Sample records for activating intracellular signaling

  1. Activator of G-Protein Signaling 3-Induced Lysosomal Biogenesis Limits Macrophage Intracellular Bacterial Infection.


    Vural, Ali; Al-Khodor, Souhaila; Cheung, Gordon Y C; Shi, Chong-Shan; Srinivasan, Lalitha; McQuiston, Travis J; Hwang, Il-Young; Yeh, Anthony J; Blumer, Joe B; Briken, Volker; Williamson, Peter R; Otto, Michael; Fraser, Iain D C; Kehrl, John H


    Many intracellular pathogens cause disease by subverting macrophage innate immune defense mechanisms. Intracellular pathogens actively avoid delivery to or directly target lysosomes, the major intracellular degradative organelle. In this article, we demonstrate that activator of G-protein signaling 3 (AGS3), an LPS-inducible protein in macrophages, affects both lysosomal biogenesis and activity. AGS3 binds the Gi family of G proteins via its G-protein regulatory (GoLoco) motif, stabilizing the Gα subunit in its GDP-bound conformation. Elevated AGS3 levels in macrophages limited the activity of the mammalian target of rapamycin pathway, a sensor of cellular nutritional status. This triggered the nuclear translocation of transcription factor EB, a known activator of lysosomal gene transcription. In contrast, AGS3-deficient macrophages had increased mammalian target of rapamycin activity, reduced transcription factor EB activity, and a lower lysosomal mass. High levels of AGS3 in macrophages enhanced their resistance to infection by Burkholderia cenocepacia J2315, Mycobacterium tuberculosis, and methicillin-resistant Staphylococcus aureus, whereas AGS3-deficient macrophages were more susceptible. We conclude that LPS priming increases AGS3 levels, which enhances lysosomal function and increases the capacity of macrophages to eliminate intracellular pathogens.

  2. Key mediators of intracellular amino acids signaling to mTORC1 activation.


    Duan, Yehui; Li, Fengna; Tan, Kunrong; Liu, Hongnan; Li, Yinghui; Liu, Yingying; Kong, Xiangfeng; Tang, Yulong; Wu, Guoyao; Yin, Yulong


    Mammalian target of rapamycin complex 1 (mTORC1) is activated by amino acids to promote cell growth via protein synthesis. Specifically, Ras-related guanosine triphosphatases (Rag GTPases) are activated by amino acids, and then translocate mTORC1 to the surface of late endosomes and lysosomes. Ras homolog enriched in brain (Rheb) resides on this surface and directly activates mTORC1. Apart from the presence of intracellular amino acids, Rag GTPases and Rheb, other mediators involved in intracellular amino acid signaling to mTORC1 activation include human vacuolar sorting protein-34 (hVps34) and mitogen-activating protein kinase kinase kinase kinase-3 (MAP4K3). Those molecular links between mTORC1 and its mediators form a complicate signaling network that controls cellular growth, proliferation, and metabolism. Moreover, it is speculated that amino acid signaling to mTORC1 may start from the lysosomal lumen. In this review, we discussed the function of these mediators in mTORC1 pathway and how these mediators are regulated by amino acids in details.

  3. Pharmacology of intracellular signalling pathways

    PubMed Central

    Nahorski, Stefan R


    This article provides a brief and somewhat personalized review of the dramatic developments that have occurred over the last 45 years in our understanding of intracellular signalling pathways associated with G-protein-coupled receptor activation. Signalling via cyclic AMP, the phosphoinositides and Ca2+ is emphasized and these systems have already been revealed as new pharmacological targets. The therapeutic benefits of most of such targets are, however, yet to be realized, but it is certain that the discipline of pharmacology needs to widen its boundaries to meet these challenges in the future. PMID:16402119


    EPA Science Inventory

    A book chapter in ?Molecular Toxicology: Transcriptional Targets? reviewed the role of intracellular signaling in the developmental neurotoxicity of environmental chemicals. This chapter covered a number of aspects including the development of the nervous system, role of intrace...

  5. Antagonistic and cooperative actions of Kif7 and Sufu define graded intracellular Gli activities in Hedgehog signaling.


    Law, Kelvin King Lo; Makino, Shigeru; Mo, Rong; Zhang, Xiaoyun; Puviindran, Vijitha; Hui, Chi-Chung


    Graded Hedgehog (Hh) signaling governs the balance of Gli transcriptional activators and repressors to specify diverse ventral cell fates in the spinal cord. It remains unclear how distinct intracellular Gli activity is generated. Here, we demonstrate that Sufu acts universally as a negative regulator of Hh signaling, whereas Kif7 inhibits Gli activity in cooperation with, and independent of, Sufu. Together, they deter naïve precursors from acquiring increasingly ventral identity. We show that Kif7 is also required to establish high intracellular Gli activity by antagonizing the Sufu-inhibition of Gli2. Strikingly, by abolishing the negative regulatory action of Sufu, diverse ventral cell fates can be specified in the absence of extracellular Hh signaling. These data suggest that Sufu is the primary regulator of graded Hh signaling and establish that the antagonistic and cooperative actions of Kif7 and Sufu are responsible for setting up distinct Gli activity in ventral cell fate specification.

  6. [A role of some intracellular signaling cascades in planarian regeneration activated under irradiation with low-temperature argon plasma].


    Ermakov, A M; Ermakova, O N; Maevskiĭ, E I


    Using inhibitory analysis the role of some intracellular signaling pathways in activation of planarian regeneration under the influence of low-temperature argon plasma (LTAP) has been investigated. Inactivation of specific inhibitors of intracellular signaling enzymes such as the receptor tyrosine kinase (EGFR), TGF β receptor, calmodulin, adenylate cyclase, phospholipase A2, phospholipase C, cyclin-dependent protein kinase, JAK2-protein kinase, JNK-protein kinase MEK-protein kinase led to inhibition of the head growth during its regeneration in planarians. Pretreatment with LTAP irradiation provided no inhibitory action of some cascades regulating proliferation. However, the inhibitors of the key regulators of regeneration: TGF β receptor, calmodulin and MEK-protein kinase completely suppressed the activating effect of plasma. Thus, by the example of regenerating planarians it is shown, that biological activity of low-temperature argon plasma LTAP is caused by modulation of a plurality of cellular signaling systems.

  7. Revisiting intracellular calcium signaling semantics.


    Haiech, Jacques; Audran, Emilie; Fève, Marie; Ranjeva, Raoul; Kilhoffer, Marie-Claude


    Cells use intracellular free calcium concentration changes for signaling. Signal encoding occurs through both spatial and temporal modulation of the free calcium concentration. The encoded message is detected by an ensemble of intracellular sensors forming the family of calcium-binding proteins (CaBPs) which must faithfully translate the message using a new syntax that is recognized by the cell. The cell is home to a significant although limited number of genes coding for proteins involved in the signal encoding and decoding processes. In a cell, only a subset of this ensemble of genes is expressed, leading to a genetic regulation of the calcium signal pathways. Calmodulin (CaM), the most ubiquitous expressed intracellular calcium-binding protein, plays a major role in calcium signal translation. Similar to a hub, it is central to a large and finely tuned network, receiving information, integrating it and dispatching the cognate response. In this review, we examine the different steps starting with an external stimulus up to a cellular response, with special emphasis on CaM and the mechanism by which it decodes calcium signals and translates it into exquisitely coordinated cellular events. By this means, we will revisit the calcium signaling semantics, hoping that we will ease communication between scientists dealing with calcium signals in different biological systems and different domains.

  8. Ehrlichia chaffeensis TRP120 Activates Canonical Notch Signaling To Downregulate TLR2/4 Expression and Promote Intracellular Survival

    PubMed Central

    Lina, Taslima T.; Dunphy, Paige S.; Luo, Tian


    ABSTRACT Ehrlichia chaffeensis preferentially targets mononuclear phagocytes and survives through a strategy of subverting innate immune defenses, but the mechanisms are unknown. We have shown E. chaffeensis type 1 secreted tandem repeat protein (TRP) effectors are involved in diverse molecular pathogen-host interactions, such as the TRP120 interaction with the Notch receptor-cleaving metalloprotease ADAM17. In the present study, we demonstrate E. chaffeensis, via the TRP120 effector, activates the canonical Notch signaling pathway to promote intracellular survival. We found that nuclear translocation of the transcriptionally active Notch intracellular domain (NICD) occurs in response to E. chaffeensis or recombinant TRP120, resulting in upregulation of Notch signaling pathway components and target genes notch1, adam17, hes, and hey. Significant differences in canonical Notch signaling gene expression levels (>40%) were observed during early and late stages of infection, indicating activation of the Notch pathway. We linked Notch pathway activation specifically to the TRP120 effector, which directly interacts with the Notch metalloprotease ADAM17. Using pharmacological inhibitors and small interfering RNAs (siRNAs) against γ-secretase enzyme, Notch transcription factor complex, Notch1, and ADAM17, we demonstrated that Notch signaling is required for ehrlichial survival. We studied the downstream effects and found that E. chaffeensis TRP120-mediated activation of the Notch pathway causes inhibition of the extracellular signal-regulated kinase 1/2 (ERK1/2) and p38 mitogen-activated protein kinase (MAPK) pathways required for PU.1 and subsequent Toll-like receptor 2/4 (TLR2/4) expression. This investigation reveals a novel mechanism whereby E. chaffeensis exploits the Notch pathway to evade the host innate immune response for intracellular survival. PMID:27381289

  9. Intracellular calcium promotes radioresistance of non-small cell lung cancer A549 cells through activating Akt signaling.


    Wang, Yiling; He, Jiantao; Zhang, Shenghui; Yang, Qingbo


    Radiotherapy is a major therapeutic approach in non-small cell lung cancer but is restricted by radioresistance. Although Akt signaling promotes radioresistance in non-small cell lung cancer, it is not well understood how Akt signaling is activated. Since intracellular calcium (Ca(2+)) could activate Akt in A549 cells, we investigated the relationship between intracellular calcium (Ca(2+)) and Akt signaling in radioresistant A549 cells by establishing radioresistant non-small cell lung cancer A549 cells. The radioresistant cell line A549 was generated by dose-gradient irradiation of the parental A549 cells. The cell viability, proliferation, and apoptosis were, respectively, assessed using the cell counting kit-8, EdU labeling, and flow cytometry analysis. The phosphorylation of Akt was evaluated by Western blotting, and the intracellular Ca(2+) concentration was assessed by Fluo 4-AM. The radioresistant A549 cells displayed mesenchymal morphology. After additional irradiation, the radioresistant A549 cells showed decreased cell viability and proliferation but increased apoptosis. Moreover, the intracellular Ca(2+) concentration and the phosphorylation level on the Akt473 site in radioresistant A549 cells were higher than those in original cells, whereas the percentage of apoptosis in radioresistant A549 cells was less. All these results could be reversed by verapamil. In conclusion, our study found that intracellular Ca(2+) could promote radioresistance of non-small cell lung cancer cells through phosphorylating of Akt on the 473 site, which contributes to a better understanding on the non-small cell lung cancer radioresistance, and may provide a new target for radioresistance management.

  10. Intracellular Signalling in Retinal Ischemia

    DTIC Science & Technology


    36) However, vascularization of the RPE is not known to occur in human diseases of photoreceptor degeneration, such as retinitis pigmentosa ...A.C. (1986) Retinitis pigmentosa and retinal neovascularization. Ophthalmology 91, 1599- 1603. Figure la: Control rat retina, 8 weeks of age, central...TITLE (Include Security Classification) Intracellular Signalling in Retinal Ischemia 12. PERSONAL AUTHOR(S) Burns, Margaret Sue; Bellhorn, Roy William

  11. Synaptic generation of an intracellular retrograde signal requires activation of the tyrosine kinase and mitogen-activated protein kinase signaling cascades in Aplysia.


    Stough, Shara; Kopec, Ashley M; Carew, Thomas J


    Cellular changes underlying memory formation can be generated in an activity-dependent manner at specific synapses. Thus an important question concerns the mechanisms by which synaptic signals communicate with the cell body to mediate these cellular changes. A monosynaptic circuit that is enhanced by sensitization in Aplysia is well-suited to study this question because three different subcellular compartments: (i) the sensorimotor SN-MN synapses, (ii) the SN projections to MNs via axonal connections, (iii) the SN cell bodies, can all be manipulated and studied independently. Here, we report that activity-dependent (AD) training in either the entire SN-MN circuit or in only the synaptic compartment, activates MAPK in a temporally and spatially specific pattern. Specifically, we find (i) MAPK activation is first transiently generated at SN-MN synapses during training, (ii) immediately after training MAPK is transiently activated in SN-MN axonal connections and persistently activated in SN cell bodies, and finally, (iii) MAPK is activated in SN cell bodies and SN-MN synapses 1h after training. These data suggest that there is an intracellularly transported retrograde signal generated at the synapse which is later responsible for delayed MAPK activation at SN somata. Finally, we find that this retrograde signal requires activation of tyrosine kinase (TK) and MEK signaling cascades at the synapses.

  12. Miro1 Regulates Activity-Driven Positioning of Mitochondria within Astrocytic Processes Apposed to Synapses to Regulate Intracellular Calcium Signaling

    PubMed Central

    Stephen, Terri-Leigh; Higgs, Nathalie F.; Sheehan, David F.; Al Awabdh, Sana; López-Doménech, Guillermo; Arancibia-Carcamo, I. Lorena


    It is fast emerging that maintaining mitochondrial function is important for regulating astrocyte function, although the specific mechanisms that govern astrocyte mitochondrial trafficking and positioning remain poorly understood. The mitochondrial Rho-GTPase 1 protein (Miro1) regulates mitochondrial trafficking and detachment from the microtubule transport network to control activity-dependent mitochondrial positioning in neurons. However, whether Miro proteins are important for regulating signaling-dependent mitochondrial dynamics in astrocytic processes remains unclear. Using live-cell confocal microscopy of rat organotypic hippocampal slices, we find that enhancing neuronal activity induces transient mitochondrial remodeling in astrocytes, with a concomitant, transient reduction in mitochondrial trafficking, mediated by elevations in intracellular Ca2+. Stimulating neuronal activity also induced mitochondrial confinement within astrocytic processes in close proximity to synapses. Furthermore, we show that the Ca2+-sensing EF-hand domains of Miro1 are important for regulating mitochondrial trafficking in astrocytes and required for activity-driven mitochondrial confinement near synapses. Additionally, activity-dependent mitochondrial positioning by Miro1 reciprocally regulates the levels of intracellular Ca2+ in astrocytic processes. Thus, the regulation of intracellular Ca2+ signaling, dependent on Miro1-mediated mitochondrial positioning, could have important consequences for astrocyte Ca2+ wave propagation, gliotransmission, and ultimately neuronal function. SIGNIFICANCE STATEMENT Mitochondria are key cellular organelles that play important roles in providing cellular energy and buffering intracellular calcium ions. The mechanisms that control mitochondrial distribution within the processes of glial cells called astrocytes and the impact this may have on calcium signaling remains unclear. We show that activation of glutamate receptors or increased neuronal

  13. Characteristics of receptor- and transducer-coupled activation of the intracellular signalling in sensory neuron revealed by atomic force microscopy

    NASA Astrophysics Data System (ADS)

    Khalisov, M. M.; Penniyaynen, V. A.; Esikova, N. A.; Ankudinov, A. V.; Krylov, B. V.


    The mechanical properties of sensory neurons upon activation of intracellular cascade processes by comenic acid binding to a membrane opioid-like receptor (receptor-coupled), as well as a very low (endogenous) concentration of ouabain (transducer-coupled), have been investigated. Using atomic force microscopy, it is established that exposure to ouabain, in contrast to the impact of comenic acid, leads to a hardening of the neuron soma. This suggests that the receptor-coupled signal transmission to the cell genome is carried out through mechanisms that are different from the transducer-coupled signal pathways.

  14. Phospholipase C-η1 is activated by intracellular Ca(2+) mobilization and enhances GPCRs/PLC/Ca(2+) signaling.


    Kim, Jung Kuk; Choi, Jung Woong; Lim, Seyoung; Kwon, Ohman; Seo, Jeong Kon; Ryu, Sung Ho; Suh, Pann-Ghill


    Phospholipase C-η1 (PLC-η1) is the most recently identified PLC isotype and is primarily expressed in nerve tissue. However, its functional role is unclear. In the present study, we report for the first time that PLC-η1 acts as a signal amplifier in G protein-coupled receptor (GPCR)-mediated PLC and Ca(2+) signaling. Short-hairpin RNA (shRNA)-mediated knockdown of endogenous PLC-η1 reduced lysophosphatidic acid (LPA)-, bradykinin (BK)-, and PACAP-induced PLC activity in mouse neuroblastoma Neuro2A (N2A) cells, indicating that PLC-η1 participates in GPCR-mediated PLC activation. Interestingly, ionomycin-induced PLC activity was significantly decreased by PLC-η1, but not PLC-η2, knockdown. In addition, we found that intracellular Ca(2+) source is enough for PLC-η1 activation. Furthermore, the IP(3) receptor inhibitor, 2-APB, inhibited LPA-induced PLC activity in control N2A cells, whereas this effect was not observed in PLC-η1 knockdown N2A cells, suggesting a pivotal role of intracellular Ca(2+) mobilization in PLC-η1 activation. Finally, we found that LPA-induced ERK1/2 phosphorylation and expression of the downstream target gene, krox-24, were significantly decreased by PLC-η1 knockdown, and these knockdown effects were abolished by 2-APB. Taken together, our results strongly suggest that PLC-η1 is activated via intracellular Ca(2+) mobilization from the ER, and therefore amplifies GPCR-mediated signaling.

  15. In Vivo Characterization of Intracellular Signaling Pathways Activated by the Nerve Agent Sarin

    DTIC Science & Technology


    Ca+2/calmodulin-dependent protein phosphatase signaling cascade, which dephosphorylates T34- DARPP-32 (Nishi et al., 1999). Activation of the D 1...phosphorylation state of DARPP-32 at Ser-102 (S102) and Ser-137 (S137) (see Figure 1). For example, S 102 on DARPP-32 is phosphorylated by casein kinase...cGMP-dependent protein kinase (PKG) (Girault et al., 1989). DARPP-32 is also phosphorylated on amino acid S137 by casein kinase I (CK1). Increases in

  16. Moderate increases in intracellular calcium activate neuroprotective signals in hippocampal neurons.


    Bickler, P E; Fahlman, C S


    Although large increases in neuronal intracellular calcium concentrations ([Ca(2+)](i)) are lethal, moderate increases in [Ca(2+)](i) of 50-200 nM may induce immediate or long-term tolerance of ischemia or other stresses. In neurons in rat hippocampal slice cultures, we determined the relationship between [Ca(2+)](i), cell death, and Ca(2+)-dependent neuroprotective signals before and after a 45 min period of oxygen and glucose deprivation (OGD). Thirty minutes before OGD, [Ca(2+)](i) was increased in CA1 neurons by 40-200 nM with 1 nM-1 microM of a Ca(2+)-selective ionophore (calcimycin or ionomycin-"Ca(2+) preconditioning"). Ca(2+) preconditioning greatly reduced cell death in CA1, CA3 and dentate during the following 7 days, even though [Ca(2+)](i) was similar (approximately 2 microM) in preconditioned and control neurons 1 h after the OGD. When pre-OGD [Ca(2+)](i) was lowered to 25 nM (10 nM ionophore in Ca(2+)-free medium) or increased to 8 microM (10 microM ionophore), more than 90% of neurons died. Increased levels of the anti-apoptotic protein protein kinase B (Akt) and the MAP kinase ERK (p42/44) were present in preconditioned slices after OGD. Reducing Ca(2+) influx, inhibiting calmodulin, and preventing Akt or MAP kinase p42/44 upregulation prevented Ca(2+) preconditioning, supporting a specific role for Ca(2+) in the neuroprotective process. Further, in continuously oxygenated cultured hippocampal/cortical neurons, preconditioning for 30 min with 10 nM ionomycin reduced cell death following a 4 microM increase in [Ca(2+)](i) elicited by 1 microM ionomycin. Thus, a zone of moderately increased [Ca(2+)](i) before a potentially lethal insult promotes cell survival, uncoupling subsequent large increases in [Ca(2+)](i) from initiating cell death processes.

  17. An inside job: hacking into Janus kinase/signal transducer and activator of transcription signaling cascades by the intracellular protozoan Toxoplasma gondii.


    Denkers, Eric Y; Bzik, David J; Fox, Barbara A; Butcher, Barbara A


    The intracellular protozoan Toxoplasma gondii is well known for its skill at invading and living within host cells. New discoveries are now also revealing the astounding ability of the parasite to inject effector proteins into the cytoplasm to seize control of the host cell. This review summarizes recent advances in our understanding of one such secretory protein called ROP16. This molecule is released from rhoptries into the host cell during invasion. The ROP16 molecule acts as a kinase, directly activating both signal transducer and activator of transcription 3 (STAT3) and STAT6 signaling pathways. In macrophages, an important and preferential target cell of parasite infection, the injection of ROP16 has multiple consequences, including downregulation of proinflammatory cytokine signaling and macrophage deviation to an alternatively activated phenotype.

  18. Intracellular Signal Modulation by Nanomaterials

    PubMed Central

    Hussain, Salik; Garantziotis, Stavros; Rodrigues-Lima, Fernando; Dupret, Jean-Marie; Baeza-Squiban, Armelle; Boland, Sonja


    A thorough understanding of the interactions of nanomaterials with biological systems and the resulting activation of signal transduction pathways is essential for the development of safe and consumer friendly nanotechnology. Here we present an overview of signaling pathways induced by nanomaterial exposures and describe the possible correlation of their physicochemical characteristics with biological outcomes. In addition to the hierarchical oxidative stress model and a review of the intrinsic and cell-mediated mechanisms of reactive Oxygen species (ROS) generating capacities of nanomaterials, we also discuss other oxidative stress dependent and independent cellular signaling pathways. Induction of the inflammasome, calcium signaling, and endoplasmic reticulum stress are reviewed. Furthermore, the uptake mechanisms can crucially affect the cytotoxicity of nanomaterials and membrane-dependent signaling pathways can be responsible for cellular effects of nanomaterials. Epigenetic regulation by nanomaterials effects of nanoparticle-protein interactions on cell signaling pathways, and the induction of various cell death modalities by nanomaterials are described. We describe the common trigger mechanisms shared by various nanomaterials to induce cell death pathways and describe the interplay of different modalities in orchestrating the final outcome after nanomaterial exposures. A better understanding of signal modulations induced by nanomaterials is not only essential for the synthesis and design of safer nanomaterials but will also help to discover potential nanomedical applications of these materials. Several biomedical applications based on the different signaling pathways induced by nanomaterials are already proposed and will certainly gain a great deal of attraction in the near future. PMID:24683030

  19. Intracellular signal modulation by nanomaterials.


    Hussain, Salik; Garantziotis, Stavros; Rodrigues-Lima, Fernando; Dupret, Jean-Marie; Baeza-Squiban, Armelle; Boland, Sonja


    A thorough understanding of the interactions of nanomaterials with biological systems and the resulting activation of signal transduction pathways is essential for the development of safe and consumer friendly nanotechnology. Here we present an overview of signaling pathways induced by nanomaterial exposures and describe the possible correlation of their physicochemical characteristics with biological outcomes. In addition to the hierarchical oxidative stress model and a review of the intrinsic and cell-mediated mechanisms of reactive oxygen species (ROS) generating capacities of nanomaterials, we also discuss other oxidative stress dependent and independent cellular signaling pathways. Induction of the inflammasome, calcium signaling, and endoplasmic reticulum stress are reviewed. Furthermore, the uptake mechanisms can be of crucial importance for the cytotoxicity of nanomaterials and membrane-dependent signaling pathways have also been shown to be responsible for cellular effects of nanomaterials. Epigenetic regulation by nanomaterials, effects of nanoparticle-protein interactions on cell signaling pathways, and the induction of various cell death modalities by nanomaterials are described. We describe the common trigger mechanisms shared by various nanomaterials to induce cell death pathways and describe the interplay of different modalities in orchestrating the final outcome after nanomaterial exposures. A better understanding of signal modulations induced by nanomaterials is not only essential for the synthesis and design of safer nanomaterials but will also help to discover potential nanomedical applications of these materials. Several biomedical applications based on the different signaling pathways induced by nanomaterials are already proposed and will certainly gain a great deal of attraction in the near future.

  20. Juglanthraquinone C Induces Intracellular ROS Increase and Apoptosis by Activating the Akt/Foxo Signal Pathway in HCC Cells.


    Hou, Ya-Qin; Yao, Yao; Bao, Yong-Li; Song, Zhen-Bo; Yang, Cheng; Gao, Xiu-Li; Zhang, Wen-Jing; Sun, Lu-Guo; Yu, Chun-Lei; Huang, Yan-Xin; Wang, Guan-Nan; Li, Yu-Xin


    Juglanthraquinone C (JC), a naturally occurring anthraquinone extracted from Juglans mandshurica, could induce apoptosis of cancer cells. This study aims to investigate the detailed cytotoxicity mechanism of JC in HepG2 and BEL-7402 cells. The Affymetrix HG-U133 Plus 2.0 arrays were first used to analyze the mRNA expression exposed to JC or DMSO in HepG2 cells. Consistent with the previous results, the data indicated that JC could induce apoptosis and hyperactivated Akt. The Western blot analysis further revealed that Akt, a well-known survival protein, was strongly activated in HepG2 and BEL-7402 cells. Furthermore, an obvious inhibitory effect on JC-induced apoptosis was observed when the Akt levels were decreased, while the overexpression of constitutively active mutant Akt greatly accelerated JC-induced apoptosis. The subsequent results suggested that JC treatment suppressed nuclear localization and increased phosphorylated levels of Foxo3a, and the overexpression of Foxo3a abrogated JC-induced apoptosis. Most importantly, the inactivation of Foxo3a induced by JC further led to an increase of intracellular ROS levels by suppressing ROS scavenging enzymes, and the antioxidant N-acetyl-L-cysteine and catalase successfully decreased JC-induced apoptosis. Collectively, this study demonstrated that JC induced the apoptosis of hepatocellular carcinoma (HCC) cells by activating Akt/Foxo signaling pathway and increasing intracellular ROS levels.

  1. Regulation of spine and synapse formation by activity-dependent intracellular signaling pathways

    PubMed Central

    Saneyoshi, Takeo; Fortin, Dale A; Soderling, Thomas R


    Formation of the human brain during embryonic and postnatal development is an extraordinarily complex process resulting at maturity in billions of neurons with trillions of specialized connections called synapses. These synapses, composed of a varicosity or bouton from a presynaptic neuron that communicates with a dendritic spine of the postsynaptic neuron, comprise the neural network that is essential for complex behavioral phenomena and cognition. Inappropriate synapse formation or structure is thought to underlie several developmental neuropathologies. Even in the mature CNS, alterations in synapse structure and function continues to be a very dynamic process that is foundational to learning and memory as well as other adaptive abilities of the brain. This synaptic plasticity in mature neurons, which is often triggered by certain patterns of neural activity, is again multifaceted and involves post-translational modifications (e.g. phosphorylation) and subcellular relocalization or trafficking (endocytosis/exocytosis) of existing synaptic proteins, initiation of protein synthesis from existing mRNAs localized in dendrites or spines, and triggering of new gene transcription in the nucleus. These various cellular processes support varying temporal components of synaptic plasticity that begin within 1–2 min but can persist for hours to days. This review will give a critical assessment of activity-dependent molecular modulations of synapses reported over the past couple years. Owing to space limitations, it will focus on mammalian excitatory (i.e. glutamatergic) synapses and will not consider several activity-independent signaling pathways (e.g. ephrinB receptor) that also modulate spine and synapse formation [1,2]. PMID:19896363

  2. Control of Intracellular Calcium Signaling as a Neuroprotective Strategy

    PubMed Central

    Duncan, R. Scott; Goad, Daryl L.; Grillo, Michael A.; Kaja, Simon; Payne, Andrew J.; Koulen, Peter


    Both acute and chronic degenerative diseases of the nervous system reduce the viability and function of neurons through changes in intracellular calcium signaling. In particular, pathological increases in the intracellular calcium concentration promote such pathogenesis. Disease involvement of numerous regulators of intracellular calcium signaling located on the plasma membrane and intracellular organelles has been documented. Diverse groups of chemical compounds targeting ion channels, G-protein coupled receptors, pumps and enzymes have been identified as potential neuroprotectants. The present review summarizes the discovery, mechanisms and biological activity of neuroprotective molecules targeting proteins that control intracellular calcium signaling to preserve or restore structure and function of the nervous system. Disease relevance, clinical applications and new technologies for the identification of such molecules are being discussed. PMID:20335972

  3. Intracellular carbonic anhydrase activity sensitizes cancer cell pH signaling to dynamic changes in CO2 partial pressure.


    Hulikova, Alzbeta; Aveyard, Nicholas; Harris, Adrian L; Vaughan-Jones, Richard D; Swietach, Pawel


    Carbonic anhydrase (CA) enzymes catalyze the chemical equilibration among CO2, HCO3(-) and H(+). Intracellular CA (CAi) isoforms are present in certain types of cancer, and growing evidence suggests that low levels correlate with disease severity. However, their physiological role remains unclear. Cancer cell CAi activity, measured as cytoplasmic CO2 hydration rate (kf), ranged from high in colorectal HCT116 (∼2 s(-1)), bladder RT112 and colorectal HT29, moderate in fibrosarcoma HT1080 to negligible (i.e. spontaneous kf = 0.18 s(-1)) in cervical HeLa and breast MDA-MB-468 cells. CAi activity in cells correlated with CAII immunoreactivity and enzymatic activity in membrane-free lysates, suggesting that soluble CAII is an important intracellular isoform. CAi catalysis was not obligatory for supporting acid extrusion by H(+) efflux or HCO3(-) influx, nor for maintaining intracellular pH (pHi) uniformity. However, in the absence of CAi activity, acid loading from a highly alkaline pHi was rate-limited by HCO3(-) supply from spontaneous CO2 hydration. In solid tumors, time-dependence of blood flow can result in fluctuations of CO2 partial pressure (pCO2) that disturb cytoplasmic CO2-HCO3(-)-H(+) equilibrium. In cancer cells with high CAi activity, extracellular pCO2 fluctuations evoked faster and larger pHi oscillations. Functionally, these resulted in larger pH-dependent intracellular [Ca(2+)] oscillations and stronger inhibition of the mTORC1 pathway reported by S6 kinase phosphorylation. In contrast, the pHi of cells with low CAi activity was less responsive to pCO2 fluctuations. Such low pass filtering would "buffer" cancer cell pHi from non-steady-state extracellular pCO2. Thus, CAi activity determines the coupling between pCO2 (a function of tumor perfusion) and pHi (a potent modulator of cancer cell physiology).

  4. Modeling of spatially-restricted intracellular signaling.


    Neves, Susana R


    Understanding the signaling capabilities of a cell presents a major challenge, not only due to the number of molecules involved, but also because of the complex network connectivity of intracellular signaling. Recently, the proliferation of quantitative imaging techniques has led to the discovery of the vast spatial organization of intracellular signaling. Computational modeling has emerged as a powerful tool for understanding how inhomogeneous signaling originates and is maintained. This article covers the current imaging techniques used to obtain quantitative spatial data and the mathematical approaches used to model spatial cell biology. Modeling-derived hypotheses have been experimentally tested and the integration of modeling and imaging approaches has led to non-intuitive mechanistic insights.

  5. Tumour suppressors hamartin and tuberin: intracellular signalling.


    Krymskaya, Vera P


    Tumour suppressors hamartin and tuberin, encoded by tuberous sclerosis complex 1(TSC1) and TSC2 genes, respectively, are critical regulators of cell growth and proliferation. Mutations in TSC1 and TSC2 genes are the cause of an autosomal dominant disorder known as tuberous sclerosis complex (TSC). Another genetic disorder, lymphangioleiomyomatosis (LAM), is also associated with mutations in the TSC2 gene. Hamartin and tuberin control cell growth by negatively regulating S6 kinase 1 (S6K1) and eukaryotic initiation factor 4E binding protein 1 (4E-BP1), potentially through their upstream modulator mammalian target of rapamycin (mTOR). Growth factors and insulin promote Akt/PKB-dependent phosphorylation of tuberin, which in turn, releases S6K1 from negative regulation by tuberin and results in the activation of S6K1. Although much has been written regarding the molecular genetics of TSC and LAM, which is associated with either the loss of or mutation in the TSC1 and TSC2 genes, few reviews have addressed the intracellular signalling pathways regulated by hamartin and tuberin. The current review will fill the gap in our understanding of their role in cellular signalling networks, and by improving this understanding, an integrated picture regarding the normal function of tuberin and hamartin is beginning to emerge.

  6. Danger signals, inflammasomes, and the intricate intracellular lives of chlamydiae.


    Pettengill, Matthew A; Abdul-Sater, Ali; Coutinho-Silva, Robson; Ojcius, David M


    Chlamydiae are obligate intracellular bacterial pathogens, and as such are sensitive to alterations in the cellular physiology of their hosts. Chlamydial infections often cause pathologic consequences due to prolonged localized inflammation. Considerable advances have been made in the last few years regarding our understanding of how two key inflammation-associated signaling pathways influence the biology of Chlamydia infections: inflammation regulating purinergic signaling pathways significantly impact intracellular chlamydial development, and inflammasome activation modulates both chlamydial growth and infection mediated pro-inflammatory cytokine production. We review here elements of both pathways, presenting the latest developments contributing to our understanding of how chlamydial infections are influenced by inflammasomes and purinergic signaling.

  7. Desnitro-imidacloprid activates the extracellular signal-regulated kinase cascade via the nicotinic receptor and intracellular calcium mobilization in N1E-115 cells.


    Tomizawa, Motohiro; Casida, John E


    Imidacloprid (IMI) is the principal neonicotinoid (the only major new class of synthetic insecticides of the past three decades). The excellent safety profile of IMI is not shared with a metabolite, desnitro-IMI (DNIMI), which displays high toxicity to mammals associated with agonist action at the alpha4beta2 nicotinic acetylcholine receptor (nAChR) in brain. This study examines the hypothesis that IMI, DNIMI, and (-)-nicotine activate the extracellular signal-regulated kinase (ERK) cascade via primary interaction with the alpha4beta2 nAChR in mouse neuroblastoma N1E-115 cells. These three nicotinic agonists induce phosphorylation of ERK (p44/p42) in a concentration-dependent manner with an optimal incubation period of 30 min. DNIMI (1 microM)-induced ERK activation is blocked by nicotinic antagonist mecamylamine but not by alpha-bungarotoxin and muscarinic antagonist atropine. This activation is prevented by intracellular Ca(2+) chelator BAPTA-AM but not by removal of external Ca(2+) using EGTA and Ca(2+)-free medium. 2-Aminoethoxy-diphenylborate, a blocker for inositol 1,4,5-trisphosphate (IP(3))-mediated Ca(2+) release from intracellular stores, inhibits DNIMI-induced ERK activation but a high level of ryanodine (to block ryanodine receptor-mediated Ca(2+) release) does not. The inhibitor U-73122 for phospholipase C (to suppress IP(3) production) prevents ERK activation evoked by DNIMI. Inhibitors for protein kinase C (PKC) (GF109203X) and ERK kinase (PD98059) block this activation whereas an inhibitor (H-89) for cyclic AMP-dependent protein kinase does not. Thus, neonicotinoids activate the ERK cascade triggered by primary action at the alpha4beta2 nAChR with an involvement of intracellular Ca(2+) mobilization possibly mediated by IP(3). It is further suggested that intracellular Ca(2+) activates a sequential pathway from PKC to ERK.

  8. Cell adhesion and intracellular calcium signaling in neurons

    PubMed Central


    Cell adhesion molecules (CAMs) play indispensable roles in the developing and mature brain by regulating neuronal migration and differentiation, neurite outgrowth, axonal fasciculation, synapse formation and synaptic plasticity. CAM-mediated changes in neuronal behavior depend on a number of intracellular signaling cascades including changes in various second messengers, among which CAM-dependent changes in intracellular Ca2+ levels play a prominent role. Ca2+ is an essential secondary intracellular signaling molecule that regulates fundamental cellular functions in various cell types, including neurons. We present a systematic review of the studies reporting changes in intracellular Ca2+ levels in response to activation of the immunoglobulin superfamily CAMs, cadherins and integrins in neurons. We also analyze current experimental evidence on the Ca2+ sources and channels involved in intracellular Ca2+ increases mediated by CAMs of these families, and systematically review the role of the voltage-dependent Ca2+ channels (VDCCs) in neurite outgrowth induced by activation of these CAMs. Molecular mechanisms linking CAMs to VDCCs and intracellular Ca2+ stores in neurons are discussed. PMID:24330678

  9. Receptor-activated Ca2+ inflow in animal cells: a variety of pathways tailored to meet different intracellular Ca2+ signalling requirements.

    PubMed Central

    Barritt, G J


    Receptor-activated Ca2+ channels (RACCs) play a central role in regulation of the functions of animal cells. Together with voltage-operated Ca2+ channels (VOCCs) and ligand-gated non-selective cation channels, RACCs provide a variety of pathways by which Ca2+ can be delivered to the cytoplasmic space and the endoplasmic reticulum (ER) in order to initiate or maintain specific types of intracellular Ca2+ signal. Store-operated Ca2+ channels (SOCs), which are activated by a decrease in Ca2+ in the ER, are a major subfamily of RACCs. A careful analysis of the available data is required in order to discern the different types of RACCs (differentiated chiefly on the basis of ion selectivity and mechanism of activation) and to properly develop hypotheses for structures and mechanisms of activation. Despite much intensive research, the structures and mechanisms of activation of RACCs are only now beginning to be understood. In considering the physiological functions of the different RACCs, it is useful to consider the specificity for Ca2+ of each type of cation channel and the rate at which Ca2+ flows through a single open channel; the locations of the channels on the plasma membrane (in relation to the ER, cytoskeleton and other intracellular units of structure and function); the Ca2+-responsive enzymes and proteins; and the intracellular buffers and proteins that control the distribution of Ca2+ in the cytoplasmic space. RACCs which are non-selective cation channels can deliver Ca2+ directly to specific regions of the cytoplasmic space, and can also admit Na+, which induces depolarization of the plasma membrane, the opening of VOCCs and the subsequent inflow of Ca2+. SOCs appear to deliver Ca2+ specifically to the ER, thereby maintaining oscillating Ca2+ signals. PMID:9882611

  10. 4-Hydroxy-2-nonenal induces apoptosis by activating ERK1/2 signaling and depleting intracellular glutathione in intestinal epithelial cells

    PubMed Central

    Ji, Yun; Dai, Zhaolai; Wu, Guoyao; Wu, Zhenlong


    Excessive reactive oxygen species (ROS) induces oxidative damage to cellular constituents, ultimately leading to induction of apoptotic cell death and the pathogenesis of various diseases. The molecular mechanisms for the action of ROS in intestinal diseases remain poorly defined. Here, we reported that 4-hydroxy-2-nonenal (4-HNE) treatment led to capses-3-dependent apoptosis accompanied by increased intracellular ROS level and reduced glutathione concentration in intestinal epithelial cells. These effects of 4-HNE were markedly abolished by the antioxidant L-cysteine derivative N-acetylcysteine (NAC). Further studies demonstrated that the protective effect of NAC was associated with restoration of intracellular redox state by Nrf2-related regulation of expression of genes involved in intracellular glutathione (GSH) biosynthesis and inactivation of 4-HNE-induced phosphorylation of extracellular signal-regulated protein kinases (ERK1/2). The 4-HNE-induced ERK1/2 activation was mediated by repressing mitogen-activated protein kinase phosphatase-1 (MKP-1), a negative regulator of ERK1/2, through a proteasome-dependent degradation mechanism. Importantly, either overexpression of MKP-1 or NAC treatment blocked 4-HNE-induced MKP-1 degradation, thereby protecting cell from apoptosis. These novel findings provide new insights into a functional role of MKP-1 in oxidative stress-induced cell death by regulating ERK1/2 MAP kinase in intestinal epithelial cells. PMID:27620528

  11. Evaluation of Intracellular Signaling Downstream Chimeric Antigen Receptors

    PubMed Central

    Karlsson, Hannah; Svensson, Emma; Gigg, Camilla; Jarvius, Malin; Olsson-Strömberg, Ulla; Savoldo, Barbara; Dotti, Gianpietro; Loskog, Angelica


    CD19-targeting CAR T cells have shown potency in clinical trials targeting B cell leukemia. Although mainly second generation (2G) CARs carrying CD28 or 4-1BB have been investigated in patients, preclinical studies suggest that third generation (3G) CARs with both CD28 and 4-1BB have enhanced capacity. However, little is known about the intracellular signaling pathways downstream of CARs. In the present work, we have analyzed the signaling capacity post antigen stimulation in both 2G and 3G CARs. 3G CAR T cells expanded better than 2G CAR T cells upon repeated stimulation with IL-2 and autologous B cells. An antigen-driven accumulation of CAR+ cells was evident post antigen stimulation. The cytotoxicity of both 2G and 3G CAR T cells was maintained by repeated stimulation. The phosphorylation status of intracellular signaling proteins post antigen stimulation showed that 3G CAR T cells had a higher activation status than 2G. Several proteins involved in signaling downstream the TCR were activated, as were proteins involved in the cell cycle, cell adhesion and exocytosis. In conclusion, 3G CAR T cells had a higher degree of intracellular signaling activity than 2G CARs which may explain the increased proliferative capacity seen in 3G CAR T cells. The study also indicates that there may be other signaling pathways to consider when designing or evaluating new generations of CARs. PMID:26700307

  12. Uncoupling Caveolae from Intracellular Signaling In Vivo

    PubMed Central

    Kraehling, Jan R.; Hao, Zhengrong; Lee, Monica Y.; Vinyard, David J.; Velazquez, Heino; Liu, X.; Stan, Radu V.; Brudvig, Gary W.; Sessa, William C.


    Rationale Caveolin-1 negatively regulates eNOS derived NO production and this has been mapped to several residues on Cav-1 including F92. Herein, we reasoned that endothelial expression of an F92ACav-1 transgene would let us decipher the mechanisms and relationships between caveolae structure and intracellular signaling. Objective This study was designed to separate caveolae formation from its downstream signaling effects. Methods and Results An endothelial-specific doxycycline-regulated mouse model for the expression of Cav-1-F92A was developed. Blood pressure by telemetry and nitric oxide bioavailability by electron paramagnetic resonance and phosphorylation of VASP were determined. Caveolae integrity in the presence of Cav-1-F92A was measured by stabilization of Cav-2, sucrose gradient and electron microscopy. Histological analysis of heart and lung, echocardiography and signaling were performed. Conclusions This study shows that mutant Cav-1-F92A forms caveolae structures similar to WT but leads to increases in NO bioavailability in vivo thereby demonstrating that caveolae formation and downstream signaling events occur through independent mechanisms. PMID:26602865

  13. Large-conductance channel formation mediated by P2X7 receptor activation is regulated through distinct intracellular signaling pathways in peritoneal macrophages and 2BH4 cells.


    Faria, R X; Cascabulho, C M; Reis, R A M; Alves, Luiz Anastácio


    The P2X(7) receptor (P2X7R) is a ligand-gated ATP receptor that acts as a low- and large-conductance channel (pore) and is known to be coupled to several downstream effectors. Recently, we demonstrated that the formation of a large-conductance channel associated with the P2X(7) receptor is induced by increasing the intracellular Ca(2+) concentration (Faria et al., Am J Physiol Cell Physiol 297:C28-C42, 2005). Here, we investigated the intracellular signaling pathways associated with P2X(7) large-conductance channel formation using the patch clamp technique in conjunction with fluorescent imaging and flow cytometry assays in 2BH4 cells and peritoneal macrophages. Different antagonists were applied to investigate the following pathways: Ca(2+)-calmodulin, phospholipase A, phospholipase D, phospholipase C, protein kinase C (PKC), mitogen-activated protein kinase (MAPK), MAPK/extracellular signal-regulated kinase, phosphoinositide 3-kinase (PI3K), and cytoskeletal proteins. Macroscopic ionic currents induced by 1 mM ATP were reduced by 85% in the presence of PKC antagonists. The addition of antagonists for MAPK, PI3K, and the cytoskeleton (actin, intermediary filament, and microtubule) blocked 92%, 83%, and 95% of the ionic currents induced by 1 mM ATP, respectively. Our results show that PKC, MAPK, PI3K, and cytoskeletal components are involved in P2X(7) receptor large-channel formation in 2BH4 cells and peritoneal macrophages.

  14. Activation of the neuroprotective ERK signaling pathway by fructose-1,6-bisphosphate during hypoxia involves intracellular Ca2+ and phospholipase C.


    Fahlman, C S; Bickler, P E; Sullivan, Breandan; Gregory, G A


    The mechanism of the neuroprotective action of the glycolytic pathway intermediate fructose-1,6-bisphosphate (FBP) may involve activation of a phospholipase-C (PLC) dependent MAP kinase signaling pathway. In this study, we determined whether FBP's capacity to decrease delayed cell death in hippocampal slice cultures is dependent on PLC signaling or activation of the intracellular Ca(2+)-MEK/ERK neuroprotective signaling cascade. FBP (3.5 mM) reduced delayed death from oxygen/glucose deprivation in CA1, CA3 and dentate neurons in slice cultures. The phospholipase-C inhibitor U73122 and the MEK1/2 inhibitor U0126 prevented this protection. In hippocampal and cortical neurons, FBP increased phospho-ERK1/2 (p42/44) immunostaining during hypoxic, but not normoxic conditions. Increased phospho-ERK immunostaining was dependent on PLC and also on MEK 1/2, an upstream regulator of ERK. Further, we found that FBP enhancement of phospho-ERK immunostaining depended on [Ca(2+)](i): PLC inhibition and the IP(3) receptor blocker xestospongin C prevented FBP from increasing [Ca(2+)](i) and increasing phospho-ERK levels. However, while FBP-induced increases in [Ca(2+)](i) were blocked by xestospongin and a PLC inhibitor, [Ca(2+)](i) increases induced by the neuroprotective growth factor BDNF were not prevented. We conclude that during hypoxia FBP initiates a series of neuroprotective signals which include PLC activation, small increases in [Ca(2+)](i), and increased activity of the MEK/ERK signaling pathway.

  15. Human β-Cell Proliferation and Intracellular Signaling: Part 3

    PubMed Central

    Hussain, Mehboob A.; García-Ocaña, Adolfo; Vasavada, Rupangi C.; Bhushan, Anil; Bernal-Mizrachi, Ernesto


    This is the third in a series of Perspectives on intracellular signaling pathways coupled to proliferation in pancreatic β-cells. We contrast the large knowledge base in rodent β-cells with the more limited human database. With the increasing incidence of type 1 diabetes and the recognition that type 2 diabetes is also due in part to a deficiency of functioning β-cells, there is great urgency to identify therapeutic approaches to expand human β-cell numbers. Therapeutic approaches might include stem cell differentiation, transdifferentiation, or expansion of cadaver islets or residual endogenous β-cells. In these Perspectives, we focus on β-cell proliferation. Past Perspectives reviewed fundamental cell cycle regulation and its upstream regulation by insulin/IGF signaling via phosphatidylinositol-3 kinase/mammalian target of rapamycin signaling, glucose, glycogen synthase kinase-3 and liver kinase B1, protein kinase Cζ, calcium-calcineurin–nuclear factor of activated T cells, epidermal growth factor/platelet-derived growth factor family members, Wnt/β-catenin, leptin, and estrogen and progesterone. Here, we emphasize Janus kinase/signal transducers and activators of transcription, Ras/Raf/extracellular signal–related kinase, cadherins and integrins, G-protein–coupled receptors, and transforming growth factor β signaling. We hope these three Perspectives will serve to introduce these pathways to new researchers and will encourage additional investigators to focus on understanding how to harness key intracellular signaling pathways for therapeutic human β-cell regeneration for diabetes. PMID:25999530


    PubMed Central

    Kocab, Andrew J.; Duckett, Colin S.


    The inhibitor of apoptosis (IAP) proteins have often been considered inhibitors of cell death due to early studies describing their ability to directly bind and inhibit caspases, the primary factors that implement apoptosis. However, a greater understanding is evolving for the vital roles played by the IAPs as transduction intermediates in a diverse set of signaling cascades that have been associated with functions ranging from the innate immune response to cell migration to cell cycle regulation. In this review, we discuss the functions of the IAPs in signaling, focusing primarily on the cellular IAP (c-IAP) proteins. The c-IAPs are important components in the TNF receptor superfamily signaling cascades, which include the activation of the NF-κB transcription factor family. Since these receptors can modulate cell proliferation and cell death, the roles of the c-IAPs in these pathways provide additional means of controlling cellular fate beyond simply inhibiting caspase activity. Additionally, IAP binding proteins, such as Smac and caspases, which have been described as having cell death-independent roles, may impact c-IAP activity in intracellular signaling. Collectively, the multifaceted functions and complex regulation of the c-IAPs illustrate the importance of the c-IAPs as intracellular signaling intermediates. PMID:26462035

  17. Inhibitor of apoptosis proteins as intracellular signaling intermediates.


    Kocab, Andrew J; Duckett, Colin S


    Inhibitor of apoptosis (IAP) proteins have often been considered inhibitors of cell death due to early reports that described their ability to directly bind and inhibit caspases, the primary factors that implement apoptosis. However, a greater understanding is evolving regarding the vital roles played by IAPs as transduction intermediates in a diverse set of signaling cascades associated with functions ranging from the innate immune response to cell migration to cell-cycle regulation. In this review, we discuss the functions of IAPs in signaling, focusing primarily on the cellular IAP (c-IAP) proteins. The c-IAPs are important components in tumor necrosis factor receptor superfamily signaling cascades, which include activation of the NF-κB transcription factor family. As these receptors modulate cell proliferation and cell death, the involvement of the c-IAPs in these pathways provides an additional means of controlling cellular fate beyond simply inhibiting caspase activity. Additionally, IAP-binding proteins, such as Smac and caspases, which have been described as having cell death-independent roles, may affect c-IAP activity in intracellular signaling. Collectively, the multi-faceted functions and complex regulation of the c-IAPs illustrate their importance as intracellular signaling intermediates.

  18. Intracellular signaling by phospholipase D as a therapeutic target.


    Steed, P M; Chow, A H


    The pharmaceutical industry has recently focused on intracellular signaling as a means to integrate the multiple facets of complex disease states, such as inflammation, because these pathways respond to numerous extracellular signals and coordinate a collection of cell responses contributing to pathology. One critical aspect of intracellular signaling is regulation of key cell functions by lipid mediators, in particular the generation of a key mediator, phosphatidic acid (PA) via the hydrolysis of phosphatidylcholine by phospholipase D (PLD). Research in this field has intensified, due in part to the recent cloning and partial characterization of the two PLD isoforms in mammalian cells, and this work has contributed significantly to our understanding of events downstream of PA generation. It is these effector functions of PLD activity that make this pathway attractive as a therapeutic target while the biochemical properties of the PLD isozymes make them amenable to small molecule intervention. Recent studies indicate that PA, and its immediate metabolites diacylglycerol and lyso-PA, affect numerous cellular pathways including ligand-mediated secretion, cytoskeletal reorganisations, respiratory burst, prostaglandin release, cell migration, cytokine release, and mitogenesis. This review summarises the data implicating signaling via PLD in these cell functions, obtained from: (i) molecular analyses of PLD/effector interactions, (ii) correlation between PA production and cell responses, (iii) experimental manipulation of PA levels, (iv) inhibition of PLD regulators, and (v) direct inhibition of PA production. The utility of targeting PLD signaling for the treatment of acute/chronic inflammation and other indications is discussed in light of these data.

  19. Microdamage induced calcium efflux from bone matrix activates intracellular calcium signaling in osteoblasts via L-type and T-type voltage-gated calcium channels.


    Jung, Hyungjin; Best, Makenzie; Akkus, Ozan


    Mechanisms by which bone microdamage triggers repair response are not completely understood. It has been shown that calcium efflux ([Ca(2+)]E) occurs from regions of bone undergoing microdamage. Such efflux has also been shown to trigger intracellular calcium signaling ([Ca(2+)]I) in MC3T3-E1 cells local to damaged regions. Voltage-gated calcium channels (VGCCs) are implicated in the entry of [Ca(2+)]E to the cytoplasm. We investigated the involvement of VGCC in the extracellular calcium induced intracellular calcium response (ECIICR). MC3T3-E1 cells were subjected to one dimensional calcium efflux from their basal aspect which results in an increase in [Ca(2+)]I. This increase was concomitant with membrane depolarization and it was significantly reduced in the presence of Bepridil, a non-selective VGCC inhibitor. To identify specific type(s) of VGCC in ECIICR, the cells were treated with selective inhibitors for different types of VGCC. Significant changes in the peak intensity and the number of [Ca(2+)]I oscillations were observed when L-type and T-type specific VGCC inhibitors (Verapamil and NNC55-0396, respectively) were used. So as to confirm the involvement of L- and T-type VGCC in the context of microdamage, cells were seeded on devitalized notched bone specimen, which were loaded to induce microdamage in the presence and absence of Verapamil and NNC55-0396. The results showed significant decrease in [Ca(2+)]I activity of cells in the microdamaged regions of bone when L- and T-type blockers were applied. This study demonstrated that extracellular calcium increase in association with damage depolarizes the cell membrane and the calcium ions enter the cell cytoplasm by L- and T-type VGCCs.

  20. Calcium, channels, intracellular signaling and autoimmunity.


    Izquierdo, Jorge-Hernán; Bonilla-Abadía, Fabio; Cañas, Carlos A; Tobón, Gabriel J


    Calcium (Ca²⁺) is an important cation able to function as a second messenger in different cells of the immune system, particularly in B and T lymphocytes, macrophages and mastocytes, among others. Recent discoveries related to the entry of Ca²⁺ through the store-operated calcium entry (SOCE) has opened a new investigation area about the cell destiny regulated by Ca²⁺ especially in B and T lymphocytes. SOCE acts through calcium-release-activated calcium (CRAC) channels. The function of CRAC depends of two recently discovered regulators: the Ca²⁺ sensor in the endoplasmic reticulum or stromal interaction molecule (STIM-1) and one subunit of CRAC channels called Orai1. This review focuses on the role of Ca²⁺ signals in B and T lymphocytes functions, the signalling pathways leading to Ca²⁺ influx, and the relationship between Ca²⁺ signals and autoimmune diseases.

  1. The Growth Hormone Secretagogue Receptor: Its Intracellular Signaling and Regulation

    PubMed Central

    Yin, Yue; Li, Yin; Zhang, Weizhen


    The growth hormone secretagogue receptor (GHSR), also known as the ghrelin receptor, is involved in mediating a wide variety of biological effects of ghrelin, including: stimulation of growth hormone release, increase of food intake and body weight, modulation of glucose and lipid metabolism, regulation of gastrointestinal motility and secretion, protection of neuronal and cardiovascular cells, and regulation of immune function. Dependent on the tissues and cells, activation of GHSR may trigger a diversity of signaling mechanisms and subsequent distinct physiological responses. Distinct regulation of GHSR occurs at levels of transcription, receptor interaction and internalization. Here we review the current understanding on the intracellular signaling pathways of GHSR and its modulation. An overview of the molecular structure of GHSR is presented first, followed by the discussion on its signaling mechanisms. Finally, potential mechanisms regulating GHSR are reviewed. PMID:24651458

  2. Potential involvement of extracellular signal-regulated kinase 1 and 2 in encystation of a primitive eukaryote, Giardia lamblia. Stage-specific activation and intracellular localization.


    Ellis, John G; Davila, Monica; Chakrabarti, Ratna


    Mitogen-activated protein kinase (MAPK) pathways are major signaling systems by which eukaryotic cells convert environmental cues to intracellular events such as proliferation and differentiation. We have identified Giardia lamblia homologues of two members of the MAPK family ERK1 and ERK2. Functional characterization of giardial ERK1 and ERK2 revealed that both kinases were expressed in trophozoites and encysting cells as 44- and 41-kDa polypeptides, respectively, and were catalytically active. Analysis of the kinetic parameters of the recombinant proteins showed that ERK2 is approximately 5 times more efficient than ERK1 in phosphorylating myelin basic protein as a substrate, although the phosphorylating efficiency of the native ERK1 and ERK2 appeared to be the same. Immunofluorescence analysis of the subcellular localization of ERK1 and ERK2 in trophozoites showed ERK1 staining mostly in the median body and in the outer edges of the adhesive disc and ERK2 staining in the nuclei and in the caudal flagella. Our study also showed a noticeable change in the subcellular distribution of ERK2 during encystation, which became more punctate and mostly cytoplasmic, but no significant change in the ERK1 localization at any time during encystation. Interestingly, both ERK1 and ERK2 enzymes exhibited a significantly reduced kinase activity during encystation reaching a minimum at 24 h, except for an initial approximately 2.5-fold increase in the ERK1 activity at 2 h, which resumed back to the normal levels at 48 h despite no apparent change in the expression level of either one of these kinases in encysting cells. A reduced concentration of the phosphorylated ERK1 and ERK2 was also evident in these cells at 24 h. Our study suggests a functional distinction between ERK1 and ERK2 and that these kinases may play a critical role in trophozoite differentiation into cysts.

  3. The role of Noise for Intracellular Calcium Signaling

    NASA Astrophysics Data System (ADS)

    Jung, Peter


    Calcium signaling is one of the most important and common cellular signaling mechanisms. Calcium signals turn on the wound response in epithelia cells (e.g. the cornea) and brain tissue, play an important role for metabolic processes in liver and pancreas, signal the heart muscle to contract, and are important players in learning and memory. Binding of agonist to receptors in the cell membrane can trigger the release of Ca^2+ from internal stores through small patches of release channels and the formation of intracellular, spatiotemporal calcium patterns that can be observed by using fluorescent markers. What makes these patterns so interesting from the biologic as well as the nonlinear dynamics perspective is that active elements (the release channels) are distributed discretely in small patches (about 100nm in size) that are typically 2mm apart. Processes on this scale are subject to large fluctuations that can dominate the overall calcium signal on a cellular and tissue scale depending on physiologic parameters. Pattern formation in such systems, with discretely distributed active sites and fluctuations poses new challenges that researchers have started to address only in the last years. Recent results in computational modeling of these processes from the elementary release process to the cellular level, are put into context with experimental findings. We focus on the effects of receptor clustering in the context of the cellular Ca^2+ signaling capability.

  4. Intracellular signalling involved in volume regulatory decrease.


    Hoffmann, E K


    The following volume-sensitive channels are characterized in Ehrlich ascites tumor cells (EATC), (i) a tamoxifen- and AA acid sensitive, outwardly rectifying small anion channel (I(Cl,vol)) with low field anion selectivity (I(-)>Cl(-)) and moderate depolarisation-induced inactivation, (ii) a separate DIDS- and niflumic acid-sensitive organic osmolyte/anion channel (OOC) transporting predominantly taurine, and (iii) a clofilium- and Ba(2+)-sensitive, voltage- and Ca(2+)-insensitive 5 pS K(+) channel (I(K,vol)), resistant to a range of K(+) channel inhibitors including ChTX, clotrimazole, apamin, kaliotoxin, margatoxin, and TEA, and with a pH(o) dependence reminiscent of the two-pore domain background K(+) channels TASK. Cell swelling leads to an immediate and transient 3.3 fold increase in the rate of AA release resulting from activation of cPLA(2)alpha, which is found to be translocated to the nucleus upon cell swelling (probably to the inner nuclear membrane), where it is phosphorylated and activated by a G-protein coupled process. AA is a precursor for LTC(4), which is transported out of the cell, where it is converted to LTD(4), which activates I(K,vol), and OOC, whereas I(Cl,vol) is activated via a different pathway. In the absence of an increase in [Ca(2+)](i), the unitary conductance, kinetics, and pharmacological profile are similar for I(K,vol) and the K(+)-channels activated by LTD(4). Tyrosine phosphorylations are involved in the volume regulatory pathways and in defining the volume set-point. Tyrosin kinases appear to be involved in the signalling sequence leading to opening of the channels, and tyrosin phosphatases seem to be involved in closing of the channels. Finally a significant de-polymerization of F-actin is observed after cell swelling, the potential role of which in the volume regulatory mechanisms is under investigation.

  5. Intracellular Mono-ADP-Ribosylation in Signaling and Disease

    PubMed Central

    Bütepage, Mareike; Eckei, Laura; Verheugd, Patricia; Lüscher, Bernhard


    A key process in the regulation of protein activities and thus cellular signaling pathways is the modification of proteins by post-translational mechanisms. Knowledge about the enzymes (writers and erasers) that attach and remove post-translational modifications, the targets that are modified and the functional consequences elicited by specific modifications, is crucial for understanding cell biological processes. Moreover detailed knowledge about these mechanisms and pathways helps to elucidate the molecular causes of various diseases and in defining potential targets for therapeutic approaches. Intracellular adenosine diphosphate (ADP)-ribosylation refers to the nicotinamide adenine dinucleotide (NAD+)-dependent modification of proteins with ADP-ribose and is catalyzed by enzymes of the ARTD (ADP-ribosyltransferase diphtheria toxin like, also known as PARP) family as well as some members of the Sirtuin family. Poly-ADP-ribosylation is relatively well understood with inhibitors being used as anti-cancer agents. However, the majority of ARTD enzymes and the ADP-ribosylating Sirtuins are restricted to catalyzing mono-ADP-ribosylation. Although writers, readers and erasers of intracellular mono-ADP-ribosylation have been identified only recently, it is becoming more and more evident that this reversible post-translational modification is capable of modulating key intracellular processes and signaling pathways. These include signal transduction mechanisms, stress pathways associated with the endoplasmic reticulum and stress granules, and chromatin-associated processes such as transcription and DNA repair. We hypothesize that mono-ADP-ribosylation controls, through these different pathways, the development of cancer and infectious diseases. PMID:26426055

  6. Systematic Characterization of Dynamic Parameters of Intracellular Calcium Signals

    PubMed Central

    Mackay, Laurent; Mikolajewicz, Nicholas; Komarova, Svetlana V.; Khadra, Anmar


    Dynamic processes, such as intracellular calcium signaling, are hallmark of cellular biology. As real-time imaging modalities become widespread, a need for analytical tools to reliably characterize time-series data without prior knowledge of the nature of the recordings becomes more pressing. The goal of this study is to develop a signal-processing algorithm for MATLAB that autonomously computes the parameters characterizing prominent single transient responses (TR) and/or multi-peaks responses (MPR). The algorithm corrects for signal contamination and decomposes experimental recordings into contributions from drift, TRs, and MPRs. It subsequently provides numerical estimates for the following parameters: time of onset after stimulus application, activation time (time for signal to increase from 10 to 90% of peak), and amplitude of response. It also provides characterization of the (i) TRs by quantifying their area under the curve (AUC), response duration (time between 1/2 amplitude on ascent and descent of the transient), and decay constant of the exponential decay region of the deactivation phase of the response, and (ii) MPRs by quantifying the number of peaks, mean peak magnitude, mean periodicity, standard deviation of periodicity, oscillatory persistence (time between first and last discernable peak), and duty cycle (fraction of period during which system is active) for all the peaks in the signal, as well as coherent oscillations (i.e., deterministic spikes). We demonstrate that the signal detection performance of this algorithm is in agreement with user-mediated detection and that parameter estimates obtained manually and algorithmically are correlated. We then apply this algorithm to study how metabolic acidosis affects purinergic (P2) receptor-mediated calcium signaling in osteoclast precursor cells. Our results reveal that acidosis significantly attenuates the amplitude and AUC calcium responses at high ATP concentrations. Collectively, our data

  7. Neutrophil cell surface receptors and their intracellular signal transduction pathways☆

    PubMed Central

    Futosi, Krisztina; Fodor, Szabina; Mócsai, Attila


    Neutrophils play a critical role in the host defense against bacterial and fungal infections, but their inappropriate activation also contributes to tissue damage during autoimmune and inflammatory diseases. Neutrophils express a large number of cell surface receptors for the recognition of pathogen invasion and the inflammatory environment. Those include G-protein-coupled chemokine and chemoattractant receptors, Fc-receptors, adhesion receptors such as selectins/selectin ligands and integrins, various cytokine receptors, as well as innate immune receptors such as Toll-like receptors and C-type lectins. The various cell surface receptors trigger very diverse signal transduction pathways including activation of heterotrimeric and monomeric G-proteins, receptor-induced and store-operated Ca2 + signals, protein and lipid kinases, adapter proteins and cytoskeletal rearrangement. Here we provide an overview of the receptors involved in neutrophil activation and the intracellular signal transduction processes they trigger. This knowledge is crucial for understanding how neutrophils participate in antimicrobial host defense and inflammatory tissue damage and may also point to possible future targets of the pharmacological therapy of neutrophil-mediated autoimmune or inflammatory diseases. PMID:23994464

  8. MC1R signaling. Intracellular partners and pathophysiological implications.


    Herraiz, Cecilia; Garcia-Borron, Jose C; Jiménez-Cervantes, Celia; Olivares, Conchi


    The melanocortin-1 receptor (MC1R) preferentially expressed in melanocytes is best known as a key regulator of the synthesis of epidermal melanin pigments. Its paracrine stimulation by keratinocyte-derived melanocortins also activates DNA repair pathways and antioxidant defenses to build a complex, multifaceted photoprotective response. Many MC1R actions rely on cAMP-dependent activation of two transcription factors, MITF and PGC1α, but pleiotropic MC1R signaling also involves activation of mitogen-activated kinases and AKT. MC1R partners such as β-arrestins, PTEN and the E3 ubiquitin ligase MGRN1 differentially regulate these pathways. The MC1R gene is complex and polymorphic, with frequent variants associated with skin phenotypes and increased cancer risk. We review current knowledge of signaling from canonical MC1R, its splice isoforms and natural polymorphic variants. Recently discovered intracellular targets and partners are also discussed, to highlight the diversity of mechanisms that may contribute to normal and pathological variation of pigmentation and sensitivity to solar radiation-induced damage. This article is part of a Special Issue entitled: Melanocortin Receptors - edited by Ya-Xiong Tao.

  9. Activities of Antimicrobial Agents against Intracellular Pneumococci

    PubMed Central

    Mandell, Gerald L.; Coleman, Elizabeth J.


    Pneumococci can enter and survive inside human lung alveolar carcinoma cells. We examined the activity of azithromycin, gentamicin, levofloxacin, moxifloxacin, penicillin G, rifampin, telithromycin, and trovafloxacin against pneumococci inside and outside cells. We found that moxifloxacin, trovafloxacin, and telithromycin were the most active, but only telithromycin killed all intracellular organisms. PMID:10952618

  10. The Notch intracellular domain integrates signals from Wnt, Hedgehog, TGFβ/BMP and hypoxia pathways.


    Borggrefe, Tilman; Lauth, Matthias; Zwijsen, An; Huylebroeck, Danny; Oswald, Franz; Giaimo, Benedetto Daniele


    Notch signaling is a highly conserved signal transduction pathway that regulates stem cell maintenance and differentiation in several organ systems. Upon activation, the Notch receptor is proteolytically processed, its intracellular domain (NICD) translocates into the nucleus and activates expression of target genes. Output, strength and duration of the signal are tightly regulated by post-translational modifications. Here we review the intracellular post-translational regulation of Notch that fine-tunes the outcome of the Notch response. We also describe how crosstalk with other conserved signaling pathways like the Wnt, Hedgehog, hypoxia and TGFβ/BMP pathways can affect Notch signaling output. This regulation can happen by regulation of ligand, receptor or transcription factor expression, regulation of protein stability of intracellular key components, usage of the same cofactors or coregulation of the same key target genes. Since carcinogenesis is often dependent on at least two of these pathways, a better understanding of their molecular crosstalk is pivotal.

  11. [Intracellular signals involved in glucose control].


    Cruz, M; Velasco, E; Kumate, J


    Many proteins are involved in glucose control. The first step for glucose uptake is insulin receptor-binding. Stimulation of the insulin receptor results in rapid autophosphorylation and conformational changes in the beta chain and the subsequent phosphorylation of the insulin receptor substrate. This results in the docking of several SH2 domain proteins, including PI 3-kinase and other adapters. The final event is glucose transporter (GLUT) translocation to the cell surface. GLUT is in the cytosol but after insulin stimulation, several proteins are activated either in the GLUT vesicles or in the inner membrane. The role of the cytoskeleton is not well known, but it apparently participates in membrane fusion and vesicle mobilization. After glucose uptake, several hexokines metabolize the glucose to generate energy, convert the glucose in glycogen and store it. Type 2 diabetes is characterized by high glucose levels and insulin resistance. The insulin receptor is diminished on the cell surface membrane, tyrosine phosphorylation is decreased, serine and threonine phosphorylation is augmented. Apparently, the main problem with GLUT protein is in its translocation to the cell surface. At present, we know the role of many proteins involved in glucose control. However, we do not understand the significance of insulin resistance at the molecular level with type 2 diabetes.

  12. Adaptation of fast marching methods to intracellular signaling

    NASA Astrophysics Data System (ADS)

    Chikando, Aristide C.; Kinser, Jason M.


    Imaging of signaling phenomena within the intracellular domain is a well studied field. Signaling is the process by which all living cells communicate with their environment and with each other. In the case of signaling calcium waves, numerous computational models based on solving homogeneous reaction diffusion equations have been developed. Typically, the reaction diffusion approach consists of solving systems of partial differential equations at each update step. The traditional methods used to solve these reaction diffusion equations are very computationally expensive since they must employ small time steps in order to reduce the computational error. The presented research suggests the application of fast marching methods to imaging signaling calcium waves, more specifically fertilization calcium waves, in Xenopus laevis eggs. The fast marching approach provides fast and efficient means of tracking the evolution of monotonically advancing fronts. A model that employs biophysical properties of intracellular calcium signaling, and adapts fast marching methods to tracking the propagation of signaling calcium waves is presented. The developed model is used to reproduce simulation results obtained with reaction diffusion based model. Results obtained with our model agree with both the results obtained with reaction diffusion based models, and confocal microscopy observations during in vivo experiments. The adaptation of fast marching methods to intracellular protein or macromolecule trafficking is also briefly explored.

  13. Evolution of the Calcium-Based Intracellular Signaling System

    PubMed Central

    Marchadier, Elodie; Oates, Matt E.; Fang, Hai; Donoghue, Philip C.J.; Hetherington, Alistair M.; Gough, Julian


    To progress our understanding of molecular evolution from a collection of well-studied genes toward the level of the cell, we must consider whole systems. Here, we reveal the evolution of an important intracellular signaling system. The calcium-signaling toolkit is made up of different multidomain proteins that have undergone duplication, recombination, sequence divergence, and selection. The picture of evolution, considering the repertoire of proteins in the toolkit of both extant organisms and ancestors, is radically different from that of other systems. In eukaryotes, the repertoire increased in both abundance and diversity at a far greater rate than general genomic expansion. We describe how calcium-based intracellular signaling evolution differs not only in rate but in nature, and how this correlates with the disparity of plants and animals. PMID:27358427

  14. Role of I-TAC-binding receptors CXCR3 and CXCR7 in proliferation, activation of intracellular signaling pathways and migration of various tumor cell lines.


    Miekus, Katarzyna; Jarocha, Danuta; Trzyna, Elzbieta; Majka, Marcin


    Chemokines and its receptors stimulate tumor growth, migration and invasion. In this study we evaluated the expression and function of CXCR3 and CXCR7 receptors in cervical carcinoma, rhabdomyosarcoma and glioblastoma cell lines. We found that both receptors were expressed at different degree by tumor cells. CXCR7 was expressed at both mRNA and protein level by all tumor cell lines. The expression of CXCR7 differed between rhabdomyosarcoma subtypes. The receptor was highly expressed in alveolar rhabdomyosarcoma and the expression was low in embryonal rhabdomyosarcoma. The expression of CXCR3 was low in majority of the tumor cell lines. Upon I-TAC stimulation AKT and MAPK kinases were activated. However, the activation of growth promoting pathways did not increased the proliferation rate of tumor cells. Since chemokines stimulate the migration of various cell types the ability of I-TAC to stimulate migration of tumor cells were studied. We did not observe the migration of tumor cells toward I-TAC gradient alone. However, at the low dose, I-TAC sensitized tumor cells toward SDF-1beta gradient and synergized with SDF-1beta in activation of intracellular pathways. Our data suggest an important role of I-TAC and its receptors in biology of solid tumors and we postulate that I-TAC-binding receptors might be used as the potential targets for antitumor therapy.

  15. Practical aspects of measuring intracellular calcium signals with fluorescent indicators.


    Kao, Joseph P Y; Li, Gong; Auston, Darryl A


    The use of fluorescent indicators for monitoring calcium (Ca(2+)) signals and for measuring Ca(2+) concentration ([Ca(2+)]) in living cells is described. The following topics are covered in detail: (1) ratiometric and nonratiometric fluorescent indicators and the principles underlying their use, (2) techniques for loading Ca(2+) indicators and Ca(2+) buffers into living cells, (3) calibration of indicator fluorescence intensity measurements to yield values of intracellular [Ca(2+)], (4) analysis of nonratiometric fluorescence intensity data and caveats relating to their interpretation, (5) techniques for manipulating intracellular and extracellular [Ca(2+)], and (6) the use of fluorescent indicators to monitor Ca(2+) signals in mitochondria. The chapter aims to present these fundamental topics in a manner that is practically useful and intuitively accessible. The origins of key mathematical equations used in the article are outlined in two appendices.

  16. Connexin 43 hemichannels and intracellular signaling in bone cells

    PubMed Central

    Plotkin, Lilian I.


    Cell function and survival are controlled by intracellular signals, and modulated by surrounding cells and the extracellular environment. Connexin channels participate in these processes by mediating cell-to-cell communication. In bone cells, gap junction channels were detected in the early 1970s, and are present among bone resorbing osteoclasts, bone forming osteoblasts, and osteocytes - mature osteoblasts embedded in the mineralized matrix. These channels are composed mainly by Cx43, although the expression of other connexins (45, 46, and 37) has also been reported. It is now believed that undocked Cx43 hemichannels (connexons) formed in unopposed cell membranes facing the extracellular environment participate in the interaction of bone cells with the extracellular environment, and in their communication with neighboring cells. Thus, we and others demonstrated the presence of active hemichannels in osteoblastic and osteocytic cells. These hemichannels open in response to pharmacological and mechanical stimulation. In particular, preservation of the viability of osteoblasts and osteocytes by the anti-osteoporotic drugs bisphosphonates depends on Cx43 expression in vitro and in vivo, and is mediated by undocked hemichannels. Cx43 hemichannels are also required for the release of prostaglandins and ATP by osteocytes, and for cell survival induced by mechanical stimulation in vitro. Moreover, they are required for the anti-apoptotic effect of parathyroid hormone in osteoblastic cells. This review summarizes the current knowledge on the presence and function of undocked connexons, and the role of hemichannel regulation for the maintenance of bone cell viability and, potentially, bone health. PMID:24772090

  17. Ca2+ signaling and intracellular Ca2+ binding proteins.


    Niki, I; Yokokura, H; Sudo, T; Kato, M; Hidaka, H


    Changes in cytosolic Ca2+ concentrations evoke a wide range of cellular responses and intracellular Ca(2+)-binding proteins are the key molecules to transduce Ca2+ signaling via enzymatic reactions or modulation of protein/protein interations (Fig.1). The EF hand proteins, like calmodulin and S100 proteins, are considered to exert Ca(2+)-dependent actions in the nucleus or the cytoplasm. The Ca2+/phospholipid binding proteins are classified into two groups, the annexins and the C2 region proteins. These proteins, distributed mainly in the cytoplasm, translocate to the plasma membrane in response to an increase in cytosolic Ca2+ and function in the vicinity of the membrane. Ca2+ storage proteins in the endoplasmic or sarcoplasmic reticulum provide the high Ca2+ capacity of the Ca2+ store sites, which regulate intracellular Ca2+ distribution. The variety and complexity of Ca2+ signaling result from the cooperative actions of specific Ca(2+)-binding proteins. This review describes biochemical properties of intracellular Ca(2+)-binding proteins and their proposed roles in mediating Ca2+ signaling.

  18. Intracellular Uptake of Curcumin-Loaded Solid Lipid Nanoparticles Exhibit Anti-Inflammatory Activities Superior to Those of Curcumin Through the NF-κB Signaling Pathway.


    Wang, Jiao; Zhu, Rongrong; Sun, Dongmei; Sun, Xiaoyu; Geng, Zhengsong; Liu, Hui; Wang, Shi-Long


    Curcumin (Cur) is a naturally derived, novel anti-inflammatory agent, but its poor solubility limits its clinical use. The aim of the present study was to encapsulate Cur into solid lipid nanoparticles (SLNs) to improve its anti-inflammatory activity. The Cur-loaded SLNs (Cur-SLNs) were prepared using emulsification and low-temperature solidification methods. In contrast to free Cur, the particles were well dispersed in aqueous medium, showing a narrow size distribution with a range of 55 : 1.2 nm, a zeta potential value of -26.2 ± 1.3 mV, and a high drug loading efficiency of 37% ± 2.5%. The sustained release of Cur was observed for up to 6 days. The particles displayed enhanced stability in phosphate-buffered saline by protecting the encapsulated Cur against hydrolysis and biotransformation, as well as increasing biocompatibility. Cur-SLNs were more effective than free Cur at reducing the expression levels of several pro- inflammatory mediators, including inflammatory cytokines (IL-6, TNF-α, and IL-1β) and nitric oxide (NO), under in vitro conditions. By Western blotting, we found that Cur-SLNs were more active than free Cur in inhibiting the LPS-induced activation of the inflammatory transcription factor NF-κB through the suppression of IκB kinase activation. Compared to free Cur, Cur-SLNs had an increased intracellular uptake over time (observed after 24 h) in RAW264.7 cells. Moreover, the Cur-SLNs (≥ 20 μM) significantly improved RAW264.7 cell viability by inhibiting apoptosis. Thus, these results demonstrated that SLNs could be used as potential anti-inflammatory drug carriers for the treatment of various chronic diseases.

  19. H⁺-activated Na⁺ influx in the ventricular myocyte couples Ca²⁺-signalling to intracellular pH.


    Garciarena, Carolina D; Youm, Jae Boum; Swietach, Pawel; Vaughan-Jones, Richard D


    Acid extrusion on Na(+)-coupled pH-regulatory proteins (pH-transporters), Na(+)/H(+) exchange (NHE1) and Na(+)-HCO3(-) co-transport (NBC), drives Na(+) influx into the ventricular myocyte. This H(+)-activated Na(+)-influx is acutely up-regulated at pHi<7.2, greatly exceeding Na(+)-efflux on the Na(+)/K(+) ATPase. It is spatially heterogeneous, due to the co-localisation of NHE1 protein (the dominant pH-transporter) with gap-junctions at intercalated discs. Overall Na(+)-influx via NBC is considerably lower, but much is co-localised with L-type Ca(2+)-channels in transverse-tubules. Through a functional coupling with Na(+)/Ca(2+) exchange (NCX), H(+)-activated Na(+)-influx increases sarcoplasmic-reticular Ca(2+)-loading and release during intracellular acidosis. This raises Ca(2+)-transient amplitude, rescuing it from direct H(+)-inhibition. Functional coupling is biochemically regulated and linked to membrane receptors, through effects on NHE1 and NBC. It requires adequate cytoplasmic Na(+)-mobility, as NHE1 and NCX are spatially separated (up to 60μm). The relevant functional NCX activity must be close to dyads, as it exerts no effect on bulk diastolic Ca(2+). H(+)-activated Na(+)-influx is up-regulated during ischaemia-reperfusion and some forms of maladaptive hypertrophy and heart failure. It is thus an attractive system for therapeutic manipulation. This article is part of a Special Issue entitled "Na(+) Regulation in Cardiac Myocytes".

  20. Intracellular Ca(2+) signaling is required for neurotrophin-induced potentiation in the adult rat hippocampus.


    Kang, H; Schuman, E M


    Recent studies have demonstrated the importance of neurotrophin function in adult synaptic plasticity. In an effort to characterize the intracellular signaling pathways that couple Trk receptor activation to the final physiological effects of neurotrophins, we have examined the role of intracellular calcium rises in neurotrophin-induced synaptic enhancement in hippocampal slices. Using pharmacological blockers to two different calcium ion (Ca(2+)) sources, voltage-gated Ca(2+) channels and intracellular Ca(2+) stores, we show that the potentiating effects of neurotrophins in hippocampal slices are mediated by intracellular Ca(2+) signaling. Although basal synaptic transmission between hippocampal CA3 and CA1 neurons was not affected by nifedipine or thapsigargin, both drugs significantly attenuated brain-derived neurotrophic factor or neurotrophin-3-induced synaptic enhancement. The pharmacological blockade of Ca(2+) signaling is effective only during the initial period of neurotrophin-induced potentiation. These data suggest that the minimal requirements for inducing potentiation by neurotrophins involve a transient increase in intracellular Ca(2+) concentration, via voltage-gated Ca(2+) channels and/or intracellular Ca(2+) stores.

  1. Skin Aging-Dependent Activation of the PI3K Signaling Pathway via Downregulation of PTEN Increases Intracellular ROS in Human Dermal Fibroblasts

    PubMed Central

    Park, Jinny; Song, Hwa-Ryung; Lee, Minok; Hong, On-Yu; Whang, Pyoung H.; Han, Myung-Kwan; Kwon, Kang-Beom


    Reactive oxygen species (ROS) play a major role in both chronological aging and photoaging. ROS induce skin aging through their damaging effect on cellular constituents. However, the origins of ROS have not been fully elucidated. We investigated that ROS generation of replicative senescent fibroblasts is generated by the modulation of phosphatidylinositol 3,4,5-triphosphate (PIP3) metabolism. Reduction of the PTEN protein, which dephosphorylates PIP3, was responsible for maintaining a high level of PIP3 in replicative cells and consequently mediated the activation of the phosphatidylinositol-3-OH kinase (PI3K)/Akt pathway. Increased ROS production was blocked by inhibition of PI3K or protein kinase C (PKC) or by NADPH oxidase activating in replicative senescent cells. These data indicate that the signal pathway to ROS generation in replicative aged skin cells can be stimulated by reduced PTEN level. Our results provide new insights into skin aging-associated modification of the PI3K/NADPH oxidase signaling pathway and its relationship with a skin aging-dependent increase of ROS in human dermal fibroblasts. PMID:28003865

  2. p38 mitogen-activated protein kinase-dependent and -independent intracellular signal transduction pathways leading to apoptosis in human neutrophils.


    Frasch, S C; Nick, J A; Fadok, V A; Bratton, D L; Worthen, G S; Henson, P M


    Human neutrophils undergo apoptosis spontaneously when cultured in vitro; however, the signal transduction pathways involved remain largely unknown. In some cell types, c-Jun NH2-terminal kinase and p38 mitogen-activated protein kinase (MAPK) have been implicated in the pathways leading to stress-induced apoptosis. In this study, we begin to define two pathways leading to apoptosis in the neutrophil induced either by stress stimuli (UV, hyperosmolarity, sphingosine) or by anti-Fas antibody or overnight culture in vitro (spontaneous apoptosis). Apoptosis induced by stress stimuli activated p38 MAPK, and apoptosis was inhibited by the specific p38 MAPK inhibitor, 6-(4-Fluorophenyl)-2.3-dihydro-5-(4-puridinyl)imidazo(2, 1-beta)thiazole dihydrochloride. Furthermore, differentiation of HL-60 cells toward the neutrophil phenotype resulted in a loss in c-Jun NH2-terminal kinase activation with concomitant acquisition of formylmethionylleucylphenylalanine-stimulatable and stress-inducible p38 MAPK activity as well as apoptosis blockade by the p38 MAPK inhibitor. In contrast, anti-Fas-induced or spontaneous apoptosis occurred independent of p38 MAPK activation and was not blocked by the inhibitor. Both pathways appear to utilize member(s) of the caspase family, since pretreatment with either Val-Ala-Asp-fluoromethyl ketone or Asp-Glu-Val-Asp-fluoromethyl ketone inhibited apoptosis induced by each of the stimuli. We propose the presence of at least two pathways leading to apoptosis in human neutrophils, a stress-activated pathway that is dependent on p38 MAPK activation and an anti-FAS/spontaneous pathway that is p38 MAPK-independent.

  3. Modeling intracellular signaling underlying striatal function in health and disease

    PubMed Central

    Nair, Anu G; Gutierrez-Arenas, Omar; Eriksson, Olivia; Jauhiainen, Alexandra; Blackwell, Kim T; Kotaleski, Jeanette Hellgren


    Striatum, which is the input nucleus of the basal ganglia, integrates cortical and thalamic glutamatergic inputs with dopaminergic afferents from the substantia nigra pars compacta. The combination of dopamine and glutamate strongly modulates molecular and cellular properties of striatal neurons and the strength of corticostriatal synapses. These actions are performed via intracellular signaling networks, containing several intertwined feedback loops. Understanding the role of dopamine and other neuromodulators requires the development of quantitative dynamical models for describing the intracellular signaling, in order to provide precise unambiguous descriptions and quantitative predictions. Building such models requires integration of data from multiple data sources containing information regarding the molecular interactions, the strength of these interactions, and the subcellular localization of the molecules. Due to the uncertainty, variability, and sparseness of these data, parameter estimation techniques are critical for inferring or constraining the unknown parameters, and sensitivity analysis evaluates which parameters are most critical for a given observed macroscopic behavior. Here, we briefly review the modeling approaches and tools that have been used to investigate biochemical signaling in the striatum, along with some of the models built around striatum. We also suggest a future direction for the development of such models from the, now becoming abundant, high-throughput data. PMID:24560149

  4. Kinetic insulation as an effective mechanism for achieving pathway specificity in intracellular signaling networks

    PubMed Central

    Behar, Marcelo; Dohlman, Henrik G.; Elston, Timothy C.


    Intracellular signaling pathways that share common components often elicit distinct physiological responses. In most cases, the biochemical mechanisms responsible for this signal specificity remain poorly understood. Protein scaffolds and cross-inhibition have been proposed as strategies to prevent unwanted cross-talk. Here, we report a mechanism for signal specificity termed “kinetic insulation.” In this approach signals are selectively transmitted through the appropriate pathway based on their temporal profile. In particular, we demonstrate how pathway architectures downstream of a common component can be designed to efficiently separate transient signals from signals that increase slowly over time. Furthermore, we demonstrate that upstream signaling proteins can generate the appropriate input to the common pathway component regardless of the temporal profile of the external stimulus. Our results suggest that multilevel signaling cascades may have evolved to modulate the temporal profile of pathway activity so that stimulus information can be efficiently encoded and transmitted while ensuring signal specificity. PMID:17913886

  5. Mechanisms of Borrelia burgdorferi internalization and intracellular innate immune signaling.


    Petnicki-Ocwieja, Tanja; Kern, Aurelie


    Lyme disease is a long-term infection whose most severe pathology is characterized by inflammatory arthritis of the lower bearing joints, carditis, and neuropathy. The inflammatory cascades are initiated through the early recognition of invading Borrelia burgdorferi spirochetes by cells of the innate immune response, such as neutrophils and macrophage. B. burgdorferi does not have an intracellular niche and thus much research has focused on immune pathways activated by pathogen recognition molecules at the cell surface, such as the Toll-like receptors (TLRs). However, in recent years, studies have shown that internalization of the bacterium by host cells is an important component of the defense machinery in response to B. burgdorferi. Upon internalization, B. burgdorferi is trafficked through an endo/lysosomal pathway resulting in the activation of a number of intracellular pathogen recognition receptors including TLRs and Nod-like receptors (NLRs). Here we will review the innate immune molecules that participate in both cell surface and intracellular immune activation by B. burgdorferi.

  6. Menstrual cycle and reproductive aging alters immune reactivity, NGF expression, antioxidant enzyme activities, and intracellular signaling pathways in the peripheral blood mononuclear cells of healthy women.


    Priyanka, Hannah P; Sharma, Utsav; Gopinath, Srinivasan; Sharma, Varun; Hima, Lalgi; ThyagaRajan, Srinivasan


    Reproductive senescence in women is a process that begins with regular menstrual cycles and culminates in menopause followed by gradual development of diseases such as autoimmune diseases, osteoporosis, neurodegenerative diseases, and hormone-dependent cancers. The age-associated impairment in the functions of neuroendocrine system and immune system results in menopause which contributes to subsequent development of diseases and cancer. The aim of this study is to characterize the alterations in immune responses, compensatory factors such as nerve growth factor (NGF) and antioxidant enzyme activities, and the molecular mechanisms of actions in the peripheral blood mononuclear cells (PBMCs) of young (follicular and luteal phases), middle-aged, and old healthy women. Peripheral blood mononuclear cells were isolated from young women in follicular and luteal phases of the menstrual cycle (n=20; 22.6±2.9 yrs), middle-aged women (n=19; 47.1±3.8 yrs; perimenopausal) and old (n=16; 63.2±4.7 yrs; post-menopausal) women and analyzed for Concanavalin (Con A)-induced proliferation of lymphocytes and cytokine (IL-2 and IFN-γ) production, expression of NGF, p-NF-κB, p-ERK, p-CREB, and p-Akt, antioxidant enzymes [superoxide dismutase (SOD), catalase, and glutathione peroxidase (GPx), glutathione-S-transferase (GST)], extent of lipid peroxidation, and nitric oxide (NO) production. Serum gonadal hormones (17β-estradiol and progesterone) were also measured. A characteristic age- and menstrual cycle-related change was observed in the serum gonadal hormone secretion (estrogen and progesterone), T lymphocyte proliferation and IFN-γ production. Salient features include the age-related decline observed in target-derived growth factors (lymphocyte NGF expression), signaling molecules (p-ERK/ERK and p-CREB/CREB ratios) and compensatory factors such as the activities of plasma and PBMC antioxidant enzymes (SOD and catalase) and NO production. Further, an age-associated increase in p

  7. Intracellular signals of lung cancer cells as possible therapeutic targets

    PubMed Central

    Tanaka, Kiyomichi; Kumano, Keiki; Ueno, Hiroo


    In recent years, several molecularly targeted therapies have been developed as part of lung cancer treatment; they have produced dramatically good results. However, among the many oncogenes that have been identified to be involved in the development of lung cancers, a number of oncogenes are not covered by these advanced therapies. For the treatment of lung cancers, which is a group of heterogeneous diseases, persistent effort in developing individual therapies based on the respective causal genes is important. In addition, for the development of a novel therapy, identification of the lung epithelial stem cells and the origin cells of lung cancer, and understanding about candidate cancer stem cells in lung cancer tissues, their intracellular signaling pathways, and the mechanism of dysregulation of the pathways in cancer cells are extremely important. However, the development of drug resistance by cancer cells, despite the use of molecularly targeted drugs for the causal genes, thus obstructing treatment, is a well-known phenomenon. In this article, we discuss major causal genes of lung cancers and intracellular signaling pathways involving those genes, and review studies on origin and stem cells of lung cancers, as well as the possibility of developing molecularly targeted therapies based on these studies. PMID:25707772

  8. Redox Regulation of Intracellular Zinc: Molecular Signaling in the Life and Death of Neurons

    PubMed Central

    Aizenman, Elias


    Abstract Zn2+ has emerged as a major regulator of neuronal physiology, as well as an important signaling agent in neural injury. The intracellular concentration of this metal is tightly regulated through the actions of Zn2+ transporters and the thiol-rich metal binding protein metallothionein, closely linking the redox status of the cell to cellular availability of Zn2+. Accordingly, oxidative and nitrosative stress during ischemic injury leads to an accumulation of neuronal free Zn2+ and the activation of several downstream cell death processes. While this Zn2+ rise is an established signaling event in neuronal cell death, recent evidence suggests that a transient, sublethal accumulation of free Zn2+ can also play a critical role in neuroprotective pathways activated during ischemic preconditioning. Thus, redox-sensitive proteins, like metallothioneins, may play a critical role in determining neuronal cell fate by regulating the localization and concentration of intracellular free Zn2+. Antioxid. Redox Signal. 15, 2249–2263. PMID:20849376

  9. Acoustic tweezers for studying intracellular calcium signaling in SKBR-3 human breast cancer cells.


    Hwang, Jae Youn; Yoon, Chi Woo; Lim, Hae Gyun; Park, Jin Man; Yoon, Sangpil; Lee, Jungwoo; Shung, K Kirk


    Extracellular matrix proteins such as fibronectin (FNT) play crucial roles in cell proliferation, adhesion, and migration. For better understanding of these associated cellular activities, various microscopic manipulation tools have been used to study their intracellular signaling pathways. Recently, it has appeared that acoustic tweezers may possess similar capabilities in the study. Therefore, we here demonstrate that our newly developed acoustic tweezers with a high-frequency lithium niobate ultrasonic transducer have potentials to study intracellular calcium signaling by FNT-binding to human breast cancer cells (SKBR-3). It is found that intracellular calcium elevations in SKBR-3 cells, initially occurring on the microbead-contacted spot and then eventually spreading over the entire cell, are elicited by attaching an acoustically trapped FNT-coated microbead. Interestingly, they are suppressed by either extracellular calcium elimination or phospholipase C (PLC) inhibition. Hence, this suggests that our acoustic tweezers may serve as an alternative tool in the study of intracellular signaling by FNT-binding activities.

  10. Intracellular calcium strongly potentiates agonist-activated TRPC5 channels

    PubMed Central

    Blair, Nathaniel T.; Kaczmarek, J. Stefan


    TRPC5 is a calcium (Ca2+)-permeable nonselective cation channel expressed in several brain regions, including the hippocampus, cerebellum, and amygdala. Although TRPC5 is activated by receptors coupled to phospholipase C, the precise signaling pathway and modulatory signals remain poorly defined. We find that during continuous agonist activation, heterologously expressed TRPC5 currents are potentiated in a voltage-dependent manner (∼5-fold at positive potentials and ∼25-fold at negative potentials). The reversal potential, doubly rectifying current–voltage relation, and permeability to large cations such as N-methyl-d-glucamine remain unchanged during this potentiation. The TRPC5 current potentiation depends on extracellular Ca2+: replacement by Ba2+ or Mg2+ abolishes it, whereas the addition of 10 mM Ca2+ accelerates it. The site of action for Ca2+ is intracellular, as simultaneous fura-2 imaging and patch clamp recordings indicate that potentiation is triggered at ∼1 µM [Ca2+]. This potentiation is prevented when intracellular Ca2+ is tightly buffered, but it is promoted when recording with internal solutions containing elevated [Ca2+]. In cell-attached and excised inside-out single-channel recordings, increases in internal [Ca2+] led to an ∼10–20-fold increase in channel open probability, whereas single-channel conductance was unchanged. Ca2+-dependent potentiation should result in TRPC5 channel activation preferentially during periods of repetitive firing or coincident neurotransmitter receptor activation. PMID:19398778

  11. Light generation of intracellular Ca2+ signals by a genetically encoded protein BACCS

    PubMed Central

    Ishii, Tomohiro; Sato, Koji; Kakumoto, Toshiyuki; Miura, Shigenori; Touhara, Kazushige; Takeuchi, Shoji; Nakata, Takao


    Ca2+ signals are highly regulated in a spatiotemporal manner in numerous cellular physiological events. Here we report a genetically engineered blue light-activated Ca2+ channel switch (BACCS), as an optogenetic tool for generating Ca2+ signals. BACCS opens Ca2+-selective ORAI ion channels in response to light. A BACCS variant, dmBACCS2, combined with Drosophila Orai, elevates the Ca2+ concentration more rapidly, such that Ca2+ elevation in mammalian cells is observed within 1 s on light exposure. Using BACCSs, we successfully control cellular events including NFAT-mediated gene expression. In the mouse olfactory system, BACCS mediates light-dependent electrophysiological responses. Furthermore, we generate BACCS mutants, which exhibit fast and slow recovery of intracellular Ca2+. Thus, BACCSs are a useful optogenetic tool for generating temporally various intracellular Ca2+ signals with a large dynamic range, and will be applicable to both in vitro and in vivo studies. PMID:26282514

  12. Simplest relationship between local field potential and intracellular signals in layered neural tissue.


    Chizhov, Anton V; Sanchez-Aguilera, Alberto; Rodrigues, Serafim; de la Prida, Liset Menendez


    The relationship between the extracellularly measured electric field potential resulting from synaptic activity in an ensemble of neurons and intracellular signals in these neurons is an important but still open question. Based on a model neuron with a cylindrical dendrite and lumped soma, we derive a formula that substantiates a proportionality between the local field potential and the total somatic transmembrane current that emerges from the difference between the somatic and dendritic membrane potentials. The formula is tested by intra- and extracellular recordings of evoked synaptic responses in hippocampal slices. Additionally, the contribution of different membrane currents to the field potential is demonstrated in a two-population mean-field model. Our formalism, which allows for a simple estimation of unknown dendritic currents directly from somatic measurements, provides an interpretation of the local field potential in terms of intracellularly measurable synaptic signals. It is also applicable to the study of cortical activity using two-compartment neuronal population models.

  13. Simplest relationship between local field potential and intracellular signals in layered neural tissue

    NASA Astrophysics Data System (ADS)

    Chizhov, Anton V.; Sanchez-Aguilera, Alberto; Rodrigues, Serafim; de la Prida, Liset Menendez


    The relationship between the extracellularly measured electric field potential resulting from synaptic activity in an ensemble of neurons and intracellular signals in these neurons is an important but still open question. Based on a model neuron with a cylindrical dendrite and lumped soma, we derive a formula that substantiates a proportionality between the local field potential and the total somatic transmembrane current that emerges from the difference between the somatic and dendritic membrane potentials. The formula is tested by intra- and extracellular recordings of evoked synaptic responses in hippocampal slices. Additionally, the contribution of different membrane currents to the field potential is demonstrated in a two-population mean-field model. Our formalism, which allows for a simple estimation of unknown dendritic currents directly from somatic measurements, provides an interpretation of the local field potential in terms of intracellularly measurable synaptic signals. It is also applicable to the study of cortical activity using two-compartment neuronal population models.

  14. A physiologic signaling role for the γ-secretase-derived intracellular fragment of APP

    PubMed Central

    Leissring, Malcolm A.; Murphy, M. Paul; Mead, Tonya R.; Akbari, Yama; Sugarman, Michael C.; Jannatipour, Mehrdad; Anliker, Brigitte; Müller, Ulrike; Saftig, Paul; De Strooper, Bart; Wolfe, Michael S.; Golde, Todd E.; LaFerla, Frank M.


    Presenilins mediate an unusual intramembranous proteolytic activity known as γ-secretase, two substrates of which are the Notch receptor (Notch) and the β-amyloid precursor protein (APP). γ-Secretase-mediated cleavage of APP, like that of Notch, yields an intracellular fragment [APP intracellular domain (AICD)] that forms a transcriptively active complex. We now demonstrate a functional role for AICD in regulating phosphoinositide-mediated calcium signaling. Genetic ablation of the presenilins or pharmacological inhibition of γ-secretase activity (and thereby AICD production) attenuated calcium signaling in a dose-dependent and reversible manner through a mechanism involving the modulation of endoplasmic reticulum calcium stores. Cells lacking APP (and hence AICD) exhibited similar calcium signaling deficits, and—notably—these disturbances could be reversed by transfection with APP constructs containing an intact AICD, but not by constructs lacking this domain. Our findings indicate that the AICD regulates phosphoinositide-mediated calcium signaling through a γ-secretase-dependent signaling pathway, suggesting that the intramembranous proteolysis of APP may play a signaling role analogous to that of Notch. PMID:11917117

  15. Noise decomposition of intracellular biochemical signaling networks using nonequivalent reporters

    PubMed Central

    Rhee, Alex; Cheong, Raymond; Levchenko, Andre


    Experimental measurements of biochemical noise have primarily focused on sources of noise at the gene expression level due to limitations of existing noise decomposition techniques. Here, we introduce a mathematical framework that extends classical extrinsic–intrinsic noise analysis and enables mapping of noise within upstream signaling networks free of such restrictions. The framework applies to systems for which the responses of interest are linearly correlated on average, although the framework can be easily generalized to the nonlinear case. Interestingly, despite the high degree of complexity and nonlinearity of most mammalian signaling networks, three distinct tumor necrosis factor (TNF) signaling network branches displayed linearly correlated responses, in both wild-type and perturbed versions of the network, across multiple orders of magnitude of ligand concentration. Using the noise mapping analysis, we find that the c-Jun N-terminal kinase (JNK) pathway generates higher noise than the NF-κB pathway, whereas the activation of c-Jun adds a greater amount of noise than the activation of ATF-2. In addition, we find that the A20 protein can suppress noise in the activation of ATF-2 by separately inhibiting the TNF receptor complex and JNK pathway through a negative feedback mechanism. These results, easily scalable to larger and more complex networks, pave the way toward assessing how noise propagates through cellular signaling pathways and create a foundation on which we can further investigate the relationship between signaling system architecture and biological noise. PMID:25404303

  16. Structural Basis of Intracellular TGF-β Signaling: Receptors and Smads.


    Chaikuad, Apirat; Bullock, Alex N


    Stimulation of the transforming growth factor β (TGF-β) family receptors activates an intracellular phosphorylation-dependent signaling cascade that culminates in Smad transcriptional activation and turnover. Structural studies have identified a number of allosteric mechanisms that control the localization, conformation, and oligomeric state of the receptors and Smads. Such mechanisms dictate the ordered binding of substrate and adaptor proteins that determine the directionality of the signaling process. Activation of the pathway has been illustrated by the various structures of the receptor-activated Smads (R-Smads) with SARA, Smad4, and YAP, respectively, whereas mechanisms of down-regulation have been elucidated by the structural complexes of FKBP12, Ski, and Smurf1. Interesting parallels have emerged between the R-Smads and the Forkhead-associated (FHA) and interferon regulatory factor (IRF)-associated domains, as well as the Hippo pathway. However, important questions remain as to the mechanism of Smad-independent signaling.

  17. Intracellular light-induced release of signaling molecules from gold-coated liposomes

    NASA Astrophysics Data System (ADS)

    Orsinger, Gabriel V.; Williams, Joshua D.; Romanowski, Marek


    The combination of laser light and composite nanovesicles enables unique opportunities for precise delivery to, and ondemand release of molecular compounds within, single cells at high spatiotemporal resolution. Here, we demonstrate precise delivery and intracellular release of molecules from gold-coated liposomes via near infrared (NIR) light. The plasmon resonant gold shell provides a light-sensitive trigger for on-demand content release from thermosensitive liposomes. Two demonstrations of intracellular delivery and release from gold-coated liposomes are presented here. The first example uses microinjection to preload gold-coated liposomes into a single cell, followed by exposure to onresonant NIR laser light to trigger release of a fluorescent nuclear dye intracellularly. In the second delivery and release demonstration, gold-coated liposomes encapsulating inositol trisphosphate (IP3), a ubiquitous secondary messenger in cell signaling cascades, passively accumulate within cells via endocytosis. Exposure to on-resonant NIR laser wavelength of light induces rapid release of IP3 from the intracellular liposomes and subsequent activation of Ca2+ signaling at a single cell, monitored by changes in fluorescence intensity of a Ca 2+-sensitive dye.

  18. Intracellular sensing of microbes and danger signals by the inflammasomes.


    Horvath, Gabor L; Schrum, Jacob E; De Nardo, Christine M; Latz, Eicke


    The cells of the innate immune system mobilize a coordinated immune response towards invading microbes and after disturbances in tissue homeostasis. These immune responses typically lead to infection control and tissue repair. Exaggerated or uncontrolled immune responses, however, can also induce acute of chronic inflammatory pathologies that are characteristic for many common diseases such as sepsis, arthritis, atherosclerosis, or Alzheimer's disease. In recent years, the concerted efforts of many scientists have uncovered numerous mechanisms by which immune cells detect foreign or changed self-substances that appear in infections or during tissue damage. These substances stimulate signaling receptors, which leads to cellular activation and the induction of effector mechanisms. Here, we review the role of inflammasomes, a family of signaling molecules that form multi-molecular signaling platforms and activate inflammatory caspases and interleukin-1β cytokines.

  19. The emerging role of phosphoinositide clustering in intracellular trafficking and signal transduction

    PubMed Central

    Picas, Laura; Gaits-Iacovoni, Frederique; Goud, Bruno


    Phosphoinositides are master regulators of multiple cellular processes: from vesicular trafficking to signaling, cytoskeleton dynamics, and cell growth. They are synthesized by the spatiotemporal regulated activity of phosphoinositide-metabolizing enzymes. The recent observation that some protein modules are able to cluster phosphoinositides suggests that alternative or complementary mechanisms might operate to stabilize the different phosphoinositide pools within cellular compartments. Herein, we discuss the different known and potential molecular players that are prone to engage phosphoinositide clustering and elaborate on how such a mechanism might take part in the regulation of intracellular trafficking and signal transduction. PMID:27092250

  20. Estrogen modulates neural-immune interactions through intracellular signaling pathways and antioxidant enzyme activity in the spleen of middle-aged ovariectomized female rats.


    Kale, Prathamesh; Mohanty, Aparna; Patil, Anushree; Mishra, Miti; Pratap, Uday P; Priyanka, Hannah P; ThyagaRajan, Srinivasan


    Modulation of neural-immune interactions by estrogen in the spleens of ovariectomized (OVX) middle-aged female rats was examined. Con A-induced lymphoproliferation, splenic tyrosine hydroxylase (TH) and nerve growth factor (NGF) expression, levels of p-ERK 1/2, p-CREB, and p-Akt, and activity of superoxide dismutase decreased in OVX rats while estrogen treatment enhanced their expression, levels, and activity. Also, estrogen treatment enhanced Con A-induced IFN-γ production and decreased Con A-induced IL-2 production compared to OVX animals. In contrast, estrogen increased the extent of lipid peroxidation and protein carbonyl formation while OVX induced a decline in protein carbonyl formation. These results suggest that estrogen enhances neural-immune interactions while simultaneously affecting it through generation of free radicals as reflected by increased lipid peroxidation and protein carbonyl formation.

  1. Microglial Intracellular Ca2+ Signaling in Synaptic Development and its Alterations in Neurodevelopmental Disorders

    PubMed Central

    Mizoguchi, Yoshito; Monji, Akira


    Autism spectrum disorders (ASDs) are neurodevelopmental disorders characterized by deficits in social interaction, difficulties with language and repetitive/restricted behaviors. Microglia are resident innate immune cells which release many factors including proinflammatory cytokines, nitric oxide (NO) and brain-derived neurotrophic factor (BDNF) when they are activated in response to immunological stimuli. Recent in vivo imaging has shown that microglia sculpt and refine the synaptic circuitry by removing excess and unwanted synapses and be involved in the development of neural circuits or synaptic plasticity thereby maintaining the brain homeostasis. BDNF, one of the neurotrophins, has various important roles in cell survival, neurite outgrowth, neuronal differentiation, synaptic plasticity and the maintenance of neural circuits in the CNS. Intracellular Ca2+ signaling is important for microglial functions including ramification, de-ramification, migration, phagocytosis and release of cytokines, NO and BDNF. BDNF induces a sustained intracellular Ca2+ elevation through the upregulation of the surface expression of canonical transient receptor potential 3 (TRPC3) channels in rodent microglia. BDNF might have an anti-inflammatory effect through the inhibition of microglial activation and TRPC3 could play important roles in not only inflammatory processes but also formation of synapse through the modulation of microglial phagocytic activity in the brain. This review article summarizes recent findings on emerging dual, inflammatory and non-inflammatory, roles of microglia in the brain and reinforces the importance of intracellular Ca2+ signaling for microglial functions in both normal neurodevelopment and their potential contributing to neurodevelopmental disorders such as ASDs. PMID:28367116

  2. G beta gamma signaling reduces intracellular cAMP to promote meiotic progression in mouse oocytes.


    Gill, Arvind; Hammes, Stephen R


    In nearly every vertebrate species, elevated intracellular cAMP maintains oocytes in prophase I of meiosis. Prior to ovulation, gonadotropins trigger various intra-ovarian processes, including the breakdown of gap junctions, the activation of EGF receptors, and the secretion of steroids. These events in turn decrease intracellular cAMP levels in select oocytes to allow meiotic progression, or maturation, to resume. Studies suggest that cAMP levels are kept elevated in resting oocytes by constitutive G protein signaling, and that the drop in intracellular cAMP that accompanies maturation may be due in part to attenuation of this inhibitory G protein-mediated signaling. Interestingly, one of these G protein regulators of meiotic arrest is the Galpha(s) protein, which stimulates adenylyl cyclase to raise intracellular cAMP in two important animal models of oocyte development: Xenopus leavis frogs and mice. In addition to G(alpha)(s), constitutive Gbetagamma activity similarly stimulates adenylyl cyclase to raise cAMP and prevent maturation in Xenopus oocytes; however, the role of Gbetagamma in regulating meiosis in mouse oocytes has not been examined. Here we show that Gbetagamma does not contribute to the maintenance of murine oocyte meiotic arrest. In fact, contrary to observations in frog oocytes, Gbetagamma signaling in mouse oocytes reduces cAMP and promotes oocyte maturation, suggesting that Gbetagamma might in fact play a positive role in promoting oocyte maturation. These observations emphasize that, while many general concepts and components of meiotic regulation are conserved from frogs to mice, specific differences exist that may lead to important insights regarding ovarian development in vertebrates.

  3. Impact of photosensitizers activation on intracellular trafficking and viscosity.


    Aubertin, Kelly; Bonneau, Stéphanie; Silva, Amanda K A; Bacri, Jean-Claude; Gallet, François; Wilhelm, Claire


    The intracellular microenvironment is essential for the efficiency of photo-induced therapies, as short-lived reactive oxygen species generated must diffuse through their intracellular surrounding medium to reach their cellular target. Here, by combining measurements of local cytoplasmic dissipation and active trafficking, we found that photosensitizers activation induced small changes in surrounding viscosity but a massive decrease in diffusion. These effects are the signature of a return to thermodynamic equilibrium of the system after photo-activation and correlated with depolymerization of the microtubule network, as shown in a reconstituted system. These mechanical measurements were performed with two intracellular photosensitizing chlorins having similar quantum yield of singlet oxygen production but different intracellular localizations (cytoplasmic for mTHPC, endosomal for TPCS2a). These two agents demonstrated different intracellular impact.

  4. Impact of Photosensitizers Activation on Intracellular Trafficking and Viscosity

    PubMed Central

    Aubertin, Kelly; Bonneau, Stéphanie; Silva, Amanda K. A.; Bacri, Jean-Claude; Gallet, François; Wilhelm, Claire


    The intracellular microenvironment is essential for the efficiency of photo-induced therapies, as short-lived reactive oxygen species generated must diffuse through their intracellular surrounding medium to reach their cellular target. Here, by combining measurements of local cytoplasmic dissipation and active trafficking, we found that photosensitizers activation induced small changes in surrounding viscosity but a massive decrease in diffusion. These effects are the signature of a return to thermodynamic equilibrium of the system after photo-activation and correlated with depolymerization of the microtubule network, as shown in a reconstituted system. These mechanical measurements were performed with two intracellular photosensitizing chlorins having similar quantum yield of singlet oxygen production but different intracellular localizations (cytoplasmic for mTHPC, endosomal for TPCS2a). These two agents demonstrated different intracellular impact. PMID:24386423

  5. Host Intracellular Signaling Events and Pro-inflammatory Cytokine Production in African Trypanosomiasis

    PubMed Central

    Kuriakose, Shiby M.; Singh, Rani; Uzonna, Jude E.


    Pathogens, such as bacteria, viruses, and parasites, possess specific molecules or proteins that are recognized by several host innate immune receptors, leading to the activation of several intracellular signaling molecules and pathways. The magnitude and quality of these events significantly affect the outcome of infection. African trypanosomes, including Trypanosoma congolense, are capable of manipulating the host immune response, including the activity of macrophages, which are the key immune cells that contribute to the immunopathogenesis of African trypanosomiasis. Although it is known that immune hyperactivation and excessive pro-inflammatory cytokine production are the hallmarks of African trypanosomiasis, the mechanisms through which these events are triggered are poorly defined. However, it is known that macrophages may play a significant role in these processes, because phagocytosis of trypanosomes by macrophages initiates intracellular signal transduction cascades that lead to the release of pro-inflammatory cytokines and alteration in cell function. This review highlights recent progress in our understanding of the innate immune receptors, signaling pathways, and transcription factors involved in T. congolense-induced pro-inflammatory cytokine production in macrophages. It will reveal the existence of complex signaling events through which the parasite modulates the host immune response, thus identifying novel targets that could aid in designing strategies to effectively control the disease. PMID:27242788

  6. Intracellular LINGO-1 negatively regulates Trk neurotrophin receptor signaling.


    Meabon, James S; de Laat, Rian; Ieguchi, Katsuaki; Serbzhinsky, Dmitry; Hudson, Mark P; Huber, B Russel; Wiley, Jesse C; Bothwell, Mark


    Neurotrophins, essential regulators of many aspects of neuronal differentiation and function, signal via four receptors, p75, TrkA, TrkB and TrkC. The three Trk paralogs are members of the LIG superfamily of membrane proteins, which share extracellular domains consisting of leucine-rich repeat and C2 Ig domains. Another LIG protein, LINGO-1 has been reported to bind and influence signaling of p75 as well as TrkA, TrkB and TrkC. Here we examine the manner in which LINGO-1 influences the function of TrkA, TrkB and TrkC. We report that Trk activation promotes Trk association with LINGO-1, and that this association promotes Trk degradation by a lysosomal mechanism. This mechanism resembles the mechanism by which another LIG protein, LRIG1, promotes lysosomal degradation of receptor tyrosine kinases such as the EGF receptor. We present evidence indicating that the Trk/LINGO-1 interaction occurs, in part, within recycling endosomes. We show that a mutant form of LINGO-1, with much of the extracellular domain deleted, has the capacity to enhance TrkA signaling in PC12 cells, possibly by acting as an inhibitor of Trk down-regulation by full length LINGO-1. We propose that LINGO-1 functions as a negative feedback regulator of signaling by cognate receptor tyrosine kinases including TrkA, TrkB and TrkC.

  7. Study of neurotoxic intracellular calcium signalling triggered by amyloids.


    Villalobos, Carlos; Caballero, Erica; Sanz-Blasco, Sara; Núñez, Lucía


    Neurotoxicity in Alzheimer's disease (AD) is associated to dishomeostasis of intracellular Ca(2+) induced by amyloid β peptide (Aβ) species. Understanding of the effects of Aβ on intracellular Ca(2+) homeostasis requires preparation of the different Aβ assemblies including oligomers and fibrils and the testing of their effects on cytosolic and mitochondrial Ca(2+) in neurons. Procedures for cerebellar granule cell culture, preparation of Aβ species as well as fluorescence and bioluminescence imaging of cytosolic and mitochondrial Ca(2+) in neurons are described.

  8. Colocalization of β-catenin with Notch intracellular domain in colon cancer: a possible role of Notch1 signaling in activation of CyclinD1-mediated cell proliferation.


    Gopalakrishnan, Natarajan; Saravanakumar, Marimuthu; Madankumar, Perumal; Thiyagu, Mani; Devaraj, Halagowder


    The Wnt and Notch1 signaling pathways play major roles in intestinal development and tumorigenesis. Sub-cellular localization of β-catenin has been implicated in colorectal carcinogenesis. However, the β-catenin and Notch intracellular domain (NICD) interaction has to be addressed. Immunohistochemistries of β-catenin, NICD, and dual immunofluorescence of β-catenin and NICD were analyzed in colorectal tissues and HT29 cell line. Moreover, real-time PCR analysis of CyclinD1, Hes1 and MUC2 was done in HT29 cells upon N-[N-(3, 5-difluorophenacetyl)-L-alanyl]-S-phenylglycine t-butyl ester (DAPT) treatment. Dual staining emphasized the strong interaction of β-catenin and NICD in adenoma and adenocarcinoma than in normal tissues. Hes1 transcript levels were decreased 1.5- and 7.1-fold in 12.5 and 25 µM DAPT-treated HT29 cells. CyclinD1 transcript levels decreased 1.2- and 1.6-fold, and MUC2 transcript level increased 4.3- and 7.5-fold in 12.5 and 25 µM DAPT-treated HT29 cells. The results of this study showed that the sub-cellular localization of β-catenin converges with NICD inducing proliferation through the activation of CyclinD1 and Hes1. Moreover, the inhibition of Notch1 signaling by DAPT leads to the arrest of cell proliferation and induces apoptosis leading to the upregulation of MUC2, a secretory cell lineage marker.

  9. Intracellular cAMP signaling by soluble adenylyl cyclase

    PubMed Central

    Tresguerres, Martin; Levin, Lonny R.; Buck, Jochen


    Soluble adenylyl cyclase (sAC) is a recently identified source of the ubiquitous second messenger cAMP. sAC is distinct from the more widely studied source of cAMP, the transmembrane adenylyl cyclases (tmACs); its activity is uniquely regulated by bicarbonate anions, and it is distributed throughout the cytoplasm and in cellular organelles. Due to its unique localization and regulation, sAC has various functions in a variety of physiological systems which are distinct from tmACs. In this review, we detail the known functions of sAC, and we reassess commonly held views of cAMP signaling inside cells. PMID:21490586

  10. The deiodinases and the control of intracellular thyroid hormone signaling during cellular differentiation☆

    PubMed Central

    Dentice, Monica; Marsili, Alessandro; Zavacki, AnnMarie; Larsen, P. Reed; Salvatore, Domenico


    Background Thyroid hormone influences gene expression in virtually all vertebrates. Its action is initiated by the activation of T4 to T3, an outer ring deiodination reaction that is catalyzed by the type 1 or the type 2 iodothyronine selenodeiodinases (D1 or D2). Inactivation of T4 and T3 occurs via inner ring deiodination catalyzed by the type 3 iodothyronine selenodeiodinases (D3). The T4 concentration is generally quite stable in human plasma, with T3 levels also remaining constant. Deiodinase actions are tightly regulated in both pre- and post-natal life when they are required to make local adjustments of intracellular T3 concentrations in a precise spatio- and temporal manner. Although all the signals governing the dynamic expression of deiodinases in specific cell types are not known, many important regulatory factors have been deciphered. Scope of review This review provides striking examples from the recent literature illustrating how the expression of D2 and D3 is finely tuned during maturation of different organs, and how their action play a critical role in different settings to control intracellular T3 availability. Major conclusions Emerging evidence indicates that in various cell contexts, D2 and D3 are expressed in a dynamic balance, in which the expression of one enzyme is coordinately regulated with that of the other to tightly control intracellular T3 levels commensurate with cell requirements at that time. General significance Deiodinases control TH action in a precise spatio-temporal fashion thereby providing a novel mechanism for the local paracrine and autocrine regulation of TH action. This remarkable tissue-specific regulation of intracellular thyroid status remains hidden due to the maintenance of constant circulating TH concentrations by the hypothalamic–pituitary–thyroid axis. This article is part of a Special Issue entitled Thyroid hormone signalling. PMID:22634734

  11. Intracellular cAMP signaling by soluble adenylyl cyclase.


    Tresguerres, Martin; Levin, Lonny R; Buck, Jochen


    Soluble adenylyl cyclase (sAC) is a recently identified source of the ubiquitous second messenger cyclic adenosine 3',5' monophosphate (cAMP). sAC is distinct from the more widely studied source of cAMP, the transmembrane adenylyl cyclases (tmACs); its activity is uniquely regulated by bicarbonate anions, and it is distributed throughout the cytoplasm and in cellular organelles. Due to its unique localization and regulation, sAC has various functions in a variety of physiological systems that are distinct from tmACs. In this review, we detail the known functions of sAC, and we reassess commonly held views of cAMP signaling inside cells.

  12. Emerin suppresses Notch signaling by restricting the Notch intracellular domain to the nuclear membrane.


    Lee, Byongsun; Lee, Tae-Hee; Shim, Jaekyung


    Emerin is an inner nuclear membrane protein that is involved in maintaining the mechanical integrity of the nuclear membrane. Increasing evidence supports the involvement of emerin in the regulation of gene expression; however, its precise function remains to be elucidated. Here, we show that emerin downregulated genes downstream of Notch signaling, which are activated exclusively by the Notch intracellular domain (NICD). Deletion mutant experiments revealed that the transmembrane domain of emerin is important for the inhibition of Notch signaling. Emerin interacted directly and colocalized with the NICD at the nuclear membrane. Emerin knockdown induced the phosphorylation of ERK and AKT, increased endogenous Notch signaling, and inhibited hydrogen peroxide-induced apoptosis in HeLa cells. Notably, the downregulation of barrier-to-autointegration factor (BAF) or lamin A/C increased Notch signaling by inducing the release of emerin into the cytosol, implying that nuclear membrane-bound emerin acts as an endogenous inhibitor of Notch signaling. Taken together, our results indicate that emerin negatively regulates Notch signaling by promoting the retention of the NICD at the nuclear membrane. This mechanism could constitute a new therapeutic target for the treatment of emerin-related diseases.

  13. Intracellular Redox Compartmentation and ROS-Related Communication in Regulation and Signaling1[OPEN

    PubMed Central


    Recent years have witnessed enormous progress in understanding redox signaling related to reactive oxygen species (ROS) in plants. The consensus view is that such signaling is intrinsic to many developmental processes and responses to the environment. ROS-related redox signaling is tightly wedded to compartmentation. Because membranes function as barriers, highly redox-active powerhouses such as chloroplasts, peroxisomes, and mitochondria may elicit specific signaling responses. However, transporter functions allow membranes also to act as bridges between compartments, and so regulated capacity to transmit redox changes across membranes influences the outcome of triggers produced at different locations. As well as ROS and other oxidizing species, antioxidants are key players that determine the extent of ROS accumulation at different sites and that may themselves act as signal transmitters. Like ROS, antioxidants can be transported across membranes. In addition, the intracellular distribution of antioxidative enzymes may be modulated to regulate or facilitate redox signaling appropriate to the conditions. Finally, there is substantial plasticity in organellar shape, with extensions such as stromules, peroxules, and matrixules playing potentially crucial roles in organelle-organelle communication. We provide an overview of the advances in subcellular compartmentation, identifying the gaps in our knowledge and discussing future developments in the area. PMID:27208308

  14. Mechanisms Associated with Activation of Intracellular Metabotropic Glutamate Receptor, mGluR5.


    Jong, Yuh-Jiin I; O'Malley, Karen L


    The group 1 metabotropic glutamate receptor, mGluR5, is found on the cell surface as well as on intracellular membranes where it can mediate both overlapping and unique signaling effects. Previously we have shown that glutamate activates intracellular mGluR5 by entry through sodium-dependent transporters and/or cystine glutamate exchangers. Calibrated antibody labelling suggests that the glutamate concentration within neurons is quite high (~10 mM) raising the question as to whether intracellular mGluR5 is maximally activated at all times or whether a different ligand might be responsible for receptor activation. To address this issue, we used cellular, optical and molecular techniques to show that intracellular glutamate is largely sequestered in mitochondria; that the glutamate concentration necessary to activate intracellular mGluR5 is about ten-fold higher than what is necessary to activate cell surface mGluR5; and uncaging caged glutamate within neurons can directly activate the receptor. Thus these studies further the concept that glutamate itself serves as the ligand for intracellular mGluR5.

  15. Regulation of Epidermal Growth Factor Receptor Signaling by Endocytosis and Intracellular Trafficking

    SciTech Connect

    Burke, Patrick; Schooler, Kevin; Wiley, H S.


    Ligand activation of the epidermal growth factor receptor (EGFR) leads to its rapid internalization and eventual delivery to lysosomes. This process is thought to be a mechanism to attenuate signaling, but signals could potentially be generated following endocytosis. To directly evaluate EGFR signaling during receptor trafficking, we developed a technique to rapidly and selectively isolate internalized EGFR and associated molecules using reversibly-biotinylated anti-EGFR antibodies. In addition, we developed antibodies specific to tyrosine-phosphorylated EGFR. Using a combination of fluorescence imaging and affinity precipitation approaches, we evaluated the state of EGFR activation and substrate association during trafficking in epithelial cells. We found that following internalization, EGFR remained active in the early endosomes. However, receptors were inactivated prior to degradation, apparently due to ligand removal from endosomes. Adapter molecules, such as Shc, were associated with EGFR both at the cell surface and within endosomes. Some molecules, such as Grb2, were primarily found associated with surface EGFR, while others, such as Eps8, were only found with intracellular receptors. During the inactivation phase, c-Cbl became EGFR-associated, consistent with its postulated role in receptor attenuation. We conclude that the association of the EGFR with different proteins is compartment-specific . In addition, ligand loss is the proximal cause of EGFR inactivation. Thus, regulated trafficking could potentially influence the pattern as well as the duration of signal transduction.

  16. Fluoxetine suppresses calcium signaling in human T lymphocytes through depletion of intracellular calcium stores.


    Gobin, V; De Bock, M; Broeckx, B J G; Kiselinova, M; De Spiegelaere, W; Vandekerckhove, L; Van Steendam, K; Leybaert, L; Deforce, D


    Selective serotonin reuptake inhibitors, such as fluoxetine, have recently been shown to exert anti-inflammatory and immunosuppressive effects. Although the effects on cytokine secretion, proliferation and viability of T lymphocytes have been extensively characterized, little is known about the mechanism behind these effects. It is well known that Ca(2+) signaling is an important step in the signaling transduction pathway following T cell receptor activation. Therefore, we investigated if fluoxetine interferes with Ca(2+) signaling in Jurkat T lymphocytes. Fluoxetine was found to suppress Ca(2+) signaling in response to T cell receptor activation. Moreover, fluoxetine was found to deplete intracellular Ca(2+) stores, thereby leaving less Ca(2+) available for release upon IP3- and ryanodine-receptor activation. The Ca(2+)-modifying effects of fluoxetine are not related to its capability to block the serotonin transporter, as even a large excess of 5HT did not abolish the effects. In conclusion, these data show that fluoxetine decreases IP3- and ryanodine-receptor mediated Ca(2+) release in Jurkat T lymphocytes, an effect likely to be at the basis of the observed immunosuppression.

  17. Uptake and intracellular activity of fluconazole in human polymorphonuclear leukocytes.

    PubMed Central

    Pascual, A; García, I; Conejo, C; Perea, E J


    The penetration of fluconazole into human polymorphonuclear leukocytes (PMNs) and tissue culture epithelial cells (McCoy) was evaluated. At different extracellular concentrations (0.5 to 10 mg/liter), fluconazole reached cell-associated concentrations greater than the extracellular ones in either human PMNs (intracellular concentration to extracellular concentration ratio, > or = 2.2) or McCoy cells (intracellular concentration to extracellular concentration ratio, > or = 1.3). The uptake of fluconazole by PMNs was rapid and reversible but was not energy dependent. The intracellular penetration of fluconazole was not affected by environmental pH or temperature. Ingestion of opsonized zymosan and opsonized Candida albicans did not significantly increase the amount of PMN-associated fluconazole. At therapeutic extracellular concentrations, the intracellular activity of fluconazole against C. albicans in PMNs was significantly lower than that of amphotericin B. It was concluded that fluconazole reaches high intracellular concentrations within PMNs but shows moderate activity against intracellular C. albicans in vitro. PMID:8452347

  18. Intracellular calcium signals display an avalanche-like behavior over multiple lengthscales

    PubMed Central

    Lopez, Lucía; Piegari, Estefanía; Sigaut, Lorena; Ponce Dawson, Silvina


    Many natural phenomena display “self-organized criticality” (SOC), (Bak et al., 1987). This refers to spatially extended systems for which patterns of activity characterized by different lengthscales can occur with a probability density that follows a power law with pattern size. Differently from power laws at phase transitions, systems displaying SOC do not need the tuning of an external parameter. Here we analyze intracellular calcium (Ca2+) signals, a key component of the signaling toolkit of almost any cell type. Ca2+ signals can either be spatially restricted (local) or propagate throughout the cell (global). Different models have suggested that the transition from local to global signals is similar to that of directed percolation. Directed percolation has been associated, in turn, to the appearance of SOC. In this paper we discuss these issues within the framework of simple models of Ca2+ signal propagation. We also analyze the size distribution of local signals (“puffs”) observed in immature Xenopus Laevis oocytes. The puff amplitude distribution obtained from observed local signals is not Gaussian with a noticeable fraction of large size events. The experimental distribution of puff areas in the spatio-temporal record of the image has a long tail that is approximately log-normal. The distribution can also be fitted with a power law relationship albeit with a smaller goodness of fit. The power law behavior is encountered within a simple model that includes some coupling among individual signals for a wide range of parameter values. An analysis of the model shows that a global elevation of the Ca2+ concentration plays a major role in determining whether the puff size distribution is long-tailed or not. This suggests that Ca2+-clearing from the cytosol is key to determine whether IP3-mediated Ca2+ signals can display a SOC-like behavior or not. PMID:22969730

  19. Spatiotemporal Properties of Intracellular Calcium Signaling in Osteocytic and Osteoblastic Cell Networks under Fluid Flow

    PubMed Central

    Jing, Da; Lu, X. Lucas; Luo, Erping; Sajda, Paul; Leong, Pui L; Guo, X. Edward


    Mechanical stimuli can trigger intracellular calcium (Ca2+) responses in osteocytes and osteoblasts. Successful construction of bone cell networks necessitates more elaborate and systematic analysis for the spatiotemporal properties of Ca2+ signaling in the networks. In the present study, an unsupervised algorithm based on independent component analysis (ICA) was employed to extract the Ca2+ signals of bone cells in the network. We demonstrated that the ICA-based technology could yield higher signal fidelity than the manual region of interest (ROI) method. Second, the spatiotemporal properties of Ca2+ signaling in osteocyte-like MLO-Y4 and osteoblast-like MC3T3-E1 cell networks under laminar and steady fluid flow stimulation were systematically analyzed and compared. MLO-Y4 cells exhibited much more active Ca2+ transients than MC3T3-E1 cells, evidenced by more Ca2+ peaks, less time to the 1st peak and less time between the 1st and 2nd peaks. With respect to temporal properties, MLO-Y4 cells demonstrated higher spike rate and Ca2+ oscillating frequency. The spatial intercellular synchronous activities of Ca2+ signaling in MLO-Y4 cell networks were higher than those in MC3T3-E1 cell networks and also negatively correlated with the intercellular distance, revealing faster Ca2+ wave propagation in MLO-Y4 cell networks. Our findings show that the unsupervised ICA-based technique results in more sensitive and quantitative signal extraction than traditional ROI analysis, with the potential to be widely employed in Ca2+ signaling extraction in the cell networks. The present study also revealed a dramatic spatiotemporal difference in Ca2+ signaling for osteocytic and osteoblastic cell networks in processing the mechanical stimulus. The higher intracellular Ca2+ oscillatory behaviors and intercellular coordination of MLO-Y4 cells provided further evidences that osteocytes may behave as the major mechanical sensor in bone modeling and remodeling processes. PMID:23328496

  20. Intracellular activity of azithromycin against bacterial enteric pathogens.

    PubMed Central

    Rakita, R M; Jacques-Palaz, K; Murray, B E


    Azithromycin, a new azalide antibiotic, is active in vitro against a variety of enteric bacterial pathogens. Since it is concentrated inside human neutrophils and other cells, it might be particularly useful in the treatment of infections caused by enteropathogens that invade host tissues. The intracellular activity of azithromycin against several enteric pathogens that had been phagocytosed by neutrophils was determined. Azithromycin was effective in reducing the intracellular viabilities of almost all strains tested, including representative strains of Salmonella, Shigella, and enteroinvasive, enteropathogenic, enterotoxigenic, and enterohemorrhagic Escherichia coli. Erythromycin was also effective in this model system, although azithromycin was generally more effective than erythromycin against strains of invasive enteric pathogens. Cefotaxime reduced intracellular bacterial viability to a lesser extent than either azithromycin or erythromycin. The presence of neutrophils did not significantly affect the activity of azithromycin in this system. Azithromycin may be a useful agent for the treatment of bacterial diarrhea, and clinical trials should be considered. PMID:7810998

  1. Multiple Model-Informed Open-Loop Control of Uncertain Intracellular Signaling Dynamics

    PubMed Central

    Perley, Jeffrey P.; Mikolajczak, Judith; Harrison, Marietta L.; Buzzard, Gregery T.; Rundell, Ann E.


    Computational approaches to tune the activation of intracellular signal transduction pathways both predictably and selectively will enable researchers to explore and interrogate cell biology with unprecedented precision. Techniques to control complex nonlinear systems typically involve the application of control theory to a descriptive mathematical model. For cellular processes, however, measurement assays tend to be too time consuming for real-time feedback control and models offer rough approximations of the biological reality, thus limiting their utility when considered in isolation. We overcome these problems by combining nonlinear model predictive control with a novel adaptive weighting algorithm that blends predictions from multiple models to derive a compromise open-loop control sequence. The proposed strategy uses weight maps to inform the controller of the tendency for models to differ in their ability to accurately reproduce the system dynamics under different experimental perturbations (i.e. control inputs). These maps, which characterize the changing model likelihoods over the admissible control input space, are constructed using preexisting experimental data and used to produce a model-based open-loop control framework. In effect, the proposed method designs a sequence of control inputs that force the signaling dynamics along a predefined temporal response without measurement feedback while mitigating the effects of model uncertainty. We demonstrate this technique on the well-known Erk/MAPK signaling pathway in T cells. In silico assessment demonstrates that this approach successfully reduces target tracking error by 52% or better when compared with single model-based controllers and non-adaptive multiple model-based controllers. In vitro implementation of the proposed approach in Jurkat cells confirms a 63% reduction in tracking error when compared with the best of the single-model controllers. This study provides an experimentally

  2. Multiple model-informed open-loop control of uncertain intracellular signaling dynamics.


    Perley, Jeffrey P; Mikolajczak, Judith; Harrison, Marietta L; Buzzard, Gregery T; Rundell, Ann E


    Computational approaches to tune the activation of intracellular signal transduction pathways both predictably and selectively will enable researchers to explore and interrogate cell biology with unprecedented precision. Techniques to control complex nonlinear systems typically involve the application of control theory to a descriptive mathematical model. For cellular processes, however, measurement assays tend to be too time consuming for real-time feedback control and models offer rough approximations of the biological reality, thus limiting their utility when considered in isolation. We overcome these problems by combining nonlinear model predictive control with a novel adaptive weighting algorithm that blends predictions from multiple models to derive a compromise open-loop control sequence. The proposed strategy uses weight maps to inform the controller of the tendency for models to differ in their ability to accurately reproduce the system dynamics under different experimental perturbations (i.e. control inputs). These maps, which characterize the changing model likelihoods over the admissible control input space, are constructed using preexisting experimental data and used to produce a model-based open-loop control framework. In effect, the proposed method designs a sequence of control inputs that force the signaling dynamics along a predefined temporal response without measurement feedback while mitigating the effects of model uncertainty. We demonstrate this technique on the well-known Erk/MAPK signaling pathway in T cells. In silico assessment demonstrates that this approach successfully reduces target tracking error by 52% or better when compared with single model-based controllers and non-adaptive multiple model-based controllers. In vitro implementation of the proposed approach in Jurkat cells confirms a 63% reduction in tracking error when compared with the best of the single-model controllers. This study provides an experimentally

  3. Criticality in intracellular calcium signaling in cardiac myocytes.


    Nivala, Michael; Ko, Christopher Y; Nivala, Melissa; Weiss, James N; Qu, Zhilin


    Calcium (Ca) is a ubiquitous second messenger that regulates many biological functions. The elementary events of local Ca signaling are Ca sparks, which occur randomly in time and space, and integrate to produce global signaling events such as intra- and intercellular Ca waves and whole-cell Ca oscillations. Despite extensive experimental characterization in many systems, the transition from local random to global synchronous events is still poorly understood. Here we show that criticality, a ubiquitous dynamical phenomenon in nature, is responsible for the transition from local to global Ca signaling. We demonstrate this first in a computational model of Ca signaling in a cardiac myocyte and then experimentally in mouse ventricular myocytes, complemented by a theoretical agent-based model to delineate the underlying dynamics. We show that the interaction between the Ca release units via Ca-induced Ca release causes self-organization of Ca spark clusters. When the coupling between Ca release units is weak, the cluster-size distribution is exponential. As the interactions become strong, the cluster-size distribution changes to a power-law distribution, which is characteristic of criticality in thermodynamic and complex nonlinear systems, and facilitates the formation and propagation of Ca waves and whole-cell Ca oscillations. Our findings illustrate how criticality is harnessed by a biological cell to regulate Ca signaling via self-organization of random subcellular events into cellular-scale oscillations, and provide a general theoretical framework for the transition from local Ca signaling to global Ca signaling in biological cells.

  4. Intracellular Zn(2+) signaling in the dentate gyrus is required for object recognition memory.


    Takeda, Atsushi; Tamano, Haruna; Ogawa, Taisuke; Takada, Shunsuke; Nakamura, Masatoshi; Fujii, Hiroaki; Ando, Masaki


    The role of perforant pathway-dentate granule cell synapses in cognitive behavior was examined focusing on synaptic Zn(2+) signaling in the dentate gyrus. Object recognition memory was transiently impaired when extracellular Zn(2+) levels were decreased by injection of clioquinol and N,N,N',N'-tetrakis-(2-pyridylmethyl) ethylendediamine. To pursue the effect of the loss and/or blockade of Zn(2+) signaling in dentate granule cells, ZnAF-2DA (100 pmol, 0.1 mM/1 µl), an intracellular Zn(2+) chelator, was locally injected into the dentate molecular layer of rats. ZnAF-2DA injection, which was estimated to chelate intracellular Zn(2+) signaling only in the dentate gyrus, affected object recognition memory 1 h after training without affecting intracellular Ca(2+) signaling in the dentate molecular layer. In vivo dentate gyrus long-term potentiation (LTP) was affected under the local perfusion of the recording region (the dentate granule cell layer) with 0.1 mM ZnAF-2DA, but not with 1-10 mM CaEDTA, an extracellular Zn(2+) chelator, suggesting that the blockade of intracellular Zn(2+) signaling in dentate granule cells affects dentate gyrus LTP. The present study demonstrates that intracellular Zn(2+) signaling in the dentate gyrus is required for object recognition memory, probably via dentate gyrus LTP expression.

  5. Gamma Band Activity in the RAS-intracellular mechanisms

    PubMed Central

    Garcia-Rill, E.; Kezunovic, N.; D’Onofrio, S.; Luster, B.; Hyde, J.; Bisagno, V.; Urbano, F.J.


    Gamma band activity participates in sensory perception, problem solving, and memory. This review considers recent evidence showing that cells in the reticular activating system (RAS) exhibit gamma band activity, and describes the intrinsic membrane properties behind such manifestation. Specifically, we discuss how cells in the mesopontine pedunculopontine nucleus (PPN), intralaminar parafascicular nucleus (Pf), and pontine Subcoeruleus nucleus dorsalis (SubCD) all fire in the gamma band range when maximally activated, but no higher. The mechanisms involve high threshold, voltage-dependent P/Q-type calcium channels or sodium-dependent subthreshold oscillations. Rather than participating in the temporal binding of sensory events as in the cortex, gamma band activity in the RAS may participate in the processes of preconscious awareness, and provide the essential stream of information for the formulation of many of our actions. We address three necessary next steps resulting from these discoveries, an intracellular mechanism responsible for maintaining gamma band activity based on persistent G-protein activation, separate intracellular pathways that differentiate between gamma band activity during waking vs during REM sleep, and an intracellular mechanism responsible for the dysregulation in gamma band activity in schizophrenia. These findings open several promising research avenues that have not been thoroughly explored. What are the effects of sleep or REM sleep deprivation on these RAS mechanisms? Are these mechanisms involved in memory processing during waking and/or during REM sleep? Does gamma band processing differ during waking vs REM sleep after sleep or REM sleep deprivation? PMID:24309750

  6. The Yeast Retrograde Response as a Model of Intracellular Signaling of Mitochondrial Dysfunction

    PubMed Central

    Jazwinski, S. Michal; Kriete, Andres


    Mitochondrial dysfunction activates intracellular signaling pathways that impact yeast longevity, and the best known of these pathways is the retrograde response. More recently, similar responses have been discerned in other systems, from invertebrates to human cells. However, the identity of the signal transducers is either unknown or apparently diverse, contrasting with the well-established signaling module of the yeast retrograde response. On the other hand, it has become equally clear that several other pathways and processes interact with the retrograde response, embedding it in a network responsive to a variety of cellular states. An examination of this network supports the notion that the master regulator NFκB aggregated a variety of mitochondria-related cellular responses at some point in evolution and has become the retrograde transcription factor. This has significant consequences for how we view some of the deficits associated with aging, such as inflammation. The support for NFκB as the retrograde response transcription factor is not only based on functional analyses. It is bolstered by the fact that NFκB can regulate Myc–Max, which is activated in human cells with dysfunctional mitochondria and impacts cellular metabolism. Myc–Max is homologous to the yeast retrograde response transcription factor Rtg1–Rtg3. Further research will be needed to disentangle the pro-aging from the anti-aging effects of NFκB. Interestingly, this is also a challenge for the complete understanding of the yeast retrograde response. PMID:22629248

  7. Activity of 10 antimicrobial agents against intracellular Rhodococcus equi.


    Giguère, Steeve; Berghaus, Londa J; Lee, Elise A


    Studies with facultative intracellular bacterial pathogens have shown that evaluation of the bactericidal activity of antimicrobial agents against intracellular bacteria is more closely associated with in vivo efficacy than traditional in vitro susceptibility testing. The objective of this study was to determine the relative activity of 10 antimicrobial agents against intracellular Rhodococcus equi. Equine monocyte-derived macrophages were infected with virulent R. equi and exposed to erythromycin, clarithromycin, azithromycin, rifampin, ceftiofur, gentamicin, enrofloxacin, vancomycin, imipenem, or doxycycline at concentrations achievable in plasma at clinically recommended dosages in foals. The number of intracellular R. equi was determined 48h after infection by counting colony forming units (CFUs). The number of R. equi CFUs in untreated control wells were significantly higher than those of monolayers treated with antimicrobial agents. Numbers of R. equi were significantly lower in monolayers treated with enrofloxacin followed by those treated with gentamicin, and vancomycin, when compared to monolayers treated with other antimicrobial agents. Numbers of R. equi in monolayers treated with doxycycline were significantly higher than those of monolayers treated with other antimicrobial agents. Differences in R. equi CFUs between monolayers treated with other antimicrobial agents were not statistically significant. Enrofloxacin, gentamicin, and vancomycin are the most active drugs in equine monocyte-derived macrophages infected with R. equi. Additional studies will be needed to determine if these findings correlate with in vivo efficacy.

  8. Irisin Controls Growth, Intracellular Ca2+ Signals, and Mitochondrial Thermogenesis in Cardiomyoblasts.


    Xie, Chao; Zhang, Yuan; Tran, Tran D N; Wang, Hai; Li, Shiwu; George, Eva Vertes; Zhuang, Haoyang; Zhang, Peilan; Kandel, Avi; Lai, Yimu; Tang, Dongqi; Reeves, Westley H; Cheng, Henrique; Ding, Yousong; Yang, Li-Jun


    Exercise offers short-term and long-term health benefits, including an increased metabolic rate and energy expenditure in myocardium. The newly-discovered exercise-induced myokine, irisin, stimulates conversion of white into brown adipocytes as well as increased mitochondrial biogenesis and energy expenditure. Remarkably, irisin is highly expressed in myocardium, but its physiological effects in the heart are unknown. The objective of this work is to investigate irisin's potential multifaceted effects on cardiomyoblasts and myocardium. For this purpose, H9C2 cells were treated with recombinant irisin produced in yeast cells (r-irisin) and in HEK293 cells (hr-irisin) for examining its effects on cell proliferation by MTT [3-(4, 5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay and on gene transcription profiles by qRT-PCR. R-irisin and hr-irisin both inhibited cell proliferation and activated genes related to cardiomyocyte metabolic function and differentiation, including myocardin, follistatin, smooth muscle actin, and nuclear respiratory factor-1. Signal transduction pathways affected by r-irisin in H9C2 cells and C57BL/6 mice were examined by detecting phosphorylation of PI3K-AKT, p38, ERK or STAT3. We also measured intracellular Ca2+ signaling and mitochondrial thermogenesis and energy expenditure in r-irisin-treated H9C2 cells. The results showed that r-irisin, in a certain concentration rage, could activate PI3K-AKT and intracellular Ca2+ signaling and increase cellular oxygen consumption in H9C2 cells. Our study also suggests the existence of irisin-specific receptor on the membrane of H9C2 cells. In conclusion, irisin in a certain concentration rage increased myocardial cell metabolism, inhibited cell proliferation and promoted cell differentiation. These effects might be mediated through PI3K-AKT and Ca2+ signaling, which are known to activate expression of exercise-related genes such as follistatin and myocardin. This work supports the value

  9. Irisin Controls Growth, Intracellular Ca2+ Signals, and Mitochondrial Thermogenesis in Cardiomyoblasts

    PubMed Central

    Xie, Chao; Zhang, Yuan; Tran, Tran D. N.; Wang, Hai; Li, Shiwu; George, Eva Vertes; Zhuang, Haoyang; Zhang, Peilan; Kandel, Avi; Lai, Yimu; Tang, Dongqi; Reeves, Westley H.; Cheng, Henrique; Ding, Yousong; Yang, Li-Jun


    Exercise offers short-term and long-term health benefits, including an increased metabolic rate and energy expenditure in myocardium. The newly-discovered exercise-induced myokine, irisin, stimulates conversion of white into brown adipocytes as well as increased mitochondrial biogenesis and energy expenditure. Remarkably, irisin is highly expressed in myocardium, but its physiological effects in the heart are unknown. The objective of this work is to investigate irisin’s potential multifaceted effects on cardiomyoblasts and myocardium. For this purpose, H9C2 cells were treated with recombinant irisin produced in yeast cells (r-irisin) and in HEK293 cells (hr-irisin) for examining its effects on cell proliferation by MTT [3-(4, 5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay and on gene transcription profiles by qRT-PCR. R-irisin and hr-irisin both inhibited cell proliferation and activated genes related to cardiomyocyte metabolic function and differentiation, including myocardin, follistatin, smooth muscle actin, and nuclear respiratory factor-1. Signal transduction pathways affected by r-irisin in H9C2 cells and C57BL/6 mice were examined by detecting phosphorylation of PI3K-AKT, p38, ERK or STAT3. We also measured intracellular Ca2+ signaling and mitochondrial thermogenesis and energy expenditure in r-irisin-treated H9C2 cells. The results showed that r-irisin, in a certain concentration rage, could activate PI3K-AKT and intracellular Ca2+ signaling and increase cellular oxygen consumption in H9C2 cells. Our study also suggests the existence of irisin-specific receptor on the membrane of H9C2 cells. In conclusion, irisin in a certain concentration rage increased myocardial cell metabolism, inhibited cell proliferation and promoted cell differentiation. These effects might be mediated through PI3K-AKT and Ca2+ signaling, which are known to activate expression of exercise-related genes such as follistatin and myocardin. This work supports the value

  10. Tollip, an intracellular trafficking protein, is a novel modulator of the transforming growth factor-β signaling pathway.


    Zhu, Lu; Wang, Lingdi; Luo, Xiaolin; Zhang, Yongxian; Ding, Qiurong; Jiang, Xiaomeng; Wang, Xiao; Pan, Yi; Chen, Yan


    Upon activation, TGF-β type I receptor (TβRI) undergoes active ubiquitination via recruitment of E3 ligases to the receptor complex by Smad7. However, how ubiquitination of TβRI is coupled to intracellular trafficking, and protein degradation remains unclear. We report here that Tollip, an adaptor protein that contains both ubiquitin-associated domains and endosome-targeting domain, plays an important role in modulating trafficking and degradation of TβRI. Tollip was previously demonstrated to possess a functional role in modulating the signaling of interleukin-1 and Toll-like receptors. We identify here that Tollip interacts with Smad7, a major modulatory protein involved in the negative regulation of TGF-β signaling. Overexpression of Tollip antagonizes TGF-β-stimulated transcriptional response, Smad2 phosphorylation, and epithelial-mesenchymal transition. Tollip also interacts with ubiquitinated TβRI, and such interaction requires ubiquitin-associated domains of Tollip. The interaction and intracellular colocalization of Tollip with TβRI is enhanced by Smad7. Overexpression of Tollip accelerates protein degradation of activated TβRI. In addition, Tollip alters subcellular compartmentalization and endosomal trafficking of activated TβRI. Collectively, our studies reveal that Tollip cooperates with Smad7 to modulate intracellular trafficking and degradation of ubiquitinated TβRI, whereby negatively regulates TGF-β signaling pathway.

  11. EpCAM Intracellular Domain Promotes Porcine Cell Reprogramming by Upregulation of Pluripotent Gene Expression via Beta-catenin Signaling

    PubMed Central

    Yu, Tong; Ma, Yangyang; Wang, Huayan


    Previous study showed that expression of epithelial cell adhesion molecule (EpCAM) was significantly upregulated in porcine induced pluripotent stem cells (piPSCs). However, the regulatory mechanism and the downstream target genes of EpCAM were not well investigated. In this study, we found that EpCAM was undetectable in fibroblasts, but highly expressed in piPSCs. Promoter of EpCAM was upregulated by zygotic activated factors LIN28, and ESRRB, but repressed by maternal factors OCT4 and SOX2. Knocking down EpCAM by shRNA significantly reduced the pluripotent gene expression. Conversely, overexpression of EpCAM significantly increased the number of alkaline phosphatase positive colonies and elevated the expression of endogenous pluripotent genes. As a key surface-to-nucleus factor, EpCAM releases its intercellular domain (EpICD) by a two-step proteolytic processing sequentially. Blocking the proteolytic processing by inhibitors TAPI-1 and DAPT could reduce the intracellular level of EpICD and lower expressions of OCT4, SOX2, LIN28, and ESRRB. We noticed that increasing intracellular EpICD only was unable to improve activity of EpCAM targeted genes, but by blocking GSK-3 signaling and stabilizing beta-catenin signaling, EpICD could then significantly stimulate the promoter activity. These results showed that EpCAM intracellular domain required beta-catenin signaling to enhance porcine cell reprogramming. PMID:28393933

  12. Mechanisms of HIV-1 Nef Function and Intracellular Signaling

    PubMed Central

    Foster, John L.; Denial, Sarah J.; Temple, Brenda R. S.; Garcia, J. Victor


    Advances in the last several years have enhanced mechanistic understanding of Nef induced CD4 and MHCI downregulation and have suggested a new paradigm for analyzing Nef function. In both of these cases, Nef acts by forming ternary complexes with significant contributions to stability imparted by non-canonical interactions. The mutational analyses and binding assays that have led to these conclusions are discussed. The recent progress has been dependent on conservative mutations and multi-protein binding assays. The poorly understood Nef functions of p21 activated protein kinase (PAK2) activation, enhancement of virion infectivity, and inhibition of immunoglobulin class switching are also likely to involve ternary complexes and non-canonical interactions. Hence, investigation of these latter Nef functions should benefit from a similar approach. Six historically used alanine substitutions for determining structure-function relationships of Nef are discussed. These are M20A, E62A/E63A/E64A/E65A (AAAA), P72A/P75A (AXXA), R106A, L164A/L165A, and D174A/D175A. Investigations of less disruptive mutations in place of AAAA and AXXA have led to different interpretations of mechanism. Two recent examples of this alternate approach applied to PAK2 activation F191 and critical residue D123 are presented. The implications of the new findings and the resulting new paradigm for Nef structure-function are discussed with respect to creating a map of Nef functions on the protein surface. We report the results of a PPI-Pred analysis for protein-protein interfaces. There are three predicted patches produced by the analysis which describe regions consistent with the currently known mutational analyses of Nef function. PMID:21336563

  13. Role of α7 nicotinic receptor in the immune system and intracellular signaling pathways

    PubMed Central

    Zdanowski, Robert; Ujazdowska, Dominika; Lewicka, Aneta; Lewicki, Sławomir


    Acetylcholine has been well known as one of the most exemplary neurotransmitters. In humans, this versatile molecule and its synthesizing enzyme, choline acetyltransferase, have been found in various non-neural tissues such as the epithelium, endothelium, mesothelium muscle, blood cells and immune cells. The non-neuronal acetylcholine is accompanied by the expression of acetylcholinesterase and nicotinic/muscarinic acetylcholine receptors. Increasing evidence of the non-neuronal acetylcholine system found throughout the last few years has indicated this neurotransmitter as one of the major cellular signaling molecules (associated e.g. with kinases and transcription factors activity). This system is responsible for maintenance and optimization of the cellular function, such as proliferation, differentiation, adhesion, migration, intercellular contact and apoptosis. Additionally, it controls proper activity of immune cells and affects differentiation, antigen presentation or cytokine production (both pro- and anti-inflammatory). The present article reviews recent findings about the non-neuronal cholinergic system in the field of immune system and intracellular signaling pathways. PMID:26648784

  14. Anabolic androgenic steroids and intracellular calcium signaling: a mini review on mechanisms and physiological implications.


    Vicencio, J M; Estrada, M; Galvis, D; Bravo, R; Contreras, A E; Rotter, D; Szabadkai, G; Hill, J A; Rothermel, B A; Jaimovich, E; Lavandero, S


    Increasing evidence suggests that nongenomic effects of testosterone and anabolic androgenic steroids (AAS) operate concertedly with genomic effects. Classically, these responses have been viewed as separate and independent processes, primarily because nongenomic responses are faster and appear to be mediated by membrane androgen receptors, whereas long-term genomic effects are mediated through cytosolic androgen receptors regulating transcriptional activity. Numerous studies have demonstrated increases in intracellular Ca2+ in response to AAS. These Ca2+ mediated responses have been seen in a diversity of cell types, including osteoblasts, platelets, skeletal muscle cells, cardiac myocytes and neurons. The versatility of Ca2+ as a second messenger provides these responses with a vast number of pathophysiological implications. In cardiac cells, testosterone elicits voltage-dependent Ca2+ oscillations and IP3R-mediated Ca2+ release from internal stores, leading to activation of MAPK and mTOR signaling that promotes cardiac hypertrophy. In neurons, depending upon concentration, testosterone can provoke either physiological Ca2+ oscillations, essential for synaptic plasticity, or sustained, pathological Ca2+ transients that lead to neuronal apoptosis. We propose therefore, that Ca2+ acts as an important point of crosstalk between nongenomic and genomic AAS signaling, representing a central regulator that bridges these previously thought to be divergent responses.

  15. Intracellular signaling as a potential target for antiplatelet therapy.


    Andre, Patrick


    Three classes of inhibitors of platelet aggregation have demonstrated substantial clinical benfits. Aspirin acts by irreversibly inhibiting COX-1 and therefore blocking the synthesis of proaggregatory thromboxane A (2) (TxA(2)). The indirect acting (ticlopidine, clopidogrel, prasugrel) and the direct acting (ticagrelor) antagonists of P2Y(12) block the thrombus stabilizing activity of ADP. Parenteral GP IIb-IIIa inhibitors directly block platelet-platelet interactions. Despite well-established benefits, all antiplatelet agents have important limitations: increased bleeding and gastrointestinal toxicities (aspirin), high incidence of thrombotic thrombocytopenic purpura (ticlopidine), potentially nonresponders (clopidogrel), severe bleeding (prasugrel, GP IIb-IIIa antagonists) and "complicated" relationships with aspirin ticagrelor). In this chapter, we present the genetic and pharmacological evidence that supports the development and expectations associated with novel antiplatelet strategies directed at intrasignaling pathways.

  16. Dictyostelium uses ether-linked inositol phospholipids for intracellular signalling.


    Clark, Jonathan; Kay, Robert R; Kielkowska, Anna; Niewczas, Izabella; Fets, Louise; Oxley, David; Stephens, Len R; Hawkins, Phillip T


    Inositol phospholipids are critical regulators of membrane biology throughout eukaryotes. The general principle by which they perform these roles is conserved across species and involves binding of differentially phosphorylated inositol head groups to specific protein domains. This interaction serves to both recruit and regulate the activity of several different classes of protein which act on membrane surfaces. In mammalian cells, these phosphorylated inositol head groups are predominantly borne by a C38:4 diacylglycerol backbone. We show here that the inositol phospholipids of Dictyostelium are different, being highly enriched in an unusual C34:1e lipid backbone, 1-hexadecyl-2-(11Z-octadecenoyl)-sn-glycero-3-phospho-(1'-myo-inositol), in which the sn-1 position contains an ether-linked C16:0 chain; they are thus plasmanylinositols. These plasmanylinositols respond acutely to stimulation of cells with chemoattractants, and their levels are regulated by PIPKs, PI3Ks and PTEN. In mammals and now in Dictyostelium, the hydrocarbon chains of inositol phospholipids are a highly selected subset of those available to other phospholipids, suggesting that different molecular selectors are at play in these organisms but serve a common, evolutionarily conserved purpose.

  17. Intracellular calcium signaling in the fertilized eggs of Annelida.


    Nakano, Takeshi; Deguchi, Ryusaku; Kyozuka, Keiichiro


    Fertilization is such a universal and indispensable step in sexual reproduction, but a high degree of variability exists in the way it takes place in the animal kingdom. As discussed in other reviews in this issue, recent works on this subject clarified many points. However, important results on the mechanisms of fertilization are obtained mainly from a few restricted model organisms. In this sense, it is utterly important to collect more information from various phyla. In this review, we have re-introduced Annelida as one of the most suitable models for the analysis of fertilization process. We have briefly reviewed the historical works on the fertilization of Annelida. Then, we have described recent findings on the two independent Ca(2+) increases in the fertilized eggs of Annelida, which arise from two different mechanisms and may have distinct physiological roles toward sperm entry and egg activation. We propose that the Ca(2+) increase in the fertilized eggs reflect the specific needs of the zygote in a given species.

  18. Regulation of Notch1 signaling by the APP intracellular domain facilitates degradation of the Notch1 intracellular domain and RBP-Jk.


    Kim, Mi-Yeon; Mo, Jung-Soon; Ann, Eun-Jung; Yoon, Ji-Hye; Jung, Jane; Choi, Yun-Hee; Kim, Su-Man; Kim, Hwa-Young; Ahn, Ji-Seon; Kim, Hangun; Kim, Kwonseop; Hoe, Hyang-Sook; Park, Hee-Sae


    The Notch1 receptor is a crucial controller of cell fate decisions, and is also a key regulator of cell growth and differentiation in a variety of contexts. In this study, we have demonstrated that the APP intracellular domain (AICD) attenuates Notch1 signaling by accelerated degradation of the Notch1 intracellular domain (Notch1-IC) and RBP-Jk, through different degradation pathways. AICD suppresses Notch1 transcriptional activity by the dissociation of the Notch1-IC-RBP-Jk complex after processing by γ-secretase. Notch1-IC is capable of forming a trimeric complex with Fbw7 and AICD, and AICD enhances the protein degradation of Notch1-IC through an Fbw7-dependent proteasomal pathway. AICD downregulates the levels of RBP-Jk protein through the lysosomal pathway. AICD-mediated degradation is involved in the preferential degradation of non-phosphorylated RBP-Jk. Collectively, our results demonstrate that AICD functions as a negative regulator in Notch1 signaling through the promotion of Notch1-IC and RBP-Jk protein degradation.

  19. Calcium inhibition as an intracellular signal for actin–myosin interaction

    PubMed Central

    KOHAMA, Kazuhiro


    Intracellular signaling pathways include both the activation and the inhibition of biological processes. The activation of Ca2+ regulation of actin-myosin interactions was examined first, whereas it took 20 years for the author to clarify the inhibitory mode by using Physarum polycephalum, a lower eukaryote. This review describes the investigation of the inhibitory mode since 1980. The inhibitory effect of Ca2+ on myosin was detected chemically by ATPase assays and mechanically by in vitro motility assays. The Ca2+-binding ability of Physarum myosin is as high as that of scallop myosin. Ca2+ inhibits Physarum myosin, whereas it activates scallop myosin. We cloned cDNA of the myosin heavy chain and light chains to express a hybrid of Physarum and scallop myosin, and found that the Ca-binding light chain (CaLc), which belongs to an alkali light chain class, plays a major role in Ca inhibition. The role of CaLc was confirmed by mutating its EF-hand, Ca-binding structure and expressing Physarum myosin as a recombinant protein. Thus, the data obtained by classical protein purification were confirmed by the results obtained with the modern recombinant techniques. However, there are some discrepancies that remain to be solved as described in Section XII. PMID:27941307

  20. Methoxychlor and Vinclozolin Induce Rapid Changes in Intercellular and Intracellular Signaling in Liver Progenitor Cells.


    Babica, Pavel; Zurabian, Rimma; Kumar, Esha R; Chopra, Rajus; Mianecki, Maxwell J; Park, Joon-Suk; Jaša, Libor; Trosko, James E; Upham, Brad L


    Methoxychlor (MXC) and vinclozolin (VIN) are well-recognized endocrine disrupting chemicals known to alter epigenetic regulations and transgenerational inheritance; however, non-endocrine disruption endpoints are also important. Thus, we determined the effects of MXC and VIN on the dysregulation of gap junctional intercellular communication (GJIC) and activation of mitogen-activated protein kinases (MAPKs) in WB-F344 rat liver epithelial cells. Both chemicals induced a rapid dysregulation of GJIC at non-cytotoxic doses, with 30 min EC50 values for GJIC inhibition being 10 µM for MXC and 126 µM for VIN. MXC inhibited GJIC for at least 24 h, while VIN effects were transient and GJIC recovered after 4 h. VIN induced rapid hyperphosphorylation and internalization of gap junction protein connexin43, and both chemicals also activated MAPK ERK1/2 and p38. Effects on GJIC were not prevented by MEK1/2 inhibitor, but by an inhibitor of phosphatidylcholine-specific phospholipase C (PC-PLC), resveratrol, and in the case of VIN, also, by a p38 inhibitor. Estrogen (ER) and androgen receptor (AR) modulators (estradiol, ICI 182,780, HPTE, testosterone, flutamide, VIN M2) did not attenuate MXC or VIN effects on GJIC. Our data also indicate that the effects were elicited by the parental compounds of MXC and VIN. Our study provides new evidence that MXC and VIN dysregulate GJIC via mechanisms involving rapid activation of PC-PLC occurring independently of ER- or AR-dependent genomic signaling. Such alterations of rapid intercellular and intracellular signaling events involved in regulations of gene expression, tissue development, function and homeostasis, could also contribute to transgenerational epigenetic effects of endocrine disruptors.

  1. Aquaporin-3 mediates hydrogen peroxide uptake to regulate downstream intracellular signaling

    PubMed Central

    Miller, Evan W.; Dickinson, Bryan C.; Chang, Christopher J.


    Hydrogen peroxide (H2O2) produced by cell-surface NADPH Oxidase (Nox) enzymes is emerging as an important signaling molecule for growth, differentiation, and migration processes. However, how cells spatially regulate H2O2 to achieve physiological redox signaling over nonspecific oxidative stress pathways is insufficiently understood. Here we report that the water channel Aquaporin-3 (AQP3) can facilitate the uptake of H2O2 into mammalian cells and mediate downstream intracellular signaling. Molecular imaging with Peroxy Yellow 1 Methyl-Ester (PY1-ME), a new chemoselective fluorescent indicator for H2O2, directly demonstrates that aquaporin isoforms AQP3 and AQP8, but not AQP1, can promote uptake of H2O2 specifically through membranes in mammalian cells. Moreover, we show that intracellular H2O2 accumulation can be modulated up or down based on endogenous AQP3 expression, which in turn can influence downstream cell signaling cascades. Finally, we establish that AQP3 is required for Nox-derived H2O2 signaling upon growth factor stimulation. Taken together, our findings demonstrate that the downstream intracellular effects of H2O2 can be regulated across biological barriers, a discovery that has broad implications for the controlled use of this potentially toxic small molecule for beneficial physiological functions. PMID:20724658

  2. NMDA receptor-mediated epileptiform persistent activity requires calcium release from intracellular stores in prefrontal neurons.


    Gao, Wen-Jun; Goldman-Rakic, Patricia S


    Various normal and pathological forms of synchronized population activity are generated by recurrent excitation among pyramidal neurons in the neocortex. However, the intracellular signaling mechanisms underlying this activity remain poorly understood. In this study, we have examined the cellular properties of synchronized epileptiform activity in the prefrontal cortex with particular emphasis on a potential role of intracellular calcium stores. We find that the zero-magnesium-induced synchronized activity is blocked by inhibition of sarco-endoplasmic reticulum Ca(2+)-ATPases, phospholipase C (PLC), the inositol 1,4,5-trisphosphate (IP3) receptor, and the ryanodine receptor. This same activity is, however, not affected by application of metabotropic glutamatergic receptor (mGluR) agonists, nor by introduction of an mGluR antagonist. These results suggest that persistent synchronized activity in vitro is dependent upon calcium release from internal calcium stores through the activation of PLC-IP3 receptor pathway. Our findings also raise the possibility that intracellular calcium release may be involved in the generation of pathologic synchronized activity in epilepsy in vivo and in physiological forms of synchronized cortical activity.

  3. Dynamic changes in intracellular ROS levels regulate airway basal stem cell homeostasis through Nrf2-dependent Notch signaling.


    Paul, Manash K; Bisht, Bharti; Darmawan, Daphne O; Chiou, Richard; Ha, Vi L; Wallace, William D; Chon, Andrew T; Hegab, Ahmed E; Grogan, Tristan; Elashoff, David A; Alva-Ornelas, Jackelyn A; Gomperts, Brigitte N


    Airways are exposed to myriad environmental and damaging agents such as reactive oxygen species (ROS), which also have physiological roles as signaling molecules that regulate stem cell function. However, the functional significance of both steady and dynamically changing ROS levels in different stem cell populations, as well as downstream mechanisms that integrate ROS sensing into decisions regarding stem cell homeostasis, are unclear. Here, we show in mouse and human airway basal stem cells (ABSCs) that intracellular flux from low to moderate ROS levels is required for stem cell self-renewal and proliferation. Changing ROS levels activate Nrf2, which activates the Notch pathway to stimulate ABSC self-renewal and an antioxidant program that scavenges intracellular ROS, returning overall ROS levels to a low state to maintain homeostatic balance. This redox-mediated regulation of lung stem cell function has significant implications for stem cell biology, repair of lung injuries, and diseases such as cancer.

  4. Single-Molecule Imaging Reveals the Activation Dynamics of Intracellular Protein Smad3 on Cell Membrane

    NASA Astrophysics Data System (ADS)

    Li, Nan; Yang, Yong; He, Kangmin; Zhang, Fayun; Zhao, Libo; Zhou, Wei; Yuan, Jinghe; Liang, Wei; Fang, Xiaohong


    Smad3 is an intracellular protein that plays a key role in propagating transforming growth factor β (TGF-β) signals from cell membrane to nucleus. However whether the transient process of Smad3 activation occurs on cell membrane and how it is regulated remains elusive. Using advanced live-cell single-molecule fluorescence microscopy to image and track fluorescent protein-labeled Smad3, we observed and quantified, for the first time, the dynamics of individual Smad3 molecules docking to and activation on the cell membrane. It was found that Smad3 docked to cell membrane in both unstimulated and stimulated cells, but with different diffusion rates and dissociation kinetics. The change in its membrane docking dynamics can be used to study the activation of Smad3. Our results reveal that Smad3 binds with type I TGF-β receptor (TRI) even in unstimulated cells. Its activation is regulated by TRI phosphorylation but independent of receptor endocytosis. This study offers new information on TGF-β/Smad signaling, as well as a new approach to investigate the activation of intracellular signaling proteins for a better understanding of their functions in signal transduction.

  5. Single-Molecule Imaging Reveals the Activation Dynamics of Intracellular Protein Smad3 on Cell Membrane

    PubMed Central

    Li, Nan; Yang, Yong; He, Kangmin; Zhang, Fayun; Zhao, Libo; Zhou, Wei; Yuan, Jinghe; Liang, Wei; Fang, Xiaohong


    Smad3 is an intracellular protein that plays a key role in propagating transforming growth factor β (TGF-β) signals from cell membrane to nucleus. However whether the transient process of Smad3 activation occurs on cell membrane and how it is regulated remains elusive. Using advanced live-cell single-molecule fluorescence microscopy to image and track fluorescent protein-labeled Smad3, we observed and quantified, for the first time, the dynamics of individual Smad3 molecules docking to and activation on the cell membrane. It was found that Smad3 docked to cell membrane in both unstimulated and stimulated cells, but with different diffusion rates and dissociation kinetics. The change in its membrane docking dynamics can be used to study the activation of Smad3. Our results reveal that Smad3 binds with type I TGF-β receptor (TRI) even in unstimulated cells. Its activation is regulated by TRI phosphorylation but independent of receptor endocytosis. This study offers new information on TGF-β/Smad signaling, as well as a new approach to investigate the activation of intracellular signaling proteins for a better understanding of their functions in signal transduction. PMID:27641076

  6. Intracellular Heat Shock Protein-70 Negatively Regulates Toll-like Receptor-4 Signaling in the Newborn Intestinal Epithelium1

    PubMed Central

    Afrazi, Amin; Sodhi, Chhinder P.; Good, Misty; Jia, Hongpeng; Siggers, Richard; Yazji, Ibrahim; Neal, Matthew D.; Prindle, Thomas; Grant, Zachary; Branca, Maria F.; Ozolek, John; Chang, Eugene; Hackam, David J.


    Necrotizing enterocolitis (NEC) is the leading cause of gastrointestinal-related mortality in premature infants, and develops under conditions of exaggerated Toll-like receptor-4 (TLR4) signaling in the newborn intestinal epithelium. Since NEC does not develop spontaneously despite the presence of seemingly tonic stimulation of intestinal TLR4, we hypothesized that mechanisms must exist to constrain TLR4 signaling that become diminished during NEC pathogenesis, and focused on the intracellular stress response protein and chaperone Heat Shock Protein-70 (Hsp70). We now demonstrate that the induction of intracellular Hsp70 in enterocytes dramatically reduced TLR4 signaling as assessed by LPS-induced NFkB translocation, cytokine expression and apoptosis. These findings were confirmed in vivo, using mice that either globally lacked Hsp70 or which over-expressed Hsp70 within the intestinal epithelium. TLR4 activation itself significantly increased Hsp70 expression in enterocytes, which provided a mechanism of auto-inhibition of TLR4 signaling in enterocytes. In seeking to define the mechanisms involved, intracellular Hsp70-mediated inhibition of TLR4 signaling required both its substrate-binding EEVD-domain and association with the co-chaperone CHIP, resulting in ubiquitination and proteosomal degradation of TLR4. The expression of Hsp70 in the intestinal epithelium was significantly decreased in murine and human NEC compared to healthy controls, suggesting loss of Hsp70 protection from TLR4 could lead to NEC. In support of this, intestinal-Hsp70 overexpression in mice and pharmacologic upregulation of Hsp70 reversed TLR4-induced cytokines and enterocyte apoptosis, and prevented and treated experimental NEC. Thus, a novel TLR4 regulatory pathway exists within the newborn gut involving Hsp70 that may be pharmacologically activated to limit NEC severity. PMID:22461698

  7. Intracellular calcium signals regulate growth of hepatic stellate cells via specific effects on cell cycle progression.


    Soliman, Elwy M; Rodrigues, Michele Angela; Gomes, Dawidson Assis; Sheung, Nina; Yu, Jin; Amaya, Maria Jimina; Nathanson, Michael H; Dranoff, Jonathan A


    Hepatic stellate cells (HSC) are important mediators of liver fibrosis. Hormones linked to downstream intracellular Ca(2+) signals upregulate HSC proliferation, but the mechanisms by which this occurs are unknown. Nuclear and cytosolic Ca(2+) signals may have distinct effects on cell proliferation, so we expressed plasmid and adenoviral constructs containing the Ca(2+) chelator parvalbumin (PV) linked to either a nuclear localization sequence (NLS) or a nuclear export sequence (NES) to block Ca(2+) signals in distinct compartments within LX-2 immortalized human HSC and primary rat HSC. PV-NLS and PV-NES constructs each targeted to the appropriate intracellular compartment and blocked Ca(2+) signals only within that compartment. PV-NLS and PV-NES constructs inhibited HSC growth. Furthermore, blockade of nuclear or cytosolic Ca(2+) signals arrested growth at the G2/mitosis (G2/M) cell-cycle interface and prevented the onset of mitosis. Blockade of nuclear or cytosolic Ca(2+) signals downregulated phosphorylation of the G2/M checkpoint phosphatase Cdc25C. Inhibition of calmodulin kinase II (CaMK II) had identical effects on LX-2 growth and Cdc25C phosphorylation. We propose that nuclear and cytosolic Ca(2+) are critical signals that regulate HSC growth at the G2/M checkpoint via CaMK II-mediated regulation of Cdc25C phosphorylation. These data provide a new logical target for pharmacological therapy directed against progression of liver fibrosis.

  8. EphrinA2 Receptor (EphA2) Is an Invasion and Intracellular Signaling Receptor for Chlamydia trachomatis

    PubMed Central

    Subbarayal, Prema; Karunakaran, Karthika; Winkler, Ann-Cathrin; Rother, Marion; Gonzalez, Erik; Meyer, Thomas F.; Rudel, Thomas


    The obligate intracellular bacterium Chlamydia trachomatis invades into host cells to replicate inside a membrane-bound vacuole called inclusion. Multiple different host proteins are recruited to the inclusion and are functionally modulated to support chlamydial development. Invaded and replicating Chlamydia induces a long-lasting activation of the PI3 kinase signaling pathway that is required for efficient replication. We identified the cell surface tyrosine kinase EphrinA2 receptor (EphA2) as a chlamydial adherence and invasion receptor that induces PI3 kinase (PI3K) activation, promoting chlamydial replication. Interfering with binding of C. trachomatis serovar L2 (Ctr) to EphA2, downregulation of EphA2 expression or inhibition of EphA2 activity significantly reduced Ctr infection. Ctr interacts with and activates EphA2 on the cell surface resulting in Ctr and receptor internalization. During chlamydial replication, EphA2 remains active accumulating around the inclusion and interacts with the p85 regulatory subunit of PI3K to support the activation of the PI3K/Akt signaling pathway that is required for normal chlamydial development. Overexpression of full length EphA2, but not the mutant form lacking the intracellular cytoplasmic domain, enhanced PI3K activation and Ctr infection. Despite the depletion of EphA2 from the cell surface, Ctr infection induces upregulation of EphA2 through the activation of the ERK pathway, which keeps the infected cell in an apoptosis-resistant state. The significance of EphA2 as an entry and intracellular signaling receptor was also observed with the urogenital C. trachomatis-serovar D. Our findings provide the first evidence for a host cell surface receptor that is exploited for invasion as well as for receptor-mediated intracellular signaling to facilitate chlamydial replication. In addition, the engagement of a cell surface receptor at the inclusion membrane is a new mechanism by which Chlamydia subverts the host cell and

  9. Lipid raft-dependent uptake, signaling, and intracellular fate of Porphyromonas gingivalis in mouse macrophages

    PubMed Central

    Wang, Min; Hajishengallis, George


    Summary Lipid rafts are cholesterol-enriched microdomains involved in cellular trafficking and implicated as portals for certain pathogens. We sought to determine whether the oral pathogen Porphyromonas gingivalis enters macrophages via lipid rafts, and if so, to examine the impact of raft entry on its intracellular fate. Using J774A.1 mouse macrophages, we found that P. gingivalis colocalizes with lipid rafts in a cholesterol-dependent way. Depletion of cellular cholesterol using methyl-β-cyclodextrin resulted in about 50% inhibition of P. gingivalis uptake, although this effect was reversed by cholesterol reconstitution. The intracellular survival of P. gingivalis was dramatically inhibited in cholesterol-depleted cells relative to untreated or cholesterol-reconstituted cells, even when infections were adjusted to allow equilibration of the initial intracellular bacterial load. P. gingivalis thus appeared to exploit raft-mediated uptake for promoting its survival. Consistent with this, lipid raft disruption enhanced the colocalization of internalized P. gingivalis with lysosomes. In contrast, raft disruption did not affect the expression of host receptors interacting with P. gingivalis, although it significantly inhibited signal transduction. In summary, P. gingivalis uses macrophage lipid rafts as signaling and entry platforms, which determine its intracellular fate to the pathogen’s own advantage. PMID:18547335

  10. Stress Induces a Switch of Intracellular Signaling in Sensory Neurons in a Model of Generalized Pain

    PubMed Central

    Khasar, Sachia G.; Burkham, Jennifer; Dina, Olayinka A.; Brown, Adrienne S.; Bogen, Oliver; Alessandri-Haber, Nicole; Green, Paul G.; Reichling, David B.; Levine, Jon D.


    Stress dramatically exacerbates pain in diseases such as fibromyalgia and rheumatoid arthritis, but the underlying mechanisms are unknown. We tested the hypothesis that stress causes generalized hyperalgesia by enhancing pro-nociceptive effects of immune mediators. Rats exposed to non-habituating sound stress exhibited no change in mechanical nociceptive threshold, but showed a marked increase in hyperalgesia evoked by local injections of prostaglandin E2 or epinephrine. This enhancement, which developed more than a week after exposure to stress, required concerted action of glucocorticoids and catecholamines at receptors located in the periphery on sensory afferents. The altered response to pronociceptive mediators involved a switch in coupling of their receptors from predominantly stimulatory to inhibitory G-proteins (Gs to Gi), and for prostaglandin E2, emergence of novel dependence on protein kinase C epsilon. Thus, an important mechanism in generalized pain syndromes may be stress-induced co-activation of the hypothalmo-pituitary-adrenal and sympatho-adrenal axes, causing a long-lasting alteration in intracellular signaling pathways, enabling normally innocuous levels of immune mediators to produce chronic hyperalgesia. PMID:18509033

  11. Structural rearrangement of the intracellular domains during AMPA receptor activation

    PubMed Central

    Zachariassen, Linda G.; Katchan, Ljudmila; Jensen, Anna G.; Pickering, Darryl S.; Plested, Andrew J. R.


    α-Amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors (AMPARs) are ligand-gated ion channels that mediate the majority of fast excitatory neurotransmission in the central nervous system. Despite recent advances in structural studies of AMPARs, information about the specific conformational changes that underlie receptor function is lacking. Here, we used single and dual insertion of GFP variants at various positions in AMPAR subunits to enable measurements of conformational changes using fluorescence resonance energy transfer (FRET) in live cells. We produced dual CFP/YFP-tagged GluA2 subunit constructs that had normal activity and displayed intrareceptor FRET. We used fluorescence lifetime imaging microscopy (FLIM) in live HEK293 cells to determine distinct steady-state FRET efficiencies in the presence of different ligands, suggesting a dynamic picture of the resting state. Patch-clamp fluorometry of the double- and single-insert constructs showed that both the intracellular C-terminal domain (CTD) and the loop region between the M1 and M2 helices move during activation and the CTD is detached from the membrane. Our time-resolved measurements revealed unexpectedly complex fluorescence changes within these intracellular domains, providing clues as to how posttranslational modifications and receptor function interact. PMID:27313205

  12. ZIP7-mediated intracellular zinc transport contributes to aberrant growth factor signaling in antihormone-resistant breast cancer Cells.


    Taylor, Kathryn M; Vichova, Petra; Jordan, Nicola; Hiscox, Stephen; Hendley, Rhiannon; Nicholson, Robert I


    Antiestrogens such as tamoxifen are the mainstay of treatment for estrogen receptor-positive breast cancer. However, their effectiveness is limited by the development of endocrine resistance, allowing tumor regrowth and progression. Importantly, in vitro MCF7 cell models of acquired tamoxifen resistance (TamR cells) display an aggressive, invasive phenotype in which activation of epithelial growth factor receptor/IGF-I receptor/Src signaling plays a critical role. In this study, we report that TamR cells have increased levels of zinc and zinc transporter, ZIP7 [solute carrier family 39 (zinc transporter) member 7, also known as SLC39A7], resulting in an enhanced response to exogenous zinc, which is manifested as a greatly increased growth factor receptor activation, leading to increased growth and invasion. Removal of ZIP7, using small interfering RNA, destroys this activation of epithelial growth factor receptor/IGF-I receptor/Src signaling by reducing intracellular zinc levels. Similarly, it also blocks the activation of HER2, -3, and -4. These data suggest that intracellular zinc levels may be a critical factor in determining growth factor responses and that the targeting of zinc transporters may have novel therapeutic implications. We show that ZIP7 is a critical component in the redistribution of zinc from intracellular stores to the cytoplasm and, as such, is essential for the zinc-induced inhibition of phosphatases, which leads to activation of growth factor receptors. Removal of ZIP7 therefore offers a means through which zinc-induced activation of growth factor receptors may be effectively suppressed and provides a mechanism of targeting multiple growth factor pathways, increasing tumor kill, and preventing further development of resistance in breast cancer.

  13. An Intracellular Antioxidant Determines the Expression of a Melanin-Based Signal in a Bird

    PubMed Central

    Galván, Ismael; Alonso-Alvarez, Carlos


    To understand how traits used in animal communication evolved and are maintained as honest signals, we need to understand the mechanisms that prevent cheating. It has been proposed that honest signaling is guaranteed by the costs associated with the signal expression. However, the nature of these costs is still under debate. Melanin-based signals are intriguing because their expression seems to be tightly controlled by genes and the resource involved (i.e. melanin) seems to be not limited. However, in vertebrates, low levels of a key intracellular antioxidant (i.e. glutathione) are needed to promote melanogenesis. We propose that melanin-based ornaments can signal the ability to cope with oxidative stress because those individuals with low enough levels of glutathione, such as those required for melanin production, should manage well the whole of the antioxidant machinery in order to maintain a certain oxidative status. We analysed the expression of a melanin-based signal: the well-known black stripe of the great tit (Parus major). Great tit nestlings were injected with a specific inhibitor of glutathione production (DL-buthionine-S,R-sulfoximine; BSO) throughout their development. BSO effectively decreased intracellular glutathione levels without apparent side effects on growth or body condition. Instead, treated nestlings developed black breast stripes 70–100% larger than controls. Moreover, treated nestlings also compensated the decrease in glutathione levels by increasing the levels of circulating antioxidants. Results indicate that melanin-based signals can be at least partially permeable to environmental influences such as those associated to oxidative stress. They also reveal a potential handicap associated to the expression of this kind of signals. Finally, although other contributing factors could have been present, our findings emphasize the role of oxidative stress in shaping the evolution of animal signals in general and, in particular, those produced

  14. Model-based control of the temporal patterns of intracellular signaling in silico

    PubMed Central

    Murakami, Yohei; Koyama, Masanori; Oba, Shigeyuki; Kuroda, Shinya; Ishii, Shin


    The functions of intracellular signal transduction systems are determined by the temporal behavior of intracellular molecules and their interactions. Of the many dynamical properties of the system, the relationship between the dynamics of upstream molecules and downstream molecules is particularly important. A useful tool in understanding this relationship is a methodology to control the dynamics of intracellular molecules with an extracellular stimulus. However, this is a difficult task because the relationship between the levels of upstream molecules and those of downstream molecules is often not only stochastic, but also time-inhomogeneous, nonlinear, and not one-to-one. In this paper, we present an easy-to-implement model-based control method that makes the target downstream molecule to trace a desired time course by changing the concentration of a controllable upstream molecule. Our method uses predictions from Monte Carlo simulations of the model to decide the strength of the stimulus, while using a particle-based approach to make inferences regarding unobservable states. We applied our method to in silico control problems of insulin-dependent AKT pathway model and EGF-dependent Akt pathway model with system noise. We show that our method can robustly control the dynamics of the intracellular molecules against unknown system noise of various strengths, even in the absence of complete knowledge of the true model of the target system. PMID:28275530

  15. Altered intracellular signaling cascades in peripheral blood mononuclear cells from BD patients.


    Barbosa, Izabela Guimarães; Nogueira, Camila R C; Rocha, Natália Pessoa; Queiroz, Ana Luiza Lemos; Vago, Juliana Priscila; Tavares, Luciana Pádua; Assis, Frankcinéia; Fagundes, Caio Tavares; Huguet, Rodrigo Barreto; Bauer, Moisés Evandro; Teixeira, Antônio Lúcio; de Sousa, Lirlândia Pires


    Bipolar disorder (BD) is a severe psychiatric disorder of complex physiopathology that has been associated with a pro-inflammatory state. The aim of the present study was to investigate intracellular pathways associated with inflammatory signaling, assessing the phosphorylation levels of transcription factor nuclear factor kappa B (NF-κB) and mitogen-activated protein kinase (MAPKs) in peripheral blood mononuclear cells of euthymic BD patients and healthy controls. Fifteen BD euthymic type I patients, and 12 healthy controls matched by age and gender were enrolled in this study. All subjects were assessed by the Mini-International Neuropsychiatry Interview and the patients also by the Young Mania Rating Scale and the Hamilton Depression Rating Scale. Phosphorylation levels of p65 NF-κB subunit, and MAPK ERK1/2, and p38 were assessed by Western blot and flow cytometry. Plasma cytokines (IL-2, IL-4, IL6, IL-10, IFN-γ, TNF-α, and IL-17A) were measured using cytometric bead arrays. Western blot and flow cytometry analyses showed increased phosphorylation levels of p65 NF-κB subunit, and MAPKs ERK1/2, and p38 in BD patients in euthymia in comparison with controls. BD patients presented increased pro-inflammatory cytokines levels in comparison with controls, and TNF-α correlated with the levels of phosphorylated p65 NF-κB. The present study found increased activation of MAPK and NF-κB pathways in BD patients, which is in line with a pro-inflammatory status.

  16. Diverse intracellular pathogens activate type III interferon expression from peroxisomes.


    Odendall, Charlotte; Dixit, Evelyn; Stavru, Fabrizia; Bierne, Helene; Franz, Kate M; Durbin, Ann Fiegen; Boulant, Steeve; Gehrke, Lee; Cossart, Pascale; Kagan, Jonathan C


    Type I interferon responses are considered the primary means by which viral infections are controlled in mammals. Despite this view, several pathogens activate antiviral responses in the absence of type I interferons. The mechanisms controlling type I interferon-independent responses are undefined. We found that RIG-I like receptors (RLRs) induce type III interferon expression in a variety of human cell types, and identified factors that differentially regulate expression of type I and type III interferons. We identified peroxisomes as a primary site of initiation of type III interferon expression, and revealed that the process of intestinal epithelial cell differentiation upregulates peroxisome biogenesis and promotes robust type III interferon responses in human cells. These findings highlight the importance of different intracellular organelles in specific innate immune responses.

  17. Enzyme-activated intracellular drug delivery with tubule clay nanoformulation

    NASA Astrophysics Data System (ADS)

    Dzamukova, Maria R.; Naumenko, Ekaterina A.; Lvov, Yuri M.; Fakhrullin, Rawil F.


    Fabrication of stimuli-triggered drug delivery vehicle s is an important milestone in treating cancer. Here we demonstrate the selective anticancer drug delivery into human cells with biocompatible 50-nm diameter halloysite nanotube carriers. Physically-adsorbed dextrin end stoppers secure the intercellular release of brilliant green. Drug-loaded nanotubes penetrate through the cellular membranes and their uptake efficiency depends on the cells growth rate. Intercellular glycosyl hydrolases-mediated decomposition of the dextrin tube-end stoppers triggers the release of the lumen-loaded brilliant green, which allowed for preferable elimination of human lung carcinoma cells (A549) as compared with hepatoma cells (Hep3b). The enzyme-activated intracellular delivery of brilliant green using dextrin-coated halloysite nanotubes is a promising platform for anticancer treatment.

  18. Identification of intracellular receptor proteins for activated protein kinase C.

    PubMed Central

    Mochly-Rosen, D; Khaner, H; Lopez, J


    Protein kinase C (PKC) translocates from the cytosol to the particulate fraction on activation. This activation-induced translocation of PKC is thought to reflect PKC binding to the membrane lipids. However, immunological and biochemical data suggest that PKC may bind to proteins in the cytoskeletal elements in the particulate fraction and in the nuclei. Here we describe evidence for the presence of intracellular receptor proteins that bind activated PKC. Several proteins from the detergent-insoluble material of the particulate fraction bound PKC in the presence of phosphatidylserine and calcium; binding was further increased with the addition of diacylglycerol. Binding of PKC to two of these proteins was concentration-dependent, saturable, and specific, suggesting that these binding proteins are receptors for activated C-kinase, termed here "RACKs." PKC binds to RACKs via a site on PKC distinct from the substrate binding site. We suggest that binding to RACKs may play a role in activation-induced translocation of PKC. Images PMID:1850844

  19. The effect of feeding during recovery from aerobic exercise on skeletal muscle intracellular signaling.


    Reidy, Paul T; Konopka, Adam R; Hinkley, J Matthew; Undem, Miranda K; Harber, Matthew P


    We previously reported an increase in skeletal muscle protein synthesis during fasted and fed recovery from nonexhaustive aerobic exercise (Harber et al., 2010). The current study examined skeletal muscle intracellular signaling in the same subjects to further investigate mechanisms of skeletal muscle protein metabolism with and without feeding following aerobic exercise. Eight males (VO₂peak: 52 ± 2 ml⁻¹·kg⁻¹·min⁻¹) performed 60-min of cycle ergometry at 72 ± 1% VO₂peak on two occasions in a counter-balanced design. Exercise trials differed only in the postexercise nutritional intervention: EX-FED (5 kcal, 0.83 g carbohydrate, 0.37 g protein, 0.03 g fat per kg body weight) and EX-FAST (noncaloric, isovolumic placebo) ingested immediately and one hour after exercise. Muscle biopsies were obtained from the vastus lateralis at rest (on a separate day) and two hours postexercise to assess intracellular signaling via western blotting of p70S6K1, eEF2, 4EBP1, AMPKα and p38 MAPK. p70S6K1 phosphorylation was elevated (p < .05) in EX-FED relative to REST and EX-FAST. eEF2, 4EBP1, AMPKα and p38 MAPK signaling were unaltered at 2 h after exercise independent of feeding status when expressed as the ratio of phosphorylated to total protein normalized to actin. These data demonstrate that feeding after a nonexhaustive bout of aerobic exercise stimulates skeletal muscle p70S6K1 intracellular signaling favorable for promoting protein synthesis which may, as recent literature has suggested, better prepare the muscle for subsequent exercise bouts. These data provide further support into the role of feeding on mechanisms regulating muscle protein metabolism during recovery from aerobic exercise.

  20. Dynamics of signaling between Ca(2+) sparks and Ca(2+)- activated K(+) channels studied with a novel image-based method for direct intracellular measurement of ryanodine receptor Ca(2+) current.


    ZhuGe, R; Fogarty, K E; Tuft, R A; Lifshitz, L M; Sayar, K; Walsh, J V


    Ca(2+) sparks are highly localized cytosolic Ca(2+) transients caused by a release of Ca(2+) from the sarcoplasmic reticulum via ryanodine receptors (RyRs); they are the elementary events underlying global changes in Ca(2+) in skeletal and cardiac muscle. In smooth muscle and some neurons, Ca(2+) sparks activate large conductance Ca(2+)-activated K(+) channels (BK channels) in the spark microdomain, causing spontaneous transient outward currents (STOCs) that regulate membrane potential and, hence, voltage-gated channels. Using the fluorescent Ca(2+) indicator fluo-3 and a high speed widefield digital imaging system, it was possible to capture the total increase in fluorescence (i.e., the signal mass) during a spark in smooth muscle cells, which is the first time such a direct approach has been used in any system. The signal mass is proportional to the total quantity of Ca(2+) released into the cytosol, and its rate of rise is proportional to the Ca(2+) current flowing through the RyRs during a spark (I(Ca(spark))). Thus, Ca(2+) currents through RyRs can be monitored inside the cell under physiological conditions. Since the magnitude of I(Ca(spark)) in different sparks varies more than fivefold, Ca(2+) sparks appear to be caused by the concerted opening of a number of RyRs. Sparks with the same underlying Ca(2+) current cause STOCs, whose amplitudes vary more than threefold, a finding that is best explained by variability in coupling ratio (i.e., the ratio of RyRs to BK channels in the spark microdomain). The time course of STOC decay is approximated by a single exponential that is independent of the magnitude of signal mass and has a time constant close to the value of the mean open time of the BK channels, suggesting that STOC decay reflects BK channel kinetics, rather than the time course of [Ca(2+)] decline at the membrane. Computer simulations were carried out to determine the spatiotemporal distribution of the Ca(2+) concentration resulting from the measured

  1. Oxidized ATM promotes abnormal proliferation of breast CAFs through maintaining intracellular redox homeostasis and activating the PI3K-AKT, MEK-ERK, and Wnt-β-catenin signaling pathways.


    Tang, Shifu; Hou, Yixuan; Zhang, Hailong; Tu, Gang; Yang, Li; Sun, Yifan; Lang, Lei; Tang, Xi; Du, Yan-E; Zhou, Mingli; Yu, Tenghua; Xu, Liyun; Wen, Siyang; Liu, Chunming; Liu, Manran


    Abnormal proliferation is one characteristic of cancer-associated fibroblasts (CAFs), which play a key role in tumorigenesis and tumor progression. Oxidative stress (OS) is the root cause of CAFs abnormal proliferation. ATM (ataxia-telangiectasia mutated protein kinase), an important redox sensor, is involved in DNA damage response and cellular homeostasis. Whether and how oxidized ATM regulating CAFs proliferation remains unclear. In this study, we show that there is a high level of oxidized ATM in breast CAFs in the absence of double-strand breaks (DSBs) and that oxidized ATM plays a critical role in CAFs proliferation. The effect of oxidized ATM on CAFs proliferation is mediated by its regulation of cellular redox balance and the activity of the ERK, PI3K-AKT, and Wnt signaling pathways. Treating cells with antioxidant N-acetyl-cysteine (NAC) partially rescues the proliferation defect of the breast CAFs caused by ATM deficiency. Administrating cells with individual or a combination of specific inhibitors of the ERK, PI3K-AKT, and Wnt signaling pathways mimics the effect of ATM deficiency on breast CAF proliferation. This is mainly ascribed to the β-catenin suppression and down-regulation of c-Myc, thus further leading to the decreased cyclinD1, cyclinE, and E2F1 expression and the enhanced p21(Cip1) level. Our results reveal an important role of oxidized ATM in the regulation of the abnormal proliferation of breast CAFs. Oxidized ATM could serve as a potential target for treating breast cancer.

  2. Activation of Oral Trigeminal Neurons by Fatty Acids is Dependent upon Intracellular Calcium

    PubMed Central

    Yu, Tian; Shah, Bhavik P.; Hansen, Dane R.; Park-York, MieJung; Gilbertson, Timothy A.


    The chemoreception of dietary fat in the oral cavity has largely been attributed to activation of the somatosensory system that conveys the textural properties of fat. However, the ability of fatty acids, which are believed to represent the proximate stimulus for fat taste, to stimulate rat trigeminal neurons has remained unexplored. Here, we found that several free fatty acids are capable of activating trigeminal neurons with different kinetics. Further, a polyunsaturated fatty acid, linoleic acid (LA), activates trigeminal neurons by increasing intracellular calcium concentration and generating depolarizing receptor potentials. Ion substitution and pharmacological approaches reveal that intracellular calcium store depletion is crucial for LA-induced signaling in a subset of trigeminal neurons. Using pseudorabies virus (PrV) as a live cell tracer, we identified a subset of lingual nerve-innervated trigeminal neurons that respond to different subsets of fatty acids. Quantitative real-time PCR of several transient receptor potential (TRP) channel markers in individual neurons validated that PrV labeled a subset but not the entire population of lingual-innervated trigeminal neurons. We further confirmed that the LA-induced intracellular calcium rise is exclusively coming from the release of calcium stores from the endoplasmic reticulum in this subset of lingual nerve-innervated trigeminal neurons. PMID:22644615

  3. Tuning cell migration: contractility as an integrator of intracellular signals from multiple cues.


    Bordeleau, Francois; Reinhart-King, Cynthia A


    There has been immense progress in our understanding of the factors driving cell migration in both two-dimensional and three-dimensional microenvironments over the years. However, it is becoming increasingly evident that even though most cells share many of the same signaling molecules, they rarely respond in the same way to migration cues. To add to the complexity, cells are generally exposed to multiple cues simultaneously, in the form of growth factors and/or physical cues from the matrix. Understanding the mechanisms that modulate the intracellular signals triggered by multiple cues remains a challenge. Here, we will focus on the molecular mechanism involved in modulating cell migration, with a specific focus on how cell contractility can mediate the crosstalk between signaling initiated at cell-matrix adhesions and growth factor receptors.

  4. Tuning cell migration: contractility as an integrator of intracellular signals from multiple cues

    PubMed Central

    Bordeleau, Francois; Reinhart-King, Cynthia A.


    There has been immense progress in our understanding of the factors driving cell migration in both two-dimensional and three-dimensional microenvironments over the years. However, it is becoming increasingly evident that even though most cells share many of the same signaling molecules, they rarely respond in the same way to migration cues. To add to the complexity, cells are generally exposed to multiple cues simultaneously, in the form of growth factors and/or physical cues from the matrix. Understanding the mechanisms that modulate the intracellular signals triggered by multiple cues remains a challenge. Here, we will focus on the molecular mechanism involved in modulating cell migration, with a specific focus on how cell contractility can mediate the crosstalk between signaling initiated at cell-matrix adhesions and growth factor receptors. PMID:27508074

  5. Curcumin improves intestinal barrier function: modulation of intracellular signaling, and organization of tight junctions.


    Wang, Jing; Ghosh, Siddhartha S; Ghosh, Shobha


    Association between circulating lipopolysaccharide (LPS) and metabolic diseases (such as type 2 diabetes and atherosclerosis) has shifted the focus from high-fat high-cholesterol containing Western-type diet (WD)-induced changes in gut microbiota per se to release of gut bacteria-derived products (e.g., LPS) into circulation due to intestinal barrier dysfunction as the possible mechanism for the chronic inflammatory state underlying the development of these diseases. We demonstrated earlier that oral supplementation with curcumin attenuates WD-induced development of type 2 diabetes and atherosclerosis. Poor bioavailability of curcumin has precluded the establishment of a causal relationship between oral supplementation and it is in vivo effects. We hypothesized that curcumin attenuates WD-induced chronic inflammation and associated metabolic diseases by modulating the function of intestinal epithelial cells (IECs) and the intestinal barrier function. The objective of the present study was to delineate the underlying mechanisms. The human IEC lines Caco-2 and HT-29 were used for these studies and modulation of direct as well as indirect effects of LPS on intracellular signaling as well as tight junctions were examined. Pretreatment with curcumin significantly attenuated LPS-induced secretion of master cytokine IL-1β from IECs and macrophages. Furthermore, curcumin also reduced IL-1β-induced activation of p38 MAPK in IECs and subsequent increase in expression of myosin light chain kinase involved in the phosphorylation of tight junction proteins and ensuing disruption of their normal arrangement. The major site of action of curcumin is, therefore, likely the IECs and the intestinal barrier, and by reducing intestinal barrier dysfunction, curcumin modulates chronic inflammatory diseases despite poor bioavailability.

  6. The γ-secretase-generated intracellular domain of β-amyloid precursor protein binds Numb and inhibits Notch signaling

    PubMed Central

    Roncarati, Roberta; Šestan, Nenad; Scheinfeld, Meir H.; Berechid, Bridget E.; Lopez, Peter A.; Meucci, Olimpia; McGlade, Jane C.; Rakic, Pasko; D'Adamio, Luciano


    The β-amyloid precursor protein (APP) and the Notch receptor undergo intramembranous proteolysis by the Presenilin-dependent γ-secretase. The cleavage of APP by γ-secretase releases amyloid-β peptides, which have been implicated in the pathogenesis of Alzheimer's disease, and the APP intracellular domain (AID), for which the function is not yet well understood. A similar γ-secretase-mediated cleavage of the Notch receptor liberates the Notch intracellular domain (NICD). NICD translocates to the nucleus and activates the transcription of genes that regulate the generation, differentiation, and survival of neuronal cells. Hence, some of the effects of APP signaling and Alzheimer's disease pathology may be mediated by the interaction of APP and Notch. Here, we show that membrane-tethered APP binds to the cytosolic Notch inhibitors Numb and Numb-like in mouse brain lysates. AID also binds Numb and Numb-like, and represses Notch activity when released by APP. Thus, γ-secretase may have opposing effects on Notch signaling; positive by cleaving Notch and generating NICD, and negative by processing APP and generating AID, which inhibits the function of NICD. PMID:12011466

  7. Acidic calcium stores open for business: expanding the potential for intracellular Ca2+ signaling

    PubMed Central

    Patel, Sandip; Docampo, Roberto


    Changes in cytosolic calcium concentration are crucial for a variety of cellular processes in all cells. It has long been appreciated that calcium is stored and released from intracellular calcium stores such as the endoplasmic reticulum. However, emerging evidence indicates that calcium is also dynamically regulated by a seemingly disparate collection of acidic organelles. Here, we review the defining features of these acidic calcium stores and highlight recent progress in understanding the mechanisms of uptake and release of calcium from these stores. We also examine the nature of calcium buffering within the stores and summarize the physiological and patho-physiological significance of these ubiquitous organelles in calcium signaling. PMID:20303271

  8. Metabotropic glutamate receptor 5 couples cellular prion protein to intracellular signalling in Alzheimer’s disease

    PubMed Central

    Haas, Laura T.; Salazar, Santiago V.; Kostylev, Mikhail A.; Um, Ji Won; Kaufman, Adam C.


    Alzheimer’s disease-related phenotypes in mice can be rescued by blockade of either cellular prion protein or metabotropic glutamate receptor 5. We sought genetic and biochemical evidence that these proteins function cooperatively as an obligate complex in the brain. We show that cellular prion protein associates via transmembrane metabotropic glutamate receptor 5 with the intracellular protein mediators Homer1b/c, calcium/calmodulin-dependent protein kinase II, and the Alzheimer’s disease risk gene product protein tyrosine kinase 2 beta. Coupling of cellular prion protein to these intracellular proteins is modified by soluble amyloid-β oligomers, by mouse brain Alzheimer’s disease transgenes or by human Alzheimer’s disease pathology. Amyloid-β oligomer-triggered phosphorylation of intracellular protein mediators and impairment of synaptic plasticity in vitro requires Prnp–Grm5 genetic interaction, being absent in transheterozygous loss-of-function, but present in either single heterozygote. Importantly, genetic coupling between Prnp and Grm5 is also responsible for signalling, for survival and for synapse loss in Alzheimer’s disease transgenic model mice. Thus, the interaction between metabotropic glutamate receptor 5 and cellular prion protein has a central role in Alzheimer’s disease pathogenesis, and the complex is a potential target for disease-modifying intervention. PMID:26667279

  9. Metabotropic glutamate receptor 5 couples cellular prion protein to intracellular signalling in Alzheimer's disease.


    Haas, Laura T; Salazar, Santiago V; Kostylev, Mikhail A; Um, Ji Won; Kaufman, Adam C; Strittmatter, Stephen M


    Alzheimer's disease-related phenotypes in mice can be rescued by blockade of either cellular prion protein or metabotropic glutamate receptor 5. We sought genetic and biochemical evidence that these proteins function cooperatively as an obligate complex in the brain. We show that cellular prion protein associates via transmembrane metabotropic glutamate receptor 5 with the intracellular protein mediators Homer1b/c, calcium/calmodulin-dependent protein kinase II, and the Alzheimer's disease risk gene product protein tyrosine kinase 2 beta. Coupling of cellular prion protein to these intracellular proteins is modified by soluble amyloid-β oligomers, by mouse brain Alzheimer's disease transgenes or by human Alzheimer's disease pathology. Amyloid-β oligomer-triggered phosphorylation of intracellular protein mediators and impairment of synaptic plasticity in vitro requires Prnp-Grm5 genetic interaction, being absent in transheterozygous loss-of-function, but present in either single heterozygote. Importantly, genetic coupling between Prnp and Grm5 is also responsible for signalling, for survival and for synapse loss in Alzheimer's disease transgenic model mice. Thus, the interaction between metabotropic glutamate receptor 5 and cellular prion protein has a central role in Alzheimer's disease pathogenesis, and the complex is a potential target for disease-modifying intervention.

  10. The Mechanical Environment Modulates Intracellular Calcium Oscillation Activities of Myofibroblasts

    PubMed Central

    Godbout, Charles; Follonier Castella, Lysianne; Smith, Eric A.; Talele, Nilesh; Chow, Melissa L.; Garonna, Adriano; Hinz, Boris


    Myofibroblast contraction is fundamental in the excessive tissue remodeling that is characteristic of fibrotic tissue contractures. Tissue remodeling during development of fibrosis leads to gradually increasing stiffness of the extracellular matrix. We propose that this increased stiffness positively feeds back on the contractile activities of myofibroblasts. We have previously shown that cycles of contraction directly correlate with periodic intracellular calcium oscillations in cultured myofibroblasts. We analyze cytosolic calcium dynamics using fluorescent calcium indicators to evaluate the possible impact of mechanical stress on myofibroblast contractile activity. To modulate extracellular mechanics, we seeded primary rat subcutaneous myofibroblasts on silicone substrates and into collagen gels of different elastic modulus. We modulated cell stress by cell growth on differently adhesive culture substrates, by restricting cell spreading area on micro-printed adhesive islands, and depolymerizing actin with Cytochalasin D. In general, calcium oscillation frequencies in myofibroblasts increased with increasing mechanical challenge. These results provide new insight on how changing mechanical conditions for myofibroblasts are encoded in calcium oscillations and possibly explain how reparative cells adapt their contractile behavior to the stresses occurring in normal and pathological tissue repair. PMID:23691248

  11. Platelet activating factor raises intracellular calcium ion concentration in macrophages

    PubMed Central


    Peritoneal cells from thioglycollate-stimulated mice were allowed to adhere to coverglasses for 2 h to give a dense monolayer of adherent cells greater than 95% of which were macrophages. After incubation with the tetra-acetoxymethyl ester of quin2, coverglasses were rinsed with Ca2+-free saline, oriented at a 45 degree angle in square cuvettes containing a magnetically driven stir bar, and analyzed for changes in quin2 fluorescence in a spectrofluorimeter. Such fluorescence, taken as an indication of intracellular calcium ion concentration ([Ca2+]i), increased as exogenous calcium ion concentration ([Ca2+]o) was raised to 1 mM. At [Ca2+]o approximately equal to 10 microM, [Ca2+]i = 72 +/- 14 nM (n = 26); at [Ca2+]o = 1 mM, [Ca2+]i = 140-220 nM, levels not increased by N, N, N', N'-tetrakis (2-pyridylmethyl) ethylenediamine, a membrane-permeant chelator of heavy metals than can quench quin2. Addition of mouse alpha + beta fibroblast interferon, lipopolysaccharide, thrombin, collagen, vasopressin, ADP, compound 48/80, or U46619 did not change [Ca2+]i. However, addition of platelet activating factor (PAF) (2-20 ng/ml) raised [Ca2+]i by 480 nM within 1 min if [Ca2+]o = 1 mM. In the presence of 5 mM EGTA, PAF raised [Ca2+]i by 25 nM. This suggests that PAF causes influx of exogenous Ca2+, as well as releasing some Ca2+ from intracellular stores. Consistent with these results, when PAF was added to 1 mM Ca2+ in the presence of 100 microM Cd2+ or Mn2+ to block Ca2+ influx, [Ca2+]i increased by only intermediate amounts; at the times of such dampened peak response, [Ca2+]i could be raised within 1 min to normal PAF-stimulated levels by chelation of the exogenous heavy metals with diethylenetriaminepentaacetic acid. Normal PAF responses were observed in the presence of indomethacin. The lowest dose of PAF observed to raise [Ca2+]i was 0.1 ng/ml. Response of [Ca2+]i to 2-20 ng/ml PAF was transient, and second applications had no effect. The PAF response also was seen in

  12. Spatio-temporal PLC activation in parallel with intracellular Ca2+ wave propagation in mechanically stimulated single MDCK cells.


    Tsukamoto, Akira; Hayashida, Yasunori; Furukawa, Katsuko S; Ushida, Takashi


    Intracellular Ca2+ transients are evoked either by the opening of Ca2+ channels on the plasma membrane or by phospholipase C (PLC) activation resulting in IP3 production. Ca2+ wave propagation is known to occur in mechanically stimulated cells; however, it remains uncertain whether and how PLC activation is involved in intracellular Ca2+ wave propagation in mechanically stimulated cells. To answer these questions, it is indispensable to clarify the spatio-temporal relations between intracellular Ca2+ wave propagation and PLC activation. Thus, we visualized both cytosolic Ca2+ and PLC activation using a real-time dual-imaging system in individual Mardin-Darby Canine Kidney (MDCK) cells. This system allowed us to simultaneously observe intracellular Ca2+ wave propagation and PLC activation in a spatio-temporal manner in a single mechanically stimulated MDCK cell. The results showed that PLC was activated not only in the mechanically stimulated region but also in other subcellular regions in parallel with intracellular Ca2+ wave propagation. These results support a model in which PLC is involved in Ca2+ signaling amplification in mechanically stimulated cells.

  13. Glucose regulates diacylglycerol intracellular levels and protein kinase C activity by modulating diacylglycerol kinase subcellular localization.


    Miele, Claudia; Paturzo, Flora; Teperino, Raffaele; Sakane, Fumio; Fiory, Francesca; Oriente, Francesco; Ungaro, Paola; Valentino, Rossella; Beguinot, Francesco; Formisano, Pietro


    Although chronic hyperglycemia reduces insulin sensitivity and leads to impaired glucose utilization, short term exposure to high glucose causes cellular responses positively regulating its own metabolism. We show that exposure of L6 myotubes overexpressing human insulin receptors to 25 mm glucose for 5 min decreased the intracellular levels of diacylglycerol (DAG). This was paralleled by transient activation of diacylglycerol kinase (DGK) and of insulin receptor signaling. Following 30-min exposure, however, both DAG levels and DGK activity returned close to basal levels. Moreover, the acute effect of glucose on DAG removal was inhibited by >85% by the DGK inhibitor R59949. DGK inhibition was also accompanied by increased protein kinase C-alpha (PKCalpha) activity, reduced glucose-induced insulin receptor activation, and GLUT4 translocation. Glucose exposure transiently redistributed DGK isoforms alpha and delta, from the prevalent cytosolic localization to the plasma membrane fraction. However, antisense silencing of DGKdelta, but not of DGKalpha expression, was sufficient to prevent the effect of high glucose on PKCalpha activity, insulin receptor signaling, and glucose uptake. Thus, the short term exposure of skeletal muscle cells to glucose causes a rapid induction of DGK, followed by a reduction of PKCalpha activity and transactivation of the insulin receptor signaling. The latter may mediate, at least in part, glucose induction of its own metabolism.

  14. Are Molecular Vibration Patterns of Cell Structural Elements Used for Intracellular Signalling?

    PubMed Central

    Jaross, Werner


    Background: To date the manner in which information reaches the nucleus on that part within the three-dimensional structure where specific restorative processes of structural components of the cell are required is unknown. The soluble signalling molecules generated in the course of destructive and restorative processes communicate only as needed. Hypothesis: All molecules show temperature-dependent molecular vibration creating a radiation in the infrared region. Each molecule species has in its turn a specific frequency pattern under given specific conditions. Changes in their structural composition result in modified frequency patterns of the molecules in question. The main structural elements of the cell membrane, of the endoplasmic reticulum, of the Golgi apparatus, and of the different microsomes representing the great variety of polar lipids show characteristic frequency patterns with peaks in the region characterised by low water absorption. These structural elements are very dynamic, mainly caused by the creation of signal molecules and transport containers. By means of the characteristic radiation, the area where repair or substitution services are needed could be identified; this spatial information complements the signalling of the soluble signal molecules. Based on their resonance properties receptors located on the outer leaflet of the nuclear envelope should be able to read typical frequencies and pass them into the nucleus. Clearly this physical signalling must be blocked by the cell membrane to obviate the flow of information into adjacent cells. Conclusion: If the hypothesis can be proved experimentally, it should be possible to identify and verify characteristic infrared frequency patterns. The application of these signal frequencies onto cells would open entirely new possibilities in medicine and all biological disciplines specifically to influence cell growth and metabolism. Similar to this intracellular system, an extracellular signalling system

  15. [Intracellular signal systems in the epithelium- and endothelium-dependent relaxation of smooth muscles].


    Kapilevich, L V; Kovalev, I V; Baskakov, M B; Medvedev, M A


    The research of mechanisms of a regulation electrical and contractile of properties of unstriated muscles of an internals remains by an actual problem of modern physiology and medicine. Already now it is possible to state that the efficacy of means of correction of distresses of an internals depends on a degree of a level of scrutiny of these mechanisms. Among physiologically active substances effecting on smooth muscle cells (SM), the special relaxing factor synthesized by endotheliocytes, epithelial cells and SM. Identified by the majority of the explorers as oxide of nitrogen (NO), relaxing factor responds for exhibiting of many myogenic responses of pots and pneumatic routes. The mechanisms of synthesis and implementation of effects of this factor in SM cells up to the extremity are not clarified. The considerable advance in learning mechanisms of operation relaxing factor on SM is connected to discovering of ability of some nitro compounds to replicate NO-dependent relaxing effects in these cells. The main systems of intracellular regulation are involved in mechanisms of implementation endothelial and epithelial local regulatory effects on SM. The majority of the explorers bind an epithelium-dependent release phenomenon SM to an activation of a solvable fraction guanilatcyclase, found in the majority of cells, and effects of cGMP-dependent protein kinases. There are reports on ability of inhibitors NO-sintase to depress a release phenomenon SM of pots and bronchuses, about dependence of a mechanical strain SM of pots and respiratory tract from a contents cGMP in cells. However there are datas giving establishments to guess, that alongside with guanilatciclase in a release phenomenon SM, induced relaxing factors or nitro compounds, the immediate involvement is accepted by cAMP-dependent protein kinases. The most probable point of interaction cAMP and cGMP-dependent processes is phospodiesterase of cyclic nucleotides. It citosolium the enzyme labilized by

  16. From intracellular signaling to population oscillations: bridging size- and time-scales in collective behavior

    PubMed Central

    Sgro, Allyson E; Schwab, David J; Noorbakhsh, Javad; Mestler, Troy; Mehta, Pankaj; Gregor, Thomas


    Collective behavior in cellular populations is coordinated by biochemical signaling networks within individual cells. Connecting the dynamics of these intracellular networks to the population phenomena they control poses a considerable challenge because of network complexity and our limited knowledge of kinetic parameters. However, from physical systems, we know that behavioral changes in the individual constituents of a collectively behaving system occur in a limited number of well-defined classes, and these can be described using simple models. Here, we apply such an approach to the emergence of collective oscillations in cellular populations of the social amoeba Dictyostelium discoideum. Through direct tests of our model with quantitative in vivo measurements of single-cell and population signaling dynamics, we show how a simple model can effectively describe a complex molecular signaling network at multiple size and temporal scales. The model predicts novel noise-driven single-cell and population-level signaling phenomena that we then experimentally observe. Our results suggest that like physical systems, collective behavior in biology may be universal and described using simple mathematical models. PMID:25617347

  17. Cell type- and activity-dependent extracellular correlates of intracellular spiking

    PubMed Central

    Perin, Rodrigo; Buzsáki, György; Markram, Henry; Koch, Christof


    Despite decades of extracellular action potential (EAP) recordings monitoring brain activity, the biophysical origin and inherent variability of these signals remain enigmatic. We performed whole cell patch recordings of excitatory and inhibitory neurons in rat somatosensory cortex slice while positioning a silicon probe in their vicinity to concurrently record intra- and extracellular voltages for spike frequencies under 20 Hz. We characterize biophysical events and properties (intracellular spiking, extracellular resistivity, temporal jitter, etc.) related to EAP recordings at the single-neuron level in a layer-specific manner. Notably, EAP amplitude was found to decay as the inverse of distance between the soma and the recording electrode with similar (but not identical) resistivity across layers. Furthermore, we assessed a number of EAP features and their variability with spike activity: amplitude (but not temporal) features varied substantially (∼30–50% compared with mean) and nonmonotonically as a function of spike frequency and spike order. Such EAP variation only partly reflects intracellular somatic spike variability and points to the plethora of processes contributing to the EAP. Also, we show that the shape of the EAP waveform is qualitatively similar to the negative of the temporal derivative to the intracellular somatic voltage, as expected from theory. Finally, we tested to what extent EAPs can impact the lowpass-filtered part of extracellular recordings, the local field potential (LFP), typically associated with synaptic activity. We found that spiking of excitatory neurons can significantly impact the LFP at frequencies as low as 20 Hz. Our results question the common assertion that the LFP acts as proxy for synaptic activity. PMID:25995352

  18. Intracellular calcium signalling in magnocellular neurones of the rat supraoptic nucleus: understanding the autoregulatory mechanisms.


    Dayanithi, G; Sabatier, N; Widmer, H


    Oxytocin and vasopressin, released at the soma and dendrites of neurones, bind to specific autoreceptors and induce an increase in [Ca2+]i. In oxytocin cells, the increase results from a mobilisation of Ca2+ from intracellular stores, whereas in vasopressin cells, it results mainly from an influx of Ca2+ through voltage-dependent channels. The response to vasopressin is coupled to phospholipase C and adenylyl-cyclase pathways which are activated by V1 (V1a and V1b)- and V2-type receptors respectively. Measurements of [Ca2+]i in response to V1a and V2 agonists and antagonists suggest the functional expression of these two types of receptors in vasopressin neurones. The intracellular mechanisms involved are similar to those observed for the action of the pituitary adenylyl-cyclase-activating peptide (PACAP). Isolated vasopressin neurones exhibit spontaneous [Ca2+]i oscillations and these are synchronised with phasic bursts of electrical activity. Vasopressin modulates these spontaneous [Ca2+]i oscillations in a manner that depends on the initial state of the neurone, and such varied effects of vasopressin may be related to those observed on the electrical activity of vasopressin neurones in vivo.

  19. Engineering intracellular active transport systems as in vivo biomolecular tools.

    SciTech Connect

    Bachand, George David; Carroll-Portillo, Amanda


    Active transport systems provide essential functions in terms of cell physiology and metastasis. These systems, however, are also co-opted by invading viruses, enabling directed transport of the virus to and from the cell's nucleus (i.e., the site of virus replication). Based on this concept, fundamentally new approaches for interrogating and manipulating the inner workings of living cells may be achievable by co-opting Nature's active transport systems as an in vivo biomolecular tool. The overall goal of this project was to investigate the ability to engineer kinesin-based transport systems for in vivo applications, specifically the collection of effector proteins (e.g., transcriptional regulators) within single cells. In the first part of this project, a chimeric fusion protein consisting of kinesin and a single chain variable fragment (scFv) of an antibody was successfully produced through a recombinant expression system. The kinesin-scFv retained both catalytic and antigenic functionality, enabling selective capture and transport of target antigens. The incorporation of a rabbit IgG-specific scFv into the kinesin established a generalized system for functionalizing kinesin with a wide range of target-selective antibodies raised in rabbits. The second objective was to develop methods of isolating the intact microtubule network from live cells as a platform for evaluating kinesin-based transport within the cytoskeletal architecture of a cell. Successful isolation of intact microtubule networks from two distinct cell types was demonstrated using glutaraldehyde and methanol fixation methods. This work provides a platform for inferring the ability of kinesin-scFv to function in vivo, and may also serve as a three-dimensional scaffold for evaluating and exploiting kinesin-based transport for nanotechnological applications. Overall, the technology developed in this project represents a first-step in engineering active transport system for in vivo applications. Further

  20. Intracellular localization of human cytidine deaminase. Identification of a functional nuclear localization signal.


    Somasekaram, A; Jarmuz, A; How, A; Scott, J; Navaratnam, N


    The cytidine deaminases belong to the family of multisubunit enzymes that catalyze the hydrolytic deamination of their substrate to a corresponding uracil product. They play a major role in pyrimidine nucleoside and nucleotide salvage. The intracellular distribution of cytidine deaminase and related enzymes has previously been considered to be cytosolic. Here we show that human cytidine deaminase (HCDA) is present in the nucleus. A highly specific, affinity purified polyclonal antibody against HCDA was used to analyze the intracellular localization of native HCDA in a variety of mammalian cells by in situ immunochemistry. Native HCDA was found to be present in the nucleus as well as the cytoplasm in several cell types. Indirect immunofluorescence microscopy indicated a predominantly nuclear localization of FLAG-tagged HCDA overexpressed in these cells. We have identified an amino-terminal bipartite nuclear localization signal that is both necessary and sufficient to direct HCDA and a non-nuclear reporter protein to the nucleus. We also show HCDA binding to the nuclear import receptor, importin alpha. Similar putative bipartite nuclear localization sequences are found in other cytidine/deoxycytidylate deaminases. The results presented here suggest that the pyrimidine nucleotide salvage pathway may operate in the nucleus. This localization may have implications in the regulation of nucleoside and nucleotide metabolism and nucleic acid biosynthesis.

  1. Coupling mechanical forces to electrical signaling: molecular motors and the intracellular transport of ion channels.


    Barry, Joshua; Gu, Chen


    Proper localization of various ion channels is fundamental to neuronal functions, including postsynaptic potential plasticity, dendritic integration, action potential initiation and propagation, and neurotransmitter release. Microtubule-based forward transport mediated by kinesin motors plays a key role in placing ion channel proteins to correct subcellular compartments. PDZ- and coiled-coil-domain proteins function as adaptor proteins linking ionotropic glutamate and GABA receptors to various kinesin motors, respectively. Recent studies show that several voltage-gated ion channel/transporter proteins directly bind to kinesins during forward transport. Three major regulatory mechanisms underlying intracellular transport of ion channels are also revealed. These studies contribute to understanding how mechanical forces are coupled to electrical signaling and illuminating pathogenic mechanisms in neurodegenerative diseases.

  2. A Carboxyl Ester Lipase (CEL) Mutant Causes Chronic Pancreatitis by Forming Intracellular Aggregates That Activate Apoptosis.


    Xiao, Xunjun; Jones, Gabrielle; Sevilla, Wednesday A; Stolz, Donna B; Magee, Kelsey E; Haughney, Margaret; Mukherjee, Amitava; Wang, Yan; Lowe, Mark E


    Patients with chronic pancreatitis (CP) frequently have genetic risk factors for disease. Many of the identified genes have been connected to trypsinogen activation or trypsin inactivation. The description of CP in patients with mutations in the variable number of tandem repeat (VNTR) domain of carboxyl ester lipase (CEL) presents an opportunity to study the pathogenesis of CP independently of trypsin pathways. We tested the hypothesis that a deletion and frameshift mutation (C563fsX673) in the CEL VNTR causes CP through proteotoxic gain-of-function activation of maladaptive cell signaling pathways including cell death pathways. HEK293 or AR42J cells were transfected with constructs expressing CEL with 14 repeats in the VNTR (CEL14R) or C563fsX673 CEL (CEL maturity onset diabetes of youth with a deletion mutation in the VNTR (MODY)). In both cell types, CEL MODY formed intracellular aggregates. Secretion of CEL MODY was decreased compared with that of CEL14R. Expression of CEL MODY increased endoplasmic reticulum stress, activated the unfolded protein response, and caused cell death by apoptosis. Our results demonstrate that disorders of protein homeostasis can lead to CP and suggest that novel therapies to decrease the intracellular accumulation of misfolded protein may be successful in some patients with CP.

  3. Intracellular sodium ion activity and sodium transport in rabbit urinary bladder.

    PubMed Central

    Eaton, D C


    1. Intracellular potentials and the intracellular activities of Na+ and K+ were examined using conventional and ion-selective micro-electrodes. 2. In animals on a normal diet, the intracellular Na+ activity was 8.6 +/- 2.9 mM (mean +/- S.D.) with a mean short-circuit current of 2.8 +/- 0.9 microA/cm2. 3. In animals on a low-Na+ diet, the intracellular Na+ activity was 18.5 +/- 9.9 mM with a short-circuit current of 4.5 +/- 1.3 microA/cm2 (mean +/- S.D.). 4. There was a correlation between short-circuit current and intracellular Na+ activity which could be fitted by a saturating hyperbolic relationship. 5. Treatment of the issue with ouabain and amiloride produced an increase and a decrease, respectively, in the intracellular Na+ activity. 6. Treatment with aldosterone produced a large increase in short-circuit current with a substantial increase in intracellular Na+ activity. 7. Intracellular Na+ activity does not seem to affect apical membrane permeability directly. PMID:7320880

  4. Heteromerization of dopamine D2 receptors with dopamine D1 or D5 receptors generates intracellular calcium signaling by different mechanisms

    PubMed Central

    Hasbi, Ahmed; O’Dowd, Brian F.; George, Susan R.


    The repertoire of signal transduction pathways activated by dopamine in brain includes the increase of intracellular calcium. However the mechanism(s) by which dopamine activated this important second messenger system was unknown. Although we showed that activation of the D5 dopamine receptor increased calcium concentrations, the restricted anatomic distribution of this receptor made this unlikely to be the major mechanism in brain. We have identified novel heteromeric dopamine receptor complexes that are linked to calcium signaling. The calcium pathway activated through the D1–D2 receptor heteromer involved coupling to Gq, through phospholipase C and IP3 receptors to result in a rise in intracellular calcium. The calcium rise activated through the D2–D5 receptor heteromer involved a small rise in intracellular calcium through the Gq pathway that triggered a store operated channel mediated influx of extracellular calcium. These novel receptor heteromeric complexes, for the first time, establish the link between dopamine action and rapid calcium signaling. PMID:19897420

  5. Co-Encapsulating the Fusogenic Peptide INF7 and Molecular Imaging Probes in Liposomes Increases Intracellular Signal and Probe Retention

    PubMed Central

    Martin, Erik W.; Li, Changqing; Lu, Wuyuan; Kao, Joseph P. Y.


    Liposomes are promising vehicles to deliver diagnostic and therapeutic agents to cells in vivo. After uptake into cells by endocytosis, liposomes are degraded in the endolysosomal system. Consequently, the encapsulated cargo molecules frequently remain sequestered in endosomal compartments; this limits their usefulness in many applications (e.g. gene delivery). To overcome this, various fusogenic peptides have been developed to facilitate delivery of liposomally-encapsulated molecules into the cytosol. One such peptide is the pH-sensitive influenza-derived peptide INF7. Liposomal delivery of imaging agents is an attractive approach for enabling cell imaging and cell tracking in vivo, but can be hampered by inadequate intracellular accumulation and retention of probes caused by exocytosis (and possible degradation) of endosome-entrapped probes. Such signal loss could be minimized by facilitating escape of probe molecules from endolysosomal compartments into the cytosol. We investigated the ability of co-encapsulated INF7 to release liposomally-delivered rhodamine fluorophores into the cytosol after endosomal acidification/maturation. We co-encapsulated INF7 and fluorescent rhodamine derivatives having vastly different transport properties to show that after endocytosis by CV1 cells, the INF7 peptide is activated by acidic endosomal pH and facilitates efficient release of the fluorescent tracers into the cytosol. Furthermore, we show that INF7-facilitated escape from endosomes markedly enhanced retention of tracers that cannot be actively extruded from the cytosol. Minimizing loss of intracellular probes improves cellular imaging by increasing the signal-to-noise ratio of images and lengthening the time window that imaging can be performed. In particular, this will enhance in vivo electron paramagnetic resonance imaging, an emergent magnetic resonance imaging modality requires exogenous paramagnetic imaging agents and is highly promising for cellular and molecular

  6. CDPK Activation in PRR Signaling.


    Seybold, Heike; Boudsocq, Marie; Romeis, Tina


    Calcium-dependent protein kinases undergo a rapid biochemical activation in response to an intracellular Ca increase induced by the PRR-dependent perception of a pathogen-related stimulus. Based on SDS gel resolution, the in-gel kinase assay allows the analysis of multiple in vivo protein samples in parallel, combining the advantage of protein separation according to molecular mass with the activity read-out of a protein kinase assay. It thus enables to follow the transient CDPK activation and inactivation in response to in vivo elicitation with a time-wise resolution. In addition, changes of CDPK phosphorylation activity often correlate with slight shifts in the enzyme's apparent molecular mass, indicating posttranslational modifications and a conformational change of the active enzyme compared to its inactive resting form. These band shifts can be detected by a simple immunoblotting to monitor CDPK activation.

  7. Intracellular calcium signaling regulates autophagy via calcineurin-mediated TFEB dephosphorylation

    PubMed Central

    Tong, Yanju; Song, Fuyong


    The transcription-regulating activity of TFEB is dependent on its phosphorylation modification, but the phosphatase(s) involved in TFEB dephosphorylation have remained elusive. It has now become clear that lysosomal calcium signaling activates calcineurin, an endogenous serine/threonine phosphatase, which dephosphorylate TFEB leading to upregulation of autophagy. PMID:26043755

  8. Functional receptors and intracellular signal pathways of midkine (MK) and pleiotrophin (PTN).


    Xu, Chuanying; Zhu, Shunying; Wu, Mingyuan; Han, Wei; Yu, Yan


    Midkine (MK) and pleiotrophin (PTN) belong to the subfamily of heparin binding growth factors. They have ca. 50% structural homology, with similar C- and N-domains as well as comparable binding affinity to heparin, glycoproteins and proteoglycans. Both MK and PTN have diverse functions, such as mitogenicity, inflammation, angiogenesis, oncogenesis and stem cell self-renewal. The high expression of MK and PTN in many kinds of cancers makes them excellent as cancer biomarkers and targets for anticancer drug development. In addition, the important roles of MK and PTN in the regeneration of tissues, such as myocardium, cartilage, neuron, muscle, and bone, make them attractive candidates for the treatment of degenerative diseases such as myocardiac and cerebral infarction, Alzheimer's disease, Parkinson's disease and skeletal muscle injury. As a result, there has been a growing interest in the mechanisms of MK and PTN function, including the diverse receptors on the cell membrane and complex signal pathways in the cytoplasm. This work reviews the structures of MK and PTN, as well as the receptors and the intracellular signal pathways involving MK and PTN which will pave the way for future development of MK and PTN therapeutics.

  9. [Signal transduction and intracellular recruitment of gastric proton pump in the parietal cell].


    Urushidani, T; Nagao, T


    The parietal cell has three types of activating receptors for acid secretion on its basolateral membrane, i.e., histamine H2, acetylcholine M3, and gastrin CCKB. Activation of acid secretion is achieved by two concomitant functional changes namely: (i) tubulovesicles fuse with the apical secretory membrane, thus recruiting functional pumps to the expanded microvillar surface, and (ii) the apical membrane acquires a permeability to KCl. The major path for parietal cell stimulation is via H2-receptor-mediated adenylate cyclase and elevation of cAMP to activate protein kinase A (PKA), which phosphorylates key effector proteins, e.g., ezrin, a membrane-cytoskeletal linker, apical Cl- or K(+)-channels. Ca2+ is liberated from intracellular stores by IP3, which in turn is the result of M3-, CCKB-, or possibly H2-coupled activation of phospholipase C. The resulting protein kinase C activation may have both inhibitory and excitatory roles. Elevated Ca2+ activates calmodulin-dependent kinases, e.g., calmodulin kinase II and myosin light chain kinase, that could promote vesicular motor activity. Ezrin is considered to play a main role in the vesicular transport system of the parietal cell. The regulation might be conducted through the phosphorylation of the molecule to modify its property to interact with the cytoskeletal components, membranes or membrane proteins.

  10. The Keap1/Nrf2 Protein Axis Plays a Role in Osteoclast Differentiation by Regulating Intracellular Reactive Oxygen Species Signaling*

    PubMed Central

    Kanzaki, Hiroyuki; Shinohara, Fumiaki; Kajiya, Mikihito; Kodama, Tetsuya


    Reactive oxygen species (ROS) act as intracellular signaling molecules in the regulation of receptor activator of nuclear factor-κB ligand (RANKL)-dependent osteoclast differentiation, but they also have cytotoxic effects that include peroxidation of lipids and oxidative damage to proteins and DNA. Cellular protective mechanisms against oxidative stress include transcriptional control of cytoprotective enzymes by the transcription factor, nuclear factor E2-related factor 2 (Nrf2). This study investigated the relationship between Nrf2 and osteoclastogenesis. Stimulation of osteoclast precursors (mouse primary peritoneal macrophages and RAW 264.7 cells) with RANKL resulted in the up-regulation of kelch-like ECH-associated protein 1 (Keap1), a negative regulator of Nrf2. It also decreased the Nrf2/Keap1 ratio, and it down-regulated cytoprotective enzymes (heme oxygenase-1, γ-glutamylcysteine synthetase, and glucose-6-phosphate dehydrogenase). Nrf2 overexpression up-regulated the expression of cytoprotective enzymes, decreased ROS levels, decreased the number of tartrate-resistant acid phosphatase-positive multinucleated cells, reduced marker genes for osteoclast differentiation, and attenuated bone destruction in both in vitro and in vivo models. Overexpression of Keap1 or RNAi knockdown of Nrf2 exerted the opposite actions. In addition, in vivo local Nrf2 overexpression attenuated lipopolysaccharide-mediated RANKL-dependent cranial bone destruction in vivo. This is the first study to show that the Keap1/Nrf2 axis regulates RANKL-dependent osteoclastogenesis through modulation of intracellular ROS signaling via expression of cytoprotective enzymes. This raises the exciting possibility that the Keap1-Nrf2 axis may be a therapeutic target for the treatment of bone destructive disease. PMID:23801334

  11. Cyproheptadine enhances the I(K) of mouse cortical neurons through sigma-1 receptor-mediated intracellular signal pathway.


    He, Yan-Lin; Zhang, Chun-Lei; Gao, Xiao-Fei; Yao, Jin-Jing; Hu, Chang-Long; Mei, Yan-Ai


    Cyproheptadine (CPH) is a histamine- and serotonin-receptor antagonist, and its effects are observed recently in the modulation of multiple intracellular signals. In this study, we used cortical neurons and HEK-293 cells transfected with Kv2.1 α-subunit to address whether CPH modify neural voltage-gated K(+) channels by a mechanism independent of its serotonergic and histaminergic properties. Our results demonstrate that intracellularly delivered CPH increased the I(K) by reducing the activity of protein kinas A (PKA). Inhibition of G(i) eliminated the CPH-induced effect on both the I(K) and PKA. Blocking of 5-HT-, M-, D(2)-, H(1)- or H(2)-type GPCR receptors with relevant antagonists did not eliminate the CPH-induced effect on the I(K). Antagonists of the sigma-1 receptor, however, blocked the effect of CPH. Moreover, the inhibition of sigma-1 by siRNA knockdown significantly reduced the CPH-induced effect on the I(K). On the contrary, sigma-1 receptor agonist mimicked the effects of CPH on the induction of I(K). A ligand-receptor binding assay indicated that CPH bound to the sigma-1 receptor. Similar effect of CPH were obtained from HEK-293 cells transfected with the α-subunit of Kv2.1. In overall, we reveal for the first time that CPH enhances the I(K) by modulating activity of PKA, and that the associated activation of the sigma-1 receptor/G(i)-protein pathway might be involved. Our findings illustrate an uncharacterized effect of CPH on neuron excitability through the I(K), which is independent of histamine H(1) and serotonin receptors.

  12. Cyproheptadine Enhances the IK of Mouse Cortical Neurons through Sigma-1 Receptor-Mediated Intracellular Signal Pathway

    PubMed Central

    He, Yan-Lin; Zhang, Chun-Lei; Gao, Xiao-Fei; Yao, Jin-Jing; Hu, Chang-Long; Mei, Yan-Ai


    Cyproheptadine (CPH) is a histamine- and serotonin-receptor antagonist, and its effects are observed recently in the modulation of multiple intracellular signals. In this study, we used cortical neurons and HEK-293 cells transfected with Kv2.1 α-subunit to address whether CPH modify neural voltage-gated K+ channels by a mechanism independent of its serotonergic and histaminergic properties. Our results demonstrate that intracellularly delivered CPH increased the IK by reducing the activity of protein kinas A (PKA). Inhibition of Gi eliminated the CPH-induced effect on both the IK and PKA. Blocking of 5-HT-, M-, D2-, H1- or H2- type GPCR receptors with relevant antagonists did not eliminate the CPH-induced effect on the IK. Antagonists of the sigma-1 receptor, however, blocked the effect of CPH. Moreover, the inhibition of sigma-1 by siRNA knockdown significantly reduced the CPH-induced effect on the IK. On the contrary, sigma-1 receptor agonist mimicked the effects of CPH on the induction of IK. A ligand-receptor binding assay indicated that CPH bound to the sigma-1 receptor. Similar effect of CPH were obtained from HEK-293 cells transfected with the α-subunit of Kv2.1. In overall, we reveal for the first time that CPH enhances the IK by modulating activity of PKA, and that the associated activation of the sigma-1 receptor/Gi-protein pathway might be involved. Our findings illustrate an uncharacterized effect of CPH on neuron excitability through the IK, which is independent of histamine H1 and serotonin receptors. PMID:22844454

  13. Unlocking Doors without Keys: Activation of Src by Truncated C-terminal Intracellular Receptor Tyrosine Kinases Lacking Tyrosine Kinase Activity

    PubMed Central

    Mezquita, Belén; Mezquita, Pau; Pau, Montserrat; Mezquita, Jovita; Mezquita, Cristóbal


    One of the best examples of the renaissance of Src as an open door to cancer has been the demonstration that just five min of Src activation is sufficient for transformation and also for induction and maintenance of cancer stem cells [1]. Many tyrosine kinase receptors, through the binding of their ligands, become the keys that unlock the structure of Src and activate its oncogenic transduction pathways. Furthermore, intracellular isoforms of these receptors, devoid of any tyrosine kinase activity, still retain the ability to unlock Src. This has been shown with a truncated isoform of KIT (tr-KIT) and a truncated isoform of VEGFR-1 (i21-VEGFR-1), which are intracellular and require no ligand binding, but are nonetheless able to activate Src and induce cell migration and invasion of cancer cells. Expression of the i21-VEGFR-1 is upregulated by the Notch signaling pathway and repressed by miR-200c and retinoic acid in breast cancer cells. Both Notch inhibitors and retinoic acid have been proposed as potential therapies for invasive breast cancer. PMID:24709904

  14. Intracellular Voyeurism: Examining the Modulation of Host Cell Activities bySalmonella enterica Serovar Typhimurium.


    Szeto, Jason; Brumell, John H


    Salmonella spp. can infect host cells by gaining entry through phagocytosis or by inducing host cell membrane ruffling that facilitates bacterial uptake. With its wide host range, Salmonella enterica serovar Typhimurium has proven to be an important model organism for studying intracellular bacterial pathogenesis. Upon entry into host cells, serovar Typhimurium typically resides within a membrane-bound compartment termed the Salmonella-containing vacuole (SCV). From the SCV, serovar Typhimurium can inject several effector proteins that subvert many normal host cell systems, including endocytic trafficking, cytoskeletal rearrangements, lipid signaling and distribution, and innate and adaptive host defenses. The study of these intracellular events has been made possible through the use of various imaging techniques, ranging from classic methods of transmission electron microscopy to advanced livecell fluorescence confocal microscopy. In addition, DNA microarrays have now been used to provide a "snapshot" of global gene expression in serovar Typhimurium residing within the infected host cell. This review describes key aspects of Salmonella-induced subversion of host cell activities, providing examples of imaging that have been used to elucidate these events. Serovar Typhimurium engages specific host cell machinery from initial contact with the host cell to replication within the SCV. This continuous interaction with the host cell has likely contributed to the extensive arsenal that serovar Typhimurium now possesses, including two type III secretion systems, a range of ammunition in the form of TTSS effectors, and a complex genetic regulatory network that coordinates the expression of hundreds of virulence factors.

  15. Endocannabinoid signaling enhances visual responses through modulation of intracellular chloride levels in retinal ganglion cells

    PubMed Central

    Miraucourt, Loïs S; Tsui, Jennifer; Gobert, Delphine; Desjardins, Jean-François; Schohl, Anne; Sild, Mari; Spratt, Perry; Castonguay, Annie; De Koninck, Yves; Marsh-Armstrong, Nicholas; Wiseman, Paul W; Ruthazer, Edward S


    Type 1 cannabinoid receptors (CB1Rs) are widely expressed in the vertebrate retina, but the role of endocannabinoids in vision is not fully understood. Here, we identified a novel mechanism underlying a CB1R-mediated increase in retinal ganglion cell (RGC) intrinsic excitability acting through AMPK-dependent inhibition of NKCC1 activity. Clomeleon imaging and patch clamp recordings revealed that inhibition of NKCC1 downstream of CB1R activation reduces intracellular Cl− levels in RGCs, hyperpolarizing the resting membrane potential. We confirmed that such hyperpolarization enhances RGC action potential firing in response to subsequent depolarization, consistent with the increased intrinsic excitability of RGCs observed with CB1R activation. Using a dot avoidance assay in freely swimming Xenopus tadpoles, we demonstrate that CB1R activation markedly improves visual contrast sensitivity under low-light conditions. These results highlight a role for endocannabinoids in vision and present a novel mechanism for cannabinoid modulation of neuronal activity through Cl− regulation. DOI: PMID:27501334

  16. Modulation of Macrophage Inflammatory Nuclear Factor κB (NF-κB) Signaling by Intracellular Cryptococcus neoformans.


    Hayes, James B; Sircy, Linda M; Heusinkveld, Lauren E; Ding, Wandi; Leander, Rachel N; McClelland, Erin E; Nelson, David E


    Cryptococcus neoformans (Cn) is a common facultative intracellular pathogen that can cause life-threatening fungal meningitis in immunocompromised individuals. Shortly after infection, Cn is detectable as both extra- and intracellular yeast particles, with Cn being capable of establishing long-lasting latent infections within host macrophages. Although recent studies have shown that shed capsular polysaccharides and intact extracellular Cn can compromise macrophage function through modulation of NF-κB signaling, it is currently unclear whether intracellular Cn also affects NF-κB signaling. Utilizing live cell imaging and computational modeling, we find that extra- and intracellular Cn support distinct modes of NF-κB signaling in cultured murine macrophages. Specifically, in RAW 264.7 murine macrophages treated with extracellular glucuronoxylomannan (GXM), the major Cn capsular polysaccharide, LPS-induced nuclear translocation of p65 is inhibited, whereas in cells with intracellular Cn, LPS-induced nuclear translocation of p65 is both amplified and sustained. Mathematical simulations and quantification of nascent protein expression indicate that this is a possible consequence of Cn-induced "translational interference," impeding IκBα resynthesis. We also show that long term Cn infection induces stable nuclear localization of p65 and IκBα proteins in the absence of additional pro-inflammatory stimuli. In this case, nuclear localization of p65 is not accompanied by TNFα or inducible NOS (iNOS) expression. These results demonstrate that capsular polysaccharides and intact intracellular yeast manipulate NF-κB via multiple distinct mechanisms and provide new insights into how Cn might modulate cellular signaling at different stages of an infection.

  17. The effects of red ginseng saponin fraction-A (RGSF-A) on phagocytosis and intracellular signaling in Brucella abortus infected RAW 264.7 cells.


    Arayan, Lauren Togonon; Simborio, Hannah Leah; Reyes, Alisha Wehdnesday Bernardo; Hop, Huynh Tan; Min, WonGi; Lee, Hu Jang; Rhee, Man Hee; Chang, Hong Hee; Kim, Suk


    This study indicated that RGSF-A caused a marked reduction in the adherence, internalization and intracellular growth of Brucella abortus in RGSF-A-treated cells. Furthermore, a decline in the intensity of F-actin fluorescence was observed in RGSF-A-treated cells compared with untreated B. abortus-infected cells. In addition, an evaluation of phagocytic signaling proteins by Western blot analysis revealed an apparent reduction of ERK and p38α phosphorylation levels in B. abortus-infected RGSF-A-treated cells compared with the control. Upon intracellular trafficking of the pathogen, a higher number of B. abortus-containing phagosomes colocalized with LAMP-1 in RGSF-A-treated cells compared with control cells. These results strongly suggest that inhibition of B. abortus uptake could be mediated by suppression in the activation of MAPKs signaling proteins phospho-ERK 1/2, and p38 levels. On the other hand, inhibition of intracellular replication results from the enhancement of phagolysosome fusion in host macrophages. This study highlights the phagocytic and intracellular modulating effect of RGSF-A and its potential as an alternative remedy to control B. abortus infection.

  18. Intracellular Parasite Invasion Strategies

    NASA Astrophysics Data System (ADS)

    Sibley, L. D.


    Intracellular parasites use various strategies to invade cells and to subvert cellular signaling pathways and, thus, to gain a foothold against host defenses. Efficient cell entry, ability to exploit intracellular niches, and persistence make these parasites treacherous pathogens. Most intracellular parasites gain entry via host-mediated processes, but apicomplexans use a system of adhesion-based motility called ``gliding'' to actively penetrate host cells. Actin polymerization-dependent motility facilitates parasite migration across cellular barriers, enables dissemination within tissues, and powers invasion of host cells. Efficient invasion has brought widespread success to this group, which includes Toxoplasma, Plasmodium, and Cryptosporidium.

  19. Depollution potential of three macrophytes: exudated, wall-bound and intracellular peroxidase activities plus intracellular phenol concentrations.


    Larue, Camille; Korboulewsky, Nathalie; Wang, Runying; Mévy, Jean-Philippe


    The aim of this study was to investigate the potential role of three macrophyte species (Iris pseudacorus, Typha latifolia and Phragmites australis) for detoxication of xenobiotics, and to study their variations with seasons or concentrations of sewage sludge from the food industry. For this purpose, some aspects of the green liver concept were explored through peroxidase measurements in three compartments in roots: intracellular, cell wall and extracellular. In addition, phenol concentrations were also measured in order to assess heavy metal detoxication potential. Enzyme activities and phenol concentrations were overall lower in winter according to the phenological stages and some sludge effects occurred. Results show that P. australis roots exuded and contained more peroxidase in all seasons: 17 U/g (1373 U/g protein), 0.8 U/g (613 U/g protein) and 4.8 U/g (1329 U/g protein) in intracellular compartments, cell wall and exudates, respectively. In contrast, the highest phenol concentration was found in I. pseudacorus roots: 3.58 mg eq. [corrected] gallic acid/g. Hence, in constructed wetlands, P. australis is suitable for organic waste water treatment, while I. pseudacorus should be used in the case of waters highly charged with heavy metals.

  20. Enhanced intracellular signaling pathway in osteoblasts on ultraviolet lighttreated hydrophilic titanium.


    Iwasa, Fuminori; Baba, Kazuyoshi; Ogawa, Takahiro


    Ultraviolet (UV) light treatment of titanium immediately prior to use, or photofunctionalization, reactivates the time-dependent degradation of bioactivity of titanium (biological aging of titanium) and increases its osseointegration capacity beyond the inherent maximal level. Although the initial osteoblast attachment is reportedly enhanced on UV-treated titanium surfaces, the detailed mechanism behind the increase in osseointegration is unknown. This study examined the potential modulation of intracellular signaling pathway in osteoblasts on UV-treated titanium surfaces. Rat bone marrow-derived osteoblasts were cultured on 4-week-old, new, and UV-treated titanium surfaces. The new and UV-treated surfaces were superhydrophilic, whereas the 4-week-old surface was hydrophobic. Although the rate of protein adsorption was similarly increased on the new and UV-treated surfaces compared with the 4-week-old surface, the number of attached cells and their spreading behavior were further enhanced on the UV-treated surface. This additional enhancement was associated with the remarkably upregulated expression of paxillin and phospho-paxillin and exclusive upregulation of Rho GTPase family genes. This study provides with the first molecular evidence of the enhanced initial behavior of osteoblasts on UV-treated titanium surfaces. The enhancement was accentuated and distinct from the new titanium surface with similar hydrophilicity, suggesting that surface properties other than the level of hydrophilicity are responsible.

  1. Intracellular TCR-signaling pathway: novel markers for lymphoma diagnosis and potential therapeutic targets.


    Agostinelli, Claudio; Rizvi, Hasan; Paterson, Jennifer; Shende, Vishvesh; Akarca, Ayse U; Agostini, Elena; Fuligni, Fabio; Righi, Simona; Spagnolo, Sebastiano; Piccaluga, Pier Paolo; Clark, Edward A; Pileri, Stefano A; Marafioti, Teresa


    Despite the immunologic functions of T-cell receptor signaling molecules being extensively investigated, their potential as immunohistochemical markers has been poorly explored. With this background, we evaluated the expression of 5 intracellular proteins-GADS, DOK2, SKAP55, ITK, and PKCα-involved in T-cell receptor signaling in normal and neoplastic hematologic tissue samples, using antibodies raised against fixation-resistant epitopes of the 5 molecules. All 5 antibodies were associated with normal T-cell differentiation. GADS, DOK2, SKAP55, and ITK turned out to be T-cell lineage-specific markers in the setting of lymphoid and myeloid precursor neoplasms but showed differential expression in peripheral T-cell lymphoma (PTCL) subtypes, being detected in PTCL/not otherwise specified (NOS) and angioimmunoblastic T-cell lymphoma but negative in anaplastic large cell lymphoma (ALCL). Peripheral B-cell lymphomas were consistently negative for ITK, with occasional cases showing expression of DOK2 and SKAP55, and a proportion (47%) of hairy cell leukemias were GADS. Notably, PKCα highlighted a defective antigen in both PTCL/NOS (6%) and angioimmunoblastic T-cell lymphoma (10%), mostly negative in ALCL, and was aberrantly expressed in classical Hodgkin lymphoma (65%), Burkitt lymphoma (48%), and plasma cell myeloma (48%). In conclusion, all five molecules evaluated play a role in T-cell differentiation in normal and neoplastic tissues. They can be applied confidently to routine sections contributing primarily to assignment of T-lineage differentiation in the setting of hematopoietic precursor neoplasms (GADS/DOK2/SKAP55/ITK) and for the differential diagnosis between ALCL and PTCL/NOS (GADS/DOK2/SKAP55/ITK) or classical Hodgkin lymphoma (PKCα). Finally, association with specific tumor subtypes may have therapeutic potential.

  2. Intracellular Ca2+ signals in human-derived pancreatic somatostatin-secreting cells (QGP-1N).


    Squires, P E; Amiranoff, B; Dunne, M J


    Single-cell microfluorimetry techniques have been used to examine the effects of acetylcholine (0.1-100 microM) on the intracellular free calcium ion concentration ([Ca2+]i) in a human-derived pancreatic somatostatin-secreting cell line, QGP-1N. When applied to the bath solution, acetylcholine was found to evoke a marked and rapid increase in [Ca2+]i at all concentrations tested. These responses were either sustained, or associated with the generation of complex patterns of [Ca2+]i transients. Overall, the pattern of response was concentration related. In general, 0.1-10 microM acetylcholine initiated a series of repetitive oscillations in cytoplasmic Ca2+, whilst at higher concentrations the responses consisted of a rapid rise in [Ca2+]i followed by a smaller more sustained increase. Without external Ca2+, 100 microM acetylcholine caused only a transient rise in [Ca2+]i, whereas lower concentrations of the agonist were able to initiate, but not maintain, [Ca2+]i oscillations. Acetylcholine-evoked Ca2+ signals were abolished by atropine (1-10 microM), verapamil (100 microM) and caffeine (20 mM). Nifedipine failed to have any significant effect upon agonist-evoked increases in [Ca2+]i, whilst 50 mM KCl, used to depolarise the cell membrane, only elicited a transient increase in [Ca2+]i. Ryanodine (50-500 nM) and caffeine (1-20 mM) did not increase basal Ca2+ levels, but the Ca(2+)-ATPase inhibitors 2,5-di(tert-butyl)-hydroquinone (TBQ) and thapsigargin both elevated [Ca2+]i levels. These data demonstrate for the first time cytosolic Ca2+ signals in single isolated somatostatin-secreting cells of the pancreas. We have demonstrated that acetylcholine will evoke both Ca2+ influx and Ca2+ mobilisation, and we have partially addressed the subcellular mechanism responsible for these events.

  3. Intracellular Signal Triggered by Cholera Toxin in Saccharomyces boulardii and Saccharomyces cerevisiae

    PubMed Central

    Brandão, Rogelio L.; Castro, Ieso M.; Bambirra, Eduardo A.; Amaral, Sheila C.; Fietto, Luciano G.; Tropia, Maria José M.; Neves, Maria José; Dos Santos, Raquel G.; Gomes, Newton C. M.; Nicoli, Jacques R.


    As is the case for Saccharomyces boulardii, Saccharomyces cerevisiae W303 protects Fisher rats against cholera toxin (CT). The addition of glucose or dinitrophenol to cells of S. boulardii grown on a nonfermentable carbon source activated trehalase in a manner similar to that observed for S. cerevisiae. The addition of CT to the same cells also resulted in trehalase activation. Experiments performed separately on the A and B subunits of CT showed that both are necessary for activation. Similarly, the addition of CT but not of its separate subunits led to a cyclic AMP (cAMP) signal in both S. boulardii and S. cerevisiae. These data suggest that trehalase stimulation by CT probably occurred through the cAMP-mediated protein phosphorylation cascade. The requirement of CT subunit B for both the cAMP signal and trehalase activation indicates the presence of a specific receptor on the yeasts able to bind to the toxin, a situation similar to that observed for mammalian cells. This hypothesis was reinforced by experiments with 125I-labeled CT showing specific binding of the toxin to yeast cells. The adhesion of CT to a receptor on the yeast surface through the B subunit and internalization of the A subunit (necessary for the cAMP signal and trehalase activation) could be one more mechanism explaining protection against the toxin observed for rats treated with yeasts. PMID:9464394

  4. Intracellular signal triggered by cholera toxin in Saccharomyces boulardii and Saccharomyces cerevisiae.


    Brandão, R L; Castro, I M; Bambirra, E A; Amaral, S C; Fietto, L G; Tropia, M J; Neves, M J; Dos Santos, R G; Gomes, N C; Nicoli, J R


    As is the case for Saccharomyces boulardii, Saccharomyces cerevisiae W303 protects Fisher rats against cholera toxin (CT). The addition of glucose or dinitrophenol to cells of S. boulardii grown on a nonfermentable carbon source activated trehalase in a manner similar to that observed for S.cerevisiae. The addition of CT to the same cells also resulted in trehalase activation. Experiments performed separately on the A and B subunits of CT showed that both are necessary for activation. Similarly, the addition of CT but not of its separate subunits led to a cyclic AMP (cAMP) signal in both S. boulardii and S. cerevisiae. These data suggest that trehalase stimulation by CT probably occurred through the cAMP-mediated protein phosphorylation cascade. The requirement of CT subunit B for both the cAMP signal and trehalase activation indicates the presence of a specific receptor on the yeasts able to bind to the toxin, a situation similar to that observed for mammalian cells. This hypothesis was reinforced by experiments with 125I-labeled CT showing specific binding of the toxin to yeast cells. The adhesion of CT to a receptor on the yeast surface through the B subunit and internalization of the A subunit (necessary for the cAMP signal and trehalase activation) could be one more mechanism explaining protection against the toxin observed for rats treated with yeasts.

  5. Intracellular complement activation sustains T cell homeostasis and mediates effector differentiation.


    Liszewski, M Kathryn; Kolev, Martin; Le Friec, Gaelle; Leung, Marilyn; Bertram, Paula G; Fara, Antonella F; Subias, Marta; Pickering, Matthew C; Drouet, Christian; Meri, Seppo; Arstila, T Petteri; Pekkarinen, Pirkka T; Ma, Margaret; Cope, Andrew; Reinheckel, Thomas; Rodriguez de Cordoba, Santiago; Afzali, Behdad; Atkinson, John P; Kemper, Claudia


    Complement is viewed as a critical serum-operative component of innate immunity, with processing of its key component, C3, into activation fragments C3a and C3b confined to the extracellular space. We report here that C3 activation also occurred intracellularly. We found that the T cell-expressed protease cathepsin L (CTSL) processed C3 into biologically active C3a and C3b. Resting T cells contained stores of endosomal and lysosomal C3 and CTSL and substantial amounts of CTSL-generated C3a. While "tonic" intracellular C3a generation was required for homeostatic T cell survival, shuttling of this intracellular C3-activation-system to the cell surface upon T cell stimulation induced autocrine proinflammatory cytokine production. Furthermore, T cells from patients with autoimmune arthritis demonstrated hyperactive intracellular complement activation and interferon-γ production and CTSL inhibition corrected this deregulated phenotype. Importantly, intracellular C3a was observed in all examined cell populations, suggesting that intracellular complement activation might be of broad physiological significance.

  6. Intracellular signaling in the regulation of renal Na-K-ATPase. II. Role of eicosanoids.

    PubMed Central

    Satoh, T; Cohen, H T; Katz, A I


    We recently reported a novel intracellular mechanism of renal Na-K-ATPase regulation by agents that increase cell cAMP, which involves protein kinase A-phospholipase A2 and is mediated by one or more arachidonic acid metabolites (Satoh, T., H. T. Cohen, and A. I. Katz. 1992. J. Clin. Invest. 89:1496). The present studies were, therefore, designed to assess the role of eicosanoids in the modulation of Na-K-ATPase activity in the rat cortical collecting duct. The effect of various cAMP agonists (dopamine, fenoldopam, vasopressin, forskolin, and dibutyryl cAMP), which inhibited the pump to a similar extent (approximately 50%), was independent of altered Na entry as it was elicited in the presence of amiloride or nystatin, or when NaCl was replaced with choline Cl. This effect was completely blocked by SKF 525A or ethoxyresorufin, two inhibitors of the cytochrome P450-dependent monooxygenase pathway, or by pretreating the animals with CoCl2, which depletes cytochrome P450. Equimolar concentrations (10(-7) M) of the cyclooxygenase inhibitors indomethacin or meclofenamate caused only a partial inhibition of the cAMP agonists' effect on the pump, whereas nordihydroguaiaretic acid or A 63162, two inhibitors of the lipoxygenase pathway, were without effect. Furthermore, two products of this pathway, leukotriene B4 and leukotriene D4, had no effect on Na-K-ATPase activity, and ICI 198615, a leukotriene receptor antagonist, did not alter pump inhibition by cAMP agonists. Several P450 monoxygenase arachidonic acid metabolites (5,6-epoxyeicosatrienoic acid; 11,12-epoxyeicosatrienoic acid; 11,12-dihydroxyeicosatrienoic acid; and 12(R)-hydroxyeicosatetraenoic acid) as well as PGE2 inhibited the Na:K pump in dose-dependent manner, but the effect of PGE2 was blocked when Na availability was altered, whereas that of 12(R)-HETE remained unchanged. We conclude that the cytochrome P450-monooxygenase pathway of the arachidonic acid cascade plays a major role in the modulation of Na

  7. Recombinant differential anchorage probes that tower over the spatial dimension of intracellular signals for high content screening and analysis.


    Schembri, Laura; Zanese, Marion; Depierre-Plinet, Gaelle; Petit, Muriel; Elkaoukabi-Chaibi, Assia; Tauzin, Loic; Florean, Cristina; Lartigue, Lydia; Medina, Chantal; Rey, Christophe; Belloc, Francis; Reiffers, Josy; Ichas, François; De Giorgi, Francesca


    Recombinant fluorescent probes allow the detection of molecular events inside living cells. Many of them exploit the intracellular space to provide positional signals and, thus, require detection by single cell imaging. We describe here a novel strategy based on probes capable of encoding the spatial dimension of intracellular signals into "all-or-none" fluorescence intensity changes (differential anchorage probes, DAPs). The resulting signals can be acquired in single cells at high throughput by automated flow cytometry, (i) bypassing image acquisition and analysis, (ii) providing a direct quantitative readout, and (iii) allowing the exploration of large experimental series. We illustrate our purpose with DAPs for Bax and the effector caspases 3 and 7, which are keys players in apoptotic cell death, and show applications in basic research, high content multiplexed library screening, compound characterization, and drug profiling.

  8. Cell-specific Activation of Nuclear Factor-κB by the Parasite Trypanosoma cruzi Promotes Resistance to Intracellular Infection

    PubMed Central

    Hall, Belinda S.; Tam, Winnie; Sen, Ranjan; Pereira, Miercio E. A.


    The transcription factor nuclear factor-κB (NF-κB) is central to the innate and acquired immune response to microbial pathogens, coordinating cellular responses to the presence of infection. Here we demonstrate a direct role for NF-κB activation in controlling intracellular infection in nonimmune cells. Trypanosoma cruzi is an intracellular parasite of mammalian cells with a marked preference for infection of myocytes. The molecular basis for this tissue tropism is unknown. Trypomastigotes, the infectious stage of T. cruzi, activate nuclear translocation and DNA binding of NF-κB p65 subunit and NF-κB-dependent gene expression in epithelial cells, endothelial cells, and fibroblasts. Inactivation of epithelial cell NF-κB signaling by inducible expression of the inhibitory mutant IκBaM significantly enhances parasite invasion. T. cruzi do not activate NF-κB in cells derived from skeletal, smooth, or cardiac muscle, despite the ability of these cells to respond to tumor necrosis factor-α with NF-κB activation. The in vitro infection level in these muscle-derived cells is more than double that seen in the other cell types tested. Therefore, the ability of T. cruzi to activate NF-κB correlates inversely with susceptibility to infection, suggesting that NF-κB activation is a determinant of the intracellular survival and tissue tropism of T. cruzi. PMID:10637298

  9. Limiting angiotensin II signaling with a cell penetrating peptide mimicking the second intracellular loop of the angiotensin II type I receptor

    PubMed Central

    Yu, Jun; Taylor, Linda; Mierke, Dale; Berg, Eric; Shia, Michael; Fishman, Jordan; Sallum, Christine; Polgar, Peter


    A cell-penetrating peptide consisting of the second intracellular loop (IC2) of the Angiotensin II (AngII) type I receptor (AT1) linked to the HIV transactivating regulatory protein (TAT) domain was used to identify the role of this motif for intracellular signal transduction. HEK-293 cells stably transfected with AT1R cDNA and primary cultures of human pulmonary artery smooth muscle cells expressing endogenous AT1 receptor were exposed to the cell-penetrating peptide construct and the effect on angiotensin II signaling determined. The AT1 IC2 peptide effectively inhibited AngII stimulated phosphatidylinositol turnover and calcium influx. It also limited the activation of Akt/PKB as determined by an inhibition of phosphorylation of Akt at Ser473 and completely abolished the AngII dependent activation of the transcriptional factor NFκB. In contrast, the AT1 IC2 peptide had no effect on AngII/AT1 receptor activation of ERK. These results illustrate the potential of using cell penetrating peptides to both delineate receptor-mediated signal transduction as well as to selectively regulate G protein coupled receptor signaling. PMID:20492449

  10. Intracellular Signaling and Desmoglein 2 Shedding Triggered by Human Adenoviruses Ad3, Ad14, and Ad14P1

    PubMed Central

    Wang, Hongjie; Ducournau, Corinne; Saydaminova, Kamola; Richter, Maximilian; Yumul, Roma; Ho, Martin; Carter, Darrick; Zubieta, Chloé


    ABSTRACT We recently discovered that desmoglein 2 (DSG2) is a receptor for human adenovirus species B serotypes Ad3, Ad7, Ad11, and Ad14. Ad3 is considered to be a widely distributed human pathogen. Ad3 binding to DSG2 triggers the transient opening of epithelial junctions. Here, we further delineate the mechanism that leads to DSG2-mediated epithelial junction opening in cells exposed to Ad3 and recombinant Ad3 fiber proteins. We identified an Ad3 fiber knob-dependent pathway that involves the phosphorylation of mitogen-activated protein (MAP) kinases triggering the activation of the matrix-metalloproteinase ADAM17. ADAM17, in turn, cleaves the extracellular domain of DSG2 that links epithelial cells together. The shed DSG2 domain can be detected in cell culture supernatant and also in serum of mice with established human xenograft tumors. We then extended our studies to Ad14 and Ad14P1. Ad14 is an important research and clinical object because of the recent appearance of a new, more pathogenic strain (Ad14P1). In a human epithelial cancer xenograft model, Ad14P1 showed more efficient viral spread and oncolysis than Ad14. Here, we tested the hypothesis that a mutation in the Ad14P1 fiber knob could account for the differences between the two strains. While our X-ray crystallography studies suggested an altered three-dimensional (3D) structure of the Ad14P1 fiber knob in the F-G loop region, this did not significantly change the fiber knob affinity to DSG2 or the intracellular signaling and DSG2 shedding in epithelial cancer cells. IMPORTANCE A number of widely distributed adenoviruses use the epithelial junction protein DSG2 as a receptor for infection and lateral spread. Interaction with DSG2 allows the virus not only to enter cells but also to open epithelial junctions which form a physical barrier to virus spread. Our study elucidates the mechanism beyond virus-triggered junction opening with a focus on adenovirus serotype 3. Ad3 binds to DSG2 with its fiber

  11. The role of cAMP-mediated intracellular signaling in regulating Na+ uptake in zebrafish larvae

    PubMed Central

    Kumai, Yusuke; Kwong, Raymond W. M.


    In the current study, the role of cAMP in stimulating Na+ uptake in larval zebrafish was investigated. Treating larvae at 4 days postfertilization (dpf) with 10 μM forskolin or 1 μM 8-bromo cAMP significantly increased Na+ uptake by three-fold and twofold, respectively. The cAMP-dependent stimulation of Na+ uptake was probably unrelated to protein trafficking via microtubules because pretreatment with 200 μM colchicine or 30 μM nocodazole did not attenuate the magnitude of the response. Na+ uptake was stimulated markedly following acute (2 h) exposure to acidic water. The acid-induced increase in Na+ uptake was accompanied by a twofold elevation in whole body cAMP levels and attenuated by inhibiting PKA with 10 μM H-89. Knockdown of Na+-H+ exchanger 3b (NHE3b) attenuated, but did not abolish, the stimulation of Na+ uptake during forskolin treatment. In glial cell missing 2 morphants, in which the role of NHE3b in Na+ uptake is diminished and the Na+-Cl− cotransporter (NCC) becomes the predominant route of Na+ entry, forskolin treatment continued to increase Na+ uptake. These data suggest that at least NHE3b and NCC are targeted by cAMP in zebrafish larvae. Staining of larvae with fluorescent forskolin and propranolol revealed the presence of transmembrane adenylyl cyclase within multiple subtypes of ionocytes expressing β-adrenergic receptors. Taken together, results of the present study demonstrate that cAMP-mediated intracellular signaling may regulate multiple Na+ transporters and plays an important role in regulating Na+ uptake in zebrafish larvae during acute exposure to an acidic environment. PMID:24259461

  12. The Molecular Basis of Toxins’ Interactions with Intracellular Signaling via Discrete Portals

    PubMed Central

    Lahiani, Adi; Yavin, Ephraim; Lazarovici, Philip


    An understanding of the molecular mechanisms by which microbial, plant or animal-secreted toxins exert their action provides the most important element for assessment of human health risks and opens new insights into therapies addressing a plethora of pathologies, ranging from neurological disorders to cancer, using toxinomimetic agents. Recently, molecular and cellular biology dissecting tools have provided a wealth of information on the action of these diverse toxins, yet, an integrated framework to explain their selective toxicity is still lacking. In this review, specific examples of different toxins are emphasized to illustrate the fundamental mechanisms of toxicity at different biochemical, molecular and cellular- levels with particular consideration for the nervous system. The target of primary action has been highlighted and operationally classified into 13 sub-categories. Selected examples of toxins were assigned to each target category, denominated as portal, and the modulation of the different portal’s signaling was featured. The first portal encompasses the plasma membrane lipid domains, which give rise to pores when challenged for example with pardaxin, a fish toxin, or is subject to degradation when enzymes of lipid metabolism such as phospholipases A2 (PLA2) or phospholipase C (PLC) act upon it. Several major portals consist of ion channels, pumps, transporters and ligand gated ionotropic receptors which many toxins act on, disturbing the intracellular ion homeostasis. Another group of portals consists of G-protein-coupled and tyrosine kinase receptors that, upon interaction with discrete toxins, alter second messengers towards pathological levels. Lastly, subcellular organelles such as mitochondria, nucleus, protein- and RNA-synthesis machineries, cytoskeletal networks and exocytic vesicles are also portals targeted and deregulated by other diverse group of toxins. A fundamental concept can be drawn from these seemingly different toxins with

  13. The Molecular Basis of Toxins' Interactions with Intracellular Signaling via Discrete Portals.


    Lahiani, Adi; Yavin, Ephraim; Lazarovici, Philip


    An understanding of the molecular mechanisms by which microbial, plant or animal-secreted toxins exert their action provides the most important element for assessment of human health risks and opens new insights into therapies addressing a plethora of pathologies, ranging from neurological disorders to cancer, using toxinomimetic agents. Recently, molecular and cellular biology dissecting tools have provided a wealth of information on the action of these diverse toxins, yet, an integrated framework to explain their selective toxicity is still lacking. In this review, specific examples of different toxins are emphasized to illustrate the fundamental mechanisms of toxicity at different biochemical, molecular and cellular- levels with particular consideration for the nervous system. The target of primary action has been highlighted and operationally classified into 13 sub-categories. Selected examples of toxins were assigned to each target category, denominated as portal, and the modulation of the different portal's signaling was featured. The first portal encompasses the plasma membrane lipid domains, which give rise to pores when challenged for example with pardaxin, a fish toxin, or is subject to degradation when enzymes of lipid metabolism such as phospholipases A₂ (PLA₂) or phospholipase C (PLC) act upon it. Several major portals consist of ion channels, pumps, transporters and ligand gated ionotropic receptors which many toxins act on, disturbing the intracellular ion homeostasis. Another group of portals consists of G-protein-coupled and tyrosine kinase receptors that, upon interaction with discrete toxins, alter second messengers towards pathological levels. Lastly, subcellular organelles such as mitochondria, nucleus, protein- and RNA-synthesis machineries, cytoskeletal networks and exocytic vesicles are also portals targeted and deregulated by other diverse group of toxins. A fundamental concept can be drawn from these seemingly different toxins with

  14. Tissue Plasminogen Activator Alters Intracellular Sequestration of Zinc through Interaction with the Transporter ZIP4

    SciTech Connect

    Emmetsberger, Jaime; Mirrione, Martine M.; Zhou, Chun; Fernandez-Monreal, Monica; Siddiq, Mustafa M.; Ji, Kyungmin; Tsirka, Stella E.


    Glutamatergic neurons contain free zinc packaged into neurotransmitter-loaded synaptic vesicles. Upon neuronal activation, the vesicular contents are released into the synaptic space, whereby the zinc modulates activity of postsynaptic neurons though interactions with receptors, transporters and exchangers. However, high extracellular concentrations of zinc trigger seizures and are neurotoxic if substantial amounts of zinc reenter the cells via ion channels and accumulate in the cytoplasm. Tissue plasminogen activator (tPA), a secreted serine protease, is also proepileptic and excitotoxic. However, tPA counters zinc toxicity by promoting zinc import back into the neurons in a sequestered form that is nontoxic. Here, we identify the zinc influx transporter, ZIP4, as the pathway through which tPA mediates the zinc uptake. We show that ZIP4 is upregulated after excitotoxin stimulation of the mouse, male and female, hippocampus. ZIP4 physically interacts with tPA, correlating with an increased intracellular zinc influx and lysosomal sequestration. Changes in prosurvival signals support the idea that this sequestration results in neuroprotection. These experiments identify a mechanism via which neurons use tPA to efficiently neutralize the toxic effects of excessive concentrations of free zinc.

  15. Structurally similar estradiol analogs uniquely alter the regulation of intracellular signaling pathways.


    Yarger, James G; Babine, Robert E; Bittner, Michael; Shanle, Erin; Xu, Wei; Hershberger, Pamela; Nye, Steven H


    Ligand structure can affect the activation of nuclear receptors, such as estrogen receptors (ERs), and their control of signaling pathways for cellular responses including death and differentiation. We hypothesized that distinct biological functions of similar estradiol (E(2)) analogs could be identified by integrating gene expression patterns obtained from human tumor cell lines with receptor binding and functional data for the purpose of developing compounds for treatment of a variety of diseases. We compared the estrogen receptor subtype selectivity and impact on signaling pathways for three distinct, but structurally similar, analogs of E(2). Modifications in the core structure of E(2) led to pronounced changes in subtype selectivity for estrogen receptors, ER-α or ER-β, along with varying degrees of ER dimerization and activation. While all three E(2) analogs are predominantly ER-β agonists, the cell growth inhibitory activity commonly associated with this class of compounds was detected for only two of the analogs and might be explained by a ligand-specific pattern of gene transcription. Microarray studies using three different human tumor cell lines demonstrated that the analogs distinctly affect the transcription of genes in signaling pathways for chromosome replication, cell death, and oligodendrocyte progenitor cell differentiation. That the E(2) analogs could lower tumor cell viability and stimulate neuronal differentiation confirmed that gene expression data could accurately distinguish biological activity of the E(2) analogs. The findings reported here confirm that cellular responses can be regulated by making key structural alterations to the core structure of endogenous ER ligands.

  16. Pathways of intracellular communication: tetrapyrroles and plastid-to-nucleus signaling.


    Rodermel, Steve; Park, Sungsoon


    Retrograde plastid-to-nucleus signaling plays a central role in coordinating nuclear and plastid gene expression. The gun (genomes uncoupled) mutants of Arabidopsis have been used to demonstrate that Mg-protoporphyrin (Mg-Proto) acts as a plastid signal to repress the transcription of nuclear photosynthesis genes (1). It is unclear how Mg-Proto triggers repression, but several components of this pathway have been recently identified. These include the products of GUN4 and GUN5. GUN5 is the ChlH subunit of Mg-chelatase, which produces Mg-Proto, and GUN4 is a regulator of ChlH activity (2). GUN4 might also play a role in photoprotection and in the trafficking of Mg-Proto.

  17. Regulation of monocarboxylate transporter 1 in skeletal muscle cells by intracellular signaling pathways.


    Narumi, Katsuya; Furugen, Ayako; Kobayashi, Masaki; Otake, Sho; Itagaki, Shirou; Iseki, Ken


    Skeletal muscle is the major producer of lactic acid in the body, but its oxidative fibers also use lactic acid as a respiratory fuel. Monocarboxylate transporter (MCT) 1 has been suggested to play a major role in influx of L-lactic acid for oxidation. The regulation mechanism of MCT1 was characterized utilizing rhabdomyosarcoma cells as an in vitro skeletal muscle model. The uptake of L-lactic acid via MCT1 was studied in the presence of various intracellular regulatory pathways, including pathways mediated by protein kinases A, C and G (PKA, PKC and PKG), protein tyrosine kinase (PTK), and Ca2+/calmodulin modulators. The results showed that PKG-, PTK-, and Ca2+/calmodulin-mediated regulatory pathways play no role in the regulation of L-lactic acid uptake, but a role for PKC- and PKA-mediated pathways was apparent. Uptake of L-lactic acid appeared to be stimulated by phorbol 12-myristate 13-acetate (PMA, a PKC activator) via an increase in Vmax of transport processes with no alteration in Km. In parallel, PMA treatment also resulted in an increase in the level of MCT1 expression. On the other hand, exposure to 8-Br-cAMP, a cAMP analog, and to forskolin, an adenylyl cyclase activator, resulted in a significant decrease in L-lactic acid uptake. Additionally, 8-Br-cAMP reduced Vmax but not Km values. Parallel to the decrease in Vmax of L-lactic acid uptake, the level of MCT1 expression was decreased in response to incubation with 8-Br-cAMP. These results indicate the possible involvement of a PKC- and PKA-mediated pathway associated with expression of MCT1 and lactate transport.

  18. N-myristoylated proteins, key components in intracellular signal transduction systems enabling rapid and flexible cell responses

    PubMed Central

    HAYASHI, Nobuhiro; TITANI, Koiti


    N-myristoylation, one of the co- or post-translational modifications of proteins, has so far been regarded as necessary for anchoring of proteins to membranes. Recently, we have revealed that Nα-myristoylation of several brain proteins unambiguously regulates certain protein–protein interactions that may affect signaling pathways in brain. Comparison of the amino acid sequences of myristoylated proteins including those in other organs suggests that this regulation is involved in signaling pathways not only in brain but also in other organs. Thus, it has been shown that myristoylated proteins in cells regulate the signal transduction between membranes and cytoplasmic fractions. An algorithm we have developed to identify myristoylated proteins in cells predicts the presence of hundreds of myristoylated proteins. Interestingly, a large portion of the myristoylated proteins thought to take part in signal transduction between membranes and cytoplasmic fractions are included in the predicted myristoylated proteins. If the proteins functionally regulated by myristoylation, a posttranslational protein modification, were understood as cross-talk points within the intracellular signal transduction system, known signaling pathways could thus be linked to each other, and a novel map of this intracellular network could be constructed. On the basis of our recent results, this review will highlight the multifunctional aspects of protein N-myristoylation in brain. PMID:20467215

  19. Macrophage activation induced by Brucella DNA suppresses bacterial intracellular replication via enhancing NO production.


    Liu, Ning; Wang, Lin; Sun, Changjiang; Yang, Li; Tang, Bin; Sun, Wanchun; Peng, Qisheng


    Brucella DNA can be sensed by TLR9 on endosomal membrane and by cytosolic AIM2-inflammasome to induce proinflammatory cytokine production that contributes to partially activate innate immunity. Additionally, Brucella DNA has been identified to be able to act as a major bacterial component to induce type I IFN. However, the role of Brucella DNA in Brucella intracellular growth remains unknown. Here, we showed that stimulation with Brucella DNA promote macrophage activation in TLR9-dependent manner. Activated macrophages can suppresses wild type Brucella intracellular replication at early stage of infection via enhancing NO production. We also reported that activated macrophage promotes bactericidal function of macrophages infected with VirB-deficient Brucella at the early or late stage of infection. This study uncovers a novel function of Brucella DNA, which can help us further elucidate the mechanism of Brucella intracellular survival.

  20. Plant PRRs and the activation of innate immune signaling.


    Macho, Alberto P; Zipfel, Cyril


    Despite being sessile organisms constantly exposed to potential pathogens and pests, plants are surprisingly resilient to infections. Plants can detect invaders via the recognition of pathogen-associated molecular patterns (PAMPs) by pattern recognition receptors (PRRs). Plant PRRs are surface-localized receptor-like kinases, which comprise a ligand-binding ectodomain and an intracellular kinase domain, or receptor-like proteins, which do not exhibit any known intracellular signaling domain. In this review, we summarize recent discoveries that shed light on the molecular mechanisms underlying ligand perception and subsequent activation of plant PRRs. Notably, plant PRRs appear as central components of multiprotein complexes at the plasma membrane that contain additional transmembrane and cytosolic kinases required for the initiation and specificity of immune signaling. PRR complexes are under tight control by protein phosphatases, E3 ligases, and other regulatory proteins, illustrating the exquisite and complex regulation of these molecular machines whose proper activation underlines a crucial layer of plant immunity.

  1. Direct activation of cardiac pacemaker channels by intracellular cyclic AMP.


    DiFrancesco, D; Tortora, P


    Cyclic AMP acts as a second messenger in the modulation of several ion channels that are typically controlled by a phosphorylation process. In cardiac pacemaker cells, adrenaline and acetylcholine regulate the hyperpolarization-activated current (if), but in opposite ways; this current is involved in the generation and modulation of pacemaker activity. These actions are mediated by cAMP and underlie control of spontaneous rate by neurotransmitters. Whether the cAMP modulation of if is mediated by channel phosphorylation is, however, still unknown. Here we investigate the action of cAMP on if in excised patches of cardiac pacemaker cells and find that cAMP activates if by a mechanism independent of phosphorylation, involving a direct interaction with the channels at their cytoplasmic side. Cyclic AMP activates if by shifting its activation curve to more positive voltages, in agreement with whole-cell results. This is the first evidence of an ion channel whose gating is dually regulated by voltage and direct cAMP binding.

  2. Dysregulated intracellular signaling in the striatum in a pathophysiologically grounded model of Tourette syndrome.


    Rapanelli, Maximiliano; Frick, Luciana R; Pogorelov, Vladimir; Ota, Kristie T; Abbasi, Eeman; Ohtsu, Hiroshi; Pittenger, Christopher


    Tic disorders produce substantial morbidity, but their pathophysiology remains poorly understood. Convergent evidence suggests that dysregulation of the cortico-basal ganglia circuitry is central to the pathogenesis of tics. Tourette syndrome (TS), the most severe end of the continuum of tic disorders, is substantially genetic, but causative mutations have been elusive. We recently described a mouse model, the histidine decarboxylase (Hdc) knockout mouse, that recapitulates a rare, highly penetrant mutation found in a single family; these mice exhibit TS-like phenomenology. These animals have a global deficit in brain histamine and a consequent dysregulation of DA in the basal ganglia. Histamine modulation of DA effects is increasingly appreciated, but the mechanisms underlying this modulation remain unclear; the consequences of modest DA elevation in the context of profound HA deficiency are difficult to predict, but understanding them in the Hdc knockout mouse may provide generalizable insights into the pathophysiology of TS. Here we characterized signaling pathways in striatal cells in this model system, at baseline and after amphetamine challenge. In vivo microdialysis confirms elevated DA in Hdc-KO mice. We find dephosphorylation of Akt and its target GSK3β and activation of the MAPK signaling cascade and its target rpS6; these are characteristic of the effects of DA on D2- and D1-expressing striatal neurons, respectively. Strikingly, there is no alteration in mTOR signaling, which can be regulated by DA in both cell types. These cellular effects help elucidate striatal signaling abnormalities in a uniquely validated mouse model of TS and move towards the identification of new potential therapeutic targets for tic disorders.

  3. Quercetin regulates the sestrin 2-AMPK-p38 MAPK signaling pathway and induces apoptosis by increasing the generation of intracellular ROS in a p53-independent manner.


    Kim, Guen Tae; Lee, Se Hee; Kim, Jong Il; Kim, Young Min


    The induction of apoptosis in cancer cells is a therapeutic strategy for the treatment of cancer. In the present study, we investigated the regulatory mechanisms responsible for quercetin-induced apoptosis, mamely the increased expression of sestrin 2 and the activation of the 5' AMP-activated protein kinase (AMPK)/p38 MAPK signaling pathway. Our results revealed that quercetin induced apoptosis by generating the production of intracellular reactive oxygen species (ROS) and increasing the expression of sestrin 2. The induction of apoptosis by quercetin occurred through the activation of the AMPK/p38 signaling pathway and was dependent on sestrin 2. However, the silencing of sestrin 2 using small interfering RNA (siRNA) targeting sestrin 2 revealed that quercetin did not regulate AMPK or p38 phosphorylation in the cells in which sestrin 2 was silenced. On the other hand, it has been previously reported that sestrin 2 expression is not dependent on p53 expression under hypoxic conditions, whereas DNA damage is dependent on p53. We demonstrate that the increase in the expression of sestrin 2 by quercetin-generated intracellular ROS is p53-independent. The increased expression of sestrin 2 induced apoptosis through the AMPK/p38 signaling pathway in the HT-29 colon cancer cells, which are p53 mutant, treated with quercetin. Thus, our data suggest that quercetin induces apoptosis by reducing mitochondrial membrane potential, generating intracellular ROS production and increasing sestrin 2 expression through the AMPK/p38 pathway. In addition, p53 is not a necessary element for an apoptotic event induced by sestrin 2.

  4. Membrane lipids, EGF receptors, and intracellular signals colocalize and are polarized in epithelial cells moving directionally in a physiological electric field.


    Zhao, Min; Pu, Jin; Forrester, John V; McCaig, Colin D


    Directed cell migration is essential for tissue formation, inflammation, and wound healing. Chemotaxis plays a major role in these situations and is underpinned by asymmetric intracellular signaling. Endogenous electric fields (EFs) are common where cell movement occurs, such as in wound healing, and cells respond to electric field gradients by reorienting and migrating directionally (galvanotaxis/electrotaxis). We show that a physiological EF redistributed both EGF (epidermal growth factor) receptors and detergent-insoluble membrane lipids asymmetrically, leading to cathodal polarization and enhanced activation of the MAP kinase, ERK1/2. This induced leading-edge actin polymerization in directionally migrating mammalian epithelial cells. Inhibiting the EGF receptor-MAP kinase signaling pathway significantly decreased leading edge actin asymmetry and directional migration. We propose a model in which EF-polarized membrane lipid domains and EGF receptors cause asymmetric signaling through MAP kinase, which drives directional cell migration. A comparison is made with the mechanisms underpinning chemotaxis.

  5. Measles virus hemagglutinin triggers intracellular signaling in CD150-expressing dendritic cells and inhibits immune response

    PubMed Central

    Romanets-Korbut, Olga; Kovalevska, Larysa M.; Seya, Tsukasa; Sidorenko, Svetlana P.; Horvat, Branka


    Measles virus (MV) is highly contagious pathogen, which causes a profound immunosuppression, resulting in high infant mortality. This virus infects dendritic cells (DCs) following the binding of MV hemagglutinin (MV-H) to CD150 receptor and alters DC functions by a mechanism that is not completely understood. We have analyzed the effect of MV-H interaction with CD150-expressing DCs on the DC signaling pathways and consequent phenotypic and functional changes in the absence of infectious context. We demonstrated that contact between CD150 on human DCs and MV-H expressed on membrane of transfected CHO cells was sufficient to modulate the activity of two major regulatory pathways of DC differentiation and function: to stimulate Akt and inhibit p38 MAPK phosphorylation, without concomitant ERK1/2 activation. Furthermore, interaction with MV-H decreased the expression level of DC activation markers CD80, CD83, CD86, and HLA-DR and strongly downregulated IL-12 production but did not modulate IL-10 secretion. Moreover, contact with MV-H suppressed DC-mediated T-cell alloproliferation, demonstrating profound alteration of DC maturation and functions. Finally, engagement of CD150 by MV-H in mice transgenic for human CD150 decreased inflammatory responses, showing the immunosuppressive effect of CD150–MV-H interaction in vivo. Altogether, these results uncover novel mechanism of MV-induced immunosuppression, implicating modulation of cell signaling pathways following MV-H interaction with CD150-expressing DCs and reveal anti-inflammatory effects of CD150 stimulation. PMID:26073466

  6. Intracellular calcium oscillations in strongly metastatic human breast and prostate cancer cells: control by voltage-gated sodium channel activity.


    Rizaner, Nahit; Onkal, Rustem; Fraser, Scott P; Pristerá, Alessandro; Okuse, Kenji; Djamgoz, Mustafa B A


    The possible association of intracellular Ca(2+) with metastasis in human cancer cells is poorly understood. We have studied Ca(2+) signaling in human prostate and breast cancer cell lines of strongly versus weakly metastatic potential in a comparative approach. Intracellular free Ca(2+) was measured using a membrane-permeant fluorescent Ca(2+)-indicator dye (Fluo-4 AM) and confocal microscopy. Spontaneous Ca(2+) oscillations were observed in a proportion of strongly metastatic human prostate and breast cancer cells (PC-3M and MDA-MB-231, respectively). In contrast, no such oscillations were observed in weakly/non metastatic LNCaP and MCF-7 cells, although a rise in the resting Ca(2+) level could be induced by applying a high-K(+) solution. Various parameters of the oscillations depended on extracellular Ca(2+) and voltage-gated Na(+) channel activity. Treatment with either tetrodotoxin (a general blocker of voltage-gated Na(+) channels) or ranolazine (a blocker of the persistent component of the channel current) suppressed the Ca(2+) oscillations. It is concluded that the functional voltage-gated Na(+) channel expression in strongly metastatic cancer cells makes a significant contribution to generation of oscillatory intracellular Ca(2+) activity. Possible mechanisms and consequences of the Ca(2+) oscillations are discussed.

  7. Glial potassium channels activated by neuronal firing or intracellular cyclic AMP in Helix.


    Gommerat, I; Gola, M


    1. Cell-attached and whole cell patch clamp experiments were performed on satellite glial cells adhering to the cell body of neurones in situ within the nervous system of the snail Helix pomatia. The underlying neurone was under current or voltage-clamp control. 2. Neuronal firing induced a delayed (20-30 s) persistent (3-4 min) increase in the opening probability of glial K+ channels. The channels were also activated by perfusing the ganglion with a depolarizing high-K+ saline, except when the underlying neurone was prevented from depolarizing under voltage-clamp conditions. 3. Two K(+)-selective channels were detected in the glial membrane. The channel responding to neuronal firing was present in 95% of the patches (n = 393). It had a unitary conductance of 56 pS, a Na+ :K+ permeability ratio < 0.02 and displayed slight inward rectification in symmetrical [K+] conditions. It was sensitive to TEA, Ba2+ and Cs+. The following results refer to this channel as studied in the cell-attached configuration. 4. The glial K+ channel was activated by bath application of the membrane-permeant cyclic AMP derivatives 8-bromo-cAMP and dibutyryl-cAMP, the adenylyl cyclase activator forskolin and the diesterase inhibitors IBMX, theophylline and caffeine. It was insensitive to cyclic GMP activators and to conditions that might alter the intracellular [Ca2+] (ionomycin, low-Ca2+ saline and Ca2+ channel blockers). 5. The forskolin-induced changes in channel behaviour (open and closed time distributions, burst duration, short and long gaps within bursts) could be accounted for by a four-state model (3 closed states, 1 open state) by simply changing one of the six rate parameters. 6. The present results suggest that the signal sent by an active neurone to satellite glial cells is confined to the glial cells round that neurone. The effect of this signal on the class of glial K+ channels studied can be mimicked by an increase in glial cAMP concentration. The subsequent delayed opening

  8. Glial potassium channels activated by neuronal firing or intracellular cyclic AMP in Helix.

    PubMed Central

    Gommerat, I; Gola, M


    1. Cell-attached and whole cell patch clamp experiments were performed on satellite glial cells adhering to the cell body of neurones in situ within the nervous system of the snail Helix pomatia. The underlying neurone was under current or voltage-clamp control. 2. Neuronal firing induced a delayed (20-30 s) persistent (3-4 min) increase in the opening probability of glial K+ channels. The channels were also activated by perfusing the ganglion with a depolarizing high-K+ saline, except when the underlying neurone was prevented from depolarizing under voltage-clamp conditions. 3. Two K(+)-selective channels were detected in the glial membrane. The channel responding to neuronal firing was present in 95% of the patches (n = 393). It had a unitary conductance of 56 pS, a Na+ :K+ permeability ratio < 0.02 and displayed slight inward rectification in symmetrical [K+] conditions. It was sensitive to TEA, Ba2+ and Cs+. The following results refer to this channel as studied in the cell-attached configuration. 4. The glial K+ channel was activated by bath application of the membrane-permeant cyclic AMP derivatives 8-bromo-cAMP and dibutyryl-cAMP, the adenylyl cyclase activator forskolin and the diesterase inhibitors IBMX, theophylline and caffeine. It was insensitive to cyclic GMP activators and to conditions that might alter the intracellular [Ca2+] (ionomycin, low-Ca2+ saline and Ca2+ channel blockers). 5. The forskolin-induced changes in channel behaviour (open and closed time distributions, burst duration, short and long gaps within bursts) could be accounted for by a four-state model (3 closed states, 1 open state) by simply changing one of the six rate parameters. 6. The present results suggest that the signal sent by an active neurone to satellite glial cells is confined to the glial cells round that neurone. The effect of this signal on the class of glial K+ channels studied can be mimicked by an increase in glial cAMP concentration. The subsequent delayed opening

  9. Intracellular calcium during signal transduction in the lymphocyte is altered by ELF magnetic and electric fields

    SciTech Connect

    Liburdy, R.P. )


    Research has shown that ELF magnetic and electric fields alter calcium transport in rat thymic T-lymphocytes during signal transduction initiated by mitogen. Interestingly activated T-lymphocytes display a nonlinear dose-response for this basic field interaction which scales with the induced electric field in contrast to the applied magnetic field. Specialized multiring annular well cell culture plates based on Faraday's Law of Current Induction were used to demonstrate that the electric field associated with the magnetic field is the exposure metric of biological interest. The first real-time measurements of (Ca{sup 2+}){sub i} were recently presented and (Ca{sup 2+}){sub i} was shown to be altered by sinusoidal 60 Hz electric fields; magnetic fields that induced comparable electric fields yielded similar alterations in (Ca{sup 2+}){sub i}. The author now presents evidence that both parameters, (Ca{sup 2+}){sub i} and calcium transport, are altered by ELF fields during calcium signaling in thymocytes and scale with the induced electric field. In addition, (Ca{sup 2+}){sub i} studies have been conducted that provide evidence supporting the hypothesis that the mitogen-gated calcium channel present in the plasma cell membrane represents a specific site of interaction for ELF fields.

  10. The Potential of Vitamin D-Regulated Intracellular Signaling Pathways as Targets for Myeloid Leukemia Therapy

    PubMed Central

    Gocek, Elzbieta; Studzinski, George P.


    The current standard regimens for the treatment of acute myeloid leukemia (AML) are curative in less than half of patients; therefore, there is a great need for innovative new approaches to this problem. One approach is to target new treatments to the pathways that are instrumental to cell growth and survival with drugs that are less harmful to normal cells than to neoplastic cells. In this review, we focus on the MAPK family of signaling pathways and those that are known to, or potentially can, interact with MAPKs, such as PI3K/AKT/FOXO and JAK/STAT. We exemplify the recent studies in this field with specific relevance to vitamin D and its derivatives, since they have featured prominently in recent scientific literature as having anti-cancer properties. Since microRNAs also are known to be regulated by activated vitamin D, this is also briefly discussed here, as are the implications of the emerging acquisition of transcriptosome data and potentiation of the biological effects of vitamin D by other compounds. While there are ongoing clinical trials of various compounds that affect signaling pathways, more studies are needed to establish the clinical utility of vitamin D in the treatment of cancer. PMID:26239344

  11. Danger, intracellular signaling, and the orchestration of dendritic cell function in skin sensitization.


    Ainscough, Joseph S; Frank Gerberick, G; Dearman, Rebecca J; Kimber, Ian


    Allergic contact dermatitis is an important occupational and environmental disease caused by topical exposure to chemical allergens. An area of considerable interest and, in the context of hazard identification and characterization, an area of great importance is developing an understanding of the characteristics that confer on chemicals the ability to cause skin sensitization. For the successful acquisition of skin sensitization, it is necessary that a chemical must gain access to the viable epidermis, form stable immunogenic associations with host proteins, and provide the necessary stimuli for the activation, mobilization, and maturation of skin dendritic cells (DC). It is the last of these properties that is the subject of this article. The purpose here is to review the mechanisms through which skin sensitizers provide the triggers necessary for engagement of cutaneous DC. Of particular interest are the nature and function of danger signals elicited by skin sensitizing chemicals. Among the pathways considered here are those involving Toll-like receptors, C-type lectin receptors, neuropeptide receptors, prostanoid receptors, and the inflammasome. Collectively, danger signals in the skin provide a bridge between the innate and adaptive immune systems and are of pivotal importance for the initiation of cutaneous immune responses, including those to chemical allergens that result in skin sensitization.

  12. The Role of the Francisella Tularensis Pathogenicity Island in Type VI Secretion, Intracellular Survival, and Modulation of Host Cell Signaling

    PubMed Central

    Bröms, Jeanette E.; Sjöstedt, Anders; Lavander, Moa


    Francisella tularensis is a highly virulent gram-negative intracellular bacterium that causes the zoonotic disease tularemia. Essential for its virulence is the ability to multiply within host cells, in particular monocytic cells. The bacterium has developed intricate means to subvert host immune mechanisms and thereby facilitate its intracellular survival by preventing phagolysosomal fusion followed by escape into the cytosol, where it multiplies. Moreover, it targets and manipulates numerous host cell signaling pathways, thereby ameliorating the otherwise bactericidal capacity. Many of the underlying molecular mechanisms still remain unknown but key elements, directly or indirectly responsible for many of the aforementioned mechanisms, rely on the expression of proteins encoded by the Francisella pathogenicity island (FPI), suggested to constitute a type VI secretion system. We here describe the current knowledge regarding the components of the FPI and the roles that have been ascribed to them. PMID:21687753

  13. Acylcarnitines activate proinflammatory signaling pathways.


    Rutkowsky, Jennifer M; Knotts, Trina A; Ono-Moore, Kikumi D; McCoin, Colin S; Huang, Shurong; Schneider, Dina; Singh, Shamsher; Adams, Sean H; Hwang, Daniel H


    Incomplete β-oxidation of fatty acids in mitochondria is a feature of insulin resistance and type 2 diabetes mellitus (T2DM). Previous studies revealed that plasma concentrations of medium- and long-chain acylcarnitines (by-products of incomplete β-oxidation) are elevated in T2DM and insulin resistance. In a previous study, we reported that mixed D,L isomers of C12- or C14-carnitine induced an NF-κB-luciferase reporter gene in RAW 264.7 cells, suggesting potential activation of proinflammatory pathways. Here, we determined whether the physiologically relevant L-acylcarnitines activate classical proinflammatory signaling pathways and if these outcomes involve pattern recognition receptor (PRR)-associated pathways. Acylcarnitines induced the expression of cyclooxygenase-2 in a chain length-dependent manner in RAW 264.7 cells. L-C14 carnitine (5-25 μM), used as a representative acylcarnitine, stimulated the expression and secretion of proinflammatory cytokines in a dose-dependent manner. Furthermore, L-C14 carnitine induced phosphorylation of JNK and ERK, common downstream components of many proinflammatory signaling pathways including PRRs. Knockdown of MyD88, a key cofactor in PRR signaling and inflammation, blunted the proinflammatory effects of acylcarnitine. While these results point to potential involvement of PRRs, L-C14 carnitine promoted IL-8 secretion from human epithelial cells (HCT-116) lacking Toll-like receptors (TLR)2 and -4, and did not activate reporter constructs in TLR overexpression cell models. Thus, acylcarnitines have the potential to activate inflammation, but the specific molecular and tissue target(s) involved remain to be identified.

  14. Acylcarnitines activate proinflammatory signaling pathways

    PubMed Central

    Rutkowsky, Jennifer M.; Knotts, Trina A.; Ono-Moore, Kikumi D.; McCoin, Colin S.; Huang, Shurong; Schneider, Dina; Singh, Shamsher; Hwang, Daniel H.


    Incomplete β-oxidation of fatty acids in mitochondria is a feature of insulin resistance and type 2 diabetes mellitus (T2DM). Previous studies revealed that plasma concentrations of medium- and long-chain acylcarnitines (by-products of incomplete β-oxidation) are elevated in T2DM and insulin resistance. In a previous study, we reported that mixed d,l isomers of C12- or C14-carnitine induced an NF-κB-luciferase reporter gene in RAW 264.7 cells, suggesting potential activation of proinflammatory pathways. Here, we determined whether the physiologically relevant l-acylcarnitines activate classical proinflammatory signaling pathways and if these outcomes involve pattern recognition receptor (PRR)-associated pathways. Acylcarnitines induced the expression of cyclooxygenase-2 in a chain length-dependent manner in RAW 264.7 cells. l-C14 carnitine (5–25 μM), used as a representative acylcarnitine, stimulated the expression and secretion of proinflammatory cytokines in a dose-dependent manner. Furthermore, l-C14 carnitine induced phosphorylation of JNK and ERK, common downstream components of many proinflammatory signaling pathways including PRRs. Knockdown of MyD88, a key cofactor in PRR signaling and inflammation, blunted the proinflammatory effects of acylcarnitine. While these results point to potential involvement of PRRs, l-C14 carnitine promoted IL-8 secretion from human epithelial cells (HCT-116) lacking Toll-like receptors (TLR)2 and -4, and did not activate reporter constructs in TLR overexpression cell models. Thus, acylcarnitines have the potential to activate inflammation, but the specific molecular and tissue target(s) involved remain to be identified. PMID:24760988

  15. Inhibitory effect of red ginseng acidic polysaccharide from Korean red ginseng on phagocytic activity and intracellular replication of Brucella abortus in RAW 264.7 cells

    PubMed Central

    Bernardo Reyes, Alisha Wehdnesday; Simborio, Hannah Leah Tadeja; Hop, Huynh Tan; Arayan, Lauren Togonon; Min, Won Gi; Lee, Hu Jang; Rhee, Man Hee; Chang, Hong Hee


    Korean red ginseng (KRG) has long been used in traditional Korean and Oriental medicine. However, the anti-bacterial mechanism and therapeutic efficiency of KGR for intracellular Brucella infection are still unclear. In this study, the bactericidal activity of Korean red ginseng acidic polysaccharide (RGAP) on Brucella (B.) abortus and its cytotoxic effects on RAW 264.7 cells were evaluated. In addition, B. abortus internalization and intracellular replication in macrophages were investigated after RGAP treatment. RGAP-incubated cells displayed a marked reduction in the adherence, internalization and intracellular growth of B. abortus in macrophages. Furthermore, decreased F-actin fluorescence was observed relative to untreated B. abortus-infected cells. Western blot analysis of intracellular signaling proteins revealed reduced ERK, JNK and p38α phosphorylation levels in B. abortus-infected RGAP-treated cells compared to the control. Moreover, elevated co-localization of B. abortus-containing phagosomes with lysosome-associated membrane protein 1 (LAMP-1) were observed in RGAP-treated cells compared with the control. Overall, the results of this study suggest that RGAP can disrupt phagocytic activity of B. abortus via suppression of mitogen-activated protein kinases (MAPKs) signaling proteins ERK, JNK and p38 levels and inhibit intracellular replication of B. abortus by enhancing phagolysosome fusion, which may provide an alternative control of brucellosis. PMID:26726017

  16. TRPM2 contributes to LPC-induced intracellular Ca(2+) influx and microglial activation.


    Jeong, Heejin; Kim, Yong Ho; Lee, Yunsin; Jung, Sung Jun; Oh, Seog Bae


    Microglia are the resident immune cells which become activated in some pathological conditions in central nervous system (CNS). Lysophosphatidylcholine (LPC), an endogenous inflammatory phospholipid, is implicated in immunomodulatory function of glial cells in the CNS. Although several studies uncovered that LPC induces intracellular Ca(2+) influx and morphologic change in microglia, there is still no direct evidence showing change of phosphorylation of mitogen-activated protein kinase (MAPK) p38 (p-p38), a widely used microglia activation marker, by LPC. Furthermore, the cellular mechanism of LPC-induced microglia activation remains unknown. In this study, we found that LPC induced intracellular Ca(2+) increase in primary cultured microglia, which was blocked in the presence of Gd(3+), non-selective transient receptor potential (TRP) channel blocker. RT-PCR and whole cell patch clamp recordings revealed molecular and functional expression of TRP melastatin 2 (TRPM2) in microglia. Using western blotting, we also observed that LPC increased phosphorylation of p38 MAPK, and the increase of p-p38 expression is also reversed in TRPM2-knockout (KO) microglia. Moreover, LPC induced membrane trafficking of TRPM2 and intrathecal injection of LPC increased Iba-1 immunoreactivity in the spinal cord, which were significantly reduced in KO mice. In addition, LPC-induced intracellular Ca(2+) increase and inward currents were abolished in TRPM2-KO microglia. Taken together, our results suggest that LPC induces intracellular Ca(2+) influx and increases phosphorylation of p38 MAPK via TRPM2, which in turn activates microglia.

  17. TGF-β-Mediated Sustained ERK1/2 Activity Promotes the Inhibition of Intracellular Growth of Mycobacterium avium in Epithelioid Cells Surrogates

    PubMed Central

    L'Abbate, Carolina; Cipriano, Ivone; Pérez-Hurtado, Elizabeth Cristina; Leão, Sylvia Cardoso; Carneiro, Célia Regina Whitaker; Machado, Joel


    Transforming growth factor beta (TGF-β) has been implicated in the pathogenesis of several diseases including infection with intracellular pathogens such as the Mycobacterium avium complex. Infection of macrophages with M. avium induces TGF-β production and neutralization of this cytokine has been associated with decreased intracellular bacterial growth. We have previously demonstrated that epithelioid cell surrogates (ECs) derived from primary murine peritoneal macrophages through a process of differentiation induced by IL-4 overlap several features of epithelioid cells found in granulomas. In contrast to undifferentiated macrophages, ECs produce larger amounts of TGF-β and inhibit the intracellular growth of M. avium. Here we asked whether the levels of TGF-β produced by ECs are sufficient to induce a self-sustaining autocrine TGF-β signaling controlling mycobacterial replication in infected-cells. We showed that while exogenous addition of increased concentration of TGF-β to infected-macrophages counteracted M. avium replication, pharmacological blockage of TGF-β receptor kinase activity with SB-431542 augmented bacterial load in infected-ECs. Moreover, the levels of TGF-β produced by ECs correlated with high and sustained levels of ERK1/2 activity. Inhibition of ERK1/2 activity with U0126 increased M. avium replication in infected-cells, suggesting that modulation of intracellular bacterial growth is dependent on the activation of ERK1/2. Interestingly, blockage of TGF-β receptor kinase activity with SB-431542 in infected-ECs inhibited ERK1/2 activity, enhanced intracellular M. avium burden and these effects were followed by a severe decrease in TGF-β production. In summary, our findings indicate that the amplitude of TGF-β signaling coordinates the strength and duration of ERK1/2 activity that is determinant for the control of intracellular mycobacterial growth. PMID:21731758

  18. Adiponectin Receptors Form Homomers and Heteromers Exhibiting Distinct Ligand Binding and Intracellular Signaling Properties*

    PubMed Central

    Almabouada, Farid; Diaz-Ruiz, Alberto; Rabanal-Ruiz, Yoana; Peinado, Juan R.; Vazquez-Martinez, Rafael; Malagon, Maria M.


    Adiponectin binds to two widely expressed receptors (AdipoR1 and AdipoR2) that contain seven transmembrane domains but, unlike G-protein coupled receptors, present an extracellular C terminus and a cytosolic N terminus. Recently, AdipoR1 was found to associate in high order complexes. However, it is still unknown whether AdipoR2 may also form homomers or heteromers with AdipoR1 or if such interactions may be functionally relevant. Herein, we have analyzed the oligomerization pattern of AdipoRs by FRET and immunoprecipitation and evaluated both the internalization of AdipoRs in response to various adiponectin isoforms and the effect of adiponectin binding to different AdipoR combinations on AMP-activated protein kinase phosphorylation and peroxisome proliferator-activated receptor α activation. Transfection of HEK293AD cells with AdipoR1 and AdipoR2 showed that both receptors colocalize at both the plasma membrane and the endoplasmic reticulum. Co-transfection with the different AdipoR pairs yielded high FRET efficiencies in non-stimulated cells, which indicates that AdipoR1 and AdipoR2 form homo- and heteromeric complexes under resting conditions. Live FRET imaging suggested that both homo- and heteromeric AdipoR complexes dissociate in response to adiponectin, but heteromers separate faster than homomers. Finally, phosphorylation of AMP-activated protein kinase in response to adiponectin was delayed in cells wherein heteromer formation was favored. In sum, our findings indicate that AdipoR1 and AdipoR2 form homo- and heteromers that present unique interaction behaviors and signaling properties. This raises the possibility that the pleiotropic, tissue-dependent functions of adiponectin depend on the expression levels of AdipoR1 and AdipoR2 and, therefore, on the steady-state proportion of homo- and heteromeric complexes. PMID:23255609


    EPA Science Inventory

    ARE MACROPHAGES ACTIVATED AND INDUCE PULMONARY INJURY BY INTRACELLULARLY BIOAVAILABLE IRON? UP Kodavanti1, MCJ Schladweiler1, S Becker2, DL Costa1, P Mayer3, A Ziesenis3, WG Kreyling3, 1ETD, 2HSDivision, NHEERL, USEPA, Research Triangle Park, NC, USA, and 3GSF, Inhalation Biology...

  20. Polymodal Responses in C. elegans Phasmid Neurons Rely on Multiple Intracellular and Intercellular Signaling Pathways

    PubMed Central

    Zou, Wenjuan; Cheng, Hankui; Li, Shitian; Yue, Xiaomin; Xue, Yadan; Chen, Sixi; Kang, Lijun


    Animals utilize specialized sensory neurons enabling the detection of a wide range of environmental stimuli from the presence of toxic chemicals to that of touch. However, how these neurons discriminate between different kinds of stimuli remains poorly understood. By combining in vivo calcium imaging and molecular genetic manipulation, here we investigate the response patterns and the underlying mechanisms of the C. elegans phasmid neurons PHA/PHB to a variety of sensory stimuli. Our observations demonstrate that PHA/PHB neurons are polymodal sensory neurons which sense harmful chemicals, hyperosmotic solutions and mechanical stimulation. A repulsive concentration of IAA induces calcium elevations in PHA/PHB and both OSM-9 and TAX-4 are essential for IAA-sensing in PHA/PHB. Nevertheless, the PHA/PHB neurons are inhibited by copper and post-synaptically activated by copper removal. Neuropeptide is likely involved in copper removal-induced calcium elevations in PHA/PHB. Furthermore, mechanical stimulation activates PHA/PHB in an OSM-9-dependent manner. Our work demonstrates how PHA/PHB neurons respond to multiple environmental stimuli and lays a foundation for the further understanding of the mechanisms of polymodal signaling, such as nociception, in more complex organisms. PMID:28195191

  1. Intracellular activity of tedizolid phosphate and ACH-702 versus Mycobacterium tuberculosis infected macrophages

    PubMed Central


    Background Due to the emergency of multidrug-resistant strains of Mycobacterium tuberculosis, is necessary the evaluation of new compounds. Findings Tedizolid, a novel oxazolidinone, and ACH-702, a new isothiazoloquinolone, were tested against M. tuberculosis infected THP-1 macrophages. These two compounds significantly decreased the number of intracellular mycobacteria at 0.25X, 1X, 4X and 16X the MIC value. The drugs were tested either in nanoparticules or in free solution. Conclusion Tedizolid and ACH-702 have a good intracellular killing activity comparable to that of rifampin or moxifloxacin. PMID:24708819

  2. Inhibitory effects of SSRIs on IFN-γ induced microglial activation through the regulation of intracellular calcium.


    Horikawa, Hideki; Kato, Takahiro A; Mizoguchi, Yoshito; Monji, Akira; Seki, Yoshihiro; Ohkuri, Takatoshi; Gotoh, Leo; Yonaha, Megumi; Ueda, Tadashi; Hashioka, Sadayuki; Kanba, Shigenobu


    Microglia, which are a major glial component of the central nervous system (CNS), have recently been suggested to mediate neuroinflammation through the release of pro-inflammatory cytokines and nitric oxide (NO). Microglia are also known to play a critical role as resident immunocompetent and phagocytic cells in the CNS. Immunological dysfunction has recently been demonstrated to be associated with the pathophysiology of depression. However, to date there have only been a few studies on the relationship between microglia and depression. We therefore investigated if antidepressants can inhibit microglial activation in vitro. Our results showed that the selective serotonin reuptake inhibitors (SSRIs) paroxetine and sertraline significantly inhibited the generation of NO and tumor necrosis factor (TNF)-α from interferon (IFN)-γ-activated 6-3 microglia. We further investigated the intracellular signaling mechanism underlying NO and TNF-α release from IFN-γ-activated 6-3 microglia. Our results suggest that paroxetine and sertraline may inhibit microglial activation through inhibition of IFN-γ-induced elevation of intracellular Ca(2+). Our results suggest that the inhibitory effect of paroxetine and sertraline on microglial activation may not be a prerequisite for antidepressant function, but an additional beneficial effect.

  3. The Aer protein and the serine chemoreceptor Tsr independently sense intracellular energy levels and transduce oxygen, redox, and energy signals for Escherichia coli behavior

    PubMed Central

    Rebbapragada, Anuradha; Johnson, Mark S.; Harding, Gordon P.; Zuccarelli, Anthony J.; Fletcher, Hansel M.; Zhulin, Igor B.; Taylor, Barry L.


    We identified a protein, Aer, as a signal transducer that senses intracellular energy levels rather than the external environment and that transduces signals for aerotaxis (taxis to oxygen) and other energy-dependent behavioral responses in Escherichia coli. Domains in Aer are similar to the signaling domain in chemotaxis receptors and the putative oxygen-sensing domain of some transcriptional activators. A putative FAD-binding site in the N-terminal domain of Aer shares a consensus sequence with the NifL, Bat, and Wc-1 signal-transducing proteins that regulate gene expression in response to redox changes, oxygen, and blue light, respectively. A double mutant deficient in aer and tsr, which codes for the serine chemoreceptor, was negative for aerotaxis, redox taxis, and glycerol taxis, each of which requires the proton motive force and/or electron transport system for signaling. We propose that Aer and Tsr sense the proton motive force or cellular redox state and thereby integrate diverse signals that guide E. coli to environments where maximal energy is available for growth. PMID:9380671

  4. Status of the intracellular gate in the activated-not-open state of shaker K+ channels.


    del Camino, Donato; Kanevsky, Max; Yellen, Gary


    Voltage-dependent K+ channels like Shaker use an intracellular gate to control ion flow through the pore. When the membrane voltage becomes more positive, these channels traverse a series of closed conformations before the final opening transition. Does the intracellular gate undergo conformational changes before channel opening? To answer this question we introduced cysteines into the intracellular end of the pore and studied their chemical modification in conditions favoring each of three distinct states, the open state, the resting closed state, and the activated-not-open state (the closed state adjacent to the open state). We used two independent ways to isolate the channels in the activated-not-open state. First, we used mutations in S4 (ILT; Smith-Maxwell, C.J., J.L. Ledwell, and R.W. Aldrich. 1998. J. Gen. Physiol. 111:421-439; Ledwell, J.L., and R.W. Aldrich. 1999. J. Gen. Physiol. 113:389-414) that separate the final opening step from earlier charge-movement steps. Second, we used the open channel blocker 4-aminopyridine (4-AP), which has been proposed to promote closure of the intracellular gate and thus specifically to stabilize the activated-not-open state of the channels. Supporting this proposed mechanism, we found that 4-AP enters channels only after opening, remaining trapped in closed channels, and that in the open state it competes with tetraethylammonium for binding. Using these tools, we found that in the activated-not-open state, a cysteine located at a position considered to form part of the gate (Shaker 478) showed higher reactivity than in either the open or the resting closed states. Additionally, we have found that in this activated state the intracellular gate continued to prevent access to the pore by molecules as small as Cd2+ ions. Our results suggest that the intracellular opening to the pore undergoes some rearrangements in the transition from the resting closed state to the activated-not-open state, but throughout this process the

  5. The Analysis of Intracellular and Intercellular Calcium Signaling in Human Anterior Lens Capsule Epithelial Cells with Regard to Different Types and Stages of the Cataract.


    Gosak, Marko; Markovič, Rene; Fajmut, Aleš; Marhl, Marko; Hawlina, Marko; Andjelić, Sofija


    In this work we investigated how modifications of the Ca2+ homeostasis in anterior lens epithelial cells (LECs) are associated with different types of cataract (cortical or nuclear) and how the progression of the cataract (mild or moderate) affects the Ca2+ signaling. We systematically analyzed different aspects of intra- and inter-cellular Ca2+ signaling in the human LECs, which are attached to surgically isolated lens capsule (LC), obtained during cataract surgery. We monitored the temporal and spatial changes in intracellular Ca2+ concentration after stimulation with acetylcholine by means of Fura-2 fluorescence captured with an inverted microscope. In our analysis we compared the features of Ca2+ signals in individual cells, synchronized activations, spatio-temporal grouping and the nature of intercellular communication between LECs. The latter was assessed by using the methodologies of the complex network theory. Our results point out that at the level of individual cells there are no significant differences when comparing the features of the signals with regard either to the type or the stage of the cataract. On the other hand, noticeable differences are observed at the multicellular level, despite inter-capsule variability. LCs associated with more developed cataracts were found to exhibit a slower collective response to stimulation, a less pronounced spatio-temporal clustering of LECs with similar signaling characteristics. The reconstructed intercellular networks were found to be sparser and more segregated than in LCs associated with mild cataracts. Moreover, we show that spontaneously active LECs often operate in localized groups with quite well aligned Ca2+ activity. The presence of spontaneous activity was also found to affect the stimulated Ca2+ responses of individual cells. Our findings indicate that the cataract progression entails the impairment of intercellular signaling thereby suggesting the functional importance of altered Ca2+ signaling of

  6. The Analysis of Intracellular and Intercellular Calcium Signaling in Human Anterior Lens Capsule Epithelial Cells with Regard to Different Types and Stages of the Cataract

    PubMed Central

    Gosak, Marko; Markovič, Rene; Fajmut, Aleš; Marhl, Marko; Hawlina, Marko; Andjelić, Sofija


    In this work we investigated how modifications of the Ca2+ homeostasis in anterior lens epithelial cells (LECs) are associated with different types of cataract (cortical or nuclear) and how the progression of the cataract (mild or moderate) affects the Ca2+ signaling. We systematically analyzed different aspects of intra- and inter-cellular Ca2+ signaling in the human LECs, which are attached to surgically isolated lens capsule (LC), obtained during cataract surgery. We monitored the temporal and spatial changes in intracellular Ca2+ concentration after stimulation with acetylcholine by means of Fura-2 fluorescence captured with an inverted microscope. In our analysis we compared the features of Ca2+ signals in individual cells, synchronized activations, spatio-temporal grouping and the nature of intercellular communication between LECs. The latter was assessed by using the methodologies of the complex network theory. Our results point out that at the level of individual cells there are no significant differences when comparing the features of the signals with regard either to the type or the stage of the cataract. On the other hand, noticeable differences are observed at the multicellular level, despite inter-capsule variability. LCs associated with more developed cataracts were found to exhibit a slower collective response to stimulation, a less pronounced spatio-temporal clustering of LECs with similar signaling characteristics. The reconstructed intercellular networks were found to be sparser and more segregated than in LCs associated with mild cataracts. Moreover, we show that spontaneously active LECs often operate in localized groups with quite well aligned Ca2+ activity. The presence of spontaneous activity was also found to affect the stimulated Ca2+ responses of individual cells. Our findings indicate that the cataract progression entails the impairment of intercellular signaling thereby suggesting the functional importance of altered Ca2+ signaling of

  7. Intracellular acidification is required for full activation of the sweet taste receptor by miraculin

    PubMed Central

    Sanematsu, Keisuke; Kitagawa, Masayuki; Yoshida, Ryusuke; Nirasawa, Satoru; Shigemura, Noriatsu; Ninomiya, Yuzo


    Acidification of the glycoprotein, miraculin (MCL), induces sweet taste in humans, but not in mice. The sweet taste induced by MCL is more intense when acidification occurs with weak acids as opposed to strong acids. MCL interacts with the human sweet receptor subunit hTAS1R2, but the mechanisms by which the acidification of MCL activates the sweet taste receptor remain largely unexplored. The work reported here speaks directly to this activation by utilizing a sweet receptor TAS1R2 + TAS1R3 assay. In accordance with previous data, MCL-applied cells displayed a pH dependence with citric acid (weak acid) being right shifted to that with hydrochloric acid (strong acid). When histidine residues in both the intracellular and extracellular region of hTAS1R2 were exchanged for alanine, taste-modifying effect of MCL was reduced or abolished. Stronger intracellular acidification of HEK293 cells was induced by citric acid than by HCl and taste-modifying effect of MCL was proportional to intracellular pH regardless of types of acids. These results suggest that intracellular acidity is required for full activation of the sweet taste receptor by MCL. PMID:26960429

  8. Dextran sulfate sodium upregulates MAPK signaling for the uptake and subsequent intracellular survival of Brucella abortus in murine macrophages.


    Reyes, Alisha Wehdnesday Bernardo; Arayan, Lauren Togonon; Simborio, Hannah Leah Tadeja; Hop, Huynh Tan; Min, WonGi; Lee, Hu Jang; Kim, Dong Hee; Chang, Hong Hee; Kim, Suk


    Brucellosis is one of the major zoonoses worldwide that inflicts important health problems in animal and human. Here, we demonstrated that dextran sulfate sodium (DSS) significantly increased adhesion of Brucella (B.) abortus in murine macrophages compared to untreated cells. Even without infection, Brucella uptake into macrophages increased and F-actin reorganization was induced compared with untreated cells. Furthermore, DSS increased the phosphorylation of MAPKs (ERK1/2 and p38α) in Brucella-infected, DSS-treated cells compared with the control cells. Lastly, DSS markedly increased the intracellular survival of Brucella abortus in macrophages by up to 48 h. These results suggest that DSS enhanced the adhesion and phagocytosis of B. abortus into murine macrophages by stimulating the MAPK signaling proteins phospho-ERK1/2 and p38α and that DSS increased the intracellular survival of B. abortus by inhibiting colocalization of Brucella-containing vacuoles (BCVs) with the late endosome marker LAMP-1. This study emphasizes the enhancement of the phagocytic and intracellular modulatory effects of DSS, which may suppress the innate immune system and contribute to prolonged Brucella survival and chronic infection.

  9. Imaging intracellular Ca²⁺ signals in striatal astrocytes from adult mice using genetically-encoded calcium indicators.


    Jiang, Ruotian; Haustein, Martin D; Sofroniew, Michael V; Khakh, Baljit S


    Astrocytes display spontaneous intracellular Ca(2+) concentration fluctuations ([Ca(2+)]i) and in several settings respond to neuronal excitation with enhanced [Ca(2+)]i signals. It has been proposed that astrocytes in turn regulate neurons and blood vessels through calcium-dependent mechanisms, such as the release of signaling molecules. However, [Ca(2+)]i imaging in entire astrocytes has only recently become feasible with genetically encoded calcium indicators (GECIs) such as the GCaMP series. The use of GECIs in astrocytes now provides opportunities to study astrocyte [Ca(2+)]i signals in detail within model microcircuits such as the striatum, which is the largest nucleus of the basal ganglia. In the present report, detailed surgical methods to express GECIs in astrocytes in vivo, and confocal imaging approaches to record [Ca(2+)]i signals in striatal astrocytes in situ, are described. We highlight precautions, necessary controls and tests to determine if GECI expression is selective for astrocytes and to evaluate signs of overt astrocyte reactivity. We also describe brain slice and imaging conditions in detail that permit reliable [Ca(2+)]i imaging in striatal astrocytes in situ. The use of these approaches revealed the entire territories of single striatal astrocytes and spontaneous [Ca(2+)]i signals within their somata, branches and branchlets. The further use and expansion of these approaches in the striatum will allow for the detailed study of astrocyte [Ca(2+)]i signals in the striatal microcircuitry.

  10. Imaging Intracellular Ca2+ Signals in Striatal Astrocytes from Adult Mice Using Genetically-encoded Calcium Indicators

    PubMed Central

    Jiang, Ruotian; Haustein, Martin D.; Sofroniew, Michael V.; Khakh, Baljit S.


    Astrocytes display spontaneous intracellular Ca2+ concentration fluctuations ([Ca2+]i) and in several settings respond to neuronal excitation with enhanced [Ca2+]i signals. It has been proposed that astrocytes in turn regulate neurons and blood vessels through calcium-dependent mechanisms, such as the release of signaling molecules. However, [Ca2+]i imaging in entire astrocytes has only recently become feasible with genetically encoded calcium indicators (GECIs) such as the GCaMP series. The use of GECIs in astrocytes now provides opportunities to study astrocyte [Ca2+]i signals in detail within model microcircuits such as the striatum, which is the largest nucleus of the basal ganglia. In the present report, detailed surgical methods to express GECIs in astrocytes in vivo, and confocal imaging approaches to record [Ca2+]i signals in striatal astrocytes in situ, are described. We highlight precautions, necessary controls and tests to determine if GECI expression is selective for astrocytes and to evaluate signs of overt astrocyte reactivity. We also describe brain slice and imaging conditions in detail that permit reliable [Ca2+]i imaging in striatal astrocytes in situ. The use of these approaches revealed the entire territories of single striatal astrocytes and spontaneous [Ca2+]i signals within their somata, branches and branchlets. The further use and expansion of these approaches in the striatum will allow for the detailed study of astrocyte [Ca2+]i signals in the striatal microcircuitry. PMID:25490346

  11. p190-B RhoGAP and intracellular cytokine signals balance hematopoietic stem and progenitor cell self-renewal and differentiation

    PubMed Central

    Hinge, Ashwini; Xu, Juying; Javier, Jose; Mose, Eucabeth; Kumar, Sachin; Kapur, Reuben; Srour, Edward F.; Malik, Punam; Aronow, Bruce J.; Filippi, Marie-Dominique


    The mechanisms regulating hematopoietic stem and progenitor cell (HSPC) fate choices remain ill-defined. Here, we show that a signalling network of p190-B RhoGAP-ROS-TGF-β-p38MAPK balances HSPC self-renewal and differentiation. Upon transplantation, HSPCs express high amounts of bioactive TGF-β1 protein, which is associated with high levels of p38MAPK activity and loss of HSC self-renewal in vivo. Elevated levels of bioactive TGF-β1 are associated with asymmetric fate choice in vitro in single HSPCs via p38MAPK activity and this is correlated with the asymmetric distribution of activated p38MAPK. In contrast, loss of p190-B, a RhoGTPase inhibitor, normalizes TGF-β levels and p38MAPK activity in HSPCs and is correlated with increased HSC self-renewal in vivo. Loss of p190-B also promotes symmetric retention of multi-lineage capacity in single HSPC myeloid cell cultures, further suggesting a link between p190-B-RhoGAP and non-canonical TGF-β signalling in HSPC differentiation. Thus, intracellular cytokine signalling may serve as ‘fate determinants' used by HSPCs to modulate their activity. PMID:28176763

  12. Dexamethasone enhances insulin-like growth factor-I effects on skeletal muscle cell proliferation. Role of specific intracellular signaling pathways.

    PubMed Central

    Giorgino, F; Smith, R J


    IGF-I stimulation of cell proliferation and c-Fos expression in skeletal muscle cells is markedly enhanced by dexamethasone. The effect of dexamethasone is not mediated by changes in IGF-binding proteins, as evidenced by similar effects of dexamethasone on the actions of insulin, PDGF-BB, and the IGF-I analogue long R3IGF-I. Dexamethasone also does not alter autocrine IGF-II secretion by muscle cells. To investigate the mechanism of the augmentation of IGF-I action, the effects of dexamethasone on intracellular IGF-I signaling pathways were determined. In dexamethasone-treated cells, the levels of IGF-I receptor tyrosine phosphorylation and receptor-associated phosphatidylinositol 3-kinase activity were increased. Dexamethasone-treated cells also showed increased and prolonged tyrosine phosphorylation of the Shc proteins. In contrast, dexamethasone decreased both tyrosine phosphorylation and expression of insulin receptor substrate 1 (IRS-1) and IRS-1-associated phosphatidylinositol 3-kinase activity. Thus, distinct signaling pathways activated by the IGF-I receptor in skeletal muscle cells are differentially regulated by dexamethasone. Potentiation of IGF-I action correlates with increased IGF-I receptor-associated phosphatidylinositol 3-kinase activity and tyrosine phosphorylation of Shc, but appears to be independent of activation of the IRS-1/phosphatidylinositol 3-kinase signaling pathway. Images PMID:7544807

  13. The selective Bcl-2 inhibitor venetoclax, a BH3 mimetic, does not dysregulate intracellular Ca(2+) signaling.


    Vervloessem, Tamara; Ivanova, Hristina; Luyten, Tomas; Parys, Jan B; Bultynck, Geert


    Anti-apoptotic B cell-lymphoma-2 (Bcl-2) proteins are emerging as therapeutic targets in a variety of cancers for precision medicines, like the BH3-mimetic drug venetoclax (ABT-199), which antagonizes the hydrophobic cleft of Bcl-2. However, the impact of venetoclax on intracellular Ca(2+) homeostasis and dynamics in cell systems has not been characterized in detail. Here, we show that venetoclax did not affect Ca(2+)-transport systems from the endoplasmic reticulum (ER) in permeabilized cell systems. Venetoclax (1μM) did neither trigger Ca(2+) release by itself nor affect agonist-induced Ca(2+) release in a variety of intact cell models. Among the different cell types, we also studied two Bcl-2-dependent cancer cell models with a varying sensitivity towards venetoclax, namely SU-DHL-4 and OCI-LY-1, both diffuse large B-cell lymphoma cell lines. Acute application of venetoclax did also not dysregulate Ca(2+) signaling in these Bcl-2-dependent cancer cells. Moreover, venetoclax-induced cell death was independent of intracellular Ca(2+) overload, since Ca(2+) buffering using BAPTA-AM did not suppress venetoclax-induced cell death. This study therefore shows that venetoclax does not dysregulate the intracellular Ca(2+) homeostasis in a variety of cell types, which may underlie its limited toxicity in human patients. Furthermore, venetoclax-induced cell death in Bcl-2-dependent cancer cells is not mediated by intracellular Ca(2+) overload. This article is part of a Special Issue entitled: ECS Meeting edited by Claus Heizmann, Joachim Krebs and Jacques Haiech.

  14. Probing intracellular biomarkers and mediators of cell activation using nanosensors and bioorthogonal chemistry.


    Haun, Jered B; Devaraj, Neal K; Marinelli, Brett S; Lee, Hakho; Weissleder, Ralph


    Nanomaterials offer unique physical properties that make them ideal biosensors for scant cell populations. However, specific targeting of nanoparticles to intracellular proteins has been challenging. Here, we describe a technique to improve intracellular biomarker sensing using nanoparticles that is based on bioorthogonal chemistry. Using trans-cyclooctene-modified affinity ligands that are administered to semipermeabilized cells and revealed by cycloaddition reaction with tetrazine-conjugated nanoparticles, we demonstrate site-specific amplification of nanomaterial binding. We also show that this technique is capable of sensing protein biomarkers and phosho-protein signal mediators, both within the cytosol and nucleus, via magnetic or fluorescent modalities. We expect the described method will have broad applications in nanomaterial-based diagnostics and therapeutics.

  15. Modeling spontaneous activity in the developing spinal cord using activity-dependent variations of intracellular chloride.


    Marchetti, Cristina; Tabak, Joel; Chub, Nikolai; O'Donovan, Michael J; Rinzel, John


    We investigated how spontaneous activity is generated in developing, hyperexcitable networks. We focused our study on the embryonic chick spinal cord, a preparation that exhibits rhythmic discharge on multiple timescales: slow episodes (lasting minutes) and faster intraepisode cycling (approximately 1 Hz frequency). For this purpose, we developed a mean field model of a recurrent network with slow chloride dynamics and a fast depression variable. We showed that the model, in addition to providing a biophysical mechanism for the slow dynamics, was able to account for the experimentally observed activity. The model made predictions on how interval and duration of episodes are affected when changing chloride-mediated synaptic transmission or chloride flux across cell membrane. These predictions guided experiments, and the model results were compared with experimental data obtained with electrophysiological recordings. We found agreement when transmission was affected through changes in synaptic conductance and good qualitative agreement when chloride flux was varied through changes in external chloride concentration or in the rate of the Na+-K+-2Cl- cotransporter. Furthermore, the model made predictions about the time course of intracellular chloride concentration and chloride reversal potential and how these are affected by changes in synaptic conductance. Based on the comparison between modeling and experimental results, we propose that chloride dynamics could be an important mechanism in rhythm generation in the developing chick spinal cord.

  16. Activation of tumoricidal properties in human blood monocytes by muramyl dipeptide requires specific intracellular interaction

    SciTech Connect

    Fogler, W.E.; Fidler, I.J.


    The purpose of this study was to identify the mechanism by which muramyl dipeptide (MDP) activates antitumor cytotoxic properties in normal and interferon-..gamma.. (IFN-..gamma..)-primed human peripheral blood monocytes. The structurally and functionally active MDP analog, nor-muramyl dipeptide (nor-MDP), and (/sup 3/H)nor-MDP were used as reference glycopeptides. Direct activation of normal, noncytotoxic monocytes by nor-MDP was enhanced its encapsulation within multilamellar vesicles (MLV). Studies with (/sup 3/H)nor-MDP revealed that the activation of monocytes by nor-MDP was not attributable to its interaction with a specific cell surface receptor, nor did it result merely from the internalization by monocytes of glycopeptide. Subthreshold concentrations of nor-MDP could activate tumor cytotoxic properties in IFN-..gamma..-primed monocytes. The intracellular interaction of (/sup 3/H)nor-MDP with IFN-..gamma..-primed monocytes was specific in that intracellular levels of radiolabeled material could be displaced and recovered as intact molecules by unlabeled nor-MDP, but not by a biologically inactive MDP stereoisomer. Collectively, these results suggest that the activation of tumoricidal properties in human blood monocytes by MDP occurs subsequent to intracellular interaction with specific MDP receptors.

  17. Dual chemotaxis signalling regulates Dictyostelium development: intercellular cyclic AMP pulses and intracellular F-actin disassembly waves induce each other.


    Vicker, Michael G; Grutsch, James F


    Aggregating Dictyostelium discoideum amoebae periodically emit and relay cAMP, which regulates their chemotaxis and morphogenesis into a multicellular, differentiated organism. Cyclic AMP also stimulates F-actin assembly and chemotactic pseudopodium extension. We used actin-GFP expression to visualise for the first time intracellular F-actin assembly as a spatio-temporal indicator of cell reactions to cAMP, and thus the kinematics of cell communication, in aggregating streams. Every natural cAMP signal pulse induces an autowave of F-actin disassembly, which propagates from each cell's leading end to its trailing end at a linear rate, much slower than the calculated and measured velocities of cAMP diffusion in aggregating Dictyostelium. A sequence of transient reactions follows behind the wave, including anterior F-actin assembly, chemotactic pseudopodium extension and cell advance at the cell front and, at the back, F-actin assembly, extension of a small retrograde pseudopodium (forcing a brief cell retreat) and chemotactic stimulation of the following cell, yielding a 20s cAMP relay delay. These dynamics indicate that stream cell behaviour is mediated by a dual signalling system: a short-range cAMP pulse directed from one cell tail to an immediately following cell front and a slower, long-range wave of intracellular F-actin disassembly, each inducing the other.

  18. CETSA screening identifies known and novel thymidylate synthase inhibitors and slow intracellular activation of 5-fluorouracil

    NASA Astrophysics Data System (ADS)

    Almqvist, Helena; Axelsson, Hanna; Jafari, Rozbeh; Dan, Chen; Mateus, André; Haraldsson, Martin; Larsson, Andreas; Molina, Daniel Martinez; Artursson, Per; Lundbäck, Thomas; Nordlund, Pär


    Target engagement is a critical factor for therapeutic efficacy. Assessment of compound binding to native target proteins in live cells is therefore highly desirable in all stages of drug discovery. We report here the first compound library screen based on biophysical measurements of intracellular target binding, exemplified by human thymidylate synthase (TS). The screen selected accurately for all the tested known drugs acting on TS. We also identified TS inhibitors with novel chemistry and marketed drugs that were not previously known to target TS, including the DNA methyltransferase inhibitor decitabine. By following the cellular uptake and enzymatic conversion of known drugs we correlated the appearance of active metabolites over time with intracellular target engagement. These data distinguished a much slower activation of 5-fluorouracil when compared with nucleoside-based drugs. The approach establishes efficient means to associate drug uptake and activation with target binding during drug discovery.

  19. CETSA screening identifies known and novel thymidylate synthase inhibitors and slow intracellular activation of 5-fluorouracil

    PubMed Central

    Almqvist, Helena; Axelsson, Hanna; Jafari, Rozbeh; Dan, Chen; Mateus, André; Haraldsson, Martin; Larsson, Andreas; Molina, Daniel Martinez; Artursson, Per; Lundbäck, Thomas; Nordlund, Pär


    Target engagement is a critical factor for therapeutic efficacy. Assessment of compound binding to native target proteins in live cells is therefore highly desirable in all stages of drug discovery. We report here the first compound library screen based on biophysical measurements of intracellular target binding, exemplified by human thymidylate synthase (TS). The screen selected accurately for all the tested known drugs acting on TS. We also identified TS inhibitors with novel chemistry and marketed drugs that were not previously known to target TS, including the DNA methyltransferase inhibitor decitabine. By following the cellular uptake and enzymatic conversion of known drugs we correlated the appearance of active metabolites over time with intracellular target engagement. These data distinguished a much slower activation of 5-fluorouracil when compared with nucleoside-based drugs. The approach establishes efficient means to associate drug uptake and activation with target binding during drug discovery. PMID:27010513

  20. Separation of synaptic and spike activity in intracellular recordings for selective analysis.


    Hedwig, B; Knepper, M


    A software spike filter has been developed which allows the separation of synaptic activity and action potentials in intracellular recordings. The algorithm uses the different velocities of the membrane potential during synaptic and spike activity and a time window to identify action potentials. When spikes are recognized, they are removed and the membrane potential is substituted by interpolated values. The spike filter makes possible a separate quantitative evaluation of postsynaptic potentials and spike activity. Thus a comprehensive characterization of neuron activity can be obtained. The spike filter is part of a modular software package designed for the evaluation of neurobiological data.

  1. Modelling intracellular competition for calcium: kinetic and thermodynamic control of different molecular modes of signal decoding

    PubMed Central

    Antunes, Gabriela; Roque, Antonio C.; Simoes de Souza, Fabio M.


    Frequently, a common chemical entity triggers opposite cellular processes, which implies that the components of signalling networks must detect signals not only through their chemical natures, but also through their dynamic properties. To gain insights on the mechanisms of discrimination of the dynamic properties of cellular signals, we developed a computational stochastic model and investigated how three calcium ion (Ca2+)-dependent enzymes (adenylyl cyclase (AC), phosphodiesterase 1 (PDE1), and calcineurin (CaN)) differentially detect Ca2+ transients in a hippocampal dendritic spine. The balance among AC, PDE1 and CaN might determine the occurrence of opposite Ca2+-induced forms of synaptic plasticity, long-term potentiation (LTP) and long-term depression (LTD). CaN is essential for LTD. AC and PDE1 regulate, indirectly, protein kinase A, which counteracts CaN during LTP. Stimulations of AC, PDE1 and CaN with artificial and physiological Ca2+ signals demonstrated that AC and CaN have Ca2+ requirements modulated dynamically by different properties of the signals used to stimulate them, because their interactions with Ca2+ often occur under kinetic control. Contrarily, PDE1 responds to the immediate amplitude of different Ca2+ transients and usually with the same Ca2+ requirements observed under steady state. Therefore, AC, PDE1 and CaN decode different dynamic properties of Ca2+ signals. PMID:27033299

  2. Differential functions of the Apoer2 intracellular domain in selenium uptake and cell signaling.


    Masiulis, Irene; Quill, Timothy A; Burk, Raymond F; Herz, Joachim


    Apolipoprotein E receptor 2 (Apoer2) is a multifunctional transport and signaling receptor that regulates the uptake of selenium into the mouse brain and testis through endocytosis of selenoprotein P (Sepp1). Mice deficient in Apoer2 or Sepp1 are infertile, with kinked and hypomotile spermatozoa. They also develop severe neurological defects on a low selenium diet, due to a profound impairment of selenium uptake. Little is known about the function of Apoer2 in the testis beyond its role as a Sepp1 receptor. By contrast, in the brain, Apoer2 is an essential component of the Reelin signaling pathway, which is required for proper neuronal organization and synapse function. Using knock-in mice, we have functionally dissociated the signaling motifs in the Apoer2 cytoplasmic domain from Sepp1 uptake. Selenium concentration of brain and testis was normal in the knock-in mutants, in contrast to Apoer2 knock-outs. Thus, the neurological defects in the signaling impaired knock-in mice are not caused by a selenium uptake defect, but instead are a direct consequence of a disruption of the Reelin signal. Reduced sperm motility was observed in some of the knock-in mice, indicating a novel signaling role for Apoer2 in sperm development and function that is independent of selenium uptake.

  3. PIP2 Activates TRPV5 and Releases Its Inhibition by Intracellular Mg2+

    PubMed Central

    Lee, Jason; Cha, Seung-Kuy; Sun, Tie-Jun; Huang, Chou-Long


    The transient receptor potential type V5 channel (TRPV5) is a Ca2+-selective TRP channel important for epithelial Ca2+ transport. Intracellular Mg2+ causes a fast voltage-dependent block of the TRPV5 channel by binding to the selectivity filter. Here, we report that intracellular Mg2+ binding to the selectivity filter of TRPV5 also causes a slower reversible conformational change leading to channel closure. We further report that PIP2 activates TRPV5. Activation of TRPV5 by PIP2 is independent of Mg2+. Yet, PIP2 decreases sensitivity of the channel to the Mg2+-induced slow inhibition. Mutation of aspartate-542, a critical Mg2+-binding site in the selectivity filter, abolishes Mg2+-induced slow inhibition. PIP2 has no effects on Mg2+-induced voltage-dependent block. Thus, PIP2 prevents the Mg2+-induced conformational change without affecting Mg2+ binding to the selectivity filter. Hydrolysis of PIP2 via receptor activation of phospholipase C sensitizes TRPV5 to the Mg2+-induced slow inhibition. These results provide a novel mechanism for regulation of TRP channels by phospholipase C–activating hormones via alteration of the sensitivity to intracellular Mg2+. PMID:16230466

  4. Variation in human cancer cell external phosphatidylserine is regulated by flippase activity and intracellular calcium.


    Vallabhapurapu, Subrahmanya D; Blanco, Víctor M; Sulaiman, Mahaboob K; Vallabhapurapu, Swarajya Lakshmi; Chu, Zhengtao; Franco, Robert S; Qi, Xiaoyang


    Viable cancer cells expose elevated levels of phosphatidylserine (PS) on the exoplasmic face of the plasma membrane. However, the mechanisms leading to elevated PS exposure in viable cancer cells have not been defined. We previously showed that externalized PS may be used to monitor, target and kill tumor cells. In addition, PS on tumor cells is recognized by macrophages and has implications in antitumor immunity. Therefore, it is important to understand the molecular details of PS exposure on cancer cells in order to improve therapeutic targeting. Here we explored the mechanisms regulating the surface PS exposure in human cancer cells and found that differential flippase activity and intracellular calcium are the major regulators of surface PS exposure in viable human cancer cells. In general, cancer cell lines with high surface PS exhibited low flippase activity and high intracellular calcium, whereas cancer cells with low surface PS exhibited high flippase activity and low intracellular calcium. High surface PS cancer cells also had higher total cellular PS than low surface PS cells. Together, our results indicate that the amount of external PS in cancer cells is regulated by calcium dependent flippase activity and may also be influenced by total cellular PS.

  5. Two helices in the third intracellular loop determine anoctamin 1 (TMEM16A) activation by calcium.


    Lee, Jesun; Jung, Jooyoung; Tak, Min Ho; Wee, Jungwon; Lee, Byeongjoon; Jang, Yongwoo; Chun, Hyeyeon; Yang, Dong-Jin; Yang, Young Duk; Park, Sang Ho; Han, Byung Woo; Hyun, Soonsil; Yu, Jaehoon; Cho, Hawon; Hartzell, H Criss; Oh, Uhtaek


    Anoctamin 1 (ANO1)/TMEM16A is a Cl(-) channel activated by intracellular Ca(2+) mediating numerous physiological functions. However, little is known of the ANO1 activation mechanism by Ca(2+). Here, we demonstrate that two helices, "reference" and "Ca(2+) sensor" helices in the third intracellular loop face each other with opposite charges. The two helices interact directly in a Ca(2+)-dependent manner. Positively and negatively charged residues in the two helices are essential for Ca(2+)-dependent activation because neutralization of these charges change the Ca(2+) sensitivity. We now predict that the Ca(2+) sensor helix attaches to the reference helix in the resting state, and as intracellular Ca(2+) rises, Ca(2+) acts on the sensor helix, which repels it from the reference helix. This Ca(2+)-dependent push-pull conformational change would be a key electromechanical movement for gating the ANO1 channel. Because chemical activation of ANO1 is viewed as an alternative means of rescuing cystic fibrosis, understanding its gating mechanism would be useful in developing novel treatments for cystic fibrosis.

  6. Single-cell mass cytometry reveals intracellular survival/proliferative signaling in FLT3-ITD-mutated AML stem/progenitor cells.


    Han, Lina; Qiu, Peng; Zeng, Zhihong; Jorgensen, Jeffrey L; Mak, Duncan H; Burks, Jared K; Schober, Wendy; McQueen, Teresa J; Cortes, Jorge; Tanner, Scott D; Roboz, Gail J; Kantarjian, Hagop M; Kornblau, Steven M; Guzman, Monica L; Andreeff, Michael; Konopleva, Marina


    Understanding the unique phenotypes and complex signaling pathways of leukemia stem cells (LSCs) will provide insights and druggable targets that can be used to eradicate acute myeloid leukemia (AML). Current work on AML LSCs is limited by the number of parameters that conventional flow cytometry (FCM) can analyze because of cell autofluorescence and fluorescent dye spectral overlap. Single-cell mass cytometry (CyTOF) substitutes rare earth elements for fluorophores to label antibodies, which allows measurements of up to 120 parameters in single cells without correction for spectral overlap. The aim of this study was the evaluation of intracellular signaling in antigen-defined stem/progenitor cell subsets in primary AML. CyTOF and conventional FCM yielded comparable results on LSC phenotypes defined by CD45, CD34, CD38, CD123, and CD99. Intracellular phosphoprotein responses to ex vivo cell signaling inhibitors and cytokine stimulation were assessed in myeloid leukemia cell lines and one primary AML sample. CyTOF and conventional FCM results were confirmed by western blotting. In the primary AML sample, we investigated the cell responses to ex vivo stimulation with stem cell factor and BEZ235-induced inhibition of PI3K and identified activation patterns in multiple PI3K downstream signaling pathways including p-4EBP1, p-AKT, and p-S6, particularly in CD34(+) subsets. We evaluated multiple signaling pathways in antigen-defined subpopulations in primary AML cells with FLT3-ITD mutations. The data demonstrated the heterogeneity of cell phenotype distribution and distinct patterns of signaling activation across AML samples and between AML and normal samples. The mTOR targets p-4EBP1 and p-S6 were exclusively found in FLT3-ITD stem/progenitor cells, but not in their normal counterparts, suggesting both as novel targets in FLT3 mutated AML. Our data suggest that CyTOF can identify functional signaling pathways in antigen-defined subpopulations in primary AML, which may

  7. Members of the chloride intracellular ion channel protein family demonstrate glutaredoxin-like enzymatic activity.


    Al Khamici, Heba; Brown, Louise J; Hossain, Khondker R; Hudson, Amanda L; Sinclair-Burton, Alxcia A; Ng, Jane Phui Mun; Daniel, Elizabeth L; Hare, Joanna E; Cornell, Bruce A; Curmi, Paul M G; Davey, Mary W; Valenzuela, Stella M


    The Chloride Intracellular Ion Channel (CLIC) family consists of six evolutionarily conserved proteins in humans. Members of this family are unusual, existing as both monomeric soluble proteins and as integral membrane proteins where they function as chloride selective ion channels, however no function has previously been assigned to their soluble form. Structural studies have shown that in the soluble form, CLIC proteins adopt a glutathione S-transferase (GST) fold, however, they have an active site with a conserved glutaredoxin monothiol motif, similar to the omega class GSTs. We demonstrate that CLIC proteins have glutaredoxin-like glutathione-dependent oxidoreductase enzymatic activity. CLICs 1, 2 and 4 demonstrate typical glutaredoxin-like activity using 2-hydroxyethyl disulfide as a substrate. Mutagenesis experiments identify cysteine 24 as the catalytic cysteine residue in CLIC1, which is consistent with its structure. CLIC1 was shown to reduce sodium selenite and dehydroascorbate in a glutathione-dependent manner. Previous electrophysiological studies have shown that the drugs IAA-94 and A9C specifically block CLIC channel activity. These same compounds inhibit CLIC1 oxidoreductase activity. This work for the first time assigns a functional activity to the soluble form of the CLIC proteins. Our results demonstrate that the soluble form of the CLIC proteins has an enzymatic activity that is distinct from the channel activity of their integral membrane form. This CLIC enzymatic activity may be important for protecting the intracellular environment against oxidation. It is also likely that this enzymatic activity regulates the CLIC ion channel function.

  8. Intracellular Loop 2 Peptides of the Human 5HT1a Receptor are Differential Activators of Gi

    PubMed Central

    Hall, Brian; Squires, Carley; Parker, Keith K.


    Peptide mimics of intracellular loop 2 (ic2) of the human 5HT1a receptor have been studied with respect to their ability to inhibit agonist binding via interference with receptor-G-protein coupling. These peptides give shallow concentration-effect relationships. Additionally, these peptides have been studied with respect to their ability to trigger the signal transduction system of this Gi-coupled receptor. Two signaling parameters have been quantified: concentration of intracellular cAMP and changes in incorporation into the G protein of a stable analog of GTP. In both cases, peptide mimics near midloop of ic2 actually show agonist activity with efficacy falling off toward both loop termini near TM 3 and TM 4. Previous results have suggested that the loop region near the TM3/ic2 interface is primarily responsible for receptor-G-protein coupling, while the current result emphasizes the mid-ic2 loop region's ability to activate the G protein following initial coupling. A limited number of peptides from the receptor's TM5/ic3 loop vicinity were also studied regarding agonist inhibition and G-protein activation. These peptides provide additional evidence that the human 5HT1a receptor, TM5/ic3 loop region, is involved in both coupling and activation actions. Overall, these results provide further information about potential pharmacological intervention and drug development with respect to the human 5HT1a receptor/G-protein system. Finally, the structural evidence generated here provides testable models pending crystallization and X-ray analysis of the receptor. PMID:22649462

  9. Active intracellular transport in metastatic cells studied by spatial light interference microscopy

    NASA Astrophysics Data System (ADS)

    Ceballos, Silvia; Kandel, Mikhail; Sridharan, Shamira; Majeed, Hassaan; Monroy, Freddy; Popescu, Gabriel


    Spatiotemporal patterns of intracellular transport are very difficult to quantify and, consequently, continue to be insufficiently understood. While it is well documented that mass trafficking inside living cells consists of both random and deterministic motions, quantitative data over broad spatiotemporal scales are lacking. We studied the intracellular transport in live cells using spatial light interference microscopy, a high spatiotemporal resolution quantitative phase imaging tool. The results indicate that in the cytoplasm, the intracellular transport is mainly active (directed, deterministic), while inside the nucleus it is both active and passive (diffusive, random). Furthermore, we studied the behavior of the two-dimensional mass density over 30 h in HeLa cells and focused on the active component. We determined the standard deviation of the velocity distribution at the point of cell division for each cell and compared the standard deviation velocity inside the cytoplasm and the nucleus. We found that the velocity distribution in the cytoplasm is consistently broader than in the nucleus, suggesting mechanisms for faster transport in the cytosol versus the nucleus. Future studies will focus on improving phase measurements by applying a fluorescent tag to understand how particular proteins are transported inside the cell.

  10. Clioquinol and pyrithione activate TRPA1 by increasing intracellular Zn2+.


    Andersson, David A; Gentry, Clive; Moss, Sian; Bevan, Stuart


    The antifungal and amoebicidal drug clioquinol (CQ) was withdrawn from the market when it was linked to an epidemic of subacute myelo-optico-neuropathy (SMON). Clioquinol exerts its anti-parasitic actions by acting as a Cu/Zn chelator and ionophore. Here we show that local injections of CQ produce mechanical hyperalgesia and cold hypersensitivity through a mechanism involving TRPA1 in mice. We also show that CQ activates TRPA1 in a Zn(2+)-dependent manner. Using a different Zn(2+)-ionophore, zinc pyrithione (ZnPy), we demonstrate that low, nanomolar concentrations of intracellular Zn(2+) ([Zn(2+)](i)) stimulate TRPA1. Direct application of Zn(2+) to the intracellular face of excised, inside-out patches activates TRPA1 with an EC(50) value of 7.5 +/- 1 nM. TRPA1 is expressed in a subpopulation of nociceptive dorsal root ganglion (DRG) neurons, where it acts as a sensory receptor for environmental irritants and oxidants. Using cultured DRG neurons from wild-type and TRPA1-deficient mice, we demonstrate that TRPA1 is the principal excitatory receptor for increased [Zn(2+)](i) in DRG neurons. In conclusion, we have discovered that TRPA1 acts a sensor of intracellular Zn(2+), and that Zn(2+) ionophores, such as CQ and ZnPy, activate TRPA1 by increasing [Zn(2+)](i). We also demonstrate that CQ-evoked mechanical hyperalgesia and cold allodynia require TRPA1 in vivo.

  11. In vitro activity of artemisone and artemisinin derivatives against extracellular and intracellular Helicobacter pylori.


    Sisto, Francesca; Scaltrito, Maria Maddalena; Masia, Carla; Bonomi, Arianna; Coccè, Valentina; Marano, Giuseppe; Haynes, Richard K; Miani, Alessandro; Farronato, Giampietro; Taramelli, Donatella


    The in vitro activity of the new artemisinin derivative artemisone as well as other molecules of the same class against Helicobacter pylori and their effects when combined with standard antibiotics were evaluated. Since H. pylori can be internalised into gastric epithelial cells, the effects of artemisinin, dihydroartemisinin and artemisone against intracellular H. pylori were also investigated. Bacteriostatic [minimum inhibitory concentration (MIC)] and bactericidal [minimum bactericidal concentration (MBC)] activities were assessed against 24 clinical strains of H. pylori with different antibiotics susceptibilities. Artemisone showed MIC50 and MIC90 values of 0.25 mg/L and 0.5 mg/L, respectively, and an MBC50 value of 0.5 mg/L. Artemisone was synergistic with amoxicillin in 60% of strains, with clarithromycin in 40% and with metronidazole in 20%. There was no interaction between artemisone and omeprazole or bismuth citrate. Against intracellular H. pylori, only dihydroartemisinin at 2× MIC caused a 1 log10 CFU decrease after 18 h and 24 h of incubation. This is the first demonstration in vitro of the activity of artemisinin derivatives against intracellular H. pylori and indicates that artemisone has the potential to be efficacious for the treatment of H. pylori infection, especially in combination with antibiotics.

  12. Intracellular ROS Protection Efficiency and Free Radical-Scavenging Activity of Curcumin

    PubMed Central

    Barzegar, Abolfazl; Moosavi-Movahedi, Ali A.


    Curcumin has many pharmaceutical applications, many of which arise from its potent antioxidant properties. The present research examined the antioxidant activities of curcumin in polar solvents by a comparative study using ESR, reduction of ferric iron in aqueous medium and intracellular ROS/toxicity assays. ESR data indicated that the steric hindrance among adjacent big size groups within a galvinoxyl molecule limited the curcumin to scavenge galvinoxyl radicals effectively, while curcumin showed a powerful capacity for scavenging intracellular smaller oxidative molecules such as H2O2, HO•, ROO•. Cell viability and ROS assays demonstrated that curcumin was able to penetrate into the polar medium inside the cells and to protect them against the highly toxic and lethal effects of cumene hydroperoxide. Curcumin also showed good electron-transfer capability, with greater activity than trolox in aqueous solution. Curcumin can readily transfer electron or easily donate H-atom from two phenolic sites to scavenge free radicals. The excellent electron transfer capability of curcumin is because of its unique structure and different functional groups, including a β-diketone and several π electrons that have the capacity to conjugate between two phenyl rings. Therfore, since curcumin is inherently a lipophilic compound, because of its superb intracellular ROS scavenging activity, it can be used as an effective antioxidant for ROS protection within the polar cytoplasm. PMID:22016801

  13. Catalytic activity of human carbonic anhydrase isoform IX is displayed both extra- and intracellularly.


    Klier, Michael; Jamali, Somayeh; Ames, Samantha; Schneider, Hans-Peter; Becker, Holger M; Deitmer, Joachim W


    Most carbonic anhydrases catalyse the reversible conversion of carbon dioxide to protons and bicarbonate, either as soluble cytosolic enzymes, in or at intracellular organelles, or at the extracellular face of the cell membrane as membrane-anchored proteins. Carbonic anhydrase isoform IX (CA IX), a membrane-bound enzyme with catalytic activity at the extracellular membrane surface, has come to prominence in recent years because of its association with hypoxic tissue, particularly tumours, often indicating poor prognosis. We have evaluated the catalytic activity of CA IX heterologously expressed in Xenopus laevis oocytes by measuring the amplitude and rate of cytosolic pH changes as well as pH changes at the outer membrane surface (pHs ) during addition and removal of 5% CO2 /25 mm HCO3-, and by mass spectrometry. Our results indicate both extracellular and intracellular catalytic activity of CA IX. Reduced rates of CO2 -dependent intracellular pH changes after knockdown of CA IX confirmed these findings in two breast cancer cell lines: MCF-7 and MDA-MB-231. Our results demonstrate a new function of CA IX that may be important in the search for therapeutic cancer drugs targeting CA IX.

  14. Valproic Acid Influences MTNR1A Intracellular Trafficking and Signaling in a β-Arrestin 2-Dependent Manner.


    Hong, Ling-juan; Jiang, Quan; Long, Sen; Wang, Huan; Zhang, Ling-di; Tian, Yun; Wang, Cheng-kun; Cao, Jing-jing; Tao, Rong-rong; Huang, Ji-yun; Liao, Mei-hua; Lu, Ying-mei; Fukunaga, Kohji; Zhou, Nai-ming; Han, Feng


    Valproate exposure is associated with increased risks of autism spectrum disorder. To date, the mechanistic details of disturbance of melatonin receptor subtype 1 (MTNR1A) internalization upon valproate exposure remain elusive. By expressing epitope-tagged receptors (MTNR1A-EGFP) in HEK-293 and Neuro-2a cells, we recorded the dynamic changes of MTNR1A intracellular trafficking after melatonin treatment. Using time-lapse confocal microscopy, we showed in living cells that valproic acid interfered with the internalization kinetics of MTNR1A in the presence of melatonin. This attenuating effect was associated with a decrease in the phosphorylation of PKA (Thr197) and ERK (Thr202/Tyr204). VPA treatment did not alter the whole-cell currents of cells with or without melatonin. Furthermore, fluorescence resonance energy transfer imaging data demonstrated that valproic acid reduced the melatonin-initiated association between YFP-labeled β-arrestin 2 and CFP-labeled MTNR1A. Together, we suggest that valproic acid influences MTNR1A intracellular trafficking and signaling in a β-arrestin 2-dependent manner.

  15. Localization of the Intracellular Activity Domain of Pasteurella multocida Toxin to the N Terminus

    PubMed Central

    Wilson, Brenda A.; Ponferrada, Virgilio G.; Vallance, Jefferson E.; Ho, Mengfei


    We have shown that Pasteurella multocida toxin (PMT) directly causes transient activation of Gqα protein that is coupled to phosphatidylinositol-specific phospholipase Cβ1 in Xenopus oocytes (B. A. Wilson, X. Zhu, M. Ho, and L. Lu, J. Biol. Chem. 272:1268–1275, 1997). We found that antibodies directed against an N-terminal peptide of PMT inhibited the toxin-induced response in Xenopus oocytes, but antibodies against a C-terminal peptide did not. To test whether the intracellular activity domain of PMT is localized to the N terminus, we conducted a deletion mutational analysis of the PMT protein, using the Xenopus oocyte system as a means of screening for toxin activity. Using PCR and conventional cloning techniques, we cloned from a toxinogenic strain of P. multocida the entire toxA gene, encoding the 1,285-amino-acid PMT protein, and expressed the recombinant toxin as a His-tagged fusion protein in Escherichia coli. We subsequently generated a series of N-terminal and C-terminal deletion mutants and expressed the His-tagged PMT fragments in E. coli. These proteins were screened for cytotoxic activity on cultured Vero cells and for intracellular activity in the Xenopus oocyte system. Only the full-length protein without the His tag exhibited activity on Vero cells. The full-length PMT and N-terminal fragments containing the first 500 residues elicited responses in oocytes, but the C-terminal 780 amino acid fragment did not. Our results confirm that the intracellular activity domain of PMT is localized to the N-terminal 500 amino acids of the protein and that the C terminus is required for entry into cells. PMID:9864199

  16. Activation of intracellular serine proteinase in Bacillus subtilis cells during sporulation.

    PubMed Central

    Burnett, T J; Shankweiler, G W; Hageman, J H


    Cells of Bacillus subtilis 168 (trpC2) growing and sporulating in a single chemically defined medium carried out intracellular protein degradation and increased their levels of intracellular serine protease-1 in a manner very similar to what had previously been reported for cells sporulating in nutrient broth. The results were interpreted to mean that these processes are intrinsic to sporulation rather than medium dependent. To determine the cause of these increases in specific activity of proteinases, we purified the protease, prepared rabbit immunoglobulins directed against it, and monitored changes in protease antigen levels by performing rocket immunoelectrophoresis. In cells sporulating in nutrient broth, the protease antigen levels increased about 7-fold, whereas the specific activity increased about 150-fold, for an activation of about 20-fold. In cells sporulating in the single chemically defined sporulation medium, the protease antigen increased about 10-fold, whereas the specific activity increased at least 400-fold, for an activation of about 40-fold. These results were interpreted to mean that a posttranslational event activated the protease in vivo; a previously described endogenous proteinase inhibitor was confirmed to be present in the strain used. Chloramphenicol added to the cultures inhibited both the increases in antigen levels and in the specific activity of the proteinase. PMID:3079745

  17. Activity Dependent Signal Transduction in Skeletal Muscle

    NASA Technical Reports Server (NTRS)

    Hamilton, Susan L.


    The overall goals of this project are: 1) to define the initial signal transduction events whereby the removal of gravitational load from antigravity muscles, such as the soleus, triggers muscle atrophy, and 2) to develop countermeasures to prevent this from happening. Our rationale for this approach is that, if countermeasures can be developed to regulate these early events, we could avoid having to deal with the multiple cascades of events that occur downstream from the initial event. One of our major findings is that hind limb suspension causes an early and sustained increase in intracellular Ca(2+) concentration ([Ca (2+)](sub i)). In most cells the consequences of changes in ([Ca (2+)](sub i))depend on the amplitude, frequency and duration of the Ca(2+) signal and on other factors in the intracellular environment. We propose that muscle remodeling in microgravity represents a change in the balance among several CA(2+) regulated signal transduction pathways, in particular those involving the transcription factors NFAT and NFkB and the pro-apoptotic protein BAD. Other Ca(2+) sensitive pathways involving PKC, ras, rac, and CaM kinase II may also contribute to muscle remodeling.

  18. Activation of Ca(2+) -activated Cl(-) channel ANO1 by localized Ca(2+) signals.


    Jin, Xin; Shah, Sihab; Du, Xiaona; Zhang, Hailin; Gamper, Nikita


    Ca(2+)-activated chloride channels (CaCCs) regulate numerous physiological processes including epithelial transport, smooth muscle contraction and sensory processing. Anoctamin-1 (ANO1, TMEM16A) is a principal CaCC subunit in many cell types, yet our understanding of the mechanisms of ANO1 activation and regulation are only beginning to emerge. Ca(2+) sensitivity of ANO1 is rather low and at negative membrane potentials the channel requires several micromoles of intracellular Ca(2+) for activation. However, global Ca(2+) levels in cells rarely reach such levels and, therefore, there must be mechanisms that focus intracellular Ca(2+) transients towards the ANO1 channels. Recent findings indeed indicate that ANO1 channels often co-localize with sources of intracellular Ca(2+) signals. Interestingly, it appears that in many cell types ANO1 is particularly tightly coupled to the Ca(2+) release sites of the intracellular Ca(2+) stores. Such preferential coupling may represent a general mechanism of ANO1 activation in native tissues.

  19. Intracellular alkalization causes pain sensation through activation of TRPA1 in mice

    PubMed Central

    Fujita, Fumitaka; Uchida, Kunitoshi; Moriyama, Tomoko; Shima, Asako; Shibasaki, Koji; Inada, Hitoshi; Sokabe, Takaaki; Tominaga, Makoto


    Vertebrate cells require a very narrow pH range for survival. Cells accordingly possess sensory and defense mechanisms for situations where the pH deviates from the viable range. Although the monitoring of acidic pH by sensory neurons has been attributed to several ion channels, including transient receptor potential vanilloid 1 channel (TRPV1) and acid-sensing ion channels (ASICs), the mechanisms by which these cells detect alkaline pH are not well understood. Here, using Ca2+ imaging and patch-clamp recording, we showed that alkaline pH activated transient receptor potential cation channel, subfamily A, member 1 (TRPA1) and that activation of this ion channel was involved in nociception. In addition, intracellular alkalization activated TRPA1 at the whole-cell level, and single-channel openings were observed in the inside-out configuration, indicating that alkaline pH activated TRPA1 from the inside. Analyses of mutants suggested that the two N-terminal cysteine residues in TRPA1 were involved in activation by intracellular alkalization. Furthermore, intraplantar injection of ammonium chloride into the mouse hind paw caused pain-related behaviors that were not observed in TRPA1-deficient mice. These results suggest that alkaline pH causes pain sensation through activation of TRPA1 and may provide a molecular explanation for some of the human alkaline pH–related sensory disorders whose mechanisms are largely unknown. PMID:19033673

  20. In Situ Ratiometric Quantitative Tracing of Intracellular Leucine Aminopeptidase Activity via an Activatable Near-Infrared Fluorescent Probe.


    Gu, Kaizhi; Liu, Yajing; Guo, Zhiqian; Lian, Cheng; Yan, Chenxu; Shi, Ping; Tian, He; Zhu, Wei-Hong


    Leucine aminopeptidase (LAP), one of the important proteolytic enzymes, is intertwined with the progress of many pathological disorders as a well-defined biomarker. To explore fluorescent aminopeptidase probe for quantitative detection of LAP distribution and dynamic changes, herein we report a LAP-targeting near-infrared (NIR) fluorescent probe (DCM-Leu) for ratiometric quantitative trapping of LAP activity in different kinds of living cells. DCM-Leu is composed of a NIR-emitting fluorophore (DCM) as a reporter and l-leucine as a triggered moiety, which are linked together by an amide bond specific for LAP cleavage. High contrast on the ratiometric NIR fluorescence signal can be achieved in response to LAP activity, thus enabling quantification of endogenous LAP with "build-in calibration" as well as minimal background interference. Its ratiometric NIR signal can be blocked in a dose-dependent manner by bestatin, an LAP inhibitor, indicating that the alteration of endogenous LAP activity results in these obviously fluorescent signal responses. It is worth noting that DCM-Leu features striking characteristics such as a large Stokes shift (∼205 nm), superior selectivity, and strong photostability responding to LAP. Impressively, not only did we successfully exemplify DCM-Leu in situ ratiometric trapping and quantification of endogenous LAP activity in various types of living cells, but also, with the aid of three-dimensional confocal imaging, the intracellular LAP distribution is clearly observed from different perspectives for the first time, owing to the high signal-to-noise of ratiometric NIR fluorescent response. Collectively, these results demonstrate preclinical potential value of DCM-Leu serving as a useful NIR fluorescent probe for early detection of LAP-associated disease and screening inhibitor.

  1. Linkage of protein kinase C-beta activation and intracellular interleukin-2 accumulation in human naive CD4 T cells.

    PubMed Central

    Hassan, J; Rainsford, E; Reen, D J


    A critical role for protein kinase C (PKC) in signal transduction events has been well established. Moreover, studies of regulation in PKC levels suggest participation in mediating long-term cellular functions. Protein kinase C-beta (PKC-beta) has been reported to be involved in interleukin-2 (IL-2) synthesis in T lymphocytes. In this study, the role of PKC-beta in intracellular accumulation of IL-2 was investigated using specific inhibitors. Preincubation with two different PKC inhibitors, one specific for classical isotypes (alpha and beta I) Go6976, and one which inhibits both classical and non-classical isotypes, GF109203X, caused a complete block in cytoplasmic IL-2 accumulation when naive CD4 T cells were stimulated in the presence of CD2+CD28+phorbol myristate acetate (PMA). In contrast, preincubation with up to 1000 ng/ml of cyclosporin A (CsA) resulted in a reduction in the intracellular IL-2 detected, as observed by a decrease in the proportion of positive cells as well as a fall in the mean fluorescence intensity (MFI). CsA did not influence PKC-beta translocation. Flow cytometric assessments of PKC-beta and its isoforms beta I and beta II correlated with Western blotting analysis and these results were further supported by the use of PKC-beta-positive (HUT 78) and -negative (BW5147) T-cell lines. Using the specific inhibitors, Go6976 and GF109203X, the findings in this study suggest that activation and translocation of PKC-beta is critical for accumulation of intracellular IL-2. The influence of CsA in reducing but not blocking IL-2 synthesis is discussed. PMA-induced down-regulation of the CD4 antigen was observed in the presence of Go6976 and but not GF109203X, suggesting regulation by non-classical PKC isoforms. Images Figure 4 PMID:9497487

  2. Fluorescent protein pair emit intracellular FRET signal suitable for FACS screening

    SciTech Connect

    Johansson, Daniel X.; Brismar, Hjalmar . E-mail:


    The fluorescent proteins ECFP and HcRed were shown to give an easily resolved FRET-signal when expressed as a fusion inside mammalian cells. HeLa-tat cells expressing ECFP, pHcRed, or the fusion protein pHcRed-ECFP were analyzed by flow cytometry after excitation of ECFP. Cells expressing HcRed-ECFP, or ECFP and HcRed, were mixed and FACS-sorted for FRET positive cells: HcRed-ECFP cells were greatly enriched (72 times). Next, cloned human antibodies were fused with ECFP and expressed anchored to the ER membrane. Their cognate antigens (HIV-1 gp120 or gp41) were fused to HcRed and co-expressed in the ER. An increase of 13.5 {+-} 1.5% (mean {+-} SEM) and 8.0 {+-} 0.7% in ECFP fluorescence for the specific antibodies reacting with gp120 or gp41, respectively, was noted after photobleaching. A positive control (HcRed-ECFP) gave a 14.8 {+-} 2.6% increase. Surprisingly, the unspecific antibody (anti-TT) showed 12.1 {+-} 1.1% increase, possibly because overexpression in the limited ER compartment gave false FRET signals.

  3. Crosstalk between intracellular and extracellular signals regulating interneuron production, migration and integration into the cortex

    PubMed Central

    Peyre, Elise; Silva, Carla G.; Nguyen, Laurent


    During embryogenesis, cortical interneurons are generated by ventral progenitors located in the ganglionic eminences of the telencephalon. They travel along multiple tangential paths to populate the cortical wall. As they reach this structure they undergo intracortical dispersion to settle in their final destination. At the cellular level, migrating interneurons are highly polarized cells that extend and retract processes using dynamic remodeling of microtubule and actin cytoskeleton. Different levels of molecular regulation contribute to interneuron migration. These include: (1) Extrinsic guidance cues distributed along migratory streams that are sensed and integrated by migrating interneurons; (2) Intrinsic genetic programs driven by specific transcription factors that grant specification and set the timing of migration for different subtypes of interneurons; (3) Adhesion molecules and cytoskeletal elements/regulators that transduce molecular signalings into coherent movement. These levels of molecular regulation must be properly integrated by interneurons to allow their migration in the cortex. The aim of this review is to summarize our current knowledge of the interplay between microenvironmental signals and cell autonomous programs that drive cortical interneuron porduction, tangential migration, and intergration in the developing cerebral cortex. PMID:25926769

  4. Antibody-Mediated Elimination of the Obligate Intracellular Bacterial Pathogen Ehrlichia chaffeensis during Active Infection

    PubMed Central

    Winslow, Gary M.; Yager, Eric; Shilo, Konstantin; Volk, Erin; Reilly, Andrew; Chu, Frederick K.


    It is generally accepted that cellular, but not humoral immunity, plays an important role in host defense against intracellular bacteria. However, studies of some of these pathogens have provided evidence that antibodies can provide immunity if present during the initiation of infection. Here, we examined immunity against infection by Ehrlichia chaffeensis, an obligate intracellular bacterium that causes human monocytic ehrlichiosis. Studies with mice have demonstrated that immunocompetent strains are resistant to persistent infection but that SCID mice become persistently and fatally infected. Transfer of immune serum or antibodies obtained from immunocompetent C57BL/6 mice to C57BL/6 scid mice provided significant although transient protection from infection. Bacterial clearance was observed when administration occurred at the time of inoculation or well after infection was established. The effect was dose dependent, occurred within 2 days, and persisted for as long as 2 weeks. Weekly serum administration prolonged the survival of susceptible mice. Although cellular immunity is required for complete bacterial clearance, the data show that antibodies can play a significant role in the elimination of this obligate intracellular bacterium during active infection and thus challenge the paradigm that humoral responses are unimportant for immunity to such organisms. PMID:10722619

  5. Superoxide dismutase activity of Mycobacterium avium, M. intracellulare, and M. scrofulaceum.

    PubMed Central

    Mayer, B K; Falkinham, J O


    Superoxide dismutase (EC (SOD) activity has been detected in crude cell extracts of representative strains of the Mycobacterium avium, M. intracellulare, and M. scrofulaceum (MAIS) group. Polyacrylamide gel electrophoresis demonstrated a single SOD activity band for each of the MAIS strains, though there were differences in mobility. All M. avium and M. intracellulare and two of five M. scrofulaceum strains demonstrated a single activity band of identical mobility (Rf = 0.83), while the SOD activity band for the three remaining M. scrofulaceum strains migrated farther (Rf = 0.85). The differences in mobility correlated with differences in sensitivity to NaN3 and H2O2. The SOD activities of the majority of the MAIS strains which displayed the slower-migrating activity band were inhibited 22 to 81% after 15 min of exposure to 5 mM H2O2, suggesting that both iron and manganese may be present in a single enzyme. The SOD activities of the three M. scrofulaceum strains which had the faster-migrating activity band were inhibited 100% after only 5 min of exposure to 5 mM H2O2 and exhibited greater sensitivity to 5 and 10 mM NaN3, characteristics of an iron-containing SOD. A concentration of 1 mM KCN did not cause inhibition of enzyme activity in any of the MAIS strains tested. Extracellular SOD activity was detected in four of six MAIS strains and was shown to be identical in mobility to the SOD activity of the crude extracts. Images PMID:3744555

  6. Intracellular Na(+) modulates large conductance Ca(2+)-activated K (+) currents in human umbilical vein endothelial cells.


    Liang, Guo Hua; Kim, Moon Young; Park, Seonghee; Kim, Ji Aee; Choi, Shinkyu; Suh, Suk Hyo


    We studied the effects of Na(+) influx on large-conductance Ca(2+)-activated K(+) (BK(Ca)) channels in cultured human umbilical vein endothelial cells (HUVECs) by means of patch clamp and SBFI microfluorescence measurements. In current-clamped HUVECs, extracellular Na(+) replacement by NMDG(+) or mannitol hyperpolarized cells. In voltage-clamped HUVECs, changing membrane potential from 0 mV to negative potentials increased intracellular Na(+) concentration ([Na(+)](i)) and vice versa. In addition, extracellular Na(+) depletion decreased [Na(+)](i). In voltage-clamped cells, BK(Ca) currents were markedly increased by extracellular Na(+) depletion. In inside-out patches, increasing [Na(+)](i) from 0 to 20 or 40 mM reduced single channel conductance but not open probability (NPo) of BK(Ca) channels and decreasing intracellular K(+) concentration ([K(+)](i)) gradually from 140 to 70 mM reduced both single channel conductance and NPo. Furthermore, increasing [Na(+)](i) gradually from 0 to 70 mM, by replacing K(+), markedly reduced single channel conductance and NPo. The Na(+)-Ca(2+) exchange blocker Ni(2+) or KB-R7943 decreased [Na(+)](i) and increased BK(Ca) currents simultaneously, and the Na(+) ionophore monensin completely inhibited BK(Ca) currents. BK(Ca) currents were significantly augmented by increasing extracellular K(+) concentration ([K(+)](o)) from 6 to 12 mM and significantly reduced by decreasing [K(+)](o) from 12 or 6 to 0 mM or applying the Na(+)-K(+) pump inhibitor ouabain. These results suggest that intracellular Na(+) inhibit single channel conductance of BK(Ca) channels and that intracellular K(+) increases single channel conductance and NPo.

  7. Collagen type IV stimulates an increase in intracellular Ca2+ in pancreatic acinar cells via activation of phospholipase C.

    PubMed Central

    Somogyi, L; Lasić, Z; Vukicević, S; Banfić, H


    Intracellular Ca2+ responses to extracellular matrix molecules were studied in suspensions of pancreatic acinar cells loaded with Fura-2. Collagen type I, laminin, fibrinogen and fibronectin were unable to raise cytosolic free Ca2+ concentration ([Ca2+]i), whereas collagen type IV, at concentrations from 5 to 50 micrograms/ml, significantly increased it. The effect of collagen type IV was not due to possible contamination with type-I transforming growth factor beta or plasminogen, as neither of these agents was able to increase [Ca2+]i. Using highly specific mass assays, concentrations of inositol lipids, 1,2-diacylglycerol (DAG) and Ins(1,4,5) P3 were measured in pancreatic acinar cells stimulated with collagen type IV. A decrease in the concentrations of PtdIns(4,5) P2 and PtdIns4 P with a concomitant increase in the concentrations of DAG and InsP3 mass were observed, showing that collagen type IV increases [Ca2+]i by activation of phospholipase C. The observed [Ca2+]i signals had two components, the first resulting from Ca2+ release from the intracellular stores, and the second resulting from Ca2+ flux from the extracellular medium through the verapamil-insensitive channels. A tyrosine kinase inhibitor (tyrphostine) was able to block inositol lipid signalling caused by collagen type IV, which together with the insensitivity of this pathway to cholera toxin and pertussis toxin or to preactivation of protein kinase C, the longer duration of the increase in [Ca2+]i and a longer lag period needed for observation of increases in DAG and InsP3 concentration with collagen type IV than with carbachol (50 mM) suggest that activation of phospholipase C by collagen type IV is caused by tyrosine kinase activation. Inositol lipid signalling and increases in [Ca2+]i were also observed with Arg-Gly-Asp (RGD)-containing peptide but not with Arg-Asp-Gly (RDG)-containing peptide. Collagen type IV and RGD-containing peptide, but not carbachol, competed in increasing [Ca2+]i and

  8. Anti-infective Activity of 2-Cyano-3-Acrylamide Inhibitors with Improved Drug-Like Properties against Two Intracellular Pathogens

    PubMed Central

    Passalacqua, Karla D.; Charbonneau, Marie-Eve; Donato, Nicholas J.; Showalter, Hollis D.; Sun, Duxin; Wen, Bo; He, Miao; Sun, Hanshi


    Due to the rise of antibiotic resistance and the small number of effective antiviral drugs, new approaches for treating infectious diseases are urgently needed. Identifying targets for host-based therapies represents an emerging strategy for drug discovery. The ubiquitin-proteasome system is a central mode of signaling in the eukaryotic cell and may be a promising target for therapies that bolster the host's ability to control infection. Deubiquitinase (DUB) enzymes are key regulators of the host inflammatory response, and we previously demonstrated that a selective DUB inhibitor and its derivative promote anti-infective activities in host cells. To find compounds with anti-infective efficacy but improved toxicity profiles, we tested a library of predominantly 2-cyano-3-acrylamide small-molecule DUB inhibitors for anti-infective activity in macrophages against two intracellular pathogens: murine norovirus (MNV) and Listeria monocytogenes. We identified compound C6, which inhibited DUB activity in human and murine cells and reduced intracellular replication of both pathogens with minimal toxicity in cell culture. Treatment with C6 did not significantly affect the ability of macrophages to internalize virus, suggesting that the anti-infective activity interferes with postentry stages of the MNV life cycle. Metabolic stability and pharmacokinetic assays showed that C6 has a half-life in mouse liver microsomes of ∼20 min and has a half-life of approximately 4 h in mice when administered intravenously. Our results provide a framework for targeting the host ubiquitin system in the development of host-based therapies for infectious disease. Compound C6 represents a promising tool with which to elucidate the role of DUBs in the macrophage response to infection. PMID:27139470

  9. Partial equilibrium approximations in apoptosis. I. The intracellular-signaling subsystem.


    Huang, Ya-Jing; Yong, Wen-An


    Apoptosis is one of the most basic biological processes. In apoptosis, tens of species are involved in many biochemical reactions with times scales of widely differing orders of magnitude. By the law of mass action, the process is mathematically described with a large and stiff system of ODEs (ordinary differential equations). The goal of this work is to simplify such systems of ODEs with the PEA (partial equilibrium approximation) method. In doing so, we propose a general framework of the PEA method together with some conditions, under which the PEA method can be justified rigorously. The main condition is the principle of detailed balance for fast reactions as a whole and the framework provides some meaningful physical insights of the full chemical kinetics. With the justified method as a tool, we simplify the Fas-signaling pathway model due to Hua et al. [6] under the empirical assumption that nine reactions therein can be well regarded as relatively fast. This paper reports our simplification, together with numerical results which confirm the reliability of both our simplified model and the empirical assumption.

  10. Study of local intracellular signals regulating axonal morphogenesis using a microfluidic device

    PubMed Central

    Uryu, Daiki; Tamaru, Tomohiro; Suzuki, Azusa; Sakai, Rie; Konishi, Yoshiyuki


    Abstract The establishment and maintenance of axonal patterning is crucial for neuronal function. To identify the molecular systems that operate locally to control axonal structure, it is important to manipulate molecular functions in restricted subcellular areas for a long period of time. Microfluidic devices can be powerful tools for such purposes. In this study, we demonstrate the application of a microfluidic device to clarify the function of local Ca2+ signals in axons. Membrane depolarization significantly induced axonal branch-extension in cultured cerebellar granule neurons (CGNs). Local application of nifedipine using a polydimethylsiloxane (PDMS)-based microfluidic device demonstrated that Ca2+ entry from the axonal region via L-type voltage-dependent calcium channels (L-VDCC) is required for branch extension. Furthermore, we developed a method for locally controlling protein levels by combining genetic techniques and use of a microfluidic culture system. A vector for enhanced green fluorescent protein (EGFP) fused to a destabilizing domain derived from E. coli dihydrofolate reductase (ecDHFR) is introduced in neurons by electroporation. By local application of the DHFR ligand, trimethoprim (TMP) using a microfluidic device, we were able to manipulate differentially the level of fusion protein between axons and somatodendrites. The present study revealed the effectiveness of microfluidic devices to address fundamental biological issues at subcellular levels, and the possibility of their development in combination with molecular techniques. PMID:27877916

  11. Intracellular Na+ and K+ activities and membrane conductances in the collecting tubule of Amphiuma

    PubMed Central


    Membrane potentials and conductances, and intracellular ionic activities were studied in isolated perfused collecting tubules of K+- adapted Amphiuma. Intracellular Na+ (aNai) and K+ (aKi) activities were measured, using liquid ion-exchanger double-barreled microelectrodes. Apical and basolateral membrane conductances were estimated by cable analysis. The effects of inhibition of the apical conductance by amiloride (10(-5) M) and of inhibition of the basolateral Na-K pump by either a low K+ (0.1 mM) bath or by ouabain (10(-4) M) were studied. Under control conditions, aNai was 8.4 +/- 1.9 mM and aKi 56 +/- 3 mM. With luminal amiloride, aNai decreased to 2.2 +/- 0.4 mM and aKi increased to 66 +/- 3 mM. Ouabain produced an increase of aNai to 44 +/- 4 mM, and a decrease of aKi to 22 +/- 6, and similar changes were observed when the tubule was exposed to a low K+ bath solution. During pump inhibition, there was a progressive decrease of the K+-selective basolateral membrane conductance and of the Na+ permeability of the apical membrane. A similar inhibition of both membrane conductances was observed after pump inhibition by low K+ solution. Upon reintroduction of K+, a basolateral membrane hyperpolarization of -23 +/- 4 mV was observed, indicating an immediate reactivation of the electrogenic Na-K pump. However, the recovery of the membrane conductances occurred over a slower time course. These data imply that both membrane conductances are regulated according to the intracellular ionic composition, but that the basolateral K+ conductance is not directly linked to the pump activity. PMID:3235975

  12. Intracellular synthesis of silver nanoparticle by actinobacteria and its antimicrobial activity

    NASA Astrophysics Data System (ADS)

    Otari, S. V.; Patil, R. M.; Ghosh, S. J.; Thorat, N. D.; Pawar, S. H.


    Intracellular synthesis of silver nanoparticles (AgNPs) using Rhodococcus spp. is demonstrated. The synthesized nanoparticles were characterized by UV-Vis spectroscopy, X-ray diffraction, energy dispersive spectroscopy, Fourier trans-form infrared spectroscopy, and transmission electron microscopy. Transmission electron microscopy study of microorganisms' revealed synthesis of nanoparticle was occurring inside the cell, in the cytoplasm. AgNPs ranged from 5 to 50 nm. Formed nanoparticles were stable in the colloidal solution due to presence of proteins on the surface. AgNPs showed excellent bactericidal and bacteriostatic activity against pathogenic microorganisms.

  13. The Satiety Signaling Neuropeptide Perisulfakinin Inhibits the Activity of Central Neurons Promoting General Activity

    PubMed Central

    Wicher, Dieter; Derst, Christian; Gautier, Hélène; Lapied, Bruno; Heinemann, Stefan H.; Agricola, Hans-Jürgen


    The metabolic state is one of the determinants of the general activity level. Satiety is related to resting or sleep whereas hunger correlates to wakefulness and activity. The counterpart to the mammalian satiety signal cholecystokinin (CCK) in insects are the sulfakinins. The aim of this study was to resolve the mechanism by which the antifeedant activity of perisulfakinin (PSK) in Periplaneta americana is mediated. We identified the sources of PSK which is used both as hormone and as paracrine messenger. PSK is found in the neurohemal organ of the brain and in nerve endings throughout the central nervous system. To correlate the distributions of PSK and its receptor (PSKR), we cloned the gene coding for PSKR and provide evidence for its expression within the nervous system. It occurs only in a few neurons, among them are the dorsal unpaired median (DUM) neurons which release octopamine thereby regulating the general level of activity. Application of PSK to DUM neurons attenuated the spiking frequency (EC50=11pM) due to reduction of a pacemaker Ca2+ current through cAMP-inhibited pTRPγ channels. PSK increased the intracellular cAMP level while decreasing the intracellular Ca2+ concentration in DUM neurons. Thus, the satiety signal conferred by PSK acts antagonistically to the hunger signal, provided by the adipokinetic hormone (AKH): PSK depresses the electrical activity of DUM neurons by inhibiting the pTRPγ channel that is activated by AKH under conditions of food shortage. PMID:18946521

  14. [Activators, receptors and signal transduction pathways of blood platelets].


    Shaturnyĭ, V I; Shakhidzhanov, S S; Sveshnikova, A N; Panteleev, M A


    Platelet participation in hemostatic plug formation requires transition into an activated state (or, rather, variety of states) upon action of agonists like ADP, thromboxane A , collagen, thrombin, and others. The mechanisms of action for different agonists, their receptors and signaling pathways associated with them, as well as the mechanisms of platelet response inhibition are the subject of the present review. Collagen exposed upon vessel wall damage induced initial platelet attachment and start of thrombus formation, which involves numerous processes such as aggregation, activation of integrins, granule secretion and increase of intracellular Ca2+. Thrombin, ADP, thromboxane A , and ATP activated platelets that were not initially in contact with the wall and induce additional secretion of activating substances. Vascular endothelium and secretory organs also affect platelet activation, producing both positive (adrenaline) an d negative (prostacyclin, nitric oxide) regulators, thereby determining the relation of activation and inhibition signals, which plays a significant role in the formation of platelet aggregate under normal and pathological conditions. The pathways of platelet signaling are still incompletely understood, and their exploration presents an important objective both for basic cell biology and for the development of new drugs, the methods of diagnostics and of treatment of hemostasis disorders.

  15. Cinnamaldehyde inhibits pro-inflammatory cytokines secretion from monocytes/macrophages through suppression of intracellular signaling.


    Chao, Louis Kuoping; Hua, Kuo-Feng; Hsu, Hsien-Yeh; Cheng, Sen-Sung; Lin, I-Fan; Chen, Chia-Jung; Chen, Shui-Tein; Chang, Shang-Tzen


    We investigated the in vitro anti-inflammatory effects of Cinnamaldehyde, a cytokine production inhibitor isolated from an essential oil produced from the leaves of Cinnamomum osmophloeum Kaneh, and its mechanism of action. Although Cinnamaldehyde has been reported to have contact sensitizing properties at high concentration (mM), we found that low concentration of Cinnamaldehyde (muM) inhibited the secretion of interleukin-1beta and tumor necrosis factor alpha within lipopolysaccharide (LPS) or lipoteichoic acid (LTA) stimulated murine J774A.1 macrophages. Cinnamaldehyde also suppressed the production of these cytokines from LPS stimulated human blood monocytes derived primary macrophages and human THP-1 monocytes. Furthermore, Cinnamaldehyde also inhibited the production of prointerleukin-1beta within LPS or LTA stimulated human THP-1 monocytes. Reactive oxygen species release from LPS stimulated J774A.1 macrophages was reduced by Cinnamaldehyde. The phosphorylation of extracellular signal-regulated kinase 1/2 and c-Jun N-terminal kinase 1/2 induced by LPS was also inhibited by Cinnamaldehyde; however, Cinnamaldehyde neither antagonize the binding of LPS to the cells nor alter the cell surface expression of toll-like receptor 4 and CD14. In addition, we also noted that Cinnamaldehyde appeared to elicit no cytotoxic effect upon J774A.1 macrophages under our experimental conditions, although Cinnamaldehyde reduced J774A.1 macrophages proliferation as analysed by MTT assay. Our current results have demonstrated the anti-oxidation and anti-inflammatory properties of Cinnamaldehyde that could provide the possibility for Cinnamaldehyde's future pharmaceutical application in the realm of immuno-modulation.

  16. Aroclor 1254, a developmental neurotoxicant, alters energy metabolism- and intracellular signaling-associated protein networks in rat cerebellum and hippocampus

    SciTech Connect

    Kodavanti, Prasada Rao S.; Osorio, Cristina; Royland, Joyce E.; Ramabhadran, Ram; Alzate, Oscar


    The vast literature on the mode of action of polychlorinated biphenyls (PCBs) indicates that PCBs are a unique model for understanding the mechanisms of toxicity of environmental mixtures of persistent chemicals. PCBs have been shown to adversely affect psychomotor function and learning and memory in humans. Although the molecular mechanisms for PCB effects are unclear, several studies indicate that the disruption of Ca{sup 2+}-mediated signal transduction plays significant roles in PCB-induced developmental neurotoxicity. Culminating events in signal transduction pathways include the regulation of gene and protein expression, which affects the growth and function of the nervous system. Our previous studies showed changes in gene expression related to signal transduction and neuronal growth. In this study, protein expression following developmental exposure to PCB is examined. Pregnant rats (Long Evans) were dosed with 0.0 or 6.0 mg/kg/day of Aroclor-1254 from gestation day 6 through postnatal day (PND) 21, and the cerebellum and hippocampus from PND14 animals were analyzed to determine Aroclor 1254-induced differential protein expression. Two proteins were found to be differentially expressed in the cerebellum following PCB exposure while 18 proteins were differentially expressed in the hippocampus. These proteins are related to energy metabolism in mitochondria (ATP synthase, sub unit {beta} (ATP5B), creatine kinase, and malate dehydrogenase), calcium signaling (voltage-dependent anion-selective channel protein 1 (VDAC1) and ryanodine receptor type II (RyR2)), and growth of the nervous system (dihydropyrimidinase-related protein 4 (DPYSL4), valosin-containing protein (VCP)). Results suggest that Aroclor 1254-like persistent chemicals may alter energy metabolism and intracellular signaling, which might result in developmental neurotoxicity. -- Highlights: Black-Right-Pointing-Pointer We performed brain proteomic analysis of rats exposed to the neurotoxicant

  17. Intracellular multiplication of Paracoccidioides brasiliensis in macrophages: killing and restriction of multiplication by activated macrophages.

    PubMed Central

    Brummer, E; Hanson, L H; Restrepo, A; Stevens, D A


    The effect of coculturing yeast-form Paracoccidioides brasiliensis with murine cells was studied. Coculture of resident peritoneal or pulmonary macrophages with P. brasiliensis for 72 h dramatically enhanced fungal multiplication 19.3 +/- 2.4- and 4.7 +/- 0.8-fold, respectively, compared with cocultures with lymph node cells or complete tissue culture medium alone. Support of P. brasiliensis multiplication by resident peritoneal macrophages was macrophage dose dependent. Lysates of macrophages, supernatants from macrophage cultures, or McVeigh-Morton broth, like complete tissue culture medium, did not support multiplication of P. brasiliensis in 72-h cultures. Time course microscopic studies of cocultures in slide wells showed that macrophages ingested P. brasiliensis cells and that the ingested cells multiplied intracellularly. In sharp contrast to resident macrophages, lymphokine-activated peritoneal and pulmonary macrophages not only prevented multiplication but reduced inoculum CFU by 96 and 100%, respectively, in 72 h. Microscopic studies confirmed killing and digestion of P. brasiliensis ingested by activated macrophages in 48 h. These findings indicate that resident macrophages are permissive for intracellular multiplication of P. brasiliensis and that this could be a factor in pathogenicity. By contrast, activated macrophages are fungicidal for P. brasiliensis. Images PMID:2744848

  18. Statins have beneficial effects on platelet free radical activity and intracellular distribution of GTPases in hyperlipidaemia.


    Hamilton, Paul K; Hughes, Sinead M T; Plumb, Richard D; Devine, Adrian; Leahey, William; Lyons, Kristopher S; Johnston, Dennis; McVeigh, Gary E


    In addition to lowering cholesterol, statins may alter endothelial release of the vasodilator NO and harmful superoxide free radicals. Statins also reduce cholesterol intermediates including isoprenoids. These are important for post-translational modification of substances including the GTPases Rho and Rac. By altering the membrane association of these molecules, statins affect intracellular positioning and hence activity of a multitude of substances. These include eNOS(endothelial NO synthase), which produces NO (inhibited by Rho), and NADPH oxidase, which produces superoxide (dependent on Rac). Statins may improve endothelial function by enhancing production of NO while decreasing superoxide production. A total of 40 hypercholesterolaemic patients were randomized to treatment with either atorvastatin or placebo; 20 normolipidaemic patients were also studied. Platelet nitrite, NO and superoxide were examined as was the cellular distribution of the GTPases Rho and Rac at baseline and after 8 weeks of treatment.Following atorvastatin therapy, platelet NO was increased (3.2 pmol/10(8) platelets) and superoxide output was attenuated [-3.4 pmol min(-1) (10(8) platelets)(-1)] when compared with placebo. The detection of both Rho and Rac was significantly reduced in the membranes of platelets, implying reduced activity. In conclusion, the results of the present study show altered NO/superoxide production following statin therapy. A potential mechanism for this is the change in the distribution of intracellular GTPases, which was considered to be secondary to decreases in isoprenoid intermediates, suggesting that the activity of the former had been affected by atorvastatin.

  19. Active site structure and catalytic mechanism of phosphodiesterase for degradation of intracellular second messengers

    NASA Astrophysics Data System (ADS)

    Zhan, Chang-Guo


    Phosphodiesterases are clinical targets for a variety of biological disorders, because this superfamily of enzymes regulate intracellular concentration of cyclic nucleotides that serve as the second messengers playing a critical role in a variety of physiological processes. Understanding structure and mechanism of a phosphodiesterase will provide a solid basis for rational design of the more efficient therapeutics. Although a three-dimensional X-ray crystal structure of the catalytic domain of human phosphodiesterase 4B2B was recently reported, it was uncertain whether a critical bridging ligand in the active site is a water molecule or a hydroxide ion. The identity of this bridging ligand has been determined by performing first-principles quantum chemical calculations on models of the active site. All the results obtained indicate that this critical bridging ligand in the active site of the reported X-ray crystal structure is a hydroxide ion, rather than a water molecule, expected to serve as the nucleophile to initialize the catalytic degradation of the intracellular second messengers.

  20. Intracellular signaling is changed after clustering of the neural cell adhesion molecules axonin-1 and NgCAM during neurite fasciculation

    PubMed Central


    Neural cell adhesion molecules of the immunoglobulin/fibronectin type III family on axons have been implicated in promotion of neurite outgrowth, fasciculation, and the mediation of specific cell adhesion. The present study demonstrates that two of these molecules on dorsal root ganglion neurons are associated with distinct protein kinases, axonin-1 with the src-related nonreceptor tyrosine kinase fyn and NgCAM with a casein kinase II-related activity and a serine/ threonine kinase related to S6 kinase. When neurites grew without contacts involving axonin-1 and NgCAM, strong fyn kinase activity was associated with axonin-1, whereas the NgCAM-associated kinase activities were low. Clustering of axonin-1 with NgCAM induced by the formation of cell-cell contacts correlated with a reduction of the axonin-1-associated fyn activity and an increased phosphorylation of NgCAM by the associated casein kinase II-related activity. Thus, axonin-1 and NgCAM trigger distinctive intracellular signals during in vitro differentiation depending on their state of association. PMID:8858178

  1. Modulation of Breast Cancer Cell Functions by Intracellular Signaling Through the Membrane Type-1 Matrix Metalloproteinase

    DTIC Science & Technology


    mutations in the ecto- and cytoplasmic domains ofMT1-MMP. For this purpose we used: 1) a mutant with a complete deletion of the cytoplasmic domain (A563...582), 2) a mutant with a point mutation (E240A) in the catalytic domain that causes loss of the proteolytic activ- ity, and 3) a mutant with a deletion ...mediate this effect: decreased expression of the uPA and! or uPA receptor (uPAR) gene , removal of uPAR-bound uPA or increased internalization and degrada

  2. Characteristics of intracellular Ca2+ signals consisting of two successive peaks in hepatocytes during liver regeneration after 70% partial hepatectomy in rats

    PubMed Central

    Taira, Zenei; Ueda, Yukari; Monmasu, Hiroshi; Yamase, Daisuke; Miyake, Sayaka; Shiraishi, Maya


    Two specific signals for regulating liver regeneration were found after 70% partial hepatectomy (PH) in rats. The first finding was a sustained increasing signal of intracellular Ca2+ ([Ca2+]i) in hepatocytes, consisting of two successive peaks with the first narrow peak at 1 hour and the second broad peak increasing by day 3 and then returning to normal by day 4. The second finding was an abnormal peak in the restoring ratio (Rr) curve of liver regeneration after 70% PH at day 4, where the Rr exceeded 100% temporarily, returned to a lower level, and then proceeded to a termination phase of liver regeneration. For 4 days around the two successive [Ca2+]i peaks and abnormal peak, various physiological activities were induced to promote liver regeneration after 70% PH. mRNA expression of genes encoding Ca2+-binding proteins S100A4 and calpain was induced between the two Ca2+ peaks. Hepatocytes underwent synchronous cell proliferation as the liver was restored from 30% to 70% at day 4, and significant expression of VEGF mRNA at around day 4 promoted angiogenesis to remodel the sinusoidal system. Cytochrome P450 activity levels in microsomes and alanine aminotransferase values at 24 hours after CCl4 administration were decreased after 70% PH, which recovered transiently to the control level at day 4, returned to the decreased level, and then slowly recovered by day 10. Thus, these results indicate that day 4 is important during liver regeneration after 70% PH. PMID:27757054

  3. Apocynin Derivatives Interrupt Intracellular Signaling Resulting in Decreased Migration in Breast Cancer Cells

    PubMed Central

    Klees, Robert F.; De Marco, Paul C.; Salasznyk, Roman M.; Ahuja, Disha; Hogg, Michael; Antoniotti, Sylvain; Kamath, Lakshmi; Dordick, Jonathan S.; Plopper, George E.


    Cancer cells are defined by their ability to divide uncontrollably and metastasize to secondary sites in the body. Consequently, tumor cell migration represents a promising target for anticancer drug development. Using our high-throughput cell migration assay, we have screened several classes of compounds for noncytotoxic tumor cell migration inhibiting activity. One such compound, apocynin (4-acetovanillone), is oxidized by peroxidases to yield a variety of oligophenolic and quinone-type compounds that are recognized inhibitors of NADPH oxidase and may be inhibitors of the small G protein Rac1 that controls cell migration. We report here that while apocynin itself is not effective, apocynin derivatives inhibit migration of the breast cancer cell line MDA-MB-435 at subtoxic concentrations; the migration of nonmalignant MCF10A breast cells is unaffected. These compounds also cause a significant rearrangement of the actin cytoskeleton, cell rounding, and decreased levels of active Rac1 and its related G protein Cdc42. These results may suggest a promising new route to the development of novel anticancer therapeutics. PMID:16883056

  4. Rotenone decreases intracellular aldehyde dehydrogenase activity: implications for the pathogenesis of Parkinson's disease.


    Goldstein, David S; Sullivan, Patti; Cooney, Adele; Jinsmaa, Yunden; Kopin, Irwin J; Sharabi, Yehonatan


    Repeated systemic administration of the mitochondrial complex I inhibitor rotenone produces a rodent model of Parkinson's disease (PD). Mechanisms of relatively selective rotenone-induced damage to nigrostriatal dopaminergic neurons remain incompletely understood. According to the 'catecholaldehyde hypothesis,' buildup of the autotoxic dopamine metabolite 3,4-dihydroxyphenylacetaldehyde (DOPAL) contributes to PD pathogenesis. Vesicular uptake blockade increases DOPAL levels, and DOPAL is detoxified mainly by aldehyde dehydrogenase (ALDH). We tested whether rotenone interferes with vesicular uptake and intracellular ALDH activity. Endogenous and F-labeled catechols were measured in PC12 cells incubated with rotenone (0-1000 nM, 180 min), without or with F-dopamine (2 μM) to track vesicular uptake and catecholamine metabolism. Rotenone dose dependently increased DOPAL, F-DOPAL, and 3,4-dihydroxyphenylethanol (DOPET) levels while decreasing dopamine and 3,4-dihydroxyphenylacetic acid (DOPAC) levels and the ratio of dopamine to the sum of its deaminated metabolites. In test tubes, rotenone did not affect conversion of DOPAL to DOPAC by ALDH when NAD(+) was supplied, whereas the direct-acting ALDH inhibitor benomyl markedly increased DOPAL and decreased DOPAC concentrations in the reaction mixtures. We propose that rotenone builds up intracellular DOPAL by decreasing ALDH activity and attenuating vesicular sequestration of cytoplasmic catecholamines. The results provide a novel mechanism for selective rotenone-induced toxicity in dopaminergic neurons. We report that rotenone, a mitochondrial complex I inhibitor that produces an animal model of Parkinson's disease, increases intracellular levels of the toxic dopamine metabolite 3,4-dihydroxyphenyl-acetaldehyde (DOPAL), via decreased DOPAL metabolism by aldehyde dehydrogenase (ALDH) and decreased vesicular sequestration of cytoplasmic dopamine by the vesicular monoamine transporter (VMAT). The results provide a novel

  5. Intracellular RNA recognition pathway activates strong anti-viral response in human mast cells.


    Lappalainen, J; Rintahaka, J; Kovanen, P T; Matikainen, S; Eklund, K K


    Mast cells have been implicated in the first line of defence against parasites and bacteria, but less is known about their role in anti-viral responses. Allergic diseases often exacerbate during viral infection, suggesting an increased activation of mast cells in the process. In this study we investigated human mast cell response to double-stranded RNA and viral infection. Cultured human mast cells were incubated with poly(I:C), a synthetic RNA analogue and live Sendai virus as a model of RNA parainfluenza virus infection, and analysed for their anti-viral response. Mast cells responded to intracellular poly(I:C) by inducing type 1 and type 3 interferons and TNF-α. In contrast, extracellular Toll-like receptor 3 (TLR)-3-activating poly(I:C) failed to induce such response. Infection of mast cells with live Sendai virus induced an anti-viral response similar to that of intracellular poly(I:C). Type 1, but not type 3 interferons, up-regulated the expression of melanoma differentiation-associated gene 5 (MDA-5) and retinoic acid-inducible gene-1 (RIG-1), and TLR-3, demonstrating that human mast cells do not express functional receptors for type 3 interferons. Furthermore, virus infection induced the anti-viral proteins MxA and IFIT3 in human mast cells. In conclusion, our results support the notion that mast cells can recognize an invading virus through intracellular virus sensors and produce high amounts of type 1 and type 3 interferons and the anti-viral proteins human myxovirus resistance gene A (MxA) and interferon-induced protein with tetratricopeptide repeats 3 (IFIT3) in response to the virus infection.

  6. The role of polymorphisms in Toll-like receptors and their associated intracellular signaling genes in measles vaccine immunity

    PubMed Central

    Ovsyannikova, Inna G.; Haralambieva, Iana H.; Vierkant, Robert A.; Pankratz, V. Shane; Jacobson, Robert M.; Poland, Gregory A.


    Toll-like receptors (TLRs) and their intracellular signaling molecules play an important role in innate immunity. In this study, we examined associations between polymorphisms in TLR family genes and measles vaccine-specific immune responses. We genotyped 764 subjects (11–22 years old) after two doses of measles vaccine for TLR signaling SNP markers (n = 454). The major alleles of coding SNPs in the TLR2 (rs3804100) and TLR4 (rs5030710) genes were associated with a dose-related increase (660 vs. 892 mIU/ml, p = 0.002) and a dose-related decrease (2,209 vs. 830 mIU/ml, p = 0.001) in measles-specific antibodies, respectively. A significant association was found between lower measles antibody levels and the haplotype ACGGCGAGAAAAGAGAAGAGAGAGAA (p = 0.01) in the MAP3K7 gene. Furthermore, the minor allele of a SNP (rs702966) of the KIAA1542 (IRF7) gene was associated with a dose-related decrease in IFN-γ Elispot responses (38 vs. 26 spot-forming cells per 2 × 105 PBMCs, p = 0.00002). We observed an additional 12 associations (p < 0.01) between coding (nonsynonymous and synonymous) polymorphisms within the TLRs (TLR 2, 7, and 8), IKBKE, TICAM1, NFKBIA, IRAK2, and KIAA1542 genes and variations in measles-specific IL-2, IL-6, IFN-α, IFN-γ, IFNλ-1, and TNF-α secretion levels. Our data demonstrate that polymorphisms in TLR and other related immune response signaling molecules have significant effects on measles vaccine-associated immune responses. These data help to establish the genetic foundation for immune response variation in response to measles immunization and provide important insights for the rational development of new measles vaccines. PMID:21424379

  7. The Death Domain Superfamily in Intracellular Signaling of Apoptosis and Inflammation

    PubMed Central

    Park, Hyun Ho; Lo, Yu-Chih; Lin, Su-Chang; Wang, Liwei; Yang, Jin Kuk; Wu, Hao


    The death domain (DD) superfamily comprising the death domain (DD) subfamily, the death effector domain (DED) subfamily, the caspase recruitment domain (CARD) subfamily and the pyrin domains (PYD) subfamily is one of the largest domain superfamilies. By mediating homotypic interactions within each domain subfamily, these proteins play important roles in the assembly and activation of apoptotic and inflammatory complexes. In this article, we review the molecular complexes that are assembled by these proteins, the structural and biochemical features of these domains and the molecular interactions mediated by them. By analyzing the potential molecular basis for the function of these domains, we hope to provide a comprehensive understanding on the function, structure, interaction and evolution of this important family of domains. PMID:17201679

  8. Signaling during platelet adhesion and activation

    PubMed Central

    Li, Zhenyu; Delaney, M. Keegan; O’Brien, Kelly A.; Du, Xiaoping


    Upon vascular injury, platelets are activated by adhesion to adhesive proteins like von Willebrand factor and collagen, or by soluble platelet agonists like ADP, thrombin, and thromboxane A2. These adhesive proteins and soluble agonists induce signal transduction via their respective receptors. The various receptor-specific platelet activation signaling pathways converge into common signaling events, which stimulate platelet shape change, granule secretion, and ultimately induce the “inside-out” signaling process leading to activation of the ligand binding function of integrin αIIbβ3. Ligand binding to integrin αIIbβ3 mediates platelet adhesion and aggregation and triggers “outside-in” signaling, resulting in platelet spreading, additional granule secretion, stabilization of platelet adhesion and aggregation, and clot retraction. It has become increasingly evident that agonist-induced platelet activation signals also crosstalk with integrin “outside-in” signals to regulate platelet responses. Platelet activation involves a series of rapid positive feedback loops that greatly amplify initial activation signals, and enable robust platelet recruitment and thrombus stabilization. Recent studies have provided novel insight into the molecular mechanisms of these processes. PMID:21071698

  9. Intracellular pH regulates basolateral K+ and Cl- conductances in colonic epithelial cells by modulating Ca2+ activation

    PubMed Central


    The role of intracellular pH as a modulator of basolateral K+ and Cl- conductances in epithelial cells was studied using digitonin- permeabilized colonic cell layers so that cytosolic pH could be clamped at specific values, while basolateral K+ and Cl- conductances were activated by stepwise increases in intracellular free Ca2+. Increasing the intracellular pH from 6.6 to 8.0 enhanced the sensitivity of both ionic conductances to intracellular Ca2+, but changing extracellular pH had no effect. Maximal K+ and Cl- currents activated by Ca2+ were not affected by changes in intracellular pH, suggesting that protons do not alter the conduction properties of the channels. Hill analysis of the Ca2+ activation process revealed that raising the cytosolic pH from 6.6 to 8.0 reduced the K1/2 for Ca2+ activation. In the absence of Ca2+, changes in intracellular pH did not have a significant effect on the basolateral K+ and Cl- conductances. These results are consistent with the notion that changes in cytosolic pH can modulate basolateral conductances by modifying the action of calcium, perhaps by acting at or near the activation site to provide a mechanism of variable "gain control." PMID:1719125

  10. Intracellular oxidant activity, antioxidant enzyme defense system, and cell senescence in fibroblasts with trisomy 21.


    Rodríguez-Sureda, Víctor; Vilches, Ángel; Sánchez, Olga; Audí, Laura; Domínguez, Carmen


    Down's syndrome (DS) is characterized by a complex phenotype associated with chronic oxidative stress and mitochondrial dysfunction. Overexpression of genes on chromosome-21 is thought to underlie the pathogenesis of the major phenotypic features of DS, such as premature aging. Using cultured fibroblasts with trisomy 21 (T21F), this study aimed to ascertain whether an imbalance exists in activities, mRNA, and protein expression of the antioxidant enzymes SOD1, SOD2, glutathione-peroxidase, and catalase during the cell replication process in vitro. T21F had high SOD1 expression and activity which led to an interenzymatic imbalance in the antioxidant defense system, accentuated with replicative senescence. Intracellular ROS production and oxidized protein levels were significantly higher in T21F compared with control cells; furthermore, a significant decline in intracellular ATP content was detected in T21F. Cell senescence was found to appear prematurely in DS cells as shown by SA-β-Gal assay and p21 assessment, though not apoptosis, as neither p53 nor the proapoptotic proteins cytochrome c and caspase 9 were altered in T21F. These novel findings would point to a deleterious role of oxidatively modified molecules in early cell senescence of T21F, thereby linking replicative and stress-induced senescence in cultured cells to premature aging in DS.

  11. Rotenone Decreases Intracellular Aldehyde Dehydrogenase Activity: Implications for the Pathogenesis of Parkinson Disease

    PubMed Central

    Goldstein, David S.; Sullivan, Patti; Cooney, Adele; Jinsmaa, Yunden; Kopin, Irwin J.; Sharabi, Yehonatan


    Repeated systemic administration of the mitochondrial complex I inhibitor rotenone produces a rodent model of Parkinson disease (PD). Mechanisms of relatively selective rotenone-induced damage to nigrostriatal dopaminergic neurons remain incompletely understood. According to the “catecholaldehyde hypothesis,” buildup of the autotoxic dopamine metabolite 3,4-dihydroxyphenylacetaldehyde (DOPAL) contributes to PD pathogenesis. Vesicular uptake blockade increases DOPAL levels, and DOPAL is detoxified mainly by aldehyde dehydrogenase (ALDH). We tested whether rotenone interferes with vesicular uptake and intracellular ALDH activity. Endogenous and F-labeled catechols were measured in PC12 cells incubated with rotenone (0-1000 nM, 180 minutes), without or with F-dopamine (2 μM) to track vesicular uptake and catecholamine metabolism. Rotenone dose-dependently increased DOPAL, F-DOPAL, and 3,4-dihydroxyphenylethanol (DOPET) levels while decreasing dopamine and 3,4-dihydroxyphenylacetic acid (DOPAC) levels and the ratio of dopamine to the sum of its deaminated metabolites. In test tubes, rotenone did not affect conversion of DOPAL to DOPAC by ALDH when NAD+ was supplied, whereas the direct-acting ALDH inhibitor benomyl markedly increased DOPAL and decreased DOPAC concentrations in the reaction mixtures. We propose that rotenone builds up intracellular DOPAL by decreasing ALDH activity and attenuating vesicular sequestration of cytoplasmic catecholamines. The results provide a novel mechanism for selective rotenone-induced toxicity in dopaminergic neurons. PMID:25645689

  12. Role of receptor desensitization, phosphatase induction and intracellular cyclic AMP in the termination of mitogen-activated protein kinase activity in UTP-stimulated EAhy 926 endothelial cells.

    PubMed Central

    Graham, A; McLees, A; Malarkey, K; Gould, G W; Plevin, R


    We have investigated the mechanisms that bring about the termination of mitogen-activated protein kinase (MAP kinase) activation in response to UTP in EAhy 926 endothelial cells. UTP-stimulated MAP kinase activity was transient, returning to basal values by 60 min. At this time MAP kinase activation was desensitized; re-application of UTP did not further activate MAP kinase, full re-activation of MAP kinase being only apparent after a 1-2 h wash period. However, activation of MAP kinase by UTP could be sustained beyond 60 min by preincubation of the cells with the protein synthesis inhibitor cycloheximide. UTP also stimulated expression of MAP kinase phosphatase-1 and this was abolished after pretreatment with cycloheximide. Pretreatment of cells with forskolin abolished the initial activation of MAP kinase kinase or c-Raf-1 by UTP, but only affected MAP kinase activity during prolonged stimulation. The effect of forskolin on prolonged MAP kinase activation was also prevented by cycloheximide. These results suggest that the termination of MAP kinase activity in response to UTP involves a number of interacting mechanisms including receptor desensitization and the induction of a phosphatase. However, several pieces of evidence do not support a major role for MAP kinase phosphatase-1 in termination of the MAP kinase signal. Raising intracellular cyclic AMP may also be involved but only after an initial protein-synthesis step and by a mechanism that does not involve the inactivation of c-Raf-1 or MAP kinase kinase. PMID:8615830

  13. Lyn mediates FIP1L1-PDGFRA signal pathway facilitating IL- 5RA intracellular signal through FIP1L1-PDGFRA/JAK2/Lyn/Akt network complex in CEL.


    Li, Bin; Zhang, Guangsen; Li, Cui; Li, Ruijuan; Lu, Jingchen; He, Zhengxi; Wang, Quan; Peng, Zhenzi; Wang, Jun; Dong, Yeping; Zhang, Chunfang; Tan, Jie Qiong; Bahri, Nacef; Wang, Yuexiang; Duan, Chaojun


    The Fip1-like1 (FIP1L1)-platelet-derived growth factor receptor alpha (PDGFRA) (F/P) oncogene can cause chronic eosinophilic leukemia (CEL), but requires IL-5 cytokine participation. In this study, we investigate the mechanism of F/P in collaboration with IL-5 in CEL. The results showed that Lyn, a key effector in the IL-5-motivated eosinophil production, is extensively activated in F/P-positive CEL cells. Lyn can associate and phosphorylate IL-5 receptor α (IL-5RA) in F/P-positive cells. Moreover, the activation of Lyn and IL-5R kinase were strengthened when the cells were stimulated by IL-5. Lyn inhibition in F/P-positive CEL cells attenuated cellular proliferation, induced apoptosis, and blocked cell migration and major basic protein (MBP) release. We identified the FIP1L1-PDGFRA/JAK2/Lyn/Akt complex in the F/P-expressing cells which can be disrupted by dual inhibition of JAK2 and Lyn, repressing cell proliferation in both EOL-1(F/P-positive human eosinophilic cell line) and imatinib-resistance (IR) cells. Altogether, our data demonstrate that Lyn is a vital downstream kinase activated by F/P converged with IL-5 signals in CEL cells. Lyn activate and expand IL-5RA intracellular signaling through FIP1L1-PDGFRA/JAK2/Lyn/Akt network complex, provoking eosinophils proliferation and exaggerated activation manifested as CEL.

  14. A label-free optical biosensor with microfluidics identifies an intracellular signalling wave mediated through the β(2)-adrenergic receptor.


    Ferrie, Ann M; Wang, Chaoming; Deng, Huayun; Fang, Ye


    The canonical model of G protein-coupled receptor (GPCR) signalling states that it is solely initiated at the cell surface. In recent years, a handful of evidence has started emerging from high-resolution molecular assays that the internalized receptors can mediate the third wave of signalling, besides G protein- and β-arrestin-mediated signalling both initiating at the cell surface. However, little is known about the functional consequences of distinct waves of GPCR signalling, in particular, at the whole cell system level. We here report the development of label-free biosensor antagonist reverse assays and their use to differentiate the signalling waves of an endogenous β2-adrenergic receptor (β2-AR) in A431 cells. Results showed that the persistent agonist treatment activated the β2-ARs, leading to a long-term sustained dynamic mass redistribution (DMR) signal, a whole cell phenotypic response. Under the persistent treatment scheme in microplates, a panel of known β-blockers all dose-dependently and completely reversed the DMR signal of epinephrine at a relatively low dose (10 nM), except for sotalol which partially reversed the DMR. Under the perfusion conditions with microfluidics, the subsequent perfusion with sotalol only reversed the DMR induced by epinephrine or isoproterenol at 10 nM, but not at 10 μM. Furthermore, the degree of the DMR reversion by sotalol was found to be in an opposite relation with the duration of the initial agonist treatment. Together, these results suggest that the hydrophilic antagonist sotalol is constrained outside the cells throughout the assays, and the early signalling wave initiated at the cell surface dominates the DMR induced by epinephrine or isoproterenol at relatively low doses, while a secondary and late signalling wave is initiated once the receptors are internalized and contributes partially to the long-term sustainability of the DMR of epinephrine or isoproterenol at high doses.

  15. Biased signaling by peptide agonists of protease activated receptor 2.


    Jiang, Yuhong; Yau, Mei-Kwan; Kok, W Mei; Lim, Junxian; Wu, Kai-Chen; Liu, Ligong; Hill, Timothy A; Suen, Jacky Y; Fairlie, David P


    Protease activated receptor 2 (PAR2) is associated with metabolism, obesity, inflammatory, respiratory and gastrointestinal disorders, pain, cancer and other diseases. The extracellular N-terminus of PAR2 is a common target for multiple proteases, which cleave it at different sites to generate different N-termini that activate different PAR2-mediated intracellular signaling pathways. There are no synthetic PAR2 ligands that reproduce the same signaling profiles and potencies as proteases. Structure-activity relationships here for 26 compounds spanned a signaling bias over 3 log units, culminating in three small ligands as biased agonist tools for interrogating PAR2 functions. DF253 (2f-LAAAAI-NH2) triggered PAR2-mediated calcium release (EC50 2 μM) but not ERK1/2 phosphorylation (EC50 > 100 μM) in CHO cells transfected with hPAR2. AY77 (Isox-Cha-Chg-NH2) was a more potent calcium-biased agonist (EC50 40 nM, Ca2+; EC50 2 μM, ERK1/2), while its analogue AY254 (Isox-Cha-Chg-A-R-NH2) was an ERK-biased agonist (EC50 2 nM, ERK1/2; EC50 80 nM, Ca2+). Signaling bias led to different functional responses in human colorectal carcinoma cells (HT29). AY254, but not AY77 or DF253, attenuated cytokine-induced caspase 3/8 activation, promoted scratch-wound healing and induced IL-8 secretion, all via PAR2-ERK1/2 signaling. Different ligand components were responsible for different PAR2 signaling and functions, clues that can potentially lead to drugs that modulate different pathway-selective cellular and physiological responses.

  16. Different activation signals induce distinct mast cell degranulation strategies

    PubMed Central

    Sibilano, Riccardo; Marichal, Thomas; Reber, Laurent L.; Cenac, Nicolas; McNeil, Benjamin D.; Dong, Xinzhong; Hernandez, Joseph D.; Sagi-Eisenberg, Ronit; Hammel, Ilan; Roers, Axel; Valitutti, Salvatore; Tsai, Mindy


    Mast cells (MCs) influence intercellular communication during inflammation by secreting cytoplasmic granules that contain diverse mediators. Here, we have demonstrated that MCs decode different activation stimuli into spatially and temporally distinct patterns of granule secretion. Certain signals, including substance P, the complement anaphylatoxins C3a and C5a, and endothelin 1, induced human MCs rapidly to secrete small and relatively spherical granule structures, a pattern consistent with the secretion of individual granules. Conversely, activating MCs with anti-IgE increased the time partition between signaling and secretion, which was associated with a period of sustained elevation of intracellular calcium and formation of larger and more heterogeneously shaped granule structures that underwent prolonged exteriorization. Pharmacological inhibition of IKK-β during IgE-dependent stimulation strongly reduced the time partition between signaling and secretion, inhibited SNAP23/STX4 complex formation, and switched the degranulation pattern into one that resembled degranulation induced by substance P. IgE-dependent and substance P–dependent activation in vivo also induced different patterns of mouse MC degranulation that were associated with distinct local and systemic pathophysiological responses. These findings show that cytoplasmic granule secretion from MCs that occurs in response to different activating stimuli can exhibit distinct dynamics and features that are associated with distinct patterns of MC-dependent inflammation. PMID:27643442

  17. Intracellular calcium overloading and oxidative stress in cardiomyocyte necrosis via a mitochondriocentric signal-transducer-effector pathway

    PubMed Central

    Shaheen, Mazen; Cheema, Yaser; Shahbaz, Atta U; Bhattacharya, Syamal K; Weber, Karl T


    Congestive heart failure (CHF), a common clinical syndrome, has reached epidemic proportions. Its disabling symptoms account for frequent hospitalizations and readmissions. Pathophysiological mechanisms that lead to CHF and account for its progressive nature are of considerable interest. Important scientific observations obtained from Dr Pawan K Singal’s laboratory in Winnipeg, Manitoba, have provided crucial insights to our understanding of the pathophysiological factors that contribute to cardiomyocyte necrosis (the heart is a postmitotic organ incapable of tolerating an ongoing loss of these cells without adverse functional consequences). This increment in knowledge and the mechanistic insights afforded by Dr Singal and his colleagues have highlighted the role of excessive intracellular calcium accumulation and the appearance of oxidative stress in CHF, in which the rate of reactive oxygen species generation overwhelms their rate of detoxification by antioxidant defenses. They have shown that this common pathophysiological scenario applies to diverse entities such as ischemia/reperfusion and hypoxia/reoxygenation forms of injury, myocardial infarction and the cardiomyopathies that accompany diabetes and excess levels of catecholamines and adriamycin. The authors are honoured to be invited to contribute to the present focus issue of Experimental & Clinical Cardiology in recognizing Dr Singal’s numerous scholarly accomplishments. The present article reviews the authors’ recent work on a mitochondriocentric signal-transducer-effector pathway to cardiomyocyte necrosis found in rats with either an acute stressor state that accompanies isoproterenol administration or a chronic stressor state manifested after four weeks of aldosterone/salt treatment. PMID:22131852

  18. Encapsulation of Anti-Tuberculosis Drugs within Mesoporous Silica and Intracellular Antibacterial Activities

    PubMed Central

    Xia, Xin; Pethe, Kevin; Kim, Ryangyeo; Ballell, Lluis; Barros, David; Cechetto, Jonathan; Jeon, HeeKyoung; Kim, Kideok; Garcia-Bennett, Alfonso E.


    Tuberculosis is a major problem in public health. While new effective treatments to combat the disease are currently under development, they tend suffer from poor solubility often resulting in low and/or inconsistent oral bioavailability. Mesoporous materials are here investigated in an in vitro intracellular assay, for the effective delivery of compound PA-824; a poorly soluble bactericidal agent being developed against Tuberculosis (TB). Mesoporous materials enhance the solubility of PA-824; however, this is not translated into a higher antibacterial activity in TB-infected macrophages after 5 days of incubation, where similar values are obtained. The lack of improved activity may be due to insufficient release of the drug from the mesopores in the context of the cellular environment. However, these results show promising data for the use of mesoporous particles in the context of oral delivery with expected improvements in bioavailability.

  19. Intracellular coenzymes as natural biomarkers for metabolic activities and mitochondrial anomalies

    PubMed Central

    Heikal, Ahmed A


    Mitochondria play a pivotal role in energy metabolism, programmed cell death and oxidative stress. Mutated mitochondrial DNA in diseased cells compromises the structure of key enzyme complexes and, therefore, mitochondrial function, which leads to a myriad of health-related conditions such as cancer, neurodegenerative diseases, diabetes and aging. Early detection of mitochondrial and metabolic anomalies is an essential step towards effective diagnoses and therapeutic intervention. Reduced nicotinamide adenine dinucleotide (NADH) and flavin adenine dinucleotide (FAD) play important roles in a wide range of cellular oxidation–reduction reactions. Importantly, NADH and FAD are naturally fluorescent, which allows noninvasive imaging of metabolic activities of living cells and tissues. Furthermore, NADH and FAD autofluorescence, which can be excited using distinct wavelengths for complementary imaging methods and is sensitive to protein binding and local environment. This article highlights recent developments concerning intracellular NADH and FAD as potential biomarkers for metabolic and mitochondrial activities. PMID:20406068

  20. The effect of pulsed electric fields on the electrotactic migration of human neural progenitor cells through the involvement of intracellular calcium signaling.


    Hayashi, Hisamitsu; Edin, Fredrik; Li, Hao; Liu, Wei; Rask-Andersen, Helge


    Endogenous electric fields (EFs) are required for the physiological control of the central nervous system development. Application of the direct current EFs to neural stem cells has been studied for the possibility of stem cell transplantation as one of the therapies for brain injury. EFs generated within the nervous system are often associated with action potentials and synaptic activity, apparently resulting in a pulsed current in nature. The aim of this study is to investigate the effect of pulsed EF, which can reduce the cytotoxicity, on the migration of human neural progenitor cells (hNPCs). We applied the mono-directional pulsed EF with a strength of 250mV/mm to hNPCs for 6h. The migration distance of the hNPCs exposed to pulsed EF was significantly greater compared with the control not exposed to the EF. Pulsed EFs, however, had less of an effect on the migration of the differentiated hNPCs. There was no significant change in the survival of hNPCs after exposure to the pulsed EF. To investigate the role of Ca(2+) signaling in electrotactic migration of hNPCs, pharmacological inhibition of Ca(2+) channels in the EF-exposed cells revealed that the electrotactic migration of hNPCs exposed to Ca(2+) channel blockers was significantly lower compared to the control group. The findings suggest that the pulsed EF induced migration of hNPCs is partly influenced by intracellular Ca(2+) signaling.

  1. Intracellular chloride activities in canine tracheal epithelium. Direct evidence for sodium-coupled intracellular chloride accumulation in a chloride-secreting epithelium.

    PubMed Central

    Welsh, M J


    Canine tracheal epithelium secretes Cl via an electrogenic transport process that appears to apply to a wide variety of secretory epithelia. To examine the mechanisms involved, intracellular chloride activity, acCl, was measured with Cl-selective intracellular microelectrodes. The results indicate that when the rate of secretion was minimal acCl was 37 mM; with stimulation of secretion the intracellular voltage depolarized, but acCl was not significantly altered, at 39 mM. These findings indicate that: (a) Cl is accumulated across the basolateral membrane under nonsecreting and secreting conditions at an activity 3.8 and 2.4 times, respectively, that predicted for an equilibrium distribution; (b) Cl exit across the apical membrane may be passive with an electrochemical driving force of 22 mV; and (c) stimulation of secretion enhanced the rate of Cl entry across the basolateral membrane, since Cl transport increased without a change in acCl. In the absence of Na in the extracellular fluid, acCl approached the value expected for an equilibrium distribution. This finding suggests that "uphill" entry of Cl into the cell against its electrochemical gradient is dependent upon, and energized by, the entry of Na down its gradient. Submucosal bumetanide, a loop diuretic, also decreased the rate of Cl secretion and decreased acCl, indicating an inhibition of Cl entry. These findings indicate that Cl entry into the cell is directed against its electrochemical gradient and is mediated by a Na-coupled, bumetanide-inhibitable, transport process at the basolateral membrane and that Cl may exit passively down a favorable electrochemical gradient across the apical membrane. PMID:6853719

  2. Prolonged Intracellular Na+ Dynamics Govern Electrical Activity in Accessory Olfactory Bulb Mitral Cells

    PubMed Central

    Zylbertal, Asaph; Kahan, Anat; Ben-Shaul, Yoram; Yarom, Yosef; Wagner, Shlomo


    Persistent activity has been reported in many brain areas and is hypothesized to mediate working memory and emotional brain states and to rely upon network or biophysical feedback. Here, we demonstrate a novel mechanism by which persistent neuronal activity can be generated without feedback, relying instead on the slow removal of Na+ from neurons following bursts of activity. We show that mitral cells in the accessory olfactory bulb (AOB), which plays a major role in mammalian social behavior, may respond to a brief sensory stimulation with persistent firing. By combining electrical recordings, Ca2+ and Na+ imaging, and realistic computational modeling, we explored the mechanisms underlying the persistent activity in AOB mitral cells. We found that the exceptionally slow inward current that underlies this activity is governed by prolonged dynamics of intracellular Na+ ([Na+]i), which affects neuronal electrical activity via several pathways. Specifically, elevated dendritic [Na+]i reverses the Na+-Ca2+ exchanger activity, thus modifying the [Ca2+]i set-point. This process, which relies on ubiquitous membrane mechanisms, is likely to play a role in other neuronal types in various brain regions. PMID:26674618

  3. Probing cytoskeletal modulation of passive and active intracellular dynamics using nanobody-functionalized quantum dots

    PubMed Central

    Katrukha, Eugene A.; Mikhaylova, Marina; van Brakel, Hugo X.; van Bergen en Henegouwen, Paul M.; Akhmanova, Anna; Hoogenraad, Casper C.; Kapitein, Lukas C.


    The cytoplasm is a highly complex and heterogeneous medium that is structured by the cytoskeleton. How local transport depends on the heterogeneous organization and dynamics of F-actin and microtubules is poorly understood. Here we use a novel delivery and functionalization strategy to utilize quantum dots (QDs) as probes for active and passive intracellular transport. Rapid imaging of non-functionalized QDs reveals two populations with a 100-fold difference in diffusion constant, with the faster fraction increasing upon actin depolymerization. When nanobody-functionalized QDs are targeted to different kinesin motor proteins, their trajectories do not display strong actin-induced transverse displacements, as suggested previously. Only kinesin-1 displays subtle directional fluctuations, because the subset of microtubules used by this motor undergoes prominent undulations. Using actin-targeting agents reveals that F-actin suppresses most microtubule shape remodelling, rather than promoting it. These results demonstrate how the spatial heterogeneity of the cytoskeleton imposes large variations in non-equilibrium intracellular dynamics. PMID:28322225

  4. Two-Component Signaling System VgrRS Directly Senses Extracytoplasmic and Intracellular Iron to Control Bacterial Adaptation under Iron Depleted Stress

    PubMed Central

    Wang, Li; Pan, Yue; Yuan, Zhi-Hui; Zhang, Huan; Peng, Bao-Yu; Wang, Fang-Fang


    Both iron starvation and excess are detrimental to cellular life, especially for animal and plant pathogens since they always live in iron-limited environments produced by host immune responses. However, how organisms sense and respond to iron is incompletely understood. Herein, we reveal that in the phytopathogenic bacterium Xanthomonas campestris pv. campestris, VgrS (also named ColS) is a membrane-bound receptor histidine kinase that senses extracytoplasmic iron limitation in the periplasm, while its cognate response regulator, VgrR (ColR), detects intracellular iron excess. Under iron-depleted conditions, dissociation of Fe3+ from the periplasmic sensor region of VgrS activates the VgrS autophosphorylation and subsequent phosphotransfer to VgrR, an OmpR-family transcription factor that regulates bacterial responses to take up iron. VgrR-VgrS regulon and the consensus DNA binding motif of the transcription factor VgrR were dissected by comparative proteomic and ChIP-seq analyses, which revealed that in reacting to iron-depleted environments, VgrR directly or indirectly controls the expressions of hundreds of genes that are involved in various physiological cascades, especially those associated with iron-uptake. Among them, we demonstrated that the phosphorylated VgrR tightly represses the transcription of a special TonB-dependent receptor gene, tdvA. This regulation is a critical prerequisite for efficient iron uptake and bacterial virulence since activation of tdvA transcription is detrimental to these processes. When the intracellular iron accumulates, the VgrR-Fe2+ interaction dissociates not only the binding between VgrR and the tdvA promoter, but also the interaction between VgrR and VgrS. This relieves the repression in tdvA transcription to impede continuous iron uptake and avoids possible toxic effects of excessive iron accumulation. Our results revealed a signaling system that directly senses both extracytoplasmic and intracellular iron to modulate

  5. Kaposi's sarcoma herpesvirus-encoded latency-associated nuclear antigen stabilizes intracellular activated Notch by targeting the Sel10 protein.


    Lan, Ke; Verma, Subhash C; Murakami, Masanao; Bajaj, Bharat; Kaul, Rajeev; Robertson, Erle S


    Deregulation of the evolutionarily conserved Notch signaling is highly correlated with oncogenesis. Intracellular activated Notch (ICN) is a protooncogene linked to the transcription activation of a number of cellular genes involved in cell cycle regulation, differentiation, and proliferation. Stability of ICN is tightly regulated by the Sel10-mediated ubiquitin-proteasome pathway. Sel10 can function as a negative regulator of Notch and exhibits activities of a tumor-suppressor protein. This article shows that the Kaposi's sarcoma-associated herpesvirus (KSHV) latency-associated nuclear antigen (LANA) directly interacts with Sel10 and forms a complex in KSHV-infected cells. This results in suppression of ICN ubiquitination and degradation. The carboxyl terminus of LANA interacts with the F-box and WD40 domains of Sel10 and competes with ICN for binding to Sel10. This elevated level of ICN is also critical for maintaining the enhanced proliferation of KSHV-infected tumor cells. These findings describe a mechanism by which the KSHV-encoded LANA protein regulates ubiquitination of ICN mediated by the F-box component of the E3 ligase Sel10, leading to proliferation of the virus-infected cells.

  6. Choline-releasing glycerophosphodiesterase EDI3 links the tumor metabolome to signaling network activities

    PubMed Central

    Marchan, Rosemarie; Lesjak, Michaela S.; Stewart, Joanna D.; Winter, Roland; Seeliger, Janine; Hengstler, Jan G.


    Recently, EDI3 was identified as a key factor for choline metabolism that controls tumor cell migration and is associated with metastasis in endometrial carcinomas. EDI3 cleaves glycerophosphocholine (GPC) to form choline and glycerol-3-phosphate (G3P). Choline is then further metabolized to phosphatidylcholine (PtdC), the major lipid in membranes and a key player in membrane-mediated cell signaling. The second product, G3P, is a precursor molecule for several lipids with central roles in signaling, for example lysophosphatidic acid (LPA), phosphatidic acid (PA) and diacylglycerol (DAG). LPA activates intracellular signaling pathways by binding to specific LPA receptors, including membrane-bound G protein-coupled receptors and the intracellular nuclear receptor, PPARγ. Conversely, PA and DAG mediate signaling by acting as lipid anchors that bind and activate several signaling proteins. For example, binding of GTPases and PKC to PA and DAG, respectively, increases the activation of signaling networks, mediating processes such as migration, adhesion, proliferation or anti-apoptosis—all relevant for tumor development. We present a concept by which EDI3 either directly generates signaling molecules or provides “membrane anchors” for downstream signaling factors. As a result, EDI3 links choline metabolism to signaling activities resulting in a more malignant phenotype. PMID:23114620

  7. A cell-permeable tool for analysing APP intracellular domain function and manipulation of PIKfyve activity

    PubMed Central

    Guscott, Benjamin; Balklava, Zita; Safrany, Stephen T.; Wassmer, Thomas


    The mechanisms for regulating PIKfyve complex activity are currently emerging. The PIKfyve complex, consisting of the phosphoinositide kinase PIKfyve (also known as FAB1), VAC14 and FIG4, is required for the production of phosphatidylinositol 3,5-bisphosphate [PI(3,5)P2]. PIKfyve function is required for homoeostasis of the endo/lysosomal system and is crucially implicated in neuronal function and integrity, as loss of function mutations in the PIKfyve complex lead to neurodegeneration in mouse models and human patients. Our recent work has shown that the intracellular domain of the amyloid precursor protein (APP), a molecule central to the aetiology of Alzheimer's disease binds to VAC14 and enhances PIKfyve function. In the present study, we utilize this recent advance to create an easy-to-use tool for increasing PIKfyve activity in cells. We fused APP intracellular domain (AICD) to the HIV TAT domain, a cell-permeable peptide allowing proteins to penetrate cells. The resultant TAT–AICD fusion protein is cell permeable and triggers an increase in PI(3,5)P2. Using the PI(3,5)P2 specific GFP-ML1Nx2 probe, we show that cell-permeable AICD alters PI(3,5)P2 dynamics. TAT–AICD also provides partial protection from pharmacological inhibition of PIKfyve. All three lines of evidence show that the AICD activates the PIKfyve complex in cells, a finding that is important for our understanding of the mechanism of neurodegeneration in Alzheimer's disease. PMID:26934981

  8. Increased intracellular calcium activates serum and glucocorticoid-inducible kinase 1 (SGK1) through a calmodulin-calcium calmodulin dependent kinase kinase pathway in Chinese hamster ovary cells.


    Imai, Seiji; Okayama, Naotsuka; Shimizu, Manabu; Itoh, Makoto


    SGK1 is one of the protein-serine/threonine kinases that is activated by insulin in a PI3K-dependent manner. Although SGK1 mediates a variety of biological activities, the mechanisms regulating its activity remain unclear. In this study, we examined the potential roles of calcium signaling in the activation of SGK1. Treatment of CHO-IR cells with a cell-permeable calcium chelator, BAPTA-AM, abolished the insulin-induced activation of SGK1. Increasing intracellular calcium concentration by treating cells with thapsigargin or ionomycin induced a 6-8 fold increase in SGK1 activation. This was not affected by a PI3K inhibitor, wortmannin, but was completely inhibited by the calmodulin inhibitors, W 7 and W 5. Co-transfection of CHO cells with FLAG-SGK1 and CaMKK revealed the direct association of CaMKK with SGK1. These results suggest a calcium-triggered signaling cascade in which an increase in intracellular calcium concentration directly stimulates SGK1 through CaMKK.

  9. Expression of the potential therapeutic target CXXC5 in primary acute myeloid leukemia cells - high expression is associated with adverse prognosis as well as altered intracellular signaling and transcriptional regulation

    PubMed Central

    Bruserud, Øystein; Reikvam, Håkon; Fredly, Hanne; Skavland, Jørn; Hagen, Karen-Marie; van Hoang, Tuyen Thy; Brenner, Annette K.; Kadi, Amir; Astori, Audrey; Gjertsen, Bjørn Tore; Pendino, Frederic


    The CXXC5 gene encodes a transcriptional activator with a zinc-finger domain, and high expression in human acute myeloid leukemia (AML) cells is associated with adverse prognosis. We now characterized the biological context of CXXC5 expression in primary human AML cells. The global gene expression profile of AML cells derived from 48 consecutive patients was analyzed; cells with high and low CXXC5 expression then showed major differences with regard to extracellular communication and intracellular signaling. We observed significant differences in the phosphorylation status of several intracellular signaling mediators (CREB, PDK1, SRC, STAT1, p38, STAT3, rpS6) that are important for PI3K-Akt-mTOR signaling and/or transcriptional regulation. High CXXC5 expression was also associated with high mRNA expression of several stem cell-associated transcriptional regulators, the strongest associations being with WT1, GATA2, RUNX1, LYL1, DNMT3, SPI1, and MYB. Finally, CXXC5 knockdown in human AML cell lines caused significantly increased expression of the potential tumor suppressor gene TSC22 and genes encoding the growth factor receptor KIT, the cytokine Angiopoietin 1 and the selenium-containing glycoprotein Selenoprotein P. Thus, high CXXC5 expression seems to affect several steps in human leukemogenesis, including intracellular events as well as extracellular communication. PMID:25605239

  10. Protein kinase C activation inhibits eosinophil degranulation through stimulation of intracellular cAMP production.


    Ezeamuzie, Charles I; Taslim, Najla


    The mechanism of inhibition of eosinophil degranulation by protein kinase C (PKC) was investigated in complement C5a (C5a)-stimulated degranulation of highly purified human eosinophils using the specific PKC activator - phorbol 12-myristate 13-acetate (PMA). C5a-induced release of eosinophil peroxidase and eosinophil cationic protein was potently inhibited in a concentration-dependent manner by PMA (IC(50): 3 and 5 nM, respectively). The inhibition by PMA, but not histamine, was significantly reversed by the specific, but isoform nonselective, PKC inhibitor Ro 31-8220 (1 microM). In the presence of phosphodiesterase inhibitor rolipram (5 microM), PMA stimulated a pronounced concentration-dependent increase in intracellular cAMP, with a potency 400 times that of histamine (EC(50): 55 nM vs 22.5 microM). The inactive PMA analogue, 4alpha-PMA, had no such effect. The cAMP production by PMA, but not histamine, was significantly reversed by Ro 31-8220 (1 microM) and the selective inhibitor of the novel PKCdelta, rottlerin (1-3 microM), but not the selective inhibitor of the classical PKC isoforms, Gö 6976 (0.01-0.1 microM). Western blot analysis revealed the presence of six PKC isoforms (alpha, betaI, betaII, delta, iota and zeta) in isolated eosinophils. Chelation of internal or external calcium had no effect on PMA-induced cAMP response, but abolished that induced by histamine. There was a good correlation between increase in intracellular cAMP and inhibition of degranulation. These results show, for the first time, that in human eosinophils, PMA, via activation of PKCdelta isoform, can stimulate cAMP production, and that this may be the basis for its potent anti-degranulatory effect.

  11. Protein kinase C activation inhibits eosinophil degranulation through stimulation of intracellular cAMP production

    PubMed Central

    Ezeamuzie, Charles I; Taslim, Najla


    The mechanism of inhibition of eosinophil degranulation by protein kinase C (PKC) was investigated in complement C5a (C5a)-stimulated degranulation of highly purified human eosinophils using the specific PKC activator – phorbol 12-myristate 13-acetate (PMA). C5a-induced release of eosinophil peroxidase and eosinophil cationic protein was potently inhibited in a concentration-dependent manner by PMA (IC50: 3 and 5 nM, respectively). The inhibition by PMA, but not histamine, was significantly reversed by the specific, but isoform nonselective, PKC inhibitor Ro 31-8220 (1 μM). In the presence of phosphodiesterase inhibitor rolipram (5 μM), PMA stimulated a pronounced concentration-dependent increase in intracellular cAMP, with a potency 400 times that of histamine (EC50: 55 nM vs 22.5 μM). The inactive PMA analogue, 4α-PMA, had no such effect. The cAMP production by PMA, but not histamine, was significantly reversed by Ro 31-8220 (1 μM) and the selective inhibitor of the novel PKCδ, rottlerin (1–3 μM), but not the selective inhibitor of the classical PKC isoforms, Gö 6976 (0.01–0.1 μM). Western blot analysis revealed the presence of six PKC isoforms (α, βI, βII, δ, ι and ζ) in isolated eosinophils. Chelation of internal or external calcium had no effect on PMA-induced cAMP response, but abolished that induced by histamine. There was a good correlation between increase in intracellular cAMP and inhibition of degranulation. These results show, for the first time, that in human eosinophils, PMA, via activation of PKCδ isoform, can stimulate cAMP production, and that this may be the basis for its potent anti-degranulatory effect. PMID:15504748

  12. Very High Concentrations of Active Intracellular Phosphorylated Emtricitabine in Neonates (ANRS 12109 Trial, Step 2)▿

    PubMed Central

    Hirt, Déborah; Pruvost, Alain; Ekouévi, Didier K.; Urien, Saïk; Arrivé, Elise; Kone, Mamourou; Nerrienet, Eric; Nyati, Mandisa; Gray, Glenda; Kruy, Leang Sim; Blanche, Stéphane; Dabis, François; Tréluyer, Jean-Marc


    Our objective was to investigate neonatal emtricitabine (FTC) plasma and intracellular pharmacokinetics. The study was designed as a phase I/II prospective trial in two sequential steps evaluating the combination of tenofovir disoproxil fumarate (TDF) and FTC for the prevention of mother-to-child-transmission (PMTCT) of HIV. HIV-1-infected pregnant women received two tablets of TDF (300 mg) and FTC (200 mg) at onset of labor and then one tablet daily for 7 days postpartum. Based on the data obtained in the first part of the Tenofovir/Emtricitabine in Africa and Asia (TEmAA) Study, single doses of 2 mg/kg of FTC and 13 mg/kg of TDF were given to the neonates within 12 h after birth. A total of 540 FTC plasma concentrations and 44 active intracellular phosphorylated metabolite FTC-TP concentrations were taken from the 36 enrolled women and their neonates. Concentrations were measured by the liquid chromatography-tandem mass spectrometry (LC-MS/MS) method and analyzed by a population approach. The proposed dose obtained by simulations based on plasma drug concentrations was confirmed. However, median FTC-TP exposures were, respectively, 5.9 and 6.8 times higher in the fetus and the neonate than in the adult. High FTC-TP concentrations were observed in the four children who had serious adverse events (SAEs), but the link between FTC-TP concentrations and SAEs in children was not formally identified. The exposure to the active form of FTC was high in neonates despite plasma drug concentrations equivalent to those in adults. Our results are similar to those obtained with zidovudine or lamivudine. PMID:21464241

  13. Nanosecond pulsed electric field induced dose dependent phosphatidylinositol-4,5-bisphosphate signaling and intracellular electro-sensitization.


    Tolstykh, Gleb P; Tarango, Melissa; Roth, Caleb C; Ibey, Bennett L


    Previously, it was demonstrated that nanometer-sized pores (nanopores) are formed in outer cellular membranes after exposure to nanosecond electric pulses (nsEPs). We reported that plasma membrane nanoporation affects phospholipids of the cell membrane, culminating in cascading phosphoinositide phosphatidylinositol-4,5-bisphosphate (PIP2) intracellular signaling. In the current study, we show that nsEPs initiated electric field (EF) dose-dependent PIP2 hydrolysis and/or depletion from the plasma membrane. This process was confirmed using fluorescent optical probes of PIP2 hydrolysis: PLCδ-PH-EGFP and GFP-C1-PKCγ-C1a. The 50% maximum response occurs with a single 600ns pulse achieving an effective dose (ED50) of EF~8kV/cm within our model cell system. At 16.2kV/cm, the ED50 for the pulse width was 484ns. Reduction of the pulse width or EF amplitude gradually reduced the observed effect, but twenty 60ns 16.2kV/cm pulses produced an effect similar to a single 600ns pulse of the same amplitude. Propidium iodide (PI) uptake after the nsEP exposure confirmed a strong relationship between EF-induced plasma membrane impact and PIP2 depletion. These results have expanded our current knowledge of nsEPs dependent cell physiological effects, and serve as a basis for model development of new exposure standards, providing novel tools for drug independent stimulation and approaches to differential modulation of key cellular functions.

  14. Prediction of hammerhead ribozyme intracellular activity with the catalytic core fingerprint.


    Gabryelska, Marta Magdalena; Wyszko, Eliza; Szymański, Maciej; Popenda, Mariusz; Barciszewski, Jan


    Hammerhead ribozyme is a versatile tool for down-regulation of gene expression in vivo. Owing to its small size and high activity, it is used as a model for RNA structure-function relationship studies. In the present paper we describe a new extended hammerhead ribozyme HH-2 with a tertiary stabilizing motif constructed on the basis of the tetraloop receptor sequence. This ribozyme is very active in living cells, but shows low activity in vitro. To understand it, we analysed tertiary structure models of substrate-ribozyme complexes. We calculated six unique catalytic core geometry parameters as distances and angles between particular atoms that we call the ribozyme fingerprint. A flanking sequence and tertiary motif change the geometry of the general base, general acid, nucleophile and leaving group. We found almost complete correlation between these parameters and the decrease of target gene expression in the cells. The tertiary structure model calculations allow us to predict ribozyme intracellular activity. Our approach could be widely adapted to characterize catalytic properties of other RNAs.

  15. α/β-Peptide Foldamers Targeting Intracellular Protein-Protein Interactions with Activity in Living Cells.


    Checco, James W; Lee, Erinna F; Evangelista, Marco; Sleebs, Nerida J; Rogers, Kelly; Pettikiriarachchi, Anne; Kershaw, Nadia J; Eddinger, Geoffrey A; Belair, David G; Wilson, Julia L; Eller, Chelcie H; Raines, Ronald T; Murphy, William L; Smith, Brian J; Gellman, Samuel H; Fairlie, W Douglas


    Peptides can be developed as effective antagonists of protein-protein interactions, but conventional peptides (i.e., oligomers of l-α-amino acids) suffer from significant limitations in vivo. Short half-lives due to rapid proteolytic degradation and an inability to cross cell membranes often preclude biological applications of peptides. Oligomers that contain both α- and β-amino acid residues ("α/β-peptides") manifest decreased susceptibility to proteolytic degradation, and when properly designed these unnatural oligomers can mimic the protein-recognition properties of analogous "α-peptides". This report documents an extension of the α/β-peptide approach to target intracellular protein-protein interactions. Specifically, we have generated α/β-peptides based on a "stapled" Bim BH3 α-peptide, which contains a hydrocarbon cross-link to enhance α-helix stability. We show that a stapled α/β-peptide can structurally and functionally mimic the parent stapled α-peptide in its ability to enter certain types of cells and block protein-protein interactions associated with apoptotic signaling. However, the α/β-peptide is nearly 100-fold more resistant to proteolysis than is the parent stapled α-peptide. These results show that backbone modification, a strategy that has received relatively little attention in terms of peptide engineering for biomedical applications, can be combined with more commonly deployed peripheral modifications such as side chain cross-linking to produce synergistic benefits.

  16. Scaffolds are 'active' regulators of signaling modules.


    Alexa, Anita; Varga, János; Reményi, Attila


    Signaling cascades, in addition to proteins with obvious signaling-relevant activities (e.g. protein kinases or receptors), also employ dedicated 'inactive' proteins whose functions appear to be the organization of the former components into higher order complexes through protein-protein interactions. The core function of signaling adaptors, anchors and scaffolds is the recruitment of proteins into one macromolecular complex. Several recent studies have demonstrated that the recruiter and the recruited molecules mutually influence each other in a scaffolded complex. This yields fundamentally novel properties for the signaling complex as a whole. Because these are not merely additive to the properties of the individual components, scaffolded signaling complexes may behave as functionally distinct modules.

  17. Intracellular activated Notch1 is critical for proliferation of Kaposi's sarcoma-associated herpesvirus-associated B-lymphoma cell lines in vitro.


    Lan, Ke; Choudhuri, Tathagata; Murakami, Masanao; Kuppers, Daniel A; Robertson, Erle S


    Kaposi's sarcoma-associated herpesvirus (KSHV) is a human tumor virus expressing latent antigens critical for pathogenesis. The mechanism by which KSHV mediates oncogenesis has not been fully elucidated. Notch signaling is an evolutionarily conserved pathway controlling diverse events related to development, proliferation, and tissue homeostasis. Deregulation of Notch signaling has also been shown to be highly correlated with oncogenesis. Here we show that the activated intracellular domain of Notch1 (ICN) is aberrantly accumulated in latently KSHV-infected pleural effusion lymphoma cells and results in increased proliferation. Specifically, growth of the infected cells was dramatically inhibited at the G(1) phase by treatment with a gamma-secretase inhibitor which specifically blocks the production of ICN. Increased ICN also up-regulated the cyclin D1 cell cycle regulator. Taken together, these studies define an important mechanism directly linking latent KSHV infection to induction of oncogenesis through dysregulation of the conserved Notch signaling pathway.

  18. Signal integration by Ca2+ regulates intestinal stem cell activity

    PubMed Central

    Deng, Hansong; Gerencser, Akos A.; Jasper, Heinrich


    Summary Somatic stem cells (SCs) maintain tissue homeostasis by dynamically adjusting proliferation and differentiation in response to stress and metabolic cues. Here, we identify Ca2+ signaling as a central regulator of intestinal SC (ISC) activity in Drosophila. We find that dietary L-glutamate stimulates ISC division and gut growth. The metabotropic glutamate receptor (mGluR) is required in ISCs for this response and for an associated modulation of cytosolic Ca2+ oscillations that results in sustained high cytosolic Ca2+ concentrations. High cytosolic Ca2+ induces ISC proliferation by regulating Calcineurin and CREB - regulated transcriptional co-activator (CRTC). In response to a wide range of dietary and stress stimuli, ISCs reversibly transition between Ca2+ oscillation states that represent poised or activated modes of proliferation, respectively. We propose that the dynamic regulation of intracellular Ca2+ levels allows effective integration of diverse mitogenic signals in ISCs to tailor their proliferative activity to the needs of the tissue. PMID:26633624

  19. Potassium permeability activated by intracellular calcium ion concentration in the pancreatic beta-cell.

    PubMed Central

    Atwater, I; Dawson, C M; Ribalet, B; Rojas, E


    1. Membrane potentials and input resistance were measured in beta-cells from mouse pancreatic islets of Langerhans in a study designed to assess the role of a K permeability specifically blocked by quinine or quinidine and activated by intracellular calcium ion concentration ([Ca2+])i-activated PK). 2. Addition of 100 microM-quinine to the perifusion medium resulted in a 10--30 mV depolarization of the membrane and an increase in the input resistance of ca. 4.10(7) omega. 3. In the absence of glucose, 100 microM-quinine induced electrical activity. 4. In the presence of glucose, 100 microM-quinine abolished the burst pattern of electrical activity and very much reduced the graded response of spike frequency normally seen with different concentrations of glucose. 5. Addition of mitochondrial inhibitors, KCN, NaN3, DNP, CCCP, FCCP, to the perifusion medium containing glucose rapidly hyperpolarized the beta-cell membrane, inducing a concomitant decrease in input resistance. 6. In the presence of glucose, these mitochondrial inhibitors reversibly blocked electrical activity; upon removal of the inhibitor, recovery of electrical activity followed a biphasic pattern. 7. The effects of mitochondrial inhibitors were partially reversed by 100 microM-quinine. 8. It is proposed that the membrane potential of the beta-cell in the absence of glucose is predominantly controlled by the [Ca2+]i-activated PK. It is further suggested that this permeability to K controls the level for glucose stimulation and leads to the generation of the burst pattern. PMID:381636

  20. Dietary flavonoid apigenin is a potential inducer of intracellular oxidative stress: the role in the interruptive apoptotic signal.


    Miyoshi, Noriyuki; Naniwa, Kisa; Yamada, Takayo; Osawa, Toshihiko; Nakamura, Yoshimasa


    Apigenin is a representative dietary flavone (2-phenyl-4H-1-benzopyran-4-one) inhibiting cancer cell growth both in cell culture systems and in vivo. The prooxidant potential of apigenin was confirmed by the observations using flowcytometric and immunoblotting techniques that the intracellular accumulations of reactive oxygen species (ROS) and protein carbonyls were detected in the cells treated with apigenin in a dose-dependent manner. Conversely, chrysin (5,7-dihydroxyflavone) did not show any prooxidant effect. A structure-activity relationship data thus indicated that a 4'-monohydroxyl group, which can be oxidized to semiquinone radical but not up to quinone-like metabolite, is essential for prooxidant effect. When HL-60 cells were treated with not only a heme synthesis inhibitor succinyl acetone (SA) but also myeloperoxidase (MPO) inhibitors, the ROS level enhanced by apigenin was significantly reduced. The gathered data suggested that peroxidase-catalyzed production of apigenin B-ring phenoxyl radicals might be responsible for the prooxidant effect. This is supported by the observation that MPO is able to catalyze production of apigenin phenoxyl radicals, detected by an electron spin resonance-spin trapping technique. We also reveal that both SA and alpha-tocopherol enhance cellular susceptibility to apoptosis-inducing stimuli by apigenin. In conclusion, the prooxidant effect of apigenin is likely to oxidize a variety of thiols through the formation of phenoxyl radicals and thus seems to play a significant role in the abortive apoptotic pathway switching to necrotic cell death.

  1. Enhanced glucose-induced intracellular signaling promotes insulin hypersecretion: pancreatic beta-cell functional adaptations in a model of genetic obesity and prediabetes.


    Irles, Esperanza; Ñeco, Patricia; Lluesma, Mónica; Villar-Pazos, Sabrina; Santos-Silva, Junia Carolina; Vettorazzi, Jean F; Alonso-Magdalena, Paloma; Carneiro, Everardo M; Boschero, Antonio C; Nadal, Ángel; Quesada, Ivan


    Obesity is associated with insulin resistance and is known to be a risk factor for type-2 diabetes. In obese individuals, pancreatic beta-cells try to compensate for the increased insulin demand in order to maintain euglycemia. Most studies have reported that this adaptation is due to morphological changes. However, the involvement of beta-cell functional adaptations in this process needs to be clarified. For this purpose, we evaluated different key steps in the glucose-stimulated insulin secretion (GSIS) in intact islets from female ob/ob obese mice and lean controls. Obese mice showed increased body weight, insulin resistance, hyperinsulinemia, glucose intolerance and fed hyperglycemia. Islets from ob/ob mice exhibited increased glucose-induced mitochondrial activity, reflected by enhanced NAD(P)H production and mitochondrial membrane potential hyperpolarization. Perforated patch-clamp examination of beta-cells within intact islets revealed several alterations in the electrical activity such as increased firing frequency and higher sensitivity to low glucose concentrations. A higher intracellular Ca(2+) mobilization in response to glucose was also found in ob/ob islets. Additionally, they displayed a change in the oscillatory pattern and Ca(2+) signals at low glucose levels. Capacitance experiments in intact islets revealed increased exocytosis in individual ob/ob beta-cells. All these up-regulated processes led to increased GSIS. In contrast, we found a lack of beta-cell Ca(2+) signal coupling, which could be a manifestation of early defects that lead to beta-cell malfunction in the progression to diabetes. These findings indicate that beta-cell functional adaptations are an important process in the compensatory response to obesity.

  2. Nonlinear Dynamic Modeling of Neuron Action Potential Threshold During Synaptically Driven Broadband Intracellular Activity

    PubMed Central

    Roach, Shane M.; Song, Dong; Berger, Theodore W.


    Activity-dependent variation of neuronal thresholds for action potential (AP) generation is one of the key determinants of spike-train temporal-pattern transformations from presynaptic to postsynaptic spike trains. In this study, we model the nonlinear dynamics of the threshold variation during synaptically driven broadband intracellular activity. First, membrane potentials of single CA1 pyramidal cells were recorded under physiologically plausible broadband stimulation conditions. Second, a method was developed to measure AP thresholds from the continuous recordings of membrane potentials. It involves measuring the turning points of APs by analyzing the third-order derivatives of the membrane potentials. Four stimulation paradigms with different temporal patterns were applied to validate this method by comparing the measured AP turning points and the actual AP thresholds estimated with varying stimulation intensities. Results show that the AP turning points provide consistent measurement of the AP thresholds, except for a constant offset. It indicates that 1) the variation of AP turning points represents the nonlinearities of threshold dynamics; and 2) an optimization of the constant offset is required to achieve accurate spike prediction. Third, a nonlinear dynamical third-order Volterra model was built to describe the relations between the threshold dynamics and the AP activities. Results show that the model can predict threshold accurately based on the preceding APs. Finally, the dynamic threshold model was integrated into a previously developed single neuron model and resulted in a 33% improvement in spike prediction. PMID:22156947

  3. Activity of Medicinal Plant Extracts on Multiplication of Mycobacterium tuberculosis under Reduced Oxygen Conditions Using Intracellular and Axenic Assays

    PubMed Central

    Bhatter, Purva D.; Gupta, Pooja D.; Birdi, Tannaz J.


    Aim. Test the activity of selected medicinal plant extracts on multiplication of Mycobacterium tuberculosis under reduced oxygen concentration which represents nonreplicating conditions. Material and Methods. Acetone, ethanol and aqueous extracts of the plants Acorus calamus L. (rhizome), Ocimum sanctum L. (leaf), Piper nigrum L. (seed), and Pueraria tuberosa DC. (tuber) were tested on Mycobacterium tuberculosis H37Rv intracellularly using an epithelial cell (A549) infection model. The extracts found to be active intracellularly were further studied axenically under reducing oxygen concentrations. Results and Conclusions. Intracellular multiplication was inhibited ≥60% by five of the twelve extracts. Amongst these 5 extracts, in axenic culture, P. nigrum (acetone) was active under aerobic, microaerophilic, and anaerobic conditions indicating presence of multiple components acting at different levels and P. tuberosa (aqueous) showed bactericidal activity under microaerophilic and anaerobic conditions implying the influence of anaerobiosis on its efficacy. P. nigrum (aqueous) and A. calamus (aqueous and ethanol) extracts were not active under axenic conditions but only inhibited intracellular growth of Mycobacterium tuberculosis, suggesting activation of host defense mechanisms to mediate bacterial killing rather than direct bactericidal activity. PMID:26941797

  4. Activation of Src and release of intracellular calcium by phosphatidic acid during Xenopus laevis fertilization.


    Bates, Ryan C; Fees, Colby P; Holland, William L; Winger, Courtney C; Batbayar, Khulan; Ancar, Rachel; Bergren, Todd; Petcoff, Douglas; Stith, Bradley J


    We report a new step in the fertilization in Xenopus laevis which has been found to involve activation of Src tyrosine kinase to stimulate phospholipase C-γ (PLC-γ) which increases inositol 1,4,5-trisphosphate (IP3) to release intracellular calcium ([Ca](i)). Molecular species analysis and mass measurements suggested that sperm activate phospholipase D (PLD) to elevate phosphatidic acid (PA). We now report that PA mass increased 2.7 fold by 1 min after insemination and inhibition of PA production by two methods inhibited activation of Src and PLCγ, increased [Ca](i) and other fertilization events. As compared to 14 other lipids, PA specifically bound Xenopus Src but not PLCγ. Addition of synthetic PA activated egg Src (an action requiring intact lipid rafts) and PLCγ as well as doubling the amount of PLCγ in rafts. In the absence of elevated [Ca](i), PA addition elevated IP3 mass to levels equivalent to that induced by sperm (but twice that achieved by calcium ionophore). Finally, PA induced [Ca](i) release that was blocked by an IP3 receptor inhibitor. As only PLD1b message was detected, and Western blotting did not detect PLD2, we suggest that sperm activate PLD1b to elevate PA which then binds to and activates Src leading to PLCγ stimulation, IP3 elevation and [Ca](i) release. Due to these and other studies, PA may also play a role in membrane fusion events such as sperm-egg fusion, cortical granule exocytosis, the elevation of phosphatidylinositol 4,5-bisphosphate and the large, late increase in sn 1,2-diacylglycerol in fertilization.

  5. Intracellular Delivery of Peptidyl Ligands by Reversible Cyclization: Discovery of a PDZ Domain Inhibitor that Rescues CFTR Activity**

    PubMed Central

    Qian, Ziqing; Xu, Xiaohua; Amacher, Jeanine F.; Madden, Dean R.; Cormet-Boyaka, Estelle


    We report a general strategy for intracellular delivery of linear peptidyl ligands by fusing them with a cell-penetrating peptide and cyclizing the fusion peptides through a disulfide bond. The resulting cyclic peptides are cell permeable and have improved proteolytic stability. Once inside the cell, the disulfide bond is reduced to produce linear, biologically active peptides. This strategy was applied to generate a cell-permeable peptide substrate for real-time detection of intracellular caspase activities during apoptosis and a CAL-PDZ domain inhibitor for potential treatment of cystic fibrosis. PMID:25785567

  6. The role of substrate specificity and metal binding in defining the activity and structure of an intracellular subtilisin.


    Gamble, Michael; Künze, Georg; Brancale, Andrea; Wilson, Keith S; Jones, D Dafydd


    The dimeric intracellular subtilisin proteases (ISPs) found throughout Gram-positive bacteria are a structurally distinct class of the subtilase family. Unlike the vast majority of subtilisin-like proteases, the ISPs function exclusively within the cell, contributing the majority of observed cellular proteolytic activity. Given that they are active within the cell, little is known about substrate specificity and the role of stress signals such as divalent metal ions in modulating ISP function. We demonstrate that both play roles in defining the proteolytic activity of Bacillus clausii ISP and propose the molecular basis of their effects. Enzyme kinetics reveal that one particular synthetic tetrapeptide substrate, Phe-Ala-Ala-Phe-pNA, is hydrolysed with a catalytic efficiency ∼100-fold higher than any other tested. Heat-denatured whole proteins were found to be better substrates for ISP than the native forms. Substrate binding simulations suggest that the S1, S2 and S4 sites form defined binding pockets. The deep S1 cavity and wide S4 site are fully occupied by the hydrophobic aromatic side-chains of Phe. Divalent metal ions, probably Ca(2+), are proposed to be important for ISP activity through structural changes. The presence of >0.01 mM EDTA inactivates ISP, with CD and SEC suggesting that the protein becomes less structured and potentially monomeric. Removal of Ca(2+) at sites close to the dimer interface and the S1 pocket are thought to be responsible for the effect. These studies provide a new insight into the potential physiological function of ISPs, by reconciling substrate specificity and divalent metal binding to associate ISP with the unfolded protein response under stress conditions.

  7. The role of substrate specificity and metal binding in defining the activity and structure of an intracellular subtilisin

    PubMed Central

    Gamble, Michael; Künze, Georg; Brancale, Andrea; Wilson, Keith S.; Jones, D. Dafydd


    The dimeric intracellular subtilisin proteases (ISPs) found throughout Gram-positive bacteria are a structurally distinct class of the subtilase family. Unlike the vast majority of subtilisin-like proteases, the ISPs function exclusively within the cell, contributing the majority of observed cellular proteolytic activity. Given that they are active within the cell, little is known about substrate specificity and the role of stress signals such as divalent metal ions in modulating ISP function. We demonstrate that both play roles in defining the proteolytic activity of Bacillus clausii ISP and propose the molecular basis of their effects. Enzyme kinetics reveal that one particular synthetic tetrapeptide substrate, Phe-Ala-Ala-Phe-pNA, is hydrolysed with a catalytic efficiency ∼100-fold higher than any other tested. Heat-denatured whole proteins were found to be better substrates for ISP than the native forms. Substrate binding simulations suggest that the S1, S2 and S4 sites form defined binding pockets. The deep S1 cavity and wide S4 site are fully occupied by the hydrophobic aromatic side-chains of Phe. Divalent metal ions, probably Ca2+, are proposed to be important for ISP activity through structural changes. The presence of >0.01 mM EDTA inactivates ISP, with CD and SEC suggesting that the protein becomes less structured and potentially monomeric. Removal of Ca2+ at sites close to the dimer interface and the S1 pocket are thought to be responsible for the effect. These studies provide a new insight into the potential physiological function of ISPs, by reconciling substrate specificity and divalent metal binding to associate ISP with the unfolded protein response under stress conditions. PMID:23650602

  8. Near-Infrared Light Activation of Proteins Inside Living Cells Enabled by Carbon Nanotube-Mediated Intracellular Delivery.


    Li, He; Fan, Xinqi; Chen, Xing


    Light-responsive proteins have been delivered into the cells for controlling intracellular events with high spatial and temporal resolution. However, the choice of wavelength is limited to the UV and visible range; activation of proteins inside the cells using near-infrared (NIR) light, which has better tissue penetration and biocompatibility, remains elusive. Here, we report the development of a single-walled carbon nanotube (SWCNT)-based bifunctional system that enables protein intracellular delivery, followed by NIR activation of the delivered proteins inside the cells. Proteins of interest are conjugated onto SWCNTs via a streptavidin-desthiobiotin (SA-DTB) linkage, where the protein activity is blocked. SWCNTs serve as both a nanocarrier for carrying proteins into the cells and subsequently a NIR sensitizer to photothermally cleave the linkage and release the proteins. The released proteins become active and exert their functions inside the cells. We demonstrated this strategy by intracellular delivery and NIR-triggered nuclear translocation of enhanced green fluorescent protein, and by intracellular delivery and NIR-activation of a therapeutic protein, saporin, in living cells. Furthermore, we showed that proteins conjugated onto SWCNTs via the SA-DTB linkage could be delivered to the tumors, and optically released and activated by using NIR light in living mice.

  9. Intracellular β2-adrenergic receptor signaling specificity in mouse skeletal muscle in response to single-dose β2-agonist clenbuterol treatment and acute exercise.


    Sato, Shogo; Shirato, Ken; Mitsuhashi, Ryosuke; Inoue, Daisuke; Kizaki, Takako; Ohno, Hideki; Tachiyashiki, Kaoru; Imaizumi, Kazuhiko


    The aim of this study was to clarify the intracellular β2-adrenergic receptor signaling specificity in mouse slow-twitch soleus and fast-twitch tibialis anterior (TA) muscles, resulting from single-dose β2-agonist clenbuterol treatment and acute exercise. At 1, 4, and 24 h after single-dose treatment with clenbuterol or after acute running exercise, the soleus and TA muscles were isolated and subjected to analysis. The phosphorylation of p38 mitogen-activated protein kinase (MAPK) increased after single-dose clenbuterol treatment and acute exercise in the soleus muscle but not in the TA muscle. Although there was no change in the phosphorylation of Akt after acute exercise in either muscle, phosphorylation of Akt in the soleus muscle increased after single-dose clenbuterol treatment, whereas that in the TA muscle remained unchanged. These results suggest that p38 MAPK and Akt pathways play a functional role in the adaptation to clenbuterol treatment and exercise, particularly in slow-twitch muscles.

  10. Role of intracellular Ca2+ signal in the ascorbate-induced apoptosis in a human hepatoma cell line.


    Lee, Yong Soo


    Although ascorbate (vitamin C) has been shown to have anti-cancer actions, its effect on human hepatoma cells has not yet been investigated, and thus, the exact mechanism of this action is not fully understood. In this study, the mechanism by which ascorbate induces apoptosis using HepG2 human hepatoblastoma cells is investigated. Ascorbate induced apoptotic cell death in a dose-dependent manner in the cells, was assessed through flow cytometric analysis. Contrary to expectation, ascorbate did not alter the cellular redox status, and treatment with antioxidants (N-acetyl cysteine and N,N-diphenyl-p-phenylenediamine) had no influence on the ascorbate-induced apoptosis. However, ascorbate induced a rapid and sustained increase in intracellular Ca2+ concentration. EGTA, an extracellular Ca2+ chelator did not significantly alter the ascorbate-induced intracellular Ca2+ increase and apoptosis, whereas dantrolene, an intracellular Ca2+ release blocker, completely blocked these actions of ascorbate. In addition, phospholipase C (PLC) inhibitors (U-73122 and manoalide) significantly suppressed the intracellular Ca2+ release and apoptosis induced by ascorbate. Collectively, these results suggest that ascorbate induced apoptosis without changes in the cellular redox status in HepG2 cells, and that the PLC-coupled intracellular Ca2+ release mechanism may mediate ascorbate-induced apoptosis.

  11. In vivo optical microprobe imaging for intracellular Ca2+ dynamics in response to dopaminergic signaling in deep brain evoked by cocaine

    NASA Astrophysics Data System (ADS)

    Luo, Zhongchi; Pan, Yingtian; Du, Congwu


    Ca2+ plays a vital role as second messenger in signal transduction and the intracellular Ca2+ ([Ca2+]i) change is an important indicator of neuronal activity in the brain, including both cortical and subcortical brain regions. Due to the highly scattering and absorption of brain tissue, it is challenging to optically access the deep brain regions (e.g., striatum at >3mm under the brain surface) and image [Ca2+]i changes with cellular resolutions. Here, we present two micro-probe approaches (i.e., microlens, and micro-prism) integrated with a fluorescence microscope modified to permit imaging of neuronal [Ca2+]i signaling in the striatum using a calcium indicator Rhod2(AM). While a micro-prism probe provides a larger field of view to image neuronal network from cortex to striatum, a microlens probe enables us to track [Ca2+]i dynamic change in individual neurons within the brain. Both techniques are validated by imaging neuronal [Ca2+]i changes in transgenic mice with dopamine receptors (D1R, D2R) expressing EGFP. Our results show that micro-prism images can map the distribution of D1R- and D2R-expressing neurons in various brain regions and characterize their different mean [Ca2+]i changes induced by an intervention (e.g., cocaine administration, 8mg/kg., i.p). In addition, microlens images can characterize the different [Ca2+]i dynamics of D1 and D2 neurons in response to cocaine, including new mechanisms of these two types of neurons in striatum. These findings highlight the power of the optical micro-probe imaging for dissecting the complex cellular and molecular insights of cocaine in vivo.

  12. The C-terminal domains of the GABA(b) receptor subunits mediate intracellular trafficking but are not required for receptor signaling.


    Calver, A R; Robbins, M J; Cosio, C; Rice, S Q; Babbs, A J; Hirst, W D; Boyfield, I; Wood, M D; Russell, R B; Price, G W; Couve, A; Moss, S J; Pangalos, M N


    GABA(B) receptors are G-protein-coupled receptors that mediate slow synaptic inhibition in the brain and spinal cord. These receptors are heterodimers assembled from GABA(B1) and GABA(B2) subunits, neither of which is capable of producing functional GABA(B) receptors on homomeric expression. GABA(B1,) although able to bind GABA, is retained within the endoplasmic reticulum (ER) when expressed alone. In contrast, GABA(B2) is able to access the cell surface when expressed alone but does not couple efficiently to the appropriate effector systems or produce any detectable GABA-binding sites. In the present study, we have constructed chimeric and truncated GABA(B1) and GABA(B2) subunits to explore further GABA(B) receptor signaling and assembly. Removal of the entire C-terminal intracellular domain of GABA(B1) results in plasma membrane expression without the production of a functional GABA(B) receptor. However, coexpression of this truncated GABA(B1) subunit with either GABA(B2) or a truncated GABA(B2) subunit in which the C terminal has also been removed is capable of functional signaling via G-proteins. In contrast, transferring the entire C-terminal tail of GABA(B1) to GABA(B2) leads to the ER retention of the GABA(B2) subunit when expressed alone. These results indicate that the C terminal of GABA(B1) mediates the ER retention of this protein and that neither of the C-terminal tails of GABA(B1) or GABA(B2) is an absolute requirement for functional coupling of heteromeric receptors. Furthermore although GABA(B1) is capable of producing GABA-binding sites, GABA(B2) is of central importance in the functional coupling of heteromeric GABA(B) receptors to G-proteins and the subsequent activation of effector systems.

  13. Hypoxia Affects Neprilysin Expression Through Caspase Activation and an APP Intracellular Domain-dependent Mechanism

    PubMed Central

    Kerridge, Caroline; Kozlova, Daria I.; Nalivaeva, Natalia N.; Turner, Anthony J.


    While gene mutations in the amyloid precursor protein (APP) and the presenilins lead to an accumulation of the amyloid β-peptide (Aβ) in the brain causing neurodegeneration and familial Alzheimer's disease (AD), over 95% of all AD cases are sporadic. Despite the pathologies being indistinguishable, relatively little is known about the mechanisms affecting generation of Aβ in the sporadic cases. Vascular disorders such as ischaemia and stroke are well established risk factors for the development of neurodegenerative diseases and systemic hypoxic episodes have been shown to increase Aβ production and accumulation. We have previously shown that hypoxia causes a significant decrease in the expression of the major Aβ-degrading enzyme neprilysin (NEP) which might deregulate Aβ clearance. Aβ itself is derived from the transmembrane APP along with several other biologically active metabolites including the C-terminal fragment (CTF) termed the APP intracellular domain (AICD), which regulates the expression of NEP and some other genes in neuronal cells. Here we show that in hypoxia there is a significantly increased expression of caspase-3, 8, and 9 in human neuroblastoma NB7 cells, which can degrade AICD. Using chromatin immunoprecipitation we have revealed that there was also a reduction of AICD bound to the NEP promoter region which underlies the decreased expression and activity of the enzyme under hypoxic conditions. Incubation of the cells with a caspase-3 inhibitor Z-DEVD-FMK could rescue the effect of hypoxia on NEP activity protecting the levels of AICD capable of binding the NEP promoter. These data suggest that activation of caspases might play an important role in regulation of NEP levels in the brain under pathological conditions such as hypoxia and ischaemia leading to a deficit of Aβ clearance and increasing the risk of development of AD. PMID:26617481

  14. Intracellular Erythrocyte Platelet-activating Factor Acetylhydrolase I Inactivates Aspirin in Blood*

    PubMed Central

    Zhou, Gang; Marathe, Gopal K.; Willard, Belinda; McIntyre, Thomas M.


    Aspirin (acetylsalicylic acid) prophylaxis suppresses major adverse cardiovascular events, but its rapid turnover limits inhibition of platelet cyclooxygenase activity and thrombosis. Despite its importance, the identity of the enzyme(s) that hydrolyzes the acetyl residue of circulating aspirin, which must be an existing enzyme, remains unknown. We find that circulating aspirin was extensively hydrolyzed within erythrocytes, and chromatography indicated these cells contained a single hydrolytic activity. Purification by over 1400-fold and sequencing identified the PAFAH1B2 and PAFAH1B3 subunits of type I platelet-activating factor (PAF) acetylhydrolase, a phospholipase A2 with selectivity for acetyl residues of PAF, as a candidate for aspirin acetylhydrolase. Western blotting showed that catalytic PAFAH1B2 and PAFAH1B3 subunits of the type I enzyme co-migrated with purified erythrocyte aspirin hydrolytic activity. Recombinant PAFAH1B2, but not its family member plasma PAF acetylhydrolase, hydrolyzed aspirin, and PAF competitively inhibited aspirin hydrolysis by purified or recombinant erythrocyte enzymes. Aspirin was hydrolyzed by HEK cells transfected with PAFAH1B2 or PAFAH1B3, and the competitive type I PAF acetylhydrolase inhibitor NaF reduced erythrocyte hydrolysis of aspirin. Exposing aspirin to erythrocytes blocked its ability to inhibit thromboxane A2 synthesis and platelet aggregation. Not all individuals or populations are equally protected by aspirin prophylaxis, the phenomenon of aspirin resistance, and erythrocyte hydrolysis of aspirin varied 3-fold among individuals, which correlated with PAFAH1B2 and not PAFAH1B3. We conclude that intracellular type I PAF acetylhydrolase is the major aspirin hydrolase of human blood. PMID:21844189

  15. Intracellular mechanisms involved in copper-gonadotropin-releasing hormone (Cu-GnRH) complex-induced cAMP/PKA signaling in female rat anterior pituitary cells in vitro.


    Gajewska, Alina; Zielinska-Gorska, Marlena; Wolinska-Witort, Ewa; Siawrys, Gabriela; Baran, Marta; Kotarba, Grzegorz; Biernacka, Katarzyna


    The copper-gonadotropin-releasing hormone molecule (Cu-GnRH) is a GnRH analog, which preserves its amino acid sequence, but which contains a Cu(2+) ion stably bound to the nitrogen atoms including that of the imidazole ring of Histidine(2). A previous report indicated that Cu-GnRH was able to activate cAMP/PKA signaling in anterior pituitary cells in vitro, but raised the question of which intracellular mechanism(s) mediated the Cu-GnRH-induced cAMP synthesis in gonadotropes. To investigate this mechanism, in the present study, female rat anterior pituitary cells in vitro were pretreated with 0.1 μM antide, a GnRH antagonist; 0.1 μM cetrorelix, a GnRH receptor antagonist; 0.1 μM PACAP6-38, a PAC-1 receptor antagonist; 2 μM GF109203X, a protein kinase C inhibitor; 50 mM PMA, a protein kinase C activator; the protein kinase A inhibitors H89 (30 μM) and KT5720 (60 nM); factors affecting intracellular calcium activity: 2.5 mM EGTA; 2 μM thapsigargin; 5 μM A23187, a Ca(2+) ionophore; or 10 μg/ml cycloheximide, a protein synthesis inhibitor. After one of the above pretreatments, cells were incubated in the presence of 0.1 μM Cu-GnRH for 0.5, 1, and 3 h. Radioimmunoassay analysis of cAMP confirmed the functional link between Cu-GnRH stimulation and cAMP/PKA signal transduction in rat anterior pituitary cells, demonstrating increased intracellular cAMP, which was reduced in the presence of specific PKA inhibitors. The stimulatory effect of Cu-GnRH on cAMP production was partly dependent on GnRH receptor activation. In addition, an indirect and Ca(2+)-dependent mechanism might be involved in intracellular adenylate cyclase stimulation. Neither activation of protein kinase C nor new protein synthesis was involved in the Cu-GnRH-induced increase of cAMP in the rat anterior pituitary primary cultures. Presented data indicate that conformational changes of GnRH molecule resulting from cooper ion coordination affect specific pharmacological properties of Cu

  16. Enhancement of intracellular signaling associated with hematopoietic progenitor cell survival in response to SDF-1/CXCL12 in synergy with other cytokines.


    Lee, Younghee; Gotoh, Akihiko; Kwon, Hyung-Joo; You, Minute; Kohli, Lisa; Mantel, Charlie; Cooper, Scott; Hangoc, Giao; Miyazawa, Keisuke; Ohyashiki, Kazuma; Broxmeyer, Hal E


    Stromal cell-derived factor 1 (SDF-1/CXCL12) is a multifunctional cytokine. We previously reported that myelopoiesis was enhanced in SDF-1 alpha transgenic mice, probably due in part to SDF-1 alpha enhancement of myeloid progenitor cell (MPC) survival. To understand signaling pathways involved in this activity, we studied the effects on factor-dependent cell line MO7e cells incubated with SDF-1 alpha alone or in combination with other cytokines. SDF-1 alpha induced transient activation of extracellular stress-regulated kinase (ERK1/2), ribosomal S6 kinase (p90RSK) and Akt, molecules implicated in cell survival. Moreover, ERK1/2, p90RSK, and Akt were synergistically activated by SDF-1 alpha in combination with granulocyte-macrophage colony-stimulating factor (GM-CSF), Steel factor (SLF), or thrombopoietin (TPO). Similar effects were seen after pretreatment of MO7e cells with SDF-1 alpha followed by stimulation with the other cytokines, suggesting a priming effect of SDF-1 alpha. Nuclear factor-kappa B (NF-kappa B) did not appear to be involved in SDF-1 alpha actions, alone or in combination with other cytokines. These intracellular effects were consistent with enhanced myeloid progenitor cell survival by SDF-1 alpha after delayed addition of growth factors. SDF-1 alpha alone supported survival of highly purified human cord blood CD34(+++) cells, less purified human cord blood, and MO7e cells; this effect was synergistically enhanced when SDF-1 alpha was combined with low amounts of other survival-promoting cytokines (GM-CSF, SLF, TPO, and FL). SDF-1 may contribute to maintenance of MPCs in bone marrow by enhancing cell survival alone and in combination with other cytokines.

  17. Depletion of Intracellular Thiols and Increased Production of 4-Hydroxynonenal that Occur During Cryopreservation of Stallion Spermatozoa Lead to Caspase Activation, Loss of Motility, and Cell Death.


    Martin Muñoz, Patricia; Ortega Ferrusola, Cristina; Vizuete, Guillermo; Plaza Dávila, Maria; Rodriguez Martinez, Heriberto; Peña, Fernando J


    Oxidative stress has been linked to sperm death and the accelerated senescence of cryopreserved spermatozoa. However, the molecular mechanisms behind this phenomenon remain poorly understood. Reactive oxygen species (ROS) are considered relevant signaling molecules for sperm function, only becoming detrimental when ROS homeostasis is lost. We hereby hypothesize that a major component of the alteration of ROS homeostasis in cryopreserved spermatozoa is the exhaustion of intrinsic antioxidant defense mechanisms. To test this hypothesis, semen from seven stallions was frozen using a standard technique. The parameters of sperm quality (motility, velocity, and membrane integrity) and markers of sperm senescence (caspase 3, 4-hydroxynonenal, and mitochondrial membrane potential) were assessed before and after cryopreservation. Changes in the intracellular thiol content were also monitored. Cryopreservation caused significant increases in senescence markers as well as dramatic depletion of intracellular thiols to less than half of the initial values (P < 0.001) postthaw. Interestingly, very high and positive correlations were observed among thiol levels with sperm functionality postthaw: total motility (r = 0.931, P < 0.001), progressive motility (r = 0.904, P < 0.001), and percentage of live spermatozoa without active caspase 3 (r = 0.996, P < 0.001). In contrast, negative correlations were detected between active caspase 3 and thiol content both in living (r = -0.896) and dead (r = -0.940) spermatozoa; additionally, 4-hydroxynonenal levels were negatively correlated with thiol levels (r = -0.856). In conclusion, sperm functionality postthaw correlates with the maintenance of adequate levels of intracellular thiols. The accelerated senescence of thawed spermatozoa is related to oxidative and electrophilic stress induced by increased production of 4-hydroxynoneal in thawed samples once intracellular thiols are depleted.

  18. Nuclease activity of Legionella pneumophila Cas2 promotes intracellular infection of amoebal host cells.


    Gunderson, Felizza F; Mallama, Celeste A; Fairbairn, Stephanie G; Cianciotto, Nicholas P


    Legionella pneumophila, the primary agent of Legionnaires' disease, flourishes in both natural and man-made environments by growing in a wide variety of aquatic amoebae. Recently, we determined that the Cas2 protein of L. pneumophila promotes intracellular infection of Acanthamoeba castellanii and Hartmannella vermiformis, the two amoebae most commonly linked to cases of disease. The Cas2 family of proteins is best known for its role in the bacterial and archeal clustered regularly interspaced short palindromic repeat (CRISPR)-CRISPR-associated protein (Cas) system that constitutes a form of adaptive immunity against phage and plasmid. However, the infection event mediated by L. pneumophila Cas2 appeared to be distinct from this function, because cas2 mutants exhibited infectivity defects in the absence of added phage or plasmid and since mutants lacking the CRISPR array or any one of the other cas genes were not impaired in infection ability. We now report that the Cas2 protein of L. pneumophila has both RNase and DNase activities, with the RNase activity being more pronounced. By characterizing a catalytically deficient version of Cas2, we determined that nuclease activity is critical for promoting infection of amoebae. Also, introduction of Cas2, but not its catalytic mutant form, into a strain of L. pneumophila that naturally lacks a CRISPR-Cas locus caused that strain to be 40- to 80-fold more infective for amoebae, unequivocally demonstrating that Cas2 facilitates the infection process independently of any other component encoded within the CRISPR-Cas locus. Finally, a cas2 mutant was impaired for infection of Willaertia magna but not Naegleria lovaniensis, suggesting that Cas2 promotes infection of most but not all amoebal hosts.

  19. Intracellular mediators of Na -K pump activity in guinea pig pancreatic acinar cells

    SciTech Connect

    Hootman, S.R.; Ochs, D.L.; Williams, J.A.


    The involvement of CaS and cyclic nucleotides in neurohormonal regulation of Na -K -ATPase (Na -K pump) activity in guinea pig pancreatic acinar cells was investigated. Changes in Na+-K+ pump activity elicited by secretagogues were assessed by (3H)ouabain binding and by ouabain-sensitive YWRb uptake. Carbachol (CCh) and cholecystokinin octapeptide (CCK-8) each stimulated both ouabain-sensitive 86Rb+ uptake and equilibrium binding of (TH)ouabain by approximately 60%. Secretin increased both indicators of Na+-K+ pump activity by approximately 40% as did forskolin, 8-bromo- and dibutyryl cAMP, theophylline, and isobutylmethylxanthine. Incubation of acinar cells in CaS -free HEPES-buffered Ringer (HR) with 0.5 mM EGTA reduced the stimulatory effects of CCh and CCK-8 by up to 90% but caused only a small reduction in the effects of secretin, forskolin, and cAMP analogues. In addition, CCh, CCK-8, secretin, and forskolin each stimulated ouabain-insensitive 86Rb+ uptake by acinar cells. The increase elicited by CCh and CCK-8 was greatly reduced in the absence of extracellular CaS , while that caused by the latter two agents was not substantially altered. The effects of secretagogues on free CaS levels in pancreatic acinar cells also were investigated with quin-2, a fluorescent CaS chelator. Basal intracellular CaS concentration ((CaS )i) was 161 nM in resting cells and increased to 713 and 803 nM within 15 s after addition of 100 microM CCh or 10 nM CCK-8, respectively.

  20. Nuclease Activity of Legionella pneumophila Cas2 Promotes Intracellular Infection of Amoebal Host Cells

    PubMed Central

    Gunderson, Felizza F.; Mallama, Celeste A.; Fairbairn, Stephanie G.


    Legionella pneumophila, the primary agent of Legionnaires' disease, flourishes in both natural and man-made environments by growing in a wide variety of aquatic amoebae. Recently, we determined that the Cas2 protein of L. pneumophila promotes intracellular infection of Acanthamoeba castellanii and Hartmannella vermiformis, the two amoebae most commonly linked to cases of disease. The Cas2 family of proteins is best known for its role in the bacterial and archeal clustered regularly interspaced short palindromic repeat (CRISPR)–CRISPR-associated protein (Cas) system that constitutes a form of adaptive immunity against phage and plasmid. However, the infection event mediated by L. pneumophila Cas2 appeared to be distinct from this function, because cas2 mutants exhibited infectivity defects in the absence of added phage or plasmid and since mutants lacking the CRISPR array or any one of the other cas genes were not impaired in infection ability. We now report that the Cas2 protein of L. pneumophila has both RNase and DNase activities, with the RNase activity being more pronounced. By characterizing a catalytically deficient version of Cas2, we determined that nuclease activity is critical for promoting infection of amoebae. Also, introduction of Cas2, but not its catalytic mutant form, into a strain of L. pneumophila that naturally lacks a CRISPR-Cas locus caused that strain to be 40- to 80-fold more infective for amoebae, unequivocally demonstrating that Cas2 facilitates the infection process independently of any other component encoded within the CRISPR-Cas locus. Finally, a cas2 mutant was impaired for infection of Willaertia magna but not Naegleria lovaniensis, suggesting that Cas2 promotes infection of most but not all amoebal hosts. PMID:25547789

  1. Anti-cancer effects of cerium oxide nanoparticles and its intracellular redox activity.


    Pešić, Milica; Podolski-Renić, Ana; Stojković, Sonja; Matović, Branko; Zmejkoski, Danica; Kojić, Vesna; Bogdanović, Gordana; Pavićević, Aleksandra; Mojović, Miloš; Savić, Aleksandar; Milenković, Ivana; Kalauzi, Aleksandar; Radotić, Ksenija


    Data on medical applications of cerium oxide nanoparticles CeO2 (CONP) are promising, yet information regarding their action in cells is incomplete and there are conflicting reports about in vitro toxicity. Herein, we have studied cytotoxic effect of CONP in several cancer and normal cell lines and their potential to change intracellular redox status. The IC50 was achieved only in two of eight tested cell lines, melanoma 518A2 and colorectal adenocarcinoma HT-29. Self-propagating room temperature method was applied to produce CONP with an average crystalline size of 4 nm. The results confirmed presence of Ce(3+) and O(2-) vacancies. The induction of cell death by CONP and the production of reactive oxygen species (ROS) were analyzed by flow-cytometry. Free radicals related antioxidant capacity of the cells was studied by the reduction of stable free radical TEMPONE using electron spin resonance spectroscopy. CONP showed low or moderate cytotoxicity in cancer cell lines: adenocarcinoma DLD1 and multi-drug resistant DLD1-TxR, non-small cell lung carcinoma NCI-H460 and multi-drug resistant NCI-H460/R, while normal cell lines (keratinocytes HaCaT, lung fetal fibroblasts MRC-5) were insensitive. The most sensitive were 518A2 melanoma and HT-29 colorectal adenocarcinoma cell lines, with the IC50 values being between 100 and 200 μM. Decreased rate of TEMPONE reduction and increased production of certain ROS species (peroxynitrite and hydrogen peroxide anion) indicates that free radical metabolism, thus redox status was changed, and antioxidant capacity damaged in the CONP treated 518A2 and HT-29 cells. In conclusion, changes in intracellular redox status induced by CONP are partly attributed to the prooxidant activity of the nanoparticles. Further, ROS induced cell damages might eventually lead to the cell death. However, low inhibitory potential of CONP in the other human cell lines tested indicates that CONP may be safe for human usage in industry and medicine.

  2. Properties of a Novel Intracellular Poly(3-Hydroxybutyrate) Depolymerase with High Specific Activity (PhaZd) in Wautersia eutropha H16

    PubMed Central

    Abe, Tomoko; Kobayashi, Teruyuki; Saito, Terumi


    A novel intracellular poly(3-hydroxybutyrate) (PHB) depolymerase (PhaZd) of Wautersia eutropha (formerly Ralstonia eutropha) H16 which shows similarity with the catalytic domain of the extracellular PHB depolymerase in Ralstonia pickettii T1 was identified. The positions of the catalytic triad (Ser190-Asp266-His330) and oxyanion hole (His108) in the amino acid sequence of PhaZd deduced from the nucleotide sequence roughly accorded with those of the extracellular PHB depolymerase of R. pickettii T1, but a signal peptide, a linker domain, and a substrate binding domain were missing. The PhaZd gene was cloned and the gene product was purified from Escherichia coli. The specific activity of PhaZd toward artificial amorphous PHB granules was significantly greater than that of other known intracellular PHB depolymerase or 3-hydroxybutyrate (3HB) oligomer hydrolases of W. eutropha H16. The enzyme degraded artificial amorphous PHB granules and mainly released various 3-hydroxybutyrate oligomers. PhaZd distributed nearly equally between PHB inclusion bodies and the cytosolic fraction. The amount of PHB was greater in phaZd deletion mutant cells than the wild-type cells under various culture conditions. These results indicate that PhaZd is a novel intracellular PHB depolymerase which participates in the mobilization of PHB in W. eutropha H16 along with other PHB depolymerases. PMID:16199568

  3. Properties of a novel intracellular poly(3-hydroxybutyrate) depolymerase with high specific activity (PhaZd) in Wautersia eutropha H16.


    Abe, Tomoko; Kobayashi, Teruyuki; Saito, Terumi


    A novel intracellular poly(3-hydroxybutyrate) (PHB) depolymerase (PhaZd) of Wautersia eutropha (formerly Ralstonia eutropha) H16 which shows similarity with the catalytic domain of the extracellular PHB depolymerase in Ralstonia pickettii T1 was identified. The positions of the catalytic triad (Ser190-Asp266-His330) and oxyanion hole (His108) in the amino acid sequence of PhaZd deduced from the nucleotide sequence roughly accorded with those of the extracellular PHB depolymerase of R. pickettii T1, but a signal peptide, a linker domain, and a substrate binding domain were missing. The PhaZd gene was cloned and the gene product was purified from Escherichia coli. The specific activity of PhaZd toward artificial amorphous PHB granules was significantly greater than that of other known intracellular PHB depolymerase or 3-hydroxybutyrate (3HB) oligomer hydrolases of W. eutropha H16. The enzyme degraded artificial amorphous PHB granules and mainly released various 3-hydroxybutyrate oligomers. PhaZd distributed nearly equally between PHB inclusion bodies and the cytosolic fraction. The amount of PHB was greater in phaZd deletion mutant cells than the wild-type cells under various culture conditions. These results indicate that PhaZd is a novel intracellular PHB depolymerase which participates in the mobilization of PHB in W. eutropha H16 along with other PHB depolymerases.

  4. Ziram and sodium N,N-dimethyldithiocarbamate inhibit ubiquitin activation through intracellular metal transport and increased oxidative stress in HEK293 cells.


    Dennis, Kathleen E; Valentine, William M


    Ubiquitin activating enzyme E1 plays a pivotal role in ubiquitin based protein signaling through regulating the initiating step of the cascade. Previous studies demonstrated that E1 is inhibited by covalent modification of reactive cysteines contained within the ubiquitin-binding groove and by conditions that increase oxidative stress and deplete cellular antioxidants. In this study, we determined the relative contribution of covalent adduction and oxidative stress to E1 inhibition produced by ziram and sodium N,N-dimethyldithiocarbamate (DMDC) in HEK293 cells. Although no dithiocarbamate-derived E1 adducts were identified on E1 using shotgun LC/MS/MS for either ziram or DMDC, both dithiocarbamates significantly decreased E1 activity, with ziram demonstrating greater potency. Ziram increased intracellular levels of zinc and copper, DMDC increased intracellular levels of only copper, and both dithiocarbamates enhanced oxidative injury evidenced by elevated levels of protein carbonyls and expression of heme oxygenase-1. To assess the contribution of intracellular copper transport to E1 inhibition, coincubations were performed with the copper chelator triethylenetetramine hydrochloride (TET). TET significantly protected E1 activity for both of the dithiocarbamates and decreased the associated oxidative injury in HEK293 cells as well as prevented dithiocarbamate-mediated lipid peroxidation assayed using an ethyl aracidonate micelle system. Because TET did not completely ameliorate intracellular transport of copper or zinc for ziram, TET apparently maintained E1 activity through its ability to diminish dithiocarbamate-mediated oxidative stress. Experiments to determine the relative contribution of elevated intracellular zinc and copper were performed using a metal free incubation system and showed that increases in either metal were sufficient to inhibit E1. To evaluate the utility of the HEK293 in vitro system for screening environmental agents, a series of additional

  5. Zn(2+) induces hyperpolarization by activation of a K(+) channel and increases intracellular Ca(2+) and pH in sea urchin spermatozoa.


    Beltrán, Carmen; Rodríguez-Miranda, Esmeralda; Granados-González, Gisela; García de De la Torre, Lucia; Nishigaki, Takuya; Darszon, Alberto


    Zinc (Zn(2+)) has been recently recognized as a crucial element for male gamete function in many species although its detailed mechanism of action is poorly understood. In sea urchin spermatozoa, Zn(2+) was reported as an essential trace ion for efficient sperm motility initiation and the acrosome reaction by modulating intracellular pH (pHi). In this study we found that submicromolar concentrations of free Zn(2+) change membrane potential (Em) and increase the concentration of intracellular Ca(2+) ([Ca(2+)]i) and cAMP in Lytechinus pictus sperm. Our results indicate that the Zn(2+) response in sperm of this species mainly involves an Em hyperpolarization caused by K(+) channel activation. The pharmacological profile of the Zn(2+)-induced hyperpolarization indicates that the cGMP-gated K(+) selective channel (tetraKCNG/CNGK), which is crucial for speract signaling, is likely a main target for Zn(2+). Considering that Zn(2+) also induces [Ca(2+)]i fluctuations, our observations suggest that Zn(2+) activates the signaling cascade of speract, except for an increase in cGMP, and facilitates sperm motility initiation upon spawning. These findings provide new insights about the role of Zn(2+) in male gamete function.

  6. Parathyroid hormone inhibition of Na{sup +}/H{sup +} exchanger 3 transcription: Intracellular signaling pathways and transcription factor expression

    SciTech Connect

    Neri, Elida Adalgisa; Bezerra, Camila Nogueira Alves Queiroz-Leite, Gabriella Duarte; Polidoro, Juliano Zequini; Rebouças, Nancy Amaral


    The main transport mechanism of reabsorption of sodium bicarbonate and fluid in the renal proximal tubules involves Na{sup +}/H{sup +} exchanger 3 (NHE3), which is acutely and chronically downregulated by parathyroid hormone (PTH). Although PTH is known to exert an inhibitory effect on NHE3 expression and transcription, the molecular mechanisms involved remain unclear. Here, we demonstrated that, in opossum kidney proximal tubule (OKP) cells, PTH-induced inhibition of Nhe3 gene promoter occurs even in the core promoter that controls expression of the reporter gene. We found that inhibition of the protein kinase A (PKA) and Janus kinase/signal transducer and activator of transcription (JAK/STAT) pathways transformed PTH from an inhibitor of promoter activity into an activator of that same activity, as did point mutations in the EGR1, Sp1, and Sp3 binding consensus elements in the promoter. In nuclear extracts of PTH-treated OKP cells, we also observed increased expression of EGR1 mRNA and of some Sp3 isoforms. Electrophoretic mobility shift assay showed a supershift of the −61 to −42-bp probe with an anti-EGR1 antibody in PTH-treated cells, suggesting that EGR1 binding is relevant for the inhibitory activity of PTH. We conclude that PTH-induced inhibition of NHE3 transcription is related to higher EGR1 expression; to EGR1 binding to the proximal and core promoters; and to PKA and JAK/STAT pathway activation. This mechanism might be responsible, at least in part, for lower NHE3 expression and sodium reabsorption in renal proximal tubules in the presence of high PTH levels. - Highlights: • PTH regulation of Nhe3 promoter depends on EGR1 binding. • EGR1, PKA and JAK/STAT are involved in PTH inhibition of the Nhe3 promoter. • PTH alters expression of EGR1 and Sp3. • PTH inhibits the Nhe3 promoter by regulating PKA and JAK/STAT signaling.

  7. Methylmercury-induced toxicity is mediated by enhanced intracellular calcium through activation of phosphatidylcholine-specific phospholipase C

    SciTech Connect

    Kang, Mi Sun; Jeong, Ju Yeon; Seo, Ji Heui; Jeon, Hyung Jun; Jung, Kwang Mook; Chin, Mi-Reyoung; Moon, Chang-Kiu; Bonventre, Joseph V.; Jung, Sung Yun; Kim, Dae Kyong . E-mail:


    Methylmercury (MeHg) is a ubiquitous environmental toxicant to which humans can be exposed by ingestion of contaminated food. MeHg has been suggested to exert its toxicity through its high reactivity to thiols, generation of arachidonic acid and reactive oxygen species (ROS), and elevation of free intracellular Ca{sup 2+} levels ([Ca{sup 2+}]{sub i}). However, the precise mechanism has not been fully defined. Here we show that phosphatidylcholine-specific phospholipase C (PC-PLC) is a critical pathway for MeHg-induced toxicity in MDCK cells. D609, an inhibitor of PC-PLC, significantly reversed the toxicity in a time- and dose-dependent manner with concomitant inhibition of the diacylglycerol (DAG) generation and the phosphatidylcholine (PC)-breakdown. MeHg activated the group IV cytosolic phospholipase A{sub 2} (cPLA{sub 2}) and acidic form of sphingomyelinase (A-SMase) downstream of PC-PLC, but these enzymes as well as protein kinase C (PKC) were not linked to the toxicity by MeHg. Furthermore, MeHg produced ROS, which did not affect the toxicity. Addition of EGTA to culture media resulted in partial decrease of [Ca{sup 2+}]{sub i} and partially blocked the toxicity. In contrast, when the cells were treated with MeHg in the presence of Ca{sup 2+} in the culture media, D609 completely prevented cell death with parallel decrease in [Ca{sup 2+}]{sub i}. Our results demonstrated that MeHg-induced toxicity was linked to elevation of [Ca{sup 2+}]{sub i} through activation of PC-PLC, but not attributable to the signaling pathways such as cPLA{sub 2}, A-SMase, and PKC, or to the generation of ROS.

  8. Stepwise-activable multifunctional peptide-guided prodrug micelles for cancerous cells intracellular drug release

    NASA Astrophysics Data System (ADS)

    Zhang, Jing; Li, Mengfei; Yuan, Zhefan; Wu, Dan; Chen, Jia-da; Feng, Jie


    A novel type of stepwise-activable multifunctional peptide-guided prodrug micelles (MPPM) was fabricated for cancerous cells intracellular drug release. Deca-lysine sequence (K10), a type of cell-penetrating peptide, was synthesized and terminated with azido-glycine. Then a new kind of molecule, alkyne modified doxorubicin (DOX) connecting through disulfide bond (DOX-SS-alkyne), was synthesized. After coupling via Cu-catalyzed azide-alkyne cycloaddition (CuAAC) click chemistry reaction, reduction-sensitive peptide-guided prodrug was obtained. Due to the amphiphilic property of the prodrug, it can assemble to form micelles. To prevent the nanocarriers from unspecific cellular uptake, the prodrug micelles were subsequently modified with 2,3-dimethyl maleic anhydride to obtain MPPM with a negatively charged outer shell. In vitro studies showed that MPPM could be shielded from cells under psychological environment. However, when arriving at mild acidic tumor site, the cell-penetrating capacity of MPPM would be activated by charge reversal of the micelles via hydrolysis of acid-labile β-carboxylic amides and regeneration of K10, which enabled efficient internalization of MPPM by tumor cells as well as following glutathione- and protease-induced drug release inside the cancerous cells. Furthermore, since the guide peptide sequences can be accurately designed and synthesized, it can be easily changed for various functions, such as targeting peptide, apoptotic peptide, even aptamers, only need to be terminated with azido-glycine. This method can be used as a template for reduction-sensitive peptide-guided prodrug for cancer therapy.

  9. Electrochemically triggered release of acetylcholine from scCO2 impregnated conductive polymer films evokes intracellular Ca(2+) signaling in neurotypic SH-SY5Y cells.


    Löffler, Susanne; Seyock, Silke; Nybom, Rolf; Jacobson, Gunilla B; Richter-Dahlfors, Agneta


    Implantable devices for electronically triggered drug release are attractive to achieve spatial and temporal control over drug concentrations in patients. Realization of such devices is, however, associated with technical and biological challenges. Among these are containment of drug reservoirs, lack of precise control cues, as well as the charge and size of the drug. Here, we present a method for electronically triggered release of the quaternary ammonium cation acetylcholine (ACh) from an impregnated conductive polymer film. Using supercritical carbon dioxide (scCO2), a film of PEDOT/PSS (poly(3,4)-ethylenedioxythiophene doped with poly(styrenesulfonate)) is impregnated with the neurotransmitter acetylcholine. The gentle scCO2 process generated a dry, drug-impregnated surface, well suited for interaction with biological material, while maintaining normal electrochemical properties of the polymer. Electrochemical switching of impregnated PEDOT/PSS films stimulated release of ACh from the polymer matrix, likely due to swelling mediated by the influx and efflux of charged and solvated ions. Triggered release of ACh did not affect the biological activity of the drug. This was shown by real-time monitoring of intracellular Ca(2+) signaling in neurotypic cells growing on the impregnated polymer surface. Collectively, scCO2 impregnation of conducting polymers offers the first one-step, dopant-independent drug impregnation process, potentially facilitating loading of both anionic and cationic drugs that can be dissolved in scCO2 on its own or by using a co-solvent. We foresee that scCO2-loaded devices for electronically triggered drug release will create novel opportunities when generating active bio-coatings, tunable for specific needs, in a variety of medical settings.

  10. Intracellular pH and calcium signaling as molecular targets of diclofenac-induced apoptosis against colon cancer.


    Kaur, Jasmeet; Sanyal, Sankar Nath


    The role of intracellular pH and Ca2+ and their association with mitochondrial dysfunction and intracellular reactive oxygen species (ROS) are explored in the chemoprevention of colon cancer. 1,2-dimethylhydrazine dihydrochloride (DMH), a potent procarcinogen with selectivity for the colon, at a dose of 30 mg/kg body weight was used to induce initial stages of colon cancer when administered for 6 weeks in male Sprague-Dawley rats. Diclofenac, a preferential cyclooxygenase-2 inhibitor, was used at the anti-inflammatory dose (8 mg/kg body weight) for chemoprevention. The control group was administered vehicles for both DMH and diclofenac. A diclofenac-alone group with the same dose was also run simultaneously. Intracellular pH values as determined by biscarboxyethyl carboxyfluorescein fluorescence assay showed an alkaline pH in colonocytes from the DMH-treated group as compared with the control group. Moreover, the level of intracellular Ca2+ was also found to be decreased with DMH treatment, as shown by the fura-2 acetoxymethyl study and chlortetracycline assay. Apoptosis was studied by comet assay and Apaf-1 immunofluorescent expression and was found to be markedly decreased in this group, indicating that disturbances in pH and Ca2+ homeostasis promoted proliferation in colon and inhibited apoptosis. Changes in mitochondrial membrane potential and ROS levels were analyzed in isolated colonocytes by rhodamine 123 and 2,7-dichlorofluorescein diacetate labeling, respectively. DMH treatment promoted a higher mitochondrial membrane potential while reducing ROS levels. These parameters are known to be associated with pH and Ca2+ changes intracellularly and hence can be suggested to be linked with them in this study also. Diclofenac promoted apoptosis in colonocytes when coadministered with DMH and also ameliorated the changes observed in the above parameters, confirming these mechanisms as early events for the onset of apoptosis in cancer cells.

  11. Identification of an endocytosis motif in an intracellular loop of Wntless protein, essential for its recycling and the control of Wnt protein signaling.


    Gasnereau, Isabelle; Herr, Patrick; Chia, Pei Zhi Cheryl; Basler, Konrad; Gleeson, Paul A


    The secretion of Wnt signaling proteins is dependent upon the transmembrane sorting receptor, Wntless (Wls), which recycles between the trans-Golgi network and the cell surface. Loss of Wls results in impairment of Wnt secretion and defects in development and homeostasis in Drosophila, Caenorhabditis elegans, and the mouse. The sorting signals for the internalization and trafficking of Wls have not been defined. Here, we demonstrate that Wls internalization requires clathrin and dynamin I, components of the clathrin-mediated endocytosis pathway. Moreover, we have identified a conserved YXXϕ endocytosis motif in the third intracellular loop of the multipass membrane protein Wls. Mutation of the tyrosine-based motif YEGL to AEGL (Y425A) resulted in the accumulation of human mutant Wls on the cell surface of transfected HeLa cells. The cell surface accumulation of Wls(AEGL) was rescued by the insertion of a classical YXXϕ motif in the cytoplasmic tail. Significantly, a Drosophila Wls(AEGL) mutant displayed a wing notch phenotype, with reduced Wnt secretion and signaling. These findings demonstrate that YXXϕ endocytosis motifs can occur in the intracellular loops of multipass membrane proteins and, moreover, provide direct evidence that the trafficking of Wls is required for efficient secretion of Wnt signaling proteins.

  12. Identification of an Endocytosis Motif in an Intracellular Loop of Wntless Protein, Essential for Its Recycling and the Control of Wnt Protein Signaling*

    PubMed Central

    Gasnereau, Isabelle; Herr, Patrick; Chia, Pei Zhi Cheryl; Basler, Konrad; Gleeson, Paul A.


    The secretion of Wnt signaling proteins is dependent upon the transmembrane sorting receptor, Wntless (Wls), which recycles between the trans-Golgi network and the cell surface. Loss of Wls results in impairment of Wnt secretion and defects in development and homeostasis in Drosophila, Caenorhabditis elegans, and the mouse. The sorting signals for the internalization and trafficking of Wls have not been defined. Here, we demonstrate that Wls internalization requires clathrin and dynamin I, components of the clathrin-mediated endocytosis pathway. Moreover, we have identified a conserved YXXφ endocytosis motif in the third intracellular loop of the multipass membrane protein Wls. Mutation of the tyrosine-based motif YEGL to AEGL (Y425A) resulted in the accumulation of human mutant Wls on the cell surface of transfected HeLa cells. The cell surface accumulation of WlsAEGL was rescued by the insertion of a classical YXXφ motif in the cytoplasmic tail. Significantly, a Drosophila WlsAEGL mutant displayed a wing notch phenotype, with reduced Wnt secretion and signaling. These findings demonstrate that YXXφ endocytosis motifs can occur in the intracellular loops of multipass membrane proteins and, moreover, provide direct evidence that the trafficking of Wls is required for efficient secretion of Wnt signaling proteins. PMID:22027831

  13. Altered intracellular and extracellular signaling leads to impaired T-cell functions in ADA-SCID patients

    PubMed Central

    Cassani, Barbara; Mirolo, Massimiliano; Cattaneo, Federica; Benninghoff, Ulrike; Hershfield, Michael; Carlucci, Filippo; Tabucchi, Antonella; Bordignon, Claudio; Roncarolo, Maria Grazia


    Mutations in the adenosine deaminase (ADA) gene are responsible for a form of severe combined immunodeficiency (SCID) caused by the lymphotoxic accumulation of ADA substrates, adenosine and 2′-deoxy-adenosine. The molecular mechanisms underlying T-cell dysfunction in humans remain to be elucidated. Here, we show that CD4+ T cells from ADA-SCID patients have severely compromised TCR/CD28-driven proliferation and cytokine production, both at the transcriptional and protein levels. Such an impairment is associated with an intrinsically reduced ZAP-70 phosphorylation, Ca2+ flux, and ERK1/2 signaling and to defective transcriptional events linked to CREB and NF-κB. Moreover, exposure to 2′-deoxy-adenosine results in a stronger inhibition of T-cell activation, mediated by the aberrant A2A adenosine receptor signaling engagement and PKA hyperactivation, or in a direct apoptotic effect at higher doses. Conversely, in T cells isolated from patients after gene therapy with retrovirally transduced hematopoietic stem/progenitor cells, the biochemical events after TCR triggering occur properly, leading to restored effector functions and normal sensitivity to apoptosis. Overall, our findings provide a better understanding of the pathogenesis of the immune defects associated with an altered purine metabolism and confirm that ADA gene transfer is an efficacious treatment for ADA-SCID. The trials in this study are enrolled at as #NCT00598481 and #NCT0059978. PMID:18218852

  14. Altered intracellular and extracellular signaling leads to impaired T-cell functions in ADA-SCID patients.


    Cassani, Barbara; Mirolo, Massimiliano; Cattaneo, Federica; Benninghoff, Ulrike; Hershfield, Michael; Carlucci, Filippo; Tabucchi, Antonella; Bordignon, Claudio; Roncarolo, Maria Grazia; Aiuti, Alessandro


    Mutations in the adenosine deaminase (ADA) gene are responsible for a form of severe combined immunodeficiency (SCID) caused by the lymphotoxic accumulation of ADA substrates, adenosine and 2'-deoxy-adenosine. The molecular mechanisms underlying T-cell dysfunction in humans remain to be elucidated. Here, we show that CD4(+) T cells from ADA-SCID patients have severely compromised TCR/CD28-driven proliferation and cytokine production, both at the transcriptional and protein levels. Such an impairment is associated with an intrinsically reduced ZAP-70 phosphorylation, Ca(2+) flux, and ERK1/2 signaling and to defective transcriptional events linked to CREB and NF-kappaB. Moreover, exposure to 2'-deoxy-adenosine results in a stronger inhibition of T-cell activation, mediated by the aberrant A(2A) adenosine receptor signaling engagement and PKA hyperactivation, or in a direct apoptotic effect at higher doses. Conversely, in T cells isolated from patients after gene therapy with retrovirally transduced hematopoietic stem/progenitor cells, the biochemical events after TCR triggering occur properly, leading to restored effector functions and normal sensitivity to apoptosis. Overall, our findings provide a better understanding of the pathogenesis of the immune defects associated with an altered purine metabolism and confirm that ADA gene transfer is an efficacious treatment for ADA-SCID. The trials in this study are enrolled at as #NCT00598481 and #NCT0059978.

  15. Intracellular Signal Transduction and Modification of the Tumor Microenvironment Induced by RET/PTCs in Papillary Thyroid Carcinoma

    PubMed Central

    Menicali, Elisa; Moretti, Sonia; Voce, Pasquale; Romagnoli, Serena; Avenia, Nicola; Puxeddu, Efisio


    RET gene rearrangements (RET/PTCs) represent together with BRAF point mutations the two major groups of mutations involved in papillary thyroid carcinoma (PTC) initiation and progression. In this review, we will examine the mechanisms involved in RET/PTC-induced thyroid cell transformation. In detail, we will summarize the data on the molecular mechanisms involved in RET/PTC formation and in its function as a dominant oncogene, on the activated signal transduction pathways and on the induced gene expression modifications. Moreover, we will report on the effects of RET/PTCs on the tumor microenvironment. Finally, a short review of the literature on RET/PTC prognostic significance will be presented. PMID:22661970

  16. Short food deprivation inhibits orexin receptor 1 expression and orexin-A induced intracellular calcium signaling in acutely isolated duodenal enterocytes.


    Bengtsson, Magnus W; Mäkelä, Kari; Herzig, Karl-Heinz; Flemström, Gunnar


    Close intra-arterial infusion of the appetite regulating peptide orexin-A stimulates bicarbonate secretion from the duodenal mucosa. The aim of the present study was to elucidate the ability of orexin-A to induce intracellular calcium signaling in acutely isolated duodenal enterocytes. Freshly isolated clusters of enterocytes, obtained from rat duodenal mucosa or human duodenal biopsies, were loaded with fura 2-AM and mounted in a perfusion chamber. Cryptlike enterocytes were selected (caged), and changes in intracellular calcium concentration ([Ca2+]i) were evaluated by fluorescence imaging. Total RNA was extracted from pellets of enterocytes and reverse transcribed to cDNA, and expression of orexin receptors 1 and 2 (OX1R and OX2R) was measured by quantitative real-time PCR. Orexin-A at all concentrations tested (1-100 nM) increased [Ca2+]i in enterocytes isolated from continuously fed rats, and the OX1R-antagonist SB-334867 (10 nM) attenuated the response. The primary [Ca2+]i response was a slow increase to a sustained plateau persisting after orexin-A removal, and a similar response was observed in enterocytes from human biopsies. In contrast to orexin-A, the OX2R agonist (Ala11,D-Leu15)-orexin-B (1-10 nM) did not induce calcium signaling. There were no significant [Ca2+]i responses in enterocytes from animals food deprived overnight, and overnight fasting decreased (P<0.01) enterocyte OX1R as well as OX2R mRNA. Induction of intracellular calcium signaling in isolated duodenal enterocytes is thus mediated primarily by OX1R receptors. Short (overnight) food deprivation markedly depresses receptor expression and inhibits orexin-A induced increases in [Ca2+]i. Studies of enterocyte signaling and intestinal secretion requires particular evaluation regarding feeding status.

  17. Signal Transduction in T Cell Activation and Tolerance

    DTIC Science & Technology


    wealth of new information regarding the mechanism by which these surface receptors influence intracellular biochemical events. Transmembrane...Ltd 98 7 1 5 Vi 86 Basic MI | I L I IF a 86 Basic Mechanisms - How can an understanding of signal transduction aid in our understand- ing of T...distribution of the r consensus sequence suggests that it may represent a common mechanism used by a variety of immune system receptors to couple to signal

  18. Localization of intracellular calcium release in cells injured by venom from the ectoparasitoid Nasonia vitripennis (Walker) (Hymenoptera: Pteromalidae) and dependence of calcium mobilization on G-protein activation.


    Rivers, David B; Crawley, Timothy; Bauser, Holly


    Venom from the ectoparasitic wasp Nasonia vitripennis induces cellular injury that appears to involve the release of intracellular calcium stores via the activation of phospholipase C, and culminates in oncotic death. A linkage between release of intracellular Ca2+ and oncosis has not been clearly established and was the focus of this study. When BTI-TN-5B1-4 cells were treated with suramin, an uncoupler of G-proteins, venom-induced swelling and oncotic death were inhibited in a dose-dependent manner for at least 24 h. Suramin also blocked increases in free cytosolic [Ca2+], arguing that venom induces calcium mobilization through G-protein signaling pathways. Endoplasmic reticulum (ER) was predicted to be the source of intracellular calcium release, but labeling with the fluorescent probe ER-tracker revealed no indication of organelle swelling or loss of membrane integrity as would be expected if the Ca(2+)-ATPase pump was disabled by crude venom. Incubation of cell monolayers with calmodulin or nitrendipine, modulators of ER calcium release channels, neither attenuated nor augmented the effects of wasp venom. These results suggest that wasp venom stimulates calcium release from ER compartments distinct from RyRs, L-type Ca2+ channels, and the Ca(2+)-ATPase pump, or calcium is released from some other intracellular store. A reduction of mitochondrial membrane potential delta psi(m) appeared to precede a rise in cytosolic free Ca2+ as evidenced by fluorescent microscopy using the calcium-sensitive probe fluo-4 AM. This argues that the initial insult to the cell resulting from venom elicits a rapid loss of (delta psi(m)), followed by unregulated calcium efflux from mitochondria into the cytosol. Mobilization of calcium in this fashion could stimulate cAMP formation, and subsequently promote calcium release from NAADP-sensitive stores.

  19. NHE1 is the sodium-hydrogen exchanger active in acute intracellular pH regulation in preimplantation mouse embryos.


    Siyanov, Violetta; Baltz, Jay M


    Sodium-hydrogen exchangers (NHE) of the Slc9 gene family are the major regulators of intracellular pH against acidosis in mammalian cells. Of five plasma membrane NHE isoforms, mouse oocytes and preimplantation embryos express mRNAs encoding NHE1 (SLC9A1), NHE3 (SLC9A3), and NHE4 (SLC9A4), with higher mRNA levels for each in oocytes through one-cell stage embryos and lower levels after the two-cell stage. NHE2 (SLC9A2) and NHE5 (SLC9A5) are not expressed. Measurements of intracellular pH during recovery from induced acidosis indicated that recovery occurred via NHE activity at all preimplantation stages assessed (one-cell, two-cell, eight-cell and morula). Recovery from acidosis at each stage was entirely inhibited by cariporide, which is very highly selective for NHE1. In contrast, the moderately NHE3-selective inhibitor S3226 did not preferentially block recovery, nor did adding S3226 increase inhibition over cariporide alone, indicating that NHE3 did not play a role. There was no indication of NHE4 activity. Another regulator of intracellular pH against acidosis, the sodium-dependent bicarbonate/chloride exchanger (NDBCE; SLC4A8), had low or absent activity in two-cell embryos. Thus, NHE1 appears to be the only significant regulator of intracellular pH in preimplantation mouse embryos. Culturing embryos from the one-cell or two-cell stages in acidotic medium inhibited their development. Unexpectedly, inhibition of NHE1 with cariporide, NDBCE with DIDS, or both together did not affect embryo development to the blastocyst stage more substantially under conditions of chronic acidosis than at normal pH. Preimplantation mouse embryos thus appear to have limited capacity to resist chronic acidosis using intracellular pH regulatory mechanisms.

  20. Intracellular pH regulation in unstimulated Calliphora salivary glands is Na+ dependent and requires V-ATPase activity.


    Schewe, Bettina; Blenau, Wolfgang; Walz, Bernd


    Salivary gland cells of the blowfly Calliphora vicina have a vacuolar-type H(+)-ATPase (V-ATPase) that lies in their apical membrane and energizes the secretion of a KCl-rich primary saliva upon stimulation with serotonin (5-hydroxytryptamine). Whether and to what extent V-ATPase contributes to intracellular pH (pH(i)) regulation in unstimulated gland cells is unknown. We used the fluorescent dye BCECF to study intracellular pH(i) regulation microfluorometrically and show that: (1) under resting conditions, the application of Na(+)-free physiological saline induces an intracellular alkalinization attributable to the inhibition of the activity of a Na(+)-dependent glutamate transporter; (2) the maintenance of resting pH(i) is Na(+), Cl(-), concanamycin A and DIDS sensitive; (3) recovery from an intracellular acid load is Na(+) sensitive and requires V-ATPase activity; (4) the Na(+)/H(+) antiporter is not involved in pH(i) recovery after a NH(4)Cl prepulse; and (5) at least one Na(+)-dependent transporter and the V-ATPase maintain recovery from an intracellular acid load. Thus, under resting conditions, the V-ATPase and at least one Na(+)-dependent transporter maintain normal pH(i) values of pH 7.5. We have also detected the presence of a Na(+)-dependent glutamate transporter, which seems to act as an acid loader. Despite this not being a common pH(i)-regulating transporter, its activity affects steady-state pH(i) in C. vicina salivary gland cells.

  1. Modulation of intracellular calcium concentrations and T cell activation by prickly pear polyphenols.


    Aires, Virginie; Adote, Sylvie; Hichami, Aziz; Moutairou, Kabirou; Boustani, Es-Saddik E; Khan, Naim A


    Opuntia ficus indica (prickly pear) polyphenolic compounds (OFPC) triggered an increase in [Ca2+]i in human Jurkat T-cell lines. Furthermore, OFPC-induced rise in [Ca2+]i was significantly curtailed in calcium-free buffer (0% Ca2+) as compared to that in 100% Ca2+ medium. Preincubation of cells with tyrphostin A9, an inhibitor of Ca2+ release-activated Ca2+ (CRAC) channels, significantly diminished the OFPC-induced sustained response on the increases in [Ca2+]i. Lanthanum and nifedipine, the respective inhibitors of voltage-dependent and L-type calcium channels, failed to curtail significantly the OFPC-induced calcium response. As OFPC still stimulated increases in [Ca2+]i in 0% Ca2+ medium, the role of intracellular calcium was investigated. Hence, addition of thapsigargin (TG), an inhibitor of Ca2+-ATPase of the endoplasmic reticulum (ER), during the OFPC-induced peak response exerted an additive effect, indicating that the mechanism of action of these two agents are different. Furthermore, U73122, an inhibitor of IP3 production, completely abolished increases in [Ca2+]i, induced by OFPC, suggesting that these polyphenols induce the production of IP3 that recruits calcium from ER pool. Polyphenolic compounds do act extracellularly as addition of fatty acid-free bovine serum albumin (BSA) significantly diminished the rise in [Ca2+]i evoked by the formers. OFPC also induced plasma membrane hyperpolarisation which was reversed by addition of BSA. OFPC were found to curtail the expression of IL-2 mRNA and T-cell blastogenesis. Together these results suggest that OFPC induce increases in [Ca2+]i via ER pool and opening of CRAC channels, and exert immunosuppressive effects in Jurkat T-cells.

  2. K+ efflux agonists induce NLRP3 inflammasome activation independently of Ca2+ signaling1

    PubMed Central

    Katsnelson, Michael A.; Rucker, L. Graham; Russo, Hana M.; Dubyak, George R.


    Perturbation of intracellular ion homeostasis is a major cellular stress signal for activation of NLRP3 inflammasome signaling that results in caspase-1 mediated production of IL-1β and pyroptosis. However, the relative contributions of decreased cytosolic [K+] versus increased cytosolic [Ca2+] remain disputed and incompletely defined. We investigated roles for elevated cytosolic [Ca2+] in NLRP3 activation and downstream inflammasome signaling responses in primary murine dendritic cells and macrophages in response to two canonical NLRP3 agonists (ATP and nigericin) that facilitate primary K+ efflux by mechanistically distinct pathways or the lysosome-destabilizing agonist Leu-Leu-O-methyl ester (LLME). The study provides three major findings relevant to this unresolved area of NLRP3 regulation. First, increased cytosolic [Ca2+] was neither a necessary nor sufficient signal for the NLRP3 inflammasome cascade during activation by endogenous ATP-gated P2X7 receptor channels, the exogenous bacterial ionophore nigericin, or the lysosomotropic agent LLME. Second, agonists for three Ca2+-mobilizing G protein-coupled receptors (formyl peptide receptor/FPR; P2Y2 purinergic receptor/P2Y2R; calcium-sensing receptor/CaSR) expressed in murine dendritic cells were ineffective as activators of rapidly induced NLRP3 signaling when directly compared to the K+ efflux agonists. Third, the intracellular Ca2+ buffer, BAPTA, and the channel blocker, 2-aminoethoxydiphenyl borate (2-APB), widely used reagents for disruption of Ca2+-dependent signaling pathways, strongly suppressed nigericin-induced NLRP3 inflammasome signaling via mechanisms dissociated from their canonical or expected effects on Ca2+ homeostasis. The results indicate that the ability of K+ efflux agonists to activate NLRP3 inflammasome signaling can be dissociated from changes in cytosolic [Ca2+] as a necessary or sufficient signal. PMID:25762778

  3. Nandrolone reduces activation of Notch signaling in denervated muscle associated with increased Numb expression.


    Liu, Xin-Hua; Yao, Shen; Qiao, Rui-Fang; Levine, Alice C; Kirschenbaum, Alexander; Pan, Jiangping; Wu, Yong; Qin, Weiping; Bauman, William A; Cardozo, Christopher P


    Nandrolone, an anabolic steroid, slows denervation-atrophy in rat muscle. The molecular mechanisms responsible for this effect are not well understood. Androgens and anabolic steroids activate Notch signaling in animal models of aging and thereby mitigate sarcopenia. To explore the molecular mechanisms by which nandrolone prevents denervation-atrophy, we investigated the effects of nandrolone on Notch signaling in denervated rat gastrocnemius muscle. Denervation significantly increased Notch activity reflected by elevated levels of nuclear Notch intracellular domain (NICD) and expression of Hey1 (a Notch target gene). Activation was greatest at 7 and 35 days after denervation but remained present at 56 days after denervation. Activation of Notch in denervated muscle was prevented by nandrolone associated with upregulated expression of Numb mRNA and protein. These data demonstrate that denervation activates Notch signaling, and that nandrolone abrogates this response associated with increased expression of Numb, suggesting a potential mechanism by which nandrolone reduces denervation-atrophy.

  4. The roles of serine protease, intracellular and extracellular phenoloxidase in activation of prophenoloxidase system, and characterization of phenoloxidase from shrimp haemocytes induced by lipopolysaccharide or dopamine

    NASA Astrophysics Data System (ADS)

    Xie, Peng; Pan, Luqing; Xu, Wujie; Yue, Feng


    We investigated the effects of lipopolysaccharide (LPS) and dopamine (DA) on the activation of the prophenoloxidase (proPO) system of Litopenaeus vannamei. LPS and DA were shown with a negative dose-dependent effect on hyalne cells (HC), semi-granular cells (SGC), large granular cells (LGC), and total haemocyte count (THC). When haemocytes were treated with LPS or DA, serine proteinase activity and intracellular phenoloxidase (PO) activity were significantly reduced, but extracellular PO activity increased significantly. These findings indicated that the reduction in haemocyte counts was mainly because of the degranulation and activation of the proPO system from semi-granule and large granule cells. The PKC inhibitor, chelerythrine, and the TPK inhibitor, genistein, had an inhibitory effect on extracellular PO activity, while serine proteinase and intracellular PO activity increased. This suggests that the LPS and DA induce the activation of proPO in haemocytes via PKC and TPK-related signaling pathways, but serine proteinase may be activated only by PKC, as the genistein effects were not statistically significant. Electrophoresis analysis revealed that POs induced by LPS or DA have the same molecular mass and high diphenolase activity. Two PO bands at 526 kDa and 272 kDa were observed in PAGE, while in the haemocyte lysate supernatant (HLS), only a 272-kDa band was observed. This band was resolved after SDS-PAGE under non-reducing and reducing conditions into two groups of POs, 166 kDa and 126 kDa, and 78.1 kDa and 73.6 kDa, respectively, suggesting that PO in L. vannamei is an oligomer, which may have different compositions intra- and extracellularly.

  5. Evaluating the anti Mycobacterium tuberculosis activity of Alpinia galanga (L.) Willd. axenically under reducing oxygen conditions and in intracellular assays

    PubMed Central


    Background In tuberculosis (TB), the steadily increasing bacterial resistance to existing drugs and latent TB continue to be major concerns. A combination of conventional drugs and plant derived therapeutics can serve to expand the antimicrobial spectrum, prevent the emergence of drug resistant mutants and minimize toxicity. Alpinia galanga, used in various traditional medicines, possesses broad spectrum antibacterial properties. The study was undertaken to assess the antimycobacterial potential of A. galanga in axenic (under aerobic and anaerobic conditions) and intracellular assays. Methods Phytochemical analysis was done using HPTLC. The acetone, aqueous and ethanolic extracts (1, 10, 25, 50 and 100 μg/ml) of A. galanga were tested axenically using Microplate Alamar Blue Assay (MABA) against Mycobacterium tuberculosis (M.tb) H37Rv and three drug sensitive and three multi drug resistant clinical isolates. The activity of the extracts was also evaluated intracellularly in A549 cell line against these strains. The extracts active under intracellular conditions were further tested in an axenic setup under reducing oxygen concentrations using only H37Rv. Results 1´ acetoxychavicol acetate, the reference standard used, was present in all the three extracts. The acetone and ethanolic extracts were active in axenic (aerobic and anaerobic) and intracellular assays. The aqueous extract did not demonstrate activity under the defined assay parameters. Conclusion A. galanga exhibits anti M.tb activity with multiple modes of action. Since the activity of the extracts was observed under reducing oxygen concentrations, it may be effective in treating the dormant and non-replicating bacteria of latent TB. Though the hypothesis needs further testing, A. galanga being a regular dietary component may be utilized in combination with the conventional TB therapy for enhanced efficacy. PMID:24592852

  6. Regulation of Leukemic Cell Differentiation through the Vitamin D Receptor at the Levels of Intracellular Signal Transduction, Gene Transcription, and Protein Trafficking and Stability

    PubMed Central

    Gocek, Elżbieta; Baurska, Hanna; Marchwicka, Aleksandra; Marcinkowska, Ewa


    1α,25-Dihydroxyvitamin D3 (1,25(OH)2D) exerts its biological activities through vitamin D receptor (VDR), which is a member of the superfamily of steroid receptors, that act as ligand-dependent transcription factors. Ligated VDR in complex with retinoid X receptor (RXR) binds to regulatory regions of 1,25(OH)2D-target genes. 1,25(OH)2D is able to induce differentiation of leukemic blasts towards macrophage-like cells. Many different acute myeloid leukemia (AML) cell lines respond to 1,25(OH)2D by increasing CD14 cell surface receptor, some additionally upregulate CD11b and CD11c integrins. In untreated AML cells VDR protein is present in cytosol at a very low level, even though its mRNA is continuously expressed. Ligation of VDR causes protein stabilization and translocation to the cell nuclei, where it regulates transcription of target genes. Several important groups of genes are regulated by 1,25(OH)2D in HL60 cells. These genes include differentiation-related genes involved in macrophage function, as well as a gene regulating degradation of 1,25(OH)2D, namely CYP24A1. We summarize here the data which demonstrate that though some cellular responses to 1,25(OH)2D in AML cells are transcription-dependent, there are many others which depend on intracellular signal transduction, protein trafficking and stabilization. The final effect of 1,25(OH)2D action in leukemic cells requires all these acting together. PMID:23213549

  7. Number and brightness analysis of sFRP4 domains in live cells demonstrates vesicle association signal of the NLD domain and dynamic intracellular responses to Wnt3a

    PubMed Central

    Perumal, Vanathi; Krishnan, Kannan; Gratton, Enrico; Dharmarajan, Arun M; Fox, Simon A


    The Wnts are secreted, lipidated glycoproteins that play a role in cellular processes of differentiation, proliferation, migration, survival, polarity and stem cell self-renewal. The majority of Wnts biological effects are through binding to specific frizzled (Fzd) receptor complexes leading to activation of downstream pathways. Secreted Frizzled-related proteins (sFRPs) were first identified as antagonists of Wnt signalling by binding directly to Wnts. They comprise two domains, a Fzd-like cysteine rich domain (CRD) and a netrin-like domain (NLD). Subsequently sFRPs have been shown to also interact with Fzd receptors and more diverse functions have been identified, including potentiation of Wnt signalling. Many aspects of the biology of this family remain to be elucidated. We used the number and brightness (N&B) method, a technique based on fluorescence fluctuation analysis, to characterise the intracellular aggregation and trafficking of sFRP4 domains. We expressed sFRP4 and its’ domains as EGFP fusions and then characterised the effect of endogenous Wnt3a by fluorescence confocal imaging. We observed vesicular trafficking of sFRP4 and that the NLD domain has a vesicular association signal. We found that sFRP4 and the CRD formed oligomeric aggregates in the perinuclear region while the NLD was distributed evenly throughout the cell with a larger proportion of aggregates. Most significantly we observed intracellular redistribution of sFRP4 in response to Wnt3a suggesting that Wnt3a can modulate intracellular localisation and secretion of sFRP4. Our results reveal a number of novel findings regarding sFRP4 which are likely to have relevance to this wider family. PMID:25805505

  8. A molecular signature in the pannexin1 intracellular loop confers channel activation by the α1 adrenoreceptor in smooth muscle cells

    PubMed Central

    Billaud, Marie; Chiu, Yu-Hsin; Lohman, Alexander W.; Parpaite, Thibaud; Butcher, Joshua T.; Mutchler, Stephanie M.; DeLalio, Leon J.; Artamonov, Mykhaylo V.; Sandilos, Joanna K.; Best, Angela K.; Somlyo, Avril V.; Thompson, Roger J.; Le, Thu H.; Ravichandran, Kodi S.; Bayliss, Douglas A.; Isakson, Brant E.


    Both purinergic signaling through nucleotides such as ATP (adenosine 5′-triphosphate) and noradrenergic signaling through molecules such as norepinephrine regulate vascular tone and blood pressure. Pannexin1 (Panx1), which forms large-pore, ATP-releasing channels, is present in vascular smooth muscle cells in peripheral blood vessels and participates in noradrenergic responses. Using pharmacological approaches and mice conditionally lacking Panx1 in smooth muscle cells, we found that Panx1 contributed to vaso-constriction mediated by the α1 adrenoreceptor (α1AR), whereas vasoconstriction in response to serotonin or endothelin-1 was independent of Panx1. Analysis of the Panx1-deficient mice showed that Panx1 contributed to blood pressure regulation especially during the night cycle when sympathetic nervous activity is highest. Using mimetic peptides and site-directed mutagenesis, we identified a specific amino acid sequence in the Panx1 intracellular loop that is essential for activation by α1AR signaling. Collectively, these data describe a specific link between noradrenergic and purinergic signaling in blood pressure homeostasis. PMID:25690012

  9. Cannabinoid Receptor Activation Modifies NMDA Receptor Mediated Release of Intracellular Calcium: Implications for Endocannabinoid Control of Hippocampal Neural Plasticity

    PubMed Central

    Hampson, Robert E.; Miller, Frances; Palchik, Guillermo; Deadwyler, Sam A.


    Chronic activation or inhibition of cannabinoid receptors (CB1) leads to continuous suppression of neuronal plasticity in hippocampus and other brain regions, suggesting that endocannabinoids may have a functional role in synaptic processes that produce state-dependent transient modulation of hippocampal cell activity. In support of this, it has previously been shown in vitro that cannabinoid CB1 receptors modulate second messenger systems in hippocampal neurons that can modulate intracellular ion channels, including channels which release calcium from intracellular stores. Here we demonstrate in hippocampal slices a similar endocannabinoid action on excitatory glutamatergic synapses via modulation of NMDA-receptor mediated intracellular calcium levels in confocal imaged neurons. Calcium entry through glutamatergic NMDA-mediated ion channels increases intracellular calcium concentrations via modulation of release from ryanodine-sensitive channels in endoplasmic reticulum. The studies reported here show that NMDA-elicited increases in Calcium Green fluorescence are enhanced by CB1 receptor antagonists (i.e. rimonabant), and inhibited by CB1 agonists (i.e. WIN 55,212-2). Suppression of endocannabinoid breakdown by either reuptake inhibition (AM404) or fatty-acid amide hydrolase inhibition (URB597) produced suppression of NMDA elicited calcium increases comparable to WIN 55,212-2, while enhancement of calcium release provoked by endocannabinoid receptor antagonists (Rimonabant) was shown to depend on the blockade of CB1 receptor mediated de-phosphorylation of Ryanodine receptors. Such CB1 receptor modulation of NMDA elicited increases in intracellular calcium may account for the respective disruption and enhancement by CB1 agents of trial-specific hippocampal neuron ensemble firing patterns during performance of a short-term memory task, reported previously from this laboratory. PMID:21288475

  10. Efficient intracellular delivery of molecules with high cell viability using nanosecond-pulsed laser-activated carbon nanoparticles.


    Sengupta, Aritra; Kelly, Sean C; Dwivedi, Nishant; Thadhani, Naresh; Prausnitz, Mark R


    Conventional physical and chemical methods that efficiently deliver molecules into cells are often associated with low cell viability. In this study, we evaluated the cellular effects of carbon nanoparticles believed to emit photoacoustic waves due to nanosecond-pulse laser activation to test the hypothesis that this method could achieve efficient intracellular delivery while maintaining high cell viability. Suspensions of DU145 human prostate carcinoma cells, carbon black (CB) nanoparticles, and calcein were exposed to 5-9 ns long laser pulses of near-infrared (1064 nm wavelength) light and then analyzed by flow cytometry for intracellular uptake of calcein and cell viability by propidium iodide staining. We found that intracellular uptake increased and in some cases saturated at high levels with only small losses in cell viability as a result of increasing laser fluence, laser exposure time, and as a unifying parameter, the total laser energy. Changing interpulse spacing between 0.1 and 10 s intervals showed no significant change in bioeffects, suggesting that the effects of each pulse were independent when spaced by at least 0.1 s intervals. Pretreatment of CB nanoparticles to intense laser exposure followed by mixing with cells also had no significant effect on uptake or viability. Similar uptake and viability were seen when CB nanoparticles were substituted with India ink, when DU145 cells were substituted with H9c2 rat cardiomyoblast cells, and when calcein was substituted with FITC-dextran. The best laser exposure conditions tested led to 88% of cells with intracellular uptake and close to 100% viability, indicating that nanosecond-pulse laser-activated carbon nanoparticles can achieve efficient intracellular delivery while maintaining high cell viability.

  11. Efficient Intracellular Delivery of Molecules with High Cell Viability Using Nanosecond-Pulsed Laser-Activated Carbon Nanoparticles

    PubMed Central


    Conventional physical and chemical methods that efficiently deliver molecules into cells are often associated with low cell viability. In this study, we evaluated the cellular effects of carbon nanoparticles believed to emit photoacoustic waves due to nanosecond-pulse laser activation to test the hypothesis that this method could achieve efficient intracellular delivery while maintaining high cell viability. Suspensions of DU145 human prostate carcinoma cells, carbon black (CB) nanoparticles, and calcein were exposed to 5–9 ns long laser pulses of near-infrared (1064 nm wavelength) light and then analyzed by flow cytometry for intracellular uptake of calcein and cell viability by propidium iodide staining. We found that intracellular uptake increased and in some cases saturated at high levels with only small losses in cell viability as a result of increasing laser fluence, laser exposure time, and as a unifying parameter, the total laser energy. Changing interpulse spacing between 0.1 and 10 s intervals showed no significant change in bioeffects, suggesting that the effects of each pulse were independent when spaced by at least 0.1 s intervals. Pretreatment of CB nanoparticles to intense laser exposure followed by mixing with cells also had no significant effect on uptake or viability. Similar uptake and viability were seen when CB nanoparticles were substituted with India ink, when DU145 cells were substituted with H9c2 rat cardiomyoblast cells, and when calcein was substituted with FITC-dextran. The best laser exposure conditions tested led to 88% of cells with intracellular uptake and close to 100% viability, indicating that nanosecond-pulse laser-activated carbon nanoparticles can achieve efficient intracellular delivery while maintaining high cell viability. PMID:24547946

  12. Anaplasma marginale Actively Modulates Vacuolar Maturation during Intracellular Infection of Its Tick Vector, Dermacentor andersoni

    PubMed Central

    Thompson, Chelsea Wright; Schneider, David A.; Noh, Susan M.


    ABSTRACT Tick-borne transmission of bacterial pathogens in the order Rickettsiales is responsible for diverse infectious diseases, many of them severe, in humans and animals. Transmission dynamics differ among these pathogens and are reflected in the pathogen-vector interaction. Anaplasma marginale has been shown to establish and maintain infectivity within Dermacentor spp. for weeks to months while escaping the complex network of vacuolar peptidases that are responsible for digestion of the tick blood meal. How this prolonged maintenance of infectivity in a potentially hostile environment is achieved has been unknown. Using the natural vector Dermacentor andersoni, we demonstrated that A. marginale-infected tick vacuoles (AmVs) concurrently recruit markers of the early endosome (Rab5), recycling endosome (Rab4 and Rab11), and late endosome (Rab7), are maintained near neutral pH, do not fuse with lysosomes, exclude the protease cathepsin L, and engage the endoplasmic reticulum and Golgi apparatus for up to 21 days postinfection. Maintenance of this safe vacuolar niche requires active A. marginale protein synthesis; in its absence, the AmVs mature into acidic, protease-active phagolysosomes. Identification of this bacterially directed modeling of the tick midgut endosome provides a mechanistic basis for examination of the differences in transmission efficiency observed among A. marginale strains and among vector populations. IMPORTANCE Ticks transmit a variety of intracellular bacterial pathogens that cause significant diseases in humans and animals. For successful transmission, these bacterial pathogens must first gain entry into the tick midgut digestive cells, avoid digestion, and establish a replicative niche without harming the tick vector. Little is known about how this replicative niche is established and maintained. Using the ruminant pathogen A. marginale and its natural tick vector, D. andersoni, this study characterized the features of the A. marginale

  13. Heparin activates Wnt signaling for neuronal morphogenesis.


    Colombres, Marcela; Henríquez, Juan Pablo; Reig, Germán F; Scheu, Jessica; Calderón, Rosario; Alvarez, Alejandra; Brandan, Enrique; Inestrosa, Nibaldo C


    Wnt factors are secreted ligands that affect different aspects of the nervous system behavior like neurodevelopment, synaptogenesis and neurodegeneration. In different model systems, Wnt signaling has been demonstrated to be regulated by heparan sulfate proteoglycans (HSPGs). Whether HSPGs modulate Wnt signaling in the context of neuronal behavior is currently unknown. Here we demonstrate that activation of Wnt signaling with the endogenous ligand Wnt-7a results in an increased of neurite outgrowth in the neuroblastoma N2a cell line. Interestingly, heparin induces glycogen synthase kinase-3beta (GSK-3beta) inhibition, beta-catenin stabilization and morphological differentiation in both N2a cells and in rat primary hippocampal neuronal cultures. We also show that heparin modulates Wnt-3a-induced stabilization of beta-catenin. Several extracellular matrix and membrane-attached HSPGs were found to be expressed in both in vitro neuronal models. Changes in the expression of specific HSPGs were observed upon differentiation of N2a cells. Taken together, our findings suggest that HSPGs may modulate canonical Wnt signaling for neuronal morphogenesis.

  14. Intracellular and membrane-damaging activities of methyl gallate isolated from Terminalia chebula against multidrug-resistant Shigella spp.


    Acharyya, Saurabh; Sarkar, Prodipta; Saha, Dhira R; Patra, Amarendra; Ramamurthy, T; Bag, Prasanta K


    Shigella spp. (Shigella dysenteriae, Shigella flexneri, Shigella boydii and Shigella sonnei) cause bacillary dysentery (shigellosis), which is characterized by bloody mucous diarrhoea. Although a variety of antibiotics have been effective for treatment of shigellosis, options are becoming limited due to globally emerging drug resistance. In the present study, in vitro antibacterial activity of methyl gallate (MG) isolated from Terminalia chebula was determined by performing MIC, minimal bactericidal concentration (MBC) and time-kill kinetic studies. Bacterial membrane-damaging activity of MG was determined by membrane perturbation and transmission electron microscopy (TEM). Cellular drug accumulation, cell infection and assessment of intracellular activities of MG and reference antibiotics were performed using HeLa cell cultures. The bactericidal activity of MG against multidrug-resistant (MDR) Shigella spp. in comparison with other commonly used drugs including fluoroquinolone was demonstrated here. TEM findings in the present study revealed that MG caused the total disintegration of inner and outer membranes, and leakage of the cytoplasmic contents of S. dysenteriae. The level of accumulation of MG and tetracycline in HeLa cells incubated for 24  h was relatively higher than that of ciprofloxacin and nalidixic acid (ratio of intracellular concentration/extracellular concentration of antibiotic for MG and tetracycline>ciprofloxacin and nalidixic acid). The viable number of intracellular S. dysenteriae was decreased in a time-dependent manner in the presence of MG (4 × MBC) and reduced to zero within 20  h. The significant intracellular activities of MG suggested that it could potentially be used as an effective antibacterial agent for the treatment of severe infections caused by MDR Shigella spp.

  15. Impact of intracellular domain flexibility upon properties of activated human 5-HT3 receptors*

    PubMed Central

    Kozuska, J L; Paulsen, I M; Belfield, W J; Martin, I L; Cole, D J; Holt, A; Dunn, S M J


    Background and Purpose It has been proposed that arginine residues lining the intracellular portals of the homomeric 5-HT3A receptor cause electrostatic repulsion of cation flow, accounting for a single-channel conductance substantially lower than that of the 5-HT3AB heteromer. However, comparison of receptor homology models for wild-type pentamers suggests that salt bridges in the intracellular domain of the homomer may impart structural rigidity, and we hypothesized that this rigidity could account for the low conductance. Experimental Approach Mutations were introduced into the portal region of the human 5-HT3A homopentamer, such that putative salt bridges were broken by neutralizing anionic partners. Single-channel and whole cell currents were measured in transfected tsA201 cells and in Xenopus oocytes respectively. Computational simulations of protein flexibility facilitated comparison of wild-type and mutant receptors. Key Results Single-channel conductance was increased substantially, often to wild-type heteromeric receptor values, in most 5-HT3A mutants. Conversely, introduction of arginine residues to the portal region of the heteromer, conjecturally creating salt bridges, decreased conductance. Gating kinetics varied significantly between different mutant receptors. EC50 values for whole-cell responses to 5-HT remained largely unchanged, but Hill coefficients for responses to 5-HT were usually significantly smaller in mutants. Computational simulations suggested increased flexibility throughout the protein structure as a consequence of mutations in the intracellular domain. Conclusions and Implications These data support a role for intracellular salt bridges in maintaining the quaternary structure of the 5-HT3 receptor and suggest a role for the intracellular domain in allosteric modulation of cooperativity and agonist efficacy. Linked Article This article is commented on by Vardy and Kenakin, pp. 1614–1616 of volume 171 issue 7. To view this commentary

  16. Short inter-set rest blunts resistance exercise-induced increases in myofibrillar protein synthesis and intracellular signalling in young males.


    McKendry, James; Pérez-López, Alberto; McLeod, Michael; Luo, Dan; Dent, Jessica R; Smeuninx, Benoit; Yu, Jinglei; Taylor, Angela E; Philp, Andrew; Breen, Leigh


    phosphorylation of eEF2(Thr56) , TSC2(Thr1462) , AMPK(Thr172) and REDD1 protein were greater for 1 compared with 5 min inter-set rest. Serum testosterone was greater at 20-40 min postexercise and plasma lactate greater immediately postexercise for 1 versus 5 min inter-set rest. Resistance exercise with short (1 min) inter-set rest duration attenuated myofibrillar protein synthesis during the early postexercise recovery period compared with longer (5 min) rest duration, potentially through compromised activation of intracellular signalling.

  17. Isosmotic modulation of cell volume and intracellular ion activities during stimulation of single exocrine cells.


    Foskett, J K; Wong, M M; Sue-A-Quan, G; Robertson, M A


    Stimulation of salivary secretion is associated with a rise of [Ca2+]i in acinar cells. We examined the osmotic and ionic consequences of activation of Ca(2+)-dependent K+ and Cl- channels, by simultaneous optical determinations of cell volume and [Ca2+]i, [Cl-]i or [Na+]i during muscarinic stimulation of single salivary acinar cells, using a differential interference contrast (DIC)-fluorescence microscope. Carbachol caused a rapid rise of [Ca2+]i, as well as a substantial cell shrinkage. Despite variability in the level and kinetics of the subsequent sustained phase of the [Ca2+]i response, cell volume was correlated with [Ca2+]i in all cases. Elevated [Ca2+]i was both necessary and sufficient to cause these changes in cell volume. The proposition that changes in cell volume reflected changes in cell solute content was confirmed by simultaneously measuring [Cl-]i and cell volume. Simultaneous determinations of cell volume and [Na+]i indicated that the initial cell shrinkage was due entirely to K+ and Cl- efflux. Subsequent to the initial shrinkage, [Na+]i rose to high levels, primarily due to activation of Na+/H+ exchange. Thus, modulation of ion transport activities under isosmotic conditions results in substantial changes in cell solute content and cell volume. Subsequent to the early Ca(2+)-induced changes in these parameters, other transporters become active, but it is unclear what signals their activation. Cell swelling by osmotic dilution of the bath resulted in compensatory cell shrinkage (RVD) which was sensitive to K+ and Cl- gradients. Nevertheless, a rise of [Ca2+]i was not necessary for RVD. Osmotic shrinkage and/or cell acidification were insufficient to activate Na+ influx.(ABSTRACT TRUNCATED AT 250 WORDS)

  18. Role of Mitochondrial Reactive Oxygen Species in the Activation of Cellular Signals, Molecules, and Function.


    Indo, Hiroko P; Hawkins, Clare L; Nakanishi, Ikuo; Matsumoto, Ken-Ichiro; Matsui, Hirofumi; Suenaga, Shigeaki; Davies, Michael J; St Clair, Daret K; Ozawa, Toshihiko; Majima, Hideyuki J


    Mitochondria are a major source of intracellular energy and reactive oxygen species in cells, but are also increasingly being recognized as a controller of cell death. Here, we review evidence of signal transduction control by mitochondrial superoxide generation via the nuclear factor-κB (NF-κB) and GATA signaling pathways. We have also reviewed the effects of ROS on the activation of MMP and HIF. There is significant evidence to support the hypothesis that mitochondrial superoxide can initiate signaling pathways following transport into the cytosol. In this study, we provide evidence of TATA signal transductions by mitochondrial superoxide. Oxidative phosphorylation via the electron transfer chain, glycolysis, and generation of superoxide from mitochondria could be important factors in regulating signal transduction, cellular homeostasis, and cell death.

  19. Supramolecular organizing centers (SMOCs) as signaling machines in innate immune activation.


    Qiao, Qi; Wu, Hao


    Innate immunity offers the first line of defense against infections and other types of danger such as tumorigenesis. Its discovery provides tremendous therapeutic opportunities for numerous human diseases. Delving into the structural basis of signal transduction by innate immune receptors, our lab has recently helped to establish the new paradigm in which innate immune receptors transduce ligand-binding signals through formation of higher-order assemblies containing intracellular adapters, signaling enzymes and their substrates. These large signalosome assemblies may be visible under light microscopy as punctate structures in the µm scale, connecting to the underlying molecular structures in the nm scale. They drive proximity-induced enzyme activation, and provide a mechanism for signaling amplification by nucleated polymerization. These supramolecular signaling complexes also open new questions on their cellular organization and mode of regulation, pose challenges to our methodology, and afford valuable implications in drug discovery against these medically important pathways.

  20. Early induction of CREB activation and CREB-regulating signalling by antidepressants.


    Tardito, Daniela; Musazzi, Laura; Tiraboschi, Ettore; Mallei, Alessandra; Racagni, Giorgio; Popoli, Maurizio


    Converging evidence points to adaptive changes in neuroplasticity and gene expression as mediators of therapeutic action of antidepressants. Activation of cAMP response-element binding protein (CREB) and CREB-regulating signalling are considered main effectors in these mechanisms. We analysed the temporal profile of intracellular changes induced by antidepressants, by measuring activation of major CREB-regulating signalling cascades and activation (Ser133 phosphorylation) of CREB. The main aims of the study were to investigate how these different variables are modulated with time, whether stronger activation of signalling cascades corresponds to stronger activation of CREB, and whether these changes are different in distinct brain areas. Rat groups were treated for 1, 2 or 3 wk with the antidepressants fluoxetine or reboxetine; in additional groups drug treatment was followed by a washout week (3+1). Activation of CREB and major effectors in signalling cascades were analysed by Western blot analysis with phospho-antibodies, in nuclear and cytosolic fractions from hippocampus and prefrontal/frontal cortex (P/FC). Surprisingly, CREB activation was already maximal after 1-wk treatment. In hippocampus early and stronger CREB activation was consistent with early and stronger activation of signalling. For both drugs, the profile of activation in P/FC was different from that observed in hippocampus. The results also showed that, contrary to the activatory role of MAP-ERKs and CaM kinase IV, nuclear alphaCaM kinase II was inactivated in parallel with activation of CREB.

  1. Human T cell lymphotropic virus type I genomic expression and impact on intracellular signaling pathways during neurodegenerative disease and leukemia.


    Yao, J; Wigdahl, B


    HTLV-I has been identified as the etiologic agent of neoplasia within the human peripheral blood T lymphocyte population, and a progressive neurologic disorder based primarily within the central nervous system. We have examined the role of HTLV-I in these two distinctly different clinical syndromes by examining the life cycle of the virus, with emphasis on the regulation of viral gene expression within relevant target cell populations. In particular, we have examined the impact of specific viral gene products, particularly Tax, on cellular metabolic function. Tax is a highly promiscuous and pleiotropic viral oncoprotein, and is the most important factor contributing to the initial stages of viral-mediated transformation of T cells after HTLV-I infection. Tax, which weakly binds to Tax response element 1 (TRE-1) in the viral long terminal repeat (LTR), can dramatically trans-activate viral gene expression by interacting with cellular transcription factors, such as activated transcription factors and cyclic AMP response element binding proteins (ATF/CREB), CREB binding protein (CBP/p300), and factors involved with the basic transcription apparatus. At the same time, Tax alters cellular gene expression by directly or indirectly interacting with a variety of cellular transcription factors, cell cycle control elements, and cellular signal transduction molecules ultimately resulting in dysregulated cell proliferation. The mechanisms associated with HTLV-I infection, leading to tropical spastic paraparesis (TSP) are not as clearly resolved. Possible explanations of viral-induced neurologic disease range from central nervous system (CNS) damage caused by direct viral invasion of the CNS to bystander CNS damage caused by the immune response to HTLV-I infection. It is interesting to note that it is very rare for an HTLV-I infected individual to develop both adult T cell leukemia (ATL) and TSP in his/her life time, suggesting that the mechanisms governing development of these

  2. The Mitogen-Activated Protein Kinase (MAPK) Signaling Pathway as a Discovery Target in Stroke.


    Sun, Jing; Nan, Guangxian


    Protein kinases are critical modulators of a variety of intracellular and extracellular signal transduction pathways, and abnormal phosphorylation events can contribute to disease progression in a variety of diseases. As a result, protein kinases have emerged as important new drug targets for small molecule therapeutics. The mitogen-activated protein kinase (MAPK) signaling pathway transmits signals from the cell membrane to the nucleus in response to a variety of different stimuli. Because this pathway controls a broad spectrum of cellular processes, including growth, inflammation, and stress responses, it is accepted as a therapeutic target for cancer and peripheral inflammatory disorders. There is also increasing evidence that MAPK is an important regulator of ischemic and hemorrhagic cerebral vascular disease, raising the possibility that it might be a drug discovery target for stroke. In this review, we discuss the MAPK signaling pathway in association with its activation in stroke-induced brain injury.

  3. Selection of Intracellularly Functional RNA Mimics of Green Fluorescent Protein Using Fluorescence-Activated Cell Sorting.


    Zou, Jiawei; Huang, Xin; Wu, Lei; Chen, Gangyi; Dong, Juan; Cui, Xin; Tang, Zhuo


    Fluorescence-activated cell sorting (FACS) was exploited to isolate Escherichia coli cells that were highly fluorescent due to the expression of RNA aptamers that induce fluorescence of 3,5-difluoro-4-hydroxybenzylidene imidazolinone. Two different aptamers, named ZT-26 and ZT-324, were identified by this method and compared to the fluorescence-signaling properties of Spinach, a previously reported RNA aptamer. Aptamer ZT-26 exhibits significantly enhanced fluorescence over Spinach only in vitro. However, aptamer ZT-324 is 36% brighter than Spinach when expressed in E. coli. The FACS-based selection strategy presented here is attractive for deriving fluorescent RNA aptamers that function in cells as it directly selects for cells with a high level of fluorescence due to the expression of the RNA aptamer.

  4. Mitofusin 2 decreases intracellular lipids in macrophages by regulating peroxisome proliferator-activated receptor-γ

    SciTech Connect

    Liu, Chun; Ge, Beihai; He, Chao; Zhang, Yi; Liu, Xiaowen; Liu, Kejian; Qian, Cuiping; Zhang, Yu; Peng, Wenzhong; Guo, Xiaomei


    Highlights: • Mfn2 decreases cellular lipid accumulation by activating cholesterol transporters. • PPARγ is involved in the Mfn2-mediated increase of cholesterol transporter expressions. • Inactivation of ERK1/2 and p38 is involved in Mfn2-induced PPARγ expression. - Abstract: Mitofusin 2 (Mfn2) inhibits atherosclerotic plaque formation, but the underlying mechanism remains elusive. This study aims to reveal how Mfn2 functions in the atherosclerosis. Mfn2 expression was found to be significantly reduced in arterial atherosclerotic lesions of both mice and human compared with healthy counterparts. Here, we observed that Mfn2 increased cellular cholesterol transporter expression in macrophages by upregulating peroxisome proliferator-activated receptor-γ, an effect achieved at least partially by inhibiting extracellular signal-regulated kinase1/2 (ERK1/2) and p38 mitogen-activated protein kinases (MAPKs) pathway. These findings provide insights into potential mechanisms of Mfn2-mediated alterations in cholesterol transporter expression, which may have significant implications for the treatment of atherosclerotic heart disease.

  5. Proteomes of Host Cell Membranes Modified by Intracellular Activities of Salmonella enterica*

    PubMed Central

    Vorwerk, Stephanie; Krieger, Viktoria; Deiwick, Jörg; Hensel, Michael; Hansmeier, Nicole


    Intracellular pathogens need to establish a growth-stimulating host niche for survival and replication. A unique feature of the gastrointestinal pathogen Salmonella enterica serovar Typhimurium is the creation of extensive membrane networks within its host. An understanding of the origin and function of these membranes is crucial for the development of new treatment strategies. However, the characterization of this compartment is very challenging, and only fragmentary knowledge of its composition and biogenesis exists. Here, we describe a new proteome-based approach to enrich and characterize Salmonella-modified membranes. Using a Salmonella mutant strain that does not form this unique membrane network as a reference, we identified a high-confidence set of host proteins associated with Salmonella-modified membranes. This comprehensive analysis allowed us to reconstruct the interactions of Salmonella with host membranes. For example, we noted that Salmonella redirects endoplasmic reticulum (ER) membrane trafficking to its intracellular niche, a finding that has not been described for Salmonella previously. Our system-wide approach therefore has the potential to rapidly close gaps in our knowledge of the infection process of intracellular pathogens and demonstrates a hitherto unrecognized complexity in the formation of Salmonella host niches. PMID:25348832

  6. Intracellular activities related to in vitro hippocampal sharp waves are altered in CA3 pyramidal neurons of aged mice.


    Moradi-Chameh, H; Peng, J; Wu, C; Zhang, L


    Pyramidal neurons in the hippocampal CA3 area interconnect intensively via recurrent axonal collaterals, and such CA3-to-CA3 recurrent circuitry plays important roles in the generation of hippocampal network activities. In particular, the CA3 circuitry is able to generate spontaneous sharp waves (SPWs) when examined in vitro. These in vitro SPWs are thought to result from the network activity of GABAergic inhibitory interneurons as SPW-correlating intracellular activities are featured with strong IPSPs in pyramidal neurons and EPSPs or spikes in GABAergic interneurons. In view of accumulating evidence indicating a decrease in subgroups of hippocampal GABAergic interneurons in aged animals, we test the hypothesis that the intracellular activities related to in vitro SPWs are altered in CA3 pyramidal neurons of aged mice. Hippocampal slices were prepared from adult and aged C57 black mice (ages 3-6 and 24-28months respectively). Population and single-cell activities were examined via extracellular and whole-cell patch-clamp recordings. CA3 SPW frequencies were not significantly different between the slices of adult and aged mice but SPW-correlating intracellular activities featured weaker IPSC components in aged CA3 pyramidal neurons compared to adult neurons. It was unlikely that this latter phenomenon was due to general impairments of GABAergic synapses in the aged CA3 circuitry as evoked IPSC responses and pharmacologically isolated IPSCs were observed in aged CA3 pyramidal neurons. In addition, aged CA3 pyramidal neurons displayed more positive resting potentials and had a higher propensity of burst firing than adult neurons. We postulate that alterations of GABAergic network activity may explain the reduced IPCS contributions to in vitro SPWs in aged CA3 pyramidal neurons. Overall, our present observations are supportive of the notion that excitability of hippocampal CA3 circuitry is increased in aged mice.

  7. Isomer-nonspecific action of dichlorodiphenyltrichloroethane on aryl hydrocarbon receptor and G-protein-coupled receptor 30 intracellular signaling in apoptotic neuronal cells.


    Kajta, M; Litwa, E; Rzemieniec, J; Wnuk, A; Lason, W; Zelek-Molik, A; Nalepa, I; Grzegorzewska-Hiczwa, M; Tokarski, K; Golas, A; Guzik, E; Grochowalski, A; Szychowski, K A; Wojtowicz, A K


    Extended residual persistence of the pesticide dichlorodiphenyltrichloroethane (DDT) raises concerns about its long-term neurotoxic effects. Little is known, however, about DDT toxicity during the early stages of neural development. This study demonstrated that DDT-induced apoptosis of mouse embryonic neuronal cells is a caspase-9-, caspase-3-, and GSK-3β-dependent process, which involves p,p'-DDT-specific impairment of classical ERs. It also provided evidence for DDT-isomer-nonspecific alterations of AhR- and GPR30-mediated intracellular signaling, including changes in the levels of the receptor and receptor-regulated mRNAs, and also changes in the protein levels of the receptors. DDT-induced stimulation of AhR-signaling and reduction of GPR30-signaling were verified using selective ligands and specific siRNAs. Co-localization of the receptors was demonstrated with confocal microscopy, and the presence of functional GPR30 was detected by electrophysiology. This study demonstrates that stimulation of AhR-signaling and impairment of GPR30-signaling play important roles in the propagation of DDT-induced apoptosis during the early stages of neural development.

  8. Nandrolone reduces activation of Notch signaling in denervated muscle associated with increased Numb expression

    SciTech Connect

    Liu, Xin-Hua; Yao, Shen; Qiao, Rui-Fang; Levine, Alice C.; Kirschenbaum, Alexander; Pan, Jiangping; Wu, Yong; Qin, Weiping; Bauman, William A.; Cardozo, Christopher P.


    Highlights: {yields} Nerve transection increased Notch signaling in paralyzed muscle. {yields} Nandrolone prevented denervation-induced Notch signaling. {yields} Nandrolone induced the expression of an inhibitor of the Notch signaling, Numb. {yields} Reduction of denervation-induced Notch signaling by nandrolone is likely through upregulation of Numb. -- Abstract: Nandrolone, an anabolic steroid, slows denervation-atrophy in rat muscle. The molecular mechanisms responsible for this effect are not well understood. Androgens and anabolic steroids activate Notch signaling in animal models of aging and thereby mitigate sarcopenia. To explore the molecular mechanisms by which nandrolone prevents denervation-atrophy, we investigated the effects of nandrolone on Notch signaling in denervated rat gastrocnemius muscle. Denervation significantly increased Notch activity reflected by elevated levels of nuclear Notch intracellular domain (NICD) and expression of Hey1 (a Notch target gene). Activation was greatest at 7 and 35 days after denervation but remained present at 56 days after denervation. Activation of Notch in denervated muscle was prevented by nandrolone associated with upregulated expression of Numb mRNA and protein. These data demonstrate that denervation activates Notch signaling, and that nandrolone abrogates this response associated with increased expression of Numb, suggesting a potential mechanism by which nandrolone reduces denervation-atrophy.

  9. Functionally active t1-t1 interfaces revealed by the accessibility of intracellular thiolate groups in kv4 channels.


    Wang, Guangyu; Shahidullah, Mohammad; Rocha, Carmen A; Strang, Candace; Pfaffinger, Paul J; Covarrubias, Manuel


    Gating of voltage-dependent K(+) channels involves movements of membrane-spanning regions that control the opening of the pore. Much less is known, however, about the contributions of large intracellular channel domains to the conformational changes that underlie gating. Here, we investigated the functional role of intracellular regions in Kv4 channels by probing relevant cysteines with thiol-specific reagents. We find that reagent application to the intracellular side of inside-out patches results in time-dependent irreversible inhibition of Kv4.1 and Kv4.3 currents. In the absence or presence of Kv4-specific auxiliary subunits, mutational and electrophysiological analyses showed that none of the 14 intracellular cysteines is essential for channel gating. C110, C131, and C132 in the intersubunit interface of the tetramerization domain (T1) are targets responsible for the irreversible inhibition by a methanethiosulfonate derivative (MTSET). This result is surprising because structural studies of Kv4-T1 crystals predicted protection of the targeted thiolate groups by constitutive high-affinity Zn(2+) coordination. Also, added Zn(2+) or a potent Zn(2+) chelator (TPEN) does not significantly modulate the accessibility of MTSET to C110, C131, or C132; and furthermore, when the three critical cysteines remained as possible targets, the MTSET modification rate of the activated state is approximately 200-fold faster than that of the resting state. Biochemical experiments confirmed the chemical modification of the intact alpha-subunit and the purified tetrameric T1 domain by MTS reagents. These results conclusively demonstrate that the T1--T1 interface of Kv4 channels is functionally active and dynamic, and that critical reactive thiolate groups in this interface may not be protected by Zn(2+) binding.

  10. Functionally Active T1-T1 Interfaces Revealed by the Accessibility of Intracellular Thiolate Groups in Kv4 Channels

    PubMed Central

    Wang, Guangyu; Shahidullah, Mohammad; Rocha, Carmen A.; Strang, Candace; Pfaffinger, Paul J.; Covarrubias, Manuel


    Gating of voltage-dependent K+ channels involves movements of membrane-spanning regions that control the opening of the pore. Much less is known, however, about the contributions of large intracellular channel domains to the conformational changes that underlie gating. Here, we investigated the functional role of intracellular regions in Kv4 channels by probing relevant cysteines with thiol-specific reagents. We find that reagent application to the intracellular side of inside-out patches results in time-dependent irreversible inhibition of Kv4.1 and Kv4.3 currents. In the absence or presence of Kv4-specific auxiliary subunits, mutational and electrophysiological analyses showed that none of the 14 intracellular cysteines is essential for channel gating. C110, C131, and C132 in the intersubunit interface of the tetramerization domain (T1) are targets responsible for the irreversible inhibition by a methanethiosulfonate derivative (MTSET). This result is surprising because structural studies of Kv4-T1 crystals predicted protection of the targeted thiolate groups by constitutive high-affinity Zn2+ coordination. Also, added Zn2+ or a potent Zn2+ chelator (TPEN) does not significantly modulate the accessibility of MTSET to C110, C131, or C132; and furthermore, when the three critical cysteines remained as possible targets, the MTSET modification rate of the activated state is ∼200-fold faster than that of the resting state. Biochemical experiments confirmed the chemical modification of the intact α-subunit and the purified tetrameric T1 domain by MTS reagents. These results conclusively demonstrate that the T1–T1 interface of Kv4 channels is functionally active and dynamic, and that critical reactive thiolate groups in this interface may not be protected by Zn2+ binding. PMID:15955876

  11. Agonist-Biased Signaling via Proteinase Activated Receptor-2: Differential Activation of Calcium and Mitogen-Activated Protein Kinase Pathways

    PubMed Central

    Ramachandran, Rithwik; Mihara, Koichiro; Mathur, Maneesh; Rochdi, Moulay Driss; Bouvier, Michel; DeFea, Kathryn


    We evaluated the ability of different trypsin-revealed tethered ligand (TL) sequences of rat proteinase-activated receptor 2 (rPAR2) and the corresponding soluble TL-derived agonist peptides to trigger agonist-biased signaling. To do so, we mutated the proteolytically revealed TL sequence of rPAR2 and examined the impact on stimulating intracellular calcium transients and mitogen-activated protein (MAP) kinase. The TL receptor mutants, rPAR2-Leu37Ser38, rPAR2-Ala37–38, and rPAR2-Ala39–42 were compared with the trypsin-revealed wild-type rPAR2 TL sequence, S37LIGRL42—. Upon trypsin activation, all constructs stimulated MAP kinase signaling, but only the wt-rPAR2 and rPAR2-Ala39–42 triggered calcium signaling. Furthermore, the TL-derived synthetic peptide SLAAAA-NH2 failed to cause PAR2-mediated calcium signaling but did activate MAP kinase, whereas SLIGRL-NH2 triggered both calcium and MAP kinase signaling by all receptors. The peptides AAIGRL-NH2 and LSIGRL-NH2 triggered neither calcium nor MAP kinase signals. Neither rPAR2-Ala37–38 nor rPAR2-Leu37Ser38 constructs recruited β-arrestins-1 or -2 in response to trypsin stimulation, whereas both β-arrestins were recruited to these mutants by SLIGRL-NH2. The lack of trypsin-triggered β-arrestin interactions correlated with impaired trypsin-activated TL-mutant receptor internalization. Trypsin-stimulated MAP kinase activation by the TL-mutated receptors was not blocked by inhibitors of Gαi (pertussis toxin), Gαq [N-cyclohexyl-1-(2,4-dichlorophenyl)-1,4-dihydro-6-methylindeno[1,2-c]pyrazole-3-carboxamide (GP2A)], Src kinase [4-amino-5-(4-methylphenyl)-7-(t-butyl)pyrazolo[3,4-d]-pyrimidine (PP1)], or the epidermal growth factor (EGF) receptor [4-(3′-chloroanilino)-6,7-dimethoxy-quinazoline (AG1478)], but was inhibited by the Rho-kinase inhibitor (R)-(+)-trans-N-(4-pyridyl)-4-(1-aminoethyl)-cyclohexanecarboxamide, 2HCl (Y27362). The data indicate that the proteolytically revealed TL sequence(s) and the mode

  12. Prostaglandin E2 inhibits NLRP3 inflammasome activation through EP4 receptor and intracellular cAMP in human macrophages

    PubMed Central

    Liu, Yueqin; Martinez-Anton, Asuncion; Qi, Hai-Yan; Logun, Carolea; Alsaaty, Sara; Park, Yong Hwan; Kastner, Daniel L.; Chae, Jae Jin; Shelhamer, James H.


    Prostaglandin E2 (PGE2) is a potent lipid mediator involved in maintaining homeostasis but also promotion of acute inflammation or immune suppression in chronic inflammation and cancer. NLRP3 inflammasome plays an important role in host defense. Uncontrolled activation of NLRP3 inflammasome, due to mutations in the NLRP3 gene causes cryopyrin-associated periodic syndromes (CAPS). Here, we showed that NLRP3 inflammasome activation is inhibited by PGE2 in human primary monocyte-derived macrophages. This effect was mediated through prostaglandin E receptor 4 (EP4) and an increase in intracellular cAMP, independently of protein kinase A (PKA) or exchange protein directly activated by cAMP (Epac). A specific agonist of EP4 mimicked, while its antagonist or EP4 knockdown reversed PGE2-mediated NLRP3 inhibition. PGE2 caused an increase in intracellular cAMP. Blockade of adenylate cyclase by its inhibitor reversed PGE2-mediated NLRP3 inhibition. Increase of intracellular cAMP by an activator of adenylate cyclase or an analog of cAMP, or a blockade of cAMP degradation by phosphodiesterase inhibitor decreased NLRP3 activation. PKA or Epac agonists did not mimic and their antagonists did not reverse PGE2-mediated NLRP3 inhibition. In addition, constitutive IL-1β secretion from LPS-primed PBMCs of CAPS patients was substantially reduced by high doses of PGE2. Moreover, blocking cytosolic phospholipase A2α by its inhibitor or siRNA or inhibiting cyclooxygenase 2, resulting in inhibition of endogenous PGE2 production, caused an increase in NLRP3 inflammasome activation. Our results suggest that PGE2 might play a role in maintaining homeostasis during the resolution phase of inflammation and might serve as an autocrine and paracrine regulator. PMID:25917098

  13. Biological Activities of Reactive Oxygen and Nitrogen Species: Oxidative Stress versus Signal Transduction

    PubMed Central

    Weidinger, Adelheid; Kozlov, Andrey V.


    In the past, reactive oxygen and nitrogen species (RONS) were shown to cause oxidative damage to biomolecules, contributing to the development of a variety of diseases. However, recent evidence has suggested that intracellular RONS are an important component of intracellular signaling cascades. The aim of this review was to consolidate old and new ideas on the chemical, physiological and pathological role of RONS for a better understanding of their properties and specific activities. Critical consideration of the literature reveals that deleterious effects do not appear if only one primary species (superoxide radical, nitric oxide) is present in a biological system, even at high concentrations. The prerequisite of deleterious effects is the formation of highly reactive secondary species (hydroxyl radical, peroxynitrite), emerging exclusively upon reaction with another primary species or a transition metal. The secondary species are toxic, not well controlled, causing irreversible damage to all classes of biomolecules. In contrast, primary RONS are well controlled (superoxide dismutase, catalase), and their reactions with biomolecules are reversible, making them ideal for physiological/pathophysiological intracellular signaling. We assume that whether RONS have a signal transducing or damaging effect is primarily defined by their quality, being primary or secondary RONS, and only secondly by their quantity. PMID:25884116

  14. n-Propyl gallate activates hypoxia-inducible factor 1 by modulating intracellular oxygen-sensing systems.


    Kimura, Motohide; Takabuchi, Satoshi; Tanaka, Tomoharu; Murata, Miyahiko; Nishi, Kenichiro; Oda, Seiko; Oda, Tomoyuki; Kanai, Michiyuki; Fukuda, Kazuhiko; Kizaka-Kondoh, Shinae; Adachi, Takehiko; Takabayashi, Arimichi; Semenza, Gregg L; Hirota, Kiichi


    HIF-1 (hypoxia-inducible factor 1) is a master regulator of cellular adaptive responses to hypoxia. The expression and transcriptional activity of the HIF-1alpha subunit is stringently controlled by intracellular oxygen tension through the action of prolyl and asparaginyl hydroxylases. In the present study we demonstrate that PG (n-propyl gallate) activates HIF-1 and expression of its downstream target genes under normoxic conditions in cultured cells and in mice. The stability and transcriptional activity of HIF-1alpha are increased by PG. PG treatment inhibits the interaction between HIF-1alpha and VHL (von Hippel-Lindau protein) and promotes the interaction between HIF-1alpha and p300, indicating that PG inhibits the activity of both prolyl and asparaginyl HIF-1alpha hydroxylases. We conclude that PG activates HIF-1 and enhances the resultant gene expression by directly affecting the intracellular oxygen sensing system in vitro and in vivo and that PG represents a lead compound for the development of a non-toxic activator of HIF-1.

  15. A highly calcium-selective cation current activated by intracellular calcium release in MDCK cells.


    Delles, C; Haller, T; Dietl, P


    1. The whole-cell patch clamp technique and fluorescence microscopy with the Ca2+ indicators fura-2 and fluo-3 were used to measure the whole-cell current and the free intracellular Ca2+ concentration ([Ca2+]i) in Madin-Darby canine kidney (MDCK) cells. 2. In a Ca(2+)-free bath solution, thapsigargin (TG) caused a transient increase of [Ca2+]i. Subsequent addition of Ca2+ caused a long lasting elevation of [Ca2+]i. 3. In a Ca(2+)-free bath solution, extracellular application of TG, ATP or ionomycin, or intracellular application of inositol 1,4,5-trisphosphate (IP3), caused a small but significant inward current (Iin) and a transient outward Ca(2+)-dependent K+ current (IK(Ca)), consistent with intracellular Ca2+ release. Subsequent addition of Ca2+ induced a prominent Iin with a current density of -4.2 +/- 0.7 pA pF-1. This Iin was unaffected by inositol 1,3,4,5-tetrakisphosphate (IP4). 4. Na+ replacement by mannitol, N-methyl-D-glucamine+ (NMG+), aminomethylidin-trimethanol+ (Tris+) or choline+ reduced Iin by 54, 65, 52 and 56%, respectively. This indicates an apparent Ca2+ selectivity over Na+ of 26:1. Iin was, however, unaffected by replacing Cl- with gluconate- or by the K+ channel blocker charybdotoxin (CTX). 5. Iin was completely blocked by La3+ (IC50 = 0.77 microM). Consistently, La3+ completely reversed the TG-induced elevation of [Ca2+]i. SK&F 96365 (1-[3-(4-methoxyphenyl)-propoxyl]-1-(4-methoxy-phenyl)-ethyl-1H-im idazole) HCl did not inhibit the TG-induced Iin. It did, however, exhibit a biphasic effect on [Ca2+]i, consisting of an initial Ca2+ decay and a subsequent Ca2+ elevation. La3+ completely reversed the SK&F 96365-induced elevation of [Ca2+]i. 6. In the absence of Na+, Iin was dependent on the bath Ca2+ concentration (EC50 = 1.02 mM). Ca2+ replacement by Ba2+ or Mn2+ resulted in a reduction of Iin by 95 and 94%, respectively. 7. From these experiments we conclude that Ca2+ release from intracellular Ca2+ stores, induced by different independent

  16. Intracellular Distribution and Nuclear Activity of Antisense Oligonucleotides After Unassisted Uptake in Myoblasts and Differentiated Myotubes In Vitro.


    González-Barriga, Anchel; Nillessen, Bram; Kranzen, Julia; van Kessel, Ingeborg D G; Croes, Huib J E; Aguilera, Begoña; de Visser, Peter C; Datson, Nicole A; Mulders, Susan A M; van Deutekom, Judith C T; Wieringa, Bé; Wansink, Derick G


    Clinical efficacy of antisense oligonucleotides (AONs) for the treatment of neuromuscular disorders depends on efficient cellular uptake and proper intracellular routing to the target. Selection of AONs with highest in vitro efficiencies is usually based on chemical or physical methods for forced cellular delivery. Since these methods largely bypass existing natural mechanisms for membrane passage and intracellular trafficking, spontaneous uptake and distribution of AONs in cells are still poorly understood. Here, we report on the unassisted uptake of naked AONs, so-called gymnosis, in muscle cells in culture. We found that gymnosis works similarly well for proliferating myoblasts as for terminally differentiated myotubes. Cell biological analyses combined with microscopy imaging showed that a phosphorothioate backbone promotes efficient gymnosis, that uptake is clathrin mediated and mainly results in endosomal-lysosomal accumulation. Nuclear localization occurred at a low level, but the gymnotically delivered AONs effectively modulated the expression of their nuclear RNA targets. Chloroquine treatment after gymnotic delivery helped increase nuclear AON levels. In sum, we demonstrate that gymnosis is feasible in proliferating and non-proliferating muscle cells and we confirm the relevance of AON chemistry for uptake and intracellular trafficking with this method, which provides a useful means for bio-activity screening of AONs in vitro.

  17. Activation of frog (Xenopus laevis) eggs by inositol trisphosphate. I. Characterization of Ca2+ release from intracellular stores

    PubMed Central


    Iontophoresis of inositol 1, 4, 5-triphosphate into frog (Xenopus laevis) eggs activated early developmental events such as membrane depolarization, cortical contraction, cortical granule exocytosis, and abortive cleavage furrow formation (pseudocleavage). Inositol 1, 4- bisphosphate also triggered these events, but only at doses approximately 100-fold higher, whereas no level of fructose-1, 6- bisphosphate tested activated eggs. Using Ca2+-selective microelectrodes, we observed that activating doses of inositol 1, 4, 5- trisphosphate triggered a Ca2+ release from intracellular stores that was indistinguishable from that previously observed at fertilization (Busa, W. B., and R. Nuccitelli, 1985, J. Cell Biol., 100:1325-1329), whereas subthreshold doses triggered only a localized Ca2+ release at the site of injection. The subthreshold IP3 response could be distinguished from the major Ca2+ release at activation with respect to their dose-response characteristics, relative timing, sensitivity to external Ca2+ levels, additivity, and behavior in the activated egg, suggesting that the Xenopus egg may possess two functionally distinct Ca2+ pools mobilized by different effectors. In light of these differences, we suggest a model for intracellular Ca2+ mobilization by sperm-egg interaction. PMID:3874873

  18. Mycobacterium tuberculosis Differentially Activates cGAS- and Inflammasome-Dependent Intracellular Immune Responses through ESX-1.


    Wassermann, Ruth; Gulen, Muhammet F; Sala, Claudia; Perin, Sonia Garcia; Lou, Ye; Rybniker, Jan; Schmid-Burgk, Jonathan L; Schmidt, Tobias; Hornung, Veit; Cole, Stewart T; Ablasser, Andrea


    Cytosolic detection of microbial products is essential for the initiation of an innate immune response against intracellular pathogens such as Mycobacterium tuberculosis (Mtb). During Mtb infection of macrophages, activation of cytosolic surveillance pathways is dependent on the mycobacterial ESX-1 secretion system and leads to type I interferon (IFN) and interleukin-1β (IL-1β) production. Whereas the inflammasome regulates IL-1β secretion, the receptor(s) responsible for the activation of type I IFNs has remained elusive. We demonstrate that the cytosolic DNA sensor cyclic GMP-AMP synthase (cGAS) is essential for initiating an IFN response to Mtb infection. cGAS associates with Mtb DNA in the cytosol to stimulate cyclic GAMP (cGAMP) synthesis. Notably, activation of cGAS-dependent cytosolic host responses can be uncoupled from inflammasome activation by modulating the secretion of ESX-1 substrates. Our findings identify cGAS as an innate sensor of Mtb and provide insight into how ESX-1 controls the activation of specific intracellular recognition pathways.

  19. An In Vivo Selection Identifies Listeria monocytogenes Genes Required to Sense the Intracellular Environment and Activate Virulence Factor Expression

    PubMed Central

    Portnoy, Daniel A.


    Listeria monocytogenes is an environmental saprophyte and facultative intracellular bacterial pathogen with a well-defined life-cycle that involves escape from a phagosome, rapid cytosolic growth, and ActA-dependent cell-to-cell spread, all of which are dependent on the master transcriptional regulator PrfA. The environmental cues that lead to temporal and spatial control of L. monocytogenes virulence gene expression are poorly understood. In this study, we took advantage of the robust up-regulation of ActA that occurs intracellularly and expressed Cre recombinase from the actA promoter and 5’ untranslated region in a strain in which loxP sites flanked essential genes, so that activation of actA led to bacterial death. Upon screening for transposon mutants that survived intracellularly, six genes were identified as necessary for ActA expression. Strikingly, most of the genes, including gshF, spxA1, yjbH, and ohrA, are predicted to play important roles in bacterial redox regulation. The mutants identified in the genetic selection fell into three broad categories: (1) those that failed to reach the cytosolic compartment; (2) mutants that entered the cytosol, but failed to activate the master virulence regulator PrfA; and (3) mutants that entered the cytosol and activated transcription of actA, but failed to synthesize it. The identification of mutants defective in vacuolar escape suggests that up-regulation of ActA occurs in the host cytosol and not the vacuole. Moreover, these results provide evidence for two non-redundant cytosolic cues; the first results in allosteric activation of PrfA via increased glutathione levels and transcriptional activation of actA while the second results in translational activation of actA and requires yjbH. Although the precise host cues have not yet been identified, we suggest that intracellular redox stress occurs as a consequence of both host and pathogen remodeling their metabolism upon infection. PMID:27414028

  20. Intracellular proteoglycans.

    PubMed Central

    Kolset, Svein Olav; Prydz, Kristian; Pejler, Gunnar


    Proteoglycans (PGs) are proteins with glycosaminoglycan chains, are ubiquitously expressed and have a wide range of functions. PGs in the extracellular matrix and on the cell surface have been the subject of extensive structural and functional studies. Less attention has so far been given to PGs located in intracellular compartments, although several reports suggest that these have biological functions in storage granules, the nucleus and other intracellular organelles. The purpose of this review is, therefore, to present some of these studies and to discuss possible functions linked to PGs located in different intracellular compartments. Reference will be made to publications relevant for the topics we present. It is beyond the scope of this review to cover all publications on PGs in intracellular locations. PMID:14759226

  1. Identification of Three Classes of Heteroaromatic Compounds with Activity against Intracellular Trypanosoma cruzi by Chemical Library Screening

    PubMed Central

    Bettiol, Esther; Samanovic, Marie; Murkin, Andrew S.; Raper, Jayne; Buckner, Frederick; Rodriguez, Ana


    The development of new drugs against Chagas disease is a priority since the currently available medicines have toxic effects, partial efficacy and are targeted against the acute phase of disease. At present, there is no drug to treat the chronic stage. In this study, we have optimized a whole cell-based assay for high throughput screening of compounds that inhibit infection of mammalian cells by Trypanosoma cruzi trypomastigotes. A 2000-compound chemical library was screened using a recombinant T. cruzi (Tulahuen strain) expressing β-galactosidase. Three hits were selected for their high activity against T. cruzi and low toxicity to host cells in vitro: PCH1, NT1 and CX1 (IC50: 54, 190 and 23 nM, respectively). Each of these three compounds presents a different mechanism of action on intracellular proliferation of T. cruzi amastigotes. CX1 shows strong trypanocidal activity, an essential characteristic for the development of drugs against the chronic stage of Chagas disease where parasites are found intracellular in a quiescent stage. NT1 has a trypanostatic effect, while PCH1 affects parasite division. The three compounds also show high activity against intracellular T. cruzi from the Y strain and against the related kinetoplastid species Leishmania major and L. amazonensis. Characterization of the anti–T. cruzi activity of molecules chemically related to the three library hits allowed the selection of two compounds with IC50 values of 2 nM (PCH6 and CX2). These values are approximately 100 times lower than those of the medicines used in patients against T. cruzi. These results provide new candidate molecules for the development of treatments against Chagas disease and leishmaniasis. PMID:19238193

  2. Sleep Loss Activates Cellular Inflammatory Signaling

    PubMed Central

    Irwin, Michael R.; Wang, Minge; Ribeiro, Denise; Cho, Hyong Jin; Olmstead, Richard; Breen, Elizabeth Crabb; Martinez-Maza, Otoniel; Cole, Steve


    Background Accumulating evidence suggests that sleep disturbance is associated with inflammation and related disorders including cardiovascular disease, arthritis, and diabetes mellitus. This study was undertaken to test the effects of sleep loss on activation of nuclear factor (NF) -κB, a transcription factor that serves a critical role in the inflammatory signaling cascade. Methods In 14 healthy adults (7 females; 7 males), peripheral blood mononuclear cell NF-κB was repeatedly assessed, along with enumeration of lymphocyte subpopulations, in the morning after baseline sleep, partial sleep deprivation (awake from 23:00 h to 03:00 h), and recovery sleep. Results In the morning after a night of sleep loss, mononuclear cell NF-κB activation was significantly greater compared with morning levels following uninterrupted baseline or recovery sleep, in which the response was found in females but not in males. Conclusions These results identify NF-κB activation as a molecular pathway by which sleep disturbance may influence leukocyte inflammatory gene expression and the risk of inflammation-related disease. PMID:18561896

  3. Heat dissipation guides activation in signaling proteins

    PubMed Central

    Weber, Jeffrey K.; Shukla, Diwakar; Pande, Vijay S.


    Life is fundamentally a nonequilibrium phenomenon. At the expense of dissipated energy, living things perform irreversible processes that allow them to propagate and reproduce. Within cells, evolution has designed nanoscale machines to do meaningful work with energy harnessed from a continuous flux of heat and particles. As dictated by the Second Law of Thermodynamics and its fluctuation theorem corollaries, irreversibility in nonequilibrium processes can be quantified in terms of how much entropy such dynamics produce. In this work, we seek to address a fundamental question linking biology and nonequilibrium physics: can the evolved dissipative pathways that facilitate biomolecular function be identified by their extent of entropy production in general relaxation processes? We here synthesize massive molecular dynamics simulations, Markov state models (MSMs), and nonequilibrium statistical mechanical theory to probe dissipation in two key classes of signaling proteins: kinases and G-protein–coupled receptors (GPCRs). Applying machinery from large deviation theory, we use MSMs constructed from protein simulations to generate dynamics conforming to positive levels of entropy production. We note the emergence of an array of peaks in the dynamical response (transient analogs of phase transitions) that draw the proteins between distinct levels of dissipation, and we see that the binding of ATP and agonist molecules modifies the observed dissipative landscapes. Overall, we find that dissipation is tightly coupled to activation in these signaling systems: dominant entropy-producing trajectories become localized near important barriers along known biological activation pathways. We go on to classify an array of equilibrium and nonequilibrium molecular switches that harmonize to promote functional dynamics. PMID:26240354

  4. From intracellular signaling networks to cell death: the dual role of reactive oxygen species in seed physiology.


    Bailly, Christophe; El-Maarouf-Bouteau, Hayat; Corbineau, Françoise


    Reactive Oxygen Species (ROS) are continuously produced during seed development, from embryogenesis to germination, but also during seed storage. ROS play a dual role in seed physiology behaving, on the one hand, as actors of cellular signaling pathways and, on the other hand, as toxic products that accumulate under stress conditions. ROS, provided that their amount is tightly regulated by the balance between production and scavenging, appear now as being beneficial for germination, and in particular to act as a positive signal for seed dormancy release. Such an effect might result from the interplay between ROS and hormone signaling pathways thus leading to changes in gene expression or in cellular redox status. We also propose that changes in ROS homeostasis would play a role in perception of environmental factors by seeds during their germination, and thus act as a signal controlling the completion of germination. However, uncontrolled accumulation of ROS is likely to occur during seed aging or seed desiccation thus leading to oxidative damage toward a wide range of biomolecules and ultimately to necroses and cell death. We present here the concept of the "oxidative window for germination", which restricts the occurrence of the cellular events associated with germination to a critical range of ROS level, enclosed by lower and higher limits. Above or below the "oxidative window for germination", weak or high amounts of ROS, respectively, would not permit progress toward germination.

  5. Intracellular ascorbate enhances hypoxia-inducible factor (HIF)-hydroxylase activity and preferentially suppresses the HIF-1 transcriptional response.


    Kuiper, Caroline; Dachs, Gabi U; Currie, Margaret J; Vissers, Margreet C M


    Hypoxia-inducible factor (HIF)-1 drives the transcription of hundreds of genes to support cell survival under conditions of microenvironmental and metabolic stress. HIF-1 is downregulated by iron-containing 2-oxoglutarate-dependent enzymes that require ascorbate as a cofactor. The HIF hydroxylases control both protein stability and the formation of an active transcription complex and, consequently, ascorbate could affect HIF-1α stabilization and/or gene expression, but the relative effect of ascorbate on these separate processes has not been well characterized. In this study we examined the effects of known intracellular ascorbate concentrations on both processes in response to various means of hydroxylase inhibition, including CoCl2, NiCl2, desferrioxamine, dimethyloxalylglycine, and hypoxia. Ascorbate inhibited HIF-1 activity most dramatically with all mechanisms of iron competition. In addition, HIF-1-dependent gene expression was effectively prevented by ascorbate and was inhibited even under conditions that allowed HIF-1α protein stabilization. This suggests that (1) ascorbate acts primarily to stabilize and reduce the iron atom in the hydroxylase active site and (2) the asparagine hydroxylase controlling HIF-1 transcriptional activity is particularly susceptible to fluctuations in intracellular ascorbate. These findings suggest that ascorbate plays a significant role in supporting HIF-hydroxylase function and that it could thereby modulate the cell survival response.

  6. Sonic hedgehog stimulates the proliferation of rat gastric mucosal cells through ERK activation by elevating intracellular calcium concentration

    SciTech Connect

    Osawa, Hiroyuki; Ohnishi, Hirohide . E-mail:; Takano, Koji; Noguti, Takasi; Mashima, Hirosato; Hoshino, Hiroko; Kita, Hiroto; Sato, Kiichi; Matsui, Hirofumi; Sugano, Kentaro


    Sonic Hedgehog (Shh), a member of hedgehog peptides family, is expressed in gastric gland epithelium. To elucidate Shh function to gastric mucosal cells, we examined the effect of Shh on the proliferation of a rat normal gastric mucosal cell line, RGM-1. RGM-1 cells express essential components of Shh receptor system, patched-1, and smoothened. Shh enhanced DNA synthesis in RGM-1 cells and elevated intracellular calcium concentration ([Ca{sup 2+}]{sub i}). In addition, Shh as well as calcium ionophore A32187 rapidly activated ERK. However, Shh failed to activate ERK under calcium-free culture condition. Pretreatment of cells with PD98059 attenuated the DNA synthesis promoted by Shh. Moreover, when cells were pretreated with cyclopamine, Shh could not elevate [Ca{sup 2+}]{sub i}, activate ERK or promote DNA synthesis. On the other hand, although Shh induced Gli-1 nuclear accumulation in RGM-1 cells, Shh activated ERK even in cells pretreated with actinomycin D. These results indicate that Shh promotes the proliferation of RGM-1 cells through an intracellular calcium- and ERK-dependent but transcription-independent pathway via Patched/Smoothened receptor system.

  7. Active voltammetric microsensors with neural signal processing.

    SciTech Connect

    Vogt, M. C.


    Many industrial and environmental processes, including bioremediation, would benefit from the feedback and control information provided by a local multi-analyte chemical sensor. For most processes, such a sensor would need to be rugged enough to be placed in situ for long-term remote monitoring, and inexpensive enough to be fielded in useful numbers. The multi-analyte capability is difficult to obtain from common passive sensors, but can be provided by an active device that produces a spectrum-type response. Such new active gas microsensor technology has been developed at Argonne National Laboratory. The technology couples an electrocatalytic ceramic-metallic (cermet) microsensor with a voltammetric measurement technique and advanced neural signal processing. It has been demonstrated to be flexible, rugged, and very economical to produce and deploy. Both narrow interest detectors and wide spectrum instruments have been developed around this technology. Much of this technology's strength lies in the active measurement technique employed. The technique involves applying voltammetry to a miniature electrocatalytic cell to produce unique chemical ''signatures'' from the analytes. These signatures are processed with neural pattern recognition algorithms to identify and quantify the components in the analyte. The neural signal processing allows for innovative sampling and analysis strategies to be employed with the microsensor. In most situations, the whole response signature from the voltammogram can be used to identify, classify, and quantify an analyte, without dissecting it into component parts. This allows an instrument to be calibrated once for a specific gas or mixture of gases by simple exposure to a multi-component standard rather than by a series of individual gases. The sampled unknown analytes can vary in composition or in concentration, the calibration, sensing, and processing methods of these active voltammetric microsensors can detect, recognize, and

  8. Glucagon receptor activates extracellular signal-regulated protein kinase 1/2 via cAMP-dependent protein kinase

    PubMed Central

    Jiang, Youwei; Cypess, Aaron M.; Muse, Evan D.; Wu, Cui-Rong; Unson, Cecilia G.; Merrifield, R. B.; Sakmar, Thomas P.


    We prepared a stable cell line expressing the glucagon receptor to characterize the effect of Gs-coupled receptor stimulation on extracellular signal-regulated protein kinase 1/2 (ERK1/2) activity. Glucagon treatment of the cell line caused a dose-dependent increase in cAMP concentration, activation of cAMP-dependent protein kinase (PKA), and transient release of intracellular calcium. Glucagon treatment also caused rapid dose-dependent phosphorylation and activation of mitogen-activated protein kinase kinase/ERK kinase (MEK1/2) and ERK1/2. Inhibition of either PKA or MEK1/2 blocked ERK1/2 activation by glucagon. However, no significant activation of several upstream activators of MEK, including Ras, Rap1, and Raf, was observed in response to glucagon treatment. In addition, chelation of intracellular calcium reduced glucagon-mediated ERK1/2 activation. In transient transfection experiments, glucagon receptor mutants that bound glucagon but failed to increase intracellular cAMP and calcium concentrations showed no glucagon-stimulated ERK1/2 phosphorylation. We conclude that glucagon-induced MEK1/2 and ERK1/2 activation is mediated by PKA and that an increase in intracellular calcium concentration is required for maximal ERK activation. PMID:11517300

  9. Signal integration by Ca(2+) regulates intestinal stem-cell activity.


    Deng, Hansong; Gerencser, Akos A; Jasper, Heinrich


    Somatic stem cells maintain tissue homeostasis by dynamically adjusting proliferation and differentiation in response to stress and metabolic cues. Here we identify Ca(2+) signalling as a central regulator of intestinal stem cell (ISC) activity in Drosophila. We show that dietary L-glutamate stimulates ISC division and gut growth. The metabotropic glutamate receptor (mGluR) is required in ISCs for this response, and for an associated modulation of cytosolic Ca(2+) oscillations that results in sustained high cytosolic Ca(2+) concentrations. High cytosolic Ca(2+) concentrations induce ISC proliferation by regulating Calcineurin and CREB-regulated transcriptional co-activator (Crtc). In response to a wide range of dietary and stress stimuli, ISCs reversibly transition between Ca(2+) oscillation states that represent poised or activated modes of proliferation, respectively. We propose that the dynamic regulation of intracellular Ca(2+) levels allows effective integration of diverse mitogenic signals in ISCs to adapt their proliferative activity to the needs of the tissue.

  10. Intracellular signaling of the Ufo/Axl receptor tyrosine kinase is mediated mainly by a multi-substrate docking-site.


    Braunger, J; Schleithoff, L; Schulz, A S; Kessler, H; Lammers, R; Ullrich, A; Bartram, C R; Janssen, J W


    Ufo/Axl belongs to a new family of receptor tyrosine kinases with an extracellular structure similar to that of neural cell adhesion molecules. In order to elucidate intracellular signaling, the cytoplasmic moiety of Ufo/Axl was used to screen an expression library according to the CORT (cloning of receptor targets) method. Three putative Ufo substrates were identified: phospholipase Cgamma1 (PLCgamma), as well as p85alpha and p85beta subunits of phosphatidylinositol 3'-kinase (PI3-kinase). Subsequently, chimeric EGFR/Ufo receptors consisting of the extracellular domains of the epidermal growth factor receptor (EGFR) and the transmembrane and intracellular moiety of Ufo were engineered. Using different far-Western blot analyses and coimmunoprecipitation assays, receptor binding of PLCgamma and p85 proteins as well as GRB2, c-src and lck was examined in vitro and in vivo. Competitive inhibition of substrate binding and mutagenesis experiments with EGFR/Ufo constructs revealed C-terminal tyrosine 821 (EILpYVNMDEG) as a docking site for multiple effectors, namely PLCgamma, p85 proteins, GRB2, c-src and lck. Tyrosine 779 (DGLpYALMSRC) demonstrated an additional, but lower binding affinity for the p85 proteins in vitro. In addition, binding of PLCgamma occurred through tyrosine 866 (AGRpYVLCPST). Moreover, our in vivo data indicate that further direct or indirect binding sites for PLCgamma, GRB2, c-src and lck on the human Ufo receptor may exist.

  11. Effect of external sodium on intracellular chloride activity in the surface cells of frog gastric mucosa. Microelectrode studies.


    Curci, S; Schettino, T


    The intracellular chloride activity and its dependence on ionic substitutions in the bathing media was studied in individual surface cells of resting gastric mucosa using conventional and Cl- selective microelectrodes. When the tissue was perfused with control NaCl-Ringer the cell membrane p.d.'s, cell-lumen (psi cm) and cell-serosa (psi cs) were -40.9 +/- 0.6 mV and -66.8 +/- 0.5 mV (n = 175) respectively and the p.d. measured by the Cl- selective microelectrodes across the serosal membrane (psi csCl-) averaged -32.4 +/- 0.7 mV (n = 138). From these values an intracellular Cl- activity (acCl-) of 15.3 mmol/l can be estimated. The data indicate that chloride ion is distributed close to equilibrium at the luminal membrane while it is accumulated by an energy requiring step at the serosal membrane. Reduction (2 mmol/l) or absence of chloride from the luminal bath did not result in any detectable change of acCl-; on the other hand, after removal of Cl- from the serosal bath the intracellular Cl- activity fell to 7.1 mmol/l. When the tissue was exposed to serosal Na+-free Ringer (Na+ replaced by choline or TMA), although the acCl- remained unaffected, a marked reduction of the electrochemical gradient for Cl- at the serosal membrane was observed. These data indicate that: chloride is accumulated in the surface cells against its electrochemical potential difference at the serosal membrane; the luminal membrane has a negligible conductance to Cl-, while the serosal membrane represents a conductive pathway to chloride; the uphill entry of chloride at the serosal membrane seems to be, at least partially, Na+-dependent.

  12. Intracellular Antioxidant Activity of Grape Skin Polyphenolic Extracts in Rat Superficial Colonocytes: In situ Detection by Confocal Fluorescence Microscopy

    PubMed Central

    Giordano, M. Elena; Ingrosso, Ilaria; Schettino, Trifone; Caricato, Roberto; Giovinazzo, Giovanna; Lionetto, M. Giulia


    Colon is exposed to a number of prooxidant conditions and several colon diseases are associated with increased levels of reactive species. Polyphenols are the most abundant antioxidants in the diet, but to date no information is available about their absorption and potential intracellular antioxidant activity on colon epithelial cells. The work was addressed to study the intracellular antioxidant activity of red grape polyphenolic extracts on rat colon epithelium experimentally exposed to prooxidant conditions. The experimental model chosen was represented by freshly isolated colon explants, which closely resemble the functional, and morphological characteristics of the epithelium in vivo. The study was carried out by in situ confocal microscopy observation on CM-H2DCFDA charged explants exposed to H2O2 (5, 10, and 15 min). The qualitative and quantitative polyphenolic composition of the extracts as well as their in vitro oxygen radical absorbing capacity (ORAC) was determined. The incubation of the explants with the polyphenolic extracts for 1 h produced a significant decrease of the H2O2 induced fluorescence. This effect was more pronounced following 15 min H2O2 exposure with respect to 5 min and it was also more evident for extracts obtained from mature grapes, which showed an increased ORAC value and qualitative peculiarities in the polyphenolic composition. The results demonstrated the ability of red grape polyphenols to cross the plasma membrane and exert a direct intracellular antioxidant activity in surface colonocytes, inducing a protection against pro-oxidant conditions. The changes in the polyphenol composition due to ripening process was reflected in a more effective antioxidant protection. PMID:27303304

  13. Intracellular signaling modifications involved in the anti-inflammatory effect of 4-alkoxy-6,9-dichloro[1,2,4]triazolo[4,3-a]quinoxalines on macrophages.


    Ruiz-Alcaraz, Antonio J; Tristán-Manzano, María; Guirado, Antonio; Gálvez, Jesús; Martínez-Esparza, María; García-Peñarrubia, Pilar


    Inflammation is part of a complex biological response directed by the immune system to fight pathogens and maintain homeostasis. Dysregulation of the inflammatory process leads to development of chronic inflammatory or autoimmune diseases. Several cell types, such as macrophages, and cytokines such as interleukin 6 (IL-6) and tumor necrosis factor alpha (TNF-α) are involved in the regulation of inflammation. The important role played by these cytokines as mediators of the inflammatory process and the side effects of current therapies have promoted the search of new therapeutic alternatives. Quinoxalines are important compounds allowing a wide range of chemical modifications in order to provide an extensive repertoire of biological activities. We have previously shown that a series of 4-alkoxy-6,9-dichloro[1,2,4]triazolo[4,3-a]quinoxalines exhibit potent anti-inflammatory activity, inhibiting the production of TNF-α and IL-6. Our aim here was to study the mechanism thereby this series of compounds act upon different intracellular signaling pathways to uncover their potential molecular targets. By using immunoblotting assays, we found that these compounds inhibit ERK 1/2 and JNK/c-Jun cascades, and reduce c-Fos expression, while activate the anti-inflammatory PI3K/Akt route. These results provide further information on their effect upon the intracellular signal transduction mechanisms leading to inhibition of TNF-α and IL-6 secretion. Our results may be of great interest for the pharmaceutical industry, and could be used as a starting point for the development of new and more potent anti-inflammatory drugs derived from the quinoxaline core.

  14. Intracellular calcium-dependent regulation of the sperm-specific calcium-activated potassium channel, hSlo3, by the BKCa activator LDD175

    PubMed Central

    Wijerathne, Tharaka Darshana; Kim, Jihyun; Yang, Dongki


    Plasma membrane hyperpolarization associated with activation of Ca2+-activated K+ channels plays an important role in sperm capacitation during fertilization. Although Slo3 (slowpoke homologue 3), together with the auxiliary γ2-subunit, LRRC52 (leucine-rich-repeat–containing 52), is known to mediate the pH-sensitive, sperm-specific K+ current KSper in mice, the molecular identity of this channel in human sperm remains controversial. In this study, we tested the classical BKCa activators, NS1619 and LDD175, on human Slo3, heterologously expressed in HEK293 cells together with its functional interacting γ2 subunit, hLRRC52. As previously reported, Slo3 K+ current was unaffected by iberiotoxin or 4-aminopyridine, but was inhibited by ~50% by 20 mM TEA. Extracellular alkalinization potentiated hSlo3 K+ current, and internal alkalinization and Ca2+ elevation induced a leftward shift its activation voltage. NS1619, which acts intracellularly to modulate hSlo1 gating, attenuated hSlo3 K+ currents, whereas LDD175 increased this current and induced membrane potential hyperpolarization. LDD175-induced potentiation was not associated with a change in the half-activation voltage at different intracellular pHs (pH 7.3 and pH 8.0) in the absence of intracellular Ca2+. In contrast, elevation of intracellular Ca2+ dramatically enhanced the LDD175-induced leftward shift in the half-activation potential of hSlo3. Therefore, the mechanism of action does not involve pH-dependent modulation of hSlo3 gating; instead, LDD175 may modulate Ca2+-dependent activation of hSlo3. Thus, LDD175 potentially activates native KSper and may induce membrane hyperpolarization-associated hyperactivation in human sperm. PMID:28280418

  15. The Role of DARPP-32, an Intracellular Signaling Molecule, in the Actions of the Nerve Agent Sarin

    DTIC Science & Technology


    calmodulin-dependent protein phosphatase signaling cascade, which dephosphorylates phospho-T34-DARPP-32 (Nishi et al., 1999). DARPP-32 is also...32 at Ser-102 (S102) and Ser-137 (S137). For example, S102 on DARPP-32 is phosphorylated by casein kinase II (CK2). In previously, 1989). DARPP-32 is also phosphorylated on amino acid S137 by casein kinase I (CK1). Increases in phosphorylation at this site decrease the rate

  16. Identification of intracellular localization signals and of mechanisms underlining the nucleocytoplasmic shuttling of human aryl hydrocarbon receptor repressor

    SciTech Connect

    Kanno, Yuichiro Miyama, Yasuo; Takane, Yusuke; Nakahama, Takayuki; Inouye, Yoshio


    Two members of the 'AhR family' (a family which is part of the bHLH-PAS superfamily), aryl hydrocarbon receptor (AhR) and AhR repressor (AhRR), originated from a common ancestor and form a regulatory circuit in xenobiotic signal transduction. AhRR is a nucleocytoplasmic shuttle protein, harboring both a nuclear localization signal (NLS) and a nuclear export signal (NES). Because NLS is dominant over NES, AhRR resides predominantly in the nuclear compartment. The NES of AhRR resembles that of AhR in sensitivity to leptomycin B, whereas the NLS of AhRR is monopartite and is, therefore, distinguished from the reported bipartite NLS of AhR. The NLS deletion mutant of GFP-AhRR was transported into the nuclear compartment in the presence of AhR nuclear translocator (Arnt), suggesting the assembly of an AhRR/Arnt heterodimer complex in the cytoplasmic compartment and Arnt-dependent nuclear translocation of this complex.

  17. Arsenic-induced alteration in intracellular calcium homeostasis induces head kidney macrophage apoptosis involving the activation of calpain-2 and ERK in Clarias batrachus

    SciTech Connect

    Banerjee, Chaitali; Goswami, Ramansu; Datta, Soma; Rajagopal, R.; Mazumder, Shibnath


    We had earlier shown that exposure to arsenic (0.50 {mu}M) caused caspase-3 mediated head kidney macrophage (HKM) apoptosis involving the p38-JNK pathway in Clarias batrachus. Here we examined the roles of calcium (Ca{sup 2+}) and extra-cellular signal-regulated protein kinase (ERK), the other member of MAPK-pathway on arsenic-induced HKM apoptosis. Arsenic-induced HKM apoptosis involved increased expression of ERK and calpain-2. Nifedipine, verapamil and EGTA pre-treatment inhibited the activation of calpain-2, ERK and reduced arsenic-induced HKM apoptosis as evidenced from reduced caspase-3 activity, Annexin V-FITC-propidium iodide and Hoechst 33342 staining. Pre-incubation with ERK inhibitor U 0126 inhibited the activation of calpain-2 and interfered with arsenic-induced HKM apoptosis. Additionally, pre-incubation with calpain-2 inhibitor also interfered with the activation of ERK and inhibited arsenic-induced HKM apoptosis. The NADPH oxidase inhibitor apocynin and diphenyleneiodonium chloride also inhibited ERK activation indicating activation of ERK in arsenic-exposed HKM also depends on signals from NADPH oxidase pathway. Our study demonstrates the critical role of Ca{sup 2+} homeostasis on arsenic-induced HKM apoptosis. We suggest that arsenic-induced alteration in intracellular Ca{sup 2+} levels initiates pro-apoptotic ERK and calpain-2; the two pathways influence each other positively and induce caspase-3 mediated HKM apoptosis. Besides, our study also indicates the role of ROS in the activation of ERK pathway in arsenic-induced HKM apoptosis in C. batrachus. - Highlights: > Altered Ca{sup 2+} homeostasis leads to arsenic-induced HKM apoptosis. > Calpain-2 plays a critical role in the process. > ERK is pro-apoptotic in arsenic-induced HKM apoptosis. > Arsenic-induced HKM apoptosis involves cross talk between calpain-2 and ERK.

  18. Glibenclamide decreases ATP-induced intracellular calcium transient elevation via inhibiting reactive oxygen species and mitochondrial activity in macrophages.


    Li, Duo-ling; Ma, Zhi-yong; Fu, Zhi-jie; Ling, Ming-ying; Yan, Chuan-zhu; Zhang, Yun


    Increasing evidence has revealed that glibenclamide has a wide range of anti-inflammatory effects. However, it is unclear whether glibenclamide can affect the resting and adenosine triphosphate (ATP)-induced intracellular calcium ([Ca(2+)]i) handling in Raw 264.7 macrophages. In the present study, [Ca(2+)]i transient, reactive oxygen species (ROS) and mitochondrial activity were measured by the high-speed TILLvisION digital imaging system using the indicators of Fura 2-am, DCFDA and rhodamine-123, respectively. We found that glibenclamide, pinacidil and other unselective K(+) channel blockers had no effect on the resting [Ca(2+)]i of Raw 264.7 cells. Extracellular ATP (100 µM) induced [Ca(2+)]i transient elevation independent of extracellular Ca(2+). The transient elevation was inhibited by an ROS scavenger (tiron) and mitochondria inhibitor (rotenone). Glibenclamide and 5-hydroxydecanoate (5-HD) also decreased ATP-induced [Ca(2+)]i transient elevation, but pinacidil and other unselective K(+) channel blockers had no effect. Glibenclamide also decreased the peak of [Ca(2+)]i transient induced by extracellular thapsigargin (Tg, 1 µM). Furthermore, glibenclamide decreased intracellular ROS and mitochondrial activity. When pretreated with tiron and rotenone, glibenclamide could not decrease ATP, and Tg induced maximal [Ca(2+)]i transient further. We conclude that glibenclamide may inhibit ATP-induced [Ca(2+)]i transient elevation by blocking mitochondria KATP channels, resulting in decreased ROS generation and mitochondrial activity in Raw 264.7 macrophages.

  19. Potentiation of acid-sensing ion channel activity by peripheral group I metabotropic glutamate receptor signaling.


    Gan, Xiong; Wu, Jing; Ren, Cuixia; Qiu, Chun-Yu; Li, Yan-Kun; Hu, Wang-Ping


    Glutamate activates peripheral group I metabotropic glutamate receptors (mGluRs) and contributes to inflammatory pain. However, it is still not clear the mechanisms are involved in group I mGluR-mediated peripheral sensitization. Herein, we report that group I mGluRs signaling sensitizes acid-sensing ion channels (ASICs) in dorsal root ganglion (DRG) neurons and contributes to acidosis-evoked pain. DHPG, a selective group I mGluR agonist, can potentiate the functional activity of ASICs, which mediated the proton-induced events. DHPG concentration-dependently increased proton-gated currents in DRG neurons. It shifted the proton concentration-response curve upwards, with a 47.3±7.0% increase of the maximal current response to proton. Group I mGluRs, especially mGluR5, mediated the potentiation of DHPG via an intracellular cascade. DHPG potentiation of proton-gated currents disappeared after inhibition of intracellular Gq/11 proteins, PLCβ, PKC or PICK1 signaling. Moreover, DHPG enhanced proton-evoked membrane excitability of rat DRG neurons and increased the amplitude of the depolarization and the number of spikes induced by acid stimuli. Finally, peripherally administration of DHPG dose-dependently exacerbated nociceptive responses to intraplantar injection of acetic acid in rats. Potentiation of ASIC activity by group I mGluR signaling in rat DRG neurons revealed a novel peripheral mechanism underlying group I mGluRs involvement in hyperalgesia.

  20. Ethanol Enhances TGF-β Activity by Recruiting TGF-β Receptors From Intracellular Vesicles/Lipid Rafts/Caveolae to Non-Lipid Raft Microdomains.


    Huang, Shuan Shian; Chen, Chun-Lin; Huang, Franklin W; Johnson, Frank E; Huang, Jung San


    Regular consumption of moderate amounts of ethanol has important health benefits on atherosclerotic cardiovascular disease (ASCVD). Overindulgence can cause many diseases, particularly alcoholic liver disease (ALD). The mechanisms by which ethanol causes both beneficial and harmful effects on human health are poorly understood. Here we demonstrate that ethanol enhances TGF-β-stimulated luciferase activity with a maximum of 0.5-1% (v/v) in Mv1Lu cells stably expressing a luciferase reporter gene containing Smad2-dependent elements. In Mv1Lu cells, 0.5% ethanol increases the level of P-Smad2, a canonical TGF-β signaling sensor, by ∼ 2-3-fold. Ethanol (0.5%) increases cell-surface expression of the type II TGF-β receptor (TβR-II) by ∼ 2-3-fold from its intracellular pool, as determined by I(125) -TGF-β-cross-linking/Western blot analysis. Sucrose density gradient ultracentrifugation and indirect immunofluorescence staining analyses reveal that ethanol (0.5% and 1%) also displaces cell-surface TβR-I and TβR-II from lipid rafts/caveolae and facilitates translocation of these receptors to non-lipid raft microdomains where canonical signaling occurs. These results suggest that ethanol enhances canonical TGF-β signaling by increasing non-lipid raft microdomain localization of the TGF-β receptors. Since TGF-β plays a protective role in ASCVD but can also cause ALD, the TGF-β enhancer activity of ethanol at low and high doses appears to be responsible for both beneficial and harmful effects. Ethanol also disrupts the location of lipid raft/caveolae of other membrane proteins (e.g., neurotransmitter, growth factor/cytokine, and G protein-coupled receptors) which utilize lipid rafts/caveolae as signaling platforms. Displacement of these membrane proteins induced by ethanol may result in a variety of pathologies in nerve, heart and other tissues.

  1. A novel exon in the human Ca2+-activated Cl- channel Ano1 imparts greater sensitivity to intracellular Ca2.


    Strege, Peter R; Bernard, Cheryl E; Mazzone, Amelia; Linden, David R; Beyder, Arthur; Gibbons, Simon J; Farrugia, Gianrico


    Anoctamin 1 (Ano1; TMEM16A) is a Ca(2+)-activated Cl(-) channel (CACC) expressed in interstitial cells of Cajal. The mechanisms by which Ca(2+) regulates Ano1 are incompletely understood. In the gastrointestinal tract, Ano1 is required for normal slow wave activity and is involved in regulating cell proliferation. Splice variants of Ano1 have varying electrophysiological properties and altered expression in disease states. Recently, we identified a transcript for human Ano1 containing a novel exon-"exon 0" upstream of and in frame with exon 1. The electrophysiological properties of this longer Ano1 isoform are unknown. Our aim was to determine the functional contribution of the newly identified exon to the Ca(2+) sensitivity and electrophysiological properties of Ano1. Constructs with [Ano1(+0)] or without [Ano1(-0)] the newly identified exon were transfected into human embryonic kidney-293 cells. Voltage-clamp electrophysiology was used to determine voltage- and time-dependent parameters of whole cell Cl(-) currents between isoforms with varying concentrations of intracellular Ca(2+), extracellular anions, or Cl(-) channel inhibitors. We found that exon 0 did not change voltage sensitivity and had no impact on the relative permeability of Ano1 to most anions. Ano1(+0) exhibited greater changes in current density but lesser changes in kinetics than Ano1(-0) in response to varying intracellular Ca(2+). The CACC inhibitor niflumic acid inhibited current with greater efficacy and higher potency against Ano1(+0) compared with Ano1(-0). Likewise, the Ano1 inhibitor T16Ainh-A01 reduced Ano1(+0) more than Ano1(-0). In conclusion, human Ano1 containing exon 0 imparts its Cl(-) current with greater sensitivity to intracellular Ca(2+) and CACC inhibitors.

  2. A novel exon in the human Ca2+-activated Cl− channel Ano1 imparts greater sensitivity to intracellular Ca2+

    PubMed Central

    Strege, Peter R.; Bernard, Cheryl E.; Mazzone, Amelia; Linden, David R.; Beyder, Arthur; Gibbons, Simon J.


    Anoctamin 1 (Ano1; TMEM16A) is a Ca2+-activated Cl− channel (CACC) expressed in interstitial cells of Cajal. The mechanisms by which Ca2+ regulates Ano1 are incompletely understood. In the gastrointestinal tract, Ano1 is required for normal slow wave activity and is involved in regulating cell proliferation. Splice variants of Ano1 have varying electrophysiological properties and altered expression in disease states. Recently, we identified a transcript for human Ano1 containing a novel exon-“exon 0” upstream of and in frame with exon 1. The electrophysiological properties of this longer Ano1 isoform are unknown. Our aim was to determine the functional contribution of the newly identified exon to the Ca2+ sensitivity and electrophysiological properties of Ano1. Constructs with [Ano1(+0)] or without [Ano1(−0)] the newly identified exon were transfected into human embryonic kidney-293 cells. Voltage-clamp electrophysiology was used to determine voltage- and time-dependent parameters of whole cell Cl− currents between isoforms with varying concentrations of intracellular Ca2+, extracellular anions, or Cl− channel inhibitors. We found that exon 0 did not change voltage sensitivity and had no impact on the relative permeability of Ano1 to most anions. Ano1(+0) exhibited greater changes in current density but lesser changes in kinetics than Ano1(−0) in response to varying intracellular Ca2+. The CACC inhibitor niflumic acid inhibited current with greater efficacy and higher potency against Ano1(+0) compared with Ano1(−0). Likewise, the Ano1 inhibitor T16Ainh-A01 reduced Ano1(+0) more than Ano1(−0). In conclusion, human Ano1 containing exon 0 imparts its Cl− current with greater sensitivity to intracellular Ca2+ and CACC inhibitors. PMID:26359375

  3. Disfacilitation and active inhibition in the neocortex during the natural sleep-wake cycle: An intracellular study

    PubMed Central

    Timofeev, Igor; Grenier, François; Steriade, Mircea


    Earlier extracellular recordings during natural sleep have shown that, during slow-wave sleep (SWS), neocortical neurons display long-lasting periods of silence, whereas they are tonically active and discharge at higher rates during waking and sleep with rapid eye movements (REMs). We analyzed the nature of long-lasting periods of neuronal silence in SWS and the changes in firing rates related to ocular movements during REM sleep and waking using intracellular recordings from electrophysiologically identified neocortical neurons in nonanesthetized and nonparalyzed cats. We found that the silent periods during SWS are associated with neuronal hyperpolarizations, which are due to a mixture of K+ currents and disfacilitation processes. Conventional fast-spiking neurons (presumably local inhibitory interneurons) increased their firing rates during REMs and eye movements in waking. During REMs, the firing rates of regular-spiking neurons from associative areas decreased and intracellular traces revealed numerous, short-lasting, low-amplitude inhibitory postsynaptic potentials (IPSPs), that were reversed after intracellular chloride infusion. In awake cats, regular-spiking neurons could either increase or decrease their firing rates during eye movements. The short-lasting IPSPs associated with eye movements were still present in waking; they preceded the spikes and affected their timing. We propose that there are two different forms of firing rate control: disfacilitation induces long-lasting periods of silence that occur spontaneously during SWS, whereas active inhibition, consisting of low-amplitude, short-lasting IPSPs, is prevalent during REMs and precisely controls the timing of action potentials in waking. PMID:11172052

  4. Commitment to the CD4 lineage mediated by extracellular signal-related kinase mitogen-activated protein kinase and lck signaling.


    Sharp, L L; Hedrick, S M


    The development of T cells results in a concordance between the specificity of the TCR for MHC class I and class II molecules and the expression of CD8 and CD4 coreceptors. Based on analogy to simple metazoan models of organ development and lineage commitment, we sought to determine whether extracellular signal-related kinase (Erk) mitogen-activated protein (MAP) kinase pathway signaling acts as an inductive signal for the CD4 lineage. Here, we show that, by altering the intracellular signaling involving the Erk/MAP kinase pathway, T cells with specificity for MHC class I can be diverted to express CD4, and, conversely, T cells with specificity for MHC class II can be diverted to express CD8. Furthermore, we find that activation of the src-family tyrosine kinase, p56lck is an upstream mediator of lineage commitment. These results suggest a simple mechanism for lineage commitment in T cell development.

  5. Feedback between intracellular flow, signaling and active stresses in Physarum plasmodial fragments

    NASA Astrophysics Data System (ADS)

    Zhang, Shun; Guy, Robert; Del Alamo, Juan Carlos


    Physarum polycephalum is a multinucleated slime mold whose endoplasm flows periodically driven by the contraction of its ectoplasm, a dense shell of F-actin cross-linked by myosin molecular motors and attached to the cell membrane. Ectoplasm contractions are regulated by calcium ions whose propagation is in turn governed by the flow. We study experimentally how this feedback leads to auto-oscillation by simultaneously measuring endoplasmic flow speed and rheological properties, the traction stresses between the ectoplasm and its substratum and the distribution of endoplasmic free calcium ions. We find that physarum fragments smaller than 100 microns remain round and stay in place. However, larger fragments break symmetry leading to sustained forward locomotion, in process that is reminiscent of an interfacial instability that seems to settle around two different limit cycles (traveling waves and standing waves). By using different adhesive coatings in the substratum we investigate the role of substratum friction in the emergence of coherent endoplasmic flow patterns and overall physarum fragment locomotion.

  6. Identification of a Lambda Toxin-Negative Clostridium perfringens Strain that Processes and Activates Epsilon Prototoxin Intracellularly

    PubMed Central

    Harkness, Justine M.; Li, Jihong; McClane, Bruce A.


    Clostridium perfringens type B and D strains produce epsilon toxin (ETX), which is one of the most potent clostridial toxins and is involved in enteritis and enterotoxemias of domestic animals. ETX is produced initially as an inactive prototoxin that is typically then secreted and processed by intestinal proteases or possibly, for some strains, lambda toxin. During the current work a unique C. perfringens strain was identified that intracellularly processes epsilon prototoxin to an active form capable of killing MDCK cells. This activated toxin is not secreted but instead is apparently released upon lysis of bacterial cells entering stationary phase. These findings broaden understanding of the pathogenesis of type B and D infections by identifying a new mechanism of ETX activation. PMID:22982043

  7. Conjugated Bilirubin Differentially Regulates CD4+ T Effector Cells and T Regulatory Cell Function through Outside-In and Inside-Out Mechanisms: The Effects of HAV Cell Surface Receptor and Intracellular Signaling

    PubMed Central

    Corral-Jara, Karla F.; Gómez-Leyva, Juan F.; Rosenstein, Yvonne; Jose-Abrego, Alexis; Roman, Sonia


    We recently reported an immune-modulatory role of conjugated bilirubin (CB) in hepatitis A virus (HAV) infection. During this infection the immune response relies on CD4+ T lymphocytes (TLs) and it may be affected by the interaction of HAV with its cellular receptor (HAVCR1/TIM-1) on T cell surface. How CB might affect T cell function during HAV infection remains to be elucidated. Herein, in vitro stimulation of CD4+ TLs from healthy donors with CB resulted in a decrease in the degree of intracellular tyrosine phosphorylation and an increase in the activity of T regulatory cells (Tregs) expressing HAVCR1/TIM-1. A comparison between CD4+ TLs from healthy donors and HAV-infected patients revealed changes in the TCR signaling pathway relative to changes in CB levels. The proportion of CD4+CD25+ TLs increased in patients with low CB serum levels and an increase in the percentage of Tregs expressing HAVCR1/TIM-1 was found in HAV-infected patients relative to controls. A low frequency of 157insMTTTVP insertion in the viral receptor gene HAVCR1/TIM-1 was found in patients and controls. Our data revealed that, during HAV infection, CB differentially regulates CD4+ TLs and Tregs functions by modulating intracellular pathways and by inducing changes in the proportion of Tregs expressing HAVCR1/TIM-1. PMID:27578921

  8. Conjugated Bilirubin Differentially Regulates CD4+ T Effector Cells and T Regulatory Cell Function through Outside-In and Inside-Out Mechanisms: The Effects of HAV Cell Surface Receptor and Intracellular Signaling.


    Corral-Jara, Karla F; Trujillo-Ochoa, Jorge L; Realpe, Mauricio; Panduro, Arturo; Gómez-Leyva, Juan F; Rosenstein, Yvonne; Jose-Abrego, Alexis; Roman, Sonia; Fierro, Nora A
