Science.gov

Sample records for activating smooth muscle

  1. Smooth muscle cell calcium activation mechanisms

    PubMed Central

    Berridge, Michael J

    2008-01-01

    Smooth muscle cell (SMC) contraction is controlled by the Ca2+ and Rho kinase signalling pathways. While the SMC Rho kinase system seems to be reasonably constant, there is enormous variation with regard to the mechanisms responsible for generating Ca2+ signals. One way of dealing with this diversity is to consider how this system has been adapted to control different SMC functions. Phasic SMCs (vas deferens, uterus and bladder) rely on membrane depolarization to drive Ca2+ influx across the plasma membrane. This depolarization can be induced by neurotransmitters or through the operation of a membrane oscillator. Many tonic SMCs (vascular, airway and corpus cavernosum) are driven by a cytosolic Ca2+ oscillator that generates periodic pulses of Ca2+. A similar oscillator is present in pacemaker cells such as the interstitial cells of Cajal (ICCs) and atypical SMCs that control other tonic SMCs (gastrointestinal, urethra, ureter). The changes in membrane potential induced by these cytosolic oscillators does not drive contraction directly but it functions to couple together individual oscillators to provide the synchronization that is a characteristic feature of many tonic SMCs. PMID:18787034

  2. Estimates of activation in arterial smooth muscle.

    PubMed

    Singer, H A; Kamm, K E; Murphy, R A

    1986-09-01

    We have previously described the onset of a "latch" state in the swine carotid media after K+ depolarization. This state was characterized by maintained stress after a decrease in shortening velocities and in the level of cross-bridge phosphorylation. The present experiments were designed to determine whether there were changes in other mechanical properties in swine carotid media associated with the onset of the latch state. Medial strips (less than 500 microM thick), incubated in physiological salt solution (PSS) at 37 degrees C at their optimal length (Lo), were subjected to ramp stretches (5.86 mm/s) of 5% Lo. The active stress (Sa) response to stretch was computed by subtraction of the passive element contribution (as determined from identical stretches after 30 min incubation in Ca2+-free PSS) from the total response in the activated muscle. Transitions in the total and active stress responses to stretch were observed in strips stimulated with 109 mM K+ for 1 min or longer and were interpreted as yielding of the contractile apparatus. Active dynamic stiffness (dS/dLo) calculated from the initial 1% Lo portion of the stretch response, correlated linearly with active stress over a wide range. Maximal stress and dynamic stiffness were reached by 1 min and were maintained for at least 30 min in K+-depolarized preparations. However, yield stress increased significantly between 1 and 10 min, and there was a large increase in the length at which yield was observed (1.09 +/- 0.06 to 1.86 +/- 0.10% Lo; n = 9). These increases were maintained between 10 and 30 min.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:3752237

  3. Alpha-Smooth Muscle Actin Expression Upregulates Fibroblast Contractile Activity

    PubMed Central

    Hinz, Boris; Celetta, Giuseppe; Tomasek, James J.; Gabbiani, Giulio; Chaponnier, Christine

    2001-01-01

    To evaluate whether α-smooth muscle actin (α-SMA) plays a role in fibroblast contractility, we first compared the contractile activity of rat subcutaneous fibroblasts (SCFs), expressing low levels of α-SMA, with that of lung fibroblasts (LFs), expressing high levels of α-SMA, with the use of silicone substrates of different stiffness degrees. On medium stiffness substrates the percentage of cells producing wrinkles was similar to that of α-SMA–positive cells in each fibroblast population. On high stiffness substrates, wrinkle production was limited to a subpopulation of LFs very positive for α-SMA. In a second approach, we measured the isotonic contraction of SCF- and LF-populated attached collagen lattices. SCFs exhibited 41% diameter reduction compared with 63% by LFs. TGFβ1 increased α-SMA expression and lattice contraction by SCFs to the levels of LFs; TGFβ-antagonizing agents reduced α-SMA expression and lattice contraction by LFs to the level of SCFs. Finally, 3T3 fibroblasts transiently or permanently transfected with α-SMA cDNA exhibited a significantly higher lattice contraction compared with wild-type 3T3 fibroblasts or to fibroblasts transfected with α-cardiac and β- or γ-cytoplasmic actin. This took place in the absence of any change in smooth muscle or nonmuscle myosin heavy-chain expression. Our results indicate that an increased α-SMA expression is sufficient to enhance fibroblast contractile activity. PMID:11553712

  4. Human colonic smooth muscle: electrical and contractile activity in vitro.

    PubMed Central

    Gill, R C; Cote, K R; Bowes, K L; Kingma, Y J

    1986-01-01

    Extracellular electrical and contractile activities were recorded in vitro from strips of human colonic smooth muscle obtained at the time of surgery. Serosal electrical activity of longitudinally oriented strips from the taenia and intertaenial region was characterised by continuous oscillation at a frequency of 28 +/- 1/min. Contractions were marked electrically by a series of oscillations upon which spikes were superimposed. The electrical activity recorded from the submucosal surface of circularly oriented strips exhibited oscillations at 24 +/- 4/min, a frequency significantly lower (p less than 0.001) than that recorded from the serosal surface of similar preparations. The contractile force and frequency was dependent upon the part of the colon from which the strip originated; the most powerful contractions were recorded from strips of sigmoid colon. The contractile frequency of circularly oriented strips from the right colon was 6.3 +/- 0.6/min, significantly higher (p less than 0.001) than that of strips from the left colon (3.4 +/- 0.3/min). Stretching these strips caused an increase in contractile frequency to that of the electrical oscillation. PMID:3699550

  5. Arterial Myogenic Activation through Smooth Muscle Filamin A.

    PubMed

    Retailleau, Kevin; Arhatte, Malika; Demolombe, Sophie; Peyronnet, Rémi; Baudrie, Véronique; Jodar, Martine; Bourreau, Jennifer; Henrion, Daniel; Offermanns, Stefan; Nakamura, Fumihiko; Feng, Yuanyi; Patel, Amanda; Duprat, Fabrice; Honoré, Eric

    2016-03-01

    Mutations in the filamin A (FlnA) gene are frequently associated with severe arterial abnormalities, although the physiological role for this cytoskeletal element remains poorly understood in vascular cells. We used a conditional mouse model to selectively delete FlnA in smooth muscle (sm) cells at the adult stage, thus avoiding the developmental effects of the knockout. Basal blood pressure was significantly reduced in conscious smFlnA knockout mice. Remarkably, pressure-dependent tone of the resistance caudal artery was lost, whereas reactivity to vasoconstrictors was preserved. Impairment of the myogenic behavior was correlated with a lack of calcium influx in arterial myocytes upon an increase in intraluminal pressure. Notably, the stretch activation of CaV1.2 was blunted in the absence of smFlnA. In conclusion, FlnA is a critical upstream element of the signaling cascade underlying the myogenic tone. These findings allow a better understanding of the molecular basis of arterial autoregulation and associated disease states. PMID:26923587

  6. Smooth Muscle-Alpha Actin Inhibits Vascular Smooth Muscle Cell Proliferation and Migration by Inhibiting Rac1 Activity

    PubMed Central

    Chen, Lihua; DeWispelaere, Allison; Dastvan, Frank; Osborne, William R. A.; Blechner, Christine; Windhorst, Sabine; Daum, Guenter

    2016-01-01

    Smooth muscle alpha-actin (SMA) is a marker for the contractile, non-proliferative phenotype of adult smooth muscle cells (SMCs). Upon arterial injury, expression of SMA and other structural proteins decreases and SMCs acquire a pro-migratory and proliferative phenotype. To what extent SMA regulates migration and proliferation of SMCs is unclear and putative signaling pathways involved remain to be elucidated. Here, we used lentiviral-mediated gene transfer and siRNA technology to manipulate expression of SMA in carotid mouse SMCs and studied effects of SMA. Overexpression of SMA results in decreased proliferation and migration and blunts serum-induced activation of the small GTPase Rac, but not RhoA. All inhibitory effects of SMA are rescued by expression of a constitutively active Rac1 mutant (V12rac1). Moreover, reduction of SMA expression by siRNA technology results in an increased activation of Rac. Taken together, this study identifies Rac1 as a downstream target for SMA to inhibit SMC proliferation and migration. PMID:27176050

  7. Role of magnesium in activation of smooth muscle.

    PubMed

    Paul, R J; Rüegg, J C

    1988-10-01

    We studied the effects of Mg2+-free solutions on isometric force (F0) and unloaded shortening velocity (Vus) in contractions elicited by Ca2+ or by ATP after thiophosphorylation by adenosine 5'-O-(3-thiotriphosphate (ATP gamma S) in chemically skinned guinea pig taenia coli smooth muscle. In Mg2+-free solutions, increasing Ca2+ did not increase Fo above resting levels. At the peak of a control contraction elicited by Ca2+, transfer to Mg2+-free (but Ca2+-containing) solutions resulted in a rapid relaxation and concomitant dephosphorylation of myosin. After ATP gamma S, a contracture required neither Mg2+ nor Ca2+ in the solutions for control levels of Fo. Vus in the Mg2+-free solutions after ATP gamma S was approximately 50% of control and could be restored to near control levels by addition of Mg2+ but not Ca2+. After ATP gamma S, pretreatment with 4 mM EDTA and contracture in 0.1 mM EDTA-containing solutions decreased Fo to 70-80% of control and Vus to 50-60% of control. Our results suggest that the relatively high requirement for Mg2+ for contraction in skinned smooth muscle largely reflects the Mg2+ dependence of myosin kinase and not for actin-myosin interaction. The dependence of Fo on Mg2+ (in the presence of excess ATP) in taenia coli is less than that reported for skeletal muscle. Appreciable force can be maintained with no added Mg2+ in the presence of 4 mMEDTA, and thus it appears that ATP4- can be a substrate for contraction after ATP gamma S treatment. In addition, our data imply that any Ca2+-dependent regulatory mechanism that does not involve myosin phosphorylation/dephosphorylation, if present, requires Mg2+ for expression. PMID:3140671

  8. SMOOTH MUSCLE STEM CELLS

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Vascular smooth muscle cells (SMCs) originate from multiple types of progenitor cells. In the embryo, the most well-studied SMC progenitor is the cardiac neural crest stem cell. Smooth muscle differentiation in the neural crest lineage is controlled by a combination of cell intrinsic factors, includ...

  9. In vivo recording of electrical activity of canine tracheal smooth muscle.

    PubMed

    Kondo, T; Tamura, K; Onoe, K; Takahira, H; Ohta, Y; Yamabayashi, H

    1992-01-01

    Electrical activity of the tracheal smooth muscle was studied using extracellular bipolar electrodes in 37 decerebrate, paralyzed, and mechanically ventilated dogs. A spontaneous oscillatory potential that consisted of a slow sinusoidal wave of 0.57 +/- 0.13 (SD) Hz mean frequency but lacked a fast spike component was recorded from 15 dogs. Lung collapse accomplished by bilateral pneumothoraxes evoked or augmented the slow potentials that were associated with an increase in tracheal muscle contraction in 26 dogs. This suggests that the inputs from the airway mechanoreceptors reflexly activate the tracheal smooth muscle cells. Bilateral vagal transection abolished both the spontaneous and the reflexly evoked slow waves and provided relaxation of the tracheal smooth muscle. Electrical stimulation of the distal nerve with a train pulse (0.5 ms, 1-30 Hz) evoked slow-wave oscillatory potentials accompanied by a contraction of the tracheal smooth muscle in all the experimental animals. Our observations in this in vivo study confirm that the electrical activity of tracheal smooth muscle consists of slow oscillatory potentials and that tracheal contraction is at least partly coupled to the slow-wave activity of the smooth muscle. PMID:1537706

  10. Length adaptation of smooth muscle contractile filaments in response to sustained activation.

    PubMed

    Stålhand, Jonas; Holzapfel, Gerhard A

    2016-05-21

    Airway and bladder smooth muscles are known to undergo length adaptation under sustained contraction. This adaptation process entails a remodelling of the intracellular actin and myosin filaments which shifts the peak of the active force-length curve towards the current length. Smooth muscles are therefore able to generate the maximum force over a wide range of lengths. In contrast, length adaptation of vascular smooth muscle has attracted very little attention and only a handful of studies have been reported. Although their results are conflicting on the existence of a length adaptation process in vascular smooth muscle, it seems that, at least, peripheral arteries and arterioles undergo such adaptation. This is of interest since peripheral vessels are responsible for pressure regulation, and a length adaptation will affect the function of the cardiovascular system. It has, e.g., been suggested that the inward remodelling of resistance vessels associated with hypertension disorders may be related to smooth muscle adaptation. In this study we develop a continuum mechanical model for vascular smooth muscle length adaptation by assuming that the muscle cells remodel the actomyosin network such that the peak of the active stress-stretch curve is shifted towards the operating point. The model is specialised to hamster cheek pouch arterioles and the simulated response to stepwise length changes under contraction. The results show that the model is able to recover the salient features of length adaptation reported in the literature. PMID:26925813

  11. Emodin augments calcium activated chloride channel in colonic smooth muscle cells by Gi/Go protein.

    PubMed

    Xu, Long; Ting-Lou; Lv, Nonghua; Zhu, Xuan; Chen, Youxiang; Yang, Jing

    2009-08-01

    Emodin is a natural anthraquinone in rhubarb. It has been identified as a prokinetic drug for gastrointestinal motility in Chinese traditional medicine. Emodin contracts smooth muscle by increasing the concentration of intracellular Ca(2+). In many smooth muscles, increasing intracellular Ca(2+) activates Ca(2+)-activated Cl(-) channels (ClCA). The study was aimed to investigate the effects of emodin on ClCA channels in colonic smooth muscle. 4 channel physiology signal acquire system was used to measure isometric contraction of smooth muscle strips. ClCA currents were recorded by EPC10 with perforated whole cell model. Emodin contracted strips and cells in colonic smooth muscle and augmented ClCA currents. Niflumic acid (NFA) and 4', 4'-diisothiostilbene-2, 2-disulfonic acid (DIDS) blocked the effects. Gi/Go protein inhibits protein kinase A (PKA) and protein kinase C (PKC), and PKA and PKC reduced ClCA currents. Pertussis toxin (PTX, a special inhibitor of Gi/Go protein), 8-bromoadenosine 38, 58-cyclic monophosphate (8-BrcAMP, a membrane-permeant protein kinase A activator) and Phorbol-12-myristate-13-acetate (PMA, a membrane-permeant protein kinase C activator) inhibited the effects on ClCA currents significantly. Our findings suggest that emodin augments ClCA channels to contract smooth muscle in colon, and the effect is induced mostly by enhancement of membrane Gi/Go protein signal transducer pathway. PMID:19409890

  12. Stretch activates myosin light chain kinase in arterial smooth muscle

    SciTech Connect

    Barany, K.; Rokolya, A.; Barany, M. )

    1990-11-30

    Stretching of porcine carotid arterial muscle increased the phosphorylation of the 20 kDa myosin light chain from 0.23 to 0.68 mol (32P)phosphate/mol light chain, whereas stretching of phorbol dibutyrate treated muscle increased the phosphorylation from 0.30 to 0.91 mol/mol. Two-dimensional gel electrophoresis followed by two-dimensional tryptic phosphopeptide mapping was used to identify the enzyme involved in the stretch-induced phosphorylation. Quantitation of the (32P)phosphate content of the peptides revealed considerable light chain phosphorylation by protein kinase C only in the phorbol dibutyrate treated arterial muscle, whereas most of the light chain phosphorylation was attributable to myosin light chain kinase. Upon stretch of either the untreated or treated muscle, the total increment in (32P)phosphate incorporation into the light chain could be accounted for by peptides characteristic for myosin light chain kinase catalyzed phosphorylation, demonstrating that the stretch-induced phosphorylation is caused by this enzyme exclusively.

  13. Smooth muscle relaxant activity of Crocus sativus (saffron) and its constituents: possible mechanisms.

    PubMed

    Mokhtari-Zaer, Amin; Khazdair, Mohammad Reza; Boskabady, Mohammad Hossein

    2015-01-01

    Saffron, Crocus sativus L. (C. sativus) is rich in carotenoids and used in traditional medicine for treatment of various conditions such as coughs, stomach disorders, amenorrhea, asthma and cardiovascular disorders. These therapeutic effects of the plant are suggested to be due to its relaxant effect on smooth muscles. The effect of C. sativus and its constituents on different smooth muscles and the underlying mechanisms have been studied. Several studies have shown the relaxant effects of C. sativus and its constituents including safranal, crocin, crocetin and kaempferol on blood vessels. In addition, it was reported that saffron stigma lowers systolic blood pressure. The present review highlights the relaxant effects of C. sativus and its constituents on various smooth muscles. The possible mechanisms of this relaxing effect including activation of ß2-adrenoceptors, inhibition of histamine H1 and muscarinic receptors and calcium channels and modulation of nitric oxide (NO) are also reviewed. PMID:26468456

  14. Smooth muscle relaxant activity of Crocus sativus (saffron) and its constituents: possible mechanisms

    PubMed Central

    Mokhtari-Zaer, Amin; Khazdair, Mohammad Reza; Boskabady, Mohammad Hossein

    2015-01-01

    Saffron, Crocus sativus L. (C. sativus) is rich in carotenoids and used in traditional medicine for treatment of various conditions such as coughs, stomach disorders, amenorrhea, asthma and cardiovascular disorders. These therapeutic effects of the plant are suggested to be due to its relaxant effect on smooth muscles. The effect of C. sativus and its constituents on different smooth muscles and the underlying mechanisms have been studied. Several studies have shown the relaxant effects of C. sativus and its constituents including safranal, crocin, crocetin and kaempferol on blood vessels. In addition, it was reported that saffron stigma lowers systolic blood pressure. The present review highlights the relaxant effects of C. sativus and its constituents on various smooth muscles. The possible mechanisms of this relaxing effect including activation of ß2-adrenoceptors, inhibition of histamine H1 and muscarinic receptors and calcium channels and modulation of nitric oxide (NO) are also reviewed. PMID:26468456

  15. AMPK Dilates Resistance Arteries via Activation of SERCA and BKCa Channels in Smooth Muscle.

    PubMed

    Schneider, Holger; Schubert, Kai Michael; Blodow, Stephanie; Kreutz, Claus-Peter; Erdogmus, Serap; Wiedenmann, Margarethe; Qiu, Jiehua; Fey, Theres; Ruth, Peter; Lubomirov, Lubomir T; Pfitzer, Gabriele; Mederos Y Schnitzler, Michael; Hardie, D Grahame; Gudermann, Thomas; Pohl, Ulrich

    2015-07-01

    The protective effects of 5'-AMP-activated protein kinase (AMPK) on the metabolic syndrome may include direct effects on resistance artery vasomotor function. However, the precise actions of AMPK on microvessels and their potential interaction are largely unknown. Thus, we set to determine the effects of AMPK activation on vascular smooth muscle tone and the underlying mechanisms. Resistance arteries isolated from hamster and mouse exhibited a pronounced endothelium-independent dilation on direct pharmacological AMPK activation by 2 structurally unrelated compounds (PT1 and A769662). The dilation was associated with a decrease of intracellular-free calcium [Ca(2+)]i in vascular smooth muscle cell. AMPK stimulation induced activation of BKCa channels as assessed by patch clamp studies in freshly isolated hamster vascular smooth muscle cell and confirmed by direct proof of membrane hyperpolarization in intact arteries. The BKCa channel blocker iberiotoxin abolished the hyperpolarization but only partially reduced the dilation and did not affect the decrease of [Ca(2+)]i. By contrast, the sarcoplasmic/endoplasmic Ca(2+)-ATPase (SERCA) inhibitor thapsigargin largely reduced these effects, whereas combined inhibition of SERCA and BKCa channels virtually abolished them. AMPK stimulation significantly increased the phosphorylation of the SERCA modulator phospholamban at the regulatory T17 site. Stimulation of smooth muscle AMPK represents a new, potent vasodilator mechanism in resistance vessels. AMPK directly relaxes vascular smooth muscle cell by a decrease of [Ca(2+)]i. This is achieved by calcium sequestration via SERCA activation, as well as activation of BKCa channels. There is in part a mutual compensation of both calcium-lowering mechanisms. However, SERCA activation which involves an AMPK-dependent phosphorylation of phospholamban is the predominant mechanism in resistance vessels. PMID:26034200

  16. ACTIVATION OF GATA-4 BY SEROTONIN IN PULMONARY ARTERY SMOOTH MUSCLE CELLS

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Serotonin (5-HT) is a mitogen of pulmonary artery smooth muscle cells (PASMC) and plays an important role in the development of pulmonary hypertension. Signal transduction initiated by 5-HT involves serotonin transporter (SERT)-dependent generation of reactive oxygen species (ROS) and activation of...

  17. Anti-smooth muscle antibody

    MedlinePlus

    ... medlineplus.gov/ency/article/003531.htm Anti-smooth muscle antibody To use the sharing features on this page, please enable JavaScript. Anti-smooth muscle antibody is a blood test that detects the ...

  18. Depolarization-induced contractile activity of smooth muscle in calcium-free solution.

    PubMed

    Mangel, A W; Nelson, D O; Rabovsky, J L; Prosser, C L; Connor, J A

    1982-01-01

    In calcium-free solution, strips of cat intestinal muscle developed slow, rhythmic electrical potential changes that triggered contractions. Some strips failed to develop spontaneous electrical activity in calcium-free solution but responded with contractions to depolarization by direct electrical stimulation or by treatment with barium chloride, potassium chloride, or acetylcholine. Similar results were obtained with segments of cat stomach, colon, esophagus, bladder, uterus, and vena cava, as well as with rabbit vena cava. In calcium-free saline, rat small intestinal muscle showed fast electrical activity with accompanying development of a tetanuslike contraction. After 60 min in calcium-free solution, cat small intestinal muscle retained 17.7% of its original concentration of calcium. It is concluded that in some smooth muscles, depolarization-triggered release of intracellular calcium does not require an associated influx of calcium. PMID:7058877

  19. Smooth muscle BK channel activity influences blood pressure independent of vascular tone in mice

    PubMed Central

    Sachse, Gregor; Faulhaber, Jörg; Seniuk, Anika; Ehmke, Heimo; Pongs, Olaf

    2014-01-01

    The large conductance voltage- and Ca2+-activated K+ (BK) channel is an important determinant of vascular tone and contributes to blood pressure regulation. Both activities depend on the ancillary BKβ1 subunit. To determine the significance of smooth muscle BK channel activity for blood pressure regulation, we investigated the potential link between changes in arterial tone and altered blood pressure in BKβ1 knockout (BKβ1−/−) mice from three different genetically defined strains. While vascular tone was consistently increased in all BKβ1−/− mice independent of genetic background, BKβ1−/− strains exhibited increased (strain A), unaltered (strain B) or decreased (strain C) mean arterial blood pressures compared to their corresponding BKβ1+/+ controls. In agreement with previous data on aldosterone regulation by renal/adrenal BK channel function, BKβ1−/− strain A mice have increased plasma aldosterone and increased blood pressure. Consistently, blockade of mineralocorticoid receptors by spironolactone treatment reversibly restored the elevated blood pressure to the BKβ1+/+ strain A level. In contrast, loss of BKβ1 did not affect plasma aldosterone in strain C mice. Smooth muscle-restricted restoration of BKβ1 expression increased blood pressure in BKβ1−/− strain C mice, implying that impaired smooth muscle BK channel activity lowers blood pressure in these animals. We conclude that BK channel activity directly affects vascular tone but influences blood pressure independent of this effect via different pathways. PMID:24687584

  20. Natural Bile Acids and Synthetic Analogues Modulate Large Conductance Ca2+-activated K+ (BKCa) Channel Activity in Smooth Muscle Cells

    PubMed Central

    Dopico, Alejandro M.; Walsh, John V.; Singer, Joshua J.

    2002-01-01

    Bile acids have been reported to produce relaxation of smooth muscle both in vitro and in vivo. The cellular mechanisms underlying bile acid–induced relaxation are largely unknown. Here we demonstrate, using patch-clamp techniques, that natural bile acids and synthetic analogues reversibly increase BKCa channel activity in rabbit mesenteric artery smooth muscle cells. In excised inside-out patches bile acid–induced increases in channel activity are characterized by a parallel leftward shift in the activity-voltage relationship. This increase in BKCa channel activity is not due to Ca2+-dependent mechanism(s) or changes in freely diffusible messengers, but to a direct action of the bile acid on the channel protein itself or some closely associated component in the cell membrane. For naturally occurring bile acids, the magnitude of bile acid–induced increase in BKCa channel activity is inversely related to the number of hydroxyl groups in the bile acid molecule. By using synthetic analogues, we demonstrate that such increase in activity is not affected by several chemical modifications in the lateral chain of the molecule, but is markedly favored by polar groups in the side of the steroid rings opposite to the side where the methyl groups are located, which stresses the importance of the planar polarity of the molecule. Bile acid–induced increases in BKCa channel activity are also observed in smooth muscle cells freshly dissociated from rabbit main pulmonary artery and gallbladder, raising the possibility that a direct activation of BKCa channels by these planar steroids is a widespread phenomenon in many smooth muscle cell types. Bile acid concentrations that increase BKCa channel activity in mesenteric artery smooth muscle cells are found in the systemic circulation under a variety of human pathophysiological conditions, and their ability to enhance BKCa channel activity may explain their relaxing effect on smooth muscle. PMID:11865021

  1. Se Enhances MLCK Activation by Regulating Selenoprotein T (SelT) in the Gastric Smooth Muscle of Rats.

    PubMed

    Li, Jia-Ping; Zhou, Jing-Xuan; Wang, Qi; Gu, Gao-Qin; Yang, Shi-Jin; Li, Cheng-Ye; Qiu, Chang-Wei; Deng, Gan-Zhen; Guo, Meng-Yao

    2016-09-01

    Selenium (Se), a nutritionally essential trace element, is associated with health and disease. Selenoprotein T (SelT) was identified as a redoxin protein with a selenocystein, localizing in the endoplasmic reticulum. The myosin light chain kinase (MLCK) and myosin light chain (MLC) play key roles in the contraction process of smooth muscle. The present study was to detect the effect and mechanism of SelT on the contraction process of gastric smooth muscle. The WT rats were fed with different Se concentration diets, and Se and Ca(2+) concentrations were detected in the gastric smooth muscle. Western blot and qPCR were performed to determine SelT, CaM, MLCK, and MLC expressions. MLCK activity was measured by identifying the rates of [γ-32P]ATP incorporated into the MLC. The results showed Se and Ca(2+) concentrations were enhanced with Se intake in gastric smooth muscle tissues. With increasing Se, SelT, CaM, MLCK and MLC expressions increased, and MLCK and MLC activation improved in gastric smooth muscle tissue. The SelT RNA interference experiments showed that Ca(2+) release, MLCK activation, and MLC phosphorylation were regulated by SelT. Se affected the gastric smooth muscle constriction by regulating Ca(2+) release, MLCK activation, and MLC phosphorylation through SelT. Se plays a major role in regulating the contraction processes of gastric smooth muscle with the SelT. PMID:26779623

  2. Smooth Muscle-Targeted Overexpression of Peroxisome Proliferator Activated Receptor-γ Disrupts Vascular Wall Structure and Function

    PubMed Central

    Kleinhenz, Jennifer M.; Murphy, Tamara C.; Pokutta-Paskaleva, Anastassia P.; Gleason, Rudolph L.; Lyle, Alicia N.; Taylor, W. Robert; Blount, Mitsi A.; Cheng, Juan; Yang, Qinglin; Sutliff, Roy L.; Hart, C. Michael

    2015-01-01

    Activation of the nuclear hormone receptor, PPARγ, with pharmacological agonists promotes a contractile vascular smooth muscle cell phenotype and reduces oxidative stress and cell proliferation, particularly under pathological conditions including vascular injury, restenosis, and atherosclerosis. However, pharmacological agonists activate both PPARγ-dependent and -independent mechanisms in multiple cell types confounding efforts to clarify the precise role of PPARγ in smooth muscle cell structure and function in vivo. We, therefore, designed and characterized a mouse model with smooth muscle cell-targeted PPARγ overexpression (smPPARγOE). Our results demonstrate that smPPARγOE attenuated contractile responses in aortic rings, increased aortic compliance, caused aortic dilatation, and reduced mean arterial pressure. Molecular characterization revealed that compared to littermate control mice, aortas from smPPARγOE mice expressed lower levels of contractile proteins and increased levels of adipocyte-specific transcripts. Morphological analysis demonstrated increased lipid deposition in the vascular media and in smooth muscle of extravascular tissues. In vitro adenoviral-mediated PPARγ overexpression in human aortic smooth muscle cells similarly increased adipocyte markers and lipid uptake. The findings demonstrate that smooth muscle PPARγ overexpression disrupts vascular wall structure and function, emphasizing that balanced PPARγ activity is essential for vascular smooth muscle homeostasis. PMID:26451838

  3. BMP promotes motility and represses growth of smooth muscle cells by activation of tandem Wnt pathways

    PubMed Central

    de Jesus Perez, Vinicio A.; Ali, Ziad; Alastalo, Tero-Pekka; Ikeno, Fumiaki; Sawada, Hirofumi; Lai, Ying-Ju; Kleisli, Thomas; Spiekerkoetter, Edda; Qu, Xiumei; Rubinos, Laura H.; Ashley, Euan; Amieva, Manuel; Dedhar, Shoukat

    2011-01-01

    We present a novel cell-signaling paradigm in which bone morphogenetic protein 2 (BMP-2) consecutively and interdependently activates the wingless (Wnt)–β-catenin (βC) and Wnt–planar cell polarity (PCP) signaling pathways to facilitate vascular smooth muscle motility while simultaneously suppressing growth. We show that BMP-2, in a phospho-Akt–dependent manner, induces βC transcriptional activity to produce fibronectin, which then activates integrin-linked kinase 1 (ILK-1) via α4-integrins. ILK-1 then induces the Wnt–PCP pathway by binding a proline-rich motif in disheveled (Dvl) and consequently activating RhoA-Rac1–mediated motility. Transfection of a Dvl mutant that binds βC without activating RhoA-Rac1 not only prevents BMP-2–mediated vascular smooth muscle cell motility but promotes proliferation in association with persistent βC activity. Interfering with the Dvl-dependent Wnt–PCP activation in a murine stented aortic graft injury model promotes extensive neointima formation, as shown by optical coherence tomography and histopathology. We speculate that, in response to injury, factors that subvert BMP-2–mediated tandem activation of Wnt–βC and Wnt–PCP pathways contribute to obliterative vascular disease in both the systemic and pulmonary circulations. PMID:21220513

  4. Migration of smooth muscle cells from the arterial anastomosis of arteriovenous fistulas requires Notch activation to form neointima.

    PubMed

    Liang, Ming; Wang, Yun; Liang, Anlin; Mitch, William E; Roy-Chaudhury, Prabir; Han, Guofeng; Cheng, Jizhong

    2015-09-01

    A major factor contributing to failure of arteriovenous fistulas (AVFs) is migration of smooth muscle cells into the forming neointima. To identify the source of smooth muscle cells in neointima, we created end-to-end AVFs by anastomosing the common carotid artery to the jugular vein and studied neural crest-derived smooth muscle cells from the carotid artery, which are Wnt1-positive during development. In Wnt1-cre-GFP mice, smooth muscle cells in the carotid artery but not the jugular vein are labeled with GFP. About half of the cells were GFP-positive in the neointima, indicating their migration from the carotid artery to the jugular vein in AVFs created in these mice. As fibroblast-specific protein-1 (FSP-1) regulates smooth muscle cell migration, we examined FSP-1 in failed AVFs and polytetrafluoroethylene grafts from patients with end-stage kidney disease or from AVFs in mice with chronic kidney disease. In smooth muscle cells of AVFs or polytetrafluoroethylene grafts, FSP-1 and activation of Notch1 are present. In smooth muscle cells, Notch1 increased RBP-Jκ transcription factor activity and RBP-Jκ stimulated FSP-1 expression. Conditional knockout of RBP-Jκ in smooth muscle cells or general knockout of FSP-1 suppressed neointima formation in AVFs in mice. Thus, the artery of AVFs is the major source of smooth muscle cells during neointima formation. Knockout of RBP-Jκ or FSP-1 ameliorates neointima formation and might improve AVF patency during long-term follow-up. PMID:25786100

  5. Leiomodin and tropomodulin in smooth muscle

    NASA Technical Reports Server (NTRS)

    Conley, C. A.

    2001-01-01

    Evidence is accumulating to suggest that actin filament remodeling is critical for smooth muscle contraction, which implicates actin filament ends as important sites for regulation of contraction. Tropomodulin (Tmod) and smooth muscle leiomodin (SM-Lmod) have been found in many tissues containing smooth muscle by protein immunoblot and immunofluorescence microscopy. Both proteins cofractionate with tropomyosin in the Triton-insoluble cytoskeleton of rabbit stomach smooth muscle and are solubilized by high salt. SM-Lmod binds muscle tropomyosin, a biochemical activity characteristic of Tmod proteins. SM-Lmod staining is present along the length of actin filaments in rat intestinal smooth muscle, while Tmod stains in a punctate pattern distinct from that of actin filaments or the dense body marker alpha-actinin. After smooth muscle is hypercontracted by treatment with 10 mM Ca(2+), both SM-Lmod and Tmod are found near alpha-actinin at the periphery of actin-rich contraction bands. These data suggest that SM-Lmod is a novel component of the smooth muscle actin cytoskeleton and, furthermore, that the pointed ends of actin filaments in smooth muscle may be capped by Tmod in localized clusters.

  6. A role of stretch-activated potassium currents in the regulation of uterine smooth muscle contraction.

    PubMed

    Buxton, Iain L O; Heyman, Nathanael; Wu, Yi-ying; Barnett, Scott; Ulrich, Craig

    2011-06-01

    Rates of premature birth are alarming and threaten societies and healthcare systems worldwide. Premature labor results in premature birth in over 50% of cases. Preterm birth accounts for three-quarters of infant morbidity and mortality. Children that survive birth before 34 weeks gestation often face life-long disability. Current treatments for preterm labor are wanting. No treatment has been found to be generally effective and none are systematically evaluated beyond 48 h. New approaches to the treatment of preterm labor are desperately needed. Recent studies from our laboratory suggest that the uterine muscle is a unique compartment with regulation of uterine relaxation unlike that of other smooth muscles. Here we discuss recent evidence that the mechanically activated 2-pore potassium channel, TREK-1, may contribute to contraction-relaxation signaling in uterine smooth muscle and that TREK-1 gene variants associated with human labor and preterm labor may lead to a better understanding of preterm labor and its possible prevention. PMID:21642947

  7. Modification of smooth muscle Ca2+-sparks by tetracaine: evidence for sequential RyR activation.

    PubMed

    Curtis, Tim M; Tumelty, James; Stewart, Michael T; Arora, A Rakha; Lai, F Anthony; McGahon, Mary K; Scholfield, C Norman; McGeown, J Graham

    2008-02-01

    Spontaneous Ca(2+)-sparks were imaged using confocal line scans of fluo-4 loaded myocytes in retinal arterioles. Tetracaine produced concentration-dependent decreases in spark frequency, and modified the spatiotemporal characteristics of residual sparks. Tetracaine (10 microM) reduced the rate of rise but prolonged the average rise time so that average spark amplitude was unaltered. The mean half-time of spark decay was also unaffected, suggesting that spark termination, although delayed, remained well synchronized. Sparks spread transversely across the myocytes in these vessels, and the speed of spread within individual sparks was slowed by approximately 60% in 10 microM tetracaine, as expected if the spark was propagated across the cell but the average P(o) for RyRs was reduced. Staining of isolated vessels with BODIPY-ryanodine and di-4-ANEPPS showed that RyRs were located both peripherally, adjacent to the plasma membrane, and in transverse extensions of the SR from one side of the cell to the other. Immuno-labelling of retinal flat mounts demonstrated the presence RyR(2) in arteriole smooth muscle but not RyR(1). We conclude that Ca(2+)-sparks in smooth muscle can result from sequential activation of RyRs distributed over an area of several microm(2), rather than from tightly clustered channels as in striated muscle. PMID:17574671

  8. Vascular smooth muscle in hypertension.

    PubMed

    Winquist, R J; Webb, R C; Bohr, D F

    1982-06-01

    The cause of the elevated arterial pressure in most forms of hypertension is an increase in total peripheral resistance. This brief review is directed toward an assessment of recent investigations contributing information about the factors responsible for this increased vascular resistance. Structural abnormalities in the vasculature that characterize the hypertensive process are 1) changes in the vascular media, 2) rarefication of the resistance vessels, and 3) lesions of the intimal vascular surface. These abnormalities are mainly the result of an adaptive process and are secondary to the increase in wall stress and/or to pathological damage to cellular components in the vessel wall. Functional alterations in the vascular smooth muscle are described as changes in agonist-smooth muscle interaction or plasma membrane permeability. These types of changes appear to play a primary, initiating role in the elevation of vascular resistance of hypertension. These alterations are not the result of an increase in wall stress and they often precede the development of high blood pressure. The functional changes are initiated by abnormal function of neurogenic, humoral, and/or myogenic changes that alter vascular smooth muscle activity. PMID:6282652

  9. Smooth Muscle Strips for Intestinal Tissue Engineering

    PubMed Central

    Walthers, Christopher M.; Lee, Min; Wu, Benjamin M.; Dunn, James C. Y.

    2014-01-01

    Functionally contracting smooth muscle is an essential part of the engineered intestine that has not been replicated in vitro. The purpose of this study is to produce contracting smooth muscle in culture by maintaining the native smooth muscle organization. We employed intact smooth muscle strips and compared them to dissociated smooth muscle cells in culture for 14 days. Cells isolated by enzymatic digestion quickly lost maturity markers for smooth muscle cells and contained few enteric neural and glial cells. Cultured smooth muscle strips exhibited periodic contraction and maintained neural and glial markers. Smooth muscle strips cultured for 14 days also exhibited regular fluctuation of intracellular calcium, whereas cultured smooth muscle cells did not. After implantation in omentum for 14 days on polycaprolactone scaffolds, smooth muscle strip constructs expressed high levels of smooth muscle maturity markers as well as enteric neural and glial cells. Intact smooth muscle strips may be a useful component for engineered intestinal smooth muscle. PMID:25486279

  10. Activity of sap from Croton lechleri on rat vascular and gastric smooth muscles.

    PubMed

    Froldi, G; Zagotto, G; Filippini, R; Montopoli, M; Dorigo, P; Caparrotta, L

    2009-08-01

    The effects of red sap from Croton lechleri (SdD), Euphorbiaceae, on vascular and gastric smooth muscles were investigated. SdD, from 10 to 1000 microg/ml, induced concentration-dependent vasoconstriction in rat caudal arteries, which was endothelium-independent. In arterial preparations pre-constricted by phenylephrine (0.1 microM) or KCl (30 mM), SdD also produced concentration-dependent vasoconstriction. To study the mechanisms implicated in this effect we used selective inhibitors such as prazosin (0.1 microM), an antagonist of alpha(1)-adrenoceptors, atropine (0.1 microM), an antagonist of muscarinic receptors, and ritanserin (50 nM), a 5-HT(2A) antagonist; none of these influenced vasoconstriction caused by SdD. Likewise, nifedipine (50 nM), an inhibitor of L-type calcium channels, did not modify the action of SdD. Capsaicin (100 nM), an agonist of vanilloid receptors, also did not affect vasoconstriction by SdD. We also investigated the action of SdD (10-1000 microg/ml) on rat gastric fundus; per se the sap slightly increased contractile tension. When the gastric fundus was pre-treated with SdD (100 microg/ml) the contraction induced by carbachol (1 microM) was increased, whereas that by KCl (60mM) or capsaicin (100 nM) were unchanged. The data shows that SdD increased contractile tension in a concentration-dependent way, both on vascular and gastric smooth muscles. The vasoconstriction is unrelated to alpha(1), M, 5-HT(2A) and vanilloid receptors as well as L-type calcium channels. SdD increased also contraction by carbachol on rat gastric fundus. Thus for the first time, experimental data provides evidence that sap from C. lechleri owns constricting activity on smooth muscles. PMID:19406630

  11. Platelet-activating factor biosynthesis in rat vascular smooth muscle cells.

    PubMed

    Tomlinson, P R; Croft, K; Harris, T; Stewart, A G

    1994-01-01

    The ability of platelet-activating factor (PAF) receptor antagonists to protect rats from the cardiovascular collapse induced by large doses of endothelin 1 led us to examine the capacity of rat cultured vascular smooth muscle cells to produce PAF and also to evaluate its potential functional roles in this cell type. Adenosine triphosphate and the vasoactive peptides, endothelin 1, angiotensin II, and arginine vasopressin, each elicited an increase in the PAF level in extracts of rat cultured vascular smooth muscle cells as determined by bioassay. PAF was not detectable (above 20 fmol/mg protein) in the supernatants of these cells. The identity of the bioactivity as PAF was confirmed by GC/MS which indicated that more than 80% of the PAF was 1-O-hexadecyl-2-acetyl-3-sn-glyceryl-phosphorylcholine. Exogenous PAF (100 nM) elicited increases in intracellular calcium that were inhibited by WEB 2086 (10 microM). Endothelin 1, at a concentration which stimulated PAF synthesis, (1 nM), elicited increases in intracellular calcium levels that were not inhibited by WEB 2086 (10 microM). Thus, endogenous PAF is unlikely to be involved in the endothelin-1-induced calcium increases. Although WEB 2086 (3-100 microM) inhibited concentration dependently fetal calf serum (10% v/v) induced [3H]-thymidine incorporation, reaching a maximum effect at 30 microM of 40-50% reduction, in parallel experiments WEB 2086 had no effect on serum-induced increases in cell numbers. We conclude that PAF is produced and retained by cultured rat vascular smooth muscle and that it is unlikely to contribute to the signaling of increases in intracellular calcium or proliferation. PMID:8148465

  12. Activation of the retinoid X receptor modulates angiotensin II-induced smooth muscle gene expression and inflammation in vascular smooth muscle cells.

    PubMed

    Lehman, Allison M B; Montford, John R; Horita, Henrick; Ostriker, Allison C; Weiser-Evans, Mary C M; Nemenoff, Raphael A; Furgeson, Seth B

    2014-11-01

    The retinoid X receptor (RXR) partners with numerous nuclear receptors, such as the peroxisome proliferator activated receptor (PPAR) family, liver X receptors (LXRs), and farnesoid X receptor (FXR). Although each heterodimer can be activated by specific ligands, a subset of these receptors, defined as permissive nuclear receptors, can also be activated by RXR agonists known as rexinoids. Many individual RXR heterodimers have beneficial effects in vascular smooth muscle cells (SMCs). Because rexinoids can potently activate multiple RXR pathways, we hypothesized that treating SMCs with rexinoids would more effectively reverse the pathophysiologic effects of angiotensin II than an individual heterodimer agonist. Cultured rat aortic SMCs were pretreated with either an RXR agonist (bexarotene or 9-cis retinoic acid) or vehicle (dimethylsulfoxide) for 24 hours before stimulation with angiotensin II. Compared with dimethylsulfoxide, bexarotene blocked angiotensin II-induced SM contractile gene induction (calponin and smooth muscle-α-actin) and protein synthesis ([(3)H]leucine incorporation). Bexarotene also decreased angiotensin II-mediated inflammation, as measured by decreased expression of monocyte chemoattractant protein-1 (MCP-1). Activation of p38 mitogen-activated protein (MAP) kinase but not extracellular signal-related kinase (ERK) or protein kinase B (Akt) was also blunted by bexarotene. We compared bexarotene to five agonists of nuclear receptors (PPARα, PPARγ, PPARδ, LXR, and FXR). Bexarotene had a greater effect on calponin reduction, MCP-1 inhibition, and p38 MAP kinase inhibition than any individual agonist. PPARγ knockout cells demonstrated blunted responses to bexarotene, indicating that PPARγ is necessary for the effects of bexarotene. These data demonstrate that RXR is a potent modulator of angiotensin II-mediated responses in the vasculature, partially through inhibition of p38. PMID:25169989

  13. Potentiation of carbachol-induced detrusor smooth muscle contractions by β-adrenoceptor activation

    PubMed Central

    Klausner, Adam P; Rourke, Keith F; Miner, Amy S; Ratz, Paul H

    2011-01-01

    In strips of rabbit bladder free of urothelium, the β-adrenoceptor agonist, isoproterenol, significantly reduced basal detrusor smooth muscle tone and inhibited contractions produced by low concentrations of the muscarinic receptor agonist, carbachol. During a carbachol concentration-response curve, instead of inhibiting, isoproterenol strengthened contractions produced by high carbachol concentrations. Thus, the carbachol concentration-response curve was shifted by isoproterenol from a shallow, graded relationship, to a steep, switch-like relationship. The tyrosine kinase inhibitor, genistein, inhibited carbachol-induced contractions only in the presence of isoproterenol. Contraction produced by a single high carbachol concentration (1 µM) displayed 1 fast and 1 slow peak. In the presence of isoproterenol, the slow peak was not strengthened, but was delayed, and U-0126 (mitogen-activated protein kinase kinase inhibitor) selectively inhibited this delay concomitantly with inhibition of extracellular signal-regulated kinase (ERK) phosphorylation. Isoproterenol reduced ERK phosphorylation only in the absence of carbachol. These data support the concept that, by inhibiting weak contractions, potentiating strong contractions, and producing a more switch-like concentration-response curve, β-adrenoceptor stimulation enhanced the effectiveness of muscarinic receptor-induced detrusor smooth muscle contraction. Moreover, β-adrenoceptor stimulation changed the cellular mechanism by which carbachol produced contraction. The potential significance of multi-receptor and multi-cell crosstalk is discussed. PMID:19374847

  14. Energetic cost of activation processes during contraction of swine arterial smooth muscle.

    PubMed Central

    Wingard, C J; Paul, R J; Murphy, R A

    1997-01-01

    1. The objective of this study was to partition the increase in ATP consumption during contraction of swine carotid arterial smooth muscle estimated from suprabasal oxygen consumption (suprabasal JO2) and lactate release (Jlactate) into a component associated with cross-bridge cycling (JX) and one reflecting activation (JA). 2. Two experimental approaches-varying length under constant activation, and varying activation at a long length (1.8 times the optimal length for force development (Lo)) where force generation is minimal-revealed a linear dependence of JO2 and activation energy (JA) on cross-bridge phosphorylation. Protocols inducing a large increase in myosin regulatory light chain (MRLC) phosphorylation at 1.8 Lo resulted in significant elevations of JO2 and marked reductions in the economy of force maintenance. Our evidence suggests that this is primarily due to the increased cost of cross-bridge phosphorylation. 3. The extrapolated estimate of JA during maximal K(+)-induced depolarization made by varying length was 16%, while at 1.8 Lo it was 33% of the suprabasal JO2 at Lo. Calculated activation energies ranged from 17 to 45% of the suprabasal JO2 at Lo and from 72 to 87% of the suprabasal JO2 at 1.8 Lo under stimulation conditions that varied steady-state MRLC phosphorylation from 15 to 50%. 4. The results suggest that the kinetics of cross-bridge phosphorylation-dephosphorylation can rival those of cross-bridge cycling during isometric contractions in swine arterial smooth muscle. PMID:9175004

  15. Genetic differences in airway smooth muscle function.

    PubMed

    Martin, James G; Jo, Taisuke

    2008-01-01

    The genetic basis for airway smooth muscle properties is poorly explored. Contraction and relaxation are altered in asthmatic airway smooth muscle, but the basis for the alterations and the role that muscle-specific susceptibility genes may play is largely unexplored. Alterations in the beta-adrenergic receptor, signaling pathways affecting inositol phosphate metabolism, adenylyl and guanylyl cyclase activity, and contractile proteins such as the myosin heavy chain are all suggested by experimental model systems. Significant changes in proliferative and secretory capacities of asthmatic smooth muscle are also demonstrated, but their genetic basis also requires elucidation. Certain asthma-related genes such as ADAM33, although potentially important for smooth muscle function, have been incompletely explored. PMID:18094088

  16. Activated mineralocorticoid receptor regulates micro-RNA-29b in vascular smooth muscle cells.

    PubMed

    Bretschneider, Maria; Busch, Bianca; Mueller, Daniel; Nolze, Alexander; Schreier, Barbara; Gekle, Michael; Grossmann, Claudia

    2016-04-01

    Inappropriately activated mineralocorticoid receptor (MR) is a risk factor for vascular remodeling with unclear molecular mechanism. Recent findings suggest that post-transcriptional regulation by micro-RNAs (miRs) may be involved. Our aim was to search for MR-dependent miRs in vascular smooth muscle cells (VSMCs) and to explore the underlying molecular mechanism and the pathologic relevance. We detected that aldosteroneviathe MR reduces miR-29bin vivoin murine aorta and in human primary and cultured VSMCs (ED50= 0.07 nM) but not in endothelial cells [quantitative PCR (qPCR), luciferase assays]. This effect was mediated by an increased decay of miR-29b in the cytoplasm with unchanged miR-29 family member or primary-miR levels. Decreased miR-29b led to an increase in extracellular matrix measured by ELISA and qPCR and enhanced VSMC migration in single cell-tracking experiments. Additionally, cell proliferation and the apoptosis/necrosis ratio (caspase/lactate dehydrogenase assay) was modulated by miR-29b. Enhanced VSMC migration by aldosterone required miR-29b regulation. Control experiments were performed with scrambled RNA and empty plasmids, by comparing aldosterone-stimulated with vehicle-incubated cells. Overall, our findings provide novel insights into the molecular mechanism of aldosterone-mediated vascular pathogenesis by identifying miR-29b as a pathophysiologic relevant target of activated MR in VSMCs and by highlighting the importance of miR processing for miR regulation.-Bretschneider, M., Busch, B., Mueller, D., Nolze, A., Schreier, B., Gekle, M., Grossmann, C. Activated mineralocorticoid receptor regulates micro-RNA-29b in vascular smooth muscle cells. PMID:26728178

  17. Transient contractions of urinary bladder smooth muscle are drivers of afferent nerve activity during filling.

    PubMed

    Heppner, Thomas J; Tykocki, Nathan R; Hill-Eubanks, David; Nelson, Mark T

    2016-04-01

    Activation of afferent nerves during urinary bladder (UB) filling conveys the sensation of UB fullness to the central nervous system (CNS). Although this sensory outflow is presumed to reflect graded increases in pressure associated with filling, UBs also exhibit nonvoiding, transient contractions (TCs) that cause small, rapid increases in intravesical pressure. Here, using an ex vivo mouse bladder preparation, we explored the relative contributions of filling pressure and TC-induced pressure transients to sensory nerve stimulation. Continuous UB filling caused an increase in afferent nerve activity composed of a graded increase in baseline activity and activity associated with increases in intravesical pressure produced by TCs. For each ∼4-mmHg pressure increase, filling pressure increased baseline afferent activity by ∼60 action potentials per second. In contrast, a similar pressure elevation induced by a TC evoked an ∼10-fold greater increase in afferent activity. Filling pressure did not affect TC frequency but did increase the TC rate of rise, reflecting a change in the length-tension relationship of detrusor smooth muscle. The frequency of afferent bursts depended on the TC rate of rise and peaked before maximum pressure. Inhibition of small- and large-conductance Ca(2+)-activated K(+)(SK and BK) channels increased TC amplitude and afferent nerve activity. After inhibiting detrusor muscle contractility, simulating the waveform of a TC by gently compressing the bladder evoked similar increases in afferent activity. Notably, afferent activity elicited by simulated TCs was augmented by SK channel inhibition. Our results show that afferent nerve activity evoked by TCs represents the majority of afferent outflow conveyed to the CNS during UB filling and suggest that the maximum TC rate of rise corresponds to an optimal length-tension relationship for efficient UB contraction. Furthermore, our findings implicate SK channels in controlling the gain of sensory

  18. Use of liposome-mediated DNA transfection to determine promoter activity in smooth muscle cells.

    PubMed

    Fabunmi, R P

    1999-01-01

    The transfer and expression of DNA plasmids containing promoter fragments of heterologous genes linked to reporter cDNAs in mammalian cells has become an invaluable technique for studying the regulation of gene expression. Several reporter genes such as luciferase, β-galactosidase, chloramphenicol acetyl transferase, and green flourescent protein are ideal to study promoter activities as their gene products are not endogenous to smooth muscle cells (SMC) and their expression can be readily detected using convenient assays (1). Among these genes, a popular choice is the firefly luciferase, as its expression can be easily detected in cells using a highly sensitive chemiluminescent assay (2). The firefly luciferase catalyses a rapid, ATP-dependent oxidation of the substrate, luciferin, which then emits light. Reactions catalyzed by firefly luciferase are: [Formula: see text]. PMID:21341022

  19. Statins meditate anti-atherosclerotic action in smooth muscle cells by peroxisome proliferator-activated receptor-γ activation

    SciTech Connect

    Fukuda, Kazuki; Matsumura, Takeshi; Senokuchi, Takafumi; Ishii, Norio; Kinoshita, Hiroyuki; Yamada, Sarie; Murakami, Saiko; Nakao, Saya; Motoshima, Hiroyuki; Kondo, Tatsuya; Kukidome, Daisuke; Kawasaki, Shuji; Kawada, Teruo; Nishikawa, Takeshi; Araki, Eiichi

    2015-01-30

    Highlights: • Statins induce PPARγ activation in vascular smooth muscle cells. • Statin-induced PPARγ activation is mediated by COX-2 expression. • Statins suppress cell migration and proliferation in vascular smooth muscle cells. • Statins inhibit LPS-induced inflammatory responses by PPARγ activation. • Fluvastatin suppress the progression of atherosclerosis and induces PPARγ activation in the aorta of apoE-deficient mice. - Abstract: The peroxisome proliferator-activated receptor-γ (PPARγ) is an important regulator of lipid and glucose metabolism, and its activation is reported to suppress the progression of atherosclerosis. We have reported that 3-hydroxy-3-methylglutaryl coenzyme A reductase inhibitors (statins) activate PPARγ in macrophages. However, it is not yet known whether statins activate PPARγ in other vascular cells. In the present study, we investigated whether statins activate PPARγ in smooth muscle cells (SMCs) and endothelial cells (ECs) and thus mediate anti-atherosclerotic effects. Human aortic SMCs (HASMCs) and human umbilical vein ECs (HUVECs) were used in this study. Fluvastatin and pitavastatin activated PPARγ in HASMCs, but not in HUVECs. Statins induced cyclooxygenase-2 (COX-2) expression in HASMCs, but not in HUVECs. Moreover, treatment with COX-2-siRNA abrogated statin-mediated PPARγ activation in HASMCs. Statins suppressed migration and proliferation of HASMCs, and inhibited lipopolysaccharide-induced expression of monocyte chemoattractant protein-1 (MCP-1) and tumor necrosis factor-α (TNF-α) in HASMCs. These effects of statins were abrogated by treatment with PPARγ-siRNA. Treatment with statins suppressed atherosclerotic lesion formation in Apoe{sup −/−} mice. In addition, transcriptional activity of PPARγ and CD36 expression were increased, and the expression of MCP-1 and TNF-α was decreased, in the aorta of statin-treated Apoe{sup −/−} mice. In conclusion, statins mediate anti-atherogenic effects

  20. Mn2+ activates skinned smooth muscle cells in the absence of myosin light chain phosphorylation.

    PubMed

    Hoar, P E; Kerrick, W G

    1988-08-01

    Two effects of Mn2+ on skinned fibers from chicken gizzard smooth muscle were observed, dependent on the presence or absence of dithiothreitol (DTT) reducing agent. One involves protein oxidation (in the absence of DTT) with production of a "latch"-like state, and the other involves direct Mn2+ activation of contractile proteins. Cells activated by Mn2+ in the presence of ATP and the absence of Ca2+, Mg2+ and DTT did not relax when transferred to normal relaxing solutions. In contrast, when 5 mM DTT was included in the Mn2+ contracting solution to prevent protein oxidation by Mn2+, the cells still contracted when exposed to Mn2+, but relaxed rapidly when the Mn2+ was removed. In the presence of DTT both the Mn2+ activation and the relaxation following removal of Mn2+ were more rapid than normal Ca2+-activated contractions and relaxations. The skinned fibers activated by Mn2+ in the absence of DTT showed little active shortening unless DTT was added. This rigor-like state is probably due to oxidation of contractile proteins since the cells relaxed when exposed to a relaxing solution containing DTT (50 mM) and then contracted again in response to Ca2+ and relaxed normally. The Mn2+ activation was not associated with myosin light chain phosphorylation, in contrast to Ca2+-activated contractions. PMID:3186428

  1. Differential regulation of protease activated receptor-1 and tissue plasminogen activator expression by shear stress in vascular smooth muscle cells

    NASA Technical Reports Server (NTRS)

    Papadaki, M.; Ruef, J.; Nguyen, K. T.; Li, F.; Patterson, C.; Eskin, S. G.; McIntire, L. V.; Runge, M. S.

    1998-01-01

    Recent studies have demonstrated that vascular smooth muscle cells are responsive to changes in their local hemodynamic environment. The effects of shear stress on the expression of human protease activated receptor-1 (PAR-1) and tissue plasminogen activator (tPA) mRNA and protein were investigated in human aortic smooth muscle cells (HASMCs). Under conditions of low shear stress (5 dyn/cm2), PAR-1 mRNA expression was increased transiently at 2 hours compared with stationary control values, whereas at high shear stress (25 dyn/cm2), mRNA expression was decreased (to 29% of stationary control; P<0.05) at all examined time points (2 to 24 hours). mRNA half-life studies showed that this response was not due to increased mRNA instability. tPA mRNA expression was decreased (to 10% of stationary control; P<0.05) by low shear stress after 12 hours of exposure and was increased (to 250% of stationary control; P<0.05) after 24 hours at high shear stress. The same trends in PAR-1 mRNA levels were observed in rat smooth muscle cells, indicating that the effects of shear stress on human PAR-1 were not species-specific. Flow cytometry and ELISA techniques using rat smooth muscle cells and HASMCs, respectively, provided evidence that shear stress exerted similar effects on cell surface-associated PAR-1 and tPA protein released into the conditioned media. The decrease in PAR-1 mRNA and protein had functional consequences for HASMCs, such as inhibition of [Ca2+] mobilization in response to thrombin stimulation. These data indicate that human PAR-1 and tPA gene expression are regulated differentially by shear stress, in a pattern consistent with their putative roles in several arterial vascular pathologies.

  2. Silodosin Inhibits Noradrenaline-Activated Transcription Factors Elk1 and SRF in Human Prostate Smooth Muscle

    PubMed Central

    Hennenberg, Martin; Strittmatter, Frank; Beckmann, Christer; Rutz, Beata; Füllhase, Claudius; Waidelich, Raphaela; Montorsi, Francesco; Hedlund, Petter; Andersson, Karl-Erik; Stief, Christian G.; Gratzke, Christian

    2012-01-01

    Background The transcription factors Elk1 and serum response factor (SRF) are central regulators of cell cycle and phenotype in various cell types. Elk1 is activated by phosphorylation (serine-383), while activation of SRF requires its co-factor, myocardin. Activation of Elk1 and SRF results in binding to specific DNA sequences in promoter regions, and may be induced by adrenergic receptor activation in different organs. Objective To examine the effects of adrenergic stimulation on Elk1 and SRF in the human prostate and the ability of the highly selective α1A-adrenoceptor antagonist, silodosin, on transcription factor activation. Methods Prostate tissue was obtained from patients undergoing radical prostatectomy. Expression of Elk1, SRF, and myocardin was estimated by Western blot and immunohistochemistry. Colocalizations were studied by double immunofluorescence staining. Noradrenaline- (NA-) and phenylephrine- (PE-) induced phosphorylation of Elk1 was assessed by Western blot analysis using a phospho-specific antibody. NA-induced activation of Elk1 and SRF was investigated by electrophoretic mobility shift assay (EMSA). Results Immunoreactivity for Elk1, SRF, and myocardin was observed in stromal cells of tissues from each patient. In fluorescence stainings, SRF colocalized with myocardin and α-smooth muscle actin (αSMA). Stimulation of prostate tissues with PE (10 µM) or NA (30 µM) increased the phosphorylation of Elk1 at serine-383. NA-induced Elk1 activation was confirmed by EMSA, where a NA-induced binding of Elk1 to the DNA sequence TTTGCAAAATGCAGGAATTGTTTTCACAGT was observed. Similarly, NA caused SRF binding to the SRF-specific DNA sequence CCATATTAGGCCATATTAGG. Application of silodosin (3 µM) to prostate tissues reduced the activity of Elk1 and SRF in NA-stimulated tissues. Conclusions Silodosin blocks the activation of the two transcription factors, Elk1 and SRF, which is induced by noradrenaline in the human prostate. A role of α1-adrenoceptors

  3. Autonomic Modification of Intestinal Smooth Muscle Contractility

    ERIC Educational Resources Information Center

    Montgomery, Laura E. A.; Tansey, Etain A.; Johnson, Chris D.; Roe, Sean M.; Quinn, Joe G.

    2016-01-01

    Intestinal smooth muscle contracts rhythmically in the absence of nerve and hormonal stimulation because of the activity of pacemaker cells between and within the muscle layers. This means that the autonomic nervous system modifies rather than initiates intestinal contractions. The practical described here gives students an opportunity to observe…

  4. The modulatory effect of MgATP on heterotrimeric smooth muscle myosin phosphatase activity.

    PubMed

    Sato, O; Ogawa, Y

    1999-10-01

    Regulation of the enzymatic activity of heterotrimeric smooth muscle myosin phosphatase (SMMP) by MgATP was examined using phosphorylated myosin (P-myosin), heavy meromyosin (P-HMM), subfragment-1 (P-S1), and 20 kDa myosin light chain (P-MLC(20)) as substrates. The activity toward P-myosin and P-HMM was dose-dependently reduced by MgATP, whereas that toward P-S1 or P-MLC(20) was unchanged. The reduction was mainly due to a decrease in the affinity of SMMP for the substrate with the unchanged maximum activity. This regulation is entirely new in the respect that the responsible molecule is the substrate, not SMMP. Because P-myosin derived from myosin stored in 50% glycerol at -20 degrees C was insensitive to MgATP, the proper integrity of P-myosin is required. Coexisting myosin did not affect this regulation, but it inhibited the SMMP activity in the absence of MgATP. With P-myosin, the enzyme activity was biphasically steeply dependent on the ionic strength. This requires that determinations are conducted with a fixed ionic strength. The Q(10) value was about 2, which was quite similar to that for myosin light chain kinase. These results suggest that the rate of dephosphorylation of P-myosin is lowered at rest, but that it may reach a value comparable to the rate of phosphorylation of myosin in the sarcoplasm with the increased level of P-myosin during muscle activation. This regulation by MgATP may underlie the "latch mechanism" in some respects. PMID:10502690

  5. Vasopressin activates Akt/mTOR pathway in smooth muscle cells cultured in high glucose concentration

    SciTech Connect

    Montes, Daniela K.; Brenet, Marianne; Muñoz, Vanessa C.; Burgos, Patricia V.; Villanueva, Carolina I.; Figueroa, Carlos D.; González, Carlos B.

    2013-11-29

    Highlights: •AVP induces mTOR phosphorylation in A-10 cells cultured in high glucose concentration. •The mTOR phosphorylation is mediated by the PI3K/Akt pathway activation. •The AVP-induced mTOR phosphorylation inhibited autophagy and stimulated cell proliferation. -- Abstract: Mammalian target of rapamycin (mTOR) complex is a key regulator of autophagy, cell growth and proliferation. Here, we studied the effects of arginine vasopressin (AVP) on mTOR activation in vascular smooth muscle cells cultured in high glucose concentration. AVP induced the mTOR phosphorylation in A-10 cells grown in high glucose, in contrast to cells cultured in normal glucose; wherein, only basal phosphorylation was observed. The AVP-induced mTOR phosphorylation was inhibited by a PI3K inhibitor. Moreover, the AVP-induced mTOR activation inhibited autophagy and increased thymidine incorporation in cells grown in high glucose. This increase was abolished by rapamycin which inhibits the mTORC1 complex formation. Our results suggest that AVP stimulates mTOR phosphorylation by activating the PI3K/Akt signaling pathway and, subsequently, inhibits autophagy and raises cell proliferation in A-10 cells maintained in high glucose concentration.

  6. Cyclic strain increases protease-activated receptor-1 expression in vascular smooth muscle cells

    NASA Technical Reports Server (NTRS)

    Nguyen, K. T.; Frye, S. R.; Eskin, S. G.; Patterson, C.; Runge, M. S.; McIntire, L. V.

    2001-01-01

    Cyclic strain regulates many vascular smooth muscle cell (VSMC) functions through changing gene expression. This study investigated the effects of cyclic strain on protease-activated receptor-1 (PAR-1) expression in VSMCs and the possible signaling pathways involved, on the basis of the hypothesis that cyclic strain would enhance PAR-1 expression, reflecting increased thrombin activity. Uniaxial cyclic strain (1 Hz, 20%) of cells cultured on elastic membranes induced a 2-fold increase in both PAR-1 mRNA and protein levels. Functional activity of PAR-1, as assessed by cell proliferation in response to thrombin, was also increased by cyclic strain. In addition, treatment of cells with antioxidants or an NADPH oxidase inhibitor blocked strain-induced PAR-1 expression. Preincubation of cells with protein kinase inhibitors (staurosporine or Ro 31-8220) enhanced strain-increased PAR-1 expression, whereas inhibitors of NO synthase, tyrosine kinase, and mitogen-activated protein kinases had no effect. Cyclic strain in the presence of basic fibroblast growth factor induced PAR-1 mRNA levels beyond the effect of cyclic strain alone, whereas no additive effect was observed between cyclic strain and platelet-derived growth factor-AB. Our findings that cyclic strain upregulates PAR-1 mRNA expression but that shear stress downregulates this gene in VSMCs provide an opportunity to elucidate signaling differences by which VSMCs respond to different mechanical forces.

  7. Statins activate GATA-6 and induce differentiated vascular smooth muscle cells

    SciTech Connect

    Wada, Hiromichi Abe, Mitsuru; Ono, Koh; Morimoto, Tatsuya; Kawamura, Teruhisa; Takaya, Tomohide; Satoh, Noriko; Fujita, Masatoshi; Kita, Toru; Shimatsu, Akira; Hasegawa, Koji

    2008-10-03

    The beneficial effects of 3-hydroxy-3-methylglutaryl coenzyme A reductase inhibitors (statins) beyond cholesterol lowering involve their direct actions on vascular smooth muscle cells (VSMCs). However, the effects of statins on phenotypic modulation of VSMCs are unknown. We herein show that simvastatin (Sm) and atorvastatin (At) inhibited DNA synthesis in human aortic VSMCs dose-dependently, while cell toxicity was not observed below the concentration of 1 {mu}M of Sm or 100 nM of At. Stimulating proliferative VSMCs with Sm or At induced the expression of SM-{alpha}-actin and SM-MHC, highly specific markers of differentiated phenotype. Sm up-regulated the binding activity of GATA-6 to SM-MHC GATA site and activated the transfected SM-MHC promoter in proliferative VSMCs, while mutating the GATA-6 binding site abolished this activation. Geranylgeranylpyrophosphate (10 {mu}M), an inhibitor of Rho family proteins, abolished the statin-mediated induction of the differentiated phenotype in VSMCs. These findings suggest that statins activate GATA-6 and induce differentiated VSMCs.

  8. Evodiamine Attenuates PDGF-BB-Induced Migration of Rat Vascular Smooth Muscle Cells through Activating PPARγ

    PubMed Central

    Ge, Xie; Chen, Siyu; Liu, Mei; Liang, Tingming; Liu, Chang

    2015-01-01

    The uncontrolled migration of vascular smooth muscle cells (VSMCs) into the intima is a critical process in the development of atherosclerosis. Evodiamine, an indole alkaloid extracted from the Chinese medicine evodia, has been shown to inhibit tumor cell invasion and protect the cardiovascular system, but its effects on VSMCs remain unknown. In the present study, we investigated the inhibitory effects of evodiamine on the platelet-derived growth factor-BB (PDGF-BB)-induced VSMC migration using wound healing and transwell assays, and assessed its role in decreasing the protein levels of matrix metalloproteinases and cell adhesion molecules. More importantly, we found that evodiamine activated the expression and nuclear translocation of peroxisome proliferator-activated receptor γ (PPARγ). Inhibition of PPARγ activity by using its antagonist T0070907 and its specific siRNA oligonucleotides significantly attenuated the inhibitory effects of evodiamine on VSMC migration. Taken together, our results indicate a promising anti-atherogenic effect of evodiamine through attenuation of VSMC migration by activating PPARγ. PMID:26703570

  9. Protease-activated receptors modulate excitability of murine colonic smooth muscles by differential effects on interstitial cells

    PubMed Central

    Sung, Tae Sik; Kim, Heung Up; Kim, Jeong Hwan; Lu, Hongli; Sanders, Kenton M; Koh, Sang Don

    2015-01-01

    Abstract Protease-activated receptors (PARs) are G protein-coupled receptors activated by proteolytic cleavage at their amino termini by serine proteases. PAR activation contributes to the inflammatory response in the gastrointestinal (GI) tract and alters GI motility, but little is known about the specific cells within the tunica muscularis that express PARs and the mechanisms leading to contractile responses. Using real time PCR, we found PARs to be expressed in smooth muscle cells (SMCs), interstitial cells of Cajal (ICC) and platelet-derived growth factor receptor α positive (PDGFRα+) cells. The latter cell-type showed dominant expression of F2r (encodes PAR1) and F2rl1 (encodes PAR2). Contractile and intracellular electrical activities were measured to characterize the integrated responses to PAR activation in whole muscles. Cells were isolated and ICC and PDGFRα+ cells were identified by constitutive expression of fluorescent reporters. Thrombin (PAR1 agonist) and trypsin (PAR2 agonist) caused biphasic responses in colonic muscles: transient hyperpolarization and relaxation followed by repolarization and excitation. The inhibitory phase was blocked by apamin, revealing a distinct excitatory component. Patch clamp studies showed that the inhibitory response was mediated by activation of small conductance calcium-activated K+ channels in PDGFRα+ cells, and the excitatory response was mediated by activation of a Cl− conductance in ICC. SMCs contributed little to PAR responses in colonic muscles. In summary, PARs regulate the excitability of colonic muscles; different conductances are activated in each cell type of the SMC–ICC–PDGFRα+ cell (SIP) syncytium. Motor responses to PAR agonists are integrated responses of the SIP syncytium. Key points Activation of protease-activated receptors (PAR) regulates gastrointestinal (GI) motility but little is known about the cells and mechanisms in GI muscles responsible for PAR responses. Using mouse cells, we

  10. Arterial Wall Stress Controls NFAT5 Activity in Vascular Smooth Muscle Cells

    PubMed Central

    Scherer, Clemens; Pfisterer, Larissa; Wagner, Andreas H.; Hödebeck, Maren; Cattaruzza, Marco; Hecker, Markus; Korff, Thomas

    2014-01-01

    Background Nuclear factor of activated T‐cells 5 (NFAT5) has recently been described to control the phenotype of vascular smooth muscle cells (VSMCs). Although an increase in wall stress or stretch (eg, elicited by hypertension) is a prototypic determinant of VSMC activation, the impact of this biomechanical force on the activity of NFAT5 is unknown. This study intended to reveal the function of NFAT5 and to explore potential signal transduction pathways leading to its activation in stretch‐stimulated VSMCs. Methods and Results Human arterial VSMCs were exposed to biomechanical stretch and subjected to immunofluorescence and protein‐biochemical analyses. Stretch promoted the translocation of NFAT5 to the nucleus within 24 hours. While the protein abundance of NFAT5 was regulated through activation of c‐Jun N‐terminal kinase under these conditions, its translocation required prior activation of palmitoyltransferases. DNA microarray and ChiP analyses identified the matrix molecule tenascin‐C as a prominent transcriptional target of NFAT5 under these conditions that stimulates migration of VSMCs. Analyses of isolated mouse femoral arteries exposed to hypertensive perfusion conditions verified that NFAT5 translocation to the nucleus is followed by an increase in tenascin‐C abundance in the vessel wall. Conclusions Collectively, our data suggest that biomechanical stretch is sufficient to activate NFAT5 both in native and cultured VSMCs where it regulates the expression of tenascin‐C. This may contribute to an improved migratory activity of VSMCs and thus promote maladaptive vascular remodeling processes such as hypertension‐induced arterial stiffening. PMID:24614757

  11. Endogenous cannabinoid receptor CB1 activation promotes vascular smooth-muscle cell proliferation and neointima formation

    PubMed Central

    Molica, Filippo; Burger, Fabienne; Thomas, Aurélien; Staub, Christian; Tailleux, Anne; Staels, Bart; Pelli, Graziano; Zimmer, Andreas; Cravatt, Benjamin; Matter, Christian M.; Pacher, Pal; Steffens, Sabine

    2013-01-01

    Percutaneous transluminal angioplasty is frequently used in patients with severe arterial narrowing due to atherosclerosis. However, it induces severe arterial injury and an inflammatory response leading to restenosis. Here, we studied a potential activation of the endocannabinoid system and the effect of FA amide hydrolase (FAAH) deficiency, the major enzyme responsible for endocannabinoid anandamide degradation, in arterial injury. We performed carotid balloon injury in atherosclerosis-prone apoE knockout (apoE−/−) and apoE−/−FAAH−/− mice. Anandamide levels were systemically elevated in apoE−/− mice after balloon injury. ApoE−/−FAAH−/− mice had significantly higher baseline anandamide levels and enhanced neointima formation compared with apoE−/− controls. The latter effect was inhibited by treatment with CB1 antagonist AM281. Similarly, apoE−/− mice treated with AM281 had reduced neointimal areas, reduced lesional vascular smooth-muscle cell (SMC) content, and proliferating cell counts. The lesional macrophage content was unchanged. In vitro proliferation rates were significantly reduced in CB1−/− SMCs or when treating apoE−/− or apoE−/−FAAH−/− SMCs with AM281. Macrophage in vitro adhesion and migration were marginally affected by CB1 deficiency. Reendothelialization was not inhibited by treatment with AM281. In conclusion, endogenous CB1 activation contributes to vascular SMC proliferation and neointima formation in response to arterial injury. PMID:23479425

  12. Fermented soshiho-tang with Lactobacillus plantarum enhances the antiproliferative activity in vascular smooth muscle cell

    PubMed Central

    2014-01-01

    Background Soshiho-tang (SST) is a traditional medicine widely used for the treatment of chronic hepatitis. SST has been shown to confer a variety of pharmacological activities, including prevention of hepatotoxicity, promotion of liver regeneration, and modulation of liver fibrosis. In this study, we investigated the antiproliferative activity of native and fermented (FSST) formulations of SST in vascular smooth muscle cells (VSMCs) and examined the potential underlying mechanisms driving these effects. Methods SST, along with preparations fermented with Lactobacillus plantarum KFRI-144 (S-A144), L. amylophilus KFRI-161 (S-A161) and L. bulgaricus KFRI-344 (S-A344), were investigated to determine their effects on the proliferation and viability of VSMCs, along with the signalling pathways underlying these effects. Results S-A144 exhibited a strong, dose-dependent inhibition of VSMC proliferation relative to untreated controls, but the others did not affect. In addition, S-A144 significantly decreased the phosphorylation of Akt and PLCγ1 in a dose-dependent manner and induced cell cycle arrest at the G0/G1 phase characterised by decreased expression of CDKs, cyclins and PCNA. Conclusions The findings suggest that S-A144 exhibit enhanced inhibition of PDGF-BB-induced VSMC proliferation comparison to S-AOR through the suppression of cell cycle progression and expression of cell cycle-related proteins, along with the downregulation of Akt phosphorylation. PMID:24580756

  13. Interstitial Cells: Regulators of Smooth Muscle Function

    PubMed Central

    Sanders, Kenton M.; Ward, Sean M.; Koh, Sang Don

    2014-01-01

    Smooth muscles are complex tissues containing a variety of cells in addition to muscle cells. Interstitial cells of mesenchymal origin interact with and form electrical connectivity with smooth muscle cells in many organs, and these cells provide important regulatory functions. For example, in the gastrointestinal tract, interstitial cells of Cajal (ICC) and PDGFRα+ cells have been described, in detail, and represent distinct classes of cells with unique ultrastructure, molecular phenotypes, and functions. Smooth muscle cells are electrically coupled to ICC and PDGFRα+ cells, forming an integrated unit called the SIP syncytium. SIP cells express a variety of receptors and ion channels, and conductance changes in any type of SIP cell affect the excitability and responses of the syncytium. SIP cells are known to provide pacemaker activity, propagation pathways for slow waves, transduction of inputs from motor neurons, and mechanosensitivity. Loss of interstitial cells has been associated with motor disorders of the gut. Interstitial cells are also found in a variety of other smooth muscles; however, in most cases, the physiological and pathophysiological roles for these cells have not been clearly defined. This review describes structural, functional, and molecular features of interstitial cells and discusses their contributions in determining the behaviors of smooth muscle tissues. PMID:24987007

  14. Stretch-activated channels in pulmonary arterial smooth muscle cells from normoxic and chronically hypoxic rats.

    PubMed

    Ducret, Thomas; El Arrouchi, Jalila; Courtois, Arnaud; Quignard, Jean-François; Marthan, Roger; Savineau, Jean-Pierre

    2010-11-01

    Stretch-activated channels (SACs) act as membrane mechanotransducers since they convert physical forces into biological signals and hence into a cell response. Pulmonary arterial smooth muscle cells (PASMCs) are continuously exposed to mechanical stimulations e.g., compression and stretch, that are enhanced under conditions of pulmonary arterial hypertension (PAH). Using the patch-clamp technique (cell-attached configuration) in PASMCs, we showed that applying graded negative pressures (from 0 to -60 mmHg) to the back end of the patch pipette increases occurrence and activity of SACs. The current-voltage relationship (from -80 to +40 mV) was almost linear with a reversal potential of 1 mV and a slope conductance of 34 pS. SACs were inhibited in the presence of GsMTx-4, a specific SACs blocker. Using microspectrofluorimetry (indo-1), we found that hypotonic-induced cell swelling increases intracellular Ca(2+) concentration ([Ca(2+)](i)). This [Ca(2+)](i) increase was markedly inhibited in the absence of external Ca(2+) or in the presence of the following blockers of SACs: gadolinium, streptomycin, and GsMTx-4. Interestingly, in chronically hypoxic rats, an animal model of PAH, SACs were more active and hypotonic-induced calcium response in PASMCs was significantly higher (nearly a two-fold increase). Moreover, unlike in normoxic rats, intrapulmonary artery rings from hypoxic rats mounted in a Mulvany myograph, exhibited a myogenic tone sensitive to SAC blockers. In conclusion, this work demonstrates that SACs in rat PASMCs can be activated by membrane stretch as well as hypotonic stimulation and are responsible for [Ca(2+)](i) increase. The link between SACs activation-induced calcium response and myogenic tone in chronically hypoxic rats suggests that SACs are an important element for the increased pulmonary vascular tone in PAH and that they may represent a molecular target for PAH treatment. PMID:21035852

  15. Activation of the pluripotency factor OCT4 in smooth muscle cells is atheroprotective.

    PubMed

    Cherepanova, Olga A; Gomez, Delphine; Shankman, Laura S; Swiatlowska, Pamela; Williams, Jason; Sarmento, Olga F; Alencar, Gabriel F; Hess, Daniel L; Bevard, Melissa H; Greene, Elizabeth S; Murgai, Meera; Turner, Stephen D; Geng, Yong-Jian; Bekiranov, Stefan; Connelly, Jessica J; Tomilin, Alexey; Owens, Gary K

    2016-06-01

    Although somatic cell activation of the embryonic stem cell (ESC) pluripotency factor OCT4 has been reported, this previous work has been controversial and has not demonstrated a functional role for OCT4 in somatic cells. Here we demonstrate that smooth muscle cell (SMC)-specific conditional knockout of Oct4 in Apoe(-/-) mice resulted in increased lesion size and changes in lesion composition that are consistent with decreased plaque stability, including a thinner fibrous cap, increased necrotic core area, and increased intraplaque hemorrhage. Results of SMC-lineage-tracing studies showed that these effects were probably the result of marked reductions in SMC numbers within lesions and SMC investment within the fibrous cap, which may result from impaired SMC migration. The reactivation of Oct4 within SMCs was associated with hydroxymethylation of the Oct4 promoter and was hypoxia inducible factor-1α (HIF-1α, encoded by HIF1A) and Krüppel-like factor-4 (KLF4)-dependent. These results provide the first direct evidence that OCT4 has a functional role in somatic cells, and they highlight the potential role of OCT4 in normal and diseased somatic cells. PMID:27183216

  16. Tremorgenic indole alkaloids potently inhibit smooth muscle high-conductance calcium-activated potassium channels.

    PubMed

    Knaus, H G; McManus, O B; Lee, S H; Schmalhofer, W A; Garcia-Calvo, M; Helms, L M; Sanchez, M; Giangiacomo, K; Reuben, J P; Smith, A B

    1994-05-17

    Tremorgenic indole alkaloids produce neurological disorders (e.g., staggers syndromes) in ruminants. The mode of action of these fungal mycotoxins is not understood but may be related to their known effects on neurotransmitter release. To determine whether these effects could be due to inhibition of K+ channels, the interaction of various indole diterpenes with high-conductance Ca(2+)-activated K+ (maxi-K) channels was examined. Paspalitrem A, paspalitrem C, aflatrem, penitrem A, and paspalinine inhibit binding of [125I]charybdotoxin (ChTX) to maxi-K channels in bovine aortic smooth muscle sarcolemmal membranes. In contrast, three structurally related compounds, paxilline, verruculogen, and paspalicine, enhanced toxin binding. As predicted from the binding studies, covalent incorporation of [125I]ChTX into the 31-kDa subunit of the maxi-K channel was blocked by compounds that inhibit [125I]ChTX binding and enhanced by compounds that stimulate [125I]ChTX binding. Modulation of [125I]ChTX binding was due to allosteric mechanisms. Despite their different effects on binding of [125I]ChTX to maxi-K channels, all compounds potently inhibited maxi-K channels in electrophysiological experiments. Other types of voltage-dependent or Ca(2+)-activated K+ channels examined were not affected. Chemical modifications of paxilline indicate a defined structure-activity relationship for channel inhibition. Paspalicine, a deshydroxy analog of paspalinine lacking tremorgenic activity, also potently blocked maxi-K channels. Taken together, these data suggest that indole diterpenes are the most potent nonpeptidyl inhibitors of maxi-K channels identified to date. Some of their pharmacological properties could be explained by inhibition of maxi-K channels, although tremorgenicity may be unrelated to channel block. PMID:7514038

  17. Molecular and functional significance of Ca2+-activated Cl− channels in pulmonary arterial smooth muscle

    PubMed Central

    Forrest, Abigail S.; Ayon, Ramon J.; Wiwchar, Michael; Angermann, Jeff E.; Pritchard, Harry A. T.; Singer, Cherie A.; Valencik, Maria L.; Britton, Fiona; Greenwood, Iain A.

    2015-01-01

    Abstract Increased peripheral resistance of small distal pulmonary arteries is a hallmark signature of pulmonary hypertension (PH) and is believed to be the consequence of enhanced vasoconstriction to agonists, thickening of the arterial wall due to remodeling, and increased thrombosis. The elevation in arterial tone in PH is attributable, at least in part, to smooth muscle cells of PH patients being more depolarized and displaying higher intracellular Ca2+ levels than cells from normal subjects. It is now clear that downregulation of voltage-dependent K+ channels (e.g., Kv1.5) and increased expression and activity of voltage-dependent (Cav1.2) and voltage-independent (e.g., canonical and vanilloid transient receptor potential [TRPC and TRPV]) Ca2+ channels play an important role in the functional remodeling of pulmonary arteries in PH. This review focuses on an anion-permeable channel that is now considered a novel excitatory mechanism in the systemic and pulmonary circulations. It is permeable to Cl− and is activated by a rise in intracellular Ca2+ concentration (Ca2+-activated Cl− channel, or CaCC). The first section outlines the biophysical and pharmacological properties of the channel and ends with a description of the molecular candidate genes postulated to encode for CaCCs, with particular emphasis on the bestrophin and the newly discovered TMEM16 and anoctamin families of genes. The second section provides a review of the various sources of Ca2+ activating CaCCs, which include stimulation by mobilization from intracellular Ca2+ stores and Ca2+ entry through voltage-dependent and voltage-independent Ca2+ channels. The third and final section summarizes recent findings that suggest a potentially important role for CaCCs and the gene TMEM16A in PH. PMID:26064450

  18. Autonomic modification of intestinal smooth muscle contractility.

    PubMed

    Montgomery, Laura E A; Tansey, Etain A; Johnson, Chris D; Roe, Sean M; Quinn, Joe G

    2016-03-01

    Intestinal smooth muscle contracts rhythmically in the absence of nerve and hormonal stimulation because of the activity of pacemaker cells between and within the muscle layers. This means that the autonomic nervous system modifies rather than initiates intestinal contractions. The practical described here gives students an opportunity to observe this spontaneous activity and its modification by agents associated with parasympathetic and sympathetic nerve activity. A section of the rabbit small intestine is suspended in an organ bath, and the use of a pressure transducer and data-acquisition software allows the measurement of tension generated by the smooth muscle of intestinal walls. The application of the parasympathetic neurotransmitter ACh at varying concentrations allows students to observe an increase in intestinal smooth muscle tone with increasing concentrations of this muscarinic receptor agonist. Construction of a concentration-effect curve allows students to calculate an EC50 value for ACh and consider some basic concepts surrounding receptor occupancy and activation. Application of the hormone epinephrine to the precontracted intestine allows students to observe the inhibitory effects associated with sympathetic nerve activation. Introduction of the drug atropine to the preparation before a maximal concentration of ACh is applied allows students to observe the inhibitory effect of a competitive antagonist on the physiological response to a receptor agonist. The final experiment involves the observation of the depolarizing effect of K(+) on smooth muscle. Students are also invited to consider why the drugs atropine, codeine, loperamide, and botulinum toxin have medicinal uses in the management of gastrointestinal problems. PMID:26873897

  19. TLR4-Activated MAPK-IL-6 Axis Regulates Vascular Smooth Muscle Cell Function.

    PubMed

    Lee, Guan-Lin; Wu, Jing-Yiing; Tsai, Chien-Sung; Lin, Chih-Yuan; Tsai, Yi-Ting; Lin, Chin-Sheng; Wang, Yi-Fu; Yet, Shaw-Fang; Hsu, Yu-Juei; Kuo, Cheng-Chin

    2016-01-01

    Migration of vascular smooth muscle cells (VSMCs) into the intima is considered to be a vital event in the pathophysiology of atherosclerosis. Despite substantial evidence supporting the pathogenic role of Toll-like receptor 4 (TLR4) in the progression of atherogenesis, its function in the regulation of VSMC migration remains unclear. The goal of the present study was to elucidate the mechanism by which TLR4 regulates VSMC migration. Inhibitor experiments revealed that TLR4-induced IL-6 secretion and VSMC migration were mediated via the concerted actions of MyD88 and TRIF on the activation of p38 MAPK and ERK1/2 signaling. Neutralizing anti-IL-6 antibodies abrogated TLR4-driven VSMC migration and F-actin polymerization. Blockade of p38 MAPK or ERK1/2 signaling cascade inhibited TLR4 agonist-mediated activation of cAMP response element binding protein (CREB). Moreover, siRNA-mediated suppression of CREB production repressed TLR4-induced IL-6 production and VSMC migration. Rac-1 inhibitor suppressed TLR4-driven VSMC migration but not IL-6 production. Importantly, the serum level of IL-6 and TLR4 endogenous ligand HMGB1 was significantly higher in patients with coronary artery diseases (CAD) than in healthy subjects. Serum HMGB1 level was positively correlated with serum IL-6 level in CAD patients. The expression of both HMGB1 and IL-6 was clearly detected in the atherosclerotic tissue of the CAD patients. Additionally, there was a positive association between p-CREB and HMGB1 in mouse atherosclerotic tissue. Based on our findings, we concluded that, upon ligand binding, TLR4 activates p38 MAPK and ERK1/2 signaling through MyD88 and TRIF in VSMCs. These signaling pathways subsequently coordinate an additive augmentation of CREB-driven IL-6 production, which in turn triggers Rac-1-mediated actin cytoskeleton to promote VSMC migration. PMID:27563891

  20. TonEBP/NFAT5 regulates ACTBL2 expression in biomechanically activated vascular smooth muscle cells

    PubMed Central

    Hödebeck, Maren; Scherer, Clemens; Wagner, Andreas H.; Hecker, Markus; Korff, Thomas

    2014-01-01

    Cytoskeletal reorganization and migration are critical responses which enable vascular smooth muscle cells (VSMCs) cells to evade, compensate, or adapt to alterations in biomechanical stress. An increase in wall stress or biomechanical stretch as it is elicited by arterial hypertension promotes their reorganization in the vessel wall which may lead to arterial stiffening and contractile dysfunction. This adaptive remodeling process is dependent on and driven by subtle phenotype changes including those controlling the cytoskeletal architecture and motility of VSMCs. Recently, it has been reported that the transcription factor nuclear factor of activated T-cells 5 (TonEBP/NFAT5) controls critical aspects of the VSMC phenotype and is activated by biomechanical stretch. We therefore hypothesized that NFAT5 controls the expression of gene products orchestrating cytoskeletal reorganization in stretch-stimulated VSMCs. Automated immunofluorescence and Western blot analyses revealed that biomechanical stretch enhances the expression and nuclear translocation of NFAT5 in VSMCs. Subsequent in silico analyses suggested that this transcription factor binds to the promotor region of ACTBL2 encoding kappa-actin which was shown to be abundantly expressed in VSMCs upon exposure to biomechanical stretch. Furthermore, ACTBL2 expression was inhibited in these cells upon siRNA-mediated knockdown of NFAT5. Kappa-actin appeared to be aligned with stress fibers under static culture conditions, dispersed in lamellipodia and supported VSMC migration as its knockdown diminishes lateral migration of these cells. In summary, our findings delineated biomechanical stretch as a determinant of NFAT5 expression and nuclear translocation controlling the expression of the cytoskeletal protein ACTBL2. This response may orchestrate the migratory activity of VSMCs and thus promote maladaptive rearrangement of the arterial vessel wall during hypertension. PMID:25520667

  1. INSULIN INDUCED EPIDERMAL GROWTH FACTOR ACTIVATION IN VASCULAR SMOOTH MUSCLE CELLS IS ADAM-DEPENDENT

    PubMed Central

    Roztocil, Elisa; Nicholl, Suzanne M.; Davies, Mark G.

    2008-01-01

    Background With the rise in metabolic syndrome, understanding the role of insulin signaling within the cells of vasculature has become more important but yet remains poorly defined. The study examines the role of insulin actions on a pivotal cross-talk receptor, Epidermal Growth Factor Receptor (EGFR). EGFR is transactivated by both G-protein-coupled receptors and receptor linked tyrosine kinases and is key to many of their responses. Objective To determine the pathway of EGFR transactivation by insulin in human coronary smooth muscle cells (VSMC) Methods VSMC were cultured in vitro. Assays of EGFR phosphorylation were examined in response to insulin in the presence and absence of the plasmin inhibitors (e-aminocaproic acid and aprotinin) matrix metalloprotease (MMP) inhibitor GM6001, the ADAM (A Disintegrin And Metalloproteinase Domain) inhibitors TAPI-0 and TAPI-1, Heparin binding epidermal growth factor (HB-EGF) inhibitor, CRM197, HB-EGF inhibitory antibodies, EGF inhibitory antibodies and the EGFR inhibitor AG1478. Results Insulin induced time-dependent EGFR phosphorylation, which was inhibited by AG1478 in a concentration dependent manner. Application of the plasmin inhibitors did not block the response. EGFR phosphorylation by insulin was blocked by inhibition of MMP activity and the ligand HB-EGF. The presence of the ADAM inhibitors, TAPI-0 and TAPI-1 significantly decreased EGFR activation. EGFR phosphorylation by EGF was not interrupted by inhibition of plasmin, MMPs TAPIs, or HB-EGF. Direct blockade of the EGFR prevented activation by both insulin and EGF. Conclusion Insulin can induce transactivation of EGFR by an ADAM-mediated, HB-EGF dependent process. This is the first description of crosstalk via ADAM between insulin and EGFR in vascular SMC. Targeting a pivotal cross-talk receptor such as EGFR, which can be transactivated by both G-protein-coupled receptors and receptor tyrosine kinases is an attractive molecular target. PMID:18656632

  2. Activation of NADPH oxidase 1 increases intracellular calcium and migration of smooth muscle cells.

    PubMed

    Zimmerman, Matthew C; Takapoo, Maysam; Jagadeesha, Dammanahalli K; Stanic, Bojana; Banfi, Botond; Bhalla, Ramesh C; Miller, Francis J

    2011-09-01

    Redox-dependent migration and proliferation of vascular smooth muscle cells (SMCs) are central events in the development of vascular proliferative diseases; however, the underlying intracellular signaling mechanisms are not fully understood. We tested the hypothesis that activation of Nox1 NADPH oxidase modulates intracellular calcium ([Ca(2+)](i)) levels. Using cultured SMCs from wild-type and Nox1 null mice, we confirmed that thrombin-dependent generation of reactive oxygen species requires Nox1. Thrombin rapidly increased [Ca(2+)](i), as measured by fura-2 fluorescence ratio imaging, in wild-type but not Nox1 null SMCs. The increase in [Ca(2+)](i) in wild-type SMCs was inhibited by antisense to Nox1 and restored by expression of Nox1 in Nox1 null SMCs. Investigation into potential mechanisms by which Nox1 modulates [Ca(2+)](i) showed that thrombin-induced inositol triphosphate generation and thapsigargin-induced intracellular calcium mobilization were similar in wild-type and Nox1 null SMCs. To examine the effects of Nox1 on Ca(2+) entry, cells were either bathed in Ca(2+)-free medium or exposed to dihydropyridines to block L-type Ca(2+) channel activity. Treatment with nifedipine or removal of extracellular Ca(2+) reduced the thrombin-mediated increase of [Ca(2+)](i) in wild-type SMCs, whereas the response in Nox1 null SMCs was unchanged. Sodium vanadate, an inhibitor of protein tyrosine phosphatases, restored the thrombin-induced increase of [Ca(2+)](i) in Nox1 null SMCs. Migration of SMCs was impaired with deficiency of Nox1 and restored with expression of Nox1 or the addition of sodium vanadate. In summary, we conclude that Nox1 NADPH oxidase modulates Ca(2+) mobilization in SMCs, in part through regulation of Ca(2+) influx, to thereby promote cell migration. PMID:21810651

  3. Reaction of human smooth muscle antibody with thyroid cells

    PubMed Central

    Biberfeld, Gunnel; Fagraeus, Astrid; Lenkei, Rodica

    1974-01-01

    Sera from cases of active chronic hepatitis or acute hepatitis containing smooth muscle antibodies reacted by immunofluorescence with the membrane region of sectioned thyroid cells from thyrotoxic glands. With non-toxic glands the reaction was negative or weak. The prerequisite for a positive reaction was that the complement of the sera had been heat-inactivated. Absorption with smooth muscle antigen abolished the reaction of smooth muscle antibody positive sera with thyroid cells. Some smooth muscle antibody negative sera from cases with disorders other than liver disease were found to give a similar immunofluorescence staining of the membrane region of sectioned thyroid cells, but these antibodies were not absorbed with smooth muscle antigen. Culture of thyroid cells was found to increase the number of cells reacting with smooth muscle antibody. In contrast, the thyroid cell antigen reacting with smooth muscle antibody negative sera was lost during culture. PMID:4619977

  4. TLR3 activation increases chemokine expression in human fetal airway smooth muscle cells.

    PubMed

    Faksh, Arij; Britt, Rodney D; Vogel, Elizabeth R; Thompson, Michael A; Pandya, Hitesh C; Martin, Richard J; Pabelick, Christina M; Prakash, Y S

    2016-01-15

    Viral infections, such as respiratory syncytial virus and rhinovirus, adversely affect neonatal and pediatric populations, resulting in significant lung morbidity, including acute asthma exacerbation. Studies in adults have demonstrated that human airway smooth muscle (ASM) cells modulate inflammation through their ability to secrete inflammatory cytokines and chemokines. The role of ASM in the developing airway during infection remains undefined. In our study, we used human fetal ASM cells as an in vitro model to examine the effect of Toll-like receptor (TLR) agonists on chemokine secretion. We found that fetal ASM express multiple TLRs, including TLR3 and TLR4, which are implicated in the pathogenesis of respiratory syncytial virus and rhinovirus infection. Cells were treated with TLR agonists, polyinosinic-polycytidylic acid [poly(I:C)] (TLR3 agonist), lipopolysaccharide (TLR4 agonist), or R848 (TLR7/8 agonist), and IL-8 and chemokine (C-C motif) ligand 5 (CCL5) secretion were evaluated. Interestingly, poly(I:C), but neither lipopolysaccharide nor R848, increased IL-8 and chemokine (C-C motif) ligand 5 secretion. Examination of signaling pathways suggested that the poly(I:C) effects in fetal ASM involve TLR and ERK signaling, in addition to another major inflammatory pathway, NF-κB. Moreover, there are variations between fetal and adult ASM with respect to poly(I:C) effects on signaling pathways. Pharmacological inhibition suggested that ERK pathways mediate poly(I:C) effects. Overall, our data show that poly(I:C) initiates activation of proinflammatory pathways in developing ASM, which may contribute to immune responses to infection and exacerbation of asthma. PMID:26589477

  5. Constitutively active PKA regulates neuronal acetylcholine release and contractility of guinea pig urinary bladder smooth muscle.

    PubMed

    Xin, Wenkuan; Li, Ning; Fernandes, Vitor S; Petkov, Georgi V

    2016-06-01

    Autonomic and somatic motor neurons that innervate the urinary bladder and urethra control the highly coordinated functions of the lower urinary tract, the storage, and the emptying of urine. ACh is the primary excitatory neurotransmitter in the bladder. Here, we aimed to determine whether PKA regulates neuronal ACh release and related nerve-evoked detrusor smooth muscle (DSM) contractions in the guinea pig urinary bladder. Isometric DSM tension recordings were used to measure spontaneous phasic and electrical field stimulation (EFS)- and carbachol-induced DSM contractions with a combination of pharmacological tools. The colorimetric method was used to measure ACh released by the parasympathetic nerves in DSM isolated strips. The pharmacological inhibition of PKA with H-89 (10 μM) increased the spontaneous phasic contractions, whereas it attenuated the EFS-induced DSM contractions. Intriguingly, H-89 (10 μM) attenuated the (primary) cholinergic component, whereas it simultaneously increased the (secondary) purinergic component of the nerve-evoked contractions in DSM isolated strips. The acetylcholinesterase inhibitor, eserine (10 μM), increased EFS-induced DSM contractions, and the subsequent addition of H-89 attenuated the contractions. H-89 (10 μM) significantly increased DSM phasic contractions induced by the cholinergic agonist carbachol. The inhibition of PKA decreased the neuronal release of ACh in DSM tissues. This study revealed that PKA-mediated signaling pathways differentially regulate nerve-evoked and spontaneous phasic contractions of guinea pig DSM. Constitutively active PKA in the bladder nerves controls synaptic ACh release, thus regulating the nerve-evoked DSM contractions, whereas PKA in DSM cells controls the spontaneous phasic contractility. PMID:27029424

  6. Effect of smooth muscle relaxant drugs on proximal human ureteric activity in vivo: a pilot study.

    PubMed

    Davenport, Kim; Timoney, Anthony G; Keeley, Francis X

    2007-08-01

    Drugs are increasingly being used to promote stone passage in renal colic. Diclofenac, nifedipine and tamsulosin cause ureteric smooth muscle relaxation in vitro; however, in clinical trials nifedipine and tamsulosin promote stone passage whereas diclofenac has no apparent benefit. We adapted a ureteric pressure transducer catheter in an attempt to compare the human ureteric response to these drugs in vivo. The catheter was inserted into the contralateral ureter following ureteroscopy for stone disease. Contraction frequency, pressure and velocity measurements were recorded at 24 h. Each patient was randomly allocated to receive oral diclofenac, nifedipine or tamsulosin. Measurements were taken following drug administration. Eighteen patients (mean age 50 years) were recruited. Two patients were excluded intraoperatively and three required early removal of the catheter. Prior to drug administration, the mean number of contractions recorded was 0-4.1/min and the peak contraction pressure ranged from 11 to 35 mmHg. Conduction velocity ranged from 1.5 to 2.6 cm/s. Ureteric peristalsis persisted in all patients despite these drugs. Diclofenac and nifedipine produced inconsistent ureteric pressure responses but had little effect on contraction frequency. Tamsulosin significantly reduced ureteric pressure but had no effect on contraction frequency. There are many limitations associated with the use of ureteric catheters, however, they may provide some useful information when used to record the response to an intervention in the same patient. These preliminary results suggest a reduction in pressure generation may be the essential factor in the promotion of stone passage. More work is required but these drugs may work by preventing the increased, uncoordinated muscular activity seen in renal colic whilst maintaining peristalsis, thereby promoting stone passage. PMID:17530238

  7. Thyrotropin-releasing hormone activates KCa channels in gastric smooth muscle cells via intracellular Ca2+ release.

    PubMed

    Petkova-Kirova, P S; Lubomirov, L T; Gagov, H S; Kolev, V B; Duridanova, D B

    2001-03-01

    Thyrotropin-releasing hormone (TRH) is released in high concentrations into gastric juice, but its direct effect on gastric smooth muscles has not been studied yet. We undertook studies on TRH effect on gastric smooth muscle using contraction and patch clamp methods. TRH was found to inhibit both acetylcholine- and BaCl2-induced contractions of gastric strips. TRH, applied to single cells, inhibited the voltage-dependent Ca2+ currents and activated the whole-cell K+ currents. The TRH-induced changes in K+ currents and membrane potential were effectively abolished by inhibitors of either intracellular Ca2+ release channels or phospholipase C. Neither activators, nor blockers of protein kinase C could affect the action of TRH on K+ currents. In conclusion, TRH activates K+ channels via inositol-1,4,5-trisphosphate-induced release of Ca2+ in the direction to the plasma membrane, which in turn leads to stimulation of the Ca2+-sensitive K+ conductance, membrane hyperpolarization and relaxation. The data imply that TRH may act physiologically as a local modulator of gastric smooth muscle tone. PMID:11508821

  8. Potential Role of Glycogen Synthase Kinase-3β in Regulation of Myocardin Activity in Human Vascular Smooth Muscle Cells.

    PubMed

    Zhou, Yi-Xia; Shi, Zhan; Singh, Pavneet; Yin, Hao; Yu, Yan-Ni; Li, Long; Walsh, Michael P; Gui, Yu; Zheng, Xi-Long

    2016-02-01

    Glycogen synthase kinase (GSK)-3β, a serine/threonine kinase with an inhibitory role in glycogen synthesis in hepatocytes and skeletal muscle, is also expressed in cardiac and smooth muscles. Inhibition of GSK-3β results in cardiac hypertrophy through reducing phosphorylation and increasing transcriptional activity of myocardin, a transcriptional co-activator for serum response factor. Myocardin plays critical roles in differentiation of smooth muscle cells (SMCs). This study, therefore, aimed to examine whether and how inhibition of GSK-3β regulates myocardin activity in human vascular SMCs. Treatment of SMCs with the GSK-3β inhibitors AR-A014418 and TWS 119 significantly reduced endogenous myocardin activity, as indicated by lower expression of myocardin target genes (and gene products), CNN1 (calponin), TAGLN1 (SM22), and ACTA2 (SM α-actin). In human SMCs overexpressing myocardin through the T-REx system, treatment with either GSK-3β inhibitor also inhibited the expression of CNN1, TAGLN1, and ACTA2. These effects of GSK-3β inhibitors were mimicked by transfection with GSK-3β siRNA. Notably, both AR-A014418 and TWS 119 decreased the serine/threonine phosphorylation of myocardin. The chromatin immunoprecipitation assay showed that AR-A014418 treatment reduced myocardin occupancy of the promoter of the myocardin target gene ACTA2. Overexpression of a dominant-negative GSK-3β mutant in myocardin-overexpressing SMCs reduced the expression of calponin, SM22, and SM α-actin. As expected, overexpression of constitutively active or wild-type GSK-3β in SMCs without myocardin overexpression increased expression of these proteins. In summary, our results indicate that inhibition of GSK-3β reduces myocardin transcriptional activity, suggesting a role for GSK-3β in myocardin transcriptional activity and smooth muscle differentiation. PMID:26129946

  9. Swelling-activated and arachidonic acid-induced currents are TREK-1 in rat bladder smooth muscle cells.

    PubMed

    Fukasaku, Mitsuko; Kimura, Junko; Yamaguchi, Osamu

    2016-06-01

    Using the perforated patch voltage clamp, we investigated swelling-activated ionic channels (SACs) in rat urinary bladder smooth muscle cells. Hypo-osmotic (60%) bath solution increased a membrane current which was inhibited by the SAC inhibitor, gadolinium. The reversal potential of the hypotonicity-induced current shifted in the positive direction by increasing external K(+) concentration. The hypotonicity-induced current was inhibited by extracellular acidic pH, phorbol ester and forskolin. These pharmacological properties are identical to those of arachidonic acid-induced current present in these cells, suggesting the presence of TREK-1, a four-transmembrane two pore domain K(+) channel. Using RT-PCR we screened rat bladder smooth muscles and cerebellum for expression of TREK-1, TREK-2 and TRAAK mRNAs. Only TREK-1 mRNA was expressed in the bladder, while all three were expressed in the cerebellum. We conclude that a mechanosensitive K(+) channel is present in rat bladder myocytes, which is activated by arachidonic acid and most likely is TREK-1. This K(+) channel may have an important role in the regulation of bladder smooth muscle tone during urine storage. PMID:26911303

  10. PYK2 selectively mediates signals for growth versus differentiation in response to stretch of spontaneously active vascular smooth muscle.

    PubMed

    Bhattachariya, Anirban; Turczyńska, Karolina M; Grossi, Mario; Nordström, Ina; Buckbinder, Leonard; Albinsson, Sebastian; Hellstrand, Per

    2014-01-01

    Stretch of vascular smooth muscle stimulates growth and proliferation as well as contraction and expression of contractile/cytoskeletal proteins, all of which are also regulated by calcium-dependent signals. We studied the role of the calcium- and integrin-activated proline-rich tyrosine kinase 2 (PYK2) in stretch-induced responses of the rat portal vein loaded by a hanging weight ex vivo. PYK2 phosphorylation at Tyr-402 was increased both by a 10-min stretch and by organ culture with load over several days. Protein and DNA synthesis were reduced by the novel PYK2 inhibitor PF-4594755 (0.5-1 μmol/L), while still sensitive to stretch. In 3-day organ culture, PF-4594755 caused maintained myogenic spontaneous activity but did not affect contraction in response to high-K(+) (60 mmol/L) or to α1-adrenergic stimulation by cirazoline. Basal and stretch-induced PYK2 phosphorylation in culture were inhibited by PF-4594755, closely mimicking inhibition of non-voltage-dependent calcium influx by 2-APB (30 μmol/L). In contrast, the L-type calcium channel blocker, nifedipine (1 μmol/L) eliminated stretch-induced but not basal PYK2 phosphorylation. Stretch-induced Akt and ERK1/2 phosphorylation was eliminated by PF-4594755. PYK2 inhibition had no effect on mRNA expression of several smooth muscle markers, and stretch-sensitive SM22α synthesis was preserved. Culture of portal vein with the Ang II inhibitor losartan (1 μmol/L) eliminated stretch sensitivity of PYK2 and Akt phosphorylation, but did not affect mRNA expression of smooth muscle markers. The results suggest that PYK2 signaling functionally distinguishes effects of voltage- and non-voltage-dependent calcium influx. A small-molecule inhibitor of PYK2 reduces growth and DNA synthesis but does not affect contractile differentiation of vascular smooth muscle. PMID:25347863

  11. Effects of trimebutine maleate (TM-906) on electrical and mechanical activities of smooth muscles of the guinea-pig stomach.

    PubMed

    Furukawa, K; Kimoto, Y

    1984-07-01

    The effects of trimebutine maleate (TM-906) on electrical and mechanical activities of smooth muscles of the guinea-pig stomach were investigated using a microelectrode and isometric tension recording methods. TM-906 (2 X 10(-5) M) depolarized the membrane of smooth muscles in the antrum to about 10 mV. From the current-voltage relationship and changes in membrane potentials in various [K]0, the TM-906-induced depolarization is considered to be mainly due to a decrease in the K-conductance. TM-906 increased the amplitude of the first spike potential and regularized the rhythm of slow waves. These excitatory effects are presumably due to the K-channel-blocking action during the repolarizing phase of the spikes and to the depolarization. TM-906 reduced the amplitudes of mechanical activities and slow waves. These inhibitory effects are presumably due to the inhibition of Ca-release from storage sites and to the block of Ca-influx. The biphasic effects are possibly due to the local anesthetic properties. TM-906 modified neither the membrane potential nor the membrane conductance of circular muscles in the fundus. This may mean that the circular muscles in the fundus lack the K-channel sensitive to TM-906. PMID:6482091

  12. Calcium Sensitization Mechanisms in Gastrointestinal Smooth Muscles

    PubMed Central

    Perrino, Brian A

    2016-01-01

    An increase in intracellular Ca2+ is the primary trigger of contraction of gastrointestinal (GI) smooth muscles. However, increasing the Ca2+ sensitivity of the myofilaments by elevating myosin light chain phosphorylation also plays an essential role. Inhibiting myosin light chain phosphatase activity with protein kinase C-potentiated phosphatase inhibitor protein-17 kDa (CPI-17) and myosin phosphatase targeting subunit 1 (MYPT1) phosphorylation is considered to be the primary mechanism underlying myofilament Ca2+ sensitization. The relative importance of Ca2+ sensitization mechanisms to the diverse patterns of GI motility is likely related to the varied functional roles of GI smooth muscles. Increases in CPI-17 and MYPT1 phosphorylation in response to agonist stimulation regulate myosin light chain phosphatase activity in phasic, tonic, and sphincteric GI smooth muscles. Recent evidence suggests that MYPT1 phosphorylation may also contribute to force generation by reorganization of the actin cytoskeleton. The mechanisms responsible for maintaining constitutive CPI-17 and MYPT1 phosphorylation in GI smooth muscles are still largely unknown. The characteristics of the cell-types comprising the neuroeffector junction lead to fundamental differences between the effects of exogenous agonists and endogenous neurotransmitters on Ca2+ sensitization mechanisms. The contribution of various cell-types within the tunica muscularis to the motor responses of GI organs to neurotransmission must be considered when determining the mechanisms by which Ca2+ sensitization pathways are activated. The signaling pathways regulating Ca2+ sensitization may provide novel therapeutic strategies for controlling GI motility. This article will provide an overview of the current understanding of the biochemical basis for the regulation of Ca2+ sensitization, while also discussing the functional importance to different smooth muscles of the GI tract. PMID:26701920

  13. Endothelial and smooth muscle histamine receptors

    SciTech Connect

    Blank, R.S.; Hollis, T.M.

    1986-03-01

    Histamine is produced within the vascular wall and mediates a variety of normal and pathologic vascular responses. The interaction of histamine with its vascular cell receptors has been shown to affect factors such as actin cable formation, cyclase activities, prostacyclin synthesis, cell motility, and proliferation. In addition, abundant evidence exists to implicate an arterial nascent histamine pool in the control of vessel wall permeability under conditions of stress and injury. However, endothelial and smooth muscle cell histamine receptors have been only incompletely characterized. The authors report here the time-dependent, saturable, and trypsin sensitive binding of /sup 3/H-histamine to the endothelial cell surface. The K/sub d/ for endothelial and smooth muscle cell histamine receptors are 0.70 and 2.80 ..mu..M respectively. Histamine binding to smooth muscle cells also exhibited saturation with concentrations of /sup 3/H-histamine up to 4 ..mu..M. While the smooth muscle cell H/sub 1/ receptor binding was negligible, the H/sub 2/ receptor appeared to represent a relatively low affinity, high capacity site for histamine binding. The uptake of /sup 3/H-histamine in both cell types displayed kinetics consistent with that of fluid-phase pinocytosis.

  14. Effect of trimebutine on voltage-activated calcium current in rabbit ileal smooth muscle cells.

    PubMed

    Nagasaki, M; Komori, S; Ohashi, H

    1993-09-01

    1. The effect of trimebutine on the voltage-dependent inward Ca2+ current was investigated by the whole-cell voltage-clamp technique in single smooth muscle cells from rabbit ileum. 2. Trimebutine (3-100 microM) reduced the Ca2+ current in a concentration-dependent manner. The inhibitory effect on the Ca2+ current was also dependent on the holding potential. The Ca2+ current after a low holding potential was inhibited to a greater extent than that after a high membrane potential: the IC50 values were 7 microM and 36 microM at holding potentials of -40 mV and -60 mV, respectively. The Ca2+ current elicited from a holding potential of -80 mV could not be reduced by as much as 50% of the control by trimebutine at concentrations as high as 100 microM. 3. Trimebutine (30 microM) shifted the voltage-dependent inactivation curve for the Ca2+ current by 18 mV in the negative direction. The affinity of the drug for Ca2+ channels was calculated to be 36 times higher in the inactivated state than in the closed-available state. 4. Blockade of the Ca2+ current by trimebutine, unlike verapamil, was not use-dependent. 5. The results suggest that trimebutine inhibits the voltage-dependent inward Ca2+ current through a preferential binding to Ca2+ channels in the inactivated state in the smooth muscle cell from rabbit ileum. The inhibitory effect of trimebutine on gastrointestinal motility is discussed in the light of the present findings. PMID:8220900

  15. Impaired Peroxisome Proliferator-activated Receptor-γ Contributes to Phenotypic Modulation of Vascular Smooth Muscle Cells during Hypertension*

    PubMed Central

    Zhang, Lili; Xie, Peng; Wang, Jingzhou; Yang, Qingwu; Fang, Chuanqin; Zhou, Shuang; Li, Jingcheng

    2010-01-01

    The phenotypic modulation of vascular smooth muscle cells (VSMCs) plays a pivotal role in hypertension-induced vascular changes including vascular remodeling. The precise mechanisms underlying VSMC phenotypic modulation remain elusive. Here we test the role of peroxisome proliferator-activated receptor (PPAR)-γ in the VSMC phenotypic modulation during hypertension. Both spontaneously hypertensive rat (SHR) aortas and SHR-derived VSMCs exhibited reduced PPAR-γ expression and excessive VSMC phenotypic modulation identified by reduced contractile proteins, α-smooth muscle actin (α-SMA) and smooth muscle 22α (SM22α), and enhanced proliferation and migration. PPAR-γ overexpression rescued the expression of α-SMA and SM22α, and inhibited the proliferation and migration in SHR-derived VSMCs. In contrast, PPAR-γ silencing exerted the opposite effect. Activating PPAR-γ using rosiglitazone in vivo up-regulated aortic α-SMA and SM22α expression and attenuated aortic remodeling in SHRs. Increased activation of phosphoinositide 3-kinase (PI3K)/protein kinase B (AKT) signaling was observed in SHR-derived VSMCs. PI3K inhibitor LY294002 rescued the impaired expression of contractile proteins, and inhibited proliferation and migration in VSMCs from SHRs, whereas constitutively active PI3K mutant had the opposite effect. Overexpression or silencing of PPAR-γ inhibited or excited PI3K/Akt activity, respectively. LY294002 counteracted the PPAR-γ silencing induced proliferation and migration in SHR-derived VSMCs, whereas active PI3K mutant had the opposite effect. In contrast, reduced proliferation and migration by PPAR-γ overexpression were reversed by the active PI3K mutant, and further inhibited by LY294002. We conclude that PPAR-γ inhibits VSMC phenotypic modulation through inhibiting PI3K/Akt signaling. Impaired PPAR-γ expression is responsible for VSMC phenotypic modulation during hypertension. These findings highlight an attractive therapeutic target for

  16. Adenosine 3',5'-monophosphate in relation to inhibition of cervical smooth muscle activity in early pregnant women.

    PubMed

    Norström, A; Bryman, I

    1991-08-01

    Contractile activity was registered in strips of cervical tissue obtained by needle biopsy from women in the first trimester of pregnancy. Dibutyryl cyclic adenosine-3',5'-monophosphate (5 x 10(-6) mol/l), isobutyryl methylxanthine (10(-4) mol/l), and forskolin (10(-5)-10(-4) mol/l), the latter two drugs known to increase the levels of endogenous cAMP, inhibited spontaneous muscle activity. The levels of tissue cAMP were determined in strips during relaxation induced by prostaglandin E2 or purified porcine relaxin and compared with cAMP levels in strips from the same women during contractile activity. Exposure to prostaglandin E2 but not to relaxin was followed by increased levels of cAMP. It is suggested that cAMP has a role as a second messenger in the prostaglandin E2-mediated relaxation of cervical smooth muscle. PMID:1654721

  17. Calcium Signaling in Smooth Muscle

    PubMed Central

    Hill-Eubanks, David C.; Werner, Matthias E.; Heppner, Thomas J.; Nelson, Mark T.

    2011-01-01

    Changes in intracellular Ca2+ are central to the function of smooth muscle, which lines the walls of all hollow organs. These changes take a variety of forms, from sustained, cell-wide increases to temporally varying, localized changes. The nature of the Ca2+ signal is a reflection of the source of Ca2+ (extracellular or intracellular) and the molecular entity responsible for generating it. Depending on the specific channel involved and the detection technology employed, extracellular Ca2+ entry may be detected optically as graded elevations in intracellular Ca2+, junctional Ca2+ transients, Ca2+ flashes, or Ca2+ sparklets, whereas release of Ca2+ from intracellular stores may manifest as Ca2+ sparks, Ca2+ puffs, or Ca2+ waves. These diverse Ca2+ signals collectively regulate a variety of functions. Some functions, such as contractility, are unique to smooth muscle; others are common to other excitable cells (e.g., modulation of membrane potential) and nonexcitable cells (e.g., regulation of gene expression). PMID:21709182

  18. Activation of G protein-coupled estrogen receptor induces endothelium-independent relaxation of coronary artery smooth muscle.

    PubMed

    Yu, Xuan; Ma, Handong; Barman, Scott A; Liu, Alexander T; Sellers, Minga; Stallone, John N; Prossnitz, Eric R; White, Richard E; Han, Guichun

    2011-11-01

    Estrogens can either relax or contract arteries via rapid, nongenomic mechanisms involving classic estrogen receptors (ER). In addition to ERα and ERβ, estrogen may also stimulate G protein-coupled estrogen receptor 1 (GPER) in nonvascular tissue; however, a potential role for GPER in coronary arteries is unclear. The purpose of this study was to determine how GPER activity influenced coronary artery reactivity. In vitro isometric force recordings were performed on endothelium-denuded porcine arteries. These studies were augmented by RT-PCR and single-cell patch-clamp experiments. RT-PCR and immunoblot studies confirmed expression of GPER mRNA and protein, respectively, in smooth muscle from either porcine or human coronary arteries. G-1, a selective GPER agonist, produced a concentration-dependent relaxation of endothelium-denuded porcine coronary arteries in vitro. This response was attenuated by G15, a GPER-selective antagonist, or by inhibiting large-conductance calcium-activated potassium (BK(Ca)) channels with iberiotoxin, but not by inhibiting NO signaling. Last, single-channel patch-clamp studies demonstrated that G-1 stimulates BK(Ca) channel activity in intact smooth muscle cells from either porcine or human coronary arteries but had no effect on channels isolated in excised membrane patches. In summary, GPER activation relaxes coronary artery smooth muscle by increasing potassium efflux via BK(Ca) channels and requires an intact cellular signaling mechanism. This novel action of estrogen-like compounds may help clarify some of the controversy surrounding the vascular effects of estrogens. PMID:21791623

  19. The flavonoid quercetin induces apoptosis and inhibits JNK activation in intimal vascular smooth muscle cells

    SciTech Connect

    Perez-Vizcaino, Francisco . E-mail: fperez@med.ucm.es; Bishop-Bailley, David; Lodi, Federica; Duarte, Juan; Cogolludo, Angel; Moreno, Laura; Bosca, Lisardo; Mitchell, Jane A.; Warner, Timothy D.

    2006-08-04

    Quercetin, the most abundant dietary flavonol, exerts vasodilator, anti-hypertensive, and anti-atherogenic effects and reduces the vascular remodelling associated with elevated blood pressure. Here, we have compared the effects of quercetin in intimal- and medial-type rat vascular smooth muscle cells (VSMC) in culture. After 48 h, quercetin reduced the viability of a polyclonal intimal-type cell line derived from neonatal aorta but not of a medial-type cell line derived from adult aorta. These differential effects were similar in both proliferating and quiescent VSMC. Quercetin also preferentially reduced the viability of intimal-type over medial-type VSMC in primary cultures derived from balloon-injured carotid arteries. The effects of quercetin on cell viability were mainly dependent upon induction of apoptosis, as demonstrated by nuclear condensation and fragmentation, and were unrelated to PPAR{gamma}, pro-oxidant effects or nitric oxide. The expression of MAPKs (ERK, p38, and JNK) and ERK phosphorylation were not different between intimal- and medial-type VSMC. p38 phosphorylation was negligible in both cell types. Medial-type showed a weak JNK phosphorylation while this was markedly increased in intimal-type cells. Quercetin reduced JNK phosphorylation but had no consistent effect on ERK phosphorylation. In conclusion, quercetin preferentially produced apoptosis in intimal-type compared to medial-type VSMC. This might play a role in the anti-atherogenic and anti-hypertensive effects of quercetin.

  20. An invertebrate smooth muscle with striated muscle myosin filaments

    PubMed Central

    Sulbarán, Guidenn; Alamo, Lorenzo; Pinto, Antonio; Márquez, Gustavo; Méndez, Franklin; Padrón, Raúl; Craig, Roger

    2015-01-01

    Muscle tissues are classically divided into two major types, depending on the presence or absence of striations. In striated muscles, the actin filaments are anchored at Z-lines and the myosin and actin filaments are in register, whereas in smooth muscles, the actin filaments are attached to dense bodies and the myosin and actin filaments are out of register. The structure of the filaments in smooth muscles is also different from that in striated muscles. Here we have studied the structure of myosin filaments from the smooth muscles of the human parasite Schistosoma mansoni. We find, surprisingly, that they are indistinguishable from those in an arthropod striated muscle. This structural similarity is supported by sequence comparison between the schistosome myosin II heavy chain and known striated muscle myosins. In contrast, the actin filaments of schistosomes are similar to those of smooth muscles, lacking troponin-dependent regulation. We conclude that schistosome muscles are hybrids, containing striated muscle-like myosin filaments and smooth muscle-like actin filaments in a smooth muscle architecture. This surprising finding has broad significance for understanding how muscles are built and how they evolved, and challenges the paradigm that smooth and striated muscles always have distinctly different components. PMID:26443857

  1. Mechanics of Vascular Smooth Muscle.

    PubMed

    Ratz, Paul H

    2015-01-01

    Vascular smooth muscle (VSM; see Table 1 for a list of abbreviations) is a heterogeneous biomaterial comprised of cells and extracellular matrix. By surrounding tubes of endothelial cells, VSM forms a regulated network, the vasculature, through which oxygenated blood supplies specialized organs, permitting the development of large multicellular organisms. VSM cells, the engine of the vasculature, house a set of regulated nanomotors that permit rapid stress-development, sustained stress-maintenance and vessel constriction. Viscoelastic materials within, surrounding and attached to VSM cells, comprised largely of polymeric proteins with complex mechanical characteristics, assist the engine with countering loads imposed by the heart pump, and with control of relengthening after constriction. The complexity of this smart material can be reduced by classical mechanical studies combined with circuit modeling using spring and dashpot elements. Evaluation of the mechanical characteristics of VSM requires a more complete understanding of the mechanics and regulation of its biochemical parts, and ultimately, an understanding of how these parts work together to form the machinery of the vascular tree. Current molecular studies provide detailed mechanical data about single polymeric molecules, revealing viscoelasticity and plasticity at the protein domain level, the unique biological slip-catch bond, and a regulated two-step actomyosin power stroke. At the tissue level, new insight into acutely dynamic stress-strain behavior reveals smooth muscle to exhibit adaptive plasticity. At its core, physiology aims to describe the complex interactions of molecular systems, clarifying structure-function relationships and regulation of biological machines. The intent of this review is to provide a comprehensive presentation of one biomachine, VSM. PMID:26756629

  2. Role of mitochondria in spontaneous rhythmic activity and intracellular calcium waves in the guinea pig gallbladder smooth muscle.

    PubMed

    Balemba, Onesmo B; Bartoo, Aaron C; Nelson, Mark T; Mawe, Gary M

    2008-02-01

    Mitochondrial Ca(2+) handling has been implicated in spontaneous rhythmic activity in smooth muscle and interstitial cells of Cajal. In this investigation we evaluated the effect of mitochondrial inhibitors on spontaneous action potentials (APs), Ca(2+) flashes, and Ca(2+) waves in gallbladder smooth muscle (GBSM). Disruption of the mitochondrial membrane potential with carbonyl cyanide 3-chlorophenylhydrazone, carbonyl cyanide 4-(trifluoromethoxy) phenylhydrazone, rotenone, and antimycin A significantly reduced or eliminated APs, Ca(2+) flashes, and Ca(2+) waves in GBSM. Blockade of ATP production with oligomycin did not alter APs or Ca(2+) flashes but significantly reduced Ca(2+) wave frequency. Inhibition of mitochondrial Ca(2+) uptake and Ca(2+) release with Ru360 and CGP-37157, respectively, reduced the frequency of Ca(2+) flashes and Ca(2+) waves in GBSM. Similar to oligomycin, cyclosporin A did not alter AP and Ca(2+) flash frequency but significantly reduced Ca(2+) wave activity. These data suggest that mitochondrial Ca(2+) handling is necessary for the generation of spontaneous electrical activity and may therefore play an important role in gallbladder tone and motility. PMID:18048480

  3. PYK2 selectively mediates signals for growth versus differentiation in response to stretch of spontaneously active vascular smooth muscle

    PubMed Central

    Bhattachariya, Anirban; Turczyńska, Karolina M.; Grossi, Mario; Nordström, Ina; Buckbinder, Leonard; Albinsson, Sebastian; Hellstrand, Per

    2014-01-01

    Abstract Stretch of vascular smooth muscle stimulates growth and proliferation as well as contraction and expression of contractile/cytoskeletal proteins, all of which are also regulated by calcium‐dependent signals. We studied the role of the calcium‐ and integrin‐activated proline‐rich tyrosine kinase 2 (PYK2) in stretch‐induced responses of the rat portal vein loaded by a hanging weight ex vivo. PYK2 phosphorylation at Tyr‐402 was increased both by a 10‐min stretch and by organ culture with load over several days. Protein and DNA synthesis were reduced by the novel PYK2 inhibitor PF‐4594755 (0.5–1 μmol/L), while still sensitive to stretch. In 3‐day organ culture, PF‐4594755 caused maintained myogenic spontaneous activity but did not affect contraction in response to high‐K+ (60 mmol/L) or to α1‐adrenergic stimulation by cirazoline. Basal and stretch‐induced PYK2 phosphorylation in culture were inhibited by PF‐4594755, closely mimicking inhibition of non‐voltage‐dependent calcium influx by 2‐APB (30 μmol/L). In contrast, the L‐type calcium channel blocker, nifedipine (1 μmol/L) eliminated stretch‐induced but not basal PYK2 phosphorylation. Stretch‐induced Akt and ERK1/2 phosphorylation was eliminated by PF‐4594755. PYK2 inhibition had no effect on mRNA expression of several smooth muscle markers, and stretch‐sensitive SM22α synthesis was preserved. Culture of portal vein with the Ang II inhibitor losartan (1 μmol/L) eliminated stretch sensitivity of PYK2 and Akt phosphorylation, but did not affect mRNA expression of smooth muscle markers. The results suggest that PYK2 signaling functionally distinguishes effects of voltage‐ and non‐voltage‐dependent calcium influx. A small‐molecule inhibitor of PYK2 reduces growth and DNA synthesis but does not affect contractile differentiation of vascular smooth muscle. PMID:25347863

  4. The effect of hyperpolarization-activated cyclic nucleotide-gated ion channel inhibitors on the vagal control of guinea pig airway smooth muscle tone

    PubMed Central

    McGovern, Alice E; Robusto, Jed; Rakoczy, Joanna; Simmons, David G; Phipps, Simon; Mazzone, Stuart B

    2014-01-01

    BACKGROUND AND PURPOSE Subtypes of the hyperpolarization-activated cyclic nucleotide-gated (HCN) family of cation channels are widely expressed on nerves and smooth muscle cells in many organ systems, where they serve to regulate membrane excitability. Here we have assessed whether HCN channel inhibitors alter the function of airway smooth muscle or the neurons that regulate airway smooth muscle tone. EXPERIMENTAL APPROACH The effects of the HCN channel inhibitors ZD7288, zatebradine and Cs+ were assessed on agonist and nerve stimulation-evoked changes in guinea pig airway smooth muscle tone using tracheal strips in vitro, an innervated tracheal tube preparation ex vivo or in anaesthetized mechanically ventilated guinea pigs in vivo. HCN channel expression in airway nerves was assessed using immunohistochemistry, PCR and in situ hybridization. KEY RESULTS HCN channel inhibition did not alter airway smooth muscle reactivity in vitro to exogenously administered smooth muscle spasmogens, but significantly potentiated smooth muscle contraction evoked by the sensory nerve stimulant capsaicin and electrical field stimulation of parasympathetic cholinergic postganglionic neurons. Sensory nerve hyperresponsiveness was also evident in in vivo following HCN channel blockade. Cs+, but not ZD7288, potentiated preganglionic nerve-dependent airway contractions and over time induced autorhythmic preganglionic nerve activity, which was not mimicked by inhibitors of potassium channels. HCN channel expression was most evident in vagal sensory ganglia and airway nerve fibres. CONCLUSIONS AND IMPLICATIONS HCN channel inhibitors had a previously unrecognized effect on the neural regulation of airway smooth muscle tone, which may have implications for some patients receiving HCN channel inhibitors for therapeutic purposes. PMID:24762027

  5. Monocyte/macrophage cytokine activity regulates vascular smooth muscle cell function within a degradable polyurethane scaffold.

    PubMed

    Battiston, K G; Ouyang, B; Labow, R S; Simmons, C A; Santerre, J P

    2014-03-01

    Tissue engineering strategies rely on the ability to promote cell proliferation and migration into porous biomaterial constructs, as well as to support specific phenotypic states of the cells in vitro. The present study investigated the use of released factors from monocytes and their derived macrophages (MDM) and the mechanism by which they regulate vascular smooth muscle cell (VSMC) response in a VSMC-monocyte co-culture system within a porous degradable polyurethane (D-PHI) scaffold. VSMCs cultured in monocyte/MDM-conditioned medium (MCM), generated from the culture of monocytes/MDM on D-PHI scaffolds for up to 28 days, similarly affected VSMC contractile marker expression, growth and three-dimensional migration when compared to direct VSMC-monocyte co-culture. Monocyte chemotactic protein-1 (MCP-1) and interleukin-6 (IL-6) were identified as two cytokines present in MCM, at concentrations that have previously been shown to influence VSMC phenotype. VSMCs cultured alone on D-PHI scaffolds and exposed to MCP-1 (5 ng ml(-1)) or IL-6 (1 ng ml(-1)) for 7 days experienced a suppression in contractile marker expression (with MCP-1 or IL-6) and increased growth (with MCP-1) compared to no cytokine medium supplementation. These effects were also observed in VSMC-monocyte co-culture on D-PHI. Neutralization of IL-6, but not MCP-1, was subsequently shown to decrease VSMC growth and enhance calponin expression for VSMC-monocyte co-cultures on D-PHI scaffolds for 7 days, implying that IL-6 mediates VSMC response in monocyte-VSMC co-cultures. This study highlights the use of monocytes and their derived macrophages in conjunction with immunomodulatory biomaterials, such as D-PHI, as agents for regulating VSMC response, and demonstrates the importance of monocyte/MDM-released factors, such as IL-6 in particular, in this process. PMID:24361424

  6. Effect of palmitate on carbohydrate utilization and Na/K-ATPase activity in aortic vascular smooth muscle from diabetic rats.

    PubMed

    Smith, J M; Solar, S M; Paulson, D J; Hill, N M; Broderick, T L

    1999-04-01

    Several investigators have reported that carbohydrate metabolism is suppressed in blood vessels from diabetic (Db) rats. However, it is not known if metabolites from the reciprocal increase in oxidation of long-chain fatty acids that accompanies insulin-deficiency exacerbates the suppression of this pathway in the Db blood vessels. Such inhibition may have particularly deleterious consequences in vascular smooth muscle since aerobic glycolysis is believed to preferentially fuel the sarcolemmal Na/K ATPase in this tissue. Therefore, this study evaluated the effect of physiological (0.4 mM) and elevated (1.2 mM) concentrations of the long-chain fatty acid palmitate on both carbohydrate utilization and Na/K-ATPase activity in aorta from insulin-deficient Db rat. Thoracic aorta were removed from 10 week Db (streptozotocin 60 mg/Kg , i.v.) or control (C) rats and intima-media aortic preparations were incubated in the absence or presence of palmitate. Glycolysis (microM/g dry wt/h) and glucose oxidation (microM/g dry wt/h) were quantified using 3H-glucose and 14C-glucose, respectively. Na/K-ATPase activity was estimated by the measurement of 86rubidium uptake in the absence and presence of 2 mM ouabain. In the absence of exogenous palmitate, glycolysis (p < 0.05), glucose oxidation (p < 0.01) and the estimated ATP production from exogenous glucose were decreased in aorta from Db rat. However, despite this diminished rate of glycolysis, Na/K ATPase activity was similar in Db and C aorta. Palmitate (0.4 mM) inhibited Na/K ATPase activity and glucose oxidation to a similar extent in both Db and C but had no effect on glycolysis in either group. Elevation of palmitate to 1.2 mM had no additional inhibitory effect on glucose oxidation, Na/K ATPase activity or glycolysis in either the Db or C aorta. The metabolism of exogenous palmitate restored the ATP production in Db to control values. These data demonstrate that, despite the diminished glycolysis and glucose oxidation

  7. Calcitonin gene-related peptide activated ATP-sensitive K+ currents in rabbit arterial smooth muscle via protein kinase A.

    PubMed Central

    Quayle, J M; Bonev, A D; Brayden, J E; Nelson, M T

    1994-01-01

    1. Whole-cell K+ currents activated by calcitonin gene-related peptide (CGRP) in smooth muscle cells enzymatically isolated from rabbit mesenteric arteries were measured in the conventional and perforated configurations of the patch clamp technique. The signal transduction pathway from CGRP receptors to activation of potassium currents was investigated. 2. CGRP (10 nM) activated a whole-cell current that was blocked by glibenclamide (10 microM), an inhibitor of ATP-sensitive K+ channels. Elevating intracellular ATP reduced glibenclamide-sensitive currents. CGRP increased the glibenclamide-sensitive currents by 3- to 6-fold in cells dialysed with 0.1 mM ATP, 3.0 mM ATP or in intact cells. The reversal potential of the glibenclamide-sensitive current in the presence of CGRP shifted with the potassium equilibrium potential, while its current-voltage relationship exhibited little voltage dependence. 3. Forskolin (10 microM), an adenylyl cyclase activator, Sp-cAMPS (500 microM) and the catalytic subunit of protein kinase A increased glibenclamide-sensitive K+ currents 2.1-, 3.3- and 8.2-fold, respectively. 4. Nitric oxide and nitroprusside did not activate glibenclamide-sensitive K+ currents. 5. Dialysis of the cell's interior with inhibitors of protein kinase A (synthetic peptide inhibitor, 4.6 microM or H-8, 100 microM) completely blocked activation of K+ currents by CGRP. 6. Our results suggest the following signal transduction scheme for activation of K+ currents by CGRP in arterial smooth muscle: (1) CGRP stimulates adenylyl cyclase, which leads to an elevation of cAMP; (2) cAMP activates protein kinase A, which opens ATP-sensitive K+ channels. PMID:8189394

  8. Nonadrenergic, noncholinergic responses stabilize smooth muscle tone, with and without parasympathetic activation, in guinea-pig isolated airways.

    PubMed

    Lindén, A; Löfdahl, C G; Ullman, A; Skoogh, B E

    1993-03-01

    In guinea-pig isolated airways, nonadrenergic, noncholinergic (NANC) neural responses converge towards a similar level of smooth muscle tone, via a contraction when the tone is low prior to stimulation, and via a relaxation when the tone is high prior to stimulation. We wanted to assess the effect of simultaneous parasympathetic activation on these converging NANC responses, with and without the addition of sympathetic activation. In guinea-pig isolated airways, the spontaneous airway tone was initially abolished by indomethacin (10 microM). In one series, adrenergic depletion by guanethidine (10 microM) was then established, with and without cholinergic blockade by atropine (1 microM). In another series, either cholinergic blockade by atropine (1 microM) or no blockade was utilized. Responses to electrical field stimulation (1,200 mA, 0.5 ms, 3 Hz for 240 s) were studied with no induced tone, at a moderate (0.3 microM) and at a near-maximum (6 microM), histamine-induced tone. The mean level of the tonus equilibrium (% of maximum tone) was higher with the simultaneous NANC and parasympathetic activation than with NANC activation alone (75% compared with 44%, in the main bronchus, n = 8). The level of the tonus equilibrium was also higher with the simultaneous NANC, sympathetic and parasympathetic activation than with NANC and sympathetic activation only (49% compared with 21%, in the main bronchus, n = 8). The pattern was similar in the distal trachea. In conclusion, NANC neural responses can stabilize smooth muscle tone, and this stabilizing effect can be modulated by both parasympathetic and sympathetic activation, in guinea-pig isolated airways. PMID:8472834

  9. Store depletion induces Gαq-mediated PLCβ1 activity to stimulate TRPC1 channels in vascular smooth muscle cells

    PubMed Central

    Shi, Jian; Miralles, Francesc; Birnbaumer, Lutz; Large, William A.; Albert, Anthony P.

    2016-01-01

    Depletion of sarcoplasmic reticulum (SR) Ca2+ stores activates store-operated channels (SOCs) composed of canonical transient receptor potential (TRPC) 1 proteins in vascular smooth muscle cells (VSMCs), which contribute to important cellular functions. We have previously shown that PKC is obligatory for activation of TRPC1 SOCs in VSMCs, and the present study investigates if the classic phosphoinositol signaling pathway involving Gαq-mediated PLC activity is responsible for driving PKC-dependent channel gating. The G-protein inhibitor GDP-β-S, anti-Gαq antibodies, the PLC inhibitor U73122, and the PKC inhibitor GF109203X all inhibited activation of TRPC1 SOCs, and U73122 and GF109203X also reduced store-operated PKC-dependent phosphorylation of TRPC1 proteins. Three distinct SR Ca2+ store-depleting agents, 1,2-bis(2-aminophenoxy)ethane-N,N,N′,N′-tetraacetic acid acetoxymethyl ester, cyclopiazonic acid, and N,N,N′,N′-tetrakis(2-pyridylmethyl)ethane-1,2-diamineed, induced translocations of the fluorescent biosensor GFP-PLCδ1-PH from the cell membrane to the cytosol, which were inhibited by U73122. Knockdown of PLCβ1 with small hairpin RNA reduced both store-operated PLC activity and stimulation of TRPC1 SOCs. Immunoprecipitation studies and proximity ligation assays revealed that store depletion induced interactions between TRPC1 and Gαq, and TRPC1 and PLCβ1. We propose a novel activation mechanism for TRPC1 SOCs in VSMCs, in which store depletion induces formation of TRPC1-Gαq-PLCβ1 complexes that lead to PKC stimulation and channel gating.—Shi, J., Miralles, F., Birnbaumer, L., Large, W. A., Albert, A. P. Store depletion induces Gαq-mediated PLCβ1 activity to stimulate TRPC1 channels in vascular smooth muscle cells. PMID:26467792

  10. Activations of the Ca dependent K channel by Ca released from the sarcoplasmic reticulum of mammalian smooth muscles.

    PubMed

    Kitamura, K; Sakai, T; Kajioka, S; Kuriyama, H

    1989-01-01

    In mammalian smooth muscles, the outward K current recorded using the whole cell voltage clamp or patch clamp methods can be classified into the Ca-dependent and independent K currents. The former is sub-classified into the extra- and intra-cellular Ca dependent K current. The intra-cellular Ca dependent K current has a close relation to Ca released from the sarcoplasmic reticulum, i.e. Ca released by inositol 1,4,5-trisphosphate (InsP3), ryanodine or Ca ionophores (A23187 or ionomycin) modify the appearance of the K current. The transient (Ca dependent) outward current evoked by depolarization pulses, as measured using the whole cell voltage clamp method, is closely related with after-hyperpolarization of the action potential as recorded using the microelectrode method and is postulated to be due to activations of the Ca-induced Ca release mechanism in the sarcoplasmic reticulum. The oscillatory (Ca dependent) outward K current is closely related with the amount of Ca released from the sarcoplasmic reticulum during the long depolarization induced by electrical stimulation (command pulse) or applications of Ca releasers such as InsP3 or ryanodine. In this review, the Ca dependent K current recorded from smooth muscle cells is compared with the influx and release of Ca. PMID:2667516

  11. Endogenous Cytosolic Ca2+ Buffering is Necessary for TRPM4 Activity in Cerebral Artery Smooth Muscle Cells

    PubMed Central

    Gonzales, Albert L.; Earley, Scott

    2011-01-01

    The melastatin transient receptor potential (TRP) channel, TRPM4, is a critical regulator of smooth muscle membrane potential and arterial tone. Activation of the channel is Ca2+-dependent, but prolonged exposures to high global Ca2+ causes rapid inactivation under conventional whole-cell patch clamp conditions. Using amphotericin B perforated whole cell patch clamp electrophysiology, which minimally disrupts cytosolic Ca2+ dynamics, we recently showed that Ca2+ released from inositol trisphosphate receptors (IP3R) on the sarcoplasmic reticulum (SR) activates TRPM4 channels, producing sustained Transient Inward Cation Currents (TICCs). Thus, Ca2+-dependent inactivation of TRPM4 may not be inherent to the channel itself but rather is a result of the recording conditions. We hypothesized that under conventional whole-cell configurations, loss of intrinsic cytosolic Ca2+ buffering following cell dialysis contributes to inactivation of TRPM4 channels. With the inclusion of the Ca2+ buffers ethylene glycol-bis(2-aminoethylether)-N,N,N′,N′-tetraacetic acid (EGTA, 10 mM) or bis-ethane-N,N,N′,N′-tetraacetic acid (BAPTA, 0.1 mM) in the pipette solution, we mimic endogenous Ca2+ buffering and record novel, sustained whole-cell TICC activity from freshly-isolated cerebral artery myocytes. Biophysical properties of TICCs recorded under perforated and whole-cell patch clamp were nearly identical. Furthermore, whole-cell TICC activity was reduced by the selective TRPM4 inhibitor, 9-phenanthrol, and by siRNA-mediated knockdown of TRPM4. When a higher concentration (10 mM) of BAPTA was included in the pipette solution, TICC activity was disrupted, suggesting that TRPM4 channels on the plasma membrane and IP3R on the SR are closely opposed but not physically coupled, and that endogenous Ca2+ buffer proteins play a critical role in maintaining TRPM4 channel activity in native cerebral artery smooth muscle cells. PMID:22153976

  12. miR-143 Activation Regulates Smooth Muscle and Endothelial Cell Crosstalk in Pulmonary Arterial Hypertension

    PubMed Central

    Stevens, Hannah; Lu, Ruifang; Caudrillier, Axelle; McBride, Martin; McClure, John D; Grant, Jenny; Thomas, Matthew; Frid, Maria; Stenmark, Kurt; White, Kevin; Seto, Anita G.; Morrell, Nicholas W.; Bradshaw, Angela C; MacLean, Margaret R.; Baker, Andrew H.

    2015-01-01

    Rationale The pathogenesis of PAH remains unclear. The four microRNAs representing the miR-143 and miR-145 stem loops are genomically clustered. Objective To elucidate the transcriptional regulation of the miR-143/145 cluster, and the role of miR-143 in PAH. Methods and Results We identified the promoter region that regulates miR-143/145 miRNA expression in pulmonary artery smooth muscle cells (PASMCs). We mapped PAH-related signalling pathways, including estrogens receptor (ER), liver X factor/retinoic X receptor (LXR/RXR), TGF-β (Smads), and hypoxia (HRE) that regulated levels of all pri-miR stem loop transcription and resulting miRNA expression. We observed that miR-143-3p is selectively upregulated compared to miR-143-5p during PASMC migration. Modulation of miR-143 in PASMCs significantly altered cell migration and apoptosis. In addition, we found high abundance of miR-143-3p in PASMCs-derived exosomes. Using assays with pulmonary arterial endothelial cells (PAECs) we demonstrated a paracrine pro-migratory and pro-angiogenic effect of miR-143-3p enriched exosomes from PASMC. Quantitative PCR and in situ hybridisation showed elevated expression of miR-143 in calf models of PAH as well as in samples from PAH patients. Moreover, in contrast to our previous findings that had not supported a therapeutic role in vivo, we now demonstrate a protective role for miR-143 in experimental PH in vivo in miR-143−/− and antimiR143-3p-treated mice exposed to chronic hypoxia in both preventative and reversal settings. Conclusions miR-143-3p modulated both cellular and exosome-mediated responses in pulmonary vascular cells, while inhibition of miR-143-3p blocked experimental PH. Taken together these findings confirm an important role for the miR-143/145 cluster in PAH pathobiology. PMID:26311719

  13. Emergence of airway smooth muscle functions related to structural malleability

    PubMed Central

    Fredberg, Jeffrey J.

    2011-01-01

    The function of a complex system such as a smooth muscle cell is the result of the active interaction among molecules and molecular aggregates. Emergent macroscopic manifestations of these molecular interactions, such as the length-force relationship and its associated length adaptation, are well documented, but the molecular constituents and organization that give rise to these emergent muscle behaviors remain largely unknown. In this minireview, we describe emergent properties of airway smooth muscle that seem to have originated from inherent fragility of the cellular structures, which has been increasingly recognized as a unique and important smooth muscle attribute. We also describe molecular interactions (based on direct and indirect evidence) that may confer malleability on fragile structural elements that in turn may allow the muscle to adapt to large and frequent changes in cell dimensions. Understanding how smooth muscle works may hinge on how well we can relate molecular events to its emergent macroscopic functions. PMID:21127211

  14. Endothelin stimulates a sustained 1,2-diacylglycerol increase and protein kinase C activation in bovine aortic smooth muscle cells

    SciTech Connect

    Lee, T.S.; Chao, T.; Hu, K.Q.; King, G.L.

    1989-07-14

    Endothelin is a long-lasting potent vasoconstrictor peptide. We report here that in bovine aortic smooth muscle cells, endothelin biphasically increased total cellular diacylglycerol (DAG) content. When cellular DAG was labeled with (/sup 14/C) glycerol for 48h, endothelin stimulated (/sup 14/C)DAG formation in a biphasic pattern. Only one prolonged phase of DAG accumulation was observed when cells were labeled with (/sup 3/H)glycerol for 2 h. Endothelin induced an increase in the membranous protein kinase C (PKC) activities, which lasted for more than 20 min. These data suggest that (i) endothelin stimulates a sustained generation of DAG, (ii) this accumulation of DAG results in a sustained translocation of cytosolic PKC activities to the membrane.

  15. Activation of the Ca{sup 2+}/calcineurin/NFAT{sub 2} pathway controls smooth muscle cell differentiation

    SciTech Connect

    Larrieu, Daniel; Thiebaud, Pierre; Duplaa, Cecile; Sibon, Igor; Theze, Nadine; Lamaziere, Jean-Marie Daniel . E-mail: jean-marie.d-lamaziere@bordeaux.inserm.fr

    2005-10-15

    Cellular mechanisms controlling smooth muscle cells (SMCs) phenotypic modulation are largely unknown. Intracellular Ca{sup 2+} movements are essential to ensure SMC functions; one of the roles of Ca{sup 2+} is to regulate calcineurin, which in turn induces nuclear localization of the nuclear factor of activated T-cell (NFAT). In order to investigate, during phenotypic differentiation of SMCs, the effect of calcineurin inhibition on NFAT{sub 2} nuclear translocation, we used a culture model of SMC differentiation in serum-free conditions. We show that the treatment of cultured SMC with the calcineurin inhibitor cyclosporine A induced their dedifferentiation while preventing their differentiation. These findings suggest that nuclear translocation of NFAT{sub 2} is dependent of calcineurin activity during the in vitro SMC differentiation kinetic and that the nuclear presence of NFAT{sub 2} is critical in the acquisition and maintenance of SMC differentiation.

  16. Acrylodan smooth muscle tropomyosin reports differences in effects of troponin and caldesmon in the transition from the active state to the inactive state†

    PubMed Central

    Chalovich, Joseph M.; Lutz, Evan; Baxley, Tamatha; Schroeter, Mechthild M.

    2011-01-01

    Changes in the orientation of tropomyosin on actin are important for the regulation of striated muscle contraction and could also be important for smooth muscle regulation. We showed earlier that acrylodan-labeled skeletal muscle tropomyosin reports the kinetics of the reversible transitions among the active, intermediate and inactive states when S11 is rapidly detached from actin-tropomyosin. We now show that acrylodan-labeled smooth muscle tropomyosin reports similar transitions among states of actin-tropomyosin. When S1 was rapidly detached from actin-smooth muscle tropomyosin there was a rapid decrease in acrylodan-tropomyosin fluorescence as the intermediate state became populated. The rate constant for this process was >600/sec at temperatures near 5° C. In the presence of skeletal troponin and EGTA, the decrease in fluorescence was followed by a redevelopment of fluorescence as the inactive state became populated. The apparent rate constant for the fluorescence increase was 14/sec at 5° C. Substituting smooth muscle caldesmon for skeletal muscle troponin produced a similar decrease and re-increase in fluorescence but the apparent rate constant for the increase was >10 times that observed with troponin. Furthermore, the fluorescence increase was correlated with an increase in caldesmon attachment as S1-ATP dissociated. Although the measured rate constant appeared to reflect the rate limiting transition for inactivation it is unclear if the fluorescence change resulted from caldesmon binding, tropomyosin movement over actin or both. PMID:21639115

  17. Effects of flavone on the contractile activity of the circular smooth muscle of the rabbit middle colon in vitro.

    PubMed

    Benabdallah, Hassiba; Gharzouli, Kamel

    2015-08-01

    The circular smooth muscles of the middle colon of the rabbit generate giant contractions of high amplitude and low frequency. Flavone, at various concentrations, reduces the giant contractions and the tonic contraction induced by 10 µM carbachol and 80 mM KCl. The contractions induced by dequalinium and tetraethylammonium are reduced by flavone (30 µM). At 100 µM, flavone decreases the contraction induced by 100 µM methylene blue and 1mM orthovanadate. These results suggest that flavone inhibit the giant contractions by (1) inhibition of voltage-dependent Ca(2+) channels, (2) activation of guanyl cyclase, (3) opening of K(+) channels and (4) inhibition of tyrosines kinases. PMID:25895637

  18. Antinociceptive and Smooth Muscle Relaxant Activity of Croton tiglium L Seed: An In-vitro and In-vivo Study.

    PubMed

    Liu, Zhen; Gao, Wenyuan; Zhang, Jingze; Hu, Jing

    2012-01-01

    The seed of Croton tiglium L. (SCT) is a well known folk medicine. In China, it has used to treat gastrointestinal disorders, intestinal inflammation, rheumatism, and so on. Previous studies established its purgative and inflammation properties. In addition, the effects of essential oil of SCT on intestinal transit and gastrointestinal tract has been studied. In the present study, we evaluated the antinociceptive effect of SCT through the writhing test in mice, investigated the effects of it on spontaneous smooth muscle contractions of isolated rabbit jejunum and examined the in-vitro results through the in-vivo small intestine propulsion. We further investigated the possible compounds using HPLC-MS, and six compounds were tentatively identified as phorbol esters. Furthermore, the possible fragmentation pathways of phorbol esters were proposed, and we also detected the possible compounds in the active parts. PMID:24250486

  19. A monoclonal antibody to the calmodulin-binding (Ca2+ + Mg2+)-dependent ATPase from pig stomach smooth muscle inhibits plasmalemmal (Ca2+ + Mg2+)-dependent ATPase activity.

    PubMed Central

    Verbist, J; Wuytack, F; Raeymaekers, L; Van Leuven, F; Cassiman, J J; Casteels, R

    1986-01-01

    A monoclonal antibody (2B3) directed against the calmodulin-binding (Ca2+ + Mg2+)-dependent ATPase from pig stomach smooth muscle was prepared. This antibody reacts with a 130,000-Mr protein that co-migrates on SDS/polyacrylamide-gel electrophoresis with the calmodulin-binding (Ca2+ + Mg2+)-ATPase purified from smooth muscle by calmodulin affinity chromatography. The antibody causes partial inhibition of the (Ca2+ + Mg2+)-ATPase activity in plasma membranes from pig stomach smooth muscle, in pig erythrocytes and human erythrocytes. It appears to be directed against a specific functionally important site of the plasmalemmal Ca2+-transport ATPase and acts as a competitive inhibitor of ATP binding. Binding of the antibody does not change the Km of the ATPase for Ca2+ and its inhibitory effect is not altered by the presence of calmodulin. No inhibition of (Ca2+ + Mg2+)-ATPase activity or of the oxalate-stimulated Ca2+ uptake was observed in a pig smooth-muscle vesicle preparation enriched in endoplasmic reticulum. These results confirm the existence in smooth muscle of two different types of Ca2+-transport ATPase: a calmodulin-binding (Ca2+ + Mg2+)-ATPase located in the plasma membrane and a second one confined to the endoplasmic reticulum. Images Fig. 4. Fig. 5. PMID:2950852

  20. Detection of differentially regulated subsarcolemmal calcium signals activated by vasoactive agonists in rat pulmonary artery smooth muscle cells

    PubMed Central

    Subedi, Krishna P.; Paudel, Omkar

    2013-01-01

    Intracellular calcium (Ca2+) plays pivotal roles in distinct cellular functions through global and local signaling in various subcellular compartments, and subcellular Ca2+ signal is the key factor for independent regulation of different cellular functions. In vascular smooth muscle cells, subsarcolemmal Ca2+ is an important regulator of excitation-contraction coupling, and nucleoplasmic Ca2+ is crucial for excitation-transcription coupling. However, information on Ca2+ signals in these subcellular compartments is limited. To study the regulation of the subcellular Ca2+ signals, genetically encoded Ca2+ indicators (cameleon), D3cpv, targeting the plasma membrane (PM), cytoplasm, and nucleoplasm were transfected into rat pulmonary arterial smooth muscle cells (PASMCs) and Ca2+ signals were monitored using laser scanning confocal microscopy. In situ calibration showed that the Kd for Ca2+ of D3cpv was comparable in the cytoplasm and nucleoplasm, but it was slightly higher in the PM. Stimulation of digitonin-permeabilized cells with 1,4,5-trisphosphate (IP3) elicited a transient elevation of Ca2+ concentration with similar amplitude and kinetics in the nucleoplasm and cytoplasm. Activation of G protein-coupled receptors by endothelin-1 and angiotensin II preferentially elevated the subsarcolemmal Ca2+ signal with higher amplitude in the PM region than the nucleoplasm and cytoplasm. In contrast, the receptor tyrosine kinase activator, platelet-derived growth factor, elicited Ca2+ signals with similar amplitudes in all three regions, except that the rise-time and decay-time were slightly slower in the PM region. These data clearly revealed compartmentalization of Ca2+ signals in the subsarcolemmal regions and provide the basis for further investigations of differential regulation of subcellular Ca2+ signals in PASMCs. PMID:24352334

  1. TRPC channels in smooth muscle cells.

    PubMed

    Gonzalez-Cobos, Jose C; Trebak, Mohamed

    2010-01-01

    Transient receptor potential canonical (TRPC) proteins constitute a family of seven (TRPC1-7) nonselective cation channels within the wider TRP superfamily. TRPC1, TRPC3, TRPC4, TRPC5 and TRPC6 channels are expressed in vascular smooth muscle cells from human vessels of all calibers and in smooth muscle from organs such as the uterus and the gastrointestinal tract. TRPC channels have recently emerged as important players in the control of smooth muscle function. This review will focus on the retrospective analysis of studies proposing contributions of TRPC channels to native calcium entry pathways in smooth muscle and to physiological and pathophysiological responses with emphasis on the vascular system. PMID:20515740

  2. Abnormal Activation of RhoA/ROCK-I Signaling in Junctional Zone Smooth Muscle Cells of Patients With Adenomyosis.

    PubMed

    Wang, S; Duan, H; Zhang, Y; Sun, F Q

    2016-03-01

    Adenomyosis (ADS) is a common estrogen-dependent gynecological disease with unknown etiology. The RhoA/Rho-kinase (ROCK) signaling pathway is involved in various cellular functions, including migration, proliferation, and smooth muscle contraction. Here we examined the potential role of this pathway in junctional zone (JZ) contraction in women with and without ADS. We demonstrated that in the normal JZ, RhoA and ROCK-I messenger RNA (mRNA) and protein expression was significantly higher in the proliferative phase of the menstrual cycle than in the secretory phase. Expression of RhoA and ROCK-I in the JZ from women with ADS was significantly higher than in the control women and showed no significant differences across the menstrual cycle. Treatment of JZ smooth muscle cells (JZSMCs) with estrogen at 0, 1, 10, or 100 nmol/L for 24 hours resulted in increased expression of RhoA, ROCK-I, and myosin light-chain (MLC) phosphorylation (p-MLC) in a dose-dependent manner. In parallel to its effects on p-MLC, estrogen-mediated, dose-dependent contraction responses in JZSMCs. Estrogen-mediated contraction in the ADS group was significantly higher than in the controls and also showed no significant differences across the menstrual cycle. These effects were suppressed in the presence of ICI 182780 or Y27632, supporting an estrogen receptor-dependent and RhoA activation-dependent mechanism. Our results indicate that the level of RhoA and ROCK-I increases in patients with ADS and the cyclic change is lost. Estrogen may affect uterine JZ contraction of ADS by enhancing RhoA/ ROCK-I signaling. PMID:26335177

  3. Modeling the dispersion effects of contractile fibers in smooth muscles

    NASA Astrophysics Data System (ADS)

    Murtada, Sae-Il; Kroon, Martin; Holzapfel, Gerhard A.

    2010-12-01

    Micro-structurally based models for smooth muscle contraction are crucial for a better understanding of pathological conditions such as atherosclerosis, incontinence and asthma. It is meaningful that models consider the underlying mechanical structure and the biochemical activation. Hence, a simple mechanochemical model is proposed that includes the dispersion of the orientation of smooth muscle myofilaments and that is capable to capture available experimental data on smooth muscle contraction. This allows a refined study of the effects of myofilament dispersion on the smooth muscle contraction. A classical biochemical model is used to describe the cross-bridge interactions with the thin filament in smooth muscles in which calcium-dependent myosin phosphorylation is the only regulatory mechanism. A novel mechanical model considers the dispersion of the contractile fiber orientations in smooth muscle cells by means of a strain-energy function in terms of one dispersion parameter. All model parameters have a biophysical meaning and may be estimated through comparisons with experimental data. The contraction of the middle layer of a carotid artery is studied numerically. Using a tube the relationships between the internal pressure and the stretches are investigated as functions of the dispersion parameter, which implies a strong influence of the orientation of smooth muscle myofilaments on the contraction response. It is straightforward to implement this model in a finite element code to better analyze more complex boundary-value problems.

  4. Caveolae in smooth muscles: nanocontacts

    PubMed Central

    Popescu, LM; Gherghiceanu, Mihaela; Mandache, E; Cretoiu, D

    2006-01-01

    Smooth muscle cell (SMC) caveolae have been investigated by quantitative and qualitative analysis of transmission electron microscopy (TEM) images of rat stomach, bladder and myometrium, guinea pig taenia coli, human ileum, and rat aortic SMCs. Ultrathin (below 30 nm) serial sections were used for examination of caveolar morphology and their connections with SMC organelles. Average caveolar diameter was smaller in vascular SMCs (70 nm, n=50) than in visceral SMCs (77 nm, n=100), but with the same morphology. Most of the caveolae, featured as flask-shaped plasma membrane (PM) invaginations, opened to the extracellular space through a 20 nm stoma (21, 3nm) having a 7 nm thick diaphragm. A small percentage of caveolae (3%), gathered as grape-like clusters, did not open directly to the extracellular space, but to irregular PM pockets having a 20-30 nm opening to the extracellular space. In visceral SMCs, caveolae were disposed in 4 - 6 rows, parallel to myofilaments, whilst aortic SMCs caveolae were arranged as clusters. This caveolar organization in rows or clusters minimizes the occupied volume, providing more space for the contractile machinery. The morphometric analysis of relative volumes (% of cell volume) showed that caveolae were more conspicuous in visceral than in vascular SMCs (myometrium - 2.40%; bladder - 3.66%, stomach - 2.61%, aorta - 1.43%). We also observed a higher number of caveolae per length unit of cell membrane in most visceral SMCs compared to vascular SMCs (myometrium - 1.06/μm, bladder - 0.74/μm, aorta - 0.57/μm, stomach - 0.48/μm). Caveolae increase the cellular perimeter up to 15% and enlarge the surface area of the plasma membrane about 80% in SMCs. Three-dimensional reconstructions (15μ3) showed that most caveolae, in both visceral and vascular SMCs, have nanocontacts with SR (87%), or with mitochondria (10%), and only 3%, apparently, have no contact with these organelles. Usually, 15 nm wide junctional spaces exist between caveolae

  5. Activation of the MAPK/ERK Cell-Signaling Pathway in Uterine Smooth Muscle Cells of Women With Adenomyosis.

    PubMed

    Streuli, Isabelle; Santulli, Pietro; Chouzenoux, Sandrine; Chapron, Charles; Batteux, Frédéric

    2015-12-01

    We investigated whether the myometrium might be intrinsically different in women with adenomyosis. We studied whether the mitogen-activated protein kinases/extracellular signal-regulated kinases (MAPKs/ERKs) and phosphoinositide 3-kinase/mammalian target of rapamycin/AKT (PI3K/mTOR/AKT) cell-signaling pathways, implicated in the pathogenesis of endometriosis, might also be activated in uterine smooth muscle cells (uSMCs) of women with adenomyosis and measured the production of reactive oxygen species (ROS), proinflammatory mediators that modulate cell proliferation and have been shown to activate the MAPK/ERK pathway in endometriosis. The uSMC cultures were derived from myometrium biopsies obtained during hysterectomy or myomectomy in women with adenomyosis and controls with leiomyoma. Proliferation of uSMCs and in vitro activation of the MAPK/ERK cell-signaling pathway were increased in women with adenomyosis compared to controls. The activation of the PI3K/mTOR/AKT pathway was not significant. The ROS production and ROS detoxification pathways were not different between uSMCs of women with adenomyosis and controls suggesting an ROS-independent activation of the MAPK/ERK pathway. Our results also provide evidence that protein kinase inhibitors and the rapanalogue temsirolimus can control proliferation of uSMCs in vitro suggesting an implication of the MAPK/ERK and the PI3K/mTOR/AKT pathways in proliferation of uSMCs in women with adenomyosis and leiomyomas. PMID:26071388

  6. Sphingosylphosphorylcholine inhibits macrophage adhesion to vascular smooth muscle cells.

    PubMed

    Wirrig, Christiane; McKean, Jenny S; Wilson, Heather M; Nixon, Graeme F

    2016-09-01

    Inflammation in de-endothelialised arteries contributes to the development of cardiovascular diseases. The process that initiates this inflammatory response is the adhesion of monocytes/macrophages to exposed vascular smooth muscle cells, typically stimulated by cytokines such as tumour necrosis factor-α (TNF). The aim of this study was to determine the effect of the sphingolipid sphingosylphosphorylcholine (SPC) on the interaction of monocytes/macrophages with vascular smooth muscle cells. Rat aortic smooth muscle cells and rat bone marrow-derived macrophages were co-cultured using an in vitro assay following incubation with sphingolipids to assess inter-cellular adhesion. We reveal that SPC inhibits the TNF-induced adhesion of macrophages to smooth muscle cells. This anti-adhesive effect was the result of SPC-induced changes to the smooth muscle cells (but not the macrophages) and was mediated, at least partly, via the sphingosine 1-phosphate receptor subtype 2. Lipid raft domains were also required. Although SPC did not alter expression or membrane distribution of the adhesion proteins intercellular adhesion molecule-1 and vascular cellular adhesion protein-1 in smooth muscle cells, SPC preincubation inhibited the TNF-induced increase in inducible nitric oxide synthase (NOS2) resulting in a subsequent decrease in nitric oxide production. Inhibiting NOS2 activation in smooth muscle cells led to a decrease in the adhesion of macrophages to smooth muscle cells. This study has therefore delineated a novel pathway which can inhibit the interaction between macrophages and vascular smooth muscle cells via SPC-induced repression of NOS2 expression. This mechanism could represent a potential drug target in vascular disease. PMID:27402344

  7. Smooth muscle signalling pathways in health and disease

    PubMed Central

    Kim, H R; Appel, S; Vetterkind, S; Gangopadhyay, S S; Morgan, K G

    2008-01-01

    Smooth muscle contractile activity is a major regulator of function of the vascular system, respiratory system, gastrointestinal system and the genitourinary systems. Malfunction of contractility in these systems leads to a host of clinical disorders, and yet, we still have major gaps in our understanding of the molecular mechanisms by which contractility of the differentiated smooth muscle cell is regulated. This review will summarize recent advances in the molecular understanding of the regulation of smooth muscle myosin activity via phosphorylation/dephosphorylation of myosin, the regulation of the accessibility of actin to myosin via the actin-binding proteins calponin and caldesmon, and the remodelling of the actin cytoskeleton. Understanding of the molecular ‘players’ should identify target molecules that could point the way to novel drug discovery programs for the treatment of smooth muscle disorders such as cardiovascular disease, asthma, functional bowel disease and pre-term labour. PMID:19120701

  8. Abnormal activation of potassium channels in aortic smooth muscle of rats with peritonitis-induced septic shock.

    PubMed

    Kuo, Jiunn-Horng; Chen, Shiu-Jen; Shih, Chih-Chin; Lue, Wei-Ming; Wu, Chin-Chen

    2009-07-01

    This study was conducted to examine the role of membrane hyperpolarization in mediating vascular hyporeactivity induced by cecal ligation and puncture (CLP) in endothelial-denuded strips of rat thoracic aorta ex vivo. The CLP for 18 h elicited a significant fall of blood pressure and a severe vascular hyporeactivity to norepinephrine as seen in severe sepsis. At the end of the in vivo experiments, thoracic aortas were removed from both CLP-treated and control rats. After removal of the endothelium, aortic segments were mounted in myographs for the recording of isometric tension and smooth muscle membrane potential. The membrane potential recording showed that a hyperpolarization was observed in the CLP-treated rats when compared with the control rats. This hyperpolarization was reversed by iberiotoxin (a large-conductance Ca2+-activated K+ channel blocker), 4-aminopyridine (a voltage-dependent K+ channel blocker), barium (an inward rectifier K+ channels blocker), N-(1-adamantyl)-N'-cyclohexyl-4-morpholinecarboxamidine hydrochloride (a pore-forming blocker of adenosine triphosphate (ATP)-sensitive K+ channels [KATP]), or methylene blue (a nonspecific guanylyl cyclase [GC] inhibitor). However, this hyperpolarization was not significantly affected by apamin (a small-conductance Ca2+-activated K+ channel blocker), glibenclamide (a sulfonylurea blocker of KATP), N(omega)-nitro-L-arginine methyl ester (a NOS inhibitor), or 1H-[1,2,4]oxadiazolo[4,3-a]quinoxalin-1-one (an NO-sensitive GC inhibitor). In addition, the basal tension of the tissues obtained from CLP rats was increased simultaneously, whereas membrane potential was reversed. In contrast, none of these inhibitors had significant effects on the membrane potential or the basal tension in control tissues. Thus, we provide electrophysiological and functional evidence demonstrating that an abnormal activation of K+ channels in vascular smooth muscle in animals with septic shock induced by CLP. Our observations

  9. NADPH oxidase activation contributes to native low-density lipoprotein-induced proliferation of human aortic smooth muscle cells

    PubMed Central

    Park, Il Hwan; Hwang, Hye Mi; Jeon, Byeong Hwa; Kwon, Hyung-Joo; Hoe, Kwang Lae; Kim, Young Myeong; Ryoo, Sungwoo

    2015-01-01

    Elevated plasma concentration of native low-density lipoprotein (nLDL) is associated with vascular smooth muscle cell (VSMC) activation and cardiovascular disease. We investigated the mechanisms of superoxide generation and its contribution to pathophysiological cell proliferation in response to nLDL stimulation. Lucigenin-induced chemiluminescence was used to measure nLDL-induced superoxide production in human aortic smooth muscle cells (hAoSMCs). Superoxide production was increased by nicotinamide adenine dinucleotide phosphate (NADPH) and decreased by NADPH oxidase inhibitors in nLDL-stimulated hAoSMC and hAoSMC homogenates, as well as in prepared membrane fractions. Extracellular signal-regulated kinase 1/2 (Erk1/2), protein kinase C-θ (PKCθ) and protein kinase C-β (PKCβ) were phosphorylated and maximally activated within 3 min of nLDL stimulation. Phosphorylated Erk1/2 mitogen-activated protein kinase, PKCθ and PKCβ stimulated interactions between p47phox and p22phox; these interactions were prevented by MEK and PKC inhibitors (PD98059 and calphostin C, respectively). These inhibitors decreased nLDL-dependent superoxide production and blocked translocation of p47phox to the membrane, as shown by epifluorescence imaging and cellular fractionation experiments. Proliferation assays showed that a small interfering RNA against p47phox, as well as superoxide scavenger and NADPH oxidase inhibitors, blocked nLDL-induced hAoSMC proliferation. The nLDL stimulation in deendothelialized aortic rings from C57BL/6J mice increased dihydroethidine fluorescence and induced p47phox translocation that was blocked by PD98059 or calphostin C. Isolated aortic SMCs from p47phox−/− mice (mAoSMCs) did not respond to nLDL stimulation. Furthermore, NADPH oxidase 1 (Nox1) was responsible for superoxide generation and cell proliferation in nLDL-stimulated hAoSMCs. These data demonstrated that NADPH oxidase activation contributed to cell proliferation in nLDL-stimulated h

  10. Cortex phellodendri Extract Relaxes Airway Smooth Muscle

    PubMed Central

    Jiang, Qiu-Ju; Chen, Weiwei; Dan, Hong; Tan, Li; Zhu, He; Yang, Guangzhong; Shen, Jinhua; Peng, Yong-Bo; Zhao, Ping; Xue, Lu; Yu, Meng-Fei; Ma, Liqun; Si, Xiao-Tang; Wang, Zhuo; Dai, Jiapei; Qin, Gangjian; Zou, Chunbin; Liu, Qing-Hua

    2016-01-01

    Cortex phellodendri is used to reduce fever and remove dampness and toxin. Berberine is an active ingredient of C. phellodendri. Berberine from Argemone ochroleuca can relax airway smooth muscle (ASM); however, whether the nonberberine component of C. phellodendri has similar relaxant action was unclear. An n-butyl alcohol extract of C. phellodendri (NBAECP, nonberberine component) was prepared, which completely inhibits high K+- and acetylcholine- (ACH-) induced precontraction of airway smooth muscle in tracheal rings and lung slices from control and asthmatic mice, respectively. The contraction induced by high K+ was also blocked by nifedipine, a selective blocker of L-type Ca2+ channels. The ACH-induced contraction was partially inhibited by nifedipine and pyrazole 3, an inhibitor of TRPC3 and STIM/Orai channels. Taken together, our data demonstrate that NBAECP can relax ASM by inhibiting L-type Ca2+ channels and TRPC3 and/or STIM/Orai channels, suggesting that NBAECP could be developed to a new drug for relieving bronchospasm. PMID:27239213

  11. Stimulation by endothelin-1 of mitogen-activated protein kinases and DNA synthesis in bovine tracheal smooth muscle cells.

    PubMed Central

    Malarkey, K.; Chilvers, E. R.; Lawson, M. F.; Plevin, R.

    1995-01-01

    1. In cultures of bovine tracheal smooth muscle cells, platelet-derived growth factor-BB (PDGF), bradykinin (BK) and endothelin-1 (ET-1) stimulated the tyrosine phosphorylation and activation of both pp42 and pp44 kDa forms of mitogen-activated protein (MAP) kinase. 2. Both ET-1 and PDGF stimulated a sustained activation of MAP kinase whilst the response to BK was transient. 3. Activation of MAP kinase occurred in a concentration-dependent manner (EC50 values: ET-1, 2.3 +/- 1.3 nM; BK, 8.7 +/- 4.1 nM, PDGF, 9.7 +/- 3.2 ng ml-1). 4. Pretreatment with the protein kinase C (PKC) inhibitor Ro-318220, significantly reduced ET-1 activation of MAP kinase at 2 and 5 min but enhanced MAP kinase activation at 60 min. 5. Following chronic phorbol ester pretreatment, BK-stimulated activation of MAP kinase was abolished whilst the responses to PDGF and ET-1 were only partly reduced (80 and 45% inhibition respectively). 6. Pretreatment with pertussis toxin reduced ET-1 stimulated activation of MAP kinase particularly at later times (60 min), but left the responses to both PDGF and BK unaffected. 7. ET-1 also stimulated a 3 fold increase in [3H]-thymidine incorporation which was abolished by pertussis toxin pretreatment. In contrast, PDGF stimulated a 131 fold increase in [3H]-thymidine incorporation which was not affected by pertussis toxin. 8. These results suggest that a pertussis toxin-sensitive activation of MAP kinase may play an important role in ET-1-stimulated DNA synthesis but that activation of MAP kinase alone is not sufficient to induce the magnitude of DNA synthesis observed in response to PDGF. Images Figure 1 Figure 2 Figure 5 Figure 6 Figure 7 PMID:8564258

  12. Arsenic alters vascular smooth muscle cell focal adhesion complexes leading to activation of FAK-src mediated pathways

    SciTech Connect

    Pysher, Michele D. Chen, Qin M.; Vaillancourt, Richard R.

    2008-09-01

    Chronic exposure to arsenic has been linked to tumorigenesis, cardiovascular disease, hypertension, atherosclerosis, and peripheral vascular disease; however, the molecular mechanisms underlying its pathological effects remain elusive. In this study, we investigated arsenic-induced alteration of focal adhesion protein complexes in normal, primary vascular smooth muscle cells. We demonstrate that exposure to environmentally relevant concentrations of arsenic (50 ppb As{sup 3+}) can alter focal adhesion protein co-association leading to activation of downstream pathways. Co-associated proteins were identified and quantitated via co-immunoprecipitation, SDS-PAGE, and Western blot analysis followed by scanning densitometry. Activation of MAPK pathways in total cell lysates was evaluated using phosphor-specific antibodies. In our model, arsenic treatment caused a sustained increase in FAK-src association and activation, and induced the formation of unique signaling complexes (beginning after 3-hour As{sup 3+} exposure and continuing throughout the 12-hour time course studied). The effects of these alterations were manifested as chronic stimulation of downstream PAK, ERK and JNK pathways. Past studies have demonstrated that these pathways are involved in cellular survival, growth, proliferation, and migration in VSMCs.

  13. Fibroblast growth factor-2 induces osteogenic differentiation through a Runx2 activation in vascular smooth muscle cells

    SciTech Connect

    Nakahara, Takehiro; Sato, Hiroko; Shimizu, Takehisa; Tanaka, Toru; Matsui, Hiroki; Kawai-Kowase, Keiko; Sato, Mahito; Iso, Tatsuya; Arai, Masashi; Kurabayashi, Masahiko

    2010-04-02

    Expression of bone-associated proteins and osteoblastic transcription factor Runx2 in arterial cells has been implicated in the development of vascular calcification. However, the signaling upstream of the Runx2-mediated activation of osteoblastic program in vascular smooth muscle cells (VSMC) is poorly understood. We examined the effects of fibroblast growth factor-2 (FGF-2), an important regulator of bone formation, on osteoblastic differentiation of VSMC. Stimulation of cultured rat aortic SMC (RASMC) with FGF-2 induced the expression of the osteoblastic markers osteopontin (OPN) and osteocalcin. Luciferase assays showed that FGF-2 induced osteocyte-specific element (OSE)-dependent transcription. Downregulation of Runx2 by siRNA repressed the basal and FGF-2-stimulated expression of the OPN gene in RASMC. FGF-2 produced hydrogen peroxide in RASMC, as evaluated by fluorescent probe. Induction of OPN expression by FGF-2 was inhibited not only by PD98059 (MEK1 inhibitor) and PP1 (c-Src inhibitor), but also by an antioxidant, N-acetyl cysteine. Nuclear extracts from FGF-2-treated RASMC exhibited increased DNA-binding of Runx2 to its target sequence. Immunohistochemistry of human coronary atherectomy specimens and calcified aortic tissues showed that expression of FGF receptor-1 and Runx2 was colocalized. In conclusion, these results suggest that FGF-2 plays a role in inducing osteoblastic differentiation of VSMC by activating Runx2 through mitogen-activated protein kinase (MAPK)-dependent- and oxidative stress-sensitive-signaling pathways.

  14. In vivo assessment of artery smooth muscle [Ca2+]i and MLCK activation in FRET-based biosensor mice

    PubMed Central

    Chen, Ling; Raina, Hema; Blaustein, Mordecai P.; Wier, W. Gil

    2010-01-01

    The cellular mechanisms that control arterial diameter in vivo, particularly in hypertension, are uncertain. Here, we report a method that permits arterial intracellular Ca2+ concentration ([Ca2+]i), myosin light-chain kinase (MLCK) activation, and artery external diameter to be recorded simultaneously with arterial blood pressure (BP) in living mice under 1.5% isofluorane anesthesia. The method also enables an assessment of local receptor activity on [Ca2+]i, MLCK activity, and diameter in arteries, uncomplicated by systemic effects. Transgenic mice that express, in smooth muscle, a Ca2+/calmodulin-activated, Förster resonance energy transfer (FRET)-based “ratiometric”, exogenous MLCK biosensor were used. Vasoactive substances were administered either intravenously or locally to segments of exposed femoral or cremaster arteries. In the basal state, mean BP was ∼90 mmHg, femoral arteries were constricted to 65% of their passive diameter, MLCK fractional activation was 0.14, and [Ca2+]i was 131 nM. Phenylephrine (300 ng/g wt iv) elevated mean BP transiently to ∼110 mmHg, decreased heart rate, increased femoral artery [Ca2+]i to 244 nM and fractional MLCK activation to 0.24, and decreased artery diameter by 23%. In comparison, local application of 1.0 μM phenylephrine raised [Ca2+]i to 279 nM and fractional MLCK activation to 0.26, and reduced diameter by 25%, but did not affect BP or heart rate. Intravital FRET imaging of exogenous MLCK biosensor mice permits quantification of changes in [Ca2+]i and MLCK activation that accompany small changes in BP. Based on the observed variance of the FRET data, this method should enable the detection of a difference in basal [Ca2+]i of 29 nM between two groups of 12 mice with a significance of P < 0.05. PMID:20622107

  15. Activation of small conductance Ca(2+)-dependent K+ channels by purinergic agonists in smooth muscle cells of the mouse ileum.

    PubMed

    Vogalis, F; Goyal, R K

    1997-08-01

    1. Whole-cell and single-channel K+ currents were recorded at room temperature (22-24 degrees C), from smooth muscle cells enzymatically dispersed from the mouse ileum, using variations of the patch-clamp technique. 2. Net outward K+ currents recorded through amphotericin-B-perforated patches in response to step depolarizations positive to -50 mV from a holding potential of -80 mV were decreased by up to 70% by external apamin (0.5 microM). Apamin-sensitive whole-cell currents were also recorded from cells perfused internally with 150 nM Ca2+ but not from cells perfused internally with 85 nM Ca2+. 3. Three types of non-inactivating Ca(2+)-sensitive K+ channels were identified in cell-attached and excised patches under an asymmetrical K+ gradient: (i) large conductance (BKCa; approximately 200 pS) channels blocked by 2 mM external TEA; (ii) intermediate conductance (IKCa; approximately 39 pS) channels blocked by 2 mM external TEA and inhibited by external apamin (0.5 microM); and (iii) small conductance (SKCa; approximately 10 pS) channels that were not blocked by 5 mM external TEA but were sensitive to extracellular apamin (0.5 microM). 4. The TEA-resistant SKCa channels were activated by an increase in [Ca2+]i with an EC50 of 1.5 microM and a Hill coefficient of 1.3. 5. P2 purinoceptor agonists 2-methylthioATP (2-MeSATP), 2-chloroATP and ATP (10-50 microM) increased an apamin-sensitive whole-cell outward K+ current. Extrapatch application of 2-MeSATP (20-100 microM) stimulated the apamin-sensitive IKCa and SKCa channels and activated an apamin-sensitive steady outward current at 0 mV. 6. Smooth muscle cells from the mouse ileum possess two apamin-sensitive K+ channels (IKCa and SKCa); of these, the IKCa channels are TEA sensitive while the SKCa channels are TEA resistant. These channels, along with an apamin-sensitive but TEA-resistant steady outward current, may mediate membrane hyperpolarization elicited by purinergic agonists. PMID:9279803

  16. [Mechanism of eosin Y action of activity of solubilized Ca2+, Mg2+- ATPase from smooth muscle sarcolemma].

    PubMed

    Chernysh, I H

    1999-01-01

    The eosin Y inhibitory effect on the activity of smooth muscle plasma membrane Ca(2+)-transporting ATPase was studied: effect of this inhibitor on the maximal initial rate of ATP-hydrolase reaction, catalyzed by Ca2+, Mg(2+)-ATPase, on the affinity of enzyme for the reaction reagents (Ca2+, Mg2+, ATP). Dependence of eosin Y inhibitory effect on some physicochemical factors of incubation medium was studied too. It was determined that eosin Y inhibited reversibly and with high specificity purified Ca2+, Mg(2+)-ATPase solubilized from myometrial cell plasma membrane (Ki--0.8 microM), decreased the turnover rate of this enzyme determined both by Mg2+, ATP and Ca2+. This inhibitor had no effect on the enzyme affinity for Ca2+, increased affinity for Mg2+ and decreased affinity for ATP. It was determined that inhibition of Ca2+, Mg(2+)-ATPase by eosin Y depended on pH and dielectric permeability of the incubation medium: increasing of pH from 6.5 to 8.0 reduced the apparent Ki, decreasing of dielectric permeability from 74.07 to 71.19 increased the apparent Ki. PMID:10726322

  17. The Activation Function-1 of Estrogen Receptor Alpha Prevents Arterial Neointima Development Through a Direct Effect on Smooth Muscle Cells

    PubMed Central

    Smirnova, Natalia F.; Fontaine, Coralie; Buscato, Mélissa; Lupieri, Adrien; Vinel, Alexia; Valera, Marie-Cécile; Guillaume, Maeva; Malet, Nicole; Foidart, Jean-Michel; Raymond-Letron, Isabelle; Lenfant, Francoise; Gourdy, Pierre; Katzenellenbogen, Benita S.; Katzenellenbogen, John A.; Laffargue, Muriel; Arnal, Jean-Francois

    2015-01-01

    Rationale: 17β-Estradiol (E2) exerts numerous beneficial effects in vascular disease. It regulates gene transcription through nuclear estrogen receptor α (ERα) via 2 activation functions, AF1 and AF2, and can also activate membrane ERα. The role of E2 on the endothelium relies on membrane ERα activation, but the molecular mechanisms of its action on vascular smooth muscle cells (VSMCs) are not fully understood. Objective: The aim of this study was to determine which cellular target and which ERα subfunction are involved in the preventive action of E2 on neointimal hyperplasia. Methods and Results: To trigger neointimal hyperplasia of VSMC, we used a mouse model of femoral arterial injury. Cre-Lox models were used to distinguish between the endothelial- and the VSMC-specific actions of E2. The molecular mechanisms underlying the role of E2 were further characterized using both selective ERα agonists and transgenic mice in which the ERαAF1 function had been specifically invalidated. We found that (1) the selective inactivation of ERα in VSMC abrogates the neointimal hyperplasia protection induced by E2, whereas inactivation of endothelial and hematopoietic ERα has no effect; (2) the selective activation of membrane ERα does not prevent neointimal hyperplasia; and (3) ERαAF1 is necessary and sufficient to inhibit postinjury VSMC proliferation. Conclusions: Altogether, ERαAF1-mediated nuclear action is both necessary and sufficient to inhibit postinjury arterial VSMC proliferation, whereas membrane ERα largely regulates the endothelial functions of E2. This highlights the exquisite cell/tissue-specific actions of the ERα subfunctions and helps to delineate the spectrum of action of selective ER modulators. PMID:26316608

  18. Aldosterone Increases Oxidant Stress to Impair Guanylyl Cyclase Activity by Cysteinyl Thiol Oxidation in Vascular Smooth Muscle Cells*S⃞

    PubMed Central

    Maron, Bradley A.; Zhang, Ying-Yi; Handy, Diane E.; Beuve, Annie; Tang, Shiow-Shih; Loscalzo, Joseph; Leopold, Jane A.

    2009-01-01

    Hyperaldosteronism is associated with impaired endothelium-dependent vascular reactivity owing to increased reactive oxygen species and decreased bioavailable nitric oxide (NO·); however, the effects of aldosterone on vasodilatory signaling pathways in vascular smooth muscle cells (VSMC) remain unknown. Soluble guanylyl cyclase (GC) is a heterodimer that is activated by NO· to convert cytosolic GTP to cGMP, a second messenger required for normal VSMC relaxation. Here, we show that aldosterone (10-9-10-7 mol/liter) diminishes GC activity by activating NADPH oxidase in bovine aortic VSMC to increase reactive oxygen species levels and induce oxidative posttranslational modification(s) of Cys-122, a β1-subunit cysteinyl residue demonstrated previously to modulate NO· sensing by GC. In VSMC treated with aldosterone, Western immunoblotting detected evidence of GC β1-subunit disulfide bonding, whereas mass spectrometry analysis of a homologous peptide containing the Cys-122-bearing sequence exposed to conditions of increased oxidant stress confirmed cysteinyl sulfinic acid (m/z 435), sulfonic acid (m/z 443), and disulfide (m/z 836) bond formation. The functional effect of these modifications was examined by transfecting COS-7 cells with wild-type GC or mutant GC containing an alanine substitution at Cys-122 (C122A). Exposure to aldosterone or hydrogen peroxide (H2O2) significantly decreased cGMP levels in cells expressing wild-type GC. In contrast, aldosterone or H2O2 did not influence cGMP levels in cells expressing the mutant C122A GC, confirming that oxidative modification of Cys-122 specifically impairs GC activity. These findings demonstrate that pathophysiologically relevant concentrations of aldosterone increase oxidant stress to convert GC to an NO·-insensitive state, resulting in disruption of normal vasodilatory signaling pathways in VSMC. PMID:19141618

  19. P21-Activated Kinase Inhibitors FRAX486 and IPA3: Inhibition of Prostate Stromal Cell Growth and Effects on Smooth Muscle Contraction in the Human Prostate

    PubMed Central

    Wang, Yiming; Gratzke, Christian; Tamalunas, Alexander; Wiemer, Nicolas; Ciotkowska, Anna; Rutz, Beata; Waidelich, Raphaela; Strittmatter, Frank; Liu, Chunxiao; Stief, Christian G.; Hennenberg, Martin

    2016-01-01

    Prostate smooth muscle tone and hyperplastic growth are involved in the pathophysiology and treatment of male lower urinary tract symptoms (LUTS). Available drugs are characterized by limited efficacy. Patients’ adherence is particularly low to combination therapies of 5α-reductase inhibitors and α1-adrenoceptor antagonists, which are supposed to target contraction and growth simultaneously. Consequently, molecular etiology of benign prostatic hyperplasia (BPH) and new compounds interfering with smooth muscle contraction or growth in the prostate are of high interest. Here, we studied effects of p21-activated kinase (PAK) inhibitors (FRAX486, IPA3) in hyperplastic human prostate tissues, and in stromal cells (WPMY-1). In hyperplastic prostate tissues, PAK1, -2, -4, and -6 may be constitutively expressed in catecholaminergic neurons, while PAK1 was detected in smooth muscle and WPMY-1 cells. Neurogenic contractions of prostate strips by electric field stimulation were significantly inhibited by high concentrations of FRAX486 (30 μM) or IPA3 (300 μM), while noradrenaline- and phenylephrine-induced contractions were not affected. FRAX486 (30 μM) inhibited endothelin-1- and -2-induced contractions. In WPMY-1 cells, FRAX486 or IPA3 (24 h) induced concentration-dependent (1–10 μM) degeneration of actin filaments. This was paralleled by attenuation of proliferation rate, being observed from 1 to 10 μM FRAX486 or IPA3. Cytotoxicity of FRAX486 and IPA3 in WPMY-1 cells was time- and concentration-dependent. Stimulation of WPMY-1 cells with endothelin-1 or dihydrotestosterone, but not noradrenaline induced PAK phosphorylation, indicating PAK activation by endothelin-1. Thus, PAK inhibitors may inhibit neurogenic and endothelin-induced smooth muscle contractions in the hyperplastic human prostate, and growth of stromal cells. Targeting prostate smooth muscle contraction and stromal growth at once by a single compound is principally possible, at least under

  20. Effects of pinaverium on voltage-activated calcium channel currents of single smooth muscle cells isolated from the longitudinal muscle of the rabbit jejunum.

    PubMed Central

    Beech, D. J.; MacKenzie, I.; Bolton, T. B.; Christen, M. O.

    1990-01-01

    1. Smooth muscle cells of the longitudinal muscle of the rabbit jejunum were dispersed by enzyme treatment and recordings of membrane current were made in the whole-cell mode by patch clamp technique. The action of pinaverium bromide on the voltage-dependent inward current of single isolated smooth muscle cells was studied in solutions containing normal concentrations of calcium or high concentrations of barium at room temperature. 2. Pinaverium reduced the voltage-dependent inward current with an IC50 of 1.5 microM. This IC50 is similar to those of verapamil, diltiazem and flunarizine on these cells as described by others. Occasionally evidence of a potentiating action of pinaverium on the inward current was seen. 3. Repetitive stimulation of the cells did not increase blockade of inward current by pinaverium unlike the use-dependent blockade seen with verapamil, methoxyverapamil, and diltiazem in these and in other smooth muscle cells. 4. The inactivation of inward current was studied by holding at various potentials for 2 or 10 s before evoking inward current. The voltage at which current was 50% available was changed very little by pinaverium although other calcium entry blockers, for example the dihydropyridines, have been reported to produce appreciable negative shifts which indicate considerable voltage-dependence of their blockade. This may indicate that pinaverium has similar affinities for the closed available and inactivated calcium channel states so that blockade is not appreciably voltage-dependent. PMID:1691676

  1. Effects of pinaverium on voltage-activated calcium channel currents of single smooth muscle cells isolated from the longitudinal muscle of the rabbit jejunum.

    PubMed

    Beech, D J; MacKenzie, I; Bolton, T B; Christen, M O

    1990-02-01

    1. Smooth muscle cells of the longitudinal muscle of the rabbit jejunum were dispersed by enzyme treatment and recordings of membrane current were made in the whole-cell mode by patch clamp technique. The action of pinaverium bromide on the voltage-dependent inward current of single isolated smooth muscle cells was studied in solutions containing normal concentrations of calcium or high concentrations of barium at room temperature. 2. Pinaverium reduced the voltage-dependent inward current with an IC50 of 1.5 microM. This IC50 is similar to those of verapamil, diltiazem and flunarizine on these cells as described by others. Occasionally evidence of a potentiating action of pinaverium on the inward current was seen. 3. Repetitive stimulation of the cells did not increase blockade of inward current by pinaverium unlike the use-dependent blockade seen with verapamil, methoxyverapamil, and diltiazem in these and in other smooth muscle cells. 4. The inactivation of inward current was studied by holding at various potentials for 2 or 10 s before evoking inward current. The voltage at which current was 50% available was changed very little by pinaverium although other calcium entry blockers, for example the dihydropyridines, have been reported to produce appreciable negative shifts which indicate considerable voltage-dependence of their blockade. This may indicate that pinaverium has similar affinities for the closed available and inactivated calcium channel states so that blockade is not appreciably voltage-dependent. PMID:1691676

  2. Endothelium and the effect of activated neutrophils on arterial smooth muscle

    PubMed Central

    Sotnikova, Ruzena

    2015-01-01

    The aim of the study was to analyze the involvement of the endothelium in the effects of neutrophils (PMNL) on phenylephrine-precontracted isolated rings of the rat thoracic aorta and to compare their effects with those of peroxynitrite (ONOO−) and hypochlorous acid (HOCl). Activated PMNL-induced contraction of the precontracted aorta was prevented by the blockade of NO-synthase and by endothelium removal. In the endothelium-free preparations, the effect of PMNL reappeared in the presence of sodium nitroprusside. The effect of ONOO– and HOCl significantly differed from that of activated PMNL both in the presence and absence of the endothelium. It is therefore likely that neither ONOO– nor HOCl generated by transformation of superoxide anion radical (O2•–) produced by PMNL is involved in their action. Reduction of the relaxant effect of nitric oxide derived from the endothelium by O2•– seems to be the keystone mechanism in generation of PMNL-induced contraction. PMID:27486359

  3. Caveolar nanospaces in smooth muscle cells

    PubMed Central

    Gherghiceanu, Mihaela; Popescu, L M

    2006-01-01

    Caveolae, specialized membrane nanodomains, have a key role in signaling processes, including calcium handling in smooth muscle cells (SMC). We explored the three-dimensional (3D) architecture of peripheral cytoplasmic space at the nanoscale level and the close spatial relationships between caveolae, sarcoplasmic reticulum (SR), and mitochondria, as ultrastructural basis for an excitation-contraction coupling system and, eventually, for excitation - transcription coupling. About 150 electron micrographs of SMC showed that superficial SR and peripheral mitochondria are rigorously located along the caveolar domains of plasma membrane, alternating with plasmalemmal dense plaques. Electron micrographs made on serial ultrathin sections were digitized, then computer-assisted organellar profiles were traced on images, and automatic 3D reconstruction was obtained using the ‘Reconstruct’ software. The reconstruction was made for 1 μm3 in rat stomach (muscularis mucosae) and 10 μm3 in rat urinary bladder (detrusor smooth muscle). The close appositions (about 15 nm distance) of caveolae, peripheral SR, and mitochondria create coherent cytoplasmic nanoscale subdomains. Apparently, 80% of caveolae establish close contacts with SR and about 10% establish close contacts with mitochondria in both types of SMC. Thus, our results show that caveolae and peripheral SR build Ca2+release units in which mitochondria often could play a part. The caveolae-SR couplings occupy 4.19% of the cellular volume in stomach and 3.10% in rat urinary bladder, while caveolae-mitochondria couplings occupy 3.66% and 3.17%, respectively. We conclude that there are strategic caveolae-SR or caveolae-mitochondria contacts at the nanoscale level in the cortical cytoplasm of SMC, presumably responsible for a vectorial control of free Ca2+ cytoplasmic concentrations in definite nanospaces. This may account for slective activation of specific Ca2+ signaling pathways. PMID:16796817

  4. Role of plasminogen activator inhibitor in the reciprocal regulation of bovine aortic endothelial and smooth muscle cell migration by TGF-beta 1.

    PubMed Central

    Petzelbauer, E.; Springhorn, J. P.; Tucker, A. M.; Madri, J. A.

    1996-01-01

    Vascular endothelial and smooth muscle cells exhibit reciprocal migratory responses after transforming growth factor (TGF)-beta 1 treatment. Endothelial cells exhibit a decreased migratory rate and smooth muscle cells exhibit an increased migratory rate. Previous studies have demonstrated increases in extracellular matrix and integrin synthesis and expression in response to TGF-beta 1. In this report, we illustrate the roles of plasminogen activator inhibitor in modulating the migratory rates in these two cell types. Endothelial cells appear to require a proteolytic phenotype for rapid migration, whereas vascular smooth muscle cells appear to require an anti-proteolytic phenotype. Modulation of proteinase/anti-proteinase activity ratios was accomplished via TGF-beta 1 induction, addition of exogenous plasminogen activator inhibitor, addition of anti-catalytic antibodies directed against urokinase plasminogen activator, overexpression of plasminogen activator inhibitor utilizing stable transfectants, and the use of vitronectin as a substratum. The reciprocal migratory behaviors exhibited by these two vascular cell types in response to TGF-beta 1 is discussed in the context that these two vascular cell types utilize distinct adhesive and signaling pathways in their interactions with extracellular matrix components and responsiveness to proteolytic activity. Images Figure 1 Figure 2 Figure 3 PMID:8780396

  5. On the thermodynamics of smooth muscle contraction

    NASA Astrophysics Data System (ADS)

    Stålhand, Jonas; McMeeking, Robert M.; Holzapfel, Gerhard A.

    2016-09-01

    Cell function is based on many dynamically complex networks of interacting biochemical reactions. Enzymes may increase the rate of only those reactions that are thermodynamically consistent. In this paper we specifically treat the contraction of smooth muscle cells from the continuum thermodynamics point of view by considering them as an open system where matter passes through the cell membrane. We systematically set up a well-known four-state kinetic model for the cross-bridge interaction of actin and myosin in smooth muscle, where the transition between each state is driven by forward and reverse reactions. Chemical, mechanical and energy balance laws are provided in local forms, while energy balance is also formulated in the more convenient temperature form. We derive the local (non-negative) production of entropy from which we deduce the reduced entropy inequality and the constitutive equations for the first Piola-Kirchhoff stress tensor, the heat flux, the ion and molecular flux and the entropy. One example for smooth muscle contraction is analyzed in more detail in order to provide orientation within the established general thermodynamic framework. In particular the stress evolution, heat generation, muscle shorting rate and a condition for muscle cooling are derived.

  6. Vinpocetine Attenuates the Osteoblastic Differentiation of Vascular Smooth Muscle Cells.

    PubMed

    Ma, Yun-Yun; Sun, Lin; Chen, Xiu-Juan; Wang, Na; Yi, Peng-Fei; Song, Min; Zhang, Bo; Wang, Yu-Zhong; Liang, Qiu-Hua

    2016-01-01

    Vascular calcification is an active process of osteoblastic differentiation of vascular smooth muscle cells; however, its definite mechanism remains unknown. Vinpocetine, a derivative of the alkaloid vincamine, has been demonstrated to inhibit the high glucose-induced proliferation of vascular smooth muscle cells; however, it remains unknown whether vinpocetine can affect the osteoblastic differentiation of vascular smooth muscle cells. We hereby investigated the effect of vinpocetine on vascular calcification using a beta-glycerophosphate-induced cell model. Our results showed that vinpocetine significantly reduced the osteoblast-like phenotypes of vascular smooth muscle cells including ALP activity, osteocalcin, collagen type I, Runx2 and BMP-2 expression as well as the formation of mineralized nodule. Vinpocetine, binding to translocation protein, induced phosphorylation of extracellular signal-related kinase and Akt and thus inhibited the translocation of nuclear factor-kappa B into the nucleus. Silencing of translocator protein significantly attenuated the inhibitory effect of vinpocetine on osteoblastic differentiation of vascular smooth muscle cells. Taken together, vinpocetine may be a promising candidate for the clinical therapy of vascular calcification. PMID:27589055

  7. Bronchodilator and anti-inflammatory activities of glaucine: In vitro studies in human airway smooth muscle and polymorphonuclear leukocytes.

    PubMed

    Cortijo, J; Villagrasa, V; Pons, R; Berto, L; Martí-Cabrera, M; Martinez-Losa, M; Domenech, T; Beleta, J; Morcillo, E J

    1999-08-01

    1. Selective phosphodiesterase 4 (PDE4) inhibitors are of potential interest in the treatment of asthma. We examined the effects of the alkaloid S-(+)-glaucine, a PDE4 inhibitor, on human isolated bronchus and granulocyte function. 2. Glaucine selectively inhibited PDE4 from human bronchus and polymorphonuclear leukocytes (PMN) in a non-competitive manner (Ki=3.4 microM). Glaucine displaced [3H]-rolipram from its high-affinity binding sites in rat brain cortex membranes (IC50 approximately 100 microM). 3. Glaucine inhibited the spontaneous and histamine-induced tone in human isolated bronchus (pD2 approximately 4.5). Glaucine (10 microM) did not potentiate the isoprenaline-induced relaxation but augmented cyclic AMP accumulation by isoprenaline. The glaucine-induced relaxation was resistant to H-89, a protein kinase A inhibitor. Glaucine depressed the contractile responses to Ca2+ (pD'2 approximately 3.62) and reduced the sustained rise of [Ca2+]i produced by histamine in cultured human airway smooth muscle cells (-log IC50 approximately 4.3). 4. Glaucine augmented cyclic AMP levels in human polymorphonuclear leukocytes challenged with N-formyl-Met-Leu-Phe (FMLP) or isoprenaline, and inhibited FMLP-induced superoxide generation, elastase release, leukotriene B4 production, [Ca2+]i signal and platelet aggregation as well as opsonized zymosan-, phorbol myristate acetate-, and A23187-induced superoxide release. The inhibitory effect of glaucine on superoxide generation by FMLP was reduced by H-89. 5. In conclusion, Ca2+ channel antagonism by glaucine appears mainly responsible for the relaxant effect of glaucine in human isolated bronchus while PDE4 inhibition contributes to the inhibitory effects of glaucine in human granulocytes. The very low PDE4/binding site ratio found for glaucine makes this compound attractive for further structure-activity studies. PMID:10455321

  8. Bronchodilator and anti-inflammatory activities of glaucine: In vitro studies in human airway smooth muscle and polymorphonuclear leukocytes

    PubMed Central

    Cortijo, J; Villagrasa, V; Pons, R; Berto, L; Martí-Cabrera, M; Martinez-Losa, M; Domenech, T; Beleta, J; Morcillo, E J

    1999-01-01

    Selective phosphodiesterase 4 (PDE4) inhibitors are of potential interest in the treatment of asthma. We examined the effects of the alkaloid S-(+)-glaucine, a PDE4 inhibitor, on human isolated bronchus and granulocyte function.Glaucine selectively inhibited PDE4 from human bronchus and polymorphonuclear leukocytes (PMN) in a non-competitive manner (Ki=3.4 μM). Glaucine displaced [3H]-rolipram from its high-affinity binding sites in rat brain cortex membranes (IC50∼100 μM).Glaucine inhibited the spontaneous and histamine-induced tone in human isolated bronchus (pD2∼4.5). Glaucine (10 μM) did not potentiate the isoprenaline-induced relaxation but augmented cyclic AMP accumulation by isoprenaline. The glaucine-induced relaxation was resistant to H-89, a protein kinase A inhibitor. Glaucine depressed the contractile responses to Ca2+ (pD'2∼3.62) and reduced the sustained rise of [Ca2+]i produced by histamine in cultured human airway smooth muscle cells (−log IC50∼4.3).Glaucine augmented cyclic AMP levels in human polymorphonuclear leukocytes challenged with N-formyl-Met-Leu-Phe (FMLP) or isoprenaline, and inhibited FMLP-induced superoxide generation, elastase release, leukotriene B4 production, [Ca2+]i signal and platelet aggregation as well as opsonized zymosan-, phorbol myristate acetate-, and A23187-induced superoxide release. The inhibitory effect of glaucine on superoxide generation by FMLP was reduced by H-89.In conclusion, Ca2+ channel antagonism by glaucine appears mainly responsible for the relaxant effect of glaucine in human isolated bronchus while PDE4 inhibition contributes to the inhibitory effects of glaucine in human granulocytes. The very low PDE4/binding site ratio found for glaucine makes this compound attractive for further structure-activity studies. PMID:10455321

  9. K(V)7 potassium channels: a new therapeutic target in smooth muscle disorders.

    PubMed

    Stott, Jennifer B; Jepps, Thomas A; Greenwood, Iain A

    2014-04-01

    Potassium channels are key regulators of smooth muscle tone, with increases in activity resulting in hyperpolarisation of the cell membrane, which acts to oppose vasoconstriction. Several potassium channels exist within smooth muscle, but the KV7 family of voltage-gated potassium channels have been identified as being crucial mediators of this process in a variety of smooth muscle. Recently, KV7 channels have been shown to be involved in the pathogenesis of hypertension, as well as being implicated in other smooth muscle disorders, providing a new and inviting target for smooth muscle disorders. PMID:24333708

  10. Indoxyl Sulfate-Induced Activation of (Pro)renin Receptor Promotes Cell Proliferation and Tissue Factor Expression in Vascular Smooth Muscle Cells

    PubMed Central

    Yisireyili, Maimaiti; Saito, Shinichi; Abudureyimu, Shaniya; Adelibieke, Yelixiati; Ng, Hwee-Yeong; Nishijima, Fuyuhiko; Takeshita, Kyosuke; Murohara, Toyoaki; Niwa, Toshimitsu

    2014-01-01

    Chronic kidney disease (CKD) is associated with an increased risk of cardiovascular disease (CVD). (Pro)renin receptor (PRR) is activated in the kidney of CKD. The present study aimed to determine the role of indoxyl sulfate (IS), a uremic toxin, in PRR activation in rat aorta and human aortic smooth muscle cells (HASMCs). We examined the expression of PRR and renin/prorenin in rat aorta using immunohistochemistry. Both CKD rats and IS-administrated rats showed elevated expression of PRR and renin/prorenin in aorta compared with normal rats. IS upregulated the expression of PRR and prorenin in HASMCs. N-acetylcysteine, an antioxidant, and diphenyleneiodonium, an inhibitor of nicotinamide adenine dinucleotide phosphate oxidase, suppressed IS-induced expression of PRR and prorenin in HASMCs. Knock down of organic anion transporter 3 (OAT3), aryl hydrocarbon receptor (AhR) and nuclear factor-κB p65 (NF-κB p65) with small interfering RNAs inhibited IS-induced expression of PRR and prorenin in HASMCs. Knock down of PRR inhibited cell proliferation and tissue factor expression induced by not only prorenin but also IS in HASMCs. Conclusion IS stimulates aortic expression of PRR and renin/prorenin through OAT3-mediated uptake, production of reactive oxygen species, and activation of AhR and NF-κB p65 in vascular smooth muscle cells. IS-induced activation of PRR promotes cell proliferation and tissue factor expression in vascular smooth muscle cells. PMID:25343458

  11. Ablation of smooth muscle myosin heavy chain SM2 increases smooth muscle contraction and results in postnatal death in mice.

    PubMed

    Chi, Mei; Zhou, Yingbi; Vedamoorthyrao, Srikanth; Babu, Gopal J; Periasamy, Muthu

    2008-11-25

    The physiological relevance of smooth muscle myosin isoforms SM1 and SM2 has not been understood. In this study we generated a mouse model specifically deficient in SM2 myosin isoform but expressing SM1, using an exon-specific gene targeting strategy. The SM2 homozygous knockout (SM2(-/-)) mice died within 30 days after birth, showing pathologies including segmental distention of alimentary tract, retention of urine in renal pelvis, distension of bladder, and the development of end-stage hydronephrosis. In contrast, the heterozygous (SM2(+/-)) mice appeared normal and reproduced well. In SM2(-/-) bladder smooth muscle the loss of SM2 myosin was accompanied by a concomitant down-regulation of SM1 and a reduced number of thick filaments. However, muscle strips from SM2(-/-) bladder showed increased contraction to K(+) depolarization or in response to M3 receptor agonist Carbachol. An increase of contraction was also observed in SM2(-/-) aorta. However, the SM2(-/-) bladder was associated with unaltered regulatory myosin light chain (MLC20) phosphorylation. Moreover, other contractile proteins, such as alpha-actin and tropomyosin, were not altered in SM2(-/-) bladder. Therefore, the loss of SM2 myosin alone could have induced hypercontractility in smooth muscle, suggesting that distinctly from SM1, SM2 may negatively modulate force development during smooth muscle contraction. Also, because SM2(-/-) mice develop lethal multiorgan dysfunctions, we propose this regulatory property of SM2 is essential for normal contractile activity in postnatal smooth muscle physiology. PMID:19011095

  12. Muscarinic receptor size on smooth muscle cells and membranes

    SciTech Connect

    Collins, S.M.; Jung, C.Y.; Grover, A.K.

    1986-08-01

    The loss of (/sup 3/H)quinuclidinyl benzilate ((/sup 3/H)QNB) binding following high-energy radiation was used to compare the muscarinic receptor size on single smooth muscle cells isolated by collagenase digestion from the canine stomach and on plasma membranes derived from intact gastric smooth muscle without exposure to exogenous proteolysis. Radiation inactivation of galactose oxidase (68 kdaltons), yeast alcohol dehydrogenase (160 kdaltons), and pyruvate kinase (224 kdaltons) activities were used as molecular-weight standards. Radiation inactivation of (/sup 3/H)QNB binding to rat brain membranes, which gave a target size of 86 kdaltons, served as an additional control. In isolated smooth muscle cells, the calculated size of the muscarinic receptor was 80 +/- 8 kdaltons. In contrast, in a smooth muscle enriched plasma membrane preparation, muscarinic receptor size was significantly smaller at 45 +/- 3 kdaltons. Larger molecular sizes were obtained either in the presence of protease inhibitors (62 +/- 4 kdaltons) or by using a crude membrane preparation of gastric smooth muscle 86 +/- 7 kdaltons).

  13. Activation of bitter taste receptors (tas2rs) relaxes detrusor smooth muscle and suppresses overactive bladder symptoms

    PubMed Central

    Nyirimigabo, Eric; Mi, Yue; Wang, Yan; Liu, Qinghua; Man, Libo; Wu, Shiliang; Jin, Jie; Ji, Guangju

    2016-01-01

    Bitter taste receptors (TAS2Rs) are traditionally thought to be expressed exclusively on the taste buds of the tongue. However, accumulating evidence has indicated that this receptor family performs non-gustatory functions outside the mouth in addition to taste. Here, we examined the role of TAS2Rs in human and mouse detrusor smooth muscle (DSM). We showed that mRNA for various TAS2R subtypes was expressed in both human and mouse detrusor smooth muscle (DSM) at distinct levels. Chloroquine (CLQ), an agonist for TAS2Rs, concentration-dependently relaxed carbachol- and KCl-induced contractions of human DSM strips. Moreover, 100 μM of CLQ significantly inhibited spontaneous and electrical field stimulation (EFS)-induced contractions of human DSM strips. After a slight contraction, CLQ (1 mM) entirely relaxed carbachol-induced contraction of mouse DSM strips. Furthermore, denatonium and quinine concentration-dependently decreased carbachol-induced contractions of mouse DSM strips. Finally, we demonstrated that CLQ treatment significantly suppressed the overactive bladder (OAB) symptoms of mice with partial bladder outlet obstruction (PBOO). In conclusion, we for the first time provide evidence of the existence of TAS2Rs in the urinary DSM and demonstrate that TAS2Rs may represent a potential target for OAB. These findings open a new approach to develop drugs for OAB in the future. PMID:27056888

  14. Activation of bitter taste receptors (tas2rs) relaxes detrusor smooth muscle and suppresses overactive bladder symptoms.

    PubMed

    Zhai, Kui; Yang, Zhiguang; Zhu, Xiaofei; Nyirimigabo, Eric; Mi, Yue; Wang, Yan; Liu, Qinghua; Man, Libo; Wu, Shiliang; Jin, Jie; Ji, Guangju

    2016-04-19

    Bitter taste receptors (TAS2Rs) are traditionally thought to be expressed exclusively on the taste buds of the tongue. However, accumulating evidence has indicated that this receptor family performs non-gustatory functions outside the mouth in addition to taste. Here, we examined the role of TAS2Rs in human and mouse detrusor smooth muscle (DSM). We showed that mRNA for various TAS2R subtypes was expressed in both human and mouse detrusor smooth muscle (DSM) at distinct levels. Chloroquine (CLQ), an agonist for TAS2Rs, concentration-dependently relaxed carbachol- and KCl-induced contractions of human DSM strips. Moreover, 100 µM of CLQ significantly inhibited spontaneous and electrical field stimulation (EFS)-induced contractions of human DSM strips. After a slight contraction, CLQ (1 mM) entirely relaxed carbachol-induced contraction of mouse DSM strips. Furthermore, denatonium and quinine concentration-dependently decreased carbachol-induced contractions of mouse DSM strips. Finally, we demonstrated that CLQ treatment significantly suppressed the overactive bladder (OAB) symptoms of mice with partial bladder outlet obstruction (PBOO). In conclusion, we for the first time provide evidence of the existence of TAS2Rs in the urinary DSM and demonstrate that TAS2Rs may represent a potential target for OAB. These findings open a new approach to develop drugs for OAB in the future. PMID:27056888

  15. Simvastatin induces the apoptosis of normal vascular smooth muscle through the disruption of actin integrity via the impairment of RhoA/Rac-1 activity.

    PubMed

    Kang, Seojin; Kim, Keunyoung; Noh, Ji-Yoon; Jung, Yeryeon; Bae, Ok-Nam; Lim, Kyung-Min; Chung, Jin-Ho

    2016-08-30

    Statins, lipid-lowering agents for the prevention of atherosclerosis and fatal coronary heart diseases, have pleiotropic modalities on the function and physiology of vascular smooth muscle that include anti-contractile and pro-apoptotic effects. These effects were suggested to stem from the inhibition of small GTPase Rho A, but they are largely regarded as distinct and unrelated. Recently, we discovered that simvastatin causes both contractile dysfunction and apoptosis of vascular smooth muscle cells (VSMCs), reflecting that they may be closely related, yet their connecting link remains unexplained. Here, we elaborated the mechanism underlying simvastatin-induced apoptosis of normal VSMCs in connection with contractile dysfunction. Repeated oral administration of simvastatin to rats in vivo resulted in contractile dysfunction and apoptosis of vascular smooth muscle, of which pattern was well reproduced in rat VSMCs in vitro. Of note, contractile dysfunction and apoptosis occurred in concerted manners both in vivo and in vitro in the aspects of time course and dose of exposure. In rat VSMCs, simvastatin impaired the activation of small GTPases, RhoA along with Rac-1, which resulted in the disruption of actin integrity, a pivotal factor both for the generation of contractile force and survival of VSMCs. In line with the disruption of actin integrity, Bmf, a pro-apoptotic factor bound to intact actin, dissociated and translocated into mitochondria, which corresponded well with the dissipation of mitochondrial membrane potential, caspase-3 activation and ultimately apoptosis. These events were all rescued by an actin stabilisation agent, jasplakinolide as well as geranylgeraniol, indicating that damages of the actin integrity from disrupted activation of RhoA/Rac-1 lies at the center of simvastatin-induced contractile dysfunction and apoptosis in vascular smooth muscle. PMID:27306926

  16. Magnesium inhibits Wnt/β-catenin activity and reverses the osteogenic transformation of vascular smooth muscle cells.

    PubMed

    Montes de Oca, Addy; Guerrero, Fatima; Martinez-Moreno, Julio M; Madueño, Juan A; Herencia, Carmen; Peralta, Alan; Almaden, Yolanda; Lopez, Ignacio; Aguilera-Tejero, Escolastico; Gundlach, Kristina; Büchel, Janine; Peter, Mirjam E; Passlick-Deetjen, Jutta; Rodriguez, Mariano; Muñoz-Castañeda, Juan R

    2014-01-01

    Magnesium reduces vascular smooth muscle cell (VSMC) calcification in vitro but the mechanism has not been revealed so far. This work used only slightly increased magnesium levels and aimed at determining: a) whether inhibition of magnesium transport into the cell influences VSMC calcification, b) whether Wnt/β-catenin signaling, a key mediator of osteogenic differentiation, is modified by magnesium and c) whether magnesium can influence already established vascular calcification. Human VSMC incubated with high phosphate (3.3 mM) and moderately elevated magnesium (1.4 mM) significantly reduced VSMC calcification and expression of the osteogenic transcription factors Cbfa-1 and osterix, and up-regulated expression of the natural calcification inhibitors matrix Gla protein (MGP) and osteoprotegerin (OPG). The protective effects of magnesium on calcification and expression of osteogenic markers were no longer observed in VSMC cultured with an inhibitor of cellular magnesium transport (2-aminoethoxy-diphenylborate [2-APB]). High phosphate induced activation of Wnt/β-catenin pathway as demonstrated by the translocation of β-catenin into the nucleus, increased expression of the frizzled-3 gene, and downregulation of Dkk-1 gene, a specific antagonist of the Wnt/β-catenin signaling pathway. The addition of magnesium however inhibited phosphate-induced activation of Wnt/β-catenin signaling pathway. Furthermore, TRPM7 silencing using siRNA resulted in activation of Wnt/β-catenin signaling pathway. Additional experiments were performed to test the ability of magnesium to halt the progression of already established VSMC calcification in vitro. The delayed addition of magnesium decreased calcium content, down-regulated Cbfa-1 and osterix and up-regulated MGP and OPG, when compared with a control group. This effect was not observed when 2-APB was added. In conclusion, magnesium transport through the cell membrane is important to inhibit VSMC calcification in vitro

  17. A crosstalk triggered by hypoxia and maintained by MCP-1/miR-98/IL-6/p38 regulatory loop between human aortic smooth muscle cells and macrophages leads to aortic smooth muscle cells apoptosis via Stat1 activation.

    PubMed

    Wang, Qing; Shu, Chang; Su, Jing; Li, Xin

    2015-01-01

    Hypoxia and inflammation are central characteristics of the abdominal aortic aneurysm (AAA), but the mechanisms for their relationship and actual role remain far from full understood. Here, we showed MCP-1 (monocyte chemotactic protein-1) induced by hypoxia in primary human Aortic Smooth Muscle Cells (hASMCs) increased the chemotaxis of THP-1 macrophages and MCP-1 induced IL-6 expression in THP-1 cells via downregulating miR-98 which directly targets IL-6. In addition, IL-6 positively feedback regulated MCP-1 expression in hASMCs via p38 signal that is independent on hypoxia, and inhibition of p38 signal blocked the effect of IL-6 on MCP-1 expression regulation. Moreover, IL-6 exposure time-dependently induces phASMCs apoptosis via Stat1 activation. Collectively, our data provide compelling evidence on the association between hypoxia and inflammation triggered by hypoxia and then mediated by MCP-1/miR-98/IL-6/p38 regulatory loop, which leads to hASMCs apoptosis via Stat1 activation to contribute to AAA formation and progression. PMID:26045772

  18. Regulation of mitogen-activated protein kinase by protein kinase C and mitogen-activated protein kinase phosphatase-1 in vascular smooth muscle.

    PubMed

    Trappanese, Danielle M; Sivilich, Sarah; Ets, Hillevi K; Kako, Farah; Autieri, Michael V; Moreland, Robert S

    2016-06-01

    Vascular smooth muscle contraction is primarily regulated by phosphorylation of myosin light chain. There are also modulatory pathways that control the final level of force development. We tested the hypothesis that protein kinase C (PKC) and mitogen-activated protein (MAP) kinase modulate vascular smooth muscle activity via effects on MAP kinase phosphatase-1 (MKP-1). Swine carotid arteries were mounted for isometric force recording and subjected to histamine stimulation in the presence and absence of inhibitors of PKC [bisindolylmaleimide-1 (Bis)], MAP kinase kinase (MEK) (U0126), and MKP-1 (sanguinarine) and flash frozen for measurement of MAP kinase, PKC-potentiated myosin phosphatase inhibitor 17 (CPI-17), and caldesmon phosphorylation levels. CPI-17 was phosphorylated in response to histamine and was inhibited in the presence of Bis. Caldesmon phosphorylation levels increased in response to histamine stimulation and were decreased in response to MEK inhibition but were not affected by the addition of Bis. Inhibition of PKC significantly increased p42 MAP kinase, but not p44 MAP kinase. Inhibition of MEK with U0126 inhibited both p42 and p44 MAP kinase activity. Inhibition of MKP-1 with sanguinarine blocked the Bis-dependent increase of MAP kinase activity. Sanguinarine alone increased MAP kinase activity due to its effects on MKP-1. Sanguinarine increased MKP-1 phosphorylation, which was inhibited by inhibition of MAP kinase. This suggests that MAP kinase has a negative feedback role in inhibiting MKP-1 activity. Therefore, PKC catalyzes MKP-1 phosphorylation, which is reversed by MAP kinase. Thus the fine tuning of vascular contraction is due to the concerted effort of PKC, MAP kinase, and MKP-1. PMID:27053523

  19. Sodium Tanshinone IIA Silate Inhibits High Glucose-Induced Vascular Smooth Muscle Cell Proliferation and Migration through Activation of AMP-Activated Protein Kinase

    PubMed Central

    Wu, Wen-yu; Yan, Hong; Wang, Xin-bo; Gui, Yu-zhou; Gao, Fei; Tang, Xi-lan; Qin, Yin-lin; Su, Mei; Chen, Tao; Wang, Yi-ping

    2014-01-01

    The proliferation of vascular smooth muscle cells may perform a crucial role in the pathogenesis of diabetic vascular disease. AMPK additionally exerts several salutary effects on vascular function and improves vascular abnormalities. The current study sought to determine whether sodium tanshinone IIA silate (STS) has an inhibitory effect on vascular smooth muscle cell (VSMC) proliferation and migration under high glucose conditions mimicking diabetes without dyslipidemia, and establish the underlying mechanism. In this study, STS promoted the phosphorylation of AMP-activated protein kinase (AMPK) at T172 in VSMCs. VSMC proliferation was enhanced under high glucose (25 mM glucose, HG) versus normal glucose conditions (5.5 mM glucose, NG), and this increase was inhibited significantly by STS treatment. We utilized western blotting analysis to evaluate the effects of STS on cell-cycle regulatory proteins and found that STS increased the expression of p53 and the Cdk inhibitor, p21, subsequent decreased the expression of cell cycle-associated protein, cyclin D1. We further observed that STS arrested cell cycle progression at the G0/G1 phase. Additionally, expression and enzymatic activity of MMP-2, translocation of NF-κB, as well as VSMC migration were suppressed in the presence of STS. Notably, Compound C (CC), a specific inhibitor of AMPK, as well as AMPK siRNA blocked STS-mediated inhibition of VSMC proliferation and migration. We further evaluated its potential for activating AMPK in aortas in animal models of type 2 diabetes and found that Oral administration of STS for 10 days resulted in activation of AMPK in aortas from ob/ob or db/db mice. In conclusion, STS inhibits high glucose-induced VSMC proliferation and migration, possibly through AMPK activation. The growth suppression effect may be attributable to activation of AMPK-p53-p21 signaling, and the inhibitory effect on migration to the AMPK/NF-κB signaling axis. PMID:24739942

  20. Inhibitory action of relaxin on human cervical smooth muscle.

    PubMed

    Norström, A; Bryman, I; Wiqvist, N; Sahni, S; Lindblom, B

    1984-09-01

    The influence of purified porcine relaxin on contractility of human cervical smooth muscle was investigated in vitro. Strips of cervical tissue were obtained by needle biopsy from pregnant and nonpregnant women and were mounted in a superfused organ chamber for isometric measurement of contractile activity. Relaxin (0.005-25 micrograms/ml) inhibited the spontaneous contractions in cervical strips from 18% of nonpregnant, 68% of early pregnant, and in 100% of term pregnant women. These results indicate that relaxin has an inhibitory action on cervical smooth muscle and that this effect is more constantly detected as pregnancy proceeds. PMID:6746858

  1. Modulation of myosin filament activation by telokin in smooth muscle liberation of myosin kinase and phosphatase from supramolecular complexes.

    PubMed

    Sobieszek, Apolinary; Andruchov, Oleg Y; Grabarek, Zenon; Kulikova, Natalia; Liebetrau, Claudia; Matusovsky, Oleg S

    2005-01-01

    result from dissociation of its catalytic subunit from a MLCK/MLCP complex bound to the filamentous myosin. Analogous desensitizing effects of telokin were also demonstrated for the contraction and relaxation cycle of Triton-skinned fibers from guinea pig Teania coli. Taken together, our results indicate that telokin acted as an effective modulator or chaperone of the myosin filament and a scheme for its action in smooth muscle was proposed. PMID:15617808

  2. Tracheobronchial smooth muscle atrophy and separation.

    PubMed

    Mehta, Atul C; Zaki, Khawaja Salman; Banga, Amit; Singh, Jarmanjeet; Gildea, Thomas R; Arrossi, Valeria

    2015-01-01

    We report a case series involving 4 patients with chronic obstructive pulmonary disease who were on an appropriate medical regimen including a high dose of inhaled corticosteroids (ICS). During bronchoscopy, patients were found to have an excessive dynamic collapse of the posterior wall and its separation from the ends of the adjacent cartilaginous rings. This was causing a near-total occlusion of the tracheal and bronchial lumen during exhalation, thereby presenting with an obstructive pattern on the pulmonary functions. We suspect that this was caused by the atrophy of the smooth muscles of the tracheobronchial wall. We reviewed the literature to explore the mechanisms causing atrophy of the bronchial smooth muscle, focusing on the potential role of long-term ICS use. PMID:26138002

  3. Effects of Buscopan on human gastrointestinal smooth muscle activity in an ex vivo model: Are there any differences for various sections?

    PubMed

    Zhang, Lei; Song, Jun; Bai, Tao; Lu, Xiaoming; Yang, Guanghai; Qian, Wei; Wang, Ruiyun; Hou, Xiaohua

    2016-06-01

    Hyoscine butylbromide (Buscopan ®) is clinically used as an anticholinergic antispasmodic for the treatment of abdominal cramping or visceral pain associated with cramps. However, the spasmolytic efficacy on contractile activity of human gastrointestinal smooth muscle from various sections remains unclear. We aimed to investigate the potentially selective actions of Buscopan on different bowel segments, as well as muscular layers and contractile states. Human smooth muscle tissues of the esophagus, gastric corpus and antrum, jejunum, ileum and colon were obtained. Isometric measurements of circular and longitudinal muscle strips were performed to determine effects of Buscopan on spontaneous activity and induced-contractions by 30mM KCl, 10μM bethanechol and electrical field stimulation (EFS). Buscopan concentration-dependently (10(-9)-10(-5)M) inhibited smooth muscle activity, particularly in spasticity evoked by bethanechol and EFS but not high K(+). The inhibiting effects were mainly responsible for the antagonism on muscarinic M2 and M3 receptors (IC50 values: 3.1×10(-5)M vs. 0.9×10(-5)M). The sensitivity toward Buscopan revealed a tendency of increasing from the esophagus, gastric corpus and antrum to the colon, jejunum and ileum. There was a reversed gradient of mRNA and protein expression of muscarinic M2 and M3 receptors from the blocking effects of Buscopan, which could be ascribed to the fact that a higher concentration of Buscopan was needed to antagonize the spastic contraction to reach the equipotent inhibitory rate in the region with higher muscarinic receptor activity. The findings of different inhibitory effectiveness on various parts of the gastrointestinal tract provide a potential guideline for the clinical application. PMID:27020547

  4. Nox regulation of smooth muscle contraction

    PubMed Central

    Ritsick, Darren R.; Edens, William A.; Finnerty, Victoria; Lambeth, J. David

    2007-01-01

    The catalytic subunit, gp91phox (a.k.a., Nox2) of the NADPH-oxidase of mammalian phagocytes is activated by microbes and immune mediators to produce large amounts of reactive oxygen species (ROS) which participate in microbial killing. Homologs of gp91phox, the Nox and Duox enzymes, were recently described in a range of organisms, including plants, vertebrates, and invertebrates such as Drosophila melanogaster. While their enzymology and cell biology is being extensively studied in many laboratories, little is known about in vivo functions of Noxes. Here, we establish and use an inducible system for RNAi to discover functions of dNox, an ortholog of human Nox5 in Drosophila. We report here that depletion of dNox in musculature causes retention of mature eggs within ovaries, leading to female sterility. In dNox-depleted ovaries and ovaries treated with a Nox inhibitor, muscular contractions induced by the neuropeptide proctolin are markedly inhibited. This functional defect results from a requirement for dNox for the proctolin-induced calcium flux in Drosophila ovaries. Thus, these studies demonstrate a novel biological role for Nox-generated ROS in mediating agonist-induced calcium flux and smooth muscle contraction. PMID:17561091

  5. Study of the function of sarcoplasmic reticulum of vascular smooth muscle during activation due to depolarization-induced calcium influx

    SciTech Connect

    Hwang, K.S.

    1987-01-01

    The role of sarcoplasmic reticulum (SR) in vascular smooth muscle was evaluated with respect to regulation of myoplasmic Ca{sup 2+} during the Ca{sup 2+} entry induced by depolarization. Calcium agonist, Bay K8644, stimulated Ca{sup 2+} influx as well as tension in physiological salt solution, (PSS) in contrast to the priming effects due to the depolarization originally reported. Disparity, however, was found between the Ca{sup 2+} entered and tension developed. Correlation between the tension and {sup 45}Ca influx showed a typical threshold phenomenon; the basal Ca{sup 2+} influx can be raised to a certain level (25%) without tension induction, after which a minor increase in Ca{sup 2+} influx produced significant tension. This subthreshold Ca{sup 2+} influx was found accumulated in the caffeine-sensitive Ca stores, the SR. This confirmed the dependency of tension on the rate of Ca{sup 2+} entry demonstrated by a previous report.

  6. Calpain-2 activates Akt via TGF-β1-mTORC2 pathway in pulmonary artery smooth muscle cells.

    PubMed

    Abeyrathna, Prasanna; Kovacs, Laszlo; Han, Weihong; Su, Yunchao

    2016-07-01

    Calpain is a family of calcium-dependent nonlysosomal neutral cysteine endopeptidases. Akt is a serine/threonine kinase that belongs to AGC kinases and plays important roles in cell survival, growth, proliferation, angiogenesis, and cell metabolism. Both calpain and Akt are the downstream signaling molecules of platelet-derived growth factor (PDGF) and mediate PDGF-induced collagen synthesis and proliferation of pulmonary artery smooth muscle cells (PASMCs) in pulmonary vascular remodeling. We found that inhibitions of calpain-2 by using calpain inhibitor MDL28170 and calpain-2 small interfering RNA attenuated Akt phosphorylations at serine-473 (S473) and threonine-308 (T308), as well as collagen synthesis and cell proliferation of PASMCs induced by PDGF. Overexpression of calpain-2 in PASMCs induced dramatic increases in Akt phosphorylations at S473 and T308. Moreover, knockout of calpain attenuated Akt phosphorylations at S473 and T308 in smooth muscle of pulmonary arterioles of mice with chronic hypoxic pulmonary hypertension. The cell-permeable-specific transforming growth factor (TGF)-β receptor inhibitor SB431542 attenuated Akt phosphorylations at both S473 and T308 induced by PDGF and by overexpressed calpain-2 in PASMCs. Furthermore, SB-431452 and knocking down activin receptor-like kinase-5 significantly reduced PDGF-induced collagen synthesis and cell proliferation of PASMCs. Nevertheless, neutralizing extracellular TGF-β1 using a cell-impermeable TGF-β1 neutralizing antibody did not affect PDGF-induced Akt phosphorylations at S473 and T308. Furthermore, inhibition of mammalian target of rapamycin complex 2 (mTORC2) by knocking down its component protein Rictor prevented Akt phosphorylations at S473 and T308 induced by PDGF and by overexpressed calpain-2. These data provide first evidence supporting that calpain-2 upregulates PDGF-induced Akt phosphorylation in pulmonary vascular remodeling via an intracrine TGF-β1/mTORC2 mechanism. PMID:27099352

  7. Mechanisms of relaxant activity of the nitric oxide-independent soluble guanylyl cyclase stimulator BAY 41-2272 in rat tracheal smooth muscle.

    PubMed

    Toque, Haroldo A; Mónica, Fabíola Z T; Morganti, Rafael P; De Nucci, Gilberto; Antunes, Edson

    2010-10-25

    The soluble guanylyl cyclase is expressed in airway smooth muscle, and agents that stimulate this enzyme activity cause airway smooth muscle relaxation and bronchodilation. The compound 5-Cyclopropyl-2-[1-(2-fluoro-benzyl)-1H-pyrazolo[3,4-b]pyridin-3-yl]-pyrimidin-4-ylamine (BAY 41-2272) is a potent nitric oxide (NO)-independent soluble guanylyl cyclase stimulator, but little is known about its effects in airway smooth muscle. Therefore, this study aimed to investigate the mechanisms underlying the relaxations of rat tracheal smooth muscle induced by BAY 41-2272. Tracheal rings were mounted in 10-ml organ baths for isometric force recording. BAY 41-2272 concentration-dependently relaxed carbachol-precontracted tracheal rings (pEC(50)=6.68+/-0.14). Prior incubation with the NO synthesis inhibitor l-NAME (100 microM) or the soluble guanylyl cyclase inhibitor ODQ (10 microM) caused significant rightward shifts in the concentration-response curves to BAY 41-2272. Sodium nitroprusside caused concentration-dependent relaxations, which were greatly potentiated by BAY 41-2272 and completely inhibited by ODQ. In addition, BAY 41-2272 shifted to the right the tracheal contractile responses to either carbachol (0.01-1 microM) or electrical field stimulation (EFS, 1-32 Hz). BAY 41-2272 (1 microM) also caused a marked rightward shift and decreased the maximal contractile responses to extracellular CaCl2, and such effect was not modified by pretreatment with ODQ. In addition, BAY 41-2272 (up to 1 microM) significantly increased the cGMP levels, and that was abolished by ODQ. Our results indicate that BAY 41-2272 causes cGMP-dependent rat tracheal smooth muscle relaxations in a synergistic fashion with exogenous NO. BAY 41-2272 has also an additional mechanism independently of soluble guanylyl cyclase activation possibly involving Ca(2+) entry blockade. PMID:20670622

  8. Equol increases cerebral blood flow in rats via activation of large-conductance Ca(2+)-activated K(+) channels in vascular smooth muscle cells.

    PubMed

    Yu, Wei; Wang, Yan; Song, Zheng; Zhao, Li-Mei; Li, Gui-Rong; Deng, Xiu-Ling

    2016-05-01

    The present study was designed to investigate the effect of equol on cerebral blood flow and the underlying molecular mechanisms. The regional cerebral blood flow in parietal lobe of rats was measured by using a laser Doppler flowmetry. Isolated cerebral basilar artery and mesenteric artery rings from rats were used for vascular reactivity measurement with a multi wire myography system. Outward K(+) current in smooth muscle cells of cerebral basilar artery, large-conductance Ca(2+)-activated K(+) (BK) channel current in BK-HEK 293 cells stably expressing both human α (hSlo)- and β1-subunits, and hSlo channel current in hSlo-HEK 293 cells expressing only the α-subunit of BK channels were recorded with whole cell patch-clamp technique. The results showed that equol significantly increased regional cerebral blood flow in rats, and produced a concentration-dependent but endothelium-independent relaxation in rat cerebral basilar arteries. Both paxilline and iberiotoxin, two selective BK channel blockers, significantly inhibited equol-induced vasodilation in cerebral arteries. Outward K(+) currents in smooth muscle cells of cerebral basilar artery were increased by equol and fully reversed by washout or blockade of BK channels with iberiotoxin. Equol remarkably enhanced human BK current in BK-HEK 293 cells, but not hSlo current in hSlo-HEK 293 cells, and the increase was completely abolished by co-application of paxilline. Our findings provide the first information that equol selectively stimulates BK channel current by acting on its β1 subunit, which may in turn contribute to the equol-mediated vasodilation and cerebral blood flow increase. PMID:26995303

  9. Regulation of vascular tone and arterial blood pressure: role of chloride transport in vascular smooth muscle.

    PubMed

    Hübner, Christian A; Schroeder, Björn C; Ehmke, Heimo

    2015-03-01

    Recent studies suggest that primary changes in vascular resistance can cause sustained changes in arterial blood pressure. In this review, we summarize current knowledge about Cl(-) homeostasis in vascular smooth muscle cells. Within vascular smooth muscle cells, Cl(-) is accumulated above the electrochemical equilibrium, causing Cl(-) efflux, membrane depolarization, and increased contractile force when Cl(-) channels are opened. At least two different transport mechanisms contribute to raise [Cl(-)] i in vascular smooth muscle cells, anion exchange, and cation-chloride cotransport. Recent work suggests that TMEM16A-associated Ca(2+)-activated Cl(-) currents mediate Cl(-) efflux in vascular smooth muscle cells leading to vasoconstriction. Additional proteins associated with Cl(-) flux in vascular smooth muscle are bestrophins, which modulate vasomotion, the volume-activated LRRC8, and the cystic fibrosis transmembrane conductance regulator (CFTR). Cl(-) transporters and Cl(-) channels in vascular smooth muscle cells (VSMCs) significantly contribute to the physiological regulation of vascular tone and arterial blood pressure. PMID:25588975

  10. Mechanisms of Vascular Smooth Muscle Contraction and the Basis for Pharmacologic Treatment of Smooth Muscle Disorders

    PubMed Central

    Brozovich, F.V.; Nicholson, C.J.; Degen, C.V.; Gao, Yuan Z.; Aggarwal, M.

    2016-01-01

    The smooth muscle cell directly drives the contraction of the vascular wall and hence regulates the size of the blood vessel lumen. We review here the current understanding of the molecular mechanisms by which agonists, therapeutics, and diseases regulate contractility of the vascular smooth muscle cell and we place this within the context of whole body function. We also discuss the implications for personalized medicine and highlight specific potential target molecules that may provide opportunities for the future development of new therapeutics to regulate vascular function. PMID:27037223

  11. In vitro proliferation of aortic smooth muscle cells from spontaneously hypertensive and normotensive rats.

    PubMed

    Pang, S C

    1989-06-01

    The characteristics and proliferation of aortic smooth muscle cells (SMC) from spontaneously hypertensive rats (SHR) and normotensive Wistar-Kyoto (WKY) rats were studied in culture. Smooth muscle cells were isolated from the tunica media of the thoracic aorta by an explant method. Immunofluorescence microscopy showed that 93-95 per cent of cells were positively labelled with antibodies raised against smooth muscle actin, indicating that these were smooth muscle cells. The proliferative activity was compared between aortic smooth muscle cells from hypertensive and normotensive rats in culture by thymidine incorporation and cell number determinations. The results demonstrate that aortic smooth muscle cells from hypertensive rats grew faster than those from normotensive rats in culture. The increased proliferative activity of cultured aortic smooth muscle cells from hypertensive rats was detectable even when they were cultured in a chemically defined serum-free medium. These data have shown that an increased proliferative activity of aortic smooth muscle cells from hypertensive rats can occur in culture conditions without the influence of arterial pressure or other stimuli as in intact animals. The mechanisms underlying the accelerated proliferative activity of aortic smooth muscle cells from genetically hypertensive rats in vitro remain to be determined. PMID:2754547

  12. Caffeine relaxes smooth muscle through actin depolymerization.

    PubMed

    Tazzeo, Tracy; Bates, Genevieve; Roman, Horia Nicolae; Lauzon, Anne-Marie; Khasnis, Mukta D; Eto, Masumi; Janssen, Luke J

    2012-08-15

    Caffeine is sometimes used in cell physiological studies to release internally stored Ca(2+). We obtained evidence that caffeine may also act through a different mechanism that has not been previously described and sought to examine this in greater detail. We ruled out a role for phosphodiesterase (PDE) inhibition, since the effect was 1) not reversed by inhibiting PKA or adenylate cyclase; 2) not exacerbated by inhibiting PDE4; and 3) not mimicked by submillimolar caffeine nor theophylline, both of which are sufficient to inhibit PDE. Although caffeine is an agonist of bitter taste receptors, which in turn mediate bronchodilation, its relaxant effect was not mimicked by quinine. After permeabilizing the membrane using β-escin and depleting the internal Ca(2+) store using A23187, we found that 10 mM caffeine reversed tone evoked by direct application of Ca(2+), suggesting it functionally antagonizes the contractile apparatus. Using a variety of molecular techniques, we found that caffeine did not affect phosphorylation of myosin light chain (MLC) by MLC kinase, actin-filament motility catalyzed by MLC kinase, phosphorylation of CPI-17 by either protein kinase C or RhoA kinase, nor the activity of MLC-phosphatase. However, we did obtain evidence that caffeine decreased actin filament binding to phosphorylated myosin heads and increased the ratio of globular to filamentous actin in precontracted tissues. We conclude that, in addition to its other non-RyR targets, caffeine also interferes with actin function (decreased binding by myosin, possibly with depolymerization), an effect that should be borne in mind in studies using caffeine to probe excitation-contraction coupling in smooth muscle. PMID:22683573

  13. Oxidative stress-dependent activation of collagen synthesis is induced in human pulmonary smooth muscle cells by sera from patients with scleroderma-associated pulmonary hypertension

    PubMed Central

    2014-01-01

    Pulmonary arterial hypertension is a major complication of systemic sclerosis. Although oxidative stress, intima hyperplasia and a progressive vessel occlusion appear to be clearly involved, the fine molecular mechanisms underpinning the onset and progression of systemic sclerosis-associated pulmonary arterial hypertension remain largely unknown. Here we shows for the first time that an increase of NADPH-derived reactive oxygen species production induced by sera from systemic sclerosis patients with pulmonary arterial hypertension drives collagen type I promoter activity in primary human pulmonary artery smooth muscle cells, suggesting that antioxidant-based therapies should be considered in the treatment of systemic sclerosis-associated vascular diseases. PMID:25085432

  14. Overexpression of smooth muscle myosin heavy chain leads to activation of the unfolded protein response and autophagic turnover of thick filament-associated proteins in vascular smooth muscle cells.

    PubMed

    Kwartler, Callie S; Chen, Jiyuan; Thakur, Dhananjay; Li, Shumin; Baskin, Kedryn; Wang, Shanzhi; Wang, Zhao V; Walker, Lori; Hill, Joseph A; Epstein, Henry F; Taegtmeyer, Heinrich; Milewicz, Dianna M

    2014-05-16

    Duplications spanning nine genes at the genomic locus 16p13.1 predispose individuals to acute aortic dissections. The most likely candidate gene in this region leading to the predisposition for dissection is MYH11, which encodes smooth muscle myosin heavy chain (SM-MHC). The effects of increased expression of MYH11 on smooth muscle cell (SMC) phenotypes were explored using mouse aortic SMCs with transgenic overexpression of one isoform of SM-MHC. We found that these cells show increased expression of Myh11 and myosin filament-associated contractile genes at the message level when compared with control SMCs, but not at the protein level due to increased protein degradation. Increased expression of Myh11 resulted in endoplasmic reticulum (ER) stress in SMCs, which led to a paradoxical decrease of protein levels through increased autophagic degradation. An additional consequence of ER stress in SMCs was increased intracellular calcium ion concentration, resulting in increased contractile signaling and contraction. The increased signals for contraction further promote transcription of contractile genes, leading to a feedback loop of metabolic abnormalities in these SMCs. We suggest that overexpression of MYH11 can lead to increased ER stress and autophagy, findings that may be globally implicated in disease processes associated with genomic duplications. PMID:24711452

  15. NO Hyperpolarizes Pulmonary Artery Smooth Muscle Cells and Decreases the Intracellular Ca2+ Concentration by Activating Voltage-Gated K+ Channels

    NASA Astrophysics Data System (ADS)

    Yuan, Xiao-Jian; Tod, Mary L.; Rubin, Lewis J.; Blaustein, Mordecai P.

    1996-09-01

    NO causes pulmonary vasodilation in patients with pulmonary hypertension. In pulmonary arterial smooth muscle cells, the activity of voltage-gated K+ (KV) channels controls resting membrane potential. In turn, membrane potential is an important regulator of the intracellular free calcium concentration ([Ca2+]i) and pulmonary vascular tone. We used patch clamp methods to determine whether the NO-induced pulmonary vasodilation is mediated by activation of KV channels. Quantitative fluorescence microscopy was employed to test the effect of NO on the depolarization-induced rise in [Ca2+]i. Blockade of KV channels by 4-aminopyridine (5 mM) depolarized pulmonary artery myocytes to threshold for initiation of Ca2+ action potentials, and thereby increased [Ca2+]i. NO (≈ 3 μ M) and the NO-generating compound sodium nitroprusside (5-10 μ M) opened KV channels in rat pulmonary artery smooth muscle cells. The enhanced K+ currents then hyperpolarized the cells, and blocked Ca2+-dependent action potentials, thereby preventing the evoked increases in [Ca2+]i. Nitroprusside also increased the probability of KV channel opening in excised, outside-out membrane patches. This raises the possibility that NO may act either directly on the channel protein or on a closely associated molecule rather than via soluble guanylate cyclase. In isolated pulmonary arteries, 4-aminopyridine significantly inhibited NO-induced relaxation. We conclude that NO promotes the opening of KV channels in pulmonary arterial smooth muscle cells. The resulting membrane hyperpolarization, which lowers [Ca2+]i, is apparently one of the mechanisms by which NO induces pulmonary vasodilation.

  16. ATP induces guinea pig gallbladder smooth muscle excitability via the P2Y4 receptor and COX-1 activity.

    PubMed

    Bartoo, Aaron C; Nelson, Mark T; Mawe, Gary M

    2008-06-01

    The purpose of this study was to elucidate the mechanisms by which ATP increases guinea pig gallbladder smooth muscle (GBSM) excitability. We evaluated changes in membrane potential and action potential (AP) frequency in GBSM by use of intracellular recording. Application of ATP (100 microM) caused membrane depolarization and a significant increase in AP frequency that were not sensitive to block by tetrodotoxin (0.5 microM). The nonselective P2 antagonist, suramin (100 microM), blocked the excitatory response, resulting in decreased AP frequency in the presence of ATP. The excitatory response to ATP was not altered by pyridoxal-phosphate-6-azophenyl-2,4-disulfonic acid (30 microM), a nonselective P2X antagonist. UTP also caused membrane depolarization and increased AP frequency, with a similar dose-response relationship as ATP. RT-PCR demonstrated that the P2Y(4), but not P2Y(2), receptor subtype is expressed in guinea pig gallbladder muscularis. ATP induced excitation was blocked by indomethacin (10 microM) and the cyclooxygenase (COX)-1 inhibitor SC-560 (300 nM), but not the COX-2 inhibitor nimesulide (500 nM). These data suggest that ATP stimulates P2Y(4) receptors within the gallbladder muscularis and, in turn, stimulate prostanoid production via COX-1 leading to increased excitability of GBSM. PMID:18436624

  17. Comparison of pinaverium bromide, manganese chloride and D600 effects on electrical and mechanical activities in rat uterine smooth muscle.

    PubMed

    Mironneau, J; Lalanne, C; Mironneau, C; Savineau, J P; Lavie, J L

    1984-02-10

    The effects of pinaverium bromide, were compared with those of D600 and manganese chloride (Mn), on membrane potentials, ionic currents and isometric contractions in uterine smooth muscle strips from pregnant rats. Pinaverium bromide (10(-7) - 10(-6) M) depressed twitch contractions and K-contractures within 15-20 min while D600 (2 X 10(-6) M) and Mn (10(-3) M) abolished both contractions. D600 and pinaverium bromide were more potent inhibitors in K-depolarized preparations than in polarized tissues. At a supramaximal dose (10(-5) M), pinaverium bromide decreased the rate of rise, amplitude, and rate of repolarization of the action potential, and prolonged the potential duration. The inward Ca current was depressed and the reduction in Cai was responsible for the decrease in K current. Pinaverium bromide (10(-5) M) depressed the myometrial contractions induced in Ca-free solution by acetylcholine (10(-4) M) and by prolonged membrane depolarizations. Mn (2.5 X 10(-3) M) only reduced the Ach-induced contraction and D600 (10(-5) M) had no effect on intracellular Ca stores. The results indicate that pinaverium bromide has Ca channel blocking properties similar to those of currently used Ca antagonists; it may also exert an effect to depress contractions supported by intracellular Ca release. PMID:6325214

  18. Naturally Extended CT · AG Repeats Increase H-DNA Structures and Promoter Activity in the Smooth Muscle Myosin Light Chain Kinase Gene▿

    PubMed Central

    Han, Yoo-Jeong; de Lanerolle, Primal

    2008-01-01

    Naturally occurring repeat sequences capable of adopting H-DNA structures are abundant in promoters of disease-related genes. In support of this, we found (CT)22 · (AG)22 repeats in the promoter of smooth muscle myosin light chain kinase (smMLCK), a key regulator of vascular smooth muscle function. We also found an insertion mutation that adds another six pairs of CT · AG repeats and increases smMLCK promoter activity in spontaneously hypertensive rats (SHR). Therefore, we used the smMLCK promoters from normotensive and hypertensive rats as a model system to determine how CT · AG repeats form H-DNA, an intramolecular triplex, and regulate promoter activity. High-resolution mapping with a chemical probe selective for H-DNA showed that the CT · AG repeats adopt H-DNA structures at a neutral pH. Importantly, the SHR promoter forms longer H-DNA structures than the promoter from normotensive rats. Reconstituting nucleosomes on the promoters, in vitro, showed no difference in nucleosome positioning between the two promoters. However, chromatin immunoprecipitation analyses revealed that histone acetylations are greater in the hypertensive promoter. Thus, our findings suggest that the extended CT · AG repeats in the SHR promoter increase H-DNA structures, histone modifications, and promoter activity of the smMLCK, perhaps contributing to vascular disorders in hypertension. PMID:17991897

  19. Studies of the voltage-sensitive calcium channels in smooth muscle, neuronal, and cardiac tissues using 1,4-dihydropyridine calcium channel antagonists and activators

    SciTech Connect

    Wei, X.

    1988-01-01

    This study describes the investigation of the voltage-sensitive Ca{sup +} channels in vascular and intestinal smooth muscle, chick neural retina cells and neonatal rat cardiac myocytes using 1,4-dihydropyridine Ca{sup 2+} channel antagonists and activators. In rat aorta, the tumor promoting phorbol ester, 12-O-tetradecanoylphorbol-13-acetate (TPA) produced Ca{sup 2+}-dependent contractile responses. The responses to TPA were blocked by the Ca{sup 2+} channel antagonists. The effects of the enantiomers of Bay K 8644 and 202-791 were characterized in both rat tail artery and guinea pig ileal longitudinal smooth muscle preparations using pharmacologic and radioligand binding assays. The (S)-enantiomers induced contraction and potentiated the responses to K{sup +} depolarization. The (R)-enantiomers inhibited the tension responses to K{sup +}. All the enantiomers inhibited specific ({sup 3}H)nitrendipine binding. The pharmacologic activities of both activator and antagonist ligands correlated on a 1:1 basis with the binding affinities. In chick neural retina cells the (S)-enantiomers of Bay K 8644 and 202-791 enhanced Ca{sup 2+} influx. In contrast, the (R)-enantiomers inhibited Ca{sup 2+} influx. The enantiomers of Bay K 8644 and 202-791 inhibited specific ({sup 3}H)PN 200-110 binding competitively. Binding of 1,4-dihydropyridines was characterized in neonatal rat heart cells.

  20. Activation of protease-activated receptors (PARs)-1 and -2 promotes alpha-smooth muscle actin expression and release of cytokines from human lung fibroblasts

    PubMed Central

    Asokananthan, Nithiananthan; Lan, Rommel S; Graham, Peter T; Bakker, Anthony J; Tokanović, Ana; Stewart, Geoffrey A

    2015-01-01

    Previous studies have shown that protease-activated receptors (PARs) play an important role in various physiological processes. In the present investigation, we determined the expression of PARs on human lung fibroblasts (HLF-1) and whether they were involved in cellular differentiation and pro-inflammatory cytokine and prostaglandin (PGE2) secretion. PAR-1, PAR-2, PAR-3, and PAR-4 were detected in fibroblasts using RT-PCR, immunocytochemistry, and flow cytometry. Increased expression of PAR-4, but not other PARs, was observed in fibroblasts stimulated with phorbol myristate acetate. The archetypical activators of PARs, namely, thrombin and trypsin, as well as PAR-1 and PAR-2 agonist peptides, stimulated transient increases in intracellular Ca2+, and promoted increased α-smooth muscle actin expression. The proteolytic and peptidic PAR activators also stimulated the release of IL-6 and IL-8, as well as PGE2, with a rank order of potency of PAR-1 > PAR-2. The combined stimulation of PAR-1 and PAR-2 resulted in an additive release of both IL-6 and IL-8. In contrast, PAR-3 and PAR-4 agonist peptides, as well as all the PAR control peptides examined, were inactive. These results suggest an important role for PARs associated with fibroblasts in the modulation of inflammation and remodeling in the airway. PMID:25663523

  1. NF-κB and Matrix-Dependent Regulation of Osteopontin Promoter Activity in Allylamine-Activated Vascular Smooth Muscle Cells

    PubMed Central

    Williams, E. Spencer; Wilson, Emily; Ramos, Kenneth S.

    2012-01-01

    Repeated cycles of oxidative injury by allylamine in vivo induce a proliferative rat vascular (aortic) smooth muscle cell (vSMC) phenotype characterized by matrix-dependent enhancement of mitogenic sensitivity, changes in cell surface integrin expression, and osteopontin (opn) overexpression. Here, we show that constitutive and mitogen-stimulated NF-κB DNA binding activity is enhanced in allylamine vSMCs. Matrix-specific changes in cellular Rel protein expression were observed in allylamine vSMCs. The NF-κB DNA binding element located at −1943 in the 5′-UTR strongly inhibited opn promoter activity in allylamine vSMCs, and this response was regulated by the extracellular matrix. Constitutive increases in opn promoter activity were only seen when allylamine cells were seeded on a fibronectin substrate, and this response was independent of the NF-κB DNA binding sequence within the regulatory region. Thus, NF-κB functions as a critical regulator of the allylamine-induced proliferative phenotype in vSMCs. PMID:22315656

  2. Wogonin suppresses TNF-{alpha}-induced MMP-9 expression by blocking the NF-{kappa}B activation via MAPK signaling pathways in human aortic smooth muscle cells

    SciTech Connect

    Lee, Syng-Ook; Jeong, Yun-Jeong; Yu, Mi Hee; Lee, Ji-Won; Hwangbo, Mi Hyang; Kim, Cheorl-Ho; Lee, In-Seon . E-mail: inseon@kmu.ac.kr

    2006-12-08

    Matrix metalloproteinase-9 (MMP-9) plays a major role in the pathogenesis of atherosclerosis and restenosis by regulating both migration and proliferation of vascular smooth muscle cells (VSMC) after an arterial injury. In this study, we examined the inhibitory effect of three major flavonoids in Scutellariae Radix, baicalin, baicalein, and wogonin, on TNF-{alpha}-induced MMP-9 expression in human aortic smooth muscle cells (HASMC). Wogonin, but not baicalin and baicalein, significantly and selectively suppressed TNF-{alpha}-induced MMP-9 expression in HASMC. Reporter gene, electrophoretic mobility shift, and Western blotting assays showed that wogonin inhibits MMP-9 gene transcriptional activity by blocking the activation of NF-{kappa}B via MAPK signaling pathways. Moreover, the Matrigel migration assay showed that wogonin reduced TNF-{alpha}-induced HASMC migration. These results suggest that wogonin effectively suppresses TNF-{alpha}-induced HASMC migration through the selective inhibition of MMP-9 expression and represents a potential agent for the prevention of vascular disorders related to the migration of VSMC.

  3. A molecular signature in the pannexin1 intracellular loop confers channel activation by the α1 adrenoreceptor in smooth muscle cells

    PubMed Central

    Billaud, Marie; Chiu, Yu-Hsin; Lohman, Alexander W.; Parpaite, Thibaud; Butcher, Joshua T.; Mutchler, Stephanie M.; DeLalio, Leon J.; Artamonov, Mykhaylo V.; Sandilos, Joanna K.; Best, Angela K.; Somlyo, Avril V.; Thompson, Roger J.; Le, Thu H.; Ravichandran, Kodi S.; Bayliss, Douglas A.; Isakson, Brant E.

    2015-01-01

    Both purinergic signaling through nucleotides such as ATP (adenosine 5′-triphosphate) and noradrenergic signaling through molecules such as norepinephrine regulate vascular tone and blood pressure. Pannexin1 (Panx1), which forms large-pore, ATP-releasing channels, is present in vascular smooth muscle cells in peripheral blood vessels and participates in noradrenergic responses. Using pharmacological approaches and mice conditionally lacking Panx1 in smooth muscle cells, we found that Panx1 contributed to vaso-constriction mediated by the α1 adrenoreceptor (α1AR), whereas vasoconstriction in response to serotonin or endothelin-1 was independent of Panx1. Analysis of the Panx1-deficient mice showed that Panx1 contributed to blood pressure regulation especially during the night cycle when sympathetic nervous activity is highest. Using mimetic peptides and site-directed mutagenesis, we identified a specific amino acid sequence in the Panx1 intracellular loop that is essential for activation by α1AR signaling. Collectively, these data describe a specific link between noradrenergic and purinergic signaling in blood pressure homeostasis. PMID:25690012

  4. Smooth muscle FGF/TGFβ cross talk regulates atherosclerosis progression.

    PubMed

    Chen, Pei-Yu; Qin, Lingfeng; Li, Guangxin; Tellides, George; Simons, Michael

    2016-01-01

    The conversion of vascular smooth muscle cells (SMCs) from contractile to proliferative phenotype is thought to play an important role in atherosclerosis. However, the contribution of this process to plaque growth has never been fully defined. In this study, we show that activation of SMC TGFβ signaling, achieved by suppression of SMC fibroblast growth factor (FGF) signaling input, induces their conversion to a contractile phenotype and dramatically reduces atherosclerotic plaque size. The FGF/TGFβ signaling cross talk was observed in vitro and in vivo In vitro, inhibition of FGF signaling increased TGFβ activity, thereby promoting smooth muscle differentiation and decreasing proliferation. In vivo, smooth muscle-specific knockout of an FGF receptor adaptor Frs2α led to a profound inhibition of atherosclerotic plaque growth when these animals were crossed on Apoe(-/-) background and subjected to a high-fat diet. In particular, there was a significant reduction in plaque cellularity, increase in fibrous cap area, and decrease in necrotic core size. In agreement with these findings, examination of human coronary arteries with various degrees of atherosclerosis revealed a strong correlation between the activation of FGF signaling, loss of TGFβ activity, and increased disease severity. These results identify SMC FGF/TGFβ signaling cross talk as an important regulator of SMC phenotype switch and document a major contribution of medial SMC proliferation to atherosclerotic plaque growth. PMID:27189169

  5. Changes of smooth muscle contractile filaments in small bowel atresia

    PubMed Central

    Gfroerer, Stefan; Fiegel, Henning; Ramachandran, Priya; Rolle, Udo; Metzger, Roman

    2012-01-01

    AIM: To investigate morphological changes of intestinal smooth muscle contractile fibres in small bowel atresia patients. METHODS: Resected small bowel specimens from small bowel atresia patients (n = 12) were divided into three sections (proximal, atretic and distal). Standard histology hematoxylin-eosin staining and enzyme immunohistochemistry was performed to visualize smooth muscle contractile markers α-smooth muscle actin (SMA) and desmin using conventional paraffin sections of the proximal and distal bowel. Small bowel from age-matched patients (n = 2) undergoing Meckel’s diverticulum resection served as controls. RESULTS: The smooth muscle coat in the proximal bowel of small bowel atresia patients was thickened compared with control tissue, but the distal bowel was unchanged. Expression of smooth muscle contractile fibres SMA and desmin within the proximal bowel was slightly reduced compared with the distal bowel and control tissue. There were no major differences in the architecture of the smooth muscle within the proximal bowel and the distal bowel. The proximal and distal bowel in small bowel atresia patients revealed only minimal differences regarding smooth muscle morphology and the presence of smooth muscle contractile filament markers. CONCLUSION: Changes in smooth muscle contractile filaments do not appear to play a major role in postoperative motility disorders in small bowel atresia. PMID:22791945

  6. Collagen formation by transformed smooth muscle cells after arterial injury.

    PubMed

    Chidi, C C; DePalma, R G

    1981-01-01

    Twenty-five normocholesterolemic rabbits were sacrificed at intervals up to 60 days after the thoracic aortas were de-endothelialized. Ultrastructural studies of both the re-endothelialized and nonendothelialized intima were done. The smooth muscle cells in the re-endothelialized intima showed segmental structural changes typically associated with transformation to a secretory cell type; abundant accumulations of collagen were in juxtaposition with these cells. The nonendothelialized intima did not demonstrate similar smooth muscle cell changes and collagen accumulation. These observations suggest that regenerating endothelial cells and intimal smooth muscle cells interact to cause smooth muscle cell transformation and collagen accumulation during arterial repair. PMID:7455897

  7. Lysyl oxidase propeptide inhibits smooth muscle cell signaling and proliferation

    SciTech Connect

    Hurtado, Paola A.; Vora, Siddharth; Sume, Siddika Selva; Yang, Dan; Hilaire, Cynthia St.; Guo Ying; Palamakumbura, Amitha H.; Schreiber, Barbara M.; Ravid, Katya; Trackman, Philip C.

    2008-02-01

    Lysyl oxidase is required for the normal biosynthesis and maturation of collagen and elastin. It is expressed by vascular smooth muscle cells, and its increased expression has been previously found in atherosclerosis and in models of balloon angioplasty. The lysyl oxidase propeptide (LOX-PP) has more recently been found to have biological activity as a tumor suppressor, and it inhibits Erk1/2 Map kinase activation. We reasoned that LOX-PP may have functions in normal non-transformed cells. We, therefore, investigated its effects on smooth muscle cells, focusing on important biological processes mediated by Erk1/2-dependent signaling pathways including proliferation and matrix metalloproteinase-9 (MMP-9) expression. In addition, we investigated whether evidence for accumulation of LOX-PP could be found in vivo in a femoral artery injury model. Recombinant LOX-PP was expressed and purified, and was found to inhibit primary rat aorta smooth muscle cell proliferation and DNA synthesis by more than 50%. TNF-{alpha}-stimulated MMP-9 expression and Erk1/2 activation were both significantly inhibited by LOX-PP. Immunohistochemistry studies carried out with affinity purified anti-LOX-PP antibody showed that LOX-PP epitopes were expressed at elevated levels in vascular lesions of injured arteries. These novel data suggest that LOX-PP may provide a feedback control mechanism that serves to inhibit properties associated with the development of vascular pathology.

  8. Upregulation of Intermediate-Conductance Ca2+-Activated K+ Channels (KCNN4) in Porcine Coronary Smooth Muscle Requires NADPH Oxidase 5 (NOX5)

    PubMed Central

    Gole, Hope K. A.; Tharp, Darla L.; Bowles, Douglas K.

    2014-01-01

    Aims NADPH oxidase (NOX) is the primary source of reactive oxygen species (ROS) in vascular smooth muscle cells (SMC) and is proposed to play a key role in redox signaling involved in the pathogenesis of cardiovascular disease. Growth factors and cytokines stimulate coronary SMC (CSMC) phenotypic modulation, proliferation, and migration during atherosclerotic plaque development and restenosis. We previously demonstrated that increased expression and activity of intermediate-conductance Ca2+-activated K+ channels (KCNN4) is necessary for CSMC phenotypic modulation and progression of stenotic lesions. Therefore, the purpose of this study was to determine whether NOX is required for KCNN4 upregulation induced by mitogenic growth factors. Methods and Results Dihydroethidium micro-fluorography in porcine CSMCs demonstrated that basic fibroblast growth factor (bFGF) increased superoxide production, which was blocked by the NOX inhibitor apocynin (Apo). Apo also blocked bFGF-induced increases in KCNN4 mRNA levels in both right coronary artery sections and CSMCs. Similarly, immunohistochemistry and whole cell voltage clamp showed bFGF-induced increases in CSMC KCNN4 protein expression and channel activity were abolished by Apo. Treatment with Apo also inhibited bFGF-induced increases in activator protein-1 promoter activity, as measured by luciferase activity assay. qRT-PCR demonstrated porcine coronary smooth muscle expression of NOX1, NOX2, NOX4, and NOX5 isoforms. Knockdown of NOX5 alone prevented both bFGF-induced upregulation of KCNN4 mRNA and CSMC migration. Conclusions Our findings provide novel evidence that NOX5-derived ROS increase functional expression of KCNN4 through activator protein-1, providing another potential link between NOX, CSMC phenotypic modulation, and atherosclerosis. PMID:25144362

  9. Epigenetic regulation of smooth muscle cell plasticity

    PubMed Central

    Liu, Renjing; Leslie, Kristen L.; Martin, Kathleen A.

    2014-01-01

    Smooth muscle cells (SMC) are the major cell type in blood vessels. Their principle function in the body is to regulate blood flow and pressure through vessel wall contraction and relaxation. Unlike many other mature cell types in the adult body, SMC do not terminally differentiate but retain a remarkable plasticity. They have the unique ability to toggle between a differentiated and quiescent “contractile” state and a highly proliferative and migratory “synthetic” phenotype in response to environmental stresses. While there have been major advances in our understanding of SMC plasticity through the identification of growth factors and signals that can influence the SMC phenotype, how these regulate SMC plasticity remains unknown. To date, several key transcription factors and regulatory cis elements have been identified that play a role in modulating SMC state. The frontier in understanding the molecular mechanisms underlying SMC plasticity has now advanced to the level of epigenetics. This review will summarize the epigenetic regulation of SMC, highlighting the role of histone modification, DNA methylation, and our most recent identification of a DNA demethylation pathway in SMC that is pivotal in the regulation of the SMC phenotypic state. Many disorders are associated with smooth muscle dysfunction, including atherosclerosis, the major underlying cause of stroke and coronary heart disease, as well as transplant vasculopathy, aneurysm, asthma, hypertension, and cancer. An increased understanding of the major regulators of SMC plasticity will lead to the identification of novel target molecules that may, in turn, lead to novel drug discoveries for the treatment of these diseases. PMID:24937434

  10. Epigenetic regulation of smooth muscle cell plasticity.

    PubMed

    Liu, Renjing; Leslie, Kristen L; Martin, Kathleen A

    2015-04-01

    Smooth muscle cells (SMC) are the major cell type in blood vessels. Their principal function in the body is to regulate blood flow and pressure through vessel wall contraction and relaxation. Unlike many other mature cell types in the adult body, SMC do not terminally differentiate but retain a remarkable plasticity. They have the unique ability to toggle between a differentiated and quiescent "contractile" state and a highly proliferative and migratory "synthetic" phenotype in response to environmental stresses. While there have been major advances in our understanding of SMC plasticity through the identification of growth factors and signals that can influence the SMC phenotype, how these regulate SMC plasticity remains unknown. To date, several key transcription factors and regulatory cis elements have been identified that play a role in modulating SMC state. The frontier in understanding the molecular mechanisms underlying SMC plasticity has now advanced to the level of epigenetics. This review will summarize the epigenetic regulation of SMC, highlighting the role of histone modification, DNA methylation, and our most recent identification of a DNA demethylation pathway in SMC that is pivotal in the regulation of the SMC phenotypic state. Many disorders are associated with smooth muscle dysfunction, including atherosclerosis, the major underlying cause of stroke and coronary heart disease, as well as transplant vasculopathy, aneurysm, asthma, hypertension, and cancer. An increased understanding of the major regulators of SMC plasticity will lead to the identification of novel target molecules that may, in turn, lead to novel drug discoveries for the treatment of these diseases. This article is part of a Special Issue entitled: Stress as a fundamental theme in cell plasticity. PMID:24937434

  11. Regeneration and Maintenance of Intestinal Smooth Muscle Phenotypes

    NASA Astrophysics Data System (ADS)

    Walthers, Christopher M.

    Tissue engineering is an emerging field of biomedical engineering that involves growing artificial organs to replace those lost to disease or injury. Within tissue engineering, there is a demand for artificial smooth muscle to repair tissues of the digestive tract, bladder, and vascular systems. Attempts to develop engineered smooth muscle tissues capable of contracting with sufficient strength to be clinically relevant have so far proven unsatisfactory. The goal of this research was to develop and sustain mature, contractile smooth muscle. Survival of implanted SMCs is critical to sustain the benefits of engineered smooth muscle. Survival of implanted smooth muscle cells was studied with layered, electrospun polycaprolactone implants with lasercut holes ranging from 0--25% porosity. It was found that greater angiogenesis was associated with increased survival of implanted cells, with a large increase at a threshold between 20% and 25% porosity. Heparan sulfate coatings improved the speed of blood vessel infiltration after 14 days of implantation. With these considerations, thicker engineered tissues may be possible. An improved smooth muscle tissue culture technique was utilized. Contracting smooth muscle was produced in culture by maintaining the native smooth muscle tissue organization, specifically by sustaining intact smooth muscle strips rather than dissociating tissue in to isolated smooth muscle cells. Isolated cells showed a decrease in maturity and contained fewer enteric neural and glial cells. Muscle strips also exhibited periodic contraction and regular fluctuation of intracellular calclium. The muscle strip maturity persisted after implantation in omentum for 14 days on polycaprolactone scaffolds. A low-cost, disposable bioreactor was developed to further improve maturity of cultured smooth muscle cells in an environment of controlled cyclical stress.The bioreactor consistently applied repeated mechanical strain with controllable inputs for strain

  12. Increased smooth muscle contractility in mice deficient for neuropilin 2.

    PubMed

    Bielenberg, Diane R; Seth, Abhishek; Shimizu, Akio; Pelton, Kristine; Cristofaro, Vivian; Ramachandran, Aruna; Zwaans, Bernadette M M; Chen, Cheng; Krishnan, Ramaswamy; Seth, Meetu; Huang, Lin; Takashima, Seiji; Klagsbrun, Michael; Sullivan, Maryrose P; Adam, Rosalyn M

    2012-08-01

    Neuropilins (NRPs) are transmembrane receptors that bind class 3 semaphorins and VEGF family members to regulate axon guidance and angiogenesis. Although expression of NRP1 by vascular smooth muscle cells (SMCs) has been reported, NRP function in smooth muscle (SM) in vivo is unexplored. Using Nrp2(+/LacZ) and Nrp2(+/gfp) transgenic mice, we observed robust and sustained expression of Nrp2 in the SM compartments of the bladder and gut, but no expression in vascular SM, skeletal muscle, or cardiac muscle. This expression pattern was recapitulated in vitro using primary human SM cell lines. Alterations in cell morphology after treatment of primary visceral SMCs with the NRP2 ligand semaphorin-3F (SEMA3F) were accompanied by inhibition of RhoA activity and myosin light chain phosphorylation, as well as decreased cytoskeletal stiffness. Ex vivo contractility testing of bladder muscle strips exposed to electrical stimulation or soluble agonists revealed enhanced tension generation of tissues from mice with constitutive or SM-specific knockout of Nrp2, compared with controls. Mice lacking Nrp2 also displayed increased bladder filling pressures, as assessed by cystometry in conscious mice. Together, these findings identify Nrp2 as a mediator of prorelaxant stimuli in SMCs and suggest a novel function for Nrp2 as a regulator of visceral SM contractility. PMID:22688055

  13. Immune/Inflammatory Response and Hypocontractility of Rabbit Colonic Smooth Muscle After TNBS-Induced Colitis

    PubMed Central

    Zhang, Yonggang; Li, Fang; Wang, Hong; Yin, Chaoran; Huang, JieAn; Mahavadi, Sunila; Murthy, Karnam S.

    2016-01-01

    Background The contractility of colonic smooth muscle is dysregulated due to immune/inflammatory responses in inflammatory bowel diseases. Inflammation in vitro induces up-regulation of regulator of G-protein signaling 4 (RGS4) expression in colonic smooth muscle cells. Aims To characterize the immune/inflammatory responses and RGS4 expression pattern in colonic smooth muscle after induction of colitis. Methods Colitis was induced in rabbits by intrarectal instillation of 2,4,6-trinitrobenzene sulfonic acid (TNBS). Innate/adaptive immune response RT-qPCR array was performed using colonic circular muscle strips. At 1–9 weeks after colonic intramuscular microinjection of lentivirus, the distal and proximal colons were collected, and muscle strips and dispersed muscle cells were prepared from circular muscle layer. Expression levels of RGS4 and NFκB signaling components were determined by Western blot analysis. The biological consequences of RGS4 knockdown were assessed by measurement of muscle contraction and phospholipase C (PLC)-β activity in response to acetylcholine (ACh). Results Contraction in response to ACh was significantly inhibited in the inflamed colonic circular smooth muscle cells. RGS4, IL-1, IL-6, IL-8, CCL3, CD1D, and ITGB2 were significantly up-regulated, while IL-18, CXCR4, CD86, and C3 were significantly down-regulated in the inflamed muscle strips. RGS4 protein expression in the inflamed smooth muscles was dramatically increased. RGS4 stable knockdown in vivo augmented ACh-stimulated PLC-β activity and contraction in colonic smooth muscle cells. Conclusion Inflamed smooth muscle exhibits up-regulation of IL-1-related signaling components, Th1 cytokines and RGS4, and inhibition of contraction. Stable knockdown of endogenous RGS4 in colonic smooth muscle increases PLC-β activity and contractile responses. PMID:26879904

  14. Aspirin-induced AMP-activated protein kinase activation regulates the proliferation of vascular smooth muscle cells from spontaneously hypertensive rats

    SciTech Connect

    Sung, Jin Young; Choi, Hyoung Chul

    2011-05-06

    Highlights: {yields} Aspirin-induced AMPK phosphorylation was greater in VSMC from SHR than WKY. {yields} Aspirin-induced AMPK phosphorylation inhibited proliferation of VSMC from SHR. {yields} Low basal AMPK phosphorylation in SHR elicits increased VSMC proliferation. {yields} Inhibition of AMPK restored decreased VSMC proliferation by aspirin in SHR. {yields} Aspirin exerts anti-proliferative effect through AMPK activation in VSMC from SHR. -- Abstract: Acetylsalicylic acid (aspirin), used to reduce risk of cardiovascular disease, plays an important role in the regulation of cellular proliferation. However, mechanisms responsible for aspirin-induced growth inhibition are not fully understood. Here, we investigated whether aspirin may exert therapeutic effects via AMP-activated protein kinase (AMPK) activation in vascular smooth muscle cells (VSMC) from wistar kyoto rats (WKY) and spontaneously hypertensive rats (SHR). Aspirin increased AMPK and acetyl-CoA carboxylase phosphorylation in a time- and dose-dependent manner in VSMCs from WKY and SHR, but with greater efficacy in SHR. In SHR, a low basal phosphorylation status of AMPK resulted in increased VSMC proliferation and aspirin-induced AMPK phosphorylation inhibited proliferation of VSMCs. Compound C, an AMPK inhibitor, and AMPK siRNA reduced the aspirin-mediated inhibition of VSMC proliferation, this effect was more pronounced in SHR than in WKY. In VSMCs from SHR, aspirin increased p53 and p21 expression and inhibited the expression of cell cycle associated proteins, such as p-Rb, cyclin D, and cyclin E. These results indicate that in SHR VSMCs aspirin exerts anti-proliferative effects through the induction of AMPK phosphorylation.

  15. Angiotensin II-induced Akt activation through the epidermal growth factor receptor in vascular smooth muscle cells is mediated by phospholipid metabolites derived by activation of phospholipase D.

    PubMed

    Li, Fang; Malik, Kafait U

    2005-03-01

    Angiotensin II (Ang II) activates cytosolic Ca(2+)-dependent phospholipase A(2) (cPLA(2)), phospholipase D (PLD), p38 mitogen-activated protein kinase (MAPK), epidermal growth factor receptor (EGFR) and Akt in vascular smooth muscle cells (VSMC). This study was conducted to investigate the relationship between Akt activation by Ang II and other signaling molecules in rat VSMC. Ang II-induced Akt phosphorylation was significantly reduced by the PLD inhibitor 1-butanol, but not by its inactive analog 2-butanol, and by brefeldin A, an inhibitor of the PLD cofactor ADP-ribosylation factor, and in cells infected with retrovirus containing PLD(2) siRNA or transfected with PLD(2) antisense but not control LacZ or sense oligonucleotide. Diacylglycerol kinase inhibitor II diminished Ang II-induced and diC8-phosphatidic acid (PA)-increased Akt phosphorylation, suggesting that PLD-dependent Akt activation is mediated by PA. Ang II-induced EGFR phosphorylation was inhibited by 1-butanol and PLD(2) siRNA and also by cPLA(2) siRNA. In addition, the inhibitor of arachidonic acid (AA) metabolism 5,8,11,14-eicosatetraynoic acid (ETYA) reduced both Ang II- and AA-induced EGFR transactivation. Furthermore, ETYA, cPLA(2) antisense, and cPLA(2) siRNA attenuated Ang II-elicited PLD activation. p38 MAPK inhibitor SB202190 [4-(4-flurophenyl)-2-(4-hydroxyphenyl)-5-(4-pyridyl)1H-imidazole] reduced PLD activity and EGFR and Akt phosphorylation elicited by Ang II. Pyrrolidine-1, a cPLA(2) inhibitor, and cPLA(2) siRNA decreased p38 MAPK activity. These data indicate that Ang II-stimulated Akt activity is mediated by cPLA(2)-dependent, p38 MAPK regulated PLD(2) activation and EGFR transactivation. We propose the following scheme of the sequence of events leading to activation of Akt in VSMC by Ang II: Ang II-->cPLA(2)-->AA-->p38 MAPK-->PLD(2)-->PA-->EGFR-->Akt. PMID:15525798

  16. Activity of Ca2+ -activated Cl- channels contributes to regulating receptor- and store-operated Ca2+ entry in human pulmonary artery smooth muscle cells

    PubMed Central

    Yamamura, Aya; Yamamura, Hisao; Zeifman, Amy; Yuan, Jason X.-J.

    2011-01-01

    Intracellular Ca2+ plays a fundamental role in regulating cell functions in pulmonary arterial smooth muscle cells (PASMCs). A rise in cytosolic Ca2+ concentration ([Ca2+]cyt) triggers pulmonary vasoconstriction and stimulates PASMC proliferation. [Ca2+]cyt is increased mainly by Ca2+ release from intracellular stores and Ca2+ influx through plasmalemmal Ca2+-permeable channels. Given the high concentration of intracellular Cl- in PASMCs, Ca2+-activated Cl-(ClCa) channels play an important role in regulating membrane potential and cell excitability of PASMCs. In this study, we examined whether activity of ClCa channels was involved in regulating [Ca2+]cyt in human PASMCs via regulating receptor- (ROCE) and store- (SOCE) operated Ca2+ entry. The data demonstrated that an angiotensin II (100 nM)-mediated increase in [Ca2+]cyt via ROCE was markedly attenuated by the ClCa channel inhibitors, niflumic acid (100 μM), flufenamic acid (100 μM), and 4,4’-diisothiocyanatostilbene-2,2’-disulfonic acid (100 μM). The inhibition of ClCa channels by niflumic acid and flufenamic acid significantly reduced both transient and plateau phases of SOCE that was induced by passive depletion of Ca2+ from the sarcoplasmic reticulum by 10 μM cyclopiazonic acid. In addition, ROCE and SOCE were abolished by SKF-96365 (50 μM) and 2-aminoethyl diphenylborinate (100 μM), and were slightly decreased in the presence of diltiazem (10 μM). The electrophysiological and immunocytochemical data indicate that ClCa currents were present and TMEM16A was functionally expressed in human PASMCs. The results from this study suggest that the function of ClCa channels, potentially formed by TMEM16A proteins, contributes to regulating [Ca2+]cyt by affecting ROCE and SOCE in human PASMCs. PMID:22034612

  17. Solving the confusion of gnaphaliin structure: gnaphaliin A and gnaphaliin B identified as active principles of Gnaphalium liebmannii with tracheal smooth muscle relaxant properties.

    PubMed

    Rodríguez-Ramos, Fernando; Navarrete, Andrés

    2009-06-01

    Inflorescences of Gnaphalium liebmannii, commonly known as "Gordolobo", is the most important remedy in Mexican traditional medicine to treat respiratory diseases, including asthma. By a bioguided fractionation of the n-hexane extract of this plant, following the relaxant effect on guinea pig tracheal smooth muscle, the flavones 5,7-dihydroxy-3,8-dimethoxyflavone (1) and 3,5-dihydroxy-7,8-dimethoxyflavone (2) were identified as the active relaxant compounds. Compounds 1 and 2 showed more potent relaxant properties than aminophylline in this model. Both 1 and 2 have been described as gnaphaliin in the past; here EIMS data, NMR experiments for both compounds, and X-ray diffraction analysis for 1 provided structural information to suggest that 1 and 2 should be named gnaphaliins A and B, respectively. PMID:19505084

  18. A-272651, a nonpeptidic blocker of large-conductance Ca2+-activated K+ channels, modulates bladder smooth muscle contractility and neuronal action potentials

    PubMed Central

    Shieh, C-C; Turner, S C; Zhang, X-F; Milicic, I; Parihar, A; Jinkerson, T; Wilkins, J; Buckner, S A; Gopalakrishnan, M

    2007-01-01

    Background and Purpose: The large-conductance Ca2+-activated K+ channel (BKCa, KCa1.1) links membrane excitability with intracellular Ca2+ signaling and plays important roles in smooth muscle contraction, neuronal firing, and neuroendocrine secretion. This study reports the characterization of a novel BKCa channel blocker, 2,4-dimethoxy-N-naphthalen-2-yl-benzamide (A-272651). Experimental Approach: 86Rb+ efflux in HEK-293 cells expressing BKCa was measured. Effects of A-272651 on BKCa α- and BKCa αβ1-mediated currents were evaluated by patch-clamp. Effects on contractility were assessed using low-frequency electrical field stimulated pig detrusor and spontaneously contracting guinea pig detrusor. Effects of A-272651 on neuronal activity were determined in rat small diameter dorsal root ganglia (DRG). Key Results: A-272651 (10 μM) inhibited 86Rb+ efflux evoked by NS-1608 in HEK-293 cells expressing BKCa currents. A-272651 concentration-dependently inhibited BKCa currents with IC50 values of 4.59 μM (Hill coefficient 1.04, measured at +40 mV), and 2.82 μM (Hill coefficient 0.89), respectively, for BKCa α and BKCa αβ1-mediated currents. Like iberiotoxin, A-272651 enhanced field stimulated twitch responses in pig detrusor and spontaneous contractions in guinea pig detrusor with EC50 values of 4.05±0.05 and 37.95±0.12 μM, respectively. In capsaicin-sensitive DRG neurons, application of A-272651 increased action potential firing and prolonged action potential duration. Conclusions and Implications: These data demonstrate that A-272651 modulates smooth muscle contractility and neuronal firing properties. Unlike previously reported peptide BKCa blockers, A-272651 represents one of the first small molecule BKCa channel blockers that could serve as a useful tool for further characterization of BKCa channels in physiological and pathological states. PMID:17519951

  19. Smooth muscle myosin expression, isoform composition, and functional activities in rat corpus cavernosum altered by the streptozotocin-induced type 1 diabetes

    PubMed Central

    Zhang, Xinhua; Kanika, Nirmala D.; Melman, Arnold

    2012-01-01

    Diabetes mellitus (DM) is a quite common chronic disease, and the prevalence of erectile dysfunction (ED) is three times higher in this large population. Although diabetes-related ED has been studied extensively, the actin-myosin contractile apparatus was not examined. The mRNAs encoding smooth muscle myosin (SMM) heavy chains (MHC) and essential light chains (LC17) exist as several different alternatively spliced isoforms with distinct contractile properties. Recently, we provided novel data that blebbistatin (BLEB), a specific myosin II inhibitor, potently relaxed corpus cavernosum smooth muscle (CCSM). In this study, we examine whether diabetes alters SMM expression, alternative splicing, and/or functional activities, including sensitivity to BLEB. By using streptozotocin (STZ)-induced 2-mo diabetic rats, functional activities were tested in vivo by intracavernous pressure (ICP) recording during cavernous nerve stimulation and in vitro via organ bath contractility studies. SMM isoform composition was analyzed by competitive RT-PCR and total SMM, myocardin, and embryonic SMM (SMemb) expression by real-time RT-PCR. Results revealed that the blood glucose level of STZ rats was 407.0 vs. 129.5 mg/dl (control). STZ rats exhibited ED confirmed by significantly increased CCSM contractile response to phenylephrine and decreased ICP response. For STZ rats, SM-B, LC17a and SM2 isoforms, total SMM, and myocardin expression increased, whereas SM-A, LC17b, and SM1 isoforms were decreased, with SMemb unchanged. BLEB was significantly more effective in relaxing STZ CCSM both in vitro and in vivo. Thus we demonstrated a novel diabetes-specific effect on alternative splicing of the SMM heavy chain and essential light chain genes to a SMM isoform composition favoring a heightened contractility and ED. A switch to a more contractile phenotype was supported further by total SMM expression increase. Moreover, the change in CCSM phenotype was associated with an increased sensitivity

  20. Vascular Smooth Muscle Cells in Atherosclerosis.

    PubMed

    Bennett, Martin R; Sinha, Sanjay; Owens, Gary K

    2016-02-19

    The historical view of vascular smooth muscle cells (VSMCs) in atherosclerosis is that aberrant proliferation of VSMCs promotes plaque formation, but that VSMCs in advanced plaques are entirely beneficial, for example preventing rupture of the fibrous cap. However, this view has been based on ideas that there is a homogenous population of VSMCs within the plaque, that can be identified separate from other plaque cells (particularly macrophages) using standard VSMC and macrophage immunohistochemical markers. More recent genetic lineage tracing studies have shown that VSMC phenotypic switching results in less-differentiated forms that lack VSMC markers including macrophage-like cells, and this switching directly promotes atherosclerosis. In addition, VSMC proliferation may be beneficial throughout atherogenesis, and not just in advanced lesions, whereas VSMC apoptosis, cell senescence, and VSMC-derived macrophage-like cells may promote inflammation. We review the effect of embryological origin on VSMC behavior in atherosclerosis, the role, regulation and consequences of phenotypic switching, the evidence for different origins of VSMCs, and the role of individual processes that VSMCs undergo in atherosclerosis in regard to plaque formation and the structure of advanced lesions. We think there is now compelling evidence that a full understanding of VSMC behavior in atherosclerosis is critical to identify therapeutic targets to both prevent and treat atherosclerosis. PMID:26892967

  1. ASIC proteins regulate smooth muscle cell migration.

    PubMed

    Grifoni, Samira C; Jernigan, Nikki L; Hamilton, Gina; Drummond, Heather A

    2008-03-01

    The purpose of the present study was to investigate Acid Sensing Ion Channel (ASIC) protein expression and importance in cellular migration. We recently demonstrated that Epithelial Na(+)Channel (ENaC) proteins are required for vascular smooth muscle cell (VSMC) migration; however, the role of the closely related ASIC proteins has not been addressed. We used RT-PCR and immunolabeling to determine expression of ASIC1, ASIC2, ASIC3 and ASIC4 in A10 cells. We used small interference RNA to silence individual ASIC expression and determine the importance of ASIC proteins in wound healing and chemotaxis (PDGF-bb)-initiated migration. We found ASIC1, ASIC2, and ASIC3, but not ASIC4, expression in A10 cells. ASIC1, ASIC2, and ASIC3 siRNA molecules significantly suppressed expression of their respective proteins compared to non-targeting siRNA (RISC) transfected controls by 63%, 44%, and 55%, respectively. Wound healing was inhibited by 10, 20, and 26% compared to RISC controls following suppression of ASIC1, ASIC2, and ASIC3, respectively. Chemotactic migration was inhibited by 30% and 45%, respectively, following suppression of ASIC1 and ASIC3. ASIC2 suppression produced a small, but significant, increase in chemotactic migration (4%). Our data indicate that ASIC expression is required for normal migration and may suggest a novel role for ASIC proteins in cellular migration. PMID:17936312

  2. Functional and Proteomic Investigations Reveal Major Royal Jelly Protein 1 Associated with Anti-hypertension Activity in Mouse Vascular Smooth Muscle Cells

    PubMed Central

    Fan, Pei; Han, Bin; Feng, Mao; Fang, Yu; Zhang, Lan; Hu, Han; Hao, Yue; Qi, Yuping; Zhang, Xiaozhen; Li, Jianke

    2016-01-01

    Vascular smooth muscle cells (VSMCs) are a major cell type of the arterial wall and their functionality is associated with blood pressure regulation. Although royal jelly (RJ) has reported effects on anti-hypertension, the mechanism of blood pressure regulation by major royal jelly protein 1 (MRJP1), the most abundant RJ protein, is still unknown. The mrjp1 gene was inserted into mouse VSMCs to investigate how MRJP1 influences VSMC functionality by functional and proteomic analysis. The expression of MRJP1 in VSMCs significantly reduced cell contraction, migration, and proliferation, suggesting a potential role in decreasing hypertension via action on VSMCs. These anti-hypertension activities were further observed in the changes of the proteome setting of mouse VSMCs. Among 675 different proteins after MRJP1 expression, 646 were down-regulated and significantly enriched in pathways implicated in VSMC contraction and migration, which suggest MRJP1 lowers VSMC contraction and migration by inhibiting muscle filament movement. The down-regulated proteins also enriched pathways in proliferation, indicating that MRJP1 hinders VSMC proliferation by reducing the supply of energy and genetic material. This is the first report integrating MRJP1 into VSMC, revealing the function and mechanism correlated with anti-hypertensive activity. This offers a therapeutic potential to control hypertension by gene-therapy using bee-products. PMID:27444336

  3. Functional and Proteomic Investigations Reveal Major Royal Jelly Protein 1 Associated with Anti-hypertension Activity in Mouse Vascular Smooth Muscle Cells.

    PubMed

    Fan, Pei; Han, Bin; Feng, Mao; Fang, Yu; Zhang, Lan; Hu, Han; Hao, Yue; Qi, Yuping; Zhang, Xiaozhen; Li, Jianke

    2016-01-01

    Vascular smooth muscle cells (VSMCs) are a major cell type of the arterial wall and their functionality is associated with blood pressure regulation. Although royal jelly (RJ) has reported effects on anti-hypertension, the mechanism of blood pressure regulation by major royal jelly protein 1 (MRJP1), the most abundant RJ protein, is still unknown. The mrjp1 gene was inserted into mouse VSMCs to investigate how MRJP1 influences VSMC functionality by functional and proteomic analysis. The expression of MRJP1 in VSMCs significantly reduced cell contraction, migration, and proliferation, suggesting a potential role in decreasing hypertension via action on VSMCs. These anti-hypertension activities were further observed in the changes of the proteome setting of mouse VSMCs. Among 675 different proteins after MRJP1 expression, 646 were down-regulated and significantly enriched in pathways implicated in VSMC contraction and migration, which suggest MRJP1 lowers VSMC contraction and migration by inhibiting muscle filament movement. The down-regulated proteins also enriched pathways in proliferation, indicating that MRJP1 hinders VSMC proliferation by reducing the supply of energy and genetic material. This is the first report integrating MRJP1 into VSMC, revealing the function and mechanism correlated with anti-hypertensive activity. This offers a therapeutic potential to control hypertension by gene-therapy using bee-products. PMID:27444336

  4. The LIM protein leupaxin is enriched in smooth muscle and functions as an serum response factor cofactor to induce smooth muscle cell gene transcription.

    PubMed

    Sundberg-Smith, Liisa J; DiMichele, Laura A; Sayers, Rebecca L; Mack, Christopher P; Taylor, Joan M

    2008-06-20

    Leupaxin is a LIM domain-containing adapter protein belonging to the paxillin family that has been previously reported to be preferentially expressed in hematopoietic cells. Herein, we identified leupaxin in a screen for focal adhesion kinase binding partners in aortic smooth muscle, and we show that leupaxin is enriched in human and mouse vascular smooth muscle and that leupaxin expression is dynamically regulated during development. In addition, our studies reveal that leupaxin can undergo cytoplasmic/nuclear shuttling and functions as an serum response factor cofactor in the nucleus. We found that leupaxin forms a complex with serum response factor and associates with CArG-containing regions of smooth muscle promoters and that ectopic expression of leupaxin induces smooth muscle marker gene expression in both 10T1/2 cells and rat aortic smooth muscle cells. Subsequent studies indicated that enhanced focal adhesion kinase activity (induced by fibronectin or expression of constitutively active focal adhesion kinase) attenuates the nuclear accumulation of leupaxin and limits the ability of leupaxin to enhance serum response factor-dependent gene transcription. Thus, these studies indicate that modulation of the subcellular localization of serum response factor cofactors is 1 mechanism by which extracellular matrix-dependent signals may regulate phenotypic switching of smooth muscle cells. PMID:18497331

  5. The ability of AIF-1 to activate human vascular smooth muscle cells is lost by mutations in the EF-hand calcium-binding region

    SciTech Connect

    Autieri, Michael V. . E-mail: mautieri@temple.edu; Chen Xing

    2005-07-01

    Allograft Inflammatory Factor-1 (AIF-1) is a cytoplasmic calcium-binding protein expressed in vascular smooth muscle cells (VSMC) in response to injury or cytokine stimulation. AIF-1 contains a partially conserved EF-hand calcium-binding domain, and participates in VSMC activation by activation of Rac1 and induction of Granulocyte-Colony Stimulating Factor (G-CSF) expression; however, the mechanism whereby AIF-1 mediates these effects is presently uncharacterized. To determine if calcium binding plays a functional role in AIF-1 activity, a single site-specific mutation was made in the EF-hand calcium-binding domain to abrogate binding of calcium (AIF-1{delta}A), which was confirmed by calcium overlay. Functionally, similar to wild-type AIF-1, AIF-1{delta}A was able to polymerize F-actin in vitro. However, in contrast to wild-type AIF-1, over-expression of AIF-1{delta}A was unable to increase migration or proliferation of primary human VSMC. Further, it was unable to activate Rac1, or induce G-CSF expression to the degree as wild-type AIF-1. Taken together, modification of the wild-type EF-hand domain and native calcium-binding activity results in a loss of AIF-1 function. We conclude that appropriate calcium-binding potential is critical in AIF-1-mediated effects on VSMC pathophysiology, and that AIF-1 activity is mediated by Rac1 activation and G-CSF expression.

  6. Cardiac, skeletal, and smooth muscle mitochondrial respiration: are all mitochondria created equal?

    PubMed Central

    Park, Song-Young; Gifford, Jayson R.; Andtbacka, Robert H. I.; Trinity, Joel D.; Hyngstrom, John R.; Garten, Ryan S.; Diakos, Nikolaos A.; Ives, Stephen J.; Dela, Flemming; Larsen, Steen; Drakos, Stavros

    2014-01-01

    Unlike cardiac and skeletal muscle, little is known about vascular smooth muscle mitochondrial respiration. Therefore, the present study examined mitochondrial respiratory rates in smooth muscle of healthy human feed arteries and compared with that of healthy cardiac and skeletal muscles. Cardiac, skeletal, and smooth muscles were harvested from a total of 22 subjects (53 ± 6 yr), and mitochondrial respiration was assessed in permeabilized fibers. Complex I + II, state 3 respiration, an index of oxidative phosphorylation capacity, fell progressively from cardiac to skeletal to smooth muscles (54 ± 1, 39 ± 4, and 15 ± 1 pmol·s−1·mg−1, P < 0.05, respectively). Citrate synthase (CS) activity, an index of mitochondrial density, also fell progressively from cardiac to skeletal to smooth muscles (222 ± 13, 115 ± 2, and 48 ± 2 μmol·g−1·min−1, P < 0.05, respectively). Thus, when respiration rates were normalized by CS (respiration per mitochondrial content), oxidative phosphorylation capacity was no longer different between the three muscle types. Interestingly, complex I state 2 normalized for CS activity, an index of nonphosphorylating respiration per mitochondrial content, increased progressively from cardiac to skeletal to smooth muscles, such that the respiratory control ratio, state 3/state 2 respiration, fell progressively from cardiac to skeletal to smooth muscles (5.3 ± 0.7, 3.2 ± 0.4, and 1.6 ± 0.3 pmol·s−1·mg−1, P < 0.05, respectively). Thus, although oxidative phosphorylation capacity per mitochondrial content in cardiac, skeletal, and smooth muscles suggest all mitochondria are created equal, the contrasting respiratory control ratio and nonphosphorylating respiration highlight the existence of intrinsic functional differences between these muscle mitochondria. This likely influences the efficiency of oxidative phosphorylation and could potentially alter ROS production. PMID:24906913

  7. Neurotrophin and Neurotrophin Receptors in Vascular Smooth Muscle Cells

    PubMed Central

    Donovan, Michael J.; Miranda, Rajesh C.; Kraemer, Rosemary; McCaffrey, Timothy A.; Tessarollo, Lino; Mahadeo, Debbie; Sharif, Setareh; Kaplan, David R.; Tsoulfas, Pantelis; Parada, Luis; Toran-Allerand, C. Dominique; Hajjar, David P.; Hempstead, Barbara L.

    1995-01-01

    The neurotrophins, a family of related polypeptide growth factors including nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF) and neurotrophin (NT)-3 and NT-4/5 promote the survival and differentiation of distinctive sets of embryonic neurons. Here we define a new functional role for neurotrophins, as autocrine or local paracrine mediators of vascular smooth muscle cell migration. We have identified neurotrophins, and their cognate receptors, the trk tyrosine kinases, in human and rat vascular smooth muscle cells in vivo. In vitro, cultured human smooth muscle cells express BDNF; NT-3; and trk A, B, and C Similarly, rat smooth muscle cells expressed all three trk receptors as well as all four neurotrophins. Moreover, NGF induces cultured human smooth muscle cell migration at subnanomolar concentrations. In the rat aortic balloon deendothelialization model of vascular injury, the expression of NGF, BDNF, and their receptors trk A and trk B increased dramatically in the area of injury within 3 days and persisted during the formation of the neointima. In human coronary atherosclerotic lesions, BDNF, NT-3, and NT-4/5, and the trk B and trk C receptors could be demonstrated in smooth muscle cells. These findings suggest that neurotrophins play an important role in regulating the response of vascular smooth muscle cells to injury. ImagesFigure 1Figure 2Figure 3Figure 5Figure 6Figure 7Figure 8 PMID:7639328

  8. Serotonin augments smooth muscle differentiation of bone marrow stromal cells.

    PubMed

    Hirota, Nobuaki; McCuaig, Sarah; O'Sullivan, Michael J; Martin, James G

    2014-05-01

    Bone marrow stromal cells (BMSCs) contain a subset of multipotent stem cells. Here, we demonstrate that serotonin, a biogenic amine released by platelets and mast cells, can induce the smooth muscle differentiation of BMSCs. Brown Norway rat BMSCs stimulated with serotonin had increased expression of the smooth muscle markers smooth muscle myosin heavy chain (MHC) and α actin (α-SMA) by qPCR and Western blot, indicating smooth muscle differentiation. This was accompanied by a concomitant down-regulation of the microRNA miR-25-5p, which was found to negatively regulate smooth muscle differentiation. Serotonin upregulated serum response factor (SRF) and myocardin, transcription factors known to induce contractile protein expression in smooth muscle cells, while it down-regulated Elk1 and Kruppel-like factor 4 (KLF4), known to induce proliferation. Serotonin increased SRF binding to promoter regions of the MHC and α-SMA genes, assessed by chromatin immunoprecipitation assay. Induction of smooth muscle differentiation by serotonin was blocked by the knock-down of SRF and myocardin. Transforming growth factor (TGF)-β1 was constitutively expressed by BMSCs and serotonin triggered its release. Inhibition of miR-25-5p augmented TGF-β1 expression, however the differentiation of BMSCs was not mediated by TGF-β1. These findings demonstrate that serotonin promotes a smooth muscle-like phenotype in BMSCs by altering the balance of SRF, myocardin, Elk1 and KLF4 and miR-25-5p is involved in modulating this balance. Therefore, serotonin potentially contributes to the pathogenesis of diseases characterized by tissue remodeling with increased smooth muscle mass. PMID:24595007

  9. Tetramethylpyrazine inhibits agiontensin II-induced nuclear factor-kappaB activation and bone morphogenetic protein-2 downregulation in rat vascular smooth muscle cells.

    PubMed

    Ren, Xin-Yu; Ruan, Qiu-Rong; Zhu, Da-He; Zhu, Min; Qu, Zhi-Ling; Lu, Jun

    2007-06-25

    Tetramethylpyrazine (TMP), an effective component of traditional Chinese medicine Chuanxiong, is commonly used to resolve embolism. Its possible therapeutic effect against atherosclerosis has received considerable attention recently. Angiotensin II (Ang II) is highly implicated in the proliferation of vascular smooth muscle cells (VSMCs), resulting in atherosclerosis. The mechanisms of TMP in the proliferation of VSMCs induced by Ang II remain to be defined. The present study was aimed to study the effect of TMP on Ang II-induced VSMC proliferation through detection of nuclear factor-kappaB (NF-kappaB) activity and bone morphogenetic protein-2 (BMP-2) expression. Primary cultured rat aortic smooth muscle cells were divided into the control group, Ang II group, Ang II + TMP group and TMP group. Cells in each group were harvested at different time points (15, 30 and 60 min for detection of NF-kappaB activity; 6, 12 and 24 h for measurement of BMP-2 expression). NF-kappaB activation was identified as nuclear staining by immunohistochemistry. BMP-2 expression was observed through Western blot, immunohistochemistry and in situ hybridization. The results showed that: (1) Ang II stimulated the activation of NF-kappaB. Translocation of NF-kappaB p65 subunit from cytoplasm to nucleus appeared as early as 15 min, peaked at 30 min (P<0.01) and declined after 1 h. (2) TMP inhibited Ang II-induced NF-kappaB activation (P<0.01). (3) Ang II increased BMP-2 expression at 6 h but declined it significantly at 12 and 24 h (P<0.01). (4) BMP-2 expression was also kept at high level at 6 h in Ang II + TMP group but maintained at the normal level at 12 and 24 h. (5) There was no significant difference in NF-kappaB activation and BMP-2 expression between the control group and TMP group. These results indicate that TMP inhibits Ang II-induced VSMC proliferation through repression of NF-kappaB activation and BMP-2 reduction, and BMP-2 expression is independent of the NF-kappaB pathway. In

  10. Internally applied endotoxin and the activation of BK channels in cerebral artery smooth muscle via a nitric oxide-like pathway

    PubMed Central

    Hoang, L M; Mathers, D A

    1998-01-01

    In this study the role of nitric oxide synthase (NOS) in the acute activation of large conductance, Ca2+-activated K+ channels (BK channels) by internally applied E. coli lipopolysaccharide (LPS, endotoxin) was examined in vascular smooth muscle cells.Cerebrovascular smooth muscle cells (CVSMCs) were enzymatically dispersed from the middle, posterior communicating and posterior cerebral arteries of adult Wistar rats and maintained at 4°C for 2–4 days before recording with standard patch-clamp techniques.Acute application of LPS (100 μg ml−1) to inside-out patches of CVSMC membrane isolated in a cell-free environment rapidly and reversibly increased the open probability, Po of BK channels in these patches by 3.3±0.30 fold.Acute application of the nitric oxide (NO) donor sodium nitroprusside (SNP, 100 μM) to inside-out patches of CVSMC membrane, studied in the presence of intact cells, also reversibly increased Po, by some 1.8±0.2 fold over control.Kinetic analysis showed that both LPS and SNP increased Po by accelerating the rate of BK channel reopening, rather than by retarding the closure of open channels.Neither LPS nor SNP altered the reversal potential or conductance of BK channels.The NOS substrate L-arginine (1 μM) potentiated the acute activation of BK channels by LPS, while the synthetic enantiomer D-arginine (1 μM) inhibited the action of LPS on BK channels.The acute activation of BK channels by LPS was suppressed by pre-incubation of cells with Nω-nitro-L-arginine (50 μM) or Nω-nitro-L-arginine methyl ester (1  mM), two competitive antagonists of nitric oxide synthases. Nω-nitro-D-arginine (50 μM), a poor inhibitor of NOS in in vitro assays, had no effect on BK channel activation by LPS.These results indicate that excised, inside-out patches of CVSMC membrane exhibit a NOS-like activity which is acutely activated when LPS is present at the cytoplasmic membrane surface. Possible relationships between this novel mechanism

  11. Differential Activation of Vascular Smooth Muscle Kv7.4, Kv7.5, and Kv7.4/7.5 Channels by ML213 and ICA-069673

    PubMed Central

    Brueggemann, Lyubov I.; Haick, Jennifer M.; Cribbs, Leanne L.

    2014-01-01

    Recent research suggests that smooth muscle cells express Kv7.4 and Kv7.5 voltage-activated potassium channels, which contribute to maintenance of their resting membrane voltage. New pharmacologic activators of Kv7 channels, ML213 (N-mesitybicyclo[2.2.1]heptane-2-carboxamide) and ICA-069673 N-(6-chloropyridin-3-yl)-3,4-difluorobenzamide), have been reported to discriminate among channels formed from different Kv7 subtypes. We compared the effects of ML213 and ICA-069673 on homomeric human Kv7.4, Kv7.5, and heteromeric Kv7.4/7.5 channels exogenously expressed in A7r5 vascular smooth muscle cells. We found that, despite its previous description as a selective activator of Kv7.2 and Kv7.4, ML213 significantly increased the maximum conductance of homomeric Kv7.4 and Kv7.5, as well as heteromeric Kv7.4/7.5 channels, and induced a negative shift of their activation curves. Current deactivation rates decreased in the presence of the ML213 (10 μM) for all three channel combinations. Mutants of Kv7.4 (W242L) and Kv7.5 (W235L), previously found to be insensitive to another Kv7 channel activator, retigabine, were also insensitive to ML213 (10 μM). In contrast to ML213, ICA-069673 robustly activated Kv7.4 channels but was significantly less effective on homomeric Kv7.5 channels. Heteromeric Kv7.4/7.5 channels displayed intermediate responses to ICA-069673. In each case, ICA-069673 induced a negative shift of the activation curves without significantly increasing maximal conductance. Current deactivation rates decreased in the presence of ICA-069673 in a subunit-specific manner. Kv7.4 W242L responded to ICA-069673-like wild-type Kv7.4, but a Kv7.4 F143A mutant was much less sensitive to ICA-069673. Based on these results, ML213 and ICA-069673 likely bind to different sites and are differentially selective among Kv7.4, Kv7.5, and Kv7.4/7.5 channel subtypes. PMID:24944189

  12. Tobacco constituents are mitogenic for arterial smooth-muscle cells

    SciTech Connect

    Becker, C.G.; Hajjar, D.P.; Hefton, J.M.

    1985-07-01

    Tobacco glycoprotein (TGP) purified from flue-cured tobacco leaves, tar-derived material (TAR), the water soluble, nondialyzable, delipidized extract of cigarette smoke condensate, rutin-bovine serum albumin conjugates, quercetin, and chlorogenic acid are mitogenic for bovine aortic smooth-muscle cells, but not adventitial fibroblasts. The mitogenicity appears to depend on polyphenol epitopes on carrier molecules. Ellagic acid, another plant polyphenol, inhibited arterial smooth-muscle proliferation. These results suggest that a number of ubiquitous, plant-derived substances may influence smooth-muscle cell proliferation in the arterial wall.

  13. Myosin assembly critical for the enzyme activity of smooth muscle myosin phosphatase: effects of MgATP, ionic strength, and Mg(2+).

    PubMed

    Sato, O; Ogawa, Y

    2001-06-01

    We suggested that an assembled form of phosphorylated myosin (P-myosin) might exhibit higher affinity for smooth muscle myosin phosphatase (SMMP) than dissociated P-myosin on the basis of the effect of MgATP [Sato and Ogawa (1999) J. Biochem. 126, 787-797]. To further deepen our understanding, we examined the SMMP activity and P-myosin assembly with various ionic strengths and Mg(2+) concentrations, with and without MgATP, all of which are well known to be critical for myosin assembly. The structure of myosin molecules was directly observed by electron microscopy using a rotary shadowing procedure, which was found to be consistent with the sedimentation assay. We found that the SMMP activity was always high when P-myosin was assembled. MgATP, which disassembled P-myosin mostly into a folded conformation, in contrast, decreased the enzyme activity. We also found that glycerol had a dissociating action on P-myosin, primarily dissociating it into an extended conformation, resulting in reduced SMMP activity, and that increases in the ionic strength and Mg(2+) (>5 mM) inhibited SMMP. These results indicate that myosin assembly is essential for SMMP activity. PMID:11388902

  14. Heat shock protein 60 stimulates the migration of vascular smooth muscle cells via Toll-like receptor 4 and ERK MAPK activation

    PubMed Central

    Zhao, Ying; Zhang, Chenxu; Wei, Xuge; Li, Pei; Cui, Ying; Qin, Yuanhua; Wei, Xiaoqing; Jin, Minli; Kohama, Kazuhiro; Gao, Ying

    2015-01-01

    Accumulating evidence indicates that heat shock protein (HSP) 60 is strongly associated with the pathology of atherosclerosis (AS). However, the precise mechanisms by which HSP60 promotes atherosclerosis remain unclear. In the present study, we found that HSP60 mRNA and protein expression levels in the thoracic aorta are enhanced not only in a mouse model of AS but also in high-fat diet (HFD) mice. HSP60 expression and secretion was activated by platelet-derived growth factor-BB (PDGF-BB) and interleukin (IL)-8 in both human umbilical vein endothelial cells (HUVECs) and vascular smooth muscle cells (VSMCs). HSP60 was found to induce VSMC migration, and exposure to HSP60 activated ERK MAPK signaling. U0126, an inhibitor of ERK, reduced VSMC migration. The HSP60-stimulated VSMCs were found to express TLR4 mRNA but not TLR2 mRNA. Knockdown of TLR4 by siRNA reduced HSP60-induced VSMC migration and HSP60-induced ERK activation. Finally, HSP60 induced IL-8 secretion in VSMCs. Together these results suggest that HSP60 is involved in the stimulation of VSMC migration, via TLR4 and ERK MAPK activation. Meanwhile, activation of HSP60 is one of the most powerful methods of sending a ‘danger signal’ to the immune system to generate IL-8, which assists in the management of an infection or disease. PMID:26477505

  15. Stainless Steel Ions Stimulate Increased Thrombospondin-1-Dependent TGF-Beta Activation by Vascular Smooth Muscle Cells: Implications for In-Stent Restenosis

    PubMed Central

    Pallero, Manuel A.; Talbert Roden, Melissa; Chen, Yiu-Fai; Anderson, Peter G.; Lemons, Jack; Brott, Brigitta C.; Murphy-Ullrich, Joanne E.

    2010-01-01

    Background/Aims Despite advances in stent design, in-stent restenosis (ISR) remains a significant clinical problem. All implant metals exhibit corrosion, which results in release of metal ions. Stainless steel (SS), a metal alloy widely used in stents, releases ions to the vessel wall and induces reactive oxygen species, inflammation and fibroproliferative responses. The molecular mechanisms are unknown. TGF-β is known to be involved in the fibroproliferative responses of vascular smooth muscle cells (VSMCs) in restenosis, and TGF-β antagonists attenuate ISR. We hypothesized that SS ions induce the latent TGF-β activator, thrombospondin-1 (TSP1), through altered oxidative signaling to stimulate increased TGF-β activation and VSMC phenotype change. Methods VSMCs were treated with SS metal ion cocktails, and morphology, TSP1, extracellular matrix production, desmin and TGF-β activity were assessed by immunoblotting. Results SS ions stimulate the synthetic phenotype, increased TGF-β activity, TSP1, increased extracellular matrix and downregulation of desmin in VSMCs. Furthermore, SS ions increase hydrogen peroxide and decrease cGMP-dependent protein kinase (PKG) signaling, a known repressor of TSP1 transcription. Catalase blocks SS ion attenuation of PKG signaling and increased TSP1 expression. Conclusions These data suggest that ions from stent alloy corrosion contribute to ISR through stimulation of TSP1-dependent TGF-β activation. PMID:20016205

  16. Calcineurin/Nuclear Factor of Activated T Cells–Coupled Vanilliod Transient Receptor Potential Channel 4 Ca2+ Sparklets Stimulate Airway Smooth Muscle Cell Proliferation

    PubMed Central

    Zhao, Limin; Sullivan, Michelle N.; Chase, Marlee; Gonzales, Albert L.

    2014-01-01

    Proliferation of airway smooth muscle cells (ASMCs) contributes to the remodeling and irreversible obstruction of airways during severe asthma, but the mechanisms underlying this disease process are poorly understood. Here we tested the hypothesis that Ca2+ influx through the vanilliod transient receptor potential channel (TRPV) 4 stimulates ASMC proliferation. We found that synthetic and endogenous TRPV4 agonists increase proliferation of primary ASMCs. Furthermore, we demonstrate that Ca2+ influx through individual TRPV4 channels produces Ca2+ microdomains in ASMCs, called “TRPV4 Ca2+ sparklets.” We also show that TRPV4 channels colocalize with the Ca2+/calmodulin–dependent protein phosphatase calcineurin in ASMCs. Activated calcineurin dephosphorylates nuclear factor of activated T cells (NFAT) transcription factors cytosolic (c) to allow nuclear translocation and activation of synthetic transcriptional pathways. We show that ASMC proliferation in response to TRPV4 activity is associated with calcineurin-dependent nuclear translocation of the NFATc3 isoform tagged with green florescent protein. Our findings suggest that Ca2+ microdomains created by TRPV4 Ca2+ sparklets activate calcineurin to stimulate nuclear translocation of NFAT and ASMC proliferation. These findings further suggest that inhibition of TRPV4 could diminish asthma-induced airway remodeling. PMID:24392954

  17. Stimulant actions of volatile anaesthetics on smooth muscle

    PubMed Central

    Rang, H. P.

    1964-01-01

    A number of volatile anaesthetics, and some compounds synthesized in the search for new anaesthetics, have been tested on guinea-pig intestinal smooth muscle in vitro. All the compounds produced a contractile response. This effect did not correlate well with convulsant activity in vivo among the compounds tested. Two kinds of stimulant effect were distinguishable: (1) Rapid, transient contractions, abolished by cocaine or lachesine; most of the anaesthetics in clinical use had this action. (2) Slow, sustained contractions, unaffected by cocaine or lachesine; this effect predominated among the fluorinated ring compounds. Hexamethonium and mepyramine did not affect the contractile response to any of the compounds. The first type of effect presumably represents excitation of postganglionic nerve cells, while the second type is a direct action on the muscle cell. The action of perfluorobenzene, which is of the latter kind, was studied further. Adrenaline and lack of calcium diminished the contraction in parallel with the contraction to histamine, which suggests that the cell membrane was the site of action; in contrast to the stimulant action of histamine or acetylcholine, the effect was highly temperature-sensitive, being almost abolished by cooling to 32° C, and enhanced at 40° C. The depressant action of anaesthetics on smooth muscle is affected very little by temperature changes. These findings are discussed in relation to other observations which suggest a stimulant action of volatile anaesthetics on excitable tissues. Protein denaturation is tentatively suggested as a mechanism of action. PMID:14190470

  18. MURC deficiency in smooth muscle attenuates pulmonary hypertension

    PubMed Central

    Nakanishi, Naohiko; Ogata, Takehiro; Naito, Daisuke; Miyagawa, Kotaro; Taniguchi, Takuya; Hamaoka, Tetsuro; Maruyama, Naoki; Kasahara, Takeru; Nishi, Masahiro; Matoba, Satoaki; Ueyama, Tomomi

    2016-01-01

    Emerging evidence suggests that caveolin-1 (Cav1) is associated with pulmonary arterial hypertension. MURC (also called Cavin-4) is a member of the cavin family, which regulates caveolar formation and functions together with caveolins. Here, we show that hypoxia increased Murc mRNA expression in the mouse lung, and that Murc-null mice exhibited attenuation of hypoxia-induced pulmonary hypertension (PH) accompanied by reduced ROCK activity in the lung. Conditional knockout mice lacking Murc in smooth muscle also resist hypoxia-induced PH. MURC regulates the proliferation and migration of pulmonary artery smooth muscle cells (PASMCs) through Rho/ROCK signalling. Cav1 suppresses RhoA activity in PASMCs, which is reversed by MURC. MURC binds to Cav1 and inhibits the association of Cav1 with the active form of Gα13, resulting in the facilitated association of the active form of Gα13 with p115RhoGEF. These results reveal that MURC has a function in the development of PH through modulating Rho/ROCK signalling. PMID:27546070

  19. Transglutaminase 2 Promotes PDGF-Mediated Activation of PDGFR/Akt1 and β-catenin Signaling in Vascular Smooth Muscle Cells and Supports Neointima Formation

    PubMed Central

    Nurminskaya, Maria; Beazley, Kelly E.; Smith, Elizabeth P.; Belkin, Alexey M.

    2015-01-01

    Background Phenotypic switch of vascular smooth muscle cells (VSMCs) accompanies neointima formation and associates with vascular diseases. Platelet derived growth factor (PDGF)-induced activation of PDGFR/Akt1 and β-catenin signaling pathways in VSMCs has been implicated in vessel occlusion. Transglutaminase 2 (TG2) regulates these pathways and its levels are increased in the neointima. Objective To evaluate the role of TG2 in PDGF/β-catenin signaling cross-talk and assess its contribution to neointima. Methods Aortic VSMCs from wild-type and TG2 knockout mice were tested in vitro for levels of VSMC markers, proliferation, migration, and PDGF-induced activation of PDGFR/Akt1 and β-catenin pathways. Neointima in these mice was studied ex vivo in coronary vessels using heart slice model and in vivo using carotid artery ligation (CAL) model. Results Genetic deletion of TG2 attenuated the PDGF-induced phenotypic switch of aortic VSMCs, reduced their proliferation and migration rates, and inhibited PDGF-induced activation of PDGFR/Akt1 and β-catenin pathways in both ex vivo and in vivo neointima models. Importantly, genetic deletion of TG2 also markedly attenuated vessel occlusion. Conclusions TG2 promotes neointima formation by mediating the PDGF-induced activation of the PDGFR/Akt1 and β-catenin pathways in VSMCs. This study identifies TG2 as a potential therapeutic target for blocking neointima in blood vessels. PMID:25612735

  20. Antioxidant activity of caffeoyl-prolyl-histidine amide and its effects on PDGF-induced proliferation of vascular smooth muscle cells.

    PubMed

    Kwak, Seon-Yeong; Lee, Hyun Jung; Yang, Jin-Kyoung; Lee, Eun Jig; Seo, MiRan; Lee, Yoon-Sik

    2014-12-01

    Caffeic acid (CA) is one of the antioxidants found in plants, which protects vascular cells against vascular injuries from oxidative stress. In our previous study, caffeoyl-prolyl-histidine amide (CA-L-Pro-L-His-NH2; CA-PH; a CA derivative) was synthesized, which exhibited a strong antioxidant activity with sufficient stability. In this study, we investigated the role of CA-PH in vascular smooth muscle cells (VSMCs) and confirmed the enhanced antioxidant activity of CA-PH compared with that of CA. In in vitro tube assays, CA-PH showed a higher free-radical-scavenging activity and lipid-peroxidation-inhibition activity than those of CA. In VSMCs, CA-PH significantly reduced hydrogen peroxide-induced ROS generation and increased the expression of heme oxygenase-1. Moreover, CA-PH effectively inhibited the platelet-derived growth factor-induced cellular proliferation of VSMCs, which was confirmed by a decrease in the expression of the proliferating cell nuclear antigen and the phosphorylation of Akt. PMID:25218135

  1. β-Arrestin-mediated Angiotensin II Signaling Controls the Activation of ARF6 Protein and Endocytosis in Migration of Vascular Smooth Muscle Cells.

    PubMed

    Charles, Ricardo; Namkung, Yoon; Cotton, Mathieu; Laporte, Stéphane A; Claing, Audrey

    2016-02-19

    Angiotensin II (Ang II) is a vasopressive hormone but is also a potent activator of cellular migration. We have previously shown that it can promote the activation of the GTPase ARF6 in a heterologous overexpressing system. The molecular mechanisms by which receptors control the activation of this small G protein remain, however, largely unknown. Furthermore, how ARF6 coordinates the activation of complex cellular responses needs to be further elucidated. In this study, we demonstrate that Ang II receptors engage β-arrestin, but not Gq, to mediate ARF6 activation in HEK 293 cells. To further confirm the key role of β-arrestin proteins, we overexpressed β-arrestin2-(1-320), a dominant negative mutant known to block receptor endocytosis. We show that expression of this truncated construct does not support the activation of the GTPase nor cell migration. Interestingly, β-arrestin2 can interact with the ARF guanine nucleotide exchange factor ARNO, although the C-terminally lacking mutant does not. We finally examined whether receptor endocytosis controlled ARF6 activation and cell migration. Although the clathrin inhibitor PitStop2 did not impact the ability of Ang II to activate ARF6, cell migration was markedly impaired. To further show that ARF activation regulates key signaling events leading to migration, we also examined MAPK activation. We demonstrate that this signaling axis is relevant in smooth muscle cells of the vasculature. Altogether, our findings show for the first time that Ang II receptor signaling to β-arrestin regulates ARF6 activation. These proteins together control receptor endocytosis and ultimately cell migration. PMID:26703465

  2. Mechanisms underlying activation of transient BK current in rabbit urethral smooth muscle cells and its modulation by IP3-generating agonists

    PubMed Central

    Kyle, Barry D.; Bradley, Eamonn; Large, Roddy; Sergeant, Gerard P.; McHale, Noel G.; Thornbury, Keith D.

    2013-01-01

    We used the perforated patch-clamp technique at 37°C to investigate the mechanisms underlying the activation of a transient large-conductance K+ (tBK) current in rabbit urethral smooth muscle cells. The tBK current required an elevation of intracellular Ca2+, resulting from ryanodine receptor (RyR) activation via Ca2+-induced Ca2+ release, triggered by Ca2+ influx through L-type Ca2+ (CaV) channels. Carbachol inhibited tBK current by reducing Ca2+ influx and Ca2+ release and altered the shape of spike complexes recorded under current-clamp conditions. The tBK currents were blocked by iberiotoxin and penitrem A (300 and 100 nM, respectively) and were also inhibited when external Ca2+ was removed or the CaV channel inhibitors nifedipine (10 μM) and Cd2+ (100 μM) were applied. The tBK current was inhibited by caffeine (10 mM), ryanodine (30 μM), and tetracaine (100 μM), suggesting that RyR-mediated Ca2+ release contributed to the activation of the tBK current. When IP3 receptors (IP3Rs) were blocked with 2-aminoethoxydiphenyl borate (2-APB, 100 μM), the amplitude of the tBK current was not reduced. However, when Ca2+ release via IP3Rs was evoked with phenylephrine (1 μM) or carbachol (1 μM), the tBK current was inhibited. The effect of carbachol was abolished when IP3Rs were blocked with 2-APB or by inhibition of muscarinic receptors with the M3 receptor antagonist 4-diphenylacetoxy-N-methylpiperidine methiodide (1 μM). Under current-clamp conditions, bursts of action potentials could be evoked with depolarizing current injection. Carbachol reduced the number and amplitude of spikes in each burst, and these effects were reduced in the presence of 2-APB. In the presence of ryanodine, the number and amplitude of spikes were also reduced, and carbachol was without further effect. These data suggest that IP3-generating agonists can modulate the electrical activity of rabbit urethral smooth muscle cells and may contribute to the effects of neurotransmitters on

  3. Proline-rich tyrosine kinase 2 downregulates peroxisome proliferator-activated receptor gamma to promote hypoxia-induced pulmonary artery smooth muscle cell proliferation.

    PubMed

    Bijli, Kaiser M; Kang, Bum-Yong; Sutliff, Roy L; Hart, C Michael

    2016-06-01

    Hypoxia stimulates pulmonary hypertension (PH), in part by increasing the proliferation of human pulmonary artery smooth muscle cells (HPASMCs) via sustained activation of mitogen-activated protein kinase, extracellular signal-regulated kinases 1 and 2 (ERK 1/2), and nuclear factor-kappa B (NF-κB); elevated expression of NADPH oxidase 4 (Nox4); and downregulation of peroxisome proliferator-activated receptor gamma (PPARγ) levels. However, the upstream mediators that control these responses remain largely unknown. We hypothesized that proline-rich tyrosine kinase 2 (Pyk2) plays a critical role in the mechanism of hypoxia-induced HPASMC proliferation. To test this hypothesis, HPASMCs were exposed to normoxia or hypoxia (1% O2) for 72 hours. Hypoxia activated Pyk2 (detected as Tyr402 phosphorylation), and inhibition of Pyk2 with small interfering RNA (siRNA) or tyrphostin A9 attenuated hypoxia-induced HPASMC proliferation. Pyk2 inhibition attenuated ERK 1/2 activation as early as 24 hours after the onset of hypoxia, suggesting a proximal role for Pyk2 in this response. Pyk2 inhibition also attenuated hypoxia-induced NF-κB activation, reduced HPASMC PPARγ messenger RNA levels and activity, and increased NF-κB-mediated Nox4 levels. The siRNA-mediated PPARγ knockdown enhanced Pyk2 activation, whereas PPARγ overexpression reduced Pyk2 activation in HPASMCs, confirming a reciprocal relationship between Pyk2 and PPARγ. Pyk2 depletion also attenuated hypoxia-induced NF-κB p65 activation and reduced PPARγ protein levels in human pulmonary artery endothelial cells. These in vitro findings suggest that Pyk2 plays a central role in the proliferative phenotype of pulmonary vascular wall cells under hypoxic conditions. Coupled with recent reports that hypoxia-induced PH is attenuated in Pyk2 knockout mice, these findings suggest that Pyk2 may represent a novel therapeutic target in PH. PMID:27252847

  4. Proline-rich tyrosine kinase 2 downregulates peroxisome proliferator–activated receptor gamma to promote hypoxia-induced pulmonary artery smooth muscle cell proliferation

    PubMed Central

    2016-01-01

    Abstract Hypoxia stimulates pulmonary hypertension (PH), in part by increasing the proliferation of human pulmonary artery smooth muscle cells (HPASMCs) via sustained activation of mitogen-activated protein kinase, extracellular signal–regulated kinases 1 and 2 (ERK 1/2), and nuclear factor-kappa B (NF-κB); elevated expression of NADPH oxidase 4 (Nox4); and downregulation of peroxisome proliferator–activated receptor gamma (PPARγ) levels. However, the upstream mediators that control these responses remain largely unknown. We hypothesized that proline-rich tyrosine kinase 2 (Pyk2) plays a critical role in the mechanism of hypoxia-induced HPASMC proliferation. To test this hypothesis, HPASMCs were exposed to normoxia or hypoxia (1% O2) for 72 hours. Hypoxia activated Pyk2 (detected as Tyr402 phosphorylation), and inhibition of Pyk2 with small interfering RNA (siRNA) or tyrphostin A9 attenuated hypoxia-induced HPASMC proliferation. Pyk2 inhibition attenuated ERK 1/2 activation as early as 24 hours after the onset of hypoxia, suggesting a proximal role for Pyk2 in this response. Pyk2 inhibition also attenuated hypoxia-induced NF-κB activation, reduced HPASMC PPARγ messenger RNA levels and activity, and increased NF-κB-mediated Nox4 levels. The siRNA-mediated PPARγ knockdown enhanced Pyk2 activation, whereas PPARγ overexpression reduced Pyk2 activation in HPASMCs, confirming a reciprocal relationship between Pyk2 and PPARγ. Pyk2 depletion also attenuated hypoxia-induced NF-κB p65 activation and reduced PPARγ protein levels in human pulmonary artery endothelial cells. These in vitro findings suggest that Pyk2 plays a central role in the proliferative phenotype of pulmonary vascular wall cells under hypoxic conditions. Coupled with recent reports that hypoxia-induced PH is attenuated in Pyk2 knockout mice, these findings suggest that Pyk2 may represent a novel therapeutic target in PH. PMID:27252847

  5. Origins of increased airway smooth muscle mass in asthma.

    PubMed

    Berair, Rachid; Saunders, Ruth; Brightling, Christopher E

    2013-01-01

    Asthma is characterized by both chronic inflammation and airway remodeling. Remodeling--the structural changes seen in asthmatic airways--is pivotal in the pathogenesis of the disease. Although significant advances have been made recently in understanding the different aspects of airway remodeling, the exact biology governing these changes remains poorly understood. There is broad agreement that, in asthma, increased airway smooth muscle mass, in part due to smooth muscle hyperplasia, is a very significant component of airway remodeling. However, significant debate persists on the origins of these airway smooth muscle cells. In this review article we will explore the natural history of airway remodeling in asthma and we will discuss the possible contribution of progenitors, stem cells and epithelial cells in mesenchymal cell changes, namely airway smooth muscle hyperplasia seen in the asthmatic airways. PMID:23742314

  6. Phosphate and ADP differently inhibit coordinated smooth muscle myosin groups.

    PubMed

    Hilbert, Lennart; Balassy, Zsombor; Zitouni, Nedjma B; Mackey, Michael C; Lauzon, Anne-Marie

    2015-02-01

    Actin filaments propelled in vitro by groups of skeletal muscle myosin motors exhibit distinct phases of active sliding or arrest, whose occurrence depends on actin length (L) within a range of up to 1.0 μm. Smooth muscle myosin filaments are exponentially distributed with ≈150 nm average length in vivo--suggesting relevance of the L-dependence of myosin group kinetics. Here, we found L-dependent actin arrest and sliding in in vitro motility assays of smooth muscle myosin. We perturbed individual myosin kinetics with varying, physiological concentrations of phosphate (Pi, release associated with main power stroke) and adenosine diphosphate (ADP, release associated with minor mechanical step). Adenosine triphosphate was kept constant at physiological concentration. Increasing [Pi] lowered the fraction of time for which actin was actively sliding, reflected in reduced average sliding velocity (ν) and motile fraction (fmot, fraction of time that filaments are moving); increasing [ADP] increased the fraction of time actively sliding and reduced the velocity while sliding, reflected in reduced ν and increased fmot. We introduced specific Pi and ADP effects on individual myosin kinetics into our recently developed mathematical model of actin propulsion by myosin groups. Simulations matched our experimental observations and described the inhibition of myosin group kinetics. At low [Pi] and [ADP], actin arrest and sliding were reflected by two distinct chemical states of the myosin group. Upon [Pi] increase, the probability of the active state decreased; upon [ADP] increase, the probability of the active state increased, but the active state became increasingly similar to the arrested state. PMID:25650929

  7. Ubiquitin carboxyl terminal hydrolase L1 negatively regulates TNF{alpha}-mediated vascular smooth muscle cell proliferation via suppressing ERK activation

    SciTech Connect

    Ichikawa, Tomonaga; Li, Jinqing; Dong, Xiaoyu; Potts, Jay D.; Tang, Dong-Qi; Li, Dong-Sheng; Cui, Taixing

    2010-01-01

    Deubiquitinating enzymes (DUBs) appear to be critical regulators of a multitude of processes such as proliferation, apoptosis, differentiation, and inflammation. We have recently demonstrated that a DUB of ubiquitin carboxyl terminal hydrolase L1 (UCH-L1) inhibits vascular lesion formation via suppressing inflammatory responses in vasculature. However, the precise underlying mechanism remains to be defined. Herein, we report that a posttranscriptional up-regulation of UCH-L1 provides a negative feedback to tumor necrosis factor alpha (TNF{alpha})-mediated activation of extracellular signal-regulated kinases (ERK) and proliferation in vascular smooth muscle cells (VSMCs). In rat adult VSMCs, adenoviral over-expression of UCH-L1 inhibited TNF{alpha}-induced activation of ERK and DNA synthesis. In contrast, over-expression of UCH-L1 did not affect platelet derived growth factor (PDGF)-induced VSMC proliferation and activation of growth stimulating cascades including ERK. TNF{alpha} hardly altered UCH-L1 mRNA expression and stability; however, up-regulated UCH-L1 protein expression via increasing UCH-L1 translation. These results uncover a novel mechanism by which UCH-L1 suppresses vascular inflammation.

  8. A role for p38(MAPK)/HSP27 pathway in smooth muscle cell migration.

    PubMed

    Hedges, J C; Dechert, M A; Yamboliev, I A; Martin, J L; Hickey, E; Weber, L A; Gerthoffer, W T

    1999-08-20

    Smooth muscle cells are exposed to growth factors and cytokines that contribute to pathological states including airway hyperresponsiveness, atherosclerosis, angiogenesis, smooth muscle hypertrophy, and hyperplasia. A common feature of several of these conditions is migration of smooth muscle beyond the initial boundary of the organ. Signal transduction pathways activated by extracellular signals that instigate migration are mostly undefined in smooth muscles. We measured migration of cultured tracheal myocytes in response to platelet-derived growth factor, interleukin-1beta, and transforming growth factor-beta. Cellular migration was blocked by SB203580, an inhibitor of p38(MAPK). Time course experiments demonstrated increased phosphorylation of p38(MAPK). Activation of p38(MAPK) resulted in the phosphorylation of HSP27 (heat shock protein 27), which may modulate F-actin polymerization. Inhibition of p38(MAPK) activity inhibited phosphorylation of HSP27. Adenovirus-mediated expression of activated mutant MAPK kinase 6b(E), an upstream activator for p38(MAPK), increased cell migration, whereas overexpression of p38alpha MAPK dominant negative mutant and an HSP27 phosphorylation mutant blocked cell migration completely. The results indicate that activation of the p38(MAPK) pathway by growth factors and proinflammatory cytokines regulates smooth muscle cell migration and may contribute to pathological states involving smooth muscle dysfunction. PMID:10446196

  9. Ionic conductances regulating the excitability of colonic smooth muscles

    PubMed Central

    Koh, Sang Don; Ward, Sean M.; Sanders, Kenton M.

    2012-01-01

    The tunica muscularis of the gastrointestinal (GI) tract contains two layers of smooth muscle cells (SMC) oriented perpendicular to each other. SMC express a variety of voltage-dependent and voltage-independent ionic conductance(s) that develop membrane potential and control excitability. Resting membrane potentials (RMP) vary through the GI tract but generally are within the range of −80 to −40mV. RMP sets the ‘gain’ of smooth muscle and regulates openings of voltage-dependent Ca2+ channels. A variety of K+ channels contribute to setting RMP of SMC. In most regions RMP is considerably less negative than the K+ equilibrium potential, due to a finely tuned balance between background K+ channels and non-selective cation channels (NSCC). Variations in expression patterns and openings of K+ channels and NSCC account for differences of the RMP in different regions of the GI tract. Smooth muscle excitability is also regulated by interstitial cells (interstitial cells of Cajal (ICC) and PDGFRα+ cells) that express additional conductances and are electrically coupled to SMC. Thus, ‘myogenic’ activity results from the integrated behavior of the SMC/ICC/PDGFRα+ cell (SIP) syncytium. Inputs from excitatory and inhibitory motor neurons are required to produce the complex motor patterns of the gut. Motor neurons innervate three cell-types in the SIP, and receptors, second messenger pathways and ion channels in these cells mediate post-junctional responses. Studies of isolated SIP cells have begun to unravel the mechanisms responsible for neural responses. This review discusses ion channels that set and regulate RMP of SIP cells and how neurotransmitters regulate membrane potential. PMID:22726670

  10. Stimulation of aortic smooth muscle cell mitogenesis by serotonin

    SciTech Connect

    Nemecek, G.M.; Coughlin, S.R.; Handley, D.A.; Moskowitz, M.A.

    1986-02-01

    Bovine aortic smooth muscle cells in vitro responded to 1 nM to 10 ..mu..M serotonin with increased incorporation of (/sup 3/H)thymidine into DNA. The mitogenic effect of serotonin was half-maximal at 80 nM and maximal above 1 ..mu..M. At a concentration of 1 ..mu..M, serotonin stimulated smooth muscle cell mitogenesis to the same extent as human platelet-derived growth factor (PDGF) at 12 ng/ml. Tryptamine was approx. = 1/10th as potent as serotonin as a mitogen for smooth muscle cells. Other indoles that are structurally related to serotonin (D- and L-tryptophan, 5-hydroxy-L-tryptophan, N-acetyl-5-hydroxytryptamine, melatonin, 5-hydroxyindoleacetic acid, and 5-hydroxytryptophol) and quipazine were inactive. The stimulatory effect of serotonin on smooth muscle cell DNA synthesis required prolonged (20-24 hr) exposure to the agonist and was attenuated in the presence of serotonin D receptor antagonists. When smooth muscle cells were incubated with submaximal concentrations of serotonin and PDGF, synergistic rather than additive mitogenic responses were observed. These data indicate that serotonin has a significant mitogenic effect on smooth muscle cells in vitro, which appears to be mediated by specific plasma membrane receptors.

  11. Dense-body aggregates as plastic structures supporting tension in smooth muscle cells.

    PubMed

    Zhang, Jie; Herrera, Ana M; Paré, Peter D; Seow, Chun Y

    2010-11-01

    The wall of hollow organs of vertebrates is a unique structure able to generate active tension and maintain a nearly constant passive stiffness over a large volume range. These properties are predominantly attributable to the smooth muscle cells that line the organ wall. Although smooth muscle is known to possess plasticity (i.e., the ability to adapt to large changes in cell length through structural remodeling of contractile apparatus and cytoskeleton), the detailed structural basis for the plasticity is largely unknown. Dense bodies, one of the most prominent structures in smooth muscle cells, have been regarded as the anchoring sites for actin filaments, similar to the Z-disks in striated muscle. Here, we show that the dense bodies and intermediate filaments formed cable-like structures inside airway smooth muscle cells and were able to adjust the cable length according to cell length and tension. Stretching the muscle cell bundle in the relaxed state caused the cables to straighten, indicating that these intracellular structures were connected to the extracellular matrix and could support passive tension. These plastic structures may be responsible for the ability of smooth muscle to maintain a nearly constant tensile stiffness over a large length range. The finding suggests that the structural plasticity of hollow organs may originate from the dense-body cables within the smooth muscle cells. PMID:20709732

  12. Short-term variability in respiratory impedance and effect of deep breath in asthmatic and healthy subjects with airway smooth muscle activation and unloading.

    PubMed

    Gobbi, Alessandro; Pellegrino, Riccardo; Gulotta, Carlo; Antonelli, Andrea; Pompilio, Pasquale; Crimi, Claudia; Torchio, Roberto; Dutto, Luca; Parola, Paolo; Dellacà, Raffaele L; Brusasco, Vito

    2013-09-01

    Inspiratory resistance (RINSP) and reactance (XINSP) were measured for 7 min at 5 Hz in 10 subjects with mild asymptomatic asthma and 9 healthy subjects to assess the effects of airway smooth muscle (ASM) activation by methacholine (MCh) and unloading by chest wall strapping (CWS) on the variability of lung function and the effects of deep inspiration (DI). Subjects were studied at control conditions, after MCh, with CWS, and after MCh with CWS. In all experimental conditions XINSP was significantly more negative in subjects with asthma than in healthy subjects, suggesting greater inhomogeneity in the former. However, the variability in both RINSP and XINSP was increased by either ASM activation or CWS, without significant difference between groups. DI significantly reversed MCh-induced changes in RINSP both in subjects with asthma and healthy subjects, but XINSP in the former only. This effect was impaired by CWS more in subjects with asthma than in healthy subjects. The velocity of RINSP and XINSP recovery after DI was faster in subjects with asthma than healthy subjects. In conclusion, these results support the opinion that the short-term variability in respiratory impedance is related to ASM tone or operating length, rather than to the disease. Nevertheless, ASM in individuals with asthma differs from that in healthy individuals in an increased velocity of shortening and a reduced sensitivity to mechanical stress when strain is reduced. PMID:23766502

  13. TWEAK favors phosphate-induced calcification of vascular smooth muscle cells through canonical and non-canonical activation of NFκB

    PubMed Central

    Hénaut, L; Sanz, A B; Martin-Sanchez, D; Carrasco, S; Villa-Bellosta, R; Aldamiz-Echevarria, G; Massy, Z A; Sanchez-Nino, M D; Ortiz, A

    2016-01-01

    Vascular calcification (VC) is associated with increased cardiovascular mortality in aging, chronic kidney disease (CKD), type 2 diabetes mellitus (T2DM) and atherosclerosis. TNF-like weak inducer of apoptosis (TWEAK) recently emerged as a new biomarker for the diagnosis and prognosis of cardiovascular diseases. TWEAK binding to its functional receptor Fn14 was reported to promote several steps of atherosclerotic plaque progression. However, no information is currently available on the role of TWEAK/Fn14 on the development of medial calcification, which is highly prevalent in aging, CKD and T2DM. This study explored the involvement of TWEAK in human vascular smooth muscle cells (h-VSMCs) calcification in vitro. We report that TWEAK binding to Fn14 promotes inorganic phosphate-induced h-VSMCs calcification, favors h-VSMCs osteogenic transition, decreasing acta2 and myh11 and increasing bmp2 mRNA and tissue non-specific alkaline phosphatase (TNAP), and increases MMP9 activity. Blockade of the canonical NFκB pathway reduced by 80% TWEAK pro-calcific properties and decreased osteogenic transition, TNAP and MMP9 activity. Blockade of non-canonical NFκB signaling by a siRNA targeting RelB reduced by 20% TWEAK pro-calcific effects and decreased TWEAK-induced loss of h-VSMCs contractile phenotype and MMP9 activity, without modulating bmp2 mRNA or TNAP activity. Inhibition of ERK1/2 activation by a MAPK kinase inhibitor did not influence TWEAK pro-calcific properties. Our results suggest that TWEAK/Fn14 directly favors inorganic phosphate-induced h-VSMCs calcification by activation of both canonical and non-canonical NFκB pathways. Given the availability of neutralizing anti-TWEAK strategies, our study sheds light on the TWEAK/Fn14 axis as a novel therapeutic target in the prevention of VC. PMID:27441657

  14. TWEAK favors phosphate-induced calcification of vascular smooth muscle cells through canonical and non-canonical activation of NFκB.

    PubMed

    Hénaut, L; Sanz, A B; Martin-Sanchez, D; Carrasco, S; Villa-Bellosta, R; Aldamiz-Echevarria, G; Massy, Z A; Sanchez-Nino, M D; Ortiz, A

    2016-01-01

    Vascular calcification (VC) is associated with increased cardiovascular mortality in aging, chronic kidney disease (CKD), type 2 diabetes mellitus (T2DM) and atherosclerosis. TNF-like weak inducer of apoptosis (TWEAK) recently emerged as a new biomarker for the diagnosis and prognosis of cardiovascular diseases. TWEAK binding to its functional receptor Fn14 was reported to promote several steps of atherosclerotic plaque progression. However, no information is currently available on the role of TWEAK/Fn14 on the development of medial calcification, which is highly prevalent in aging, CKD and T2DM. This study explored the involvement of TWEAK in human vascular smooth muscle cells (h-VSMCs) calcification in vitro. We report that TWEAK binding to Fn14 promotes inorganic phosphate-induced h-VSMCs calcification, favors h-VSMCs osteogenic transition, decreasing acta2 and myh11 and increasing bmp2 mRNA and tissue non-specific alkaline phosphatase (TNAP), and increases MMP9 activity. Blockade of the canonical NFκB pathway reduced by 80% TWEAK pro-calcific properties and decreased osteogenic transition, TNAP and MMP9 activity. Blockade of non-canonical NFκB signaling by a siRNA targeting RelB reduced by 20% TWEAK pro-calcific effects and decreased TWEAK-induced loss of h-VSMCs contractile phenotype and MMP9 activity, without modulating bmp2 mRNA or TNAP activity. Inhibition of ERK1/2 activation by a MAPK kinase inhibitor did not influence TWEAK pro-calcific properties. Our results suggest that TWEAK/Fn14 directly favors inorganic phosphate-induced h-VSMCs calcification by activation of both canonical and non-canonical NFκB pathways. Given the availability of neutralizing anti-TWEAK strategies, our study sheds light on the TWEAK/Fn14 axis as a novel therapeutic target in the prevention of VC. PMID:27441657

  15. Phenotypic switching induced by damaged matrix is associated with DNA methyltransferase 3A (DNMT3A) activity and nuclear localization in smooth muscle cells (SMC).

    PubMed

    Jiang, Jia-Xin; Aitken, Karen J; Sotiropoulos, Chris; Sotiropolous, Chris; Kirwan, Tyler; Panchal, Trupti; Zhang, Nicole; Pu, Shuye; Wodak, Shoshana; Tolg, Cornelia; Bägli, Darius J

    2013-01-01

    Extracellular matrix changes are often crucial inciting events for fibroproliferative disease. Epigenetic changes, specifically DNA methylation, are critical factors underlying differentiated phenotypes. We examined the dependency of matrix-induced fibroproliferation and SMC phenotype on DNA methyltransferases. The cooperativity of matrix with growth factors, cell density and hypoxia was also examined. Primary rat visceral SMC of early passage (0-2) were plated on native collagen or damaged/heat-denatured collagen. Hypoxia was induced with 3% O2 (balanced 5% CO2 and 95% N2) over 48 hours. Inhibitors were applied 2-3 hours after cells were plated on matrix, or immediately before hypoxia. Cells were fixed and stained for DNMT3A and smooth muscle actin (SMA) or smooth muscle myosin heavy chain. Illumina 450 K array of CpG sites was performed on bisulfite-converted DNA from smooth muscle cells on damaged matrix vs native collagen. Matrix exquisitely regulates DNMT3A localization and expression, and influences differentiation in SMCs exposed to denatured matrix +/- hypoxia. Analysis of DNA methylation signatures showed that Matrix caused significant DNA methylation alterations in a discrete number of CpG sites proximal to genes related to SMC differentiation. Matrix has a profound effect on the regulation of SMC phenotype, which is associated with altered expression, localization of DNMTs and discrete changes DNA methylation. PMID:24282625

  16. Activation of Transcription Factor GAX and Concomitant Downregulation of IL-1β and ERK1/2 Modulate Vascular Smooth Muscle Cell Phenotype in 3D Fibrous Scaffolds.

    PubMed

    Lin, Shigang; Mequanint, Kibret

    2015-09-01

    Since vascular smooth muscle cells (VSMCs) display phenotypic plasticity in response to changing environmental cues, understanding the molecular mechanisms underlying the phenotypic modulation mediated by a three-dimensional (3D) scaffold is important to engineer functional vasculature. Following cell seeding into 3D scaffolds, the synthetic phenotype is desired to enable cells to expand rapidly and produce and assemble extracellular matrix components, but must revert to a quiescent contractile phenotype after tissue fabrication to impart the contractile properties found in native blood vessels. This study shows that 3D electrospun fibrous scaffolds regulate human coronary artery smooth muscle cells (HCASMCs) toward a more synthetic phenotype characterized by reduced contractile markers, such as smooth muscle alpha-actin and calponin. The reduction in contractile markers expression was mediated by endogenously expressed proinflammatory cytokine interleukin-1β (IL-1β). 3D topography transiently induces concomitant upregulation of IL-1β and MAPK ERK1/2 through nuclear factor-κB-dependent signaling pathway. An early burst of expression of IL-1β is essential for suppression of the homeobox transcription factor Gax and related cyclin-dependent kinase inhibitor p21(Cip1), which are key regulators for cells exiting from cell cycle. Our findings provide new insights for understanding signaling mechanisms of HCASMCs in electrospun 3D fibrous scaffolds, which have considerable value for application in vascular tissue engineering. PMID:26041434

  17. GATA-6 and NF-κB Activate CPI-17 Gene Transcription and Regulate Ca2+ Sensitization of Smooth Muscle Contraction

    PubMed Central

    Boopathi, Ettickan; Hypolite, Joseph A.; Zderic, Stephen A.; Gomes, Cristiano Mendes; Malkowicz, Bruce; Liou, Hsiou-Chi; Wein, Alan J.

    2013-01-01

    Protein kinase C (PKC)-potentiated inhibitory protein of 17 kDa (CPI-17) inhibits myosin light chain phosphatase, altering the levels of myosin light chain phosphorylation and Ca2+ sensitivity in smooth muscle. In this study, we characterized the CPI-17 promoter and identified binding sites for GATA-6 and nuclear factor kappa B (NF-κB). GATA-6 and NF-κB upregulated CPI-17 expression in cultured human and mouse bladder smooth muscle (BSM) cells in an additive manner. CPI-17 expression was decreased upon GATA-6 silencing in cultured BSM cells and in BSM from NF-κB knockout (KO) mice. Moreover, force maintenance by BSM strips from KO mice was decreased compared with the force maintenance of BSM strips from wild-type mice. GATA-6 and NF-κB overexpression was associated with CPI-17 overexpression in BSM from men with benign prostatic hyperplasia (BPH)-induced bladder hypertrophy and in a mouse model of bladder outlet obstruction. Thus, aberrant expression of NF-κB and GATA-6 deregulates CPI-17 expression and the contractile function of smooth muscle. Our data provide insight into how GATA-6 and NF-κB mediate CPI-17 transcription, PKC-mediated signaling, and BSM remodeling associated with lower urinary tract symptoms in patients with BPH. PMID:23275439

  18. Glycogen synthase kinase 3{beta} regulation of nuclear factor of activated T-cells isoform c1 in the vascular smooth muscle cell response to injury

    SciTech Connect

    Chow Winsion; Hou Guangpei; Bendeck, Michelle P.

    2008-10-01

    The migration and proliferation of vascular smooth muscle cells (vSMCs) are critical events in neointima formation during atherosclerosis and restenosis. The transcription factor nuclear factor of activated T-cells-isoform c1 (NFATc1) is regulated by atherogenic cytokines, and has been implicated in the migratory and proliferative responses of vSMCs through the regulation of gene expression. In T-cells, calcineurin de-phosphorylates NFATc1, leading to its nuclear import, while glycogen synthase kinase 3 {beta} (GSK3{beta}) phosphorylates NFATc1 and promotes its nuclear export. However, the relationship between NFATc1 and GSK3{beta} has not been studied during SMC migration and proliferation. We investigated this by scrape wounding vSMCs in vitro, and studying wound repair. NFATc1 protein was transiently increased, reaching a peak at 8 h after wounding. Cell fractionation and immunocytochemistry revealed that NFATc1 accumulation in the nucleus was maximal at 4 h after injury, and this was coincident with a significant 9 fold increase in transcriptional activity. Silencing NFATc1 expression with siRNA or inhibition of NFAT with cyclosporin A (CsA) attenuated wound closure by vSMCs. Phospho-GSK3{beta} (inactive) increased to a peak at 30 min after injury, preceding the nuclear accumulation of NFATc1. Overexpression of a constitutively active mutant of GSK3{beta} delayed the nuclear accumulation of NFATc1, caused a 50% decrease in NFAT transcriptional activity, and attenuated vSMC wound repair. We conclude that NFATc1 promotes the vSMC response to injury, and that inhibition of GSK3{beta} is required for the activation of NFAT during wound repair.

  19. Inositol 1,4,5-trisphosphate activates TRPC3 channels to cause extracellular Ca2+ influx in airway smooth muscle cells.

    PubMed

    Song, Tengyao; Hao, Qiongyu; Zheng, Yun-Min; Liu, Qing-Hua; Wang, Yong-Xiao

    2015-12-15

    Transient receptor potential-3 (TRPC3) channels play a predominant role in forming nonselective cation channels (NSCCs) in airway smooth muscle cells (ASMCs) and are significantly increased in their activity and expression in asthmatic ASMCs. To extend these novel findings, we have explored the regulatory mechanisms that control the activity of TRPC3 channels. Our data for the first time reveal that inositol 1,4,5-trisphosphate (IP3), an important endogenous signaling molecule, can significantly enhance the activity of single NSCCs in ASMCs. The analog of diacylglycerol (DAG; another endogenous signaling molecule), 1-oleyl-2-acetyl-sn-glycerol (OAG), 1-stearoyl-2-arachidonoyl-sn-glycerol (SAG), and 1-stearoyl-2-linoleoyl-sn-glycerol (SLG) all augment NSCC activity. The effects of IP3 and OAG are fully abolished by lentiviral short-hairpin (sh)RNA-mediated TRPC3 channel knockdown (KD). The stimulatory effect of IP3 is eliminated by heparin, an IP3 receptor (IP3R) antagonist that blocks the IP3-binding site, but not by xestospongin C, the IP3R antagonist that has no effect on the IP3-binding site. Lentiviral shRNA-mediated KD of IP3R1, IP3R2, or IP3R3 does not alter the excitatory effect of IP3. TRPC3 channel KD greatly inhibits IP3-induced increase in intracellular Ca(2+) concentration. IP3R1 KD produces a similar inhibitory effect. TRPC3 channel and IP3R1 KD both diminish the muscarinic receptor agonist methacholine-evoked Ca(2+) responses. Taking these findings together, we conclude that IP3, the important intracellular second messenger, may activate TRPC3 channels to cause extracellular Ca(2+) influx, in addition to opening IP3Rs to induce intracellular Ca(2+) release. This novel extracellular Ca(2+) entry route may play a significant role in mediating IP3-mediated numerous cellular responses in ASMCs and other cells. PMID:26453517

  20. Transforming growth factor β-activated kinase 1 negatively regulates interleukin-1α-induced stromal-derived factor-1 expression in vascular smooth muscle cells

    SciTech Connect

    Yang, Bin; Li, Wei; Zheng, Qichang; Qin, Tao; Wang, Kun; Li, Jinjin; Guo, Bing; Yu, Qihong; Wu, Yuzhe; Gao, Yang; Cheng, Xiang; Hu, Shaobo; Kumar, Stanley Naveen; Liu, Sanguang; Song, Zifang

    2015-07-17

    Stromal-derived Factor-1 (SDF-1) derived from vascular smooth muscle cells (VSMCs) contributes to vascular repair and remodeling in various vascular diseases. In this study, the mechanism underlying regulation of SDF-1 expression by interleukin-1α (IL-1α) was investigated in primary rat VSMCs. We found IL-1α promotes SDF-1 expression by up-regulating CCAAT-enhancer-binding protein β (C/EBPβ) in an IκB kinase β (IKKβ) signaling-dependent manner. Moreover, IL-1α-induced expression of C/EBPβ and SDF-1 was significantly potentiated by knockdown of transforming growth factor β-activated kinase 1 (TAK1), an upstream activator of IKKβ signaling. In addition, we also demonstrated that TAK1/p38 mitogen-activated protein kinase (p38 MAPK) signaling exerted negative effect on IL-1α-induced expression of C/EBPβ and SDF-1 through counteracting ROS-dependent up-regulation of nuclear factor erythroid 2-related factor 2 (NRF2). In conclusion, TAK1 acts as an important regulator of IL-1α-induced SDF-1 expression in VSMCs, and modulating activity of TAK1 may serve as a potential strategy for modulating vascular repair and remodeling. - Highlights: • IL-1α induces IKKβ signaling-dependent SDF-1 expression by up-regulating C/EBPβ. • Activation of TAK1 by IL-1α negatively regulates C/EBPβ-dependent SDF-1 expression. • IL-1α-induced TAK1/p38 MAPK signaling counteracts ROS-dependent SDF-1 expression. • TAK1 counteracts IL-1α-induced SDF-1 expression by attenuating NRF2 up-regulation.

  1. Epstein-Barr Virus-Associated Smooth Muscle Tumor.

    PubMed

    Dekate, Jyoti; Chetty, Runjan

    2016-07-01

    Immunodeficient individuals are prone to develop a number of opportunistic infections and unique neoplasms. Epstein-Barr virus-associated smooth muscle tumor is an uncommon neoplasm associated with immunodeficiency. It has been described in patients infected with human immunodeficiency virus, in the posttransplant setting, and in those with congenital immunodeficiency. Different anatomic sites can be involved by Epstein-Barr virus-associated smooth muscle tumor, and even multiple locations can contain these unique lesions within the same patient. The presence of variable numbers of intratumoral lymphocytes and primitive round cell areas are the unique defining features for this tumor. Histopathologic features may vary considerably in terms of cellular atypia, mitotic activity, and necrosis, with no correlation to the clinical behavior. Demonstration of Epstein-Barr virus infection by in situ hybridization within tumor cell remains critical for the diagnosis. The mechanism for Epstein-Barr virus infection of progenitor cells and neoplastic transformation has been an area of interest and conjecture. Different treatment strategies are proposed according to underlying disease status. This paper reviews the clinicopathologic features of this uncommon neoplasm with detailed discussion of the role of Epstein-Barr virus in the pathogenesis. PMID:27362573

  2. Abnormal tracheal smooth muscle function in the CF mouse

    PubMed Central

    Wallace, Helen L; Southern, Kevin W; Connell, Marilyn G; Wray, Susan; Burdyga, Theodor

    2013-01-01

    Increased airway smooth muscle (ASM) contractility is thought to underlie symptoms of airway hyperresponsiveness (AHR). In the cystic fibrosis (CF) airway, ASM anomalies have been reported, but have not been fully characterized and the underlying mechanisms are largely unknown. We examined ASM in an adult CF mouse tracheal ring preparation, and determined whether changes in contractility were associated with altered ASM morphology. We looked for inherent changes in the cellular pathways involved in contractility, and characterized trachea morphology in the adult trachea and in an embryonic lung culture model during development. Results showed that that there was a reduction in tracheal caliber in CF mice as indicated by a reduction in the number of cartilage rings; proximal cross-sectional areas of cftr−/− tracheas and luminal areas were significantly smaller, but there was no difference in the area or distribution of smooth muscle. Morphological differences observed in adult trachea were not evident in the embryonic lung at 11.5 days gestation or after 72 h in culture. Functional data showed a significant reduction in the amplitude and duration of contraction in response to carbachol (CCh) in Ca-free conditions. The reduction in contraction was agonist specific, and occurred throughout the length of the trachea. These data show that there is a loss in the contractile capacity of the CF mouse trachea due to downregulation of the pathway specific to acetylcholine (ACh) activation. This reduction in contraction is not associated with changes in the area or distribution of ASM. PMID:24400140

  3. Relaxant effect of 6-deoxyclitoriacetal on smooth muscle preparations.

    PubMed

    Itthipanichpong, C; Ruangrungsi, N; Saibundasak, K

    2001-06-01

    The pharmacological effect of 6-deoxyclitoriacetal (6-DA), a rotenoid compound isolated from the roots of Clitoria macrophylla Wall. (Papilionaceae), was examined on different smooth muscle preparations. 6-Deoxyclitoriacetal 0.2 mg/ml produced a significant decrease in the spontaneous contraction of isolated rat uterus. It also suppressed the contraction induced by acetylcholine 5x10(-6) M and oxytocin 5x10(-3) IU/ml. The cumulative contractile responses of rat aortic strips caused by serotonin 10(-8)-10(-4) M and norepinephrine 10(-11)-10(-7) M were reduced by 6-DA 0.4 mg/ml. In calcium free Kreb's solution, 6-DA inhibited the aortic contraction produced by a cumulative dose of calcium chloride (0.1-30 mM). In guinea-pig ileum, 6-DA 0.15 mg/ml exerted the spasmolytic activity by inhibition of the contractile response evoked by various contractile agents e.g. acetylcholine 10(-9)-10(-5) M, serotonin 10(-9)-10(-5) M and histamine 10(-9)-10(-5) M. All of the results indicated that 6-DA could induce a smooth muscle relaxant effect by interference with intracellular calcium metabolism. PMID:11529336

  4. Increased Vascular Smooth Muscle Contractility in TRPC6−/− Mice

    PubMed Central

    Dietrich, Alexander; Mederos y Schnitzler, Michael; Gollasch, Maik; Gross, Volkmar; Storch, Ursula; Dubrovska, Galyna; Obst, Michael; Yildirim, Eda; Salanova, Birgit; Kalwa, Hermann; Essin, Kirill; Pinkenburg, Olaf; Luft, Friedrich C.; Gudermann, Thomas; Birnbaumer, Lutz

    2005-01-01

    Among the TRPC subfamily of TRP (classical transient receptor potential) channels, TRPC3, -6, and -7 are gated by signal transduction pathways that activate C-type phospholipases as well as by direct exposure to diacylglycerols. Since TRPC6 is highly expressed in pulmonary and vascular smooth muscle cells, it represents a likely molecular candidate for receptor-operated cation entry. To define the physiological role of TRPC6, we have developed a TRPC6-deficient mouse model. These mice showed an elevated blood pressure and enhanced agonist-induced contractility of isolated aortic rings as well as cerebral arteries. Smooth muscle cells of TRPC6-deficient mice have higher basal cation entry, increased TRPC-carried cation currents, and more depolarized membrane potentials. This higher basal cation entry, however, was completely abolished by the expression of a TRPC3-specific small interference RNA in primary TRPC6−/− smooth muscle cells. Along these lines, the expression of TRPC3 in wild-type cells resulted in increased basal activity, while TRPC6 expression in TRPC6−/− smooth muscle cells reduced basal cation influx. These findings imply that constitutively active TRPC3-type channels, which are up-regulated in TRPC6-deficient smooth muscle cells, are not able to functionally replace TRPC6. Thus, TRPC6 has distinct nonredundant roles in the control of vascular smooth muscle tone. PMID:16055711

  5. Interferon-γ Induces Major Histocompatibility Class II Transactivator (CIITA) That Mediates Collagen Repression and Major Histocompatibility Class II Activation by Human Aortic Smooth Muscle Cells

    PubMed Central

    Butticè, Giovanna; Miller, Janice; Wang, Lin; Smith, Barbara D.

    2006-01-01

    Chronic inflammation in atherosclerosis is responsible for plaque instability through alterations in extracellular matrix. Previously, we demonstrated that major histocompatibility class II (MHC II) transactivator (CIITA) in a complex with regulatory factor for X box 5 (RFX5) is a crucial protein mediating interferon (IFN)-γ–induced repression of collagen type I gene transcription in fibroblasts. This article demonstrates that, in smooth muscle cells (SMCs), IFN-γ dramatically increases the expression of CIITA isoforms III and IV, with no increase in expression of CIITA isoform I. Expression of CIITA III and IV correlates with decreased collagen type I and increased MHC II gene expression. Exogenous expression of CIITA I, III, and IV, in transiently transfected SMCs, represses collagen type I promoters (COL1A1 and COL1A2) and activates MHC II promoter. Levels of CIITA and RFX5 increase in the nucleus of cells treated with IFN-γ. Moreover, simvastatin lowers the IFN-γ–induced expression of RFX5 and MHC II in addition to repressing collagen expression. However, simvastatin does not block the IFN-γ–induced expression of CIITA III and IV, suggesting a CIITA-independent mechanism. This first demonstration that RFX5 and CIITA isoforms are expressed in SMCs after IFN-γ stimulation suggest that CIITA could be a key factor in plaque stability in atherosclerosis. PMID:16439692

  6. Fangchinoline inhibits rat aortic vascular smooth muscle cell proliferation and cell cycle progression through inhibition of ERK1/2 activation and c-fos expression.

    PubMed

    Zhang, Yong-He; Fang, Lian-Hua; Ku, Bao-Shan

    2003-11-01

    Fangchinoline (FAN; a plant alkaloid isolated from Stephania tetrandrae) is a nonspecific Ca(2+) channel blocker. The objective of the present study was to investigate the effect of FAN on the growth factor-induced proliferation of primary cultured rat aortic smooth muscle cells (RASMCs). FAN significantly inhibited both 5% fetal bovine serum (FBS)- and 50ng/mL platelet-derived growth factor (PDGF)-BB-induced proliferation, [3H]thymidine incorporation into DNA and phosphorylation of extracellular signal-regulated kinase 1/2. In accordance with these findings, FAN revealed blocking of the FBS-inducible progression through G(0)/G(1) to S phase of the cell cycle in synchronized cells and caused a 62% decrease in the early elevation of c-fos expression induced after 5% FBS addition. Furthermore, significant antiproliferative activity of FAN is observed at concentrations below those required to achieve significant inhibition of Ca(2+) channels by FAN. These results suggest that FAN reduced both FBS- and PDGF-BB-induced RASMCs proliferation by perturbing cell cycle progression. This antiproliferative effect of FAN is dependent on the MAP kinase pathway, but cannot be limited to its Ca(2+) modulation. PMID:14563495

  7. Segregation of striated and smooth muscle lineages by a Notch-dependent regulatory network

    PubMed Central

    2014-01-01

    Background Lineage segregation from multipotent epithelia is a central theme in development and in adult stem cell plasticity. Previously, we demonstrated that striated and smooth muscle cells share a common progenitor within their epithelium of origin, the lateral domain of the somite-derived dermomyotome. However, what controls the segregation of these muscle subtypes remains unknown. We use this in vivo bifurcation of fates as an experimental model to uncover the underlying mechanisms of lineage diversification from bipotent progenitors. Results Using the strength of spatio-temporally controlled gene missexpression in avian embryos, we report that Notch harbors distinct pro-smooth muscle activities depending on the duration of the signal; short periods prevent striated muscle development and extended periods, through Snail1, promote cell emigration from the dermomyotome towards a smooth muscle fate. Furthermore, we define a Muscle Regulatory Network, consisting of Id2, Id3, FoxC2 and Snail1, which acts in concert to promote smooth muscle by antagonizing the pro-myogenic activities of Myf5 and Pax7, which induce striated muscle fate. Notch and BMP closely regulate the network and reciprocally reinforce each other’s signal. In turn, components of the network strengthen Notch signaling, while Pax7 silences this signaling. These feedbacks augment the robustness and flexibility of the network regulating muscle subtype segregation. Conclusions Our results demarcate the details of the Muscle Regulatory Network, underlying the segregation of muscle sublineages from the lateral dermomyotome, and exhibit how factors within the network promote the smooth muscle at the expense of the striated muscle fate. This network acts as an exemplar demonstrating how lineage segregation occurs within epithelial primordia by integrating inputs from competing factors. PMID:25015411

  8. Smooth muscle relaxing flavonoids and terpenoids from Conyza filaginoides.

    PubMed

    Mata, R; Rojas, A; Acevedo, L; Estrada, S; Calzada, F; Rojas, I; Bye, R; Linares, E

    1997-02-01

    Activity-guided fractionation of the smooth muscle relaxing, chloroform-methanol (1:1) extract of Conyza filaginoides (D.C.) Hieron (Asteraceae) led to the isolation of three flavonoids (quercetin 3-glucoside, rutin, and pinostrobin), one sterol (alpha-spinasterol), a sesquiterpenoid (beta-caryophyllene 4,5-alpha-oxide), and two triterpenoids (erythrodiol and 3-beta-tridecanoyloxy-28-hydroxyolean-12-ene). 3-beta-Tridecanoyloxy-28-hydroxy-olean-12-ene is a new naturally occurring terpenoid. All the isolated compounds induced a concentration-dependent inhibition of the spontaneous contractions of rat ileum. The spasmolytic activity exhibited by the extract and active principles tends to support the traditional use of C filaginoides as an antispasmodic agent. PMID:9063094

  9. Rho-kinase mediated cytoskeletal stiffness in skinned smooth muscle

    PubMed Central

    Lan, Bo; Wang, Lu; Zhang, Jenny; Pascoe, Chris D.; Norris, Brandon A.; Liu, Jeffrey C.-Y.; Solomon, Dennis; Paré, Peter D.; Deng, Linhong

    2013-01-01

    The structurally dynamic cytoskeleton is important in many cell functions. Large gaps still exist in our knowledge regarding what regulates cytoskeletal dynamics and what underlies the structural plasticity. Because Rho-kinase is an upstream regulator of signaling events leading to phosphorylation of many cytoskeletal proteins in many cell types, we have chosen this kinase as the focus of the present study. In detergent skinned tracheal smooth muscle preparations, we quantified the proteins eluted from the muscle cells over time and monitored the muscle's ability to respond to acetylcholine (ACh) stimulation to produce force and stiffness. In a partially skinned preparation not able to generate active force but could still stiffen upon ACh stimulation, we found that the ACh-induced stiffness was independent of calcium and myosin light chain phosphorylation. This indicates that the myosin light chain-dependent actively cycling crossbridges are not likely the source of the stiffness. The results also indicate that Rho-kinase is central to the ACh-induced stiffness, because inhibition of the kinase by H1152 (1 μM) abolished the stiffening. Furthermore, the rate of relaxation of calcium-induced stiffness in the skinned preparation was faster than that of ACh-induced stiffness, with or without calcium, suggesting that different signaling pathways lead to different means of maintenance of stiffness in the skinned preparation. PMID:24072407

  10. BMP4 Increases Canonical Transient Receptor Potential Protein Expression by Activating p38 MAPK and ERK1/2 Signaling Pathways in Pulmonary Arterial Smooth Muscle Cells

    PubMed Central

    Li, Xiaoyan; Lu, Wenju; Fu, Xin; Zhang, Yi; Yang, Kai; Zhong, Nanshan; Ran, Pixin

    2013-01-01

    Abnormal bone morphogenetic protein (BMP) signaling has been implicated in the pathogenesis of pulmonary hypertension. We previously found that BMP4 elevated basal intracellular Ca2+ ([Ca2+]i) concentrations in distal pulmonary arterial smooth muscle cells (PASMCs), attributable in large part to enhanced store-operated Ca2+ entry through store-operated Ca2+ channels (SOCCs). Moreover, BMP4 up-regulated the expression of canonical transient receptor potential (TRPC) proteins thought to compose SOCCs. The present study investigated the signaling pathways through which BMP4 regulates TRPC expression and basal [Ca2+]i in distal PASMCs. Real-time quantitative PCR was used for the measurement of mRNA, Western blotting was used for the measurement of protein, and fluorescent microscopic for [Ca2+]i was used to determine the involvement of p38 and extracellular regulated kinase (ERK)–1/2 mitogen-activated protein kinase (MAPK) signaling in BMP4–induced TRPC expression and the elevation of [Ca2+]i in PASMCs. We found that the treatment of BMP4 led to the activation of both p38 MAPK and ERK1/2 in rat distal PASMCs. The induction of TRPC1, TRPC4, and TRPC6 expression, and the increases of [Ca2+]i caused by BMP4 in distal PASMCs, were inhibited by treatment with either SB203580 (10 μM), the selective inhibitor for p38 activation, or the specific p38 small interfering RNA (siRNA). Similarly, those responses induced by BMP4 were also abolished by treatment with PD98059 (5 μM), the selective inhibitor of ERK1/2, or by the knockdown of ERK1/2 using its specific siRNA. These results indicate that BMP4 participates in the regulation of Ca2+ signaling in PASMCs by modulating TRPC channel expression via activating p38 and ERK1/2 MAPK pathways. PMID:23526217

  11. Theophylline Represses IL-8 Secretion from Airway Smooth Muscle Cells Independently of Phosphodiesterase Inhibition. Novel Role as a Protein Phosphatase 2A Activator.

    PubMed

    Patel, Brijeshkumar S; Rahman, Md Mostafizur; Rumzhum, Nowshin N; Oliver, Brian G; Verrills, Nicole M; Ammit, Alaina J

    2016-06-01

    Theophylline is an old drug experiencing a renaissance owing to its beneficial antiinflammatory effects in chronic respiratory diseases, such as asthma and chronic obstructive pulmonary disease. Multiple modes of antiinflammatory action have been reported, including inhibition of the enzymes that degrade cAMP-phosphodiesterase (PDE). Using primary cultures of airway smooth muscle (ASM) cells, we recently revealed that PDE4 inhibitors can potentiate the antiinflammatory action of β2-agonists by augmenting cAMP-dependent expression of the phosphatase that deactivates mitogen-activated protein kinase (MAPK)-MAPK phosphatase (MKP)-1. Therefore, the aim of this study was to address whether theophylline repressed cytokine production in a similar, PDE-dependent, MKP-1-mediated manner. Notably, theophylline did not potentiate cAMP release from ASM cells treated with the long-acting β2-agonist formoterol. Moreover, theophylline (0.1-10 μM) did not increase formoterol-induced MKP-1 messenger RNA expression nor protein up-regulation, consistent with the lack of cAMP generation. However, theophylline (at 10 μM) was antiinflammatory and repressed secretion of the neutrophil chemoattractant cytokine IL-8, which is produced in response to TNF-α. Because theophylline's effects were independent of PDE4 inhibition or antiinflammatory MKP-1, we then wished to elucidate the novel mechanisms responsible. We investigated the impact of theophylline on protein phosphatase (PP) 2A, a master controller of multiple inflammatory signaling pathways, and show that theophylline increases TNF-α-induced PP2A activity in ASM cells. Confirmatory results were obtained in A549 lung epithelial cells. PP2A activators have beneficial effects in ex vivo and in vivo models of respiratory disease. Thus, our study is the first to link theophylline with PP2A activation as a novel mechanism to control respiratory inflammation. PMID:26574643

  12. Activation of Toll-like receptor 3 increases mouse aortic vascular smooth muscle cell contractility through ERK1/2 pathway.

    PubMed

    Hardigan, Trevor; Spitler, Kathryn; Matsumoto, Takayuki; Carrillo-Sepulveda, Maria Alicia

    2015-11-01

    Activation of Toll-like receptor 3 (TLR3), a pattern recognition receptor of the innate immune system, is associated with vascular complications. However, whether activation of TLR3 alters vascular contractility is unknown. We, therefore, hypothesized that TLR3 activation augments vascular contractility and activates vascular smooth muscle cell (VSMC) contractile apparatus proteins. Male mice were treated with polyinosinic-polycytidylic acid (Poly I:C group, 14 days), a TLR3 agonist; control mice received saline (vehicle, 14 days). At the end of protocol, blood pressure was measured by tail cuff method. Aortas were isolated and assessed for contractility experiments using a wire myograph. Aortic protein content was used to determine phosphorylated/total interferon regulatory factor 3 (IRF3), a downstream target of TLR3 signaling, and ERK1/2 using Western blot. We investigated the TLR3/IRF3/ERK1/2 signaling pathway and contractile-related proteins such as phosphorylated/total myosin light chain (MLC) and caldesmon (CaD) in aortic VSMC primary cultures. Poly I:C-treated mice exhibited (vs. vehicle-treated mice) (1) elevated systolic blood pressure. Moreover, Poly I:C treatment (2) enhanced aortic phenylephrine-induced maximum contraction, which was suppressed by PD98059 (ERK1/2 inhibitor), and (3) increased aortic levels of phosphorylated IRF3 and ERK1/2. Stimulation of mouse aortic VSMCs with Poly I:C resulted in increased phosphorylation of IRF3, ERK1/2, MLC, and CaD. Inhibition of ERK1/2 abolished Poly I:C-mediated phosphorylation of MLC and CaD. Our data provide functional evidence for the role of TLR3 in vascular contractile events, suggesting TLR3 as a potential new therapeutic target in vascular dysfunction and regulation of blood pressure. PMID:25724934

  13. Potassium and insulin affect the contractility of abomasal smooth muscle.

    PubMed

    Türck, G; Leonhard-Marek, S

    2010-08-01

    Abomasal displacement is a frequent and important disease of high yielding dairy cows. Although several factors are related to its occurrence, the pathogenesis of the condition is still inadequately understood, particularly in regard to K(+) and insulin homeostasis. For this reason the aim was to investigate the effects of K(+) and insulin concentrations on in vitro motility of abomasal smooth muscle. The second aim was to determine whether the in vivo change in K(+) and insulin levels might be sufficient to induce reduced abomasal motility. Muscle strips were isolated from the abomasum of slaughtered cows and incubated in buffer solution under isometric conditions. Results show that a decrease in extracellular K(+) (between 5 and 1 mmol/L) or an increase in extracellular insulin concentrations (to 21 mU/L or higher) were able to affect the contraction activity of abomasal muscles. Contraction activity given as median (25th, 75th percentiles) changed from 28.1 mN/min (2.5, 49.9) at 5 mmol/L of K(+) to 9.4 mN/min (0.6, 35.7) at 1 mmol/L of K(+), and from 34.5 mN/min (10.8, 112.4) at 0 mU/L of insulin to 12.0 mN/min (7.6, 49.8) at 120 mU/L of insulin. Because the effect of insulin could be abolished by barium, glybenclamide, or ouabain, the underlying mechanisms of the insulin action could be an increased K(+) conductance or an increased Na/K-ATPase activity or both. Low K(+) or high insulin concentrations both reduced the activity of the circular muscle of the abomasal corpus (i.e., of the part that is responsible for the propulsion of abomasal chymus) and might play an important role in the pathogenesis of abomasal displacement. PMID:20655424

  14. A Simple, Inexpensive Model to Demonstrate How Contraction of GI Longitudinal Smooth Muscle Promotes Propulsion

    ERIC Educational Resources Information Center

    Lujan, Heidi L.; DiCarlo, Stephen E.

    2015-01-01

    Peristalis is a propulsive activity that involves both circular and longitudinal muscle layers of the esophagus, distal stomach, and small and large intestines. During peristalsis, the circular smooth muscle contracts behind (on the orad side) the bolus and relaxes in front (on the aborad side) of the bolus. At the same time, the longitudinal…

  15. Cytochalasin-like activity in cultured aorta smooth muscle cells (ASMC) is increased in extracts of growing cells

    SciTech Connect

    Magargal, W.W.

    1987-05-01

    A cytochalasin-like protein, present in cultured chicken embryo fibroblasts, is increased in cells transformed by Rous sarcoma virus. They find similar activity present in ASMC. Confluent cultured porcine and rat, ASMC, were homogenized in Buffer A and centrifuged at 200,000g for 35 min. Resulting extracts reduced the low shear viscosity of F-actin. To determine whether the activity alters during the growth of non-transformed cells, cultured rat ASMC were plated at 2 x 10/sup 4/ cells/cm/sup 2/ in medium plus 10% fetal bovine serum (FBS). After 3 days actively growing cells (by /sup 3/H-thymidine incorporation) were either scraped into phosphate buffered saline (PBS) or fed media plus 1% FBS. Three days later the fed cells were scraped into PBS (nongrowing, /sup 3/H-thymidine incorporation). Cells in PBS were pelleted, homogenized in Buffer A, and centrifuged as above. Extracts from the growing and nongrowing cells reduced the low shear viscosity of actin. However, the ED/sub 50/ for growing cells was 8..mu..g and 15..mu..g for nongrowing cells. These results support those obtained with normal and transformed CEF's. This evidence indicates a relationship between cytochalasin-like activity and the growth state of cells in culture.

  16. Neuropeptide Y, its localization in the human cervix and possible effect on the contractile activity of cervix smooth muscle.

    PubMed

    Norström, A; Bryman, I; Dahlström, A

    1992-01-01

    Immunochemical methods were used to identify neuropeptide Y (NPY) in the cervical tissue of women at early and term pregnancy. NPY-containing fibers could not be demonstrated in the upper and lower uterine segments at term, but the cervical innervation persisted during labor. Moreover, NPY alone did not affect cervical contractile activity, although the stimulatory effect of noradrenaline was enhanced. PMID:1427420

  17. ASIC-like Currents in Freshly Isolated Cerebral Artery Smooth Muscle Cells are Inhibited by Endogenous Oxidase Activity

    PubMed Central

    Chung, Wen-Shuo; Farley, Jerry M.; Drummond, Heather A.

    2011-01-01

    Background/Aims: The aim of this study was to determine if VSMC ASIC-like currents are regulated by oxidative state. Methods: We used whole-cell patch clamp of isolated mouse cerebral VSMCs to determine if 1) reducing agents, such as DTT and GSH, and 2) inhibition of endogenous oxidase activity from NADPH and Xanthine oxidases potentiate active currents and activate electrically silent currents. Results: Pretreatment with 2 mM DTT or GSH, increased the mean peak amplitude of ASIC-like currents evoked by pH 6.0 from 0.4 ± 0.1 to 14.9 ± 3.6 pA/pF, and from 0.9 ± 0.3 to 11.3 ± 2.4 pA/pF, respectively. Pretreatment with apocynin, a NADPH oxidase inhibitor, mimics the effect of the reducing agents, with the mean peak current amplitude increased from 0.9 ± 0.5 to 7.0 ± 2.6 pA/pF and from 0.5 ± 0.2 to 26.4 ± 6.8 pA/pF by 50 and 200 μM apocynin, respectively. Pretreatment with allopurinol, a xanthine oxidase inhibitor, also potentiates the VSMC ASIC-like activity. Conclusion: These findings suggest that VSMC ASIC-like channels are regulated by oxidative state and may be inhibited by basal endogenous oxidative sources such as NADPH and xanthine oxidase. PMID:21325830

  18. The anti-diabetic drug repaglinide induces vasorelaxation via activation of PKA and PKG in aortic smooth muscle.

    PubMed

    Kim, Hye Won; Li, Hongliang; Kim, Han Sol; Shin, Sung Eun; Jung, Won-Kyo; Ha, Kwon-Soo; Han, Eun-Taek; Hong, Seok-Ho; Choi, Il-Whan; Firth, Amy L; Bang, Hyoweon; Park, Won Sun

    2016-09-01

    We investigated the vasorelaxant effect of repaglinide and its related signaling pathways using phenylephrine (Phe)-induced pre-contracted aortic rings. Repaglinide induced vasorelaxation in a concentration-dependent manner. The repaglinide-induced vasorelaxation was not affected by removal of the endothelium. In addition, application of a nitric oxide synthase inhibitor (L-NAME) and a small-conductance Ca(2+)-activated K(+) (SKCa) channel inhibitor (apamin) did not alter the vasorelaxant effect of repaglinide on endothelium-intact arteries. Pretreatment with an adenylyl cyclase inhibitor (SQ 22536) or a PKA inhibitor (KT 5720) effectively reduced repaglinide-induced vasorelaxation. Also, pretreatment with a guanylyl cyclase inhibitor (ODQ) or a PKG inhibitor (KT 5823) inhibited repaglinide-induced vasorelaxation. However, pretreatment with a voltage-dependent K(+) (Kv) channel inhibitor (4-AP), ATP-sensitive K(+) (KATP) channel inhibitor (glibenclamide), large-conductance Ca(2+)-activated K(+) (BKCa) channel inhibitor (paxilline), or the inwardly rectifying K(+) (Kir) channel inhibitor (Ba(2+)) did not affect the vasorelaxant effect of repaglinide. Furthermore, pretreatment with a Ca(2+) inhibitor (nifedipine) and a sarco-endoplasmic reticulum Ca(2+)-ATPase (SERCA) inhibitor (thapsigargin) did not affect the vasorelaxant effect of repaglinide. The vasorelaxant effect of repaglinide was not affected by elevated glucose (50mM). Based on these results, we conclude that repaglinide induces vasorelaxation via activation of adenylyl cyclase/PKA and guanylyl cyclase/PKG signaling pathways independently of the endothelium, K(+) channels, Ca(2+) channels, and intracellular Ca(2+) ([Ca(2+)]i). PMID:27435474

  19. Recruitment of β-catenin to N-cadherin is necessary for smooth muscle contraction.

    PubMed

    Wang, Tao; Wang, Ruping; Cleary, Rachel A; Gannon, Olivia J; Tang, Dale D

    2015-04-01

    β-Catenin is a key component that connects transmembrane cadherin with the actin cytoskeleton at the cell-cell interface. However, the role of the β-catenin/cadherin interaction in smooth muscle has not been well characterized. Here stimulation with acetylcholine promoted the recruitment of β-catenin to N-cadherin in smooth muscle cells/tissues. Knockdown of β-catenin by lentivirus-mediated shRNA attenuated smooth muscle contraction. Nevertheless, myosin light chain phosphorylation at Ser-19 and actin polymerization in response to contractile activation were not reduced by β-catenin knockdown. In addition, the expression of the β-catenin armadillo domain disrupted the recruitment of β-catenin to N-cadherin. Force development, but not myosin light chain phosphorylation and actin polymerization, was reduced by the expression of the β-catenin armadillo domain. Furthermore, actin polymerization and microtubules have been implicated in intracellular trafficking. In this study, the treatment with the inhibitor latrunculin A diminished the interaction of β-catenin with N-cadherin in smooth muscle. In contrast, the exposure of smooth muscle to the microtubule depolymerizer nocodazole did not affect the protein-protein interaction. Together, these findings suggest that smooth muscle contraction is mediated by the recruitment of β-catenin to N-cadherin, which may facilitate intercellular mechanotransduction. The association of β-catenin with N-cadherin is regulated by actin polymerization during contractile activation. PMID:25713069

  20. Inactivation of calcium-activated chloride channels in smooth muscle by calcium/calmodulin-dependent protein kinase

    PubMed Central

    Wang, Yong-Xiao; Kotlikoff, Michael I.

    1997-01-01

    To determine the mechanisms responsible for the termination of Ca2+-activated Cl− currents (ICl(Ca)), simultaneous measurements of whole cell currents and intracellular Ca2+ concentration ([Ca2+]i) were made in equine tracheal myocytes. In nondialyzed cells, or cells dialyzed with 1 mM ATP, ICl(Ca) decayed before the [Ca2+]i decline, whereas the calcium-activated potassium current decayed at the same rate as [Ca2+]i. Substitution of AMP-PNP or ADP for ATP markedly prolonged the decay of ICl(Ca), resulting in a rate of current decay similar to that of the fall in [Ca2+]i. In the presence of ATP, dialysis of the calmodulin antagonist W7, the Ca2+/calmodulin-dependent kinase II (CaMKII) inhibitor KN93, or a CaMKII-specific peptide inhibitor the rate of ICl(Ca) decay was slowed and matched the [Ca2+]i decline, whereas H7, a nonspecific kinase inhibitor with low affinity for CaMKII, was without effect. When a sustained increase in [Ca2+]i was produced in ATP dialyzed cells, the current decayed completely, whereas in cells loaded with 5′-adenylylimidodiphosphate (AMP-PNP), KN93, or the CaMKII inhibitory peptide, ICl(Ca) did not decay. Slowly decaying currents were repeatedly evoked in ADP- or AMP-PNP-loaded cells, but dialysis of adenosine 5′-O-(3-thiotriphosphate) or okadaic acid resulted in a smaller initial ICl(Ca), and little or no current (despite a normal [Ca2+]i transient) with a second stimulation. These data indicate that CaMKII phosphorylation results in the inactivation of calcium-activated chloride channels, and that transition from the inactivated state to the closed state requires protein dephosphorylation. PMID:9405714

  1. Retinoic Acid Receptor α Mediates All-trans-retinoic Acid-induced Klf4 Gene Expression by Regulating Klf4 Promoter Activity in Vascular Smooth Muscle Cells*

    PubMed Central

    Shi, Jian-hong; Zheng, Bin; Chen, Si; Ma, Guo-yan; Wen, Jin-kun

    2012-01-01

    The transcription factor Krüppel-like factor 4 (KLF4) plays a critical role in vascular smooth muscle cell (VSMC) differentiation induced by all-trans-retinoic acid (ATRA). Although it has been demonstrated that ATRA stimulation augments both KLF4 protein and mRNA levels in VSMCs, the molecular mechanisms by which ATRA regulates Klf4 transcription are unknown. In this study, we examined the roles of ATRA-selective nuclear retinoic acid receptors (RARs) in the transcriptional regulation of Klf4. The introduction of small interfering RNA and an RAR antagonist demonstrated that RARα, but not RARβ or RARγ, mediated ATRA-induced Klf4 expression. A luciferase assay for the Klf4 promoter showed that three GC boxes in the proximal Klf4 promoter were indispensible for ATRA-induced Klf4 transcription and that RARα enhanced Klf4 promoter activity in a GC box-dependent manner. Furthermore, chromatin immunoprecipitation and oligonucleotide pulldown assays demonstrated that the transcription factors KLF4, Sp1, and YB1 directly bound to the GC boxes of the proximal Klf4 promoter. Upon RARα agonist stimulation, RARα was recruited to the Klf4 promoter through its interaction with KLF4, Sp1, and YB1 to form a transcriptional activation complex on the three GC boxes of the Klf4 promoter. These results suggest that RARα serves as an essential co-activator for ATRA signaling and that the recruitment of RARα to the KLF4-Sp1-YB1 complex, which leads to Klf4 expression in VSMCs, is independent of a retinoic acid response element. PMID:22337869

  2. S1P activates store-operated calcium entry via receptor- and non-receptor-mediated pathways in vascular smooth muscle cells.

    PubMed

    Hopson, Kristen Park; Truelove, Jessica; Chun, Jerold; Wang, Yumei; Waeber, Christian

    2011-04-01

    Sphingosine-1-phosphate (S1P) has been shown to modulate intracellular Ca(2+) through both G protein-coupled receptors and intracellular second messenger pathways. The precise mechanism by which S1P activates store-operated calcium entry (SOCE) in vascular smooth muscle cells (VSMCs) has not been fully characterized. Because sphingolipids and Ca(2+) modulate proliferation and constriction in VSMCs, characterizing the connection between S1P and SOCE may provide novel therapeutic targets for vascular diseases. We found that S1P triggered STIM1 puncta formation and SOCE in VSMCs. S1P-activated SOCE was inhibited by 2-aminoethoxydiphenyl borate (2-APB), diethylstilbestrol (DES), and gadolinium (Gd(3+)). SOCE was observed in VSMCs lacking either S1P(2) or S1P(3) receptors, suggesting that S1P acts via multiple signaling pathways. Indeed, both extracellular and intracellular S1P application increased the total internal reflection fluorescence signal in VSMCs cells transfected with STIM1-yellow fluorescent protein in a 2-APB-sensitive manner. These data, and the fact that 2-APB, DES, and Gd(3+) all inhibited S1P-induced cerebral artery constriction, suggest that SOCE modulates S1P-induced vasoconstriction in vivo. Finally, S1P-induced SOCE was larger in proliferative than in contractile VSMCs, correlating with increases in STIM1, Orai1, S1P(1), and S1P(3) receptor mRNA. These data demonstrate that S1P can act through both receptors and a novel intracellular pathway to activate SOCE. Because S1P-induced SOCE contributes to vessel constriction and is increased in proliferative VSMCs, it is likely that S1P/SOCE signaling in proliferative VSMCs may play a role in vascular dysfunction such as atherosclerosis and diabetes. PMID:21270296

  3. The Intermediate Conductance Calcium-activated Potassium Channel KCa3.1 Regulates Vascular Smooth Muscle Cell Proliferation via Controlling Calcium-dependent Signaling*

    PubMed Central

    Bi, Dan; Toyama, Kazuyoshi; Lemaître, Vincent; Takai, Jun; Fan, Fan; Jenkins, David P.; Wulff, Heike; Gutterman, David D.; Park, Frank; Miura, Hiroto

    2013-01-01

    The intermediate conductance calcium-activated potassium channel KCa3.1 contributes to a variety of cell activation processes in pathologies such as inflammation, carcinogenesis, and vascular remodeling. We examined the electrophysiological and transcriptional mechanisms by which KCa3.1 regulates vascular smooth muscle cell (VSMC) proliferation. Platelet-derived growth factor-BB (PDGF)-induced proliferation of human coronary artery VSMCs was attenuated by lowering intracellular Ca2+ concentration ([Ca2+]i) and was enhanced by elevating [Ca2+]i. KCa3.1 blockade or knockdown inhibited proliferation by suppressing the rise in [Ca2+]i and attenuating the expression of phosphorylated cAMP-response element-binding protein (CREB), c-Fos, and neuron-derived orphan receptor-1 (NOR-1). This antiproliferative effect was abolished by elevating [Ca2+]i. KCa3.1 overexpression induced VSMC proliferation, and potentiated PDGF-induced proliferation, by inducing CREB phosphorylation, c-Fos, and NOR-1. Pharmacological stimulation of KCa3.1 unexpectedly suppressed proliferation by abolishing the expression and activity of KCa3.1 and PDGF β-receptors and inhibiting the rise in [Ca2+]i. The stimulation also attenuated the levels of phosphorylated CREB, c-Fos, and cyclin expression. After KCa3.1 blockade, the characteristic round shape of VSMCs expressing high l-caldesmon and low calponin-1 (dedifferentiation state) was maintained, whereas KCa3.1 stimulation induced a spindle-shaped cellular appearance, with low l-caldesmon and high calponin-1. In conclusion, KCa3.1 plays an important role in VSMC proliferation via controlling Ca2+-dependent signaling pathways, and its modulation may therefore constitute a new therapeutic target for cell proliferative diseases such as atherosclerosis. PMID:23609438

  4. Andrographolide Inhibits Nuclear Factor-κB Activation through JNK-Akt-p65 Signaling Cascade in Tumor Necrosis Factor-α-Stimulated Vascular Smooth Muscle Cells

    PubMed Central

    Chen, Yu-Ying; Hsieh, Cheng-Ying; Lee, Lin-Wen; Sheu, Joen-Rong

    2014-01-01

    Critical vascular inflammation leads to vascular dysfunction and cardiovascular diseases, including abdominal aortic aneurysms, hypertension, and atherosclerosis. Andrographolide is the most active and critical constituent isolated from the leaves of Andrographis paniculata, a herbal medicine widely used for treating anti-inflammation in Asia. In this study, we investigated the mechanisms of the inhibitory effects of andrographolide in vascular smooth muscle cells (VSMCs) exposed to a proinflammatory stimulus, tumor necrosis factor-α (TNF-α). Treating TNF-α-stimulated VSMCs with andrographolide suppressed the expression of inducible nitric oxide synthase in a concentration-dependent manner. A reduction in TNF-α-induced c-Jun N-terminal kinase (JNK), Akt, and p65 phosphorylation was observed in andrographolide-treated VSMCs. However, andrographolide affected neither IκBα degradation nor p38 mitogen-activated protein kinase or extracellular signal-regulated kinase 1/2 phosphorylation under these conditions. Both treatment with LY294002, a phosphatidylinositol 3-kinase/Akt inhibitor, and treatment with SP600125, a JNK inhibitor, markedly reversed the andrographolide-mediated inhibition of p65 phosphorylation. In addition, LY294002 and SP600125 both diminished Akt phosphorylation, whereas LY294002 had no effects on JNK phosphorylation. These results collectively suggest that therapeutic interventions using andrographolide can benefit the treatment of vascular inflammatory diseases, and andrographolide-mediated inhibition of NF-κB activity in TNF-α-stimulated VSMCs occurs through the JNK-Akt-p65 signaling cascade, an IκBα-independent mechanism. PMID:25114952

  5. From depolarization-dependent contractions in gastrointestinal smooth muscle to aortic pulse-synchronized contractions

    PubMed Central

    Marion, Sarah B; Mangel, Allen W

    2014-01-01

    For decades, it was believed that the diameter of gastrointestinal smooth muscle cells is sufficiently narrow, and that the diffusion of calcium across the plasma membrane is sufficient, to support contractile activity. Thus, depolarization-triggered release of intracellular calcium was not believed to be operative in gastrointestinal smooth muscle. However, after the incubation of muscle segments in solutions devoid of calcium and containing the calcium chelator ethylene glycol tetraacetic acid, an alternative electrical event occurred that was distinct from normal slow waves and spikes. Subsequently, it was demonstrated in gastrointestinal smooth muscle segments that membrane depolarization associated with this alternative electrical event triggered rhythmic contractions by release of intracellular calcium. Although this concept of depolarization-triggered calcium release was iconoclastic, it has now been demonstrated in multiple gastrointestinal smooth muscle preparations. On the basis of these observations, we investigated whether a rhythmic electrical and mechanical event would occur in aortic smooth muscle under the same calcium-free conditions. The incubation of aortic segments in a solution with no added calcium plus ethylene glycol tetraacetic acid induced a fast electrical event without corresponding tension changes. On the basis of the frequency of these fast electrical events, we pursued, contrary to what has been established dogma for more than three centuries, the question of whether the smooth muscle wall of the aorta undergoes rhythmic activation during the cardiac cycle. As with depolarization-triggered contractile activity in gastrointestinal smooth muscle, it was “well known” that rhythmic activation of the aorta does not occur in synchrony with the heartbeat. In a series of experiments, however, it was demonstrated that rhythmic contractions occur in the aortic wall in synchrony with the heartbeat and share a common pacemaker with the heart

  6. Piperine Congeners as Inhibitors of Vascular Smooth Muscle Cell Proliferation.

    PubMed

    Mair, Christina E; Liu, Rongxia; Atanasov, Atanas G; Wimmer, Laurin; Nemetz-Fiedler, Daniel; Sider, Nadine; Heiss, Elke H; Mihovilovic, Marko D; Dirsch, Verena M; Rollinger, Judith M

    2015-08-01

    Successful vascular healing after percutaneous coronary interventions is related to the inhibition of abnormal vascular smooth muscle cell proliferation and efficient re-endothelialization. In the search for vascular smooth muscle cell anti-proliferative agents from natural sources we identified piperine (1), the main pungent constituent of the fruits from Piper nigrum (black pepper). Piperine inhibited vascular smooth muscle cell proliferation with an IC50 of 21.6 µM, as quantified by a resazurin conversion assay. Investigations of ten piperamides isolated from black pepper fruits and 15 synthesized piperine derivatives resulted in the identification of three potent vascular smooth muscle cell proliferation inhibitors: the natural alkaloid pipertipine (4), and the two synthetic derivatives (2E,4E)-N,N-dibutyl-5-(3,5-dimethoxyphenyl)penta-2,4-dienamide (14) and (E)-N,N-dibutyl-3-(naphtho[2,3-d][1,3]dioxol-5-yl)acrylamide (20). They showed IC50 values of 3.38, 6.00, and 7.85 µM, respectively. Furthermore, the synthetic compound (2E,4E)-5-(4-fluorophenyl)-1-(piperidin-1-yl)penta-2,4-dien-1-one (12) was found to be cell type selective, by inhibiting vascular smooth muscle cell proliferation with an IC50 of 11.8 µM without influencing the growth of human endothelial cells. PMID:26132851

  7. The role of mitogen-activated protein kinase in oxytocin-induced contraction of uterine smooth muscle in pregnant rat.

    PubMed

    Nohara, A; Ohmichi, M; Koike, K; Masumoto, N; Kobayashi, M; Akahane, M; Ikegami, H; Hirota, K; Miyake, A; Murata, Y

    1996-12-24

    Oxytocin causes the rapid tyrosine phosphorylation of mitogen-activated protein (MAP) kinase in both human and rat puerperal uterine myometrial cultured cells. The potential role of the MAP kinase pathway in oxytocin action was investigated with the specific MAP kinase kinase (MEK) inhibitor, PD98059. Oxytocin stimulation of the tyrosine phosphorylation of MAP kinase in both human and rat cultured puerperal uterine cells was abolished by pretreatment of the cells with MEK inhibitor in a dose-dependent manner. Although MEK inhibitor had no effect on oxytocin-induced intracellular Ca2+ mobilization in either pregnant human or pregnant rat uterine cells, it partly inhibited oxytocin-induced pregnant rat uterine contraction in a dose-dependent manner. These results suggest that MAP kinase pathway may have some important roles in oxytocin-induced uterine contraction. PMID:8954997

  8. Oxygen mediates vascular smooth muscle relaxation in hypoxia.

    PubMed

    Dada, Jessica; Pinder, Andrew G; Lang, Derek; James, Philip E

    2013-01-01

    The activation of soluble guanylate cyclase (sGC) by nitric oxide (NO) and other ligands has been extensively investigated for many years. In the present study we considered the effect of molecular oxygen (O2) on sGC both as a direct ligand and its affect on other ligands by measuring cyclic guanosine monophosphate (cGMP) production, as an index of activity, as well as investigating smooth muscle relaxation under hypoxic conditions. Our isolated enzyme studies confirm the function of sGC is impaired under hypoxic conditions and produces cGMP in the presence of O2, importantly in the absence of NO. We also show that while O2 could partially affect the magnitude of sGC stimulation by NO when the latter was present in excess, activation by the NO independent, haem-dependent sGC stimulator 3-(5'-hydroxymethyl-2'-furyl)-1-benzylindazole (YC-1) was unaffected. Our in vitro investigation of smooth muscle relaxation confirmed that O2 alone in the form of a buffer bolus (equilibrated at 95% O2/5% CO2) had the ability to dilate vessels under hypoxic conditions and that this was dependent upon sGC and independent of eNOS. Our studies confirm that O2 can be a direct and important mediator of vasodilation through an increase in cGMP production. In the wider context, these observations are key to understanding the relative roles of O2 versus NO-induced sGC activation. PMID:23451175

  9. Oxygen Mediates Vascular Smooth Muscle Relaxation in Hypoxia

    PubMed Central

    Lang, Derek; James, Philip E.

    2013-01-01

    The activation of soluble guanylate cyclase (sGC) by nitric oxide (NO) and other ligands has been extensively investigated for many years. In the present study we considered the effect of molecular oxygen (O2) on sGC both as a direct ligand and its affect on other ligands by measuring cyclic guanosine monophosphate (cGMP) production, as an index of activity, as well as investigating smooth muscle relaxation under hypoxic conditions. Our isolated enzyme studies confirm the function of sGC is impaired under hypoxic conditions and produces cGMP in the presence of O2, importantly in the absence of NO. We also show that while O2 could partially affect the magnitude of sGC stimulation by NO when the latter was present in excess, activation by the NO independent, haem-dependent sGC stimulator 3-(5′-hydroxymethyl-2′-furyl)-1-benzylindazole (YC-1) was unaffected. Our in vitro investigation of smooth muscle relaxation confirmed that O2 alone in the form of a buffer bolus (equilibrated at 95% O2/5% CO2) had the ability to dilate vessels under hypoxic conditions and that this was dependent upon sGC and independent of eNOS. Our studies confirm that O2 can be a direct and important mediator of vasodilation through an increase in cGMP production. In the wider context, these observations are key to understanding the relative roles of O2 versus NO-induced sGC activation. PMID:23451175

  10. Inhibitory effects of SKF96365 on the activities of K+ channels in mouse small intestinal smooth muscle cells

    PubMed Central

    TANAHASHI, Yasuyuki; WANG, Ban; MURAKAMI, Yuri; UNNO, Toshihiro; MATSUYAMA, Hayato; NAGANO, Hiroshi; KOMORI, Seiichi

    2015-01-01

    In order to investigate the effects of SKF96365 (SKF), which is a non-selective cationic channel blocker, on K+ channel currents, we recorded currents through ATP sensitive K+ (IKATP), voltage-gated K+ (IKv) and Ca2+ activated K+ channels (IBK) in the absence and presence of SKF in single small intestinal myocytes of mice with patch-clamp techniques. SKF (10 µM) reversibly abolished IKATP that was induced by cromakalim (10 µM), which is a selective ATP sensitive K+ channel opener. These inhibitory effects were induced in a concentration-dependent and voltage-independent manner. The 50% inhibitory concentration (IC50) was 0.85 µM, which was obviously lower than that reported for the muscarinic cationic current. In addition, SKF (1 µM ≈ the IC50 value in IKATP suppression) reversibly inhibited the IKv that was induced by repetitive depolarizing pulses from −80 to 20 mV. However, the extent of the inhibitory effects was only ~30%. In contrast, SKF (1 µM) had no significant effects on spontaneous transient IBK and caffeine-induced IBK. These results indicated that SKF inhibited ATP sensitive K+ channels and voltage-gated K+ channels, with the ATP sensitive K+ channels being more sensitive than the voltage-gated K+ channels. These inhibitory effects on K+ channels should be considered when SKF is used as a cationic channel blocker. PMID:26498720

  11. Activity of the oxidation products of oleum terebinthinae "Landes" on guinea pig airway smooth muscle in vivo and in vitro.

    PubMed

    Bermudez, J; Burgess, M F; Cassidy, F; Clarke, G D

    1987-11-01

    The oxidation products of Oleum Terebinthinae "Landes" (Ozothin; in the following briefly called Ox. O. T. L.) have been described in many studies as being of benefit in the treatment of disturbed tracheobronchial function in obstructive airways diseases. Previous literature has dealt mainly with the influence of Ox. O. T. L. on the visco-elastic properties of mucus. However, the purpose of the present work was to study the bronchospasmolytic component. Using a standard methodology for the measurement of bronchospasmolytic effects, it could be demonstrated that Ox.O.T.L., given orally or as an aerosol, protected conscious guinea pigs against histamine-induced bronchoconstriction. The potency was lower than that of isoprenaline but was significant and reproducible. These results in vivo are paralleled by effects observed on guinea pig lung strips and tracheal spiral preparations. Ox.O.T.L. relaxed, in a dose-dependent fashion, guinea pig lung strip preparations contracted with histamine. Potency and efficacy was, however, less than that of isoprenaline. Similarly, in guinea pig tracheal spiral preparations, Ox.O.T.L. was less potent than isoprenaline in counteracting carbachol-elevated tone. However, efficacy equalled that of isoprenaline. Ox.O.T.L. was approximately 3 times more potent in the isolated tracheal spiral preparation than in lung strips. The activity of non-oxidised turpentine oil and terpin hydrate against histamine-induced bronchoconstriction in conscious animals and in the isolated organ preparations was substantially lower than that of the oxidation products of O.T.L. PMID:3440034

  12. Ca2+ current and Ca(2+)-activated chloride current in isolated smooth muscle cells of the sheep urethra.

    PubMed Central

    Cotton, K D; Hollywood, M A; McHale, N G; Thornbury, K D

    1997-01-01

    1. Isolated sheep urethral cells were studied using the perforated patch clamp technique (T = 37 degrees C). Depolarizing steps ranging from -40 to -10 mV evoked an inward current that peaked within 10 ms and a slower inward current. Stepping back to the holding potential of -80 mV evoked large inward tail currents. All three currents were abolished by nifedipine (1 microM). Substitution of external Ca2+ with Ba2+ resulted in potentiation of the fast inward current and blockade of the slow current and tails. 2. Changing the chloride equilibrium potential (ECl) from 0 to +27 mV shifted the reversal potential of the tail currents from 1 +/- 1 to 27 +/- 1 mV (number of cells, n = 5). Chloride channel blockers, niflumic acid (10 microM) and anthracene-9-carboxylic acid (9AC, 1 mM), reduced the slow current and tails suggesting that these were Ca(2+)-activated Cl- currents, ICl(Ca). 4. Caffeine (10 mM) induced currents that reversed at ECl and were blocked by niflumic acid (10 microM). 5. In current clamp mode, some cells developed spontaneous transient depolarizations (STDs) and action potentials. Short exposure to nifedipine blocked the action potentials and unmasked STDs. In contrast, 9AC and niflumic acid reduced the amplitude of the STDs and blocked the action potentials. 6. In conclusion, these cells have both L-type ICa and ICl(Ca). The former appears to be responsible for the upstroke of the action potential, while the latter may act as a pacemaker current. PMID:9409476

  13. Smooth muscle NOS, colocalized with caveolin-1, modulates contraction in mouse small intestine

    PubMed Central

    El-Yazbi, Ahmed F; Cho, Woo Jung; Cena, Jonathan; Schulz, Richard; Daniel, Edwin E

    2008-01-01

    Neuronal nitric oxide synthase (nNOS) in myenteric neurons is activated during peristalsis to produce nitric oxide which relaxes intestinal smooth muscle. A putative nNOS is also found in the membrane of intestinal smooth muscle cells in mouse and dog. In this study we studied the possible functions of this nNOS expressed in mouse small intestinal smooth muscle colocalized with caveolin-1(Cav-1). Cav-1 knockout mice lacked nNOS in smooth muscle and provided control tissues. 60 mM KCl was used to increase intracellular [Ca2+] through L-type Ca2+ channel opening and stimulate smooth muscle NOS activity in intestinal tissue segments. An additional contractile response to LNNA (100 μM, NOS inhibitor) was observed in KCl-contracted tissues from control mice and was almost absent in tissues from Cav-1 knockout mice. Disruption of caveolae with 40 mM methyl-β cyclodextrin in tissues from control mice led to the loss of Cav-1 and nNOS immunoreactivity from smooth muscle as shown by immunohistochemistry and a reduction in the response of these tissues to N-ω-nitro-L-arginine (LNNA). Reconstitution of membrane cholesterol using water soluble cholesterol in the depleted segments restored the immunoreactivity and the response to LNNA added after KCl. Nicardipine (1 μM) blocked the responses to KCl and LNNA confirming the role of L-type Ca2+ channels. ODQ (1 μM, soluble guanylate cyclase inhibitor) had the same effect as inhibition of NOS following KCl. We conclude that the activation of nNOS, localized in smooth muscle caveolae, by calcium entering through L-type calcium channels triggers nitric oxide production which modulates muscle contraction by a cGMP-dependent mechanism. PMID:18400048

  14. Polydatin inhibits the oxidative stress-induced proliferation of vascular smooth muscle cells by activating the eNOS/SIRT1 pathway.

    PubMed

    Ma, Yi; Gong, Xun; Mo, Yingli; Wu, Saizhu

    2016-06-01

    Oxidative stress-mediated proliferation of vascular smooth muscle cells (VSMCs) contributes to plaque formation and the progression of atherosclerosis. Polydatin is a derivative of resveratrol, and is widely present in certain herbal medications used for the treatment of cardiovascular diseases. In the present study, we examined whether polydatin was capable of attenuating VSMC proliferation induced by oxidative stress as well as the potential involvement of the endothelial nitric oxide synthetase (eNOS)/SIRT1 pathway. Briefly, VSMCs were exposed to H2O2 for 24 h in the absence or presence of polydatin (10-100 µM) prior to performing a cell proliferation assay. In mechanistic studies, the cells were incubated with the silent information regulator 1 (SIRT1) inhibitor, EX527, or the eNOS inhibitor, L-NAME, prior to polydatin treatment. The results showed that polydatin inhibited VSMC proliferation and the level of reactive oxygen species, increased the expression of Kip1/p27, SIRT1 and eNOS, whereas the expression of cyclin B1, Cdk1 and c-myc was decreased. The number of cells in the G2/M phase was increased. Pre-treatment with L-NAME attenuated the inhibitory effects of polydatin on cell proliferation, inhibited the expression of SIRT1 and the phosphorylation of eNOS. Pre-treatment with EX527 also attenuated the inhibitory effects of polydatin on cell proliferation, but failed to reduce the activation of eNOS and the production of nitric oxide. Taken together, these findings suggest that, polydatin inhibited the oxidative stress-induced proliferation of VMSCs by activating the eNOS/SIRT1 pathway. PMID:27081912

  15. TMEM16A knockdown abrogates two different Ca(2+)-activated Cl (-) currents and contractility of smooth muscle in rat mesenteric small arteries.

    PubMed

    Dam, Vibeke Secher; Boedtkjer, Donna M B; Nyvad, Jakob; Aalkjaer, Christian; Matchkov, Vladimir

    2014-07-01

    The presence of Ca(2+)-activated Cl(-) channels (CaCCs) in vascular smooth muscle cells (SMCs) is well established. Their molecular identity is, however, elusive. Two distinct Ca(2+)-activated Cl(-) currents (I Cl(Ca)) were previously characterized in SMCs. We have shown that the cGMP-dependent I Cl(Ca) depends on bestrophin expression, while the "classical" I Cl(Ca) is not. Downregulation of bestrophins did not affect arterial contraction but inhibited the rhythmic contractions, vasomotion. In this study, we have used in vivo siRNA transfection of rat mesenteric small arteries to investigate the role of a putative CaCC, TMEM16A. Isometric force, [Ca(2+)]i, and SMC membrane potential were measured in isolated arterial segments. I Cl(Ca) and GTPγS-induced nonselective cation current were measured in isolated SMCs. Downregulation of TMEM16A resulted in inhibition of both the cGMP-dependent I Cl(Ca) and the "classical" I Cl(Ca) in SMCs. TMEM16A downregulation also reduced expression of bestrophins. TMEM16A downregulation suppressed vasomotion both in vivo and in vitro. Downregulation of TMEM16A reduced agonist (noradrenaline and vasopressin) and K(+)-induced contractions. In accordance with the depolarizing role of CaCCs, TMEM16A downregulation suppressed agonist-induced depolarization and elevation in [Ca(2+)]i. Surprisingly, K(+)-induced depolarization was unchanged but Ca(2+) entry was reduced. We suggested that this is due to reduced expression of the L-type Ca(2+) channels, as observed at the mRNA level. Thus, the importance of TMEM16A for contraction is, at least in part, independent from membrane potential. This study demonstrates the significance of TMEM16A for two SMCs I Cl(Ca) and vascular function and suggests an interaction between TMEM16A and L-type Ca(2+) channels. PMID:24162234

  16. [Magnetic-laser influence on the system of nitric oxide and contractile activity of smooth muscles of rat aorta under hypertension].

    PubMed

    Fedorov, S M; Baziliuk, O V; Kotsiuruba, A V; Korkach, Iu P; Sahach, V F

    2012-01-01

    The study was conducted on three groups of rats: Group I included Wistar rats with normal blood pressure (first control group); group II - rats with genetically determined hypertension (second control group); group Ill - rats with genetically determined hypertension under the influence ofmagnetic-laser power (study group). For the low-intensively magnetic-laser influence (MLI) we have used device MIT-MT, Ukraine, which was designed for the treatment of low-frequency magnetic field using optical flow blue and red ranges of spectrum. The MLI duration was 15 minutes for the blue range, and 25 minutes for the red one. Biochemical studies included the determination of the activity of isoenzymes of NO-synthase: constitutive (cNOS) and inducible (iNOS), the content of free hemoglobin, stable metabolites of NO, namely nitrite - (NO2(-)) and nitrate - (NO3(-)) anions, resistance to acid hemolysis of red blood cells. The contractile activity of smooth muscles of the aorta was measured. We found that magnetic-laser exposure of rats with genetically determined hypertension in the red (630 nm) and blue (470 nm wavelength) optical range even after a single session leads to an increased synthesis of nitric oxide in the blood plasma. Our data sindicate that the most effective in the intensification of endogenous nitric oxide (increase of NO2(-) and reduction of NO3(-)) and endothelium-dependent responses of aorta in rats with genetically determined hypertension was a ten-day course of the magnetic-laser exposure in the optical flow of the blue spectral range. Also, after 10 sessions of magnetic-laser exposure in rats from the above specified spectrum a stabilization of erythrocyte membranes was observed. PMID:23530412

  17. Role of smooth muscle cell mineralocorticoid receptor in vascular tone.

    PubMed

    Tarjus, Antoine; Belozertseva, Ekaterina; Louis, Huguette; El Moghrabi, Soumaya; Labat, Carlos; Lacolley, Patrick; Jaisser, Frédéric; Galmiche, Guillaume

    2015-08-01

    Identification of the mineralocorticoid receptor (MR) in the vasculature (i.e., endothelial and smooth muscle cells) raised the question of its role in vascular function and blood pressure control. Using a mouse model with conditional inactivation of MR in vascular smooth muscle cell (VSMC) (MR(SMKO)), we have recently shown that the VSMC MR is crucial for aldosterone-salt-induced carotid stiffening. In the present study, we have investigated the specific contribution of the VSMC MR in the regulation of vascular tone in large vessels. In MR(SMKO) mice, contractions induced by potassium chloride and calcium (Ca(2+)) are decreased in the aorta, whereas contraction is normal in response to phenylephrine and caffeine. The difference in response to Ca(2+) suggests that the VSMC-specific deficiency of the MR modifies VSM Ca(2+) signaling but without altering the intracellular Ca(2+) store handling. The relaxation induced by acetylcholine is not affected by the absence of MR. However, the relaxation induced by Ach in the presence of indomethacin and the relaxation induced by sodium nitroprussiate are significantly reduced in MR(SMKO) mice compared to controls. Since endothelial nitric oxide synthase (eNOS) activity is increased in mutant mice, their altered relaxation reflects impairment of the nitric oxide (NO) signaling pathway. In addition to altered NO and Ca(2+) signaling, the activity of myosin light chain and its regulators, myosin light chain kinase (MLCK) and myosin phosphatase (MLCP), is reduced. In conclusion, MR expressed in VSMC is required for NO and Ca(2+) signaling pathways and contractile protein activity leading to an altered contraction/relaxation coupling. PMID:25262754

  18. Smooth Muscle Enriched Long Noncoding RNA (SMILR) Regulates Cell Proliferation

    PubMed Central

    Ballantyne, Margaret D.; Pinel, Karine; Dakin, Rachel; Vesey, Alex T.; Diver, Louise; Mackenzie, Ruth; Garcia, Raquel; Welsh, Paul; Sattar, Naveed; Hamilton, Graham; Joshi, Nikhil; Dweck, Marc R.; Miano, Joseph M.; McBride, Martin W.; Newby, David E.; McDonald, Robert A.

    2016-01-01

    Background— Phenotypic switching of vascular smooth muscle cells from a contractile to a synthetic state is implicated in diverse vascular pathologies, including atherogenesis, plaque stabilization, and neointimal hyperplasia. However, very little is known about the role of long noncoding RNA (lncRNA) during this process. Here, we investigated a role for lncRNAs in vascular smooth muscle cell biology and pathology. Methods and Results— Using RNA sequencing, we identified >300 lncRNAs whose expression was altered in human saphenous vein vascular smooth muscle cells following stimulation with interleukin-1α and platelet-derived growth factor. We focused on a novel lncRNA (Ensembl: RP11-94A24.1), which we termed smooth muscle–induced lncRNA enhances replication (SMILR). Following stimulation, SMILR expression was increased in both the nucleus and cytoplasm, and was detected in conditioned media. Furthermore, knockdown of SMILR markedly reduced cell proliferation. Mechanistically, we noted that expression of genes proximal to SMILR was also altered by interleukin-1α/platelet-derived growth factor treatment, and HAS2 expression was reduced by SMILR knockdown. In human samples, we observed increased expression of SMILR in unstable atherosclerotic plaques and detected increased levels in plasma from patients with high plasma C-reactive protein. Conclusions— These results identify SMILR as a driver of vascular smooth muscle cell proliferation and suggest that modulation of SMILR may be a novel therapeutic strategy to reduce vascular pathologies. PMID:27052414

  19. Strain activation of bovine aortic smooth muscle cell proliferation and alignment: study of strain dependency and the role of protein kinase A and C signaling pathways

    NASA Technical Reports Server (NTRS)

    Mills, I.; Cohen, C. R.; Kamal, K.; Li, G.; Shin, T.; Du, W.; Sumpio, B. E.

    1997-01-01

    Smooth muscle cell (SMC) phenotype can be altered by physical forces as demonstrated by cyclic strain-induced changes in proliferation, orientation, and secretion of macromolecules. However, the magnitude of strain required and the intracellular coupling pathways remain ill defined. To examine the strain requirements for SMC proliferation, we selectively seeded bovine aortic SMC either on the center or periphery of silastic membranes which were deformed with 150 mm Hg vacuum (0-7% center; 7-24% periphery). SMC located in either the center or peripheral regions showed enhanced proliferation compared to cells grown under the absence of cyclic strain. Moreover, SMC located in the center region demonstrated significantly (P < 0.005) greater proliferation as compared to those in the periphery. In contrast, SMC exposed to high strain (7-24%) demonstrated alignment perpendicular to the strain gradient, whereas SMC in the center (0-7%) remained aligned randomly. To determine the mechanisms of these phenomena, we examined the effect of cyclic strain on bovine aortic SMC signaling pathways. We observed strain-induced stimulation of the cyclic AMP pathway including adenylate cyclase activity and cyclic AMP accumulation. In addition, exposure of SMC to cyclic strain caused a significant increase in protein kinase C (PKC) activity and enzyme translocation from the cytosol to a particulate fraction. Further study was conducted to examine the effect of strain magnitude on signaling, particularly protein kinase A (PKA) activity as well as cAMP response element (CRE) binding protein levels. We observed significantly (P < 0.05) greater PKA activity and CRE binding protein levels in SMC located in the center as compared to the peripheral region. However, inhibition of PKA (with 10 microM Rp-cAMP) or PKC (with 5-20 ng/ml staurosporine) failed to alter either the strain-induced increase in SMC proliferation or alignment. These data characterize the strain determinants for activation of

  20. OUABAIN- AND MARINOBUFAGENIN-INDUCED PROLIFERATION OF HUMAN UMBILICAL VEIN SMOOTH MUSCLE CELLS AND A RAT VASCULAR SMOOTH MUSCLE CELL LINE, A7R5

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We studied the growth-promoting effects of 2 sodium pump-selective cardiotonic steroids, ouabain and marinobufagenin, on cultured cells from vascular smooth muscle (VSMCs) from human umbilical vein and a rat VSMC line, A7r5. Both ouabain and marinobufagenin activated proliferation of these cells in...

  1. Synthesis and calcium antagonist activity of new 1,4-dihydropyridines containing nitrobenzylimidazolyl substituent in guinea-pig ileal smooth muscle.

    PubMed

    Zarghi, A; Derakhshandeh, K; Roshanzamir, F; Jorjani, M; Rastegar, H; Varmazyari, M; Shafiee, A

    2002-01-01

    New alkyl ester analogues of nifedipine, in which the ortho-nitrophenyl group of position 4 is replaced by 1-(4-nitrobenzyl)-5-imidazolyl or 2-methylthio-1-(4-nitrobenzyl)-5-imidazolyl substituent, were synthesized and evaluated as calcium-channel antagonists using the electrically induced contraction of guinea-pig ileal longitudinal smooth muscle. Our results demonstrate that all compounds inhibited the contractile response of guinea-pig ileum to electrical stimulation and the IC50 value of the most potent compounds 6a and 6f were significantly lower than that of nifedipine. Therefore, they are more potent than nifedipine. PMID:12064052

  2. Acute hypoxia activates store-operated Ca2+ entry and increases intracellular Ca2+ concentration in rat distal pulmonary venous smooth muscle cells

    PubMed Central

    Peng, Gongyong; Lu, Wenju; Zhong, Nanshan

    2013-01-01

    Rationale Exposure to acute hypoxia causes vasoconstriction in both pulmonary arteries (PA) and pulmonary veins (PV). The mechanisms on the arterial side have been studied extensively. However, bare attention has been paid to the venous side. Objectives To investigate if acute hypoxia caused the increase of intracellular Ca2+ concentration ([Ca2+]i), and Ca2+ influx through store-operated calcium channels (SOCC) in pulmonary venous smooth muscle cells (PVSMCs). Methods Fluorescent microscopy and fura-2 were used to measure effects of 4% O2 on [Ca2+]i and store-operated Ca2+ entry (SOCE) in isolated rat distal PVSMCs. Measurements and main results In PVSMCs perfused with Ca2+-free Krebs Ringer bicarbonate solution (KRBS) containing cyclopiazonic acid to deplete Ca2+ stores in the sarcoplasmic reticulum (SR) and nifedipine to prevent Ca2+ entry through L-type voltage-depended Ca2+ channels (VDCC), hypoxia markedly enhanced both the increase in [Ca2+]i caused by restoration of extracellular [Ca2+] and the rate at which extracellular Mn2+ quenched fura-2 fluorescence. Moreover, the increased [Ca2+]i in PVSMCs perfused with normal salt solution was completely blocked by SOCC antagonists SKF-96365 and NiCl2 at concentrations that SOCE >85% was inhibited but [Ca2+]i responses to 60 mM KCl were not altered. On the contrary, L-type VDCC antagonist nifedipine inhibited increase in [Ca2+]i to hypoxia by only 50% at concentrations that completely blocked responses to KCl. The increased [Ca2+]i caused by hypoxia was completely abolished by perfusion with Ca2+-free KRBS. Conclusions These results suggest that acute hypoxia enhances SOCE via activating SOCCs, leading to increased [Ca2+]i in distal PVSMCs. PMID:24255773

  3. Involvement of Receptor Activity-Modifying Protein 3 (RAMP3) in the Vascular Actions of Adrenomedullin in Rat Mesenteric Artery Smooth Muscle Cells.

    PubMed

    Chauhan, Madhu; Yallampalli, Uma; Banadakappa, Manu; Yallampalli, Chandrasekhar

    2015-11-01

    CALCB, ADM, and ADM2 are potent vasodilators that share a seven-transmembrane GPCR, calcitonin receptor-like receptor (CALCRL), whose ligand specificity is dictated by the presence of one of the three receptor activity-modifying proteins (RAMPs). We assessed the relative pharmacologic potency of these peptides in mesenteric artery smooth muscle cells (VSMCs) and the specific RAMP that mediates the effect of ADM in VSMCs. VSMCs, with or without RAMP knockdown, were treated with CALCB, ADM, or ADM2 in the presence or absence of their antagonists, CALCB8-37, ADM22-52, and ADM217-47, respectively, to assess the relative effect of peptides on cAMP production and their pharmacologic potency. Proximity ligation assay was used to assess the specific RAMP that associates with CALCRL to mediate the actions of ADM in VSMCs. All three peptides induced cAMP generation in VSMCs and the order of their potency is CALCB > ADM > ADM2. Effects of CALCB were blocked by CALCB8-37, ADM effects were blocked by CALCB8-37 and ADM217-47 but not ADM22-52, and ADM2 effects were blocked by all three antagonists. Knockdown of RAMP2 was ineffective, whereas knockdown of RAMP3 inhibited ADM-induced cAMP production in VSMCs, suggesting involvement of RAMP3 with CALCRL to mediate ADM effects. Absence of both RAMP2 and RAMP3 further increased CALCB-induced cAMP synthesis compared to control (P < 0.05). ADM increased CALCRL and RAMP3 association and RAMP3 knockdown inhibited the interaction of ADM with CALCRL. PMID:26423127

  4. Iroquois homeobox transcription factor (Irx5) promotes G1/S-phase transition in vascular smooth muscle cells by CDK2-dependent activation.

    PubMed

    Liu, Dong; Pattabiraman, Vaishnavi; Bacanamwo, Methode; Anderson, Leonard M

    2016-08-01

    The Iroquois homeobox (Irx5) gene is essential in embryonic development and cardiac electrophysiology. Although recent studies have reported that IRX5 protein is involved in regulation of the cell cycle and apoptosis in prostate cancer cells, little is known about the role of IRX5 in the adult vasculature. Here we report novel observations on the role of IRX5 in adult vascular smooth muscle cells (VSMCs) during proliferation in vitro and in vivo. Comparative studies using primary human endothelial cells, VSMCs, and intact carotid arteries to determine relative expression of Irx5 in the peripheral vasculature demonstrate significantly higher expression in VSMCs. Sprague-Dawley rat carotid arteries were subjected to balloon catherization, and the presence of IRX5 was examined by immunohistochemistry after 2 wk. Results indicate markedly elevated IRX5 signal at 14 days compared with uninjured controls. Total RNA was isolated from injured and uninjured arteries, and Irx5 expression was measured by RT-PCR. Results demonstrate a significant increase in Irx5 expression at 3-14 days postinjury compared with controls. Irx5 genetic gain- and loss-of-function studies using thymidine and 5-bromo-2'-deoxyuridine incorporation assays resulted in modulation of DNA synthesis in primary rat aortic VSMCs. Quantitative RT-PCR results revealed modulation of cyclin-dependent kinase inhibitor 1B (p27(kip1)), E2F transcription factor 1 (E2f1), and proliferating cell nuclear antigen (Pcna) expression in Irx5-transduced VSMCs compared with controls. Subsequently, apoptosis was observed and confirmed by morphological observation, caspase-3 cleavage, and enzymatic activation compared with control conditions. Taken together, these results indicate that Irx5 plays an important role in VSMC G1/S-phase cell cycle checkpoint control and apoptosis. PMID:27170637

  5. Effect of the ostreolysin A/pleurotolysin B pore-forming complex on intracellular Ca2+ activity in the vascular smooth muscle cell line A10.

    PubMed

    Vrecl, Milka; Babnik, Monika; Sepčić, Kristina; Žužek, Monika C; Maček, Peter; Diacci, Uroš; Frangež, Robert

    2015-12-01

    Ostreolysin A/pleurotolysin B (OlyA/PlyB) is a binary pore-forming protein complex that produces a rapid cardiorespiratory arrest. Increased tonus of the coronary vascular wall produced by OlyA/PlyB may lead to ischemia, arrhythmias, the hypoxic injury of cardiomyocytes and cardiotoxicity. We evaluated the effects of OlyA/PlyB in cultured vascular smooth muscle A10 cells. Fluorometric measurements using the Ca(2+) indicator Fluo-4 AM and Fura-2 AM revealed that nanomolar concentrations of OlyA/PlyB increased the intracellular Ca(2+) activity [Ca(2+)]i in A10 cells. This effect was absent in a Ca(2+)-free medium, indicating that OlyA/PlyB-induced [Ca(2+)]i increase was dependent on Ca(2+) influx into cells. The increase in [Ca(2+)]i by OlyA/PlyB was partially prevented by: i) the calcium channel blockers verapamil and La(3+), ii) the inhibitor of the sodium-calcium exchanger (NCX) benzamil, and iii) the iso-osmotic replacement of NaCl by sucrose. The pre-treatment of cells with the Ca(2+)-ATPase inhibitor thapsigargin reduced the [Ca(2+)]i increase evoked by OlyA/PlyB, whereas the plasma membrane depolarization with high K(+) in the medium did not prevent OlyA/PlyB-induced [Ca(2+)]i. In summary, our data could suggest that the OlyA/PlyB-induced increase in [Ca(2+)]i is due to an influx of Ca(2+) through a variety of co-existing plasma membrane Ca(2+)-permeable channels, Ca(2+) entry through non-selective ion permeable pores formed de novo by OlyA/PlyB in the plasma membrane and calcium-induced intracellular Ca(2+) release, altogether leading to disturbed Ca(2+) homeostasis in A10 cells. PMID:26320834

  6. Bronchospasm and its biophysical basis in airway smooth muscle

    PubMed Central

    Fredberg, Jeffrey J

    2004-01-01

    Airways hyperresponsiveness is a cardinal feature of asthma but remains unexplained. In asthma, the airway smooth muscle cell is the key end-effector of bronchospasm and acute airway narrowing, but in just the past five years our understanding of the relationship of responsiveness to muscle biophysics has dramatically changed. It has become well established, for example, that muscle length is equilibrated dynamically rather than statically, and that non-classical features of muscle biophysics come to the forefront, including unanticipated interactions between the muscle and its time-varying load, as well as the ability of the muscle cell to adapt rapidly to changes in its dynamic microenvironment. These newly discovered phenomena have been described empirically, but a mechanistic basis to explain them is only beginning to emerge. PMID:15084229

  7. Endotoxin activates human vascular smooth muscle cells despite lack of expression of CD14 mRNA or endogenous membrane CD14.

    PubMed Central

    Loppnow, H; Stelter, F; Schönbeck, U; Schlüter, C; Ernst, M; Schütt, C; Flad, H D

    1995-01-01

    During infection or inflammation, cells of the blood vessel wall, such as endothelial cells (EC) and smooth muscle cells (SMC), contribute to the regulation of the immune response by production of cytokines or expression of adhesion molecules. Little is known about the mechanism(s) involved in the stimulation of vascular cells by endotoxin (lipopolysaccharide [LPS]). As reported previously, LPS antagonists reduce LPS-induced cytokine production or adhesion in vitro specifically, suggesting a specific LPS recognition mechanism. We thus investigated the role of CD14 for stimulation of vascular SMC by LPS. Complement-fixing antibodies directed against CD14 (LeuM3, RoMo I, or Mo2) lysed monocytes but failed to mediate lysis of EC or SMC, indicating the lack of endogenous membrane CD14 in vascular cells. In addition, we did not detect expression of CD14 protein on EC and SMC in cell sorting analysis or cell immunoassay experiments. These observations are in line with our finding that a CD14 probe did not hybridize with mRNA or EC or SMC in Northern (RNA) blot experiments, although it hybridized well with monocyte-derived mRNA. We obtained the same results with the much more sensitive reverse transcription-PCR. Since the vascular SMC did not express endogenous CD14, we investigated the role of human serum-derived soluble CD14 (sCD14) for activation of SMC by LPS. In medium containing human serum, anti-CD14 antibodies inhibited activation of SMC by LPS. In contrast, the same antibodies did not inhibit activation of cells cultured in medium containing fetal calf serum. SMC cultured in sCD14-depleted medium responded 1,000-fold less to LPS than cells cultured in presence of sCD14. Reconstitution of sCD14-depleted serum or supplementation of serum-free medium with recombinant CD14 restored the capacity of the cells to respond to LPS. These results show that specific activation of vascular SMC by LPS does not involve binding to endogenous membrane CD14, but that the

  8. Unregulated smooth-muscle myosin in human intestinal neoplasia.

    PubMed

    Alhopuro, Pia; Phichith, Denis; Tuupanen, Sari; Sammalkorpi, Heli; Nybondas, Miranda; Saharinen, Juha; Robinson, James P; Yang, Zhaohui; Chen, Li-Qiong; Orntoft, Torben; Mecklin, Jukka-Pekka; Järvinen, Heikki; Eng, Charis; Moeslein, Gabriela; Shibata, Darryl; Houlston, Richard S; Lucassen, Anneke; Tomlinson, Ian P M; Launonen, Virpi; Ristimäki, Ari; Arango, Diego; Karhu, Auli; Sweeney, H Lee; Aaltonen, Lauri A

    2008-04-01

    A recent study described a recessive ATPase activating germ-line mutation in smooth-muscle myosin (smmhc/myh11) underlying the zebrafish meltdown (mlt) phenotype. The mlt zebrafish develops intestinal abnormalities reminiscent of human Peutz-Jeghers syndrome (PJS) and juvenile polyposis (JP). To examine the role of MYH11 in human intestinal neoplasia, we searched for MYH11 mutations in patients with colorectal cancer (CRC), PJS and JP. We found somatic protein-elongating frameshift mutations in 55% of CRCs displaying microsatellite instability and in the germ-line of one individual with PJS. Additionally, two somatic missense mutations were found in one microsatellite stable CRC. These two missense mutations, R501L and K1044N, and the frameshift mutations were functionally evaluated. All mutations resulted in unregulated molecules displaying constitutive motor activity, similar to the mutant myosin underlying mlt. Thus, MYH11 mutations appear to contribute also to human intestinal neoplasia. Unregulated MYH11 may affect the cellular energy balance or disturb cell lineage decisions in tumor progenitor cells. These data challenge our view on MYH11 as a passive differentiation marker functioning in muscle contraction and add to our understanding of intestinal neoplasia. PMID:18391202

  9. Bladder Smooth Muscle Strip Contractility as a Method to Evaluate Lower Urinary Tract Pharmacology

    PubMed Central

    Kullmann, F. Aura; Daugherty, Stephanie L.; de Groat, William C.; Birder, Lori A.

    2015-01-01

    We describe an in vitro method to measure bladder smooth muscle contractility, and its use for investigating physiological and pharmacological properties of the smooth muscle as well as changes induced by pathology. This method provides critical information for understanding bladder function while overcoming major methodological difficulties encountered in in vivo experiments, such as surgical and pharmacological manipulations that affect stability and survival of the preparations, the use of human tissue, and/or the use of expensive chemicals. It also provides a way to investigate the properties of each bladder component (i.e. smooth muscle, mucosa, nerves) in healthy and pathological conditions. The urinary bladder is removed from an anesthetized animal, placed in Krebs solution and cut into strips. Strips are placed into a chamber filled with warm Krebs solution. One end is attached to an isometric tension transducer to measure contraction force, the other end is attached to a fixed rod. Tissue is stimulated by directly adding compounds to the bath or by electric field stimulation electrodes that activate nerves, similar to triggering bladder contractions in vivo. We demonstrate the use of this method to evaluate spontaneous smooth muscle contractility during development and after an experimental spinal cord injury, the nature of neurotransmission (transmitters and receptors involved), factors involved in modulation of smooth muscle activity, the role of individual bladder components, and species and organ differences in response to pharmacological agents. Additionally, it could be used for investigating intracellular pathways involved in contraction and/or relaxation of the smooth muscle, drug structure-activity relationships and evaluation of transmitter release. The in vitro smooth muscle contractility method has been used extensively for over 50 years, and has provided data that significantly contributed to our understanding of bladder function as well as to

  10. Wall stretch and thromboxane A2 activate NO synthase (eNOS) in pulmonary arterial smooth muscle cells via H2O2 and Akt-dependent phosphorylation.

    PubMed

    Kim, Hae Jin; Yoo, Hae Young; Jang, Ji Hyun; Lin, Hai Yue; Seo, Eun Yeong; Zhang, Yin Hua; Kim, Sung Joon

    2016-04-01

    Pulmonary arteries (PAs) have high compliance, buffering the wide ranges of blood flow. Here, we addressed a hypothesis that PA smooth muscle cells (PASMCs) express nitric oxide synthases (NOS) that might be activated by mechanical stress and vasoactive agonists. In the myograph study of endothelium-denuded rat PAs, NOS inhibition (L-NAME) induced strong contraction (96 % of 80 mM KCl-induced contraction (80K)) in the presence of 5 nM U46619 (thromboxane A2 (TXA2) analogue) with relatively high basal stretch (2.94 mN, S(+)). With lower basal stretch (0.98 mN, S(-)), however, L-NAME application following U46619 (TXA2/L-NAME) induced weak contraction (27 % of 80K). Inhibitors of nNOS and iNOS had no such effect in S(+) PAs. In endothelium-denuded S(+) mesenteric and renal arteries, TXA2/L-NAME-induced contraction was only 18 and 21 % of 80K, respectively. Expression of endothelial-type NOS (eNOS) in rat PASMCs was confirmed by RT-PCR and immunohistochemistry. Even in S(-) PAs, pretreatment with H2O2 (0.1-10 μM) effectively increased the sensitivity to TXA2/L-NAME (105 % of 80K). Vice versa, NADPH oxidase inhibitors, reactive oxygen species scavengers, or an Akt inhibitor (SC-66) suppressed TXA2/L-NAME-induced contraction in S(+) PAs. In a human PASMC line, immunoblot analysis showed the following: (1) eNOS expression, (2) Ser(1177) phosphorylation by U46619 and H2O2, and (3) Akt activation (Ser(473) phosphorylation) by U46619. In the cell-attached patch clamp study, H2O2 facilitated membrane stretch-activated cation channels in rat PASMCs. Taken together, the muscular eNOS in PAs can be activated by TXA2 and mechanical stress via H2O2 and Akt-mediated signaling, which may counterbalance the contractile signals from TXA2 and mechanical stimuli. PMID:26729266

  11. Calcium ion-regulated thin filaments from vascular smooth muscle.

    PubMed Central

    Marston, S B; Trevett, R M; Walters, M

    1980-01-01

    Myosin and actin competition tests indicated the presence of both thin-filament and myosin-linked Ca2+-regulatory systems in pig aorta and turkey gizzard smooth-muscle actomyosin. A thin-filament preparation was obtained from pig aortas. The thin filaments had no significant ATPase activity [1.1 +/- 2.6 nmol/mg per min (mean +/- S.D.)], but they activated skeletal-muscle myosin ATPase up to 25-fold [500 nmol/mg of myosin per min (mean +/- S.D.)] in the presence of 10(-4) M free Ca2+. At 10(-8) M-Ca2+ the thin filaments activated myosin ATPase activity only one-third as much. Thin-filament activation of myosin ATPase activity increased markedly in the range 10(-6)-10(-5) M-Ca2+ and was half maximal at 2.7 x 10(-6) M (pCa2+ 5.6). The skeletal myosin-aorta-thin-filament mixture gave a biphasic ATPase-rate-versus-ATP-concentration curve at 10(-8) M-Ca2+ similar to the curve obtained with skeletal-muscle thin filaments. Thin filaments bound up to 9.5 mumol of Ca2+/g in the presence of MgATP2-. In the range 0.06-27 microM-Ca2+ binding was hyperbolic with an estimated binding constant of (0.56 +/- 0.07) x 10(6) M-1 (mean +/- S.D.) and maximum binding of 8.0 +/- 0.8 mumol/g (mean +/- S.D.). Significantly less Ca2+ bound in the absence of ATP. The thin filaments contained actin, tropomyosin and several other unidentified proteins. 6 M-Urea/polyacrylamide-gel electrophoresis at pH 8.3 showed proteins that behaved like troponin I and troponin C. This was confirmed by forming interspecific complexes between radioactive skeletal-muscle troponin I and troponin C and the aorta thin-filament proteins. The thin filaments contained at least 1.4 mumol of a troponin C-like protein/g and at least 1.1 mumol of a troponin I-like protein/g. PMID:6446898

  12. Calcium efflux activity of plasma membrane Ca2+ ATPase-4 (PMCA4) mediates cell cycle progression in vascular smooth muscle cells.

    PubMed

    Afroze, Talat; Yang, Ge; Khoshbin, Amir; Tanwir, Mansoor; Tabish, Taha; Momen, Abdul; Husain, Mansoor

    2014-03-01

    We explored the role played by plasma membrane calcium ATPase-4 (PMCA4) and its alternative splice variants in the cell cycle of vascular smooth muscle cells (VSMC). A novel variant (PMCA4e) was discovered. Quantitative real-time-PCR-quantified PMCA4 splice variant proportions differed in specific organs. The PMCA4a:4b ratio in uninjured carotid arteries (∼1:1) was significantly reduced by wire denudation injury (to ∼1:3) by modulation of alternative splicing, as confirmed by novel antibodies against PMCA4a/e and PMCA4b. Laser capture microdissection localized this shift to the media and adventitia. Primary carotid VSMC from PMCA4 knock-out (P4KO) mice showed impaired [(3)H]thymidine incorporation and G1 phase arrest as compared with wild type (P4WT). Electroporation of expression constructs encoding PMCA4a, PMCA4b, and a PMCA4b mutant lacking PDZ binding rescued this phenotype of P4KO cells, whereas a mutant with only 10% of normal Ca(2+) efflux activity could not. Microarray of early G1-synchronized VSMC showed 39-fold higher Rgs16 (NFAT (nuclear factor of activated T-cells) target; MAPK inhibitor) and 69-fold higher Decorin (G1 arrest marker) expression in P4KO versus P4WT. Validation by Western blot also revealed decreased levels of Cyclin D1 and NFATc3 in P4KO. Microarrays of P4KO VSMC rescued by PMCA4a or PMCA4b expression showed reversal of perturbed Rgs16, Decorin, and NFATc3 expression levels. However, PMCA4a rescue caused a 44-fold reduction in AP-2β, a known anti-proliferative transcription factor, whereas PMCA4b rescue resulted in a 50-fold reduction in p15 (Cyclin D1/Cdk4 inhibitor). We conclude that Ca(2+) efflux activity of PMCA4 underlies G1 progression in VSMC and that PMCA4a and PMCA4b differentially regulate specific downstream mediators. PMID:24448801

  13. Functional effects of KCNQ K+ channels in airway smooth muscle

    PubMed Central

    Evseev, Alexey I.; Semenov, Iurii; Archer, Crystal R.; Medina, Jorge L.; Dube, Peter H.; Shapiro, Mark S.; Brenner, Robert

    2013-01-01

    KCNQ (Kv7) channels underlie a voltage-gated K+ current best known for control of neuronal excitability, and its inhibition by Gq/11-coupled, muscarinic signaling. Studies have indicated expression of KCNQ channels in airway smooth muscle (ASM), a tissue that is predominantly regulated by muscarinic receptor signaling. Therefore, we investigated the function of KCNQ channels in rodent ASM and their interplay with Gq/11-coupled M3 muscarinic receptors. Perforated-patch clamp of dissociated ASM cells detected a K+ current inhibited by the KCNQ antagonist, XE991, and augmented by the specific agonist, flupirtine. KCNQ channels begin to activate at voltages near resting potentials for ASM cells, and indeed XE991 depolarized resting membrane potentials. Muscarinic receptor activation inhibited KCNQ current weakly (~20%) at concentrations half-maximal for contractions. Thus, we were surprised to see that KCNQ had no affect on membrane voltage or muscle contractility following muscarinic activation. Further, M3 receptor-specific antagonist J104129 fumarate alone did not reveal KCNQ effects on muscarinic evoked depolarization or contractility. However, a role for KCNQ channels was revealed when BK-K+ channel activities are reduced. While KCNQ channels do control resting potentials, they appear to play a redundant role with BK calcium-activated K+ channels during ASM muscarinic signaling. In contrast to effect of antagonist, we observe that KCNQ agonist flupirtine caused a significant hyperpolarization and reduced contraction in vitro irrespective of muscarinic activation. Using non-invasive whole animal plethysmography, the clinically approved KCNQ agonist retigabine caused a transient reduction in indexes of airway resistance in both wild type and BK β1 knockout (KO) mice treated with the muscarinic agonist. These findings indicate that KCNQ channels can be recruited via agonists to oppose muscarinic evoked contractions and may be of therapeutic value as bronchodilators

  14. Functional effects of KCNQ K(+) channels in airway smooth muscle.

    PubMed

    Evseev, Alexey I; Semenov, Iurii; Archer, Crystal R; Medina, Jorge L; Dube, Peter H; Shapiro, Mark S; Brenner, Robert

    2013-01-01

    KCNQ (Kv7) channels underlie a voltage-gated K(+) current best known for control of neuronal excitability, and its inhibition by Gq/11-coupled, muscarinic signaling. Studies have indicated expression of KCNQ channels in airway smooth muscle (ASM), a tissue that is predominantly regulated by muscarinic receptor signaling. Therefore, we investigated the function of KCNQ channels in rodent ASM and their interplay with Gq/11-coupled M3 muscarinic receptors. Perforated-patch clamp of dissociated ASM cells detected a K(+) current inhibited by the KCNQ antagonist, XE991, and augmented by the specific agonist, flupirtine. KCNQ channels begin to activate at voltages near resting potentials for ASM cells, and indeed XE991 depolarized resting membrane potentials. Muscarinic receptor activation inhibited KCNQ current weakly (~20%) at concentrations half-maximal for contractions. Thus, we were surprised to see that KCNQ had no affect on membrane voltage or muscle contractility following muscarinic activation. Further, M3 receptor-specific antagonist J104129 fumarate alone did not reveal KCNQ effects on muscarinic evoked depolarization or contractility. However, a role for KCNQ channels was revealed when BK-K(+) channel activities are reduced. While KCNQ channels do control resting potentials, they appear to play a redundant role with BK calcium-activated K(+) channels during ASM muscarinic signaling. In contrast to effect of antagonist, we observe that KCNQ agonist flupirtine caused a significant hyperpolarization and reduced contraction in vitro irrespective of muscarinic activation. Using non-invasive whole animal plethysmography, the clinically approved KCNQ agonist retigabine caused a transient reduction in indexes of airway resistance in both wild type and BK β1 knockout (KO) mice treated with the muscarinic agonist. These findings indicate that KCNQ channels can be recruited via agonists to oppose muscarinic evoked contractions and may be of therapeutic value as

  15. SREBP inhibits VEGF expression in human smooth muscle cells

    SciTech Connect

    Motoyama, Koka; Fukumoto, Shinya . E-mail: sfukumoto@med.osaka-cu.ac.jp; Koyama, Hidenori; Emoto, Masanori; Shimano, Hitoshi; Maemura, Koji; Nishizawa, Yoshiki

    2006-03-31

    Sterol regulatory element-binding proteins (SREBPs) are transcription factors that regulate expression of genes encoding enzymes for lipid biosynthesis. SREBPs are activated by HMG-CoA reductase inhibitors (statins). Statins have been also reported to suppress vascular endothelial growth factor (VEGF) expression in vascular smooth muscle cells (VSMCs). Therefore, we hypothesized that SREBPs are involved in statin-mediated regulation of VEGF production in VSMCs. SREBP1 was robustly expressed, and was activated by atorvastatin in VSMCs, as demonstrated by increased levels of the mature nuclear form of SREBP1, and increased promoter activities of a reporter containing sterol regulatory elements by atorvastatin. Moreover, overexpression of SREBP1a dose-dependently suppressed VEGF promoter activity. Site-specific mutation or deletion of the proximal Sp1 sites reduced the inhibitory effects of SREBP1a on VEGF promoter activity. These data demonstrated that SREBP1, activated by atorvastatin, suppressed VEGF expression through the indirect interaction with the proximal tandem Sp1 sites in VSMCs.

  16. Cellular mechanism underlying the facilitation of contractile response of vas deferens smooth muscle by sodium orthovanadate.

    PubMed

    Zhao, Lei; Wang, Zhe; Ruan, Ye-Chun; Zhou, Wen-Liang

    2012-07-01

    In the earlier study, sodium orthovanadate (SOV) has been reported to be a powerful inhibitor of (Na(+), K(+)) adenosine triphosphatase, exhibit widespread actions on the renal and cardiovascular systems, induces smooth muscle contraction by inhibiting the phosphorylation of the protein tyrosine phosphatases. In the current study, we aimed to investigate the cellular mechanisms by which SOV facilitated contractile response of vas deferens smooth muscle and its potential therapeutic advantage. Exogenous application of ATP and NA-caused contraction was strengthened by pretreatment with SOV. This facilitation was inhibited not by bath with the inhibitor of P2 receptor, PPADS, or the inhibitor of α1 receptor, Prazosin, but by bath with the protein tyrosine kinase inhibitor, Genistein. SOV induced a sustained increase in intracellular Ca(2+) of smooth muscle cells, which was abolished by 100 μM Genistein or Ca(2+)-free solution. The facilitation of SOV could also be inhibited by the selective inhibitors of TRP channel, 2-APB and non-selective cation channel, Gd(3+), Ni(+). The in vivo study showed that peritoneal injection of SOV in dystrophic mice (mdx mice) enhanced the contraction of vas deferens smooth muscle stimulated by electrical field stimulation, ATP, noradrenaline, or KCl. The above results suggest that SOV facilitates the concentration of vas deferens smooth muscle through the tyrosine phosphorylation activated the non-selective cation channels, which has potential use in the therapy for muscle dysfunction. PMID:22476902

  17. Airway smooth muscle in the pathophysiology and treatment of asthma

    PubMed Central

    Solway, Julian

    2013-01-01

    Airway smooth muscle (ASM) plays an integral part in the pathophysiology of asthma. It is responsible for acute bronchoconstriction, which is potentiated by constrictor hyperresponsiveness, impaired relaxation and length adaptation. ASM also contributes to airway remodeling and inflammation in asthma. In light of this, ASM is an important target in the treatment of asthma. PMID:23305987

  18. A smooth muscle-like origin for beige adipocytes.

    PubMed

    Long, Jonathan Z; Svensson, Katrin J; Tsai, Linus; Zeng, Xing; Roh, Hyun C; Kong, Xingxing; Rao, Rajesh R; Lou, Jesse; Lokurkar, Isha; Baur, Wendy; Castellot, John J; Rosen, Evan D; Spiegelman, Bruce M

    2014-05-01

    Thermogenic UCP1-positive cells, which include brown and beige adipocytes, transform chemical energy into heat and increase whole-body energy expenditure. Using a ribosomal profiling approach, we present a comprehensive molecular description of brown and beige gene expression from multiple fat depots in vivo. This UCP1-TRAP data set demonstrates striking similarities and important differences between these cell types, including a smooth muscle-like signature expressed by beige, but not classical brown, adipocytes. In vivo fate mapping using either a constitutive or an inducible Myh11-driven Cre demonstrates that at least a subset of beige cells arise from a smooth muscle-like origin. Finally, ectopic expression of PRDM16 converts bona fide vascular smooth muscle cells into Ucp1-positive adipocytes in vitro. These results establish a portrait of brown and beige adipocyte gene expression in vivo and identify a smooth muscle-like origin for beige cells. PMID:24709624

  19. Smooth Muscle-Mediated Connective Tissue Remodeling in Pulmonary Hypertension

    NASA Astrophysics Data System (ADS)

    Mecham, Robert P.; Whitehouse, Loren A.; Wrenn, David S.; Parks, William C.; Griffin, Gail L.; Senior, Robert M.; Crouch, Edmond C.; Stenmark, Kurt R.; Voelkel, Norbert F.

    1987-07-01

    Abnormal accumulation of connective tissue in blood vessels contributes to alterations in vascular physiology associated with disease states such as hypertension and atherosclerosis. Elastin synthesis was studied in blood vessels from newborn calves with severe pulmonary hypertension induced by alveolar hypoxia in order to investigate the cellular stimuli that elicit changes in pulmonary arterial connective tissue production. A two- to fourfold increase in elastin production was observed in pulmonary artery tissue and medial smooth muscle cells from hypertensive calves. This stimulation of elastin production was accompanied by a corresponding increase in elastin messenger RNA consistent with regulation at the transcriptional level. Conditioned serum harvested from cultures of pulmonary artery smooth muscle cells isolated from hypertensive animals contained one or more low molecular weight elastogenic factors that stimulated the production of elastin in both fibroblasts and smooth muscle cells and altered the chemotactic responsiveness of fibroblasts to elastin peptides. These results suggest that connective tissue changes in the pulmonary vasculature in response to pulmonary hypertension are orchestrated by the medial smooth muscle cell through the generation of specific differentiation factors that alter both the secretory phenotype and responsive properties of surrounding cells.

  20. New insights in endothelial and smooth muscle cell communication.

    PubMed

    Conejo, Víctor Arana; De Haro, Roberto; Sosa-Melgarejo, Jorge; Méndez, José D

    2007-01-01

    Based on immunohistochemical techniques against connexins and the intercellular flux of staining molecules, it has previously been shown that electrotonic communication occurs among endothelial and vascular smooth muscle cells, this due to the presence of myoendothelial gap junctions. The aim of this study was to evaluate the density of myoendothelial contacts in the left coronary and internal mammary arteries as well as in the left saphenous vein by means of electron microscopy, the distance between both cells participating in an myoendothelial contact with a semi-automatic image analysis system and the presence of homocellular and heterocellular gap junctions between endothelial and smooth muscle cells by using the immunohistochemical technique and confocal microscopy in thoracic aorta were also analyzed. The results are that all blood vessels studied present myoendothelial contacts, while density studies show that they are more abundant in the saphenous vein. The myoendothelial contact distance is constant and in no case the cytoplasmic processes reach the plasma membrane of the partner cell toward which they are advanced. Homocellular gap junctions were found between smooth muscle cells and between endothelial cells. Heterocellular gap junctions were absent, evidencing the possibility that signaling molecules between endothelial and smooth muscle cells may be transferred through plasma membranes as was once thought and not necessarily by electrotonic communication. PMID:17383847

  1. Critical role of actin-associated proteins in smooth muscle contraction, cell proliferation, airway hyperresponsiveness and airway remodeling.

    PubMed

    Tang, Dale D

    2015-01-01

    Asthma is characterized by airway hyperresponsiveness and airway remodeling, which are largely attributed to increased airway smooth muscle contractility and cell proliferation. It is known that both chemical and mechanical stimulation regulates smooth muscle contraction. Recent studies suggest that contractile activation and mechanical stretch induce actin cytoskeletal remodeling in smooth muscle. However, the mechanisms that control actin cytoskeletal reorganization are not completely elucidated. This review summarizes our current understanding regarding how actin-associated proteins may regulate remodeling of the actin cytoskeleton in airway smooth muscle. In particular, there is accumulating evidence to suggest that Abelson tyrosine kinase (Abl) plays a critical role in regulating airway smooth muscle contraction and cell proliferation in vitro, and airway hyperresponsiveness and remodeling in vivo. These studies indicate that Abl may be a novel target for the development of new therapy to treat asthma. PMID:26517982

  2. Upregulation of decorin by FXR in vascular smooth muscle cells

    SciTech Connect

    He Fengtian; Zhang Qiuhong; Kuruba, Ramalinga; Gao Xiang; Li Jiang; Li Yong; Gong Wei; Jiang, Yu; Xie Wen; Li Song

    2008-08-08

    Decorin is a member of the family of small leucine-rich proteoglycans that are present in blood vessels and synthesized by vascular smooth muscle cells (VSMCs). Decorin plays complex roles in both normal vascular physiology and the pathogenesis of various types of vascular disorders. However, the mechanisms of regulation of decorin expression in vasculature are not clearly understood. Particularly little information is available about a role of nuclear receptors in the regulation of decorin expression. In the present study, we report that activation of vascular FXR by a specific ligand resulted in upregulation of decorin at the levels of both mRNA and protein. FXR appears to induce decorin expression at a transcriptional level because (1) upregulation of decorin mRNA expression was abolished by the treatment of a transcription inhibitor, actinomycin D; and (2) decorin promoter activity was significantly increased by activation of FXR. Functional analysis of human decorin promoter identified an imperfect inverted repeat DNA motif, IR8 (-2313TGGTCAtagtgtcaTGACCT-2294), as a likely FXR-responsive element that is involved in decorin regulation.

  3. A modified force-velocity equation for smooth muscle contraction.

    PubMed

    Wang, J; Jiang, H; Stephens, N L

    1994-01-01

    It has been suggested that in skeletal muscle the force-velocity relationship may not be a simple hyperbolic one, as defined by Hill's equation. To determine whether smooth muscle demonstrated the same properties, quick-release force-velocity curves were obtained from canine tracheal smooth muscle. The results showed that the observed data points for tracheal smooth muscle systematically deviated from a hyperbola. Such deviation occurred at values of force (P) approaching maximum isometric force (Po) for curves elicited by quick release at 2 and 10 s in the course of isometric contractions. Shortening velocities under a given afterload were overestimated at the high-force end (P > 75% Po) by Hill's equation; this implied that a relationship more complex than a simple hyperbola was involved at high loads. We next focused on finding an equation to also fit those directly measured data points that did not conform to a hyperbola. Our rationale in developing the equation was that a plot of the linearized transform of Hill's equation should yield a straight line over the entire range of loads at which velocities were measured. The plot demonstrated that, in the low-load high-velocity portion of the curve, a peak value was reached at 70-80% Po, which decreased as load increased in the high-load low-velocity portion.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:8175513

  4. Phenotypic and Functional Changes of Endothelial and Smooth Muscle Cells in Thoracic Aortic Aneurysms

    PubMed Central

    Malashicheva, Anna; Kostina, Daria; Kostina, Aleksandra; Irtyuga, Olga; Voronkina, Irina; Smagina, Larisa; Ignatieva, Elena; Gavriliuk, Natalia; Uspensky, Vladimir; Moiseeva, Olga; Vaage, Jarle; Kostareva, Anna

    2016-01-01

    Thoracic aortic aneurysm develops as a result of complex series of events that alter the cellular structure and the composition of the extracellular matrix of the aortic wall. The purpose of the present work was to study the cellular functions of endothelial and smooth muscle cells from the patients with aneurysms of the thoracic aorta. We studied endothelial and smooth muscle cells from aneurysms in patients with bicuspid aortic valve and with tricuspid aortic valve. The expression of key markers of endothelial (CD31, vWF, and VE-cadherin) and smooth muscle (SMA, SM22α, calponin, and vimentin) cells as well extracellular matrix and MMP activity was studied as well as and apoptosis and cell proliferation. Expression of functional markers of endothelial and smooth muscle cells was reduced in patient cells. Cellular proliferation, migration, and synthesis of extracellular matrix proteins are attenuated in the cells of the patients. We show for the first time that aortic endothelial cell phenotype is changed in the thoracic aortic aneurysms compared to normal aortic wall. In conclusion both endothelial and smooth muscle cells from aneurysms of the ascending aorta have downregulated specific cellular markers and altered functional properties, such as growth rate, apoptosis induction, and extracellular matrix synthesis. PMID:26904289

  5. Estradiol attenuates directed migration of vascular smooth muscle cells in vitro.

    PubMed Central

    Kolodgie, F. D.; Jacob, A.; Wilson, P. S.; Carlson, G. C.; Farb, A.; Verma, A.; Virmani, R.

    1996-01-01

    Although the cardiovascular benefits of the hormone estrogen are at least, in part, mediated by its antiproliferative effect on vascular smooth muscle, its action on the migration of these cells is unknown. To explore this relationship, female rat aortic smooth muscle cells were grown in hormone-free medium, and the effect of various concentrations of beta-estradiol on directed cellular migration was measured in vitro using a microwell Boyden chamber apparatus. Migration of smooth muscle cells to the known chemoattractants platelet-derived growth factor, insulin-like growth factor-1, and fibronectin (all at peak doses for migratory activity) was attenuated by beta-estradiol (0.5 to 10 ng/ml) in a concentration-dependent manner relative to control cells treated with vehicle (0.01% ethanol). This response was insensitive to pretreatment with indomethacin and was stereospecific (17 alpha-estradiol lacked response). Like beta-estradiol, the synthetic estrogen diethylstilbestrol attenuated directed smooth muscle cell migration whereas the male hormone testosterone was ineffective. Additional studies showed that beta-estradiol-mediated suppression of migration was inhibited by the anti-estrogen ICI 164,384 and the gene transcription inhibitor actinomycin D. These are the first results demonstrating a reduction in directed smooth muscle cell migration by beta-estradiol. The mechanism of this estrogen-mediated response appears to involve conventional estrogen receptors. PMID:8774151

  6. Inhibition of the Ca sup 2+ -ATPase of vascular smooth muscle sarcoplasmic reticulum by superoxide radicals

    SciTech Connect

    Suzuki, Yuichiro; Ford, G.D. )

    1991-03-15

    The effect of oxygen free radicals generated by hypoxanthine plus xanthine oxidase on the Ca{sup 2+}-ATPase of sarcoplasmic reticulum from bovine aortic smooth muscle were studied. Exogenous hypoxanthine plus xanthine oxidase produced an hypoxanthine concentration dependent inhibition of the Ca{sup 2+}-ATPase. The inhibition could be completely blocked by superoxide dismutase but not by either mannitol or deferoxamine. Direct addition of reagent hydrogen peroxide in the {mu}M range did not cause significant inhibition. These results suggest that superoxide is the primary damaging species. Additionally, 1.16 {plus minus} 0.17 mU/g wet wt of xanthine oxidase activity were detected in the post-nuclear supernatant of bovine aortic smooth muscle, suggesting the existence of a possible intracellular source of superoxide. This value was calculated to be approximately 5 mU/ml by using a usual value of vascular smooth muscle cellular volume. Thus the level of endogenous xanthine oxidase resident in vascular smooth muscle is comparable with the level of exogenous xanthine oxidase used in the present study. These findings suggest a potential role of xanthine oxidase-generated superoxide in free radical injury to vascular smooth muscle.

  7. Hypertrophy and hyperplasia of smooth muscle cells of small intramyocardial arteries in spontaneously hypertensive rats.

    PubMed

    Amann, K; Gharehbaghi, H; Stephen, S; Mall, G

    1995-01-01

    Hearts of stroke-prone spontaneously hypertensive rats (SHR) were investigated by means of stereology and were compared with those of normotensive. Wistar-Kyoto controls. At the age of 9 months, hypertensive rats showed cardiac hypertrophy, marked myocardial fibrosis, activation of nonvascular interstitium, focal myocytial degeneration, reduction of capillarization, and microarteriopathy of small intramyocardial arteries. Stereologically, a significant increase in the total left ventricular arterial wall volume (+180% versus controls) was found in SHR hearts. By using new stereological techniques, the orientator and the nucleator, we investigated whether this significant increase in total left ventricular arterial wall volume was due to hyperplasia of smooth muscle cells in addition to the process of vascular smooth muscle cell hypertrophy that is common in SHR. Additionally, the nuclear size and ratio of cell volume to nuclear volume were determined using another new stereological technique, the selector. The stereological data indicate a significant increase in mean cell and nuclear volumes as well as in the total number of left ventricular arterial smooth muscle cells of SHR. Additionally, the total length of intramyocardial arteries was also significantly increased in hypertensive rats. The volume and number of arterial smooth muscle cells per arterial length were significantly (P < .001 and P < .05, respectively) higher in SHR than in normotensive controls. Thus, we conclude that hypertrophy and hyperplasia of smooth muscle cells are involved in intramyocardial arterial growth processes in hypertensive heart remodeling.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:7843743

  8. Phenotypic and Functional Changes of Endothelial and Smooth Muscle Cells in Thoracic Aortic Aneurysms.

    PubMed

    Malashicheva, Anna; Kostina, Daria; Kostina, Aleksandra; Irtyuga, Olga; Voronkina, Irina; Smagina, Larisa; Ignatieva, Elena; Gavriliuk, Natalia; Uspensky, Vladimir; Moiseeva, Olga; Vaage, Jarle; Kostareva, Anna

    2016-01-01

    Thoracic aortic aneurysm develops as a result of complex series of events that alter the cellular structure and the composition of the extracellular matrix of the aortic wall. The purpose of the present work was to study the cellular functions of endothelial and smooth muscle cells from the patients with aneurysms of the thoracic aorta. We studied endothelial and smooth muscle cells from aneurysms in patients with bicuspid aortic valve and with tricuspid aortic valve. The expression of key markers of endothelial (CD31, vWF, and VE-cadherin) and smooth muscle (SMA, SM22α, calponin, and vimentin) cells as well extracellular matrix and MMP activity was studied as well as and apoptosis and cell proliferation. Expression of functional markers of endothelial and smooth muscle cells was reduced in patient cells. Cellular proliferation, migration, and synthesis of extracellular matrix proteins are attenuated in the cells of the patients. We show for the first time that aortic endothelial cell phenotype is changed in the thoracic aortic aneurysms compared to normal aortic wall. In conclusion both endothelial and smooth muscle cells from aneurysms of the ascending aorta have downregulated specific cellular markers and altered functional properties, such as growth rate, apoptosis induction, and extracellular matrix synthesis. PMID:26904289

  9. Soluble guanylyl cyclase-activated cyclic GMP-dependent protein kinase inhibits arterial smooth muscle cell migration independent of VASP-serine 239 phosphorylation.

    PubMed

    Holt, Andrew W; Martin, Danielle N; Shaver, Patti R; Adderley, Shaquria P; Stone, Joshua D; Joshi, Chintamani N; Francisco, Jake T; Lust, Robert M; Weidner, Douglas A; Shewchuk, Brian M; Tulis, David A

    2016-09-01

    Coronary artery disease (CAD) accounts for over half of all cardiovascular disease-related deaths. Uncontrolled arterial smooth muscle (ASM) cell migration is a major component of CAD pathogenesis and efforts aimed at attenuating its progression are clinically essential. Cyclic nucleotide signaling has long been studied for its growth-mitigating properties in the setting of CAD and other vascular disorders. Heme-containing soluble guanylyl cyclase (sGC) synthesizes cyclic guanosine monophosphate (cGMP) and maintains vascular homeostasis predominantly through cGMP-dependent protein kinase (PKG) signaling. Considering that reactive oxygen species (ROS) can interfere with appropriate sGC signaling by oxidizing the cyclase heme moiety and so are associated with several CVD pathologies, the current study was designed to test the hypothesis that heme-independent sGC activation by BAY 60-2770 (BAY60) maintains cGMP levels despite heme oxidation and inhibits ASM cell migration through phosphorylation of the PKG target and actin-binding vasodilator-stimulated phosphoprotein (VASP). First, using the heme oxidant ODQ, cGMP content was potentiated in the presence of BAY60. Using a rat model of arterial growth, BAY60 significantly reduced neointima formation and luminal narrowing compared to vehicle (VEH)-treated controls. In rat ASM cells BAY60 significantly attenuated cell migration, reduced G:F actin, and increased PKG activity and VASP Ser239 phosphorylation (pVASP·S239) compared to VEH controls. Site-directed mutagenesis was then used to generate overexpressing full-length wild type VASP (FL-VASP/WT), VASP Ser239 phosphorylation-mimetic (FL-VASP/239D) and VASP Ser239 phosphorylation-resistant (FL-VASP/239A) ASM cell mutants. Surprisingly, FL-VASP/239D negated the inhibitory effects of FL-VASP/WT and FL-VASP/239A cells on migration. Furthermore, when FL-VASP mutants were treated with BAY60, only the FL-VASP/239D group showed reduced migration compared to its VEH controls

  10. Cannabinoid CB{sub 1} receptor inhibition decreases vascular smooth muscle migration and proliferation

    SciTech Connect

    Rajesh, Mohanraj; Mukhopadhyay, Partha; Hasko, Gyoergy; Pacher, Pal

    2008-12-26

    Vascular smooth muscle proliferation and migration triggered by inflammatory stimuli and chemoattractants such as platelet-derived growth factor (PDGF) are key events in the development and progression of atherosclerosis and restenosis. Cannabinoids may modulate cell proliferation and migration in various cell types through cannabinoid receptors. Here we investigated the effects of CB{sub 1} receptor antagonist rimonabant (SR141716A), which has recently been shown to have anti-atherosclerotic effects both in mice and humans, on PDGF-induced proliferation, migration, and signal transduction of human coronary artery smooth muscle cells (HCASMCs). PDGF induced Ras and ERK 1/2 activation, while increasing proliferation and migration of HCASMCs, which were dose dependently attenuated by CB{sub 1} antagonist, rimonabant. These findings suggest that in addition to improving plasma lipid alterations and decreasing inflammatory cell migration and inflammatory response, CB{sub 1} antagonists may exert beneficial effects in atherosclerosis and restenosis by decreasing vascular smooth muscle proliferation and migration.

  11. Development of the smooth muscle foam cell: uptake of macrophage lipid inclusions.

    PubMed

    Wolfbauer, G; Glick, J M; Minor, L K; Rothblat, G H

    1986-10-01

    A possible mechanism for the formation of smooth muscle foam cells in the atherosclerotic lesion was explored. Cultured macrophages (J774 cell line) were induced to form cytoplasmic cholesteryl ester inclusions by exposure to acetylated low density lipoprotein in the presence of cholesterol-rich phospholipid dispersions. The macrophages were disrupted by brief sonication, and the inclusions were isolated by flotation. When these inclusions were placed in direct contact with cultured smooth muscle cells, cellular uptake of the inclusions in a time- and dose-dependent manner was observed. Light and electron microscopy indicated the presence of lipid inclusions throughout the cytoplasm of the cells. Uptake of inclusion lipid by the smooth muscle cells was inhibited by several metabolic inhibitors, indicating that the process is dependent on metabolic activity. A modest but significant hydrolysis of the cholesteryl ester was observed, showing that the stored cholesteryl esters are metabolically available. PMID:3020555

  12. Agonist-induced Ca2+ Sensitization in Smooth Muscle

    PubMed Central

    Artamonov, Mykhaylo V.; Momotani, Ko; Stevenson, Andra; Trentham, David R.; Derewenda, Urszula; Derewenda, Zygmunt S.; Read, Paul W.; Gutkind, J. Silvio; Somlyo, Avril V.

    2013-01-01

    Many agonists, acting through G-protein-coupled receptors and Gα subunits of the heterotrimeric G-proteins, induce contraction of smooth muscle through an increase of [Ca2+]i as well as activation of the RhoA/RhoA-activated kinase pathway that amplifies the contractile force, a phenomenon known as Ca2+ sensitization. Gα12/13 subunits are known to activate the regulator of G-protein signaling-like family of guanine nucleotide exchange factors (RhoGEFs), which includes PDZ-RhoGEF (PRG) and leukemia-associated RhoGEF (LARG). However, their contributions to Ca2+-sensitized force are not well understood. Using permeabilized blood vessels from PRG(−/−) mice and a new method to silence LARG in organ-cultured blood vessels, we show that both RhoGEFs are activated by the physiologically and pathophysiologically important thromboxane A2 and endothelin-1 receptors. The co-activation is the result of direct and independent activation of both RhoGEFs as well as their co-recruitment due to heterodimerization. The isolated recombinant C-terminal domain of PRG, which is responsible for heterodimerization with LARG, strongly inhibited Ca2+-sensitized force. We used photolysis of caged phenylephrine, caged guanosine 5′-O-(thiotriphosphate) (GTPγS) in solution, and caged GTPγS or caged GTP loaded on the RhoA·RhoGDI complex to show that the recruitment and activation of RhoGEFs is the cause of a significant time lag between the initial Ca2+ transient and phasic force components and the onset of Ca2+-sensitized force. PMID:24106280

  13. [Influence of nanosize particles of cobalt ferrite on contractile responses of smooth muscle segment of airways].

    PubMed

    Kapilevich, L V; Zaĭtseva, T N; Nosarev, A V; D'iakova, E Iu; Petlina, Z R; Ogorodova, L M; Ageev, B G; Magaeva, A A; Itin, V I; Terekhova, O G; Medvedev, M A

    2012-02-01

    Contractile responses of airways segments of porpoises inhaling nanopowder CoFe2O4 were stidued by means of a mechanographic method. Inhalation of the nanosize particles of CoFe2O4 in vivo and in vitro testing the nanomaterial on isolated smooth muscles led to potentiation histaminergic, cholinergic contractile activity in airways of porpoises and to strengthening of adrenergic relaxing answers. Nanosize particles vary amplitude of hyperpotassium reductions in smooth muscle segments of airways similarly to the effect of depolymerizing drug colchicine. PMID:22650066

  14. Ranolazine inhibits voltage-gated mechanosensitive sodium channels in human colon circular smooth muscle cells.

    PubMed

    Neshatian, Leila; Strege, Peter R; Rhee, Poong-Lyul; Kraichely, Robert E; Mazzone, Amelia; Bernard, Cheryl E; Cima, Robert R; Larson, David W; Dozois, Eric J; Kline, Crystal F; Mohler, Peter J; Beyder, Arthur; Farrugia, Gianrico

    2015-09-15

    Human jejunum smooth muscle cells (SMCs) and interstitial cells of Cajal (ICCs) express the SCN5A-encoded voltage-gated, mechanosensitive sodium channel NaV1.5. NaV1.5 contributes to small bowel excitability, and NaV1.5 inhibitor ranolazine produces constipation by an unknown mechanism. We aimed to determine the presence and molecular identity of Na(+) current in the human colon smooth muscle and to examine the effects of ranolazine on Na(+) current, mechanosensitivity, and smooth muscle contractility. Inward currents were recorded by whole cell voltage clamp from freshly dissociated human colon SMCs at rest and with shear stress. SCN5A mRNA and NaV1.5 protein were examined by RT-PCR and Western blots, respectively. Ascending human colon strip contractility was examined in a muscle bath preparation. SCN5A mRNA and NaV1.5 protein were identified in human colon circular muscle. Freshly dissociated human colon SMCs had Na(+) currents (-1.36 ± 0.36 pA/pF), shear stress increased Na(+) peaks by 17.8 ± 1.8% and accelerated the time to peak activation by 0.7 ± 0.3 ms. Ranolazine (50 μM) blocked peak Na(+) current by 43.2 ± 9.3% and inhibited shear sensitivity by 25.2 ± 3.2%. In human ascending colon strips, ranolazine decreased resting tension (31%), reduced the frequency of spontaneous events (68%), and decreased the response to smooth muscle electrical field stimulation (61%). In conclusion, SCN5A-encoded NaV1.5 is found in human colonic circular smooth muscle. Ranolazine blocks both peak amplitude and mechanosensitivity of Na(+) current in human colon SMCs and decreases contractility of human colon muscle strips. Our data provide a likely mechanistic explanation for constipation induced by ranolazine. PMID:26185330

  15. Human vascular smooth muscle cells express a urate transporter.

    PubMed

    Price, Karen L; Sautin, Yuri Y; Long, David A; Zhang, Li; Miyazaki, Hiroki; Mu, Wei; Endou, Hitoshi; Johnson, Richard J

    2006-07-01

    An elevated serum uric acid is associated with the development of hypertension and renal disease. Renal regulation of urate excretion is largely controlled by URAT1 (SLC22A12), a member of the organic anion transporter superfamily. This study reports the specific expression of URAT1 on human aortic vascular smooth muscle cells, as assessed by reverse transcription-PCR and Western blot analysis. Expression of URAT1 was localized to the cell membrane. Evidence that the URAT1 transporter was functional was provided by the finding that uptake of 14C-urate was significantly inhibited in the presence of probenecid, an organic anion transporter inhibitor. It is proposed that URAT1 may provide a mechanism by which uric acid enters the human vascular smooth muscle cell, a finding that may be relevant to the role of uric acid in cardiovascular disease. PMID:16775029

  16. Smooth muscle and skeletal muscle myosins produce similar unitary forces and displacements in the laser trap.

    PubMed Central

    Guilford, W H; Dupuis, D E; Kennedy, G; Wu, J; Patlak, J B; Warshaw, D M

    1997-01-01

    Purified smooth muscle myosin in the in vitro motility assay propels actin filaments at 1/10 the velocity, yet produces 3-4 times more force than skeletal muscle myosin. At the level of a single myosin molecule, these differences in force and actin filament velocity may be reflected in the size and duration of single motion and force-generating events, or in the kinetics of the cross-bridge cycle. Specifically, an increase in either unitary force or duty cycle may explain the enhanced force-generating capacity of smooth muscle myosin. Similarly, an increase in attached time or decrease in unitary displacement may explain the reduced actin filament velocity of smooth muscle myosin. To discriminate between these possibilities, we used a laser trap to measure unitary forces and displacements from single smooth and skeletal muscle myosin molecules. We analyzed our data using mean-variance analysis, which does not rely on scoring individual events by eye, and emphasizes periods in the data with constant properties. Both myosins demonstrated multiple but similar event populations with discrete peaks at approximately +11 and -11 nm in displacement, and 1.5 and 3.5 pN in force. Mean attached times for smooth muscle myosin were longer than for skeletal-muscle myosin. These results explain much of the difference in actin filament velocity between these myosins, and suggest that an increased duty cycle is responsible for the enhanced force-generating capacity of smooth over skeletal-muscle myosin. Images FIGURE 3 FIGURE 4 FIGURE 5 FIGURE 6 FIGURE 7 FIGURE 8 PMID:9138552

  17. Focal Ca2+ transient detection in smooth muscle.

    PubMed

    Young, John S; Amos, Robert J; Brain, Keith L

    2009-01-01

    Ca2+ imaging of smooth muscle provides insight into cellular mechanisms that may not result in changes of membrane potential, such as the release of Ca2+ from internal stores, and allows multiple cells to be monitored simultaneously to assess, for example, coupling in syncytial tissue. Subcellular Ca2+ transients are common in smooth muscle, yet are difficult to measure accurately because of the problems caused by their stochastic occurrence, over an often wide field of view, in an organ that it prone to contract. To overcome this problem, we've developed a series of imaging protocols and analysis routines to acquire and then analyse, in an automated fashion, the frequency, location and amplitude of such events. While this approach may be applied in other contexts, our own work involves the detection of local purinergic Ca2+ transients for locating transmitter release with submicron resolution. ATP is released as a cotransmitter from autonomic nerves, where it binds to P2X1 receptors on the smooth muscle of the detrusor and vas deferens. Ca2+ enters the smooth muscle, resulting in purinergic neuroeffector Ca2+ transients (NCTs). The focal Ca2+ transients allow the optical monitoring of neurotransmitter release in a manner that has many advantages over electrophysiology. Apart from the greatly improved spatial resolution, optical recording has the additional advantage of allowing the recording of transmitter release from many distinguishable sites simultaneously. Furthermore, the optical plane of focus is easier to maintain or correct during long recording series than is the repositioning of an intracellular sharp microelectrode. In summary, a method for imaging of Ca2+ fluorescence is outlined which details the preparation of tissue, and the acquisition and analysis of data. We outline the use of several scripts for the analysis of such Ca2+ transients. PMID:19564842

  18. Myosin light chain phosphorylation in contraction of gastric antral smooth muscle from neonate and adult rabbits.

    PubMed

    Ierardi, J A; Paul, D A; Ryan, J P

    1996-01-01

    The decreased contractility of gastric antral smooth muscle in the neonate has been attributed to reduced levels of activator calcium. It is generally accepted that calcium-dependent myosin light chain phosphorylation (MLCP) is the key step in the initiation of force development in smooth muscle. In this study, we investigated the relationship between MLCP and force development in gastric antral smooth muscle from neonatal (4-6 d old) and adult rabbits. We tested the hypothesis that the reduced force development of circular smooth muscle from the neonate would be accompanied by decreased levels of MLCP, as compared with data from adult animals. Full thickness muscle strips oriented parallel to the circular muscle layer were examined for their contractile response to acetylcholine (ACh) (10(-8) M to 10(-3) M) or 10(-4) M ACh only. In the latter study, tissues were rapidly frozen in a dry ice-acetone slurry for subsequent MLCP determination. MLCP was determined at times corresponding to 5, 10, 15, 30, and 60 s of stimulation. For each age group, maximal active force developed at an ACh concentration of 10(-4) M and was significantly greater in tissues from adults (1.86 +/- 0.24 N/m2, adult; 0.95 +/- 0.05 N/m2, neonate; p < 0.05). In contrast, no significant differences were observed with respect to basal or agonist-stimulated levels of MLCP. The data suggest that factors other than levels of MLCP contribute to the reduced force-generating capacity of antral smooth muscle from the neonate. PMID:8825402

  19. Transdifferentiation of human endothelial progenitors into smooth muscle cells.

    PubMed

    Ji, HaYeun; Atchison, Leigh; Chen, Zaozao; Chakraborty, Syandan; Jung, Youngmee; Truskey, George A; Christoforou, Nicolas; Leong, Kam W

    2016-04-01

    Access to smooth muscle cells (SMC) would create opportunities for tissue engineering, drug testing, and disease modeling. Herein we report the direct conversion of human endothelial progenitor cells (EPC) to induced smooth muscle cells (iSMC) by induced expression of MYOCD. The EPC undergo a cytoskeletal rearrangement resembling that of mesenchymal cells within 3 days post initiation of MYOCD expression. By day 7, the reprogrammed cells show upregulation of smooth muscle markers ACTA2, MYH11, and TAGLN by qRT-PCR and ACTA2 and MYH11 expression by immunofluorescence. By two weeks, they resemble umbilical artery SMC in microarray gene expression analysis. The iSMC, in contrast to EPC control, show calcium transients in response to phenylephrine stimulation and a contractility an order of magnitude higher than that of EPC as determined by traction force microscopy. Tissue-engineered blood vessels constructed using iSMC show functionality with respect to flow- and drug-mediated vasodilation and vasoconstriction. PMID:26874281

  20. Smooth muscle titin forms in vitro amyloid aggregates.

    PubMed

    Bobylev, Alexandr G; Galzitskaya, Oxana V; Fadeev, Roman S; Bobyleva, Liya G; Yurshenas, Darya A; Molochkov, Nikolay V; Dovidchenko, Nikita V; Selivanova, Olga M; Penkov, Nikita V; Podlubnaya, Zoya A; Vikhlyantsev, Ivan M

    2016-07-01

    Amyloids are insoluble fibrous protein aggregates, and their accumulation is associated with amyloidosis and many neurodegenerative diseases, including Alzheimer's disease. In the present study, we report that smooth muscle titin (SMT; 500 kDa) from chicken gizzard forms amyloid aggregates in vitro This conclusion is supported by EM data, fluorescence analysis using thioflavin T (ThT), Congo red (CR) spectroscopy and X-ray diffraction. Our dynamic light scattering (DLS) data show that titin forms in vitro amyloid aggregates with a hydrodynamic radius (Rh) of approximately 700-4500 nm. The initial titin aggregates with Rh approximately 700 nm were observed beyond first 20 min its aggregation that shows a high rate of amyloid formation by this protein. We also showed using confocal microscopy the cytotoxic effect of SMT amyloid aggregates on smooth muscle cells from bovine aorta. This effect involves the disorganization of the actin cytoskeleton and result is cell damage. Cumulatively, our results indicate that titin may be involved in generation of amyloidosis in smooth muscles. PMID:27129292

  1. Ultrastructural Changes of the Smooth Muscle in Esophageal Atresia.

    PubMed

    Al-Shraim, Mubarak M; Eid, Refaat A; Musalam, Adel Osman; Radad, Khaled; Ibrahim, Ashraf H M; Malki, Talal A

    2015-01-01

    Esophageal atresia (EA) with or without tracheo-esophageal fistula (TEF) is a relatively rare congenital anomaly. Despite the advances in the management techniques and neonatal intensive care, esophageal dysmotility remains a very common problem following EA/TEF repair. Our current study aimed to describe the most significant ultrastructural changes of the smooth muscle cells (SMCs) trying to highlight some of the underlying mechanisms of esophageal dysmotility following EA/TEF repair. Twenty-three biopsies were obtained from the tip of the lower esophageal pouch (LEP) of 23 patients during primary repair of EA/TEF. Light microscopic examination was performed with hematoxylin and eosin (HE), and Van Gieson's stains. Ultrastructural examination was done using transmission electron microscopy (TEM). Histopathological examination showed distortion of smooth muscle layer and deposition of an abundant amount of fibrous tissue in-between smooth muscles. Using TEM, SMCs exhibited loss of the cell-to-cell adhesion, mitochondrial vacuolation, formation of myelin figures, and apoptotic fragmentation. There were also plasmalemmal projections and formation of ghost bodies. Interestingly, SMCs were found extending pseudopodia-like projections around adjacent collagen fibers. Engulfed collagen fibers by SMCs underwent degradation within autophagic vacuoles. Degeneration of SMCs and deposition of abundant extracellular collagen fibers are prominent pathological changes in LEP of EA/TEF. These changes might contribute to the pathogenesis of esophageal dysmotility in patients who have survived EA/TEF. PMID:26548437

  2. Contribution of intestinal smooth muscle to Crohn's disease fibrogenesis.

    PubMed

    Severi, C; Sferra, R; Scirocco, A; Vetuschi, A; Pallotta, N; Pronio, A; Caronna, R; Di Rocco, G; Gaudio, E; Corazziari, E; Onori, P

    2014-01-01

    Mesenchymal cells transdifferentiation and extracellular matrix deposition are involved in the fibrotic process of Crohn's disease (CD). Mesenchymal smooth muscle cells (SMCs) de-differentiation, driven by Platelet-derived growth factor (PDGF) that counteracts Transforming growth factor (TGF-β) has been studied in vascular muscle. The role of SMCs in intestinal fibrogenesis is still not clearly elucidated. Aim of the study was to evaluate the possible myogenic contribution to CD fibrotic process through the comparative analysis of histological, morphometric and molecular alterations occurring in human smooth muscle. Full thickness specimens were obtained from CD (non-involved and stenotic tracts) and healthy (control) ileum. Tissues were processed for histological and immunohistochemical (IHC) analyses and SMCs were isolated from the muscularis propria for morphofunctional and molecular (qPCR) analyses. CD stenotic ileum showed a significant increased thickness of all layers compared to CD non-involved and control ileum. IHC revealed an overexpression of α-smooth muscle actin and collagens I-III throughout all intestinal layers only in stenotic tracts. The two growth factors, PDGF and TGF-β, showed a progressive increase in expression in the muscle layer from CD non-involved to stenotic tracts. Freshly isolated SMCs presented alterations in CD non-involved tracts that progressively increased in the stenotic tracts consisting in a statistical increase in mRNA encoding for PDGF-β and collagen III, paralleled to a decrease in TGF-β and Tribbles-like protein-3 mRNA, and altered morphofunctional parameters consisting in progressive decreases in cell length and contraction to acetylcholine. These findings indicate that intrinsic myogenic alterations occur in CD ileum, that they likely precede stricture formation, and might represent suitable new targets for anti-fibrotic interventions. PMID:25578979

  3. Mechanisms of BDNF regulation in asthmatic airway smooth muscle.

    PubMed

    Aravamudan, Bharathi; Thompson, Michael A; Pabelick, Christina M; Prakash, Y S

    2016-08-01

    Brain-derived neurotrophic factor (BDNF), a neurotrophin produced by airway smooth muscle (ASM), enhances inflammation effects on airway contractility, supporting the idea that locally produced growth factors influence airway diseases such as asthma. We endeavored to dissect intrinsic mechanisms regulating endogenous, as well as inflammation (TNF-α)-induced BDNF secretion in ASM of nonasthmatic vs. asthmatic humans. We focused on specific Ca(2+) regulation- and inflammation-related signaling cascades and quantified BDNF secretion. We find that TNF-α enhances BDNF release by ASM cells, via several mechanisms relevant to asthma, including transient receptor potential channels TRPC3 and TRPC6 (but not TRPC1), ERK 1/2, PI3K, PLC, and PKC cascades, Rho kinase, and transcription factors cAMP response element binding protein and nuclear factor of activated T cells. Basal BDNF expression and secretion are elevated in asthmatic ASM and increase further with TNF-α exposure, involving many of these regulatory mechanisms. We conclude that airway BDNF secretion is regulated at multiple levels, providing a basis for autocrine effects of BDNF under conditions of inflammation and disease, with potential downstream influences on contractility and remodeling. PMID:27317689

  4. Contraction of gut smooth muscle cells assessed by fluorescence imaging.

    PubMed

    Tokita, Yohei; Akiho, Hirotada; Nakamura, Kazuhiko; Ihara, Eikichi; Yamamoto, Masahiro

    2015-03-01

    Here we discuss the development of a novel cell imaging system for the evaluation of smooth muscle cell (SMC) contraction. SMCs were isolated from the circular and longitudinal muscular layers of mouse small intestine by enzymatic digestion. SMCs were stimulated by test agents, thereafter fixed in acrolein. Actin in fixed SMCs was stained with phalloidin and cell length was determined by measuring diameter at the large end of phalloidin-stained strings within the cells. The contractile response was taken as the decrease in the average length of a population of stimulated-SMCs. Various mediators and chemically identified compounds of daikenchuto (DKT), pharmaceutical-grade traditional Japanese prokinetics, were examined. Verification of the integrity of SMC morphology by phalloidin and DAPI staining and semi-automatic measurement of cell length using an imaging analyzer was a reliable method by which to quantify the contractile response. Serotonin, substance P, prostaglandin E2 and histamine induced SMC contraction in concentration-dependent manner. Two components of DKT, hydroxy-α-sanshool and hydroxy-β-sanshool, induced contraction of SMCs. We established a novel cell imaging technique to evaluate SMC contractility. This method may facilitate investigation into SMC activity and its role in gastrointestinal motility, and may assist in the discovery of new prokinetic agents. PMID:25837933

  5. Smooth Muscle Cell-targeted RNA Aptamer Inhibits Neointimal Formation.

    PubMed

    Thiel, William H; Esposito, Carla L; Dickey, David D; Dassie, Justin P; Long, Matthew E; Adam, Joshua; Streeter, Jennifer; Schickling, Brandon; Takapoo, Maysam; Flenker, Katie S; Klesney-Tait, Julia; Franciscis, Vittorio de; Miller, Francis J; Giangrande, Paloma H

    2016-04-01

    Inhibition of vascular smooth muscle cell (VSMC) proliferation by drug eluting stents has markedly reduced intimal hyperplasia and subsequent in-stent restenosis. However, the effects of antiproliferative drugs on endothelial cells (EC) contribute to delayed re-endothelialization and late stent thrombosis. Cell-targeted therapies to inhibit VSMC remodeling while maintaining EC health are necessary to allow vascular healing while preventing restenosis. We describe an RNA aptamer (Apt 14) that functions as a smart drug by preferentially targeting VSMCs as compared to ECs and other myocytes. Furthermore, Apt 14 inhibits phosphatidylinositol 3-kinase/protein kinase-B (PI3K/Akt) and VSMC migration in response to multiple agonists by a mechanism that involves inhibition of platelet-derived growth factor receptor (PDGFR)-β phosphorylation. In a murine model of carotid injury, treatment of vessels with Apt 14 reduces neointimal formation to levels similar to those observed with paclitaxel. Importantly, we confirm that Apt 14 cross-reacts with rodent and human VSMCs, exhibits a half-life of ~300 hours in human serum, and does not elicit immune activation of human peripheral blood mononuclear cells. We describe a VSMC-targeted RNA aptamer that blocks cell migration and inhibits intimal formation. These findings provide the foundation for the translation of cell-targeted RNA therapeutics to vascular disease. PMID:26732878

  6. Identification of possible adenosine receptors in vascular smooth muscle

    SciTech Connect

    Doctrow, S.R.

    1985-01-01

    Adenosine is a vasodilator and has been implicated in increased blood flow in tissues that undergo energy deficiency. During conditions such as hypoxia and ischemia, adenosine is produced and is said to increase blood flow by relaxing the vascular smooth muscle (VSM) lining the resistance vessels. The goal of this research was to identify receptors that might be responsible for adenosine-mediated VSM relaxation. When an insoluble fraction from calf aortic VSM was incubated with /sup 32/P-ATP, two components were phosphorylated. One was identified as myosin light chain by MW, pl, and immunoprecipitation. The other product was identified as phosphatidylinositol-4-phosphate (DPI) by tic. Both phosphorylations were inhibited by adenosine and by 5'-chloro-5'-deoxyadenosine (Cl-Ado). DPI production was much more sensitive to the nucleosides than was myosin phosphorylation. Neither inhibition involved change in cAMP production. Phosphatidylinositol (Pl) kinase in the VSM membranes required magnesium, was activated and solubilized by Triton X-100, and phosphorylated both endogenous and exogenous Pl. Cl-Ado inhibited Pl kinase in a manner competitive with respect to ATP and noncompetitive with respect to Pl. Adenosine and adenosine analogs modified in the ribose ring were inhibitors with potencies comparable to that of Cl-Ado. Adenine nucleotides and purine-modified adenosine analogs were weaker inhibitors than Cl-Ado.

  7. PDT-induced apoptosis in arterial smooth muscles cells

    NASA Astrophysics Data System (ADS)

    Nyamekye, Isaac; Renick, R.; Gilbert, C.; McEwan, Jean R.; Evan, G.; Bishop, Christopher C. R.; Bown, Stephen G.

    1995-03-01

    PDT kills smooth muscle cells (SMC) in vivo and thus prevents intimal hyperplasia after angioplasty. It causes little inflammation and structural integrity of the artery is not compromised. We have studied the process of the SMC death in vitro. Cultured rat SMC (cell line sv40 ATCC) were sensitized with aluminum disulphonated phthalocyanine (AlS2Pc), and then irradiated with 675 nm laser light (2.5 J/cm2). Controls were studied using only sensitizer or laser for treatment. The cells were incubated and the dying process observed with a time lapse video and microscope system. PDT caused a characteristic pattern of death. Cells lost contact with neighbors, shrank, and showed hyperactivity and membrane ruffling. The cells imploded into active and condensed membrane bound vesicles which were terminally reduced to residual bodies. These are the morphological changes of apoptosis. The control cells which were given AlS2Pc alone or laser alone showed no death. PDT induced cultured arterial SMC death by apoptosis rather than necrosis. An apoptotic mechanism of cell death in vivo would explain the relative lack of inflammation and local tissue destruction in the face of massive death.

  8. A novel transgenic marker for migrating limb muscle precursors and for vascular smooth muscle cells.

    PubMed

    Tidhar, A; Reichenstein, M; Cohen, D; Faerman, A; Copeland, N G; Gilbert, D J; Jenkins, N A; Shani, M

    2001-01-01

    A unique pattern of LacZ expression was found in a transgenic mouse line, likely due to regulatory elements at the site of integration. Two new genes flanking the transgene were identified. At early stages of development, the transgene is transiently expressed in ventro-lateral demomyotomal cells migrating from the somites into the limb buds. At late developmental stages and in the adult, lacZ staining marks vascular smooth muscle cells throughout the vascular bed, with the exception of the major elastic arteries, and in pericytes. No expression was detected in skeletal and smooth muscles. Different patterns of expression in vascular smooth muscles was observed at distinct levels of the vascular tree, in arteries as well as in veins. Vessel injury, resulting in stimulation of smooth muscle cells proliferation and migration, is associated with transgene down-regulation. After the formation of neointima thickening, it is reactivated. This transgenic insertion may therefore be used as a useful marker to identify novel physiological cues or genetic elements involved in the regulation of the vascular smooth muscle phenotype(s). It may also provide an experimental tool for studying vasculature and the involvement of pericytes in regulating microvascular homeostasis. PMID:11146508

  9. Large conducting potassium channel reconstituted from airway smooth muscle.

    PubMed

    Savaria, D; Lanoue, C; Cadieux, A; Rousseau, E

    1992-03-01

    Microsomal fractions were prepared from canine and bovine airway smooth muscle (ASM) by differential and gradient centrifugations. Surface membrane vesicles were characterized by binding assays and incorporated into planar lipid bilayers. Single-channel activities were recorded in symmetric or asymmetric K+ buffer systems and studied under voltage and Ca2+ clamp conditions. A large-conductance K(+)-selective channel (greater than 220 pS in 150 mM K+) displaying a high Ca2+, low Ba2+, and charybdotoxin (CTX) sensitivity was identified. Time analysis of single-channel recordings revealed a complex kinetic behavior compatible with the previous schemes proposed for Ca(2+)-activated K+ channels in a variety of biological surface membranes. We now report that the open probability of the channel at low Ca2+ concentration is enhanced on in vitro phosphorylation, which is mediated via an adenosine 3',5'-cyclic monophosphate-dependent protein kinase. In addition to this characterization at the molecular level, a second series of pharmacological experiments were designed to assess the putative role of this channel in ASM strips. Our results show that 50 nM CTX, a specific inhibitor of the large conducting Ca(2+)-dependent K+ channel, prevents norepinephrine transient relaxation on carbamylcholine-precontracted ASM strips. It was also shown that CTX reversed the steady-state relaxation induced by vasoactive intestinal peptide and partially antagonized further relaxation induced by cumulative doses of this potent bronchodilatator. Thus it is proposed that the Ca(2+)-activated K+ channels have a physiological role because they are indirectly activated on stimulation of various membrane receptors via intracellular mechanisms. PMID:1372487

  10. Hydrogen peroxide induced responses of cat tracheal smooth muscle cells

    PubMed Central

    Bauer, V; Oike, M; Tanaka, H; Inoue, R; Ito, Y

    1997-01-01

    The effects of hydrogen peroxide H2O2 (10−6 and 10−3 M) on membrane potential, membrane currents, intracellular calcium concentration, resting muscle tone and contractions elicited by electrical field stimulation (EFS) and carbachol were examined in cat tracheal strips and isolated smooth muscle cells. H2O2 (10−4 and 10−5 M) enhanced the amplitude of contractions and excitatory junction potentials (e.j.p.) evoked by EFS without changing muscle tone and resting membrane potential of the tracheal smooth muscle, and enhanced the contraction induced by carbachol (10−8 M). At an increased concentration (10−3 M), H2O2 elevated resting muscle tone and marginally hyperpolarized the membrane in the majority of the cells. In 51 out of 56 cells examined, H2O2 (10−6–10−3 M) elicited an outward current at a holding potential of −40 mV and enhanced the frequency of the spontaneous transient outward current (STOC). In 20 cells the outward current was preceded by a small inward current. In the other cells, H2O2 elicited only an inward current or did not affect the background current. In Ca2+ free solution the action of H2O2 on the resting muscle tone, STOCs, background current and on the current induced by ramp depolarization was significantly reduced. H2O2 (10−4 M) increased the intracellular ionized calcium concentration both in the absence and presence of external Ca2+. However, the effect developed faster and was of a higher amplitude in the presence of external Ca2+. These results suggest that H2O2 increases intracellular Ca2+, with a subsequent augmentation of stimulation-evoked contractions, and enhances Ca2+ and voltage-sensitive potassium conductance. PMID:9222542

  11. Long-Term Expression of Human Adenosine Deaminase in Vascular Smooth Muscle Cells of Rats: A Model for Gene Therapy

    NASA Astrophysics Data System (ADS)

    Lynch, Carmel M.; Clowes, Monika M.; Osborne, William R. A.; Clowes, Alexander W.; Dusty Miller, A.

    1992-02-01

    Gene transfer into vascular smooth muscle cells in animals was examined by using recombinant retroviral vectors containing an Escherichia coli β-galactosidase gene or a human adenosine deaminase (adenosine aminohydrolase, EC 3.5.4.4) gene. Direct gene transfer by infusion of virus into rat carotid arteries was not observed. However, gene transfer by infection of smooth muscle cells in culture and seeding of the transduced cells onto arteries that had been denuded of endothelial cells was successful. Potentially therapeutic levels of human adenosine deaminase activity were detected over 6 months of observation, indicating the utility of vascular smooth muscle cells for gene therapy in humans.

  12. Adaptive response of pulmonary arterial smooth muscle to length change.

    PubMed

    Syyong, Harley; Cheung, Christine; Solomon, Dennis; Seow, Chun Y; Kuo, Kuo H

    2008-04-01

    Hypervasoconstriction is associated with pulmonary hypertension and dysfunction of the pulmonary arterial smooth muscle (PASM) is implicated. However, relatively little is known about the mechanical properties of PASM. Recent advances in our understanding of plastic adaptation in smooth muscle may shed light on the disease mechanism. In this study, we determined whether PASM is capable of adapting to length changes (especially shortening) and regain its contractile force. We examined the time course of length adaptation in PASM in response to step changes in length and to length oscillations mimicking the periodic stretches due to pulsatile arterial pressure. Rings from sheep pulmonary artery were mounted on myograph and stimulated using electrical field stimulation (12-16 s, 20 V, 60 Hz). The length-force relationship was determined at L(ref) to 0.6 L(ref), where L(ref) was a reference length close to the in situ length of PASM. The response to length oscillations was determined at L(ref), after the muscle was subjected to length oscillation of various amplitudes for 200 s at 1.5 Hz. Release (or stretch) of resting PASM from L(ref) to 0.6 (and vice versa) was followed by a significant force recovery (73 and 63%, respectively), characteristic of length adaptation. All recoveries of force followed a monoexponential time course. Length oscillations with amplitudes ranging from 5 to 20% L(ref) caused no significant change in force generation in subsequent contractions. It is concluded that, like many smooth muscles, PASM possesses substantial capability to adapt to changes in length. Under pathological conditions, this could contribute to hypervasoconstriction in pulmonary hypertension. PMID:18218913

  13. Angiogenesis is induced by airway smooth muscle strain.

    PubMed

    Hasaneen, Nadia A; Zucker, Stanley; Lin, Richard Z; Vaday, Gayle G; Panettieri, Reynold A; Foda, Hussein D

    2007-10-01

    Angiogenesis is an important feature of airway remodeling in both chronic asthma and chronic obstructive pulmonary disease (COPD). Airways in those conditions are exposed to excessive mechanical strain during periods of acute exacerbations. We recently reported that mechanical strain of human airway smooth muscle (HASM) led to an increase in their proliferation and migration. Sustained growth in airway smooth muscle in vivo requires an increase in the nutritional supply to these muscles, hence angiogenesis. In this study, we examined the hypothesis that cyclic mechanical strain of HASM produces factors promoting angiogenic events in the surrounding vascular endothelial cells. Our results show: 1) a significant increase in human lung microvascular endothelial cell (HMVEC-L) proliferation, migration, and tube formation following incubation in conditioned media (CM) from HASM cells exposed to mechanical strain; 2) mechanical strain of HASM cells induced VEGF expression and release; 3) VEGF neutralizing antibodies inhibited the proliferation, migration, and tube formations of HMVEC-L induced by the strained airway smooth muscle CM; 4) mechanical strain of HASM induced a significant increase in hypoxia-inducible factor-1alpha (HIF-1alpha) mRNA and protein, a transcription factor required for VEGF gene transcription; and 5) mechanical strain of HASM induced HIF-1alpha/VEGF through dual phosphatidylinositol 3-kinase (PI3K)/Akt/mammalian target of rapamycin (mTOR) and ERK pathways. In conclusion, exposing HASM cells to mechanical strain induces signal transduction pathway through PI3K/Akt/mTOR and ERK pathways that lead to an increase in HIF-1alpha, a transcription factor required for VEGF expression. VEGF release by mechanical strain of HASM may contribute to the angiogenesis seen with repeated exacerbation of asthma and COPD. PMID:17693481

  14. PGF2α-associated vascular smooth muscle hypertrophy is ROS dependent and involves the activation of mTOR, p70S6k, and PTEN

    PubMed Central

    Rice, K. M.; Uddemarri, S.; Desai, D. H.; Morrison, R.G.; Harris, R.; Wright, G.L.; Blough, E.R.

    2008-01-01

    Prostaglandin F2α (PGF2α) increases reactive oxygen species (ROS) and induces vascular smooth muscle cell (VSMC) hypertrophy by largely unknown mechanism(s). To investigate the signaling events governing PGF2α –induced VSMC hypertrophy we examined the ability of the PGF2α analog, fluprostenol to elicit phosphorylation of Akt, the mammalian target of rapamycin (mTOR), ribosomal protein S6 kinase (p70S6k), glycogen synthase kinase-3β (GSK-3β), phosphatase and tensin homolog (PTEN), extracellular signal-regulated kinase 1/2 (ERK1/2) and Jun N-terminal kinase (JNK) in growth arrested A7r5 VSMC. Fluprostenol-induced hypertrophy was associated with increased ROS, mTOR translocation from the nucleus to the cytoplasm, along with Akt, mTOR, GSK-3β, PTEN and ERK1/2 but not JNK phosphorylation. Whereas inhibition of phosphatidylinositol 3-kinase (PI3K) by LY294002 blocked fluprostenol-induced changes in total protein content, pretreatment with rapamycin or with the ERK1/2-MAPK inhibitor UO126 did not. Taken together, these findings suggest that fluprostenol-induced changes in A7R5 hypertrophy involve mTOR translocation and occur through PI3K-dependent mechanisms. PMID:18160324

  15. Pharmacological modulation of sarcoplasmic reticulum function in smooth muscle.

    PubMed

    Laporte, Régent; Hui, Adrian; Laher, Ismail

    2004-12-01

    The sarco/endoplasmic reticulum (SR/ER) is the primary storage and release site of intracellular calcium (Ca2+) in many excitable cells. The SR is a tubular network, which in smooth muscle (SM) cells distributes close to cellular periphery (superficial SR) and in deeper aspects of the cell (deep SR). Recent attention has focused on the regulation of cell function by the superficial SR, which can act as a buffer and also as a regulator of membrane channels and transporters. Ca2+ is released from the SR via two types of ionic channels [ryanodine- and inositol 1,4,5-trisphosphate-gated], whereas accumulation from thecytoplasm occurs exclusively by an energy-dependent sarco-endoplasmic reticulum Ca2+-ATPase pump (SERCA). Within the SR, Ca2+ is bound to various storage proteins. Emerging evidence also suggests that the perinuclear portion of the SR may play an important role in nuclear transcription. In this review, we detail the pharmacology of agents that alter the functions of Ca2+ release channels and of SERCA. We describe their use and selectivity and indicate the concentrations used in investigating various SM preparations. Important aspects of cell regulation and excitation-contractile activity coupling in SM have been uncovered through the use of such activators and inhibitors of processes that determine SR function. Likewise, they were instrumental in the recent finding of an interaction of the SR with other cellular organelles such as mitochondria. Thus, an appreciation of the pharmacology and selectivity of agents that interfere with SR function in SM has greatly assisted in unveiling the multifaceted nature of the SR. PMID:15602008

  16. Epithelial modulation of preterm airway smooth muscle contraction.

    PubMed

    Panitch, H B; Wolfson, M R; Shaffer, T H

    1993-03-01

    To determine if epithelium from immature airways can modulate the responsiveness of smooth muscle, we studied paired trachealis muscle strips from preterm sheep. The epithelium was removed from one strip and left undisturbed in the other. Concentration-effect (CE) curves to acetylcholine (ACh), KCl, and isoproterenol were obtained. To evaluate maturational effects, responses to ACh and isoproterenol were studied in trachealis strips from adult airways. Maximal stress (Po) to ACh increased after epithelium removal in preterm (P < 0.05) but not adult strips. Epithelium removal caused a leftward shift of the ACh CE curves in both preterm and adult strips (P < 0.001) and a decrease in the dose required to achieve a one-half maximal response (ED50) in both preterm (P < 0.005) and adult strips (P < 0.05). The magnitude of the change in Po as well as in the ED50 for ACh between preterms and adults was similar. Epithelium removal did not alter either the Po or the CE curves of preterm strips stimulated by KCl. Response to isoproterenol in precontracted strips was enhanced in the presence of an intact epithelium in both groups (P < 0.05). These data demonstrate that preterm airway epithelium is able to modulate the responsiveness of smooth muscle. Additionally, the magnitude of the effect is unchanged with maturation. We speculate that damage of airway epithelium from mechanical ventilation may contribute to the increased incidence of airway hyperreactivity observed in preterm infants. PMID:8482688

  17. Effects of Gingko biloba extract (EGb 761) on vascular smooth muscle cell calcification induced by β-glycerophosphate.

    PubMed

    Li, En-Gang; Tian, Jun; Xu, Zhong-Hua

    2016-05-01

    Objective To investigate the effects of Gingko biloba extract (EGb 761) on calcification induced by β-glycerophosphate in rat aortic vascular smooth muscle cells. Methods Rat aortic vascular smooth muscle cells were cultured with various concentrations of EGb 761 and β-glycerophosphate for 7 days. Calcium content in the cells, alkaline phosphatase activity, cell protein content, NF-κB activation, and reactive oxygen species production were assayed, respectively. Results The calcium depositions of vascular smooth muscle cells of the β-glycerophosphate group were significantly higher than those of the control group (p < 0.01), and were inhibited by EGb 761 in a concentration-dependent manner (p < 0.05). Data showed β-glycerophosphate induced the enhanced expression of alkaline phosphatase, up-regulated the NF-κB activity and increased reactive oxygen species production of vascular smooth muscle cells while these decreased when administrated with EGb 761(p < 0.05). Conclusions EGb 761 significantly reduced deposition of calcium induced by β-glycerophosphate in rat aortic vascular smooth muscle cells. It not only reduced the deposition of calcium, but also inhibited osteogenic transdifferentiation, which may be associated with decreasing expression of alkaline phosphatase, down-regulating the NF-κB activity, and reducing reactive oxygen species production of vascular smooth muscle cells, and may have the potential to serve as a role for vascular calcification in clinical situations. PMID:26908182

  18. Interaction of Vascular Smooth Muscle Cells Under Low Shear Stress

    NASA Technical Reports Server (NTRS)

    Seidel, Charles L.

    1998-01-01

    The blood vessel wall consists of three cellular layers, an outer adventitial, a middle medial and an inner intimal layer. When the blood vessel forms in the embryo it begins as a tube composed of a single cell type called endothelial cells. Over time, other cells are recruited from the surrounding tissue to form additional layers on the outer surface of the endothelial tube. The cells that are recruited are called mesenchymal cells. Mesenchymal cells are responsible for the production of connective tissue that holds the blood vessel together and for developing into vascular smooth muscle cells that are responsible for regulating the diameter of the vessel (1) and therefore, blood flow. In a fully developed blood vessel, the endothelial cells make- up the majority of cells in the intimal layer while the mesenchymal cells make-up the majority of cells in the medial and adventitial layers. Within the medial layer of a mature vessel, cells are organized into multiple circular layers of alternating bands of connective tissue and cells. The cell layer is composed of a mixture of mesenchymal cells that have not developed into smooth muscle cells and fully developed smooth muscle cells (2). The assembly and organization of complex tissues is directed in part by a signaling system composed of proteins on the cell surface called adhesion molecules. Adhesion molecules enable cells to recognize each other as well as the composition of the connective tissue in which they reside (3). It was hypothesized that the different cell types that compose the vascular wall possess different adhesion molecules that enable them to recognize each other and through this recognition system, form the complex layered organization of the vascular wall. In other words, the layered organization is an intrinsic property of the cells. If this hypothesis is correct then the different cells that make up the vessel wall, when mixed together, should organize themselves into a layered structure

  19. Has cervical smooth muscle any physiological role in the human?

    PubMed

    Bryman, I; Norström, A; Lindblom, B

    1985-01-01

    Strips of human cervical tissue were obtained by needle biopsy and contractile activity was registered isometrically in a tissue chamber perfused by Krebs-Ringer bicarbonate buffer. The most frequently encountered pattern of contractile activity was high frequency-short duration. Prostaglandin (PG)E2, PGI2 and 6-keto-PGF1 alpha had an inhibitory effect on the muscular activity. Cervical muscle from pregnant women was more sensitive to PGE2 than specimens from non-pregnant women. PGF2 alpha had no apparent effect on cervical contractility in non-pregnant and early pregnant patients. In late pregnancy, however, PGF2 alpha inhibited muscle contractions. The present results point to a physiological role of the cervical muscles for the control of cervical competence during pregnancy. The inhibitory effect of PGs on the muscle activity may promote cervical dilatation and retraction. PMID:3893038

  20. MicroRNA regulation of airway smooth muscle function.

    PubMed

    Sun, Maoyun; Lu, Quan

    2016-06-01

    Airway smooth muscle (ASM) controls airway narrowing and plays a pivotal role in the pathogenesis of asthma. MicroRNAs are small yet powerful gene tuners that regulate diverse cellular processes. Recent studies have demonstrated the versatile role of microRNAs in regulating multiple ASM phenotypes that are critically involved in asthma pathogenesis. These ASM phenotypes include proliferation, cell size, chemokine secretion, and contractility. Here we review microRNA-mediated regulation of ASM functions and discuss the potential of microRNAs as a novel class of therapeutic targets to improve ASM function for asthma therapy. PMID:26812790

  1. Orai channel-mediated Ca2+ signals in vascular and airway smooth muscle.

    PubMed

    Spinelli, Amy M; Trebak, Mohamed

    2016-03-15

    Orai (Orai1, Orai2, and Orai3) proteins form a family of highly Ca(2+)-selective plasma membrane channels that are regulated by stromal-interacting molecules (STIM1 and STIM2); STIM proteins are Ca(2+) sensors located in the membrane of the endoplasmic reticulum. STIM and Orai proteins are expressed in vascular and airway smooth muscle and constitute the molecular components of the ubiquitous store-operated Ca(2+) entry pathway that mediate the Ca(2+) release-activated Ca(2+) current. STIM/Orai proteins also encode store-independent Ca(2+) entry pathways in smooth muscle. Altered expression and function of STIM/Orai proteins have been linked to vascular and airway pathologies, including restenosis, hypertension, and atopic asthma. In this review we discuss our current understanding of Orai proteins and the store-dependent and -independent signaling pathways mediated by these proteins in vascular and airway smooth muscle. We also discuss the current studies linking altered expression and function of Orai proteins with smooth muscle-related pathologies. PMID:26718630

  2. A mechanochemical 3D continuum model for smooth muscle contraction under finite strains.

    PubMed

    Stålhand, J; Klarbring, A; Holzapfel, G A

    2011-01-01

    This paper presents a modelling framework in which the mechanochemical properties of smooth muscle cells may be studied. The activation of smooth muscles is considered in a three-dimensional continuum model which is key to realistically capture the function of hollow organs such as blood vessels. On the basis of a general thermodynamical framework the mechanical and chemical phases are specialized in order to quantify the coupled mechanochemical process. A free-energy function is proposed as the sum of a mechanical energy stored in the passive tissue, a coupling between the mechanical and chemical kinetics and an energy related purely to the chemical kinetics and the calcium ion concentration. For the chemical phase it is shown that the cross-bridge model of Hai and Murphy [1988. Am. J. Physiol. Cell Physiol. 254, C99-C106] is included in the developed evolution law as a special case. In order to show the specific features and the potential of the proposed continuum model a uniaxial extension test of a tissue strip is analysed in detail and the related kinematics and stress-stretch relations are derived. Parameter studies point to coupling phenomena; in particular the tissue response is analysed in terms of the calcium ion level. The model for smooth muscle contraction may significantly contribute to current modelling efforts of smooth muscle tissue responses. PMID:20946904

  3. Pulmonary surfactant in the airway physiology: a direct relaxing effect on the smooth muscle.

    PubMed

    Calkovska, A; Uhliarova, B; Joskova, M; Franova, S; Kolomaznik, M; Calkovsky, V; Smolarova, S

    2015-04-01

    Beside alveoli, surface active material plays an important role in the airway physiology. In the upper airways it primarily serves in local defense. Lower airway surfactant stabilizes peripheral airways, provides the transport and defense, has barrier and anti-edematous functions, and possesses direct relaxant effect on the smooth muscle. We tested in vitro the effect of two surfactant preparations Curosurf® and Alveofact® on the precontracted smooth muscle of intra- and extra-pulmonary airways. Relaxation was more pronounced for lung tissue strip containing bronchial smooth muscle as the primary site of surfactant effect. The study does not confirm the participation of ATP-dependent potassium channels and cAMP-regulated epithelial chloride channels known as CFTR chloride channels, or nitric oxide involvement in contractile response of smooth muscle to surfactant.By controlling wall thickness and airway diameter, pulmonary surfactant is an important component of airway physiology. Thus, surfactant dysfunction may be included in pathophysiology of asthma, COPD, or other diseases with bronchial obstruction. PMID:25583659

  4. Nitric Oxide-mediated Relaxation by High K in Human Gastric Longitudinal Smooth Muscle.

    PubMed

    Kim, Young Chul; Choi, Woong; Yun, Hyo-Young; Sung, Rohyun; Yoo, Ra Young; Park, Seon-Mee; Yun, Sei Jin; Kim, Mi-Jung; Song, Young-Jin; Xu, Wen-Xie; Lee, Sang Jin

    2011-12-01

    This study was designed to elucidate high-K(+)induced response of circular and longitudinal smooth muscle from human gastric corpus using isometric contraction. Contraction from circular and longitudinal muscle stripes of gastric corpus greater curvature and lesser curvature were compared. Circular smooth muscle from corpus greater curvature showed high K(+) (50 mM)-induced tonic contraction. On the contrary, however, longitudinal smooth muscle strips showed high K(+) (50 mM)-induced sustained relaxation. To find out the reason for the discrepancy we tested several relaxation mechanisms. Protein kinase blockers like KT5720, PKA inhibitor, and KT5823, PKG inhibitor, did not affect high K(+)-induced relaxation. K(+) channel blockers like tetraethylammonium (TEA), apamin (APA), glibenclamide (Glib) and barium (Ba(2+)) also had no effect. However, N(G)-nitro-L-arginine (L-NNA) and 1H-(1,2,4) oxadiazolo (4,3-A) quinoxalin-1-one (ODQ), an inhibitor of soluble guanylate cyclase (sGC) and 4-AP (4-aminopyridine), voltage-dependent K(+) channel (K(V)) blocker, inhibited high K(+)-induced relaxation, hence reversing to tonic contraction. High K(+)-induced relaxation was observed in gastric corpus of human stomach, but only in the longitudinal muscles from greater curvature not lesser curvature. L-NNA, ODQ and K(V) channel blocker sensitive high K(+)-induced relaxation in longitudinal muscle of higher portion of corpus was also observed. These results suggest that longitudinal smooth muscle from greater curvature of gastric corpus produced high K(+)-induced relaxation which was activated by NO/sGC pathway and by K(V) channel dependent mechanism. PMID:22359479

  5. Rapid effects of phytoestrogens on human colonic smooth muscle are mediated by oestrogen receptor beta.

    PubMed

    Hogan, A M; Collins, D; Sheehan, K; Zierau, O; Baird, A W; Winter, D C

    2010-05-14

    Epidemiological studies have correlated consumption of dietary phytoestrogens with beneficial effects on colon, breast and prostate cancers. Genomic and non-genomic mechanisms are responsible for anti-carcinogenic effects but, until now, the effect on human colon was assumed to be passive and remote. No direct effect on human colonic smooth muscle has previously been described. Institutional research board approval was granted. Histologically normal colon was obtained from the proximal resection margin of colorectal carcinoma specimens. Circular smooth muscle strips were microdissected and suspended under 1g of tension in organ baths containing oxygenated Krebs solution at 37 degrees C. After an equilibration period, tissues were exposed to diarylpropionitrile (DPN) (ER beta agonist) and 1,3,5-tris(4-hydroxyphenyl)-4-propyl-1H-pyrazole (PPT) (ER alpha agonist) or to the synthetic phytoestrogen compounds genistein (n=8), daidzein (n=8), fisetin (n=8) and quercetin (n=8) in the presence or absence of fulvestrant (oestrogen receptor antagonist). Mechanism of action was investigated by inhibition of downstream pathways. The cholinergic agonist carbachol was used to induce contractile activity. Tension was recorded isometrically. Phytoestrogens inhibit carbachol-induced colonic contractility. In keeping with a non-genomic, rapid onset direct action, the effect was within minutes, reversible and similar to previously described actions of 17 beta oestradiol. No effect was seen in the presence of fulvestrant indicating receptor modulation. While the DPN exerted inhibitory effects, PPT did not. The effect appears to be reliant on a p38/mitogen activated protein kinase mediated induction of nitric oxide production in colonic smooth muscle. The present data set provides the first description of a direct effect of genistein, daidzein, fisetin and quercetin on human colonic smooth muscle. The presence of ER in colonic smooth muscle has been functionally proven and the beta

  6. Osteogenic potential of alpha smooth muscle actin expressing muscle resident progenitor cells.

    PubMed

    Matthews, Brya G; Torreggiani, Elena; Roeder, Emilie; Matic, Igor; Grcevic, Danka; Kalajzic, Ivo

    2016-03-01

    Heterotopic ossification (HO) is a pathological process where bone forms in connective tissues such as skeletal muscle. Previous studies have suggested that muscle-resident non-myogenic mesenchymal progenitors are the likely source of osteoblasts and chondrocytes in HO. However, the previously identified markers of muscle-resident osteoprogenitors label up to half the osteoblasts within heterotopic lesions, suggesting other cell populations are involved. We have identified alpha smooth muscle actin (αSMA) as a marker of osteoprogenitor cells in bone and periodontium, and of osteo-chondro progenitors in the periosteum during fracture healing. We therefore utilized a lineage tracing approach to evaluate whether αSMACreERT2 identifies osteoprogenitors in the muscle. We show that in the muscle, αSMACreERT2 labels both perivascular cells, and satellite cells. αSMACre-labeled cells undergo osteogenic differentiation in vitro and form osteoblasts and chondrocytes in BMP2-induced HO in vivo. In contrast, Pax7CreERT2-labeled muscle satellite cells were restricted to myogenic differentiation in vitro, and rarely contributed to HO in vivo. Our data indicate that αSMACreERT2 labels a large proportion of osteoprogenitors in skeletal muscle, and therefore represents another marker of muscle-resident cells with osteogenic potential under HO-inducing stimulus. In contrast, muscle satellite cells make minimal contribution to bone formation in vivo. PMID:26721734

  7. Smooth Muscle-Like Cells Generated from Human Mesenchymal Stromal Cells Display Marker Gene Expression and Electrophysiological Competence Comparable to Bladder Smooth Muscle Cells

    PubMed Central

    Brun, Juliane; Lutz, Katrin A.; Neumayer, Katharina M. H.; Klein, Gerd; Seeger, Tanja; Uynuk-Ool, Tatiana; Wörgötter, Katharina; Schmid, Sandra; Kraushaar, Udo; Guenther, Elke; Rolauffs, Bernd; Aicher, Wilhelm K.; Hart, Melanie L.

    2015-01-01

    The use of mesenchymal stromal cells (MSCs) differentiated toward a smooth muscle cell (SMC) phenotype may provide an alternative for investigators interested in regenerating urinary tract organs such as the bladder where autologous smooth muscle cells cannot be used or are unavailable. In this study we measured the effects of good manufacturing practice (GMP)-compliant expansion followed by myogenic differentiation of human MSCs on the expression of a range of contractile (from early to late) myogenic markers in relation to the electrophysiological parameters to assess the functional role of the differentiated MSCs and found that differentiation of MSCs associated with electrophysiological competence comparable to bladder SMCs. Within 1–2 weeks of myogenic differentiation, differentiating MSCs significantly expressed alpha smooth muscle actin (αSMA; ACTA2), transgelin (TAGLN), calponin (CNN1), and smooth muscle myosin heavy chain (SM-MHC; MYH11) according to qRT-PCR and/or immunofluorescence and Western blot. Voltage-gated Na+ current levels also increased within the same time period following myogenic differentiation. In contrast to undifferentiated MSCs, differentiated MSCs and bladder SMCs exhibited elevated cytosolic Ca2+ transients in response to K+-induced depolarization and contracted in response to K+ indicating functional maturation of differentiated MSCs. Depolarization was suppressed by Cd2+, an inhibitor of voltage-gated Ca2+-channels. The expression of Na+-channels was pharmacologically identified as the Nav1.4 subtype, while the K+ and Ca2+ ion channels were identified by gene expression of KCNMA1, CACNA1C and CACNA1H which encode for the large conductance Ca2+-activated K+ channel BKCa channels, Cav1.2 L-type Ca2+ channels and Cav3.2 T-type Ca2+ channels, respectively. This protocol may be used to differentiate adult MSCs into smooth muscle-like cells with an intermediate-to-late SMC contractile phenotype exhibiting voltage-gated ion channel

  8. Smooth Muscle-Like Cells Generated from Human Mesenchymal Stromal Cells Display Marker Gene Expression and Electrophysiological Competence Comparable to Bladder Smooth Muscle Cells.

    PubMed

    Brun, Juliane; Lutz, Katrin A; Neumayer, Katharina M H; Klein, Gerd; Seeger, Tanja; Uynuk-Ool, Tatiana; Wörgötter, Katharina; Schmid, Sandra; Kraushaar, Udo; Guenther, Elke; Rolauffs, Bernd; Aicher, Wilhelm K; Hart, Melanie L

    2015-01-01

    The use of mesenchymal stromal cells (MSCs) differentiated toward a smooth muscle cell (SMC) phenotype may provide an alternative for investigators interested in regenerating urinary tract organs such as the bladder where autologous smooth muscle cells cannot be used or are unavailable. In this study we measured the effects of good manufacturing practice (GMP)-compliant expansion followed by myogenic differentiation of human MSCs on the expression of a range of contractile (from early to late) myogenic markers in relation to the electrophysiological parameters to assess the functional role of the differentiated MSCs and found that differentiation of MSCs associated with electrophysiological competence comparable to bladder SMCs. Within 1-2 weeks of myogenic differentiation, differentiating MSCs significantly expressed alpha smooth muscle actin (αSMA; ACTA2), transgelin (TAGLN), calponin (CNN1), and smooth muscle myosin heavy chain (SM-MHC; MYH11) according to qRT-PCR and/or immunofluorescence and Western blot. Voltage-gated Na+ current levels also increased within the same time period following myogenic differentiation. In contrast to undifferentiated MSCs, differentiated MSCs and bladder SMCs exhibited elevated cytosolic Ca2+ transients in response to K+-induced depolarization and contracted in response to K+ indicating functional maturation of differentiated MSCs. Depolarization was suppressed by Cd2+, an inhibitor of voltage-gated Ca2+-channels. The expression of Na+-channels was pharmacologically identified as the Nav1.4 subtype, while the K+ and Ca2+ ion channels were identified by gene expression of KCNMA1, CACNA1C and CACNA1H which encode for the large conductance Ca2+-activated K+ channel BKCa channels, Cav1.2 L-type Ca2+ channels and Cav3.2 T-type Ca2+ channels, respectively. This protocol may be used to differentiate adult MSCs into smooth muscle-like cells with an intermediate-to-late SMC contractile phenotype exhibiting voltage-gated ion channel

  9. Two-pore-domain potassium channels in smooth muscles: new components of myogenic regulation.

    PubMed

    Sanders, Kenton M; Koh, Sang Don

    2006-01-01

    Gastrointestinal (GI) smooth muscles are influenced by many levels of regulation, including those provided by enteric motor neurones, hormones and paracrine substances. The integrated contractile responses to these regulatory mechanisms depend heavily on the state of excitability of smooth muscle cells. Resting ionic conductances and myogenic responses to agonists and physical parameters, such as stretch, are important in establishing basal excitability. This review discusses the role of 2-pore-domain K+ channels in contributing to background conductances and in mediating responses of GI muscles to enteric inhibitory nerve stimulation and stretch. Murine GI muscles express TREK-1 channels and display a stretch-dependent K+ (SDK) conductance that is also activated by nitric oxide via a cGMP-dependent mechanism. Cloning and expression of mTREK-1 produced an SDK conductance that was activated by cGMP-dependent phosphorylation at serine-351. GI muscle cells also express TASK-1 and TASK-2 channels that are inhibited by lidocaine and external acidification. These conductances appear to provide significant background K+ permeability that contributes to the negative resting potentials of GI muscles. PMID:16239268

  10. Calcium oscillations in human mesenteric vascular smooth muscle.

    PubMed

    Navarro-Dorado, Jorge; Garcia-Alonso, Mauricio; van Breemen, Cornelis; Tejerina, Teresa; Fameli, Nicola

    2014-02-28

    Phenylephrine (PE)-induced oscillatory fluctuations in intracellular Ca(2+) concentration ([Ca(2+)]i) of vascular smooth muscle have been observed in many blood vessels isolated from a wide variety of mammals. Paradoxically, until recently similar observations in humans have proven elusive. In this study, we report for the first time observations of adrenergically-stimulated [Ca(2+)]i oscillations in human mesenteric artery smooth muscle. In arterial segments preloaded with Fluo-4 AM and mounted on a myograph on the stage of a confocal microscope, we observed PE-induced oscillations in [Ca(2+)]i, which initiated and maintained vasoconstriction. These oscillations present some variability, possibly due to compromised health of the tissue. This view is corroborated by our ultrastructural analysis of the cells, in which we found only (5 ± 2)% plasma membrane-sarcoplasmic reticulum apposition, markedly less than measured in healthy tissue from laboratory animals. We also partially characterized the oscillations by using the inhibitory drugs 2-aminoethoxydiphenyl borate (2-APB), cyclopiazonic acid (CPA) and nifedipine. After PE contraction, all drugs provoked relaxation of the vessel segments, sometimes only partial, and reduced or inhibited oscillations, except CPA, which rarely caused relaxation. These preliminary results point to a potential involvement of the sarcoplasmic reticulum Ca(2+) and inositol 1,4,5-trisphosphate receptor (IP3R) in the maintenance of the Ca(2+) oscillations observed in human blood vessels. PMID:24508261

  11. Pericytes are progenitors for coronary artery smooth muscle.

    PubMed

    Volz, Katharina S; Jacobs, Andrew H; Chen, Heidi I; Poduri, Aruna; McKay, Andrew S; Riordan, Daniel P; Kofler, Natalie; Kitajewski, Jan; Weissman, Irving; Red-Horse, Kristy

    2015-01-01

    Epicardial cells on the heart's surface give rise to coronary artery smooth muscle cells (caSMCs) located deep in the myocardium. However, the differentiation steps between epicardial cells and caSMCs are unknown as are the final maturation signals at coronary arteries. Here, we use clonal analysis and lineage tracing to show that caSMCs derive from pericytes, mural cells associated with microvessels, and that these cells are present in adults. During development following the onset of blood flow, pericytes at arterial remodeling sites upregulate Notch3 while endothelial cells express Jagged-1. Deletion of Notch3 disrupts caSMC differentiation. Our data support a model wherein epicardial-derived pericytes populate the entire coronary microvasculature, but differentiate into caSMCs at arterial remodeling zones in response to Notch signaling. Our data are the first demonstration that pericytes are progenitors for smooth muscle, and their presence in adult hearts reveals a new potential cell type for targeting during cardiovascular disease. PMID:26479710

  12. MicroRNAs Dynamically Remodel Gastrointestinal Smooth Muscle Cells

    PubMed Central

    Park, Chanjae; Yan, Wei; Ward, Sean M.; Hwang, Sung Jin; Wu, Qiuxia; Hatton, William J.; Park, Jong Kun; Sanders, Kenton M.; Ro, Seungil

    2011-01-01

    Smooth muscle cells (SMCs) express a unique set of microRNAs (miRNAs) which regulate and maintain the differentiation state of SMCs. The goal of this study was to investigate the role of miRNAs during the development of gastrointestinal (GI) SMCs in a transgenic animal model. We generated SMC-specific Dicer null animals that express the reporter, green fluorescence protein, in a SMC-specific manner. SMC-specific knockout of Dicer prevented SMC miRNA biogenesis, causing dramatic changes in phenotype, function, and global gene expression in SMCs: the mutant mice developed severe dilation of the intestinal tract associated with the thinning and destruction of the smooth muscle (SM) layers; contractile motility in the mutant intestine was dramatically decreased; and SM contractile genes and transcriptional regulators were extensively down-regulated in the mutant SMCs. Profiling and bioinformatic analyses showed that SMC phenotype is regulated by a complex network of positive and negative feedback by SMC miRNAs, serum response factor (SRF), and other transcriptional factors. Taken together, our data suggest that SMC miRNAs are required for the development and survival of SMCs in the GI tract. PMID:21533178

  13. Collagen degradation and platelet-derived growth factor stimulate the migration of vascular smooth muscle cells.

    PubMed

    Stringa, E; Knäuper, V; Murphy, G; Gavrilovic, J

    2000-06-01

    Cell migration is a key event in many biological processes and depends on signals from both extracellular matrix and soluble motogenic factors. During atherosclerotic plaque development, vascular smooth muscle cells migrate from the tunica media to the intima through a basement membrane and interstitial collagenous matrix and proliferate to form a neointima. Matrix metalloproteinases have previously been implicated in neointimal formation and in this study smooth muscle cell adhesion and migration on degraded collagen have been evaluated. Vascular smooth muscle cells adhered to native intact collagen type I and to its first degradation by-product, 3/4 fragment (generated by collagenase-3 cleavage), unwound at 35 degrees C to mimic physiological conditions. PDGF-BB pre-treatment induced a fourfold stimulation of smooth muscle cell motility on the collagen 3/4 fragment whereas no increase in smooth muscle cell motility on collagen type I was observed. Cell migration on collagen type I was mediated by alpha2 integrin, whereas PDGF-BB-stimulated migration on the 3/4 collagen fragment was dependent on alphavbeta3 integrin. alphavbeta3 integrin was organised in clusters concentrated at the leading and trailing edges of the cells and was only expressed when cells were exposed to the 3/4 collagen fragment. Tyrphostin A9, an inhibitor of PDGF receptor-beta tyrosine kinase activity, resulted in complete abolition of migration of PDGF-BB treated cells on collagen type I and 3/4 fragment. These results strongly support the hypothesis that the cellular migratory response to soluble motogens can be regulated by proteolytic modification of the extracellular matrix. PMID:10806116

  14. Electrical properties of purinergic transmission in smooth muscle of the guinea-pig prostate.

    PubMed

    Lam, Michelle; Mitsui, Retsu; Hashitani, Hikaru

    2016-01-01

    Prostatic smooth muscle develops spontaneous myogenic tone which is modulated by autonomic neuromuscular transmission. This study aimed to investigate the role of purinergic transmission in regulating electrical activity of prostate smooth muscle and whether its contribution may be altered with age. Intracellular recordings were simultaneously made with isometric tension recordings in smooth muscle preparations of the guinea-pig prostate. Immunostaining for P2X1 receptors on whole mount preparations was also performed. In prostate preparations which generated spontaneous slow waves, electrical field stimulation (EFS)-evoked excitatory junction potentials (EJPs) which were abolished by guanethidine (10 μM), α-β-methylene ATP (10 μM) or pyridoxal phosphate-6-azophenyl-2,4-disulfonic acid (PPADS, 10 μM) but not phentolamine (1 μM). Consistently, immunostaining revealed the expression of P2X1 receptors on prostatic smooth muscle. EJPs themselves did not cause contractions, but EJPs could sum to trigger a slow wave and associated contraction. Yohimbine (1 μM) and 3,7-dimethyl-1-propargylxanthine (DMPX, 10 μM) but not propranolol (1 μM) potentiated EJPs. Although properties of EJPs were not different between young and aging guinea-pig prostates, ectoATPase inhibitor ARL 67156 (100 μM) augmented EJP amplitudes by 64.2 ± 29.6% in aging animals, compared to 22.1 ± 19.9% in young animals. These results suggest that ATP released from sympathetic nerves acts on P2X1 purinoceptors located on prostate smooth muscle to evoke EJPs, while pre-junctional α2-adrenergic and adenosine A2 receptors may play a role in preventing excessive transmitter release. Age-related up-regulation of enzymatic ATP breakdown may be a compensatory mechanism for the enhanced purinergic transmission which would cause hypercontractility arising from increased ATP release in older animals. PMID:26657181

  15. Endothelin ETA receptor expression in human cerebrovascular smooth muscle cells.

    PubMed Central

    Yu, J. C.; Pickard, J. D.; Davenport, A. P.

    1995-01-01

    1. Endothelin (ET) has been implicated in cerebrovasospasm for example, following subarachnoid haemorrhage, and blocking the interaction of ET with its receptors on cerebral vessels, may be of therapeutic benefit. The aim of our study was to characterize endothelin receptor sub-types on medial smooth muscle cells of human cerebral vessels. Cultures of vascular smooth muscle cells were explanted from human cerebral resistance vessels and characterized as human brain smooth muscle cells (HBSMCs). 2. Over a 48 h incubation period, HBSMC cultures secreted comparable levels of immunoreactive (IR) big endothelin-1 (big ET-1) and IR endothelin (ET): 12.7 +/- 10.3 and 8.3 +/- 5.6 pmol/10(6) cells, respectively (mean +/- s.e. mean from three different individuals), into the culture medium. 3. Total RNA was extracted from cultures of human brain smooth muscle cells. Reverse-transcriptase polymerase chain reaction (RI-PCR) assays and subsequent product separation by agarose gel electrophoresis revealed single bands corresponding to the expected product sizes encoding cDNA for ETA (299 base pairs) and ETB (428 base pairs) (n = 3 different cultures). 4. Autoradiography demonstrated the presence of specific binding sites for [125I]-ET-1 which labels all ET receptors, and [125I]-PD151242, an ETA subtype-selective antagonist which exclusively labels ETA receptors, but no specific-binding was detected using ETB subtype-selective [125I]-BQ3020 (n = 3 different cultures, in duplicate). 5. In saturation binding assays, [123I]-ET-1 bound with high affinity: KD = 0.8 +/- 0.1 nM and Bmax = 690 +/- 108 fmol mg-1. A one-site fit was preferred and Hill slopes were close to unity over the concentration range (10(-12) to 10(-8) M). [125I]-PD151242 also bound with similar affinity: KD = 0.4 +/- 0.1 nM and Bmax = 388 +/- 68 fmol mg-1 (mean +/- s.e. mean, n = 3 different cultures). Again, a one-site fit was preferred and Hill slopes were close to unity over the concentration range. Unlabelled PD

  16. Visualization of Head–Head Interactions in the Inhibited State of Smooth Muscle Myosin

    PubMed Central

    Wendt, Thomas; Taylor, Dianne; Messier, Terri; Trybus, Kathleen M.; Taylor, Kenneth A.

    1999-01-01

    The structural basis for the phosphoryla- tion-dependent regulation of smooth muscle myosin ATPase activity was investigated by forming two- dimensional (2-D) crystalline arrays of expressed unphosphorylated and thiophosphorylated smooth muscle heavy meromyosin (HMM) on positively charged lipid monolayers. A comparison of averaged 2-D projections of both forms at 2.3-nm resolution reveals distinct structural differences. In the active, thiophosphorylated form, the two heads of HMM interact intermolecularly with adjacent molecules. In the unphosphorylated or inhibited state, intramolecular interactions position the actin-binding interface of one head onto the converter domain of the second head, thus providing a mechanism whereby the activity of both heads could be inhibited. PMID:10613897

  17. The sGC activator inhibits the proliferation and migration, promotes the apoptosis of human pulmonary arterial smooth muscle cells via the up regulation of plasminogen activator inhibitor-2

    SciTech Connect

    Zhang, Shuai; Zou, Lihui; Yang, Ting; Yang, Yuanhua; Zhai, Zhenguo; Xiao, Fei; Wang, Chen

    2015-03-15

    Background: Different types of pulmonary hypertension (PH) share the same process of pulmonary vascular remodeling, the molecular mechanism of which is not entirely clarified by far. The abnormal biological behaviors of pulmonary arterial smooth muscle cells (PASMCs) play an important role in this process. Objectives: We investigated the regulation of plasminogen activator inhibitor-2 (PAI-2) by the sGC activator, and explored the effect of PAI-2 on PASMCs proliferation, apoptosis and migration. Methods: After the transfection with PAI-2 overexpression vector and specific siRNAs or treatment with BAY 41-2272 (an activator of sGC), the mRNA and protein levels of PAI-2 in cultured human PASMCs were detected, and the proliferation, apoptosis and migration of PASMCs were investigated. Results: BAY 41-2272 up regulated the endogenous PAI-2 in PASMCs, on the mRNA and protein level. In PAI-2 overexpression group, the proliferation and migration of PASMCs were inhibited significantly, and the apoptosis of PASMCs was increased. In contrast, PAI-2 knockdown with siRNA increased PASMCs proliferation and migration, inhibited the apoptosis. Conclusions: PAI-2 overexpression inhibits the proliferation and migration and promotes the apoptosis of human PASMCs. Therefore, sGC activator might alleviate or reverse vascular remodeling in PH through the up-regulation of PAI-2. - Highlights: • sGC activator BAY41-2272 up regulated PAI-2 in PASMCs, on the mRNA and protein level. • PAI-2 overexpression inhibits the proliferation and migration of human PASMCs. • PAI-2 overexpression promotes the apoptosis of human PASMCs. • sGC activator might alleviate the vascular remodeling in pulmonary hypertension.

  18. Phorbol 12,13-dibutyrate-induced, protein kinase C-mediated contraction of rabbit bladder smooth muscle.

    PubMed

    Wang, Tanchun; Kendig, Derek M; Trappanese, Danielle M; Smolock, Elaine M; Moreland, Robert S

    2012-01-01

    Contraction of bladder smooth muscle is predominantly initiated by M(3) muscarinic receptor-mediated activation of the G(q/11)-phospholipase C β-protein kinase C (PKC) and the G(12/13)-RhoGEF-Rho kinase (ROCK) pathways. However, these pathways and their downstream effectors are not well understood in bladder smooth muscle. We used phorbol 12,13-dibutyrate (PDBu), and 1,2-dioctanoyl-sn-glycerol (DOG), activators of PKC, in this investigation. We were interested in dissecting the role(s) of PKC and to clarify the signaling pathways in bladder smooth muscle contraction, especially the potential cross-talk with ROCK and their downstream effectors in regulating myosin light chain phosphatase activity and force. To achieve this goal, the study was performed in the presence or absence of the PKC inhibitor bisindolylmaleimide-1 (Bis) or the ROCK inhibitor H-1152. Phosphorylation levels of Thr(38)-CPI-17 and Thr(696)/Thr(850) myosin phosphatase target subunit (MYPT1) were measured during PDBu or DOG stimulation using site specific antibodies. PDBu-induced contraction in bladder smooth muscle involved both activation of PKC and PKC-dependent activation of ROCK. CPI-17 as a major downstream effector, is phosphorylated by PKC and ROCK during PDBu and DOG stimulation. Our results suggest that Thr(696) and Thr(850)-MYPT1 phosphorylation are not involved in the regulation of a PDBu-induced contraction. The results also demonstrate that bladder smooth muscle contains a constitutively active isoform of ROCK that may play an important role in the regulation of bladder smooth muscle basal tone. Together with the results from our previous study, we developed a working model to describe the complex signaling pathways that regulate contraction of bladder smooth muscle. PMID:22232602

  19. Single Nisoldipine-Sensitive Calcium Channels in Smooth Muscle Cells Isolated from Rabbit Mesenteric Artery

    NASA Astrophysics Data System (ADS)

    Worley, Jennings F.; Deitmer, Joachim W.; Nelson, Mark T.

    1986-08-01

    Single smooth muscle cells were enzymatically isolated from the rabbit mesenteric artery. At physiological levels of external Ca, these cells were relaxed and contracted on exposure to norepinephrine, caffeine, or high levels of potassium. The patch-clamp technique was used to measure unitary currents through single channels in the isolated cells. Single channels were selective for divalent cations and exhibited two conductance levels, 8 pS and 15 pS. Both types of channels were voltage-dependent, and channel activity occurred at potentials positive to -40 mV. The activity of both channel types was almost completely inhibited by 50 nM nisoldipine. These channels appear to be the pathways for voltage-dependent Ca influx in vascular smooth muscle and may be the targets of the clinically used dihydropyridines.

  20. Steroids augment relengthening of contracted airway smooth muscle: potential additional mechanism of benefit in asthma.

    PubMed

    Lakser, O J; Dowell, M L; Hoyte, F L; Chen, B; Lavoie, T L; Ferreira, C; Pinto, L H; Dulin, N O; Kogut, P; Churchill, J; Mitchell, R W; Solway, J

    2008-11-01

    Breathing (especially deep breathing) antagonises development and persistence of airflow obstruction during bronchoconstrictor stimulation. Force fluctuations imposed on contracted airway smooth muscle (ASM) in vitro result in its relengthening, a phenomenon called force fluctuation-induced relengthening (FFIR). Because breathing imposes similar force fluctuations on contracted ASM within intact lungs, FFIR represents a likely mechanism by which breathing antagonises bronchoconstriction. While this bronchoprotective effect appears to be impaired in asthma, corticosteroid treatment can restore the ability of deep breaths to reverse artificially induced bronchoconstriction in asthmatic subjects. It has previously been demonstrated that FFIR is physiologically regulated through the p38 mitogen-activated protein kinase (MAPK) signalling pathway. While the beneficial effects of corticosteroids have been attributed to suppression of airway inflammation, the current authors hypothesised that alternatively they might exert their action directly on ASM by augmenting FFIR as a result of inhibiting p38 MAPK signalling. This possibility was tested in the present study by measuring relengthening in contracted canine tracheal smooth muscle (TSM) strips. The results indicate that dexamethasone treatment significantly augmented FFIR of contracted canine TSM. Canine tracheal ASM cells treated with dexamethasone demonstrated increased MAPK phosphatase-1 expression and decreased p38 MAPK activity, as reflected in reduced phosphorylation of the p38 MAPK downstream target, heat shock protein 27. These results suggest that corticosteroids may exert part of their therapeutic effect through direct action on airway smooth muscle, by decreasing p38 mitogen-activated protein kinase activity and thus increasing force fluctuation-induced relengthening. PMID:18768574

  1. Nitric oxide mediates stretch-induced Ca2+ oscillation in smooth muscle.

    PubMed

    Zheng, Ji; Zhai, Kui; Chen, Yingxiao; Zhang, Xu; Miao, Lin; Wei, Bin; Ji, Guangju

    2016-06-15

    The stretching of smooth muscle tissue modulates contraction through augmentation of Ca(2+) transients, but the mechanism underlying stretch-induced Ca(2+) transients is still unknown. We found that mechanical stretching and maintenance of mouse urinary bladder smooth muscle strips and single myocytes at 30% and 18% beyond the initial length, respectively, resulted in Ca(2+) oscillations. Experiments indicated that mechanical stretching remarkably increased the production of nitric oxide (NO) as well as the amplitude and duration of muscle contraction. Stretch-induced Ca(2+) oscillations and contractility increases were completely abolished by the NO inhibitor L-NAME or eNOS (also known as NOS3) gene inactivation. Moreover, exposure of eNOS-knockout myocytes to exogenous NO donor induced Ca(2+) oscillations. The stretch-induced Ca(2+) oscillations were greatly inhibited by the selective inositol 1,4,5-trisphosphate receptor (IP3R) inhibitor xestospongin C and partially inhibited by ryanodine. Moreover, the stretch-induced Ca(2+) oscillations were also suppressed by the phosphoinositide 3-kinase (PI3K) inhibitor LY294002, but not by the soluble guanylyl cyclase (sGC) inhibitor ODQ. These results suggest that stretching myocyte and maintenance at a certain length results in Ca(2+) oscillations that are NO dependent , and sGC and cGMP independent, and results from the activation of PI3K in smooth muscle. PMID:27189081

  2. Simulated Hypergravity Alters Vascular Smooth Muscle Cell Proliferation and Motility

    NASA Technical Reports Server (NTRS)

    Hunt, Shameka; Bettis, Barika; Harris-Hooker, Sandra; Sanford, Gary L.

    1997-01-01

    The cellular effects of gravity are poorly understood due to its constancy and nonavailability of altered gravitational models. Such an understanding is crucial for prolonged space flights. In these studies, we assessed the influence of centrifugation at 6G (HGrav) on vascular smooth muscle (SMC) mobility and proliferation. Cells were: (a) plated at low density and subjected to HGrav for 24-72 hr for proliferation studies, or (b) grown to confluency, subjected to HGrav, mechanically denuded and monitored for cell movement into the denuded area. Controls were maintained under normogravity. SMC showed a 50% inhibition of growth under HGrav and 10% serum; HGrav and low serum resulted in greater growth inhibition. The rate of movement of SMC into the denuded area was 2-3-fold higher under HGrav in low serum compared to controls, but similar in 10% serum. These studies show that HGrav has significant effects on SMC growth and mobility, which are dependent on serum levels.

  3. The Pivotal Role of Airway Smooth Muscle in Asthma Pathophysiology

    PubMed Central

    Ozier, Annaïg; Allard, Benoit; Bara, Imane; Girodet, Pierre-Olivier; Trian, Thomas; Marthan, Roger; Berger, Patrick

    2011-01-01

    Asthma is characterized by the association of airway hyperresponsiveness (AHR), inflammation, and remodelling. The aim of the present article is to review the pivotal role of airway smooth muscle (ASM) in the pathophysiology of asthma. ASM is the main effector of AHR. The mechanisms of AHR in asthma may involve a larger release of contractile mediators and/or a lower release of relaxant mediators, an improved ASM cell excitation/contraction coupling, and/or an alteration in the contraction/load coupling. Beyond its contractile function, ASM is also involved in bronchial inflammation and remodelling. Whereas ASM is a target of the inflammatory process, it can also display proinflammatory and immunomodulatory functions, through its synthetic properties and the expression of a wide range of cell surface molecules. ASM remodelling represents a key feature of asthmatic bronchial remodelling. ASM also plays a role in promoting complementary airway structural alterations, in particular by its synthetic function. PMID:22220184

  4. Airway hyperresponsiveness; smooth muscle as the principal actor

    PubMed Central

    Lauzon, Anne-Marie; Martin, James G.

    2016-01-01

    Airway hyperresponsiveness (AHR) is a defining characteristic of asthma that refers to the capacity of the airways to undergo exaggerated narrowing in response to stimuli that do not result in comparable degrees of airway narrowing in healthy subjects. Airway smooth muscle (ASM) contraction mediates airway narrowing, but it remains uncertain as to whether the smooth muscle is intrinsically altered in asthmatic subjects or is responding abnormally as a result of the milieu in which it sits. ASM in the trachea or major bronchi does not differ in its contractile characteristics in asthmatics, but the more pertinent peripheral airways await complete exploration. The mass of ASM is increased in many but not all asthmatics and therefore cannot be a unifying hypothesis for AHR, although when increased in mass it may contribute to AHR. The inability of a deep breath to reverse or prevent bronchial narrowing in asthma may reflect an intrinsic difference in the mechanisms that lead to softening of contracted ASM when subjected to stretch. Cytokines such as interleukin-13 and tumor necrosis factor-α promote a more contractile ASM phenotype. The composition and increased stiffness of the matrix in which ASM is embedded promotes a more proliferative and pro-inflammatory ASM phenotype, but the expected dedifferentiation and loss of contractility have not been shown. Airway epithelium may drive ASM proliferation and/or molecular remodeling in ways that may lead to AHR. In conclusion, AHR is likely multifactorial in origin, reflecting the plasticity of ASM properties in the inflammatory environment of the asthmatic airway. PMID:26998246

  5. Airway hyperresponsiveness; smooth muscle as the principal actor.

    PubMed

    Lauzon, Anne-Marie; Martin, James G

    2016-01-01

    Airway hyperresponsiveness (AHR) is a defining characteristic of asthma that refers to the capacity of the airways to undergo exaggerated narrowing in response to stimuli that do not result in comparable degrees of airway narrowing in healthy subjects. Airway smooth muscle (ASM) contraction mediates airway narrowing, but it remains uncertain as to whether the smooth muscle is intrinsically altered in asthmatic subjects or is responding abnormally as a result of the milieu in which it sits. ASM in the trachea or major bronchi does not differ in its contractile characteristics in asthmatics, but the more pertinent peripheral airways await complete exploration. The mass of ASM is increased in many but not all asthmatics and therefore cannot be a unifying hypothesis for AHR, although when increased in mass it may contribute to AHR. The inability of a deep breath to reverse or prevent bronchial narrowing in asthma may reflect an intrinsic difference in the mechanisms that lead to softening of contracted ASM when subjected to stretch. Cytokines such as interleukin-13 and tumor necrosis factor-α promote a more contractile ASM phenotype. The composition and increased stiffness of the matrix in which ASM is embedded promotes a more proliferative and pro-inflammatory ASM phenotype, but the expected dedifferentiation and loss of contractility have not been shown. Airway epithelium may drive ASM proliferation and/or molecular remodeling in ways that may lead to AHR. In conclusion, AHR is likely multifactorial in origin, reflecting the plasticity of ASM properties in the inflammatory environment of the asthmatic airway. PMID:26998246

  6. Engineering smooth muscle tissue with a predefined structure.

    PubMed

    Kim, B S; Mooney, D J

    1998-08-01

    Nonwoven meshes of polyglycolic acid (PGA) fibers are attractive synthetic extracellular matrices (ECMs) for tissue engineering and have been used to engineer many types of tissues. However, these synthetic ECMs lack structural stability and often cannot maintain their original structure during tissue development. This makes it difficult to design an engineered tissue with a predefined configuration and dimensions. In this study, we investigated the ability of PGA fiber-based matrices bonded at their fiber crosspoints with a secondary polymer, poly-L-lactic acid (PLLA), to resist cellular contractile forces and maintain their predefined structure during the process of smooth muscle (SM) tissue development in vitro. Physically bonded PGA matrices exhibited a 10- to 35-fold increase in the compressive modulus over unbonded PGA matrices, depending on the mass of PLLA utilized to bond the PGA matrices. In addition, the bonded PGA matrices degraded much more slowly than the unbonded matrices. The PLLA bonding of PGA matrices had no effect on the ability of cells to adhere to the matrices. After 7 weeks in culture, the bonded matrices maintained 101 +/- 4% of their initial volume and an approximate original shape while the unbonded matrices contracted to 5 +/- 1% of their initial volume with an extreme change in their shape. At this time the bonded PGA matrices had a high cellularity, with smooth muscle cells (SMCs) and ECM proteins produced by these cells (e.g., elastin) filling the pores between PGA fibers. This study demonstrated that physically bonded PGA fiber-based matrices allow the maintenance of the configuration and dimensions of the original matrices and the development of a new tissue in a predefined three-dimensional structure. This approach may be useful for engineering a variety of tissues of various structures and shapes, and our study demonstrates the importance of matching both the initial mechanical properties and the degradation rate of a matrix to

  7. Circular smooth muscle contributes to esophageal shortening during peristalsis

    PubMed Central

    Vegesna, Anil K; Chuang, Keng-Yu; Besetty, Ramashesai; Phillips, Steven J; Braverman, Alan S; Barbe, Mary F; Ruggieri, Michael R; Miller, Larry S

    2012-01-01

    AIM: To study the angle between the circular smooth muscle (CSM) and longitudinal smooth muscle (LSM) fibers in the distal esophagus. METHODS: In order to identify possible mechanisms for greater shortening in the distal compared to proximal esophagus during peristalsis, the angles between the LSM and CSM layers were measured in 9 cadavers. The outer longitudinal layer of the muscularis propria was exposed after stripping the outer serosa. The inner circular layer of the muscularis propria was then revealed after dissection of the esophageal mucosa and the underlying muscularis mucosa. Photographs of each specimen were taken with half of the open esophagus folded back showing both the outer longitudinal and inner circular muscle layers. Angles were measured every one cm for 10 cm proximal to the squamocolumnar junction (SCJ) by two independent investigators. Two human esophagi were obtained from organ transplant donors and the angles between the circular and longitudinal smooth muscle layers were measured using micro-computed tomography (micro CT) and Image J software. RESULTS: All data are presented as mean ± SE. The CSM to LSM angle at the SCJ and 1 cm proximal to SCJ on the autopsy specimens was 69.3 ± 4.62 degrees vs 74.9 ± 3.09 degrees, P = 0.32. The CSM to LSM angle at SCJ were statistically significantly lower than at 2, 3, 4 and 5 cm proximal to the SCJ, 69.3 ± 4.62 degrees vs 82.58 ± 1.34 degrees, 84.04 ± 1.64 degrees, 84.87 ± 1.04 degrees and 83.72 ± 1.42 degrees, P = 0.013, P = 0.008, P = 0.004, P = 0.009 respectively. The CSM to LSM angle at SCJ was also statistically significantly lower than the angles at 6, 7 and 8 cm proximal to the SCJ, 69.3 ± 4.62 degrees vs 80.18 ± 2.09 degrees, 81.81 ± 1.75 degrees and 80.96 ± 2.04 degrees, P = 0.05, P = 0.02, P = 0.03 respectively. The CSM to LSM angle at 1 cm proximal to SCJ was statistically significantly lower than at 3, 4 and 5 cm proximal to the SCJ, 74.94 ± 3.09 degrees vs 84.04 ± 1

  8. Pullulan-based hydrogel for smooth muscle cell culture.

    PubMed

    Autissier, Aude; Letourneur, Didier; Le Visage, Catherine

    2007-08-01

    A hydrogel was prepared from pullulan and evaluated as a novel biomaterial for vascular engineering. Using a crosslinking process with sodium trimetaphosphate in aqueous solution, homogeneous, transparent, and easy-to-handle pullulan gels were obtained with water-content higher than 90%. A circular punch was used to cut 6-mm diameter and 2-mm thickness discs for cell culture. Environmental scanning electron microscopy analysis of hydrated gels revealed a smooth surface, on which rabbit vascular smooth muscle cells were successfully seeded. The absence of cytotoxicity was evidenced by a live/dead assay. Fluorescence-labeled cells were observed adhering and progressively spreading out on the surface of the material. Cellular proliferation was followed for up to 1 week using an MTT assay. In addition, a complete in vitro degradation of the gels was achieved in 3 h upon incubation in a pullulanase solution (44 U/mL). In conclusion, we have shown the feasibility of preparing a biocompatible pullulan-based hydrogel that could support vascular cell culture. Based on these promising results, future studies will focus on the seeding of vascular cells on tubular-shaped hydrogels and the in vivo implantation of these new biomaterials. PMID:17295223

  9. The Inhibitory Mechanism of Gentamicin on Electrical Field Stimulation Response in Rat Bladder Smooth Muscle

    PubMed Central

    Min, Chang Ho; Wang, YiYi; Bae, Jinhyung; Han, Jung Hoon

    2015-01-01

    To see the inhibitory mechanism of gentamicin in response to electrical field stimulation (EFS) using the rat bladder smooth muscle, atropine or guanethidine was treated but had no effect. Methylsergide, a non-selective 5-HT1, 5-HT2 receptor antagonist was also treated but had on effect. Kinase inhibitors, such as chelerythrine (PKC inhibitor), ML-9 (MLCK inhibitor), or Y27632 (rho kinase inhibitor) were pretreated before gentamicin treatment, but did not have effect. For U73122, a phospholipase C (PLC) inhibitor however, the inhibitory effect to gentamicin was significantly attenuated in all frequencies given by the EFS. Therefore gentamicin induced inhibitory effect on EFS response in rat bladder smooth muscle was not mediated by the activation of adrenergic, cholinergic, or serotonergic receptor. The inhibition of gentamicin might be mediated through the PLC dependent pathway, but not through the PKC, MLCK or rho kinase dependent pathway. PMID:26330761

  10. Interference with PPARγ Function in Smooth Muscle Causes Vascular Dysfunction and Hypertension

    PubMed Central

    Halabi, Carmen M.; Beyer, Andreas M.; de Lange, Willem J.; Keen, Henry L.; Baumbach, Gary L.; Faraci, Frank M.; Sigmund, Curt D.

    2008-01-01

    Summary Peroxisome proliferator-activated receptor-γ (PPARγ) is a ligand activated transcription factor playing a critical role in metabolism. Thiazolidinediones, high affinity PPARγ ligands used clinically to treat type-II diabetes, have been reported to lower blood pressure and provide other cardiovascular benefits. Some mutations in PPARγ cause type-II diabetes and severe hypertension. We tested the hypothesis that PPARγ in vascular muscle plays a role in the regulation of vascular tone and blood pressure. Transgenic mice expressing dominant negative mutations in PPARγ under the control of a smooth muscle-specific promoter exhibit a loss of responsiveness to nitric oxide and striking alterations in contractility in the aorta, hypertrophy and inward remodeling in the cerebral microcirculation, and systolic hypertension. These results identify PPARγ as pivotal in vascular muscle as a regulator of vascular structure, vascular function and blood pressure, potentially explaining some of the cardioprotective effects of thiazolidinediones. PMID:18316027

  11. Transforming growth factor-beta as a differentiating factor for cultured smooth muscle cells.

    PubMed

    Gawaziuk, J P; X; Sheikh, F; Cheng, Z-Q; Cattini, P A; Stephens, N L

    2007-10-01

    The aim of the present study was to determine whether the development of supercontractile smooth muscle cells, contributing to the nonspecific hyperreactivity of airways in asthmatic patients, is due to transforming growth factor (TGF)-beta. In cultured smooth muscle cells starved by removal of 10% foetal bovine serum for 7 days, growth arrest was seen; 30% became elongated and demonstrated super contractility. Study of conditioned medium suggested that the differentiating factor was TGF-beta. Sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) was carried out on conditioned medium from the arrested cells. Two protein bands were identified as matrix metalloproteinase (MMP)-2 and TGF-beta1. To determine second messenger signalling by SMAD2, Western blotting and confocal microscopy were employed. Conditioned medium from arrested cultures showed the presence of MMP-2 and TGF-beta1, as revealed by SDS-PAGE; 68- and 25-kDa bands were seen. Differentiation was confirmed by upregulation of marker proteins, smooth muscle type myosin heavy chain and myosin light chain kinase. Confirmation was obtained by downregulating these proteins with decorin treatment, which reduces the levels of active TGF-beta and an adenoviral dominant-negative vector coding for a mutated type II TGF-beta-receptor. Activation of second messenger signalling was demonstrated immunocytochemically by the presence of phosphorylated SMAD2 and SMAD4. Transforming growth factor-beta is likely to be the differentiating factor responsible for the development of these supercontractile smooth muscle cells. The development of such cells in vivo after cessation of an asthmatic attack could contribute to the nonspecific hyperreactivity of airways seen in patients. PMID:17596270

  12. Calphostin-C induction of vascular smooth muscle cell apoptosis proceeds through phospholipase D and microtubule inhibition.

    PubMed

    Zheng, Xi-Long; Gui, Yu; Du, Guangwei; Frohman, Michael A; Peng, Dao-Quan

    2004-02-20

    Calphostin-C, a protein kinase C inhibitor, induces apoptosis of cultured vascular smooth muscle cells. However, the mechanisms are not completely defined. Because apoptosis of vascular smooth muscle cells is critical in several proliferating vascular diseases such as atherosclerosis and restenosis after angioplasty, we decided to investigate the mechanisms underlying the calphostin-C-induced apoptotic pathway. We show here that apoptosis is inhibited by the addition of exogenous phosphatidic acid, a metabolite of phospholipase D (PLD), and that calphostin-C inhibits completely the activities of both isoforms of PLD, PLD1 and PLD2. Overexpression of either PLD1 or PLD2 prevented the vascular smooth muscle cell apoptosis induced by serum withdrawal but not the calphostin-C-elicited apoptosis. These data suggest that PLDs have anti-apoptotic effects and that complete inhibition of PLD activity by calphostin-C induces smooth muscle cell apoptosis. We also report that calphostin-C induced microtubule disruption and that the addition of exogenous phosphatidic acid inhibits calphostin-C effects on microtubules, suggesting a role for PLD in stabilizing the microtubule network. Overexpressing PLD2 in Chinese hamster ovary cells phenocopies this result, providing strong support for the hypothesis. Finally, taxol, a microtubule stabilizer, not only inhibited the calphostin-C-induced microtubule disruption but also inhibited apoptosis. We therefore conclude that calphostin-C induces apoptosis of cultured vascular smooth muscle cells through inhibiting PLD activity and subsequent microtubule polymerization. PMID:14660552

  13. Inward rectifier potassium conductance regulates membrane potential of canine colonic smooth muscle.

    PubMed

    Flynn, E R; McManus, C A; Bradley, K K; Koh, S D; Hegarty, T M; Horowitz, B; Sanders, K M

    1999-07-01

    1. The membrane potential of gastrointestinal smooth muscles determines the open probability of ion channels involved in rhythmic electrical activity. The role of Ba2+-sensitive K+ conductances in the maintenance of membrane potential was examined in canine proximal colon circular muscle. 2. Application of Ba2+ (1-100 microM) to strips of tunica muscularis produced depolarization of cells along the submucosal surface of the circular muscle layer. Significantly higher concentrations of Ba2+ were needed to depolarize preparations from which the submucosal and myenteric pacemaker regions were removed. 3. Elevation of extracellular [K+]o (from 5.9 to 12 mM) brought membrane potentials closer to EK (the Nernst potential for K+ ions), suggesting activation of a K+ conductance. This occurred at potentials much more negative than the activation range for delayed rectifier channels (Kv). 4. Forskolin (1 microM) caused hyperpolarization and a leftward shift in the dose-response relationship for Ba2+, suggesting that forskolin may activate a Ba2+-sensitive conductance. 5. Patch-clamp recordings from interstitial cells of Cajal (ICC) revealed the presence of a Ba2+-sensitive inward rectifier potassium conductance. Far less of this conductance was present in smooth muscle cells. 6. Kir2.1 was expressed in the circular muscle layer of the canine proximal colon, duodenum, jejunum and ileum. Kir2.1 mRNA was expressed in greater abundance along the submucosal surface of the circular muscle layer in the colon. 7. These results demonstrate that ICC express a Ba2+-sensitive conductance (possibly encoded by Kir2.1). This conductance contributes to the generation and maintenance of negative membrane potentials between slow waves. PMID:10373706

  14. Altered energy state reversibly controls smooth muscle contractile function in human saphenous vein during acute hypoxia-reoxygenation: Role of glycogen, AMP-activated protein kinase, and insulin-independent glucose uptake.

    PubMed

    Pyla, Rajkumar; Pichavaram, Prahalathan; Fairaq, Arwa; Park, Mary Anne; Kozak, Mark; Kamath, Vinayak; Patel, Vijay S; Segar, Lakshman

    2015-09-01

    Hypoxia is known to promote vasodilation of coronary vessels through several mediators including cardiac-derived adenosine and endothelium-derived prostanoids and nitric oxide. To date, the impact of endogenous glycogen depletion in vascular smooth muscle and the resultant alterations in cellular energy state (e.g., AMP-activated protein kinase, AMPK) on the contractile response to G protein-coupled receptor agonists (e.g., serotonin, 5-HT) has not yet been studied. In the present study, ex vivo exposure of endothelium-denuded human saphenous vein rings to hypoxic and glucose-deprived conditions during KCl-induced contractions for 30 min resulted in a marked depletion of endogenous glycogen by ∼80% (from ∼1.78 μmol/g under normoxia to ∼0.36 μmol/g under hypoxia). Importantly, glycogen-depleted HSV rings, which were maintained under hypoxia/reoxygenation and glucose-deprived conditions, exhibited significant increases in basal AMPK phosphorylation (∼6-fold ↑) and 5-HT-induced AMPK phosphorylation (∼19-fold ↑) with an accompanying suppression of 5-HT-induced maximal contractile response (∼68% ↓), compared with respective controls. Exposure of glycogen-depleted HSV rings to exogenous D-glucose, but not the inactive glucose analogs, prevented the exaggerated increase in 5-HT-induced AMPK phosphorylation and restored 5-HT-induced maximal contractile response. In addition, the ability of exogenous D-glucose to rescue cellular stress and impaired contractile function occurred through GLUT1-mediated but insulin/GLUT4-independent mechanisms. Together, the present findings from clinically-relevant human saphenous vein suggest that the loss of endogenous glycogen in vascular smooth muscle and the resultant accentuation of AMPK phosphorylation by GPCR agonists may constitute a yet another mechanism of metabolic vasodilation of coronary vessels in ischemic heart disease. PMID:26212549

  15. A long-acting β2-adrenergic agonist increases the expression of muscarine cholinergic subtype-3 receptors by activating the β2-adrenoceptor cyclic adenosine monophosphate signaling pathway in airway smooth muscle cells

    PubMed Central

    LIU, YUAN-HUA; WU, SONG-ZE; WANG, GANG; HUANG, NI-WEN; LIU, CHUN-TAO

    2015-01-01

    The persistent administration of β2-adrenergic (β2AR) agonists has been demonstrated to increase the risk of severe asthma, partly due to the induction of tolerance to bronchoprotection via undefined mechanisms. The present study investigated the potential effect of the long-acting β2-adrenergic agonist, formoterol, on the expression of muscarinic M3 receptor (M3R) in rat airway smooth muscle cells (ASMCs). Primary rat ASMCs were isolated and characterized following immunostaining with anti-α-smooth muscle actin antibodies. The protein expression levels of M3R and phospholipase C-β1 (PLCβ1) were characterized by western blot analysis and the production of inositol 1,4,5-trisphosphate (IP3) was determined using an enzyme-linked immunosorbent assay. Formoterol increased the protein expression of M3R in rat ASMCs in a time- and dose-dependent manner, which was significantly inhibited by the β2AR antagonist, ICI118,551 and the cyclic adenosine monophosphate (cAMP) inhibitor, SQ22,536. The increased protein expression of M3R was positively correlated with increased production of PLCβ1 and IP3. Furthermore, treatment with the glucocorticoid, budesonide, and the PLC inhibitor, U73,122, significantly suppressed the formoterol-induced upregulated protein expression levels of M3R and PLCβ1 and production of IP3. The present study demonstrated that formoterol mediated the upregulation of M3R in the rat ASMCs by activating the β2AR-cAMP signaling pathway, resulting in increased expression levels of PLCβ1 and IP3, which are key to inducing bronchoprotection tolerance. Administration of glucocorticoids or a PLC antagonist prevented formoterol-induced bronchoprotection tolerance by suppressing the protein expression of M3R. PMID:25672589

  16. miR-145 and miR-143 Regulate Smooth Muscle Cell Fate Decisions

    PubMed Central

    Cordes, Kimberly R.; Sheehy, Neil T.; White, Mark; Berry, Emily; Morton, Sarah U.; Muth, Alecia N.; Lee, Ting-Hein; Miano, Joseph M.; Ivey, Kathryn N.; Srivastava, Deepak

    2009-01-01

    SUMMARY microRNAs are regulators of myriad cellular events, but evidence for a single microRNA that can efficiently differentiate multipotent cells into a specific lineage or regulate direct reprogramming of cells into an alternate cell fate has been elusive. Here, we show that miR-145 and miR-143 are co-transcribed in multipotent cardiac progenitors before becoming localized to smooth muscle cells, including neural crest stem cell–derived vascular smooth muscle cells. miR-145 and miR-143 were direct transcriptional targets of serum response factor, myocardin and Nkx2.5, and were downregulated in injured or atherosclerotic vessels containing proliferating, less differentiated smooth muscle cells. miR-145 was necessary for myocardin-induced reprogramming of adult fibroblasts into smooth muscle cells and sufficient to induce differentiation of multipotent neural crest stem cells into vascular smooth muscle. Furthermore, miR-145 and miR-143 cooperatively targeted a network of transcription factors, including Klf4, myocardin, and Elk-1 to promote differentiation and repress proliferation of smooth muscle cells. These findings demonstrate that miR-145 can direct the smooth muscle fate and that miR-145 and miR-143 function to regulate the quiescent versus proliferative phenotype of smooth muscle cells. PMID:19578358

  17. Membrane properties of the smooth-muscle fibres of the guinea-pig portal vein.

    PubMed

    Ito, Y; Kuriyama, H

    1971-05-01

    The membrane activities and the various characteristic constants of the smooth-muscle membrane of the guinea-pig portal vein were investigated with the micro-electrode technique.1. The mean membrane potential was -37 mV. Spontaneous discharges appeared as regular bursts of short trains of spikes alternating with silent periods, as a mixture of single spikes and bursts of spikes appearing continuously, or as regular spikes with low frequency.2. Spontaneous spikes with overshoot were frequently observed. The maximum rate of rise of the spike was 3.7 V/sec. The shapes of the spikes were classified into three different types, i.e. pace-maker type of spike, monophasic spike and spike with a hump during the falling phase.3. Tetrodotoxin (10(-5) g/ml.) did not influence the patterns of the spontaneous train discharges nor the shape of the spike.4. Extracellularly applied outward current elicited spikes which were either monophasic or had a hump on the falling phase. Inward current elicited break excitation of the spike.5. Current-voltage relations, produced by application of inward current pulses to the tissue and measured at various distances from the stimulating partition, were linear.6. The smooth-muscle membrane of portal vein showed cable-like properties. The mean space constant of the membrane was 0.52 mm; the mean time constant of the membrane calculated from the electrotonic potential was 330 msec.7. Conduction velocity of the spike measured by insertion of two micro-electrodes was 0.58 cm/sec.8. The time constant of the foot of the propagated spike was 27 msec. The time constant of the membrane calculated from the time constant of the foot of the spike and the conduction velocity was 310 msec.9. The membrane properties of longitudinal smooth muscle of the portal vein were discussed in comparison with other veins and various visceral smooth muscles. PMID:5580862

  18. Neuropilin 1 Is Essential for Gastrointestinal Smooth Muscle Contractility and Motility in Aged Mice

    PubMed Central

    Yamaji, Maiko; Mahmoud, Marwa; Evans, Ian M.; Zachary, Ian C.

    2015-01-01

    Background and Aims Neuropilin 1 (NRP1) is a non-tyrosine kinase receptor for vascular endothelial growth factor (VEGF) and class 3 semaphorins, playing a role in angiogenesis and neuronal axon guidance, respectively. NRP1 is expressed in smooth muscle cells (SMC) but the functional role of NRP1 in SMC has not been elucidated. We therefore investigated the biological relevance of NRP1 in SMC in vivo by generating mice with SMC-specific Nrp1 deficiency. Methods Conditional gene targeting generated SMC-specific Nrp1 knockout mice (Nrp1SMKO) in which Cre recombinase is driven by the smooth muscle-specific myosin heavy chain (smMHC) promoter. Results SMC-specific Nrp1 deficiency resulted in a significant reduction in intestinal length by 6 months, and, by 18 months, in severe constipation, and enlargement of the intestine consistent with chronic intestinal pseudo-obstruction. These effects were associated with significant thinning of the intestinal smooth muscle, and decreased intestinal contractility. Expression of contractile proteins was reduced in Nrp1SMKO mice, including the smMHC isoform, SMB, whereas we observed a significant increase in the expression of the small-conductance calcium-activated potassium channel 3 (SK3/KCa2.3), implicated in negative regulation of smooth muscle contraction. Conclusions Nrp1 deficiency in visceral SMC results in adult-onset defects in gastrointestinal contractility and motility and causes a shift to a less contractile SMC phenotype. These findings indicate a new role for Nrp1 in the maintenance of the visceral SMC contractile phenotype required for normal GI motility in aged mice. PMID:25659123

  19. Cell, matrix changes and alpha-smooth muscle actin expression in repair of the canine meniscus.

    PubMed

    Kambic, H E; Futani, H; McDevitt, C A

    2000-01-01

    Processes in the repair of a crevice in the knee joint meniscus were investigated in 10 dogs. Two 2-mm cylindrical plugs from each medial meniscus were removed, rendered acellular by freezing and thawing, and then reinserted into the meniscus. Dogs were euthanized at intervals of 3-52 weeks after surgery. The crevice between the plug and meniscus at 3 weeks after surgery was filled with a tissue containing alpha-smooth muscle actin-positive cells. One year after surgery, the plug had remodeled and was populated with spindle-shaped and fibrochondrocyte-like cells. The plug had an appearance intermediate between that of hyaline and fibrocartilage at this time, with a seamless integration in sites between the remodeled plug and the surrounding meniscus. alpha-smooth muscle actin-positive cells were concentrated at the interface of the remodeled plug and adjacent meniscus and at the surface of the plug. Therefore, remodeling of both the plug and meniscal tissue and the participation of alpha-smooth muscle actin-positive cells appear essential for integration of the plug into the adjacent meniscal tissue. Cells in the superficial zone of the meniscus seem to be active in the repair process. A change in both the phenotype of the cells and the quality of the matrix toward a more hyaline state appears to be an integral part of the remodeling process in the meniscus. PMID:11208183

  20. Interaction of plasminogen-related protein B with endothelial and smooth muscle cells in vitro.

    PubMed

    Morioka, Hideo; Morii, Takeshi; Vogel, Tikva; Hornicek, Francis J; Weissbach, Lawrence

    2003-07-01

    Plasminogen-related protein B (PRP-B) closely resembles the N-terminal plasminogen activation peptide, which is released from plasminogen during conversion to plasmin. We have previously demonstrated that the steady-state level of mRNA encoding PRP-B is increased within tumor tissues, and that recombinant PRP-B antagonizes neoplastic growth when administered systemically to mice harboring tumors, but no insights into the cell targets of PRP-B have been presented. Employing serum-free medium optimized for culturing human endothelial or smooth muscle cells, we show that recombinant PRP-B inhibits basic fibroblast growth factor-dependent cell migration for both cell types, as well as tube formation of endothelial cells. Comparison with the angiogenesis inhibitors angiostatin and endostatin revealed similar results. Recombinant PRP-B is effective in promoting cell attachment of endothelial and smooth muscle cells, and antibody interference experiments reveal that the interaction of recombinant PRP-B with endothelial cells is mediated at least in part by alpha(v)-containing integrins. Inhibition of angiogenesis in vivo by PRP-B was demonstrated in the chicken chorioallantoic membrane assay. PRP-B and other antiangiogenic molecules may elicit metabolic perturbations in endothelial cells as well as perivascular mesenchymal cells such as smooth muscle cells and pericytes. PMID:12799192

  1. Cavernosum smooth muscle relaxation induced by Schisandrol A via the NO-cGMP signaling pathway.

    PubMed

    Liu, W; Choi, B R; Bak, Y O; Zhang, L T; Zhou, L X; Huang, Y R; Zhao, C; Park, J K

    2016-01-01

    To evaluate the effect of Schisandrol A on rabbit corpus cavernosum smooth muscle and elucidate the potential mechanism. Penises were obtained from healthy male New Zealand White rabbits (2.5-3.0 kg). The pre-contracted penis with phenylephrine (Phe, 10 µM) was treated with accumulative concentrations of Schisandrol A (10-7, 10-6, 10-5 and 10-4 M). The change in intracavernosum pressure (ICP) and tension was recorded, cyclic nucleotides in the cavernosum tissue were measured by radioimmunoassay, mRNA level and expression of endothelial nitric oxide synthase (eNOS) and neuronal NOS (nNOS) were measured by real time PCR and western blot respectively. The corpus cavernosum smooth muscle relaxation induced by Schisandrol A was in a dose-dependent manner. Pre-treatment with NOS inhibitor (Nω nitro-L-arginine-methyl ester, L-NAME) or guanylyl cyclase inhibitor (1H-(1,2,4)oxadiazolo(4,3-a)quinoxalin-1-one, ODQ) significantly diminished the relaxation. The cyclic guanosine monophosphate (cGMP) level was significantly increased in the cavernosum tissue. Real time PCR and western blot showed the mRNA level and expression of eNOS and nNOS was also upregulated. Schisandrol A relaxes the cavernosum smooth muscle by activating NO-cGMP signaling pathway. It may be a new promising treatment for erectile dysfunction and cardiovascular disease. PMID:27064883

  2. Hypertonic upregulation of amino acid transport system A in vascular smooth muscle cells.

    PubMed

    Chen, J G; Klus, L R; Steenbergen, D K; Kempson, S A

    1994-08-01

    The A10 line of vascular smooth muscle cells has Na+ dependent transport systems for alanine, proline, and Pi, whereas uptake of leucine, myo-inositol and D-glucose is Na+ independent. When A10 cells were incubated for 4 h in medium made hypertonic by addition of sucrose, there was a marked increase in Na(+)-dependent transport of alanine and proline but no change in Na(+)-dependent Pi uptake or Na(+)-independent uptake of leucine and inositol. Intracellular alanine content was increased 61% by the hypertonic treatment. Other nonpenetrating solutes, such as cellobiose and mannitol, reproduced the effect of sucrose, but urea, a penetrating solute, did not. Studies with 2-(methylamino)-isobutyric acid revealed that the upregulation by hypertonicity involved only system A. Increases in alanine and proline uptake also occurred after incubating the cells in isotonic medium containing 0.1 mM ouabain, suggesting that an increase in intracellular Na+ may be part of the intracellular signal for upregulation of system A. Hypertonic upregulation of Na(+)-dependent alanine transport occurred also in primary cultures of vascular smooth muscle cells. The response was blocked by actinomycin D and cycloheximide, indicating that gene transcription and protein synthesis play important roles in the mechanism leading to increased alanine uptake. We conclude that vascular smooth muscle cells, during prolonged hypertonic stress, activate system A and accumulate specific neutral amino acids which may act as organic osmolytes to help maintain normal cell volume. PMID:8074188

  3. Graded effects of unregulated smooth muscle myosin on intestinal architecture, intestinal motility and vascular function in zebrafish.

    PubMed

    Abrams, Joshua; Einhorn, Zev; Seiler, Christoph; Zong, Alan B; Sweeney, H Lee; Pack, Michael

    2016-05-01

    Smooth muscle contraction is controlled by the regulated activity of the myosin heavy chain ATPase (Myh11). Myh11 mutations have diverse effects in the cardiovascular, digestive and genitourinary systems in humans and animal models. We previously reported a recessive missense mutation, meltdown (mlt), which converts a highly conserved tryptophan to arginine (W512R) in the rigid relay loop of zebrafish Myh11. The mlt mutation disrupts myosin regulation and non-autonomously induces invasive expansion of the intestinal epithelium. Here, we report two newly identified missense mutations in the switch-1 (S237Y) and coil-coiled (L1287M) domains of Myh11 that fail to complement mlt Cell invasion was not detected in either homozygous mutant but could be induced by oxidative stress and activation of oncogenic signaling pathways. The smooth muscle defect imparted by the mlt and S237Y mutations also delayed intestinal transit, and altered vascular function, as measured by blood flow in the dorsal aorta. The cell-invasion phenotype induced by the three myh11 mutants correlated with the degree of myosin deregulation. These findings suggest that the vertebrate intestinal epithelium is tuned to the physical state of the surrounding stroma, which, in turn, governs its response to physiologic and pathologic stimuli. Genetic variants that alter the regulation of smooth muscle myosin might be risk factors for diseases affecting the intestine, vasculature, and other tissues that contain smooth muscle or contractile cells that express smooth muscle proteins, particularly in the setting of redox stress. PMID:26893369

  4. Interaction of smooth muscle relaxant drugs with calmodulin and cyclic nucleotide phosphodiesterase.

    PubMed

    Ronca-Testoni, S; Hrelia, S; Hakim, G; Rossi, C A

    1985-01-15

    Some smooth muscle relaxant drugs with an unknown mechanism of action have been tested for their interaction with calmodulin and with calmodulin-induced cyclic nucleotide phosphodiesterase (PDE) activity. The affinity of these drugs for calmodulin does not parallel their inhibitory effect on the calmodulin activation of PDE. The lack of parallelism could be due to a binding of the drugs to different sites on calmodulin; furthermore a binding of papaverine, octylonium bromide and felodipine to PDE molecule might also be considered to explain their inhibitory effect on PDE basal activity. The myolytic effect of octylonium bromide and pinaverium bromide may be due to their interaction with calmodulin-dependent systems. PMID:2981701

  5. HEF-19-induced relaxation of colonic smooth muscles and the underlying mechanisms

    PubMed Central

    Wei, Yuan-Yuan; Sun, Lu-Lu; Fu, Shou-Ting

    2013-01-01

    AIM: To investigate the relaxant effect of chromane HEF-19 on colonic smooth muscles isolated from rabbits, and the underlying mechanisms. METHODS: The relaxant effect and action mechanisms of HEF-19 were investigated using descending colon smooth muscle of the rabbits. Preparations 1 cm long were mounted in 15-mL tissue baths containing Tyrode’s solution, maintained at 37 ± 0.5 °C and aerated with a mixture of 5% CO2 in oxygen (Carbogen). The tension and amplitude of the smooth muscle strips were recorded after adding HEF-19 (10-6, 10-5 and 10-4 mol/L). After cumulative administration of four antispasmodic agents, including acetylcholine chloride (Ach) (10-4 mol/L), histamine (10-4 mol/L), high-K+ (60 mmol/L) and BaCl2 (8.2 mmol/L), HEF-19 (3 × 10-7-3 × 10-4 mol/L) was added to investigate the relaxant effect of HEF-19. CaCl2 (10-4-2.5 × 10-3 mol/L) was added cumulatively to the smooth muscle preparations pretreated with and without HEF-19 (1 × 10-6 or 3 × 10-6 mol/L) and verapamil (1 × 10-7 mol/L) to study the mechanisms involved. Finally, phasic contraction was induced with ACh (15 × 10-6 mol/L), and CaCl2 (4 × 10-3 mol/L) was added to the smooth muscle preparations pretreated with and without HEF-19 (3 × 10-6 mol/L or 1 × 10-5 mol/L) and verapamil (1 × 10-7 mol/L) in calcium-free medium to further study the underlying mechanisms. RESULTS: HEF-19 (1 × 10-6, 1 × 10-5 and 1 × 10-4 mol/L) suppressed spontaneous contraction of rabbit colonic smooth muscles. HEF-19 (3 × 10-7-3 × 10-4 mol/L) relaxed in a concentration-dependent manner colonic smooth muscle preparations pre-contracted with BaCl2, high-K+ solution, Ach or histamine with respective EC50 values of 5.15 ± 0.05, 5.12 ± 0.08, 5.58 ± 0.16 and 5.25 ± 0.24, thus showing a spasmolytic activity. HEF-19 (1 × 10-6 mol/L and 3 × 10-6 mol/L) shifted the concentration-response curves of CaCl2 to the right and depressed the maximum response to CaCl2. The two components contracted by Ach were

  6. Calponin isoforms CNN1, CNN2 and CNN3: Regulators for actin cytoskeleton functions in smooth muscle and non-muscle cells.

    PubMed

    Liu, Rong; Jin, J-P

    2016-07-01

    Calponin is an actin filament-associated regulatory protein expressed in smooth muscle and many types of non-muscle cells. Three homologous genes, CNN1, CNN2 and CNN3, encoding calponin isoforms 1, 2, and 3, respectively, are present in vertebrate species. All three calponin isoforms are actin-binding proteins with functions in inhibiting actin-activated myosin ATPase and stabilizing the actin cytoskeleton, while each isoform executes different physiological roles based on their cell type-specific expressions. Calponin 1 is specifically expressed in smooth muscle cells and plays a role in fine-tuning smooth muscle contractility. Calponin 2 is expressed in both smooth muscle and non-muscle cells and regulates multiple actin cytoskeleton-based functions. Calponin 3 participates in actin cytoskeleton-based activities in embryonic development and myogenesis. Phosphorylation has been extensively studied for the regulation of calponin functions. Cytoskeleton tension regulates the transcription of CNN2 gene and the degradation of calponin 2 protein. This review summarizes our knowledge learned from studies over the past three decades, focusing on the evolutionary lineage of calponin isoform genes, their tissue- and cell type-specific expressions, structure-function relationships, and mechanoregulation. PMID:26970176

  7. The comparative effects of aminoglycoside antibiotics and muscle relaxants on electrical field stimulation response in rat bladder smooth muscle.

    PubMed

    Min, Chang Ho; Min, Young Sil; Lee, Sang Joon; Sohn, Uy Dong

    2016-06-01

    It has been reported that several aminoglycoside antibiotics have a potential of prolonging the action of non-depolarizing muscle relaxants by drug interactions acting pre-synaptically to inhibit acetylcholine release, but antibiotics itself also have a strong effect on relaxing the smooth muscle. In this study, four antibiotics of aminoglycosides such as gentamicin, streptomycin, kanamycin and neomycin were compared with skeletal muscle relaxants baclofen, tubocurarine, pancuronium and succinylcholine, and a smooth muscle relaxant, papaverine. The muscle strips isolated from the rat bladder were stimulated with pulse trains of 40 V in amplitude and 10 s in duration, with pulse duration of 1 ms at the frequency of 1-8 Hz, at 1, 2, 4, 6, 8 Hz respectively. To test the effect of four antibiotics on bladder smooth muscle relaxation, each of them was treated cumulatively from 1 μM to 0.1 mM with an interval of 5 min. Among the four antibiotics, gentamicin and neomycin inhibited the EFS response. The skeletal muscle relaxants (baclofen, tubocurarine, pancuronium and succinylcholine) and inhibitory neurotransmitters (GABA and glycine) did not show any significant effect. However, papaverine, had a significant effect in the relaxation of the smooth muscle. It was suggested that the aminoglycoside antibiotics have inhibitory effect on the bladder smooth muscle. PMID:27260628

  8. Inhibition of tracheal smooth muscle contraction and myosin phosphorylation by ryanodine

    SciTech Connect

    Gerthoffer, W.T.; Murphey, K.A.; Khoyi, M.A.

    1988-08-01

    Previous studies have shown that muscarinic activation of airway smooth muscle in low Ca++ solutions increases myosin phosphorylation without increasing tension. Blocking Ca++ influx reduced phosphorylation, but not to basal levels. It was proposed that release of intracellular Ca++ contributed to dissociation of phosphorylation and contraction. To test this hypothesis the effects of ryanodine were studied under similar conditions. Ryanodine (10(-7) to 10(-5) M) antagonized caffeine-induced contraction of canine tracheal smooth muscle. Ryanodine also reduced carbachol-induced contractions and carbachol-induced myosin phosphorylation. The effect of ryanodine on potassium and serotonin-induced contractions was also investigated to test for a nonspecific inhibitory effect. In contrast to the effect on carbachol responses, ryanodine (10(-5) M) potentiated the contractile response to low concentrations of serotonin and potassium, but had no effect on the maximum response to either stimulant. Carbachol (10(-6) M) and ryanodine (10(-5) M) both significantly decreased /sup 45/Ca++ content of tracheal muscle. The effect of ryanodine and carbachol together on /sup 45/Ca++ content was not greater than either drug alone suggesting that ryanodine reduces the caffeine and carbachol responses by depleting releaseable Ca++ stores. Ryanodine significantly reduced Ca++-induced contraction and myosin phosphorylation in carbachol-stimulated muscle, suggesting that some of the Ca++ responsible for elevated phosphorylation is released from the sarcoplasmic reticulum.

  9. Effects of pseudophosphorylation mutants on the structural dynamics of smooth muscle myosin regulatory light chain.

    PubMed

    Espinoza-Fonseca, L Michel; Colson, Brett A; Thomas, David D

    2014-10-01

    We have performed 50 independent molecular dynamics (MD) simulations to determine the effect of pseudophosphorylation mutants on the structural dynamics of smooth muscle myosin (SMM) regulatory light chain (RLC). We previously showed that the N-terminal phosphorylation domain of RLC simultaneously populates two structural states in equilibrium, closed and open, and that phosphorylation at S19 induces a modest shift toward the open state, which is sufficient to activate smooth muscle. However, it remains unknown why pseudophosphorylation mutants poorly mimic phosphorylation-induced activation of SMM. We performed MD simulations of unphosphorylated, phosphorylated, and three pseudophosphorylated RLC mutants: S19E, T18D/S19D and T18E/S19E. We found that the S19E mutation does not shift the equilibrium toward the open state, indicating that simple charge replacement at position S19 does not mimic the activating effect of phosphorylation, providing a structural explanation for previously published functional data. In contrast, mutants T18D/S19D and T18E/S19E shift the equilibrium toward the open structure and partially activate in vitro motility, further supporting the model that an increase in the mol fraction of the open state is coupled to SMM motility. Structural analyses of the doubly-charged pseudophosphorylation mutants suggest that alterations in an interdomain salt bridge between residues R4 and D100 results in impaired signal transmission from RLC to the catalytic domain of SMM, which explains the low ATPase activity of these mutants. Our results demonstrate that phosphorylation produces a unique structural balance in the RLC. These observations have important implications for our understanding of the structural aspects of activation and force potentiation in smooth and striated muscle. PMID:25091814

  10. Leukotriene D4 receptor-mediated hydrolysis of phosphoinositide and mobilization of calcium in sheep tracheal smooth muscle cells

    SciTech Connect

    Mong, S.; Miller, J.; Wu, H.L.; Crooke, S.T.

    1988-02-01

    A sheep tracheal smooth muscle primary culture cell system was developed to characterize leukotriene D4 (LTD4) receptor-mediated biochemical and pharmacological effects. (/sup 3/H)LTD4 binding to the enriched plasma membrane receptor was specific, stereoselective and saturable. LTE4 and high affinity receptor antagonists bound to the receptors with a rank-order potency that was expected from previous smooth muscle contraction studies. In the (/sup 3/H)myoinositol labeled cells, LTD4 and LTE4 induced phosphoinositide hydrolysis. The biosynthesis of (/sup 3/H)inositol-trisphosphate was rapid and the induction of biosynthesis of (/sup 3/H)inositol-monophosphate by LTs was stereoselective and specific and was inhibited specifically by a receptor antagonist, SKF 104353. In the fura-2 loaded smooth muscle cells, LTD4 and LTE4 induced transient intracellular Ca++ mobilization. The fura-2/Ca++ transient was stereoselective and specific and was inhibited by receptor antagonist, SKF 104353. These results suggest that the cultured sheep tracheal smooth muscle cells have plasma membrane receptors for LTD4. These receptors were coupled to a phospholipase C that, when activated by agonists, induced hydrolysis of inositol containing phospholipids. The hydrolysis products, e.g. diacylglycerol and inositol-trisphosphate, may serve as intracellular messengers that trigger or contribute to the contractile effect in sheep tracheal smooth muscle.

  11. PDMS Elastic Micropost Arrays for Studying Vascular Smooth Muscle Cells

    PubMed Central

    Cheng, Qi; Sun, Zhe; Meininger, Gerald; Almasri, Mahmoud

    2015-01-01

    This paper describes the design, modeling, fabrication and characterization of a micromachined array of high-density 3-dimensional microposts (100×100) made of flexible material (silicone elastomers) for use to measure quantitatively the cellular traction force and contractile events in isolated vascular smooth muscle cells (VSMCs). The micropost array was fabricated with diameters ranged from 3 to 10 μm, with edge to edge spacing of 5, 7 and 10 μm, and with a height to diameter aspect ratio up to 10. VSMCs exerted larger basal traction forces when they were grown on stiffer micropost arrays. These basal traction forces were 80% larger in control VSMCs than in VSMCs in which integrin linked kinase (ILK) was knocked down using shRNA. The addition of Angiotensin II (ANGII) led to VSMC contraction as evidenced by an increased traction force exerted on the microposts under the cell. This ANGII induced contractile response and change in traction force on the microposts was not observed in VSMCs lacking ILK. Following treatment of VSMCs with Cytochalasin D to depolymerize the actin cytoskeleton, the VSMCs exhibited relaxation that was apparent as a significant reduction in the measured traction force exerted on microposts under the cell. Overall, this study demonstrates the usefulness of micropost arrays for study of the contractile responsiveness of VSMC and the results indicate that ILK plays a critical role in the signaling pathways leading to the generation of substrate traction force in VSMC. PMID:26451074

  12. Tensile Properties of Contractile and Synthetic Vascular Smooth Muscle Cells

    NASA Astrophysics Data System (ADS)

    Miyazaki, Hiroshi; Hasegawa, Yoshitaka; Hayashi, Kozaburo

    Tensile properties of vascular smooth muscle cells (VSMCs) of synthetic and contractile phenotypes were determined using a newly developed tensile test system. Synthetic and contractile VSMCs were isolated from the rabbit thoracic aorta with an explant and an enzymatic digestion method, respectively. Each cell floated in Hanks' balanced salt solution of 37°C was attached to the fine tips of a pair of micropipettes with a cell adhesive and, then, stretched at the rate of 6µm/sec by moving one of the micropipettes with a linear actuator. Load applied to the cell was measured with a cantilever-type load cell; its elongation was determined from the distance between the micropipette tips using a video dimension analyzer. The synthetic and contractile VSMCs were not broken even at the tensile force of 2.4µN and 3.4µN, respectively. Their stiffness was significantly higher in contractile phenotype (0.17N/m) than in synthetic one (0.09N/m). The different tensile properties between synthetic and contractile cells are attributable to the differences in cytoskeletal structures and contractile apparatus.

  13. Origin and differentiation of vascular smooth muscle cells

    PubMed Central

    Wang, Gang; Jacquet, Laureen; Karamariti, Eirini; Xu, Qingbo

    2015-01-01

    Vascular smooth muscle cells (SMCs), a major structural component of the vessel wall, not only play a key role in maintaining vascular structure but also perform various functions. During embryogenesis, SMC recruitment from their progenitors is an important step in the formation of the embryonic vascular system. SMCs in the arterial wall are mostly quiescent but can display a contractile phenotype in adults. Under pathophysiological conditions, i.e. vascular remodelling after endothelial dysfunction or damage, contractile SMCs found in the media switch to a secretory type, which will facilitate their ability to migrate to the intima and proliferate to contribute to neointimal lesions. However, recent evidence suggests that the mobilization and recruitment of abundant stem/progenitor cells present in the vessel wall are largely responsible for SMC accumulation in the intima during vascular remodelling such as neointimal hyperplasia and arteriosclerosis. Therefore, understanding the regulatory mechanisms that control SMC differentiation from vascular progenitors is essential for exploring therapeutic targets for potential clinical applications. In this article, we review the origin and differentiation of SMCs from stem/progenitor cells during cardiovascular development and in the adult, highlighting the environmental cues and signalling pathways that control phenotypic modulation within the vasculature. PMID:25952975

  14. Airway smooth muscle and bronchospasm: fluctuating, fluidizing, freezing

    PubMed Central

    Krishnan, Ramaswamy; Trepat, Xavier; Nguyen, Trang T. B.; Lenormand, Guillaume; Oliver, Madavi; Fredberg, Jeffrey J.

    2008-01-01

    We review here four recent findings that have altered in a fundamental way our understanding of airways smooth muscle (ASM), its dynamic responses to physiological loading, and their dominant mechanical role in bronchospasm. These findings highlight ASM remodeling processes that are innately out-of-equilibrium and dynamic, and bring to the forefront a striking intersection between topics in condensed matter physics and ASM cytoskeletal biology. By doing so, they place in a new light the role of enhanced ASM mass in airway hyper-responsiveness as well as in the failure of a deep inspiration to relax the asthmatic airway. These findings have established that (i) ASM length is equilibrated dynamically, not statically; (ii) ASM dynamics closely resemble physical features exhibited by so-called soft glassy materials; (iii) static force-length relationships fail to describe dynamically contracted ASM states; (iv) stretch fluidizes the ASM cytoskeleton. Taken together, these observations suggest that at the origin of the bronchodilatory effect of a deep inspiration, and its failure in asthma, may lie glassy dynamics of the ASM cell. PMID:18514592

  15. Molecular mechanisms of increased vascular smooth muscle contraction in SHR

    SciTech Connect

    Sharma, R.V.; Aqel, M.B.; Butters, C.; McEldoon, J.; Bhalla, R.C.

    1986-03-01

    The isometric tension development and /sup 45/Ca influx in response to NE and methoxamine stimulation were significantly (P < .05) increased in SHR caudal arteries as compared to WKY. Estimation of /sup 3/H-prazosin binding to the membranes isolated from caudal artery of WKY and SHR showed a single class of high affinity binding sites with Kd values: SHR, 128 +/- 14 pM; WKY, 141 +/- 19 pM and the Bmax values; SHR, 108 +/- 14 fmoles/mg protein; WKY, 113 +/- 21 fmoles/mg protein. Nifedipine inhibition of caudal artery contractions in response to NE stimulation was significantly greater (P < .05) in SHR as compared to WKY. On the other hand, there were no differences between WKY and SHR caudal artery rings either in the isometric tension development, /sup 45/Ca influx or nifedipine inhibition in response to K/sup +/-depolarization. Their results indicate that the increased vascular smooth muscle contraction in SHR in response to NE-stimulation may be due to increased Ca/sup 2 +/ influx through the receptor operated Ca/sup 2 +/ channels.

  16. Extracellular calcium sensing in rat aortic vascular smooth muscle cells

    SciTech Connect

    Smajilovic, Sanela; Hansen, Jakob Lerche; Christoffersen, Tue E.H.

    2006-10-06

    Extracellular calcium (Ca2+o) can act as a first messenger in many cell types through a G protein-coupled receptor, calcium-sensing receptor (CaR). It is still debated whether the CaR is expressed in vascular smooth muscle cells (VSMCs). Here, we report the expression of CaR mRNA and protein in rat aortic VSMCs and show that Ca2+o stimulates proliferation of the cells. The effects of Ca2+o were attenuated by pre-treatment with MAPK kinase 1 (MEK1) inhibitor, as well as an allosteric modulator, NPS 2390. Furthermore, stimulation of the VSMCs with Ca2+o-induced phosphorylation of ERK1/2, but surprisingly did not cause inositol phosphate accumulation. We were not able to conclusively state that the CaR mediates Ca2+o-induced cell proliferation. Rather, an additional calcium-sensing mechanism may exist. Our findings may be of importance with regard to atherosclerosis, an inflammatory disease characterized by abnormal proliferation of VSMCs and high local levels of calcium.

  17. Traction in smooth muscle cells varies with cell spreading

    NASA Technical Reports Server (NTRS)

    Tolic-Norrelykke, Iva Marija; Wang, Ning

    2005-01-01

    Changes in cell shape regulate cell growth, differentiation, and apoptosis. It has been suggested that the regulation of cell function by the cell shape is a result of the tension in the cytoskeleton and the distortion of the cell. Here we explore the association between cell-generated mechanical forces and the cell morphology. We hypothesized that the cell contractile force is associated with the degree of cell spreading, in particular with the cell length. We measured traction fields of single human airway smooth muscle cells plated on a polyacrylamide gel, in which fluorescent microbeads were embedded to serve as markers of gel deformation. The traction exerted by the cells at the cell-substrate interface was determined from the measured deformation of the gel. The traction was measured before and after treatment with the contractile agonist histamine, or the relaxing agonist isoproterenol. The relative increase in traction induced by histamine was negatively correlated with the baseline traction. On the contrary, the relative decrease in traction due to isoproterenol was independent of the baseline traction, but it was associated with cell shape: traction decreased more in elongated than in round cells. Maximum cell width, mean cell width, and projected area of the cell were the parameters most tightly coupled to both baseline and histamine-induced traction in this study. Wide and well-spread cells exerted larger traction than slim cells. These results suggest that cell contractility is controlled by cell spreading.

  18. LAT1 regulates growth of uterine leiomyoma smooth muscle cells.

    PubMed

    Xia Luo; Coon, John S; Su, Emily; Pearson, Elizabeth Kerry; Ping Yin; Ishikawa, Hiroshi; Bulun, Serdar E

    2010-09-01

    L-type amino acid transporter 1 (LAT1) and LAT2 were shown to encode system L, which mediates the Na(+)-independent transport of branched-chain and aromatic amino acids. We demonstrated previously that LAT2 is a progesterone receptor target gene involved in leiomyoma growth. The role of LAT1 in the regulation of human uterine leiomyoma growth, however, remains unelucidated. We herein investigated the function of LAT1 and its progesterone-mediated regulation within human uterine leiomyoma smooth muscle (LSM) cells (n = 8) and tissues (n = 29). In vivo, LAT1 expression was higher in leiomyoma than in myometrial tissue. LAT1 knockdown augmented cell proliferation and viability. Treatment of LSM cells with RU486 markedly increased LAT1 messenger RNA (mRNA) levels but decreased proliferation in a dose-dependent manner. L-type amino acid transporter 1 as a downstream target, however, did not entirely account for this antiproliferative effect of RU486 on LSM cells. Taken together, LAT1 may have a critical and complex role in regulating human leiomyoma cell growth. PMID:20601542

  19. Hydraulic Conductivity of Smooth Muscle Cell-Initiated Arterial Cocultures.

    PubMed

    Mathura, Rishi A; Russell-Puleri, Sparkle; Cancel, Limary M; Tarbell, John M

    2016-05-01

    The purpose of the study was to examine the effects of arterial coculture conditions on the transport properties of several in vitro endothelial cell (EC)-smooth muscle cell (SMC)-porous filter constructs in which SMC were grown to confluence first and then EC were inoculated. This order of culturing simulates the environment of a blood vessel wall after endothelial layer damage due to stenting, vascular grafting or other vascular wall insult. For all coculture configurations examined, we observed that hydraulic conductivity (L p) values were significantly higher than predicted by a resistances-in-series (RIS) model accounting for the L p of EC and SMC measured separately. The greatest increases were observed when EC were plated directly on top of a confluent SMC layer without an intervening filter, presumably mediated by direct EC-SMC contacts that were observed under confocal microscopy. The results are the opposite of a previous study that showed L p was significantly reduced compared to an RIS model when EC were grown to confluency first. The physiological, pathophysiological and tissue engineering implications of these results are discussed. PMID:26265460

  20. Airway smooth muscle growth from the perspective of animal models.

    PubMed

    Martin, James G; Ramos-Barbón, David

    2003-09-16

    Airway smooth muscle maintains airway tone and may assist in adjusting ventilation distribution within the normal lung. Alterations in the properties or the quantity of ASM are likely responsible for some instances of airways hyperresponsiveness to bronchoconstrictive stimuli that is a characteristic of diseases such as asthma. Morphometric studies have shown an increase in the mass of ASM in human asthmatic airways. Animal models have been developed that confirm that ASM can be induced to grow by allergic sensitization and challenge. Growth is in large part by hyperplasia as measured by incorporation of bromodeoxyuridine as a marker of the S-phase of the cell cycle. T cells, in particular CD4+ cells, may participate in the stimulation of growth of ASM by allergen challenge. The growth factors responsible for the increase in ASM are as yet unidentified but two mediators associated with allergic airway responses, cysteinyl leukotrienes and endothelin, have been implicated using specific receptor antagonists. The links between T cells and the biochemical mediators of growth have not been established. PMID:14516730

  1. Arteriolar vascular smooth muscle cells: mechanotransducers in a complex environment.

    PubMed

    Hill, Michael A; Meininger, Gerald A

    2012-09-01

    Contraction of small artery (diameters typically less than 250 μm) vascular smooth muscle cells (VSMCs) plays a critical role in local control of blood flow and arterial pressure through its affect on vascular caliber. Specifically, contraction of small arteries in response to increased intraluminal pressure is referred to as the myogenic response and represents an important role for mechanotransduction. Critical questions remain as to how changes in pressure are sensed by VSMCs and transduced across the cell membrane to tune the contractile state of the cell. Recent studies suggest a pivotal role for interactions between VSMCs and extracellular matrix (ECM) proteins. Thus, pressure-induced deformation of ECM proteins and their cell surface receptors (for example, integrins) may initiate contraction and cytoskeletal remodeling through modulation of ion channels, membrane depolarization, increased intracellular Ca(2+) and actomyosin crossbridge cycling. Importantly, it is argued that the contractile properties of small artery VSMCs reflect an intimate and integrated interaction with their extracellular environment and the three-dimensional structure of the vessel wall. PMID:22677491

  2. Angiotensin II-Induced Migration of Vascular Smooth Muscle Cells Is Mediated by p38 Mitogen-Activated Protein Kinase-Activated c-Src Through Spleen Tyrosine Kinase and Epidermal Growth Factor Receptor Transactivation

    PubMed Central

    Mugabe, Benon E.; Yaghini, Fariborz A.; Song, Chi Young; Buharalioglu, Cuneyt K.; Waters, Christopher M.

    2010-01-01

    Angiotensin II (Ang II) stimulates protein synthesis by activating spleen tyrosine kinase (Syk) and DNA synthesis through epidermal growth factor receptor (EGFR) transactivation in vascular smooth muscle cells (VSMCs). This study was conducted to determine whether Syk mediates Ang II-induced migration of aortic VSMCs using a scratch wound approach. Treatment with Ang II (200 nM) for 24 h increased VSMC migration by 1.56 ± 0.14-fold. Ang II-induced VSMC migration and Syk phosphorylation as determined by Western blot analysis were minimized by the Syk inhibitor piceatannol (10 μM) and by transfecting VSMCs with dominant-negative but not wild-type Syk plasmid. Ang II-induced VSMC migration and Syk phosphorylation were attenuated by inhibitors of c-Src [4-amino-5-(4-chlorophenyl)-7-(t-butyl)pyrazolo[3,4-d]pyrimidine (PP2)], p38 mitogen-activated protein kinase (MAPK) [4-(4-fluorophenyl)-2-(4-hydroxyphenyl)-5-(4-pyridyl)1H-imidazole (SB202190)], and extracellular signal-regulated kinase (ERK) 1/2 [1,4-diamino-2,3-dicyano-1,4-bis(2-aminophenylthio) butadiene (U0126)]. SB202190 attenuated p38 MAPK and c-Src but not ERK1/2 phosphorylation, indicating that p38 MAPK acts upstream of c-Src and Syk. The c-Src inhibitor PP2 attenuated Syk and ERK1/2 phosphorylation, suggesting that c-Src acts upstream of Syk and ERK1/2. Ang II- and epidermal growth factor (EGF)-induced VSMC migration and EGFR phosphorylation were inhibited by the EGFR blocker 4-(3-chloroanilino)-6,7-dimethoxyquinazoline (AG1478) (2 μM). Neither the Syk inhibitor piceatannol nor the dominant-negative Syk mutant altered EGF-induced cell migration or Ang II- and EGF-induced EGFR phosphorylation. The c-Src inhibitor PP2 diminished EGF-induced VSMC migration and EGFR, ERK1/2, and p38 MAPK phosphorylation. The ERK1/2 inhibitor U0126 (10 μM) attenuated EGF-induced cell migration and ERK1/2 but not EGFR phosphorylation. These data suggest that Ang II stimulates VSMC migration via p38 MAPK-activated c-Src through

  3. Angiotensin II-induced migration of vascular smooth muscle cells is mediated by p38 mitogen-activated protein kinase-activated c-Src through spleen tyrosine kinase and epidermal growth factor receptor transactivation.

    PubMed

    Mugabe, Benon E; Yaghini, Fariborz A; Song, Chi Young; Buharalioglu, Cuneyt K; Waters, Christopher M; Malik, Kafait U

    2010-01-01

    Angiotensin II (Ang II) stimulates protein synthesis by activating spleen tyrosine kinase (Syk) and DNA synthesis through epidermal growth factor receptor (EGFR) transactivation in vascular smooth muscle cells (VSMCs). This study was conducted to determine whether Syk mediates Ang II-induced migration of aortic VSMCs using a scratch wound approach. Treatment with Ang II (200 nM) for 24 h increased VSMC migration by 1.56 +/- 0.14-fold. Ang II-induced VSMC migration and Syk phosphorylation as determined by Western blot analysis were minimized by the Syk inhibitor piceatannol (10 microM) and by transfecting VSMCs with dominant-negative but not wild-type Syk plasmid. Ang II-induced VSMC migration and Syk phosphorylation were attenuated by inhibitors of c-Src [4-amino-5-(4-chlorophenyl)-7-(t-butyl)pyrazolo[3,4-d]pyrimidine (PP2)], p38 mitogen-activated protein kinase (MAPK) [4-(4-fluorophenyl)-2-(4-hydroxyphenyl)-5-(4-pyridyl)1H-imidazole (SB202190)], and extracellular signal-regulated kinase (ERK) 1/2 [1,4-diamino-2,3-dicyano-1,4-bis(2-aminophenylthio) butadiene (U0126)]. SB202190 attenuated p38 MAPK and c-Src but not ERK1/2 phosphorylation, indicating that p38 MAPK acts upstream of c-Src and Syk. The c-Src inhibitor PP2 attenuated Syk and ERK1/2 phosphorylation, suggesting that c-Src acts upstream of Syk and ERK1/2. Ang II- and epidermal growth factor (EGF)-induced VSMC migration and EGFR phosphorylation were inhibited by the EGFR blocker 4-(3-chloroanilino)-6,7-dimethoxyquinazoline (AG1478) (2 microM). Neither the Syk inhibitor piceatannol nor the dominant-negative Syk mutant altered EGF-induced cell migration or Ang II- and EGF-induced EGFR phosphorylation. The c-Src inhibitor PP2 diminished EGF-induced VSMC migration and EGFR, ERK1/2, and p38 MAPK phosphorylation. The ERK1/2 inhibitor U0126 (10 microM) attenuated EGF-induced cell migration and ERK1/2 but not EGFR phosphorylation. These data suggest that Ang II stimulates VSMC migration via p38 MAPK-activated c

  4. The role of K+ conductances in regulating membrane excitability in human gastric corpus smooth muscle

    PubMed Central

    Lee, Ji Yeon; Ko, Eun-ju; Ahn, Ki Duck; Kim, Sung

    2015-01-01

    Changes in resting membrane potential (RMP) regulate membrane excitability. K+ conductance(s) are one of the main factors in regulating RMP. The functional role of K+ conductances has not been studied the in human gastric corpus smooth muscles (HGCS). To examine the role of K+ channels in regulation of RMP in HGCS we employed microelectrode recordings, patch-clamp, and molecular approaches. Tetraethylammonium and charybdotoxin did not affect the RMP, suggesting that BK channels are not involved in regulating RMP. Apamin, a selective small conductance Ca2+-activated K+ channel (SK) blocker, did not show a significant effect on the membrane excitability. 4-Aminopyridine, a Kv channel blocker, caused depolarization and increased the duration of slow wave potentials. 4-Aminopyridine also inhibited a delayed rectifying K+ current in isolated smooth muscle cells. End-product RT-PCR gel detected Kv1.2 and Kv1.5 in human gastric corpus muscles. Glibenclamide, an ATP-sensitive K+ channel (KATP) blocker, did not induce depolarization, but nicorandil, a KATP opener, hyperpolarized HGCS, suggesting that KATP are expressed but not basally activated. Kir6.2 transcript, a pore-forming subunit of KATP was expressed in HGCS. A low concentration of Ba2+, a Kir blocker, induced strong depolarization. Interestingly, Ba2+-sensitive currents were minimally expressed in isolated smooth muscle cells under whole-cell patch configuration. KCNJ2 (Kir2.1) transcript was expressed in HGCS. Unique K+ conductances regulate the RMP in HGCS. Delayed and inwardly rectifying K+ channels are the main candidates in regulating membrane excitability in HGCS. With the development of cell dispersion techniques of interstitial cells, the cell-specific functional significance will require further analysis. PMID:25591864

  5. Effect of some smooth muscle relaxant drugs on calcium-related phenomena.

    PubMed

    Ronca-Testoni, S; Hrelia, S; Hakim, G; Ronca, G; Rossi, C A

    1984-04-30

    Some smooth muscle relaxant drugs devoid of anticholinergic action have been tested for their interaction with calmodulin, calmodulin-stimulated cyclic nucleotide phosphodiesterase activity, and uterine membrane binding sites for nitrendipine and adenosine. The myolytic activity of octylonium bromide and pinaverium bromide may be due to their interaction with calmodulin-dependent systems. Trimebutine maleate does not bind either to calmodulin or to nitrendipine and adenosine receptors. Tiropramide has no effect on calmodulin-dependent systems and on Ca2+ channels but it shows a competition for the A2-type adenosine receptors. PMID:6329247

  6. Stretch-dependent potassium channels in murine colonic smooth muscle cells.

    PubMed

    Koh, S D; Sanders, K M

    2001-05-15

    Gastrointestinal muscles are able to maintain negative resting membrane potentials in spite of stretch. We investigated whether stretch-dependent K+ channels might contribute to myogenic regulation of smooth muscle cells from the mouse colon. Negative pressure applied to on-cell membrane patches activated K+ channels that were voltage independent and had a slope conductance of 95 pS in symmetrical K+ gradients. The effects of negative pressure on open probability were graded as a function of pressure and reversible when atmospheric pressure was restored. Cell elongation activated K+ channels with the same properties as those activated by negative pressure, suggesting that the channels were stretch-dependent K+ (SDK) channels. Channels with the same properties were maximally activated by patch excision, suggesting that either an intracellular messenger or interactions with the cytoskeleton regulate open probability. Internal 4-aminopyridine, Ca2+ (10(-8) to 10(-6) M), and tetraethylammonium (internal or external) were without effect on SDK channels. Nitric oxide donors (and cell-permeant cGMP analogues) activated SDK channels, suggesting that these channels may mediate a portion of the enteric inhibitory neural response in colonic muscles. In summary, SDK channels are an important conductance expressed by colonic muscle cells. SDK channels may stabilize membrane potential during dynamic changes in cell length and mediate responses to enteric neurotransmitters. PMID:11351024

  7. Ethylacetate fraction from Korean seaside starfish, Asterias amurensis, has an inhibitory effect on MMP-9 activity and expression and on migration behavior of TNF-α induced human aortic smooth muscle cells.

    PubMed

    Suh, Seok-Jong; Ko, Hyun-Kwon; Song, Kwon-Ho; Kim, Jeong-Ran; Kwon, Kyung-Min; Chang, Young-Chae; Lee, Young-Choon; Kim, Dong-Soo; Park, Sung-Jae; Yang, Ju Hye; Son, Jong-Keun; Na, Min-Kyun; Chang, Hyeun-Wook; Kim, Cheorl-Ho

    2011-06-01

    Atherosclerosis is accompanied by the proliferation of human aortic smooth muscle cells (HASMC) and their movement into the intima. Many reports have indicated the involvement of gelatinases (MMP-9 and MMP-2) in this pathogenesis. The ethylacetate fraction from starfish, Asterias amurensis (EFA), harvested from the Korean seaside has an inhibitory effect on MMP-9 and MMP-2 activities, as well as on the expression of MMP-9 in TNF-α induced HASMC in a dose-dependent manner. Also, EFA inhibits the migration of TNF-α induced HASMC in transwells containing gelatin coated plugs. EFA was not cytotoxic to HASMC over the range 0-1mg/ml. By Western-blot analysis, it was revealed that the phosphorylation of extracellular signal regulated kinase (ERK) in TNF-α induced cells was inhibited and nuclear factor kappa B (NF-κB) p65 levels in nuclear extracts were decreased by EFA treatment. In addition, ERK inhibitor (U0126) treated cells exhibited decreased MMP-9 activity in the zymographic assay. From these results, it was found that the gelatinolytic activity was regulated (1) by enzymatic inhibition of both MMP-9 and MMP-2, as well as (2) by the decreased production of MMP-9 via ERK pathways in EFA treated HASMCs. Taken together, it has been shown that EFA has a putative anti-atherosclerotic effect. PMID:21276846

  8. Co-cultures of human coronary smooth muscle cells and dimethyl sulfoxide-differentiated HL60 cells upregulate ProMMP9 activity and promote mobility-modulation by reactive oxygen species.

    PubMed

    Bernard, Yohann; Melchior, Chantal; Tschirhart, Eric; Bueb, Jean-Luc

    2008-10-01

    Vascular cells and leukocytes, involved in the development of atherosclerosis, produce cytokines and/or reactive oxygen species (ROS) and matrix metalloproteinases (MMPs) implicated in cell mobility. We investigated by co-culture experiments the effects of human coronary smooth muscle cells (HCSMC) on MMPs characteristics and mobility of neutrophil-like dimethyl sulfoxide-differentiated HL60 cells (not equal HL60). The effects of superoxide dismutase (SOD) and catalase were also analyzed. All the studied MMP2 characteristics remained unchanged. HCSMC stimulated MMP9 protein level, activity and mobility of not equal HL60 cells and expressed and secreted a variety of cytokines implicated in atherosclerosis. SOD and catalase increased MMP9 expression, protein level and activity of not equal HL60, but migration of not equal HL60 cells was only decreased by catalase, demonstrating that ROS are more efficient in modulating MMP9 activity of not equal HL60 than their mobility. Finally, HCSMC being able to stimulate not equal HL60, their co-cultures may represent an in vitro approach to study cellular interactions occurring in vivo during atherosclerosis. PMID:18665441

  9. Distinctive G Protein-Dependent Signaling by Protease-Activated Receptor 2 (PAR2) in Smooth Muscle: Feedback Inhibition of RhoA by cAMP-Independent PKA

    PubMed Central

    Sriwai, Wimolpak; Mahavadi, Sunila; Al-Shboul, Othman; Grider, John R.; Murthy, Karnam S.

    2013-01-01

    We examined expression of protease-activated receptors 2 (PAR2) and characterized their signaling pathways in rabbit gastric muscle cells. The PAR2 activating peptide SLIGRL (PAR2-AP) stimulated Gq, G13, Gi1, PI hydrolysis, and Rho kinase activity, and inhibited cAMP formation. Stimulation of PI hydrolysis was partly inhibited in cells expressing PAR2 siRNA, Gaq or Gai minigene and in cells treated with pertussis toxin, and augmented by expression of dominant negative regulator of G protein signaling (RGS4(N88S)). Stimulation of Rho kinase activity was abolished by PAR-2 or Ga13 siRNA, and by Ga13 minigene. PAR2-AP induced a biphasic contraction; initial contraction was selectively blocked by the inhibitor of PI hydrolysis (U73122) or MLC kinase (ML-9), whereas sustained contraction was selectively blocked by the Rho kinase inhibitor (Y27632). PAR2-AP induced phosphorylation of MLC20, MYPT1 but not CPI-17. PAR2-AP also caused a decrease in the association of NF-kB and PKA catalytic subunit: the effect of PAR2-AP was blocked by PAR2 siRNA or phosphorylation-deficient RhoA (RhoA(S188A)). PAR2-AP-induced degradation of IkBa and activation of NF-kB were abolished by the blockade of RhoA activity by Clostridium botulinum C3 exoenzyme suggesting RhoA-dependent activation of NF-kB. PAR2-AP-stimulated Rho kinase activity was significantly augmented by the inhibitors of PKA (myristoylated PKI), IKK2 (IKKIV) or NF-kB (MG132), and in cells expressing dominant negative mutants of IKK (IKK(K44A), IkBa (IkBa (S32A/S36A)) or RhoA(S188A), suggesting feedback inhibition of Rho kinase activity via PKA derived from NF-kB pathway. PAR2-AP induced phosphorylation of RhoA and the phosphorylation was attenuated in cells expressing phosphorylation-deficient RhoA(S188A). Our results identified signaling pathways activated by PAR2 to mediate smooth muscle contraction and a novel pathway for feedback inhibition of PAR2-stimulated RhoA. The pathway involves activation of the NF-kB to release

  10. Platelet-derived-growth-factor stimulation of the p42/p44 mitogen-activated protein kinase pathway in airway smooth muscle: role of pertussis-toxin-sensitive G-proteins, c-Src tyrosine kinases and phosphoinositide 3-kinase.

    PubMed Central

    Conway, A M; Rakhit, S; Pyne, S; Pyne, N J

    1999-01-01

    The mechanism used by the platelet-derived growth factor receptor (PDGFR) to activate the mitogen-activated- protein-kinase (p42/p44 MAPK) pathway was investigated in cultured airway smooth muscle (ASM) cells. We have found that pertussis toxin (PTX, which was used to inactivate the heterotrimeric G-protein Gi) induced an approx. 40-50% decrease in the activation of c-Src and p42/p44 MAPK by PDGF. An essential role for c-Src was confirmed using the c-Src inhibitor, PP1, which abolished p42/p44 MAPK activation (PP1 and PTX were without effect on PDGFR tyrosine phosphorylation). Furthermore, the PTX-dependent decrease in c-Src and p42/p44 MAPK activation appeared correlated. These findings suggest that the PDGFR can utilize the PTX-sensitive G-protein, Gi, to regulate c-Src and subsequent p42/p44 MAPK activation. Phosphoinositide 3-kinase (PI3K) has been shown by others to be involved in p42/p44 MAPK activation. This is confirmed here by experiments which showed that PI3K inhibitors (wortmannin and LY294002) reduced the activation of p42/p44 MAPK by PDGF. PI3K activity was increased in Grb-2 immunoprecipitates from PDGF-stimulated cells and was decreased by pretreating these cells with PTX. These findings show that Gi might also promote Grb-2-PI3K complex formation and that Grb-2 may be a site at which PI3K is integrated into the p42/p44 MAPK cascade. In conclusion, our results demonstrate that Gi enables the PDGFR to signal more efficiently to p42/p44 MAPK, and this appears to be achieved through the regulation of c-Src and Grb-2/PI3K, which are intermediates in the p42/p44 MAPK cascade. PMID:9882612

  11. Sphingosine 1-phosphate stimulation of the p42/p44 mitogen-activated protein kinase pathway in airway smooth muscle. Role of endothelial differentiation gene 1, c-Src tyrosine kinase and phosphoinositide 3-kinase.

    PubMed Central

    Rakhit, S; Conway, A M; Tate, R; Bower, T; Pyne, N J; Pyne, S

    1999-01-01

    We report here that cultured airway smooth muscle cells contain transcripts of endothelial differentiation gene 1 (EDG-1), a prototypical orphan Gi-coupled receptor whose natural ligand is sphingosine 1-phosphate (S1P). This is consistent with data that showed that S1P activated both c-Src and p42/p44 mitogen-activated protein kinase (p42/p44 MAPK) in a pertussis toxin (PTX)-sensitive manner in these cells. An essential role for c-Src was confirmed by using the c-Src inhibitor, PP1, which markedly decreased p42/p44 MAPK activation. We have also shown that phosphoinositide 3-kinase (PI-3K) inhibitors (wortmannin and LY294002) decreased p42/p44 MAPK activation. An essential role for PI-3K was supported by experiments that showed that PI-3K activity was increased in Grb-2 immunoprecipitates from S1P-stimulated cells. Significantly, Grb-2 associated PI-3K activity was decreased by pretreatment of cells with PTX. Finally, we have shown that the co-stimulation of cells with platelet-derived growth factor (PDGF) and S1P (which failed to stimulate DNA synthesis) elicited a larger p42/p44 MAPK activation over a 30 min stimulation compared with each agonist alone. This was associated with a S1P-dependent increase in PDGF-stimulated DNA synthesis. These results demonstrate that S1P activates c-Src and Grb-2-PI-3K (intermediates in the p42/p44 MAPK cascade) via a PTX-sensitive mechanism. This action of S1P is consistent with the stimulation of EDG-1 receptors. S1P might also function as a co-mitogen with PDGF, producing a more robust activation of a common permissive signal transduction pathway linked to DNA synthesis. PMID:10051434

  12. Vitamin E mediated response of smooth muscle cell to oxidant stress.

    PubMed

    Azzi, A; Boscoboinik, D; Clément, S; Ozer, N; Ricciarelli, R; Stocker, A

    1999-09-01

    Oxidant stress is associated with diminution of antioxidant molecules, such as alpha-tocopherol. Alpha-tocopherol specifically decreases, in a concentration dependent way, the proliferation of vascular smooth muscle cells. At the same concentrations (10-50 microM) it induces inhibition of protein kinase C (PKC) activity. The latter event is not due to a decrease in PKC level or to alpha-tocopherol binding to PKC, but it results from increase of protein phosphatase 2A1 activity. In vitro data, as well as at a cellular level, demonstrates that protein phosphatase 2A1 is activated, in its trimeric structure--but not as a dimer by alpha-tocopherol. This activation is followed by PKC-alpha dephosphorylation. The activation of protein phosphatase 2A1 and deactivation of PKC-alpha affect the AP1 transcription factor, resulting in a change in the composition and the binding of this factor to DNA. By transfecting smooth muscle cell with a construct containing three TRE (TPA responsive elements), the promoter thymidine kinase and the reporter gene chloramphenicol-acetyl-transferase a modulation of gene expression by alpha-tocopherol is observed. Beta-tocopherol does not cause any of the responses observed with alpha-tocopherol and R,R,R-alpha-tocopherol is twice as potent as all-rac-alpha-tocopherol. When added together, beta-tocopherol prevents the effects of alpha-tocopherol indicating that the mechanism involved is not related to the radical-scavenging properties of these two molecules, which are essentially equal. By differential display analysis it has been found that several genes of smooth muscle cells are differentially transcribed in the presence of alpha-tocopherol but not beta-tocopherol. In particular, the gene of alpha-tropomyosin shows a transient enhancement of transcription as a function of the cell cycle time. Alpha-tropomyosin translation is also increased by alpha-tocopherol and not by beta-tocopherol. Because no changes of mRNA stability can be observed

  13. Nitric oxide suppresses a Ca(2+)-stimulated Cl- current in smooth muscle cells of opossum esophagus.

    PubMed

    Zhang, Y; Vogalis, F; Goyal, R K

    1998-05-01

    Nitric oxide (NO) hyperpolarizes visceral smooth muscles. Using the patch-clamp technique, we investigated the possibility that NO-mediated hyperpolarization in the circular muscle of opossum esophagus results from the suppression of a Ca(2+)-stimulated Cl- current. Smooth muscle cells were dissociated from the circular layer and bathed in high-K+ Ca(2+)-EGTA-buffered solution. Macroscopic ramp currents were recorded from cell-attached patches. Contaminating K(+)-channel currents were blocked with tetrapentylammonium chloride (200 microM) added to all solutions. Raising bath Ca2+ concentration above 150 nM in the presence of A-23187 (10 microM) activated a leak current (IL-Ca) with an EC50 of 1.2 microM at -100 mV. The reversal potential (Erev) of IL-Ca (-8.5 +/- 1.8 mV, n = 8) was significantly different (P < 0.05) from Erev of the background current (+4.2 +/- 1.2 mV, n = 8). Equimolar substitution of 135 mM Cl- in the pipette solution with gluconate significantly shifted Erev of IL-Ca to +16.6 +/- 3.4 mV (n = 4) (P < 0.05 compared with background), whereas replacement of total Na+ with Tris+ suppressed IL-Ca but did not affect Erev (-15 +/- 3 mV, n = 3; P > 0.05). IL-Ca was inhibited by DIDS (500 microM). Diethylenetriamine-NO adduct (200 microM), a NO donor, and 8-bromo-cGMP (200 microM) suppressed IL-Ca by 59 +/- 15% (n = 5) and 62 +/- 21% (n = 4) at -100 mV, respectively. We conclude that in opossum esophageal smooth muscle NO-mediated hyperpolarization may be produced by suppression of a Ca(2+)-stimulated Cl(-)-permeable conductance via formation of cGMP. PMID:9612270

  14. Establishment of an interleukin-1β-induced inflammation-activated endothelial cell-smooth muscle cell-mononuclear cell co-culture model and evaluation of the anti-inflammatory effects of tanshinone IIA on atherosclerosis.

    PubMed

    Li, Yujie; Guo, Yan; Chen, Ying; Wang, Yajie; You, Yun; Yang, Qing; Weng, Xiaogang; Li, Qi; Zhu, Xiaoxin; Zhou, Bingbing; Liu, Xucen; Gong, Zaipeng; Zhang, Ruijie

    2015-08-01

    Increasing evidence supports the hypothesis that inflammatory reactions serves an important function in the formation, progression and plaque rupture of atherosclerosis. Interleukin (IL)-1 primarily induces inflammation and is closely associated with the inflammatory environment and the formation of atherosclerosis. The present study aimed to establish an in vitro model for the evaluation of drug efficacy in the intervention of atherosclerosis from the inflammatory perspective, and to observe the anti-inflammatory effects of tanshinone IIA and andrographolide on atherosclerosis. The IL-1β-induced inflammation-activated endothelial cell (EC)-smooth muscle cell (SMC)-mononuclear cell (MC) co-culture model was established, based on the changes in a series of atherosclerosis-associated inflammatory markers secreted by ECs and SMCs. The expression of connexin in ECs, adhesion of MCs and changes in inflammatory signalling molecules were selected as evaluation indices for the inflammatory microenvironment of atherosclerosis. The use of this model revealed that tanshinone IIA exhibited significant efficacy against atherosclerosis and its inflammatory reactions. Inflammatory reactions were regarded as the primary mechanism underlying atherosclerosis. The established model simulated a series of relevant changes in the arterial wall under the inflammatory cytokines with oxidized low-density lipoprotein during the atherosclerotic process. The present study presented a reliable method for the identification of drugs with potential anti-inflammatory activity in atherosclerosis, for investigating the mechanisms of action, considering the improvement of the inflammatory state and the increase in plaque stability observed. PMID:25936371

  15. MODULAR STRUCTURE OF SMOOTH MUSCLE MYOSIN LIGHT CHAIN KINASE: HYDRODYNAMIC MODELING AND FUNCTIONAL IMPLICATIONS†

    PubMed Central

    Mabuchi, Yasuko; Mabuchi, Katsuhide; Stafford, Walter F.; Grabarek, Zenon

    2010-01-01

    Smooth muscle myosin light chain kinase (smMLCK) is a calcium/calmodulin dependent enzyme that activates contraction of smooth muscle. The polypeptide chain of rabbit uterine smMLCK (Swiss-Prot: P29294) contains the catalytic/regulatory domain, three immunoglobulin related motifs (Ig), one fibronectin related motif (Fn3), a repetitive, proline rich segment (PEVK) and, at the N-terminus, a unique F-actin binding domain. We have evaluated the spatial arrangement of these domains in a recombinant 125 kDa full-length smMLCK and its two catalytically active C-terminal fragments (77 kDa, residues 461-1147 and 61 kDa, residues 461-1002). Electron microscopic images of smMLCK cross-linked to F-actin show particles at variable distance (11-55 nm) from the filament, suggesting that a well-structured C-terminal segment of smMLCK is connected to the actin-binding domain by a long, flexible tether. We have used structural homology and molecular dynamics methods to construct various all-atom representation models of smMLCK and its two fragments. The theoretical sedimentation coefficients computed with the program HYDROPRO were compared with those determined by sedimentation velocity. We found agreement between the predicted and observed sedimentation coefficients for models in which the independently folded catalytic domain, Fn3 and Ig domains are aligned consecutively on the long axis of the molecule. The PEVK segment is modeled as an extensible linker that enables smMLCK to remain bound to F-actin and simultaneously activate the myosin heads of adjacent myosin filaments at a distance of 40 nm or more. The structural properties of smMLCK may contribute to the elasticity of smooth muscle cells. PMID:20196616

  16. Effect of pinaverium bromide on stress-induced colonic smooth muscle contractility disorder in rats

    PubMed Central

    Dai, Yun; Liu, Jian-Xiang; Li, Jun-Xia; Xu, Yun-Feng

    2003-01-01

    AIM: To investigate the effect of pinaverium bromide, a L-type calcium channel blocker with selectivity for the gastrointestinal tract on contractile activity of colonic circular smooth muscle in normal or cold-restraint stressed rats and its possible mechanism. METHODS: Cold-restraint stress was conducted on rats to increase fecal pellets output. Each isolated colonic circular muscle strip was suspended in a tissue chamber containing warm oxygenated Tyrode-Ringer solution. The contractile response to ACh or KCl was measured isometrically on ink-writing recorder. Incubated muscle in different concentrations of pinaverium and the effects of pinaverium were investigated on ACh or KCl-induced contraction. Colon smooth muscle cells were cultured from rats and [Ca2+]i was measured in cell suspension using the Ca2+ fluorescent dye fura-2/AM. RESULTS: During stress, rats fecal pellet output increased 61% (P < 0.01). Stimulated with ACh or KCl, the muscle contractility was higher in stress than that in control. Pinaverium inhibited the increment of [Ca2+]i and the muscle contraction in response to ACh or KCl in a dose dependent manner. A significant inhibition of pinaverium to ACh or KCl induced [Ca2+]i increment was observed at 10-6 mol/L. The IC50 values for inhibition of ACh induced contraction for the stress and control group were 1.66 × 10-6 mol/L and 0.91 × 10-6 mol/L, respectively. The IC50 values for inhibition of KCl induced contraction for the stress and control group were 8.13 × 10-7 mol/L and 3.80 × 10-7 mol/L, respectively. CONCLUSION: Increase in [Ca2+]i of smooth muscle cells is directly related to the generation of contraction force in colon. L-type Ca2+ channels represent the main route of Ca2+ entry. Pinaverium inhibits the calcium influx through L-type channels; decreases the contractile response to many kinds of agonists and regulates the stress-induced colon hypermotility. PMID:12632518

  17. Caveolin-3 Promotes a Vascular Smooth Muscle Contractile Phenotype

    PubMed Central

    Gutierrez-Pajares, Jorge L.; Iturrieta, Jeannette; Dulam, Vipin; Wang, Yu; Pavlides, Stephanos; Malacari, Gabriella; Lisanti, Michael P.; Frank, Philippe G.

    2015-01-01

    Epidemiological studies have demonstrated the importance of cardiovascular diseases in Western countries. Among the cell types associated with a dysfunctional vasculature, smooth muscle (SM) cells are believed to play an essential role in the development of these illnesses. Vascular SM cells are key regulators of the vascular tone and also have an important function in the development of atherosclerosis and restenosis. While in the normal vasculature, contractile SM cells are predominant, in atherosclerotic vascular lesions, synthetic cells migrate toward the neointima, proliferate, and synthetize extracellular matrix proteins. In the present study, we have examined the role of caveolin-3 in the regulation of SM cell phenotype. Caveolin-3 is expressed in vivo in normal arterial SM cells, but its expression appears to be lost in cultured SM cells. Our data show that caveolin-3 expression in the A7r5 SM cell line is associated with increased expression of contractility markers such as SM α-actin, SM myosin heavy chain but decreased expression of the synthetic phenotype markers such as p-Elk and Klf4. Moreover, we also show that caveolin-3 expression can reduce proliferation upon treatment with LDL or PDGF. Finally, we show that caveolin-3-expressing SM cells are less sensitive to apoptosis than control cells upon treatment with oxidized LDL. Taken together, our data suggest that caveolin-3 can regulate the phenotypic switch between contractile and synthetic SM cells. A better understanding of the factors regulating caveolin-3 expression and function in this cell type will permit the development of a better comprehension of the factors regulating SM function in atherosclerosis and restenosis. PMID:26664898

  18. Regulation of smooth muscle cell phenotype by glycosaminoglycan identity.

    PubMed

    Qu, Xin; Jimenez-Vergara, Andrea Carolina; Munoz-Pinto, Dany J; Ortiz, Diana; McMahon, Rebecca E; Cristancho, Deissy; Becerra-Bayona, Silvia; Guiza-Arguello, Viviana; Grande-Allen, K Jane; Hahn, Mariah S

    2011-03-01

    The retention of lipoproteins in the arterial intima is an initial event in early atherosclerosis and occurs, in part, through interactions between negatively charged glycosaminoglycans (GAGs) and the positively charged residues of apolipoproteins. Smooth muscle cells (SMCs) which infiltrate into the lipoprotein-enriched intima have been observed to transform into lipid-laden foam cells. This phenotypic switch is associated with SMC acquisition of a macrophage-like capacity to phagocytose lipoproteins and/or of an adipocyte-like capacity to synthesize fatty acids de novo. The aim of the present work was to explore the impact of GAG identity on SMC foam cell formation using a scaffold environment intended to be mimetic of early atherosclerosis. In these studies, we focused on chondroitin sulfate C (CSC), dermatan sulfate (DS), and an intermediate molecular weight hyaluronan (HAIMW, ∼400 kDa), the levels and/or distribution of each of which are significantly altered in atherosclerosis. DS hydrogels were associated with greater SMC phagocytosis of apolipoprotein B than HAIMW gels. Similarly, only SMCs in DS constructs maintained increased expression of the adipocyte marker A-FABP relative to HAIMW gels over 35 days of culture. The increased SMC foam cell phenotype in DS hydrogels was reflected in a corresponding decrease in SMC myosin heavy chain expression in these constructs relative to HAIMW gels at day 35. In addition, this DS-associated increase in foam cell formation was mirrored in an increased SMC synthetic phenotype, as evidenced by greater levels of collagen type I and glucose 6-phosphate dehydrogenase in DS gels than in HAIMW gels. Combined, these results support the increasing body of literature that suggests a critical role for DS-bearing proteoglycans in early atherosclerosis. PMID:21094702

  19. Distribution of a lanthanide (147 Pm) in vascular smooth muscle.

    PubMed

    Weiss, G B; Goodman, F R

    1976-08-01

    In order to ascertain whether trivalent rare earth ions such as lanthanum (La+++) penetrate the cell membrane under physiological conditions, the extracellular and cellular distribution of promethium (147 Pm), a carrier-free rare earth radioisotope, was examined in rabbit aortic smooth muscle. As the duration of incubation was lengthened, uptake of 147Pm continued to increase; it was inhibited by La+++ and other rare earth ions (Nd+++, Lu+++) only when the 147 Pm/rare earth concentration ratio exceeded 1:10(6). However, equally high concentrations of Ca++ had no effect on 147Pm uptake. Efflux of 147Pm was only transiently increased by 1.5 mM La+++, and exposure to 0.05 mM EDTA elicited an increased 147Pm efflux with both transient and maintained components. The magnitude of the EDTA-induced increase in 147 Pm efflux was similar over a 30-fold range of EDTA concentration (0.05-1.5 mM); the limiting factor for 147Pm efflux is the rate of 147Pm desorption from the tissue rather than the extracellular concentration of EDTA. Loss of 147Pm in the presence of 0.05 mM EDTA could be described in terms of two specific washout components (the more rapid of which included 147Pm within the extracellular space and the slower of which had half-times of washout of approximately 7-10 minutes). Uptake of 147Pm was inhibited by lowering the incubation solution temperature to 0 degrees C or by procaine. However, concentrations of metabolic inhibitors (iodoacetate and dinitrophenol) which diminish loss of Ca++ from the cell did not decrease either the uptake or efflux of 147Pm. Thus, significant quantities of 147Pm do not appear to be accumulated within the cell or transported out of the cell; distribution of 147Pm can be most simply described in terms of a binding at and desorption from surface acessible fiber sites. PMID:820850

  20. Interaction of chicken gizzard smooth muscle calponin with brain microtubules.

    PubMed

    Fujii, T; Hiromori, T; Hamamoto, M; Suzuki, T

    1997-08-01

    Calponin, a major actin-, tropomyosin-, and calmodulin-binding protein in smooth muscle, interacted with tubulin, a main constituent of microtubules, in a concentration-dependent fashion in vitro. The apparent K(d) value of calponin to tubulin was calculated to be 5.2 microM with 2 mol of calponin maximally bound per 1 mol of tubulin. At low ionic strength, tubulin bound to calponin immobilized on Sepharose 4B, and the bound protein was released at about 270 mM NaCl. Chemical cross-linking experiments showed that a 1:1 molar covalent complex of calponin and tubulin was produced. The amount of calponin bound to microtubules decreased with increasing ionic strength or Ca2+ concentration. The addition of calmodulin or S100 to the mixture of calponin and microtubule proteins caused the removal of calponin from microtubules in the presence of Ca2+, but not in the presence of EGTA. Calponin-related proteins including tropomyosin, SM22, and caldesmon had little effect on the calponin binding to microtubules, whereas MAP2 inhibited the binding. Interestingly, there was little, if any, effect of mycalolide B-treated actin on the binding of calponin to microtubules. Furthermore, only about 20% of calponin-F-actin interaction was inhibited in the presence of an excess amount of tubulin (4 mol per mol of calponin), indicating that tubulin binds to calponin at a different site from that of actin. Compared with MAP2, calponin had little effect on microtubule polymerization. PMID:9378712

  1. MECHANISM BY WHICH AVENANTHRAMIDE-C, A POLYPHENOL OF OATS, BLOCKS CELL CYCLE PROGRESSION IN VASCULAR SMOOTH MUSCLE CELLS

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Avenanthramides (Avn) are unique polyphenols present in oats. We have reported that Avn-c, one of the major forms of Avn with the most antioxidant activity, inhibited the proliferation of vascular smooth muscle cells (SMC), an important process in the development of atherosclerosis and restenosis fo...

  2. The neuropeptide catestatin promotes vascular smooth muscle cell proliferation through the Ca{sup 2+}-calcineurin-NFAT signaling pathway

    SciTech Connect

    Guo, Xiaoxia; Zhou, Chunyan; Sun, Ningling

    2011-04-22

    Highlights: {yields} Catestatin stimulates proliferation of vascular smooth muscle cells in a dose-dependent manner. {yields} Catestatin provokes sustained increase in intracellular Ca{sup 2+}. {yields} Catestatin produces increased activation of calcineurin and promotes NFATc1 translocation into the nucleus. -- Abstract: The Chromogranin A-derived neuropeptide catestatin is an endogenous nicotinic cholinergic antagonist that acts as a pleiotropic hormone. Since catestatin shares several functions with other members derived from the chromogranin/secretogranin protein family and other neuropeptides which exert proliferative effects on vascular smooth muscle cells (VSMCs), we therefore hypothesized that catestatin would regulate VSMC proliferation. The present study demonstrates that catestatin caused a dose-dependent induction of proliferation in rat aortic smooth muscle cells and furthermore evoked a sustained increase in intracellular calcium. This subsequently leaded to enhanced activation of the Ca{sup 2+}/calmodulin-dependent phosphatase, calcineurin and resulted in an activation of the Ca{sup 2+}-dependent transcription factor, nuclear factor of activated T cells (NFAT), initiating transcription of proliferative genes. In addition, cyclosporin A (CsA), a potent inhibitor of calcineurin, abrogated catestatin-mediated effect on VSMCs, indicating that the calcineurin-NFAT signaling is strongly required for catestatin-induced growth of VSMCs. The present study establishes catestatin as a novel proliferative cytokine on vascular smooth muscle cells and this effect is mediated by the Ca{sup 2+}-calcineurin-NFAT signaling pathway.

  3. Cross-talk between NADPH oxidase-PKCα-p(38)MAPK and NF-κB-MT1MMP in activating proMMP-2 by ET-1 in pulmonary artery smooth muscle cells.

    PubMed

    Sarkar, Jaganmay; Chowdhury, Animesh; Chakraborti, Tapati; Chakraborti, Sajal

    2016-04-01

    Treatment of bovine pulmonary artery smooth muscle cells with endothelin-1 (ET-1) caused an increase in the expression and activation of proMMP-2 in the cells. The present study was undertaken to determine the underlying mechanisms involved in this scenario. We demonstrated that (i) pretreatment with NADPH oxidase inhibitor, apocynin; PKC-α inhibitor, Go6976; p(38)MAPK inhibitor SB203580 and NF-κB inhibitor, Bay11-7082 inhibited the expression and activation of proMMP-2 induced by ET-1; (ii) ET-1 treatment to the cells stimulated NADPH oxidase and PKCα activity, p(38)MAPK phosphorylation as well as NF-κB activation by translocation of NF-κBp65 subunit from cytosol to the nucleus, and subsequently by increasing its DNA-binding activity; (iii) ET-1 increases MT1-MMP expression, which was inhibited upon pretreatment with apocynin, Go6976, SB293580, and Bay 11-7082; (iv) ET-1 treatment to the cells downregulated TIMP-2 level. Although apocynin and Go6976 pretreatment reversed ET-1 effect on TIMP-2 level, yet pretreatment of the cells with SB203580 and Bay 11-7082 did not show any discernible change in TIMP-2 level by ET-1. Overall, our results suggest that ET-1-induced activation of proMMP-2 is mediated via cross-talk between NADPH oxidase-PKCα-p(38)MAPK and NFκB-MT1MMP signaling pathways along with a marked decrease in TIMP-2 expression in the cells. PMID:26910780

  4. Myorelaxant action of fluorine-containing pinacidil analog, flocalin, in bladder smooth muscle is mediated by inhibition of L-type calcium channels rather than activation of KATP channels.

    PubMed

    Philyppov, Igor B; Golub, Andriy А; Boldyriev, Oleksiy I; Shtefan, Natalia L; Totska, Khrystyna; Voitychuk, Oleg I; Shuba, Yaroslav M

    2016-06-01

    Flocalin (FLO) is a new ATP-sensitive K(+) (KATP) channel opener (KCO) derived from pinacidil (PIN) by adding fluorine group to the drug's structure. FLO acts as a potent cardioprotector against ischemia-reperfusion damage in isolated heart and whole animal models primarily via activating cardiac-specific Kir6.2/SUR2A KATP channels. Given that FLO also confers relaxation on several types of smooth muscles and can partially inhibit L-type Ca(2+) channels, in this study, we asked what is the mechanism of FLO action in bladder detrusor smooth muscle (DSM). The actions of FLO and PIN on contractility of rat and guinea pig DSM strips and membrane currents of isolated DSM cells were compared by tensiometry and patch clamp. Kir6 and SUR subunit expression in rat DSM was assayed by reverse transcription PCR (RT-PCR). In contrast to PIN (10 μM), FLO (10 μM) did not produce glibenclamide-sensitive DSM strips' relaxation and inhibition of spontaneous and electrically evoked contractions. However, FLO, but not PIN, inhibited contractions evoked by high K(+) depolarization. FLO (40 μM) did not change the level of isolated DSM cell's background K(+) current, but suppressed by 20 % L-type Ca(2+) current. Determining various Kir6 and SUR messenger RNA (mRNA) expressions in rat DSM by RT-PCR indicated that dominant KATP channel in rat DSM is of vascular type involving association of Kir6.1 and SUR2B subunits. Myorelaxant effects of FLO in bladder DSM are explained by partial blockade of L-type Ca(2+) channel-mediated Ca(2+) influx rather than by hyperpolarization associated with increased K(+) permeability. Thus, insertion of fluorine group in PIN's structure made the drug more discriminative between Kir6.2/SUR2A cardiac- and Kir6.1/SUR2B vascular-type KATP channels and rendered it partial L-type Ca(2+) channel-blocking potency. PMID:26976335

  5. Prostanoid receptors EP2, EP4, and FP are regulated by estradiol in bovine oviductal smooth muscle.

    PubMed

    Huang, Na; Liu, Bo; Dong, Zhiheng; Mao, Wei; Zhang, Nan; Li, Changyou; Cao, Jinshan

    2015-09-01

    Gamete and embryo transport is an important function of the oviduct. This transport involves both smooth muscle contraction and epithelial cell secretions, the former of which is mediated by prostaglandins (PGs) and their receptors. Our aim was to study the regulation of prostaglandin E2 and prostaglandin F2α receptors (EP2, EP4, and FP receptor) by estradiol in bovine oviduct smooth muscle. EP2, EP4, and FP receptor mRNA and protein expression was investigated using real-time RT-PCR and Western blot analyses, respectively. To evaluate the contraction or relaxation of cultured bovine oviductal smooth muscle tissue, peristalsis was used to assess contractile activity. EP2, EP4, and FP receptor mRNA and protein expression was increased in oviductal smooth muscle tissue after treatment with different concentrations of estradiol for various durations. The expression of all receptors peaked at an estradiol concentration of 10(-11)mol/L after 8h of treatment, whereas no increase in expression was observed after fulvestrant (a selective antagonist of E2 receptor) treatment, indicating that E2 interacts with specific E2 nuclear receptors to regulate EP2, EP4, and FP receptor expression. Although PGF2α and PGE2 induced both contraction and relaxation, no significant differences were found in contractility between the estradiol-treated and control groups, with both groups of cultured smooth muscle strips showing similar vitality. In conclusion, estradiol increases EP2, EP4, and FP receptor mRNA and protein expression in bovine oviductal smooth muscle when added for different periods of time and at different concentrations. Additionally, E2 is transported intracellularly and interacts with specific E2 nuclear receptors to regulate their expression. PMID:26319698

  6. Actions of 4-aminopyridine on vascular smooth muscle tissues of the guinea-pig

    PubMed Central

    Hara, Yusuke; Kitamura, Kenji; Kuriyama, Hirosi

    1980-01-01

    1 Effects of 4-aminopyridine (4-AP) and procaine on the membrane and contractile properties of smooth muscle cells of the guinea-pig pulmonary artery and portal vein were observed. 2 The membrane potential and length constant of smooth muscle cells of the guinea-pig pulmonary artery were -53.2 mV and 1.2 mm, respectively, and those of the portal vein were -52.6 mV and 0.71 mm, respectively. The membrane was electrically quiescent in the pulmonary artery and it was electrically active in the portal vein. 3 Both 4-AP and procaine depolarized the membrane, increased the membrane resistance and suppressed the rectifying properties in both tissues. Both agents evoked a graded response from the muscle membranes of the pulmonary artery by outward current pulse. Procaine had a greater effect than 4-AP on the above membrane properties. 4 4-AP (10-5 M) produced contraction without depolarization of the membrane. The contraction evoked by 10-5 M 4-AP was completely suppressed but that evoked by 5 × 10-4 M 4-AP was only partly suppressed by phentolamine (10-7 M). However, the contraction evoked by procaine was not suppressed by phentolamine. 5 4-AP enhanced but procaine suppressed the amplitude of 118 mM [K]0-induced contraction. 6 The results suggest that 4-AP and procaine suppress K-conductance of the muscle membrane, and 4-AP but not procaine increases noradrenaline release from the nerve terminal. Presumably intracellular free Ca concentrations are also modified by these agents. The effects of 4-AP and procaine on the vascular muscle were compared with those on other excitable tissues. PMID:7357204

  7. Leptin augments coronary vasoconstriction and smooth muscle proliferation via a Rho-kinase-dependent pathway.

    PubMed

    Noblet, Jillian N; Goodwill, Adam G; Sassoon, Daniel J; Kiel, Alexander M; Tune, Johnathan D

    2016-05-01

    Leptin has been implicated as a key upstream mediator of pathways associated with coronary vascular dysfunction and disease. The purpose of this investigation was to test the hypothesis that leptin modifies the coronary artery proteome and promotes increases in coronary smooth muscle contraction and proliferation via influences on Rho kinase signaling. Global proteomic assessment of coronary arteries from lean swine cultured with obese concentrations of leptin (30 ng/mL) for 3 days revealed significant alterations in the coronary artery proteome (68 proteins) and identified an association between leptin treatment and calcium signaling/contraction (four proteins) and cellular growth and proliferation (35 proteins). Isometric tension studies demonstrated that both acute (30 min) and chronic (3 days, serum-free media) exposure to obese concentrations of leptin potentiated depolarization-induced contraction of coronary arteries. Inhibition of Rho kinase significantly reduced leptin-mediated increases in coronary artery contractions. The effects of leptin on the functional expression of Rho kinase were time-dependent, as acute treatment increased Rho kinase activity while chronic (3 day) exposure was associated with increases in Rho kinase protein abundance. Proliferation assays following chronic leptin administration (8 day, serum-containing media) demonstrated that leptin augmented coronary vascular smooth muscle proliferation and increased Rho kinase activity. Inhibition of Rho kinase significantly reduced these effects of leptin. Taken together, these findings demonstrate that leptin promotes increases in coronary vasoconstriction and smooth muscle proliferation and indicate that these phenotypic effects are associated with alterations in the coronary artery proteome and dynamic effects on the Rho kinase pathway. PMID:26975316

  8. Mechanism of action of calcium antagonists on myocardial and smooth muscle membranes.

    PubMed

    Zakhari, S

    1986-01-01

    Although calcium channel blockers vary considerably in their chemical structure and pharmacologic profile, the widely accepted mechanism of their action is an inhibition of Ca2+ influx - via voltage-activated slow channels - into smooth and cardiac muscle. Other ways of Ca2+ entry, such as passive diffusion and Na+/Ca2+ and K+/Ca2+ exchange, are not affected by these compounds. However, various blockers exert a slightly different inhibitory action on the slow channels, which indicates that various binding sites in the cell membranes, or even in intracellular sites, may be involved. Potential sites of action of calcium channel blockers in the myocardium include: the slow calcium channels; Na+/Ca2+ channels; mitochondria; sarcoplasmic reticulum; myofilaments; and calcium efflux. However, experimental evidence has been given for only the first site, and the third and fourth sites are still controversial. In the vascular smooth muscles, calcium channel blockers could possibly block the potential-dependent or receptor-operated channels, or bind to calmodulin. Again, only the first site of action has been experimentally proven. An important feature of calcium channel blockers is their different affinities for various tissues. For instance, cinnarizine and its difluorinated derivative flunarizine are 1000 times more effective in blocking slow channels in vascular smooth muscles than those in the myocardium. Even within the same system, such as the cardiovascular system, differences in tissue specificity are encountered. Thus, while nimodipine acts preferentially on cerebral vessels, diltiazem has more affinity for the coronary vasculature. Tissue specificity is exhibited even for different myocardial structures; thus, while verapamil affects the nodal and conductive tissues in the myocardium (hence its use as an antiarrhythmic agent), nifedipine is almost devoid of such activity. Organ selectivity of calcium channel blockers is one of the attractive features of this group

  9. The stellate vascular smooth muscle cell phenotype is induced by IL-1β via the secretion of PGE2 and subsequent cAMP-dependent protein kinase A activation.

    PubMed

    Blirando, Karl; Blaise, Régis; Gorodnaya, Natalia; Rouxel, Clotilde; Meilhac, Olivier; Vincent, Pierre; Limon, Isabelle

    2015-12-01

    Atherosclerosis development is associated with morphological changes to intimal cells, leading to a stellate cell phenotype. In this study, we aimed to determine whether and how key pro-atherogenic cytokines present in atherosclerotic plaques (IL-1β, TNFα and IFNγ) could induce this phenotype, as these molecules are known to trigger the transdifferentiation of vascular smooth muscle cells (VSMCs). We found that, IL-1β was the only major inflammatory mediator tested capable of inducing a stellate morphology in VSMCs. This finding was confirmed by staining for F-actin and vinculin at focal adhesions, as these two markers were disrupted only by IL-1β. We then investigated the possible association of this IL-1β-dependent change in morphology with an increase in intracellular cAMP concentration ([cAMP]), using the FRET-based biosensor for cAMP (T)Epac(VV). Experiments in the presence of IL-1β or medium conditioned by IL-1β-treated VSMCs and pharmacological tools demonstrated that the long-term increase in intracellular cAMP concentration was induced by the secretion of an autocrine/paracrine mediator, prostaglandin E₂(PGE₂), acting through the EP4 receptor. Finally, by knocking down the expression of the regulatory subunit PKAR1α, thereby reproducing the effects of IL-1β and PGE₂ on VSMCs, we demonstrated the contribution of PKA activity to the observed behavior of VSMCs. PMID:26403276

  10. Muscarinic M2 receptors in bovine tracheal smooth muscle: discrepancies between binding and function.

    PubMed

    Roffel, A F; Elzinga, C R; Van Amsterdam, R G; De Zeeuw, R A; Zaagsma, J

    1988-08-01

    Previous work showing that AF-DX 116, a cardioselective muscarinic antagonist in functional experiments, does not discriminate between muscarinic receptors in bovine cardiac and tracheal membranes has been extended. In addition to AF-DX 116 we used the muscarinic antagonists, atropine, pirenzepine, 4-DAMP methobromide, gallamine, hexahydrosiladifenidol and methoctramine, in radioligand binding experiments on bovine cardiac left ventricular and tracheal smooth muscle membranes. The functional antagonism of the methacholine-induced contraction of bovine tracheal smooth muscle strips was also evaluated. An excellent correlation was found for all compounds between the binding affinities for muscarinic receptors in cardiac and tracheal smooth muscle membranes; moreover, the affinities found in cardiac membranes correspond with the pA2 values reported for atrial preparations of rat and guinea pig. However, significant and occasionally marked discrepancies were found between binding and functional affinities of these muscarinic antagonists on bovine tracheal smooth muscle. PMID:3215279

  11. Mebendazole Reduces Vascular Smooth Muscle Cell Proliferation and Neointimal Formation Following Vascular Injury in Mice

    PubMed Central

    Wang, Jintao; Wang, Hui; Guo, Chiao; Luo, Wei; Lawler, Alyssa; Reddy, Aswin; Wang, Julia; Sun, Eddy B.; Eitzman, Daniel T.

    2014-01-01

    Mebendazole is an antihelminthic drug that exerts its effects via interference with microtubule function in parasites. To determine the utility of mebendazole as a potential treatment for vascular diseases involving proliferation of vascular smooth muscle cells, the effects of mebendazole on vascular smooth muscle cell proliferation were tested in vitro and in a mouse model of arterial injury. In vitro, mebendazole inhibited proliferation and migration of murine vascular smooth muscle cells and this was associated with altered intracellular microtubule organization. To determine in vivo effects of mebendazole following vascular injury, femoral arterial wire injury was induced in wild-type mice treated with either mebendazole or placebo control. Compared with placebo-treated mice, mebendazole-treated mice formed less neointima at the site of injury. Mebendazole is effective at inhibiting vascular smooth muscle cell proliferation and migration, and neointimal formation following arterial injury in mice. PMID:24587248

  12. ROLE OF ACETYLCHOLINE IN RHYTHMIC SPONTANEOUS CONTRACTIONS OF RAT'S DUODENAL SMOOTH MUSCLE

    EPA Science Inventory

    The purpose of the study is to reexamine the role of endogenous acetylcholine in spontaneous contractions of smooth muscle whose contractions are associated with cell metabolism. The study does not attempt to define the role of endogenous acetylcholine.

  13. [Regulation of the differentiation and proliferation of smooth muscle cells by the sex hormones].

    PubMed

    Guiochon-Mantel, A

    2000-06-01

    Steroids effects are mediated by their receptors. These proteins define the large family of steroid hormone receptors, characterized by the presence of 3 functional domains: a transactivation domain, a DNA-binding domain and a ligand-binding domain. Receptor activation induces the modulation of transcription of specific genes, and as a consequence, the modulation of production of specific proteins. Sex steroid receptors are located in the nucleus. This nuclear localization is in fact a dynamic situation, resulting from a continuous shuttling of the receptor between the cytoplasm and the nucleus. The recent discovery that an additional estrogen receptor is present in various tissues has advanced our understanding of the mechanism underlying estrogen signalling. Non genomic effects of steroids have also been described. Sex steroids inhibit proliferation of smooth muscle cells. On the contrary, they stimulate proliferation of tumoral muscle cells. The mechanisms of sex steroid effects on cellular proliferation are complex, and may involve transcriptional or non transcriptional phenomena. PMID:10939122

  14. Differentiation of Murine Bone Marrow-Derived Smooth Muscle Progenitor Cells Is Regulated by PDGF-BB and Collagen

    PubMed Central

    Lin, Clifford; Yuan, Yifan; Courtman, David W.

    2016-01-01

    Smooth muscle cells (SMCs) are key regulators of vascular disease and circulating smooth muscle progenitor cells may play important roles in vascular repair or remodelling. We developed enhanced protocols to derive smooth muscle progenitors from murine bone marrow and tested whether factors that are increased in atherosclerotic plaques, namely platelet-derived growth factor—BB (PDGF-BB) and monomeric collagen, can influence the smooth muscle specific differentiation, proliferation, and survival of mouse bone marrow-derived progenitor cells. During a 21 day period of culture, bone marrow cells underwent a marked increase in expression of the SMC markers α-SMA (1.93 ± 0.15 vs. 0.0008 ± 0.0003 (ng/ng GAPDH) at 0 d), SM22-α (1.50 ± 0.27 vs. 0.005 ± 0.001 (ng/ng GAPDH) at 0 d) and SM-MHC (0.017 ± 0.004 vs. 0.001 ± 0.001 (ng/ng GAPDH) at 0 d). Bromodeoxyuridine (BrdU) incorporation experiments showed that in early culture, the smooth muscle progenitor subpopulation could be identified by high proliferative rates prior to the expression of smooth muscle specific markers. Culture of fresh bone marrow or smooth muscle progenitor cells with PDGF-BB suppressed the expression of α-SMA and SM22-α, in a rapidly reversible manner requiring PDGF receptor kinase activity. Progenitors cultured on polymerized collagen gels demonstrated expression of SMC markers, rates of proliferation and apoptosis similar to that of cells on tissue culture plastic; in contrast, cells grown on monomeric collagen gels displayed lower SMC marker expression, lower growth rates (319 ± 36 vs. 635 ± 97 cells/mm2), and increased apoptosis (5.3 ± 1.6% vs. 1.0 ± 0.5% (Annexin 5 staining)). Our data shows that the differentiation and survival of smooth muscle progenitors are critically affected by PDGF-BB and as well as the substrate collagen structure. PMID:27258003

  15. Complex I dysfunction underlies the glycolytic switch in pulmonary hypertensive smooth muscle cells

    PubMed Central

    Rafikov, Ruslan; Sun, Xutong; Rafikova, Olga; Louise Meadows, Mary; Desai, Ankit A.; Khalpey, Zain; Yuan, Jason X.-J.; Fineman, Jeffrey R.; Black, Stephen M.

    2015-01-01

    ATP is essential for cellular function and is usually produced through oxidative phosphorylation. However, mitochondrial dysfunction is now being recognized as an important contributing factor in the development cardiovascular diseases, such as pulmonary hypertension (PH). In PH there is a metabolic change from oxidative phosphorylation to mainly glycolysis for energy production. However, the mechanisms underlying this glycolytic switch are only poorly understood. In particular the role of the respiratory Complexes in the mitochondrial dysfunction associated with PH is unresolved and was the focus of our investigations. We report that smooth muscle cells isolated from the pulmonary vessels of rats with PH (PH-PASMC), induced by a single injection of monocrotaline, have attenuated mitochondrial function and enhanced glycolysis. Further, utilizing a novel live cell assay, we were able to demonstrate that the mitochondrial dysfunction in PH-PASMC correlates with deficiencies in the activities of Complexes I–III. Further, we observed that there was an increase in mitochondrial reactive oxygen species generation and mitochondrial membrane potential in the PASMC isolated from rats with PH. We further found that the defect in Complex I activity was due to a loss of Complex I assembly, although the assembly of Complexes II and III were both maintained. Thus, we conclude that loss of Complex I assembly may be involved in the switch of energy metabolism in smooth muscle cells to glycolysis and that maintaining Complex I activity may be a potential therapeutic target for the treatment of PH. PMID:26298201

  16. Complex I dysfunction underlies the glycolytic switch in pulmonary hypertensive smooth muscle cells.

    PubMed

    Rafikov, Ruslan; Sun, Xutong; Rafikova, Olga; Meadows, Mary Louise; Desai, Ankit A; Khalpey, Zain; Yuan, Jason X-J; Fineman, Jeffrey R; Black, Stephen M

    2015-12-01

    ATP is essential for cellular function and is usually produced through oxidative phosphorylation. However, mitochondrial dysfunction is now being recognized as an important contributing factor in the development cardiovascular diseases, such as pulmonary hypertension (PH). In PH there is a metabolic change from oxidative phosphorylation to mainly glycolysis for energy production. However, the mechanisms underlying this glycolytic switch are only poorly understood. In particular the role of the respiratory Complexes in the mitochondrial dysfunction associated with PH is unresolved and was the focus of our investigations. We report that smooth muscle cells isolated from the pulmonary vessels of rats with PH (PH-PASMC), induced by a single injection of monocrotaline, have attenuated mitochondrial function and enhanced glycolysis. Further, utilizing a novel live cell assay, we were able to demonstrate that the mitochondrial dysfunction in PH-PASMC correlates with deficiencies in the activities of Complexes I-III. Further, we observed that there was an increase in mitochondrial reactive oxygen species generation and mitochondrial membrane potential in the PASMC isolated from rats with PH. We further found that the defect in Complex I activity was due to a loss of Complex I assembly, although the assembly of Complexes II and III were both maintained. Thus, we conclude that loss of Complex I assembly may be involved in the switch of energy metabolism in smooth muscle cells to glycolysis and that maintaining Complex I activity may be a potential therapeutic target for the treatment of PH. PMID:26298201

  17. Peripheral Airway Smooth Muscle, but Not the Trachealis, Is Hypercontractile in an Equine Model of Asthma.

    PubMed

    Matusovsky, Oleg S; Kachmar, Linda; Ijpma, Gijs; Bates, Genevieve; Zitouni, Nedjma; Benedetti, Andrea; Lavoie, Jean-Pierre; Lauzon, Anne-Marie

    2016-05-01

    Heaves is a naturally occurring equine disease that shares many similarities with human asthma, including reversible antigen-induced bronchoconstriction, airway inflammation, and remodeling. The purpose of this study was to determine whether the trachealis muscle is mechanically representative of the peripheral airway smooth muscle (ASM) in an equine model of asthma. Tracheal and peripheral ASM of heaves-affected horses under exacerbation, or under clinical remission of the disease, and control horses were dissected and freed of epithelium to measure unloaded shortening velocity (Vmax), stress (force/cross-sectional area), methacholine effective concentration at which 50% of the maximum response is obtained, and stiffness. Myofibrillar Mg(2+)-ATPase activity, actomyosin in vitro motility, and contractile protein expression were also measured. Horses with heaves had significantly greater Vmax and Mg(2+)-ATPase activity in peripheral airway but not in tracheal smooth muscle. In addition, a significant correlation was found between Vmax and the time elapsed since the end of the corticosteroid treatment for the peripheral airways in horses with heaves. Maximal stress and stiffness were greater in the peripheral airways of the horses under remission compared with controls and the horses under exacerbation, potentially due to remodeling. Actomyosin in vitro motility was not different between controls and horses with heaves. These data demonstrate that peripheral ASM is mechanically and biochemically altered in heaves, whereas the trachealis behaves as in control horses. It is therefore conceivable that the trachealis muscle may not be representative of the peripheral ASM in human asthma either, but this will require further investigation. PMID:26473389

  18. PPAR{gamma} activation abolishes LDL-induced proliferation of human aortic smooth muscle cells via SOD-mediated down-regulation of superoxide

    SciTech Connect

    Heo, Kyung-Sun; Kim, Dong-Uk; Ryoo, Sungwoo; Nam, Miyoung; Baek, Seung Tae; Kim, Lila; Park, Song-Kyu; Myung, Chang-Seon; Hoe, Kwang-Lae . E-mail: kwanghoe@kribb.re.kr

    2007-08-10

    Native LDL would be a mitogenic and chemotactic stimulus of VSMC proliferation and differentiation in the atherosclerotic lesion where endothelial disruption occurred. In previous studies, our group investigated the molecular mechanisms by which LDL induces IL-8 production and by which PPAR{alpha} activation abolishes LDL effects in human aortic SMCs (hAoSMCs). Herein is the first report of PPAR{gamma} activation by troglitazone (TG) exerting its inhibitory effects on LDL-induced cell proliferation via generation not of H{sub 2}O{sub 2}, but of O2?-, and the subsequent activation of Erk1/2 in hAoSMCs. Moreover, in this study TG abolished the LDL-accelerated G{sub 1}-S progression to control levels via down-regulation of active cyclinD1/CDK4 and cyclinE/CDK2 complexes and up-regulation of p21{sup Cip1} expression. TG exerted its anti-proliferative effects through the up-regulation of basal superoxide dismutase (SOD) expression. This data suggests that the regulation of O2?- is located at the crossroads between LDL signaling and cell proliferation.

  19. Antinociceptive, anti-inflammatory and smooth muscle relaxant activities of the pyrrolo[3,4-d]pyridazinone derivatives: Possible mechanisms of action.

    PubMed

    Mogilski, Szczepan; Kubacka, Monika; Redzicka, Aleksandra; Kazek, Grzegorz; Dudek, Magdalena; Malinka, Wiesław; Filipek, Barbara

    2015-06-01

    The aim of this study was to evaluate the analgesic as well as anti-inflammatory activities of the new pyrrolo[3,4-d]pyridazinone derivatives. Moreover, the present study attempted to assess some of the mechanisms involved in the pharmacological activity of these compounds. In the previous studies it was shown that these compounds were highly active in the phenylbenzoquinone-induced 'writhing syndrome' test and had much lower activity in the hot plate, which indicates that mainly peripheral mechanisms of analgesia are involved in their effects. In these extended studies the analgesic activity of two tested compounds (4c, 4f) was confirmed in some animal models of pain. The studied compounds showed a significant and dose-related antinociceptive effect in the models of pain induced by formalin, capsaicin and glutamic acid. Both compounds decreased the edema formation and one of them (4c) attenuated mechanical hyperalgesia in carrageenan-induced paw inflammation in rats. Furthermore, both compounds inhibited cell migration, plasma exudation and nociceptive reaction in zymosan A-induced mouse peritonitis. In the subsequent studies, including experiments on isolated organs (ileum, trachea, aorta), radioligand assays and biochemical tests, it was demonstrated that analgesic and anti-inflammatory effects of the investigated structures are largely due to their competitive antagonism for histamine H1 receptor. The influence on the level of cAMP in inflammatory cells (shown in RAW 264.7 macrophages) and subsequent inhibition of cytokine (TNFα, IL-1β) release can also be one of the important mechanisms of their action. Moreover some additional mechanisms may also be involved in the eventual analgesic effect of tested pyrrolo[3,4-d]pyridazinone derivatives. PMID:25847619

  20. Cyclic GMP alters Ca exchange in vascular smooth muscle

    SciTech Connect

    Magliola, L.; Bailey, B.; Jones, A.W.

    1986-03-05

    Contraction and /sup 42/K efflux from vascular smooth muscle stimulated either by norepinephrine (NE) or by K-depolarization is dependent on an increase in cytosolic Ca concentration. The purpose of this study was to determine if cyclic GMP (cGMP) inhibited these processes and if inhibition was secondary to the action of cGMP on Ca movements. Basal cGMP content of rat aorta was 1.2 fmol/mg wet wt. Sodium nitroprusside (NP) increased cGMP approx.2-fold at 1 nM and approx.750-fold at 1 ..mu..M with no effect on cAMP levels. A 5 min pretreatment with NP (1 ..mu..M) completely prevented tension development induced by 3 ..mu..M NE. The same concentration of NP also inhibited NE-stimulated /sup 42/K and /sup 45/Ca efflux > 90 and > 80%, respectively. Removal of NP in the continued presence of NE (3 ..mu..M) caused recovery of the /sup 42/K efflux response to approx.75% of control with a half-time of approx.2.5 min. NP (1 ..mu..M) also caused a rapid relaxation of aorta contracted with 3 ..mu..M NE and a loss of the /sup 42/K efflux response with half-times of 2-3 min. In contrast, 100 ..mu..M NP produced only a 50% inhibition of contraction induced by high K (55 mM). Also, NP (1 ..mu..M) inhibited K-stimulated /sup 42/K efflux only approx.25%. These results demonstrate both a concentration- and a time-dependent relationship between increases in cGMP induced by NP and decreases in NE-stimulated contraction, /sup 42/K and /sup 45/Ca effluxes. They also indicate that the sensitivity of NE-induced contraction and /sup 42/K efflux to NP is greater than that induced by high K. These studies suggest that cGMP modulates the control sites for Ca exchange in the plasma membrane and sarcoplasmic reticulum.

  1. 3D Reconstruction of Coronary Artery Vascular Smooth Muscle Cells

    PubMed Central

    Luo, Tong; Chen, Huan; Kassab, Ghassan S.

    2016-01-01

    Aims The 3D geometry of individual vascular smooth muscle cells (VSMCs), which are essential for understanding the mechanical function of blood vessels, are currently not available. This paper introduces a new 3D segmentation algorithm to determine VSMC morphology and orientation. Methods and Results A total of 112 VSMCs from six porcine coronary arteries were used in the analysis. A 3D semi-automatic segmentation method was developed to reconstruct individual VSMCs from cell clumps as well as to extract the 3D geometry of VSMCs. A new edge blocking model was introduced to recognize cell boundary while an edge growing was developed for optimal interpolation and edge verification. The proposed methods were designed based on Region of Interest (ROI) selected by user and interactive responses of limited key edges. Enhanced cell boundary features were used to construct the cell’s initial boundary for further edge growing. A unified framework of morphological parameters (dimensions and orientations) was proposed for the 3D volume data. Virtual phantom was designed to validate the tilt angle measurements, while other parameters extracted from 3D segmentations were compared with manual measurements to assess the accuracy of the algorithm. The length, width and thickness of VSMCs were 62.9±14.9μm, 4.6±0.6μm and 6.2±1.8μm (mean±SD). In longitudinal-circumferential plane of blood vessel, VSMCs align off the circumferential direction with two mean angles of -19.4±9.3° and 10.9±4.7°, while an out-of-plane angle (i.e., radial tilt angle) was found to be 8±7.6° with median as 5.7°. Conclusions A 3D segmentation algorithm was developed to reconstruct individual VSMCs of blood vessel walls based on optical image stacks. The results were validated by a virtual phantom and manual measurement. The obtained 3D geometries can be utilized in mathematical models and leads a better understanding of vascular mechanical properties and function. PMID:26882342

  2. Androgens are powerful non-genomic inducers of calcium sensitization in visceral smooth muscle.

    PubMed

    González-Montelongo, Maria C; Marín, Raquel; Gómez, Tomás; Díaz, Mario

    2010-01-01

    Androgens are recognized as genotropic inducers of a number of physiological functions mainly associated with the development of sexual characteristics. However, as in the case of estrogens, the number of studies evidencing androgen actions in non-reproductive tissues has steadily grown over the past years. Here, we show that androgens acutely ( approximately 30min) alter the frequency spectrum of peristaltic activity of intestinal smooth muscle and augment the amplitude agonist-induced contractile activity. Maximal stimulation occurred at physiological concentrations of androgens with EC(50) values in the picomolar range. Androgen-induced potentiation was prevented by preincubation with androgen receptor (AR) antagonists but unaffected by cycloheximide plus actinomycin D, indicating that potentiation was mediated by ARs via a non-genomic mechanism. The effects of androgens were mimicked by polyamines and were completely blocked by inhibitors of polyamine synthesis. Using ionomycin-permeabilized intestinal smooth muscle preparations, we demonstrate that androgens exert their effects by inducing a mechanism of sensitization to calcium and not by altering intracellular calcium homeostasis. Correspondingly, the potentiation of mechanical activity induced by androgens was accompanied by an increase in the phosphorylation of the regulatory myosin light chain (LC(20)) within the same time-course than calcium sensitization and mechanical potentiation. The pursuit of potential signalling pathways linking androgen receptor activation with calcium sensitization revealed that mechanical potentiation of intestinal muscle by androgens involve activation of the Rho pathway, whose downstream effector, Rho-associated kinase (ROCK), is eventually responsible for displacement of the phosphorylation/dephosphorylation state of LC(20) towards its phosphorylated form. PMID:19800357

  3. ROLE OF CELLULAR BIOENERGETICS IN SMOOTH MUSCLE CELL PROLIFERATION INDUCED BY PLATELET-DERIVED GROWTH FACTOR

    PubMed Central

    Perez, Jessica; Hill, Bradford G.; Benavides, Gloria A.; Dranka, Brian P.; Darley-Usmar, Victor M.

    2013-01-01

    SYNOPSIS Abnormal smooth muscle cell proliferation is a hallmark of vascular disease. Although growth factors are known to contribute to cell hyperplasia, the changes in metabolism associated with this response, particularly mitochondrial respiration, remain unclear. Given the increased energy requirements for proliferation, we hypothesized that platelet-derived growth factor (PDGF) would stimulate glycolysis and mitochondrial respiration and that this elevated bioenergetic capacity is required for smooth muscle cell hyperplasia. To test this hypothesis, cell proliferation, glycolytic flux, and mitochondrial oxygen consumption were measured after treatment of primary rat aortic smooth muscle cells with PDGF. PDGF increased basal and maximal rates of glycolytic flux and mitochondrial oxygen consumption; enhancement of these bioenergetic pathways led to a substantial increase in the mitochondrial reserve capacity. Interventions with the PI3K inhibitor LY-294002 or the glycolysis inhibitor 2-deoxy-D-glucose abrogated PDGF-stimulated proliferation and prevented augmentation of glycolysis and mitochondrial reserve capacity. Similarly, when L-glucose was substituted for D-glucose, PDGF-dependent proliferation was abolished, as were changes in glycolysis and mitochondrial respiration. Interestingly, lactate dehydrogenase protein levels and activity were significantly increased after PDGF treatment. Moreover, L-lactate substitution for D-glucose was sufficient for increasing the mitochondrial reserve capacity and cell proliferation after treatment with PDGF; these effects were inhibited by the lactate dehydrogenase inhibitor, oxamate. These data suggest that glycolysis, by providing substrates that enhance the mitochondrial reserve capacity, plays an essential role in PDGF-induced cell proliferation, underscoring the integrated metabolic response required for proliferation of VSMC in the diseased vasculature. PMID:20331438

  4. HB-EGF-Promoted Airway Smooth Muscle Cells and Their Progenitor Migration Contribute to Airway Smooth Muscle Remodeling in Asthmatic Mouse.

    PubMed

    Wang, Qing; Li, Hequan; Yao, Yinan; Lu, Guohua; Wang, Yuehong; Xia, Dajing; Zhou, Jianying

    2016-03-01

    The airway smooth muscle (ASM) cells' proliferation, migration, and their progenitor's migration are currently regarded as causative factors for ASM remodeling in asthma. Heparin-binding epidermal growth factor (HB-EGF), a potent mitogen and chemotactic factor, could promote ASM cell proliferation through MAPK pathways. In this study, we obtained primary ASM cells and their progenitors from C57BL/6 mice and went on to explore the role of HB-EGF in these cells migration and the underlying mechanisms. We found that recombinant HB-EGF (rHB-EGF) intratracheal instillation accelerated ASM layer thickening in an OVA-induced asthmatic mouse. Modified Boyden chamber assay revealed that rHB-EGF facilitate ASM cell migration in a dose-dependent manner and ASM cells from asthmatic mice had a greater migration ability than that from normal counterparts. rHB-EGF could stimulate the phosphorylation of ERK1/2 and p38 in ASM cells but further migration assay showed that only epidermal growth factor receptor inhibitor (AG1478) or p38 inhibitor (SB203580), but not ERK1/2 inhibitor (PD98059), could inhibit rHB-EGF-mediated ASM cells migration. Actin cytoskeleton experiments exhibited that rHB-EGF could cause actin stress fibers disassembly and focal adhesions formation of ASM cells through the activation of p38. Finally, airway instillation of rHB-EGF promoted the recruitment of bone marrow-derived smooth muscle progenitor cells, which were transferred via caudal vein, migrating into the airway from the circulation. These observations demonstrated that ASM remodeling in asthma might have resulted from HB-EGF-mediated ASM cells and their progenitor cells migration, via p38 MAPK-dependent actin cytoskeleton remodeling. PMID:26826248

  5. Pathway of Programmed Cell Death and Oxidative Stress Induced by β-Hydroxybutyrate in Dairy Cow Abomasum Smooth Muscle Cells and in Mouse Gastric Smooth Muscle

    PubMed Central

    Wang, Zhe; Zhang, Naisheng; Xie, Guanghong

    2014-01-01

    The administration of exogenous β-hydroxybutyrate (β-HB), as well as fasting and caloric restriction, is a condition associated with β-HB abundance and decreased appetite in animals. Increased β-HB and decreased appetite exist simultaneously in some diseases, such as bovine left displaced abomasums (LDA) and human chronic gastritis. However, the effects of β-HB on stomach injuries have not been explored. To elucidate the possible effects of exogenous β-HB on the stomach, mice were injected intraperitoneally with β-HB, and bovine abomasum smooth muscle cells (BSMCs) were treated with different concentrations of β-HB. We found that β-HB induced BSMCs endoplasmic reticulum- and mitochondria-mediated apoptotic cell death. β-HB promoted Bax expression and caspase-12, -9, and -3 activation while blocking Bcl-2 expression. β-HB also promoted AIF, EndoG release and p53 expression. β-HB acted on key molecules in the apoptotic cell death pathway and increased p38 and c-June NH2-terminal kinase phosphorylation while inhibiting ERK phosphorylation and PCNA expression. β-HB upregulated P27 and P21 mRNA levels while downregulating cyclin and CDK mRNA levels, arresting the cell cycle. These results suggest that BSMCs treated with β-HB can induce oxidative stress, which can be prevented by intracellular calcium chelators BAPTA/AM but not antioxidant NAC. Additionally, these results suggest that β-HB causes ROS generation through a Ca2+-dependent mechanism and that intracellular Ca2+ levels play a critical role in β-HB -induced apoptotic cell death. The impact of β-HB on programmed cell death and oxidative stress in vivo was confirmed in murine experiments. For the first time, we show oxidative stress effects of β-HB on smooth muscle. We propose that β-HB is a possible cause of some stomach diseases, including bovine LDA. PMID:24801711

  6. Smooth muscle-like tissue constructs with circumferentially oriented cells formed by the cell fiber technology.

    PubMed

    Hsiao, Amy Y; Okitsu, Teru; Onoe, Hiroaki; Kiyosawa, Mahiro; Teramae, Hiroki; Iwanaga, Shintaroh; Kazama, Tomohiko; Matsumoto, Taro; Takeuchi, Shoji

    2015-01-01

    The proper functioning of many organs and tissues containing smooth muscles greatly depends on the intricate organization of the smooth muscle cells oriented in appropriate directions. Consequently controlling the cellular orientation in three-dimensional (3D) cellular constructs is an important issue in engineering tissues of smooth muscles. However, the ability to precisely control the cellular orientation at the microscale cannot be achieved by various commonly used 3D tissue engineering building blocks such as spheroids. This paper presents the formation of coiled spring-shaped 3D cellular constructs containing circumferentially oriented smooth muscle-like cells differentiated from dedifferentiated fat (DFAT) cells. By using the cell fiber technology, DFAT cells suspended in a mixture of extracellular proteins possessing an optimized stiffness were encapsulated in the core region of alginate shell microfibers and uniformly aligned to the longitudinal direction. Upon differentiation induction to the smooth muscle lineage, DFAT cell fibers self-assembled to coiled spring structures where the cells became circumferentially oriented. By changing the initial core-shell microfiber diameter, we demonstrated that the spring pitch and diameter could be controlled. 21 days after differentiation induction, the cell fibers contained high percentages of ASMA-positive and calponin-positive cells. Our technology to create these smooth muscle-like spring constructs enabled precise control of cellular alignment and orientation in 3D. These constructs can further serve as tissue engineering building blocks for larger organs and cellular implants used in clinical treatments. PMID:25734774

  7. Adult human arterial smooth muscle cells in primary culture. Modulation from contractile to synthetic phenotype.

    PubMed

    Thyberg, J; Nilsson, J; Palmberg, L; Sjölund, M

    1985-01-01

    Smooth muscle cells were isolated enzymatically from adult human arteries, grown in primary culture in medium containing 10% whole blood serum, and studied by transmission electron microscopy and [3H]thymidine autoradiography. In the intact arterial wall and directly after isolation, each smooth muscle cell had a nucleus with a wide peripheral zone of condensed chromatin and a cytoplasm dominated by myofilament bundles with associated dense bodies. After 1-2 days of culture, the cells had attached to the substrate and started to spread out. At the same time, a characteristic fine-structural modification took place. It included nuclear enlargement, dispersion of the chromatin and formation of large nucleoli. Moreover, myofilament bundles disappeared and an extensive rough endoplasmic reticulum and a large Golgi complex were organized in the cytoplasm. This morphological transformation of the cells was completed in 3-4 days. It was accompanied by initiation of DNA replication and mitosis. The observations demonstrate that adult human arterial smooth muscle cells, when cultivated in vitro, pass through a phenotypic modulation of the same type as arterial smooth muscle cells from experimental animals. This modulation gives the cells morphological and functional properties resembling those of the modified smooth muscle cells found in fibroproliferative lesions of atherosclerosis. Further studies of the regulation of