:26483597

  11. Interferon regulatory factor 7 is activated by a viral oncoprotein through RIP-dependent ubiquitination.

    PubMed

    Huye, Leslie E; Ning, Shunbin; Kelliher, Michelle; Pagano, Joseph S

    2007-04-01

    As a key mediator of type I interferon (IFN) (IFN-alpha/beta) responses, IFN regulatory factor 7 (IRF7) is essential to host immune defenses. Activation of IRF7 generally requires virus-induced C-terminal phosphorylation, which leads to its nuclear accumulation and activation of target genes. Here we use the Epstein-Barr virus (EBV) oncoprotein LMP1, which activates IRF7, to identify factors involved in IRF7 activation. We demonstrate for the first time that RIP activates IRF7 and that RIP and IRF7 interact under physiological conditions in EBV-positive Burkitt's lymphoma cells. We provide evidence that both RIP and IRF7 are ubiquitinated in these cells and that IRF7 preferentially interacts with ubiquitinated RIP. RIP is required for full activation of IRF7 by LMP1, with LMP1 stimulating the ubiquitination of RIP and its interaction with IRF7. Moreover, LMP1 stimulates RIP-dependent K63-linked ubiquitination of IRF7, which regulates protein function rather than proteasomal degradation of proteins. We suggest that RIP may serve as a general activator of IRF7, responding to and transmitting the signals from various stimuli, and that ubiquitination may be a general mechanism for enhancing the activity of IRF7. PMID:17296724

  12. Effects of Light Intensity Activity on CVD Risk Factors: A Systematic Review of Intervention Studies

    PubMed Central

    Batacan, Romeo B.; Duncan, Mitch J.; Dalbo, Vincent J.; Tucker, Patrick S.; Fenning, Andrew S.

    2015-01-01

    The effects of light intensity physical activity (LIPA) on cardiovascular disease (CVD) risk factors remain to be established. This review summarizes the effects of LIPA on CVD risk factors and CVD-related markers in adults. A systematic search of four electronic databases (PubMed, Academic Search Complete, SPORTDiscus, and CINAHL) examining LIPA and CVD risk factors (body composition, blood pressure, glucose, insulin, glycosylated hemoglobin, and lipid profile) and CVD-related markers (maximal oxygen uptake, heart rate, C-reactive protein, interleukin-6, tumor necrosis factor-alpha, and tumor necrosis factor receptors 1 and 2) published between 1970 and 2015 was performed on 15 March 2015. A total of 33 intervention studies examining the effect of LIPA on CVD risk factors and markers were included in this review. Results indicated that LIPA did not improve CVD risk factors and CVD-related markers in healthy individuals. LIPA was found to improve systolic and diastolic blood pressure in physically inactive populations with a medical condition. Reviewed studies show little support for the role of LIPA to reduce CVD risk factors. Many of the included studies were of low to fair study quality and used low doses of LIPA. Further studies are needed to establish the value of LIPA in reducing CVD risk. PMID:26543862

  13. Effects of Light Intensity Activity on CVD Risk Factors: A Systematic Review of Intervention Studies.

    PubMed

    Batacan, Romeo B; Duncan, Mitch J; Dalbo, Vincent J; Tucker, Patrick S; Fenning, Andrew S

    2015-01-01

    The effects of light intensity physical activity (LIPA) on cardiovascular disease (CVD) risk factors remain to be established. This review summarizes the effects of LIPA on CVD risk factors and CVD-related markers in adults. A systematic search of four electronic databases (PubMed, Academic Search Complete, SPORTDiscus, and CINAHL) examining LIPA and CVD risk factors (body composition, blood pressure, glucose, insulin, glycosylated hemoglobin, and lipid profile) and CVD-related markers (maximal oxygen uptake, heart rate, C-reactive protein, interleukin-6, tumor necrosis factor-alpha, and tumor necrosis factor receptors 1 and 2) published between 1970 and 2015 was performed on 15 March 2015. A total of 33 intervention studies examining the effect of LIPA on CVD risk factors and markers were included in this review. Results indicated that LIPA did not improve CVD risk factors and CVD-related markers in healthy individuals. LIPA was found to improve systolic and diastolic blood pressure in physically inactive populations with a medical condition. Reviewed studies show little support for the role of LIPA to reduce CVD risk factors. Many of the included studies were of low to fair study quality and used low doses of LIPA. Further studies are needed to establish the value of LIPA in reducing CVD risk. PMID:26543862

  14. Activation of transcription factor AP-1 and mitogen-activated protein kinases in aniline-induced splenic toxicity

    SciTech Connect

    Khan, M. Firoze . E-mail: mfkhan@utmb.edu; Kannan, Subburaj; Wang Jianling

    2006-01-15

    Signaling mechanisms in aniline-induced fibrogenic and/or tumorigenic response in the spleen are not known. Previous studies have shown that aniline exposure leads to iron accumulation and oxidative stress in the spleen, which may cause activation of redox-sensitive transcription factors and regulate the transcription of genes involved in fibrosis and/or tumorigenesis. To test this, male SD rats were treated with 0.5 mmol/kg/day aniline via drinking water for 30 days, and activation of transcription factor AP-1 was determined in the splenocyte nuclear extracts (NEs). AP-1 DNA-binding activity in the NEs of freshly isolated splenocytes from aniline-treated rats increased in comparison to the controls, as determined by electrophoretic mobility shift assay (EMSA). AP-1 binding was also determined in the NEs of cultured splenocytes (2 h and 24 h), which showed even a greater increase in binding activity at 2 h. The specificity of AP-1 binding for relevant DNA motifs was confirmed by competition EMSA and by supershift EMSA using antibodies specific to c-Jun and c-Fos. To further explore the signaling mechanisms in the AP-1 activation, phosphorylation patterns of mitogen-activated protein kinases (MAPKs) were pursued. Aniline exposure induced increases in the phosphorylation of the three classes of MAPKs: extracellular-signal-regulated kinase (ERK 1/2), c-Jun N-terminal kinase (JNK 1/2), and p38 MAPKs. Furthermore, TGF-{beta}1 mRNA expression showed a 3-fold increase in the spleens of aniline-treated rats. These observations suggest a strong association among MAPK phosphorylation, AP-1 activation, and enhanced TGF-{beta}1 gene expression. The observed sequence of events subsequent to aniline exposure could regulate genes that lead to fibrogenic and/or tumorigenic response in the spleen.

  15. Immunocytochemical Localization of Latent Transforming Growth Factor-B1 Activation by Stimulated Macrophages

    SciTech Connect

    Chong, Hyonkyong; Vodovotz, Yoram; Cox, G.W.; Barcellos-Hoff, M.H.

    1998-09-22

    Transforming growth factor-{beta}1 (TGF-{beta}) is secreted in a latent form consisting of mature TGF-{beta} noncovalently associated with its amino-terminal propeptide, which is called latency associated peptide (LAP). Biological activity depends upon the release of TGF-{beta} from the latent complex following extracellular activation, which appears to be the key regulatory mechanism controlling TGF-{beta} action. We have identified two events associated with latent TGF-{beta} (LTGF-{beta}) activation in vivo: increased immunoreactivity of certain antibodies that specifically detect TGF-{beta} concomitant with decreased immunoreactivity of antibodies to LAP. Macrophages stimulated in vitro with interferon-{gamma} and lipopolysaccharide reportedly activate LTGF-{beta} via cell membrane-bound protease activity. We show through dual immunostaining of paraformaldehyde-fixed macrophages that such physiological TGF-{beta} activation is accompanied by a loss of LAP immunoreactivity with concomitant revelation of TGF-{beta} epitopes. The induction of TGF-{beta} immunoreactivity colocalized with immunoreactive betaglycan/RIII in activated macrophages, suggesting that LTGF-{beta} activation occurs on the cell surface. Confocal microscopy of metabolically active macrophages incubated with antibodies to TGF-{beta} and betaglycan/RIII prior to fixation supported the localization of activation to the cell surface. The ability to specifically detect and localize LTGF-{beta} activation provides an important tool for studies of its regulation.

  16. Immunocytochemical localization of latent transforming growth factor-beta1 activation by stimulated macrophages

    NASA Technical Reports Server (NTRS)

    Chong, H.; Vodovotz, Y.; Cox, G. W.; Barcellos-Hoff, M. H.; Chatterjee, A. (Principal Investigator)

    1999-01-01

    Transforming growth factor-beta1 (TGF-beta) is secreted in a latent form consisting of mature TGF-beta noncovalently associated with its amino-terminal propeptide, which is called latency associated peptide (LAP). Biological activity depends upon the release of TGF-beta from the latent complex following extracellular activation, which appears to be the key regulatory mechanism controlling TGF-beta action. We have identified two events associated with latent TGF-beta (LTGF-beta) activation in vivo: increased immunoreactivity of certain antibodies that specifically detect TGF-beta concomitant with decreased immunoreactivity of antibodies to LAP. Macrophages stimulated in vitro with interferon-gamma and lipopolysaccharide reportedly activate LTGF-beta via cell membrane-bound protease activity. We show through dual immunostaining of paraformaldehyde-fixed macrophages that such physiological TGF-beta activation is accompanied by a loss of LAP immunoreactivity with concomitant revelation of TGF-beta epitopes. The induction of TGF-beta immunoreactivity colocalized with immunoreactive betaglycan/RIII in activated macrophages, suggesting that LTGF-beta activation occurs on the cell surface. Confocal microscopy of metabolically active macrophages incubated with antibodies to TGF-beta and betaglycan/RIII prior to fixation supported the localization of activation to the cell surface. The ability to specifically detect and localize LTGF-beta activation provides an important tool for studies of its regulation.

  17. Microglial activation induced by factor(s) contained in sera from Alzheimer-related ApoE genotypes.

    PubMed

    Lombardi, V R; García, M; Cacabelos, R

    1998-11-15

    Several factors that increase the likelihood of developing Alzheimer's disease (AD) have already been identified. A correct evaluation of these may contribute to a better understanding of the etiology of the disease. The risk of developing AD definitely increases with (a) age, (b) head injuries, (c) family history of AD or Down syndrome, (d) sex (higher prevalence of AD in women), (e) vascular disease, (f) exposure to environmental toxins, (g) infectious processes, or (h) changes in immune function, and recent advances in molecular genetics have suggested that genetic predisposition (i) can be considered one of the most important risk factors in the development of AD. A significant increase in the number of amyloid plaques in AD patients with an apolipoprotein E4 (ApoE) allele has been observed and the results of several genetic studies indicate that the etiology of this neurodegenerative disease is associated with the presence of the allele E4 of ApoE. A potential source of damage in the AD brain is an altered response triggered by microglial activation, which is associated with amyloid plaques. It has become evident that a dysregulation of cytokine release appears within lesions of many types of brain disorders including infection, trauma, stroke, and neurodegenerative diseases. Many studies have shown that microglia secrete both cytokines and cytotoxins and since reactive microglia appears in nearly every type of brain damage, it is likely that their secreted products ultimately help to determine the rate of damaged brain tissue. In this study, in vitro cell cultures were established to investigate the effect of different concentrations of human sera (2.5% and 10%) with specific ApoE genotypes from Alzheimer's and non-Alzheimer's subjects on ameboid and flat microglial cells obtained from neonatal rat hippocampi. Results show that a modulation in the proliferation and activation of microglial cells was obtained and that AD sera, mainly in the ApoE 3/4 and 4

  18. Physical activity and associated factors among young adults in Malaysia: an online exploratory survey.

    PubMed

    Sreeramareddy, C T; Majeed Kutty, N A; Razzaq Jabbar, M A; Boo, N Y

    2012-06-01

    The burden of non-communicable diseases is increasing in Malaysia. Insufficient Physical Activity, which is an important risk factor for non-communicable diseases, is less researched in Malaysia. We aimed to assess the level of physical activity and identify its correlates. An online survey was carried out during October, 2011 in the University Tunku Abdul Rahman by the opinion poll research committee. Young adults answered the Short International Physical Activity Questionnaire and a questionnaire about factors according to a socio-ecological model which was adapted from published studies. Metabolic equivalent (MET)-hours and MET-minutes were calculated. Physical activity was classified as sufficient when MET-minutes were > 840. The mean age of the 474 participants was 22.4 years (S.D. = 4.7), and 253 (53.4%) were females. Their mean and median of MET-hours of PA done during the previous seven days were 31.36 (S.D., 52.19) and 14.7 (IQR, 5.77-32.07), respectively. Physical activity done was sufficient among 242 (51.1%) participants. Using univariate analysis, being male, good self-rated health, positive intention, self-efficacy, perceived benefits, social support, and availability of facilities were associated with sufficient physical activity. Using multivariate analysis sufficient physical activity was associated with participants' intention (OR 0.75, 95% CIs 0.64, 0.88), self-efficacy (OR 0.91, 95% CIs 0.85, 0.97) and facility availability (OR 0.81, 95% CIs 0.73, 0.91). The proportion of participants with sufficient physical activity was low. Positive intention and self-efficacy associated with sufficient physical activity should be supported by availability of facilities and a safely-built environment. A nationwide survey about physical and associated socialecological factors is needed to design rational health promotion strategies. PMID:22890157

  19. Relationships between tumour necrosis factor, eicosanoids and platelet-activating factor as mediators of endotoxin-induced shock in mice.

    PubMed Central

    Myers, A. K.; Robey, J. W.; Price, R. M.

    1990-01-01

    1. The toxicity of intravenous recombinant human tumour necrosis factor (rhTNF), a TNF fragment (TNF114-130), endotoxin and combinations of rhTNF or TNF114-130 were tested in mice. Neither rhTNF nor TNF114-130 was lethal alone, but when combined with a non-lethal dose of endotoxin, rhTNF provoked dose-dependent mortality, as did higher doses of endotoxin alone. 2. Both the toxicity and the vasopermeability changes induced by endotoxin alone were blocked by the platelet-activating factor (PAF) antagonist BN52021, indomethacin or the dual cyclo-oxygenase/lipoxygenase inhibitor BW755C. 3. The lethality of the combined low dose endotoxin/rhTNF challenge was unaffected by pretreatment with BN52021, indomethacin or BW755C, or by treatment at 6 h intervals with BN52021 or BW755C. 4. The results of these studies suggest that TNF, a putative, early mediator of septic or endotoxin shock, cannot by itself mimic all of the effects of bacterial endotoxin in the model used in this study. Apparently, TNF works synergistically with other mediators whose release is stimulated by endotoxin. 5. The results also suggest that the mechanism of shock production by the rhTNF/endotoxin combination in mice is not dependent on the early stimulation of eicosanoid or PAF synthesis by rhTNF. PMID:2110016

  20. Engineering Students' Perceptions of Academic Activities and Support Services: Factors that Influence Their Academic Performance

    ERIC Educational Resources Information Center

    Amenkhienan, Charlotte A.; Kogan, Lori R.

    2004-01-01

    The present study, through the use of focus groups, identified the academic activities and support services perceived by engineering students as having a positive impact on their academic performance. The results suggest three primary factors: (a) individual effort and involvement, (b) peer interaction, and (c) faculty contact. Differences in…

  1. Factors Influencing Attitudes toward Sexual Activity among Early Adolescents in Japan

    ERIC Educational Resources Information Center

    Nagamatsu, Miyuki; Yamawaki, Niwako; Sato, Takeshi; Nakagawa, Aki; Saito, Hisako

    2013-01-01

    The purpose of this study was to examine factors influencing attitudes toward sexual activity among early adolescents in Japan. A total of 1,551 students aged 12 to 14 years at 4 junior high schools were divided into either a conservative or liberal group. Results of chi-square tests showed that the liberal group had higher percentages of students…

  2. DIETARY PROTEIN AND LACTOSE INCREASE TRANSLATION INITIATION FACTOR ACTIVATION AND TISSUE PROTEIN SYNTHESIS IN NEONATAL PIGS

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Protein synthesis and eukaryotic initiation factor (eIF) activation are increased in muscle and liver of pigs parenterally infused with amino acids and insulin. To examine the effects of enteral protein and carbohydrate on protein synthesis, pigs (n = 42, 1.7 kg body wt) were fed isocaloric milk die...

  3. EFFECT OF PHOTOPERIOD ON PLATELET-ACTIVATING FACTOR CONCENTRATION IN BOAR SPERMATOZOA

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Platelet-activating factor (PAF, 1-0-alkyl-2-acetyl-sn-glycero-3-phosphocholine) is an important phospholipid mediator shown to be involved in fertilization. We recently reported that boars with a 70% or higher fertility history have a higher concentration of PAF in their spermatozoa. In addition,...

  4. Are There Gender-Specific Risk Factors for Suicidal Activity among Patients with Schizophrenia and Depression?

    ERIC Educational Resources Information Center

    Kaplan, Kalman J.; Harrow, Martin; Faull, Robert N.

    2012-01-01

    Are there gender-specific risk factors for suicidal activity among patients with schizophrenia and depression? A total of 74 schizophrenia patients (51 men, 23 women) and 77 unipolar nonpsychotic depressed patients (26 men, 51 women) from the Chicago Follow-up Study were studied prospectively at 2 years posthospitalization and again at 7.5 years.…

  5. A Comparison of Motivational Factors and Barriers to Physical Activity among Traditional versus Nontraditional College Students

    ERIC Educational Resources Information Center

    Kulavic, Kimberly; Hultquist, Cherilyn N.; McLester, John R.

    2013-01-01

    Objective: To investigate the motivational factors and the barriers to physical activity (PA) in traditional college students (TS) and nontraditional college students (NTS) and determine if differences exist between these 2 groups. Participants: A total of 746 college students; 628 were TS (19.1 [plus-minus] 1.2 years), and 118 were NTS (31.2…

  6. Parent Perceptions of Factors Influencing After-School Physical Activity of Children with Autism Spectrum Disorders

    ERIC Educational Resources Information Center

    Obrusnikova, Iva; Miccinello, Dannielle L.

    2012-01-01

    The study assessed parental perceptions of the benefits of physical activity (PA) and the factors that influence participation of children with autism spectrum disorders in PA after school. Data were collected from 103 parents using an online open-ended questionnaire and focus-group interviews. Data were analyzed using a socioecological model.…

  7. Associations between Physical Activity and Health-Related Factors in a National Sample of College Students

    ERIC Educational Resources Information Center

    Dinger, Mary K.; Brittain, Danielle R.; Hutchinson, Susan R.

    2014-01-01

    Objective: To examine associations between meeting the current moderate to vigorous physical activity (MVPA) recommendation and health-related factors in a national sample of college students. Participants: Participants (N = 67,861) completed the National College Health Assessment II during the Fall 2008/Spring 2009 academic year. Methods:…

  8. Structured and Dynamic Disordered Domains Regulate the Activity of a Multifunctional Anti-σ Factor

    PubMed Central

    Herrou, Julien; Willett, Jonathan W.

    2015-01-01

    ABSTRACT The anti-σ factor NepR plays a central role in regulation of the general stress response (GSR) in alphaproteobacteria. This small protein has two known interaction partners: its cognate extracytoplasmic function (ECF) σ factor and the anti-anti-σ factor, PhyR. Stress-dependent phosphorylation of PhyR initiates a protein partner switch that promotes phospho-PhyR binding to NepR, which frees ECF σ to activate transcription of genes required for cell survival under adverse or fluctuating conditions. We have defined key functional roles for structured and intrinsically disordered domains of Caulobacter crescentus NepR in partner binding and activation of GSR transcription. We further demonstrate that NepR strongly stimulates the rate of PhyR phosphorylation in vitro and that this effect requires the structured and disordered domains of NepR. This result provides evidence for an additional layer of GSR regulation in which NepR directly influences activation of its binding partner, PhyR, as an anti-anti-σ factor. We conclude that structured and intrinsically disordered domains of NepR coordinately control multiple functions in the GSR signaling pathway, including core protein partner switch interactions and pathway activation by phosphorylation. PMID:26220965

  9. Factors of Participants and Blogs That Predict Blogging Activeness during Teaching Practice and Induction Year

    ERIC Educational Resources Information Center

    Luik, Piret; Taimalu, Merle

    2016-01-01

    The blog as a type of social software has been used in education for several years, and its positive effect in the field has been asserted in many studies. This study presents the factors of participants and blogs that predict blogging activeness during teaching practice and induction year. During the teaching practice and induction year all…

  10. The Association between Socio-Ecological Factors and Having an After-School Physical Activity Program

    ERIC Educational Resources Information Center

    Van Acker, Ragnar; De Bourdeaudhuij, Ilse; De Martelaer, Kristine; Seghers, Jan; De Cocker, Katrien; Cardon, Greet

    2012-01-01

    Background: After-school physical activity (PA) programs promote PA among youth. Few studies have used socio-ecological health models to identify barriers and facilitators of after-school PA programs. This study examined which socio-ecological factors are associated with having an after-school PA program. Methods: A questionnaire was administered…

  11. Adolescents Engaging in Risky Sexual Behavior: Sexual Activity and Associated Behavioral Risk Factors in Bolivian Adolescents

    ERIC Educational Resources Information Center

    Novilla, M. Lelinneth B.; Dearden, Kirk A.; Crookston, Benjamin T.; De La Cruz, Natalie; Hill, Susan; Torres, Scott B.

    2006-01-01

    This study describes the prevalence of risky sexual activities among Bolivian adolescents within the context of other behavioral factors that contribute to compromised health outcomes, unintended pregnancies, and sexually transmitted infections including HIV/AIDS. Data was collected from 576 adolescents, 13-18 years of age, from six schools in La…

  12. School Administrators' Perceptions of Factors that Influence Children's Active Travel to School

    ERIC Educational Resources Information Center

    Price, Anna E.; Pluto, Delores M.; Ogoussan, Olga; Banda, Jorge A.

    2011-01-01

    Background: Increasing children's active travel to school may be 1 strategy for addressing the growing prevalence of obesity among school age children. Using the School Travel Survey, we examined South Carolina school district leaders' perceptions of factors that influence elementary and middle school students walking to school. Methods: Frequency…

  13. Increasing Children's Physical Activity: Individual, Social, and Environmental Factors Associated with Walking to and from School

    ERIC Educational Resources Information Center

    Trapp, Georgina S. A.; Giles-Corti, Billie; Christian, Hayley E.; Bulsara, Max; Timperio, Anna F.; McCormack, Gavin R.; Villaneuva, Karen P.

    2012-01-01

    Background. Efforts to increase the prevalence of children's active school transport require evidence to inform the development of comprehensive interventions. This study used a multilevel ecological framework to investigate individual, social, and environmental factors associated with walking to and from school among elementary school-aged…

  14. Factors Affecting Instructional Development Activities of Selected K-12 Media Professionals.

    ERIC Educational Resources Information Center

    Turner, Philip M.; Martin, Nina N.

    The goal of this study was to establish relationships and/or determine differences between various factors and the extent of instructional development activity. Subjects were 43 graduates of a masters program in library education, currently employed as school media professionals at the K-12 level, who responded to a mailed questionnaire. Forty…

  15. Regulation of the yeast metabolic cycle by transcription factors with periodic activities

    PubMed Central

    2011-01-01

    Background When growing budding yeast under continuous, nutrient-limited conditions, over half of yeast genes exhibit periodic expression patterns. Periodicity can also be observed in respiration, in the timing of cell division, as well as in various metabolite levels. Knowing the transcription factors involved in the yeast metabolic cycle is helpful for determining the cascade of regulatory events that cause these patterns. Results Transcription factor activities were estimated by linear regression using time series and genome-wide transcription factor binding data. Time-translation matrices were estimated using least squares and were used to model the interactions between the most significant transcription factors. The top transcription factors have functions involving respiration, cell cycle events, amino acid metabolism and glycolysis. Key regulators of transitions between phases of the yeast metabolic cycle appear to be Hap1, Hap4, Gcn4, Msn4, Swi6 and Adr1. Conclusions Analysis of the phases at which transcription factor activities peak supports previous findings suggesting that the various cellular functions occur during specific phases of the yeast metabolic cycle. PMID:21992532

  16. Asynchronous combinatorial action of four regulatory factors activates Bcl11b for T cell commitment.

    PubMed

    Kueh, Hao Yuan; Yui, Mary A; Ng, Kenneth K H; Pease, Shirley S; Zhang, Jingli A; Damle, Sagar S; Freedman, George; Siu, Sharmayne; Bernstein, Irwin D; Elowitz, Michael B; Rothenberg, Ellen V

    2016-08-01

    During T cell development, multipotent progenitors relinquish competence for other fates and commit to the T cell lineage by turning on Bcl11b, which encodes a transcription factor. To clarify lineage commitment mechanisms, we followed developing T cells at the single-cell level using Bcl11b knock-in fluorescent reporter mice. Notch signaling and Notch-activated transcription factors collaborate to activate Bcl11b expression irrespectively of Notch-dependent proliferation. These inputs work via three distinct, asynchronous mechanisms: an early locus 'poising' function dependent on TCF-1 and GATA-3, a stochastic-permissivity function dependent on Notch signaling, and a separate amplitude-control function dependent on Runx1, a factor already present in multipotent progenitors. Despite their necessity for Bcl11b expression, these inputs act in a stage-specific manner, providing a multitiered mechanism for developmental gene regulation. PMID:27376470

  17. Influence of Environmental Factors on the Active Substance Production and Antioxidant Activity in Potentilla fruticosa L. and Its Quality Assessment.

    PubMed

    Liu, Wei; Yin, Dongxue; Li, Na; Hou, Xiaogai; Wang, Dongmei; Li, Dengwu; Liu, Jianjun

    2016-01-01

    Environmental factors may influence types and contents of active substances. This study investigated the influence of environmental factors on the active substance contents and antioxidant activity of Potentilla fruticosa L. from different regions of China. Also, HPLC fingerprint similarity analysis (SA) coupled with hierarchical cluster analysis (HCA) and discriminant analysis (DA) were further introduced for the accurate classification and quality assessment of P. fruticosa. The results showed that altitude was significantly and negatively correlated to the content of tannin (P < 0.05). Annual sunshine duration and altitude were significantly and positively correlated to the flavonoids content, rutin content and antioxidant activity (P < 0.05). Annual mean temperature was significantly and negatively correlated to the content of total phenolics, while altitude was significantly and positively correlated to the content of total phenolics (P < 0.05). Eight samples were unambiguously separated into three groups. Two types of discriminant functions with a 100% discrimination ratio were constructed. All data consistently supported the conclusion that P. fruticosa produced from Kangding, Sichuan Province had high quality among all samples, therefore, Kangding in Sichuan Province with favorable environmental conditions is recommended as a preferable production location. PMID:27373366

  18. Activation of nuclear factor-kappaB and not activator protein-1 in cellular response to nickel compounds.

    PubMed Central

    Huang, Yi; Davidson, Gerard; Li, Jingxia; Yan, Yan; Chen, Fei; Costa, Max; Chen, Lung Chi; Huang, Chuanshu

    2002-01-01

    The predominant exposure route for nickel compounds is by inhalation, and several studies have indicated the correlation between nickel exposure and respiratory cancers. The tumor-promoting effects of nickel compounds are thought to be associated with their transactivation of transcription factors. We have investigated the possible activation of activator protein-1 (AP-1) and nuclear factor KB (NF-kappaB) in mouse C141 epidermal cells and fibroblasts 3T3 and B82, and human bronchoepithelial BEAS-2B cells in response to nickel compound exposure. Our results show that NF-kappaB activity is induced by nickel exposure in 3T3 and BEAS-2B cells. Conversely, similar nickel treatment of these cells did not induce AP-1 activity, suggesting that nickel tumorigenesis occurs through NF-kappaB and not AP-1. We also investigated the role of NF-kappaB in the induction of Cap43 by nickel compounds using dominant negative mutant Ikappabeta kinase b-KM BEAS-2B transfectants. PMID:12426142

  19. Influence of Environmental Factors on the Active Substance Production and Antioxidant Activity in Potentilla fruticosa L. and Its Quality Assessment

    PubMed Central

    Liu, Wei; Yin, Dongxue; Li, Na; Hou, Xiaogai; Wang, Dongmei; Li, Dengwu; Liu, Jianjun

    2016-01-01

    Environmental factors may influence types and contents of active substances. This study investigated the influence of environmental factors on the active substance contents and antioxidant activity of Potentilla fruticosa L. from different regions of China. Also, HPLC fingerprint similarity analysis (SA) coupled with hierarchical cluster analysis (HCA) and discriminant analysis (DA) were further introduced for the accurate classification and quality assessment of P. fruticosa. The results showed that altitude was significantly and negatively correlated to the content of tannin (P < 0.05). Annual sunshine duration and altitude were significantly and positively correlated to the flavonoids content, rutin content and antioxidant activity (P < 0.05). Annual mean temperature was significantly and negatively correlated to the content of total phenolics, while altitude was significantly and positively correlated to the content of total phenolics (P < 0.05). Eight samples were unambiguously separated into three groups. Two types of discriminant functions with a 100% discrimination ratio were constructed. All data consistently supported the conclusion that P. fruticosa produced from Kangding, Sichuan Province had high quality among all samples, therefore, Kangding in Sichuan Province with favorable environmental conditions is recommended as a preferable production location. PMID:27373366

  20. Aberrant activation of nuclear factor of activated T cell 2 in lamina propria mononuclear cells in ulcerative colitis

    PubMed Central

    Shih, Tsung-Chieh; Hsieh, Sen-Yung; Hsieh, Yi-Yueh; Chen, Tse-Chin; Yeh, Chien-Yu; Lin, Chun-Jung; Lin, Deng-Yn; Chiu, Cheng-Tang

    2008-01-01

    AIM: To investigate the role of nuclear factor of activated T cell 2 (NFAT2), the major NFAT protein in peripheral T cells, in sustained T cell activation and intractable inflammation in human ulcerative colitis (UC). METHODS: We used two-dimensional gel-electrophoresis, immunohistochemistry, double immunohistochemical staining, and confocal microscopy to inspect the expression of NFAT2 in 107, 15, 48 and 5 cases of UC, Crohn’s disease (CD), non-specific colitis, and 5 healthy individuals, respectively. RESULTS: Up-regulation with profound nucleo-translocation/activation of NFAT2 of lamina propria mononuclear cells (LPMC) of colonic mucosa was found specifically in the affected colonic mucosa from patients with UC, as compared to CD or NC (P < 0.001, Kruskal-Wallis test). Nucleo-translocation/activation of NFAT2 primarily occurred in CD8+T, but was less prominent in CD4+ T cells or CD20+B cells. It was strongly associated with the disease activity, including endoscopic stage (τ = 0.2145, P = 0.0281) and histologic grade (τ = 0.4167, P < 0.001). CONCLUSION: We disclose for the first time the nucleo-translocation/activatin of NFAT2 in lamina propria mononuclear cells in ulcerative colitis. Activation of NFAT2 was specific for ulcerative colitis and highly associated with disease activity. Since activation of NFAT2 is implicated in an auto-regulatory positive feedback loop of sustained T-cell activation and NFAT proteins play key roles in the calcium/calcineurin signaling pathways, our results not only provide new insights into the mechanism for sustained intractable inflammation, but also suggest the calcium-calcineurin/NFAT pathway as a new therapeutic target for ulcerative colitis. PMID:18350607

  1. HSP90 inhibitors enhance differentiation and MITF (microphthalmia transcription factor) activity in osteoclast progenitors.

    PubMed

    van der Kraan, A Gabrielle J; Chai, Ryan C C; Singh, Preetinder P; Lang, Benjamin J; Xu, Jiake; Gillespie, Matthew T; Price, John T; Quinn, Julian M W

    2013-04-15

    The HSP90 (heat-shock protein 90) inhibitor 17-AAG (17-allylamino-demethoxygeldanamycin) increases osteoclast formation both in vitro and in vivo, an action that can enhance cancer invasion and growth in the bone microenvironment. The cellular mechanisms through which 17-AAG exerts this action are not understood. Thus we sought to clarify the actions of 17-AAG on osteoclasts and determine whether other HSP90 inhibitors had similar properties. We determined that 17-AAG and the structurally unrelated HSP90 inhibitors CCT018159 and NVP-AUY922 dose-dependently increased RANKL [receptor activator of NF-κB (nuclear factor κB) ligand]-stimulated osteoclastogenesis in mouse bone marrow and pre-osteoclastic RAW264.7 cell cultures. Moreover, 17-AAG also enhanced RANKL- and TNF (tumour necrosis factor)-elicited osteoclastogenesis, but did not affect RANKL-induced osteoclast survival, suggesting that only differentiation mechanisms are targeted. 17-AAG affected the later stages of progenitor maturation (after 3 days of incubation), whereas the osteoclast formation enhancer TGFβ (transforming growth factor β) acted prior to this, suggesting different mechanisms of action. In studies of RANKL-elicited intracellular signalling, 17-AAG treatment did not increase c-Fos or NFAT (nuclear factor of activated T-cells) c1 protein levels nor did 17-AAG increase activity in luciferase-based NF-κB- and NFAT-response assays. In contrast, 17-AAG treatment (and RANKL treatment) increased both MITF (microphthalmia-associated transcription factor) protein levels and MITF-dependent vATPase-d2 (V-type proton ATPase subunit d2) gene promoter activity. These results indicate that HSP90 inhibitors enhance osteoclast differentiation in an NFATc1-independent manner that involves elevated MITF levels and activity. PMID:23379601

  2. Development of scaling factors for the activated concrete of the KRR-2.

    PubMed

    Hong, Sang-Bum; Kang, Mun-Ja; Lee, Ki-Won; Chung, Un-Soo

    2009-01-01

    The biological shielding concrete of KRR-2 was activated by a thermal neutron reaction during the operation of the reactor, thus a variety of radionuclides were generated in the concrete. In order to verify the radioactivity for the final disposal of waste and to achieve a more efficient cutting of the concrete, the radioactivity inventories and distributions of the activated concrete were evaluated. The activity of gamma-emitting radionuclides was measured by using an HPGe detector. The beta-emitting radionuclides were measured by an oxidation/combustion method for (3)H and (14)C and a combined method of an extraction chromatography and a liquid scintillation for (55)Fe and (63)Ni. The dominant radioactive nuclides in the activated concrete were (3)H, (14)C, (55)Fe and (60)Co, and the maximum gamma activity was 105Bq/g at the surface around the thermal column. The specific activities of all the nuclides were found to decrease almost linearly on a logarithmic scale along the depth from the inner surface of the concrete. Equations for scaling factors were obtained by a linear regression of logarithms from the radioactivity data of (3)H/(60)Co, (14)C/(60)Co and (55)Fe/(60)Co nuclide pairs of the activated concrete. The scaling factors can be utilized for the estimation of beta radioactivity without the time consuming separation processes of the nuclides. PMID:19303787

  3. Genetic and environmental factors associated with plasma paraoxonase activity in healthy Chinese.

    PubMed

    Wang, Xiaoling; Huang, Jianfeng; Fan, Zhongjie; Su, Shaoyong; Zhao, Jiangong; Shen, Yan; Qiang, Boqin; Gu, Dongfeng

    2004-03-01

    To characterize factors associated with plasma paraoxonase 1 (PON1) activity in healthy Chinese Han population, we carried out the present study, not only taking into account the total set of frequent polymorphisms present in PON1 gene in the Chinese Han population, but also some environmental factors. The -107T/C polymorphism as well as drinking and smoking were independently associated with plasma PON1 activity, determined by rates of phenylacetate hydrolysis. The -107T/C polymorphism had the predominant effect and accounted for 16% of the observed variability in plasma PON1 activity. Alcohol consumption can modulate the effects of cigarette smoking on PON1 activity, and smoking only decreases PON1 activity in non-drinkers. The increase of PON1 activity by drinking or the inhibition of PON1 activity by smoking varies according to PON1 -107T/C genotypes, and the associations were only observed in -107T allele carriers. The results illustrate the complexity of polymorphism-phenotype associations. The observed interactions constitute concrete examples of gene-environment and environment-environment interactions. PMID:14767577

  4. MiT/TFE transcription factors are activated during mitophagy downstream of Parkin and Atg5

    PubMed Central

    Nezich, Catherine L.; Wang, Chunxin; Fogel, Adam I.

    2015-01-01

    The kinase PINK1 and ubiquitin ligase Parkin can regulate the selective elimination of damaged mitochondria through autophagy (mitophagy). Because of the demand on lysosomal function by mitophagy, we investigated a role for the transcription factor EB (TFEB), a master regulator of lysosomal biogenesis, in this process. We show that during mitophagy TFEB translocates to the nucleus and displays transcriptional activity in a PINK1- and Parkin-dependent manner. MITF and TFE3, homologues of TFEB belonging to the same microphthalmia/transcription factor E (MiT/TFE) family, are similarly regulated during mitophagy. Unlike TFEB translocation after starvation-induced mammalian target of rapamycin complex 1 inhibition, Parkin-mediated TFEB relocalization required Atg9A and Atg5 activity. However, constitutively active Rag guanosine triphosphatases prevented TFEB translocation during mitophagy, suggesting cross talk between these two MiT/TFE activation pathways. Analysis of clustered regularly interspaced short palindromic repeats–generated TFEB/MITF/TFE3/TFEC single, double, and triple knockout cell lines revealed that these proteins partly facilitate Parkin-mediated mitochondrial clearance. These results illuminate a pathway leading to MiT/TFE transcription factor activation, distinct from starvation-induced autophagy, which occurs during mitophagy. PMID:26240184

  5. Activation of the orphan nuclear receptor steroidogenic factor 1 by oxysterols

    PubMed Central

    Lala, Deepak S.; Syka, Peter M.; Lazarchik, Steven B.; Mangelsdorf, David J.; Parker, Keith L.; Heyman, Richard A.

    1997-01-01

    Steroidogenic factor 1 (SF-1), an orphan member of the intracellular receptor superfamily, plays an essential role in the development and function of multiple endocrine organs. It is expressed in all steroidogenic tissues where it regulates the P450 steroidogenic genes to generate physiologically active steroids. Although many of the functions of SF-1 in vivo have been defined, an unresolved question is whether a ligand modulates its transcriptional activity. Here, we show that 25-, 26-, or 27-hydroxycholesterol, known suppressors of cholesterol biosynthesis, enhance SF-1-dependent transcriptional activity. This activation is dependent upon the SF-1 activation function domain, and, is specific for SF-1 as several other receptors do not respond to these molecules. The oxysterols activate at concentrations comparable to those previously shown to inhibit cholesterol biosynthesis, and, can be derived from cholesterol by P450c27, an enzyme expressed within steroidogenic tissues. Recent studies have shown that the nuclear receptor LXR also is activated by oxysterols. We demonstrate that different oxysterols differ in their rank order potency for these two receptors, with 25-hydroxycholesterol preferentially activating SF-1 and 22(R)-hydroxycholesterol preferentially activating LXR. These results suggest that specific oxysterols may mediate transcriptional activation via different intracellular receptors. Finally, ligand-dependent transactivation of SF-1 by oxysterols may play an important role in enhancing steroidogenesis in vivo. PMID:9144161

  6. Platelet-derived growth factor (PDGF) stimulates glycogen synthase activity in 3T3 cells

    SciTech Connect

    Chan, C.P.; Bowen-Pope, D.F.; Ross, R.; Krebs, E.G.

    1986-05-01

    Hormonal regulation of glycogen synthase, an enzyme that can be phosphorylated on multiple sites, is often associated with changes in its phosphorylation state. Enzyme activation is conventionally monitored by determining the synthase activity ratio ((activity in the absence of glucose 6-P)/(activity in the presence of glucose 6-P)). Insulin causes an activation of glycogen synthase with a concomitant decrease in its phosphate content. In a previous report, the authors showed that epidermal growth factor (EGF) increases the glycogen synthase activity ratio in Swiss 3T3 cells. The time and dose-dependency of this response was similar to that of insulin. Their recent results indicate that PDGF also stimulates glycogen synthase activity. Enzyme activation was maximal after 30 min. of incubation with PDGF; the time course observed was very similar to that with insulin and EGF. At 1 ng/ml (0.03nM), PDGF caused a maximal stimulation of 4-fold in synthase activity ratio. Half-maximal stimulation was observed at 0.2 ng/ml (6 pM). The time course of changes in enzyme activity ratio closely followed that of /sup 125/I-PDGF binding. The authors data suggest that PDGF, as well as EFG and insulin, may be important in regulating glycogen synthesis through phosphorylation/dephosphorylation mechanisms.

  7. Differential Activation of Insulin Receptor Substrates 1 and 2 by Insulin-Like Growth Factor-Activated Insulin Receptors▿

    PubMed Central

    Denley, Adam; Carroll, Julie M.; Brierley, Gemma V.; Cosgrove, Leah; Wallace, John; Forbes, Briony; Roberts, Charles T.

    2007-01-01

    The insulin-like growth factors (insulin-like growth factor I [IGF-I] and IGF-II) exert important effects on growth, development, and differentiation through the IGF-I receptor (IGF-IR) transmembrane tyrosine kinase. The insulin receptor (IR) is structurally related to the IGF-IR, and at high concentrations, the IGFs can also activate the IR, in spite of their generally low affinity for the latter. Two mechanisms that facilitate cross talk between the IGF ligands and the IR at physiological concentrations have been described. The first of these is the existence of an alternatively spliced IR variant that exhibits high affinity for IGF-II as well as for insulin. A second phenomenon is the ability of hybrid receptors comprised of IGF-IR and IR hemireceptors to bind IGFs, but not insulin. To date, however, direct activation of an IR holoreceptor by IGF-I at physiological levels has not been demonstrated. We have now found that IGF-I can function through both splice variants of the IR, in spite of low affinity, to specifically activate IRS-2 to levels similar to those seen with equivalent concentrations of insulin or IGF-II. The specific activation of IRS-2 by IGF-I through the IR does not result in activation of the extracellular signal-regulated kinase pathway but does induce delayed low-level activation of the phosphatidylinositol 3-kinase pathway and biological effects such as enhanced cell viability and protection from apoptosis. These findings suggest that IGF-I can function directly through the IR and that the observed effects of IGF-I on insulin sensitivity may be the result of direct facilitation of insulin action by IGF-I costimulation of the IR in insulin target tissues. PMID:17325037

  8. Stable inhibitory activity of regulatory T cells requires the transcription factor Helios.

    PubMed

    Kim, Hye-Jung; Barnitz, R Anthony; Kreslavsky, Taras; Brown, Flavian D; Moffett, Howell; Lemieux, Madeleine E; Kaygusuz, Yasemin; Meissner, Torsten; Holderried, Tobias A W; Chan, Susan; Kastner, Philippe; Haining, W Nicholas; Cantor, Harvey

    2015-10-16

    The maintenance of immune homeostasis requires regulatory T cells (T(regs)). Given their intrinsic self-reactivity, T(regs) must stably maintain a suppressive phenotype to avoid autoimmunity. We report that impaired expression of the transcription factor (TF) Helios by FoxP3(+) CD4 and Qa-1-restricted CD8 T(regs) results in defective regulatory activity and autoimmunity in mice. Helios-deficient T(regs) develop an unstable phenotype during inflammatory responses characterized by reduced FoxP3 expression and increased effector cytokine expression secondary to diminished activation of the STAT5 pathway. CD8 T(regs) also require Helios-dependent STAT5 activation for survival and to prevent terminal T cell differentiation. The definition of Helios as a key transcription factor that stabilizes T(regs) in the face of inflammatory responses provides a genetic explanation for a core property of T(regs). PMID:26472910

  9. Transgenic songbirds with suppressed or enhanced activity of CREB transcription factor.

    PubMed

    Abe, Kentaro; Matsui, Sumiko; Watanabe, Dai

    2015-06-16

    Songbirds postnatally develop their skill to utter and to perceive a vocal signal for communication. How genetic and environmental influences act in concert to regulate the development of such skill is not fully understood. Here, we report the phenotype of transgenic songbirds with altered intrinsic activity of cAMP response element-binding protein (CREB) transcription factor. By viral vector-mediated modification of genomic DNA, we established germ line-transmitted lines of zebra finches, which exhibited enhanced or suppressed activity of CREB. Although intrinsically acquired vocalizations or their hearing ability were not affected, the transgenic birds showed reduced vocal learning quality of their own songs and impaired audio-memory formation against conspecific songs. These results thus demonstrate that appropriate activity of CREB is necessary for the postnatal acquisition of learned behavior in songbirds, and the CREB transgenic birds offer a unique opportunity to separately manipulate both genetic and environmental factors that impinge on the postnatal song learning. PMID:26048905

  10. Cohesion Establishment Factors Stimulate Endonuclease Activity of hFen1 Independently and Cooperatively.

    PubMed

    Kim, Do-Hyung; Kim, Jeong-Hoon; Park, Byoung Chul; Cho, Sayeon; Park, Sung Goo

    2015-10-01

    Human Fen1 protein (hFen1) plays an important role in Okazaki fragment processing by cleaving the flap structure at the junction between single-stranded (ss) DNA and doublestranded (ds) DNA, an intermediate formed during Okazaki fragment processing, resulting in ligatable nicked dsDNA. It was reported that hChlR1, a member of the cohesion establishment factor family, stimulates hFen1 nuclease activity regardless of its ATPase activity. In this study, we found that cohesion establishment factors cooperatively stimulate endonuclease activity of hFen1 in in vivo mimic condition, including replication protein-A-coated DNA and high salt. Our findings are helpful to explain how a DNA replication machinery larger than the cohesion complex goes through the cohesin ring structure on DNA during S phase in the cell cycle. PMID:26032365

  11. Conformationally restricted elongation factor G retains GTPase activity but is inactive in translocation on the ribosome.

    PubMed

    Peske, F; Matassova, N B; Savelsbergh, A; Rodnina, M V; Wintermeyer, W

    2000-08-01

    Elongation factor G (EF-G) from Escherichia coli is a large, five-domain GTPase that promotes tRNA translocation on the ribosome. Full activity requires GTP hydrolysis, suggesting that a conformational change of the factor is important for function. To restrict the intramolecular mobility, two cysteine residues were engineered into domains 1 and 5 of EF-G that spontaneously formed a disulfide cross-link. Cross-linked EF-G retained GTPase activity on the ribosome, whereas it was inactive in translocation as well as in turnover. Both activities were restored when the cross-link was reversed by reduction. These results strongly argue against a GTPase switch-type model of EF-G function and demonstrate that conformational mobility is an absolute requirement for EF-G function on the ribosome. PMID:10983996

  12. Seizure-Precipitating Factors in Relation to medical Recommendations: Especially Those Limiting Physical Activity.

    PubMed

    Stanuszek, Agnieszka; Wnękowicz, Emilia; Kuźniar, Ewelina; Krakowska, Karolina; Gergont, Aleksandra; Kaciński, Marek

    2015-10-01

    Identification of factors precipitating epileptic seizures should always have practical implications and should always result in special recommendations given to patients. The purpose of our study is to analyze the relation between seizure-triggering factors and restrictive recommendations involving limitation of physical activity in particular. The research group consisted of 407 children hospitalized due to seizures. Their precipitants were identified in 27.5% of the patients. The most common included infection/fever, stress, and flashing lights. Although sport was documented as a precipitant in only 3.4% of all children, 8.1% of the investigated group were recommended to limit physical activity. As some episodes of epileptic seizures are reported to be provoked by sport, multiple restrictions are imposed on children. In the light of the worldwide academic literature and the present study, the recommendation of limiting sports activity is no longer supported. PMID:25808459

  13. Sexual Activity as a Risk Factor for the Spontaneous Rupture of Cerebral Aneurysms.

    PubMed

    Blanke-Roeser, Constantin; Matschke, Jakob; Püschel, Klaus

    2016-06-01

    Subarachnoid hemorrhages from ruptured cerebral aneurysms have a high clinical relevance and often lead to death. Approximately 2% to 5% of the people worldwide, even of younger age, are said to have aneurysms at cerebral arteries. In many cases, they remain clinically unapparent for decades. However, there are numerous risk factors for the rupture of an aneurysm, including temporary raises of the blood pressure. Such changes of the blood pressure can be induced even by several everyday behaviors. For example, any sort of sexual activities may cause extensive raises of the blood pressure because of several physical and psychological factors. The term "sexual activity" covers sexual intercourse as well as masturbation. In this article, the remarkable case of a 24-year-old woman with a ruptured cerebral aneurysm in the context of masturbation is presented. It is discussed with respect to the possible pathophysiological effects of sexual activity on cerebral aneurysms. PMID:27043460

  14. Changes in nonnutritional factors and antioxidant activity during germination of nonconventional legumes.

    PubMed

    Aguilera, Yolanda; Díaz, María Felicia; Jiménez, Tania; Benítez, Vanesa; Herrera, Teresa; Cuadrado, Carmen; Martín-Pedrosa, Mercedes; Martín-Cabrejas, María A

    2013-08-28

    The present study describes the effects of germination on nonnutritional factors and antioxidant activity in the nonconventional legumes Vigna unguiculata (cowpea), Canavalia ensiformis (jack bean), Lablab purpureus (dolichos), and Stizolobium niveum (mucuna). Protease inhibitors and lectins were detected in raw legumes and were significantly decreased during the germination. Regarding total and individual inositol phosphates (IP5-IP3), important reductions of IP6 and high increases in the rest of inositol phosphates were also detected during this process. In addition, total phenols, catechins, and proanthocyanidins increased, accompanied by an overall rise of antioxidant activity (79.6 μmol of Trolox/g of DW in the case of mucuna). Germination has been shown to be a very effective process to reduce nonnutritional factors and increase bioactive phenolic compounds and antioxidant activities of these nonconventional legumes. For this reason, they could be used as ingredients to obtain high-value legume flours for food formulation. PMID:23909570

  15. Tumour necrosis factor-alpha and interferon-gamma synergistically activate the RANTES promoter through nuclear factor kappaB and interferon regulatory factor 1 (IRF-1) transcription factors.

    PubMed

    Lee, A H; Hong, J H; Seo, Y S

    2000-08-15

    Inflammatory cytokines such as tumour necrosis factor-alpha (TNF-alpha) and interferon-gamma (IFN-gamma) synergistically activate expression of the RANTES (regulated upon activation, normal T-cell expressed and secreted) gene, which plays a crucial role in the chemoattraction of leukocytes during the inflammatory response. To understand at the molecular level the mechanism by which the two cytokines activate RANTES gene expression, we determined the requirement of cis-acting elements in the RANTES promoter and trans-acting factors. The murine RANTES promoter contained one putative interferon regulatory factor, IRF, and three putative nuclear factor kappaB (NF-kappaB) binding sites. Specific destruction of the IRF binding site and one of the three NF-kappaB binding sites abolished the inducibility of promoter activity by IFN-gamma and TNF-alpha, respectively. In contrast, mutation of the other two putative NF-kappaB binding sites did not affect RANTES promoter activity significantly. In addition, the RANTES promoter was stimulated by co-transfection of plasmids that expressed either p65, an NF-kappaB family protein, or the IRF-1 transcription factor. RANTES promoters with mutations in the NF-kappaB or IRF binding sites were not stimulated by p65 or IRF-1 expression, respectively. In electrophoretic mobility-shift and immunologic assays, we showed that IRF-1 was induced after cells were treated with IFN-gamma and that NF-kappaB was activated by TNF-alpha treatment. These results demonstrate that both NF-kappaB and IRF-1 transcription factors mediate the induction of RANTES expression via their cognate cis-acting elements when cells are stimulated by TNF-alpha and IFN-gamma. PMID:10926836

  16. Environmental and policy factors related to physical activity in rural white women.

    PubMed

    Eyler, Amy A; Vest, Joshua R

    2002-01-01

    Physical activity is an important aspect of health promotion and disease prevention. However, women often have lower rates of physical activity than men. The purpose of this study was to identify environmental and policy determinants to physical activity among rural white women. Six focus groups were conducted with women aged 20-50 years who were not currently regular exercisers. Women reported that the social environment had a strong impact on physical activity level. Factors of the social environment included guilt, family responsibility, and social support. Environmental and policy barriers such as lack of access to places to exercise and safety concerns were also discussed. Intervention suggestions included family exercise and work-site programs. Information gained from this study can be used to fuel further research and inform future physical activity interventions. PMID:12487144

  17. Silodosin Inhibits Noradrenaline-Activated Transcription Factors Elk1 and SRF in Human Prostate Smooth Muscle

    PubMed Central

    Hennenberg, Martin; Strittmatter, Frank; Beckmann, Christer; Rutz, Beata; Füllhase, Claudius; Waidelich, Raphaela; Montorsi, Francesco; Hedlund, Petter; Andersson, Karl-Erik; Stief, Christian G.; Gratzke, Christian

    2012-01-01

    Background The transcription factors Elk1 and serum response factor (SRF) are central regulators of cell cycle and phenotype in various cell types. Elk1 is activated by phosphorylation (serine-383), while activation of SRF requires its co-factor, myocardin. Activation of Elk1 and SRF results in binding to specific DNA sequences in promoter regions, and may be induced by adrenergic receptor activation in different organs. Objective To examine the effects of adrenergic stimulation on Elk1 and SRF in the human prostate and the ability of the highly selective α1A-adrenoceptor antagonist, silodosin, on transcription factor activation. Methods Prostate tissue was obtained from patients undergoing radical prostatectomy. Expression of Elk1, SRF, and myocardin was estimated by Western blot and immunohistochemistry. Colocalizations were studied by double immunofluorescence staining. Noradrenaline- (NA-) and phenylephrine- (PE-) induced phosphorylation of Elk1 was assessed by Western blot analysis using a phospho-specific antibody. NA-induced activation of Elk1 and SRF was investigated by electrophoretic mobility shift assay (EMSA). Results Immunoreactivity for Elk1, SRF, and myocardin was observed in stromal cells of tissues from each patient. In fluorescence stainings, SRF colocalized with myocardin and α-smooth muscle actin (αSMA). Stimulation of prostate tissues with PE (10 µM) or NA (30 µM) increased the phosphorylation of Elk1 at serine-383. NA-induced Elk1 activation was confirmed by EMSA, where a NA-induced binding of Elk1 to the DNA sequence TTTGCAAAATGCAGGAATTGTTTTCACAGT was observed. Similarly, NA caused SRF binding to the SRF-specific DNA sequence CCATATTAGGCCATATTAGG. Application of silodosin (3 µM) to prostate tissues reduced the activity of Elk1 and SRF in NA-stimulated tissues. Conclusions Silodosin blocks the activation of the two transcription factors, Elk1 and SRF, which is induced by noradrenaline in the human prostate. A role of α1-adrenoceptors

  18. Stimulation of LDL receptor activity in Hep-G2 cells by a serum factor(s)

    SciTech Connect

    Ellsworth, J.L.; Brown, C.; Cooper, A.D.

    1988-05-01

    The regulation of low-density lipoprotein (LDL) receptor activity in the human hepatoma cell line Hep-G2 by serum components was examined. Incubation of dense monolayers of Hep-G2 cells with fresh medium containing 10% fetal calf serum (FM) produced a time-dependent increase in LDL receptor activity. Uptake and degradation of 125I-LDL was stimulated two- to four-fold, as compared with that of Hep-G2 cells cultured in the same media in which they had been grown to confluence (CM); the maximal 125I-LDL uptake plus degradation increased from 0.2 microgram/mg cell protein/4 h to 0.8 microgram/mg cell protein/4 h. In addition, a two-fold increase in cell surface binding of 125I-LDL to Hep-G2 cells was observed when binding was measured at 4 degrees C. There was no change in the apparent Kd. The stimulation of LDL receptor activity was suppressed in a concentration-dependent manner by the addition of cholesterol, as LDL, to the cell medium. In contrast to the stimulation of LDL receptor activity, FM did not affect the uptake or degradation of 125I-asialoorosomucoid. Addition of FM increased the protein content per dish, and DNA synthesis was stimulated approximately five-fold, as measured by (3H)thymidine incorporation into DNA; however, the cell number did not change. Cellular cholesterol biosynthesis was also stimulated by FM; (14C)acetate incorporation into unesterified and esterified cholesterol was increased approximately five-fold. Incubation of Hep-G2 cells with high-density lipoproteins (200 micrograms protein/ml) or albumin (8.0 mg/ml) in the absence of the serum factor did not significantly increase the total processed 125I-LDL. Stimulation of LDL receptor activity was dependent on a heat-stable, nondialyzable serum component that eluted in the inclusion volume of a Sephadex G-75 column.

  19. Contribution of Amino Acid Region 659−663 of Factor Va Heavy Chain to the Activity of Factor Xa within Prothrombinase†,‡

    PubMed Central

    2010-01-01

    Factor Va, the cofactor of prothrombinase, is composed of heavy and light chains associated noncovalently in the presence of divalent metal ions. The COOH-terminal region of the heavy chain contains acidic amino acid clusters that are important for cofactor activity. In this work, we have investigated the role of amino acid region 659−663, which contains five consecutive acidic amino acid residues, by site-directed mutagenesis. We have generated factor V molecules in which all residues were mutated to either lysine (factor V5K) or alanine (factor V5A). We have also constructed a mutant molecule with this region deleted (factor VΔ659−663). The recombinant molecules along with wild-type factor V (factor VWT) were transiently expressed in mammalian cells, purified, and assessed for cofactor activity. Two-stage clotting assays revealed that the mutant molecules had reduced clotting activities compared to that of factor VaWT. Kinetic analyses of prothrombinase assembled with the mutant molecules demonstrated diminished kcat values, while the affinity of all mutant molecules for factor Xa was similar to that for factor VaWT. Gel electrophoresis analyses of plasma-derived and recombinant mutant prothrombin activation demonstrated delayed cleavage of prothrombin at both Arg320 and Arg271 by prothrombinase assembled with the mutant molecules, resulting in meizothrombin lingering throughout the activation process. These results were confirmed after analysis of the cleavage of FPR-meizothrombin. Our findings provide new insights into the structural contribution of the acidic COOH-terminal region of factor Va heavy chain to factor Xa activity within prothrombinase and demonstrate that amino acid region 659−663 from the heavy chain of the cofactor contributes to the regulation of the rate of cleavage of prothrombin by prothrombinase. PMID:20722419

  20. The Michoud Assembly Facility (MAF)

    NASA Technical Reports Server (NTRS)

    2000-01-01

    NASA's Michoud Assembly Facility, located in eastern New Orleans, Louisiana, is an 832 acre site that is a government-owned, contractor-operated component of the George C. Marshall Space Flight Center (MSFC). The facility was acquired by NASA in 1961 at the recommendation of Dr. Wernher von Braun and his rocket team in Huntsville Alabama. The cavernous plant served as the assembly facility for the Saturn launch vehicles and most recently the external tank (ET) used for the Space Shuttle Program. The facility features one of the world's biggest manufacturing plants with 43 acres under one roof and a port with deep-water access for the transportation of large space structures. When completed, space hardware is towed on a barge across the Gulf of Mexico, around Florida and up to Kennedy Space Center. The original tract of land was part of a 34,500 acre French Royal land grant to local merchant, Gilbert Antoine de St. Maxent in 1763. Later, the land was acquired by French transplant Antoine Michoud, the son of Napoleon's Administrator of Domains, who moved to the city in 1827. Michoud operated a sugar cane plantation and refinery on the site until his death in 1863. His heirs continued operating the refinery and kept the original St. Maxent estate intact into the 20th century. Two brick smokestacks from the original refinery still stand before the Michoud facility today.

  1. The Michoud Assembly Facility (MAF)

    NASA Technical Reports Server (NTRS)

    2000-01-01

    NASA's Michoud Assembly Facility, located in eastern New Orleans, Louisiana, is an 832 acre site that is a government-owned, contractor-operated component of the George C. Marshall Space Flight Center (MSFC). The facility was acquired by NASA in 1961 at the recommendation of Dr. Wernher von Braun and his rocket team in Huntsville Alabama. The cavernous plant served as the assembly facility for the Saturn launch vehicles and most recently the external tank (ET) used for the Space Shuttle Program. The facility features one of the world's biggest manufacturing plants with 43 acres under one roof and a port with deep-water access for the transportation of large space structures. When completed, space hardware is towed on a barge across the Gulf of Mexico, around Florida and up to Kennedy Space Center. The original tract of land was part of a 34,500 acre French Royal land grant to local merchant, Gilbert Antoine de St. Maxent in 1763. Later, the land was acquired by French transplant Antoine Michoud, the son of Napoleon's Administrator of Domains, who moved to the city in 1827. Michoud operated a sugar cane plantation and refinery on the site until his death in 1863. His heirs continued operating the refinery and kept the original St. Maxent estate intact into the 20th century. Visible on the right, is one of two brick smokestacks from the original refinery that still stand before the Michoud facility today.

  2. Adherence to Physical Activity Recommendations and Its Associated Factors: An Interregional Population-Based Study

    PubMed Central

    Alkerwi, Ala’a; Schuh, Barbara; Sauvageot, Nicolas; Zannad, Faiez; Olivier, Arnaud; Guillaume, Michèle; Albert, Adelin; Larsson, Charlotte A.

    2015-01-01

    Background Though the influence of physical activity in preventing cardiovascular diseases is well documented, only a few comparative studies have determined the degree of adherence to physical activity recommendations among populations and identified the demographic, socioeco-nomic, behavioural and health-related factors associated with good compliance. Design and methods Cross-sectional interregional NESCaV survey of 3133 subjects compared three populations, Luxembourg, Lorraine (France) and Wallonia (Belgium), by using the International Physical Activity Questionnaire. Age and gender prevalence rates of physical activity were standardized to the European population. Results The likelihood to meet the recommendations was higher in Luxembourg, after adjustment for age, gender, education, employment, weight status, morbidity score, health perception and level of importance attributed to the practice of physical activity (P<0.0001). The odds for meeting the recommendations were significantly higher among those with secondary than tertiary education. Compared to good self-health perception, subjects with poor or fair self-perceived health were less likely to meet the recommendations; this also applied to those attributing little or enough importance to physical activity compared with great importance. Conclusions Region, education, self-perceived health and perception of importance of physical activity were emerged as independent determinants of meeting the recommendations. Awareness of the positive health effects of physical activity might thus be crucial for motivating the people to become more active. Further research is needed to explore potential region-specific factors which might explain the difference in population behaviours with respect to physical activity. Significance for public health This manuscript describes the prevalence of physical activity level of adult population from three European regions, Luxembourg, Wallonia and Lorraine, based on the

  3. Reduction of contact activation related fibrinolytic activity in factor XII deficient patients. Further evidence for the role of the contact system in fibrinolysis in vivo.

    PubMed Central

    Levi, M; Hack, C E; de Boer, J P; Brandjes, D P; Büller, H R; ten Cate, J W

    1991-01-01

    In this study the contribution of activation of the contact system to activation of the fibrinolytic system in vivo was investigated in healthy volunteers and in factor XII deficient patients. The plasminogen activating activity in plasma from healthy volunteers after infusion of desamino D-arginine vasopressin (DDAVP) was only partially blocked (for 77%) with specific antibodies to tissue-type plasminogen activator and urokinase type plasminogen activator. The residual activity could be quenched by a monoclonal antibody that inhibits factor XII activity and was not present in patients with a factor XII deficiency. The formation of plasmin upon the DDAVP stimulus as reflected by circulating plasmin-alpha 2-antiplasmin complexes was lower in factor XII deficient patients than in healthy volunteers. Activation of the contact system occurred after DDAVP infusion in healthy volunteers and was absent in factor XII deficient patients. These results indicate that DDAVP induces a plasminogen activating activity that is partially dependent on activation of the contact system and that contributes to the overall fibrinolytic activity as indicated by the formation of plasmin-alpha 2-antiplasmin complexes. This fibrinolytic activity is impaired in factor XII deficient patients which may explain the occurrence of thromboembolic complications in these patients. Images PMID:1833421

  4. On involvement of transcription factors nuclear factor kappa-light-chain-enhancer of activated B cells, activator protein-1 and signal transducer and activator of transcription-3 in photodynamic therapy-induced death of crayfish neurons and satellite glial cells.

    PubMed

    Berezhnaya, Elena; Neginskaya, Marya; Kovaleva, Vera; Sharifulina, Svetlana; Ischenko, Irina; Komandirov, Maxim; Rudkovskii, Mikhail; Uzdensky, Anatoly B

    2015-07-01

    Photodynamic therapy (PDT) is currently used in the treatment of brain tumors. However, not only malignant cells but also neighboring normal neurons and glial cells are damaged during PDT. In order to study the potential role of transcription factors-nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB), activator protein (AP-1), and signal transducer and activator of transcription-3 (STAT-3)-in photodynamic injury of normal neurons and glia, we photosensitized the isolated crayfish mechanoreceptor consisting of a single sensory neuron enveloped by glial cells. Application of different inhibitors and activators showed that transcription factors NF-κB (inhibitors caffeic acid phenethyl ester and parthenolide, activator betulinic acid), AP-1 (inhibitor SR11302), and STAT-3 (inhibitors stattic and cucurbitacine) influenced PDT-induced death and survival of neurons and glial cells in different ways. These experiments indicated involvement of NF-κB in PDT-induced necrosis of neurons and apoptosis of glial cells. However, in glial cells, it played the antinecrotic role. AP-1 was not involved in PDT-induced necrosis of neurons and glia, but mediated glial apoptosis. STAT-3 was involved in PDT-induced apoptosis of glial cells and necrosis of neurons and glia. Therefore, signaling pathways that regulate cell death and survival in neurons and glial cells are different. Using various inhibitors or activators of transcription factors, one can differently influence the sensitivity and resistance of neurons and glial cells to PDT. PMID:26160345

  5. On involvement of transcription factors nuclear factor kappa-light-chain-enhancer of activated B cells, activator protein-1 and signal transducer and activator of transcription-3 in photodynamic therapy-induced death of crayfish neurons and satellite glial cells

    NASA Astrophysics Data System (ADS)

    Berezhnaya, Elena; Neginskaya, Marya; Kovaleva, Vera; Sharifulina, Svetlana; Ischenko, Irina; Komandirov, Maxim; Rudkovskii, Mikhail; Uzdensky, Anatoly B.

    2015-07-01

    Photodynamic therapy (PDT) is currently used in the treatment of brain tumors. However, not only malignant cells but also neighboring normal neurons and glial cells are damaged during PDT. In order to study the potential role of transcription factors-nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB), activator protein (AP-1), and signal transducer and activator of transcription-3 (STAT-3)-in photodynamic injury of normal neurons and glia, we photosensitized the isolated crayfish mechanoreceptor consisting of a single sensory neuron enveloped by glial cells. Application of different inhibitors and activators showed that transcription factors NF-κB (inhibitors caffeic acid phenethyl ester and parthenolide, activator betulinic acid), AP-1 (inhibitor SR11302), and STAT-3 (inhibitors stattic and cucurbitacine) influenced PDT-induced death and survival of neurons and glial cells in different ways. These experiments indicated involvement of NF-κB in PDT-induced necrosis of neurons and apoptosis of glial cells. However, in glial cells, it played the antinecrotic role. AP-1 was not involved in PDT-induced necrosis of neurons and glia, but mediated glial apoptosis. STAT-3 was involved in PDT-induced apoptosis of glial cells and necrosis of neurons and glia. Therefore, signaling pathways that regulate cell death and survival in neurons and glial cells are different. Using various inhibitors or activators of transcription factors, one can differently influence the sensitivity and resistance of neurons and glial cells to PDT.

  6. SUMOylation can regulate the activity of ETS-like transcription factor 4.

    PubMed

    Kaikkonen, Sanna; Makkonen, Harri; Rytinki, Miia; Palvimo, Jorma J

    2010-08-01

    ETS-like transcription factor 4 (ELK4) (a.k.a. serum response factor accessory protein 1) belongs to the ternary complex factor (TCF) subfamily of E twenty-six (ETS) domain transcription factors. Compared to the other TCF subfamily members, ELK1 and ELK3 (NET), there is limited information of the mechanisms regulating the ELK4 activity. Here, we show that the ELK4 can be covalently modified (SUMOylated) by small ubiquitin-related modifier (SUMO) 1 protein, an important regulator of signaling and transcription. SUMOylation of ELK4 was reversed by SUMO-specific proteases (SENP) 1 and 2 and stimulated by SUMO E3 ligase PIAS3. Conserved lysine residue 167 that is located in the NET inhibitory domain of ELK4 was identified as the main site of SUMO-1 conjugation. Interestingly, mutation of the K167 disrupting the SUMOylation markedly enhanced the transcriptional activity of the ELK4, but weakened its repressive function on c-fos promoter. In conclusion, our results suggest that covalent modification by SUMO-1 can regulate the activity of ELK4, contributing to the transcriptional repression by the ELK4. PMID:20637912

  7. Mutational analysis of acute-phase response factor/Stat3 activation and dimerization.

    PubMed Central

    Sasse, J; Hemmann, U; Schwartz, C; Schniertshauer, U; Heesel, B; Landgraf, C; Schneider-Mergener, J; Heinrich, P C; Horn, F

    1997-01-01

    Signal transducer and transcription (STAT) factors are activated by tyrosine phosphorylation in response to a variety of cytokines, growth factors, and hormones. Tyrosine phosphorylation triggers dimerization and nuclear translocation of these transcription factors. In this study, the functional role of carboxy-terminal portions of the STAT family member acute-phase response factor/Stat3 in activation, dimerization, and transactivating potential was analyzed. We demonstrate that truncation of 55 carboxy-terminal amino acids causes constitutive activation of Stat3 in COS-7 cells, as is known for the Stat3 isoform Stat3beta. By the use of deletion and point mutants, it is shown that both carboxy- and amino-terminal portions of Stat3 are involved in this phenomenon. Dimerization of Stat3 was blocked by point mutations affecting residues both in the vicinity of the tyrosine phosphorylation site (Y705) and more distant from this site, suggesting that multiple interactions are involved in dimer formation. Furthermore, by reporter gene assays we demonstrate that carboxy-terminally truncated Stat3 proteins are incapable of transactivating an interleukin-6-responsive promoter in COS-7 cells. In HepG2 hepatoma cells, however, these truncated Stat3 forms transmit signals from the interleukin-6 signal transducer gp130 equally well as does full-length Stat3. We conclude that, dependent on the cell type, different mechanisms allow Stat3 to regulate target gene transcription either with or without involvement of its putative carboxy-terminal transactivation domain. PMID:9234724

  8. The yeast Hot1 transcription factor is critical for activating a single target gene, STL1

    PubMed Central

    Bai, Chen; Tesker, Masha; Engelberg, David

    2015-01-01

    Transcription factors are commonly activated by signal transduction cascades and induce expression of many genes. They therefore play critical roles in determining the cell's fate. The yeast Hog1 MAP kinase pathway is believed to control the transcription of hundreds of genes via several transcription factors. To identify the bona fide target genes of Hog1, we inducibly expressed the spontaneously active variant Hog1D170A+F318L in cells lacking the Hog1 activator Pbs2. This system allowed monitoring the effects of Hog1 by itself. Expression of Hog1D170A+F318L in pbs2∆ cells imposed induction of just 105 and suppression of only 26 transcripts by at least twofold. We looked for the Hog1-responsive element within the promoter of the most highly induced gene, STL1 (88-fold). A novel Hog1 responsive element (HoRE) was identified and shown to be the direct target of the transcription factor Hot1. Unexpectedly, we could not find this HoRE in any other yeast promoter. In addition, the only gene whose expression was abolished in hot1∆ cells was STL1. Thus Hot1 is essential for transcription of just one gene, STL1. Hot1 may represent a class of transcription factors that are essential for transcription of a very few genes or even just one. PMID:25904326

  9. RNA Helicase Important for Listeria monocytogenes Hemolytic Activity and Virulence Factor Expression

    PubMed Central

    Netterling, Sakura; Bäreclev, Caroline; Vaitkevicius, Karolis

    2015-01-01

    RNA helicases have been shown to be important for the function of RNA molecules at several levels, although their putative involvement in microbial pathogenesis has remained elusive. We have previously shown that Listeria monocytogenes DExD-box RNA helicases are important for bacterial growth, motility, ribosomal maturation, and rRNA processing. We assessed the importance of the RNA helicase Lmo0866 (here named CshA) for expression of virulence traits. We observed a reduction in hemolytic activity in a strain lacking CshA compared to the wild type. This phenomenon was less evident in strains lacking other RNA helicases. The reduced hemolysis was accompanied by lower expression of major listerial virulence factors in the ΔcshA strain, mainly listeriolysin O, but also to some degree the actin polymerizing factor ActA. Reduced expression of these virulence factors in the strain lacking CshA did not, however, correlate with a decreased level of the virulence regulator PrfA. When combining the ΔcshA knockout with a mutation creating a constitutively active PrfA protein (PrfA*), the effect of the ΔcshA knockout on LLO expression was negated. These data suggest a role for the RNA helicase CshA in posttranslational activation of PrfA. Surprisingly, although the expression of several virulence factors was reduced, the ΔcshA strain did not demonstrate any reduced ability to infect nonphagocytic cells compared to the wild-type strain. PMID:26483402

  10. Neuroprotective effects of physical activity on the brain: a closer look at trophic factor signaling

    PubMed Central

    Phillips, Cristy; Baktir, Mehmet Akif; Srivatsan, Malathi; Salehi, Ahmad

    2014-01-01

    While the relationship between increased physical activity and cognitive ability has been conjectured for centuries, only recently have the mechanisms underlying this relationship began to emerge. Convergent evidence suggests that physical activity offers an affordable and effective method to improve cognitive function in all ages, particularly the elderly who are most vulnerable to neurodegenerative disorders. In addition to improving cardiac and immune function, physical activity alters trophic factor signaling and, in turn, neuronal function and structure in areas critical for cognition. Sustained exercise plays a role in modulating anti-inflammatory effects and may play a role in preserving cognitive function in aging and neuropathological conditions. Moreover, recent evidence suggests that myokines released by exercising muscles affect the expression of brain-derived neurotrophic factor synthesis in the dentate gyrus of the hippocampus, a finding that could lead to the identification of new and therapeutically important mediating factors. Given the growing number of individuals with cognitive impairments worldwide, a better understanding of how these factors contribute to cognition is imperative, and constitutes an important first step toward developing non-pharmacological therapeutic strategies to improve cognition in vulnerable populations. PMID:24999318

  11. Transcription factor expression in lipopolysaccharide-activated peripheral-blood-derived mononuclear cells

    PubMed Central

    Roach, Jared C.; Smith, Kelly D.; Strobe, Katie L.; Nissen, Stephanie M.; Haudenschild, Christian D.; Zhou, Daixing; Vasicek, Thomas J.; Held, G. A.; Stolovitzky, Gustavo A.; Hood, Leroy E.; Aderem, Alan

    2007-01-01

    Transcription factors play a key role in integrating and modulating biological information. In this study, we comprehensively measured the changing abundances of mRNAs over a time course of activation of human peripheral-blood-derived mononuclear cells (“macrophages”) with lipopolysaccharide. Global and dynamic analysis of transcription factors in response to a physiological stimulus has yet to be achieved in a human system, and our efforts significantly advanced this goal. We used multiple global high-throughput technologies for measuring mRNA levels, including massively parallel signature sequencing and GeneChip microarrays. We identified 92 of 1,288 known human transcription factors as having significantly measurable changes during our 24-h time course. At least 42 of these changes were previously unidentified in this system. Our data demonstrate that some transcription factors operate in a functional range below 10 transcripts per cell, whereas others operate in a range three orders of magnitude greater. The highly reproducible response of many mRNAs indicates feedback control. A broad range of activation kinetics was observed; thus, combinatorial regulation by small subsets of transcription factors would permit almost any timing input to cis-regulatory elements controlling gene transcription. PMID:17913878

  12. Glypican-1 nanoliposomes for potentiating growth factor activity in therapeutic angiogenesis.

    PubMed

    Monteforte, Anthony J; Lam, Brian; Das, Subhamoy; Mukhopadhyay, Somshuvra; Wright, Catherine S; Martin, Patricia E; Dunn, Andrew K; Baker, Aaron B

    2016-07-01

    Therapeutic angiogenesis is a highly appealing concept for treating tissues that become ischemic due to vascular disease. A major barrier to the clinical translation of angiogenic therapies is that the patients that are in the greatest need of these treatments often have long term disease states and co-morbidities, such as diabetes and obesity, that make them resistant to angiogenic stimuli. In this study, we identified that human patients with type 2 diabetes have reduced levels of glypican-1 in the blood vessels of their skin. The lack of this key co-receptor in the tissue may make the application of exogenous angiogenic growth factors or cell therapies ineffective. We created a novel therapeutic enhancer for growth factor activity consisting of glypican-1 delivered in a nanoliposomal carrier (a "glypisome"). Here, we demonstrate that glypisomes enhance FGF-2 mediated endothelial cell proliferation, migration and tube formation. In addition, glypisomes enhance FGF-2 trafficking by increasing both uptake and endosomal processing. We encapsulated FGF-2 or FGF-2 with glypisomes in alginate beads and used these to deliver localized growth factor therapy in a murine hind limb ischemia model. Co-delivery of glypisomes with FGF-2 markedly increased the recovery of perfusion and vessel formation in ischemic hind limbs of wild type and diabetic mice in comparison to mice treated with FGF-2 alone. Together, our findings support that glypisomes are effective means for enhancing growth factor activity and may improve the response to local angiogenic growth factor therapies for ischemia. PMID:27101205

  13. Novel Risk Factors of Cardiovascular Disease and Their Associations Between Obesity, Physical Activity And Physical Fitness

    PubMed Central

    Buchan, Duncan S.; Thomas, Non E.; Baker, Julien S.

    2012-01-01

    The prevalence of cardiovascular disease (CVD) is increasing around the globe and is the leading cause of death around the world. Though once thought of as an adult problem, it is now recognised that the early manifestations of disease may occur during childhood. Numerous risk factors have been linked to CVD with much of the research focusing on understanding the prevalence and relationship of traditional risk factors such as dyslipidemia, smoking, diabetes mellitus, hypertension, obesity, psychosocial stress, poor diet, physical inactivity and alcohol consumption to the early etiology of disease. While this line of investigation has greatly enhanced our understanding of the relationship between these risk factors and disease, they do not fully explain all cardiovascular events. To enhance our understanding and help with the management of CVD, investigations that involve the measurement of traditional as well as novel risk factors may be necessary. Public health strategies that aim to reduce the prevalence of obesity and overweight encourage youth to increase their physical activity levels as a means of protecting against poor cardiometabolic profiles. Interventions that increase physical activity levels and improve cardiorespiratory fitness cause a reduction in certain CVD risk factors but the lack of agreement between findings makes it impossible to give precise recommendations that will ensure CVD risk reduction. Yet it is important that research continues in order to establish the most appropriate means of improving the health and well-being of those at most risk of future CVD. PMID:25170447

  14. Trajectories of Organized Activity Participation Among Urban Adolescents: An Analysis of Predisposing Factors.

    PubMed

    Eisman, Andria B; Stoddard, Sarah A; Bauermeister, José A; Caldwell, Cleopatra H; Zimmerman, Marc A

    2016-01-01

    Organized activity participation provides important opportunities for adolescents to develop assets and resources related to positive youth development. Predisposing factors, in addition to sociodemographics and self-selection factors, may influence how youth participate over time. In this study, we used growth mixture modeling with longitudinal data from African American adolescents attending urban high schools in Flint, MI to identify subgroups of participation trajectories (Wave 1 N = 681, mean age at Wave 1 = 14.86 years, 51% female). We measured activity participation using psychological and behavioral engagement across multiple contexts over the 4 years of high school. We examined how predisposing risk and promotive factors were related to these trajectories, accounting for sociodemographic and self-selection factors. The results indicated three participation trajectories: a low group decreasing over time (74%), a moderate, consistent participation group (21%) and a moderate, increasing group (5%). More substance use was associated with lower odds of being in the moderate/consistent versus low/decreasing participation group. More parental support was associated with lower odds of being in the moderate/increasing versus the moderate/consistent group. Our results suggest that addressing predisposing factors such as substance use may help facilitate participation over time. PMID:25735866

  15. Activated STAT1 Transcription Factors Conduct Distinct Saltatory Movements in the Cell Nucleus

    PubMed Central

    Speil, Jasmin; Baumgart, Eugen; Siebrasse, Jan-Peter; Veith, Roman; Vinkemeier, Uwe; Kubitscheck, Ulrich

    2011-01-01

    The activation of STAT transcription factors is a critical determinant of their subcellular distribution and their ability to regulate gene expression. Yet, it is not known how activation affects the behavior of individual STAT molecules in the cytoplasm and nucleus. To investigate this issue, we injected fluorescently labeled STAT1 in living HeLa cells and traced them by single-molecule microscopy. We determined that STAT1 moved stochastically in the cytoplasm and nucleus with very short residence times (<0.03 s) before activation. Upon activation, STAT1 mobility in the cytoplasm decreased ∼2.5-fold, indicating reduced movement of STAT1/importinα/β complexes to the nucleus. In the nucleus, activated STAT1 displayed a distinct saltatory mobility, with residence times of up to 5 s and intermittent diffusive motion. In this manner, activated STAT1 factors can occupy their putative chromatin target sites within ∼2 s. These results provide a better understanding of the timescales on which cellular signaling and regulated gene transcription operate at the single-molecule level. PMID:22261046

  16. Activation of Hypoxia Inducible Factor 1 Is a General Phenomenon in Infections with Human Pathogens

    PubMed Central

    Werth, Nadine; Beerlage, Christiane; Rosenberger, Christian; Yazdi, Amir S.; Edelmann, Markus; Amr, Amro; Bernhardt, Wanja; von Eiff, Christof; Becker, Karsten; Schäfer, Andrea; Peschel, Andreas; Kempf, Volkhard A. J.

    2010-01-01

    Background Hypoxia inducible factor (HIF)-1 is the key transcriptional factor involved in the adaptation process of cells and organisms to hypoxia. Recent findings suggest that HIF-1 plays also a crucial role in inflammatory and infectious diseases. Methodology/Principal Findings Using patient skin biopsies, cell culture and murine infection models, HIF-1 activation was determined by immunohistochemistry, immunoblotting and reporter gene assays and was linked to cellular oxygen consumption. The course of a S. aureus peritonitis was determined upon pharmacological HIF-1 inhibition. Activation of HIF-1 was detectable (i) in all ex vivo in biopsies of patients suffering from skin infections, (ii) in vitro using cell culture infection models and (iii) in vivo using murine intravenous and peritoneal S. aureus infection models. HIF-1 activation by human pathogens was induced by oxygen-dependent mechanisms. Small colony variants (SCVs) of S. aureus known to cause chronic infections did not result in cellular hypoxia nor in HIF-1 activation. Pharmaceutical inhibition of HIF-1 activation resulted in increased survival rates of mice suffering from a S. aureus peritonitis. Conclusions/Significance Activation of HIF-1 is a general phenomenon in infections with human pathogenic bacteria, viruses, fungi and protozoa. HIF-1-regulated pathways might be an attractive target to modulate the course of life-threatening infections. PMID:20644645

  17. Selective constraints on the activation domain of transcription factor Pit-1.

    PubMed Central

    Majumdar, S; Irwin, D M; Elsholtz, H P

    1996-01-01

    The POU transcription factor Pit-1 activates members of the prolactin/growth hormone gene family in specific endocrine cell types of the pituitary gland. Although Pit-1 is structurally conserved among vertebrate species, evolutionary changes in the pattern of Pit-1 RNA splicing have led to a notable "contraction" of the transactivation domain in the mammalian lineage, relative to Pit-1 in salmonid fish. By site-directed mutagenesis we demonstrate that two splice insertions in salmon Pit-1, called beta (29 aa) and gamma (33 aa), are critical for cooperative activation of the salmon prolactin gene. Paradoxically, Pit-1-dependent activation of the prolactin gene in rat is enhanced in the absence of the homologous beta-insert sequence. This apparent divergence in the mechanism of activation of prolactin genes by Pit-1 is target gene specific, as activation of rat and salmon growth hormone genes by Pit-1 splice variants is entirely conserved. Our data suggest that efficient activation of the prolactin gene in the vertebrate pituitary has significantly constrained the pattern of splicing within the Pit-1 transactivation domain. Rapid evolutionary divergence of prolactin gene function may have demanded changes in Pit-1/protein interactions to accommodate new patterns of transcriptional control by developmental or physiological factors. Images Fig. 2 Fig. 3 Fig. 4 PMID:8816787

  18. Platelet-Activating Factor Induces Epigenetic Modifications in Human Mast Cells.

    PubMed

    Damiani, Elisabetta; Puebla-Osorio, Nahum; Gorbea, Enrique; Ullrich, Stephen E

    2015-12-01

    UV radiation-induced systemic immune suppression is a major risk factor for skin cancer induction. The migration of dermal mast cells from the skin to the draining lymph nodes has a prominent role in activating systemic immune suppression. UV-induced keratinocyte-derived platelet-activating factor (PAF) activates mast cell migration, in part by upregulating the expression of CXCR4 on the surface of mast cells. Others have indicated that epigenetic mechanisms regulate CXCR4 expression; therefore, we asked whether PAF activates epigenetic mechanisms in mast cells. Human mast cells were treated with PAF, and the effect on DNA methylation and/or acetylation was measured. PAF suppressed the expression of DNA methyltransferase (DNMT) 1 and 3b. On the other hand, PAF increased p300 histone acetyltransferase expression, and the acetylation of histone H3, which coincided with a decreased expression of the histone deacetylase HDAC2. Chromatin immunoprecipitation assays indicated that PAF treatment activated the acetylation of the CXCR4 promoter. Finally, inhibiting histone acetylation blocked p300 upregulation and suppressed PAF-induced surface expression of CXCR4. Our findings suggest a novel molecular mechanism for PAF, activation of epigenetic modifications. We suggest that PAF may serve as an endogenous molecular mediator that links the environment (UV radiation) with the epigenome. PMID:26316070

  19. Platelet-Activating Factor Induces Epigenetic Modifications in Human Mast Cells

    PubMed Central

    Gorbea, Enrique; Ullrich, Stephen E.

    2015-01-01

    Ultraviolet (UV) radiation-induced systemic immune suppression is a major risk factor for skin cancer induction. The migration of dermal mast cells from the skin to the draining lymph nodes plays a prominent role in activating systemic immune suppression. UV-induced keratinocyte-derived platelet-activating factor (PAF) activates mast cell migration, in part by up regulating the expression of CXCR4 on the surface of mast cells. Others have indicated that epigenetic mechanisms regulate CXCR4 expression, so we asked whether PAF activates epigenetic mechanisms in mast cells. Human mast cells were treated with PAF and the effect on DNA methylation and/or acetylation was measured. PAF suppressed the expression of DNA methyltransferase (DNMT) 1 and 3b. On the other hand, PAF increased p300 histone acetyltransferase expression, and the acetylation of histone H3, which coincided with a decreased expression of the histone deacetylase HDAC2. Chromatin immunoprecipitation assays indicated that PAF-treatment activated the acetylation of the CXCR4 promoter. Finally, inhibiting histone acetylation blocked p300 up-regulation and suppressed PAF-induced surface expression of CXCR4. Our findings suggest a novel molecular mechanism for PAF, activation of epigenetic modifications. We suggest that PAF may serve as an endogenous molecular mediator that links the environment (UV radiation) with the epigenome. PMID:26316070

  20. New Insights into Butyrylcholinesterase Activity Assay: Serum Dilution Factor as a Crucial Parameter

    PubMed Central

    Jońca, Joanna; Żuk, Monika; Wasąg, Bartosz; Janaszak-Jasiecka, Anna; Lewandowski, Krzysztof; Wielgomas, Bartosz; Waleron, Krzysztof; Jasiecki, Jacek

    2015-01-01

    Butyrylcholinesterase (BChE) activity assay and inhibitor phenotyping can help to identify patients at risk of prolonged paralysis following the administration of neuromuscular blocking agents. The assay plays an important role in clinical chemistry as a good diagnostic marker for intoxication with pesticides and nerve agents. Furthermore, the assay is also commonly used for in vitro characterization of cholinesterases, their toxins and drugs. There is still lack of standardized procedure for measurement of BChE activity and many laboratories use different substrates at various concentrations. The purpose of this study was to validate the BChE activity assay to determine the best dilution of human serum and the most optimal concentration of substrates and inhibitors. Serum BChE activity was measured using modified Ellman’s method applicable for a microplate reader. We present our experience and new insights into the protocol for high-throughput routine assays of human plasma cholinesterase activities adapted to a microplate reader. During our routine assays used for the determination of BChE activity, we have observed that serum dilution factor influences the results obtained. We show that a 400-fold dilution of serum and 5mM S-butyrylthiocholine iodide can be successfully used for the accurate measurement of BChE activity in human serum. We also discuss usage of various concentrations of dibucaine and fluoride in BChE phenotyping. This study indicates that some factors of such a multicomponent clinical material like serum can influence kinetic parameters of the BChE. The observed inhibitory effect is dependent on serum dilution factor used in the assay. PMID:26444431

  1. New Insights into Butyrylcholinesterase Activity Assay: Serum Dilution Factor as a Crucial Parameter.

    PubMed

    Jońca, Joanna; Żuk, Monika; Wasąg, Bartosz; Janaszak-Jasiecka, Anna; Lewandowski, Krzysztof; Wielgomas, Bartosz; Waleron, Krzysztof; Jasiecki, Jacek

    2015-01-01

    Butyrylcholinesterase (BChE) activity assay and inhibitor phenotyping can help to identify patients at risk of prolonged paralysis following the administration of neuromuscular blocking agents. The assay plays an important role in clinical chemistry as a good diagnostic marker for intoxication with pesticides and nerve agents. Furthermore, the assay is also commonly used for in vitro characterization of cholinesterases, their toxins and drugs. There is still lack of standardized procedure for measurement of BChE activity and many laboratories use different substrates at various concentrations. The purpose of this study was to validate the BChE activity assay to determine the best dilution of human serum and the most optimal concentration of substrates and inhibitors. Serum BChE activity was measured using modified Ellman's method applicable for a microplate reader. We present our experience and new insights into the protocol for high-throughput routine assays of human plasma cholinesterase activities adapted to a microplate reader. During our routine assays used for the determination of BChE activity, we have observed that serum dilution factor influences the results obtained. We show that a 400-fold dilution of serum and 5mM S-butyrylthiocholine iodide can be successfully used for the accurate measurement of BChE activity in human serum. We also discuss usage of various concentrations of dibucaine and fluoride in BChE phenotyping. This study indicates that some factors of such a multicomponent clinical material like serum can influence kinetic parameters of the BChE. The observed inhibitory effect is dependent on serum dilution factor used in the assay. PMID:26444431

  2. Weight-activity associations with cardiometabolic risk factors among U.S. youth.

    PubMed

    Loprinzi, Paul D; Tudor-Locke, Catrine

    2015-10-01

    Research among adult populations suggests that underweight is associated with worse cardiometabolic health and that adequate engagement in moderate-to-vigorous physical activity (MVPA) may help to counteract the cardiometabolic consequences of overweight/obesity. Whether these findings are also true in children and adolescents (hereafter 'youth') is unknown. Therefore, the purpose of this study was to determine whether underweight and overweight/obese youth who engage in relatively more MVPA have better or similar cardiometabolic risk factors than normal weight youth who engage in relatively less MVPA. Data were extracted from the 2003-2006 National Health and Nutrition Examination Survey (N=2268). Four cardiometabolic risk factors assessed included C-reactive protein, mean arterial pressure, total cholesterol, and high-density lipoprotein (HDL) cholesterol. Weight status was assessed via dual energy X-ray absorptiometry. MVPA was assessed via accelerometry. Six weight-activity groups were created: 1) Underweight and Inactive; 2) Normal Weight and Inactive; 3) Overweight/Obese and Inactive; 4) Underweight and Active; 5) Normal Weight and Active; and, 6) Overweight/Obese and Active. An overall cardiometabolic risk score was calculated by summing the frequency with which each individual participant scored in the worst quartile for each of the 4 cardiometabolic parameters. Compared to those who were Normal Weight and Inactive, youth who were Underweight and Active (β=-0.05, p=0.78) had a similar overall cardiometabolic risk score. In contrast, Overweight/Obese and Active youth (β=1.1, p<0.001) had a higher overall cardiometabolic risk score when compared to Normal Weight and Inactive youth. These cross-sectional findings suggest that MVPA may not fully counteract the cardiometabolic consequences of overweight/obesity in youth. Rather, maintaining a normal weight may be of a more important factor related to cardiometabolic risk in youth. PMID:26056077

  3. Activation of archaeal transcription mediated by recruitment of transcription factor B.

    PubMed

    Ochs, Simon M; Thumann, Sybille; Richau, Renate; Weirauch, Matt T; Lowe, Todd M; Thomm, Michael; Hausner, Winfried

    2012-05-25

    Archaeal promoters consist of a TATA box and a purine-rich adjacent upstream sequence (transcription factor B (TFB)-responsive element (BRE)), which are bound by the transcription factors TATA box-binding protein (TBP) and TFB. Currently, only a few activators of archaeal transcription have been experimentally characterized. The best studied activator, Ptr2, mediates activation by recruitment of TBP. Here, we present a detailed biochemical analysis of an archaeal transcriptional activator, PF1088, which was identified in Pyrococcus furiosus by a bioinformatic approach. Operon predictions suggested that an upstream gene, pf1089, is polycistronically transcribed with pf1088. We demonstrate that PF1088 stimulates in vitro transcription by up to 7-fold when the pf1089 promoter is used as a template. By DNase I and hydroxyl radical footprinting experiments, we show that the binding site of PF1088 is located directly upstream of the BRE of pf1089. Mutational analysis indicated that activation requires the presence of the binding site for PF1088. Furthermore, we show that activation of transcription by PF1088 is dependent upon the presence of an imperfect BRE and is abolished when the pf1089 BRE is replaced with a BRE from a strong archaeal promoter. Gel shift experiments showed that TFB recruitment to the pf1089 operon is stimulated by PF1088, and TFB seems to stabilize PF1088 operator binding even in the absence of TBP. Taken together, these results represent the first biochemical evidence for a transcriptional activator working as a TFB recruitment factor in Archaea, for which the designation TFB-RF1 is suggested. PMID:22496454

  4. Salicylates Inhibit Flavivirus Replication Independently of Blocking Nuclear Factor Kappa B Activation

    PubMed Central

    Liao, Ching-Len; Lin, Yi-Ling; Wu, Bi-Ching; Tsao, Chang-Huei; Wang, Mei-Chuan; Liu, Chiu-I; Huang, Yue-Ling; Chen, Jui-Hui; Wang, Jia-Pey; Chen, Li-Kuang

    2001-01-01

    Flaviviruses comprise a positive-sense RNA genome that replicates exclusively in the cytoplasm of infected cells. Whether flaviviruses require an activated nuclear factor(s) to complete their life cycle and trigger apoptosis in infected cells remains elusive. Flavivirus infections quickly activate nuclear factor kappa B (NF-κB), and salicylates have been shown to inhibit NF-κB activation. In this study, we investigated whether salicylates suppress flavivirus replication and virus-induced apoptosis in cultured cells. In a dose-dependent inhibition, we found salicylates within a range of 1 to 5 mM not only restricted flavivirus replication but also abrogated flavivirus-triggered apoptosis. However, flavivirus replication was not affected by a specific NF-κB peptide inhibitor, SN50, and a proteosome inhibitor, lactacystin. Flaviviruses also replicated and triggered apoptosis in cells stably expressing IκBα-ΔN, a dominant-negative mutant that antagonizes NF-κB activation, as readily as in wild-type BHK-21 cells, suggesting that NF-κB activation is not essential for either flavivirus replication or flavivirus-induced apoptosis. Salicyl