Sample records for activating transcription factor-6

  1. Activating transcription factor 6 derepression mediates neuroprotection in Huntington disease

    PubMed Central

    Naranjo, José R.; Zhang, Hongyu; Villar, Diego; González, Paz; Dopazo, Xose M.; Morón-Oset, Javier; Higueras, Elena; Oliveros, Juan C.; Arrabal, María D.; Prieto, Angela; Cercós, Pilar; González, Teresa; De la Cruz, Alicia; Casado-Vela, Juan; Rábano, Alberto; Valenzuela, Carmen; Gutierrez-Rodriguez, Marta; Li, Jia-Yi; Mellström, Britt


    Deregulated protein and Ca2+ homeostasis underlie synaptic dysfunction and neurodegeneration in Huntington disease (HD); however, the factors that disrupt homeostasis are not fully understood. Here, we determined that expression of downstream regulatory element antagonist modulator (DREAM), a multifunctional Ca2+-binding protein, is reduced in murine in vivo and in vitro HD models and in HD patients. DREAM downregulation was observed early after birth and was associated with endogenous neuroprotection. In the R6/2 mouse HD model, induced DREAM haplodeficiency or blockade of DREAM activity by chronic administration of the drug repaglinide delayed onset of motor dysfunction, reduced striatal atrophy, and prolonged life span. DREAM-related neuroprotection was linked to an interaction between DREAM and the unfolded protein response (UPR) sensor activating transcription factor 6 (ATF6). Repaglinide blocked this interaction and enhanced ATF6 processing and nuclear accumulation of transcriptionally active ATF6, improving prosurvival UPR function in striatal neurons. Together, our results identify a role for DREAM silencing in the activation of ATF6 signaling, which promotes early neuroprotection in HD. PMID:26752648

  2. Activating transcription factor 6 derepression mediates neuroprotection in Huntington disease.


    Naranjo, José R; Zhang, Hongyu; Villar, Diego; González, Paz; Dopazo, Xose M; Morón-Oset, Javier; Higueras, Elena; Oliveros, Juan C; Arrabal, María D; Prieto, Angela; Cercós, Pilar; González, Teresa; De la Cruz, Alicia; Casado-Vela, Juan; Rábano, Alberto; Valenzuela, Carmen; Gutierrez-Rodriguez, Marta; Li, Jia-Yi; Mellström, Britt


    Deregulated protein and Ca2+ homeostasis underlie synaptic dysfunction and neurodegeneration in Huntington disease (HD); however, the factors that disrupt homeostasis are not fully understood. Here, we determined that expression of downstream regulatory element antagonist modulator (DREAM), a multifunctional Ca2+-binding protein, is reduced in murine in vivo and in vitro HD models and in HD patients. DREAM downregulation was observed early after birth and was associated with endogenous neuroprotection. In the R6/2 mouse HD model, induced DREAM haplodeficiency or blockade of DREAM activity by chronic administration of the drug repaglinide delayed onset of motor dysfunction, reduced striatal atrophy, and prolonged life span. DREAM-related neuroprotection was linked to an interaction between DREAM and the unfolded protein response (UPR) sensor activating transcription factor 6 (ATF6). Repaglinide blocked this interaction and enhanced ATF6 processing and nuclear accumulation of transcriptionally active ATF6, improving prosurvival UPR function in striatal neurons. Together, our results identify a role for DREAM silencing in the activation of ATF6 signaling, which promotes early neuroprotection in HD. PMID:26752648

  3. Activating Transcription Factor 6 Is Necessary and Sufficient for Alcoholic Fatty Liver Disease in Zebrafish

    PubMed Central

    Howarth, Deanna L.; Lindtner, Claudia; Vacaru, Ana M.; Sachidanandam, Ravi; Tsedensodnom, Orkhontuya; Vasilkova, Taisa; Buettner, Christoph; Sadler, Kirsten C.


    Fatty liver disease (FLD) is characterized by lipid accumulation in hepatocytes and is accompanied by secretory pathway dysfunction, resulting in induction of the unfolded protein response (UPR). Activating transcription factor 6 (ATF6), one of three main UPR sensors, functions to both promote FLD during acute stress and reduce FLD during chronic stress. There is little mechanistic understanding of how ATF6, or any other UPR factor, regulates hepatic lipid metabolism to cause disease. We addressed this using zebrafish genetics and biochemical analyses and demonstrate that Atf6 is necessary and sufficient for FLD. atf6 transcription is significantly upregulated in the liver of zebrafish with alcoholic FLD and morpholino-mediated atf6 depletion significantly reduced steatosis incidence caused by alcohol. Moreover, overexpression of active, nuclear Atf6 (nAtf6) in hepatocytes caused FLD in the absence of stress. mRNA-Seq and qPCR analyses of livers from five day old nAtf6 transgenic larvae revealed upregulation of genes promoting glyceroneogenesis and fatty acid elongation, including fatty acid synthase (fasn), and nAtf6 overexpression in both zebrafish larvae and human hepatoma cells increased the incorporation of 14C-acetate into lipids. Srebp transcription factors are key regulators of lipogenic enzymes, but reducing Srebp activation by scap morpholino injection neither prevented FLD in nAtf6 transgenics nor synergized with atf6 knockdown to reduce alcohol-induced FLD. In contrast, fasn morpholino injection reduced FLD in nAtf6 transgenic larvae and synergistically interacted with atf6 to reduce alcoholic FLD. Thus, our data demonstrate that Atf6 is required for alcoholic FLD and epistatically interacts with fasn to cause this disease, suggesting triglyceride biogenesis as the mechanism of UPR induced FLD. PMID:24874946

  4. The Transcriptional Activator Krüppel-like Factor-6 Is Required for CNS Myelination

    PubMed Central

    Mariani, John N.; Zhang, Jingya; Liu, Jia; Sawai, Setsu; Chapouly, Candice; Horng, Sam; Kramer, Elisabeth G.; Loo, Hannah; Burlant, Natalie; Nudelman, German; Lee, Young-Min; Braun, David A.; Lu, Q. Richard; Narla, Goutham; Raine, Cedric S.; Friedman, Scott L.; Casaccia, Patrizia; John, Gareth R.


    Growth factors of the gp130 family promote oligodendrocyte differentiation, and viability, and myelination, but their mechanisms of action are incompletely understood. Here, we show that these effects are coordinated, in part, by the transcriptional activator Krüppel-like factor-6 (Klf6). Klf6 is rapidly induced in oligodendrocyte progenitors (OLP) by gp130 factors, and promotes differentiation. Conversely, in mice with lineage-selective Klf6 inactivation, OLP undergo maturation arrest followed by apoptosis, and CNS myelination fails. Overlapping transcriptional and chromatin occupancy analyses place Klf6 at the nexus of a novel gp130-Klf-importin axis, which promotes differentiation and viability in part via control of nuclear trafficking. Klf6 acts as a gp130-sensitive transactivator of the nuclear import factor importin-α5 (Impα5), and interfering with this mechanism interrupts step-wise differentiation. Underscoring the significance of this axis in vivo, mice with conditional inactivation of gp130 signaling display defective Klf6 and Impα5 expression, OLP maturation arrest and apoptosis, and failure of CNS myelination. PMID:27213272

  5. The Transcriptional Activator Krüppel-like Factor-6 Is Required for CNS Myelination.


    Laitman, Benjamin M; Asp, Linnéa; Mariani, John N; Zhang, Jingya; Liu, Jia; Sawai, Setsu; Chapouly, Candice; Horng, Sam; Kramer, Elisabeth G; Mitiku, Nesanet; Loo, Hannah; Burlant, Natalie; Pedre, Xiomara; Hara, Yuko; Nudelman, German; Zaslavsky, Elena; Lee, Young-Min; Braun, David A; Lu, Q Richard; Narla, Goutham; Raine, Cedric S; Friedman, Scott L; Casaccia, Patrizia; John, Gareth R


    Growth factors of the gp130 family promote oligodendrocyte differentiation, and viability, and myelination, but their mechanisms of action are incompletely understood. Here, we show that these effects are coordinated, in part, by the transcriptional activator Krüppel-like factor-6 (Klf6). Klf6 is rapidly induced in oligodendrocyte progenitors (OLP) by gp130 factors, and promotes differentiation. Conversely, in mice with lineage-selective Klf6 inactivation, OLP undergo maturation arrest followed by apoptosis, and CNS myelination fails. Overlapping transcriptional and chromatin occupancy analyses place Klf6 at the nexus of a novel gp130-Klf-importin axis, which promotes differentiation and viability in part via control of nuclear trafficking. Klf6 acts as a gp130-sensitive transactivator of the nuclear import factor importin-α5 (Impα5), and interfering with this mechanism interrupts step-wise differentiation. Underscoring the significance of this axis in vivo, mice with conditional inactivation of gp130 signaling display defective Klf6 and Impα5 expression, OLP maturation arrest and apoptosis, and failure of CNS myelination. PMID:27213272

  6. The Transcriptional Repressor Polycomb Group Factor 6, PCGF6, Negatively Regulates Dendritic Cell Activation and Promotes Quiescence.


    Boukhaled, Giselle M; Cordeiro, Brendan; Deblois, Genevieve; Dimitrov, Vassil; Bailey, Swneke D; Holowka, Thomas; Domi, Anisa; Guak, Hannah; Chiu, Huai-Hsuan Clare; Everts, Bart; Pearce, Edward J; Lupien, Mathieu; White, John H; Krawczyk, Connie M


    Pro-inflammatory signals provided by the microenvironment are critical to activate dendritic cells (DCs), components of the innate immune system that shape both innate and adaptive immunity. However, to prevent inappropriate immune activation, mechanisms must be in place to restrain DC activation to ensure DCs are activated only once sufficient stimuli have been received. Here, we report that DC activation and immunogenicity are regulated by the transcriptional repressor Polycomb group factor 6 (PCGF6). Pcgf6 is rapidly downregulated upon stimulation, and this downregulation is necessary to permit full DC activation. Silencing PCGF6 expression enhanced both spontaneous and stimulated DC activation. We show that PCGF6 associates with the H3K4me3 demethylase JARID1c, and together, they negatively regulate H3K4me3 levels in DCs. Our results identify two key regulators, PCGF6 and JARID1c that temper DC activation and implicate active transcriptional silencing via histone demethylation as a previously unappreciated mechanism for regulating DC activation and quiescence. PMID:27498878

  7. Krüppel-like Factor 6 Is a Co-activator of NF-κB That Mediates p65-dependent Transcription of Selected Downstream Genes*

    PubMed Central

    Zhang, Yu; Lei, Cao-Qi; Hu, Yun-Hong; Xia, Tian; Li, Mi; Zhong, Bo; Shu, Hong-Bing


    The transcription factor NF-κB plays a pivotal role in a broad range of physiological and pathological processes, including development, inflammation, and immunity. How NF-κB integrates activating signals to expression of specific sets of target genes is of great interest. Here, we identified Krüppel-like factor 6 (KLF6) as a co-activator of NF-κB after TNFα and IL-1β stimulation. Overexpression of KLF6 enhanced TNFα- and IL-1β-induced activation of NF-κB and transcription of a subset of downstream genes, whereas knockdown of KLF6 had opposite effects. KLF6 interacted with p65 in the nucleus and bound to the promoters of target genes. Upon IL-1β stimulation, KLF6 was recruited to promoters of a subset of NF-κB target genes in a p65-dependent manner, which was in turn required for the optimal binding of p65 to the target gene promoters. Our findings thus identified KLF6 as a previously unknown but essential co-activator of NF-κB and provided new insight into the molecular regulation of p65-dependent gene expression. PMID:24634218

  8. Grass carp (Ctenopharyngodon idella) ATF6 (activating transcription factor 6) modulates the transcriptional level of GRP78 and GRP94 in CIK cells.


    Wang, Xiangqin; Zhang, Tao; Mao, Huiling; Mi, Yichuan; Zhong, Bin; Wei, Lili; Liu, Xiancheng; Hu, Chengyu


    ATF transcription factors are stress proteins containing alkaline area-leucine zipper and play an important role in endoplasmic reticulum stress. ATF6 is a protective protein which regulates the adaptation of cells to ER stress by modulating the transcription of UPR (Unfolded Protein Response) target genes, including GRP78 and GRP94. In the present study, a grass carp (Ctenopharyngodon idella) ATF6 full-length cDNA (named CiATF6, KT279356) has been cloned and identified. CiATF6 is 4176 bp in length, comprising 159 nucleotides of 5'-untranslated sequence, a 1947 nucleotides open reading frame and 2170 nucleotides of 3'-untranslated sequences. The largest open reading frame of CiATF6 translates into 648 aa with a typical DNA binding domain (BRLZ domain) and shares significant homology to the known ATF6 counterparts. Phylogenetic reconstruction confirmed its closer evolutionary relationship with other fish counterparts, especially with Zebrafish ATF6. RT-PCR showed that CiATF6 was ubiquitously expressed and significantly up-regulated after stimulation with thermal stress in all tested grass carp tissues. In order to know more about the role of CiATF6 in ER stress, recombinant CiATF6N with His-tag was over-expressed in Rosetta Escherichia coli, and the expressed protein was purified by affinity chromatography with Ni-NTA His-Bind Resin. In vitro, gel mobility shift assays were employed to analyze the interaction of CiATF6 protein with the promoters of grass carp GRP78 and GRP94, respectively. The result has shown that CiATF6 could bind to these promoters with high affinity by means of its BRLZ mainly. To further study the transcriptional regulatory mechanism of CiATF6, Dual-luciferase reporter assays were applied. Recombinant plasmids of pGL3-GRP78P and pGL3-CiGRP94P were constructed and transiently co-transfected with pcDNA3.1-CiATF6 (pcDN3.1-CiATF6-nBRLZ, respectively) into C. idella kidney (CIK) cells. The result has shown that CiATF6 could activate CiGRP78 and

  9. Activating transcription factor 6α is required for the vasopressin neuron system to maintain water balance under dehydration in male mice.


    Azuma, Yoshinori; Hagiwara, Daisuke; Lu, Wenjun; Morishita, Yoshiaki; Suga, Hidetaka; Goto, Motomitsu; Banno, Ryoichi; Sugimura, Yoshihisa; Oyadomari, Seiichi; Mori, Kazutoshi; Shiota, Akira; Asai, Naoya; Takahashi, Masahide; Oiso, Yutaka; Arima, Hiroshi


    Activating transcription factor 6α (ATF6α) is a sensor of endoplasmic reticulum (ER) stress and increases the expression of ER chaperones and molecules related to the ER-associated degradation of unfolded/misfolded proteins. In this study, we used ATF6α knockout (ATF6α(-/-)) mice to clarify the role of ATF6α in the arginine vasopressin (AVP) neuron system. Although urine volumes were not different between ATF6α(-/-) and wild-type (ATF6α(+/+)) mice with access to water ad libitum, they were increased in ATF6α(-/-) mice compared with those in ATF6α(+/+) mice under intermittent water deprivation (WD) and accompanied by less urine AVP in ATF6α(-/-) mice. The mRNA expression of immunoglobulin heavy chain binding protein, an ER chaperone, was significantly increased in the supraoptic nucleus in ATF6α(+/+) but not ATF6α(-/-) mice after WD. Electron microscopic analyses demonstrated that the ER lumen of AVP neurons was more dilated in ATF6α(-/-) mice than in ATF6α(+/+) mice after WD. ATF6α(-/-) mice that were mated with mice possessing a mutation causing familial neurohypophysial diabetes insipidus (FNDI), which is characterized by progressive polyuria and AVP neuronal loss due to the accumulation of mutant AVP precursor in the ER, manifested increased urine volume under intermittent WD. The aggregate formation in the ER of AVP neurons was further impaired in FNDI/ATF6α(-/-) mice compared with that in FNDI mice, and AVP neuronal loss was accelerated in FNDI/ATF6α(-/-) mice under WD. These data suggest that ATF6α is required for the AVP neuron system to maintain water balance under dehydration. PMID:25203138

  10. The activation of peroxisome proliferator-activated receptor γ is regulated by Krüppel-like transcription factors 6 & 9 under steatotic conditions

    SciTech Connect

    Escalona-Nandez, Ivonne; Guerrero-Escalera, Dafne; Estanes-Hernández, Alma; Ortíz-Ortega, Victor; Tovar, Armando R.; Pérez-Monter, Carlos


    Liver steatosis is characterised by lipid droplet deposition in hepatocytes that can leads to an inflammatory and fibrotic phenotype. Peroxisome proliferator-activated receptors (PPARs) play key roles in energetic homeostasis by regulating lipid metabolism in hepatic tissue. In adipose tissue PPARγ regulates the adipocyte differentiation by promoting the expression of lipid-associated genes. Within the liver PPARγ is up-regulated under steatotic conditions; however, which transcription factors participate in its expression is not completely understood. Krüppel-like transcription factors (KLFs) regulate various cellular mechanisms, such as cell proliferation and differentiation. KLFs are key components of adipogenesis by regulating the expression of PPARγ and other proteins such as the C-terminal enhancer binding protein (C/EBP). Here, we demonstrate that the transcript levels of Klf6, Klf9 and Pparγ are increased in response to a steatotic insult in vitro. Chromatin immunoprecipitation (ChIp) experiments showed that klf6 and klf9 are actively recruited to the Pparγ promoter region under these conditions. Accordingly, the loss-of-function experiments reduced cytoplasmic triglyceride accumulation. Here, we demonstrated that KLF6 and KLF9 proteins directly regulate PPARγ expression under steatotic conditions. - Highlights: • Palmitic acid promotes expression of KlF6 & KLF9 in HepG2 cells. • KLF6 and KLF9 promote the expression of PPARγ in response to palmitic acid. • Binding of KLF6 and KLF9 to the PPARγ promoter promotes steatosis in HepG2 cells. • KLF6 and KLF9 loss-of function diminishes the steatosis in HepG2 cells.

  11. Silver Nanoparticles Induce Degradation of the Endoplasmic Reticulum Stress Sensor Activating Transcription Factor-6 Leading to Activation of the NLRP-3 Inflammasome

    PubMed Central

    Simard, Jean-Christophe; Vallieres, Francis; de Liz, Rafael; Lavastre, Valerie; Girard, Denis


    In the past decade, the increasing amount of nanoparticles (NP) and nanomaterials used in multiple applications led the scientific community to investigate the potential toxicity of NP. Many studies highlighted the cytotoxic effects of various NP, including titanium dioxide, zinc oxide, and silver nanoparticles (AgNP). In a few studies, endoplasmic reticulum (ER) stress was found to be associated with NP cytotoxicity leading to apoptosis in different cell types. In this study, we report for the first time that silver nanoparticles of 15 nm (AgNP15), depending on the concentration, induced different signature ER stress markers in human THP-1 monocytes leading to a rapid ER stress response with degradation of the ATF-6 sensor. Also, AgNP15 induced pyroptosis and activation of the NLRP-3 inflammasome as demonstrated by the processing and increased activity of caspase-1 and secretion of IL-1β and ASC (apoptosis-associated speck-like protein containing a CARD domain) pyroptosome formation. Transfection of THP-1 cells with siRNA targeting NLRP-3 decreased the AgNP15-induced IL-1β production. The absence of caspase-4 expression resulted in a significant reduction of pro-IL-1β. However, caspase-1 activity was significantly higher in caspase-4-deficient cells when compared with WT cells. Inhibition of AgNP15-induced ATF-6 degradation with Site-2 protease inhibitors completely blocked the effect of AgNP15 on pyroptosis and secretion of IL-1β, indicating that ATF-6 is crucial for the induction of this type of cell death. We conclude that AgNP15 induce degradation of the ER stress sensor ATF-6, leading to activation of the NLRP-3 inflammasome regulated by caspase-4 in human monocytes. PMID:25593314

  12. Distinct roles of activating transcription factor 6 (ATF6) and double-stranded RNA-activated protein kinase-like endoplasmic reticulum kinase (PERK) in transcription during the mammalian unfolded protein response.

    PubMed Central

    Okada, Tetsuya; Yoshida, Hiderou; Akazawa, Rieko; Negishi, Manabu; Mori, Kazutoshi


    In response to accumulation of unfolded proteins in the endoplasmic reticulum (ER), a homoeostatic response, termed the unfolded protein response (UPR), is activated in all eukaryotic cells. The UPR involves only transcriptional regulation in yeast, and approx. 6% of all yeast genes, encoding not only proteins to augment the folding capacity in the ER, but also proteins working at various stages of secretion, are induced by ER stress [Travers, Patil, Wodicka, Lockhart, Weissman and Walter (2000) Cell (Cambridge, Mass.) 101, 249-258]. In the present study, we conducted microarray analysis of HeLa cells, although our analysis covered only a small fraction of the human genome. A great majority of human ER stress-inducible genes (approx. 1% of 1800 genes examined) were classified into two groups. One group consisted of genes encoding ER-resident molecular chaperones and folding enzymes, and these genes were directly regulated by the ER-membrane-bound transcription factor activating transcription factor (ATF) 6. The ER-membrane-bound protein kinase double-stranded RNA-activated protein kinase-like ER kinase (PERK)-mediated signalling pathway appeared to be responsible for induction of the remaining genes, which are not involved in secretion, but may be important after cellular recovery from ER stress. In higher eukaryotes, the PERK-mediated translational-attenuation system is known to operate in concert with the transcriptional-induction system. Thus we propose that mammalian cells have evolved a strategy to cope with ER stress different from that of yeast cells. PMID:12014989

  13. Identification of the G13 (cAMP-response-element-binding protein-related protein) gene product related to activating transcription factor 6 as a transcriptional activator of the mammalian unfolded protein response.

    PubMed Central

    Haze, K; Okada, T; Yoshida, H; Yanagi, H; Yura, T; Negishi, M; Mori, K


    Eukaryotic cells control the levels of molecular chaperones and folding enzymes in the endoplasmic reticulum (ER) by a transcriptional induction process termed the unfolded protein response (UPR). The mammalian UPR is mediated by the cis-acting ER stress response element consisting of 19 nt (CCAATN(9)CCACG), the CCACG part of which is considered to provide specificity. We recently identified the basic leucine zipper (bZIP) protein ATF6 as a mammalian UPR-specific transcription factor; ATF6 is activated by ER stress-induced proteolysis and binds directly to CCACG. Here we report that eukaryotic cells express another bZIP protein closely related to ATF6 in both structure and function. This protein encoded by the G13 (cAMP response element binding protein-related protein) gene is constitutively synthesized as a type II transmembrane glycoprotein anchored in the ER membrane and processed into a soluble form upon ER stress as occurs with ATF6. The proteolytic processing of ATF6 and the G13 gene product is accompanied by their relocation from the ER to the nucleus; their basic regions seem to function as a nuclear localization signal. Overexpression of the soluble form of the G13 product constitutively activates the UPR, whereas overexpression of a mutant lacking the activation domain exhibits a strong dominant-negative effect. Furthermore, the soluble forms of ATF6 and the G13 gene product are unable to bind to several point mutants of the cis-acting ER stress response element in vitro that hardly respond to ER stress in vivo. We thus concluded that the two related bZIP proteins are crucial transcriptional regulators of the mammalian UPR, and propose calling the ATF6 gene product ATF6alpha and the G13 gene product ATF6beta. PMID:11256944

  14. Transcriptional activators in yeast

    PubMed Central


    Eukaryotic transcription activation domains (ADs) are not well defined on the proteome scale. We systematicallly tested ∼6000 yeast proteins for transcriptional activity using a yeast one-hybrid system and identified 451 transcriptional activators. We then determined their transcription activation strength using fusions to the Gal4 DNA-binding domain and a His3 reporter gene which contained a promoter with a Gal4-binding site. Among the 132 strongest activators 32 are known transcription factors while another 35 have no known function. Although zinc fingers, helix–loop–helix domains and several other domains are highly overrepresented among the activators, only few contain characterized ADs. We also found some striking correlations: the stronger the activation activity, the more acidic, glutamine-rich, proline-rich or asparagine-rich the activators were. About 29% of the activators have been found previously to specifically interact with the transcription machinery, while 10% are known to be components of transcription regulatory complexes. Based on their transcriptional activity, localization and interaction patterns, at least six previously uncharacterized proteins are suggested to be bona fide transcriptional regulators (namely YFL049W, YJR070C, YDR520C, YGL066W/Sgf73, YKR064W and YCR082W/Ahc2). PMID:16464826

  15. Interferon Regulatory Factor 6 promotes differentiation of the periderm by activating expression of Grainyhead-like 3

    PubMed Central

    de la Garza, Gabriel; Schleiffarth, Jack Robert; Dunnwald, Martine; Mankad, Anuj; Weirather, Jason L.; Bonde, Gregory; Butcher, Stephen; Mansour, Tamer A.; Kousa, Youssef A.; Fukazawa, Cindy F.; Houston, Douglas W.; Manak, J. Robert; Schutte, Brian C.; Wagner, Daniel; Cornell, Robert A.


    Interferon Regulatory Factor 6 (IRF6) is a transcription factor that, in mammals, is required for the differentiation of skin, breast epithelium, and oral epithelium. However, the transcriptional targets that mediate these effects are currently unknown. In zebrafish and frog embryos Irf6 is necessary for differentiation of the embryonic superficial epithelium, or periderm. Here we use microarrays to identify genes that are expressed in the zebrafish periderm and whose expression is inhibited by a dominant-negative variant of Irf6 (dnIrf6). These methods identify Grhl3, an ancient regulator of the epidermal permeability barrier, as acting downstream of Irf6. In human keratinocytes, IRF6 binds conserved elements near the GHRL3 promoter. We show that one of these elements has enhancer activity in human keratinocytes and zebrafish periderm, suggesting that Irf6 directly stimulates Grhl3 expression in these tissues. Simultaneous inhibition of grhl1 and grhl3 disrupts periderm differentiation in zebrafish, and, intriguingly, forced grhl3 expression restores periderm markers in both zebrafish injected with dnIrf6 and frog embryos depleted of Irf6. Finally, in Irf6 deficient mouse embryos, Grhl3 expression in the periderm and oral epithelium is virtually absent. These results indicate that Grhl3 is a key effector of Irf6 in periderm differentiation. PMID:22931925

  16. Hepatocyte nuclear factor-6 stimulates transcription of the alpha-fetoprotein gene and synergizes with the retinoic-acid-receptor-related orphan receptor alpha-4.

    PubMed Central

    Nacer-Cherif, Habib; Bois-Joyeux, Brigitte; Rousseau, Guy G; Lemaigre, Frédéric P; Danan, Jean-Louis


    The rat alpha-fetoprotein ( afp ) gene is controlled by three enhancers whose function depends on their interaction with liver-enriched transcription factors. The afp enhancer III, located at -6 kb, is composed of three regions that act in synergy. Two of these regions, called s1 and s2, contain a putative binding site for hepatocyte nuclear factor-6 (HNF-6). This factor is the prototype of the ONECUT family of cut-homoeodomain proteins and is a known regulator of liver gene expression in adults and during development. We show here that the two splicing isoforms of HNF-6 bind to a site in the s1 region and in the s2 region. The core sequence of the s1 site corresponds to none of the known HNF-6 binding sites. Nevertheless, the binding properties of the s1 site are identical with those of the s2 site and of previously characterized HNF-6 binding sequences. The HNF-6 consensus should therefore be rewritten as DRRTCVATND. Binding of HNF-6 to the s1 and s2 sites requires both the cut and the homoeo domains, is co-operative and induces DNA bending. HNF-6 strongly stimulates the activity of the afp enhancer III in transient transfection experiments. This effect requires the stereo-specific alignment of the two HNF-6 sites. Moreover, HNF-6 stimulates the enhancer in synergy with the retinoic-acid-receptor-related orphan receptor alpha (RORalpha), which binds to a neighbouring site in the s1 region. Thus expression of the afp gene requires functional interactions between HNF-6 molecules and between HNF-6 and RORalpha. PMID:12379144

  17. Structural basis of transcription activation.


    Feng, Yu; Zhang, Yu; Ebright, Richard H


    Class II transcription activators function by binding to a DNA site overlapping a core promoter and stimulating isomerization of an initial RNA polymerase (RNAP)-promoter closed complex into a catalytically competent RNAP-promoter open complex. Here, we report a 4.4 angstrom crystal structure of an intact bacterial class II transcription activation complex. The structure comprises Thermus thermophilus transcription activator protein TTHB099 (TAP) [homolog of Escherichia coli catabolite activator protein (CAP)], T. thermophilus RNAP σ(A) holoenzyme, a class II TAP-dependent promoter, and a ribotetranucleotide primer. The structure reveals the interactions between RNAP holoenzyme and DNA responsible for transcription initiation and reveals the interactions between TAP and RNAP holoenzyme responsible for transcription activation. The structure indicates that TAP stimulates isomerization through simple, adhesive, stabilizing protein-protein interactions with RNAP holoenzyme. PMID:27284196

  18. Creating small transcription activating RNAs.


    Chappell, James; Takahashi, Melissa K; Lucks, Julius B


    We expanded the mechanistic capability of small RNAs by creating an entirely synthetic mode of regulation: small transcription activating RNAs (STARs). Using two strategies, we engineered synthetic STAR regulators to disrupt the formation of an intrinsic transcription terminator placed upstream of a gene in Escherichia coli. This resulted in a group of four highly orthogonal STARs that had up to 94-fold activation. By systematically modifying sequence features of this group, we derived design principles for STAR function, which we then used to forward engineer a STAR that targets a terminator found in the Escherichia coli genome. Finally, we showed that STARs could be combined in tandem to create previously unattainable RNA-only transcriptional logic gates. STARs provide a new mechanism of regulation that will expand our ability to use small RNAs to construct synthetic gene networks that precisely control gene expression. PMID:25643173

  19. ADP Ribosylation Factor 6 (ARF6) Promotes Acrosomal Exocytosis by Modulating Lipid Turnover and Rab3A Activation*

    PubMed Central

    Pelletán, Leonardo E.; Suhaiman, Laila; Vaquer, Cintia C.; Bustos, Matías A.; De Blas, Gerardo A.; Vitale, Nicolas; Mayorga, Luis S.; Belmonte, Silvia A.


    Regulated secretion is a central issue for the specific function of many cells; for instance, mammalian sperm acrosomal exocytosis is essential for egg fertilization. ARF6 (ADP-ribosylation factor 6) is a small GTPase implicated in exocytosis, but its downstream effectors remain elusive in this process. We combined biochemical, functional, and microscopy-based methods to show that ARF6 is present in human sperm, localizes to the acrosomal region, and is required for calcium and diacylglycerol-induced exocytosis. Results from pulldown assays show that ARF6 exchanges GDP for GTP in sperm challenged with different exocytic stimuli. Myristoylated and guanosine 5′-3-O-(thio)triphosphate (GTPγS)-loaded ARF6 (active form) added to permeabilized sperm induces acrosome exocytosis even in the absence of extracellular calcium. We explore the ARF6 signaling cascade that promotes secretion. We demonstrate that ARF6 stimulates a sperm phospholipase D activity to produce phosphatidic acid and boosts the synthesis of phosphatidylinositol 4,5-bisphosphate. We present direct evidence showing that active ARF6 increases phospholipase C activity, causing phosphatidylinositol 4,5-bisphosphate hydrolysis and inositol 1,4,5-trisphosphate-dependent intra-acrosomal calcium release. We show that active ARF6 increases the exchange of GDP for GTP on Rab3A, a prerequisite for secretion. We propose that exocytic stimuli activate ARF6, which is required for acrosomal calcium efflux and the assembly of the membrane fusion machinery. This report highlights the physiological importance of ARF6 as a key factor for human sperm exocytosis and fertilization. PMID:25713146

  20. Linking Smads and transcriptional activation.


    Inman, Gareth J


    TGF-beta1 (transforming growth factor-beta1) is the prototypical member of a large family of pleiotropic cytokines that regulate diverse biological processes during development and adult tissue homoeostasis. TGF-beta signals via membrane bound serine/threonine kinase receptors which transmit their signals via the intracellular signalling molecules Smad2, Smad3 and Smad4. These Smads contain conserved MH1 and MH2 domains separated by a flexible linker domain. Smad2 and Smad3 act as kinase substrates for the receptors, and, following phosphorylation, they form complexes with Smad4 and translocate to the nucleus. These Smad complexes regulate gene expression and ultimately determine the biological response to TGF-beta. In this issue of the Biochemical Journal, Wang et al. have shown that, like Smad4, the linker domain of Smad3 contains a Smad transcriptional activation domain. This is capable of recruiting the p300 transcriptional co-activator and is required for Smad3-dependent transcriptional activation. This study raises interesting questions about the nature and regulation of Smad-regulated gene activation and elevates the status of the linker domain to rival that of the much-lauded MH1 and MH2 domains. PMID:15702493

  1. Centaurin-alpha 1, an ADP-ribosylation factor 6 GTPase activating protein, inhibits beta 2-adrenoceptor internalization.


    Lawrence, Joanna; Mundell, Stuart J; Yun, Hongruo; Kelly, Eamonn; Venkateswarlu, Kanamarlapudi


    The small GTP-binding protein ADP ribosylation factor 6 (ARF6) has recently been implicated in the internalization of G protein-coupled receptors (GPCRs), although its precise molecular mechanism in this process remains unclear. We have recently identified centaurin alpha(1) as a GTPase activating protein (GAP) for ARF6. In the current study, we characterized the effects of centaurin alpha(1) on the agonist-induced internalization of the beta(2)-adrenoceptor transiently expressed in human embryonic kidney (HEK) 293 cells. Using an enzyme-linked immunosorbent assay as well as confocal imaging of cells, we found that expression of centaurin alpha(1) strongly inhibited the isoproterenol-induced internalization of beta(2)-adrenoceptor. On the other hand, expression of functionally inactive versions of centaurin alpha(1), including an R49C mutant, which has no catalytic activity, and a double pleckstrin homology (PH) mutant (DM; R148C/R273C), which has mutations in both the PH domains of centaurin alpha(1), rendering it unable to translocate to the cell membrane, were unable to inhibit beta(2)-adrenoceptor internalization. In addition, a constitutively active version of ARF6, ARF6Q67L, reversed the ability of centaurin alpha(1) to inhibit beta(2)-adrenoceptor internalization. Finally, expression of centaurin alpha(1) also inhibited the agonist-induced internalization of beta(2)-adrenoceptor endogenously expressed in HEK 293 cells, whereas the R49C and DM mutant versions of centaurin alpha(1) had no effect. Together, these data indicate that by acting as an ARF6 GAP, centaurin alpha(1) is able to switch off ARF6 and so inhibit its ability to mediate beta(2)-adrenoceptor internalization. Thus, ARF6 GAPs, such as centaurin alpha(1), are likely to play a crucial role in GPCR trafficking by modulating the activity of ARF6. PMID:15778454

  2. Forcing FAK into Transcriptional Activity.


    Lietha, Daniel


    Focal adhesion kinase (FAK) has known signaling roles in cytoplasmic adhesion structures, but was recently shown to act as a transcriptional regulator in the nucleus. In this issue of Structure, Cardoso et al. (2016) report that mechanical forces translocate FAK to the nucleus of cardiomyocytes, and provide structural insights into how FAK interacts with the MEF2 transcription factor to control cardiac hypertrophy. PMID:27486913

  3. Transcriptional activation in yeast cells lacking transcription factor IIA.

    PubMed Central

    Chou, S; Chatterjee, S; Lee, M; Struhl, K


    The general transcription factor IIA (TFIIA) forms a complex with TFIID at the TATA promoter element, and it inhibits the function of several negative regulators of the TATA-binding protein (TBP) subunit of TFIID. Biochemical experiments suggest that TFIIA is important in the response to transcriptional activators because activation domains can interact with TFIIA, increase recruitment of TFIID and TFIIA to the promoter, and promote isomerization of the TFIID-TFIIA-TATA complex. Here, we describe a double-shut-off approach to deplete yeast cells of Toa1, the large subunit of TFIIA, to <1% of the wild-type level. Interestingly, such TFIIA-depleted cells are essentially unaffected for activation by heat shock factor, Ace1, and Gal4-VP16. However, depletion of TFIIA causes a general two- to threefold decrease of transcription from most yeast promoters and a specific cell-cycle arrest at the G2-M boundary. These results indicate that transcriptional activation in vivo can occur in the absence of TFIIA. PMID:10581267

  4. Piceatannol attenuates cardiac hypertrophy in an animal model through regulation of the expression and binding of the transcription factor GATA binding factor 6.


    Kee, Hae Jin; Park, Sangha; Kang, Wanseok; Lim, Kyung Seob; Kim, Jung Ha; Ahn, Youngkeun; Jeong, Myung Ho


    Piceatannol is found in grapes, passion fruit, and Japanese knotweed. Piceatannol pretreatment suppresses cardiac hypertrophy induced by isoproterenol as assessed by heart weight/body weight ratio, cross-sectional area, and expression of hypertrophic markers. The anti-hypertrophic effect of piceatannol in rat neonatal cardiomyocytes is the same as that in vivo. Piceatannol inhibits lentiviral-GATA6-induced cardiomyocyte hypertrophy. Furthermore, piceatannol reduces the interaction between GATA4 and GATA6 as well as the DNA-binding activity of endogenous GATA6 in the ANP promoter. Our results suggest that piceatannol may be a novel therapeutic agent for the prevention of cardiac hypertrophy. PMID:24662306

  5. Cyclin D1 transcriptional activation in MCL.


    Beà, Sílvia


    In this issue of Blood, Allinne et al propose the nucleolin-dependent activation of the translocated CCND1 allele in mantle cell lymphoma (MCL) because of its relocalization to a transcriptionally favorable area in the perinucleolar region. PMID:24677400

  6. Chromatin insulation by a transcriptional activator

    PubMed Central

    Sutter, Nathan B.; Scalzo, David; Fiering, Steven; Groudine, Mark; Martin, David I. K.


    In eukaryotic genomes, transcriptionally active regions are interspersed with silent chromatin that may repress genes in its vicinity. Chromatin insulators are elements that can shield a locus from repressive effects of flanking chromatin. Few such elements have been characterized in higher eukaryotes, but transcriptional activating elements are an invariant feature of active loci and have been shown to suppress transgene silencing. Hence, we have assessed the ability of a transcriptional activator to cause chromatin insulation, i.e., to relieve position effects at transgene integration sites in cultured cells. The transgene contained a series of binding sites for the metal-inducible transcriptional activator MTF, linked to a GFP reporter. Clones carrying single integrated transgenes were derived without selection for expression, and in most clones the transgene was silent. Induction of MTF resulted in transition of the transgene from the silent to the active state, prolongation of the active state, and a marked narrowing of the range of expression levels at different genomic sites. At one genomic site, prolonged induction of MTF resulted in suppression of transgene silencing that persisted after withdrawal of the induction stimulus. These results are consistent with MTF acting as a chromatin insulator and imply that transcriptional activating elements can insulate active loci against chromatin repression. PMID:12547916

  7. Divergent transcriptional activities determine limb identity

    PubMed Central

    Ouimette, Jean-François; Jolin, Marisol Lavertu; L'honoré, Aurore; Gifuni, Anthony; Drouin, Jacques


    Limbs develop using a common genetic programme despite widely differing morphologies. This programme is modulated by limb-restricted regulators such as hindlimb (HL) transcription factors Pitx1 and Tbx4 and the forelimb (FL) Tbx5. Both Tbx factors have been implicated in limb patterning and growth, but their relative activities and underlying mechanisms remain unclear. In this paper, we show that Tbx4 and Tbx5 harbour conserved and divergent transcriptional regulatory domains that account for their roles in limb development. In particular, both factors share an activator domain and the ability to stimulate limb growth. However, we find that Tbx4 is the primary effector of HL identity for both skeletal and muscle development; this activity relies on a repressor domain that is inactivated by a human TBX4 small-patella syndrome mutation. We propose that limb identity is largely achieved by default in FL, whereas a specific repressor activity unique to Tbx4 determines HL identity. PMID:20975709

  8. Activating transcription factor 2 in mesenchymal tumors.


    Endo, Makoto; Su, Le; Nielsen, Torsten O


    Activating transcription factor 2 (ATF2) is a member of activator protein 1 superfamily, which can heterodimerize with other transcription factors regulating cell differentiation and survival. ATF2 assembles into a complex with the synovial sarcoma translocation, chromosome 18 (SS18)-synovial sarcoma, X breakpoint (SSX) fusion oncoprotein, and the transducin-like enhancer of split 1 (TLE1) corepressor, driving oncogenesis in synovial sarcoma. The fusion oncoproteins in many other translocation-associated sarcomas incorporate transcription factors from the ATF/cAMP response element binding or E26 families, which potentially form heterodimers with ATF2 to regulate transcription. ATF2 may therefore play an important role in the oncogenesis of many mesenchymal tumors, but as yet, little is known about its protein expression in patient specimens. Herein we perform immunohistochemical analyses using a validated specific antibody for ATF2 expression and intracellular localization on a cohort of 594 malignant and 207 benign mesenchymal tumors representing 47 diagnostic entities. Melanoma served as a positive control for nuclear and cytoplasmic staining. High nuclear ATF2 expression was mainly observed in translocation-associated and/or spindle cell sarcomas including synovial sarcoma, desmoplastic small round cell tumor, endometrial stromal sarcoma, gastrointestinal stromal tumor, malignant peripheral nerve sheath tumor, and solitary fibrous tumor. Cytoplasmic ATF2 expression was less frequently seen than nuclear expression in malignant mesenchymal tumors. Benign mesenchymal tumors mostly showed much lower nuclear and cytoplasmic ATF2 expression. PMID:24289970

  9. Coupling factor 6 downregulates platelet endothelial cell adhesion molecule-1 via c-Src activation and acts as a proatherogenic molecule.


    Kumagai, Akiko; Osanai, Tomohiro; Katoh, Chisato; Tanaka, Makoto; Tomita, Hirofumi; Morimoto, Takeshi; Murakami, Reiichi; Magota, Koji; Okumura, Ken


    Coupling factor 6 (CF6), a component of ATP synthase, suppresses the generation of prostacyclin and nitric oxide (NO). Platelet endothelial cell adhesion molecule-1 (PECAM-1) is involved in shear-induced NO production. To investigate the linkage between the actions of CF6 and PECAM-1, we examined the effects of CF6 on PECAM-1 expression and shear-mediated NO release, comparatively with those of angiotensin II (AngII). Treatment of human umbilical vein endothelial cells (HUVEC) and aortic endothelial cells (HAEC) with CF6 at 10(-7)M or AngII at 10(-7)M for 24h suppressed PECAM-1 gene and protein expression. CF6 or AngII activated c-Src at 15 min in HUVEC, and blockade of c-Src with PP1, its specific inhibitor, restored them. Efrapeptin, an inhibitor of ATPase, attenuated CF6-induced suppression of PECAM-1 gene expression by blockade of acidification, whereas superoxide dismutase or apocinin, an inhibitor of NADPH oxidase, blocked AngII-induced suppression of PECAM-1. Exposure of the cells to shear stress at 25 dynes/cm(2) for 30 min enhanced phosphorylation of eNOS at Ser(1177) and NO release. Pretreatment with CF6 or AngII for 24h attenuated them in HUVEC and HAEC. These suggest that CF6 downregulates PECAM-1 expression via c-Src activation and attenuates shear-induced NO release presumably by suppressing eNOS phosphorylation. PMID:18243211

  10. The transcriptional corepressor DSP1 inhibits activated transcription by disrupting TFIIA-TBP complex formation.

    PubMed Central

    Kirov, N C; Lieberman, P M; Rushlow, C


    Transcriptional repression of eukaryotic genes is essential for many cellular and developmental processes, yet the precise mechanisms of repression remain poorly understood. The Dorsal Switch Protein (DSP1) was identified in a genetic screen for activities which convert Dorsal into a transcriptional repressor. DSP1 shares structural homology with the HMG-1/2 family and inhibits activation by the rel transcription factors Dorsal and NF-kappaB in transfection studies. Here we investigate the mechanism of transcriptional repression by DSP1. We found that DSP1 protein can act as a potent transcriptional repressor for multiple activator families in vitro and in transfection studies. DSP1 bound directly to the TATA binding protein (TBP), and formed a stable ternary complex with TBP bound to DNA. DSP1 preferentially disrupted the DNA binding of TBP complexes containing TFIIA and displaced TFIIA from binding to TBP. Consistent with the inhibition of TFIIA-bound complexes, DSP1 was shown to inhibit activated but not basal transcription reactions in vitro. The ability of DSP1 to interact with TBP and to repress transcription was mapped to the carboxy-terminal domain which contains two HMG boxes. Our results support the model that DSP1 represses activated transcription by interfering with the binding of TFIIA, a general transcription factor implicated in activated transcription pathways. Images PMID:9003783

  11. A position-dependent transcription-activating domain in TFIIIA.


    Mao, X; Darby, M K


    Transcription of the Xenopus 5S RNA gene by RNA polymerase III requires the gene-specific factor TFIIIA. To identify domains within TFIIIA that are essential for transcriptional activation, we have expressed C-terminal deletion, substitution, and insertion mutants of TFIIIA in bacteria as fusions with maltose-binding protein (MBP). The MBP-TFIIIA fusion protein specifically binds to the 5S RNA gene internal control region and complements transcription in a TFIIIA-depleted oocyte nuclear extract. Random, cassette-mediated mutagenesis of the carboxyl region of TFIIIA, which is not required for promoter binding, has defined a 14-amino-acid region that is critical for transcriptional activation. In contrast to activators of RNA polymerase II, the activity of the TFIIIA activation domain is strikingly sensitive to its position relative to the DNA-binding domain. When the eight amino acids that separate the transcription-activating domain from the last zinc finger are deleted, transcriptional activity is lost. Surprisingly, diverse amino acids can replace these eight amino acids with restoration of full transcriptional activity, suggesting that the length and not the sequence of this region is important. Insertion of amino acids between the zinc finger region and the transcription-activating domain causes a reduction in transcription proportional to the number of amino acids introduced. We propose that to function, the transcription-activating domain of TFIIIA must be correctly positioned at a minimum distance from the DNA-binding domain. PMID:8246967

  12. Mechanisms of specificity in neuronal activity-regulated gene transcription

    PubMed Central

    Lyons, Michelle R.; West, Anne E.


    The brain is a highly adaptable organ that is capable of converting sensory information into changes in neuronal function. This plasticity allows behavior to be accommodated to the environment, providing an important evolutionary advantage. Neurons convert environmental stimuli into long-lasting changes in their physiology in part through the synaptic activity-regulated transcription of new gene products. Since the neurotransmitter-dependent regulation of Fos transcription was first discovered nearly 25 years ago, a wealth of studies have enriched our understanding of the molecular pathways that mediate activity-regulated changes in gene transcription. These findings show that a broad range of signaling pathways and transcriptional regulators can be engaged by neuronal activity to sculpt complex programs of stimulus-regulated gene transcription. However, the shear scope of the transcriptional pathways engaged by neuronal activity raises the question of how specificity in the nature of the transcriptional response is achieved in order to encode physiologically relevant responses to divergent stimuli. Here we summarize the general paradigms by which neuronal activity regulates transcription while focusing on the molecular mechanisms that confer differential stimulus-, cell-type-, and developmental-specificity upon activity-regulated programs of neuronal gene transcription. In addition, we preview some of the new technologies that will advance our future understanding of the mechanisms and consequences of activity-regulated gene transcription in the brain. PMID:21620929

  13. Constraints on transcriptional activator function contribute to transcriptional quiescence during early Xenopus embryogenesis.

    PubMed Central

    Almouzni, G; Wolffe, A P


    We have examined the cause of transcriptional quiescence prior to the mid-blastula transition (MBT) in Xenopus laevis. We have found distinct requirements for transcription of class II and class III genes. An artificial increase of the amount of DNA present within the embryo over that found at the MBT allows precocious transcription of tRNA genes, but not of the adenovirus E4 or human cytomegalovirus (CMV) promoters. Thus titration of an inhibitor by exogenous DNA determines class III but not class II gene activation. We demonstrate that the action of the inhibitor depends on the association of core histones with DNA. The addition of exogenous TBP, together with an increase in the amount of DNA within the embryo, allows significant basal transcription of class II genes prior to the MBT, whereas it does not increase transcription of tRNA genes. To examine the activation of transcription above basal levels, we used a defined minimal promoter containing five Gal4 binding sites and the activator Gal4-VP16. Precocious transcriptional activation is directed by Gal4-VP16 prior to the MBT, demonstrating that a functional transcriptional machinery exists at this early developmental stage. Furthermore, since this activation can occur in the absence of exogenous TBP or chromatin titration, a transcription factor that can penetrate chromatin is sufficient for recruitment of this machinery to a promoter. Our results support the hypothesis that the temporal regulation of transcription during early embryogenesis in Xenopus reflects not only a titration of inhibitors by DNA, but also a deficiency in the activity of transcriptional activators prior to the MBT. Images PMID:7737126

  14. Mediator protein mutations that selectively abolish activated transcription.


    Myers, L C; Gustafsson, C M; Hayashibara, K C; Brown, P O; Kornberg, R D


    Deletion of any one of three subunits of the yeast Mediator of transcriptional regulation, Med2, Pgd1 (Hrs1), and Sin4, abolished activation by Gal4-VP16 in vitro. By contrast, other Mediator functions, stimulation of basal transcription and of TFIIH kinase activity, were unaffected. A different but overlapping Mediator subunit dependence was found for activation by Gcn4. The genetic requirements for activation in vivo were closely coincident with those in vitro. A whole genome expression profile of a Deltamed2 strain showed diminished transcription of a subset of inducible genes but only minor effects on "basal" transcription. These findings make an important connection between transcriptional activation in vitro and in vivo, and identify Mediator as a "global" transcriptional coactivator. PMID:9874773

  15. The Smad3 linker region contains a transcriptional activation domain.


    Wang, Guannan; Long, Jianyin; Matsuura, Isao; He, Dongming; Liu, Fang


    Transforming growth factor-beta (TGF-beta)/Smads regulate a wide variety of biological responses through transcriptional regulation of target genes. Smad3 plays a key role in TGF-beta/Smad-mediated transcriptional responses. Here, we show that the proline-rich linker region of Smad3 contains a transcriptional activation domain. When the linker region is fused to a heterologous DNA-binding domain, it activates transcription. We show that the linker region physically interacts with p300. The adenovirus E1a protein, which binds to p300, inhibits the transcriptional activity of the linker region, and overexpression of p300 can rescue the linker-mediated transcriptional activation. In contrast, an adenovirus E1a mutant, which cannot bind to p300, does not inhibit the linker-mediated transcription. The native Smad3 protein lacking the linker region is unable to mediate TGF-beta transcriptional activation responses, although it can be phosphorylated by the TGF-beta receptor at the C-terminal tail and has a significantly increased ability to form a heteromeric complex with Smad4. We show further that the linker region and the C-terminal domain of Smad3 synergize for transcriptional activation in the presence of TGF-beta. Thus our findings uncover an important function of the Smad3 linker region in Smad-mediated transcriptional control. PMID:15588252

  16. Cooperative activation of Xenopus rhodopsin transcription by paired-like transcription factors

    PubMed Central


    Background In vertebrates, rod photoreceptor-specific gene expression is regulated by the large Maf and Pax-like transcription factors, Nrl/LNrl and Crx/Otx5. The ubiquitous occurrence of their target DNA binding sites throughout rod-specific gene promoters suggests that multiple transcription factor interactions within the promoter are functionally important. Cooperative action by these transcription factors activates rod-specific genes such as rhodopsin. However, a quantitative mechanistic explanation of transcriptional rate determinants is lacking. Results We investigated the contributions of various paired-like transcription factors and their cognate cis-elements to rhodopsin gene activation using cultured cells to quantify activity. The Xenopus rhodopsin promoter (XOP) has a bipartite structure, with ~200 bp proximal to the start site (RPP) coordinating cooperative activation by Nrl/LNrl-Crx/Otx5 and the adjacent 5300 bp upstream sequence increasing the overall expression level. The synergistic activation by Nrl/LNrl-Crx/Otx5 also occurred when XOP was stably integrated into the genome. We determined that Crx/Otx5 synergistically activated transcription independently and additively through the two Pax-like cis-elements, BAT1 and Ret4, but not through Ret1. Other Pax-like family members, Rax1 and Rax2, do not synergistically activate XOP transcription with Nrl/LNrl and/or Crx/Otx5; rather they act as co-activators via the Ret1 cis-element. Conclusions We have provided a quantitative model of cooperative transcriptional activation of the rhodopsin promoter through interaction of Crx/Otx5 with Nrl/LNrl at two paired-like cis-elements proximal to the NRE and TATA binding site. Further, we have shown that Rax genes act in cooperation with Crx/Otx5 with Nrl/LNrl as co-activators of rhodopsin transcription. PMID:24499263

  17. The transcriptional activity of human Chromosome 22

    PubMed Central

    Rinn, John L.; Euskirchen, Ghia; Bertone, Paul; Martone, Rebecca; Luscombe, Nicholas M.; Hartman, Stephen; Harrison, Paul M.; Nelson, F. Kenneth; Miller, Perry; Gerstein, Mark; Weissman, Sherman; Snyder, Michael


    A DNA microarray representing nearly all of the unique sequences of human Chromosome 22 was constructed and used to measure global-transcriptional activity in placental poly(A)+ RNA. We found that many of the known, related and predicted genes are expressed. More importantly, our study reveals twice as many transcribed bases as have been reported previously. Many of the newly discovered expressed fragments were verified by RNA blot analysis and a novel technique called differential hybridization mapping (DHM). Interestingly, a significant fraction of these novel fragments are expressed antisense to previously annotated introns. The coding potential of these novel expressed regions is supported by their sequence conservation in the mouse genome. This study has greatly increased our understanding of the biological information encoded on a human chromosome. To facilitate the dissemination of these results to the scientific community, we have developed a comprehensive Web resource to present the findings of this study and other features of human Chromosome 22 at PMID:12600945

  18. Activation domains of transcription factors mediate replication dependent transcription from a minimal HIV-1 promoter.

    PubMed Central

    Williams, R D; Lee, B A; Jackson, S P; Proudfoot, N J


    Transcription from a minimal HIV-1 promoter containing the three Sp1 binding sites and TATA box can be activated without Tat by template DNA replication. Here we show that this activation can also be mediated by recombinant GAL4 fusion proteins containing the activation domains of Sp1, VP16 or CTF (or by full-length GAL4) targeted to the HIV-1 promoter by replacing the Sp1 sites with five GAL4 binding sites. Thus Sp1 is not unique in its ability to mediate replication activated transcription, although the degree of processivity elicited by the different activators varied significantly from strongly processive (GAL4-VP16) to relatively non-processive (GAL4-Sp1 or -CTF). Processive GAL4-VP16-activated transcription, but not efficient initiation, required multiple GAL4 binding sites. In the presence of Tat, transcription with GAL4-SP1 and GAL4-CTF was further activated (principally at the level of processivity) but GAL4-VP16-potentiated transcription was only slightly stimulated. The Tat-dependent switch from non-processive to fully processive transcription was particularly marked for GAL4-Sp1, an effect which may be relevant to the selection of Sp1 binding sites by the HIV-1 promoter. PMID:8604293

  19. Activation of archaeal transcription mediated by recruitment of transcription factor B.


    Ochs, Simon M; Thumann, Sybille; Richau, Renate; Weirauch, Matt T; Lowe, Todd M; Thomm, Michael; Hausner, Winfried


    Archaeal promoters consist of a TATA box and a purine-rich adjacent upstream sequence (transcription factor B (TFB)-responsive element (BRE)), which are bound by the transcription factors TATA box-binding protein (TBP) and TFB. Currently, only a few activators of archaeal transcription have been experimentally characterized. The best studied activator, Ptr2, mediates activation by recruitment of TBP. Here, we present a detailed biochemical analysis of an archaeal transcriptional activator, PF1088, which was identified in Pyrococcus furiosus by a bioinformatic approach. Operon predictions suggested that an upstream gene, pf1089, is polycistronically transcribed with pf1088. We demonstrate that PF1088 stimulates in vitro transcription by up to 7-fold when the pf1089 promoter is used as a template. By DNase I and hydroxyl radical footprinting experiments, we show that the binding site of PF1088 is located directly upstream of the BRE of pf1089. Mutational analysis indicated that activation requires the presence of the binding site for PF1088. Furthermore, we show that activation of transcription by PF1088 is dependent upon the presence of an imperfect BRE and is abolished when the pf1089 BRE is replaced with a BRE from a strong archaeal promoter. Gel shift experiments showed that TFB recruitment to the pf1089 operon is stimulated by PF1088, and TFB seems to stabilize PF1088 operator binding even in the absence of TBP. Taken together, these results represent the first biochemical evidence for a transcriptional activator working as a TFB recruitment factor in Archaea, for which the designation TFB-RF1 is suggested. PMID:22496454

  20. Regulation of maternal transcript destabilization during egg activation in Drosophila.

    PubMed Central

    Tadros, Wael; Houston, Simon A; Bashirullah, Arash; Cooperstock, Ramona L; Semotok, Jennifer L; Reed, Bruce H; Lipshitz, Howard D


    In animals, the transfer of developmental control from maternal RNAs and proteins to zygotically derived products occurs at the midblastula transition. This is accompanied by the destabilization of a subset of maternal transcripts. In Drosophila, maternal transcript destabilization occurs in the absence of fertilization and requires specific cis-acting instability elements. We show here that egg activation is necessary and sufficient to trigger transcript destabilization. We have identified 13 maternal-effect lethal loci that, when mutated, result in failure of maternal transcript degradation. All mutants identified are defective in one or more additional processes associated with egg activation. These include vitelline membrane reorganization, cortical microtubule depolymerization, translation of maternal mRNA, completion of meiosis, and chromosome condensation (the S-to-M transition) after meiosis. The least pleiotropic class of transcript destabilization mutants consists of three genes: pan gu, plutonium, and giant nuclei. These three genes regulate the S-to-M transition at the end of meiosis and are thought to be required for the maintenance of cyclin-dependent kinase (CDK) activity during this cell cycle transition. Consistent with a possible functional connection between this S-to-M transition and transcript destabilization, we show that in vitro-activated eggs, which exhibit aberrant postmeiotic chromosome condensation, fail to initiate transcript degradation. Several genetic tests exclude the possibility that reduction of CDK/cyclin complex activity per se is responsible for the failure to trigger transcript destabilization in these mutants. We propose that the trigger for transcript destabilization occurs coincidently with the S-to-M transition at the end of meiosis and that pan gu, plutonium, and giant nuclei regulate maternal transcript destabilization independent of their role in cell cycle regulation. PMID:12871909

  1. ADP-Ribosylation Factor 6 Acts as an Allosteric Activator for the Folded but not Disordered Cholera Toxin A1 Polypeptide

    PubMed Central

    Banerjee, Tuhina; Taylor, Michael; Jobling, Michael G.; Burress, Helen; Yang, ZhiJie; Serrano, Albert; Holmes, Randall K.; Tatulian, Suren A.; Teter, Ken


    Summary The catalytic A1 subunit of cholera toxin (CTA1) has a disordered structure at 37°C. An interaction with host factors must therefore place CTA1 in a folded conformation for the modification of its Gsα target which resides in a lipid raft environment. Host ADP-ribosylation factors (ARFs) act as in vitro allosteric activators of CTA1, but the molecular events of this process are not fully characterized. Isotope-edited Fourier transform infrared spectroscopy monitored ARF6-induced structural changes to CTA1, which were correlated to changes in CTA1 activity. We found ARF6 prevents the thermal disordering of structured CTA1 and stimulates the activity of stabilized CTA1 over a range of temperatures. Yet ARF6 alone did not promote the refolding of disordered CTA1 to an active state. Instead, lipid rafts shifted disordered CTA1 to a folded conformation with a basal level of activity that could be further stimulated by ARF6. Thus, ARF alone is unable to activate disordered CTA1 at physiological temperature: additional host factors such as lipid rafts place CTA1 in the folded conformation required for its ARF-mediated activation. Interaction with ARF is required for in vivo toxin activity, as enzymatically active CTA1 mutants that cannot be further stimulated by ARF6 fail to intoxicate cultured cells. PMID:25257027

  2. Proteins of the ETS family with transcriptional repressor activity.


    Mavrothalassitis, G; Ghysdael, J


    ETS proteins form one of the largest families of signal-dependent transcriptional regulators, mediating cellular proliferation, differentiation and tumorigenesis. Most of the known ETS proteins have been shown to activate transcription. However, four ETS proteins (YAN, ERF, NET and TEL) can act as transcriptional repressors. In three cases (ERF, NET and TEL) distinct repression domains have been identified and there are indications that NET and TEL may mediate transcription via Histone Deacetylase recruitment. All four proteins appear to be regulated by MAPKs, though for YAN and ERF this regulation seems to be restricted to ERKs. YAN, ERF and TEL have been implicated in cellular proliferation although there are indications suggesting a possible involvement of YAN and TEL in differentiation as well. Other ETS-domain proteins have been shown to repress transcription in a context specific manner, and there are suggestions that the ETS DNA-binding domain may act as a transcriptional repressor. Transcriptional repression by ETS domain proteins adds an other level in the orchestrated regulation by this diverse family of transcription factors that often recognize similar if not identical binding sites on DNA and are believed to regulate critical genes in a variety of biological processes. Definitive assessment of the importance of this novel regulatory level will require the identification of ETS proteins target genes and the further analysis of transcriptional control and biological function of these proteins in defined pathways. PMID:11175368

  3. NF-Y activates mouse tryptophan hydroxylase transcription.


    Reed, G E; Kirchner, J E; Carr, L G


    Tryptophan hydroxylase catalyses the rate-limiting step in the biosynthesis of serotonin, a neurotransmitter which has been implicated in the etiologies of clinically important psychiatric illnesses. Tryptophan hydroxylase is expressed in a tissue-specific manner, but little is known about its transcriptional regulation. By analysing transcriptional activities of a set 5'-deletion constructs of promoter-reporter plasmids in P815-HTR mastocytoma cells, we found that transcription was activated by sequences between nucleotides -343 and -21. DNase I footprint analysis, using nuclear protein extracts from P815-HTR cells, revealed a protein-DNA interaction between nucleotides -77 and -46. A double stranded oligonucleotide, representing this binding site, specifically bound nuclear protein in a gel shift assay. Methylation interference analysis of this complex revealed that nuclear protein interacted with an inverted GGCCAAT element, which is a high-affinity binding motif for the transcription factor NF-Y (also known as CP1 or CBF). An NF-Y specific antibody abolished protein binding in a gel shift assay. Mutagenesis of specific base pairs abolished protein binding in vitro, and mutagenesis of the same base pairs in a reporter gene construct resulted in a 65% decrease in transcriptional activity. Our results suggest that the transcription factor NF-Y binds to a GGCCAAT motif in the tph proximal promoter and activates transcription. PMID:7552299

  4. Selective Activation of Transcription by a Novel CCAAT Binding Factor

    NASA Astrophysics Data System (ADS)

    Maity, Sankar N.; Golumbek, Paul T.; Karsenty, Gerard; de Crombrugghe, Benoit


    A novel CCAAT binding factor (CBF) composed of two different subunits has been extensively purified from rat liver. Both subunits are needed for specific binding to DNA. Addition of this purified protein to nuclear extracts of NIH 3T3 fibroblasts stimulates transcription from several promoters including the α 2(I) collagen, the α 1(I) collagen, the Rous sarcoma virus long terminal repeat (RSV-LTR), and the adenovirus major late promoter. Point mutations in the CCAAT motif that show either no binding or a decreased binding of CBF likewise abolish or reduce activation of transcription by CBF. Activation of transcription requires, therefore, the specific binding of CBF to its recognition sites.

  5. MafG Sumoylation Is Required for Active Transcriptional Repression

    PubMed Central

    Motohashi, Hozumi; Katsuoka, Fumiki; Miyoshi, Chika; Uchimura, Yasuhiro; Saitoh, Hisato; Francastel, Claire; Engel, James Douglas; Yamamoto, Masayuki


    A straightforward mechanism for eliciting transcriptional repression would be to simply block the DNA binding site for activators. Such passive repression is often mediated by transcription factors that lack an intrinsic repressor activity. MafG is a bidirectional regulator of transcription, a repressor in its homodimeric state but an activator when heterodimerized with p45. Here, we report that MafG is conjugated to SUMO-2/3 in vivo. To clarify the possible physiological role(s) for sumoylation in regulating MafG activity, we evaluated mutant and wild-type MafG in transgenic mice and cultured cells. Whereas sumoylation-deficient MafG activated p45-dependent transcription normally and did not affect heterodimer activity, repression by the sumoylation-deficient MafG mutant was severely compromised in vivo. Furthermore, the SUMO-dependent repression activity of MafG was sensitive to histone deacetylase inhibition. Thus, repression by MafG is not achieved through simple passive repression by competing for the activator binding site but requires sumoylation, which then mediates transcriptional repression through recruitment of a repressor complex containing histone deacetylase activity. PMID:16738329

  6. Potential Role of Activating Transcription Factor 5 during Osteogenesis.


    Vicari, Luisa; Calabrese, Giovanna; Forte, Stefano; Giuffrida, Raffaella; Colarossi, Cristina; Parrinello, Nunziatina Laura; Memeo, Lorenzo


    Human adipose-derived stem cells are an abundant population of stem cells readily isolated from human adipose tissue that can differentiate into connective tissue lineages including bone, cartilage, fat, and muscle. Activating transcription factor 5 is a transcription factor of the ATF/cAMP response element-binding protein (CREB) family. It is transcribed in two types of mRNAs (activating transcription factor 5 isoform 1 and activating transcription factor 5 isoform 2), encoding the same single 30-kDa protein. Although it is well demonstrated that it regulates the proliferation, differentiation, and apoptosis, little is known about its potential role in osteogenic differentiation. The aim of this study was to evaluate the expression levels of the two isoforms and protein during osteogenic differentiation of human adipose-derived stem cells. Our data indicate that activating transcription factor 5 is differentially expressed reaching a peak of expression at the stage of bone mineralization. These findings suggest that activating transcription factor 5 could play an interesting regulatory role during osteogenesis, which would provide a powerful tool to study bone physiology. PMID:26770207

  7. Theory on the dynamic memory in the transcription-factor-mediated transcription activation

    NASA Astrophysics Data System (ADS)

    Murugan, R.


    We develop a theory to explain the origin of the static and dynamical memory effects in transcription-factor-mediated transcription activation. Our results suggest that the following inequality conditions should be satisfied to observe such memory effects: (a) τL≫max(τR,τE), (b) τLT≫τT, and (c) τI⩾(τEL+τTR) where τL is the average time required for the looping-mediated spatial interactions of enhancer—transcription-factor complex with the corresponding promoter—RNA-polymerase or eukaryotic RNA polymerase type II (PolII in eukaryotes) complex that is located L base pairs away from the cis-acting element, (τR,τE) are respectively the search times required for the site-specific binding of the RNA polymerase and the transcription factor with the respective promoter and the cis-regulatory module, τLT is the time associated with the relaxation of the looped-out segment of DNA that connects the cis-acting site and promoter, τT is the time required to generate a complete transcript, τI is the transcription initiation time, τEL is the elongation time, and τTR is the termination time. We have theoretically derived the expressions for the various searching, looping, and loop-relaxation time components. Using the experimentally determined values of various time components we further show that the dynamical memory effects cannot be experimentally observed whenever the segment of DNA that connects the cis-regulatory element with the promoter is not loaded with bulky histone bodies. Our analysis suggests that the presence of histone-mediated compaction of the connecting segment of DNA can result in higher values of looping and loop-relaxation times, which is the origin of the static memory in the transcription activation that is mediated by the memory gene loops in eukaryotes.

  8. Targeting Gli Transcription Activation by Small Molecule Suppresses Tumor Growth

    PubMed Central

    Bosco-Clément, Geneviève; Zhang, Fang; Chen, Zhao; Zhou, Hai-Meng; Li, Hui; Mikami, Iwao; Hirata, Tomomi; Yagui-Beltran, Adam; Lui, Natalie; Do, Hanh T.; Cheng, Tiffany; Tseng, Hsin-Hui; Choi, Helen; Fang, Li-Tai; Kim, Il-Jin; Yue, Dongsheng; Wang, Changli; Zheng, Qingfeng; Fujii, Naoaki; Mann, Michael; Jablons, David M.; He, Biao


    Targeted inhibition of Hedgehog signaling at the cell membrane has been associated with anti-cancer activity in preclinical and early clinical studies. Hedgehog signaling involves activation of Gli transcription factors that can also be induced by alternative pathways. In this study we identified an interaction between Gli proteins and a transcription co-activator TAF9, and validated its functional relevance in regulating Gli transactivation. We also describe a novel, synthetic small molecule, FN1-8, that efficiently interferes with Gli/TAF9 interaction and down-regulate Gli/TAF9 dependent transcriptional activity. More importantly, FN1-8 suppresses cancer cell proliferation in vitro and inhibits tumor growth in vivo. Our results suggest that blocking Gli transactivation, a key control point of multiple oncogenic pathways, may be an effective anti-cancer strategy. PMID:23686308

  9. Oxytocin-Stimulated NFAT Transcriptional Activation in Human Myometrial Cells

    PubMed Central

    McArdle, Craig A.; López Bernal, Andrés


    Oxytocin (OXT) is a peptide hormone that binds the OXT receptor on myometrial cells, initiating an intracellular signaling cascade, resulting in accumulation of intracellular calcium and smooth muscle contraction. In other systems, an elevation of intracellular Ca2+ stimulates nuclear translocation of the transcription factor, nuclear factor of activated T cells (NFAT), which is transcriptionally active in arterial and ileal smooth muscle. Here we have investigated the role of NFAT in the mechanism of action of OXT. Human myometrial cells expressed all five NFAT isoforms (NFATC1–C4 and -5). Myometrial cells were transduced with a recombinant adenovirus expressing a NFATC1-EFP reporter, and a semi-automated imaging system was used to monitor effects of OXT on reporter localization in live cells. OXT induced a concentration-dependent nuclear translocation of NFATC1-EFP in a reversible manner, which was inhibited by OXT antagonists and calcineurin inhibitors. Pulsatile stimulation with OXT caused intermittent, pulse-frequency-dependent, nuclear translocation of NFATC1-EFP, which was more efficient than sustained stimulation. OXT induced nuclear translocation of endogenous NFAT that was transcriptionally active, because OXT stimulated activity of a NFAT-response element-luciferase reporter and induced calcineurin-NFAT dependent expression of RGS2, RCAN1, and PTGS2 (COX2) mRNA. Furthermore, OXT-dependent transcription was dependent on protein neosynthesis; cycloheximide abolished RGS2 transcription but augmented RCAN1 and COX2 transcriptional readouts. This study identifies a novel signaling mechanism within the myometrium, whereby calcineurin-NFAT signaling mediates OXT-induced transcriptional activity. Furthermore, we show NFATC1-EFP is responsive to pulses of OXT, a mechanism by which myometrial cells could decode OXT pulse frequency. PMID:22902539

  10. The CREB Transcription Factor Controls Transcriptional Activity of the Human RIC8B Gene.


    Maureira, Alejandro; Sánchez, Rodolfo; Valenzuela, Nicole; Torrejón, Marcela; Hinrichs, María V; Olate, Juan; Gutiérrez, José L


    Proper regulation of gene expression is essential for normal development, cellular growth, and differentiation. Differential expression profiles of mRNA coding for vertebrate Ric-8B during embryo and adult stages have been observed. In addition, Ric-8B is expressed in few cerebral nuclei subareas. These facts point to a dynamic control of RIC8B gene expression. In order to understand the transcriptional regulation of this gene, we searched for cis-elements in the sequence of the human RIC8B promoter region, identifying binding sites for the basic/leucine zipper (bZip) CREB transcription factor family (CRE sites) and C/EBP transcription factor family (C/EBP sites). CRE sites were found clustered near the transcription start site, while the C/EBP sites were found clustered at around 300 bp upstream the CRE sites. Here, we demonstrate the ability of CREB1 and C/EBPβ to bind their respective elements identified in the RIC8B promoter. Comparative protein-DNA interaction analyses revealed only the proximal elements as high affinity sites for CREB1 and only the distal elements as high affinity sites for C/EBPβ. Chromatin immunoprecipitation analyses, carried out using a human neuroblastoma cell line, confirmed the preferential association of CREB to the proximal region of the RIC8B promoter. By performing luciferase reporter assays, we found the CRE sites as the most relevant elements for its transcriptional activity. Taken together, these data show the existence of functional CREB and C/EBP binding sites in the human RIC8B gene promoter, a particular distribution of these sites and demonstrate a relevant role of CREB in stimulating transcriptional activity of this gene. J. Cell. Biochem. 117: 1797-1805, 2016. © 2016 Wiley Periodicals, Inc. PMID:26729411

  11. Sug1 modulates yeast transcription activation by Cdc68.

    PubMed Central

    Xu, Q; Singer, R A; Johnston, G C


    The Cdc68 protein is required for the transcription of a variety of genes in the yeast Saccharomyces cerevisiae. In a search for proteins involved in the activity of the Cdc68 protein, we identified four suppressor genes in which mutations reverse the temperature sensitivity caused by the cdc68-1 allele. We report here the molecular characterization of mutations in one suppressor gene, the previously identified SUG1 gene. The Sug1 protein has been implicated in both transcriptional regulation and proteolysis. sug1 suppressor alleles reversed most aspects of the cdc68-1 mutant phenotype but did not suppress the lethality of a cdc68 null allele, indicating that sug1 suppression is by restoration of Cdc68 activity. Our evidence suggests that suppression by sug1 is unlikely to be due to increased stability of mutant Cdc68 protein, despite the observation that Sug1 affected proteolysis of mutant Cdc68. We report here that attenuated Sug1 activity strengthens mutant Cdc68 activity, whereas increased Sug1 activity further inhibits enfeebled Cdc68 activity, suggesting that Sug1 antagonizes the activator function of Cdc68 for transcription. Consistent with this hypothesis, we find that Sug1 represses transcription in vivo. PMID:7565755

  12. Effect Of Simulated Microgravity On Activated T Cell Gene Transcription

    NASA Technical Reports Server (NTRS)

    Morrow, Maureen A.


    Studies of T lymphocytes under the shear stress environment of clinorotation have demonstrated an inhibition of activation in response to TCR mediated signaling. These results mimic those observed during space flight. This work investigates the molecular signaling events of T lymphocyte activation with clinorotation. Purified human T lymphocytes and the T cell clone Jurkat exhibit an uncoupling of signaling as mediated through the TCR. Activation of the transcription factor AP-1 is inhibited while activation of NFAT occurs. NFAT dephosphorylation and activation is dependent on sustained Ca(++) influx. Alternatively, AP-1, which consists of two transcription factors, jun and fos, is activated by PKC and Ras mediated pathways. TCR signaling is known to be dependent on cytoskeletal rearrangements, in particular, raft aggregation is critical. Raft aggregation, as mediated through GM, crosslinking, overcomes the inhibition of T lymphocyte activation with clinorotation, indicating that the block is occurring upstream of raft aggregation. Clinorotation is shown to have an effect similar to a weak TCR signal.

  13. An arcane role of DNA in transcription activation.

    PubMed Central

    Ryu, S; Garges, S; Adhya, S


    The mechanism by which the cAMP receptor protein (CRP) activates transcription has been investigated using the lac promoter of Escherichia coli. For transcription activation, an interaction between DNA-bound CRP and RNA polymerase is not sufficient. CRP must bind to a site in the same DNA and close to the promoter. CRP action requires an intact spacer DNA to provide a rigid support in building a CRP-RNA polymerase protein bridge or to allow a conformational change in the DNA to be transmitted to the lac promoter using the protein bridge as a structural support. Images PMID:7811325

  14. Nucleosomes unfold completely at a transcriptionally active promoter.


    Boeger, Hinrich; Griesenbeck, Joachim; Strattan, J Seth; Kornberg, Roger D


    It has long been known that promoter DNA is converted to a nuclease-sensitive state upon transcriptional activation. Recent findings have raised the possibility that this conversion reflects only a partial unfolding or other perturbation of nucleosomal structure, rather than the loss of nucleosomes. We report topological, sedimentation, nuclease digestion, and ChIP analyses, which demonstrate the complete unfolding of nucleosomes at the transcriptionally active PHO5 promoter of the yeast Saccharomyces cerevisiae. Although nucleosome loss occurs at all promoter sites, it is not complete at any of them, suggesting the existence of an equilibrium between the removal of nucleosomes and their reformation. PMID:12820971

  15. PKG-1α mediates GATA4 transcriptional activity.


    Ma, Yanlin; Wang, Jun; Yu, Yanhong; Schwartz, Robert J


    GATA4, a zinc-finger transcription factor, is central for cardiac development and diseases. Here we show that GATA4 transcriptional activity is mediated by cell signaling via cGMP dependent PKG-1α activity. Protein kinase G (PKG), a serine/tyrosine specific kinase is the major effector of cGMP signaling. We observed enhanced transcriptional activity elicited by co-expressed GATA4 and PKG-1α. Phosphorylation of GATA4 by PKG-1α was detected on serine 261 (S261), while the C-terminal activation domain of GATA4 associated with PKG-1α. GATA4's DNA binding activity was enhanced by PKG-1α via by both phosphorylation and physical association. More importantly, a number of human disease-linked GATA4 mutants exhibited impaired S261 phosphorylation, pointing to defective S261 phosphorylation in the elaboration of human heart diseases. We showed S261 phosphorylation was favored by PKG-1α but not by PKA, and several other kinase signaling pathways such as MAPK and PKC. Our observations demonstrate that cGMP-PKG signaling mediates transcriptional activity of GATA4 and links defective GATA4 and PKG-1α mutations to the development of human heart disease. PMID:26946174

  16. Ubiquitously expressed transcript is a novel interacting protein of protein inhibitor of activated signal transducer and activator of transcription 2

    PubMed Central



    Protein inhibitor of activated signal transducer and activator of transcription 2 (PIAS2) is a member of the PIAS protein family. This protein family modulates the activity of several transcription factors and acts as an E3 ubiquitin ligase in the sumoylation pathway. To improve understanding of the physiological roles of PIAS2, the current study used a yeast two-hybrid system to screen mouse stem cell cDNA libraries for proteins that interact with PIAS2. The screening identified an interaction between PIAS2 and ubiquitously expressed transcript (UXT). UXT, also termed androgen receptor trapped clone-27, is an α-class prefoldin-type chaperone that acts as a coregulator for various transcription factors, including nuclear factor-κB and androgen receptor (AR). A direct interaction between PIAS2 and UXT was confirmed by direct yeast two-hybrid analysis. In vitro evidence of the association of UXT with PIAS2 was obtained by co-immunoprecipitation. Colocalization between PIAS2 and UXT was identified in the nucleus and cytoplasm of HEK 293T and human cervical carcinoma HeLa cells. The results of the current study suggested that UXT is a binding protein of PIAS2, and interaction between PIAS2 and UXT may be important for the transcriptional activation of AR. PMID:25434787

  17. Physical coupling of activation and derepression activities to maintain an active transcriptional state at FLC.


    Yang, Hongchun; Howard, Martin; Dean, Caroline


    Establishment and maintenance of gene expression states is central to development and differentiation. Transcriptional and epigenetic mechanisms interconnect in poorly understood ways to determine these states. We explore these mechanisms through dissection of the regulation of Arabidopsis thaliana FLOWERING LOCUS C (FLC). FLC can be present in a transcriptionally active state marked by H3K36me3 or a silent state marked by H3K27me3. Here, we investigate the trans factors modifying these opposing histone states and find a physical coupling in vivo between the H3K36 methyltransferase, SDG8, and the H3K27me3 demethylase, ELF6. Previous modeling has predicted this coupling would exist as it facilitates bistability of opposing histone states. We also find association of SDG8 with the transcription machinery, namely RNA polymerase II and the PAF1 complex. Delivery of the active histone modifications is therefore likely to be through transcription at the locus. SDG8 and ELF6 were found to influence the localization of each other on FLC chromatin, showing the functional importance of the interaction. In addition, both influenced accumulation of the associated H3K27me3 and H3K36me3 histone modifications at FLC We propose the physical coupling of activation and derepression activities coordinates transcriptional activity and prevents ectopic silencing. PMID:27482092

  18. Physical coupling of activation and derepression activities to maintain an active transcriptional state at FLC

    PubMed Central

    Yang, Hongchun; Howard, Martin; Dean, Caroline


    Establishment and maintenance of gene expression states is central to development and differentiation. Transcriptional and epigenetic mechanisms interconnect in poorly understood ways to determine these states. We explore these mechanisms through dissection of the regulation of Arabidopsis thaliana FLOWERING LOCUS C (FLC). FLC can be present in a transcriptionally active state marked by H3K36me3 or a silent state marked by H3K27me3. Here, we investigate the trans factors modifying these opposing histone states and find a physical coupling in vivo between the H3K36 methyltransferase, SDG8, and the H3K27me3 demethylase, ELF6. Previous modeling has predicted this coupling would exist as it facilitates bistability of opposing histone states. We also find association of SDG8 with the transcription machinery, namely RNA polymerase II and the PAF1 complex. Delivery of the active histone modifications is therefore likely to be through transcription at the locus. SDG8 and ELF6 were found to influence the localization of each other on FLC chromatin, showing the functional importance of the interaction. In addition, both influenced accumulation of the associated H3K27me3 and H3K36me3 histone modifications at FLC. We propose the physical coupling of activation and derepression activities coordinates transcriptional activity and prevents ectopic silencing. PMID:27482092

  19. Aerobic glycolysis tunes YAP/TAZ transcriptional activity

    PubMed Central

    Enzo, Elena; Santinon, Giulia; Pocaterra, Arianna; Aragona, Mariaceleste; Bresolin, Silvia; Forcato, Mattia; Grifoni, Daniela; Pession, Annalisa; Zanconato, Francesca; Guzzo, Giulia; Bicciato, Silvio; Dupont, Sirio


    Increased glucose metabolism and reprogramming toward aerobic glycolysis are a hallmark of cancer cells, meeting their metabolic needs for sustained cell proliferation. Metabolic reprogramming is usually considered as a downstream consequence of tumor development and oncogene activation; growing evidence indicates, however, that metabolism on its turn can support oncogenic signaling to foster tumor malignancy. Here, we explored how glucose metabolism regulates gene transcription and found an unexpected link with YAP/TAZ, key transcription factors regulating organ growth, tumor cell proliferation and aggressiveness. When cells actively incorporate glucose and route it through glycolysis, YAP/TAZ are fully active; when glucose metabolism is blocked, or glycolysis is reduced, YAP/TAZ transcriptional activity is decreased. Accordingly, glycolysis is required to sustain YAP/TAZ pro-tumorigenic functions, and YAP/TAZ are required for the full deployment of glucose growth-promoting activity. Mechanistically we found that phosphofructokinase (PFK1), the enzyme regulating the first committed step of glycolysis, binds the YAP/TAZ transcriptional cofactors TEADs and promotes their functional and biochemical cooperation with YAP/TAZ. Strikingly, this regulation is conserved in Drosophila, where phosphofructokinase is required for tissue overgrowth promoted by Yki, the fly homologue of YAP. Moreover, gene expression regulated by glucose metabolism in breast cancer cells is strongly associated in a large dataset of primary human mammary tumors with YAP/TAZ activation and with the progression toward more advanced and malignant stages. These findings suggest that aerobic glycolysis endows cancer cells with particular metabolic properties and at the same time sustains transcription factors with potent pro-tumorigenic activities such as YAP/TAZ. PMID:25796446

  20. TBP domain symmetry in basal and activated archaeal transcription.


    Ouhammouch, Mohamed; Hausner, Winfried; Geiduschek, E Peter


    The TATA box binding protein (TBP) is the platform for assembly of archaeal and eukaryotic transcription preinitiation complexes. Ancestral gene duplication and fusion events have produced the saddle-shaped TBP molecule, with its two direct-repeat subdomains and pseudo-two-fold symmetry. Collectively, eukaryotic TBPs have diverged from their present-day archaeal counterparts, which remain highly symmetrical. The similarity of the N- and C-halves of archaeal TBPs is especially pronounced in the Methanococcales and Thermoplasmatales, including complete conservation of their N- and C-terminal stirrups; along with helix H'1, the C-terminal stirrup of TBP forms the main interface with TFB/TFIIB. Here, we show that, in stark contrast to its eukaryotic counterparts, multiple substitutions in the C-terminal stirrup of Methanocaldococcus jannaschii (Mja) TBP do not completely abrogate basal transcription. Using DNA affinity cleavage, we show that, by assembling TFB through its conserved N-terminal stirrup, Mja TBP is in effect ambidextrous with regard to basal transcription. In contrast, substitutions in either its N- or the C-terminal stirrup abrogate activated transcription in response to the Lrp-family transcriptional activator Ptr2. PMID:19007415

  1. Combinatorial influence of environmental parameters on transcription factor activity

    PubMed Central

    Knijnenburg, T.A.; Wessels, L.F.A.; Reinders, M.J.T.


    Motivation: Cells receive a wide variety of environmental signals, which are often processed combinatorially to generate specific genetic responses. Changes in transcript levels, as observed across different environmental conditions, can, to a large extent, be attributed to changes in the activity of transcription factors (TFs). However, in unraveling these transcription regulation networks, the actual environmental signals are often not incorporated into the model, simply because they have not been measured. The unquantified heterogeneity of the environmental parameters across microarray experiments frustrates regulatory network inference. Results: We propose an inference algorithm that models the influence of environmental parameters on gene expression. The approach is based on a yeast microarray compendium of chemostat steady-state experiments. Chemostat cultivation enables the accurate control and measurement of many of the key cultivation parameters, such as nutrient concentrations, growth rate and temperature. The observed transcript levels are explained by inferring the activity of TFs in response to combinations of cultivation parameters. The interplay between activated enhancers and repressors that bind a gene promoter determine the possible up- or downregulation of the gene. The model is translated into a linear integer optimization problem. The resulting regulatory network identifies the combinatorial effects of environmental parameters on TF activity and gene expression. Availability: The Matlab code is available from the authors upon request. Contact: Supplementary information: Supplementary data are available at Bioinformatics online. PMID:18586711

  2. Moonlighting transcriptional activation function of a fungal sulfur metabolism enzyme

    PubMed Central

    Levati, Elisabetta; Sartini, Sara; Bolchi, Angelo; Ottonello, Simone; Montanini, Barbara


    Moonlighting proteins, including metabolic enzymes acting as transcription factors (TF), are present in a variety of organisms but have not been described in higher fungi so far. In a previous genome-wide analysis of the TF repertoire of the plant-symbiotic fungus Tuber melanosporum, we identified various enzymes, including the sulfur-assimilation enzyme phosphoadenosine-phosphosulfate reductase (PAPS-red), as potential transcriptional activators. A functional analysis performed in the yeast Saccharomyces cerevisiae, now demonstrates that a specific variant of this enzyme, PAPS-red A, localizes to the nucleus and is capable of transcriptional activation. TF moonlighting, which is not present in the other enzyme variant (PAPS-red B) encoded by the T. melanosporum genome, relies on a transplantable C-terminal polypeptide containing an alternating hydrophobic/hydrophilic amino acid motif. A similar moonlighting activity was demonstrated for six additional proteins, suggesting that multitasking is a relatively frequent event. PAPS-red A is sulfur-state-responsive and highly expressed, especially in fruitbodies, and likely acts as a recruiter of transcription components involved in S-metabolism gene network activation. PAPS-red B, instead, is expressed at low levels and localizes to a highly methylated and silenced region of the genome, hinting at an evolutionary mechanism based on gene duplication, followed by epigenetic silencing of this non-moonlighting gene variant. PMID:27121330

  3. Moonlighting transcriptional activation function of a fungal sulfur metabolism enzyme.


    Levati, Elisabetta; Sartini, Sara; Bolchi, Angelo; Ottonello, Simone; Montanini, Barbara


    Moonlighting proteins, including metabolic enzymes acting as transcription factors (TF), are present in a variety of organisms but have not been described in higher fungi so far. In a previous genome-wide analysis of the TF repertoire of the plant-symbiotic fungus Tuber melanosporum, we identified various enzymes, including the sulfur-assimilation enzyme phosphoadenosine-phosphosulfate reductase (PAPS-red), as potential transcriptional activators. A functional analysis performed in the yeast Saccharomyces cerevisiae, now demonstrates that a specific variant of this enzyme, PAPS-red A, localizes to the nucleus and is capable of transcriptional activation. TF moonlighting, which is not present in the other enzyme variant (PAPS-red B) encoded by the T. melanosporum genome, relies on a transplantable C-terminal polypeptide containing an alternating hydrophobic/hydrophilic amino acid motif. A similar moonlighting activity was demonstrated for six additional proteins, suggesting that multitasking is a relatively frequent event. PAPS-red A is sulfur-state-responsive and highly expressed, especially in fruitbodies, and likely acts as a recruiter of transcription components involved in S-metabolism gene network activation. PAPS-red B, instead, is expressed at low levels and localizes to a highly methylated and silenced region of the genome, hinting at an evolutionary mechanism based on gene duplication, followed by epigenetic silencing of this non-moonlighting gene variant. PMID:27121330

  4. Transcriptional Activation of the Cyclin A Gene by the Architectural Transcription Factor HMGA2

    PubMed Central

    Tessari, Michela A.; Gostissa, Monica; Altamura, Sandro; Sgarra, Riccardo; Rustighi, Alessandra; Salvagno, Clio; Caretti, Giuseppina; Imbriano, Carol; Mantovani, Roberto; Del Sal, Giannino; Giancotti, Vincenzo; Manfioletti, Guidalberto


    The HMGA2 protein belongs to the HMGA family of architectural transcription factors, which play an important role in chromatin organization. HMGA proteins are overexpressed in several experimental and human tumors and have been implicated in the process of neoplastic transformation. Hmga2 knockout results in the pygmy phenotype in mice and in a decreased growth rate of embryonic fibroblasts, thus indicating a role for HMGA2 in cell proliferation. Here we show that HMGA2 associates with the E1A-regulated transcriptional repressor p120E4F, interfering with p120E4F binding to the cyclin A promoter. Ectopic expression of HMGA2 results in the activation of the cyclin A promoter and induction of the endogenous cyclin A gene. In addition, chromatin immunoprecipitation experiments show that HMGA2 associates with the cyclin A promoter only when the gene is transcriptionally activated. These data identify the cyclin A gene as a cellular target for HMGA2 and, for the first time, suggest a mechanism for HMGA2-dependent cell cycle regulation. PMID:14645522

  5. An Essential Viral Transcription Activator Modulates Chromatin Dynamics

    PubMed Central

    Gibeault, Rebecca L.; Bildersheim, Michael D.


    Although ICP4 is the only essential transcription activator of herpes simplex virus 1 (HSV-1), its mechanisms of action are still only partially understood. We and others propose a model in which HSV-1 genomes are chromatinized as a cellular defense to inhibit HSV-1 transcription. To counteract silencing, HSV-1 would have evolved proteins that prevent or destabilize chromatinization to activate transcription. These proteins should act as HSV-1 transcription activators. We have shown that HSV-1 genomes are organized in highly dynamic nucleosomes and that histone dynamics increase in cells infected with wild type HSV-1. We now show that whereas HSV-1 mutants encoding no functional ICP0 or VP16 partially enhanced histone dynamics, mutants encoding no functional ICP4 did so only minimally. Transient expression of ICP4 was sufficient to enhance histone dynamics in the absence of other HSV-1 proteins or HSV-1 DNA. The dynamics of H3.1 were increased in cells expressing ICP4 to a greater extent than those of H3.3. The dynamics of H2B were increased in cells expressing ICP4, whereas those of canonical H2A were not. ICP4 preferentially targets silencing H3.1 and may also target the silencing H2A variants. In infected cells, histone dynamics were increased in the viral replication compartments, where ICP4 localizes. These results suggest a mechanism whereby ICP4 activates transcription by disrupting, or preventing the formation of, stable silencing nucleosomes on HSV-1 genomes. PMID:27575707

  6. In Vitro Activation of the Transcription of araBAD Operon by araC Activator

    PubMed Central

    Lee, Nancy; Wilcox, Gary; Gielow, William; Arnold, John; Cleary, Paul; Englesberg, Ellis


    The transcription of araBAD operon requires araC activator and cyclic AMP. D-Fucose inhibits ara mRNA synthesis. Our results indicate that the positive control by araC activator is exerted at the level of transcription. PMID:4362626

  7. Signal Transducer and Activator of Transcription-3, Inflammation, and Cancer

    PubMed Central

    Aggarwal, Bharat B.; Kunnumakkara, Ajaikumar B.; Harikumar, Kuzhuvelil B.; Gupta, Shan R.; Tharakan, Sheeja T.; Koca, Cemile; Dey, Sanjit; Sung, Bokyung


    Signal transducer and activator of transcription-3 (STAT-3) is one of six members of a family of transcription factors. It was discovered almost 15 years ago as an acute-phase response factor. This factor has now been associated with inflammation, cellular transformation, survival, proliferation, invasion, angiogenesis, and metastasis of cancer. Various types of carcinogens, radiation, viruses, growth factors, oncogenes, and inflammatory cytokines have been found to activate STAT-3. STAT-3 is constitutively active in most tumor cells but not in normal cells. Phosphorylation of STAT-3 at tyrosine 705 leads to its dimerization, nuclear translocation, DNA binding, and gene transcription. The phosphorylation of STAT-3 at serine 727 may regulate its activity negatively or positively. STAT-3 regulates the expression of genes that mediate survival (survivin, bcl-xl, mcl-1, cellular FLICE-like inhibitory protein), proliferation (c-fos, c-myc, cyclin D1), invasion (matrix metalloproteinase-2), and angiogenesis (vascular endothelial growth factor). STAT-3 activation has also been associated with both chemoresistance and radioresistance. STAT-3 mediates these effects through its collaboration with various other transcription factors, including nuclear factor-κB, hypoxia-inducible factor-1, and peroxisome proliferator activated receptor-γ. Because of its critical role in tumorigenesis, inhibitors of this factor’s activation are being sought for both prevention and therapy of cancer. This has led to identification of small peptides, oligonucleotides, and small molecules as potential STAT-3 inhibitors. Several of these small molecules are chemo-preventive agents derived from plants. This review discusses the intimate relationship between STAT-3, inflammation, and cancer in more detail. PMID:19723038

  8. Isolated HIV-1 core is active for reverse transcription.


    Warrilow, David; Stenzel, Deborah; Harrich, David


    Whether purified HIV-1 virion cores are capable of reverse transcription or require uncoating to be activated is currently controversial. To address this question we purified cores from a virus culture and tested for the ability to generate authentic reverse transcription products. A dense fraction (approximately 1.28 g/ml) prepared without detergent, possibly derived from disrupted virions, was found to naturally occur as a minor sub-fraction in our preparations. Core-like particles were identified in this active fraction by electron microscopy. We are the first to report the detection of authentic strong-stop, first-strand transfer and full-length minus strand products in this core fraction without requirement for an uncoating activity. PMID:17956635

  9. The molecular biology and nomenclature of the activating transcription factor/cAMP responsive element binding family of transcription factors: activating transcription factor proteins and homeostasis.


    Hai, T; Hartman, M G


    The mammalian ATF/CREB family of transcription factors represents a large group of basic region-leucine zipper (bZip) proteins which was originally defined in the late 1980s by their ability to bind to the consensus ATF/CRE site 'TGACGTCA'. Over the past decade, cDNA clones encoding identical or homologous proteins have been isolated by different laboratories and given different names. These proteins can be grouped into subgroups according to their amino acid similarity. In this review, we will briefly describe the classification of these proteins with a historical perspective of their nomenclature. We will then review three members of the ATF/CREB family of proteins: ATF3, ATF4 and ATF6. We will address four issues for each protein: (a) homologous proteins and alternative names, (b) dimer formation with other bZip proteins, (c) transcriptional activity, and (d) potential physiological functions. Although the name Activating Transcription Factor (ATF) implies that they are transcriptional activators, some of these proteins are transcriptional repressors. ATF3 homodimer is a transcriptional repressor and ATF4 has been reported to be either an activator or a repressor. We will review the reports on the transcriptional activities of ATF4, and propose potential explanations for the discrepancy. Although the physiological functions of these proteins are not well understood, some clues can be gained from studies with different approaches. When the data are available, we will address the following questions. (a) How is the expression (at the mRNA level or protein level) regulated? (b) How are the transcriptional activities regulated? (c) What are the interacting proteins (other than bZip partners)? (d) What are the consequences of ectopically expressing the gene (gain-of-function) or deleting the gene (loss-of-function)? Although answers to these questions are far from being complete, together they provide clues to the functions of these ATF proteins. Despite the

  10. Potentiation of glucocorticoid receptor transcriptional activity by sumoylation.


    Le Drean, Yves; Mincheneau, Nathalie; Le Goff, Pascale; Michel, Denis


    The glucocorticoid receptor (GR) is a transcription factor, subject to several types of posttranslational modifications including phosphorylation and ubiquitination. We showed that the GR is covalently modified by the small ubiquitin-related modifier-1 (SUMO-1) peptide in mammalian cells. We demonstrated that GR sumoylation is not dependent on the presence of the ligand and regulates the stability of the protein as well as its transcriptional activity. SUMO-1 overexpression induces dramatic GR degradation, abolished by proteasome inhibition. We also found that SUMO-1 stimulates the transactivation capacity of GRs to an extent largely exceeding those observed so far for other sumoylated transcription factors. Overexpression of SUMO-1 specifically enhances the ligand-induced transactivation of GR up to 8-fold. However, this hyperactivation occurs only in the context of a synergy between multiple molecules of GRs. It requires more than one receptor DNA-binding site in promoter and becomes more prominent as the number of sites increases. Interestingly, these observations may be related to the transcriptional properties of the synergy control region of GRs, which precisely contains two evolutionary conserved sumoylation sites. We propose a model in which SUMO-1 regulates the synergy control function of GR and serves as a unique signal for activation and destruction. PMID:12193561

  11. The Positive Transcription Elongation Factor b Is an Essential Cofactor for the Activation of Transcription by Myocyte Enhancer Factor 2

    PubMed Central

    Nojima, Masanori; Huang, Yehong; Tyagi, Mudit; Kao, Hung-Ying; Fujinaga, Koh


    The positive transcription elongation factor b (P-TEFb), composed of cyclin-dependent kinase 9 and cyclin T1, stimulates the elongation of transcription by hyperphosphorylating the C-terminal region of RNA polymerase II. Aberrant activation of P-TEFb results in manifestations of cardiac hypertrophy in mice, suggesting that P-TEFb is an essential factor for cardiac myocyte function and development. Here, we present evidence that P-TEFb selectively activates transcription mediated by the myocyte enhancer factor 2 (MEF2) family of transcription factors, key regulatory factors for myocyte development. Knockdown of endogenous cyclin T1 in murine C2C12 cells abolishes MEF2-dependent reporter gene expression as well as transcription of endogenous MEF2 target genes, whereas overexpression of P-TEFb enhances MEF2-dependent transcription. P-TEFb interacts with MEF2 both in vitro and in vivo. Activation of MEF2-dependent transcription induced by serum starvation is mediated by a rapid dissociation of P-TEFb from its inhibitory subunit, HEXIM1, and a subsequent recruitment of P-TEFb to MEF2 binding sites in the promoter region of MEF2 target genes. These results indicate that recruitment of P-TEFb is a critical step for stimulation of MEF2-dependent transcription, therefore providing a fundamentally important regulatory mechanism underlying the transcriptional program in muscle cells. PMID:18662700

  12. Rb binds c-Jun and activates transcription.

    PubMed Central

    Nead, M A; Baglia, L A; Antinore, M J; Ludlow, J W; McCance, D J


    The retinoblastoma protein (Rb) acts as a critical cell-cycle regulator and loss of Rb function is associated with a variety of human cancer types. Here we report that Rb binds to members of the AP-1 family of transcription factors, including c-Jun, and stimulates c-Jun transcriptional activity from an AP-1 consensus sequence. The interaction involves the leucine zipper region of c-Jun and the B pocket of Rb as well as a C-terminal domain. We also present evidence that the complexes are found in terminally differentiating keratinocytes and cells entering the G1 phase of the cell cycle after release from serum starvation. The human papillomavirus type 16 E7 protein, which binds to both c-Jun and Rb, inhibits the ability of Rb to activate c-Jun. The results provide evidence of a role for Rb as a transcriptional activator in early G1 and as a potential modulator of c-Jun expression during keratinocyte differentiation. PMID:9545246

  13. A new type of NtrC transcriptional activator.

    PubMed Central

    Foster-Hartnett, D; Cullen, P J; Monika, E M; Kranz, R G


    The enteric NtrC (NRI) protein has been the paradigm for a class of bacterial enhancer-binding proteins (EBPs) that activate transcription of RNA polymerase containing the sigma 54 factor. Activators in the NtrC class are characterized by essentially three properties: (i) they bind to sites distant from the promoters that they activate (> 100 bp upstream of the transcriptional start site), (ii) they contain a conserved nucleotide-binding fold and exhibit ATPase activity that is required for activation, and (iii) they activate the sigma 54 RNA polymerase. We have characterized the NtrC protein from a photosynthetic bacterium, Rhodobacter capsulatus, which represents a metabolically versatile group of bacteria found in aquatic environments. We have shown that the R. capsulatus NtrC protein (RcNtrC) binds to two tandem sites that are distant from promoters that it activates, nifA1 and nifA2. These tandem binding sites are shown to be important for RcNtrC-dependent nitrogen regulation in vivo. Moreover, the conserved nucleotide-binding fold of RcNtrC is required to activate nifA1 and nifA2 but is not required for DNA binding of RcNtrC to upstream activation sequences. However, nifA1 and nifA2 genes do not require the sigma 54 for activation and do not contain the highly conserved nucleotides that are present in all sigma 54-type, EBP-activated promoters. Thus, the NtrC from this photosynthetic bacterium represents a novel member of the class of bacterial EBPs. It is probable that this class of EBPs is more versatile in prokaryotes than previously envisioned. Images PMID:7928986

  14. Promoter occlusion: transcription through a promoter may inhibit its activity.


    Adhya, S; Gottesman, M


    Induction of prophage lambda inhibits the expression of the gal operon from its cognate promoters. The effect is observed only in cis, and is due to frequent transcription of the gal promoter region by RNA polymerase molecules initiating upstream at the prophage PL promoter. The frequency of transcription initiation at PL is some 30 times greater than that at the gal promoter, Pg1. PL is one of the strongest procaryotic promoters. This "promoter occlusion" is essentially complete when the distance between gal and PL is small (less than or equal to 10 kb); and when PL is fully active (that is, in the absence of the cl or cro repressors). We discuss the possibility that promoter occlusion at two lambda promoters, Pint and PR', might play a role in the sequential expression of viral functions. PMID:6217898

  15. Genome-wide activities of Polycomb complexes control pervasive transcription.


    Lee, Hun-Goo; Kahn, Tatyana G; Simcox, Amanda; Schwartz, Yuri B; Pirrotta, Vincenzo


    Polycomb group (PcG) complexes PRC1 and PRC2 are well known for silencing specific developmental genes. PRC2 is a methyltransferase targeting histone H3K27 and producing H3K27me3, essential for stable silencing. Less well known but quantitatively much more important is the genome-wide role of PRC2 that dimethylates ∼70% of total H3K27. We show that H3K27me2 occurs in inverse proportion to transcriptional activity in most non-PcG target genes and intergenic regions and is governed by opposing roaming activities of PRC2 and complexes containing the H3K27 demethylase UTX. Surprisingly, loss of H3K27me2 results in global transcriptional derepression proportionally greatest in silent or weakly transcribed intergenic and genic regions and accompanied by an increase of H3K27ac and H3K4me1. H3K27me2 therefore sets a threshold that prevents random, unscheduled transcription all over the genome and even limits the activity of highly transcribed genes. PRC1-type complexes also have global roles. Unexpectedly, we find a pervasive distribution of histone H2A ubiquitylated at lysine 118 (H2AK118ub) outside of canonical PcG target regions, dependent on the RING/Sce subunit of PRC1-type complexes. We show, however, that H2AK118ub does not mediate the global PRC2 activity or the global repression and is predominantly produced by a new complex involving L(3)73Ah, a homolog of mammalian PCGF3. PMID:25986499

  16. Visualization of Estrogen Receptor Transcriptional Activation in Zebrafish

    PubMed Central

    Halpern, Marnie E.


    Estrogens regulate a diverse range of physiological processes and affect multiple tissues. Estrogen receptors (ERs) regulate transcription by binding to DNA at conserved estrogen response elements, and such elements have been used to report ER activity in cultured cells and in transgenic mice. We generated stable, transgenic zebrafish containing five consecutive elements upstream of a c-fos minimal promoter and green fluorescent protein (GFP) to visualize and quantify transcriptional activation in live larvae. Transgenic larvae show robust, dose-dependent estrogen-dependent fluorescent labeling in the liver, consistent with er gene expression, whereas ER antagonists inhibit GFP expression. The nonestrogenic steroids dexamethasone and progesterone fail to activate GFP, confirming ER selectivity. Natural and synthetic estrogens activated the transgene with varying potency, and two chemicals, genistein and bisphenol A, preferentially induce GFP expression in the heart. In adult fish, fluorescence was observed in estrogenic tissues such as the liver, ovary, pituitary gland, and brain. Individual estrogen-responsive neurons and their projections were visualized in the adult brain, and GFP-positive neurons increased in number after 17β-estradiol exposure. The transgenic estrogen-responsive zebrafish allow ER signaling to be monitored visually and serve as in vivo sentinels for detection of estrogenic compounds. PMID:21540282

  17. Clinical application of transcriptional activators of bile salt transporters☆

    PubMed Central

    Baghdasaryan, Anna; Chiba, Peter; Trauner, Michael


    Hepatobiliary bile salt (BS) transporters are critical determinants of BS homeostasis controlling intracellular concentrations of BSs and their enterohepatic circulation. Genetic or acquired dysfunction of specific transport systems causes intrahepatic and systemic retention of potentially cytotoxic BSs, which, in high concentrations, may disturb integrity of cell membranes and subcellular organelles resulting in cell death, inflammation and fibrosis. Transcriptional regulation of canalicular BS efflux through bile salt export pump (BSEP), basolateral elimination through organic solute transporters alpha and beta (OSTα/OSTβ) as well as inhibition of hepatocellular BS uptake through basolateral Na+-taurocholate cotransporting polypeptide (NTCP) represent critical steps in protection from hepatocellular BS overload and can be targeted therapeutically. In this article, we review the potential clinical implications of the major BS transporters BSEP, OSTα/OSTβ and NTCP in the pathogenesis of hereditary and acquired cholestatic syndromes, provide an overview on transcriptional control of these transporters by the key regulatory nuclear receptors and discuss the potential therapeutic role of novel transcriptional activators of BS transporters in cholestasis. PMID:24333169

  18. Regulating the regulators: modulators of transcription factor activity.


    Everett, Logan; Hansen, Matthew; Hannenhalli, Sridhar


    Gene transcription is largely regulated by DNA-binding transcription factors (TFs). However, the TF activity itself is modulated via, among other things, post-translational modifications (PTMs) by specific modification enzymes in response to cellular stimuli. TF-PTMs thus serve as "molecular switchboards" that map upstream signaling events to the downstream transcriptional events. An important long-term goal is to obtain a genome-wide map of "regulatory triplets" consisting of a TF, target gene, and a modulator gene that specifically modulates the regulation of the target gene by the TF. A variety of genome-wide data sets can be exploited by computational methods to obtain a rough map of regulatory triplets, which can guide directed experiments. However, a prerequisite to developing such computational tools is a systematic catalog of known instances of regulatory triplets. We first describe PTM-Switchboard, a recent database that stores triplets of genes such that the ability of one gene (the TF) to regulate a target gene is dependent on one or more PTMs catalyzed by a third gene, the modifying enzyme. We also review current computational approaches to infer regulatory triplets from genome-wide data sets and conclude with a discussion of potential future research. PTM-Switchboard is accessible at / PMID:20827600

  19. Development of Transcriptional Fusions to Assess Leptospira interrogans Promoter Activity

    PubMed Central

    Cerqueira, Gustavo M.; Souza, Natalie M.; Araújo, Eduardo R.; Barros, Aline T.; Morais, Zenaide M.; Vasconcellos, Sílvio A.; Nascimento, Ana L. T. O.


    Background Leptospirosis is a zoonotic infectious disease that affects both humans and animals. The existing genetic tools for Leptospira spp. have improved our understanding of the biology of this spirochete as well as the interaction of pathogenic leptospires with the mammalian host. However, new tools are necessary to provide novel and useful information to the field. Methodology and Principal Findings A series of promoter-probe vectors carrying a reporter gene encoding green fluorescent protein (GFP) were constructed for use in L. biflexa. They were tested by constructing transcriptional fusions between the lipL41, Leptospiral Immunoglobulin-like A (ligA) and Sphingomielynase 2 (sph2) promoters from L. interrogans and the reporter gene. ligA and sph2 promoters were the most active, in comparison to the lipL41 promoter and the non-induced controls. The results obtained are in agreement with LigA expression from the L. interrogans Fiocruz L1-130 strain. Conclusions The novel vectors facilitated the in vitro evaluation of L. interrogans promoter activity under defined growth conditions which simulate the mammalian host environment. The fluorescence and rt-PCR data obtained closely reflected transcriptional regulation of the promoters, thus demonstrating the suitability of these vectors for assessing promoter activity in L. biflexa. PMID:21445252

  20. Distinct TFIID complexes mediate the effect of different transcriptional activators.

    PubMed Central

    Brou, C; Chaudhary, S; Davidson, I; Lutz, Y; Wu, J; Egly, J M; Tora, L; Chambon, P


    Multiple chromatographically separable complexes containing the TATA binding protein (TBP), which exhibit different functional properties, exist in HeLa cells. At least three distinct subpopulations of such complexes can be functionally defined as TFIID since they function with RNA polymerase II. Using a partially reconstituted HeLa cell in vitro transcription system and immunoprecipitation with a monoclonal antibody directed against TBP, we show that stimulation of transcription by the chimeric activators GAL-VP16, GAL-TEF-1 and GAL-ER(EF) requires the presence of factors which are tightly associated with these TFIID complexes. Moreover, the activity of GAL-TEF-1 appears to be mediated by at least two chromatographically distinct populations of TFIID. The factor(s) associated with one of these populations is also required for the activity of GAL-ER (EF) and GAL-VP16, while the factor(s) associated with the other population functions selectively with GAL-TEF-1. These two TFIID populations are composed of both common and unique TBP associated factors (TAFs). Images PMID:8440239

  1. Dynamic Mechanism for the Transcription Apparatus Orchestrating Reliable Responses to Activators

    NASA Astrophysics Data System (ADS)

    Wang, Yaolai; Liu, Feng; Wang, Wei


    The transcription apparatus (TA) is a huge molecular machine. It detects the time-varying concentrations of transcriptional activators and initiates mRNA transcripts at appropriate rates. Based on the general structural organizations of the TA, we propose how the TA dynamically orchestrates transcriptional responses. The activators rapidly cycle in and out of a clamp-like space temporarily formed between the enhancer and the Mediator, with the concentration of activators encoded as their temporal occupancy rate (RTOR) within the space. The entry of activators into this space induces allostery in the Mediator, resulting in a facilitated circumstance for transcriptional reinitiation. The reinitiation rate is much larger than the cycling rate of activators, thereby RTOR guiding the amount of transcripts. Based on this mechanism, stochastic simulations can qualitatively reproduce and interpret multiple features of gene expression, e.g., transcriptional bursting is not mere noise as traditionally believed, but rather the basis of reliable transcriptional responses.

  2. Krüppel-like factor 6 regulates mitochondrial function in the kidney

    PubMed Central

    Mallipattu, Sandeep K.; Horne, Sylvia J.; D’Agati, Vivette; Narla, Goutham; Liu, Ruijie; Frohman, Michael A.; Dickman, Kathleen; Chen, Edward Y.; Ma’ayan, Avi; Bialkowska, Agnieszka B.; Ghaleb, Amr M.; Nandan, Mandayam O.; Jain, Mukesh K.; Daehn, Ilse; Chuang, Peter Y.; Yang, Vincent W.; He, John C.


    Maintenance of mitochondrial structure and function is critical for preventing podocyte apoptosis and eventual glomerulosclerosis in the kidney; however, the transcription factors that regulate mitochondrial function in podocyte injury remain to be identified. Here, we identified Krüppel-like factor 6 (KLF6), a zinc finger domain transcription factor, as an essential regulator of mitochondrial function in podocyte apoptosis. We observed that podocyte-specific deletion of Klf6 increased the susceptibility of a resistant mouse strain to adriamycin-induced (ADR-induced) focal segmental glomerulosclerosis (FSGS). KLF6 expression was induced early in response to ADR in mice and cultured human podocytes, and prevented mitochondrial dysfunction and activation of intrinsic apoptotic pathways in these podocytes. Promoter analysis and chromatin immunoprecipitation studies revealed that putative KLF6 transcriptional binding sites are present in the promoter of the mitochondrial cytochrome c oxidase assembly gene (SCO2), which is critical for preventing cytochrome c release and activation of the intrinsic apoptotic pathway. Additionally, KLF6 expression was reduced in podocytes from HIV-1 transgenic mice as well as in renal biopsies from patients with HIV-associated nephropathy (HIVAN) and FSGS. Together, these findings indicate that KLF6-dependent regulation of the cytochrome c oxidase assembly gene is critical for maintaining mitochondrial function and preventing podocyte apoptosis. PMID:25689250

  3. The metabolic activator FOXO1 binds hepatitis B virus DNA and activates its transcription

    SciTech Connect

    Shlomai, Amir; Shaul, Yosef


    Hepatitis B virus (HBV) is a small DNA virus that targets the liver and infects humans worldwide. Recently we have shown that the metabolic regulator PGC-1{alpha} coactivates HBV transcription thereby rendering the virus susceptible to fluctuations in the nutritional status of the liver. PGC-1{alpha} coactivation of HBV is mediated through the liver-enriched nuclear receptor HNF4{alpha} and through another yet unknown transcription factor(s). Here we show that the forkhead transcription factor FOXO1, a known target for PGC-1{alpha} coactivation and a central mediator of glucose metabolism in the liver, binds HBV core promoter and activates its transcription. This activation is further enhanced in the presence of PGC-1{alpha}, implying that FOXO1 is a target for PGC-1{alpha} coactivation of HBV transcription. Thus, our results identify another key metabolic regulator as an activator of HBV transcription, thereby supporting the principle that HBV gene expression is regulated in a similar way to key hepatic metabolic genes.

  4. In vitro transcriptional activation by a metabolic intermediate: activation by Leu3 depends on alpha-isopropylmalate.


    Sze, J Y; Woontner, M; Jaehning, J A; Kohlhaw, G B


    In the absence of the leucine biosynthetic precursor alpha-isopropylmalate (alpha-IPM), the yeast LEU3 protein (Leu3p) binds DNA and acts as a transcriptional repressor in an in vitro extract. Addition of alpha-IPM resulted in a dramatic increase in Leu3p-dependent transcription. The presence of alpha-IPM was also required for Leu3p to compete effectively with another transcriptional activator, GAL4/VP16, for limiting transcription factors. Therefore, the addition of alpha-IPM appears to convert a transcriptional repressor into an activator. This represents an example in eukaryotes of direct transcriptional regulation by a small effector molecule. PMID:1439822

  5. Transcriptional activation by simian virus 40 large T antigen: interactions with multiple components of the transcription complex.

    PubMed Central

    Gruda, M C; Zabolotny, J M; Xiao, J H; Davidson, I; Alwine, J C


    Simian virus 40 (SV40) large T antigen is a potent transcriptional activator of both viral and cellular promoters. Within the SV40 late promoter, a specific upstream element necessary for T-antigen transcriptional activation is the binding site for transcription-enhancing factor 1 (TEF-1). The promoter structure necessary for T-antigen-mediated transcriptional activation appears to be simple. For example, a promoter consisting of upstream TEF-1 binding sites (or other factor-binding sites) and a downstream TATA or initiator element is efficiently activated. It has been demonstrated that transcriptional activation by T antigen does not require direct binding to the DNA; thus, the most direct effect that T antigen could have on these simple promoters would be through protein-protein interactions with either upstream-bound transcription factors, the basal transcription complex, or both. To determine whether such interactions occur, full-length T antigen or segments of it was fused to the glutathione-binding site (GST fusions) or to the Gal4 DNA-binding domain (amino acids 1 to 147) (Gal4 fusions). With the GST fusions, it was found that TEF-1 and the TATA-binding protein (TBP) bound different regions of T antigen. A GST fusion containing amino acids 5 to 172 (region T1) efficiently bound TBP. TEF-1 bound neither region T1 nor a region between amino acids 168 and 373 (region T2); however, it bound efficiently to the combined region (T5) containing amino acids 5 to 383.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:8423815

  6. Post-transcriptional gene silencing activity of human GIGYF2.


    Kryszke, Marie-Hélène; Adjeriou, Badia; Liang, Feifei; Chen, Hong; Dautry, François


    In mammalian post-transcriptional gene silencing, the Argonaute protein AGO2 indirectly recruits translation inhibitors, deadenylase complexes, and decapping factors to microRNA-targeted mRNAs, thereby repressing mRNA translation and accelerating mRNA decay. However, the exact composition and assembly pathway of the microRNA-induced silencing complex are not completely elucidated. As the GYF domain of human GIGYF2 was shown to bind AGO2 in pulldown experiments, we wondered whether GIGYF2 could be a novel protein component of the microRNA-induced silencing complex. Here we show that full-length GIGYF2 coimmunoprecipitates with AGO2 in human cells, and demonstrate that, upon tethering to a reporter mRNA, GIGYF2 exhibits strong, dose-dependent silencing activity, involving both mRNA destabilization and translational repression. PMID:27157137

  7. The Regulatory Role of Activating Transcription Factor 2 in Inflammation

    PubMed Central

    Yu, Tao; Li, Yong Jun; Bian, Ai Hong; Zuo, Hui Bin; Zhu, Ti Wen; Ji, Sheng Xiang; Kong, Fanming; Yin, De Qing; Wang, Chuan Bao; Wang, Zi Fu; Wang, Hong Qun; Yang, Yanyan; Yoo, Byong Chul


    Activating transcription factor 2 (ATF2) is a member of the leucine zipper family of DNA-binding proteins and is widely distributed in tissues including the liver, lung, spleen, and kidney. Like c-Jun and c-Fos, ATF2 responds to stress-related stimuli and may thereby influence cell proliferation, inflammation, apoptosis, oncogenesis, neurological development and function, and skeletal remodeling. Recent studies clarify the regulatory role of ATF2 in inflammation and describe potential inhibitors of this protein. In this paper, we summarize the properties and functions of ATF2 and explore potential applications of ATF2 inhibitors as tools for research and for the development of immunosuppressive and anti-inflammatory drugs. PMID:25049453

  8. Transcription factors of Lotus: regulation of isoflavonoid biosynthesis requires coordinated changes in transcription factor activity.


    Shelton, Dale; Stranne, Maria; Mikkelsen, Lisbeth; Pakseresht, Nima; Welham, Tracey; Hiraka, Hideki; Tabata, Satoshi; Sato, Shusei; Paquette, Suzanne; Wang, Trevor L; Martin, Cathie; Bailey, Paul


    Isoflavonoids are a class of phenylpropanoids made by legumes, and consumption of dietary isoflavonoids confers benefits to human health. Our aim is to understand the regulation of isoflavonoid biosynthesis. Many studies have shown the importance of transcription factors in regulating the transcription of one or more genes encoding enzymes in phenylpropanoid metabolism. In this study, we coupled bioinformatics and coexpression analysis to identify candidate genes encoding transcription factors involved in regulating isoflavonoid biosynthesis in Lotus (Lotus japonicus). Genes encoding proteins belonging to 39 of the main transcription factor families were examined by microarray analysis of RNA from leaf tissue that had been elicited with glutathione. Phylogenetic analyses of each transcription factor family were used to identify subgroups of proteins that were specific to L. japonicus or closely related to known regulators of the phenylpropanoid pathway in other species. R2R3MYB subgroup 2 genes showed increased expression after treatment with glutathione. One member of this subgroup, LjMYB14, was constitutively overexpressed in L. japonicus and induced the expression of at least 12 genes that encoded enzymes in the general phenylpropanoid and isoflavonoid pathways. A distinct set of six R2R3MYB subgroup 2-like genes was identified. We suggest that these subgroup 2 sister group proteins and those belonging to the main subgroup 2 have roles in inducing isoflavonoid biosynthesis. The induction of isoflavonoid production in L. japonicus also involves the coordinated down-regulation of competing biosynthetic pathways by changing the expression of other transcription factors. PMID:22529285

  9. Transcriptional activation of Brassica napus β-ketoacyl-ACP synthase II with an engineered zinc finger protein transcription factor.


    Gupta, Manju; DeKelver, Russell C; Palta, Asha; Clifford, Carla; Gopalan, Sunita; Miller, Jeffrey C; Novak, Stephen; Desloover, Daniel; Gachotte, Daniel; Connell, James; Flook, Josh; Patterson, Thomas; Robbins, Kelly; Rebar, Edward J; Gregory, Philip D; Urnov, Fyodor D; Petolino, Joseph F


    Targeted gene regulation via designed transcription factors has great potential for precise phenotypic modification and acceleration of novel crop trait development. Canola seed oil composition is dictated largely by the expression of genes encoding enzymes in the fatty acid biosynthetic pathway. In the present study, zinc finger proteins (ZFPs) were designed to bind DNA sequences common to two canola β-ketoacyl-ACP Synthase II (KASII) genes downstream of their transcription start site. Transcriptional activators (ZFP-TFs) were constructed by fusing these ZFP DNA-binding domains to the VP16 transcriptional activation domain. Following transformation using Agrobacterium, transgenic events expressing ZFP-TFs were generated and shown to have elevated KASII transcript levels in the leaves of transgenic T(0) plants when compared to 'selectable marker only' controls as well as of T(1) progeny plants when compared to null segregants. In addition, leaves of ZFP-TF-expressing T(1) plants contained statistically significant decreases in palmitic acid (consistent with increased KASII activity) and increased total C18. Similarly, T(2) seed displayed statistically significant decreases in palmitic acid, increased total C18 and reduced total saturated fatty acid contents. These results demonstrate that designed ZFP-TFs can be used to regulate the expression of endogenous genes to elicit specific phenotypic modifications of agronomically relevant traits in a crop species. PMID:22520333

  10. E proteins are required to activate germline transcription of the TCR Vbeta8.2 gene.


    Jia, Jingquan; Dai, Meifang; Zhuang, Yuan


    Each TCR Vbeta gene is regulated by an individual Vbeta promoter, which becomes active prior to V(D) J recombination and drives germline transcription. It has been shown that Vbeta gene locus activation and recombination are dependent on the Vbeta promoter. However, transcription factors that regulate Vbeta germline transcription remain largely undefined. A major challenge in studying Vbeta gene germline transcription is the quantitative assessment of relatively low-level transcripts in T-cell progenitors. Here we used the established Vbeta8.2(CD2) knock-in mouse model to assess functions of E-protein transcription factors in Vbeta8.2 germline transcription. We show that E proteins are required for the activation but not the maintenance of the Vbeta8.2 germline transcription during thymocyte development. The activation of Vbeta8.2 germline transcription depends more on the E proteins encoded by the E2A gene than by the HEB gene. We further show that IL-7 receptor (IL-7R)-mediated signals are essential for Vbeta8.2 germline transcription. We provide evidence that IL-7R expression is only partially controlled by E2A, suggesting a role for E2A in driving Vbeta8.2 germline transcription independent of IL-7R activation. PMID:18958875

  11. Molecular Dynamics of "Fuzzy" Transcriptional Activator-Coactivator Interactions.


    Scholes, Natalie S; Weinzierl, Robert O J


    Transcriptional activation domains (ADs) are generally thought to be intrinsically unstructured, but capable of adopting limited secondary structure upon interaction with a coactivator surface. The indeterminate nature of this interface made it hitherto difficult to study structure/function relationships of such contacts. Here we used atomistic accelerated molecular dynamics (aMD) simulations to study the conformational changes of the GCN4 AD and variants thereof, either free in solution, or bound to the GAL11 coactivator surface. We show that the AD-coactivator interactions are highly dynamic while obeying distinct rules. The data provide insights into the constant and variable aspects of orientation of ADs relative to the coactivator, changes in secondary structure and energetic contributions stabilizing the various conformers at different time points. We also demonstrate that a prediction of α-helical propensity correlates directly with the experimentally measured transactivation potential of a large set of mutagenized ADs. The link between α-helical propensity and the stimulatory activity of ADs has fundamental practical and theoretical implications concerning the recruitment of ADs to coactivators. PMID:27175900

  12. Role of hippocampal activity-induced transcription in memory consolidation.


    Eagle, Andrew L; Gajewski, Paula A; Robison, Alfred J


    Experience-dependent changes in the strength of connections between neurons in the hippocampus (HPC) are critical for normal learning and memory consolidation, and disruption of this process drives a variety of neurological and psychiatric diseases. Proper HPC function relies upon discrete changes in gene expression driven by transcription factors (TFs) induced by neuronal activity. Here, we describe the induction and function of many of the most well-studied HPC TFs, including cyclic-AMP response element binding protein, serum-response factor, AP-1, and others, and describe their role in the learning process. We also discuss the known target genes of many of these TFs and the purported mechanisms by which they regulate long-term changes in HPC synaptic strength. Moreover, we propose that future research in this field will depend upon unbiased identification of additional gene targets for these activity-dependent TFs and subsequent meta-analyses that identify common genes or pathways regulated by multiple TFs in the HPC during learning or disease. PMID:27180338

  13. Molecular Dynamics of "Fuzzy" Transcriptional Activator-Coactivator Interactions

    PubMed Central

    Scholes, Natalie S.; Weinzierl, Robert O. J.


    Transcriptional activation domains (ADs) are generally thought to be intrinsically unstructured, but capable of adopting limited secondary structure upon interaction with a coactivator surface. The indeterminate nature of this interface made it hitherto difficult to study structure/function relationships of such contacts. Here we used atomistic accelerated molecular dynamics (aMD) simulations to study the conformational changes of the GCN4 AD and variants thereof, either free in solution, or bound to the GAL11 coactivator surface. We show that the AD-coactivator interactions are highly dynamic while obeying distinct rules. The data provide insights into the constant and variable aspects of orientation of ADs relative to the coactivator, changes in secondary structure and energetic contributions stabilizing the various conformers at different time points. We also demonstrate that a prediction of α-helical propensity correlates directly with the experimentally measured transactivation potential of a large set of mutagenized ADs. The link between α-helical propensity and the stimulatory activity of ADs has fundamental practical and theoretical implications concerning the recruitment of ADs to coactivators. PMID:27175900

  14. Transcriptional Activation of Inflammatory Genes: Mechanistic Insight into Selectivity and Diversity

    PubMed Central

    Ahmed, Afsar U.; Williams, Bryan R. G.; Hannigan, Gregory E.


    Acute inflammation, an integral part of host defence and immunity, is a highly conserved cellular response to pathogens and other harmful stimuli. An inflammatory stimulation triggers transcriptional activation of selective pro-inflammatory genes that carry out specific functions such as anti-microbial activity or tissue healing. Based on the nature of inflammatory stimuli, an extensive exploitation of selective transcriptional activations of pro-inflammatory genes is performed by the host to ensure a defined inflammatory response. Inflammatory signal transductions are initiated by the recognition of inflammatory stimuli by transmembrane receptors, followed by the transmission of the signals to the nucleus for differential gene activations. The differential transcriptional activation of pro-inflammatory genes is precisely controlled by the selective binding of transcription factors to the promoters of these genes. Among a number of transcription factors identified to date, NF-κB still remains the most prominent and studied factor for its diverse range of selective transcriptional activities. Differential transcriptional activities of NF-κB are dictated by post-translational modifications, specificities in dimer formation, and variability in activation kinetics. Apart from the differential functions of transcription factors, the transcriptional activation of selective pro-inflammatory genes is also governed by chromatin structures, epigenetic markers, and other regulators as the field is continuously expanding. PMID:26569329

  15. Transcriptional Activation of Inflammatory Genes: Mechanistic Insight into Selectivity and Diversity.


    Ahmed, Afsar U; Williams, Bryan R G; Hannigan, Gregory E


    Acute inflammation, an integral part of host defence and immunity, is a highly conserved cellular response to pathogens and other harmful stimuli. An inflammatory stimulation triggers transcriptional activation of selective pro-inflammatory genes that carry out specific functions such as anti-microbial activity or tissue healing. Based on the nature of inflammatory stimuli, an extensive exploitation of selective transcriptional activations of pro-inflammatory genes is performed by the host to ensure a defined inflammatory response. Inflammatory signal transductions are initiated by the recognition of inflammatory stimuli by transmembrane receptors, followed by the transmission of the signals to the nucleus for differential gene activations. The differential transcriptional activation of pro-inflammatory genes is precisely controlled by the selective binding of transcription factors to the promoters of these genes. Among a number of transcription factors identified to date, NF-κB still remains the most prominent and studied factor for its diverse range of selective transcriptional activities. Differential transcriptional activities of NF-κB are dictated by post-translational modifications, specificities in dimer formation, and variability in activation kinetics. Apart from the differential functions of transcription factors, the transcriptional activation of selective pro-inflammatory genes is also governed by chromatin structures, epigenetic markers, and other regulators as the field is continuously expanding. PMID:26569329

  16. Cell cycle-dependent regulation of RNA polymerase II basal transcription activity.

    PubMed Central

    Yonaha, M; Chibazakura, T; Kitajima, S; Yasukochi, Y


    Regulation of transcription by RNA polymerase II (pol II) in eukaryotic cells requires both basal and regulatory transcription factors. In this report we have investigated in vitro pol II basal transcription activity during the cell cycle by using nuclear extracts from synchronized HeLa cells. It is shown that pol II basal transcription activity is low in the S and G2 phases and high in early G1 phase and TFIID is the rate limiting component of pol II basal transcription activity during the cell cycle. Further analyses reveal that TFIID exists as a less active form in the S and G2 phases and nuclear extracts from S and G2 phase cells contain a heat-sensitive repressor(s) of TATA box binding protein (TBP). These results suggest that pol II basal transcription activity is regulated by a qualitative change in the TFIID complex, which could involve repression of TBP, during the cell cycle. Images PMID:7479063

  17. Inhibition of human insulin gene transcription and MafA transcriptional activity by the dual leucine zipper kinase

    PubMed Central

    Stahnke, Marie-Jeannette; Dickel, Corinna; Schröder, Sabine; Kaiser, Diana; Blume, Roland; Stein, Roland; Pouponnot, Celio; Oetjen, Elke


    Insulin biosynthesis is an essential β-cell function and inappropriate insulin secretion and biosynthesis contribute to the pathogenesis of diabetes mellitus type 2. Previous studies showed that the dual leucine zipper kinase (DLK) induces β-cell apoptosis. Since β-cell dysfunction precedes β-cell loss, in the present study the effect of DLK on insulin gene transcription was investigated in the HIT-T15 β-cell line. Downregulation of endogenous DLK increased whereas overexpression of DLK decreased human insulin gene transcription. 5′- and 3′-deletion human insulin promoter analyses resulted in the identification of a DLK responsive element that mapped to the DNA binding-site for the β-cell specific transcription factor MafA. Overexpression of DLK wild-type but not its kinase-dead mutant inhibited MafA transcriptional activity conferred by its transactivation domain. Furthermore, in the non-β-cell line JEG DLK inhibited MafA overexpression-induced human insulin promoter activity. Overexpression of MafA and DLK or its kinase-dead mutant into JEG cells revealed that DLK but not its mutant reduced MafA protein content. Inhibition of the down-stream DLK kinase c-Jun N-terminal kinase (JNK) by SP600125 attenuated DLK-induced MafA loss. Furthermore, mutation of the serine 65 to alanine, shown to confer MafA protein stability, increased MafA-dependent insulin gene transcription and prevented DLK-induced MafA loss in JEG cells. These data suggest that DLK by activating JNK triggers the phosphorylation and degradation of MafA thereby attenuating insulin gene transcription. Given the importance of MafA for β-cell function, the inhibition of DLK might preserve β-cell function and ultimately retard the development of diabetes mellitus type 2. PMID:24726898

  18. Inhibition of human insulin gene transcription and MafA transcriptional activity by the dual leucine zipper kinase.


    Stahnke, Marie-Jeannette; Dickel, Corinna; Schröder, Sabine; Kaiser, Diana; Blume, Roland; Stein, Roland; Pouponnot, Celio; Oetjen, Elke


    Insulin biosynthesis is an essential β-cell function and inappropriate insulin secretion and biosynthesis contribute to the pathogenesis of diabetes mellitus type 2. Previous studies showed that the dual leucine zipper kinase (DLK) induces β-cell apoptosis. Since β-cell dysfunction precedes β-cell loss, in the present study the effect of DLK on insulin gene transcription was investigated in the HIT-T15 β-cell line. Downregulation of endogenous DLK increased whereas overexpression of DLK decreased human insulin gene transcription. 5'- and 3'-deletion human insulin promoter analyses resulted in the identification of a DLK responsive element that mapped to the DNA binding-site for the β-cell specific transcription factor MafA. Overexpression of DLK wild-type but not its kinase-dead mutant inhibited MafA transcriptional activity conferred by its transactivation domain. Furthermore, in the non-β-cell line JEG DLK inhibited MafA overexpression-induced human insulin promoter activity. Overexpression of MafA and DLK or its kinase-dead mutant into JEG cells revealed that DLK but not its mutant reduced MafA protein content. Inhibition of the down-stream DLK kinase c-Jun N-terminal kinase (JNK) by SP600125 attenuated DLK-induced MafA loss. Furthermore, mutation of the serine 65 to alanine, shown to confer MafA protein stability, increased MafA-dependent insulin gene transcription and prevented DLK-induced MafA loss in JEG cells. These data suggest that DLK by activating JNK triggers the phosphorylation and degradation of MafA thereby attenuating insulin gene transcription. Given the importance of MafA for β-cell function, the inhibition of DLK might preserve β-cell function and ultimately retard the development of diabetes mellitus type 2. PMID:24726898

  19. N6-Methyldeoxyadenosine Marks Active Transcription Start Sites in Chlamydomonas

    PubMed Central

    Chen, Kai; Deng, Xin; Yu, Miao; Han, Dali; Hao, Ziyang; Liu, Jianzhao; Lu, Xingyu; Dore, Louis C; Weng, Xiaocheng; Ji, Quanjiang; Mets, Laurens; He, Chuan


    SUMMARY N6-methyldeoxyadenosine (6mA or m6A) is a DNA modification preserved in prokaryotes to eukaryotes. It is widespread in bacteria, and functions in DNA mismatch repair, chromosome segregation, and virulence regulation. In contrast, the distribution and function of 6mA in eukaryotes have been unclear. Here we present a comprehensive analysis of the 6mA landscape in the genome of Chlamydomonas using new sequencing approaches. We identified the 6mA modification in 84% of genes in Chlamydomonas. We found that 6mA mainly locates at ApT dinucleotides around transcription start sites (TSS) with a bimodal distribution, and appears to mark active genes. A periodic pattern of 6mA deposition was also observed at base resolution, which is associated with nucleosome distribution near the TSS, suggesting a possible role in nucleosome positioning. The new genome-wide mapping of 6mA and its unique distribution in the Chlamydomonas genome suggest potential regulatory roles of 6mA in gene expression in eukaryotic organisms. PMID:25936837

  20. Transcription factor PIF4 controls the thermosensory activation of flowering.


    Kumar, S Vinod; Lucyshyn, Doris; Jaeger, Katja E; Alós, Enriqueta; Alvey, Elizabeth; Harberd, Nicholas P; Wigge, Philip A


    Plant growth and development are strongly affected by small differences in temperature. Current climate change has already altered global plant phenology and distribution, and projected increases in temperature pose a significant challenge to agriculture. Despite the important role of temperature on plant development, the underlying pathways are unknown. It has previously been shown that thermal acceleration of flowering is dependent on the florigen, FLOWERING LOCUS T (FT). How this occurs is, however, not understood, because the major pathway known to upregulate FT, the photoperiod pathway, is not required for thermal acceleration of flowering. Here we demonstrate a direct mechanism by which increasing temperature causes the bHLH transcription factor PHYTOCHROME INTERACTING FACTOR4 (PIF4) to activate FT. Our findings provide a new understanding of how plants control their timing of reproduction in response to temperature. Flowering time is an important trait in crops as well as affecting the life cycles of pollinator species. A molecular understanding of how temperature affects flowering will be important for mitigating the effects of climate change. PMID:22437497

  1. In simple synthetic promoters YY1-induced DNA bending is important in transcription activation and repression.

    PubMed Central

    Kim, J; Shapiro, D J


    Depending on promoter context, YY1 can activate or repress transcription, or provide a site for transcription initiation. To investigate whether the ability of YY1 to induce DNA bending influenced its ability to activate and repress transcription, simple synthetic promoters were constructed in which the YY1 binding site was inserted between the TATA box and either the NF1 or AP1 recognition sequences. In transient transfections of COS cells, the NF1YY1TATA and NF1RYY1TATA promoters exhibited a dramatic 15-20-fold increase in correctly initiated transcription. These promoters exhibited even larger 60-80-fold increases in transcription in HeLa cells. Neither multiple copies of the YY1 binding site alone, nor placement of a YY1 site upstream of the NF1 site activated transcription. Deletion of 4 bp between the NF1 and YY1 sites, which changes the phase of the DNA bends, abolished the 16-fold activation of transcription by NF1YY1TATA. Insertion of the YY1 site between the AP1 site and the TATA box decreased transcription approximately 3-fold. Replacing the YY1 binding site with an intrinsic DNA bending sequence mimicked this transcription repression. Sequences of similar length which do not bend DNA fail to repress AP1-mediated transcription. Gel mobility shift assays were used to show that binding of YY1 to its recognition sequence did not repress binding of AP1 to its recognition sequences. Our data indicate that YY1-induced DNA bending may activate and repress transcription by changing the spatial relationships between transcription activators and components of the basal transcription apparatus. PMID:8932392

  2. TRIC: Capturing the direct cellular targets of promoter-bound transcriptional activators.


    Dugan, Amanda; Pricer, Rachel; Katz, Micah; Mapp, Anna K


    Transcriptional activators coordinate the dynamic assembly of multiprotein coactivator complexes required for gene expression to occur. Here we combine the power of in vivo covalent chemical capture with p-benzoyl-L-phenylalanine (Bpa), a genetically incorporated photo-crosslinking amino acid, and chromatin immunoprecipitation (ChIP) to capture the direct protein interactions of the transcriptional activator VP16 with the general transcription factor TBP at the GAL1 promoter in live yeast. PMID:27213278

  3. Single molecule microscopy reveals mechanistic insight into RNA polymerase II preinitiation complex assembly and transcriptional activity

    PubMed Central

    Horn, Abigail E.; Kugel, Jennifer F.; Goodrich, James A.


    Transcription by RNA polymerase II (Pol II) is a complex process that requires general transcription factors and Pol II to assemble on DNA into preinitiation complexes that can begin RNA synthesis upon binding of NTPs (nucleoside triphosphate). The pathways by which preinitiation complexes form, and how this impacts transcriptional activity are not completely clear. To address these issues, we developed a single molecule system using TIRF (total internal reflection fluorescence) microscopy and purified human transcription factors, which allows us to visualize transcriptional activity at individual template molecules. We see that stable interactions between polymerase II (Pol II) and a heteroduplex DNA template do not depend on general transcription factors; however, transcriptional activity is highly dependent upon TATA-binding protein, TFIIB and TFIIF. We also found that subsets of general transcription factors and Pol II can form stable complexes that are precursors for functional transcription complexes upon addition of the remaining factors and DNA. Ultimately we found that Pol II, TATA-binding protein, TFIIB and TFIIF can form a quaternary complex in the absence of promoter DNA, indicating that a stable network of interactions exists between these proteins independent of promoter DNA. Single molecule studies can be used to learn how different modes of preinitiation complex assembly impact transcriptional activity. PMID:27112574

  4. SUMO-activating SAE1 transcription is positively regulated by Myc

    PubMed Central

    Amente, Stefano; Lavadera, Miriam Lubrano; Palo, Giacomo Di; Majello, Barbara


    Myc protein plays a fundamental role in regulation of cell cycle, proliferation, differentiation and apoptosis by modulating the expression of a large number of targets. Here we report the transactivation ability of the human Myc protein to activate the SUMO-activating enzyme SAE1 transcription. We found that Myc activates SAE1 transcription via direct binding to canonical E-Boxes sequences located close to the SAE1 transcription start site. A recent report has highlighted the crucial role of the SAE gene expression in Myc mediated oncogenesis. Our study adds new insight in this context since we show here that Myc directly activates SAE1 transcription, suggesting that Myc oncogenic activity which depends on SAE1 is ensured by Myc itself through direct binding and transcriptional activation of SAE1 expression. PMID:22679563

  5. Transcription activation at class II CRP-dependent promoters: the role of different activating regions.

    PubMed Central

    Rhodius, V A; West, D M; Webster, C L; Busby, S J; Savery, N J


    Transcription activation by the Escherichia coli cyclic AMP receptor protein (CRP) at Class II promoters is dependent on direct interactions between two surface-exposed activating regions (AR1 and AR2) and two contact sites in RNA polymerase. The effects on transcription activation of disrupting either AR1 or AR2 have been measured at different Class II promoters. AR2 but not AR1 is essential for activation at all the Class II promoters that were tested. The effects of single positive control substitutions in AR1 and AR2 vary from one promoter to another: the effects of the different substitutions are contingent on the -35 hexamer sequence. Abortive initiation assays have been used to quantify the effects of positive control substitutions in each activating region on the kinetics of transcription initiation at the Class II CRP- dependent promoter pmelRcon. At this promoter, the HL159 substitution in AR1 results in a defect in the initial binding of RNA polymerase whilst the KE101 substitution in AR2 reduces the rate of isomerization from the closed to the open complex. PMID:9016561

  6. Improving fold activation of small transcription activating RNAs (STARs) with rational RNA engineering strategies.


    Meyer, Sarai; Chappell, James; Sankar, Sitara; Chew, Rebecca; Lucks, Julius B


    Regulatory RNAs have become integral components of the synthetic biology and bioengineering toolbox for controlling gene expression. We recently expanded this toolbox by creating small transcription activating RNAs (STARs) that act by disrupting the formation of a target transcriptional terminator hairpin placed upstream of a gene. While STARs are a promising addition to the repertoire of RNA regulators, much work remains to be done to optimize the fold activation of these systems. Here we apply rational RNA engineering strategies to improve the fold activation of two STAR regulators. We demonstrate that a combination of promoter strength tuning and multiple RNA engineering strategies can improve fold activation from 5.4-fold to 13.4-fold for a STAR regulator derived from the pbuE riboswitch terminator. We then validate the generality of our approach and show that these same strategies improve fold activation from 2.1-fold to 14.6-fold for an unrelated STAR regulator, opening the door to creating a range of additional STARs to use in a broad array of biotechnologies. We also establish that the optimizations preserve the orthogonality of these STARs between themselves and a set of RNA transcriptional repressors, enabling these optimized STARs to be used in sophisticated circuits. PMID:26134708

  7. Hepatitis C virus nonstructural region 5A protein is a potent transcriptional activator.

    PubMed Central

    Kato, N; Lan, K H; Ono-Nita, S K; Shiratori, Y; Omata, M


    The hepatitis C virus (HCV) nonstructural region 5A (NS5A) protein, without its 146 amino-terminal amino acids and fused to the DNA-binding domain of GAL4, strongly activates transcription in yeast and human hepatoma cells. Transcriptional activation by the HCV NS5A protein may play a role in viral replication and hepatocarcinogenesis. PMID:9343247

  8. PU.1 can participate in an active enhancer complex without its transcriptional activation domain

    PubMed Central

    Pongubala, Jagan M. R.; Atchison, Michael L.


    The transcription factor PU.1 is necessary for the development of multiple hematopoietic lineages and contributes to the activity of the immunoglobulin κ 3′ enhancer. A variety of proteins bind to the 3′ enhancer (PU.1, PIP, ATF1, CREM, c-Fos, c-Jun, and E2A), but the mechanism of 3′-enhancer activity and the proteins necessary for its activity are presently unclear. We show here that PU.1 participates with other transcription factors in forming a higher-order complex with 3′-enhancer DNA sequences. Each protein is necessary for formation of this complex. Individually, transcription factors that bind to the 3′ enhancer do not appreciably stimulate transcription in a cell type in which the 3′ enhancer is normally silent (NIH 3T3). However, mixture of multiple transcription factors (PU.1, PIP, c-Fos, and c-Jun) can greatly activate the enhancer. PU.1 is necessary for maximal enhancer activity, but mutants of PU.1 that lack the transcriptional activation domain are nearly as efficient at stimulating enhancer activity as the wild-type PU.1 protein. PU.1 apparently can activate transcription by playing an architectural role in interactions with other transcription factors. PMID:8990172

  9. A modified reverse one-hybrid screen identifies transcriptional activation in Phyochrome-Interacting Factor 3

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Transcriptional activation domains (TAD) are difficult to predict and identify, since they are not conserved and have little consensus. Here, we describe a yeast-based screening method that is able to identify individual amino acid residues involved in transcriptional activation in a high throughput...

  10. Maximal stimulation of meiotic recombination by a yeast transcription factor requires the transcription activation domain and a DNA-binding domain.

    PubMed Central

    Kirkpatrick, D T; Fan, Q; Petes, T D


    The DNA sequences located upstream of the yeast HIS4 represent a very strong meiotic recombination hotspot. Although the activity of this hotspot requires the transcription activator Rap1p, the level of HIS4 transcription is not directly related to the level of recombination. We find that the recombination-stimulating activity of Rap1p requires the transcription activation domain of the protein. We show that a hybrid protein with the Gal4p DNA-binding domain and the Rap1p activation domain can stimulate recombination in a strain in which Gal4p-binding sites are inserted upstream of HIS4. In addition, we find recombination hotspot activity associated with the Gal4p DNA-binding sites that is independent of known transcription factors. We suggest that yeast cells have two types of recombination hotspots, alpha (transcription factor dependent) and beta (transcription factor independent). PMID:10224246

  11. Transcriptional activation in an improved whole-cell extract from Saccharomyces cerevisiae.

    PubMed Central

    Woontner, M; Wade, P A; Bonner, J; Jaehning, J A


    We report an improved in vitro transcription system for Saccharomyces cerevisiae. Small changes in assay and whole-cell extraction procedures increase selective initiation by RNA polymerase II up to 60-fold over previous conditions (M. Woontner and J. A. Jaehning, J. Biol. Chem. 265:8979-8982, 1990), to levels comparable to those obtained with nuclear extracts. We have found that the simultaneous use of distinguishable templates with and without an upstream activation sequence is critical to the measurement of apparent activation. Transcription from any template was very sensitive to the concentrations of template and nontemplate DNA, extract, and activator (GAL4/VP16). Alterations in reaction conditions led to proportionately greater changes from a template lacking an upstream activation sequence; thus, the apparent ratio of activation is largely dependent on the level of basal transcription. Using optimal conditions for activation, we have also demonstrated activation by a bona fide yeast activator, heat shock transcription factor. Images PMID:1875938

  12. Transcriptional activation in an improved whole-cell extract from Saccharomyces cerevisiae.


    Woontner, M; Wade, P A; Bonner, J; Jaehning, J A


    We report an improved in vitro transcription system for Saccharomyces cerevisiae. Small changes in assay and whole-cell extraction procedures increase selective initiation by RNA polymerase II up to 60-fold over previous conditions (M. Woontner and J. A. Jaehning, J. Biol. Chem. 265:8979-8982, 1990), to levels comparable to those obtained with nuclear extracts. We have found that the simultaneous use of distinguishable templates with and without an upstream activation sequence is critical to the measurement of apparent activation. Transcription from any template was very sensitive to the concentrations of template and nontemplate DNA, extract, and activator (GAL4/VP16). Alterations in reaction conditions led to proportionately greater changes from a template lacking an upstream activation sequence; thus, the apparent ratio of activation is largely dependent on the level of basal transcription. Using optimal conditions for activation, we have also demonstrated activation by a bona fide yeast activator, heat shock transcription factor. PMID:1875938

  13. Prediction of Pathway Activation by Xenobiotic-Responsive Transcription Factors in the Mouse Liver

    EPA Science Inventory

    Many drugs and environmentally-relevant chemicals activate xenobioticresponsive transcription factors (TF). Identification of target genes of these factors would be useful in predicting pathway activation in in vitro chemical screening. Starting with a large compendium of Affymet...

  14. The Nuclear Matrix Protein, NRP/B, Acts as a Transcriptional Repressor of E2F-mediated Transcriptional Activity

    PubMed Central

    Choi, Jina; Yang, Eun Sung; Cha, Kiweon; Whang, John; Choi, Woo-Jung; Avraham, Shalom; Kim, Tae-Aug


    Background: NRP/B, a family member of the BTB/Kelch repeat proteins, is implicated in neuronal and cancer development, as well as the regulation of oxidative stress responses in breast and brain cancer. Our previous studies indicate that the NRP/B-BTB/POZ domain is involved in the dimerization of NRP/B and in a complex formation with the tumor suppressor, retinoblastoma protein. Although much evidence supports the potential role of NRP/B as a tumor suppressor, the molecular mechanisms of NRP/B action on E2F transcription factors have not been elucidated. Methods: Three-dimensional modeling of NRP/B was used to generate point mutations in the BTB/Kelch domains. Tet-on inducible NRP/B expression was established. The NRP/B deficient breast cancer cell line, MDA-MB-231, was generated using lentiviral shNRP/B to evaluate the effect of NRP/B on cell proliferation, invasion and migration. Immunoprecipitation was performed to verify the interaction of NRP/B with E2F and histone deacetylase (HDAC-1), and the expression level of NRP/B protein was analyzed by Western blot analysis. Changes in cell cycle were determined by flow cytometry. Transcriptional activities of E2F transcription factors were measured by chloramphenicol acetyltransferase (CAT) activity. Results: Ectopic overexpression of NRP/B demonstrated that the NRP/B-BTB/POZ domain plays a critical role in E2F-mediated transcriptional activity. Point mutations within the BTB/POZ domain restored E2-promoter activity inhibited by NRP/B. Loss of NRP/B enhanced the proliferation and migration of breast cancer cells. Endogenous NRP/B interacted with E2F and HDAC1. Treatement with an HDAC inhibitor, trichostatin A (TSA), abolished the NRP/B-mediated suppression of E2-promoter activity. Gain or loss of NRP/B in HeLa cells confirmed the transcriptional repressive capability of NRP/B on the E2F target genes, Cyclin E and HsORC (Homo sapiens Origin Recognition Complex). Conclusions: The present study shows that NRP/B acts as a

  15. Active transcription and essential role of RNA polymerase II at the centromere during mitosis

    PubMed Central

    Chan, F. Lyn; Marshall, Owen J.; Saffery, Richard; Won Kim, Bo; Earle, Elizabeth; Choo, K. H. Andy; Wong, Lee H.


    Transcription of the centromeric regions has been reported to occur in G1 and S phase in different species. Here, we investigate whether transcription also occurs and plays a functional role at the mammalian centromere during mitosis. We show the presence of actively transcribing RNA polymerase II (RNAPII) and its associated transcription factors, coupled with the production of centromere satellite transcripts at the mitotic kinetochore. Specific inhibition of RNAPII activity during mitosis leads to a decrease in centromeric α-satellite transcription and a concomitant increase in anaphase-lagging cells, with the lagging chromosomes showing reduced centromere protein C binding. These findings demonstrate an essential role of RNAPII in the transcription of α-satellite DNA, binding of centromere protein C, and the proper functioning of the mitotic kinetochore. PMID:22308327

  16. EGF activates TTP expression by activation of ELK-1 and EGR-1 transcription factors

    PubMed Central


    Background Tristetraprolin (TTP) is a key mediator of processes such as inflammation resolution, the inhibition of autoimmunity and in cancer. It carries out this role by the binding and degradation of mRNA transcripts, thereby decreasing their half-life. Transcripts modulated by TTP encode proteins such as cytokines, pro-inflammatory agents and immediate-early response proteins. TTP can also modulate neoplastic phenotypes in many cancers. TTP is induced and functionally regulated by a spectrum of both pro- and anti-inflammatory cytokines, mitogens and drugs in a MAPK-dependent manner. So far the contribution of p38 MAPK to the regulation of TTP expression and function has been best described. Results Our results demonstrate the induction of the gene coding TTP (ZFP36) by EGF through the ERK1/2-dependent pathway and implicates the transcription factor ELK-1 in this process. We show that ELK-1 regulates ZFP36 expression by two mechanisms: by binding the ZFP36 promoter directly through ETS-binding site (+ 883 to +905 bp) and by inducing expression of EGR-1, which in turn increases ZFP36 expression through sequences located between -111 and -103 bp. Conclusions EGF activates TTP expression via ELK-1 and EGR-1 transcription factors. PMID:22433566

  17. The nuclear factor SPBP contains different functional domains and stimulates the activity of various transcriptional activators.


    Rekdal, C; Sjøttem, E; Johansen, T


    SPBP (stromelysin-1 platelet-derived growth factor-responsive element binding protein) was originally cloned from a cDNA expression library by virtue of its ability to bind to a platelet-derived growth factor-responsive element in the human stromelysin-1 promoter. A 937-amino acid-long protein was deduced from a 3995-nucleotide murine cDNA sequence. By analyses of both human and murine cDNAs, we now show that SPBP is twice as large as originally found. The human SPBP gene contains six exons and is located on chromosome 22q13.1-13.3. Two isoforms differing in their C termini are expressed due to alternative splicing. PCR analyses of multitissue cDNA panels showed that SPBP is expressed in most tissues except for ovary and prostate. Functional mapping revealed that SPBP is a nuclear, multidomain protein containing an N-terminal region with transactivating ability, a novel type of DNA-binding domain containing an AT hook motif, and a bipartite nuclear localization signal as well as a C-terminal zinc finger domain. This type of zinc finger domain is also found in the trithorax family of chromatin-based transcriptional regulator proteins. Using cotransfection experiments, we find that SPBP enhances the transcriptional activity of various transcription factors such as c-Jun, Ets1, Sp1, and Pax6. Hence, SPBP seems to act as a transcriptional coactivator. PMID:10995766

  18. Transcriptional activation upon pheromone stimulation mediated by a small domain of Saccharomyces cerevisiae Ste12p.

    PubMed Central

    Pi, H; Chien, C T; Fields, S


    In the yeast Saccharomyces cerevisiae, Ste12p induces transcription of pheromone-responsive genes by binding to a DNA sequence designated the pheromone response element. We generated a series of hybrid proteins of Ste12p with the DNA-binding and activation domains of the transcriptional activator Gal4p to define a pheromone induction domain of Ste12p sufficient to mediate pheromone-induced transcription by these hybrid proteins. A minimal pheromone induction domain, delineated as residues 301 to 335 of Ste12p, is dependent on the pheromone mitogen-activated protein (MAP) kinase pathway for induction activity. Mutation of the three serine and threonine residues within the minimal pheromone induction domain did not affect transcriptional induction, indicating that the activity of this domain is not directly regulated by MAP kinase phosphorylation. By contrast, mutation of the two tyrosines or their preceding acidic residues led to a high level of transcriptional activity in the absence of pheromone and consequently to the loss of pheromone induction. This constitutively high activity was not affected by mutations in the MAP kinase cascade, suggesting that the function of the pheromone induction domain is normally repressed in the absence of pheromone. By two-hybrid analysis, this minimal domain interacts with two negative regulators, Dig1p and Dig2p (also designated Rst1p and Rst2p), and the interaction is abolished by mutation of the tyrosines. The pheromone induction domain itself has weak and inducible transcriptional activity, and its ability to potentiate transcription depends on the activity of an adjacent activation domain. These results suggest that the pheromone induction domain of Ste12p mediates transcriptional induction via a two-step process: the relief of repression and synergistic transcriptional activation with another activation domain. PMID:9343403

  19. Protein Inhibitors of Activated STAT (Pias1 and Piasy) Differentially Regulate Pituitary Homeobox 2 (PITX2) Transcriptional Activity*

    PubMed Central

    Wang, Jianbo; Sun, Zhao; Zhang, Zichao; Saadi, Irfan; Wang, Jun; Li, Xiao; Gao, Shan; Engle, Jamison J.; Kuburas, Adisa; Fu, Xueyao; Yu, Wenjie; Klein, William H.; Russo, Andrew F.; Amendt, Brad A.


    Protein inhibitors of activated STAT (Pias) proteins can act independent of sumoylation to modulate the activity of transcription factors and Pias proteins interacting with transcription factors can either activate or repress their activity. Pias proteins are expressed in many tissues and cells during development and we asked if Pias proteins regulated the pituitary homeobox 2 (PITX2) homeodomain protein, which modulates developmental gene expression. Piasy and Pias1 proteins are expressed during craniofacial/tooth development and directly interact and differentially regulate PITX2 transcriptional activity. Piasy and Pias1 are co-expressed in craniofacial tissues with PITX2. Yeast two-hybrid, co-immunoprecipitation and pulldown experiments demonstrate Piasy and Pias1 interactions with the PITX2 protein. Piasy interacts with the PITX2 C-terminal tail to attenuate its transcriptional activity. In contrast, Pias1 interacts with the PITX2 C-terminal tail to increase PITX2 transcriptional activity. The E3 ligase activity associated with the RING domain in Piasy is not required for the attenuation of PITX2 activity, however, the RING domain of Pias1 is required for enhanced PITX2 transcriptional activity. Bimolecular fluorescence complementation assays reveal PITX2 interactions with Piasy and Pias1 in the nucleus. Piasy represses the synergistic activation of PITX2 with interacting co-factors and Piasy represses Pias1 activation of PITX2 transcriptional activity. In contrast, Pias1 did not affect the synergistic interaction of PITX2 with transcriptional co-factors. Last, we demonstrate that Pias proteins form a complex with PITX2 and Lef-1, and PITX2 and β-catenin. Lef-1, β-catenin, and Pias interactions with PITX2 provide new molecular mechanisms for the regulation of PITX2 transcriptional activity and the activity of Pias proteins. PMID:23515314

  20. Multiple steps in the regulation of transcription-factor level and activity.

    PubMed Central

    Calkhoven, C F; Ab, G


    This review focuses on the regulation of transcription factors, many of which are DNA-binding proteins that recognize cis-regulatory elements of target genes and are the most direct regulators of gene transcription. Transcription factors serve as integration centres of the different signal-transduction pathways affecting a given gene. It is obvious that the regulation of these regulators themselves is of crucial importance for differential gene expression during development and in terminally differentiated cells. Transcription factors can be regulated at two, principally different, levels, namely concentration and activity, each of which can be modulated in a variety of ways. The concentrations of transcription factors, as of intracellular proteins in general, may be regulated at any of the steps leading from DNA to protein, including transcription, RNA processing, mRNA degradation and translation. The activity of a transcription factor is often regulated by (de) phosphorylation, which may affect different functions, e.g. nuclear localization DNA binding and trans-activation. Ligand binding is another mode of transcription-factor activation. It is typical for the large super-family of nuclear hormone receptors. Heterodimerization between transcription factors adds another dimension to the regulatory diversity and signal integration. Finally, non-DNA-binding (accessory) factors may mediate a diverse range of functions, e.g. serving as a bridge between the transcription factor and the basal transcription machinery, stabilizing the DNA-binding complex or changing the specificity of the target sequence recognition. The present review presents an overview of different modes of transcription-factor regulation, each illustrated by typical examples. PMID:8713055

  1. O-GlcNAc modification of Sp3 and Sp4 transcription factors negatively regulates their transcriptional activities.


    Ha, Changhoon; Lim, Kihong


    The addition of O-linked N-acetylglucosamine (O-GlcNAc) on serine or threonine modifies a myriad of proteins and regulates their function, stability and localization. O-GlcNAc modification is common among chromosome-associated proteins, such as transcription factors, suggesting its extensive involvement in gene expression regulation. In this study, we demonstrate the O-GlcNAc status of the Sp family members of transcription factors and the functional impact on their transcriptional activities. We highlight the presence of O-GlcNAc residues in Sp3 and Sp4, but not Sp2, as demonstrated by their enrichment in GlcNAc positive protein fractions and by detection of O-GlcNAc residues on Sp3 and Sp4 co-expressed in Escherichia coli together with O-GlcNAc transferase (OGT) using an O-GlcNAc-specific antibody. Deletion mutants of Sp3 and Sp4 indicate that the majority of O-GlcNAc sites reside in their N-terminal transactivation domain. Overall, using reporter gene assays and co-immunoprecipitations, we demonstrate a functional inhibitory role of O-GlcNAc modifications in Sp3 and Sp4 transcription factors. Thereby, our study strengthens the current notion that O-GlcNAc modification is an important regulator of protein interactome. PMID:26431879

  2. Distance and Helical Phase Dependence of Synergistic Transcription Activation in cis-Regulatory Module

    PubMed Central

    Huang, Qilai; Gong, Chenguang; Li, Jiahuang; Zhuo, Zhu; Chen, Yuan; Wang, Jin; Hua, Zi-Chun


    Deciphering of the spatial and stereospecific constraints on synergistic transcription activation mediated between activators bound to cis-regulatory elements is important for understanding gene regulation and remains largely unknown. It has been commonly believed that two activators will activate transcription most effectively when they are bound on the same face of DNA double helix and within a boundary distance from the transcription initiation complex attached to the TATA box. In this work, we studied the spatial and stereospecific constraints on activation by multiple copies of bound model activators using a series of engineered relative distances and stereospecific orientations. We observed that multiple copies of the activators GAL4-VP16 and ZEBRA bound to engineered promoters activated transcription more effectively when bound on opposite faces of the DNA double helix. This phenomenon was not affected by the spatial relationship between the proximal activator and initiation complex. To explain these results, we proposed the novel concentration field model, which posits the effective concentration of bound activators, and therefore the transcription activation potential, is affected by their stereospecific positioning. These results could be used to understand synergistic transcription activation anew and to aid the development of predictive models for the identification of cis-regulatory elements. PMID:22299056

  3. Selective activation of human heat shock gene transcription by nitrosourea antitumor drugs mediated by isocyanate-induced damage and activation of heat shock transcription factor

    SciTech Connect

    Kroes, R.A. Northwestern Univ., Evanston, IL ); Abravaya, K.; Morimoto, R.I. ); Seidenfeld, J. )


    Treatment of cultured human tumor cells with the chloroethylnitrosourea antitumor drug 1,3-bis(2-chloroethyl)-1-nitrosourea (BCNU) selectively induces transcription and protein synthesis of a subset of the human heat shock or stress-induced genes (HSP90 and HSP70) with little effect on other stress genes or on expression of the c-fos, c-myc, or {beta}-actin genes. The active component of BCNU and related compounds appears to be the isocyanate moiety that causes carbamoylation of proteins and nucleic acids. Transcriptional activation of the human HSP70 gene by BCNU is dependent on the heat shock element and correlates with the level of heat shock transcription factor and its binding to the heat shock element in vivo. Unlike activation by heat or heavy metals, BCNU-mediated activation is strongly dependent upon new protein synthesis. This suggests that BCNU-induced, isocyanate-mediated damage to newly synthesized protein(s) may be responsible for activation of the heat shock transcription factor and increased transcription of the HSP90 and HSP70 genes.

  4. Transcriptional trans activators of human and simian foamy viruses contain a small, highly conserved activation domain.

    PubMed Central

    Garrett, E D; He, F; Bogerd, H P; Cullen, B R


    The Bel-1 protein of human foamy virus is a potent transcriptional trans activator of its homologous long terminal repeat promoter element. Here, we demonstrate that Bel-1 can also efficiently activate gene expression when targeted to a heterologous promoter by fusion to the DNA-binding motif of the yeast GAL4 protein. Analysis of a series of deletion mutants of Bel-1 generated in this hybrid protein context suggests the presence of a single transcription activation domain that is fully contained within a discrete, approximately 30-amino-acid segment located proximal to the Bel-1 carboxy terminus. Although this short motif can be shown to function effectively in eukaryotic cells of mammalian, avian, and fungal origin, it does not bear any evident sequence homology to the known classes of eukaryotic activation domain. However, this Bel-1 activation domain was found to be fully conserved, in terms of both biological activity and location, in the distantly related Taf trans activator of simian foamy virus type 1. Images PMID:8411385

  5. The cellular bromodomain protein Brd4 has multiple functions in E2-mediated papillomavirus transcription activation.


    Helfer, Christine M; Yan, Junpeng; You, Jianxin


    The cellular bromodomain protein Brd4 functions in multiple processes of the papillomavirus life cycle, including viral replication, genome maintenance, and gene transcription through its interaction with the viral protein, E2. However, the mechanisms by which E2 and Brd4 activate viral transcription are still not completely understood. In this study, we show that recruitment of positive transcription elongation factor b (P-TEFb), a functional interaction partner of Brd4 in transcription activation, is important for E2's transcription activation activity. Furthermore, chromatin immunoprecipitation (ChIP) analyses demonstrate that P-TEFb is recruited to the actual papillomavirus episomes. We also show that E2's interaction with cellular chromatin through Brd4 correlates with its papillomavirus transcription activation function since JQ1(+), a bromodomain inhibitor that efficiently dissociates E2-Brd4 complexes from chromatin, potently reduces papillomavirus transcription. Our study identifies a specific function of Brd4 in papillomavirus gene transcription and highlights the potential use of bromodomain inhibitors as a method to disrupt the human papillomavirus (HPV) life cycle. PMID:25140737

  6. Fur-mediated activation of gene transcription in the human pathogen Neisseria gonorrhoeae.


    Yu, Chunxiao; Genco, Caroline Attardo


    It is well established that the ferric uptake regulatory protein (Fur) functions as a transcriptional repressor in diverse microorganisms. Recent studies demonstrated that Fur also functions as a transcriptional activator. In this study we defined Fur-mediated activation of gene transcription in the sexually transmitted disease pathogen Neisseria gonorrhoeae. Analysis of 37 genes which were previously determined to be iron induced and which contained putative Fur boxes revealed that only 30 of these genes exhibited reduced transcription in a gonococcal fur mutant strain. Fur-mediated activation was established by examining binding of Fur to the putative promoter regions of 16 Fur-activated genes with variable binding affinities observed. Only ∼50% of the newly identified Fur-regulated genes bound Fur in vitro, suggesting that additional regulatory circuits exist which may function through a Fur-mediated indirect mechanism. The gonococcal Fur-activated genes displayed variable transcription patterns in a fur mutant strain, which correlated with the position of the Fur box in each (promoter) region. These results suggest that Fur-mediated direct transcriptional activation is fulfilled by multiple mechanisms involving either competing with a repressor or recruiting RNA polymerase. Collectively, our studies have established that gonococcal Fur functions as an activator of gene transcription through both direct and indirect mechanisms. PMID:22287521

  7. Distinct DNA-based epigenetic switches trigger transcriptional activation of silent genes in human dermal fibroblasts

    PubMed Central

    Pandian, Ganesh N.; Taniguchi, Junichi; Junetha, Syed; Sato, Shinsuke; Han, Le; Saha, Abhijit; AnandhaKumar, Chandran; Bando, Toshikazu; Nagase, Hiroki; Vaijayanthi, Thangavel; Taylor, Rhys D.; Sugiyama, Hiroshi


    The influential role of the epigenome in orchestrating genome-wide transcriptional activation instigates the demand for the artificial genetic switches with distinct DNA sequence recognition. Recently, we developed a novel class of epigenetically active small molecules called SAHA-PIPs by conjugating selective DNA binding pyrrole-imidazole polyamides (PIPs) with the histone deacetylase inhibitor SAHA. Screening studies revealed that certain SAHA-PIPs trigger targeted transcriptional activation of pluripotency and germ cell genes in mouse and human fibroblasts, respectively. Through microarray studies and functional analysis, here we demonstrate for the first time the remarkable ability of thirty-two different SAHA-PIPs to trigger the transcriptional activation of exclusive clusters of genes and noncoding RNAs. QRT-PCR validated the microarray data, and some SAHA-PIPs activated therapeutically significant genes like KSR2. Based on the aforementioned results, we propose the potential use of SAHA-PIPs as reagents capable of targeted transcriptional activation. PMID:24457603

  8. Regulation of selected genome loci using de novo-engineered transcription activator-like effector (TALE)-type transcription factors

    PubMed Central

    Morbitzer, Robert; Römer, Patrick; Boch, Jens; Lahaye, Thomas


    Proteins that can be tailored to bind desired DNA sequences are key tools for molecular biology. Previous studies suggested that DNA-binding specificity of transcription activator-like effectors (TALEs) from the bacterial genus Xanthomonas is defined by repeat-variable diresidues (RVDs) of tandem-arranged 34/35-amino acid repeat units. We have studied chimeras of two TALEs differing in RVDs and non-RVDs and found that, in contrast to the critical contributions by RVDs, non-RVDs had no major effect on the DNA-binding specificity of the chimeras. This finding suggests that one needs only to modify the RVDs to generate designer TALEs (dTALEs) to activate transcription of user-defined target genes. We used the scaffold of the TALE AvrBs3 and changed its RVDs to match either the tomato Bs4, the Arabidopsis EGL3, or the Arabidopsis KNAT1 promoter. All three dTALEs transcriptionally activated the desired promoters in a sequence-specific manner as mutations within the targeted DNA sequences abolished promoter activation. This study is unique in showing that chromosomal loci can be targeted specifically by dTALEs. We also engineered two AvrBs3 derivatives with four additional repeat units activating specifically either the pepper Bs3 or UPA20 promoter. Because AvrBs3 activates both promoters, our data show that addition of repeat units facilitates TALE-specificity fine-tuning. Finally, we demonstrate that the RVD NK mediates specific interaction with G nucleotides that thus far could not be targeted specifically by any known RVD type. In summary, our data demonstrate that the TALE scaffold can be tailored to target user-defined DNA sequences in whole genomes. PMID:21106758

  9. Synergistic cooperation of MDM2 and E2F1 contributes to TAp73 transcriptional activity

    SciTech Connect

    Kasim, Vivi; Huang, Can; Zhang, Jing; Jia, Huizhen; Wang, Yunxia; Yang, Li; Miyagishi, Makoto; Wu, Shourong


    Highlights: • MDM2 is a novel positive regulator of TAp73 transcriptional activity. • MDM2 colocalizes together and physically interacts with E2F1. • Synergistic cooperation of MDM2 and E2F1 is crucial for TAp73 transcription. • MDM2 regulates TAp73 transcriptional activity in a p53-independent manner. - Abstract: TAp73, a structural homologue of p53, plays an important role in tumorigenesis. E2F1 had been reported as a transcriptional regulator of TAp73, however, the detailed mechanism remains to be elucidated. Here we reported that MDM2-silencing reduced the activities of the TAp73 promoters and the endogenous TAp73 expression level significantly; while MDM2 overexpression upregulated them. We further revealed that the regulation of TAp73 transcriptional activity occurs as a synergistic effect of MDM2 and E2F1, most probably through their physical interaction in the nuclei. Furthermore, we also suggested that MDM2 might be involved in DNA damage-induced TAp73 transcriptional activity. Finally, we elucidated that MDM2-silencing reduced the proliferation rate of colon carcinoma cells regardless of the p53 status. Our data show a synergistic effect of MDM2 and E2F1 on TAp73 transcriptional activity, suggesting a novel regulation pathway of TAp73.

  10. An Asp7Gly substitution in PPARG is associated with decreased transcriptional activation activity.


    Hua, Liushuai; Wang, Jing; Li, Mingxun; Sun, Xiaomei; Zhang, Liangzhi; Lei, Chuzhao; Lan, Xianyong; Fang, Xingtang; Zhao, Xin; Chen, Hong


    As the master regulator of adipogenesis, peroxisome proliferator-activated receptor gamma (PPARG) is required for the accumulation of adipose tissue and hence contributes to obesity. A previous study showed that the substitution of +20A>G in PPARG changed the 7(th) amino acid from Asp to Gly, creating a mutant referred to as PPARG Asp7Gly. In this study, association analysis indicated that PPARG Asp7Gly was associated with lower body height, body weight and heart girth in cattle (P<0.05). Overexpression of PPARG in NIH3T3-L1 cells showed that the Asp7Gly substitution may cause a decrease in its adipogenic ability and the mRNA levels of CIDEC (cell death-inducing DFFA-like effector c) and aP2, which are all transcriptionally activated by PPARG during adipocyte differentiation. A dual-luciferase reporter assay was used to analyze the promoter activity of CIDEC. The results confirmed that the mutant PPARG exhibited weaker transcriptional activation activity than the wild type (P<0.05). These findings likely explain the associations between the Asp7Gly substitution and the body measurements. Additionally, the Asp7Gly mutation may be used in molecular marker assisted selection (MAS) of cattle breeding in the future. PMID:24466299

  11. HMGA proteins as modulators of chromatin structure during transcriptional activation

    PubMed Central

    Ozturk, Nihan; Singh, Indrabahadur; Mehta, Aditi; Braun, Thomas; Barreto, Guillermo


    High mobility group (HMG) proteins are the most abundant non-histone chromatin associated proteins. HMG proteins bind to DNA and nucleosome and alter the structure of chromatin locally and globally. Accessibility to DNA within chromatin is a central factor that affects DNA-dependent nuclear processes, such as transcription, replication, recombination, and repair. HMG proteins associate with different multi-protein complexes to regulate these processes by mediating accessibility to DNA. HMG proteins can be subdivided into three families: HMGA, HMGB, and HMGN. In this review, we will focus on recent advances in understanding the function of HMGA family members, specifically their role in gene transcription regulation during development and cancer. PMID:25364713

  12. Chromatin dynamics associated with HIV-1 Tat activated transcription

    PubMed Central

    Easley, Rebecca; Van Duyne, Rachel; Coley, Will; Guendel, Irene; Dadgar, Sherry; Kehn-Hall, Kylene; Kashanchi, Fatah


    Summary Chromatin remodeling is an essential event for HIV-1 transcription. Over the last two decades this field of research has come to the forefront, as silencing of the HIV-1 provirus through chromatin modifications has been linked to latency. Here, we focus on chromatin remodeling, especially in relation to the transactivator Tat, and review the most important and newly emerging studies that investigate remodeling mechanisms. We begin by discussing covalent modifications that can alter chromatin structure including acetylation, deacetylation, and methylation, as well as topics addressing the interplay between chromatin remodeling and splicing. Next, we focus on complexes that use the energy of ATP to remove or secure nucleosomes and can additionally act to control HIV-1 transcription. Finally, we cover recent literature on viral microRNAs which have been shown to alter chromatin structure by inducing methylation or even by remodeling nucleosomes. PMID:19716452

  13. On the way of revealing coactivator complexes cross-talk during transcriptional activation.


    Krasnov, Aleksey N; Mazina, Marina Yu; Nikolenko, Julia V; Vorobyeva, Nadezhda E


    Transcriptional activation is a complex, multistage process implemented by hundreds of proteins. Many transcriptional proteins are organized into coactivator complexes, which participate in transcription regulation at numerous genes and are a driver of this process. The molecular action mechanisms of coactivator complexes remain largely understudied. Relevant publications usually deal with the involvement of these complexes in the entire process of transcription, and only a few studies are aimed to elucidate their functions at its particular stages. This review summarizes available information on the participation of key coactivator complexes in transcriptional activation. The timing of coactivator complex binding/removal has been used for restructuring previously described information about the transcriptional process. Several major stages of transcriptional activation have been distinguished based on the presence of covalent histone modifications and general transcriptional factors, and the recruitment and/or removal phases have been determined for each coactivator included in analysis. Recruitment of Mediator, SWItch/Sucrose Non-Fermentable and NUcleosome Remodeling Factor complexes during transcription activation has been investigated thoroughly; CHD and INOsitol auxotrophy 80 families are less well studied. In most cases, the molecular mechanisms responsible for the removal of certain coactivator complexes after the termination of their functions at the promoters are still not understood. On the basis of the summarized information, we propose a scheme that illustrates the involvement of coactivator complexes in different stages of the transcription activation process. This scheme may help to gain a deeper insight into the molecular mechanism of functioning of coactivator complexes, find novel participants of the process, and reveal novel structural or functional connections between different coactivators. PMID:26913181

  14. Manganese peroxidase gene transcription in Phanerochaete chrysosporium: Activation by manganese

    SciTech Connect

    Brown, J.A.; Alic, M. Gold, M.H. )


    The expression of manganese peroxidase in nitrogen-limited cultures of Phanerochaete chrysosporium is dependent on Mn, and initial work suggested that Mn regulates transcription of the mnp gene. In this study, using Northern (RNA) blot analysis of kinetic, dose-response, and inhibitor experiments, the authors demonstrate unequivocally that Mn regulates mnp gene transcription. The amount of mnp mRNA in cells of 4-day-old nitrogen-limited cultures is a direct function of the concentration of Mn in the culture medium up to a maximum of 180 {mu}M. Addition of Mn to nitrogen-limited Mn-deficient secondary metabolic (4-, 5-, and 6-day-old) cultures results in the appearance of mnp mRNA within 40 min. The appearance of this message is completely inhibited by the RNA synthesis inhibitor dactinomycin but not by the protein synthesis inhibitor cycloheximide. Furthermore, the amount of mnp mRNA produced is a direct function of the concentration of added Mn. In contrast, addition of Mn to low-nitrogen Mn-deficient 2- or 3-day-old cultures does not result in the appearance of mnp mRNA. Manganese peroxidase protein is detected by specific immunoprecipitation of the in vitro translation products of poly(A) RNA isolated from Mn-supplemented (but nor from Mn-deficient) cells. All of these results demonstrate that Mn, the substrate for the enzyme, regulates mnp gene transcription via a growth-stage-specific and concentration-dependent mechanism.

  15. TAR RNA decoys inhibit tat-activated HIV-1 transcription after preinitiation complex formation.

    PubMed Central

    Bohjanen, P R; Liu, Y; Garcia-Blanco, M A


    The ability of the HIV-1 Tat protein to trans -activate HIV-1 transcription in vitro is specifically inhibited by a circular TAR RNA decoy. This inhibition is not overcome by adding an excess of Tat to the reaction but is partially overcome by adding Tat in combination with nuclear extract, suggesting that TAR RNA might function by interacting with a complex containing Tat and cellular factor(s). A cell-free transcription system involving immobilized DNA templates was used to further define the factor(s) that interact with TAR RNA. Preinitiation complexes formed in the presence or absence of Tat were purified on immobilized templates containing the HIV-1 promoter. After washing, nucleotides and radiolabelled UTP were added and transcription was measured. The presence of Tat during preinitiation complex formation resulted in an increase in the level of full-length HIV-1 transcripts. This Tat-activated increase in HIV-1 transcription was not inhibited by circular TAR decoys added during preinitiation complex formation but was inhibited by circular TAR decoys subsequently added during the transcription reaction. These results suggest that TAR decoys inhibit Tat-activated HIV-1 transcription after preinitiation complex formation, perhaps by interacting with components of transcription complexes. PMID:9358155

  16. The yeast Hot1 transcription factor is critical for activating a single target gene, STL1

    PubMed Central

    Bai, Chen; Tesker, Masha; Engelberg, David


    Transcription factors are commonly activated by signal transduction cascades and induce expression of many genes. They therefore play critical roles in determining the cell's fate. The yeast Hog1 MAP kinase pathway is believed to control the transcription of hundreds of genes via several transcription factors. To identify the bona fide target genes of Hog1, we inducibly expressed the spontaneously active variant Hog1D170A+F318L in cells lacking the Hog1 activator Pbs2. This system allowed monitoring the effects of Hog1 by itself. Expression of Hog1D170A+F318L in pbs2∆ cells imposed induction of just 105 and suppression of only 26 transcripts by at least twofold. We looked for the Hog1-responsive element within the promoter of the most highly induced gene, STL1 (88-fold). A novel Hog1 responsive element (HoRE) was identified and shown to be the direct target of the transcription factor Hot1. Unexpectedly, we could not find this HoRE in any other yeast promoter. In addition, the only gene whose expression was abolished in hot1∆ cells was STL1. Thus Hot1 is essential for transcription of just one gene, STL1. Hot1 may represent a class of transcription factors that are essential for transcription of a very few genes or even just one. PMID:25904326

  17. GW8510 Increases Insulin Expression in Pancreatic Alpha Cells through Activation of p53 Transcriptional Activity

    PubMed Central

    Fomina-Yadlin, Dina; Kubicek, Stefan; Vetere, Amedeo; He, Kaihui Hu; Schreiber, Stuart L.; Wagner, Bridget K.


    Background Expression of insulin in terminally differentiated non-beta cell types in the pancreas could be important to treating type-1 diabetes. Previous findings led us to hypothesize involvement of kinase inhibition in induction of insulin expression in pancreatic alpha cells. Methodology/Principal Findings Alpha (αTC1.6) cells and human islets were treated with GW8510 and other small-molecule inhibitors for up to 5 days. Alpha cells were assessed for gene- and protein-expression levels, cell-cycle status, promoter occupancy status by chromatin immunoprecipitation (ChIP), and p53-dependent transcriptional activity. GW8510, a putative CDK2 inhibitor, up-regulated insulin expression in mouse alpha cells and enhanced insulin secretion in dissociated human islets. Gene-expression profiling and gene-set enrichment analysis of GW8510-treated alpha cells suggested up-regulation of the p53 pathway. Accordingly, the compound increased p53 transcriptional activity and expression levels of p53 transcriptional targets. A predicted p53 response element in the promoter region of the mouse Ins2 gene was verified by chromatin immunoprecipitation (ChIP). Further, inhibition of Jun N-terminal kinase (JNK) and p38 kinase activities suppressed insulin induction by GW8510. Conclusions/Significance The induction of Ins2 by GW8510 occurred through p53 in a JNK- and p38-dependent manner. These results implicate p53 activity in modulation of Ins2 expression levels in pancreatic alpha cells, and point to a potential approach toward using small molecules to generate insulin in an alternative cell type. PMID:22242153

  18. Helix-loop-helix transcription factors mediate activation and repression of the p75LNGFR gene.

    PubMed Central

    Chiaramello, A; Neuman, K; Palm, K; Metsis, M; Neuman, T


    Sequence analysis of rat and human low-affinity nerve growth factor receptor p75LNGFR gene promoter regions revealed a single E-box cis-acting element, located upstream of the major transcription start sites. Deletion analysis of the E-box sequence demonstrated that it significantly contributes to p75LNGFR promoter activity. This E box has a dual function; it mediates either activation or repression of the p75LNGFR promoter activity, depending on the interacting transcription factors. We showed that the two isoforms of the class A basic helix-loop-helix (bHLH) transcription factor ME1 (ME1a and ME1b), the murine homolog of the human HEB transcription factor, specifically repress p75LNGFR promoter activity. This repression can be released by coexpression of the HLH Id2 transcriptional regulator. In vitro analyses demonstrated that ME1a forms a stable complex with the p75LNGFR E box and likely competes with activating E-box-binding proteins. By using ME1a-overexpressing PC12 cells, we showed that the endogenous p75LNGFR gene is a target of ME1a repression. Together, these data demonstrate that the p75LNGFR E box and the interacting bHLH transcription factors are involved in the regulation of p75LNGFR gene expression. These results also show that class A bHLH transcription factors can repress and Id-like negative regulators can stimulate gene expression. PMID:7565756

  19. Inhibition of transcriptional activity of c-JUN by SIRT1

    SciTech Connect

    Gao Zhanguo; Ye Jianping


    c-JUN is a major component of heterodimer transcription factor AP-1 (Activator Protein-1) that activates gene transcription in cell proliferation, inflammation and stress responses. SIRT1 (Sirtuin 1) is a histone deacetylase that controls gene transcription through modification of chromatin structure. However, it is not clear if SIRT1 regulates c-JUN activity in the control of gene transcription. Here, we show that SIRT1 associated with c-JUN in co-immunoprecipitation of whole cell lysate, and inhibited the transcriptional activity of c-JUN in the mammalian two hybridization system. SIRT1 was found in the AP-1 response element in the matrix metalloproteinase-9 (MMP9) promoter DNA leading to inhibition of histone 3 acetylation as shown in a ChIP assay. The SIRT1 signal was reduced by the AP-1 activator PMA, and induced by the SIRT1 activator Resveratrol in the promoter DNA. SIRT1-mediaetd inhibition of AP-1 was demonstrated in the MMP9 gene expression at the gene promoter, mRNA and protein levels. In mouse embryonic fibroblast (MEF) with SIRT1 deficiency (SIRT1{sup -/-}), mRNA and protein of MMP9 were increased in the basal condition, and the inhibitory activity of Resveratrol was significantly attenuated. Glucose-induced MMP9 expression was also inhibited by SIRT1 in response to Resveratrol. These data consistently suggest that SIRT1 directly inhibits the transcriptional activity of AP-1 by targeting c-JUN.

  20. Transcriptional Control by A-Factor of strR, the Pathway-Specific Transcriptional Activator for Streptomycin Biosynthesis in Streptomyces griseus

    PubMed Central

    Tomono, Ayami; Tsai, Yisan; Yamazaki, Haruka; Ohnishi, Yasuo; Horinouchi, Sueharu


    A-factor (2-isocapryloyl-3R-hydroxymethyl-γ-butyrolactone) triggers streptomycin production by inducing the transcription of strR, encoding the pathway-specific transcriptional activator, through signal transduction in the A-factor regulatory cascade in Streptomyces griseus. AdpA, one of the key transcriptional activators in the cascade, bound two upstream activation sites, approximately at nucleotide positions −270 and −50 with respect to the transcriptional start point of strR, as determined by gel mobility shift assays and DNase I footprinting. Transcriptional analysis of the strR promoter with mutated AdpA-binding sites showed that both sites were required for full transcriptional activation of strR by AdpA. Potassium permanganate footprinting showed that AdpA assisted RNA polymerase in forming an open complex at an appropriate position for transcriptional initiation of strR. Nine transcriptional units within the streptomycin biosynthesis gene cluster, including the strR-aphD operon, depended on StrR, indicating that StrR is the pathway-specific transcriptional activator for the whole gene cluster. Consistent with this, expression of strR under the control of a constitutively expressed promoter in an adpA null mutant caused the host to produce streptomycin. PMID:16077104

  1. The active site of RNA polymerase II participates in transcript cleavage within arrested ternary complexes.

    PubMed Central

    Rudd, M D; Izban, M G; Luse, D S


    RNA polymerase II may become arrested during transcript elongation, in which case the ternary complex remains intact but further RNA synthesis is blocked. To relieve arrest, the nascent transcript must be cleaved from the 3' end. RNAs of 7-17 nt are liberated and transcription continues from the newly exposed 3' end. Factor SII increases elongation efficiency by strongly stimulating the transcript cleavage reaction. We show here that arrest relief can also occur by the addition of pyrophosphate. This generates the same set of cleavage products as factor SII, but the fragments produced with pyrophosphate have 5'-triphosphate termini. Thus, the active site of RNA polymerase II, in the presence of pyrophosphate, appears to be capable of cleaving phosphodiester linkages as far as 17 nt upstream of the original site of polymerization, leaving the ternary complex intact and transcriptionally active. Images PMID:8058756

  2. Characteristics of Antisense Transcript Promoters and the Regulation of Their Activity

    PubMed Central

    Lin, Shudai; Zhang, Li; Luo, Wen; Zhang, Xiquan


    Recently, an increasing number of studies on natural antisense transcripts have been reported, especially regarding their classification, temporal and spatial expression patterns, regulatory functions and mechanisms. It is well established that natural antisense transcripts are produced from the strand opposite to the strand encoding a protein. Despite the pivotal roles of natural antisense transcripts in regulating the expression of target genes, the transcriptional mechanisms initiated by antisense promoters (ASPs) remain unknown. To date, nearly all of the studies conducted on this topic have focused on the ASP of a single gene of interest, whereas no study has systematically analyzed the locations of ASPs in the genome, ASP activity, or factors influencing this activity. This review focuses on elaborating on and summarizing the characteristics of ASPs to extend our knowledge about the mechanisms of antisense transcript initiation. PMID:26703594

  3. Biomechanical Signals Suppress TAK1 Activation to Inhibit NF-κB Transcriptional Activation in Fibrochondrocytes

    PubMed Central

    Madhavan, Shashi; Anghelina, Mirela; Sjostrom, Danen; Dossumbekova, Anar; Guttridge, Denis C.; Agarwal, Sudha


    Exercise/joint mobilization is therapeutic for inflammatory joint diseases like rheumatoid and osteoarthritis, but the mechanisms underlying its actions remain poorly understood. We report that biomechanical signals at low/physiological magnitudes are potent inhibitors of inflammation induced by diverse proinflammatory activators like IL-1β, TNF-α, and lipopolysaccharides, in fibrochondrocytes. These signals exert their anti-inflammatory effects by inhibiting phosphorylation of TAK1, a critical point where signals generated by IL-1β, TNF-α, and LPS converge to initiate NF-κB signaling cascade and proinflammatory gene induction. Additionally, biomechanical signals inhibit multiple steps in the IL-1β-induced proinflammatory cascade downstream of IκB kinase activation to regulate IκBα and IκBβ degradation and synthesis, and promote IκBα shuttling to export nuclear NF-κB and terminate its transcriptional activity. The findings demonstrate that biomechanical forces are but another important signal that uses NF-κB pathway to regulate inflammation by switching the molecular activation of discrete molecules involved in proinflammatory gene transcription. PMID:17947700


    PubMed Central

    Tokizawa, Mutsutomo; Kobayashi, Yuriko; Saito, Tatsunori; Kobayashi, Masatomo; Iuchi, Satoshi; Nomoto, Mika; Tada, Yasuomi; Yamamoto, Yoshiharu Y.; Koyama, Hiroyuki


    In Arabidopsis (Arabidopsis thaliana) the root apex is protected from aluminum (Al) rhizotoxicity by excretion of malate, an Al chelator, by ALUMINUM-ACTIVATED MALATE TRANSPORTER1 (AtALMT1). AtALMT1 expression is fundamentally regulated by the SENSITIVE TO PROTON RHIZOTOXICITY1 (STOP1) zinc finger protein, but other transcription factors have roles that enable Al-inducible expression with a broad dynamic range. In this study, we characterized multiple cis-elements in the AtALMT1 promoter that interact with transcription factors. In planta complementation assays of AtALMT1 driven by 5′ truncated promoters of different lengths showed that the promoter region between –540 and 0 (the first ATG) restored the Al-sensitive phenotype of atalm1 and thus contains cis-elements essential for AtALMT1 expression for Al tolerance. Computation of overrepresented octamers showed that eight regions in this promoter region contained potential cis-elements involved in Al induction and STOP1 regulation. Mutation in a position around –297 from the first ATG completely inactivated AtALMT1 expression and Al response. In vitro binding assays showed that this region contained the STOP1 binding site, which accounted for the recognition by four zinc finger domains of the protein. Other positions were characterized as cis-elements that regulated expression by repressors and activators and a transcription factor that determines root tip expression of AtALMT1. From the consensus of known cis-elements, we identified CALMODULIN-BINDING TRANSCRIPTION ACTIVATOR2 to be an activator of AtALMT1 expression. Al-inducible expression of AtALMT1 changed transcription starting sites, which increased the abundance of transcripts with a shortened 5′ untranslated region. The present analyses identified multiple mechanisms that regulate AtALMT1 expression. PMID:25627216

  5. MK5 activates Rag transcription via Foxo1 in developing B cells

    PubMed Central

    Chow, Kwan T.; Timblin, Greg A.; McWhirter, Sarah M.


    Foxo1 is a critical, direct regulator of Rag (recombination activating gene) transcription during B cell development and is thus essential for the generation of a diverse repertoire of antigen receptors. Although Foxo1 regulation has been widely studied in many cell types, pathways regulating Foxo1 in B cells have not been fully elucidated. By screening a panel of Foxo1 mutants, we identified serine 215 on Foxo1 as a novel phosphorylation site that is essential for the activation of Rag transcription. Mutation of S215 strongly attenuated transactivation of Rag but did not affect most other Foxo1 target genes. We show that MK5, a MAPK-activated protein kinase, is a previously unidentified upstream regulator of Foxo1. MK5 was necessary and sufficient to activate Rag transcription in transformed and primary pro–B cells. Together, our experiments show that MK5 positively regulates Rag transcription via phosphorylation of Foxo1 in developing B cells. PMID:23878308

  6. Two distinct domains of Flo8 activator mediates its role in transcriptional activation and the physical interaction with Mss11.


    Kim, Hye Young; Lee, Sung Bae; Kang, Hyen Sam; Oh, Goo Taeg; Kim, TaeSoo


    Flo8 is a transcriptional activator essential for the inducible expression of a set of target genes such as STA1, FLO11, and FLO1 encoding an extracellular glucoamylase and two cell surface proteins, respectively. However, the molecular mechanism of Flo8-mediated transcriptional activation remains largely elusive. By generating serial deletion constructs, we revealed here that a novel transcriptional activation domain on its extreme C-terminal region plays a crucial role in activating transcription. On the other hand, the N-terminal LisH motif of Flo8 appears to be required for its physical interaction with another transcriptional activator, Mss11, for their cooperative transcriptional regulation of the shared targets. Additionally, GST pull-down experiments uncovered that Flo8 and Mss11 can directly form either a heterodimer or a homodimer capable of binding to DNA, and we also showed that this formed complex of two activators interacts functionally and physically with the Swi/Snf complex. Collectively, our findings provide valuable clues for understanding the molecular mechanism of Flo8-mediated transcriptional control of multiple targets. PMID:24813990

  7. EGR1 Functions as a Potent Repressor of MEF2 Transcriptional Activity

    PubMed Central

    Cooper, Olivia; Kontor, Akuah; Nocco, Sarah E.; Naya, Francisco J.


    The myocyte enhancer factor 2 (MEF2) transcription factor requires interactions with co-factors for precise regulation of its target genes. Our lab previously reported that the mammalian MEF2A isoform regulates the cardiomyocyte costamere, a critical muscle-specific focal adhesion complex involved in contractility, through its transcriptional control of genes encoding proteins localized to this cytoskeletal structure. To further dissect the transcriptional mechanisms of costamere gene regulation and identify potential co-regulators of MEF2A, a bioinformatics analysis of transcription factor binding sites was performed using the proximal promoter regions of selected costamere genes. One of these predicted sites belongs to the early growth response (EGR) transcription factor family. The EGR1 isoform has been shown to be involved in a number of pathways in cardiovascular homeostasis and disease, making it an intriguing candidate MEF2 coregulator to further characterize. Here, we demonstrate that EGR1 interacts with MEF2A and is a potent and specific repressor of MEF2 transcriptional activity. Furthermore, we show that costamere gene expression in cardiomyocytes is dependent on EGR1 transcriptional activity. This study identifies a mechanism by which MEF2 activity can be modulated to ensure that costamere gene expression is maintained at levels commensurate with cardiomyocyte contractile activity. PMID:26011708

  8. Ubiquitin ligase activity of TFIIH and the transcriptional response to DNA damage.


    Takagi, Yuichiro; Masuda, Claudio A; Chang, Wei-Hau; Komori, Hirofumi; Wang, Dong; Hunter, Tony; Joazeiro, Claudio A P; Kornberg, Roger D


    Core transcription factor (TF) IIH purified from yeast possesses an E3 ubiquitin (Ub) ligase activity, which resides, at least in part, in a RING finger (RNF) domain of the Ssl1 subunit. Yeast strains mutated in the Ssl1 RNF domain are sensitive to ultraviolet (UV) light and to methyl methanesulfonate (MMS). This increased sensitivity to DNA-damaging agents does not reflect a deficiency in nucleotide excision repair. Rather, it correlates with reduced transcriptional induction of genes involved in DNA repair, suggesting that the E3 Ub ligase activity of TFIIH mediates the transcriptional response to DNA damage. PMID:15837426

  9. FLOWERING BHLH transcriptional activators control expression of the photoperiodic flowering regulator CONSTANS in Arabidopsis

    PubMed Central

    Ito, Shogo; Song, Young Hun; Josephson-Day, Anna R.; Miller, Ryan J.; Breton, Ghislain; Olmstead, Richard G.; Imaizumi, Takato


    Many plants monitor day-length changes throughout the year and use the information to precisely regulate the timing of seasonal flowering for maximum reproductive success. In Arabidopsis thaliana, transcriptional regulation of the CONSTANS (CO) gene and posttranslational regulation of CO protein are crucial mechanisms for proper day-length measurement in photoperiodic flowering. Currently, the CYCLING DOF FACTOR proteins are the only transcription factors known to directly regulate CO gene expression, and the mechanisms that directly activate CO transcription have remained unknown. Here we report the identification of four CO transcriptional activators, named FLOWERING BHLH 1 (FBH1), FBH2, FBH3, and FBH4. All FBH proteins are related basic helix–loop–helix-type transcription factors that preferentially bind to the E-box cis-elements in the CO promoter. Overexpression of all FBH genes drastically elevated CO levels and caused early flowering regardless of photoperiod, whereas CO levels were reduced in the fbh quadruple mutants. In addition, FBH1 is expressed in the vascular tissue and bound near the transcription start site of the CO promoter in vivo. Furthermore, FBH homologs in poplar and rice induced CO expression in Arabidopsis. These results indicate that FBH proteins positively regulate CO transcription for photoperiodic flowering and that this mechanism may be conserved in diverse plant species. Our results suggest that the diurnal CO expression pattern is generated by a concert of redundant functions of positive and negative transcriptional regulators. PMID:22334645

  10. TGFβ-induced invasion of prostate cancer cells is promoted by c-Jun-dependent transcriptional activation of Snail1

    PubMed Central

    Thakur, Noopur; Gudey, Shyam Kumar; Marcusson, Anders; Fu, Jing Yi; Bergh, Anders; Heldin, Carl-Henrik; Landström, Marene


    High levels of transforming growth factor-β (TGFβ) correlate with poor prognosis for patients with prostate cancer and other cancers. TGFβ is a multifunctional cytokine and crucial regulator of cell fate, such as epithelial to mesenchymal transition (EMT), which is implicated in cancer invasion and progression. TGFβ conveys its signals upon binding to type I and type II serine/threonine kinase receptors (TβRI/II); phosphorylation of Smad2 and Smad3 promotes their association with Smad4, which regulates expression of targets genes, such as Smad7, p21, and c-Jun. TGFβ also activates the ubiquitin ligase tumor necrosis factor receptor-associated factor 6 (TRAF6), which associates with TβRI and activates the p38 mitogen-activated protein kinase (MAPK) pathway. Snail1 is a key transcription factor, induced by TGFβ that promotes migration and invasion of cancer cells. In this study, we have identified a novel binding site for c-Jun in the promoter of the Snail1 gene and report that the activation of the TGFβ–TRAF6–p38 MAPK pathway promotes both c-Jun expression and its activation via p38α-dependent phosphorylation of c-Jun at Ser63. The TRAF6-dependent activation of p38 also leads to increased stability of c-Jun, due to p38-dependent inactivation of glycogen synthase kinase (GSK) 3β by phosphorylation at Ser9. Thus, our findings elucidate a novel role for the p38 MAPK pathway in stimulated cells, leading to activation of c-Jun and its binding to the promoter of Snail1, thereby triggering motility and invasiveness of aggressive human prostate cancer cells. PMID:25483191

  11. Biochemical Analysis of Distinct Activation Functions in p300 That Enhance Transcription Initiation with Chromatin Templates

    PubMed Central

    Kraus, W. Lee; Manning, E. Tory; Kadonaga, James T.


    To investigate the mechanisms of transcriptional enhancement by the p300 coactivator, we analyzed wild-type and mutant versions of p300 with a chromatin transcription system in vitro. Estrogen receptor, NF-κB p65 plus Sp1, and Gal4-VP16 were used as different sequence-specific activators. The CH3 domain (or E1A-binding region) was found to be essential for the function of each of the activators tested. The bromodomain was also observed to be generally important for p300 coactivator activity, though to a lesser extent than the CH3 domain/E1A-binding region. The acetyltransferase activity and the C-terminal region (containing the steroid receptor coactivator/p160-binding region and the glutamine-rich region) were each found to be important for activation by estrogen receptor but not for that by Gal4-VP16. The N-terminal region of p300, which had been previously found to interact with nuclear hormone receptors, was not seen to be required for any of the activators, including estrogen receptor. Single-round transcription experiments revealed that the functionally important subregions of p300 contribute to its ability to promote the assembly of transcription initiation complexes. In addition, the acetyltransferase activity of p300 was observed to be distinct from the broadly essential activation function of the CH3 domain/E1A-binding region. These results indicate that specific regions of p300 possess distinct activation functions that are differentially required to enhance the assembly of transcription initiation complexes. Interestingly, with the estrogen receptor, four distinct regions of p300 each have an essential role in the transcription activation process. These data exemplify a situation in which a network of multiple activation functions is required to achieve gene transcription. PMID:10567538

  12. Mapping neural circuits with activity-dependent nuclear import of a transcription factor.


    Masuyama, Kaoru; Zhang, Yi; Rao, Yi; Wang, Jing W


    Abstract: Nuclear factor of activated T cells (NFAT) is a calcium-responsive transcription factor. We describe here an NFAT-based neural tracing method-CaLexA (calcium-dependent nuclear import of LexA)-for labeling active neurons in behaving animals. In this system, sustained neural activity induces nuclear import of the chimeric transcription factor LexA-VP16-NFAT, which in turn drives green fluorescent protein (GFP) reporter expression only in active neurons. We tested this system in Drosophila and found that volatile sex pheromones excite specific neurons in the olfactory circuit. Furthermore, complex courtship behavior associated with multi-modal sensory inputs activated neurons in the ventral nerve cord. This method harnessing the mechanism of activity-dependent nuclear import of a transcription factor can be used to identify active neurons in specific neuronal population in behaving animals. PMID:22236090

  13. Variable Glutamine-Rich Repeats Modulate Transcription Factor Activity

    PubMed Central

    Gemayel, Rita; Chavali, Sreenivas; Pougach, Ksenia; Legendre, Matthieu; Zhu, Bo; Boeynaems, Steven; van der Zande, Elisa; Gevaert, Kris; Rousseau, Frederic; Schymkowitz, Joost; Babu, M. Madan; Verstrepen, Kevin J.


    Summary Excessive expansions of glutamine (Q)-rich repeats in various human proteins are known to result in severe neurodegenerative disorders such as Huntington’s disease and several ataxias. However, the physiological role of these repeats and the consequences of more moderate repeat variation remain unknown. Here, we demonstrate that Q-rich domains are highly enriched in eukaryotic transcription factors where they act as functional modulators. Incremental changes in the number of repeats in the yeast transcriptional regulator Ssn6 (Cyc8) result in systematic, repeat-length-dependent variation in expression of target genes that result in direct phenotypic changes. The function of Ssn6 increases with its repeat number until a certain threshold where further expansion leads to aggregation. Quantitative proteomic analysis reveals that the Ssn6 repeats affect its solubility and interactions with Tup1 and other regulators. Thus, Q-rich repeats are dynamic functional domains that modulate a regulator’s innate function, with the inherent risk of pathogenic repeat expansions. PMID:26257283

  14. Transcriptional activation of phosphoenolpyruvate carboxylase by phosphorus deficiency in tobacco.


    Toyota, Kentaro; Koizumi, Nozomu; Sato, Fumihiko


    Phosphoenolpyruvate carboxylase (PEPC), which catalyses the carboxylation of phosphoenolpyruvate using HCO(3)(-) to generate oxaloacetic acid, is an important enzyme in the primary metabolism of plants. Although the PEPC genes (ppc) comprise only a small gene family, the function of each gene is not clear, except for roles in C(4) photosynthesis and CAM. Three PEPC genes (Nsppc1-3) from the C(3) plant Nicotiana sylvestris were used to investigate their roles and regulation in a C(3) plant, and their regulation by phosphorus depletion in particular. First, the induction of PEPC by phosphorus depletion was confirmed. Next, Nsppc1 was determined to be mainly responsive to phosphorus deficiency at the transcriptional level. Further studies using transgenic tobacco harbouring a chimeric gene consisting of the 2.0 kb promoter region of Nsppc1 and the beta-glucuronidase (GUS) reporter showed that PEPC is transcriptionally induced. It was also found that sucrose had a synergistic effect on the induction of PEPC by phosphorus deficiency. A series of transgenic tobacco containing 5'-deletion mutants of Nsppc1 promoter::GUS fusion revealed that the -539 to -442 bp Nsppc1 promoter region, relative to the translation start site, was necessary for the response to phosphorus deficiency. Gain-of-function analysis using a construct containing three tandem repeats of the -539 to -442 bp region confirmed that this region was sufficient to induce the phosphorus-deficiency response in tobacco. PMID:12598567

  15. Activation Domain-Specific and General Transcription Stimulation by Native Histone Acetyltransferase Complexes

    PubMed Central

    Ikeda, Keiko; Steger, David J.; Eberharter, Anton; Workman, Jerry L.


    Recent progress in identifying the catalytic subunits of histone acetyltransferase (HAT) complexes has implicated histone acetylation in the regulation of transcription. Here, we have analyzed the function of two native yeast HAT complexes, SAGA (Spt-Ada-Gcn5 Acetyltransferase) and NuA4 (nucleosome acetyltransferase of H4), in activating transcription from preassembled nucleosomal array templates in vitro. Each complex was tested for the ability to enhance transcription driven by GAL4 derivatives containing either acidic, glutamine-rich, or proline-rich activation domains. On nucleosomal array templates, the SAGA complex selectively stimulates transcription driven by the VP16 acidic activation domain in an acetyl coenzyme A-dependent manner. In contrast, the NuA4 complex facilitates transcription mediated by any of the activation domains tested if allowed to preacetylate the nucleosomal template, indicating a general stimulatory effect of histone H4 acetylation. However, when the extent of acetylation by NuA4 is limited, the complex also preferentially stimulates VP16-driven transcription. SAGA and NuA4 interact directly with the VP16 activation domain but not with a glutamine-rich or proline-rich activation domain. These data suggest that recruitment of the SAGA and NuA4 HAT complexes by the VP16 activation domain contributes to HAT-dependent activation. In addition, extensive H4/H2B acetylation by NuA4 leads to a general activation of transcription, which is independent of activator-NuA4 interactions. PMID:9858608

  16. Enhancer of Acetyltransferase Chameau (EAChm) Is a Novel Transcriptional Co-Activator

    PubMed Central

    Imamura, Yuko; Higashi, Miki; Yoneda, Mitsuhiro; Ito, Takashi


    Acetylation of nucleosomal histones by diverse histone acetyltransferases (HAT) plays pivotal roles in many cellular events. Discoveries of novel HATs and HAT related factors have provided new insights to understand the roles and mechanisms of histone acetylation. In this study, we identified prominent Histone H3 acetylation activity in vitro and purified its activity, showing that it is composed of the MYST acetyltransferase Chameau and Enhancer of the Acetyltransferase Chameau (EAChm) family. EAChm is a negatively charged acidic protein retaining aspartate and glutamate. Furthermore, we identified that Chameau and EAChm stimulate transcription in vitro together with purified general transcription factors. In addition, RNA-seq analysis of Chameu KD and EAChm KD S2 cells suggest that Chameau and EAChm regulate transcription of common genes in vivo. Our results suggest that EAChm regulates gene transcription in Drosophila embryos by enhancing Acetyltransferase Chameau activity. PMID:26555228

  17. Activated AMPK inhibits PPAR-{alpha} and PPAR-{gamma} transcriptional activity in hepatoma cells.


    Sozio, Margaret S; Lu, Changyue; Zeng, Yan; Liangpunsakul, Suthat; Crabb, David W


    AMP-activated protein kinase (AMPK) and peroxisome proliferator-activated receptor-α (PPAR-α) are critical regulators of short-term and long-term fatty acid oxidation, respectively. We examined whether the activities of these molecules were coordinately regulated. H4IIEC3 cells were transfected with PPAR-α and PPAR-γ expression plasmids and a peroxisome-proliferator-response element (PPRE) luciferase reporter plasmid. The cells were treated with PPAR agonists (WY-14,643 and rosiglitazone), AMPK activators 5-aminoimidazole-4-carboxamide riboside (AICAR) and metformin, and the AMPK inhibitor compound C. Both AICAR and metformin decreased basal and WY-14,643-stimulated PPAR-α activity; compound C increased agonist-stimulated reporter activity and partially reversed the effect of the AMPK activators. Similar effects on PPAR-γ were seen, with both AICAR and metformin inhibiting PPRE reporter activity. Compound C increased basal PPAR-γ activity and rosiglitazone-stimulated activity. In contrast, retinoic acid receptor-α (RAR-α), another nuclear receptor that dimerizes with retinoid X receptor (RXR), was largely unaffected by the AMPK activators. Compound C modestly increased AM580 (an RAR agonist)-stimulated activity. The AMPK activators did not affect PPAR-α binding to DNA, and there was no consistent correlation between effects of the AMPK activators and inhibitor on PPAR and the nuclear localization of AMPK-α subunits. Expression of either a constitutively active or dominant negative AMPK-α inhibited basal and WY-14,643-stimulated PPAR-α activity and basal and rosiglitazone-stimulated PPAR-γ activity. We concluded that the AMPK activators AICAR and metformin inhibited transcriptional activities of PPAR-α and PPAR-γ, whereas inhibition of AMPK with compound C activated both PPARs. The effects of AMPK do not appear to be mediated through effects on RXR or on PPAR/RXR binding to DNA. These effects are independent of kinase activity and instead appear to

  18. Voltage-gated Na+ Channel Activity Increases Colon Cancer Transcriptional Activity and Invasion Via Persistent MAPK Signaling

    NASA Astrophysics Data System (ADS)

    House, Carrie D.; Wang, Bi-Dar; Ceniccola, Kristin; Williams, Russell; Simaan, May; Olender, Jacqueline; Patel, Vyomesh; Baptista-Hon, Daniel T.; Annunziata, Christina M.; Silvio Gutkind, J.; Hales, Tim G.; Lee, Norman H.


    Functional expression of voltage-gated Na+ channels (VGSCs) has been demonstrated in multiple cancer cell types where channel activity induces invasive activity. The signaling mechanisms by which VGSCs promote oncogenesis remain poorly understood. We explored the signal transduction process critical to VGSC-mediated invasion on the basis of reports linking channel activity to gene expression changes in excitable cells. Coincidentally, many genes transcriptionally regulated by the SCN5A isoform in colon cancer have an over-representation of cis-acting sites for transcription factors phosphorylated by ERK1/2 MAPK. We hypothesized that VGSC activity promotes MAPK activation to induce transcriptional changes in invasion-related genes. Using pharmacological inhibitors/activators and siRNA-mediated gene knockdowns, we correlated channel activity with Rap1-dependent persistent MAPK activation in the SW620 human colon cancer cell line. We further demonstrated that VGSC activity induces downstream changes in invasion-related gene expression via a PKA/ERK/c-JUN/ELK-1/ETS-1 transcriptional pathway. This is the first study illustrating a molecular mechanism linking functional activity of VGSCs to transcriptional activation of invasion-related genes.

  19. Calcium-independent phospholipase A2γ enhances activation of the ATF6 transcription factor during endoplasmic reticulum stress.


    Elimam, Hanan; Papillon, Joan; Takano, Tomoko; Cybulsky, Andrey V


    Injury of visceral glomerular epithelial cells (GECs) causes proteinuria in many glomerular diseases. We reported previously that calcium-independent phospholipase A2γ (iPLA2γ) is cytoprotective against complement-mediated GEC injury. Because iPLA2γ is localized at the endoplasmic reticulum (ER), this study addressed whether the cytoprotective effect of iPLA2γ involves the ER stress unfolded protein response (UPR). In cultured rat GECs, overexpression of the full-length iPLA2γ, but not a mutant iPLA2γ that fails to associate with the ER, augmented tunicamycin-induced activation of activating transcription factor-6 (ATF6) and induction of the ER chaperones, glucose-regulated protein 94 (GRP94) and glucose-regulated protein 78 (GRP78). Augmented responses were inhibited by the iPLA2γ inhibitor, (R)-bromoenol lactone, but not by the cyclooxygenase inhibitor, indomethacin. Tunicamycin-induced cytotoxicity was reduced in GECs expressing iPLA2γ, and the cytoprotection was reversed by dominant-negative ATF6. GECs from iPLA2γ knock-out mice showed blunted ATF6 activation and chaperone up-regulation in response to tunicamycin. Unlike ATF6, the two other UPR pathways, i.e. inositol-requiring enzyme 1α and protein kinase RNA-like ER kinase pathways, were not affected by iPLA2γ. Thus, in GECs, iPLA2γ amplified activation of the ATF6 pathway of the UPR, resulting in up-regulation of ER chaperones and cytoprotection. These effects were dependent on iPLA2γ catalytic activity and association with the ER but not on prostanoids. Modulating iPLA2γ activity may provide opportunities for pharmacological intervention in glomerular diseases associated with ER stress. PMID:25492867

  20. Activated α2-Macroglobulin Regulates Transcriptional Activation of c-MYC Target Genes through Cell Surface GRP78 Protein.


    Gopal, Udhayakumar; Gonzalez-Gronow, Mario; Pizzo, Salvatore Vincent


    Activated α2-macroglobulin (α2M*) signals predominantly through cell surface GRP78 (CS-GRP78) to promote proliferation and survival of cancer cells; however, the molecular mechanism remains obscure. c-MYC is an essential transcriptional regulator that controls cell proliferation. We hypothesize that α2M*/CS-GRP78-evoked key signaling events are required for transcriptional activation of c-MYC target genes. Activation of CS-GRP78 by α2M* requires ligation of the GRP78 primary amino acid sequence (Leu(98)-Leu(115)). After stimulation with α2M*, CS-GRP78 signaling activates 3-phosphoinositide-dependent protein kinase-1 (PDK1) to induce phosphorylation of PLK1, which in turn induces c-MYC transcription. We demonstrate that PLK1 binds directly to c-MYC and promotes its transcriptional activity by phosphorylating Ser(62) Moreover, activated c-MYC is recruited to the E-boxes of target genes FOSL1 and ID2 by phosphorylating histone H3 at Ser(10) In addition, targeting the carboxyl-terminal domain of CS-GRP78 with a mAb suppresses transcriptional activation of c-MYC target genes and impairs cell proliferation. This work demonstrates that α2M*/CS-GRP78 acts as an upstream regulator of the PDK1/PLK1 signaling axis to modulate c-MYC transcription and its target genes, suggesting a therapeutic strategy for targeting c-MYC-associated malignant progression. PMID:27002159

  1. SUMOylation of DRIL1 Directs Its Transcriptional Activity Towards Leukocyte Lineage-Specific Genes

    PubMed Central

    van Lohuizen, Maarten; Peeper, Daniel S.


    DRIL1 is an ARID family transcription factor that can immortalize primary mouse fibroblasts, bypass RASV12-induced cellular senescence and collaborate with RASV12 or MYC in mediating oncogenic transformation. It also activates immunoglobulin heavy chain transcription and engages in heterodimer formation with E2F to stimulate E2F-dependent transcription. Little, however, is known about the regulation of DRIL1 activity. Recently, DRIL1 was found to interact with the SUMO-conjugating enzyme Ubc9, but the functional relevance of this association has not been assessed. Here, we show that DRIL1 is sumoylated both in vitro and in vivo at lysine 398. Moreover, we provide evidence that PIASy functions as a specific SUMO E3-ligase for DRIL1 and promotes its sumoylation both in vitro and in vivo. Furthermore, consistent with the subnuclear localization of PIASy in the Matrix-Associated Region (MAR), SUMO-modified DRIL1 species are found exclusively in the MAR fraction. This post-translational modification interferes neither with the subcellular localization nor the DNA-binding activity of the protein. In contrast, DRIL1 sumoylation impairs its interaction with E2F1 in vitro and modifies its transcriptional activity in vivo, driving transcription of subset of genes regulating leukocyte fate. Taken together, these results identify sumoylation as a novel post-translational modification of DRIL1 that represents an important mechanism for targeting and modulating DRIL1 transcriptional activity. PMID:19436740

  2. Encoding four gene expression programs in the activation dynamics of a single transcription factor.


    Hansen, Anders S; O'Shea, Erin K


    Cellular signaling response pathways often exhibit a bow-tie topology [1,2]: multiple upstream stress signals converge on a single shared transcription factor, which is thought to induce different downstream gene expression programs (Figure 1A). However, if several different signals activate the same transcription factor, can each signal then induce a specific gene expression response? A growing body of literature supports a temporal coding theory where information about environmental signals can be encoded, at least partially, in the temporal dynamics of the shared transcription factor [1,2]. For example, in the case of the budding yeast transcription factor Msn2, different stresses induce distinct Msn2 activation dynamics: Msn2 shows pulsatile nuclear activation with dose-dependent frequency under glucose limitation, but sustained nuclear activation with dose-dependent amplitude under oxidative stress [3]. These dynamic patterns can then lead to differential gene expression responses [3-5], but it is not known how much specificity can be obtained. Thus, a major question of this temporal coding theory is how many gene response programs or cellular functions can be robustly encoded by dynamic control of a single transcription factor. Here we provide the first direct evidence that, simply by regulating the activation dynamics of a single transcription factor, it is possible to preferentially induce four distinct gene expression programs. PMID:27046808

  3. The Small Molecule IMR-1 Inhibits the Notch Transcriptional Activation Complex to Suppress Tumorigenesis.


    Astudillo, Luisana; Da Silva, Thiago G; Wang, Zhiqiang; Han, Xiaoqing; Jin, Ke; VanWye, Jeffrey; Zhu, Xiaoxia; Weaver, Kelly; Oashi, Taiji; Lopes, Pedro E M; Orton, Darren; Neitzel, Leif R; Lee, Ethan; Landgraf, Ralf; Robbins, David J; MacKerell, Alexander D; Capobianco, Anthony J


    In many cancers, aberrant Notch activity has been demonstrated to play a role in the initiation and maintenance of the neoplastic phenotype and in cancer stem cells, which may allude to its additional involvement in metastasis and resistance to therapy. Therefore, Notch is an exceedingly attractive therapeutic target in cancer, but the full range of potential targets within the pathway has been underexplored. To date, there are no small-molecule inhibitors that directly target the intracellular Notch pathway or the assembly of the transcriptional activation complex. Here, we describe an in vitro assay that quantitatively measures the assembly of the Notch transcriptional complex on DNA. Integrating this approach with computer-aided drug design, we explored potential ligand-binding sites and screened for compounds that could disrupt the assembly of the Notch transcriptional activation complex. We identified a small-molecule inhibitor, termed Inhibitor of Mastermind Recruitment-1 (IMR-1), that disrupted the recruitment of Mastermind-like 1 to the Notch transcriptional activation complex on chromatin, thereby attenuating Notch target gene transcription. Furthermore, IMR-1 inhibited the growth of Notch-dependent cell lines and significantly abrogated the growth of patient-derived tumor xenografts. Taken together, our findings suggest that a novel class of Notch inhibitors targeting the transcriptional activation complex may represent a new paradigm for Notch-based anticancer therapeutics, warranting further preclinical characterization. Cancer Res; 76(12); 3593-603. ©2016 AACR. PMID:27197169

  4. Activation of vascular endothelial growth factor gene transcription by hypoxia-inducible factor 1.

    PubMed Central

    Forsythe, J A; Jiang, B H; Iyer, N V; Agani, F; Leung, S W; Koos, R D; Semenza, G L


    Expression of vascular endothelial growth factor (VEGF) is induced in cells exposed to hypoxia or ischemia. Neovascularization stimulated by VEGF occurs in several important clinical contexts, including myocardial ischemia, retinal disease, and tumor growth. Hypoxia-inducible factor 1 (HIF-1) is a heterodimeric basic helix-loop-helix protein that activates transcription of the human erythropoietin gene in hypoxic cells. Here we demonstrate the involvement of HIF-1 in the activation of VEGF transcription. VEGF 5'-flanking sequences mediated transcriptional activation of reporter gene expression in hypoxic Hep3B cells. A 47-bp sequence located 985 to 939 bp 5' to the VEGF transcription initiation site mediated hypoxia-inducible reporter gene expression directed by a simian virus 40 promoter element that was otherwise minimally responsive to hypoxia. When reporters containing VEGF sequences, in the context of the native VEGF or heterologous simian virus 40 promoter, were cotransfected with expression vectors encoding HIF-1alpha and HIF-1beta (ARNT [aryl hydrocarbon receptor nuclear translocator]), reporter gene transcription was much greater in both hypoxic and nonhypoxic cells than in cells transfected with the reporter alone. A HIF-1 binding site was demonstrated in the 47-bp hypoxia response element, and a 3-bp substitution eliminated the ability of the element to bind HIF-1 and to activate transcription in response to hypoxia and/or recombinant HIF-1. Cotransfection of cells with an expression vector encoding a dominant negative form of HIF-1alpha inhibited the activation of reporter transcription in hypoxic cells in a dose-dependent manner. VEGF mRNA was not induced by hypoxia in mutant cells that do not express the HIF-1beta (ARNT) subunit. These findings implicate HIF-1 in the activation of VEGF transcription in hypoxic cells. PMID:8756616

  5. PTEN regulates p300-dependent hypoxia-inducible factor 1 transcriptional activity through Forkhead transcription factor 3a (FOXO3a)

    PubMed Central

    Emerling, Brooke M.; Weinberg, Frank; Liu, Juinn-Lin; Mak, Tak W.; Chandel, Navdeep S.


    The tumor suppressor PTEN is mutated or deleted in many tumors, causing the activation of the PI3K pathway. Here, we show that the loss of PTEN increases the transcriptional activity of hypoxia-inducible factor 1 (HIF-1) through the inactivation of Forkhead transcription factors (FOXO) in PTEN-null cells. Reintroduction of PTEN into the nucleus, overexpression of a nonphosphorylatable FOXO3a, which accumulates in the nucleus, or inhibition of nuclear export of FOXO3a by leptomycin B represses HIF-1 transcriptional activity in PTEN-null cells. HIF-1 transcriptional activity increases in PTEN-positive cells depleted of FOXO3a with siRNA. PTEN and FOXO3a regulate the transactivation domain of HIF-1α. Chromatin immunoprecipitation indicates that FOXO3a complexes with HIF-1α and p300 on the Glut-1 promoter, a HIF-1 target gene. Overexpression of p300 reverses FOXO3a-mediated repression of HIF-1 transcriptional activity. Coimmunoprecipitation and GAL4-HIF-1α transactivation assays reveal that FOXO3a interferes with p300-dependent HIF-1 transcriptional activity. Thus, FOXO3a negatively regulates HIF-1 transcriptional activity. PMID:18268343

  6. The upstream activator CTF/NF1 and RNA polymerase II share a common element involved in transcriptional activation.

    PubMed Central

    Xiao, H; Lis, J T; Xiao, H; Greenblatt, J; Friesen, J D


    The carboxy-terminal domain (CTD) of the largest subunit of RNA polymerase II consists of tandem repeats of a heptapeptide with the consensus YSPTSPS. It has been shown that the heptapeptide repeat interacts directly with the general transcription factor TFIID. We report here that the CTD activates transcription when fused to the DNA-binding domain of GAL4. More importantly, we find that the proline-rich transcriptional activation domain of the CCAAT-box-binding factor CTF/NF1 contains a sequence with striking similarity to the heptapeptide repeats of the CTD. We show that this CTD-like motif is essential for the transcriptional activator function of the proline-rich domain of CTF/NF1. Deletion of and point mutations in this CTD-like motif abolish the transcriptional activator function of the proline-rich domain, while natural CTD repeats from RNA polymerase II are fully functional in place of the CTD-like motif. We further show that the proline-rich activation domain of CTF/NF1 interacts directly with the TATA-box-binding protein (TBP), and that a mutation in the CTD-like motif that abolishes transcriptional activation reduces the affinity of the proline-rich domain for TBP. These results demonstrate that a class of proline-rich activator proteins and RNA polymerase II possess a common structural and functional component which can interact with the same target in the general transcription machinery. We discuss the implications of these results for the mechanisms of transcriptional activation in eucaryotes. Images PMID:8029001

  7. Prothymosin alpha selectively enhances estrogen receptor transcriptional activity by interacting with a repressor of estrogen receptor activity.


    Martini, P G; Delage-Mourroux, R; Kraichely, D M; Katzenellenbogen, B S


    We find that prothymosin alpha (PTalpha) selectively enhances transcriptional activation by the estrogen receptor (ER) but not transcriptional activity of other nuclear hormone receptors. This selectivity for ER is explained by PTalpha interaction not with ER, but with a 37-kDa protein denoted REA, for repressor of estrogen receptor activity, a protein that we have previously shown binds to ER, blocking coactivator binding to ER. We isolated PTalpha, known to be a chromatin-remodeling protein associated with cell proliferation, using REA as bait in a yeast two-hybrid screen with a cDNA library from MCF-7 human breast cancer cells. PTalpha increases the magnitude of ERalpha transcriptional activity three- to fourfold. It shows lesser enhancement of ERbeta transcriptional activity and has no influence on the transcriptional activity of other nuclear hormone receptors (progesterone receptor, glucocorticoid receptor, thyroid hormone receptor, or retinoic acid receptor) or on the basal activity of ERs. In contrast, the steroid receptor coactivator SRC-1 increases transcriptional activity of all of these receptors. Cotransfection of PTalpha or SRC-1 with increasing amounts of REA, as well as competitive glutathione S-transferase pulldown and mammalian two-hybrid studies, show that REA competes with PTalpha (or SRC-1) for regulation of ER transcriptional activity and suppresses the ER stimulation by PTalpha or SRC-1, indicating that REA can function as an anticoactivator in cells. Our data support a model in which PTalpha, which does not interact with ER, selectively enhances the transcriptional activity of the ER but not that of other nuclear receptors by recruiting the repressive REA protein away from ER, thereby allowing effective coactivation of ER with SRC-1 or other coregulators. The ability of PTalpha to directly interact in vitro and in vivo with REA, a selective coregulator of the ER, thereby enabling the interaction of ER with coactivators, appears to explain

  8. Transcription factor expression in lipopolysaccharide-activated peripheral-blood-derived mononuclear cells

    PubMed Central

    Roach, Jared C.; Smith, Kelly D.; Strobe, Katie L.; Nissen, Stephanie M.; Haudenschild, Christian D.; Zhou, Daixing; Vasicek, Thomas J.; Held, G. A.; Stolovitzky, Gustavo A.; Hood, Leroy E.; Aderem, Alan


    Transcription factors play a key role in integrating and modulating biological information. In this study, we comprehensively measured the changing abundances of mRNAs over a time course of activation of human peripheral-blood-derived mononuclear cells (“macrophages”) with lipopolysaccharide. Global and dynamic analysis of transcription factors in response to a physiological stimulus has yet to be achieved in a human system, and our efforts significantly advanced this goal. We used multiple global high-throughput technologies for measuring mRNA levels, including massively parallel signature sequencing and GeneChip microarrays. We identified 92 of 1,288 known human transcription factors as having significantly measurable changes during our 24-h time course. At least 42 of these changes were previously unidentified in this system. Our data demonstrate that some transcription factors operate in a functional range below 10 transcripts per cell, whereas others operate in a range three orders of magnitude greater. The highly reproducible response of many mRNAs indicates feedback control. A broad range of activation kinetics was observed; thus, combinatorial regulation by small subsets of transcription factors would permit almost any timing input to cis-regulatory elements controlling gene transcription. PMID:17913878

  9. Phosphatidylserine enhances IKBKAP transcription by activating the MAPK/ERK signaling pathway.


    Donyo, Maya; Hollander, Dror; Abramovitch, Ziv; Naftelberg, Shiran; Ast, Gil


    Familial dysautonomia (FD) is a genetic disorder manifested due to abnormal development and progressive degeneration of the sensory and autonomic nervous system. FD is caused by a point mutation in the IKBKAP gene encoding the IKAP protein, resulting in decreased protein levels. A promising potential treatment for FD is phosphatidylserine (PS); however, the manner by which PS elevates IKAP levels has yet to be identified. Analysis of ChIP-seq results of the IKBKAP promoter region revealed binding of the transcription factors CREB and ELK1, which are regulated by the mitogen-activated protein kinase (MAPK)/extracellular-regulated kinase (ERK) signaling pathway. We show that PS treatment enhanced ERK phosphorylation in cells derived from FD patients. ERK activation resulted in elevated IKBKAP transcription and IKAP protein levels, whereas pretreatment with the MAPK inhibitor U0126 blocked elevation of the IKAP protein level. Overexpression of either ELK1 or CREB activated the IKBKAP promoter, whereas downregulation of these transcription factors resulted in a decrease of the IKAP protein. Additionally, we show that PS improves cell migration, known to be enhanced by MAPK/ERK activation and abrogated in FD cells. In conclusion, our results demonstrate that PS activates the MAPK/ERK signaling pathway, resulting in activation of transcription factors that bind the promoter region of IKBKAP and thus enhancing its transcription. Therefore, compounds that activate the MAPK/ERK signaling pathway could constitute potential treatments for FD. PMID:26769675

  10. HMG1 interacts with HOX proteins and enhances their DNA binding and transcriptional activation.

    PubMed Central

    Zappavigna, V; Falciola, L; Helmer-Citterich, M; Mavilio, F; Bianchi, M E


    High mobility group protein 1 (HMG1) is a non-histone, chromatin-associated nuclear protein with a proposed role in the regulation of eukaryotic gene expression. We show that HMG1 interacts with proteins encoded by the HOX gene family by establishing protein-protein contacts between the HMG box domains and the HOX homeodomain. The functional role of these interactions was studied using the transcriptional activity of the human HOXD9 protein as a model. HMG1 enhances, in a dose-dependent fashion, the sequence-specific DNA binding activity in vitro, and the transcriptional activation in a co-transfection assay in vivo, of the HOXD9 protein. Functional interaction between HMG1 and HOXD9 is dependent on the DNA binding activity of the homeodomain, and requires the HOXD9 transcriptional activation domain. HMG1 enhances activation by HOXD9, but not by HOXD8, of the HOXD9-controlled element. Specific target recognition and functional interaction with HMG1 can be transferred to HOXD8 by homeodomain swapping. We propose that HMG1-like proteins might be general co-factors in HOX-mediated transcriptional activation, which facilitate access of HOX proteins to specific DNA targets, and/or introduce architectural constraints in the assembly of HOX-containing transcriptional complexes. Images PMID:8890171

  11. Targeted HIV-1 Latency Reversal Using CRISPR/Cas9-Derived Transcriptional Activator Systems

    PubMed Central

    Bialek, Julia K.; Dunay, Gábor A.; Voges, Maike; Schäfer, Carola; Spohn, Michael; Stucka, Rolf; Hauber, Joachim; Lange, Ulrike C.


    CRISPR/Cas9 technology is currently considered the most advanced tool for targeted genome engineering. Its sequence-dependent specificity has been explored for locus-directed transcriptional modulation. Such modulation, in particular transcriptional activation, has been proposed as key approach to overcome silencing of dormant HIV provirus in latently infected cellular reservoirs. Currently available agents for provirus activation, so-called latency reversing agents (LRAs), act indirectly through cellular pathways to induce viral transcription. However, their clinical performance remains suboptimal, possibly because reservoirs have diverse cellular identities and/or proviral DNA is intractable to the induced pathways. We have explored two CRISPR/Cas9-derived activator systems as targeted approaches to induce dormant HIV-1 proviral DNA. These systems recruit multiple transcriptional activation domains to the HIV 5’ long terminal repeat (LTR), for which we have identified an optimal target region within the LTR U3 sequence. Using this target region, we demonstrate transcriptional activation of proviral genomes via the synergistic activation mediator complex in various in culture model systems for HIV latency. Observed levels of induction are comparable or indeed higher than treatment with established LRAs. Importantly, activation is complete, leading to production of infective viral particles. Our data demonstrate that CRISPR/Cas9-derived technologies can be applied to counteract HIV latency and may therefore represent promising novel approaches in the quest for HIV elimination. PMID:27341108

  12. ZXDC, a novel zinc finger protein that binds CIITA and activates MHC gene transcription

    PubMed Central

    Al-Kandari, Wafa; Jambunathan, Srikarthika; Navalgund, Vandana; Koneni, Rupa; Freer, Margot; Parimi, Neeta; Mudhasani, Rajini; Fontes, Joseph D.


    The class II trans-activator (CIITA) is recognized as the master regulator of major histocompatibility complex (MHC) class II gene transcription and contributes to the transcription of MHC class I genes. To better understand the function of CIITA, we performed yeast two-hybrid with the C-terminal 807 amino acids of CIITA, and cloned a novel human cDNA named zinc finger, X-linked, duplicated family member C (ZXDC). The 858 amino acid ZXDC protein contains 10 zinc fingers and a transcriptional activation domain, and was found to interact with the region of CIITA containing leucine-rich repeats. Over-expression of ZXDC in human cell lines resulted in super-activation of MHC class I and class II promoters by CIITA. Conversely, silencing of ZXDC expression reduced the ability of CIITA to activate transcription of MHC class II genes. Given the specific interaction between the ZXDC and CIITA proteins, as well as the effect of ZXDC on MHC gene transcription, it appears that ZXDC is an important regulator of both MHC class I and class II transcription. PMID:16600381

  13. Constitutively expressed ERF-VII transcription factors redundantly activate the core anaerobic response in Arabidopsis thaliana.


    Bui, Liem T; Giuntoli, Beatrice; Kosmacz, Monika; Parlanti, Sandro; Licausi, Francesco


    Plant adaptation to hypoxic conditions is mediated by the transcriptional activation of genes involved in the metabolic reprogramming of plant cells to cope with reduced oxygen availability. Recent studies indicated that members of the group VII of the Ethylene Responsive Transcription Factor (ERFs) family act as positive regulators of this molecular response. In the current study, the five ERF-VII transcription factors of Arabidopsis thaliana were compared to infer a hierarchy in their role with respect to the anaerobic response. When the activity of each transcription factor was tested on a set of hypoxia-responsive promoters, RAP2.2, RAP2.3 and RAP2.12 appeared to be the most powerful activators. RAP2.12 was further dissected in transactivation assays in Arabidopsis protoplasts to identify responsible regions for transcriptional activation. An ultimate C-terminal motif was identified as sufficient to drive gene transcription. Finally, using realtime RT-PCR in single and double mutants for the corresponding genes, we confirmed that RAP2.2 and RAP2.12 exert major control upon the anaerobic response. PMID:26025519

  14. Assessment of anaerobic toluene biodegradation activity by bssA transcript/gene ratios.


    Brow, Christina N; O'Brien Johnson, Reid; Johnson, Richard L; Simon, Holly M


    Benzylsuccinate synthase (bssA) genes associated with toluene degradation were profiled across a groundwater contaminant plume under nitrate-reducing conditions and were detected in significant numbers throughout the plume. However, differences between groundwater and core sediment samples suggested that microbial transport, rather than local activity, was the underlying cause of the high copy numbers within the downgradient plume. Both gene transcript and reactant concentrations were consistent with this hypothesis. Expression of bssA genes from denitrifying toluene degraders was induced by toluene but only in the presence of nitrate, and transcript abundance dropped rapidly following the removal of either toluene or nitrate. The drop in bssA transcripts following the removal of toluene could be described by an exponential decay function with a half-life on the order of 1 h. Interestingly, bssA transcripts never disappeared completely but were always detected at some level if either inducer was present. Therefore, the detection of transcripts alone may not be sufficient evidence for contaminant degradation. To avoid mistakenly associating basal-level gene expression with actively degrading microbial populations, an integrated approach using the ratio of functional gene transcripts to gene copies is recommended. This approach minimizes the impact of microbial transport on activity assessment and allows reliable assessments of microbial activity to be obtained from water samples. PMID:23811506

  15. Transcriptional activation by the thyroid hormone receptor through ligand-dependent receptor recruitment and chromatin remodelling.


    Grøntved, Lars; Waterfall, Joshua J; Kim, Dong Wook; Baek, Songjoon; Sung, Myong-Hee; Zhao, Li; Park, Jeong Won; Nielsen, Ronni; Walker, Robert L; Zhu, Yuelin J; Meltzer, Paul S; Hager, Gordon L; Cheng, Sheue-yann


    A bimodal switch model is widely used to describe transcriptional regulation by the thyroid hormone receptor (TR). In this model, the unliganded TR forms stable, chromatin-bound complexes with transcriptional co-repressors to repress transcription. Binding of hormone dissociates co-repressors and facilitates recruitment of co-activators to activate transcription. Here we show that in addition to hormone-independent TR occupancy, ChIP-seq against endogenous TR in mouse liver tissue demonstrates considerable hormone-induced TR recruitment to chromatin associated with chromatin remodelling and activated gene transcription. Genome-wide footprinting analysis using DNase-seq provides little evidence for TR footprints both in the absence and presence of hormone, suggesting that unliganded TR engagement with repressive complexes on chromatin is, similar to activating receptor complexes, a highly dynamic process. This dynamic and ligand-dependent interaction with chromatin is likely shared by all steroid hormone receptors regardless of their capacity to repress transcription in the absence of ligand. PMID:25916672

  16. A transcriptionally active form of GAL4 is phosphorylated and associated with GAL80.

    PubMed Central

    Parthun, M R; Jaehning, J A


    The GAL4 activator and GAL80 repressor proteins regulate the expression of yeast genes in response to galactose. A complex of the two proteins isolated from glucose-grown cells is inactive in an in vitro transcription reaction but binds DNA and blocks activation by the GAL4-VP16 chimeric activator. The complex purified from galactose-grown cells contains a mixture of phosphorylated and unphosphorylated forms of GAL4. The galactose-induced form of GAL4 activates in vitro transcription to levels similar to those seen with GAL4-VP16. The induced GAL4 complex is indistinguishable in size and apparent shape from the uninduced complex, consistent with a continued association with GAL80. These results confirm in vivo analyses that correlate GAL4 phosphorylation with galactose induction and support a model of transcriptional activation that does not require GAL80 dissociation. Images PMID:1406674

  17. A Powerful CRISPR/Cas9-Based Method for Targeted Transcriptional Activation.


    Katayama, Shota; Moriguchi, Tetsuo; Ohtsu, Naoki; Kondo, Toru


    Targeted transcriptional activation of endogenous genes is important for understanding physiological transcriptional networks, synthesizing genetic circuits, and inducing cellular phenotype changes. The CRISPR/Cas9 system has great potential to achieve this purpose, however, it has not yet been successfully used to efficiently activate endogenous genes and induce changes in cellular phenotype. A powerful method for transcriptional activation by using CRISPR/Cas9 was developed. Replacement of a methylated promoter with an unmethylated one by CRISPR/Cas9 was sufficient to activate the expression of the neural cell gene OLIG2 and the embryonic stem cell gene NANOG in HEK293T cells. Moreover, CRISPR/Cas9-based OLIG2 activation induced the embryonic carcinoma cell line NTERA-2 to express the neuronal marker βIII-tubulin. PMID:27079176

  18. Transcriptional activation and repression by cellular DNA-binding protein C/EBP.

    PubMed Central

    Pei, D Q; Shih, C H


    A putative transcription factor, C/EBP, isolated from rat liver nuclei, has been shown to bind to at least two different sequence motifs: the CCAAT promoter domain and a core sequence [GTGG(T/A)(T/A)(T/A)G] common to many viral enhancers, including simian virus 40 and human hepatitis B virus. It has been proposed that C/EBP might function as a positive transcription factor by facilitating the communication between promoter and enhancer elements through its dual binding activities to DNA. Surprisingly, results from three different approaches suggest that C/EBP functions as a transcriptional repressor to hepatitis B virus and simian virus 40. Further investigation indicated that C/EBP can function as both a transcriptional activator and a repressor, depending on the reporter gene system. Images PMID:2157040

  19. LRE2, an active human L1 element, has low level transcriptional activity and extremely low reverse transcriptase activity

    SciTech Connect

    Holmes, S.E.; Dombroski, B.A.; Sassaman, D.M.


    Previously, we found a 2 kb insertion containing a rearranged L1 element plus a unique sequence component (USC) within exon 48 of the dystrophin gene of a patient with muscular dystrophy. We used the USC to clone the precursor of this insertion, the second known {open_quotes}active{close_quotes} human L1 element. The locus LRE2 (L1 Retrotransposable Element 2) has an allele derived from the patient which matches the insertion sequence exactly. LRE2 has a perfect 13-15 bp target site duplication, 2 open reading frames (ORFs), and an unusual 21 bp truncation of the 5{prime} end in a region known to be important for L1 transcription. The truncated LRE2 promoter has about 20% of the transcriptional activity of a previously studied L1 promoter after transfection into NTera2D1 cells of a construct in which the L1 promoter drives the expression of a lacZ gene. In addition, the reverse transcriptase (RT) encoded by LRE2 is active in an in vivo pseudogene assay in yeast and an in vitro assay. However, in both assays the RT of LRE2 is 1-5% as active as that of LRE1. These data demonstrate that multiple {open_quotes}active{close_quotes} L1 elements exist in the human genome, and that active elements can have highly variable rates of transcription and reverse transcriptase activity. That the RT of LRE2 has extremely low activity suggests the possibility that retrotransposition of an L1 element may in some cases involve an RT encoded by another L1 element.

  20. MiR-125a TNF receptor-associated factor 6 to inhibit osteoclastogenesis

    SciTech Connect

    Guo, Li-Juan; Liao, Lan; Yang, Li; Li, Yu; Jiang, Tie-Jian


    MicroRNAs (miRNAs) play important roles in osteoclastogenesis and bone resorption. In the present study, we found that miR-125a was dramatically down-regulated during macrophage colony stimulating factor (M-CSF) and receptor activator of nuclear factor-κB ligand (RANKL) induced osteoclastogenesis of circulating CD14+ peripheral blood mononuclear cells (PBMCs). Overexpression of miR-125a in CD14+ PBMCs inhibited osteoclastogenesis, while inhibition of miR-125a promoted osteoclastogenesis. TNF receptor-associated factor 6 (TRAF6), a transduction factor for RANKL/RANK/NFATc1 signal, was confirmed to be a target of miR-125a. EMSA and ChIP assays confirmed that NFATc1 bound to the promoter of the miR-125a. Overexpression of NFATc1 inhibited miR-125a transcription, and block of NFATc1 expression attenuated RANKL-regulated miR-125a transcription. Here, we reported that miR-125a played a biological function in osteoclastogenesis through a novel TRAF6/ NFATc1/miR-125a regulatory feedback loop. It suggests that regulation of miR-125a expression may be a potential strategy for ameliorating metabolic disease. - Highlights: • MiR-125a was significantly down-regulated in osteoclastogenesis of CD14+ PBMCs. • MiR-125a inhibited osteoclast differentiation by targeting TRAF6. • NFATc1 inhibited miR-125a transciption by binding to the promoter of miR-125a. • TRAF6/NFATc1 and miR-125a form a regulatory feedback loop in osteoclastogenesis.

  1. DREAM Controls the On/Off Switch of Specific Activity-Dependent Transcription Pathways

    PubMed Central

    Mellström, Britt; Sahún, Ignasi; Ruiz-Nuño, Ana; Murtra, Patricia; Gomez-Villafuertes, Rosa; Savignac, Magali; Oliveros, Juan C.; Gonzalez, Paz; Kastanauskaite, Asta; Knafo, Shira; Zhuo, Min; Higuera-Matas, Alejandro; Errington, Michael L.; Maldonado, Rafael; DeFelipe, Javier; Jefferys, John G. R.; Bliss, Tim V. P.; Dierssen, Mara


    Changes in nuclear Ca2+ homeostasis activate specific gene expression programs and are central to the acquisition and storage of information in the brain. DREAM (downstream regulatory element antagonist modulator), also known as calsenilin/KChIP-3 (K+ channel interacting protein 3), is a Ca2+-binding protein that binds DNA and represses transcription in a Ca2+-dependent manner. To study the function of DREAM in the brain, we used transgenic mice expressing a Ca2+-insensitive/CREB-independent dominant active mutant DREAM (daDREAM). Using genome-wide analysis, we show that DREAM regulates the expression of specific activity-dependent transcription factors in the hippocampus, including Npas4, Nr4a1, Mef2c, JunB, and c-Fos. Furthermore, DREAM regulates its own expression, establishing an autoinhibitory feedback loop to terminate activity-dependent transcription. Ablation of DREAM does not modify activity-dependent transcription because of gene compensation by the other KChIP family members. The expression of daDREAM in the forebrain resulted in a complex phenotype characterized by loss of recurrent inhibition and enhanced long-term potentiation (LTP) in the dentate gyrus and impaired learning and memory. Our results indicate that DREAM is a major master switch transcription factor that regulates the on/off status of specific activity-dependent gene expression programs that control synaptic plasticity, learning, and memory. PMID:24366545

  2. Protein kinase A activation enhances β-catenin transcriptional activity through nuclear localization to PML bodies.


    Zhang, Mei; Mahoney, Emilia; Zuo, Tao; Manchanda, Parmeet K; Davuluri, Ramana V; Kirschner, Lawrence S


    The Protein Kinase A (PKA) and Wnt signaling cascades are fundamental pathways involved in cellular development and maintenance. In the osteoblast lineage, these pathways have been demonstrated functionally to be essential for the production of mineralized bone. Evidence for PKA-Wnt crosstalk has been reported both during tumorigenesis and during organogenesis, and the nature of the interaction is thought to rely on tissue and cell context. In this manuscript, we analyzed bone tumors arising from mice with activated PKA caused by mutation of the PKA regulatory subunit Prkar1a. In primary cells from these tumors, we observed relocalization of β-catenin to intranuclear punctuate structures, which were identified as PML bodies. Cellular redistribution of β-catenin could be recapitulated by pharmacologic activation of PKA. Using 3T3-E1 pre-osteoblasts as a model system, we found that PKA phosphorylation sites on β-catenin were required for nuclear re-localization. Further, β-catenin's transport to the nucleus was accompanied by an increase in canonical Wnt-dependent transcription, which also required the PKA sites. PKA-Wnt crosstalk in the cells was bi-directional, including enhanced interactions between β-catenin and the cAMP-responsive element binding protein (CREB) and transcriptional crosstalk between the Wnt and PKA signaling pathways. Increases in canonical Wnt/β-catenin signaling were associated with a decrease in the activity of the non-canonical Wnt/Ror2 pathway, which has been shown to antagonize canonical Wnt signaling. Taken together, this study provides a new understanding of the complex regulation of the subcellular distribution of β-catenin and its differential protein-protein interaction that can be modulated by PKA signaling. PMID:25299576

  3. IL-1 beta-dependent regulation of C/EBP delta transcriptional activity.


    Svotelis, Amy; Doyon, Geneviève; Bernatchez, Gérald; Désilets, Antoine; Rivard, Nathalie; Asselin, Claude


    We have previously shown that the transcription factor C/EBP delta is involved in the intestinal inflammatory response. C/EBP delta regulates several inflammatory response genes, such as haptoglobin, in the rat intestinal epithelial cell line IEC-6 in response to IL-1. However, the different C/EBP delta domains involved in IL-1 beta-mediated transcriptional activation and the kinases implicated have not been properly defined. To address this, we determined the role of the p38 MAP kinase in the regulation of C/EBP delta transcriptional activity. The IL-1-dependent induction of the acute phase protein gene haptoglobin in IEC-6 cells was decreased in response to the p38 MAP kinase inhibitor SB203580, as determined by Northern blot. Transcriptional activity of C/EBP delta was repressed by the specific inhibitor of the p38 MAP kinase, as assessed by transient transfection assays. Mutagenesis studies and transient transfection assays revealed an important domain for transcriptional activation between amino acids 70 and 108. This domain overlapped with a docking site for the p38 MAP kinase, between amino acids 75 and 85, necessary to insure C/EBP delta phosphorylation. Deletion of this domain led to a decrease in basal transcriptional activity of C/EBP delta and in p300-dependent transactivation, as assessed by transient transfection assays, and in IL-1-dependent haptoglobin induction. This unusual arrangement of a kinase docking site within a transactivation domain may functionally be important for the regulation of C/EBP delta transcriptional activity. PMID:15694370

  4. A critical role for alternative polyadenylation factor CPSF6 in targeting HIV-1 integration to transcriptionally active chromatin.


    Sowd, Gregory A; Serrao, Erik; Wang, Hao; Wang, Weifeng; Fadel, Hind J; Poeschla, Eric M; Engelman, Alan N


    Integration is vital to retroviral replication and influences the establishment of the latent HIV reservoir. HIV-1 integration favors active genes, which is in part determined by the interaction between integrase and lens epithelium-derived growth factor (LEDGF)/p75. Because gene targeting remains significantly enriched, relative to random in LEDGF/p75 deficient cells, other host factors likely contribute to gene-tropic integration. Nucleoporins 153 and 358, which bind HIV-1 capsid, play comparatively minor roles in integration targeting, but the influence of another capsid binding protein, cleavage and polyadenylation specificity factor 6 (CPSF6), has not been reported. In this study we knocked down or knocked out CPSF6 in parallel or in tandem with LEDGF/p75. CPSF6 knockout changed viral infectivity kinetics, decreased proviral formation, and preferentially decreased integration into transcriptionally active genes, spliced genes, and regions of chromatin enriched in genes and activating histone modifications. LEDGF/p75 depletion by contrast preferentially altered positional integration targeting within gene bodies. Dual factor knockout reduced integration into genes to below the levels observed with either single knockout and revealed that CPSF6 played a more dominant role than LEDGF/p75 in directing integration to euchromatin. CPSF6 complementation rescued HIV-1 integration site distribution in CPSF6 knockout cells, but complementation with a capsid binding mutant of CPSF6 did not. We conclude that integration targeting proceeds via two distinct mechanisms: capsid-CPSF6 binding directs HIV-1 to actively transcribed euchromatin, where the integrase-LEDGF/p75 interaction drives integration into gene bodies. PMID:26858452

  5. Selective activation of the transcription factor ATF6 mediates endoplasmic reticulum proliferation triggered by a membrane protein.


    Maiuolo, Jessica; Bulotta, Stefania; Verderio, Claudia; Benfante, Roberta; Borgese, Nica


    It is well known that the endoplasmic reticulum (ER) is capable of expanding its surface area in response both to cargo load and to increased expression of resident membrane proteins. Although the response to increased cargo load, known as the unfolded protein response (UPR), is well characterized, the mechanism of the response to membrane protein load has been unclear. As a model system to investigate this phenomenon, we have used a HeLa-TetOff cell line inducibly expressing a tail-anchored construct consisting of an N-terminal cytosolic GFP moiety anchored to the ER membrane by the tail of cytochrome b5 [GFP-b(5)tail]. After removal of doxycycline, GFP-b(5)tail is expressed at moderate levels (1-2% of total ER protein) that, nevertheless, induce ER proliferation, as assessed both by EM and by a three- to fourfold increase in phosphatidylcholine synthesis. We investigated possible participation of each of the three arms of the UPR and found that only the activating transcription factor 6 (ATF6) arm was selectively activated after induction of GFP-b(5)tail expression; peak ATF6α activation preceded the increase in phosphatidylcholine synthesis. Surprisingly, up-regulation of known ATF6 target genes was not observed under these conditions. Silencing of ATF6α abolished the ER proliferation response, whereas knockdown of Ire1 was without effect. Because GFP-b(5)tail lacks a luminal domain, the response we observe is unlikely to originate from the ER lumen. Instead, we propose that a sensing mechanism operates within the lipid bilayer to trigger the selective activation of ATF6. PMID:21521793

  6. Redefining the transcriptional regulatory dynamics of classically and alternatively activated macrophages by deepCAGE transcriptomics

    PubMed Central

    Roy, Sugata; Schmeier, Sebastian; Arner, Erik; Alam, Tanvir; Parihar, Suraj P.; Ozturk, Mumin; Tamgue, Ousman; Kawaji, Hideya; de Hoon, Michiel J. L.; Itoh, Masayoshi; Lassmann, Timo; Carninci, Piero; Hayashizaki, Yoshihide; Forrest, Alistair R. R.; Bajic, Vladimir B.; Guler, Reto; Consortium, FANTOM; Brombacher, Frank; Suzuki, Harukazu


    Classically or alternatively activated macrophages (M1 and M2, respectively) play distinct and important roles for microbiocidal activity, regulation of inflammation and tissue homeostasis. Despite this, their transcriptional regulatory dynamics are poorly understood. Using promoter-level expression profiling by non-biased deepCAGE we have studied the transcriptional dynamics of classically and alternatively activated macrophages. Transcription factor (TF) binding motif activity analysis revealed four motifs, NFKB1_REL_RELA, IRF1,2, IRF7 and TBP that are commonly activated but have distinct activity dynamics in M1 and M2 activation. We observe matching changes in the expression profiles of the corresponding TFs and show that only a restricted set of TFs change expression. There is an overall drastic and transient up-regulation in M1 and a weaker and more sustainable up-regulation in M2. Novel TFs, such as Thap6, Maff, (M1) and Hivep1, Nfil3, Prdm1, (M2) among others, were suggested to be involved in the activation processes. Additionally, 52 (M1) and 67 (M2) novel differentially expressed genes and, for the first time, several differentially expressed long non-coding RNA (lncRNA) transcriptome markers were identified. In conclusion, the finding of novel motifs, TFs and protein-coding and lncRNA genes is an important step forward to fully understand the transcriptional machinery of macrophage activation. PMID:26117544

  7. Genetic Evidence for Transcriptional Activation by the Yeast Ime1 Gene Product

    PubMed Central

    Smith, H. E.; Driscoll, S. E.; Sia, RAL.; Yuan, H. E.; Mitchell, A. P.


    IME1 is required in yeast for meiosis and for expression of IME2 and other early meiotic genes. IME1 is a 360-amino acid polypeptide with central and C-terminal tyrosine-rich regions. We report here that a fusion protein composed of the lexA DNA-binding domain and IME1 activates transcription in vivo of a reporter gene containing upstream lexA binding sites. Activation by the fusion protein shares several features with natural IME1 activity: both are dependent on the RIM11 gene product; both are impaired by the same ime1 missense mutations; both are restored by intragenic suppressors. The central tyrosine-rich region is sufficient to activate transcription when fused to lexA. Deletion of this putative activation domain results in a defective IME1 derivative. Function of the deletion derivative is restored by fusion to the acidic Herpesvirus VP16 activation domain. The C-terminal tyrosine-rich region is dispensable for transcriptional activation; rather it renders activation dependent upon starvation and RIM11. Immunofluorescence studies indicate that an IME1-lacZ fusion protein is concentrated in the nucleus. These observations are consistent with a model in which IME1 normally stimulates IME2 expression by providing a transcriptional activation domain at the IME2 5' regulatory region. PMID:8462841

  8. Transcriptional Activity of rRNA Genes in Barley Cells after Mutagenic Treatment.


    Kwasniewska, Jolanta; Jaskowiak, Joanna


    In the present study, the combination of the micronucleus test with analysis of the activity of the rRNA genes in mutagen-treated Hordeum vulgare (barley) by maleic hydrazide (MH) cells was performed. Simultaneously fluorescence in situ hybridization (FISH) with 25S rDNA as probes and an analysis of the transcriptional activity of 35S rRNA genes with silver staining were performed. The results showed that transcriptional activity is always maintained in the micronuclei although they are eliminated during the next cell cycle. The analysis of the transcriptional activity was extended to barley nuclei. MH influenced the fusion of the nucleoli in barley nuclei. The silver staining enabled detection of the nuclear bodies which arose after MH treatment. The results confirmed the usefulness of cytogenetic techniques in the characterization of micronuclei. Similar analyses can be now extended to other abiotic stresses to study the response of plant cells to the environment. PMID:27257817

  9. Cdk1 activity acts as a quantitative platform for coordinating cell cycle progression with periodic transcription

    PubMed Central

    Banyai, Gabor; Baïdi, Feriel; Coudreuse, Damien; Szilagyi, Zsolt


    Cell proliferation is regulated by cyclin-dependent kinases (Cdks) and requires the periodic expression of particular gene clusters in different cell cycle phases. However, the interplay between the networks that generate these transcriptional oscillations and the core cell cycle machinery remains largely unexplored. In this work, we use a synthetic regulable Cdk1 module to demonstrate that periodic expression is governed by quantitative changes in Cdk1 activity, with different clusters directly responding to specific activity levels. We further establish that cell cycle events neither participate in nor interfere with the Cdk1-driven transcriptional program, provided that cells are exposed to the appropriate Cdk1 activities. These findings contrast with current models that propose self-sustained and Cdk1-independent transcriptional oscillations. Our work therefore supports a model in which Cdk1 activity serves as a quantitative platform for coordinating cell cycle transitions with the expression of critical genes to bring about proper cell cycle progression. PMID:27045731

  10. Transcriptional Activity of rRNA Genes in Barley Cells after Mutagenic Treatment

    PubMed Central


    In the present study, the combination of the micronucleus test with analysis of the activity of the rRNA genes in mutagen-treated Hordeum vulgare (barley) by maleic hydrazide (MH) cells was performed. Simultaneously fluorescence in situ hybridization (FISH) with 25S rDNA as probes and an analysis of the transcriptional activity of 35S rRNA genes with silver staining were performed. The results showed that transcriptional activity is always maintained in the micronuclei although they are eliminated during the next cell cycle. The analysis of the transcriptional activity was extended to barley nuclei. MH influenced the fusion of the nucleoli in barley nuclei. The silver staining enabled detection of the nuclear bodies which arose after MH treatment. The results confirmed the usefulness of cytogenetic techniques in the characterization of micronuclei. Similar analyses can be now extended to other abiotic stresses to study the response of plant cells to the environment. PMID:27257817

  11. An Activator of Transcription Regulates Phage TP901-1 Late Gene Expression

    PubMed Central

    Brøndsted, Lone; Pedersen, Margit; Hammer, Karin


    A promoter active in the late phase of the lytic cycle of lactococcal bacteriophage TP901-1 has been identified. The promoter is tightly regulated and requires the product of the phage TP901-1 orf29 for activity. A deletion analysis of the late promoter region showed that a fragment as small as 99 bp contains both the promoter and the region necessary for activation by ORF29. The transcriptional start site of the promoter was identified by primer extension to position 13073 on the TP901-1 genome, thus located 87 bp downstream of orf29 in a 580-bp intergenic region between orf29 and orf30. Furthermore, the region located −85 to −61 bp upstream of the start site was shown to be necessary for promoter activity. During infection, the transcript arising from the late promoter is fully induced at 40 min postinfection, and our results suggest that a certain level of ORF29 must be reached in order to activate transcription of the promoter. Several lactococcal bacteriophages encode ORF29 homologous proteins, indicating that late transcription may be controlled by a similar mechanism in these phages. With the identification of this novel regulator, our results suggest that within the P335 group of lactococcal phages at least two regulatory systems controlling transcription in the late stage of infection exist. PMID:11722916

  12. Involvement of NADPH oxidases in suppression of cyclooxygenase-2 promoter-dependent transcriptional activities by sesamol

    PubMed Central

    Shimizu, Satomi; Ishigamori, Rikako; Fujii, Gen; Takahashi, Mami; Onuma, Wakana; Terasaki, Masaru; Yano, Tomohiro; Mutoh, Michihiro


    Cyclooxygenase-2 (COX-2) has been shown to play an important role in colon carcinogenesis. Moreover, one of the components of reduced nicotinamide adenine dinucleotide phosphate (NADPH) oxidase, NADPH oxidase 1 (NOX1), dominantly expressed in the colon, is implicated in the pathogenesis of colon cancer. We have reported that sesamol, one of the lignans in sesame seeds, suppressed COX-2 gene transcriptional activity in human colon cancer cells, and also suppressed intestinal polyp formation in Apc-mutant mice. In the present study, we investigated the involvement of NADPH oxidase in the inhibition of COX-2 transcriptional activity by sesamol. We found that several NADPH oxidase inhibitors, such as apocynin, showed suppressive effects on COX-2 transcriptional activity. Moreover, sesamol significantly suppressed NOX1 mRNA levels in a dose-dependent manner. In addition, we demonstrated that knockdown of NOX1 successfully suppressed COX-2 transcriptional activity. These results suggest that inhibition of NADPH oxidase, especially NOX1, may be involved in the mechanism of the suppression of COX-2 transcriptional activity by sesamol. PMID:25759517

  13. Rcs signalling-activated transcription of rcsA induces strong anti-sense transcription of upstream fliPQR flagellar genes from a weak intergenic promoter: regulatory roles for the anti-sense transcript in virulence and motility.


    Wang, Qingfeng; Harshey, Rasika M


    In Salmonella enterica, an activated Rcs signalling system inhibits initiation of transcription of the flhD master operon. Under these conditions, where motility is shut down, microarray experiments showed an increased RNA signal for three flagellar genes -fliPQR- located upstream of rcsA. We show here that it is the anti-sense (AS) strand of these genes that is transcribed, originating at a weak promoter in the intergenic region between fliR and rcsA. RcsA is an auxiliary regulator for the Rcs system, whose transcription is dependent on the response regulator RcsB. Rcs-activated rightward transcription, but not translation, of rcsA is required for stimulation of leftward AS transcription. Our results implicate a combined action of RcsB and rcsA transcription in activating the AS promoter, likely by modulating DNA superhelicity in the intergenic region. We show that the AS transcript regulates many genes in the Rcs regulon, including SPI-1 and SPI-2 virulence and stress-response genes. In the wild-type strain the AS transcript is present in low amounts, independent of Rcs signalling. Here, AS transcription modulates complementary sense RNA levels and impacts swarming motility. It appears that the flagellar AS transcript has been co-opted by the Rcs system to regulate virulence. PMID:19703110

  14. Rcs signaling-activated transcription of rcsA induces strong anti-sense transcription of upstream fliPQR flagellar genes from a weak intergenic promoter: regulatory roles for the anti-sense transcript in virulence and motility

    PubMed Central

    Wang, Qingfeng; Harshey, Rasika M.


    Summary In Salmonella enterica, an activated Rcs signaling system inhibits initiation of transcription of the flhD master operon. Under these conditions, where motility is shut down, microarray experiments showed an increased RNA signal for three flagellar genes - fliPQR - located upstream of rcsA. We show here that it is the anti-sense (AS) strand of these genes that is transcribed, originating at a weak promoter in the intergenic region between fliR and rcsA. RcsA is an auxiliary regulator for the Rcs system, whose transcription is dependent on the response regulator RcsB. Rcs-activated rightward transcription, but not translation, of rcsA is required for stimulation of leftward AS transcription. Our results implicate a combined action of RcsB and rcsA transcription in activating the AS promoter, likely by modulating DNA superhelicity in the intergenic region. We show that the AS transcript regulates many genes in the Rcs regulon, including SPI-1 and SPI-2 virulence and stress-response genes. In the wild-type strain the AS transcript is present in low amounts, independent of Rcs signaling. Here, AS transcription modulates complementary sense RNA levels and impacts swarming motility. It appears that the flagellar AS transcript has been co-opted by the Rcs system to regulate virulence. PMID:19703110

  15. Bortezomib attenuates HIF-1- but not HIF-2-mediated transcriptional activation

    PubMed Central



    Bortezomib is the first proteasomal inhibitor (PI) to be used therapeutically for treating relapse cases of multiple myeloma and mantle cell lymphoma. A proposed mechanism for its action is that it prevents the proteasomal degradation of proapoptotic proteins, leading to enhanced apoptosis. Although the α subunit of hypoxia-inducible factor (HIF)-1 is not degraded with bortezomib treatment, the heterodimeric HIF-1 fails to transactivate target genes. HIF-1 and HIF-2 are related hypoxia-inducible transcription factors that are important for the survival of hypoxic tumor cells. The majority of reports have focused on the effects of bortezomib on the transcriptional activities of HIF-1, but not HIF-2. The present study investigated the effects of bortezomib on HIF-2 activity in cancer cells with different levels of HIF-1α and HIF-2α subunits. HIF-α subunit levels were detected using specific antibodies, while HIF transcriptional activities were evaluated using immunodetection, reverse transcription-polymerase chain reaction and luciferase reporter assay. Bortezomib treatment was found to suppress the transcription and expression of CA9, a HIF-1-specific target gene; however, it had minimal effects on EPO and GLUT-1, which are target genes of both HIF-1 and HIF-2. These data suggest that bortezomib attenuates the transcriptional activity only of HIF-1, and not HIF-2. This novel finding on the lack of an inhibitory effect of bortezomib on HIF-2 transcriptional activity has implications for the improvement of design and treatment modalities of bortezomib and other PI drugs. PMID:26622817

  16. Specific induction of endogenous viral restriction factors using CRISPR/Cas-derived transcriptional activators

    PubMed Central

    Bogerd, Hal P.; Kornepati, Anand V. R.; Marshall, Joy B.; Kennedy, Edward M.; Cullen, Bryan R.


    Whereas several mammalian proteins can restrict the replication of HIV-1 and other viruses, these are often not expressed in relevant target cells. A potential method to inhibit viral replication might therefore be to use synthetic transcription factors to induce restriction factor expression. In particular, mutants of the RNA-guided DNA binding protein Cas9 that have lost their DNA cleavage activity could be used to recruit transcription activation domains to specific promoters. However, initial experiments revealed only weak activation unless multiple promoter-specific single guide RNAs (sgRNAs) were used. Recently, the recruitment of multiple transcription activation domains by a single sgRNA, modified to contain MS2-derived stem loops that recruit fusion proteins consisting of the MS2 coat protein linked to transcription activation domains, was reported to induce otherwise silent cellular genes. Here, we demonstrate that such “synergistic activation mediators” can induce the expression of two restriction factors, APOBEC3G (A3G) and APOBEC3B (A3B), in human cells that normally lack these proteins. We observed modest activation of endogenous A3G or A3B expression using single sgRNAs but high expression when two sgRNAs were used. Whereas the induced A3G and A3B proteins both blocked infection by an HIV-1 variant lacking a functional vif gene by inducing extensive dC-to-dU editing, only the induced A3B protein inhibited wild-type HIV-1. These data demonstrate that Cas9-derived transcriptional activators have the potential to be used for screens for endogenous genes that affect virus replication and raise the possibility that synthetic transcription factors might prove clinically useful if efficient delivery mechanisms could be developed. PMID:26668372

  17. Specific induction of endogenous viral restriction factors using CRISPR/Cas-derived transcriptional activators.


    Bogerd, Hal P; Kornepati, Anand V R; Marshall, Joy B; Kennedy, Edward M; Cullen, Bryan R


    Whereas several mammalian proteins can restrict the replication of HIV-1 and other viruses, these are often not expressed in relevant target cells. A potential method to inhibit viral replication might therefore be to use synthetic transcription factors to induce restriction factor expression. In particular, mutants of the RNA-guided DNA binding protein Cas9 that have lost their DNA cleavage activity could be used to recruit transcription activation domains to specific promoters. However, initial experiments revealed only weak activation unless multiple promoter-specific single guide RNAs (sgRNAs) were used. Recently, the recruitment of multiple transcription activation domains by a single sgRNA, modified to contain MS2-derived stem loops that recruit fusion proteins consisting of the MS2 coat protein linked to transcription activation domains, was reported to induce otherwise silent cellular genes. Here, we demonstrate that such "synergistic activation mediators" can induce the expression of two restriction factors, APOBEC3G (A3G) and APOBEC3B (A3B), in human cells that normally lack these proteins. We observed modest activation of endogenous A3G or A3B expression using single sgRNAs but high expression when two sgRNAs were used. Whereas the induced A3G and A3B proteins both blocked infection by an HIV-1 variant lacking a functional vif gene by inducing extensive dC-to-dU editing, only the induced A3B protein inhibited wild-type HIV-1. These data demonstrate that Cas9-derived transcriptional activators have the potential to be used for screens for endogenous genes that affect virus replication and raise the possibility that synthetic transcription factors might prove clinically useful if efficient delivery mechanisms could be developed. PMID:26668372

  18. Anti-hepatitis B virus effect of matrine-type alkaloid and involvement of p38 mitogen-activated protein kinase and tumor necrosis factor receptor-associated factor 6.


    Chen, Jia-Xin; Shen, Hong-Hui; Niu, Ming; Guo, Yu-Ming; Liu, Xiao-Qiong; Han, Yan-Zhong; Zhang, Ya-Ming; Zhao, Yan-Ling; Bai, Bing-Ke; Zhou, Wen-Jun; Xiao, Xiao-He


    The matrine-type alkaloid, oxymatrine inhibits hepatitis B virus (HBV) replication but very little is known about these effects in other matrine-type alkaloids, including sophoridine and sophocarpine. Therefore, we compared the in vitro anti-HBV effects of matrine, oxymatrine, sophocarpine, and sophoridine by treating an HBV-transfected cell line (HepG2.2.15) with 0.4-1.6mM of the compounds for 24 or 72h. The levels of the HBV surface antigen (HBsAg) and e antigen (HBeAg) in the culture medium, as well as the intracellular and extracellular HBV DNA levels, were determined. Metabolomic analysis and detection of the mRNA level of p38 mitogen-activated protein kinase (MAPK), tumor necrosis factor receptor-associated factor (TRAF) 6, extracellular signal-regulated kinase (ERK) 1, NOD-like receptor family pyrin domain containing 10 (NLRP10), and caspase-1 were conducted in sophoridine-treated HepG2.2.15 cells. HepG2.2.15 cell exposure to 0.4-1.6mM sophocarpine or sophoridine for 24h reduced the HBsAg level of the medium more effectively than exposure to matrine and oxymatrine did, and reduced the HBeAg levels more effectively than these compounds did at 1.6mM. Sophoridine (0.4-1.6mM) reduced the cell medium HBV DNA levels more than the same concentrations of matrine, oxymatrine, or sophocarpine did. After 72h, 0.4 and 0.8mM sophoridine reduced HBsAg and intracellular HBV DNA levels more potently than matrine, oxymatrine, or sophocarpine did. Furthermore, sophoridine (0.8mM) potently reduced the cell medium HBeAg levels while the metabolomic analyses revealed that HepG2.2.15 cells exposed to 0.8mM sophoridine for 72h exhibited reduced cycloleucine and phytosphingosine levels. In addition, the mRNA expression analyses revealed that HepG2.2.15 cells exposed to 0.8mM sophoridine showed reduced levels of p38 MAPK, TRAF6, ERK1, NLRP10, and caspase-1. Sophoridine produced more potent anti-HBV effects than matrine, oxymatrine, and sophocarpine did. These effects may be related

  19. Lansoprazole Upregulates Polyubiquitination of the TNF Receptor-Associated Factor 6 and Facilitates Runx2-mediated Osteoblastogenesis

    PubMed Central

    Mishima, Kenichi; Kitoh, Hiroshi; Ohkawara, Bisei; Okuno, Tatsuya; Ito, Mikako; Masuda, Akio; Ishiguro, Naoki; Ohno, Kinji


    The transcription factor, runt-related transcription factor 2 (Runx2), plays a pivotal role in the differentiation of the mesenchymal stem cells to the osteochondroblast lineages. We found by the drug repositioning strategy that a proton pump inhibitor, lansoprazole, enhances nuclear accumulation of Runx2 and induces osteoblastogenesis of human mesenchymal stromal cells. Systemic administration of lansoprazole to a rat femoral fracture model increased osteoblastogenesis. Dissection of signaling pathways revealed that lansoprazole activates a noncanonical bone morphogenic protein (BMP)-transforming growth factor-beta (TGF-β) activated kinase-1 (TAK1)–p38 mitogen-activated protein kinase (MAPK) pathway. We found by in cellulo ubiquitination studies that lansoprazole enhances polyubiquitination of the TNF receptor-associated factor 6 (TRAF6) and by in vitro ubiquitination studies that the enhanced polyubiquitination of TRAF6 is attributed to the blocking of a deubiquitination enzyme, cylindromatosis (CYLD). Structural modeling and site-directed mutagenesis of CYLD demonstrated that lansoprazole tightly fits in a pocket of CYLD where the C-terminal tail of ubiquitin lies. Lansoprazole is a potential therapeutic agent for enhancing osteoblastic differentiation. PMID:26844285

  20. Transcription of the tRNA-tufB operon of Escherichia coli: activation, termination and antitermination.

    PubMed Central

    van Delft, J H; Mariñon, B; Schmidt, D S; Bosch, L


    Signals setting the level of transcription of the tRNA-tufB operon have been studied by deletion mapping. TufB transcription was measured in vivo with plasmid-borne tRNA-tufB:galk operon fusions. Removal of the sequences from -133 to -58 with respect to the transcription start point, results in a 90% decrease of tufB transcription. This demonstrates the presence of a region, upstream of the tRNA-tufB promoter, that enhances the expression of the operon. DNA fragments bearing this upstream activator region do not display an abnormal electrophoretic mobility, as has been observed for the rrnB P1 upstream activator. Deletions starting in the first tRNA gene and directing towards tufB reveal at least two sites that influence tufB transcription. One signals transcription termination in the intergenic region between thrT and tufB. The other may be involved in antitermination. Possible mechanisms underlying antitermination and termination are considered in the light of the nucleotide sequence. Images PMID:3317280

  1. Regulation of the yeast metabolic cycle by transcription factors with periodic activities

    PubMed Central


    Background When growing budding yeast under continuous, nutrient-limited conditions, over half of yeast genes exhibit periodic expression patterns. Periodicity can also be observed in respiration, in the timing of cell division, as well as in various metabolite levels. Knowing the transcription factors involved in the yeast metabolic cycle is helpful for determining the cascade of regulatory events that cause these patterns. Results Transcription factor activities were estimated by linear regression using time series and genome-wide transcription factor binding data. Time-translation matrices were estimated using least squares and were used to model the interactions between the most significant transcription factors. The top transcription factors have functions involving respiration, cell cycle events, amino acid metabolism and glycolysis. Key regulators of transitions between phases of the yeast metabolic cycle appear to be Hap1, Hap4, Gcn4, Msn4, Swi6 and Adr1. Conclusions Analysis of the phases at which transcription factor activities peak supports previous findings suggesting that the various cellular functions occur during specific phases of the yeast metabolic cycle. PMID:21992532

  2. Transcriptional cross-activation between toxin-antitoxin systems of Escherichia coli

    PubMed Central


    Background Bacterial toxin-antitoxin (TA) systems are formed by potent regulatory or suicide factors (toxins) and their short-lived inhibitors (antitoxins). Antitoxins are DNA-binding proteins and auto-repress transcription of TA operons. Transcription of multiple TA operons is activated in temporarily non-growing persister cells that can resist killing by antibiotics. Consequently, the antitoxin levels of persisters must have been dropped and toxins are released of inhibition. Results Here, we describe transcriptional cross-activation between different TA systems of Escherichia coli. We find that the chromosomal relBEF operon is activated in response to production of the toxins MazF, MqsR, HicA, and HipA. Expression of the RelE toxin in turn induces transcription of several TA operons. We show that induction of mazEF during amino acid starvation depends on relBE and does not occur in a relBEF deletion mutant. Induction of TA operons has been previously shown to depend on Lon protease which is activated by polyphospate accumulation. We show that transcriptional cross-activation occurs also in strains deficient for Lon, ClpP, and HslV proteases and polyphosphate kinase. Furthermore, we find that toxins cleave the TA mRNA in vivo, which is followed by degradation of the antitoxin-encoding fragments and selective accumulation of the toxin-encoding regions. We show that these accumulating fragments can be translated to produce more toxin. Conclusion Transcriptional activation followed by cleavage of the mRNA and disproportionate production of the toxin constitutes a possible positive feedback loop, which can fire other TA systems and cause bistable growth heterogeneity. Cross-interacting TA systems have a potential to form a complex network of mutually activating regulators in bacteria. PMID:23432955

  3. Transcriptional and Post-transcriptional Modulation of SQU and KEW Activities in the Control of Dorsal-Ventral Asymmetric Flower Development in Lotus japonicus.


    Xu, Zhiyong; Cheng, Kai; Li, Xin; Yang, Jun; Xu, Shilei; Cao, Xiangling; Hu, Xiaohe; Xie, Wei; Yuan, Ling; Ambrose, Mike; Chen, Genyun; Mi, Hualing; Luo, Da


    In Papilionoideae legume, Lotus japonicus, the development of dorsal-ventral (DV) asymmetric flowers is mainly controlled by two TB1/CYCLOIDEA/PCF (TCP) genes, SQUARED STANDARD (SQU) and KEELED WINGS IN LOTUS (KEW), which determine dorsal and lateral identities, respectively. However, the molecular basis of how these two highly homologous genes orchestrate their diverse functions remains unclear. Here, we analyzed their expression levels, and investigated the transcriptional activities of SQU and KEW. We demonstrated that SQU possesses both activation and repression activities, while KEW acts only as an activator. They form homo- and heterodimers, and then collaboratively regulate their expression at the transcription level. Furthermore, we identified two types of post-transcriptional modifications, phosphorylation and ATP/GTP binding, both of which could affect their transcriptional activities. Mutations in ATP/GTP binding motifs of SQU and KEW lead to failure of phosphorylation, and transgenic plants bearing the mutant proteins display defective DV asymmetric flower development, indicating that the two conjugate modifications are essential for their diverse functions. Altogether, SQU and KEW activities are precisely modulated at both transcription and post-transcription levels, which might link DV asymmetric flower development to different physiological status and/or signaling pathways. PMID:26854849

  4. Mutations that alter the ability of the Escherichia coli cyclic AMP receptor protein to activate transcription.


    Bell, A; Gaston, K; Williams, R; Chapman, K; Kolb, A; Buc, H; Minchin, S; Williams, J; Busby, S


    The effects of a number of mutations in the E. coli cyclic AMP receptor protein (CRP) have been determined by monitoring the in vivo expression and in vitro open complex formation at two semi-synthetic promoters that are totally CRP-dependent. At one promoter the CRP-binding site is centered around 41.5 base pairs upstream from the transcription start whilst at the other promoter it is 61.5 base pairs upstream. The CRP mutation E171K reduces expression from both promoters whilst H159L renders CRP totally inactive: neither mutation stops CRP binding at either promoter. The mutations K52N and K52Q reverse the effect of H159L and 'reeducate' CRP to activate transcription. CRP carrying both H159L and K52N activates transcription from the promoter with the CRP site at -41.5 better than wild type CRP. In sharp contrast, this doubly changed CRP is totally inactive with respect to the activation of transcription from the promoter carrying the CRP site at -61.5. Our results suggest that CRP can use different contacts and/or conformations during transcription activation at promoters with different architectures. PMID:2259621

  5. Transcriptional activation of jun and actin genes by estrogen during mitogenic stimulation of rat uterine cells.


    Cicatiello, L; Ambrosino, C; Coletta, B; Scalona, M; Sica, V; Bresciani, F; Weisz, A


    Estrogens induce transcriptional activation of c-fos and c-myc proto-oncogenes during mitogenic stimulation of human, chicken, mouse and rat cells in vivo and in vitro. In this paper we show that 17 beta-estradiol injected into adult ovariectomized rats increases c-jun, jun-B and jun-D gene transcription in the uterus. Kinetics and amplitude of response are different for each gene, since c-jun is activated first, within 30 min after injection, followed by jun-D and jun-B, 60 and 90 min after injection, respectively. Maximal activation of jun-B marks a drop in transcription of all the jun genes. Furthermore, transcriptional activation by 17 beta-estradiol of the growth-regulated beta- and gamma-cytoskeletal actin genes is prevented by an inhibitor of protein synthesis, indicating that it is a secondary response to the hormone. These data support the hypothesis that during growth stimulation of target cells the estrogen receptor induces transcription of regulatory genes, triggering in this way a cascade of gene regulation events that results in progression through the cell cycle. PMID:1373300

  6. Mutations that alter the ability of the Escherichia coli cyclic AMP receptor protein to activate transcription.

    PubMed Central

    Bell, A; Gaston, K; Williams, R; Chapman, K; Kolb, A; Buc, H; Minchin, S; Williams, J; Busby, S


    The effects of a number of mutations in the E. coli cyclic AMP receptor protein (CRP) have been determined by monitoring the in vivo expression and in vitro open complex formation at two semi-synthetic promoters that are totally CRP-dependent. At one promoter the CRP-binding site is centered around 41.5 base pairs upstream from the transcription start whilst at the other promoter it is 61.5 base pairs upstream. The CRP mutation E171K reduces expression from both promoters whilst H159L renders CRP totally inactive: neither mutation stops CRP binding at either promoter. The mutations K52N and K52Q reverse the effect of H159L and 'reeducate' CRP to activate transcription. CRP carrying both H159L and K52N activates transcription from the promoter with the CRP site at -41.5 better than wild type CRP. In sharp contrast, this doubly changed CRP is totally inactive with respect to the activation of transcription from the promoter carrying the CRP site at -61.5. Our results suggest that CRP can use different contacts and/or conformations during transcription activation at promoters with different architectures. Images PMID:2259621

  7. Elk3 from hamster--a ternary complex factor with strong transcriptional repressor activity.


    Hjortoe, Gertrud Malene; Weilguny, Dietmar; Willumsen, Berthe Marie


    Elk3 belongs to the Ets family of transcription factors, which are regulated by the Ras/mitogen-activated protein kinase-signaling pathway. In the absence of Ras, this protein is a strong inhibitor of transcription and may be directly involved in regulation of growth by downregulating the transcription of genes that are activated during entry into G1. We have isolated the Cricetulus griseus Elk3 gene from the Chinese hamster ovary (CHO) cell line and investigated the transcriptional potential of this factor. Transient transfections revealed that, in addition to its regulation of the c-fos promoter, Elk3 from CHO cells seems to inhibit other promoters controlling expression of proteins involved in G1/S phase progression; Cyclin D1 and DHFR. As has been described for the Elk3 homologs Net (Mouse) and Sap-2 (Human), the results of the present study further indicate that hamster Elk3 is a target of the Ras-Raf-MAPK pathway, and cotransfections with constitutively active H-ras relieves its negative transcriptional activity. No cells stably expressing exogenous Elk3 could be obtained, possibly due to an unspecified toxic or growth retarding effect. These findings support a possible role for Elk3 in growth regulation and reveal a high degree of homology for this protein across species. PMID:15684718

  8. Neuronal activity-regulated gene transcription: how are distant synaptic signals conveyed to the nucleus?

    PubMed Central

    Matamales, Miriam


    Synaptic activity can trigger gene expression programs that are required for the stable change of neuronal properties, a process that is essential for learning and memory. Currently, it is still unclear how the stimulation of dendritic synapses can be coupled to transcription in the nucleus in a timely way given that large distances can separate these two cellular compartments. Although several mechanisms have been proposed to explain long distance communication between synapses and the nucleus, the possible co-existence of these models and their relevance in physiological conditions remain elusive. One model suggests that synaptic activation triggers the translocation to the nucleus of certain transcription regulators localised at postsynaptic sites that function as synapto-nuclear messengers. Alternatively, it has been hypothesised that synaptic activity initiates propagating regenerative intracellular calcium waves that spread through dendrites into the nucleus where nuclear transcription machinery is thereby regulated. It has also been postulated that membrane depolarisation of voltage-gated calcium channels on the somatic membrane is sufficient to increase intracellular calcium concentration and activate transcription without the need for transported signals from distant synapses. Here I provide a critical overview of the suggested mechanisms for coupling synaptic stimulation to transcription, the underlying assumptions behind them and their plausible physiological significance. PMID:24327840

  9. The DNA replication factor MCM5 is essential for Stat1-mediated transcriptional activation

    PubMed Central

    Snyder, Marylynn; He, Wei; Zhang, J. Jillian


    The eukaryotic minichromosome maintenance (MCM) family of proteins (MCM2–MCM7) is evolutionarily conserved from yeast to human. These proteins are essential for DNA replication. The signal transducer and activator of transcription proteins are critical for the signal transduction of a multitude of cytokines and growth factors leading to the regulation of gene expression. We previously identified a strong interaction between Stat1 and MCM5. However, the physiological significance of this interaction was not clear. We show here by chromatin immunoprecipitation (ChIP) analyses that the MCM5 protein, as well as other members of the MCM family, is inducibly recruited to Stat1 target gene promoters in response to cytokine stimulation. Furthermore, the MCM proteins are shown to move along with the RNA polymerase II during transcription elongation. We have also identified an independent domain in MCM5 that mediates the interaction between Stat1 and MCM5; overexpression of this domain can disrupt the interaction between Stat1 and MCM5 and inhibit Stat1 transcriptional activity. Finally, we used the RNA interference technique to show that MCM5 is essential for transcription activation of Stat1 target genes. Together, these results demonstrate that, in addition to their roles in DNA replication, the MCM proteins are also necessary for transcription activation. PMID:16199513

  10. Transcriptional regulation of the presenilin-1 gene controls gamma-secretase activity.


    Lee, Sebum; Das, Hriday K


    Inhibition of basal JNK activity by JNK inhibitor SP600125 or JNK1siRNA repressed presenilin-1 (PS1) expression in SK-N-SH cells by augmenting the level of p53, a repressor of the PS1 gene (1). We now showed that repression of PS1 transcription by JNK inhibitor SP600125 inhibited gamma-secretase mediated processing of amyloid precursor protein (APP) resulting in the accumulation of C99 fragment and the reduction of secreted Abeta40 level without altering the expression of nicastrin (NCT). Co-treatment of cells with SP600125 and p53 inhibitor, pifithrin-alpha, partially nullified the suppressive effects of SP610025 on PS1 expression and secreted Abeta40 level. Suppression of JNK1 by JNK1siRNA also decreased Abeta40 level. Furthermore, overexpression of the repressors p53, ZNF237 and CHD3 of the PS1 gene also suppressed the processing of APP through repression of PS1 transcription by deacetylation of histone at the PS1 promoter. Transcriptional activator Ets2 increased PS1 protein and secreted Abeta40 levels without affecting the expression of NCT by activating PS1 transcription via hyper-acetylation of histone at the PS1 promoter. Therefore, regulation of PS1 transcription modulates gamma-secretase activity. PMID:20036849

  11. Yap/Taz transcriptional activity in endothelial cells promotes intramembranous ossification via the BMP pathway

    PubMed Central

    Uemura, Mami; Nagasawa, Ayumi; Terai, Kenta


    Osteogenesis is categorized into two groups based on developmental histology, intramembranous and endochondral ossification. The role of blood vessels during endochondral ossification is well known, while their role in intramembranous ossification, especially the intertissue pathway, is poorly understood. Here, we demonstrate endothelial Yap/Taz is a novel regulator of intramembranous ossification in zebrafish. Appropriate blood flow is required for Yap/Taz transcriptional activation in endothelial cells and intramembranous ossification. Additionally, Yap/Taz transcriptional activity in endothelial cells specifically promotes intramembranous ossification. BMP expression by Yap/Taz transactivation in endothelial cells is also identified as a bridging factor between blood vessels and intramembranous ossification. Furthermore, the expression of Runx2 in pre-osteoblast cells is a downstream target of Yap/Taz transcriptional activity in endothelial cells. Our results provide novel insight into the relationship between blood flow and ossification by demonstrating intertissue regulation. PMID:27273480

  12. Cohesin and Polycomb Proteins Functionally Interact to Control Transcription at Silenced and Active Genes

    PubMed Central

    Schaaf, Cheri A.; Misulovin, Ziva; Gause, Maria; Koenig, Amanda; Gohara, David W.; Watson, Audrey; Dorsett, Dale


    Cohesin is crucial for proper chromosome segregation but also regulates gene transcription and organism development by poorly understood mechanisms. Using genome-wide assays in Drosophila developing wings and cultured cells, we find that cohesin functionally interacts with Polycomb group (PcG) silencing proteins at both silenced and active genes. Cohesin unexpectedly facilitates binding of Polycomb Repressive Complex 1 (PRC1) to many active genes, but their binding is mutually antagonistic at silenced genes. PRC1 depletion decreases phosphorylated RNA polymerase II and mRNA at many active genes but increases them at silenced genes. Depletion of cohesin reduces long-range interactions between Polycomb Response Elements in the invected-engrailed gene complex where it represses transcription. These studies reveal a previously unrecognized role for PRC1 in facilitating productive gene transcription and provide new insights into how cohesin and PRC1 control development. PMID:23818863

  13. Nutritional conditions regulate transcriptional activity of SF-1 by controlling sumoylation and ubiquitination

    PubMed Central

    Lee, Jiwon; Yang, Dong Joo; Lee, Syann; Hammer, Gary D.; Kim, Ki Woo; Elmquist, Joel K.


    Steroidogenic factor 1 (SF-1) is a transcription factor expressed in the ventral medial nucleus of the hypothalamus that regulates energy homeostasis. However, the molecular mechanisms of SF-1 in the control of energy balance are largely unknown. Here, we show that nutritional conditions, such as the presence or absence of serum, affect SF-1 action. Serum starvation significantly decreased hypothalamic SF-1 levels by promoting ubiquitin-dependent degradation, and sumoylation was required for this process. SF-1 transcriptional activity was also differentially regulated by nutritional status. Under normal conditions, the transcriptional activity of hypothalamic SF-1 was activated by SUMO, but this was attenuated during starvation. Taken together, these results indicate that sumoylation and ubiquitination play crucial roles in the regulation of SF-1 function and that these effects are dependent on nutritional conditions, further supporting the importance of SF-1 in the control of energy homeostasis. PMID:26750456

  14. RNA helicase A activity is inhibited by oncogenic transcription factor EWS-FLI1

    PubMed Central

    Erkizan, Hayriye Verda; Schneider, Jeffrey A.; Sajwan, Kamal; Graham, Garrett T.; Griffin, Brittany; Chasovskikh, Sergey; Youbi, Sarah E.; Kallarakal, Abraham; Chruszcz, Maksymilian; Padmanabhan, Radhakrishnan; Casey, John L.; Üren, Aykut; Toretsky, Jeffrey A.


    RNA helicases impact RNA structure and metabolism from transcription through translation, in part through protein interactions with transcription factors. However, there is limited knowledge on the role of transcription factor influence upon helicase activity. RNA helicase A (RHA) is a DExH-box RNA helicase that plays multiple roles in cellular biology, some functions requiring its activity as a helicase while others as a protein scaffold. The oncogenic transcription factor EWS-FLI1 requires RHA to enable Ewing sarcoma (ES) oncogenesis and growth; a small molecule, YK-4-279 disrupts this complex in cells. Our current study investigates the effect of EWS-FLI1 upon RHA helicase activity. We found that EWS-FLI1 reduces RHA helicase activity in a dose-dependent manner without affecting intrinsic ATPase activity; however, the RHA kinetics indicated a complex model. Using separated enantiomers, only (S)-YK-4-279 reverses the EWS-FLI1 inhibition of RHA helicase activity. We report a novel RNA binding property of EWS-FLI1 leading us to discover that YK-4-279 inhibition of RHA binding to EWS-FLI1 altered the RNA binding profile of both proteins. We conclude that EWS-FLI1 modulates RHA helicase activity causing changes in overall transcriptome processing. These findings could lead to both enhanced understanding of oncogenesis and provide targets for therapy. PMID:25564528

  15. Role of Transcriptional Read-Through in PRE Activity in Drosophila melanogaster

    PubMed Central

    Elizar’ev, P. V.; Lomaev, D. V.; Chetverina, D. A.; Georgiev, P. G.; Erokhin, M. M.


    Maintenance of the individual patterns of gene expression in different cell types is required for the differentiation and development of multicellular organisms. Expression of many genes is controlled by Polycomb (PcG) and Trithorax (TrxG) group proteins that act through association with chromatin. PcG/TrxG are assembled on the DNA sequences termed PREs (Polycomb Response Elements), the activity of which can be modulated and switched from repression to activation. In this study, we analyzed the influence of transcriptional read-through on PRE activity switch mediated by the yeast activator GAL4. We show that a transcription terminator inserted between the promoter and PRE doesn’t prevent switching of PRE activity from repression to activation. We demonstrate that, independently of PRE orientation, high levels of transcription fail to dislodge PcG/TrxG proteins from PRE in the absence of a terminator. Thus, transcription is not the main factor required for PRE activity switch. PMID:27446595

  16. Novel FOXC2 Mutation in Hereditary Distichiasis Impairs DNA-Binding Activity and Transcriptional Activation.


    Zhang, Leilei; He, Jie; Han, Bing; Lu, Linna; Fan, Jiayan; Zhang, He; Ge, Shengfang; Zhou, Yixiong; Jia, Renbing; Fan, Xianqun


    Distichiasis presents as double rows of eyelashes arising from aberrant differentiation of the meibomian glands of the eyelids, and it may be sporadic or hereditary. FOXC2 gene mutations in hereditary distichiasis are rarely reported. Here, we examined two generations of a Chinese family with hereditary distichiasis but without lymphedema or other features of LD syndrome. The FOXC2 gene was amplified and sequenced in all family members. Subcellular localization and luciferase assays were performed to assess the activity of the mutant FOXC2 protein. Clinical examinations showed distichiasis, lower eyelid ectropion, congenital ptosis and photophobia in all affected individuals. Sequence analysis revealed a novel frameshift mutation, c.964_965insG, in the coding region of the FOXC2 gene. This mutation caused protein truncation due to the presence of a premature stop codon. A fluorescence assay showed that this mutation did not change the nuclear localization of the protein. However, it impaired DNA-binding activity and decreased transcriptional activation. This is the first report of a FOXC2 mutation in hereditary distichiasis in the Chinese population. The findings of our study expand the FOXC2 mutation spectrum and contribute to the understanding of the genotype-phenotype correlation of this disease. PMID:27570485

  17. Novel FOXC2 Mutation in Hereditary Distichiasis Impairs DNA-Binding Activity and Transcriptional Activation

    PubMed Central

    Zhang, Leilei; He, Jie; Han, Bing; Lu, Linna; Fan, Jiayan; Zhang, He; Ge, Shengfang; Zhou, Yixiong; Jia, Renbing; Fan, Xianqun


    Distichiasis presents as double rows of eyelashes arising from aberrant differentiation of the meibomian glands of the eyelids, and it may be sporadic or hereditary. FOXC2 gene mutations in hereditary distichiasis are rarely reported. Here, we examined two generations of a Chinese family with hereditary distichiasis but without lymphedema or other features of LD syndrome. The FOXC2 gene was amplified and sequenced in all family members. Subcellular localization and luciferase assays were performed to assess the activity of the mutant FOXC2 protein. Clinical examinations showed distichiasis, lower eyelid ectropion, congenital ptosis and photophobia in all affected individuals. Sequence analysis revealed a novel frameshift mutation, c.964_965insG, in the coding region of the FOXC2 gene. This mutation caused protein truncation due to the presence of a premature stop codon. A fluorescence assay showed that this mutation did not change the nuclear localization of the protein. However, it impaired DNA-binding activity and decreased transcriptional activation. This is the first report of a FOXC2 mutation in hereditary distichiasis in the Chinese population. The findings of our study expand the FOXC2 mutation spectrum and contribute to the understanding of the genotype-phenotype correlation of this disease. PMID:27570485

  18. Inhibition of Phosphatase Activity Follows Decline in Sulfatase Activity and Leads to Transcriptional Effects through Sustained Phosphorylation of Transcription Factor MITF

    PubMed Central

    Bhattacharyya, Sumit; Feferman, Leo; Tobacman, Joanne K.


    Arylsulfatase B (B-acetylgalactosamine 4-sulfatase; ARSB) is the enzyme that removes 4-sulfate groups from the non-reducing end of the glycosaminoglycans chondroitin 4-sulfate and dermatan sulfate. Decline in ARSB has been shown in malignant prostate, colonic, and mammary cells and tissues, and decline in ARSB leads to transcriptional events mediated by galectin-3 with AP-1 and Sp1. Increased mRNA expression of GPNMB (transmembrane glycoprotein NMB) in HepG2 cells and in hepatic tissue from ARSB-deficient mice followed decline in expression of ARSB and was mediated by the microphthalmia-associated transcription factor (MITF), but was unaffected by silencing galectin-3. Since GPNMB is increased in multiple malignancies, studies were performed to determine how decline in ARSB increased GPNMB expression. The mechanism by which decline in ARSB increased nuclear phospho-MITF was due to reduced activity of SHP2, a protein tyrosine phosphatase with Src homology (SH2) domains that regulates multiple cellular processes. SHP2 activity declined due to increased binding with chondroitin 4-sulfate when ARSB was reduced. When SHP2 activity was inhibited, phosphorylations of p38 mitogen-associated phosphokinase (MAPK) and of MITF increased, leading to GPNMB promoter activation. A dominant negative SHP2 construct, the SHP2 inhibitor PHSP1, and silencing of ARSB increased phospho-p38, nuclear MITF, and GPNMB. In contrast, constitutively active SHP2 and overexpression of ARSB inhibited GPNMB expression. The interaction between chondroitin 4-sulfate and SHP2 is a novel intersection between sulfation and phosphorylation, by which decline in ARSB and increased chondroitin 4-sulfation can inhibit SHP2, thereby regulating downstream tyrosine phosphorylations by sustained phosphorylations with associated activation of signaling and transcriptional events. PMID:27078017

  19. Biomechanical Signals Inhibit IKK Activity to Attenuate NF-κB Transcription Activity in Inflamed Chondrocytes

    PubMed Central

    Dossumbekova, Anar; Anghelina, Mirela; Madhavan, Shashi; He, Lingli; Quan, Ning; Knobloch, Thomas; Agarwal, Sudha


    Objective While the effects of biomechanical signals in the form of joint movement and exercise are known to be beneficial to inflamed joints, limited information is available regarding the intracellular mechanisms of their actions. This study was undertaken to examine the intracellular mechanisms by which biomechanical signals suppress proinflammatory gene induction by the interleukin-1-β (IL-1β)–induced NF-κB signaling cascade in articular chondrocytes. Methods Primary rat articular chondrocytes were exposed to biomechanical signals in the form of cyclic tensile strain, and the effects on the NF-κB signaling cascade were examined by Western blot analysis, real-time polymerase chain reaction, and immunofluorescence. Results Cyclic tensile strain rapidly inhibited the IL-1β–induced nuclear translocation of NF-κB, but not its IL-1β–induced phosphorylation at serine 276 and serine 536, which are necessary for its transactivation and transcriptional efficacy, respectively. Examination of upstream events revealed that cyclic tensile strain also inhibited the cytoplasmic protein degradation of IκBβ and IκBα, as well as repressed their gene transcription. Additionally, cyclic tensile strain induced a rapid nuclear translocation of IκBα to potentially prevent NF-κB binding to DNA. Furthermore, the inhibition of IL-1β–induced degradation of IκB by cyclic tensile strain was mediated by down-regulation of IκB kinase activity. Conclusion These results indicate that the signals generated by cyclic tensile strain act at multiple sites within the NF-κB signaling cascade to inhibit IL-1β–induced proinflammatory gene induction. Taken together, these findings provide insight into how biomechanical signals regulate and reduce inflammation, and underscore their potential in enhancing the ability of chondrocytes to curb inflammation in diseased joints. PMID:17907174

  20. Alterations in leukocyte transcriptional control pathway activity associated with major depressive disorder and antidepressant treatment.


    Mellon, S H; Wolkowitz, O M; Schonemann, M D; Epel, E S; Rosser, R; Burke, H B; Mahan, L; Reus, V I; Stamatiou, D; Liew, C-C; Cole, S W


    Major depressive disorder (MDD) is associated with a significantly elevated risk of developing serious medical illnesses such as cardiovascular disease, immune impairments, infection, dementia and premature death. Previous work has demonstrated immune dysregulation in subjects with MDD. Using genome-wide transcriptional profiling and promoter-based bioinformatic strategies, we assessed leukocyte transcription factor (TF) activity in leukocytes from 20 unmedicated MDD subjects versus 20 age-, sex- and ethnicity-matched healthy controls, before initiation of antidepressant therapy, and in 17 of the MDD subjects after 8 weeks of sertraline treatment. In leukocytes from unmedicated MDD subjects, bioinformatic analysis of transcription control pathway activity indicated an increased transcriptional activity of cAMP response element-binding/activating TF (CREB/ATF) and increased activity of TFs associated with cellular responses to oxidative stress (nuclear factor erythroid-derived 2-like 2, NFE2l2 or NRF2). Eight weeks of antidepressant therapy was associated with significant reductions in Hamilton Depression Rating Scale scores and reduced activity of NRF2, but not in CREB/ATF activity. Several other transcriptional regulation pathways, including the glucocorticoid receptor (GR), nuclear factor kappa-B cells (NF-κB), early growth response proteins 1-4 (EGR1-4) and interferon-responsive TFs, showed either no significant differences as a function of disease or treatment, or activities that were opposite to those previously hypothesized to be involved in the etiology of MDD or effective treatment. Our results suggest that CREB/ATF and NRF2 signaling may contribute to MDD by activating immune cell transcriptome dynamics that ultimately influence central nervous system (CNS) motivational and affective processes via circulating mediators. PMID:27219347

  1. Transcription factor activation following exposure of an intact lung preparation to metallic particulate matter.

    PubMed Central

    Samet, James M; Silbajoris, Robert; Huang, Tony; Jaspers, Ilona


    Metallic constituents contained in ambient particulate matter have been associated with adverse effects in a number of epidemiologic, in vitro, and in vivo studies. Residual oil fly ash (ROFA) is a metallic by-product of the combustion of fossil fuel oil, which has been shown to induce a variety of proinflammatory responses in lung cells. We have examined signaling pathways activated in response to ROFA exposure and recently reported that ROFA treatment activates multiple mitogen-activated protein (MAP) kinases in the rat lung. In the present study we extended our investigations on the mechanism of toxicity of ROFA to include transcription factors whose activities are regulated by MAP kinases as well as possible effectors of transcriptional changes that mediate the effects of ROFA. We applied immunohistochemical methods to detect ROFA-induced activation of nuclear factor-kappa B (NF kappa B), activating transcription factor-2 (ATF-2), c-Jun, and cAMP response element binding protein (CREB) in intact lung tissue and confirmed and characterized their functional activation using DNA binding assays. We performed these studies using a perfused rabbit lung model that is devoid of blood elements in order to distinguish between intrinsic lung cell effects and effects that are secondary to inflammatory cell influx. We report here that exposure to ROFA results in a rapid activation of all of the transcription factors studied by exerting direct effects on lung cells. These findings validate the use of immunohistochemistry to detect transcription factor activation in vivo and demonstrate the utility of studying signaling changes in response to environmental exposures. PMID:12361922

  2. Juvenile hormone-activated phospholipase C pathway enhances transcriptional activation by the methoprene-tolerant protein

    PubMed Central

    Liu, Pengcheng; Peng, Hong-Juan; Zhu, Jinsong


    Juvenile hormone (JH) is a key regulator of a wide diversity of developmental and physiological events in insects. Although the intracellular JH receptor methoprene-tolerant protein (MET) functions in the nucleus as a transcriptional activator for specific JH-regulated genes, some JH responses are mediated by signaling pathways that are initiated by proteins associated with plasma membrane. It is unknown whether the JH-regulated gene expression depends on the membrane-mediated signal transduction. In Aedes aegypti mosquitoes, we found that JH activated the phospholipase C (PLC) pathway and quickly increased the levels of inositol 1,4,5-trisphosphate, diacylglycerol, and intracellular calcium, leading to activation and autophosphorylation of calcium/calmodulin-dependent protein kinase II (CaMKII). When abdomens from newly emerged mosquitoes were cultured in vitro, the JH-activated gene expression was repressed substantially if specific inhibitors of PLC or CaMKII were added to the medium together with JH. In newly emerged female mosquitoes, RNAi-mediated depletion of PLC or CaMKII considerably reduced the expression of JH-responsive genes, including the Krüppel homolog 1 gene (AaKr-h1) and the early trypsin gene (AaET). JH-induced loading of MET to the promoters of AaKr-h1 and AaET was weakened drastically when either PLC or CaMKII was inactivated in the cultured tissues. Therefore, the results suggest that the membrane-initiated signaling pathway modifies the DNA-binding activity of MET via phosphorylation and thus facilitates the genomic responses to JH. In summary, this study reveals an interplay of genomic and nongenomic signaling mechanisms of JH. PMID:25825754

  3. Juvenile hormone-activated phospholipase C pathway enhances transcriptional activation by the methoprene-tolerant protein.


    Liu, Pengcheng; Peng, Hong-Juan; Zhu, Jinsong


    Juvenile hormone (JH) is a key regulator of a wide diversity of developmental and physiological events in insects. Although the intracellular JH receptor methoprene-tolerant protein (MET) functions in the nucleus as a transcriptional activator for specific JH-regulated genes, some JH responses are mediated by signaling pathways that are initiated by proteins associated with plasma membrane. It is unknown whether the JH-regulated gene expression depends on the membrane-mediated signal transduction. In Aedes aegypti mosquitoes, we found that JH activated the phospholipase C (PLC) pathway and quickly increased the levels of inositol 1,4,5-trisphosphate, diacylglycerol, and intracellular calcium, leading to activation and autophosphorylation of calcium/calmodulin-dependent protein kinase II (CaMKII). When abdomens from newly emerged mosquitoes were cultured in vitro, the JH-activated gene expression was repressed substantially if specific inhibitors of PLC or CaMKII were added to the medium together with JH. In newly emerged female mosquitoes, RNAi-mediated depletion of PLC or CaMKII considerably reduced the expression of JH-responsive genes, including the Krüppel homolog 1 gene (AaKr-h1) and the early trypsin gene (AaET). JH-induced loading of MET to the promoters of AaKr-h1 and AaET was weakened drastically when either PLC or CaMKII was inactivated in the cultured tissues. Therefore, the results suggest that the membrane-initiated signaling pathway modifies the DNA-binding activity of MET via phosphorylation and thus facilitates the genomic responses to JH. In summary, this study reveals an interplay of genomic and nongenomic signaling mechanisms of JH. PMID:25825754

  4. A transcriptionally active form of TFIIIC is modified in poliovirus-infected HeLa cells.

    PubMed Central

    Clark, M E; Dasgupta, A


    In HeLa cells, RNA polymerase III (pol III)-mediated transcription is severely inhibited by poliovirus infection. This inhibition is due primarily to the reduction in transcriptional activity of the pol III transcription factor TFIIIC in poliovirus-infected cells. However, the specific binding of TFIIIC to the VAI gene B-box sequence, as assayed by DNase I footprinting, is not altered by poliovirus infection. We have used gel retardation analysis to analyze TFIIIC-DNA complexes formed in nuclear extracts prepared from mock- and poliovirus-infected cells. In mock-infected cell extracts, two closely migrating TFIIIC-containing complexes, complexes I and II, were detected in the gel retardation assay. The slower migrating complex, complex I, was absent in poliovirus-infected cell extracts, and an increase occurred in the intensity of the faster-migrating complex (complex II). Also, in poliovirus-infected cell extracts, a new, rapidly migrating complex, complex III, was formed. Complex III may have been the result of limited proteolysis of complex I or II. These changes in TFIIIC-containing complexes in poliovirus-infected cell extracts correlated kinetically with the decrease in TFIIIC transcriptional activity. Complexes I, II, and III were chromatographically separated; only complex I was transcriptionally active and specifically restored pol III transcription when added to poliovirus-infected cell extracts. Acid phosphatase treatment partially converted complex I to complex II but did not affect the binding of complex II or III. Dephosphorylation and limited proteolysis of TFIIIC are discussed as possible mechanisms for the inhibition of pol III-mediated transcription by poliovirus. Images PMID:2204807

  5. Transcriptional Activation of Human Matrix Metalloproteinase-9 Gene Expression by Multiple Coactivators

    PubMed Central

    Zhao, Xueyan; Benveniste, Etty N.


    Summary Matrix metalloproteinase-9 (MMP-9), a proteolytic enzyme for matrix proteins, chemokines and cytokines, is a major target in cancer and autoimmune diseases since it is aberrantly upregulated. To control MMP-9 expression in pathological conditions, it is necessary to understand the regulatory mechanisms of MMP-9 expression. MMP-9 gene expression is regulated primarily at the transcriptional level. In this study, we investigated the role of multiple coactivators in regulating MMP-9 transcription. We demonstrate that multiple transcriptional coactivators are involved in MMP-9 promoter activation, including CBP/p300, PCAF, CARM1 and GRIP1. Furthermore, enhancement of MMP-9 promoter activity requires the histone acetyltransferase activity of PCAF but not that of CBP/p300, and the methyltransferase activity of CARM1. More importantly, these coactivators are not only able to activate MMP-9 promoter activity independently, but also function in a synergistic manner. Significant synergy was observed among CARM1, p300 and GRIP1, which is dependent on the interaction of p300 and CARM1 with the AD1 and AD2 domains of GRIP1, respectively. This suggests the formation of a ternary coactivator complex on the MMP-9 promoter. Chromatin immunoprecipitation assays demonstrate that these coactivators associate with the endogenous MMP-9 promoter, and that siRNA knockdown of expression of these coactivators reduces endogenous MMP-9 expression. Taken together, these studies demonstrate a new level of transcriptional regulation of MMP-9 expression by the cooperative action of coactivators. PMID:18790699

  6. SUMOylation can regulate the activity of ETS-like transcription factor 4.


    Kaikkonen, Sanna; Makkonen, Harri; Rytinki, Miia; Palvimo, Jorma J


    ETS-like transcription factor 4 (ELK4) (a.k.a. serum response factor accessory protein 1) belongs to the ternary complex factor (TCF) subfamily of E twenty-six (ETS) domain transcription factors. Compared to the other TCF subfamily members, ELK1 and ELK3 (NET), there is limited information of the mechanisms regulating the ELK4 activity. Here, we show that the ELK4 can be covalently modified (SUMOylated) by small ubiquitin-related modifier (SUMO) 1 protein, an important regulator of signaling and transcription. SUMOylation of ELK4 was reversed by SUMO-specific proteases (SENP) 1 and 2 and stimulated by SUMO E3 ligase PIAS3. Conserved lysine residue 167 that is located in the NET inhibitory domain of ELK4 was identified as the main site of SUMO-1 conjugation. Interestingly, mutation of the K167 disrupting the SUMOylation markedly enhanced the transcriptional activity of the ELK4, but weakened its repressive function on c-fos promoter. In conclusion, our results suggest that covalent modification by SUMO-1 can regulate the activity of ELK4, contributing to the transcriptional repression by the ELK4. PMID:20637912

  7. Arsenic Directly Binds to and Activates the Yeast AP-1-Like Transcription Factor Yap8

    PubMed Central

    Kumar, Nallani Vijay; Yang, Jianbo; Pillai, Jitesh K.; Rawat, Swati; Solano, Carlos; Kumar, Abhay; Grøtli, Morten; Stemmler, Timothy L.; Rosen, Barry P.


    The AP-1-like transcription factor Yap8 is critical for arsenic tolerance in the yeast Saccharomyces cerevisiae. However, the mechanism by which Yap8 senses the presence of arsenic and activates transcription of detoxification genes is unknown. Here we demonstrate that Yap8 directly binds to trivalent arsenite [As(III)] in vitro and in vivo and that approximately one As(III) molecule is bound per molecule of Yap8. As(III) is coordinated by three sulfur atoms in purified Yap8, and our genetic and biochemical data identify the cysteine residues that form the binding site as Cys132, Cys137, and Cys274. As(III) binding by Yap8 does not require an additional yeast protein, and Yap8 is regulated neither at the level of localization nor at the level of DNA binding. Instead, our data are consistent with a model in which a DNA-bound form of Yap8 acts directly as an As(III) sensor. Binding of As(III) to Yap8 triggers a conformational change that in turn brings about a transcriptional response. Thus, As(III) binding to Yap8 acts as a molecular switch that converts inactive Yap8 into an active transcriptional regulator. This is the first report to demonstrate how a eukaryotic protein couples arsenic sensing to transcriptional activation. PMID:26711267

  8. Transcription Factor Arabidopsis Activating Factor1 Integrates Carbon Starvation Responses with Trehalose Metabolism1[OPEN

    PubMed Central

    Garapati, Prashanth; Feil, Regina; Lunn, John Edward; Van Dijck, Patrick; Balazadeh, Salma; Mueller-Roeber, Bernd


    Plants respond to low carbon supply by massive reprogramming of the transcriptome and metabolome. We show here that the carbon starvation-induced NAC (for NO APICAL MERISTEM/ARABIDOPSIS TRANSCRIPTION ACTIVATION FACTOR/CUP-SHAPED COTYLEDON) transcription factor Arabidopsis (Arabidopsis thaliana) Transcription Activation Factor1 (ATAF1) plays an important role in this physiological process. We identified TREHALASE1, the only trehalase-encoding gene in Arabidopsis, as a direct downstream target of ATAF1. Overexpression of ATAF1 activates TREHALASE1 expression and leads to reduced trehalose-6-phosphate levels and a sugar starvation metabolome. In accordance with changes in expression of starch biosynthesis- and breakdown-related genes, starch levels are generally reduced in ATAF1 overexpressors but elevated in ataf1 knockout plants. At the global transcriptome level, genes affected by ATAF1 are broadly associated with energy and carbon starvation responses. Furthermore, transcriptional responses triggered by ATAF1 largely overlap with expression patterns observed in plants starved for carbon or energy supply. Collectively, our data highlight the existence of a positively acting feedforward loop between ATAF1 expression, which is induced by carbon starvation, and the depletion of cellular carbon/energy pools that is triggered by the transcriptional regulation of downstream gene regulatory networks by ATAF1. PMID:26149570

  9. TRIM33 switches off Ifnb1 gene transcription during the late phase of macrophage activation

    PubMed Central

    Ferri, Federica; Parcelier, Aude; Petit, Vanessa; Gallouet, Anne-Sophie; Lewandowski, Daniel; Dalloz, Marion; van den Heuvel, Anita; Kolovos, Petros; Soler, Eric; Squadrito, Mario Leonardo; De Palma, Michele; Davidson, Irwin; Rousselet, Germain; Romeo, Paul-Henri


    Despite its importance during viral or bacterial infections, transcriptional regulation of the interferon-β gene (Ifnb1) in activated macrophages is only partially understood. Here we report that TRIM33 deficiency results in high, sustained expression of Ifnb1 at late stages of toll-like receptor-mediated activation in macrophages but not in fibroblasts. In macrophages, TRIM33 is recruited by PU.1 to a conserved region, the Ifnb1 Control Element (ICE), located 15 kb upstream of the Ifnb1 transcription start site. ICE constitutively interacts with Ifnb1 through a TRIM33-independent chromatin loop. At late phases of lipopolysaccharide activation of macrophages, TRIM33 is bound to ICE, regulates Ifnb1 enhanceosome loading, controls Ifnb1 chromatin structure and represses Ifnb1 gene transcription by preventing recruitment of CBP/p300. These results characterize a previously unknown mechanism of macrophage-specific regulation of Ifnb1 transcription whereby TRIM33 is critical for Ifnb1 gene transcription shutdown. PMID:26592194

  10. Transcription of Mammalian cis-Regulatory Elements Is Restrained by Actively Enforced Early Termination.


    Austenaa, Liv M I; Barozzi, Iros; Simonatto, Marta; Masella, Silvia; Della Chiara, Giulia; Ghisletti, Serena; Curina, Alessia; de Wit, Elzo; Bouwman, Britta A M; de Pretis, Stefano; Piccolo, Viviana; Termanini, Alberto; Prosperini, Elena; Pelizzola, Mattia; de Laat, Wouter; Natoli, Gioacchino


    Upon recruitment to active enhancers and promoters, RNA polymerase II (Pol II) generates short non-coding transcripts of unclear function. The mechanisms that control the length and the amount of ncRNAs generated by cis-regulatory elements are largely unknown. Here, we show that the adaptor protein WDR82 and its associated complexes actively limit such non-coding transcription. WDR82 targets the SET1 H3K4 methyltransferases and the nuclear protein phosphatase 1 (PP1) complexes to the initiating Pol II. WDR82 and PP1 also interact with components of the transcriptional termination and RNA processing machineries. Depletion of WDR82, SET1, or the PP1 subunit required for its nuclear import caused distinct but overlapping transcription termination defects at highly expressed genes and active enhancers and promoters, thus enabling the increased synthesis of unusually long ncRNAs. These data indicate that transcription initiated from cis-regulatory elements is tightly coordinated with termination mechanisms that impose the synthesis of short RNAs. PMID:26593720

  11. Transcriptional activation of nuclear estrogen receptor and progesterone receptor and its regulation.


    Xin, Qi-Liang; Qiu, Jing-Tao; Cui, Sheng; Xia, Guo-Liang; Wang, Hai-Bin


    Estrogen receptor (ER) and progesterone receptor (PR) are two important members of steroid receptors family, an evolutionarily conserved family of transcription factors. Upon binding to their ligands, ER and PR enter cell nucleus to interact with specific DNA element in the context of chromatin to initiate the transcription of diverse target genes, which largely depends on the timely recruitment of a wide range of cofactors. Moreover, the interactions between steroid hormones and their respective receptors also trigger post-translational modifications on these receptors to fine-tune their transcriptional activities. Besides the well-known phosphorylation modifications on tyrosine and serine/threonine residues, recent studies have identified several other covalent modifications, such as ubiquitylation and sumoylation. These post-translational modifications of steroid receptors affect its stability, subcellular localization, and/or cofactor recruitment; eventually influence the duration and extent of transcriptional activation. This review is to focus on the recent research progress on the transcriptional activation of nuclear ER and PR as well as their physiological functions in early pregnancy, which may help us to better understand related female reproductive diseases. PMID:27546504

  12. Transcription Factor Arabidopsis Activating Factor1 Integrates Carbon Starvation Responses with Trehalose Metabolism.


    Garapati, Prashanth; Feil, Regina; Lunn, John Edward; Van Dijck, Patrick; Balazadeh, Salma; Mueller-Roeber, Bernd


    Plants respond to low carbon supply by massive reprogramming of the transcriptome and metabolome. We show here that the carbon starvation-induced NAC (for NO APICAL MERISTEM/ARABIDOPSIS TRANSCRIPTION ACTIVATION FACTOR/CUP-SHAPED COTYLEDON) transcription factor Arabidopsis (Arabidopsis thaliana) Transcription Activation Factor1 (ATAF1) plays an important role in this physiological process. We identified TREHALASE1, the only trehalase-encoding gene in Arabidopsis, as a direct downstream target of ATAF1. Overexpression of ATAF1 activates TREHALASE1 expression and leads to reduced trehalose-6-phosphate levels and a sugar starvation metabolome. In accordance with changes in expression of starch biosynthesis- and breakdown-related genes, starch levels are generally reduced in ATAF1 overexpressors but elevated in ataf1 knockout plants. At the global transcriptome level, genes affected by ATAF1 are broadly associated with energy and carbon starvation responses. Furthermore, transcriptional responses triggered by ATAF1 largely overlap with expression patterns observed in plants starved for carbon or energy supply. Collectively, our data highlight the existence of a positively acting feedforward loop between ATAF1 expression, which is induced by carbon starvation, and the depletion of cellular carbon/energy pools that is triggered by the transcriptional regulation of downstream gene regulatory networks by ATAF1. PMID:26149570

  13. Model of transcriptional activation by MarA in escherichia coli

    SciTech Connect

    Wall, Michael E; Rosner, Judah L; Martin, Robert G


    The AraC family transcription factor MarA activates approximately 40 genes (the marA/soxS/rob regulon) of the Escherichia coli chromosome resulting in different levels of resistance to a wide array of antibiotics and to superoxides. Activation of marA/soxS/rob regulon promoters occurs in a well-defined order with respect to the level of MarA; however, the order of activation does not parallel the strength of MarA binding to promoter sequences. To understand this lack of correspondence, we developed a computational model of transcriptional activation in which a transcription factor either increases or decreases RNA polymerase binding, and either accelerates or retards post-binding events associated with transcription initiation. We used the model to analyze data characterizing MarA regulation of promoter activity. The model clearly explains the lack of correspondence between the order of activation and the MarA-DNA affinity and indicates that the order of activation can only be predicted using information about the strength of the full MarA-polymerase-DNA interaction. The analysis further suggests that MarA can activate without increasing polymerase binding and that activation can even involve a decrease in polymerase binding, which is opposite to the textbook model of activation by recruitment. These findings are consistent with published chromatin immunoprecipitation assays of interactions between polymerase and the E. coli chromosome. We find that activation involving decreased polymerase binding yields lower latency in gene regulation and therefore might confer a competitive advantage to cells. Our model yields insights into requirements for predicting the order of activation of a regulon and enables us to suggest that activation might involve a decrease in polymerase binding which we expect to be an important theme of gene regulation in E. coli and beyond.

  14. Dynamic Protein Associations Define Two Phases of IL-1β Transcriptional Activation

    PubMed Central

    Zhang, Yue; Saccani, Simona; Shin, Hyunjin; Nikolajczyk, Barbara S.


    IL-1β is a key proinflammatory cytokine with roles in multiple diseases. Monocytes package the IL-1β promoter into a “poised architecture” characterized by a histone-free transcription start site and constitutive transcription factor associations. Upon LPS stimulation, multiple proteins inducibly associate with the IL-1β gene. To understand how the complex combination of constitutive and inducible transcription factors activate the IL-1β gene from a poised structure, we measured temporal changes in NF-κB and IFN regulatory factor (IRF) association with IL-1β regulatory elements. Association of the p65 subunit of NF-κB peaks 30–60 min post-monocyte stimulation, and it shortly precedes IRF-4 recruitment to the IL-1β enhancer and maximal mRNA production. In contrast, IRF-8/enhancer association decreases poststimulation. To test the importance of delayed IRF-4/enhancer association, we introduced a mutated PU.1 protein shown to prevent PU.1-mediated IRF-4 recruitment to the enhancer sequence. Mutated PU.1 initially increased IL-1β mRNA followed by decreased mRNA levels 2–3 h poststimulation. Taken together, these data support a dynamic model of IL-1β transcriptional activation in which a combination of IRF-8 and p65 drives the initial phase of IL-1β transcription, while PU.1-mediated IRF-4 recruitment to the enhancer is important for the second phase. We further demonstrate that activation of both NF-κB and IRF-4 depends on CK2 kinase activity. Because IRF-4/enhancer association requires CK2 but not p65 activation, we conclude that CK2 triggers the IRF-4 and p65 pathways independently to serve as a master regulator of IL-1β transcription. PMID:18566416

  15. Dynamic transcription factor activity networks in response to independently altered mechanical and adhesive microenvironmental cues.


    Peñalver Bernabé, Beatriz; Shin, Seungjin; Rios, Peter D; Broadbelt, Linda J; Shea, Lonnie D; Seidlits, Stephanie K


    Multiple aspects of the local extracellular environment profoundly affect cell phenotype and function. Physical and chemical cues in the environment trigger intracellular signaling cascades that ultimately activate transcription factors (TFs) - powerful regulators of the cell phenotype. TRACER (TRanscriptional Activity CEll aRrays) was employed for large-scale, dynamic quantification of TF activity in human fibroblasts cultured on hydrogels with a controlled elastic modulus and integrin ligand density. We identified three groups of TFs: responders to alterations in ligand density alone, substrate stiffness or both. Dynamic networks of regulatory TFs were constructed computationally and revealed distinct TF activity levels, directionality (i.e., activation or inhibition), and dynamics for adhesive and mechanical cues. Moreover, TRACER networks predicted conserved hubs of TF activity across multiple cell types, which are significantly altered in clinical fibrotic tissues. Our approach captures the distinct and overlapping effects of adhesive and mechanical stimuli, identifying conserved signaling mechanisms in normal and disease states. PMID:27470442

  16. Differential roles of phosphorylation in the formation of transcriptional active RNA polymerase I

    PubMed Central

    Fath, Stephan; Milkereit, Philipp; Peyroche, Gerald; Riva, Michel; Carles, Christophe; Tschochner, Herbert


    Regulation of rDNA transcription depends on the formation and dissociation of a functional complex between RNA polymerase I (pol I) and transcription initiation factor Rrn3p. We analyzed whether phosphorylation is involved in this molecular switch. Rrn3p is a phosphoprotein that is predominantly phosphorylated in vivo when it is not bound to pol I. In vitro, Rrn3p is able both to associate with pol I and to enter the transcription cycle in its nonphosphorylated form. By contrast, phosphorylation of pol I is required to form a stable pol I-Rrn3p complex for efficient transcription initiation. Furthermore, association of pol I with Rrn3p correlates with a change in the phosphorylation state of pol I in vivo. We suggest that phosphorylation at specific sites of pol I is a prerequisite for proper transcription initiation and that phosphorylation/dephosphorylation of pol I is one possibility to modulate cellular rDNA transcription activity. PMID:11717393

  17. Ectopic expression of the Arabidopsis transcriptional activator Athb-1 alters leaf cell fate in tobacco.


    Aoyama, T; Dong, C H; Wu, Y; Carabelli, M; Sessa, G; Ruberti, I; Morelli, G; Chua, N H


    The Arabidopsis thaliana Athb-1 is a homeobox gene of unknown function. By analogy with homeobox genes of other organisms, its gene product, Athb-1, is most likely a transcription factor involved in developmental processes. We constructed a series of Athb-1-derived genes to examine the roles of Athb-1 in transcriptional regulation and plant development. Athb-1 was found to transactivate a promoter linked to a specific DNA binding site by transient expression assays. In transgenic tobacco plants, overexpression of Athb-1 or its chimeric derivatives with heterologous transactivating domains of the yeast transcription factor GAL4 or herpes simplex virus transcription factor VP16 conferred deetiolated phenotypes in the dark, including cotyledon expansion, true leaf development, and an inhibition of hypocotyl elongation. Expression of Athb-1 or the two chimeric derivatives also affected the development of palisade parenchyma under normal growth conditions, resulting in light green sectors in leaves and cotyledons, whereas other organs in the transgenic plants remained normal. Both developmental phenotypes were induced by glucocorticoid in transgenic plants expressing a chimeric transcription factor comprising the Athb-1 DNA binding domain, the VP16 transactivating domain, and the glucocorticoid receptor domain. Plants with severe inducible phenotypes showed additional abnormality in cotyledon expansion. Our results suggest that Athb-1 is a transcription activator involved in leaf development. PMID:8535134

  18. Ectopic expression of the Arabidopsis transcriptional activator Athb-1 alters leaf cell fate in tobacco.

    PubMed Central

    Aoyama, T; Dong, C H; Wu, Y; Carabelli, M; Sessa, G; Ruberti, I; Morelli, G; Chua, N H


    The Arabidopsis thaliana Athb-1 is a homeobox gene of unknown function. By analogy with homeobox genes of other organisms, its gene product, Athb-1, is most likely a transcription factor involved in developmental processes. We constructed a series of Athb-1-derived genes to examine the roles of Athb-1 in transcriptional regulation and plant development. Athb-1 was found to transactivate a promoter linked to a specific DNA binding site by transient expression assays. In transgenic tobacco plants, overexpression of Athb-1 or its chimeric derivatives with heterologous transactivating domains of the yeast transcription factor GAL4 or herpes simplex virus transcription factor VP16 conferred deetiolated phenotypes in the dark, including cotyledon expansion, true leaf development, and an inhibition of hypocotyl elongation. Expression of Athb-1 or the two chimeric derivatives also affected the development of palisade parenchyma under normal growth conditions, resulting in light green sectors in leaves and cotyledons, whereas other organs in the transgenic plants remained normal. Both developmental phenotypes were induced by glucocorticoid in transgenic plants expressing a chimeric transcription factor comprising the Athb-1 DNA binding domain, the VP16 transactivating domain, and the glucocorticoid receptor domain. Plants with severe inducible phenotypes showed additional abnormality in cotyledon expansion. Our results suggest that Athb-1 is a transcription activator involved in leaf development. PMID:8535134

  19. A Modified Reverse One-Hybrid Screen Identifies Transcriptional Activation Domains in PHYTOCHROME-INTERACTING FACTOR 3

    PubMed Central

    Dalton, Jutta C.; Bätz, Ulrike; Liu, Jason; Curie, Gemma L.; Quail, Peter H.


    Transcriptional activation domains (TADs) are difficult to predict and identify, since they are not conserved and have little consensus. Here, we describe a yeast-based screening method that is able to identify individual amino acid residues involved in transcriptional activation in a high throughput manner. A plant transcriptional activator, PIF3 (phytochrome interacting factor 3), was fused to the yeast GAL4-DNA-binding Domain (BD), driving expression of the URA3 (Orotidine 5′-phosphate decarboxylase) reporter, and used for negative selection on 5-fluroorotic acid (5FOA). Randomly mutagenized variants of PIF3 were then selected for a loss or reduction in transcriptional activation activity by survival on FOA. In the process, we developed a strategy to eliminate false positives from negative selection that can be used for both reverse-1- and 2-hybrid screens. With this method we were able to identify two distinct regions in PIF3 with transcriptional activation activity, both of which are functionally conserved in PIF1, PIF4, and PIF5. Both are collectively necessary for full PIF3 transcriptional activity, but neither is sufficient to induce transcription autonomously. We also found that the TAD appear to overlap physically with other PIF3 functions, such as phyB binding activity and consequent phosphorylation. Our protocol should provide a valuable tool for identifying, analyzing and characterizing novel TADs in eukaryotic transcription factors, and thus potentially contribute to the unraveling of the mechanism underlying transcriptional activation. PMID:27379152

  20. Genetic analysis of transcriptional activation and repression in the Tn21 mer operon. [Bacteria

    SciTech Connect

    Ross, W.; Park, S.J.; Summers, A.O. )


    Transcription of the Tn21 mercury resistance operon (mer) is controlled by the toxic metal cation Hg(II). This control is mediated by the product of the merR gene, a 144-amino-acid protein which represses transcription of the structural genes (merTPCAD) in the absence of Hg(II) and activates transcription in the presence of Hg(II). We have used a mer-lac transcriptional fusion to obtain regulatory mutants in this metal-responsive system. Some mutants were defective in Hg(II)-induced activation while retaining repression function, others were defective in repression but not activation, and some had lost both functions. Mutations in three of the four cysteine residues of merR resulted in complete loss of Hg(II)-inducible activation but retention of the repressor function. Other lesions adjacent to or very near these cysteines exhibited severely reduced activation and also retained repressor function. There were two putative helix-turn-helix (HTH) domains in merR, and mutants in each had very different phenotypes. A partially dominant mutation in the more amino-terminal region of the two putative HTH regions resulted in loss of both activation and repression, consistent with a role for this region in DNA binding. Mutations in the more centrally located HTH region resulted only in loss of Hg(II)-induced activation. Lesions in the central and in the carboxy-terminal regions of merR exhibited both Hg(II)-independent and Hg(II)-dependent transcriptional activation. The sole cis-acting mutant obtained with this operon fusion strategy, a down-promoter mutation, lies in a highly conserved base in the -35 region of the merTPCAD promoter.

  1. Thyroid Transcription Factor 1 Reprograms Angiogenic Activities of Secretome

    PubMed Central

    Wood, Lauren W.; Cox, Nicole I.; Phelps, Cody A.; Lai, Shao-Chiang; Poddar, Arjun; Talbot, Conover; Mu, David


    Through both gain- and loss-of-TTF-1 expression strategies, we show that TTF-1 positively regulates vascular endothelial growth factor (VEGF) and that the VEGF promoter element contains multiple TTF-1-responsive sequences. The major signaling receptor for VEGF, i.e VEGFR2, also appears to be under a direct and positive regulation of TTF-1. The TTF-1-dependent upregulation of VEGF was moderately sensitive to rapamycin, implicating a partial involvement of mammalian target of rapamycin (mTOR). However, hypoxia did not further increase the secreted VEGF level of the TTF-1+ lung cancer cells. The TTF-1-induced VEGF upregulation occurs in both compartments (exosomes and exosome-depleted media (EDM)) of the conditioned media. Surprisingly, the EDM of TTF-1+ lung cancer cells (designated EDM-TTF-1+) displayed an anti-angiogenic activity in the endothelial cell tube formation assay. Mechanistic studies suggest that the increased granulocyte-macrophage colony-stimulating factor (GM-CSF) level in the EDM-TTF-1+ conferred the antiangiogenic activities. In human lung cancer, the expression of TTF-1 and GM-CSF exhibits a statistically significant and positive correlation. In summary, this study provides evidence that TTF-1 may reprogram lung cancer secreted proteome into an antiangiogenic state, offering a novel basis to account for the long-standing observation of favorable prognosis associated with TTF-1+ lung adenocarcinomas. PMID:26912193

  2. Thyroid Transcription Factor 1 Reprograms Angiogenic Activities of Secretome.


    Wood, Lauren W; Cox, Nicole I; Phelps, Cody A; Lai, Shao-Chiang; Poddar, Arjun; Talbot, Conover; Mu, David


    Through both gain- and loss-of-TTF-1 expression strategies, we show that TTF-1 positively regulates vascular endothelial growth factor (VEGF) and that the VEGF promoter element contains multiple TTF-1-responsive sequences. The major signaling receptor for VEGF, i.e VEGFR2, also appears to be under a direct and positive regulation of TTF-1. The TTF-1-dependent upregulation of VEGF was moderately sensitive to rapamycin, implicating a partial involvement of mammalian target of rapamycin (mTOR). However, hypoxia did not further increase the secreted VEGF level of the TTF-1(+) lung cancer cells. The TTF-1-induced VEGF upregulation occurs in both compartments (exosomes and exosome-depleted media (EDM)) of the conditioned media. Surprisingly, the EDM of TTF-1(+) lung cancer cells (designated EDM-TTF-1(+)) displayed an anti-angiogenic activity in the endothelial cell tube formation assay. Mechanistic studies suggest that the increased granulocyte-macrophage colony-stimulating factor (GM-CSF) level in the EDM-TTF-1(+) conferred the antiangiogenic activities. In human lung cancer, the expression of TTF-1 and GM-CSF exhibits a statistically significant and positive correlation. In summary, this study provides evidence that TTF-1 may reprogram lung cancer secreted proteome into an antiangiogenic state, offering a novel basis to account for the long-standing observation of favorable prognosis associated with TTF-1(+) lung adenocarcinomas. PMID:26912193

  3. The absence of the transcription activator TFE3 impairs activation of B cells in vivo.

    PubMed Central

    Merrell, K; Wells, S; Henderson, A; Gorman, J; Alt, F; Stall, A; Calame, K


    TFE3 is a ubiquitously expressed member of the TFE3/mi family of basic helix loop helix zipper transcription factors. TFE3 binds to muE3 sites located in the immunoglobulin heavy-chain (IgH) intronic enhancer, heavy-chain variable region promoters, the Ig kappa intronic enhancer, and regulatory sites in other genes. To understand the role of TFE3 in Ig expression and lymphoid development, we used embryonic stem (ES) cell-mediated gene targeting and RAG2-/- blastocyst complementation to generate mice which lack TFE3 in their B and T lymphocytes. TFE3- ES cells fully reconstitute the B- and T-cell compartments, giving rise to normal patterns of IgM+ B220+ B cells and CD4+ and CD8+ T cells. However, TFE3- B cells show several defects consistent with poor B-cell activation. Serum IgM levels are reduced twofold and IgG and IgA isotypes are reduced three- to sixfold in the TFE3- chimeras even though in vitro, the TFE3- splenocytes secrete normal levels of all isotypes in response to lipopolysaccharide activation. Peripheral TFE3- B cells also show reduced surface expression of CD23 and CD24 (heat-stable antigen). PMID:9154832

  4. Nerve growth factor enhances the CRE-dependent transcriptional activity activated by nobiletin in PC12 cells.


    Takito, Jiro; Kimura, Junko; Kajima, Koji; Uozumi, Nobuyuki; Watanabe, Makoto; Yokosuka, Akihito; Mimaki, Yoshihiro; Nakamura, Masanori; Ohizumi, Yasushi


    Prevention and treatment of Alzheimer disease are urgent problems for elderly people in developed countries. We previously reported that nobiletin, a poly-methoxylated flavone from the citrus peel, improved the symptoms in various types of animal models of memory loss and activated the cAMP responsive element (CRE)-dependent transcription in PC12 cells. Nobiletin activated the cAMP/PKA/MEK/Erk/MAPK signaling pathway without using the TrkA signaling activated by nerve growth factor (NGF). Here, we examined the effect of combination of nobiletin and NGF on the CRE-dependent transcription in PC12 cells. Although NGF alone had little effect on the CRE-dependent transcription, NGF markedly enhanced the CRE-dependent transcription induced by nobiletin. The NGF-induced enhancement was neutralized by a TrkA antagonist, K252a. This effect of NGF was effective on the early signaling event elicited by nobiletin. These results suggested that there was crosstalk between NGF and nobiletin signaling in activating the CRE-dependent transcription in PC12 cells. PMID:27128150

  5. Characteristics of Transcriptional Activity in Nonlinear Dynamics of Genetic Regulatory Networks

    PubMed Central

    Rosenfeld, Simon


    Microarray measurements of mRNA abundances is a standard tool for evaluation of transcriptional activity in functional genomics. The methodology underlying these measurements assumes existence of a direct link between transcription levels, that is, gene-specific mRNA copy numbers present in the cell, and transcription rates, that is, the numbers of gene-specific mRNA molecules synthesized per unit of time. In this paper, the question of whether or not such a tight interdependence may exist is examined in the context of nonlinear dynamics of genetic regulatory networks. Using the equations of chemical kinetics, a model has been constructed that is capable of explicitly taking into consideration nonlinear interactions between the genes through the teamwork of transcription factors. Jacobian analysis of stability has shown that steady state equilibrium is impossible in such systems. However, phase space compressibility is found to be negative, thus suggesting that asymptotic stability may exist and assume either the form of limit cycle or of a chaotic attractor. It is argued that in rapidly fluctuating or chaotic systems, direct evaluation of transcription rates through transcription levels is highly problematic. It is also noted that even if a hypothetical steady state did exist, the knowledge of transcription levels alone would not be sufficient for the evaluation of transcription rates; an additional set of parameters, namely the mRNA decay rates, would be required. An overall conclusion of the work is that the measurements of mRNA abundances are not truly representative of the functionality of genes and structural fidelity of the genetic codes. PMID:20054406

  6. ZEB1 turns into a transcriptional activator by interacting with YAP1 in aggressive cancer types.


    Lehmann, Waltraut; Mossmann, Dirk; Kleemann, Julia; Mock, Kerstin; Meisinger, Chris; Brummer, Tilman; Herr, Ricarda; Brabletz, Simone; Stemmler, Marc P; Brabletz, Thomas


    Early dissemination, metastasis and therapy resistance are central hallmarks of aggressive cancer types and the leading cause of cancer-associated deaths. The EMT-inducing transcriptional repressor ZEB1 is a crucial stimulator of these processes, particularly by coupling the activation of cellular motility with stemness and survival properties. ZEB1 expression is associated with aggressive behaviour in many tumour types, but the potent effects cannot be solely explained by its proven function as a transcriptional repressor of epithelial genes. Here we describe a direct interaction of ZEB1 with the Hippo pathway effector YAP, but notably not with its paralogue TAZ. In consequence, ZEB1 switches its function to a transcriptional co-activator of a 'common ZEB1/YAP target gene set', thereby linking two pathways with similar cancer promoting effects. This gene set is a predictor of poor survival, therapy resistance and increased metastatic risk in breast cancer, indicating the clinical relevance of our findings. PMID:26876920

  7. ZEB1 turns into a transcriptional activator by interacting with YAP1 in aggressive cancer types

    PubMed Central

    Lehmann, Waltraut; Mossmann, Dirk; Kleemann, Julia; Mock, Kerstin; Meisinger, Chris; Brummer, Tilman; Herr, Ricarda; Brabletz, Simone; Stemmler, Marc P.; Brabletz, Thomas


    Early dissemination, metastasis and therapy resistance are central hallmarks of aggressive cancer types and the leading cause of cancer-associated deaths. The EMT-inducing transcriptional repressor ZEB1 is a crucial stimulator of these processes, particularly by coupling the activation of cellular motility with stemness and survival properties. ZEB1 expression is associated with aggressive behaviour in many tumour types, but the potent effects cannot be solely explained by its proven function as a transcriptional repressor of epithelial genes. Here we describe a direct interaction of ZEB1 with the Hippo pathway effector YAP, but notably not with its paralogue TAZ. In consequence, ZEB1 switches its function to a transcriptional co-activator of a ‘common ZEB1/YAP target gene set', thereby linking two pathways with similar cancer promoting effects. This gene set is a predictor of poor survival, therapy resistance and increased metastatic risk in breast cancer, indicating the clinical relevance of our findings. PMID:26876920

  8. Upstream activation sequence-dependent alteration of chromatin structure and transcription activation of the yeast GAL1-GAL10 genes.

    PubMed Central

    Fedor, M J; Kornberg, R D


    Conversion of the positioned nucleosome array characteristic of the repressed GAL1-GAL10 promoter region to the more accessible conformation of the induced state was found to depend on the upstream activation sequence, GAL4 protein, a positive regulator of transcription, and galactose, the inducing agent. The effect of the GAL4 protein-upstream activation sequence complex on the structure of adjacent chromatin required no other promoter sequences. Although sequences protected by histones in the repressed state became more accessible to micrococcal nuclease and (methidiumpropyl-EDTA)iron(II) cleavage following induction of transcription, DNA-protein particles containing these sequences retained the electrophoretic mobility of nucleosomes, indicating that the promoter region can be associated with nucleosomes under conditions of transcription activation. Images PMID:2657404

  9. TRIM24 Is an Oncogenic Transcriptional Activator in Prostate Cancer.


    Groner, Anna C; Cato, Laura; de Tribolet-Hardy, Jonas; Bernasocchi, Tiziano; Janouskova, Hana; Melchers, Diana; Houtman, René; Cato, Andrew C B; Tschopp, Patrick; Gu, Lei; Corsinotti, Andrea; Zhong, Qing; Fankhauser, Christian; Fritz, Christine; Poyet, Cédric; Wagner, Ulrich; Guo, Tiannan; Aebersold, Ruedi; Garraway, Levi A; Wild, Peter J; Theurillat, Jean-Philippe; Brown, Myles


    Androgen receptor (AR) signaling is a key driver of prostate cancer (PC). While androgen-deprivation therapy is transiently effective in advanced disease, tumors often progress to a lethal castration-resistant state (CRPC). We show that recurrent PC-driver mutations in speckle-type POZ protein (SPOP) stabilize the TRIM24 protein, which promotes proliferation under low androgen conditions. TRIM24 augments AR signaling, and AR and TRIM24 co-activated genes are significantly upregulated in CRPC. Expression of TRIM24 protein increases from primary PC to CRPC, and both TRIM24 protein levels and the AR/TRIM24 gene signature predict disease recurrence. Analyses in CRPC cells reveal that the TRIM24 bromodomain and the AR-interacting motif are essential to support proliferation. These data provide a rationale for therapeutic TRIM24 targeting in SPOP mutant and CRPC patients. PMID:27238081

  10. Regulation of nucleotide excision repair activity by transcriptional and post-transcriptional control of the XPA protein.


    Kang, Tae-Hong; Reardon, Joyce T; Sancar, Aziz


    The XPA (Xeroderma pigmentosum A) protein is one of the six core factors of the human nucleotide excision repair system. In this study we show that XPA is a rate-limiting factor in all human cell lines tested, including a normal human fibroblast cell line. The level of XPA is controlled at the transcriptional level by the molecular circadian clock and at the post-translational level by a HECT domain family E3 ubiquitin ligase called HERC2. Stabilization of XPA by downregulation of HERC2 moderately enhances excision repair activity. Conversely, downregulation of XPA by siRNA reduces excision repair activity in proportion to the level of XPA. Ubiquitination and proteolysis of XPA are inhibited by DNA damage that promotes tight association of the protein with chromatin and its dissociation from the HERC2 E3 ligase. Finally, in agreement with a recent report, we find that XPA is post-translationally modified by acetylation. However, contrary to the previous claim, we find that in mouse liver only a small fraction of XPA is acetylated and that downregulation of SIRT1 deacetylase in two human cell lines does not affect the overall repair rate. Collectively, the data reveal that XPA is a limiting factor in excision repair and that its level is coordinately regulated by the circadian clock, the ubiquitin-proteasome system and DNA damage. PMID:21193487

  11. Transcriptional regulator Leu3 of Saccharomyces cerevisiae: separation of activator and repressor functions.

    PubMed Central

    Sze, J Y; Remboutsika, E; Kohlhaw, G B


    The Leu3 protein of Saccharomyces cerevisiae binds to specific DNA sequences present in the 5' noncoding region of at least five RNA polymerase II-transcribed genes. Leu3 functions as a transcriptional activator only when the metabolic intermediate alpha-isopropylmalate is also present. In the absence of alpha-isopropylmalate, Leu3 causes transcription to be repressed below basal levels. We show here that different portions of the Leu3 protein are responsible for activation and repression. Fusion of the 30 C-terminal residues of Leu3 to the DNA-binding domain of the Gal4 protein created a strong cross-species activator, demonstrating that the short C-terminal region is not only required but also sufficient for transcriptional activation. Using a recently developed Leu3-responsive in vitro transcription assay as a test system for repression (J. Sze, M. Woontner, J. Jaehning, and G. B. Kohlhaw, Science 258:1143-1145, 1992), we show that mutant forms of the Leu3 protein that lack the activation domain still function as repressors. The shortest repressor thus identified had only about 15% of the mass of the full-length Leu3 protein and was centered on the DNA-binding region of Leu3. Implications of this finding for the mechanism of repression are discussed. Images PMID:8355711

  12. Transcriptional regulator Leu3 of Saccharomyces cerevisiae: separation of activator and repressor functions.


    Sze, J Y; Remboutsika, E; Kohlhaw, G B


    The Leu3 protein of Saccharomyces cerevisiae binds to specific DNA sequences present in the 5' noncoding region of at least five RNA polymerase II-transcribed genes. Leu3 functions as a transcriptional activator only when the metabolic intermediate alpha-isopropylmalate is also present. In the absence of alpha-isopropylmalate, Leu3 causes transcription to be repressed below basal levels. We show here that different portions of the Leu3 protein are responsible for activation and repression. Fusion of the 30 C-terminal residues of Leu3 to the DNA-binding domain of the Gal4 protein created a strong cross-species activator, demonstrating that the short C-terminal region is not only required but also sufficient for transcriptional activation. Using a recently developed Leu3-responsive in vitro transcription assay as a test system for repression (J. Sze, M. Woontner, J. Jaehning, and G. B. Kohlhaw, Science 258:1143-1145, 1992), we show that mutant forms of the Leu3 protein that lack the activation domain still function as repressors. The shortest repressor thus identified had only about 15% of the mass of the full-length Leu3 protein and was centered on the DNA-binding region of Leu3. Implications of this finding for the mechanism of repression are discussed. PMID:8355711

  13. Glucocorticoid receptor (GR) {beta} has intrinsic, GR{alpha}-independent transcriptional activity

    SciTech Connect

    Kino, Tomoshige; Manoli, Irini; Kelkar, Sujata; Wang, Yonghong; Su, Yan A.; Chrousos, George P.


    The human glucocorticoid receptor (GR) gene produces C-terminal GR{beta} and GR{alpha} isoforms through alternative use of specific exons 9{beta} and {alpha}, respectively. We explored the transcriptional activity of GR{beta} on endogenous genes by developing HeLa cells stably expressing EGFP-GR{beta} or EGFP. Microarray analyses revealed that GR{beta} had intrinsic gene-specific transcriptional activity, regulating mRNA expression of a large number of genes negatively or positively. Majority of GR{beta}-responsive genes was distinct from those modulated by GR{alpha}, while GR{beta} and GR{alpha} mutually modulated each other's transcriptional activity in a subpopulation of genes. We did not observe in HCT116 cells nuclear translocation of GR{beta} and activation of this receptor by RU 486, a synthetic steroid previously reported to bind GR{beta} and to induce nuclear translocation. Our results indicate that GR{beta} has intrinsic, GR{alpha}-independent, gene-specific transcriptional activity, in addition to its previously reported dominant negative effect on GR{alpha}-induced transactivation of GRE-driven promoters.

  14. MiT/TFE transcription factors are activated during mitophagy downstream of Parkin and Atg5

    PubMed Central

    Nezich, Catherine L.; Wang, Chunxin; Fogel, Adam I.


    The kinase PINK1 and ubiquitin ligase Parkin can regulate the selective elimination of damaged mitochondria through autophagy (mitophagy). Because of the demand on lysosomal function by mitophagy, we investigated a role for the transcription factor EB (TFEB), a master regulator of lysosomal biogenesis, in this process. We show that during mitophagy TFEB translocates to the nucleus and displays transcriptional activity in a PINK1- and Parkin-dependent manner. MITF and TFE3, homologues of TFEB belonging to the same microphthalmia/transcription factor E (MiT/TFE) family, are similarly regulated during mitophagy. Unlike TFEB translocation after starvation-induced mammalian target of rapamycin complex 1 inhibition, Parkin-mediated TFEB relocalization required Atg9A and Atg5 activity. However, constitutively active Rag guanosine triphosphatases prevented TFEB translocation during mitophagy, suggesting cross talk between these two MiT/TFE activation pathways. Analysis of clustered regularly interspaced short palindromic repeats–generated TFEB/MITF/TFE3/TFEC single, double, and triple knockout cell lines revealed that these proteins partly facilitate Parkin-mediated mitochondrial clearance. These results illuminate a pathway leading to MiT/TFE transcription factor activation, distinct from starvation-induced autophagy, which occurs during mitophagy. PMID:26240184

  15. SUMOylation of DLX3 by SUMO1 promotes its transcriptional activity

    PubMed Central

    Duverger, O.; Chen, S.X.; Lee, D.; Li, T.; Chock, P.B.; Morasso, M.I.


    Small Ubiquitin-Like Modifiers (SUMO) are posttranslational modifiers that regulate target protein activity in diverse ways. The most common group of SUMO substrates is transcription factors, whose transcriptional activity can be altered positively or negatively as a result of SUMOylation. DLX3 is a homeodomain transcription factor involved in placental development, in the differentiation of structures involving epithelial-mesenchymal interactions, such as hair, teeth and nails, and in bone mineralization. We identified two potential SUMOylation sites in the N-terminal domain of DLX3 at positions K83 and K112. Among the six members of the Distal-less family, DLX3 is the only member containing these sites, which are highly conserved among vertebrates. Co-expression experiments demonstrated that DLX3 can be SUMOylated by SUMO1. Site-directed mutagenesis of lysines 83 and 112 to arginines (K83R and K112R) demonstrated that only K112 is involved in SUMOylation. Immunocytochemical analysis showed that SUMOylation does not affect DLX3 subcellular localization. Moreover, using electrophoresis mobility shift assay, we found that DLX3 is still able to bind DNA when SUMOylated. Using luciferase reporter assays, we showed that DLX3K112R exhibits a significantly lower transcriptional activity compared to DLX3WT, suggesting that SUMOylation has a positive effect on DLX3 activity. We identified a new level of regulation in the activity of DLX3 that may play a crucial role in the regulation of hair, teeth and bone development. PMID:21268066

  16. Dynamic Effects of Topoisomerase I Inhibition on R-Loops and Short Transcripts at Active Promoters

    PubMed Central

    Marinello, Jessica; Bertoncini, Stefania; Aloisi, Iris; Cristini, Agnese; Malagoli Tagliazucchi, Guidantonio; Forcato, Mattia; Sordet, Olivier; Capranico, Giovanni


    Topoisomerase I-DNA-cleavage complexes (Top1cc) stabilized by camptothecin (CPT) have specific effects at transcriptional levels. We recently reported that Top1cc increase antisense transcript (aRNAs) levels at divergent CpG-island promoters and, transiently, DNA/RNA hybrids (R-loop) in nuclear and mitochondrial genomes of colon cancer HCT116 cells. However, the relationship between R-loops and aRNAs was not established. Here, we show that aRNAs can form R-loops in N-TERA-2 cells under physiological conditions, and that promoter-associated R-loops are somewhat increased and extended in length immediately upon cell exposure to CPT. In contrast, persistent Top1ccs reduce the majority of R-loops suggesting that CPT-accumulated aRNAs are not commonly involved in R-loops. The enhancement of aRNAs by Top1ccs is present both in human colon cancer HCT116 cells and WI38 fibroblasts suggesting a common response of cancer and normal cells. Although Top1ccs lead to DSB and DDR kinases activation, we do not detect a dependence of aRNA accumulation on ATM or DNA-PK activation. However, we showed that the cell response to persistent Top1ccs can involve an impairment of aRNA turnover rather than a higher synthesis rate. Finally, a genome-wide analysis shows that persistent Top1ccs also determine an accumulation of sense transcripts at 5’-end gene regions suggesting an increased occurrence of truncated transcripts. Taken together, the results indicate that Top1 may regulate transcription initiation by modulating RNA polymerase-generated negative supercoils, which can in turn favor R-loop formation at promoters, and that transcript accumulation at TSS is a response to persistent transcriptional stress by Top1 poisoning. PMID:26784695

  17. Synergistic transcriptional enhancement does not depend on the number of acidic activation domains bound to the promoter.

    PubMed Central

    Oliviero, S; Struhl, K


    Many eukaryotic transcriptional activator proteins contain a DNA-binding domain that interacts with specific promoter sequences and an acidic activation region that is required to stimulate transcription. Transcriptional enhancement by such activator proteins is often synergistic and promiscuous; promoters containing multiple binding sites for an individual protein or even for unrelated proteins can be 10-100 times more active than promoters with single sites. It has been suggested that such synergy reflects a nonlinear response of the basic transcription machinery to the number and/or quality of acidic activation regions. Here, we determine the transcriptional activity of Jun-Fos heterodimers containing one or two GCN4 acidic activation regions on promoters containing one or two Ap-1 target sites. Surprisingly, heterodimers with one or two acidic regions activate transcription with similar efficiency and are equally synergistic (10- to 15-fold) on promoters containing two target sites. Thus, transcriptional synergy does not depend on the number of acidic activation regions but rather on the number of proteins bound to the promoter. This suggests that synergy is mediated either by cooperative DNA binding or by alternative mechanisms in which the DNA-binding domain plays a more direct role in transcription (e.g., changes in DNA structure, nucleosome displacement, or direct interactions with the transcriptional machinery). Images PMID:1898773

  18. C3 exoenzyme impairs cell proliferation and apoptosis by altering the activity of transcription factors.


    von Elsner, Leonie; Hagemann, Sandra; Just, Ingo; Rohrbeck, Astrid


    C3 exoenzyme from C. botulinum is an ADP-ribosyltransferase that inactivates selectively RhoA, B, and C by coupling an ADP-ribose moiety. Rho-GTPases are involved in various cellular processes, such as regulation of actin cytoskeleton, cell proliferation, and apoptosis. Previous studies of our group with the murine hippocampal cell line HT22 revealed a C3-mediated inhibition of cell proliferation after 48 h and a prevention of serum-starved cells from apoptosis. For both effects, alterations of various signaling pathways are already known, including also changes on the transcriptional level. Investigations on the transcriptional activity in HT22 cells treated with C3 for 48 h identified five out of 48 transcription factors namely Sp1, ATF2, E2F-1, CBF, and Stat6 with a significantly regulated activity. For validation of identified transcription factors, studies on the protein level of certain target genes were performed. Western blot analyses exhibited an enhanced abundance of Sp1 target genes p21 and COX-2 as well as an increase in phosphorylation of c-Jun. In contrast, the level of p53 and apoptosis-inducing GADD153, a target gene of ATF2, was decreased. Our results reveal that C3 regulates the transcriptional activity of Sp1 and ATF2 resulting downstream in an altered protein abundance of various target genes. As the affected proteins are involved in the regulation of cell proliferation and apoptosis, thus the C3-mediated anti-proliferative and anti-apoptotic effects are consequences of the Rho-dependent alterations of the activity of certain transcriptional factors. PMID:27351882

  19. Transcriptional activity around bacterial cell death reveals molecular biomarkers for cell viability

    PubMed Central

    Kort, Remco; Keijser, Bart J; Caspers, Martien PM; Schuren, Frank H; Montijn, Roy


    Background In bacteriology, the ability to grow in selective media and to form colonies on nutrient agar plates is routinely used as a retrospective criterion for the detection of living bacteria. However, the utilization of indicators for bacterial viability-such as the presence of specific transcripts or membrane integrity-would overcome bias introduced by cultivation and reduces the time span of analysis from initiation to read out. Therefore, we investigated the correlation between transcriptional activity, membrane integrity and cultivation-based viability in the Gram-positive model bacterium Bacillus subtilis. Results We present microbiological, cytological and molecular analyses of the physiological response to lethal heat stress under accurately defined conditions through systematic sampling of bacteria from a single culture exposed to gradually increasing temperatures. We identified a coherent transcriptional program including known heat shock responses as well as the rapid expression of a small number of sporulation and competence genes, the latter only known to be active in the stationary growth phase. Conclusion The observed coordinated gene expression continued even after cell death, in other words after all bacteria permanently lost their ability to reproduce. Transcription of a very limited number of genes correlated with cell viability under the applied killing regime. The transcripts of the expressed genes in living bacteria – but silent in dead bacteria-include those of essential genes encoding chaperones of the protein folding machinery and can serve as molecular biomarkers for bacterial cell viability. PMID:19061518

  20. FOXP3 can modulate TAL1 transcriptional activity through interaction with LMO2.


    Fleskens, V; Mokry, M; van der Leun, A M; Huppelschoten, S; Pals, C E G M; Peeters, J; Coenen, S; Cardoso, B A; Barata, J T; van Loosdregt, J; Coffer, P J


    T-cell acute lymphoblastic leukemia (T-ALL) frequently involves aberrant expression of TAL1 (T-cell acute lymphocytic leukemia 1) and LMO2, oncogenic members of the TAL1 transcriptional complex. Transcriptional activity of the TAL1-complex is thought to have a pivotal role in the transformation of thymocytes and is associated with a differentiation block and self-renewal. The transcription factor Forkhead Box P3 (FOXP3) was recently described to be expressed in a variety of malignancies including T-ALL. Here we show that increased FOXP3 levels negatively correlate with expression of genes regulated by the oncogenic TAL1-complex in human T-ALL patient samples as well as a T-ALL cell line ectopically expressing FOXP3. In these cells, FOXP3 expression results in altered regulation of cell cycle progression and reduced cell viability. Finally, we demonstrate that FOXP3 binds LMO2 in vitro, resulting in decreased interaction between LMO2 and TAL1, providing a molecular mechanism for FOXP3-mediated transcriptional modulation in T-ALL. Collectively, our findings provide initial evidence for a novel role of FOXP3 as a tumor suppressor in T-ALL through modulation of TAL1 transcriptional activity. PMID:26686090

  1. Cloning, in vitro transcription, and biological activity of Escherichia coli 23S ribosomal RNA.


    Weitzmann, C J; Cunningham, P R; Ofengand, J


    The 23S rRNA gene was excised from the rrnB operon of pKK3535 and ligated into pUC19 behind the strong class III T7 promoter so that the correct 5' end of mature 23S RNA was produced upon transcription by T7 RNA polymerase. At the 3' end, generation of a restriction site for linearization required the addition of 2 adenosine residues to the mature 23S sequence. In vitro runoff transcripts were indistinguishable from natural 23S RNA in size on denaturing gels and in 5'-terminal sequence. The length and sequence of the 3' terminal T1 fragment was also as expected from the DNA sequence, except that an additional C, A, or U residue was added to 21%, 18%, or 5% of the molecules, respectively. Typical transcription reactions yielded 500-700 moles RNA per mole template. This transcript was used as a substrate for methyl transfer from S-adenosyl methionine catalyzed by Escherichia coli cell extracts. The majority (50-65%) of activity observed in a crude (S30) extract appeared in the post-ribosomal supernatant (S100). Activities catalyzing formation of m5C, m5U, m2G, and m6A residues in the synthetic transcript were observed. PMID:2194163

  2. The Sch9 kinase is a chromatin-associated transcriptional activator of osmostress-responsive genes

    PubMed Central

    Pascual-Ahuir, Amparo; Proft, Markus


    The yeast Sch9 kinase has been implicated in the cellular adjustment to nutrient availability and in the regulation of aging. Here, we define a novel role for Sch9 in the transcriptional activation of osmostress inducible genes. Loss-of-function mutants sch9 are sensitive to hyperosmotic stress and show an impaired transcriptional response upon osmotic shock of several defense genes. We show that Sch9 is required for gene expression regulated by Sko1, a transcription factor, which is directly targeted by the Hog1 MAP kinase. Sch9 interacts in vitro with both Sko1 and Hog1. Additionally, Sch9 phosphorylates Sko1 in vitro. When artificially tethered to promoter DNA, Sch9 strongly activates transcription independently of osmotic stress. Using in vivo chromatin immunoprecipitation, we demonstrate that Sch9 is recruited to the GRE2 and CTT1 genes exclusively under osmostress conditions, and that this recruitment is dependent on Hog1 and Sko1. Furthermore, Sch9 is required for the proper recruitment of Hog1 at the same genes. Our data reveal the complexity of stress-induced transcription by the regulated association of signaling kinases to chromatin. PMID:17568771

  3. Fe65 does not stabilize AICD during activation of transcription in a luciferase assay

    SciTech Connect

    Huysseune, Sandra; Kienlen-Campard, Pascal; Octave, Jean-Noel . E-mail:


    The APP intracellular domain (AICD) could be involved in signaling via interaction with the adaptor protein Fe65, and with the histone acetyl transferase Tip60. However, the real function of AICD and Fe65 in regulation of transcription remains controversial. In this study, the human APPGal4 fusion protein was expressed in CHO cells and the transcriptional activity of AICDGal4 was measured in a luciferase-based reporter assay. AICDGal4 was stabilized by expression of Fe65 and levels of AICDGal4 controlled luciferase activity. On the contrary, when human APP was expressed in CHO cells, coexpression of Fe65 increased luciferase activity without affecting the amount of AICD fragment. AICD produced from APP was protected from degradation by orthophenanthroline, but not by lactacystine, indicating that AICD is not a substrate of the chymotryptic activity of the proteasome. It is concluded that Fe65 can control luciferase activity without stabilizing the labile AICD fragment.

  4. Cyclin D1 stimulation of estrogen receptor transcriptional activity independent of cdk4.

    PubMed Central

    Neuman, E; Ladha, M H; Lin, N; Upton, T M; Miller, S J; DiRenzo, J; Pestell, R G; Hinds, P W; Dowdy, S F; Brown, M; Ewen, M E


    Cyclin D1 plays an important role in the development of breast cancer and is required for normal breast cell proliferation and differentiation associated with pregnancy. We show that ectopic expression of cyclin D1 can stimulate the transcriptional activity of the estrogen receptor in the absence of estradiol and that this activity can be inhibited by 4-hydroxytamoxifen and ICI 182,780. Cyclin D1 can form a specific complex with the estrogen receptor. Stimulation of the estrogen receptor by cyclin D1 is independent of cyclin-dependent kinase 4 activation. Cyclin D1 may manifest its oncogenic potential in breast cancer in part through binding to the estrogen receptor and activation of the transcriptional activity of the receptor. PMID:9271411

  5. Long-term climbing fibre activity induces transcription of microRNAs in cerebellar Purkinje cells.


    Barmack, Neal H; Qian, Zuyuan; Yakhnitsa, Vadim


    Synaptic activation of central neurons is often evoked by electrical stimulation leading to post-tetanic potentiation, long-term potentiation or long-term depression. Even a brief electrical tetanus can induce changes in as many as 100 proteins. Since climbing fibre activity is often associated with cerebellar behavioural plasticity, we used horizontal optokinetic stimulation (HOKS) to naturally increase synaptic input to floccular Purkinje cells in mice for hours, not minutes, and investigated how this activity influenced the transcription of microRNAs, small non-coding nucleotides that reduce transcripts of multiple, complementary mRNAs. A single microRNA can reduce the translation of as many as 30 proteins. HOKS evoked increases in 12 microRNA transcripts in floccular Purkinje cells. One of these microRNAs, miR335, increased 18-fold after 24 h of HOKS. After HOKS stopped, miR335 transcripts decayed with a time constant of approximately 2.5 h. HOKS evoked a 28-fold increase in pri-miR335 transcripts compared with an 18-fold increase in mature miR335 transcripts, confirming that climbing fibre-evoked increases in miR335 could be attributed to increases in transcription. We used three screens to identify potential mRNA targets for miR335 transcripts: (i) nucleotide complementarity, (ii) detection of increased mRNAs following microinjection of miR335 inhibitors into the cerebellum, and (iii) detection of decreased mRNAs following HOKS. Two genes, calbindin and 14-3-3-θ, passed these screens. Transfection of N2a cells with miR335 inhibitors or precursors inversely regulated 14-3-3-θ transcripts. Immunoprecipitation of 14-3-3-θ co-immunoprecipitated PKC-γ and GABAAγ2. Knockdown of either 14-3-3-θ or PKC-γ decreased the serine phosphorylation of GABAAγ2, suggesting that 14-3-3-θ and PKC-γ under the control of miR335 homeostatically regulate the phosphorylation and insertion of GABAAγ2 into the Purkinje cell post-synaptic membrane. PMID:25135969

  6. AKAP-Anchored PKA Maintains Neuronal L-type Calcium Channel Activity and NFAT Transcriptional Signaling

    PubMed Central

    Murphy, Jonathan G.; Sanderson, Jennifer L.; Gorski, Jessica A.; Scott, John D.; Catterall, William A.; Sather, William A.; Dell’Acqua, Mark L.


    Summary In neurons, Ca2+ influx through L-type voltage-gated Ca2+ channels (LTCC) couples electrical activity to changes in transcription. LTCC activity is elevated by the cAMP-dependent protein kinase (PKA) and depressed by the Ca2+-dependent phosphatase calcineurin (CaN), with both enzymes localized to the channel by A-kinase anchoring protein (AKAP) 79/150. AKAP79/150 anchoring of CaN also promotes LTCC activation of transcription through dephosphorylation of the nuclear factor of activated T-cells (NFAT). We report here that genetic disruption of PKA anchoring to AKAP79/150 also interferes with LTCC activation of CaN-NFAT signaling in neurons. Disruption of AKAP-PKA anchoring promoted redistribution of the kinase out of dendritic spines, profound decreases in LTCC phosphorylation and Ca2+ influx, and impaired NFAT movement to the nucleus and activation of transcription. Our findings support a model wherein basal activity of AKAP79/150-anchored PKA opposes CaN to preserve LTCC phosphorylation, thereby sustaining LTCC activation of CaN-NFAT signaling to the neuronal nucleus. PMID:24835999

  7. Identification of functional targets of the Zta transcriptional activator by formation of stable preinitiation complex intermediates.

    PubMed Central

    Lieberman, P


    Transcriptional activator proteins stimulate the formation of a preinitiation complex that may be distinct from a basal-level transcription complex in its composition and stability. Components of the general transcription factors that form activator-dependent stable intermediates were determined by the use of Sarkosyl and oligonucleotide challenge experiments. High-level transcriptional activation by the Epstein-Barr virus-encoded Zta protein required an activity in the TFIID fraction that is distinct from the TATA-binding protein (TBP) and the TBP-associated factors. This additional activity copurifies with and is likely to be identical to the previously defined coactivator, USA (M. Meisterernst, A. L. Roy, H. M. Lieu, and R. G. Roeder, Cell 66:981-994, 1991). The formation of a stable preinitiation complex intermediate resistant to Sarkosyl required the preincubation of the promoter DNA with Zta, holo-TFIID (TBP and TBP-associated factors), TFIIB, TFIIA, and the coactivator USA. The formation of a Zta response element-resistant preinitiation complex required the preincubation of promoter DNA with Zta, holo-TFIID, TFIIB, and TFIIA. Agarose gel electrophoretic mobility shift showed that a preformed Zta-holo-TFIID-TFIIA complex was resistant to Sarkosyl and to Zta response element oligonucleotide challenge. DNase I footprinting suggests that only Zta, holo-TFIID, and TFIIA make significant contacts with the promoter DNA. These results provide functional and physical evidence that the Zta transcriptional activator influences at least two distinct steps in preinitiation complex assembly, the formation of the stable holo-TFIID-TFIIA-promoter complex and the subsequent binding of TFIIB and a USA-like coactivator. Images PMID:7969171

  8. MEIS C termini harbor transcriptional activation domains that respond to cell signaling.


    Huang, He; Rastegar, Mojgan; Bodner, Caroline; Goh, Siew-Lee; Rambaldi, Isabel; Featherstone, Mark


    MEIS proteins form heteromeric DNA-binding complexes with PBX monomers and PBX.HOX heterodimers. We have shown previously that transcriptional activation by PBX.HOX is augmented by either protein kinase A (PKA) or the histone deacetylase inhibitor trichostatin A (TSA). To examine the contribution of MEIS proteins to this response, we used the chromatin immunoprecipitation assay to show that MEIS1 in addition to PBX1, HOXA1, and HOXB1 was recruited to a known PBX.HOX target, the Hoxb1 autoregulatory element following Hoxb1 transcriptional activation in P19 cells. Subsequent to TSA treatment, MEIS1 recruitment lagged behind that of HOX and PBX partners. MEIS1A also enhanced the transcriptional activation of a reporter construct bearing the Hoxb1 autoregulatory element after treatment with TSA. The MEIS1 homeodomain and protein-protein interaction with PBX contributed to this activity. We further mapped TSA-responsive and CREB-binding protein-dependent PKA-responsive transactivation domains to the MEIS1A and MEIS1B C termini. Fine mutation of the 56-residue MEIS1A C terminus revealed four discrete regions required for transcriptional activation function. All of the mutations impairing the response to TSA likewise reduced activation by PKA, implying a common mechanistic basis. C-terminal deletion of MEIS1 impaired transactivation without disrupting DNA binding or complex formation with HOX and PBX. Despite sequence similarity to MEIS and a shared ability to form heteromeric complexes with PBX and HOX partners, the PREP1 C terminus does not respond to TSA or PKA. Thus, MEIS C termini possess transcriptional regulatory domains that respond to cell signaling and confer functional differences between MEIS and PREP proteins. PMID:15654074

  9. Malondialdehyde inhibits an AMPK-mediated nuclear translocation and repression activity of ALDH2 in transcription

    SciTech Connect

    Choi, Ji-Woong; Kim, Jae-Hwan; Cho, Sung-Chun; Ha, Moon-Kyung; Song, Kye-Yong; Youn, Hong-Duk; Park, Sang Chul


    Research highlights: {yields} ALDH2 is an MDA-modified protein in old rat kidney tissues. {yields} AMPK associates with ALDH2 and triggers the nuclear localization of ALDH2. {yields} ALDH2 serves as a general transcriptional repressor by associating with HDACs. {yields} MDA inhibits the AMPK-mediated translocation of ALDH2 and its repression activity. -- Abstract: Aging process results from deleterious damages by reactive oxygen species, in particular, various metabolic aldehydes. Aldehyde dehydrogenase 2 (ALDH2) is one of metabolic enzymes detoxifying various aldehydes under oxidative conditions. AMP-activated protein kinase (AMPK) plays a key role in controlling metabolic process. However, little was known about the relationship of ALDH2 with AMPK under oxidative conditions. Here, we, by using MDA-specific monoclonal antibody, screened the tissues of young and old rats for MDA-modified proteins and identified an ALDH2 as a prominent MDA-modified protein band in the old rat kidney tissue. ALDH2 associates with AMPK and is phosphorylated by AMPK. In addition, AICAR, an activator of AMP-activated protein kinase, induces the nuclear translocation of ALDH2. ALDH2 in nucleus is involved in general transcription repression by association with histone deacetylases. Furthermore, MDA modification inhibited the translocation of ALDH2 and the association with AMPK, and ultimately led to de-repression of transcription in the reporter system analysis. In this study, we have demonstrated that ALDH2 acts as a transcriptional repressor in response to AMPK activation, and MDA modifies ALDH2 and inhibits repressive activity of ALDH2 in general transcription. We thus suggest that increasing amount of MDA during aging process may interrupt the nuclear function of ALDH2, modulated by AMPK.

  10. ADR1-Mediated Transcriptional Activation Requires the Presence of an Intact TFIID Complex†

    PubMed Central

    Komarnitsky, Philip B.; Klebanow, Edward R.; Weil, P. Anthony; Denis, Clyde L.


    The yeast transcriptional activator ADR1, which is required for ADH2 and other genes’ expression, contains four transactivation domains (TADs). While previous studies have shown that these TADs act through GCN5 and ADA2, and presumably TFIIB, other factors are likely to be involved in ADR1 function. In this study, we addressed the question of whether TFIID is also required for ADR1 action. In vitro binding studies indicated that TADI of ADR1 was able to retain TAFII90 from yeast extracts and TADII could retain TBP and TAFII130/145. TADIV, however, was capable of retaining multiple TAFIIs, suggesting that TADIV was binding TFIID from yeast whole-cell extracts. The ability of TADIV truncation derivatives to interact with TFIID correlated with their transcription activation potential in vivo. In addition, the ability of LexA-ADR1-TADIV to activate transcription in vivo was compromised by a mutation in TAFII130/145. ADR1 was found to associate in vivo with TFIID in that immunoprecipitation of either TAFII90 or TBP from yeast whole-cell extracts specifically coimmunoprecipitated ADR1. Most importantly, depletion of TAFII90 from yeast cells dramatically reduced ADH2 derepression. These results indicate that ADR1 physically associates with TFIID and that its ability to activate transcription requires an intact TFIID complex. PMID:9742103

  11. Ligand induction of a transcriptionally active thyroid hormone receptor coactivator complex.

    PubMed Central

    Fondell, J D; Ge, H; Roeder, R G


    Transcriptional regulation by nuclear hormone receptors is thought to involve interactions with putative cofactors that may potentiate receptor function. Here we show that human thyroid hormone receptor alpha purified from HeLa cells grown in the presence of thyroid hormone (T3) is associated with a group of distinct nuclear proteins termed thyroid hormone receptor-associated proteins (TRAPs). In an in vitro system reconstituted with general initiation factors and cofactors (and in the absence of added T3), the "liganded" thyroid hormone receptor (TR)/TRAP complex markedly activates transcription from a promoter template containing T3-response elements. Moreover, whereas the retinoid X receptor is not detected in the TR/TRAP complex, its presence is required for the function of the complex. In contrast, human thyroid hormone receptor alpha purified from cells grown in the absence of T3 lacks the TRAPs and effects only a low level of activation that is dependent on added ligand. These findings demonstrate the ligand-dependent in vivo formation of a transcriptionally active TR-multisubunit protein complex and suggest a role for TRAPs as positive coactivators for gene-specific transcriptional activation. Images Fig. 2 Fig. 3 Fig. 4 Fig. 5 Fig. 6 PMID:8710870

  12. A physical model for the translocation and helicase activities of Escherichia coli transcription termination protein Rho.

    PubMed Central

    Geiselmann, J; Wang, Y; Seifried, S E; von Hippel, P H


    Transcription termination protein Rho of Escherichia coli interacts with newly synthesized RNA chains and brings about their release from elongation complexes paused at specific Rho-dependent termination sites. Rho is thought to accomplish this by binding to a specific Rho "loading site" on the nascent RNA and then translocating preferentially along the transcript in a 5'-->3' direction. On reaching the elongation complex, Rho releases the nascent RNA by a 5'-->3' RNA.DNA helicase activity. These translocation and helicase activities are driven by the RNA-dependent ATPase activity of Rho. In this paper we propose a mechanism for these processes that is based on the structure and properties of the Rho protein. Rho is a hexamer of identical subunits that are arranged as a trimer of asymmetric dimers with D3 symmetry. The binding of ATP and RNA to Rho also reflects this pattern; the Rho hexamer carries three strong and three weak binding sites for each of these entities. The asymmetric dimers of Rho correspond to functional dimers that can undergo conformational transitions driven by ATP hydrolysis. We propose that the quaternary structure of Rho coordinates the ATP-driven RNA binding and release processes to produce a biased random walk of the Rho hexamer along the RNA, followed by RNA.DNA helicase activity and transcript release. The proposed model may have implications for other hexameric DNA.DNA, RNA.DNA, and RNA.RNA helicases that function in replication and transcription. Images Fig. 2 PMID:7689228

  13. Butyrate-induced changes in nuclease sensitivity of chromatin cannot be correlated with transcriptional activation

    SciTech Connect

    Birren, B.W.; Taplitz, S.J.; Herschman, H.R.


    The authors examined in the H4IIE rat heptoma cell line the relationship between butyrate-induced changes in the nuclease sensitivity of chromatin and changes in transcriptional activity of specific genes. The butyrate-inducible metallothionein I (MT-I) gene underwent a dramatic increase in DNase I sensitivity after 3 h of butyrate treatment. However, genes not transcribed in H4IIE cells underwent the same changes in DNase I sensitivity. Thus, butyrate-induced increases in DNase I sensitivity are not sufficient for the transcriptional activation of a gene. Butyrate treatment has also been reported to alter the sensitivity of sequence to micrococcal nuclease (MNase) in a manner reflecting their tissue-specific expression. Butyrate exposure caused increased digestion of the MT-I gene by MNase. However, butyrate-induced MNase sensitivity also occurred for genes which are neither transcribed in untreated cells nor butyrate inducible. Moreover, cadmium, a potent transcriptional activator of the MT-I gene, does not alter the sensitivity of the MT-I gene to MNase. Thus, the butyrate-induced alterations in MNase sensitivity are neither sufficient for, necessary for, nor indicative of transcriptional activation.

  14. Different functional modes of p300 in activation of RNA polymerase III transcription from chromatin templates.


    Mertens, Claudia; Roeder, Robert G


    Transcriptional coactivators that regulate the activity of human RNA polymerase III (Pol III) in the context of chromatin have not been reported. Here, we describe a completely defined in vitro system for transcription of a human tRNA gene assembled into a chromatin template. Transcriptional activation and histone acetylation in this system depend on recruitment of p300 by general initiation factor TFIIIC, thus providing a new paradigm for recruitment of histone-modifying coactivators. Beyond its role as a chromatin-modifying factor, p300 displays an acetyltransferase-independent function at the level of preinitiation complex assembly. Thus, direct interaction of p300 with TFIIIC stabilizes binding of TFIIIC to core promoter elements and results in enhanced transcriptional activity on histone-free templates. Additional studies show that p300 is recruited to the promoters of actively transcribed tRNA and U6 snRNA genes in vivo. These studies identify TFIIIC as a recruitment factor for p300 and thus may have important implications for the emerging concept that tRNA genes or TFIIIC binding sites act as chromatin barriers to prohibit spreading of silenced heterochromatin domains. PMID:18644873

  15. Different Functional Modes of p300 in Activation of RNA Polymerase III Transcription from Chromatin Templates▿

    PubMed Central

    Mertens, Claudia; Roeder, Robert G.


    Transcriptional coactivators that regulate the activity of human RNA polymerase III (Pol III) in the context of chromatin have not been reported. Here, we describe a completely defined in vitro system for transcription of a human tRNA gene assembled into a chromatin template. Transcriptional activation and histone acetylation in this system depend on recruitment of p300 by general initiation factor TFIIIC, thus providing a new paradigm for recruitment of histone-modifying coactivators. Beyond its role as a chromatin-modifying factor, p300 displays an acetyltransferase-independent function at the level of preinitiation complex assembly. Thus, direct interaction of p300 with TFIIIC stabilizes binding of TFIIIC to core promoter elements and results in enhanced transcriptional activity on histone-free templates. Additional studies show that p300 is recruited to the promoters of actively transcribed tRNA and U6 snRNA genes in vivo. These studies identify TFIIIC as a recruitment factor for p300 and thus may have important implications for the emerging concept that tRNA genes or TFIIIC binding sites act as chromatin barriers to prohibit spreading of silenced heterochromatin domains. PMID:18644873

  16. Orientation of functional activating regions in the Escherichia coli CRP protein during transcription activation at class II promoters.

    PubMed Central

    Williams, R M; Rhodius, V A; Bell, A I; Kolb, A; Busby, S J


    At class II CRP-dependent promoters the DNA site for CRP overlaps the DNA site for RNA polymerase, covering the -35 region. Transcription activation at class II CRP- dependent promoters requires a contact between an activating region in the upstream subunit of the bound CRP dimer and a contact site in the C-terminal domain of the alpha-subunit of RNA polymerase. Transcription activation is suppressed by amino acid substitutions in the activating region, but activation can be restored by second site substitutions at K52 or E96. These substitutions identify two separate regions on the surface of CRP that appear to be able to interact with RNA polymerase specifically at class II promoters. Using the method of 'oriented heterodimers' we show that these alternative activating regions are functional in the downstream subunit of the bound CRP dimer. PMID:8604346

  17. Free radical activity of industrial fibers: role of iron in oxidative stress and activation of transcription factors.

    PubMed Central

    Gilmour, P S; Brown, D M; Beswick, P H; MacNee, W; Rahman, I; Donaldson, K


    We studied asbestos, vitreous fiber (MMVF10), and refractory ceramic fiber (RCF1) from the Thermal Insulation Manufacturers' Association fiber repository regarding the following: free radical damage to plasmid DNA, iron release, ability to deplete glutathione (GSH), and activate redox-sensitive transcription factors in macrophages. Asbestos had much more free radical activity than any of the man-made vitreous fibers. More Fe3+ was released than Fe2+ and more of both was released at pH 4.5 than at pH 7.2. Release of iron from the different fibers was generally not a good correlate of ability to cause free radical injury to the plasmid DNA. All fiber types caused some degree of oxidative stress, as revealed by depletion of intracellular GSH. Amosite asbestos upregulated nuclear binding of activator protein 1 transcription factor to a greater level than MMVF10 and RCF1; long-fiber amosite was the only fiber to enhance activation of the transcription factor nuclear factor kappa B (NF kappa B). The use of cysteine methyl ester and buthionine sulfoximine to modulate GSH suggested that GSH homeostasis was important in leading to activation of transcription factors. We conclude that the intrinsic free radical activity is the major determinant of transcription factor activation and therefore gene expression in alveolar macrophages. Although this was not related to iron release or ability to deplete macrophage GSH at 4 hr, GSH does play a role in activation of NF kappa B. Images Figure 1. Figure 5. A Figure 5. B Figure 6. A Figure 6. B PMID:9400744

  18. Transcriptional activation of peroxisome proliferator-activated receptor-{gamma} requires activation of both protein kinase A and Akt during adipocyte differentiation

    SciTech Connect

    Kim, Sang-pil; Ha, Jung Min; Yun, Sung Ji; Kim, Eun Kyoung; Chung, Sung Woon; Hong, Ki Whan; Kim, Chi Dae; Bae, Sun Sik


    Research highlights: {yields} Elevated cAMP activates both PKA and Epac. {yields} PKA activates CREB transcriptional factor and Epac activates PI3K/Akt pathway via Rap1. {yields} Akt modulates PPAR-{gamma} transcriptional activity in concert with CREB. -- Abstract: Peroxisome proliferator-activated receptor-{gamma} (PPAR-{gamma}) is required for the conversion of pre-adipocytes. However, the mechanism underlying activation of PPAR-{gamma} is unclear. Here we showed that cAMP-induced activation of protein kinase A (PKA) and Akt is essential for the transcriptional activation of PPAR-{gamma}. Hormonal induction of adipogenesis was blocked by a phosphatidylinositol 3-kinase (PI3K) inhibitor (LY294002), by a protein kinase A (PKA) inhibitor (H89), and by a Rap1 inhibitor (GGTI-298). Transcriptional activity of PPAR-{gamma} was markedly enhanced by 3-isobutyl-1-methylxanthine (IBMX), but not insulin and dexamethasone. In addition, IBMX-induced PPAR-{gamma} transcriptional activity was blocked by PI3K/Akt, PKA, or Rap1 inhibitors. 8-(4-Chlorophenylthio)-2'-O-methyl-cAMP (8-pCPT-2'-O-Me-cAMP) which is a specific agonist for exchanger protein directly activated by cAMP (Epac) significantly induced the activation of Akt. Furthermore, knock-down of Akt1 markedly attenuated PPAR-{gamma} transcriptional activity. These results indicate that both PKA and Akt signaling pathways are required for transcriptional activation of PPAR-{gamma}, suggesting post-translational activation of PPAR-{gamma} might be critical step for adipogenic gene expression.

  19. Acetylation-deacetylation of the transcription factor Nrf2 (nuclear factor erythroid 2-related factor 2) regulates its transcriptional activity and nucleocytoplasmic localization.


    Kawai, Yumiko; Garduño, Lakisha; Theodore, Melanie; Yang, Jianqi; Arinze, Ifeanyi J


    Activation of Nrf2 by covalent modifications that release it from its inhibitor protein Keap1 has been extensively documented. In contrast, covalent modifications that may regulate its action after its release from Keap1 have received little attention. Here we show that CREB-binding protein induced acetylation of Nrf2, increased binding of Nrf2 to its cognate response element in a target gene promoter, and increased Nrf2-dependent transcription from target gene promoters. Heterologous sirtuin 1 (SIRT1) decreased acetylation of Nrf2 as well as Nrf2-dependent gene transcription, and its effects were overridden by dominant negative SIRT1 (SIRT1-H355A). The SIRT1-selective inhibitors EX-527 and nicotinamide stimulated Nrf2-dependent gene transcription, whereas resveratrol, a putative activator of SIRT1, was inhibitory, mimicking the effect of SIRT1. Mutating lysine to alanine or to arginine at Lys(588) and Lys(591) of Nrf2 resulted in decreased Nrf2-dependent gene transcription and abrogated the transcription-activating effect of CREB-binding protein. Furthermore, SIRT1 had no effect on transcription induced by these mutants, indicating that these sites are acetylation sites. Microscope imaging of GFP-Nrf2 in HepG2 cells as well as immunoblotting for Nrf2 showed that acetylation conditions resulted in increased nuclear localization of Nrf2, whereas deacetylation conditions enhanced its cytoplasmic rather than its nuclear localization. We posit that Nrf2 in the nucleus undergoes acetylation, resulting in binding, with basic-region leucine zipper protein(s), to the antioxidant response element and consequently in gene transcription, whereas deacetylation disengages it from the antioxidant response element, thereby resulting in transcriptional termination and subsequently in its nuclear export. PMID:21196497

  20. A conserved role for Snail as a potentiator of active transcription

    PubMed Central

    Rembold, Martina; Ciglar, Lucia; Yáñez-Cuna, J. Omar; Zinzen, Robert P.; Girardot, Charles; Jain, Ankit; Welte, Michael A.; Stark, Alexander; Leptin, Maria; Furlong, Eileen E.M.


    The transcription factors of the Snail family are key regulators of epithelial–mesenchymal transitions, cell morphogenesis, and tumor metastasis. Since its discovery in Drosophila ∼25 years ago, Snail has been extensively studied for its role as a transcriptional repressor. Here we demonstrate that Drosophila Snail can positively modulate transcriptional activation. By combining information on in vivo occupancy with expression profiling of hand-selected, staged snail mutant embryos, we identified 106 genes that are potentially directly regulated by Snail during mesoderm development. In addition to the expected Snail-repressed genes, almost 50% of Snail targets showed an unanticipated activation. The majority of “Snail-activated” genes have enhancer elements cobound by Twist and are expressed in the mesoderm at the stages of Snail occupancy. Snail can potentiate Twist-mediated enhancer activation in vitro and is essential for enhancer activity in vivo. Using a machine learning approach, we show that differentially enriched motifs are sufficient to predict Snail's regulatory response. In silico mutagenesis revealed a likely causative motif, which we demonstrate is essential for enhancer activation. Taken together, these data indicate that Snail can potentiate enhancer activation by collaborating with different activators, providing a new mechanism by which Snail regulates development. PMID:24402316

  1. Transcriptional Analysis of a Dehalococcoides-Containing Microbial Consortium Reveals Prophage Activation

    PubMed Central

    Waller, Alison S.; Hug, Laura A.; Mo, Kaiguo; Radford, Devon R.; Maxwell, Karen L.


    Chlorinated solvents are among the most prevalent groundwater contaminants in the industrialized world. Biodegradation with Dehalococcoides-containing mixed cultures is an effective remediation technology. To elucidate transcribed genes in a Dehalococcoides-containing mixed culture, a shotgun metagenome microarray was created and used to investigate gene transcription during vinyl chloride (VC) dechlorination and during starvation (no chlorinated compounds) by a microbial enrichment culture called KB-1. In both treatment conditions, methanol was amended as an electron donor. Subsequently, spots were sequenced that contained the genes most differentially transcribed between the VC-degrading and methanol-only conditions, as well as spots with the highest intensities. Sequencing revealed that during VC degradation Dehalococcoides genes involved in transcription, translation, metabolic energy generation, and amino acid and lipid metabolism and transport were overrepresented in the transcripts compared to the average Dehalococcoides genome. KB-1 rdhA14 (vcrA) was the only reductive dehalogenase homologous (RDH) gene with higher transcript levels during VC degradation, while multiple RDH genes had higher transcript levels in the absence of VC. Numerous hypothetical genes from Dehalococcoides also had higher transcript levels in methanol-only treatments, indicating that many uncharacterized proteins are involved in cell maintenance in the absence of chlorinated substrates. In addition, microarray results prompted biological experiments confirming that electron acceptor limiting conditions activated a Dehalococcoides prophage. Transcripts from Spirochaetes, Chloroflexi, Geobacter, and methanogens demonstrate the importance of non-Dehalococcoides organisms to the culture, and sequencing of identified shotgun clones of interest provided information for follow-on targeted studies. PMID:22179237

  2. Commensal Streptococcus salivarius Modulates PPARγ Transcriptional Activity in Human Intestinal Epithelial Cells

    PubMed Central

    Couvigny, Benoît; de Wouters, Tomas; Kaci, Ghalia; Jacouton, Elsa; Delorme, Christine; Doré, Joël; Renault, Pierre; Blottière, Hervé M.


    The impact of commensal bacteria in eukaryotic transcriptional regulation has increasingly been demonstrated over the last decades. A multitude of studies have shown direct effects of commensal bacteria from local transcriptional activity to systemic impact. The commensal bacterium Streptococcus salivarius is one of the early bacteria colonizing the oral and gut mucosal surfaces. It has been shown to down-regulate nuclear transcription factor (NF-кB) in human intestinal cells, a central regulator of the host mucosal immune system response to the microbiota. In order to evaluate its impact on a further important transcription factor shown to link metabolism and inflammation in the intestine, namely PPARγ (peroxisome proliferator-activated receptor), we used human intestinal epithelial cell-lines engineered to monitor PPARγ transcriptional activity in response to a wide range of S. salivarius strains. We demonstrated that different strains from this bacterial group share the property to inhibit PPARγ activation independently of the ligand used. First attempts to identify the nature of the active compounds showed that it is a low-molecular-weight, DNase-, proteases- and heat-resistant metabolite secreted by S. salivarius strains. Among PPARγ-targeted metabolic genes, I-FABP and Angptl4 expression levels were dramatically reduced in intestinal epithelial cells exposed to S. salivarius supernatant. Both gene products modulate lipid accumulation in cells and down-regulating their expression might consequently affect host health. Our study shows that species belonging to the salivarius group of streptococci impact both host inflammatory and metabolic regulation suggesting a possible role in the host homeostasis and health. PMID:25946041

  3. Commensal Streptococcus salivarius Modulates PPARγ Transcriptional Activity in Human Intestinal Epithelial Cells.


    Couvigny, Benoît; de Wouters, Tomas; Kaci, Ghalia; Jacouton, Elsa; Delorme, Christine; Doré, Joël; Renault, Pierre; Blottière, Hervé M; Guédon, Eric; Lapaque, Nicolas


    The impact of commensal bacteria in eukaryotic transcriptional regulation has increasingly been demonstrated over the last decades. A multitude of studies have shown direct effects of commensal bacteria from local transcriptional activity to systemic impact. The commensal bacterium Streptococcus salivarius is one of the early bacteria colonizing the oral and gut mucosal surfaces. It has been shown to down-regulate nuclear transcription factor (NF-кB) in human intestinal cells, a central regulator of the host mucosal immune system response to the microbiota. In order to evaluate its impact on a further important transcription factor shown to link metabolism and inflammation in the intestine, namely PPARγ (peroxisome proliferator-activated receptor), we used human intestinal epithelial cell-lines engineered to monitor PPARγ transcriptional activity in response to a wide range of S. salivarius strains. We demonstrated that different strains from this bacterial group share the property to inhibit PPARγ activation independently of the ligand used. First attempts to identify the nature of the active compounds showed that it is a low-molecular-weight, DNase-, proteases- and heat-resistant metabolite secreted by S. salivarius strains. Among PPARγ-targeted metabolic genes, I-FABP and Angptl4 expression levels were dramatically reduced in intestinal epithelial cells exposed to S. salivarius supernatant. Both gene products modulate lipid accumulation in cells and down-regulating their expression might consequently affect host health. Our study shows that species belonging to the salivarius group of streptococci impact both host inflammatory and metabolic regulation suggesting a possible role in the host homeostasis and health. PMID:25946041

  4. Novel Mechanism for Regulation of Extracellular SOD Transcription and Activity by Copper: Role of Antioxidant-1

    PubMed Central

    Itoh, Shinichi; Ozumi, Kiyoshi; Kim, Ha Won; Nakagawa, Osamu; McKinney, Ronald D.; Folz, Rodney J.; Zelko, Igor N.; Ushio-Fukai, Masuko; Fukai, Tohru


    Extracellular superoxide dismutase (SOD3), a secretory copper-containing antioxidant enzyme, plays an important role in various oxidative stress-dependent cardiovascular diseases. Although cofactor copper is required for SOD3 activity, it remains unknown whether it can regulate SOD3 transcription. We previously demonstrated that SOD3 activity requires the copper chaperone Antioxidant-1 (Atox1) involved in copper delivery to SOD3 at the trans-Golgi network (TGN). Here we show that copper treatment in mouse fibroblasts significantly increases mRNA and protein levels of SOD3, but not SOD1, which is abolished in Atox1-deficient cells. Copper promotes Atox1 translocation to the nucleus. Promoter deletion analysis identifies copper- and Atox1-response element (RE) at the SOD3 promoter. Gel shift and ChIP assays reveal that Atox1 directly binds to the Atox1-RE in a copper-dependent manner in vitro and in vivo. Adenovirus-mediated re-expression in Atox1-/- cells with nucleus-targeted Atox1 (Atox1-NLS), but not TGN-targeted Atox1 (Atox1-TGN), increases SOD3 transcription without affecting SOD3 activity. Importantly, re-expression of both Atox1-NLS and Atox1-TGN together, but not either alone, in Atox1-/- cells increases SOD3 activity. SOD3 transcription is positively regulated by copper through transcription factor function of Atox1, while full activity of SOD3 requires both copper chaperone and transcription factor function of Atox1. Thus, Atox1 is a potential therapeutic target for oxidant stress-dependent cardiovascular disease. PMID:18977292

  5. Inhibition of p53 transcriptional activity by human cytomegalovirus UL44.


    Kwon, Yejin; Kim, Mi-Na; Young Choi, Eun; Heon Kim, Jung; Hwang, Eung-Soo; Cha, Chang-Yong


    Human cytomegalovirus (HCMV) stimulates cellular synthesis of DNA and proteins and induces transition of the cell cycle from G(1) to S and G(2) /M phase, in spite of increased amounts of p53 in the infected cells. The immediate early protein IE2-86  kDa (IE86) tethers a transcriptional repression domain to p53; however, its repression of p53 function is not enough to abrogate the G(1) checkpoint function of p53. Other HCMV proteins that suppress the activity of p53 were investigated in this study. Of the HCMV proteins that bind to p53 when assessed by immunoprecipitation and immunoblot analysis, HCMV UL44 was chosen as a candidate protein. It was found that reporter gene containing p53 consensus sequence was activated by transfection with wild type p53, but when plasmids of p53 with IE86 or UL44 were co-transfected, p53 transcriptional activity was decreased to 3-7% of the p53 control in a dose-dependent manner. When the deletion mutant of UL44 was co-transected with p53, the carboxyl one-third portion of UL44 had little effect on inhibition of p53 transcriptional activity. The amount of mRNA p21 was measured in H1299 by real time PCR after transfection of the combination of p53 and UL44 vectors and it was found that p21 transcription by p53 was inhibited dose-dependently by UL44. Increased G0/G1 and decreased S phases in p53 wild type-transfected H1299 cells were recovered to the level of p53 mutant type-transfected ones by the additional transfection of UL44 in a dose-dependent manner. In conclusion, the transcriptional activity of p53 is suppressed by UL44 as well as by IE86. PMID:22376288

  6. The functional subunit of a dimeric transcription activator protein depends on promoter architecture.

    PubMed Central

    Zhou, Y; Pendergrast, P S; Bell, A; Williams, R; Busby, S; Ebright, R H


    In Class I CAP-dependent promoters, the DNA site for CAP is located upstream of the DNA site for RNA polymerase. In Class II CAP-dependent promoters, the DNA site for CAP overlaps the DNA site for RNA polymerase, replacing the -35 site. We have used an 'oriented heterodimers' approach to identify the functional subunit of CAP at two Class I promoters having different distances between the DNA sites for CAP and RNA polymerase [CC(-61.5) and CC(-72.5)] and at one Class II promoter [CC(-41.5)]. Our results indicate that transcription activation at Class I promoters, irrespective of the distance between the DNA sites for CAP and RNA polymerase, requires the activating region of the promoter-proximal subunit of CAP. In striking contrast, our results indicate that transcription activation at Class II promoters requires the activating region of the promoter-distal subunit of CAP. Images PMID:7925296

  7. Nitric Oxide Is a Signal for NNR-Mediated Transcription Activation in Paracoccus denitrificans

    PubMed Central

    Van Spanning, Rob J. M.; Houben, Edith; Reijnders, Willem N. M.; Spiro, Stephen; Westerhoff, Hans V.; Saunders, Neil


    By using the ′lacZ gene, the activities of the nirI, nirS, and norC promoters were assayed in the wild type and in NNR-deficient mutants of Paracoccus denitrificans grown under various growth conditions. In addition, induction profiles of the three promoters in response to the presence of various nitrogenous oxides were determined. Transcription from the three promoters required the absence of oxygen and the presence both of the transcriptional activator NNR and of nitric oxide. The activity of the nnr promoter itself was halved after the cells had been switched from aerobic respiration to denitrification. This response was apparently not a result of autoregulation or of regulation by FnrP, since the nnr promoter was as active in the wild-type strain as it was in NNR- or FnrP-deficient mutants. PMID:10383987

  8. The activation-induced cytidine deaminase (AID) efficiently targets DNA in nucleosomes but only during transcription

    PubMed Central

    Shen, Hong Ming; Poirier, Michael G.; Allen, Michael J.; North, Justin; Lal, Ratnesh; Widom, Jonathan


    The activation-induced cytidine deaminase (AID) initiates somatic hypermutation, class-switch recombination, and gene conversion of immunoglobulin genes. In vitro, AID has been shown to target single-stranded DNA, relaxed double-stranded DNA, when transcribed, or supercoiled DNA. To simulate the in vivo situation more closely, we have introduced two copies of a nucleosome positioning sequence, MP2, into a supercoiled AID target plasmid to determine where around the positioned nucleosomes (in the vicinity of an ampicillin resistance gene) cytidine deaminations occur in the absence or presence of transcription. We found that without transcription nucleosomes prevented cytidine deamination by AID. However, with transcription AID readily accessed DNA in nucleosomes on both DNA strands. The experiments also showed that AID targeting any DNA molecule was the limiting step, and they support the conclusion that once targeted to DNA, AID acts processively in naked DNA and DNA organized within transcribed nucleosomes. PMID:19380635

  9. A transcription activator-like effector induction system mediated by proteolysis

    PubMed Central

    Copeland, Matthew F.; Politz, Mark C.; Johnson, Charles B.; Markley, Andrew L.; Pfleger, Brian F.


    Simple and predictable trans-acting regulatory tools are needed in the fields of synthetic biology and metabolic engineering to build complex genetic circuits and optimize the levels of native and heterologous gene products. Transcription activator-like effectors (TALEs) are bacterial virulence factors that have recently gained traction in biotechnology applications due to their customizable DNA binding specificity. In this work we expand the versatility of these transcription factors to create an inducible TALE system by inserting tobacco-etch virus (TEV) protease recognition sites into the TALE backbone. The resulting engineered TALEs maintain transcriptional repression of their target genes in Escherichia coli, but are degraded following the induction of the TEV protease, thereby promoting expression of the previously repressed target gene of interest. This TALE-TEV technology enables both repression and induction of plasmid or chromosomal target genes in a manner analogous to traditional repressor proteins but with the added flexibility of being operator agnostic. PMID:26854666

  10. Occludin controls HIV transcription in brain pericytes via regulation of SIRT-1 activation.


    Castro, Victor; Bertrand, Luc; Luethen, Mareen; Dabrowski, Sebastian; Lombardi, Jorge; Morgan, Laura; Sharova, Natalia; Stevenson, Mario; Blasig, Ingolf E; Toborek, Michal


    HIV invades the brain early after infection; however, its interactions with the cells of the blood-brain barrier (BBB) remain poorly understood. Our goal was to evaluate the role of occludin, one of the tight junction proteins that regulate BBB functions in HIV infection of BBB pericytes. We provide evidence that occludin levels largely control the metabolic responses of human pericytes to HIV. Occludin in BBB pericytes decreased by 10% during the first 48 h after HIV infection, correlating with increased nuclear translocation of the gene repressor C-terminal-binding protein (CtBP)-1 and NFκB-p65 activation. These changes were associated with decreased expression and activation of the class III histone deacetylase sirtuin (SIRT)-1. Occludin levels recovered 96 h after infection, restoring SIRT-1 and reducing HIV transcription to 20% of its highest values. We characterized occludin biochemically as a novel NADH oxidase that controls the expression and activation of SIRT-1. The inverse correlation between occludin and HIV transcription was then replicated in human primary macrophages and differentiated monocytic U937 cells, in which occludin silencing resulted in 75 and 250% increased viral transcription, respectively. Our work shows that occludin has previously unsuspected metabolic properties and is a target of HIV infection, opening the possibility of designing novel pharmacological approaches to control HIV transcription. PMID:26601824

  11. Multiple mechanisms contribute to the activation of RNA polymerase III transcription in cells transformed by papovaviruses.


    Felton-Edkins, Zoë A; White, Robert J


    RNA polymerase (pol) III transcription is abnormally active in fibroblasts transformed by polyomavirus (Py) or simian virus 40 (SV40). Several distinct mechanisms contribute to this effect. In untransformed fibroblasts, the basal pol III transcription factor (TF) IIIB is repressed through association with the retinoblastoma protein RB; this restraint is overcome by large T antigens of Py and SV40. Furthermore, cells transformed by these papovaviruses overexpress the BDP1 subunit of TFIIIB, at both the protein and mRNA levels. Despite the overexpression of BDP1, the abundance of the other TFIIIB components is unperturbed following papovavirus transformation. In contrast, mRNAs encoding all five subunits of the basal factor TFIIIC2 are found at elevated levels in fibroblasts transformed by Py or SV40. Thus, both papovaviruses stimulate pol III transcription by boosting production of selected components of the basal machinery. Py differs from SV40 in encoding a highly oncogenic middle T antigen that localizes outside the nucleus and activates several signal transduction pathways. Middle T can serve as a potent activator of a pol III reporter in transfected cells. Several distinct mechanisms therefore contribute to the high levels of pol III transcription that accompany transformation by Py and SV40. PMID:12370195

  12. Insight into GATA1 transcriptional activity through interrogation of cis elements disrupted in human erythroid disorders

    PubMed Central

    Wakabayashi, Aoi; Ulirsch, Jacob C.; Ludwig, Leif S.; Fiorini, Claudia; Yasuda, Makiko; Choudhuri, Avik; McDonel, Patrick; Zon, Leonard I.; Sankaran, Vijay G.


    Whole-exome sequencing has been incredibly successful in identifying causal genetic variants and has revealed a number of novel genes associated with blood and other diseases. One limitation of this approach is that it overlooks mutations in noncoding regulatory elements. Furthermore, the mechanisms by which mutations in transcriptional cis-regulatory elements result in disease remain poorly understood. Here we used CRISPR/Cas9 genome editing to interrogate three such elements harboring mutations in human erythroid disorders, which in all cases are predicted to disrupt a canonical binding motif for the hematopoietic transcription factor GATA1. Deletions of as few as two to four nucleotides resulted in a substantial decrease (>80%) in target gene expression. Isolated deletions of the canonical GATA1 binding motif completely abrogated binding of the cofactor TAL1, which binds to a separate motif. Having verified the functionality of these three GATA1 motifs, we demonstrate strong evolutionary conservation of GATA1 motifs in regulatory elements proximal to other genes implicated in erythroid disorders, and show that targeted disruption of such elements results in altered gene expression. By modeling transcription factor binding patterns, we show that multiple transcription factors are associated with erythroid gene expression, and have created predictive maps modeling putative disruptions of their binding sites at key regulatory elements. Our study provides insight into GATA1 transcriptional activity and may prove a useful resource for investigating the pathogenicity of noncoding variants in human erythroid disorders. PMID:27044088

  13. Activation of the SMU.1882 transcription by CovR in Streptococcus mutans.


    Chong, Patrick; Chattoraj, Partho; Biswas, Indranil


    In Streptococcus mutans, the global response regulator CovR plays an important role in biofilm formation, stress-tolerance response, and caries production. We have previously shown that CovR acts as a transcriptional repressor by binding to the upstream promoter regions of its target genes. Here, we report that in vivo, CovR activates the transcription of SMU.1882, which encodes a small peptide containing a double-glycine motif. We also show that SMU.1882 is transcriptionally linked to comA that encodes a putative ABC transporter protein. Several genes from man gene clusters that encode mannose phosphotranferase system flank SMU.1882 -comA genes. Genomic comparison with other streptococci indicates that SMU.1882 is uniquely present in S. mutans, while the man operon is conserved among all streptococci, suggesting that a genetic rearrangement might have taken place at this locus. With the use of a transcriptional reporter system and semi-quantitative RT-PCR, we demonstrated the transcriptional regulation of SMU.1882 by CovR. In vitro gel shift and DNase I foot-printing analyses with purified CovR suggest that CovR binds to a large region surrounding the -10 region of the P(1882). Using this information and comparing with other CovR regulated promoters, we have developed a putative consensus binding sequence for CovR. Although CovR binds to P(1882), in vitro experiments using purified S. mutans RpoD, E. coli RNA polymerase, and CovR did not activate transcription from this promoter. Thus, we speculate that in vivo, CovR may interfere with the binding of a repressor or requires a cofactor. PMID:21124877

  14. The HIV-1 Tat Protein Has a Versatile Role in Activating Viral Transcription

    PubMed Central

    Das, Atze T.; Harwig, Alex; Berkhout, Ben


    It is generally acknowledged that the Tat protein has a pivotal role in HIV-1 replication because it stimulates transcription from the viral long terminal repeat (LTR) promoter by binding to the TAR hairpin in the nascent RNA transcript. However, a multitude of additional Tat functions have been suggested. The importance of these functions is difficult to assess in replication studies with Tat-mutated HIV-1 variants because of the dominant negative effect on viral gene expression. We therefore used an HIV-1 construct that does not depend on the Tat-TAR interaction for transcription to reevaluate whether or not Tat has a second essential function in HIV-1 replication. This HIV-rtTA variant uses the incorporated Tet-On gene expression system for activation of transcription and replicates efficiently upon complete TAR deletion. Here we demonstrated that Tat inactivation does nevertheless severely inhibit replication. Upon long-term culturing, the Tat-minus HIV-rtTA variant acquired mutations in the U3 region that improved promoter activity and reestablished replication. We showed that in the absence of a functional TAR, Tat remains important for viral transcription via Sp1 sequence elements in the U3 promoter region. Substitution of these U3 sequences with nonrelated promoter elements created a virus that replicates efficiently without Tat in SupT1 T cells. These results indicate that Tat has a versatile role in transcription via TAR and U3 elements. The results also imply that Tat has no other essential function in viral replication in cultured T cells. PMID:21752913

  15. Mitochondrial dysfunction induces SESN2 gene expression through Activating Transcription Factor 4.


    Garaeva, Alisa A; Kovaleva, Irina E; Chumakov, Peter M; Evstafieva, Alexandra G


    We found that inhibitors of mitochondrial respiratory chain complexes III (myxothiazol) and I (piericidin A) in some epithelial carcinoma cell lines induce transcription of the p53-responsive SESN2 gene that plays an important role in stress response and homeostatic regulation. However, the effect did not depend on p53 because i) there was no induction of p53 after the treatment with piericidin A; ii) after the treatment with myxothiazol the peak of SESN2 gene upregulation occurred as early as 5h, before the onset of p53 activation (13h); iii) a supplementation with uridine that abolishes the p53 activation in response to myxothiazol did not abrogate the induction of SESN2 transcripts; iv) in the p53 negative HCT116 p53 -/- cells SESN2 transcription could be also induced by myxothiazol. In response to the respiratory chain inhibitors we observed an induction of ATF4, the key transcription factor of the integrated stress response (ISR). We found that the induction of SESN2 transcripts could be prevented by the ISR inhibitory small molecule ISRIB. Also, by inhibiting or overexpressing ATF4 with specific shRNA or ATF4-expressing constructs, respectively, we have confirmed the role of ATF4 in the SESN2 gene upregulation induced by mitochondrial dysfunction. At a distance of 228 bp upstream from the SESN2 transcription start site we found a candidate sequence for the ATF4 binding site and confirmed its requirement for the induction of SESN2 in luciferase reporter experiments. We suggest that the upregulation of SESN2 by mitochondrial dysfunction provides a homeostatic feedback that attenuates biosynthetic processes during temporal losses of energy supply from mitochondria thereby assisting better adaptation and viability of cells in hostile environments. PMID:26771712

  16. Activation of the SMU.1882 Transcription by CovR in Streptococcus mutans

    PubMed Central

    Biswas, Indranil


    In Streptococcus mutans, the global response regulator CovR plays an important role in biofilm formation, stress-tolerance response, and caries production. We have previously shown that CovR acts as a transcriptional repressor by binding to the upstream promoter regions of its target genes. Here, we report that in vivo, CovR activates the transcription of SMU.1882, which encodes a small peptide containing a double-glycine motif. We also show that SMU.1882 is transcriptionally linked to comA that encodes a putative ABC transporter protein. Several genes from man gene clusters that encode mannose phosphotranferase system flank SMU.1882 -comA genes. Genomic comparison with other streptococci indicates that SMU.1882 is uniquely present in S. mutans, while the man operon is conserved among all streptococci, suggesting that a genetic rearrangement might have taken place at this locus. With the use of a transcriptional reporter system and semi-quantitative RT-PCR, we demonstrated the transcriptional regulation of SMU.1882 by CovR. In vitro gel shift and DNase I foot-printing analyses with purified CovR suggest that CovR binds to a large region surrounding the -10 region of the P1882. Using this information and comparing with other CovR regulated promoters, we have developed a putative consensus binding sequence for CovR. Although CovR binds to P1882, in vitro experiments using purified S. mutans RpoD, E. coli RNA polymerase, and CovR did not activate transcription from this promoter. Thus, we speculate that in vivo, CovR may interfere with the binding of a repressor or requires a cofactor. PMID:21124877

  17. Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex

    PubMed Central

    Konermann, Silvana; Brigham, Mark D.; Trevino, Alexandro E.; Joung, Julia; Abudayyeh, Omar O.; Barcena, Clea; Hsu, Patrick D.; Habib, Naomi; Gootenberg, Jonathan S.; Nishimasu, Hiroshi; Nureki, Osamu; Zhang, Feng


    Systematic interrogation of gene function requires the ability to perturb gene expression in a robust and generalizable manner. We describe structure-guided engineering of a CRISPR-Cas9 complex to mediate efficient transcriptional activation at endogenous genomic loci. We use these engineered Cas9 activation complexes to investigate sgRNA targeting rules for effective transcriptional activation, demonstrate multiplexed activation of 10 genes simultaneously, and upregulate long intergenic non-coding RNA (lincRNA) transcripts. We also synthesize a library consisting of 70,290 guides targeting all human RefSeq coding isoforms to screen for genes which, upon activation, confer resistance to a BRAF inhibitor. Expected and potentially novel resistance genes are enriched in the top hits and are validated using individual sgRNA as well as cDNA overexpression. The signature of our top screening hits is significantly correlated with gene expression data from clinical melanoma samples. These results collectively demonstrate the potential of Cas9-based activators as a powerful genetic perturbation technology. PMID:25494202

  18. The AP-1 transcription factor homolog Pf-AP-1 activates transcription of multiple biomineral proteins and potentially participates in Pinctada fucata biomineralization

    PubMed Central

    Zheng, Xiangnan; Cheng, Minzhang; Xiang, Liang; Liang, Jian; Xie, Liping; Zhang, Rongqing


    Activator protein-1 (AP-1) is an important bZIP transcription factor that regulates a series of physiological processes by specifically activating transcription of several genes, and one of its well-chartered functions in mammals is participating in bone mineralization. We isolated and cloned the complete cDNA of a Jun/AP-1 homolog from Pinctada fucata and called it Pf-AP-1. Pf-AP-1 had a highly conserved bZIP region and phosphorylation sites compared with those from mammals. A tissue distribution analysis showed that Pf-AP-1 was ubiquitously expressed in P. fucata and the mRNA level of Pf-AP-1 is extremely high in mantle. Pf-AP-1 expression was positively associated with multiple biomineral proteins in the mantle. The luciferase reporter assay in a mammalian cell line showed that Pf-AP-1 significantly up-regulates the transcriptional activity of the promoters of KRMP, Pearlin, and Prisilkin39. Inhibiting the activity of Pf-AP-1 depressed the expression of multiple matrix proteins. Pf-AP-1 showed a unique expression pattern during shell regeneration and pearl sac development, which was similar to the pattern observed for biomineral proteins. These results suggest that the Pf-AP-1 AP-1 homolog is an important transcription factor that regulates transcription of several biomineral proteins simultaneously and plays a role in P. fucata biomineralization, particularly during pearl and shell formation. PMID:26404494

  19. The murine Sim-2 gene product inhibits transcription by active repression and functional interference.


    Moffett, P; Reece, M; Pelletier, J


    The Drosophila single-minded (Dsim) gene encodes a master regulatory protein involved in cell fate determination during midline development. This protein is a member of a rapidly expanding family of gene products possessing basic helix-loop-helix (bHLH) and hydrophobic PAS (designated a conserved region among PER, ARNT [aryl hydrocarbon receptor nuclear translocator] and SIM) protein association domains. Members of this family function as central transcriptional regulators in cellular differentiation and in the response to environmental stimuli such as xenobiotics and hypoxia. We have previously identified a murine member of this family, called mSim-2, showing sequence homology to the bHLH and PAS domains of Dsim. Immunoprecipitation experiments with recombinant proteins indicate that mSIM-2 associates with the arnt gene product. In the present work, by using fine-structure mapping we found that the HLH and PAS motifs of both proteins are required for optimal association. Forced expression of GAL4/mSIM-2 fusion constructs in mammalian cells demonstrated the presence of two separable repression domains within the carboxy terminus of mSIM-2. We found that mSIM-2 is capable of repressing ARNT-mediated transcriptional activation in a mammalian two-hybrid system. This effect (i) is dependent on the ability of mSIM-2 and ARNT to heterodimerize, (ii) is dependent on the presence of the mSIM-2 carboxy-terminal repression domain, and (iii) is not specific to the ARNT activation domain. These results suggest that mSIM-2 repression activity can dominantly override the activation potential of adjacent transcription factors. We also demonstrated that mSIM-2 can functionally interfere with hypoxia-inducible factor 1alpha (HIF-1alpha)/ARNT transcription complexes, providing a second mechanism by which mSIM-2 may inhibit transcription. PMID:9271372

  20. P-TEFb Kinase Activity Is Essential for Global Transcription, Resumption of Meiosis and Embryonic Genome Activation in Pig.


    Oqani, Reza K; Lin, Tao; Lee, Jae Eun; Choi, Ki Myung; Shin, Hyun Young; Jin, Dong Il


    Positive transcription elongation factor b (P-TEFb) is a RNA polymerase II carboxyl-terminal domain (Pol II CTD) kinase that phosphorylates Ser2 of the CTD and promotes the elongation phase of transcription. Despite the fact that P-TEFb has role in many cellular processes, the role of this kinase complex remains to be understood in mammalian early developmental events. In this study, using immunocytochemical analyses, we found that the P-TEFb components, CDK9, Cyclin T1 and Cyclin T2 were localized to nuclear speckles, as well as in nucleolar-like bodies in pig germinal vesicle oocytes. Using nascent RNA labeling and small molecule inhibitors, we showed that inhibition of CDK9 activity abolished the transcription of GV oocytes globally. Moreover, using fluorescence in situ hybridization, in absence of CDK9 kinase activity the production of ribosomal RNAs was impaired. We also presented the evidences indicating that P-TEFb kinase activity is essential for resumption of oocyte meiosis and embryo development. Treatment with CDK9 inhibitors resulted in germinal vesicle arrest in maturing oocytes in vitro. Inhibition of CDK9 kinase activity did not interfere with in vitro fertilization and pronuclear formation. However, when in vitro produced zygotes were treated with CDK9 inhibitors, their development beyond the 4-cell stage was impaired. In these embryos, inhibition of CDK9 abrogated global transcriptional activity and rRNA production. Collectively, our data suggested that P-TEFb kinase activity is crucial for oocyte maturation, embryo development and regulation of RNA transcription in pig. PMID:27011207

  1. P-TEFb Kinase Activity Is Essential for Global Transcription, Resumption of Meiosis and Embryonic Genome Activation in Pig

    PubMed Central

    Oqani, Reza K.; Lin, Tao; Lee, Jae Eun; Choi, Ki Myung; Shin, Hyun Young; Jin, Dong Il


    Positive transcription elongation factor b (P-TEFb) is a RNA polymerase II carboxyl-terminal domain (Pol II CTD) kinase that phosphorylates Ser2 of the CTD and promotes the elongation phase of transcription. Despite the fact that P-TEFb has role in many cellular processes, the role of this kinase complex remains to be understood in mammalian early developmental events. In this study, using immunocytochemical analyses, we found that the P-TEFb components, CDK9, Cyclin T1 and Cyclin T2 were localized to nuclear speckles, as well as in nucleolar-like bodies in pig germinal vesicle oocytes. Using nascent RNA labeling and small molecule inhibitors, we showed that inhibition of CDK9 activity abolished the transcription of GV oocytes globally. Moreover, using fluorescence in situ hybridization, in absence of CDK9 kinase activity the production of ribosomal RNAs was impaired. We also presented the evidences indicating that P-TEFb kinase activity is essential for resumption of oocyte meiosis and embryo development. Treatment with CDK9 inhibitors resulted in germinal vesicle arrest in maturing oocytes in vitro. Inhibition of CDK9 kinase activity did not interfere with in vitro fertilization and pronuclear formation. However, when in vitro produced zygotes were treated with CDK9 inhibitors, their development beyond the 4-cell stage was impaired. In these embryos, inhibition of CDK9 abrogated global transcriptional activity and rRNA production. Collectively, our data suggested that P-TEFb kinase activity is crucial for oocyte maturation, embryo development and regulation of RNA transcription in pig. PMID:27011207

  2. Adaptation of the Agrobacterium tumefaciens VirG response regulator to activate transcription in plants.


    Czarnecka-Verner, Eva; Salem, Tarek A; Gurley, William B


    The Agrobacterium tumefaciens VirG response regulator of the VirA/VirG two-component system was adapted to function in tobacco protoplasts. The subcellular localization of VirG and VirA proteins transiently expressed in onion cells was determined using GFP fusions. Preliminary studies using Gal4DBD-VP16 fusions with VirG and Escherichia coli UhpA, and NarL response regulators indicated compatibility of these bacterial proteins with the eukaryotic transcriptional apparatus. A strong transcriptional activator based on tandem activation domains from the Drosophila fushi tarazu and Herpes simplex VP16 was created. Selected configurations of the two-site Gal4-vir box GUS reporters were activated by chimeric effectors dependent on either the yeast Gal4 DNA-binding domain or that of VirG. Transcriptional induction of the GUS reporter was highest for the VirE19-element promoter with both constitutive and wild-type VirG-tandem activation domain effectors. Multiple VirE19 elements increased the reporter activity proportionately, indicating that the VirG DNA binding domain was functional in plants. The VirG constitutive-Q-VP16 effector was more active than the VirG wild-type. In both the constitutive and wild-type forms of VirG, Q-VP16 activated transcription of the GUS reporter best when located at the C-terminus, i.e. juxtaposed to the VirG DNA binding domain. These results demonstrate the possibility of using DNA binding domains from bacterial response regulators and their cognate binding elements in the engineering of plant gene expression. PMID:26646288

  3. Model of Transcriptional Activation By MarA in Escherichia Coli

    NASA Astrophysics Data System (ADS)

    Wall, Michael E.; Markowitz, David A.; Rosner, Judah L.; Martin, Robert G.


    We have developed a mathematical model of transcriptional activation by MarA in Escherichia coli, and used the model to analyze measurements of MarA-dependent activity of the marRAB, sodA, and micF promoters in mar-rob- cells. The model rationalizes an unexpected poor correlation between the mid-point of in vivo promoter activity profiles and in vitro equilibrium constants for MarA binding to promoter sequences. Analysis of the promoter activity data using the model yielded the following predictions regarding activation mechanisms: (1) MarA activation of the marRAB, sodA, and micF promoters involves a net acceleration of the kinetics of transitions after RNA polymerase binding, up to and including promoter escape and message elongation; (2) RNA polymerase binds to these promoters with nearly unit occupancy in the absence of MarA, making recruitment of polymerase an insignificant factor in activation of these promoters; and (3) instead of recruitment, activation of the micF promoter might involve a repulsion of polymerase combined with a large acceleration of the kinetics of polymerase activity. These predictions are consistent with published chromatin immunoprecipitation assays of interactions between polymerase and the E. coli chromosome. A lack of recruitment in transcriptional activation represents an exception to the textbook description of activation of bacterial sigma-70 promoters. However, use of accelerated polymerase kinetics instead of recruitment might confer a competitive advantage to E. coli by decreasing latency in gene regulation.

  4. Reactive oxygen species in signalling the transcriptional activation of WIPK expression in tobacco.


    Xu, Juan; Yang, Kwang-Yeol; Yoo, Seung Jin; Liu, Yidong; Ren, Dongtao; Zhang, Shuqun


    Plant mitogen-activated protein kinases represented by tobacco WIPK (wounding-induced protein kinase) and its orthologs in other species are unique in their regulation at transcriptional level in response to stress and pathogen infection. We previously demonstrated that transcriptional activation of WIPK is essential for induced WIPK activity, and activation of salicylic acid-induced protein kinase (SIPK) by the constitutively active NtMEK2(DD) is sufficient to induce WIPK gene expression. Here, we report that the effect of SIPK on WIPK gene expression is mediated by reactive oxygen species (ROS). Using a combination of pharmacological and gain-of-function transgenic approaches, we studied the relationship among SIPK activation, WIPK gene activation in response to fungal cryptogein, light-dependent ROS generation in chloroplasts, and ROS generated via NADPH oxidase. In the conditional gain-of-function GVG-NtMEK2(DD) transgenic tobacco, induction of WIPK expression is dependent on the ROS generation in chloroplasts. Consistently, methyl viologen, an inducer of ROS generation in chloroplasts, highly activated WIPK expression. In addition to chloroplast-originated ROS, H(2)O(2) generated from the cell-surface NADPH oxidase could also activate WIPK gene expression, and inhibition of cryptogein-induced ROS generation also abolished WIPK gene activation. Our data demonstrate that WIPK gene activation is mediated by ROS, which provides a mechanism by which ROS influence cellular signalling processes in plant stress/defence response. PMID:24392654

  5. The Calmodulin-Binding Transcription Activator CAMTA1 Is Required for Long-Term Memory Formation in Mice

    ERIC Educational Resources Information Center

    Bas-Orth, Carlos; Tan, Yan-Wei; Oliveira, Ana M. M.; Bengtson, C. Peter; Bading, Hilmar


    The formation of long-term memory requires signaling from the synapse to the nucleus to mediate neuronal activity-dependent gene transcription. Synapse-to-nucleus communication is initiated by influx of calcium ions through synaptic NMDA receptors and/or L-type voltage-gated calcium channels and involves the activation of transcription factors by…

  6. Modification by SUMOylation Controls Both the Transcriptional Activity and the Stability of Delta-Lactoferrin

    PubMed Central

    Escobar-Ramirez, Adelma; Vercoutter-Edouart, Anne-Sophie; Mortuaire, Marlène; Huvent, Isabelle; Hardivillé, Stephan; Hoedt, Esthelle; Lefebvre, Tony; Pierce, Annick


    Delta-lactoferrin is a transcription factor, the expression of which is downregulated or silenced in case of breast cancer. It possesses antitumoral activities and when it is re-introduced in mammary epithelial cancer cell lines, provokes antiproliferative effects. It is posttranslationally modified and our earlier investigations showed that the O-GlcNAcylation/phosphorylation interplay plays a major role in the regulation of both its stability and transcriptional activity. Here, we report the covalent modification of delta-lactoferrin with the small ubiquitin-like modifier SUMO-1. Mutational and reporter gene analyses identified five different lysine residues at K13, K308, K361, K379 and K391 as SUMO acceptor sites. The SUMOylation deficient M5S mutant displayed enhanced transactivation capacity on a delta-lactoferrin responsive promoter, suggesting that SUMO-1 negatively regulates the transactivation function of delta-lactoferrin. K13, K308 and K379 are the main SUMO sites and among them, K308, which is located in a SUMOylation consensus motif of the NDSM-like type, is a key SUMO site involved in repression of delta-lactoferrin transcriptional activity. K13 and K379 are both targeted by other posttranslational modifications. We demonstrated that K13 is the main acetylation site and that favoring acetylation at K13 reduced SUMOylation and increased delta-lactoferrin transcriptional activity. K379, which is either ubiquitinated or SUMOylated, is a pivotal site for the control of delta-lactoferrin stability. We showed that SUMOylation competes with ubiquitination and protects delta-lactoferrin from degradation by positively regulating its stability. Collectively, our results indicate that multi-SUMOylation occurs on delta-lactoferrin to repress its transcriptional activity. Reciprocal occupancy of K13 by either SUMO-1 or an acetyl group may contribute to the establishment of finely regulated mechanisms to control delta-lactoferrin transcriptional activity. Moreover

  7. Stable inhibitory activity of regulatory T cells requires the transcription factor Helios.


    Kim, Hye-Jung; Barnitz, R Anthony; Kreslavsky, Taras; Brown, Flavian D; Moffett, Howell; Lemieux, Madeleine E; Kaygusuz, Yasemin; Meissner, Torsten; Holderried, Tobias A W; Chan, Susan; Kastner, Philippe; Haining, W Nicholas; Cantor, Harvey


    The maintenance of immune homeostasis requires regulatory T cells (T(regs)). Given their intrinsic self-reactivity, T(regs) must stably maintain a suppressive phenotype to avoid autoimmunity. We report that impaired expression of the transcription factor (TF) Helios by FoxP3(+) CD4 and Qa-1-restricted CD8 T(regs) results in defective regulatory activity and autoimmunity in mice. Helios-deficient T(regs) develop an unstable phenotype during inflammatory responses characterized by reduced FoxP3 expression and increased effector cytokine expression secondary to diminished activation of the STAT5 pathway. CD8 T(regs) also require Helios-dependent STAT5 activation for survival and to prevent terminal T cell differentiation. The definition of Helios as a key transcription factor that stabilizes T(regs) in the face of inflammatory responses provides a genetic explanation for a core property of T(regs). PMID:26472910

  8. n-Butyrate inhibits Jun NH(2)-terminal kinase activation and cytokine transcription in mast cells

    SciTech Connect

    Diakos, Christos; Prieschl, Eva E.; Saeemann, Marcus D.; Boehmig, Georg A.; Csonga, Robert; Sobanov, Yury; Baumruker, Thomas; Zlabinger, Gerhard J. . E-mail:


    Mast cells are well known to contribute to type I allergic conditions but only recently have been brought in association with chronic relapsing/remitting autoimmune diseases such as celiac disease and ulcerative colitis. Since the bacterial metabolite n-butyrate is considered to counteract intestinal inflammation we investigated the effects of this short chain fatty acid on mast cell activation. Using RNAse protection assays and reporter gene technology we show that n-butyrate downregulates TNF-{alpha} transcription. This correlates with an impaired activation of the Jun NH(2)-terminal kinase (JNK) but not other MAP kinases such as ERK and p38 that are largely unaffected by n-butyrate. As a consequence, we observed a decreased nuclear activity of AP-1 and NF-AT transcription factors. These results indicate that n-butyrate inhibits critical inflammatory mediators in mast cells by relatively selectively targeting the JNK signalling.

  9. Suppression of Epithelial Signal Transducer and Activator of Transcription 1 Activation by Extracts of Aspergillus fumigatus

    PubMed Central

    Bhushan, Bharat; Homma, Tetsuya; Norton, James E.; Sha, Quan; Siebert, Jason; Gupta, Dave S.; Schroeder, James W.


    Aspergillus fumigatus (AF) is often pathogenic in immune-deficient individuals and can cause life-threatening infections such as invasive aspergillosis. The pulmonary epithelial response to AF infection and the signaling pathways associated with it have not been completely studied. BEAS-2B cells or primary human bronchial epithelial cells were exposed to extracts of AF and challenged with IFN-β or the Toll-like receptor 3 agonist double-stranded RNA (dsRNA). Cytokine release (B-cell activating factor of the TNF family [BAFF], IFN-γ–induced protein-10 [IP-10], etc.) was assessed. AF extract was separated into low-molecular-weight (LMW) and high-molecular-weight (HMW) fractions using ultra 4 centrifugal force filters to characterize the activity. Real-time PCR was performed with a TaqMan method, and protein estimation was performed using ELISA techniques. Western blot was performed to assess phosphorylation of signal transducer and activator of transcription 1 (STAT1). IFN-β and dsRNA induced messenger RNA (mRNA) expression of BAFF (350- and 452-fold, respectively [n = 3]) and IP-10 (1,081- and 3,044-fold, respectively [n = 3]) in BEAS-2B cells. When cells were pretreated with AF extract for 1 hour and then stimulated with IFN-β or dsRNA for 6 hours, induction of BAFF and IP-10 mRNA was strongly suppressed relative to levels produced by IFN-β and dsRNA alone. When compared with control, soluble BAFF and IP-10 protein levels were maximally suppressed in dsRNA-stimulated wells treated with 1:320 wt/vol AF extract (P < 0.005). Upon molecular size fractionation, a LMW fraction of AF extract had no measurable suppressive effect on IP-10 mRNA expression. However, a HMW fraction of the AF extract significantly suppressed IP-10 expression in BEAS-2B cells that were stimulated with dsRNA or IFN-β. When BEAS-2B cells were pretreated with AF extract and then stimulated with IFN-β, reduced levels of pSTAT1 were observed, with maximum suppression at 4 and 6

  10. Suppression of epithelial signal transducer and activator of transcription 1 activation by extracts of Aspergillus fumigatus.


    Bhushan, Bharat; Homma, Tetsuya; Norton, James E; Sha, Quan; Siebert, Jason; Gupta, Dave S; Schroeder, James W; Schleimer, Robert P


    Aspergillus fumigatus (AF) is often pathogenic in immune-deficient individuals and can cause life-threatening infections such as invasive aspergillosis. The pulmonary epithelial response to AF infection and the signaling pathways associated with it have not been completely studied. BEAS-2B cells or primary human bronchial epithelial cells were exposed to extracts of AF and challenged with IFN-β or the Toll-like receptor 3 agonist double-stranded RNA (dsRNA). Cytokine release (B-cell activating factor of the TNF family [BAFF], IFN-γ-induced protein-10 [IP-10], etc.) was assessed. AF extract was separated into low-molecular-weight (LMW) and high-molecular-weight (HMW) fractions using ultra 4 centrifugal force filters to characterize the activity. Real-time PCR was performed with a TaqMan method, and protein estimation was performed using ELISA techniques. Western blot was performed to assess phosphorylation of signal transducer and activator of transcription 1 (STAT1). IFN-β and dsRNA induced messenger RNA (mRNA) expression of BAFF (350- and 452-fold, respectively [n = 3]) and IP-10 (1,081- and 3,044-fold, respectively [n = 3]) in BEAS-2B cells. When cells were pretreated with AF extract for 1 hour and then stimulated with IFN-β or dsRNA for 6 hours, induction of BAFF and IP-10 mRNA was strongly suppressed relative to levels produced by IFN-β and dsRNA alone. When compared with control, soluble BAFF and IP-10 protein levels were maximally suppressed in dsRNA-stimulated wells treated with 1:320 wt/vol AF extract (P < 0.005). Upon molecular size fractionation, a LMW fraction of AF extract had no measurable suppressive effect on IP-10 mRNA expression. However, a HMW fraction of the AF extract significantly suppressed IP-10 expression in BEAS-2B cells that were stimulated with dsRNA or IFN-β. When BEAS-2B cells were pretreated with AF extract and then stimulated with IFN-β, reduced levels of pSTAT1 were observed, with maximum suppression at 4 and 6

  11. Dimer formation and transcription activation in the sporulation response regulator Spo0A.


    Lewis, Richard J; Scott, David J; Brannigan, James A; Ladds, Joanne C; Cervin, Marguerite A; Spiegelman, George B; Hoggett, James G; Barák, Imrich; Wilkinson, Anthony J


    The response regulator Spo0A is the master control element in the initiation of sporulation in Bacillus subtilis. Like many other multi-domain response regulators, the latent activity of the effector, C-terminal domain is stimulated by phosphorylation on a conserved aspartic acid residue in the regulatory, N-terminal domain. If a threshold concentration of phosphorylated Spo0A is achieved, the transcription of genes required for sporulation is activated, whereas the genes encoding stationary phase sentinels are repressed, and sporulation proceeds. Despite detailed genetic, biochemical and structural characterisation, it is not understood how the phosphorylation signal in the receiver domain is transduced into DNA binding and transcription activation in the distal effector domain. An obstacle to our understanding of Spo0A function is the uncertainty concerning changes in quaternary structure that accompany phosphorylation. Here we have revisited this question and shown unequivocally that Spo0A forms dimers upon phosphorylation and that the subunit interactions in the dimer are mediated principally by the receiver domain. Purified dimers of two mutants of Spo0A, in which the phosphorylatable aspartic acid residue has been substituted, activate transcription from the spoIIG promoter in vitro, whereas monomers do not. This suggests that dimers represent the activated form of Spo0A. PMID:11851334

  12. Telomerase activates transcription of cyclin D1 gene through an interaction with NOL1.


    Hong, Juyeong; Lee, Ji Hoon; Chung, In Kwon


    Telomerase is a ribonucleoprotein enzyme that is required for the maintenance of telomere repeats. Although overexpression of telomerase in normal human somatic cells is sufficient to overcome replicative senescence, the ability of telomerase to promote tumorigenesis requires additional activities that are independent of its role in telomere extension. Here, we identify proliferation-associated nucleolar antigen 120 (NOL1, also known as NOP2) as a telomerase RNA component (TERC)-binding protein that is found in association with catalytically active telomerase. Although NOL1 is highly expressed in the majority of human tumor cells, the molecular mechanism by which NOL1 contributes to tumorigenesis remained unclear. We show that NOL1 binds to the T-cell factor (TCF)-binding element of the cyclin D1 promoter and activates its transcription. Interestingly, telomerase is also recruited to the cyclin D1 promoter in a TERC-dependent manner through the interaction with NOL1, further enhancing transcription of the cyclin D1 gene. Depletion of NOL1 suppresses cyclin D1 promoter activity, thereby leading to induction of growth arrest and altered cell cycle distributions. Collectively, our findings suggest that NOL1 represents a new route by which telomerase activates transcription of cyclin D1 gene, thus maintaining cell proliferation capacity. PMID:26906424

  13. KPC2 relocalizes HOXA2 to the cytoplasm and decreases its transcriptional activity.


    Bridoux, Laure; Bergiers, Isabelle; Draime, Amandine; Halbout, Mathias; Deneyer, Noémie; Twizere, Jean-Claude; Rezsohazy, René


    Regulation of transcription factor activity relies on molecular interactions or enzymatic modifications which influence their interaction with DNA cis-regulatory sequences, their transcriptional activation or repression, and stability or intracellular distribution of these proteins. Regarding the well-conserved Hox protein family, a restricted number of activity regulators have been highlighted thus far. In the framework of a proteome-wide screening aiming at identifying proteins interacting with Hoxa2, KPC2, an adapter protein constitutive of the KPC ubiquitin-ligase complex, was identified. In this work, KPC2 was confirmed as being a genuine interactor of Hoxa2 by co-precipitation and bimolecular fluorescence complementation assays. At functional level, KPC2 diminishes the transcriptional activity and induces the nuclear exit of Hoxa2. Gene expression analyses revealed that Kpc2 is active in restricted areas of the developing mouse embryo which overlap with the Hoxa2 expression domain. Together, our data support that KPC2 regulates Hoxa2 by promoting its relocation to the cytoplasm. PMID:26303204

  14. Notch-1 activates estrogen receptor-α-dependent transcription via IKKα in breast cancer cells

    PubMed Central

    Hao, L; Rizzo, P; Osipo, C; Pannuti, A; Wyatt, D; Cheung, LW-K; Sonenshein, G; Osborne, BA; Miele, L


    Approximately 80% of breast cancers express the estrogen receptor-α (ERα) and are treated with anti-estrogens. Resistance to these agents is a major cause of mortality. We have shown that estrogen inhibits Notch, whereas anti-estrogens or estrogen withdrawal activate Notch signaling. Combined inhibition of Notch and estrogen signaling has synergistic effects in ERα-positive breast cancer models. However, the mechanisms whereby Notch-1 promotes the growth of ERα-positive breast cancer cells are unknown. Here, we demonstrate that Notch-1 increases the transcription of ERα-responsive genes in the presence or absence of estrogen via a novel chromatin crosstalk mechanism. Our data support a model in which Notch-1 can activate the transcription of ERα-target genes via IKKα-dependent cooperative chromatin recruitment of Notch–CSL–MAML1 transcriptional complexes (NTC) and ERα, which promotes the recruitment of p300. CSL binding elements frequently occur in close proximity to estrogen-responsive elements (EREs) in the human and mouse genomes. Our observations suggest that a hitherto unknown Notch-1/ERα chromatin crosstalk mediates Notch signaling effects in ERα-positive breast cancer cells and contributes to regulate the transcriptional functions of ERα itself. PMID:19838210

  15. Mismatch repair enhances convergent transcription-induced cell death at trinucleotide repeats by activating ATR.


    Chatterjee, Nimrat; Lin, Yunfu; Wilson, John H


    Trinucleotide repeat (TNR) expansion beyond a certain threshold results in some 20 incurable neurodegenerative disorders where disease anticipation positively correlates with repeat length. Long TNRs typically display a bias toward further expansion during germinal transmission from parents to offspring, and then are highly unstable in somatic tissues of affected individuals. Understanding mechanisms of TNR instability will provide insights into disease pathogenesis. Previously, we showed that enhanced convergent transcription at long CAG repeat tracks induces TNR instability and cell death via ATR activation. Components of TC-NER (transcription-coupled nucleotide excision repair) and RNaseH enzymes that resolve RNA/DNA hybrids oppose cell death, whereas the MSH2 component of MMR (mismatch repair) enhances cell death. The exact role of the MMR pathway during convergent transcription-induced cell death at CAG repeats is not well understood. In this study, we show that siRNA knockdowns of MMR components-MSH2, MSH3, MLHI, PMS2, and PCNA-reduce DNA toxicity. Furthermore, knockdown of MSH2, MLH1, and PMS2 significantly reduces the frequency of ATR foci formation. These observations suggest that MMR proteins activate DNA toxicity by modulating ATR foci formation during convergent transcription. PMID:27131875

  16. Identification of active transcriptional regulatory elements from GRO-seq data.


    Danko, Charles G; Hyland, Stephanie L; Core, Leighton J; Martins, Andre L; Waters, Colin T; Lee, Hyung Won; Cheung, Vivian G; Kraus, W Lee; Lis, John T; Siepel, Adam


    Modifications to the global run-on and sequencing (GRO-seq) protocol that enrich for 5'-capped RNAs can be used to reveal active transcriptional regulatory elements (TREs) with high accuracy. Here, we introduce discriminative regulatory-element detection from GRO-seq (dREG), a sensitive machine learning method that uses support vector regression to identify active TREs from GRO-seq data without requiring cap-based enrichment ( This approach allows TREs to be assayed together with gene expression levels and other transcriptional features in a single experiment. Predicted TREs are more enriched for several marks of transcriptional activation—including expression quantitative trait loci, disease-associated polymorphisms, acetylated histone 3 lysine 27 (H3K27ac) and transcription factor binding—than those identified by alternative functional assays. Using dREG, we surveyed TREs in eight human cell types and provide new insights into global patterns of TRE function. PMID:25799441

  17. Retinoid-induced apoptosis and Sp1 cleavage occur independently of transcription and require caspase activation.

    PubMed Central

    Piedrafita, F J; Pfahl, M


    Vitamin A and its derivatives, the retinoids, are essential regulators of many important biological functions, including cell growth and differentiation, development, homeostasis, and carcinogenesis. Natural retinoids such as all-trans retinoic acid can induce cell differentiation and inhibit growth of certain cancer cells. We recently identified a novel class of synthetic retinoids with strong anti-cancer cell activities in vitro and in vivo which can induce apoptosis in several cancer cell lines. Using an electrophoretic mobility shift assay, we analyzed the DNA binding activity of several transcription factors in T cells treated with apoptotic retinoids. We found that the DNA binding activity of the general transcription factor Sp1 is lost in retinoid-treated T cells undergoing apoptosis. A truncated Sp1 protein is detected by immunoblot analysis, and cytosolic protein extracts prepared from apoptotic cells contain a protease activity which specifically cleaves purified Sp1 in vitro. This proteolysis of Sp1 can be inhibited by N-ethylmaleimide and iodoacetamide, indicating that a cysteine protease mediates cleavage of Sp1. Furthermore, inhibition of Sp1 cleavage by ZVAD-fmk and ZDEVD-fmk suggests that caspases are directly involved in this event. In fact, caspases 2 and 3 are activated in T cells after treatment with apoptotic retinoids. The peptide inhibitors also blocked retinoid-induced apoptosis, as well as processing of caspases and proteolysis of Sp1 and poly(ADP-ribose) polymerase in intact cells. Degradation of Sp1 occurs early during apoptosis and is therefore likely to have profound effects on the basal transcription status of the cell. Interestingly, retinoid-induced apoptosis does not require de novo mRNA and protein synthesis, suggesting that a novel mechanism of retinoid signaling is involved, triggering cell death in a transcriptional activation-independent, caspase-dependent manner. PMID:9343396

  18. Therapeutic doses of irradiation activate viral transcription and induce apoptosis in HIV-1 infected cells.


    Iordanskiy, Sergey; Van Duyne, Rachel; Sampey, Gavin C; Woodson, Caitlin M; Fry, Kelsi; Saifuddin, Mohammed; Guo, Jia; Wu, Yuntao; Romerio, Fabio; Kashanchi, Fatah


    The highly active antiretroviral therapy reduces HIV-1 RNA in plasma to undetectable levels. However, the virus continues to persist in the long-lived resting CD4(+) T cells, macrophages and astrocytes which form a viral reservoir in infected individuals. Reactivation of viral transcription is critical since the host immune response in combination with antiretroviral therapy may eradicate the virus. Using the chronically HIV-1 infected T lymphoblastoid and monocytic cell lines, primary quiescent CD4(+) T cells and humanized mice infected with dual-tropic HIV-1 89.6, we examined the effect of various X-ray irradiation (IR) doses (used for HIV-related lymphoma treatment and lower doses) on HIV-1 transcription and viability of infected cells. Treatment of both T cells and monocytes with IR, a well-defined stress signal, led to increase of HIV-1 transcription, as evidenced by the presence of RNA polymerase II and reduction of HDAC1 and methyl transferase SUV39H1 on the HIV-1 promoter. This correlated with the increased GFP signal and elevated level of intracellular HIV-1 RNA in the IR-treated quiescent CD4(+) T cells infected with GFP-encoding HIV-1. Exposition of latently HIV-1infected monocytes treated with PKC agonist bryostatin 1 to IR enhanced transcription activation effect of this latency-reversing agent. Increased HIV-1 replication after IR correlated with higher cell death: the level of phosphorylated Ser46 in p53, responsible for apoptosis induction, was markedly higher in the HIV-1 infected cells following IR treatment. Exposure of HIV-1 infected humanized mice with undetectable viral RNA level to IR resulted in a significant increase of HIV-1 RNA in plasma, lung and brain tissues. Collectively, these data point to the use of low to moderate dose of IR alone or in combination with HIV-1 transcription activators as a potential application for the "Shock and Kill" strategy for latently HIV-1 infected cells. PMID:26184775

  19. Identification of Ind transcription activation and repression domains required for dorsoventral patterning of the CNS.


    Von Ohlen, Tonia L; Moses, Cade


    Specification of cell fates across the dorsoventral axis of the central nervous system in Drosophila involves the subdivision of the neuroectoderm into three domains that give rise to three columns of neural precursor cells called neuroblasts. Ventral nervous system defective (Vnd), intermediate neuroblasts defective (Ind) and muscle segment homeobox (Msh) are expressed in the three columns from ventral to dorsal, respectively. The products of these genes play multiple important roles in formation and specification of the embryonic nervous system. Ind, for example, is known to play roles in two important processes. First, Ind is essential for formation of neuroblasts conjunction with SoxB class transcription factors. Sox class transcription factors are known to specify neural stem cells in vertebrates. Second, Ind plays an important role in patterning the CNS in conjunction with, vnd and msh, which is also similar to how vertebrates pattern their neural tube. This work focuses two important aspects of Ind function. First, we used multiple approaches to identify and characterize specific domains within the protein that confer repressor or activator ability. Currently, little is known about the presence of activation or repression domains within Ind. Here, we show that transcriptional repression by Ind requires multiple conserved domains within the protein, and that Ind has a transcriptional activation domain. Specifically, we have identified a novel domain, the Pst domain, that has transcriptional repression ability and appears to act independent of interaction with the co-repressor Groucho. This domain is highly conserved among insect species, but is not found in vertebrate Gsh class homeodomain proteins. Second, we show that Ind can and does repress vnd expression, but does so in a stage specific manner. We conclude from this that the function of Ind in regulating vnd expression is one of refinement and maintenance of the dorsal border. PMID:19348939

  20. Alternate RASSF1 Transcripts Control SRC Activity, E-Cadherin Contacts, and YAP-Mediated Invasion.


    Vlahov, Nikola; Scrace, Simon; Soto, Manuel Sarmiento; Grawenda, Anna M; Bradley, Leanne; Pankova, Daniela; Papaspyropoulos, Angelos; Yee, Karen S; Buffa, Francesca; Goding, Colin R; Timpson, Paul; Sibson, Nicola; O'Neill, Eric


    Tumor progression to invasive carcinoma is associated with activation of SRC family kinase (SRC, YES, FYN) activity and loss of cellular cohesion. The hippo pathway-regulated cofactor YAP1 supports the tumorigenicity of RAS mutations but requires both inactivation of hippo signaling and YES-mediated phosphorylation of YAP1 for oncogenic activity. Exactly how SRC kinases are activated and hippo signaling is lost in sporadic human malignancies remains unknown. Here, we provide evidence that hippo-mediated inhibition of YAP1 is lost upon promoter methylation of the RAS effector and hippo kinase scaffold RASSF1A. We find that RASSF1A promoter methylation reduces YAP phospho-S127, which derepresses YAP1, and actively supports YAP1 activation by switching RASSF1 transcription to the independently transcribed RASSF1C isoform that promotes Tyr kinase activity. Using affinity proteomics, proximity ligation, and real-time molecular visualization, we find that RASSF1C targets SRC/YES to epithelial cell-cell junctions and promotes tyrosine phosphorylation of E-cadherin, β-catenin, and YAP1. RASSF1A restricts SRC activity, preventing motility, invasion, and tumorigenesis in vitro and in vivo, with epigenetic inactivation correlating with increased inhibitory pY527-SRC in breast tumors. These data imply that distinct RASSF1 isoforms have opposing functions, which provide a biomarker for YAP1 activation and explain correlations of RASSF1 methylation with advanced invasive disease in humans. The ablation of epithelial integrity together with subsequent YAP1 nuclear localization allows transcriptional activation of β-catenin/TBX-YAP/TEAD target genes, including Myc, and an invasive phenotype. These findings define gene transcript switching as a tumor suppressor mechanism under epigenetic control. PMID:26549256

  1. Alternate RASSF1 Transcripts Control SRC Activity, E-Cadherin Contacts, and YAP-Mediated Invasion

    PubMed Central

    Vlahov, Nikola; Scrace, Simon; Soto, Manuel Sarmiento; Grawenda, Anna M.; Bradley, Leanne; Pankova, Daniela; Papaspyropoulos, Angelos; Yee, Karen S.; Buffa, Francesca; Goding, Colin R.; Timpson, Paul; Sibson, Nicola; O’Neill, Eric


    Summary Tumor progression to invasive carcinoma is associated with activation of SRC family kinase (SRC, YES, FYN) activity and loss of cellular cohesion. The hippo pathway-regulated cofactor YAP1 supports the tumorigenicity of RAS mutations but requires both inactivation of hippo signaling and YES-mediated phosphorylation of YAP1 for oncogenic activity. Exactly how SRC kinases are activated and hippo signaling is lost in sporadic human malignancies remains unknown. Here, we provide evidence that hippo-mediated inhibition of YAP1 is lost upon promoter methylation of the RAS effector and hippo kinase scaffold RASSF1A. We find that RASSF1A promoter methylation reduces YAP phospho-S127, which derepresses YAP1, and actively supports YAP1 activation by switching RASSF1 transcription to the independently transcribed RASSF1C isoform that promotes Tyr kinase activity. Using affinity proteomics, proximity ligation, and real-time molecular visualization, we find that RASSF1C targets SRC/YES to epithelial cell-cell junctions and promotes tyrosine phosphorylation of E-cadherin, β-catenin, and YAP1. RASSF1A restricts SRC activity, preventing motility, invasion, and tumorigenesis in vitro and in vivo, with epigenetic inactivation correlating with increased inhibitory pY527-SRC in breast tumors. These data imply that distinct RASSF1 isoforms have opposing functions, which provide a biomarker for YAP1 activation and explain correlations of RASSF1 methylation with advanced invasive disease in humans. The ablation of epithelial integrity together with subsequent YAP1 nuclear localization allows transcriptional activation of β-catenin/TBX-YAP/TEAD target genes, including Myc, and an invasive phenotype. These findings define gene transcript switching as a tumor suppressor mechanism under epigenetic control. PMID:26549256

  2. Eya protein phosphatase activity regulates Six1-Dach-Eya transcriptional effects in mammalian organogenesis.


    Li, Xue; Oghi, Kenneth A; Zhang, Jie; Krones, Anna; Bush, Kevin T; Glass, Christopher K; Nigam, Sanjay K; Aggarwal, Aneel K; Maas, Richard; Rose, David W; Rosenfeld, Michael G


    The precise mechanistic relationship between gene activation and repression events is a central question in mammalian organogenesis, as exemplified by the evolutionarily conserved sine oculis (Six), eyes absent (Eya) and dachshund (Dach) network of genetically interacting proteins. Here, we report that Six1 is required for the development of murine kidney, muscle and inner ear, and that it exhibits synergistic genetic interactions with Eya factors. We demonstrate that the Eya family has a protein phosphatase function, and that its enzymatic activity is required for regulating genes encoding growth control and signalling molecules, modulating precursor cell proliferation. The phosphatase function of Eya switches the function of Six1-Dach from repression to activation, causing transcriptional activation through recruitment of co-activators. The gene-specific recruitment of a co-activator with intrinsic phosphatase activity provides a molecular mechanism for activation of specific gene targets, including those regulating precursor cell proliferation and survival in mammalian organogenesis. PMID:14628042

  3. O-GlcNAc modification of PPAR{gamma} reduces its transcriptional activity

    SciTech Connect

    Ji, Suena; Park, Sang Yoon; Roth, Juergen; Kim, Hoe Suk; Cho, Jin Won


    Highlights: Black-Right-Pointing-Pointer We found that PPAR{gamma} is modified by O-GlcNAc in 3T3-L1 adipocytes. Black-Right-Pointing-Pointer The Thr54 of PPAR{gamma}1 is the major O-GlcNAc site. Black-Right-Pointing-Pointer Transcriptional activity of PPAR{gamma}1 was decreased on treatment with the OGA inhibitor. -- Abstract: The peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}), a member of the nuclear receptor superfamily, is a key regulator of adipogenesis and is important for the homeostasis of the adipose tissue. The {beta}-O-linked N-acetylglucosamine (O-GlcNAc) modification, a posttranslational modification on various nuclear and cytoplasmic proteins, is involved in the regulation of protein function. Here, we report that PPAR{gamma} is modified by O-GlcNAc in 3T3-L1 adipocytes. Mass spectrometric analysis and mutant studies revealed that the threonine 54 of the N-terminal AF-1 domain of PPAR{gamma} is the major O-GlcNAc site. Transcriptional activity of wild type PPAR{gamma} was decreased 30% by treatment with the specific O-GlcNAcase (OGA) inhibitor, but the T54A mutant of PPAR{gamma} did not respond to inhibitor treatment. In 3T3-L1 cells, an increase in O-GlcNAc modification by OGA inhibitor reduced PPAR{gamma} transcriptional activity and terminal adipocyte differentiation. Our results suggest that the O-GlcNAc state of PPAR{gamma} influences its transcriptional activity and is involved in adipocyte differentiation.

  4. Benzimidazoles diminish ERE transcriptional activity and cell growth in breast cancer cells

    SciTech Connect

    Payton-Stewart, Florastina; Tilghman, Syreeta L.; Williams, LaKeisha G.; Winfield, Leyte L.


    Highlights: • The methyl-substituted benzimidazole was more effective at inhibiting growth in MDA-MB 231 cells. • The naphthyl-substituted benzimidazole was more effective at inhibiting growth in MCF-7 cells than ICI. • The benzimidazole molecules demonstrated a dose-dependent reduction in ERE transcriptional activity. • The benzimidazole molecules had binding mode in ERα and ERβ comparable to that of the co-crystallized ligand. - Abstract: Estrogen receptors (ERα and ERβ) are members of the nuclear receptor superfamily. They regulate the transcription of estrogen-responsive genes and mediate numerous estrogen related diseases (i.e., fertility, osteoporosis, cancer, etc.). As such, ERs are potentially useful targets for developing therapies and diagnostic tools for hormonally responsive human breast cancers. In this work, two benzimidazole-based sulfonamides originally designed to reduce proliferation in prostate cancer, have been evaluated for their ability to modulate growth in estrogen dependent and independent cell lines (MCF-7 and MDA-MB 231) using cell viability assays. The molecules reduced growth in MCF-7 cells, but differed in their impact on the growth of MDA-MB 231 cells. Although both molecules reduced estrogen response element (ERE) transcriptional activity in a dose dependent manner, the contrasting activity in the MDA-MB-231 cells seems to suggest that the molecules may act through alternate ER-mediated pathways. Further, the methyl analog showed modest selectivity for the ERβ receptor in an ER gene expression array panel, while the naphthyl analog did not significantly alter gene expression. The molecules were docked in the ligand binding domains of the ERα-antagonist and ERβ-agonist crystal structures to evaluate the potential of the molecules to interact with the receptors. The computational analysis complimented the results obtained in the assay of transcriptional activity and gene expression suggesting that the molecules

  5. Multiple phosphorylation events control chicken ovalbumin upstream promoter transcription factor I orphan nuclear receptor activity.


    Gay, Frédérique; Baráth, Peter; Desbois-Le Péron, Christine; Métivier, Raphaël; Le Guével, Rémy; Birse, Darcy; Salbert, Gilles


    Chicken ovalbumin upstream promoter transcription factor I (COUP-TFI) is an orphan member of the nuclear hormone receptor superfamily that comprises key regulators of many biological functions, such as embryonic development, metabolism, homeostasis, and reproduction. Although COUP-TFI can both actively silence gene transcription and antagonize the functions of various other nuclear receptors, the COUP-TFI orphan receptor also acts as a transcriptional activator in certain contexts. Moreover, COUP-TFI has recently been shown to serve as an accessory factor for some ligand-bound nuclear receptors, suggesting that it may modulate, both negatively and positively, a wide range of hormonal responses. In the absence of any identified cognate ligand, the mechanisms involved in the regulation of COUP-TFI activity remain unclear. The elucidation of several putative phosphorylation sites for MAPKs, PKC, and casein kinase II within the sequence of this orphan receptor led us to investigate phosphorylation events regulating the various COUP-TFI functions. After showing that COUP-TFI is phosphorylated in vivo, we provide evidence that in vivo inhibition of either MAPK or PKC signaling pathway leads to a specific and pronounced decrease in COUP-TFI-dependent transcriptional activation of the vitronectin gene promoter. Focusing on the molecular mechanisms underlying the MAPK- and PKC-mediated regulation of COUP-TFI activity, we show that COUP-TFI can be directly targeted by PKC and MAPK. These phosphorylation events differentially modulate COUP-TFI functions: PKC-mediated phosphorylation enhances COUP-TFI affinity for DNA and MAPK-mediated phosphorylation positively regulates the transactivation function of COUP-TFI, possibly through enhancing specific coactivator recruitment. These data provide evidence that COUP-TFI is likely to integrate distinct signaling pathways and raise the possibility that multiple extracellular signals influence biological processes controlled by COUP

  6. SUMOylation of DLX3 by SUMO1 promotes its transcriptional activity.


    Duverger, Olivier; Chen, Susie X; Lee, Delia; Li, Tianwei; Chock, P Boon; Morasso, Maria I


    Small ubiquitin-like modifiers (SUMO) are post-translational modifiers that regulate target protein activity in diverse ways. The most common group of SUMO substrates is transcription factors, whose transcriptional activity can be altered positively or negatively as a result of SUMOylation. DLX3 is a homeodomain transcription factor involved in placental development, in the differentiation of structures involving epithelial-mesenchymal interactions, such as hair, teeth and nails, and in bone mineralization. We identified two potential SUMOylation sites in the N-terminal domain of DLX3 at positions K83 and K112. Among the six members of the Distal-less family, DLX3 is the only member containing these sites, which are highly conserved among vertebrates. Co-expression experiments demonstrated that DLX3 can be SUMOylated by SUMO1. Site-directed mutagenesis of lysines 83 and 112 to arginines (K83R and K112R) demonstrated that only K112 is involved in SUMOylation. Immunocytochemical analysis determined that SUMOylation does not affect DLX3 translocation to the nucleus and favors perinuclear localization. Moreover, using electrophoresis mobility shift assay (EMSA), we found that DLX3 is still able to bind DNA when SUMOylated. Using luciferase reporter assays, we showed that DLX3(K112R) exhibits a significantly lower transcriptional activity compared to DLX3(WT), suggesting that SUMOylation has a positive effect on DLX3 activity. We identified a new level of regulation in the activity of DLX3 that may play a crucial role in the regulation of hair, teeth, and bone development. PMID:21268066

  7. Identification and characterization of Drosophila relatives of the yeast transcriptional activator SNF2/SWI2.

    PubMed Central

    Elfring, L K; Deuring, R; McCallum, C M; Peterson, C L; Tamkun, J W


    The Drosophila brahma (brm) gene encodes an activator of homeotic genes that is highly related to the yeast transcriptional activator SWI2 (SNF2), a potential helicase. To determine whether brm is a functional homolog of SWI2 or merely a member of a family of SWI2-related genes, we searched for additional Drosophila genes related to SWI2 and examined their function in yeast cells. In addition to brm, we identified one other Drosophila relative of SWI2: the closely related ISWI gene. The 1,027-residue ISWI protein contains the DNA-dependent ATPase domain characteristic of the SWI2 protein family but lacks the three other domains common to brm and SWI2. In contrast, the ISWI protein is highly related (70% identical) to the human hSNF2L protein over its entire length, suggesting that they may be functional homologs. The DNA-dependent ATPase domains of brm and SWI2, but not ISWI, are functionally interchangeable; a chimeric SWI2-brm protein partially rescued the slow growth of swi2- cells and supported transcriptional activation mediated by the glucocorticoid receptor in vivo in yeast cells. These findings indicate that brm is the closest Drosophila relative of SWI2 and suggest that brm and SWI2 play similar roles in transcriptional activation. Images PMID:7908117

  8. Acetylation of lysine 109 modulates pregnane X receptor DNA binding and transcriptional activity.


    Pasquel, Danielle; Doricakova, Aneta; Li, Hao; Kortagere, Sandhya; Krasowski, Matthew D; Biswas, Arunima; Walton, William G; Redinbo, Matthew R; Dvorak, Zdenek; Mani, Sridhar


    Pregnane X receptor (PXR) is a major transcriptional regulator of xenobiotic metabolism and transport pathways in the liver and intestines, which are critical for protecting organisms against potentially harmful xenobiotic and endobiotic compounds. Inadvertent activation of drug metabolism pathways through PXR is known to contribute to drug resistance, adverse drug-drug interactions, and drug toxicity in humans. In both humans and rodents, PXR has been implicated in non-alcoholic fatty liver disease, diabetes, obesity, inflammatory bowel disease, and cancer. Because of PXR's important functions, it has been a therapeutic target of interest for a long time. More recent mechanistic studies have shown that PXR is modulated by multiple PTMs. Herein we provide the first investigation of the role of acetylation in modulating PXR activity. Through LC-MS/MS analysis, we identified lysine 109 (K109) in the hinge as PXR's major acetylation site. Using various biochemical and cell-based assays, we show that PXR's acetylation status and transcriptional activity are modulated by E1A binding protein (p300) and sirtuin 1 (SIRT1). Based on analysis of acetylation site mutants, we found that acetylation at K109 represses PXR transcriptional activity. The mechanism involves loss of RXRα dimerization and reduced binding to cognate DNA response elements. This mechanism may represent a promising therapeutic target using modulators of PXR acetylation levels. This article is part of a Special Issue entitled: Xenobiotic nuclear receptors: New Tricks for An Old Dog, edited by Dr. Wen Xie. PMID:26855179

  9. FOXO1 inhibits Runx2 transcriptional activity and prostate cancer cell migration and invasion

    PubMed Central

    Zhang, Haijun; Pan, Yunqian; Zheng, Li; Choe, Chungyoul; Lindgren, Bruce; Jensen, Eric D.; Westendorf, Jennifer J.; Cheng, Liang; Huang, Haojie


    Prostate cancer (PCa) patients with regional lymph node involvement at radical prostatectomy often experience disease progression to other organs, with the bone as the predominant site. The transcription factor Runx2 plays an important role in bone formation and PCa cell migration, invasion and metastasis. Here we demonstrated that the forkhead protein FOXO1, a key downstream effector of the tumor suppressor PTEN, inhibits the transcriptional activity of Runx2 in PCa cells. This inhibition was enhanced by PTEN but diminished by active Akt. FOXO1 bound to Runx2 in vitro and in vivo and suppressed Runx2’s activity independent of its transcriptional function. FOXO1 inhibited Runx2-promoted migration of PCa cells while silencing of endogenous FOXO1 enhanced PCa cell migration in a Runx2-dependent manner. Forced expression of FOXO1 also inhibited Runx2-promoted PCa cell invasion. Finally, we found that expression of PTEN and the level of FOXO1 in the nucleus is inversely correlated with expression of Runx2 in a cohort of PCa specimens from patients with lymph node and bone metastasis. These data reveal FOXO1 as a critical negative regulator of Runx2 in PCa cells. Inactivation of FOXO1 due to frequent loss of PTEN in PCa cells may leave the oncogenic activities of Runx2 unchecked, thereby driving promiscuous expression of Runx2 target genes involved in cell migration and invasion and favoring PCa progression. PMID:21505104

  10. SUMOylation Regulates the Transcriptional Repression Activity of FOG-2 and Its Association with GATA-4

    PubMed Central

    Perdomo, José; Jiang, Xing-Mai; Carter, Daniel R.; Khachigian, Levon M.; Chong, Beng H.


    Friend of GATA 2 (FOG-2), a co-factor of several GATA transcription factors (GATA-4, -5 and 6), is a critical regulator of coronary vessel formation and heart morphogenesis. Here we demonstrate that FOG-2 is SUMOylated and that this modification modulates its transcriptional activity. FOG-2 SUMOylation occurs at four lysine residues (K312, 471, 915, 955). Three of these residues are part of the characteristic SUMO consensus site (ψKXE), while K955 is found in the less frequent TKXE motif. Absence of SUMOylation did not affect FOG-2′s nuclear localization. However, mutation of the FOG-2 SUMOylation sites, or de-SUMOylation, with SENP-1 or SENP-8 resulted in stronger transcriptional repression activity in both heterologous cells and cardiomyocytes. Conversely, increased FOG-2 SUMOylation by overexpression of SUMO-1 or expression of a SUMO-1-FOG-2 fusion protein rendered FOG-2 incapable of repressing GATA-4-mediated activation of the B-type natriuretic peptide (BNP) promoter. Moreover, we demonstrate both increased interaction between a FOG-2 SUMO mutant and GATA-4 and enhanced SUMOylation of wild-type FOG-2 by co-expression of GATA-4. These data suggest a new dynamics in which GATA-4 may alter the activity of FOG-2 by influencing its SUMOylation status. PMID:23226341

  11. Benzimidazoles diminish ERE transcriptional activity and cell growth in breast cancer cells

    PubMed Central

    Payton-Stewart, Florastina; Tilghman, Syreeta L.; Williams, LaKeisha G.; Winfield, Leyte L.


    Estrogen receptors (ERα and ERβ) are members of the nuclear receptor superfamily. They regulate the transcription of estrogen-responsive genes and mediate numerous estrogen related diseases (i.e., fertility, osteoporosis, cancer, etc.). As such, ERs are potentially useful targets for developing therapies and diagnostic tools for hormonally responsive human breast cancers. In this work, two benzimidazole-based sulphonamides originally designed to reduce proliferation in prostate cancer, have been evaluated for their ability to modulate growth in estrogen dependent and independent cell lines (MCF-7 and MDA-MB 231) using cell viability assays. The molecules reduced growth in MCF-7 cells, but differed in their impact on the growth of MDA-MB 231 cells. Although both molecules reduced estrogen response element (ERE) transcriptional activity in a dose dependent manner, the contrasting activity in the MDA-MB-231 cells seems to suggest that the molecules may act through alternate ER-mediated pathways. Further, the methyl analog showed modest selectivity for the ERβ receptor in an ER gene expression array panel. However, the napthyl analog diminished gene expression. The molecules were docked in the ligand binding domains of the ERα-antagonist and ERβ-agonist crystal structures to evaluate the potential of the molecules to interact with the receptors. The computational analysis complimented the results obtained in the assay of transcriptional activity and gene expression suggesting that the molecules upregulate ERβ activity while down regulating that of ERα. PMID:24997336

  12. DNA recognition by a σ(54) transcriptional activator from Aquifex aeolicus.


    Vidangos, Natasha K; Heideker, Johanna; Lyubimov, Artem; Lamers, Meindert; Huo, Yixin; Pelton, Jeffrey G; Ton, Jimmy; Gralla, Jay; Berger, James; Wemmer, David E


    Transcription initiation by bacterial σ(54)-polymerase requires the action of a transcriptional activator protein. Activators bind sequence-specifically upstream of the transcription initiation site via a DNA-binding domain (DBD). The structurally characterized DBDs from activators all belong to the Fis (factor for inversion stimulation) family of helix-turn-helix DNA-binding proteins. We report here structures of the free and DNA-bound forms of the DBD of NtrC4 (4DBD) from Aquifex aeolicus, a member of the NtrC family of σ(54) activators. Two NtrC4-binding sites were identified upstream (-145 and -85bp) from the start of the lpxC gene, which is responsible for the first committed step in lipid A biosynthesis. This is the first experimental evidence for σ(54) regulation in lpxC expression. 4DBD was crystallized both without DNA and in complex with the -145-binding site. The structures, together with biochemical data, indicate that NtrC4 binds to DNA in a manner that is similar to that of its close homolog, Fis. The greater sequence specificity for the binding of 4DBD relative to Fis seems to arise from a larger number of base-specific contacts contributing to affinity than for Fis. PMID:25158097

  13. In vivo bioimaging with tissue-specific transcription factor activated luciferase reporters

    PubMed Central

    Buckley, Suzanne M. K.; Delhove, Juliette M. K. M.; Perocheau, Dany P.; Karda, Rajvinder; Rahim, Ahad A.; Howe, Steven J.; Ward, Natalie J.; Birrell, Mark A.; Belvisi, Maria G.; Arbuthnot, Patrick; Johnson, Mark R.; Waddington, Simon N.; McKay, Tristan R.


    The application of transcription factor activated luciferase reporter cassettes in vitro is widespread but potential for in vivo application has not yet been realized. Bioluminescence imaging enables non-invasive tracking of gene expression in transfected tissues of living rodents. However the mature immune response limits luciferase expression when delivered in adulthood. We present a novel approach of tissue-targeted delivery of transcription factor activated luciferase reporter lentiviruses to neonatal rodents as an alternative to the existing technology of generating germline transgenic light producing rodents. At this age, neonates acquire immune tolerance to the conditionally responsive luciferase reporter. This simple and transferrable procedure permits surrogate quantitation of transcription factor activity over the lifetime of the animal. We show principal efficacy by temporally quantifying NFκB activity in the brain, liver and lungs of somatotransgenic reporter mice subjected to lipopolysaccharide (LPS)-induced inflammation. This response is ablated in Tlr4−/− mice or when co-administered with the anti-inflammatory glucocorticoid analogue dexamethasone. Furthermore, we show the malleability of this technology by quantifying NFκB-mediated luciferase expression in outbred rats. Finally, we use somatotransgenic bioimaging to longitudinally quantify LPS- and ActivinA-induced upregulation of liver specific glucocorticoid receptor and Smad2/3 reporter constructs in somatotransgenic mice, respectively. PMID:26138224

  14. DNA-recognition by a σ54 transcriptional activator from Aquifex aeolicus

    PubMed Central

    Vidangos, Natasha K.; Heideker, Johanna; Lyubimov, Artem; Lamers, Meindert; Huo, Yixin; Pelton, Jeffrey G.; Ton, Jimmy; Gralla, Jay; Berger, James; Wemmer, David E.


    Transcription initiation by bacterial σ54-polymerase requires the action of a transcriptional activator protein. Activators bind sequence-specifically upstream of the transcription initiation site via a DNA-binding domain. The structurally characterized DNA-binding domains from activators all belong to the Factor for Inversion Stimulation (Fis) family of helix-turn-helix DNA-binding proteins. We report here structures of the free and DNA-bound forms of the DNA-binding domain of NtrC4 (4DBD) from Aquifex aeolicus, a member of the NtrC family of σ54 activators. Two NtrC4 binding sites were identified upstream (−145 and −85 base pairs) from the start of the lpxC gene, which is responsible for the first committed step in Lipid A biosynthesis. This is the first experimental evidence for σ54 regulation in lpxC expression. 4DBD was crystallized both without DNA and in complex with the −145 binding site. The structures, together with biochemical data, indicate that NtrC4 binds to DNA in a manner that is similar to that of its close homologue, Fis. The greater sequence specificity for the binding of 4DBD relative to Fis seems to arise from a larger number of base specific contacts contributing to affinity than for Fis. PMID:25158097

  15. Prolyl 4-hydroxylase activity-responsive transcription factors: From hydroxylation to gene expression and neuroprotection

    PubMed Central

    Siddiq, Ambreena; Aminova, Leila R; Ratan, Rajiv R


    Most homeostatic processes including gene transcription occur as a result of deviations in physiological tone that threatens the survival of the organism. A prototypical homeostatic stress response includes changes in gene expression following alterations in oxygen, iron or 2-oxoglutarate levels. Each of these cofactors plays an important role in cellular metabolism. Accordingly, a family of enzymes known as the Prolyl 4-hydroxylase (PHD) enzymes are a group of dioxygenases that have evolved to sense changes in 2-oxoglutarate, oxygen and iron via changes in enzyme activity. Indeed, PHDs are a part of an established oxygen sensor system that regulates transcriptional regulation of hypoxia/stress-regulated genes and thus are an important component of events leading to cellular rescue from oxygen, iron or 2-oxoglutarate deprivations. The ability of PHD activity to regulate homeostatic responses to oxygen, iron or 2-oxoglutarate metabolism has led to the development of small molecule inhibitors of the PHDs as a strategy for activating or augmenting cellular stress responses. These small molecules are proving effective in preclinical models of stroke and Parkinson's disease. However the precise protective pathways engaged by PHD inhibition are only beginning to be defined. In the current review, we summarize the role of iron, 2-oxoglutarate and oxygen in the PHD catalyzed hydroxylation reaction and provide a brief discussion of some of the transcription factors that play an effective role in neuroprotection against oxidative stress as a result of changes in PHD activity. PMID:17981760

  16. FHL2 mediates p53-induced transcriptional activation through a direct association with HIPK2

    SciTech Connect

    Lee, Sang-Wang . E-mail:


    To understand the molecular mechanism underlying HIPK2 regulation of the transcriptional activation by p53, we sought to identify the protein that interacts with HIPK2. From our yeast two-hybrid screen, we found that four and a half LIM domains 2 (FHL2) could bind to the C-terminal half of HIPK2. Further assays in yeast mapped the minimal interaction domain to amino acids 812-907 in HIPK2. The interaction was confirmed using a GST pull-down assay in vitro, and an immunoprecipitation (IP) assay and fluorescence microscopy in vivo. FHL2 alone spread throughout both the cytoplasm and nucleus but was redistributed to dot-like structures in the nucleus when HIPK2 was coexpressed in HEK293 cells. When tethered to the Gal4-responsive promoter through the Gal4 DBD fusion, FHL2 showed autonomous transcriptional activity that was enhanced by wild-type HIPK2, but not by the kinase-defective mutant. In addition, FHL2 increased the p53-dependent transcriptional activation and had an additive effect on the activation when coexpressed with HIPK2, which was again not observed with the kinase-defective mutant of HIPK2. Finally, we found a ternary complex of p53, HIPK2, and FHL2 using IP, and their recruitment to the p53-responsive p21Waf1 promoter in chromatin IP assays. Overall, our findings indicate that FHL2 can also regulate p53 via a direct association with HIPK2.

  17. DNA Recognition by a σ54 Transcriptional Activator from Aquifex aeolicus

    SciTech Connect

    Vidangos, Natasha K.; Heideker, Johanna; Lyubimov, Artem; Lamers, Meindert; Huo, Yixin; Pelton, Jeffrey G.; Ton, Jimmy; Gralla, Jay; Berger, James; Wemmer, David E.


    Transcription initiation by bacterial σ54-polymerase requires the action of a transcriptional activator protein. Activators bind sequence-specifically upstream of the transcription initiation site via a DNA-binding domain. The structurally characterized DNA-binding domains from activators all belong to the Factor for Inversion Stimulation (Fis) family of helix-turn-helix DNA-binding proteins. We report here structures of the free and DNA-bound forms of the DNA-binding domain of NtrC4 (4DBD) from Aquifex aeolicus, a member of the NtrC family of σ54 activators. Two NtrC4 binding sites were identified upstream (-145 and -85 base pairs) from the start of the lpxC gene, which is responsible for the first committed step in Lipid A biosynthesis. This is the first experimental evidence for σ54 regulation in lpxC expression. 4DBD was crystallized both without DNA and in complex with the -145 binding site. The structures, together with biochemical data, indicate that NtrC4 binds to DNA in a manner that is similar to that of its close homologue, Fis. Ultimately, the greater sequence specificity for the binding of 4DBD relative to Fis seems to arise from a larger number of base specific contacts contributing to affinity than for Fis.

  18. DNA Recognition by a σ54 Transcriptional Activator from Aquifex aeolicus


    Vidangos, Natasha K.; Heideker, Johanna; Lyubimov, Artem; Lamers, Meindert; Huo, Yixin; Pelton, Jeffrey G.; Ton, Jimmy; Gralla, Jay; Berger, James; Wemmer, David E.


    Transcription initiation by bacterial σ54-polymerase requires the action of a transcriptional activator protein. Activators bind sequence-specifically upstream of the transcription initiation site via a DNA-binding domain. The structurally characterized DNA-binding domains from activators all belong to the Factor for Inversion Stimulation (Fis) family of helix-turn-helix DNA-binding proteins. We report here structures of the free and DNA-bound forms of the DNA-binding domain of NtrC4 (4DBD) from Aquifex aeolicus, a member of the NtrC family of σ54 activators. Two NtrC4 binding sites were identified upstream (-145 and -85 base pairs) from the start of the lpxC gene, which is responsible for themore » first committed step in Lipid A biosynthesis. This is the first experimental evidence for σ54 regulation in lpxC expression. 4DBD was crystallized both without DNA and in complex with the -145 binding site. The structures, together with biochemical data, indicate that NtrC4 binds to DNA in a manner that is similar to that of its close homologue, Fis. Ultimately, the greater sequence specificity for the binding of 4DBD relative to Fis seems to arise from a larger number of base specific contacts contributing to affinity than for Fis.« less

  19. Genetic factors affecting gene transcription and catalytic activity of UDP-glucuronosyltransferases in human liver

    PubMed Central

    Liu, Wanqing; Ramírez, Jacqueline; Gamazon, Eric R.; Mirkov, Snezana; Chen, Peixian; Wu, Kehua; Sun, Chang; Cox, Nancy J.; Cook, Edwin; Das, Soma; Ratain, Mark J.


    The aim of this study was to discover cis- and trans-acting factors significantly affecting mRNA expression and catalytic activity of human hepatic UDP-glucuronosyltransferases (UGTs). Transcription levels of five major hepatic UGT1A (UGT1A1, UGT1A3, UGT1A4, UGT1A6 and UGT1A9) and five UGT2B (UGT2B4, UGT2B7, UGT2B10, UGT2B15 and UGT2B17) genes were quantified in human liver tissue samples (n = 125) using real-time PCR. Glucuronidation activities of 14 substrates were measured in 47 livers. We genotyped 167 tagSNPs (single-nucleotide polymorphisms) in UGT1A (n = 43) and UGT2B (n = 124), as well as the known functional UGT1A1*28 and UGT2B17 CNV (copy number variation) polymorphisms. Transcription levels of 15 transcription factors (TFs) known to regulate these UGTs were quantified. We found that UGT expression and activity were highly variable among the livers (median and range of coefficient of variations: 135%, 74–217% and 52%, 39–105%, respectively). CAR, PXR and ESR1 were found to be the most important trans-regulators of UGT transcription (median and range of correlation coefficients: 46%, 6–58%; 47%, 9–58%; and 52%, 24–75%, respectively). Hepatic UGT activities were mainly determined by UGT gene transcription levels. Twenty-one polymorphisms were significantly (FDR-adjusted P < 0.05) associated with mRNA expression and/or activities of UGT1A1, UGT1A3 and UGT2B17. We found novel SNPs in the UGT2B17 CNV region accounting for variability in UGT2B17 gene transcription and testosterone glucuronidation rate, in addition to that attributable to the UGT2B17 CNV. Our study discovered novel pharmacogenetic markers and provided detailed insight into the genetic network regulating hepatic UGTs. PMID:24879639

  20. Transcript degradation and noise of small RNA-controlled genes in a switch activated network in Escherichia coli.


    Arbel-Goren, Rinat; Tal, Asaf; Parasar, Bibudha; Dym, Alvah; Costantino, Nina; Muñoz-García, Javier; Court, Donald L; Stavans, Joel


    Post-transcriptional regulatory processes may change transcript levels and affect cell-to-cell variability or noise. We study small-RNA downregulation to elucidate its effects on noise in the iron homeostasis network of Escherichia coli In this network, the small-RNA RyhB undergoes stoichiometric degradation with the transcripts of target genes in response to iron stress. Using single-molecule fluorescence in situ hybridization, we measured transcript numbers of the RyhB-regulated genes sodB and fumA in individual cells as a function of iron deprivation. We observed a monotonic increase of noise with iron stress but no evidence of theoretically predicted, enhanced stoichiometric fluctuations in transcript numbers, nor of bistable behavior in transcript distributions. Direct detection of RyhB in individual cells shows that its noise is much smaller than that of these two targets, when RyhB production is significant. A generalized two-state model of bursty transcription that neglects RyhB fluctuations describes quantitatively the dependence of noise and transcript distributions on iron deprivation, enabling extraction of in vivo RyhB-mediated transcript degradation rates. The transcripts' threshold-linear behavior indicates that the effective in vivo interaction strength between RyhB and its two target transcripts is comparable. Strikingly, the bacterial cell response exhibits Fur-dependent, switch-like activation instead of a graded response to iron deprivation. PMID:27085802

  1. Nuclear Pore Proteins Nup153 and Megator Define Transcriptionally Active Regions in the Drosophila Genome

    PubMed Central

    Miura, Kota; Luscombe, Nicholas M.; Akhtar, Asifa


    Transcriptional regulation is one of the most important processes for modulating gene expression. Though much of this control is attributed to transcription factors, histones, and associated enzymes, it is increasingly apparent that the spatial organization of chromosomes within the nucleus has a profound effect on transcriptional activity. Studies in yeast indicate that the nuclear pore complex might promote transcription by recruiting chromatin to the nuclear periphery. In higher eukaryotes, however, it is not known whether such regulation has global significance. Here we establish nucleoporins as a major class of global regulators for gene expression in Drosophila melanogaster. Using chromatin-immunoprecipitation combined with microarray hybridisation, we show that Nup153 and Megator (Mtor) bind to 25% of the genome in continuous domains extending 10 kb to 500 kb. These Nucleoporin-Associated Regions (NARs) are dominated by markers for active transcription, including high RNA polymerase II occupancy and histone H4K16 acetylation. RNAi–mediated knock-down of Nup153 alters the expression of ∼5,700 genes, with a pronounced down-regulatory effect within NARs. We find that nucleoporins play a central role in coordinating dosage compensation—an organism-wide process involving the doubling of expression of the male X chromosome. NARs are enriched on the male X chromosome and occupy 75% of this chromosome. Furthermore, Nup153-depletion abolishes the normal function of the male-specific dosage compensation complex. Finally, by extensive 3D imaging, we demonstrate that NARs contribute to gene expression control irrespective of their sub-nuclear localization. Therefore, we suggest that NAR–binding is used for chromosomal organization that enables gene expression control. PMID:20174442

  2. Transcriptional activity of human endogenous retrovirus in Albanian children with autism spectrum disorders.


    Balestrieri, Emanuela; Cipriani, Chiara; Matteucci, Claudia; Capodicasa, Natale; Pilika, Anita; Korca, Ina; Sorrentino, Roberta; Argaw-Denboba, Ayele; Bucci, Ilaria; Miele, Martino Tony; Coniglio, Antonella; Alessandrelli, Riccardo; Sinibaldi Vallebona, Paola


    Recent studies suggest that autism spectrum disorders (ASD) result from interactions between genetic and environmental factors, whose possible links could be represented by epigenetic mechanisms. Here, we investigated the transcriptional activity of three human endogenous retrovirus (HERV) families, in peripheral blood mononuclear cells (PBMCs) from Albanian ASD children, by quantitative real-time PCR. We aimed to confirm the different expression profile already found in Italian ASD children, and to highlight any social and family health condition emerging from information gathered through a questionnaire, to be included among environmental risk factors. The presence of increased HERV-H transcriptional activity in all autistic patients could be understood as a constant epigenetic imprinting of the disease, potentially useful for early diagnosis and for the development of effective novel therapeutic strategies. PMID:27602423

  3. δ-Catenin interacts with LEF-1 and negatively regulates its transcriptional activity.


    He, Yongfeng; Ki, Hyunkyoung; Kim, Hangun; Kim, Kwonseop


    δ-Catenin and β-catenin belong to different subfamilies of armadillo proteins but share some common binding partners, such as E-cadherin. This is the first study that demonstrated a novel common binding partner for δ-catenin and β-catenin, lymphoid enhancer factor-1 (LEF-1). We found that the N-terminus of δ-catenin (amino acids 85-325) bound to the middle region of LEF-1 unlike β-catenin. Overexpressed δ-catenin entered the nucleus and inhibited LEF-1-mediated transcriptional activity in Bosc23 and DLD-1 cell lines. The current study provided novel insights that will provide a better understanding of the effects of δ-catenin on Wnt/LEF-1-mediated transcriptional activity. PMID:25808920

  4. Structure, function, and tethering of DNA-binding domains in σ⁵⁴ transcriptional activators.


    Vidangos, Natasha; Maris, Ann E; Young, Anisa; Hong, Eunmi; Pelton, Jeffrey G; Batchelor, Joseph D; Wemmer, David E


    We compare the structure, activity, and linkage of DNA-binding domains (DBDs) from σ(54) transcriptional activators and discuss how the properties of the DBDs and the linker to the neighboring domain are affected by the overall properties and requirements of the full proteins. These transcriptional activators bind upstream of specific promoters that utilize σ(54)-polymerase. Upon receiving a signal the activators assemble into hexamers, which then, through adenosine triphosphate (ATP) hydrolysis, drive a conformational change in polymerase that enables transcription initiation. We present structures of the DBDs of activators nitrogen regulatory protein C 1 (NtrC1) and Nif-like homolog 2 (Nlh2) from the thermophile Aquifex aeolicus. The structures of these domains and their relationship to other parts of the activators are discussed. These structures are compared with previously determined structures of the DBDs of NtrC4, NtrC, ZraR, and factor for inversion stimulation. The N-terminal linkers that connect the DBDs to the central domains in NtrC1 and Nlh2 were studied and found to be unstructured. Additionally, a crystal structure of full-length NtrC1 was solved, but density of the DBDs was extremely weak, further indicating that the linker between ATPase and DBDs functions as a flexible tether. Flexible linking of ATPase and DBDs is likely necessary to allow assembly of the active hexameric ATPase ring. The comparison of this set of activators also shows clearly that strong dimerization of the DBD only occurs when other domains do not dimerize strongly. PMID:23818155

  5. Insight into GATA1 transcriptional activity through interrogation of cis elements disrupted in human erythroid disorders.


    Wakabayashi, Aoi; Ulirsch, Jacob C; Ludwig, Leif S; Fiorini, Claudia; Yasuda, Makiko; Choudhuri, Avik; McDonel, Patrick; Zon, Leonard I; Sankaran, Vijay G


    Whole-exome sequencing has been incredibly successful in identifying causal genetic variants and has revealed a number of novel genes associated with blood and other diseases. One limitation of this approach is that it overlooks mutations in noncoding regulatory elements. Furthermore, the mechanisms by which mutations in transcriptionalcis-regulatory elements result in disease remain poorly understood. Here we used CRISPR/Cas9 genome editing to interrogate three such elements harboring mutations in human erythroid disorders, which in all cases are predicted to disrupt a canonical binding motif for the hematopoietic transcription factor GATA1. Deletions of as few as two to four nucleotides resulted in a substantial decrease (>80%) in target gene expression. Isolated deletions of the canonical GATA1 binding motif completely abrogated binding of the cofactor TAL1, which binds to a separate motif. Having verified the functionality of these three GATA1 motifs, we demonstrate strong evolutionary conservation of GATA1 motifs in regulatory elements proximal to other genes implicated in erythroid disorders, and show that targeted disruption of such elements results in altered gene expression. By modeling transcription factor binding patterns, we show that multiple transcription factors are associated with erythroid gene expression, and have created predictive maps modeling putative disruptions of their binding sites at key regulatory elements. Our study provides insight into GATA1 transcriptional activity and may prove a useful resource for investigating the pathogenicity of noncoding variants in human erythroid disorders. PMID:27044088

  6. Activation-induced deoxycytidine deaminase (AID) co-transcriptional scanning at single-molecule resolution

    NASA Astrophysics Data System (ADS)

    Senavirathne, Gayan; Bertram, Jeffrey G.; Jaszczur, Malgorzata; Chaurasiya, Kathy R.; Pham, Phuong; Mak, Chi H.; Goodman, Myron F.; Rueda, David


    Activation-induced deoxycytidine deaminase (AID) generates antibody diversity in B cells by initiating somatic hypermutation (SHM) and class-switch recombination (CSR) during transcription of immunoglobulin variable (IgV) and switch region (IgS) DNA. Using single-molecule FRET, we show that AID binds to transcribed dsDNA and translocates unidirectionally in concert with RNA polymerase (RNAP) on moving transcription bubbles, while increasing the fraction of stalled bubbles. AID scans randomly when constrained in an 8 nt model bubble. When unconstrained on single-stranded (ss) DNA, AID moves in random bidirectional short slides/hops over the entire molecule while remaining bound for ~5 min. Our analysis distinguishes dynamic scanning from static ssDNA creasing. That AID alone can track along with RNAP during transcription and scan within stalled transcription bubbles suggests a mechanism by which AID can initiate SHM and CSR when properly regulated, yet when unregulated can access non-Ig genes and cause cancer.

  7. Activation-induced deoxycytidine deaminase (AID) co-transcriptional scanning at single-molecule resolution.


    Senavirathne, Gayan; Bertram, Jeffrey G; Jaszczur, Malgorzata; Chaurasiya, Kathy R; Pham, Phuong; Mak, Chi H; Goodman, Myron F; Rueda, David


    Activation-induced deoxycytidine deaminase (AID) generates antibody diversity in B cells by initiating somatic hypermutation (SHM) and class-switch recombination (CSR) during transcription of immunoglobulin variable (IgV) and switch region (IgS) DNA. Using single-molecule FRET, we show that AID binds to transcribed dsDNA and translocates unidirectionally in concert with RNA polymerase (RNAP) on moving transcription bubbles, while increasing the fraction of stalled bubbles. AID scans randomly when constrained in an 8 nt model bubble. When unconstrained on single-stranded (ss) DNA, AID moves in random bidirectional short slides/hops over the entire molecule while remaining bound for ∼ 5 min. Our analysis distinguishes dynamic scanning from static ssDNA creasing. That AID alone can track along with RNAP during transcription and scan within stalled transcription bubbles suggests a mechanism by which AID can initiate SHM and CSR when properly regulated, yet when unregulated can access non-Ig genes and cause cancer. PMID:26681117

  8. De novo DNA demethylation and noncoding transcription define active intergenic regulatory elements.


    Schlesinger, Felix; Smith, Andrew D; Gingeras, Thomas R; Hannon, Gregory J; Hodges, Emily


    Deep sequencing of mammalian DNA methylomes has uncovered a previously unpredicted number of discrete hypomethylated regions in intergenic space (iHMRs). Here, we combined whole-genome bisulfite sequencing data with extensive gene expression and chromatin-state data to define functional classes of iHMRs, and to reconstruct the dynamics of their establishment in a developmental setting. Comparing HMR profiles in embryonic stem and primary blood cells, we show that iHMRs mark an exclusive subset of active DNase hypersensitive sites (DHS), and that both developmentally constitutive and cell-type-specific iHMRs display chromatin states typical of distinct regulatory elements. We also observe that iHMR changes are more predictive of nearby gene activity than the promoter HMR itself, and that expression of noncoding RNAs within the iHMR accompanies full activation and complete demethylation of mature B cell enhancers. Conserved sequence features corresponding to iHMR transcript start sites, including a discernible TATA motif, suggest a conserved, functional role for transcription in these regions. Similarly, we explored both primate-specific and human population variation at iHMRs, finding that while enhancer iHMRs are more variable in sequence and methylation status than any other functional class, conservation of the TATA box is highly predictive of iHMR maintenance, reflecting the impact of sequence plasticity and transcriptional signals on iHMR establishment. Overall, our analysis allowed us to construct a three-step timeline in which (1) intergenic DHS are pre-established in the stem cell, (2) partial demethylation of blood-specific intergenic DHSs occurs in blood progenitors, and (3) complete iHMR formation and transcription coincide with enhancer activation in lymphoid-specified cells. PMID:23811145

  9. Activation of BPV-1 replication in vitro by the transcription factor E2

    NASA Astrophysics Data System (ADS)

    Yang, Liu; Li, Rong; Mohr, Ian J.; Clark, Robin; Botchan, Michael R.


    Soluble extracts from uninfected murine cells supplemented with purified viral E1 and E2 proteins support the replication of exogenously added papilloma virus DNA. The E2 transactivator stimulates the binding of the E1 replication protein to the minimal origin of replication and activates DNA replication. These results support the concept that transcription factors have a direct role in the initiation of DNA replication in eukaryotes by participating in the assembly of a complex at the origin of replication.

  10. Transcriptional activation of Epstein-Barr virus BRLF1 by USF1 and Rta.


    Hung, Chen-Chia; Kuo, Chung-Wen; Wang, Wen-Hung; Chang, Tzu-Hsuan; Chang, Pey-Jium; Chang, Li-Kwan; Liu, Shih-Tung


    During its lytic cycle, Epstein-Barr virus (EBV) expresses Rta, a factor encoded by BRLF1 that activates the transcription of viral lytic genes. We found that upstream stimulating factor (USF) binds to E1, one of the five E boxes located at - 79 in the BRLF1 promoter (Rp), to activate BRLF1 transcription. Furthermore, Rta was shown to interact with USF1 in coimmunoprecipitation and glutathione S-transferase (GST)-pulldown assays, and confocal laser-scanning microscopy further confirmed that these two proteins colocalize in the nucleus. Rta was also found to bind with the E1 sequence in a biotin-labelled E1 probe, but only in the presence of USF1, suggesting that these two proteins likely form a complex on E1. We subsequently constructed p188mSZ, a reporter plasmid that contained the sequence from - 188 to +5 in Rp, within which the Sp1 site and Zta response element were mutated. In EBV-negative Akata cells cotransfected with p188mSZ and plasmids expressing USF1 and Rta, synergistic activation of Rp transcription was observed. However, after mutating the E1 sequence in p188mSZ, USF1 and Rta were no longer able to transactivate Rp, indicating that Rta autoregulates BRLF1 transcription via its interaction with USF1 on E1. This study showed that pUSF1 transfection after EBV lytic induction in P3HR1 cells increases Rta expression, indicating that USF1 activates Rta expression after the virus enters the lytic cycle. Together, these results reveal a novel mechanism by which USF interacts with Rta to promote viral lytic development, and provide additional insight into the viral-host interactions of EBV. PMID:26297580

  11. De novo DNA demethylation and noncoding transcription define active intergenic regulatory elements

    PubMed Central

    Schlesinger, Felix; Smith, Andrew D.; Gingeras, Thomas R.; Hannon, Gregory J.; Hodges, Emily


    Deep sequencing of mammalian DNA methylomes has uncovered a previously unpredicted number of discrete hypomethylated regions in intergenic space (iHMRs). Here, we combined whole-genome bisulfite sequencing data with extensive gene expression and chromatin-state data to define functional classes of iHMRs, and to reconstruct the dynamics of their establishment in a developmental setting. Comparing HMR profiles in embryonic stem and primary blood cells, we show that iHMRs mark an exclusive subset of active DNase hypersensitive sites (DHS), and that both developmentally constitutive and cell-type-specific iHMRs display chromatin states typical of distinct regulatory elements. We also observe that iHMR changes are more predictive of nearby gene activity than the promoter HMR itself, and that expression of noncoding RNAs within the iHMR accompanies full activation and complete demethylation of mature B cell enhancers. Conserved sequence features corresponding to iHMR transcript start sites, including a discernible TATA motif, suggest a conserved, functional role for transcription in these regions. Similarly, we explored both primate-specific and human population variation at iHMRs, finding that while enhancer iHMRs are more variable in sequence and methylation status than any other functional class, conservation of the TATA box is highly predictive of iHMR maintenance, reflecting the impact of sequence plasticity and transcriptional signals on iHMR establishment. Overall, our analysis allowed us to construct a three-step timeline in which (1) intergenic DHS are pre-established in the stem cell, (2) partial demethylation of blood-specific intergenic DHSs occurs in blood progenitors, and (3) complete iHMR formation and transcription coincide with enhancer activation in lymphoid-specified cells. PMID:23811145

  12. Domain-specific c-Myc ubiquitylation controls c-Myc transcriptional and apoptotic activity

    PubMed Central

    Zhang, Qin; Spears, Erick; Boone, David N.; Li, Zhaoliang; Gregory, Mark A.; Hann, Stephen R.


    The oncogenic transcription factor c-Myc causes transformation and tumorigenesis, but it can also induce apoptotic cell death. Although tumor suppressors are necessary for c-Myc to induce apoptosis, the pathways and mechanisms are unclear. To further understand how c-Myc switches from an oncogenic protein to an apoptotic protein, we examined the mechanism of p53-independent c-Myc–induced apoptosis. We show that the tumor suppressor protein ARF mediates this switch by inhibiting ubiquitylation of the c-Myc transcriptional domain (TD). Whereas TD ubiquitylation is critical for c-Myc canonical transcriptional activity and transformation, inhibition of ubiquitylation leads to the induction of the noncanonical c-Myc target gene, Egr1, which is essential for efficient c-Myc–induced p53-independent apoptosis. ARF inhibits the interaction of c-Myc with the E3 ubiquitin ligase Skp2. Overexpression of Skp2, which occurs in many human tumors, inhibits the recruitment of ARF to the Egr1 promoter, leading to inhibition of c-Myc–induced apoptosis. Therapeutic strategies could be developed to activate this intrinsic apoptotic activity of c-Myc to inhibit tumorigenesis. PMID:23277542

  13. Isolation of the protein and RNA content of active sites of transcription from mammalian cells.


    Melnik, Svitlana; Caudron-Herger, Maïwen; Brant, Lilija; Carr, Ian M; Rippe, Karsten; Cook, Peter R; Papantonis, Argyris


    Mammalian cell nuclei contain three RNA polymerases (RNAP I, RNAP II and RNAP III), which transcribe different gene subsets, and whose active forms are contained in supramolecular complexes known as 'transcription factories.' These complexes are difficult to isolate because they are embedded in the 3D structure of the nucleus. Factories exchange components with the soluble nucleoplasmic pool over time as gene expression programs change during development or disease. Analysis of their content can provide information on the nascent transcriptome and its regulators. Here we describe a protocol for the isolation of large factory fragments under isotonic salt concentrations in <72 h. It relies on DNase I-mediated detachment of chromatin from the nuclear substructure of freshly isolated, unfixed cells, followed by caspase treatment to release multi-megadalton factory complexes. These complexes retain transcriptional activity, and isolation of their contents is compatible with downstream analyses by mass spectrometry (MS) or RNA-sequencing (RNA-seq) to catalog the proteins and RNA associated with sites of active transcription. PMID:26914315

  14. Separation of the transcriptional activation and replication functions of the bovine papillomavirus-1 E2 protein.


    Winokur, P L; McBride, A A


    Replication of bovine papillomavirus-1 (BPV-1) DNA requires two viral gene products, the E1 protein and the full-length E2 protein. The 48 kDa E2 protein is a site-specific DNA-binding protein that binds to several sites which lie adjacent to the BPV-1 origin of replication. The 85 amino acid C-terminal domain contains the specific DNA binding and dimerization properties of the protein. The approximately 200 amino acid N-terminal domain is crucial for transcriptional activation. Both of these domains are highly conserved among different papillomaviruses. An internal hinge region separates the two functional domains. The region varies in amino acid sequence and length among the E2 proteins of different papillomaviruses. A series of mutations were constructed within the E2 open reading frame which delete various regions of the conserved DNA binding and transactivation domains as well as the internal hinge region. Two mutated E2 proteins that lack portions of the conserved DNA-binding domain but which support DNA replication were identified using transient replication assays. These mutated E2 proteins were unable to function as transcriptional activators. Conversely, two E2 proteins containing large deletions of the hinge region were able to activate transcription, but were defective for replication. Thus, the replication and transactivation functions of the E2 protein are separable. PMID:1327758

  15. The metal-responsive transcription factor-1 contributes to HIF-1 activation during hypoxic stress

    SciTech Connect

    Murphy, Brian J. . E-mail:; Sato, Barbara G.; Dalton, Timothy P.; Laderoute, Keith R.


    Hypoxia-inducible factor-1 (HIF-1), the major transcriptional regulator of the mammalian cellular response to low oxygen (hypoxia), is embedded within a complex network of signaling pathways. We have been investigating the importance of another stress-responsive transcription factor, MTF-1, for the adaptation of cells to hypoxia. This article reports that MTF-1 plays a central role in hypoxic cells by contributing to HIF-1 activity. Loss of MTF-1 in transformed Mtf1 null mouse embryonic fibroblasts (MEFs) results in an attenuation of nuclear HIF-1{alpha} protein accumulation, HIF-1 transcriptional activity, and expression of an established HIF-1 target gene, glucose transporter-1 (Glut1). Mtf1 null (Mtf1 KO) MEFs also have constitutively higher levels of both glutathione (GSH) and the rate-limiting enzyme involved in GSH synthesis-glutamate cysteine ligase catalytic subunit-than wild type cells. The altered cellular redox state arising from increased GSH may perturb oxygen-sensing mechanisms in hypoxic Mtf1 KO cells and decrease the accumulation of HIF-1{alpha} protein. Together, these novel findings define a role for MTF-1 in the regulation of HIF-1 activity.

  16. HSF1 transcriptional activity mediates alcohol induction of Vamp2 expression and GABA release.


    Varodayan, Florence P; Harrison, Neil L


    Many central synapses are highly sensitive to alcohol, and it is now accepted that short-term alterations in synaptic function may lead to longer-term changes in circuit function. The regulation of postsynaptic receptors by alcohol has been well studied, but the mechanisms underlying the effects of alcohol on the presynaptic terminal are relatively unexplored. To identify a pathway by which alcohol regulates neurotransmitter release, we recently investigated the mechanism by which ethanol induces Vamp2, but not Vamp1, in mouse primary cortical cultures. These two genes encode isoforms of synaptobrevin, a vesicular soluble N-ethylmaleimide-sensitive factor attachment protein receptor (SNARE) protein required for synaptic vesicle fusion. We found that alcohol activates the transcription factor heat shock factor 1 (HSF1) to induce Vamp2 expression, while Vamp1 mRNA levels remain unaffected. As the Vamp2 gene encodes a SNARE protein, we then investigated whether ethanol exposure and HSF1 transcriptional activity alter neurotransmitter release using electrophysiology. We found that alcohol increased the frequency of γ-aminobutyric acid (GABA)-mediated miniature IPSCs via HSF1, but had no effect on mEPSCs. Overall, these data indicate that alcohol induces HSF1 transcriptional activity to trigger a specific coordinated adaptation in GABAergic presynaptic terminals. This mechanism could explain some of the changes in synaptic function that occur soon after alcohol exposure, and may underlie some of the more enduring effects of chronic alcohol intake on local circuit function. PMID:24376402

  17. HSF1 transcriptional activity mediates alcohol induction of Vamp2 expression and GABA release

    PubMed Central

    Varodayan, Florence P.; Harrison, Neil L.


    Many central synapses are highly sensitive to alcohol, and it is now accepted that short-term alterations in synaptic function may lead to longer-term changes in circuit function. The regulation of postsynaptic receptors by alcohol has been well studied, but the mechanisms underlying the effects of alcohol on the presynaptic terminal are relatively unexplored. To identify a pathway by which alcohol regulates neurotransmitter release, we recently investigated the mechanism by which ethanol induces Vamp2, but not Vamp1, in mouse primary cortical cultures. These two genes encode isoforms of synaptobrevin, a vesicular soluble N-ethylmaleimide-sensitive factor attachment protein receptor (SNARE) protein required for synaptic vesicle fusion. We found that alcohol activates the transcription factor heat shock factor 1 (HSF1) to induce Vamp2 expression, while Vamp1 mRNA levels remain unaffected. As the Vamp2 gene encodes a SNARE protein, we then investigated whether ethanol exposure and HSF1 transcriptional activity alter neurotransmitter release using electrophysiology. We found that alcohol increased the frequency of γ-aminobutyric acid (GABA)-mediated miniature IPSCs via HSF1, but had no effect on mEPSCs. Overall, these data indicate that alcohol induces HSF1 transcriptional activity to trigger a specific coordinated adaptation in GABAergic presynaptic terminals. This mechanism could explain some of the changes in synaptic function that occur soon after alcohol exposure, and may underlie some of the more enduring effects of chronic alcohol intake on local circuit function. PMID:24376402

  18. Upstream Anti-sense Promoters are Hubs of Transcription Factor Binding and Active Histone Modifications

    PubMed Central

    Scruggs, Benjamin S.; Gilchrist, Daniel A.; Nechaev, Sergei; Muse, Ginger W.; Burkholder, Adam; Fargo, David C.; Adelman, Karen


    SUMMARY Anti-sense transcription originating upstream of mammalian protein-coding genes is a well-documented phenomenon, but remarkably little is known about the regulation or function of anti-sense promoters and the non-coding RNAs they generate. Here we define at nucleotide resolution the divergent transcription start sites (TSSs) near mouse mRNA genes. We find that coupled sense and anti-sense TSSs precisely define the boundaries of a nucleosome-depleted region (NDR) that is highly enriched in transcription factor (TF) motifs. Notably, as the distance between sense and anti-sense TSSs increases, so does the size of the NDR, the level of signal-dependent TF binding and gene activation. We further discover a group of anti-sense TSSs in macrophages with an enhancer-like chromatin signature. Interestingly, this signature identifies divergent promoters that are activated during immune challenge. We propose that anti-sense promoters serve as platforms for TF binding and establishment of active chromatin to further regulate or enhance sense-strand mRNA expression. PMID:26028540

  19. Signal transducer and activator of transcription 3 limits Epstein-Barr virus lytic activation in B lymphocytes.


    Hill, Erik R; Koganti, Siva; Zhi, Jizu; Megyola, Cynthia; Freeman, Alexandra F; Palendira, Umaimainthan; Tangye, Stuart G; Farrell, Paul J; Bhaduri-McIntosh, Sumita


    Lytic activation of Epstein-Barr virus (EBV) is central to its life cycle and to most EBV-related diseases. However, not every EBV-infected B cell is susceptible to lytic activation. This lack of uniform susceptibility to lytic activation also directly impacts the success of viral oncolytic therapy for EBV cancers, yet determinants of susceptibility to lytic induction signals are not well understood. To determine if host factors influence susceptibility to EBV lytic activation, we developed a technique to separate lytic from refractory cells and reported that EBV lytic activation occurs preferentially in cells with lower levels of signal transducer and activator of transcription 3 (STAT3). Using this tool to detect single cells, we now extend the correlation between STAT3 and lytic versus refractory states to EBV-infected circulating B cells in patients with primary EBV infection, leading us to investigate whether STAT3 controls susceptibility to EBV lytic activation. In loss-of-function and gain-of-function studies in EBV-positive B lymphoma and lymphoblastoid cells, we found that the levels of functional STAT3 regulate susceptibility to EBV lytic activation. This prompted us to identify a pool of candidate cellular genes that might be regulated by STAT3 to limit EBV lytic activation. From this pool, we confirmed increases in transcript levels in refractory cells of a set of genes known to participate in transcription repression. Taken together, our findings place STAT3 at a critical crossroads between EBV latency and lytic activation, processes fundamental to EBV lymphomagenesis. PMID:23966384

  20. BFV activates the NF-kappaB pathway through its transactivator (BTas) to enhance viral transcription

    SciTech Connect

    Wang Jian; Tan Juan; Zhang Xihui; Guo Hongyan; Zhang Qicheng; Guo Tingting; Geng Yunqi; Qiao Wentao


    Multiple families of viruses have evolved sophisticated strategies to regulate nuclear factor-kappaB (NF-kappaB) signaling, which plays a pivotal role in diverse cellular events, including virus-host interactions. In this study, we report that bovine foamy virus (BFV) is able to activate the NF-kappaB pathway through the action of its transactivator, BTas. Both cellular IKKbeta and IkappaBalpha also participate in this activation. In addition, we demonstrate that BTas induces the processing of p100, which implies that BTas can activate NF-kappaB through a noncanonical pathway as well. Co-immunoprecipitation analysis shows that BTas interacts with IKK catalytic subunits (IKKalpha and IKKbeta), which may be responsible for regulation of IKK kinase activity and persistent NF-kappaB activation. Furthermore, our results indicate that the level of BTas-mediated LTR transcription correlates with the activity of cellular NF-kappaB. Together, this study suggests that BFV activates the NF-kappaB pathway through BTas to enhance viral transcription.

  1. Transcriptional activation of mouse mast cell Protease-7 by activin and transforming growth factor-beta is inhibited by microphthalmia-associated transcription factor.


    Funaba, Masayuki; Ikeda, Teruo; Murakami, Masaru; Ogawa, Kenji; Tsuchida, Kunihiro; Sugino, Hiromu; Abe, Matanobu


    Previous studies have revealed that activin A and transforming growth factor-beta1 (TGF-beta1) induced migration and morphological changes toward differentiation in bone marrow-derived cultured mast cell progenitors (BMCMCs). Here we show up-regulation of mouse mast cell protease-7 (mMCP-7), which is expressed in differentiated mast cells, by activin A and TGF-beta1 in BMCMCs, and the molecular mechanism of the gene induction of mmcp-7. Smad3, a signal mediator of the activin/TGF-beta pathway, transcriptionally activated mmcp-7. Microphthalmia-associated transcription factor (MITF), a tissue-specific transcription factor predominantly expressed in mast cells, melanocytes, and heart and skeletal muscle, inhibited Smad3-mediated mmcp-7 transcription. MITF associated with Smad3, and the C terminus of MITF and the MH1 and linker region of Smad3 were required for this association. Complex formation between Smad3 and MITF was neither necessary nor sufficient for the inhibition of Smad3 signaling by MITF. MITF inhibited the transcriptional activation induced by the MH2 domain of Smad3. In addition, MITF-truncated N-terminal amino acids could associate with Smad3 but did not inhibit Smad3-mediated transcription. The level of Smad3 was decreased by co-expression of MITF but not of dominant-negative MITF, which resulted from proteasomal protein degradation. The changes in the level of Smad3 protein were paralleled by those in Smad3-mediated signaling activity. These findings suggest that MITF negatively regulates Smad-dependent activin/TGF-beta signaling in a tissue-specific manner. PMID:14527958

  2. Aryl hydrocarbon receptor-independent activation of estrogen receptor-dependent transcription by 3-methycholanthrene

    SciTech Connect

    Shipley, Jonathan M.; Waxman, David J. . E-mail:


    Aryl hydrocarbon receptor (AhR) is a ligand-activated transcription factor that stimulates transcription directed by xenobiotic response elements upstream of target genes. Recently, AhR ligands were reported to induce formation of an AhR-estrogen receptor (ER) complex, which can bind to estrogen response elements (EREs) and stimulate transcription of ER target genes. Presently, we investigate the effect of the AhR ligands 3-methylcholanthrene (3MC), 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) and 3,3',4,4',5-pentachlorobiphenyl (BZ126) on ERE-regulated luciferase reporter activity and endogenous ER target gene expression. In MCF-7 human breast cancer cells, 3MC induced transcription of ER reporter genes containing native promoter sequences of the ER-responsive genes complement 3 and pS2 and heterologous promoters regulated by isolated EREs. Dose-response studies revealed that the concentration of 3MC required to half-maximally activate transcription (EC{sub 5}) was >100-fold higher for an ER reporter (27-57 {mu}M) than for an AhR reporter (86-250 nM) in both MCF-7 cells and in human endometrial cancer Ishikawa cells. 3MC also stimulated expression of the endogenous ER target genes amphiregulin, cathepsin D and progesterone receptor, albeit to a much lower extent than was achieved following stimulation with 17{beta}-estradiol. In Ishikawa cells, 3MC, but not BZ126 or TCDD, stimulated ER{alpha}-dependent reporter activity but did not induce expression of endogenous ER target genes. Finally, studies carried out in the AhR-positive rat hepatoma cell line 5L and the AhR-deficient variant BP8 demonstrated that ER reporter activity could be induced by 3MC in a manner that was independent of AhR and thus distinct from the AhR-ER 'hijacking' mechanism described recently. 3MC may thus elicit estrogenic activity by multiple mechanisms.

  3. Genetic dissection of independent and cooperative transcriptional activation by the LysR-type activator ThnR at close divergent promoters.


    Rivas-Marín, Elena; Floriano, Belén; Santero, Eduardo


    Regulation of tetralin biodegradation operons is one of the examples of unconventional LysR-type mediated transcriptional regulation. ThnR activates transcription from two divergent and closely located promoters PB and PC. Although ThnR activates each promoter independently, transcription from each one increases when both promoters are together. Mutational analysis of the intergenic region shows that cooperative transcription is achieved through formation of a ThnR complex when bound to its respective sites at each promoter, via formation of a DNA loop. Mutations also defined ThnR contact sites that are important for independent transcriptional activation at each promoter. A mutation at the PB promoter region, which abolishes its independent transcription, does not affect at all PB transcription in the presence of the divergent promoter PC, thus indicating that the complex formed via DNA loop can compensate for the deficiencies in the correct protein-DNA interaction at one of the promoters. Combination of mutations in both promoters identifies a region at PC that is not important for its independent transcription but it is essential for cooperative transcription from both promoters. This work provides new insights into the diversity and complexity of activation mechanisms used by the most abundant type of bacterial transcriptional regulators. PMID:27087658

  4. Genetic dissection of independent and cooperative transcriptional activation by the LysR-type activator ThnR at close divergent promoters

    PubMed Central

    Rivas-Marín, Elena; Floriano, Belén; Santero, Eduardo


    Regulation of tetralin biodegradation operons is one of the examples of unconventional LysR-type mediated transcriptional regulation. ThnR activates transcription from two divergent and closely located promoters PB and PC. Although ThnR activates each promoter independently, transcription from each one increases when both promoters are together. Mutational analysis of the intergenic region shows that cooperative transcription is achieved through formation of a ThnR complex when bound to its respective sites at each promoter, via formation of a DNA loop. Mutations also defined ThnR contact sites that are important for independent transcriptional activation at each promoter. A mutation at the PB promoter region, which abolishes its independent transcription, does not affect at all PB transcription in the presence of the divergent promoter PC, thus indicating that the complex formed via DNA loop can compensate for the deficiencies in the correct protein-DNA interaction at one of the promoters. Combination of mutations in both promoters identifies a region at PC that is not important for its independent transcription but it is essential for cooperative transcription from both promoters. This work provides new insights into the diversity and complexity of activation mechanisms used by the most abundant type of bacterial transcriptional regulators. PMID:27087658

  5. On involvement of transcription factors nuclear factor kappa-light-chain-enhancer of activated B cells, activator protein-1 and signal transducer and activator of transcription-3 in photodynamic therapy-induced death of crayfish neurons and satellite glial cells.


    Berezhnaya, Elena; Neginskaya, Marya; Kovaleva, Vera; Sharifulina, Svetlana; Ischenko, Irina; Komandirov, Maxim; Rudkovskii, Mikhail; Uzdensky, Anatoly B


    Photodynamic therapy (PDT) is currently used in the treatment of brain tumors. However, not only malignant cells but also neighboring normal neurons and glial cells are damaged during PDT. In order to study the potential role of transcription factors-nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB), activator protein (AP-1), and signal transducer and activator of transcription-3 (STAT-3)-in photodynamic injury of normal neurons and glia, we photosensitized the isolated crayfish mechanoreceptor consisting of a single sensory neuron enveloped by glial cells. Application of different inhibitors and activators showed that transcription factors NF-κB (inhibitors caffeic acid phenethyl ester and parthenolide, activator betulinic acid), AP-1 (inhibitor SR11302), and STAT-3 (inhibitors stattic and cucurbitacine) influenced PDT-induced death and survival of neurons and glial cells in different ways. These experiments indicated involvement of NF-κB in PDT-induced necrosis of neurons and apoptosis of glial cells. However, in glial cells, it played the antinecrotic role. AP-1 was not involved in PDT-induced necrosis of neurons and glia, but mediated glial apoptosis. STAT-3 was involved in PDT-induced apoptosis of glial cells and necrosis of neurons and glia. Therefore, signaling pathways that regulate cell death and survival in neurons and glial cells are different. Using various inhibitors or activators of transcription factors, one can differently influence the sensitivity and resistance of neurons and glial cells to PDT. PMID:26160345

  6. On involvement of transcription factors nuclear factor kappa-light-chain-enhancer of activated B cells, activator protein-1 and signal transducer and activator of transcription-3 in photodynamic therapy-induced death of crayfish neurons and satellite glial cells

    NASA Astrophysics Data System (ADS)

    Berezhnaya, Elena; Neginskaya, Marya; Kovaleva, Vera; Sharifulina, Svetlana; Ischenko, Irina; Komandirov, Maxim; Rudkovskii, Mikhail; Uzdensky, Anatoly B.


    Photodynamic therapy (PDT) is currently used in the treatment of brain tumors. However, not only malignant cells but also neighboring normal neurons and glial cells are damaged during PDT. In order to study the potential role of transcription factors-nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB), activator protein (AP-1), and signal transducer and activator of transcription-3 (STAT-3)-in photodynamic injury of normal neurons and glia, we photosensitized the isolated crayfish mechanoreceptor consisting of a single sensory neuron enveloped by glial cells. Application of different inhibitors and activators showed that transcription factors NF-κB (inhibitors caffeic acid phenethyl ester and parthenolide, activator betulinic acid), AP-1 (inhibitor SR11302), and STAT-3 (inhibitors stattic and cucurbitacine) influenced PDT-induced death and survival of neurons and glial cells in different ways. These experiments indicated involvement of NF-κB in PDT-induced necrosis of neurons and apoptosis of glial cells. However, in glial cells, it played the antinecrotic role. AP-1 was not involved in PDT-induced necrosis of neurons and glia, but mediated glial apoptosis. STAT-3 was involved in PDT-induced apoptosis of glial cells and necrosis of neurons and glia. Therefore, signaling pathways that regulate cell death and survival in neurons and glial cells are different. Using various inhibitors or activators of transcription factors, one can differently influence the sensitivity and resistance of neurons and glial cells to PDT.

  7. NF-{kappa}B p65 represses {beta}-catenin-activated transcription of cyclin D1

    SciTech Connect

    Hwang, Injoo; Choi, Yong Seok; Jeon, Mi-Ya; Jeong, Sunjoo


    Research highlights: {yields} Cyclin D1 transcription is directly activated by {beta}-catenin; however, {beta}-catenin-induced cyclin D1 transcription is reduced by NF-{kappa}B p65. {yields} Protein-protein interaction between NF-{kappa}B p65 and {beta}-catenin might be responsible for p65-mediated repression of cyclin D1. {yields} One of five putative binding sites, located further upstream of other sites, is the major {beta}-catenin binding site in the cyclin D1 promoter. {yields} NF-{kappa}B binding site in cyclin D1 is occupied not only by p65 but also by {beta}-catenin, which is dynamically regulated by the signal. -- Abstract: Signaling crosstalk between the {beta}-catenin and NF-{kappa}B pathways represents a functional network. To test whether the crosstalk also occurs on their common target genes, the cyclin D1 promoter was used as a model because it contains binding sites for both proteins. {beta}-catenin activated transcription from the cyclin D1 promoter, while co-expression of NF-{kappa}B p65 reduced {beta}-catenin-induced transcription. Chromatin immunoprecipitation revealed lithium chloride-induced binding of {beta}-catenin on one of the T-cell activating factor binding sites. More interestingly, {beta}-catenin binding was greatly reduced by NF-{kappa}B p65, possibly by the protein-protein interaction between the two proteins. Such a dynamic and complex binding of {beta}-catenin and NF-{kappa}B on promoters might contribute to the regulated expression of their target genes.

  8. Transcriptional activity of acetylcholinesterase gene is regulated by DNA methylation during C2C12 myogenesis.


    Lau, Kei M; Gong, Amy G W; Xu, Miranda L; Lam, Candy T W; Zhang, Laura M L; Bi, Cathy W C; Cui, D; Cheng, Anthony W M; Dong, Tina T X; Tsim, Karl W K; Lin, Huangquan


    The expression of acetylcholinesterase (AChE), an enzyme hydrolyzes neurotransmitter acetylcholine at vertebrate neuromuscular junction, is regulated during myogenesis, indicating the significance of muscle intrinsic factors in controlling the enzyme expression. DNA methylation is essential for temporal control of myogenic gene expression during myogenesis; however, its role in AChE regulation is not known. The promoter of vertebrate ACHE gene carries highly conserved CG-rich regions, implying its likeliness to be methylated for epigenetic regulation. A DNA methyltransferase inhibitor, 5-azacytidine (5-Aza), was applied onto C2C12 cells throughout the myotube formation. When DNA methylation was inhibited, the promoter activity, transcript expression and enzymatic activity of AChE were markedly increased after day 3 of differentiation, which indicated the putative role of DNA methylation. By bisulfite pyrosequencing, the overall methylation rate was found to peak at day 3 during C2C12 cell differentiation; a SP1 site located at -1826bp upstream of mouse ACHE gene was revealed to be heavily methylated. The involvement of transcriptional factor SP1 in epigenetic regulation of AChE was illustrated here: (i) the SP1-driven transcriptional activity was increased in 5-Aza-treated C2C12 culture; (ii) the binding of SP1 onto the SP1 site of ACHE gene was fully blocked by the DNA methylation; and (iii) the sequence flanking SP1 sites of ACHE gene was precipitated by chromatin immuno-precipitation assay. The findings suggested the role of DNA methylation on AChE transcriptional regulation and provided insight in elucidating the DNA methylation-mediated regulatory mechanism on AChE expression during muscle differentiation. PMID:27021952

  9. Molecular genetics of blood-fleshed peach reveals activation of anthocyanin biosynthesis by NAC transcription factors.


    Zhou, Hui; Lin-Wang, Kui; Wang, Huiliang; Gu, Chao; Dare, Andrew P; Espley, Richard V; He, Huaping; Allan, Andrew C; Han, Yuepeng


    Anthocyanin pigmentation is an important consumer trait in peach (Prunus persica). In this study, the genetic basis of the blood-flesh trait was investigated using the cultivar Dahongpao, which shows high levels of cyanidin-3-glucoside in the mesocarp. Elevation of anthocyanin levels in the flesh was correlated with the expression of an R2R3 MYB transcription factor, PpMYB10.1. However, PpMYB10.1 did not co-segregate with the blood-flesh trait. The blood-flesh trait was mapped to a 200-kb interval on peach linkage group (LG) 5. Within this interval, a gene encoding a NAC domain transcription factor (TF) was found to be highly up-regulated in blood-fleshed peaches when compared with non-red-fleshed peaches. This NAC TF, designated blood (BL), acts as a heterodimer with PpNAC1 which shows high levels of expression in fruit at late developmental stages. We show that the heterodimer of BL and PpNAC1 can activate the transcription of PpMYB10.1, resulting in anthocyanin pigmentation in tobacco. Furthermore, silencing the BL gene reduces anthocyanin pigmentation in blood-fleshed peaches. The transactivation activity of the BL-PpNAC1 heterodimer is repressed by a SQUAMOSA promoter-binding protein-like TF, PpSPL1. Low levels of PpMYB10.1 expression in fruit at early developmental stages is probably attributable to lower levels of expression of PpNAC1 plus the presence of high levels of repressors such as PpSPL1. We present a mechanism whereby BL is the key gene for the blood-flesh trait in peach via its activation of PpMYB10.1 in maturing fruit. Partner TFs such as basic helix-loop-helix proteins and NAC1 are required, as is the removal of transcriptional repressors. PMID:25688923

  10. Identification of two independent nucleosome-binding domains in the transcriptional co-activator SPBP.


    Darvekar, Sagar; Johnsen, Sylvia Sagen; Eriksen, Agnete Bratsberg; Johansen, Terje; Sjøttem, Eva


    Transcriptional regulation requires co-ordinated action of transcription factors, co-activator complexes and general transcription factors to access specific loci in the dense chromatin structure. In the present study we demonstrate that the transcriptional co-regulator SPBP [stromelysin-1 PDGF (platelet-derived growth factor)-responsive element binding protein] contains two independent chromatin-binding domains, the SPBP-(1551-1666) region and the C-terminal extended PHD [ePHD/ADD (extended plant homeodomain/ATRX-DNMT3-DNMT3L)] domain. The region 1551-1666 is a novel core nucleosome-interaction domain located adjacent to the AT-hook motif in the DNA-binding domain. This novel nucleosome-binding region is critically important for proper localization of SPBP in the cell nucleus. The ePHD/ADD domain associates with nucleosomes in a histone tail-dependent manner, and has significant impact on the dynamic interaction between SPBP and chromatin. Furthermore, SPBP and its homologue RAI1 (retinoic-acid-inducible protein 1), are strongly enriched on chromatin in interphase HeLa cells, and both proteins display low nuclear mobility. RAI1 contains a region with homology to the novel nucleosome-binding region SPBP-(1551-1666) and an ePHD/ADD domain with ability to bind nucleosomes. These results indicate that the transcriptional co-regulator SPBP and its homologue RAI1 implicated in Smith-Magenis syndrome and Potocki-Lupski syndrome both belong to the expanding family of chromatin-binding proteins containing several domains involved in specific chromatin interactions. PMID:22081970

  11. MYRF is a membrane-associated transcription factor that autoproteolytically cleaves to directly activate myelin genes.


    Bujalka, Helena; Koenning, Matthias; Jackson, Stacey; Perreau, Victoria M; Pope, Bernard; Hay, Curtis M; Mitew, Stanlislaw; Hill, Andrew F; Lu, Q Richard; Wegner, Michael; Srinivasan, Rajini; Svaren, John; Willingham, Melanie; Barres, Ben A; Emery, Ben


    The myelination of axons is a crucial step during vertebrate central nervous system (CNS) development, allowing for rapid and energy efficient saltatory conduction of nerve impulses. Accordingly, the differentiation of oligodendrocytes, the myelinating cells of the CNS, and their expression of myelin genes are under tight transcriptional control. We previously identified a putative transcription factor, Myelin Regulatory Factor (Myrf), as being vital for CNS myelination. Myrf is required for the generation of CNS myelination during development and also for its maintenance in the adult. It has been controversial, however, whether Myrf directly regulates transcription, with reports of a transmembrane domain and lack of nuclear localization. Here we show that Myrf is a membrane-associated transcription factor that undergoes an activating proteolytic cleavage to separate its transmembrane domain-containing C-terminal region from a nuclear-targeted N-terminal region. Unexpectedly, this cleavage event occurs via a protein domain related to the autoproteolytic intramolecular chaperone domain of the bacteriophage tail spike proteins, the first time this domain has been found to play a role in eukaryotic proteins. Using ChIP-Seq we show that the N-terminal cleavage product directly binds the enhancer regions of oligodendrocyte-specific and myelin genes. This binding occurs via a defined DNA-binding consensus sequence and strongly promotes the expression of target genes. These findings identify Myrf as a novel example of a membrane-associated transcription factor and provide a direct molecular mechanism for its regulation of oligodendrocyte differentiation and CNS myelination. PMID:23966833

  12. Dry and wet approaches for genome-wide functional annotation of conventional and unconventional transcriptional activators.


    Levati, Elisabetta; Sartini, Sara; Ottonello, Simone; Montanini, Barbara


    Transcription factors (TFs) are master gene products that regulate gene expression in response to a variety of stimuli. They interact with DNA in a sequence-specific manner using a variety of DNA-binding domain (DBD) modules. This allows to properly position their second domain, called "effector domain", to directly or indirectly recruit positively or negatively acting co-regulators including chromatin modifiers, thus modulating preinitiation complex formation as well as transcription elongation. At variance with the DBDs, which are comprised of well-defined and easily recognizable DNA binding motifs, effector domains are usually much less conserved and thus considerably more difficult to predict. Also not so easy to identify are the DNA-binding sites of TFs, especially on a genome-wide basis and in the case of overlapping binding regions. Another emerging issue, with many potential regulatory implications, is that of so-called "moonlighting" transcription factors, i.e., proteins with an annotated function unrelated to transcription and lacking any recognizable DBD or effector domain, that play a role in gene regulation as their second job. Starting from bioinformatic and experimental high-throughput tools for an unbiased, genome-wide identification and functional characterization of TFs (especially transcriptional activators), we describe both established (and usually well affordable) as well as newly developed platforms for DNA-binding site identification. Selected combinations of these search tools, some of which rely on next-generation sequencing approaches, allow delineating the entire repertoire of TFs and unconventional regulators encoded by the any sequenced genome. PMID:27453771

  13. Reciprocal Activation of Transcription Factors Underlies the Dichotomy between Proliferation and Invasion of Glioma Cells

    PubMed Central

    Dhruv, Harshil D.; McDonough Winslow, Wendy S.; Armstrong, Brock; Tuncali, Serdar; Eschbacher, Jenny; Kislin, Kerri; Loftus, Joseph C.; Tran, Nhan L.; Berens, Michael E.


    Histology of malignant glioma depicts dense proliferative areas rich in angiogenesis as well as dissemination of neoplastic cells into adjacent brain tissue. Although the mechanisms that trigger transition from proliferative to invasive phenotypes are complex, the dichotomy of cell proliferation and migration, the “Go or Grow” hypothesis, argues for specific and coordinated regulation of these phenotypes. We investigated transcriptional elements that accompany the phenotypes of migration and proliferation, and consider the therapeutic significance of the “Go or Grow” hypothesis. Interrogation of matched core and rim regions from human glioblastoma biopsy specimens in situ (n = 44) revealed higher proliferation (Ki67 labeling index) in cells residing at the core compared to the rim. Profiling activated transcription factors in a panel of migration-activated versus migration-restricted GBM cells portrayed strong NF-κB activity in the migratory cell population. In contrast, increased c-Myc activity was found in migration-restricted proliferative cells. Validation of transcriptional activity by NF-κB- or c-Myc-driven GFP or RFP, respectively, showed an increased NF-κB activity in the active migrating cells, whereas the proliferative, migration restricted cells displayed increased c-Myc activity. Immunohistochemistry on clinical specimens validated a robust phosphorylated c-Myc staining in tumor cells at the core, whereas increased phosphorylated NF-κB staining was detected in the invasive tumor cells at the rim. Functional genomics revealed that depletion of c-Myc expression by siRNA oligonucleotides reduced cell proliferation in vitro, but surprisingly, cell migration was enhanced significantly. Conversely, inhibition of NF-κB by pharmacological inhibitors, SN50 or BAY-11, decreased both cell migration in vitro and invasion ex vivo. Notably, inhibition of NF-κB was found to have no effect on the proliferation rate of glioma cells. These findings

  14. Silodosin Inhibits Noradrenaline-Activated Transcription Factors Elk1 and SRF in Human Prostate Smooth Muscle

    PubMed Central

    Hennenberg, Martin; Strittmatter, Frank; Beckmann, Christer; Rutz, Beata; Füllhase, Claudius; Waidelich, Raphaela; Montorsi, Francesco; Hedlund, Petter; Andersson, Karl-Erik; Stief, Christian G.; Gratzke, Christian


    Background The transcription factors Elk1 and serum response factor (SRF) are central regulators of cell cycle and phenotype in various cell types. Elk1 is activated by phosphorylation (serine-383), while activation of SRF requires its co-factor, myocardin. Activation of Elk1 and SRF results in binding to specific DNA sequences in promoter regions, and may be induced by adrenergic receptor activation in different organs. Objective To examine the effects of adrenergic stimulation on Elk1 and SRF in the human prostate and the ability of the highly selective α1A-adrenoceptor antagonist, silodosin, on transcription factor activation. Methods Prostate tissue was obtained from patients undergoing radical prostatectomy. Expression of Elk1, SRF, and myocardin was estimated by Western blot and immunohistochemistry. Colocalizations were studied by double immunofluorescence staining. Noradrenaline- (NA-) and phenylephrine- (PE-) induced phosphorylation of Elk1 was assessed by Western blot analysis using a phospho-specific antibody. NA-induced activation of Elk1 and SRF was investigated by electrophoretic mobility shift assay (EMSA). Results Immunoreactivity for Elk1, SRF, and myocardin was observed in stromal cells of tissues from each patient. In fluorescence stainings, SRF colocalized with myocardin and α-smooth muscle actin (αSMA). Stimulation of prostate tissues with PE (10 µM) or NA (30 µM) increased the phosphorylation of Elk1 at serine-383. NA-induced Elk1 activation was confirmed by EMSA, where a NA-induced binding of Elk1 to the DNA sequence TTTGCAAAATGCAGGAATTGTTTTCACAGT was observed. Similarly, NA caused SRF binding to the SRF-specific DNA sequence CCATATTAGGCCATATTAGG. Application of silodosin (3 µM) to prostate tissues reduced the activity of Elk1 and SRF in NA-stimulated tissues. Conclusions Silodosin blocks the activation of the two transcription factors, Elk1 and SRF, which is induced by noradrenaline in the human prostate. A role of α1-adrenoceptors

  15. Histone H4 Lys 20 methyltransferase SET8 promotes androgen receptor-mediated transcription activation in prostate cancer

    SciTech Connect

    Yao, Lushuai; Li, Yanyan; Du, Fengxia; Han, Xiao; Li, Xiaohua; Niu, Yuanjie; Ren, Shancheng; Sun, Yingli


    Highlights: • Dihydrotestosterone stimulates H4K20me1 enrichment at the PSA promoter. • SET8 promotes AR-mediated transcription activation. • SET8 interacts with AR and promotes cell proliferation. - Abstract: Histone methylation status in different lysine residues has an important role in transcription regulation. The effect of H4K20 monomethylation (H4K20me1) on androgen receptor (AR)-mediated gene transcription remains unclear. Here we show that AR agonist stimulates the enrichment of H4K20me1 and SET8 at the promoter of AR target gene PSA in an AR dependent manner. Furthermore, SET8 is crucial for the transcription activation of PSA. Co-immunoprecipitation analyses demonstrate that SET8 interacts with AR. Therefore, we conclude that SET8 is involved in AR-mediated transcription activation, possibly through its interaction with AR and H4K20me1 modification.

  16. Transcriptional Regulation During Zygotic Genome Activation in Zebrafish and Other Anamniote Embryos.


    Wragg, J; Müller, F


    Embryo development commences with the fusion of two terminally differentiated haploid gametes into the totipotent fertilized egg, which through a series of major cellular and molecular transitions generate a pluripotent cell mass. The activation of the zygotic genome occurs during the so-called maternal to zygotic transition and prepares the embryo for zygotic takeover from maternal factors, in the control of the development of cellular lineages during differentiation. Recent advances in next generation sequencing technologies have allowed the dissection of the genomic and epigenomic processes mediating this transition. These processes include reorganization of the chromatin structure to a transcriptionally permissive state, changes in composition and function of structural and regulatory DNA-binding proteins, and changeover of the transcriptome as it is overhauled from that deposited by the mother in the oocyte to a zygotically transcribed complement. Zygotic genome activation in zebrafish occurs 10 cell cycles after fertilization and provides an ideal experimental platform for elucidating the temporal sequence and dynamics of establishment of a transcriptionally active chromatin state and helps in identifying the determinants of transcription activation at polymerase II transcribed gene promoters. The relatively large number of pluripotent cells generated by the fast cell divisions before zygotic transcription provides sufficient biomass for next generation sequencing technology approaches to establish the temporal dynamics of events and suggest causative relationship between them. However, genomic and genetic technologies need to be improved further to capture the earliest events in development, where cell number is a limiting factor. These technologies need to be complemented with precise, inducible genetic interference studies using the latest genome editing tools to reveal the function of candidate determinants and to confirm the predictions made by classic

  17. CITED2 modulates estrogen receptor transcriptional activity in breast cancer cells

    SciTech Connect

    Lau, Wen Min; Doucet, Michele; Huang, David; Weber, Kristy L.; Kominsky, Scott L.


    Highlights: •The effects of elevated CITED2 on ER function in breast cancer cells are examined. •CITED2 enhances cell growth in the absence of estrogen and presence of tamoxifen. •CITED2 functions as a transcriptional co-activator of ER in breast cancer cells. -- Abstract: Cbp/p300-interacting transactivator with Glu/Asp-rich carboxy-terminal domain 2 (CITED2) is a member of the CITED family of non-DNA binding transcriptional co-activators of the p300/CBP-mediated transcription complex. Previously, we identified CITED2 as being overexpressed in human breast tumors relative to normal mammary epithelium. Upon further investigation within the estrogen receptor (ER)-positive subset of these breast tumor samples, we found that CITED2 mRNA expression was elevated in those associated with poor survival. In light of this observation, we investigated the effect of elevated CITED2 levels on ER function. While ectopic overexpression of CITED2 in three ER-positive breast cancer cell lines (MCF-7, T47D, and CAMA-1) did not alter cell proliferation in complete media, growth was markedly enhanced in the absence of exogenous estrogen. Correspondingly, cells overexpressing CITED2 demonstrated reduced sensitivity to the growth inhibitory effects of the selective estrogen receptor modulator, 4-hydroxytamoxifen. Subsequent studies revealed that basal ER transcriptional activity was elevated in CITED2-overexpressing cells and was further increased upon the addition of estrogen. Similarly, basal and estrogen-induced expression of the ER-regulated genes trefoil factor 1 (TFF1) and progesterone receptor (PGR) was higher in cells overexpressing CITED2. Concordant with this observation, ChIP analysis revealed higher basal levels of CITED2 localized to the TFF-1 and PGR promoters in cells with ectopic overexpression of CITED2, and these levels were elevated further in response to estrogen stimulation. Taken together, these data indicate that CITED2 functions as a transcriptional co-activator

  18. Transcriptional Activation of the Interleukin-2 Promoter by Hepatitis C Virus Core Protein

    PubMed Central

    Bergqvist, Anders; Rice, Charles M.


    Most patients infected with hepatitis C virus (HCV) become chronic carriers. Viruses that efficiently establish persistent infections must have effective ways of evading host defenses. In the case of HCV, little is known about how chronic infections are established or maintained. Besides hepatocytes, several reports suggest that HCV can infect T and B lymphocytes. Since T cells are essential for viral clearance, direct or indirect effects of HCV on T-cell function could influence the outcome of infection. Given that T-cell growth and differentiation require the cytokine interleukin 2 (IL-2), we asked whether HCV might modulate synthesis of IL-2. Portions of the HCV polyprotein were expressed in Jurkat cells under a variety of conditions. We found that the highly conserved HCV core protein, in combination with other stimuli, was able to dramatically activate transcription from the IL-2 promoter. The carboxy-terminal hydrophobic portion of the core protein was required for this activity. Activation was dependent on nuclear factor of activated T cells (NFAT), occurred in cells deficient in the tyrosine kinase p56lck, and could be blocked by addition of cyclosporin A and by depletion of calcium. These results suggest that the HCV core protein can activate transcription of the IL-2 promoter through the NFAT pathway. This novel activity may have consequences for T-cell development and establishment of persistent infections. PMID:11134290

  19. Activated STAT1 Transcription Factors Conduct Distinct Saltatory Movements in the Cell Nucleus

    PubMed Central

    Speil, Jasmin; Baumgart, Eugen; Siebrasse, Jan-Peter; Veith, Roman; Vinkemeier, Uwe; Kubitscheck, Ulrich


    The activation of STAT transcription factors is a critical determinant of their subcellular distribution and their ability to regulate gene expression. Yet, it is not known how activation affects the behavior of individual STAT molecules in the cytoplasm and nucleus. To investigate this issue, we injected fluorescently labeled STAT1 in living HeLa cells and traced them by single-molecule microscopy. We determined that STAT1 moved stochastically in the cytoplasm and nucleus with very short residence times (<0.03 s) before activation. Upon activation, STAT1 mobility in the cytoplasm decreased ∼2.5-fold, indicating reduced movement of STAT1/importinα/β complexes to the nucleus. In the nucleus, activated STAT1 displayed a distinct saltatory mobility, with residence times of up to 5 s and intermittent diffusive motion. In this manner, activated STAT1 factors can occupy their putative chromatin target sites within ∼2 s. These results provide a better understanding of the timescales on which cellular signaling and regulated gene transcription operate at the single-molecule level. PMID:22261046

  20. Selective constraints on the activation domain of transcription factor Pit-1.

    PubMed Central

    Majumdar, S; Irwin, D M; Elsholtz, H P


    The POU transcription factor Pit-1 activates members of the prolactin/growth hormone gene family in specific endocrine cell types of the pituitary gland. Although Pit-1 is structurally conserved among vertebrate species, evolutionary changes in the pattern of Pit-1 RNA splicing have led to a notable "contraction" of the transactivation domain in the mammalian lineage, relative to Pit-1 in salmonid fish. By site-directed mutagenesis we demonstrate that two splice insertions in salmon Pit-1, called beta (29 aa) and gamma (33 aa), are critical for cooperative activation of the salmon prolactin gene. Paradoxically, Pit-1-dependent activation of the prolactin gene in rat is enhanced in the absence of the homologous beta-insert sequence. This apparent divergence in the mechanism of activation of prolactin genes by Pit-1 is target gene specific, as activation of rat and salmon growth hormone genes by Pit-1 splice variants is entirely conserved. Our data suggest that efficient activation of the prolactin gene in the vertebrate pituitary has significantly constrained the pattern of splicing within the Pit-1 transactivation domain. Rapid evolutionary divergence of prolactin gene function may have demanded changes in Pit-1/protein interactions to accommodate new patterns of transcriptional control by developmental or physiological factors. Images Fig. 2 Fig. 3 Fig. 4 PMID:8816787

  1. Transcriptional co-activator PGC-1 alpha drives the formation of slow-twitch muscle fibres.


    Lin, Jiandie; Wu, Hai; Tarr, Paul T; Zhang, Chen-Yu; Wu, Zhidan; Boss, Olivier; Michael, Laura F; Puigserver, Pere; Isotani, Eiji; Olson, Eric N; Lowell, Bradford B; Bassel-Duby, Rhonda; Spiegelman, Bruce M


    The biochemical basis for the regulation of fibre-type determination in skeletal muscle is not well understood. In addition to the expression of particular myofibrillar proteins, type I (slow-twitch) fibres are much higher in mitochondrial content and are more dependent on oxidative metabolism than type II (fast-twitch) fibres. We have previously identified a transcriptional co-activator, peroxisome-proliferator-activated receptor-gamma co-activator-1 (PGC-1 alpha), which is expressed in several tissues including brown fat and skeletal muscle, and that activates mitochondrial biogenesis and oxidative metabolism. We show here that PGC-1 alpha is expressed preferentially in muscle enriched in type I fibres. When PGC-1 alpha is expressed at physiological levels in transgenic mice driven by a muscle creatine kinase (MCK) promoter, a fibre type conversion is observed: muscles normally rich in type II fibres are redder and activate genes of mitochondrial oxidative metabolism. Notably, putative type II muscles from PGC-1 alpha transgenic mice also express proteins characteristic of type I fibres, such as troponin I (slow) and myoglobin, and show a much greater resistance to electrically stimulated fatigue. Using fibre-type-specific promoters, we show in cultured muscle cells that PGC-1 alpha activates transcription in cooperation with Mef2 proteins and serves as a target for calcineurin signalling, which has been implicated in slow fibre gene expression. These data indicate that PGC-1 alpha is a principal factor regulating muscle fibre type determination. PMID:12181572

  2. Activation of the Ig Iα1 promoter by the transcription factor Ets-1 triggers Ig Iα1-Cα1 germline transcription in epithelial cancer cells.


    Duan, Zhi; Zheng, Hui; Xu, San; Jiang, Yiqun; Liu, Haidan; Li, Ming; Hu, Duosha; Li, Wei; Bode, Ann M; Dong, Zigang; Cao, Ya


    Immunoglobulins (Igs) are known to be synthesized and secreted only by B lymphocytes. Class switch recombination (CSR) is a key event that enables B cells to express Igs, and one of the crucial steps for CSR initiation is the germline transcription of Ig genes. Surprisingly, recent studies have demonstrated that the Ig genes are also expressed in some epithelial cancer cells; however, the mechanisms underlying how cancer cells initiate CSR and express Igs are still unknown. In this study, we confirmed that the Ig Iα1 promoter in cancer cell lines was activated by the Ets-1 transcription factor, and the activity of the Ig Iα1 promoter and Ig Iα1-Cα1 germline transcription were attenuated after knockdown of Ets-1 by specific small interfering RNAs (siRNA). Furthermore, the expression of Ets-1 and Igα heavy chain in cancer cells was dose dependently upregulated by TGF-β1. These results indicate that activation of the Ig Iα1 promoter by the transcription factor Ets-1 is a critical pathway and provides a novel mechanism for Ig expression in non-B cell cancers. PMID:24185710

  3. Thioredoxin-interacting protein inhibits hypoxia-inducible factor transcriptional activity.


    Farrell, Michael R; Rogers, Lynette K; Liu, Yusen; Welty, Stephen E; Tipple, Trent E


    Vascular endothelial growth factor (VEGF) is required for proper lung development and is transcriptionally regulated in alveolar epithelial cells by hypoxia-inducible factor (HIF). Previous findings in a newborn mouse model of bronchopulmonary dysplasia (BPD) suggest that thioredoxin-interacting protein (Txnip) is a novel regulator of VEGF expression. The present studies were designed to test the hypothesis that Txnip negatively regulates VEGF through effects on HIF-mediated gene expression. To test this hypothesis, we first examined the levels of VEGF and Txnip protein in the lungs of 1-day-old newborn mice and E19 embryos and detected a significant inverse correlation. To elucidate the mechanisms underlying this relationship, we studied the effects of Txnip overexpression on HIF-mediated transcription using murine lung epithelial (MLE-12) cells. Overexpression of Txnip inhibited HIF-mediated reporter activity in both hypoxia and room air. Suppression of HIF activity by Txnip seemed to be independent of the ability of Txnip to bind to thioredoxin. Thus, our studies support a model in which Txnip is a potentially critical regulator of HIF-mediated gene transcription in the murine lung. Alterations in Txnip expression could alter lung VEGF expression in prematurely born human infants and contribute to the development of BPD. PMID:20692333

  4. Transcriptional activation of melanocortin 2 receptor accessory protein by PPARγ in adipocytes

    SciTech Connect

    Kim, Nam Soo; Kim, Yoon-Jin; Cho, Si Young; Lee, Tae Ryong; Kim, Sang Hoon


    Highlights: •MRAP enhanced HSL expression. •ACTH-mediated MRAP reduced glycerol release. •PPARγ induced MRAP expression. •PPARγ bound to the MRAP promoter. -- Abstract: Adrenocorticotropic hormone (ACTH) in rodents decreases lipid accumulation and body weight. Melanocortin receptor 2 (MC2R) and MC2R accessory protein (MRAP) are specific receptors for ACTH in adipocytes. Peroxisome proliferator-activated receptor γ (PPARγ) plays a role in the transcriptional regulation of metabolic pathways such as adipogenesis and β-oxidation of fatty acids. In this study we investigated the transcriptional regulation of MRAP expression during differentiation of 3T3-L1 cells. Stimulation with ACTH affected lipolysis in murine mature adipocytes via MRAP. Putative peroxisome proliferator response element (PPRE) was identified in the MRAP promoter region. In chromatin immunoprecipitation and reporter assays, we observed binding of PPARγ to the MRAP promoter. The mutagenesis experiments showed that the −1209/−1198 region of the MRAP promoter could function as a PPRE site. These results suggest that PPARγ is required for transcriptional activation of the MRAP gene during adipogenesis, which contributes to understanding of the molecular mechanism of lipolysis in adipocytes.

  5. ELK3 Suppresses Angiogenesis by Inhibiting the Transcriptional Activity of ETS-1 on MT1-MMP

    PubMed Central

    Heo, Sun-Hee; Cho, Je-Yoel


    Ets transcription factors play important roles in vasculogenesis and angiogenesis. Knockout of the Ets gene family members in mice resulted in disrupted angiogenesis and malformed vascular systems. In this study, the role and mechanism of ELK3, an Ets factor, in angiogenesis was investigated using ELK3-specific siRNA in human vascular endothelial cells (HUVECs) and in vivo implantation assay. The suppression of ELK3 expression resulted in the reinforcement of VEGF-induced tube formation in HUVECs. The in vivo Matrigel plug assay also showed that ELK3 knockdown resulted in increased angiogenesis. Luciferase activity of the MT1-MMP promoter induced by ETS-1 factor was attenuated ELK3 co-transfection. CHIP assay showed the binding of ELK3 on the MT1-MMP promoter. MT1-MMP knockdown in the ELK3 knockdowned cells resulted in the decrease of tube formation suggesting that MT1-MMP transcriptional repression is required for ELK3-mediated anti-angiogenesis effect. Our data also showed that the suppressive effect of ELK3 on the angiogenesis was partly due to the inhibitory effect of ELK3 to the ETS-1 transcriptional activity on the MT1-MMP promoter rather than direct suppression of ELK3 on the target gene, since the expression level of co-repressor Sin3A is low in endothelial cells. Our results suggest that ELK3 plays a negative role of VEGF-induced angiogenesis through indirectly inhibiting ETS-1 function. PMID:24719561

  6. ELK3 suppresses angiogenesis by inhibiting the transcriptional activity of ETS-1 on MT1-MMP.


    Heo, Sun-Hee; Cho, Je-Yoel


    Ets transcription factors play important roles in vasculogenesis and angiogenesis. Knockout of the Ets gene family members in mice resulted in disrupted angiogenesis and malformed vascular systems. In this study, the role and mechanism of ELK3, an Ets factor, in angiogenesis was investigated using ELK3-specific siRNA in human vascular endothelial cells (HUVECs) and in vivo implantation assay. The suppression of ELK3 expression resulted in the reinforcement of VEGF-induced tube formation in HUVECs. The in vivo Matrigel plug assay also showed that ELK3 knockdown resulted in increased angiogenesis. Luciferase activity of the MT1-MMP promoter induced by ETS-1 factor was attenuated ELK3 co-transfection. CHIP assay showed the binding of ELK3 on the MT1-MMP promoter. MT1-MMP knockdown in the ELK3 knockdowned cells resulted in the decrease of tube formation suggesting that MT1-MMP transcriptional repression is required for ELK3-mediated anti-angiogenesis effect. Our data also showed that the suppressive effect of ELK3 on the angiogenesis was partly due to the inhibitory effect of ELK3 to the ETS-1 transcriptional activity on the MT1-MMP promoter rather than direct suppression of ELK3 on the target gene, since the expression level of co-repressor Sin3A is low in endothelial cells. Our results suggest that ELK3 plays a negative role of VEGF-induced angiogenesis through indirectly inhibiting ETS-1 function. PMID:24719561

  7. Statins Increase Plasminogen Activator Inhibitor Type 1 Gene Transcription through a Pregnane X Receptor Regulated Element

    PubMed Central

    Stanley, Frederick M.; Linder, Kathryn M.; Cardozo, Timothy J.


    Plasminogen activator inhibitor type 1 (PAI-1) is a multifunctional protein that has important roles in inflammation and wound healing. Its aberrant regulation may contribute to many disease processes such as heart disease. The PAI-1 promoter is responsive to multiple inputs including cytokines, growth factors, steroids and oxidative stress. The statin drugs, atorvastatin, mevastatin and rosuvastatin, increased basal and stimulated expression of the PAI-1 promoter 3-fold. A statin-responsive, nuclear hormone response element was previously identified in the PAI-1 promoter, but it was incompletely characterized. We characterized this direct repeat (DR) of AGGTCA with a 3-nucleotide spacer at -269/-255 using deletion and directed mutagenesis. Deletion or mutation of this element increased basal transcription from the promoter suggesting that it repressed PAI-1 transcription in the unliganded state. The half-site spacing and the ligand specificity suggested that this might be a pregnane X receptor (PXR) responsive element. Computational molecular docking showed that atorvastatin, mevastatin and rosuvastatin were structurally compatible with the PXR ligand-binding pocket in its agonist conformation. Experiments with Gal4 DNA binding domain fusion proteins showed that Gal4-PXR was activated by statins while other DR + 3 binding nuclear receptor fusions were not. Overexpression of PXR further enhanced PAI-1 transcription in response to statins. Finally, ChIP experiments using Halo-tagged PXR and RXR demonstrated that both components of the PXR-RXR heterodimer bound to this region of the PAI-1 promoter. PMID:26379245

  8. YY1 represses human papillomavirus type 16 transcription by quenching AP-1 activity.

    PubMed Central

    O'Connor, M J; Tan, S H; Tan, C H; Bernard, H U


    YY1 is a multifunctional transcription factor that has been shown to regulate the expression of a number of cellular and viral genes, including the human papillomavirus (HPV) oncogenes E6 and E7. In this study, we have analyzed the YY1-mediated repression of the HPV type 16 (HPV-16) E6-E7 promoter. A systematic analysis to identify YY1 sites present in the HPV-16 long control region showed that of 30 potential YY1 binding motifs, 24 bound purified recombinant YY1 protein, but only 10 of these were able to bind YY1 when nuclear extracts of HeLa cells were used. Of these, only a cluster of five sites, located in the vicinity of an AP-1 motif, were found to be responsible for repressing the HPV-16 P97 promoter. All five sites were required for repression, the mutation of any one site giving rise to a four- to sixfold increase in transcriptional activity. The target for YY1-mediated repression was identified as being a highly conserved AP-1 site, and we propose that AP-1 may represent a common target for YY1 repression. We also provide data demonstrating that YY1 can bind the transcriptional coactivator CREB-binding protein and propose a potentially novel mechanism by which YY1 represses AP-1 activity as a result of this YY1-CREB-binding protein interaction. PMID:8794287

  9. Structural Analysis of the Phenol-Responsive Sensory Domain of the Transcription Activator PoxR.


    Patil, Vinod Vikas; Park, Kwang-Hyun; Lee, Seung-Goo; Woo, Euijeon


    Positive phenol-degradative gene regulator (PoxR) is a σ(54)-dependent AAA+ ATPase transcription activator that regulates the catabolism of phenols. The PoxR sensory domain detects phenols and relays signals for the activation of transcription. Here we report the first structure of the phenol sensory domain bound to phenol and five derivatives. It exists as a tightly intertwined homodimer with a phenol-binding pocket buried inside, placing two C termini on the same side of the dimer. His102 and Trp130 interact with the hydroxyl group of the phenol in a cavity surrounded by rigid hydrophobic residues on one side and a flexible region on the other. Each monomer has a V4R fold with a unique zinc-binding site. A shift at the C-terminal helix suggests that there is a possible conformational change upon ligand binding. The results provide a structural basis of chemical effector binding for transcriptional regulation with broad implications for protein engineering. PMID:27050690

  10. FBXL5 modulates HIF-1α transcriptional activity by degradation of CITED2.


    Machado-Oliveira, Gisela; Guerreiro, Eduarda; Matias, Ana Catarina; Facucho-Oliveira, João; Pacheco-Leyva, Ivette; Bragança, José


    CITED2 is a ubiquitously expressed nuclear protein exhibiting a high affinity for the cysteine-histidine-rich domain 1 (CH1) of the transcriptional co-activators CBP/p300. CITED2 is particularly efficient in the inhibition of the hypoxia-inducible factor-1α (HIF-1α) dependent transcription by competing with it for the interaction with the CH1 domain. Here we report a direct and specific interaction between CITED2 and the F-box and leucine rich repeat protein 5 (FBXL5), a substrate adaptor protein which is part of E3 ubiquitin ligase complexes mediating protein degradation by the proteasome. We demonstrated that depletion of FBXL5 by RNA interference led to an increase of CITED2 protein levels. Conversely, overexpression of FBXL5 caused the decrease of CITED2 protein levels in a proteasome-dependent manner, and impaired the interaction between CITED2 and the CH1 domain of p300 in living cells. In undifferentiated mouse embryonic stem cells, the overexpression of FBXL5 also reduced Cited2 protein levels. Finally, we evidenced that FBXL5 overexpression and the consequent degradation of CITED2 enabled the transcriptional activity of the N-terminal transactivation domain of HIF-1α. Collectively, our results highlighted a novel molecular interaction between CITED2 and FBXL5, which might regulate the steady state CITED2 protein levels and contribute to the modulation of gene expression by HIF-1α. PMID:25956243

  11. Src tyrosine kinase signaling antagonizes nuclear localization of FOXO and inhibits its transcription factor activity.


    Bülow, Margret H; Bülow, Torsten R; Hoch, Michael; Pankratz, Michael J; Jünger, Martin A


    Biochemical experiments in mammalian cells have linked Src family kinase activity to the insulin signaling pathway. To explore the physiological link between Src and a central insulin pathway effector, we investigated the effect of different Src signaling levels on the Drosophila transcription factor dFOXO in vivo. Ectopic activation of Src42A in the starved larval fatbody was sufficient to drive dFOXO out of the nucleus. When Src signaling levels were lowered by means of loss-of-function mutations or pharmacological inhibition, dFOXO localization was shifted to the nucleus in growing animals, and transcription of the dFOXO target genes d4E-BP and dInR was induced. dFOXO loss-of-function mutations rescued the induction of dFOXO target gene expression and the body size reduction of Src42A mutant larvae, establishing dFOXO as a critical downstream effector of Src signaling. Furthermore, we provide evidence that the regulation of FOXO transcription factors by Src is evolutionarily conserved in mammalian cells. PMID:24513978

  12. HEMERA Couples the Proteolysis and Transcriptional Activity of PHYTOCHROME INTERACTING FACTORs in Arabidopsis Photomorphogenesis

    PubMed Central

    Qiu, Yongjian; Li, Meina; Pasoreck, Elise K.; Long, Lingyun; Shi, Yiting; Galvão, Rafaelo M.; Chou, Conrad L.; Wang, He; Sun, Amanda Y.; Zhang, Yiyin C.; Jiang, Anna; Chen, Meng


    Phytochromes (phys) are red and far-red photoreceptors that control plant development and growth by promoting the proteolysis of a family of antagonistically acting basic helix-loop-helix transcription factors, the PHYTOCHROME-INTERACTING FACTORs (PIFs). We have previously shown that the degradation of PIF1 and PIF3 requires HEMERA (HMR). However, the biochemical function of HMR and the mechanism by which it mediates PIF degradation remain unclear. Here, we provide genetic evidence that HMR acts upstream of PIFs in regulating hypocotyl growth. Surprisingly, genome-wide analysis of HMR- and PIF-dependent genes reveals that HMR is also required for the transactivation of a subset of PIF direct-target genes. We show that HMR interacts with all PIFs. The HMR-PIF interaction is mediated mainly by HMR’s N-terminal half and PIFs’ conserved active-phytochrome B binding motif. In addition, HMR possesses an acidic nine-amino-acid transcriptional activation domain (9aaTAD) and a loss-of-function mutation in this 9aaTAD impairs the expression of PIF target genes and the destruction of PIF1 and PIF3. Together, these in vivo results support a regulatory mechanism for PIFs in which HMR is a transcriptional coactivator binding directly to PIFs and the 9aaTAD of HMR couples the degradation of PIF1 and PIF3 with the transactivation of PIF target genes. PMID:25944101

  13. Bromodomain protein 4 mediates the papillomavirus E2 transcriptional activation function.


    Schweiger, Michal-Ruth; You, Jianxin; Howley, Peter M


    The papillomavirus E2 regulatory protein has essential roles in viral transcription and the initiation of viral DNA replication as well as for viral genome maintenance. Brd4 has recently been identified as a major E2-interacting protein and, in the case of the bovine papillomavirus type 1, serves to tether E2 and the viral genomes to mitotic chromosomes in dividing cells, thus ensuring viral genome maintenance. We have explored the possibility that Brd4 is involved in other E2 functions. By analyzing the binding of Brd4 to a series of alanine-scanning substitution mutants of the human papillomavirus type 16 E2 N-terminal transactivation domain, we found that amino acids required for Brd4 binding were also required for transcriptional activation but not for viral DNA replication. Functional studies of cells expressing either the C-terminal domain of Brd4 that can bind E2 and compete its binding to Brd4 or short interfering RNA to knock down Brd4 protein levels revealed a role for Brd4 in the transcriptional activation function of E2 but not for its viral DNA replication function. Therefore, these studies establish a broader role for Brd4 in the papillomavirus life cycle than as the chromosome tether for E2 during mitosis. PMID:16611886

  14. A General Strategy to Enhance the Potency of Chimeric Transcriptional Activators

    NASA Astrophysics Data System (ADS)

    Natesan, Sridaran; Molinari, Elizabeth; Rivera, Victor M.; Rickles, Richard J.; Gilman, Michael


    Efforts to increase the potency of transcriptional activators are generally unsuccessful because poor expression of activators in mammalian cells limits their delivery to target promoters. Here we report that the effectiveness of chimeric activators can be dramatically improved by expressing them as noncovalent tetrameric bundles. Bundled activation domains are much more effective at activating a reporter gene than simple monomeric activators, presumably because, at similar expression levels, up to 4 times as many the activation domains are delivered to the target promoter. These bundled activation domains are also more effective than proteins in which activation domains are tandemly reiterated in the same polypeptide chain, because such proteins are very poorly expressed and therefore not delivered effectively. These observations suggest that there is a threshold number of activation domains that must be bound to a promoter for activation, above which promoter activity is simply a function of the number of activators bound. We show that bundling can be exploited practically to enhance the sensitivity of mammalian two-hybrid assays, enabling detection of weak interactions or those between poorly expressed proteins. Bundling also dramatically improves the performance of a small-molecule-regulated gene expression system when the expression level of regulatory protein is limiting, a situation that may be encountered in gene therapy applications.

  15. Phosphorylation-dependent sumoylation regulates estrogen-related receptor-alpha and -gamma transcriptional activity through a synergy control motif.


    Tremblay, Annie M; Wilson, Brian J; Yang, Xiang-Jiao; Giguère, Vincent


    Interplay between different posttranslational modifications of transcription factors is an important mechanism to achieve an integrated regulation of gene expression. For the estrogen-related receptors (ERRs) alpha and gamma, regulation by posttranslational modifications is still poorly documented. Here we show that transcriptional repression associated with the ERR amino-terminal domains is mediated through sumoylation at a conserved phospho-sumoyl switch, psiKxEPxSP, that exists within a larger synergy control motif. Arginine substitution of the sumoylatable lysine residue or alanine substitution of a nearby phosphorylatable serine residue (serine 19 in ERRalpha) increased the transcriptional activity of both ERRalpha and -gamma. In addition, phospho-mimetic substitution of the serine residue with aspartate restored the sumoylation and transcriptional repression activity. The increased transcriptional activity of the sumoylation-deficient mutants was more pronounced in the presence of multiple adjacent ERR response elements. We also identified protein inhibitor of activated signal transducer and activator of transcription y as an interacting partner and a small ubiquitin-related modifier E3 ligase for ERRalpha. Importantly, analysis with a phospho-specific antibody revealed that sumoylation of ERRalpha in mouse liver requires phosphorylation of serine 19. Taken together, these results show that the interplay of phosphorylation and sumoylation in the amino-terminal domain provides an additional mechanism to regulate the transcriptional activity of ERRalpha and -gamma. PMID:18063693

  16. Mercury Detoxification by Bacteria: Simulations of Transcription Activation and Mercury-Carbon Bond Cleavage

    SciTech Connect

    Guo, Hao-Bo; Parks, Jerry M; Johs, Alexander; Smith, Jeremy C


    In this chapter, we summarize recent work from our laboratory and provide new perspective on two important aspects of bacterial mercury resistance: the molecular mechanism of transcriptional regulation by MerR, and the enzymatic cleavage of the Hg-C bond in methylmercury by the organomercurial lyase, MerB. Molecular dynamics (MD) simulations of MerR reveal an opening-and-closing dynamics, which may be involved in initiating transcription of mercury resistance genes upon Hg(II) binding. Density functional theory (DFT) calculations on an active-site model of the enzyme reveal how MerB catalyzes the Hg-C bond cleavage using cysteine coordination and acid-base chemistry. These studies provide insight into the detailed mechanisms of microbial gene regulation and defense against mercury toxicity.

  17. FOXR2 Interacts with MYC to Promote Its Transcriptional Activities and Tumorigenesis.


    Li, Xu; Wang, Wenqi; Xi, Yuanxin; Gao, Min; Tran, MyKim; Aziz, Kathryn E; Qin, Jun; Li, Wei; Chen, Junjie


    By combining the results of a large-scale proteomic analysis of the human transcription factor interaction network with knowledge databases, we identified FOXR2 as one of the top-ranked candidate proto-oncogenes. Here, we show that FOXR2 forms a stable complex with MYC and MAX and subsequently regulates cell proliferation by promoting MYC's transcriptional activities. We demonstrate that FOXR2 is highly expressed in several breast, lung, and liver cancer cell lines and related patient tumor samples, while reduction of FOXR2 expression in a xenograft model inhibits tumor growth. These results indicate that FOXR2 acts with MYC to promote cancer cell proliferation, which is a potential tumor-specific target for therapeutic intervention against MYC-driven cancers. PMID:27346356

  18. Molecular genetic analysis of activation-tagged transcription factors thought to be involved in photomorphogenesis

    SciTech Connect

    Neff, Michael M.


    This is a final report for Department of Energy Grant No. DE-FG02-08ER15927 entitled “Molecular Genetic Analysis of Activation-Tagged Transcription Factors Thought to be Involved in Photomorphogenesis”. Based on our preliminary photobiological and genetic analysis of the sob1-D mutant, we hypothesized that OBP3 is a transcription factor involved in both phytochrome and cryptochrome-mediated signal transduction. In addition, we hypothesized that OBP3 is involved in auxin signaling and root development. Based on our preliminary photobiological and genetic analysis of the sob2-D mutant, we also hypothesized that a related gene, LEP, is involved in hormone signaling and seedling development.

  19. WRKY6 Transcription Factor Restricts Arsenate Uptake and Transposon Activation in Arabidopsis[W

    PubMed Central

    Castrillo, Gabriel; Sánchez-Bermejo, Eduardo; de Lorenzo, Laura; Crevillén, Pedro; Fraile-Escanciano, Ana; TC, Mohan; Mouriz, Alfonso; Catarecha, Pablo; Sobrino-Plata, Juan; Olsson, Sanna; Leo del Puerto, Yolanda; Mateos, Isabel; Rojo, Enrique; Hernández, Luis E.; Jarillo, Jose A.; Piñeiro, Manuel; Paz-Ares, Javier; Leyva, Antonio


    Stress constantly challenges plant adaptation to the environment. Of all stress types, arsenic was a major threat during the early evolution of plants. The most prevalent chemical form of arsenic is arsenate, whose similarity to phosphate renders it easily incorporated into cells via the phosphate transporters. Here, we found that arsenate stress provokes a notable transposon burst in plants, in coordination with arsenate/phosphate transporter repression, which immediately restricts arsenate uptake. This repression was accompanied by delocalization of the phosphate transporter from the plasma membrane. When arsenate was removed, the system rapidly restored transcriptional expression and membrane localization of the transporter. We identify WRKY6 as an arsenate-responsive transcription factor that mediates arsenate/phosphate transporter gene expression and restricts arsenate-induced transposon activation. Plants therefore have a dual WRKY-dependent signaling mechanism that modulates arsenate uptake and transposon expression, providing a coordinated strategy for arsenate tolerance and transposon gene silencing. PMID:23922208

  20. In Vitro Anticancer Activity of Phlorofucofuroeckol A via Upregulation of Activating Transcription Factor 3 against Human Colorectal Cancer Cells

    PubMed Central

    Eo, Hyun Ji; Kwon, Tae-Hyung; Park, Gwang Hun; Song, Hun Min; Lee, Su-Jin; Park, Nyun-Ho; Jeong, Jin Boo


    Phlorofucofuroeckol A (PFF-A), one of the phlorotannins found in brown algae, has been reported to exert anti-cancer property. However, the molecular mechanism for the anti-cancer effect of PFF-A has not been known. Activating transcription factor 3 (ATF3) has been reported to be associated with apoptosis in colorectal cancer. The present study was performed to investigate the molecular mechanism by which PFF-A stimulates ATF3 expression and apoptosis in human colorectal cancer cells. PFF-A decreased cell viability through apoptosis of human colorectal cancer cells. PFF-A increased ATF3 expression through regulating transcriptional activity. The responsible cis-element for ATF3 transcriptional activation by PFF-A was cAMP response element binding protein (CREB), located between positions −147 and −85 of the ATF3 promoter. Inhibition of p38, c-Jun N-terminal kinases (JNK), glycogen synthase kinase (GSK) 3β, and IκB kinase (IKK)-α blocked PFF-A-mediated ATF3 expression. ATF3 knockdown by ATF3 siRNA attenuated the cleavage of poly (ADP-ribose) polymerase (PARP) by PFF-A, while ATF3 overexpression increased PFF-A-mediated cleaved PARP. These results suggest that PFF-A may exert anti-cancer property through inducing apoptosis via the ATF3-mediated pathway in human colorectal cancer cells. PMID:27043582

  1. Sucrose-mediated transcriptional regulation of sucrose symporter activity in the phloem.

    SciTech Connect

    Matt Vaughn Greg Harrington Daniel R Bush


    This project was based on our discovery that sucrose acts as a signaling molecule that regulates the activity of a proton-sucrose symporter in sugar beet leaf tissue. A major objective here was determining how sucrose transporter activity is being regulated. When sucrose accumulates in the phloem sucrose transport activity drops dramatically. Western blots of plasma membrane proteins isolated from sucrose treated leaves showed that the loss of sucrose transport activity was proportional to a decline in symporter abundance, demonstrating that sucrose transport is regulated by changes in the amount of BvSUT1 protein. BvSUT1 transcript levels decreased in parallel with the loss of sucrose transport activity. Nuclear run-on experiments demonstrated that BvSUT1 gene transcription was repressed significantly in nuclei from leaves fed 100 mM exogenous sucrose, showing that sucrose-dependent modulation of BvSUT1 mRNA levels is mediated by changes in transcription. To identify which secondary messenger systems might be involved in regulating symporter activity, we used a variety of pharmacological agents to probe for a role of calcium or protein phosphorylation in sucrose signaling. In a detailed analysis, only okadaic acid altered sucrose transport activity. These results suggest a protein phosphatase is involved. We hypothesized that protein kinase inhibitors would have a neutral affect or increase symporter transcription. Transpirational feeding of the protein kinase inhibitor staurosporine had no impact on sucrose transport while calphostin C, an inhibitor of protein kinase C, caused a 60% increase. These data provided good evidence that protein phosphorylation plays a central role in regulating sucrose symporter expression and sucrose transport activity. To determine whether protein phosphorylation is involved in sucrose regulation of proton-sucrose symporter activity, we pre-fed leaves with staurosporine for 4 h and then fed the treated leaves water or 100 mM sucrose

  2. Transcriptional Responses to Estrogen and Progesterone in Mammary Gland Identify Networks Regulating p53 Activity

    PubMed Central

    Lu, Shaolei; Becker, Klaus A.; Hagen, Mary J.; Yan, Haoheng; Roberts, Amy L.; Mathews, Lesley A.; Schneider, Sallie S.; Siegelmann, Hava T.; MacBeth, Kyle J.; Tirrell, Stephen M.; Blanchard, Jeffrey L.; Jerry, D. Joseph


    Estrogen and progestins are essential for mammary growth and differentiation but also enhance the activity of the p53 tumor suppressor protein in the mammary epithelium. However, the pathways by which these hormones regulate p53 activity are unknown. Microarrays were used to profile the transcriptional changes within the mammary gland after administration of either vehicle, 17β-estradiol (E), or progesterone (P) individually and combined (EP). Treatment with EP yielded 1182 unique genes that were differentially expressed compared to the vehicle-treated group. Although 30% of genes were responsive to either E or P individually, combined treatment with both EP had a synergistic effect accounting for 60% of the differentially regulated genes. Analysis of protein-protein interactions identified p53, RelA, Snw1, and Igfals as common targets of genes regulated by EP. RelA and p53 form hubs within a network connected by genes that are regulated by EP and that may coordinate the competing functions of RelA and p53 in proliferation and survival of cells. Induction of early growth response 1 (Egr1) and Stratifin (Sfn) (also known as 14–3-3σ) by EP was confirmed by reverse transcription-quantitative PCR and shown to be p53 independent. In luciferase reporter assays, Egr1 was shown to enhance transcriptional activation by p53 and inhibit nuclear factor κB activity. These results identify a gene expression network that provides redundant activation of RelA to support proliferation as well as sensitize p53 to ensure proper surveillance and integration of their competing functions through factors such as Egr1, which both enhance p53 and inhibit RelA. PMID:18556351

  3. B Cell-Activating Transcription Factor Plays a Critical Role in the Pathogenesis of Anti-Major Histocompatibility Complex-Induced Obliterative Airway Disease.


    Xu, Z; Ramachandran, S; Gunasekaran, M; Nayak, D; Benshoff, N; Hachem, R; Gelman, A; Mohanakumar, T


    Antibodies (Abs) against major histocompatibility complex (MHC) results in T helper-17 (Th17)-mediated immunity against lung self-antigens (SAgs), K-α1 tubulin and collagen V and obliterative airway disease (OAD). Because B cell-activating transcription factor (BATF) controls Th17 and autoimmunity, we proposed that BATF may play a critical role in OAD. Anti-H2K(b) was administered intrabronchially into Batf (-/-) and C57BL/6 mice. Histopathology of the lungs on days 30 and 45 after Ab administration to Batf (-/-) mice resulted in decreased cellular infiltration, epithelial metaplasia, fibrosis, and obstruction. There was lack of Abs to SAgs, reduction of Sag-specific interleukin (IL)-17 T cells, IL-6, IL-23, IL-17, IL-1β, fibroblast growth factor-6, and CXCL12 and decreased Janus kinase 2, signal transducer and activator of transcription 3 (STAT3), and retinoid-related orphan receptor γT. Further, micro-RNA (miR)-301a, a regulator of Th17, was reduced in Batf (-/-) mice in contrast to upregulation of miR-301a and downregulation of protein inhibitor of activated STAT3 (PIAS3) in anti-MHC-induced OAD animals. We also demonstrate an increase in miR-301a in the bronchoalveolar lavage cells from lung transplant recipients with Abs to human leukocyte antigen. This was accompanied by reduction in PIAS3 mRNA. Therefore, we conclude that BATF plays a critical role in the immune responses to SAgs and pathogenesis of anti-MHC-induced rejection. Targeting BATF should be considered for preventing chronic rejection after human lung transplantation. PMID:26844425

  4. Filamin A negatively regulates the transcriptional activity of p73{alpha} in the cytoplasm

    SciTech Connect

    Kim, Eun-Joo; Park, Jong-Sup; Um, Soo-Jong


    The transcription regulator p73{alpha} is structurally different from p53 in that it possesses a unique C-terminal domain, which has been implicated in transcriptional repression. To dissect the mechanism of repression by this domain, we performed a yeast two-hybrid screen of a HeLa cDNA library using residues 487-636 of p73{alpha} as bait and isolated a cDNA clone encoding the C-terminal portion (residues 2210-2647) of filamin A, a 280-kDa actin-binding protein. Additional yeast two-hybrid assays indicated that filamin A specifically interacts with the p73{alpha} C-terminus, which is lacking in p53 and p73{beta}. The interaction was confirmed by GST pull-down assays in vitro and by immunoprecipitation analysis in vivo. Immunofluorescence microscopy revealed that p73{alpha} remained in the cytoplasm in A7 melanoma cells stably expressing filamin A, whereas it was localized in the nucleus of filamin A-deficient M2 cells. Deletion of the C-terminus of p73{alpha} (residues 487-636) resulted in nuclear localization in both cell types. Consistent with our interaction data, transient co-expression of filamin A resulted in the down-regulation of p73{alpha}, but not of p53, transcriptional activity on various p53-responsive promoters. Taken together, our data suggest that p73{alpha} is sequestered in the cytoplasm by filamin A, thereby inhibiting its transcriptional activity.

  5. SARS Coronavirus 3b Accessory Protein Modulates Transcriptional Activity of RUNX1b

    PubMed Central

    Varshney, Bhavna; Agnihotram, Sudhakar; Tan, Yee-Joo; Baric, Ralph; Lal, Sunil K.


    Background The causative agent of severe acute respiratory syndrome, SARS coronavirus (SARS-CoV) genome encodes several unique group specific accessory proteins with unknown functions. Among them, accessory protein 3b (also known as ORF4) was lately identified as one of the viral interferon antagonist. Recently our lab uncovered a new role for 3b in upregulation of AP-1 transcriptional activity and its downstream genes. Thus, we believe that 3b might play an important role in SARS-CoV pathogenesis and therefore is of considerable interest. The current study aims at identifying novel host cellular interactors of the 3b protein. Methodology/Principal Findings In this study, using yeast two-hybrid and co-immunoprecipitation techniques, we have identified a host transcription factor RUNX1b (Runt related transcription factor, isoform b) as a novel interacting partner for SARS-CoV 3b protein. Chromatin immunoprecipitaion (ChIP) and reporter gene assays in 3b expressing jurkat cells showed recruitment of 3b on the RUNX1 binding element that led to an increase in RUNX1b transactivation potential on the IL2 promoter. Kinase assay and pharmacological inhibitor treatment implied that 3b also affect RUNX1b transcriptional activity by regulating its ERK dependent phosphorylation levels. Additionally, mRNA levels of MIP-1α, a RUNX1b target gene upregulated in SARS-CoV infected monocyte-derived dendritic cells, were found to be elevated in 3b expressing U937 monocyte cells. Conclusions/Significance These results unveil a novel interaction of SARS-CoV 3b with the host factor, RUNX1b, and speculate its physiological relevance in upregulating cytokines and chemokine levels in state of SARS virus infection. PMID:22253733

  6. The cAMP response element binding protein, CREB, is a potent inhibitor of diverse transcriptional activators.

    PubMed Central

    Lemaigre, F P; Ace, C I; Green, M R


    Cyclic AMP response element binding protein (CREB) activates transcription of cAMP response element (CRE)-containing promoters following an elevation of intracellular cAMP. Here we show that CREB and the highly related protein ATF-1 are also potent transcription inhibitors. Strikingly, CREB inhibits transcription of multiple activators, whose DNA-binding domains and activation regions are unrelated to one another. Inhibition requires that the CREB dimerization and DNA-binding domains are intact. However, inhibition is not dependent upon the presence of a CRE in the promoter, and does not involve heterodimer formation between CREB and the activator. The ability of an activator protein to inhibit transcription in such a promiscuous fashion has not been previously reported. Images PMID:8332500

  7. Tyrosine phosphorylation and protein degradation control the transcriptional activity of WRKY involved in benzylisoquinoline alkaloid biosynthesis.


    Yamada, Yasuyuki; Sato, Fumihiko


    Benzylisoquinoline alkaloids (BIQ) are among the most structurally diverse and pharmaceutically valuable secondary metabolites. A plant-specific WRKY-type transcription factor, CjWRKY1, was isolated from Coptis japonica and identified as a transcriptional activator of BIQ biosynthesis. However, the expression of CjWRKY1 gene alone was not sufficient for the activation of genes encoding biosynthetic enzymes. Here, we report the importance of post-translational regulation of CjWRKY1 in BIQ biosynthesis. First, we detected the differential accumulation of CjWRKY1 protein in two cell lines with similar CjWRKY1 gene expression but different levels of accumulated alkaloids. Further investigation of the WRKY protein identified the phosphorylation of the WRKYGQK core domain at Y115. The CjWRKY(Y115E) phosphorylation-mimic mutant showed loss of nuclear localization, DNA-binding activity, and transactivation activity compared to wild-type CjWRKY1. Rapid degradation of the CjWRKY1 protein was also confirmed following treatment with inhibitors of the 26S proteasome and protease inhibitors. The existence of two independent degradation pathways as well as protein phosphorylation suggests the fine-tuning of CjWRKY1 activities is involved in the regulation of biosynthesis of BIQs. PMID:27552928

  8. Bnip3 Binds and Activates p300: Possible Role in Cardiac Transcription and Myocyte Morphology.


    Thompson, John W; Wei, Jianqin; Appau, Kweku; Wang, Huilan; Yu, Hong; Spiga, Maria G; Graham, Regina M; Webster, Keith A


    Bnip3 is a hypoxia-regulated member of the Bcl-2 family of proteins that is implicated in apoptosis, programmed necrosis, autophagy and mitophagy. Mitochondria are thought to be the primary targets of Bnip3 although its activities may extend to the ER, cytoplasm, and nucleus. Bnip3 is induced in the heart by ischemia and pressure-overload, and may contribute to cardiomyopathy and heart failure. Only mitochondrial-dependent programmed death actions have been described for Bnip3 in the heart. Here we describe a novel activity of Bnip3 in cultured cardiac myocytes and transgenic mice overexpressing Bnip3 in the heart (Bnip3-TG). In cultured myocytes Bnip3 bound and activated the acetyltransferase p300, increased acetylation of histones and the transcription factor GATA4, and conferred p300 and GATA4-sensitive cellular morphological changes. In intact Bnip3-TG hearts Bnip3 also bound p300 and GATA4 and conferred enhanced GATA4 acetylation. Bnip3-TG mice underwent age-dependent ventricular dilation and heart failure that was partially prevented by p300 inhibition with curcumin. The results suggest that Bnip3 regulates cardiac gene expression and perhaps myocyte morphology by activating nuclear p300 acetyltransferase activity and hyperacetylating histones and p300-selective transcription factors. PMID:26317696

  9. Tyrosine phosphorylation and protein degradation control the transcriptional activity of WRKY involved in benzylisoquinoline alkaloid biosynthesis

    PubMed Central

    Yamada, Yasuyuki; Sato, Fumihiko


    Benzylisoquinoline alkaloids (BIQ) are among the most structurally diverse and pharmaceutically valuable secondary metabolites. A plant-specific WRKY-type transcription factor, CjWRKY1, was isolated from Coptis japonica and identified as a transcriptional activator of BIQ biosynthesis. However, the expression of CjWRKY1 gene alone was not sufficient for the activation of genes encoding biosynthetic enzymes. Here, we report the importance of post-translational regulation of CjWRKY1 in BIQ biosynthesis. First, we detected the differential accumulation of CjWRKY1 protein in two cell lines with similar CjWRKY1 gene expression but different levels of accumulated alkaloids. Further investigation of the WRKY protein identified the phosphorylation of the WRKYGQK core domain at Y115. The CjWRKYY115E phosphorylation-mimic mutant showed loss of nuclear localization, DNA-binding activity, and transactivation activity compared to wild-type CjWRKY1. Rapid degradation of the CjWRKY1 protein was also confirmed following treatment with inhibitors of the 26S proteasome and protease inhibitors. The existence of two independent degradation pathways as well as protein phosphorylation suggests the fine-tuning of CjWRKY1 activities is involved in the regulation of biosynthesis of BIQs. PMID:27552928

  10. REACTIN: Regulatory activity inference of transcription factors underlying human diseases with application to breast cancer

    PubMed Central


    Background Genetic alterations of transcription factors (TFs) have been implicated in the tumorigenesis of cancers. In many cancers, alteration of TFs results in aberrant activity of them without changing their gene expression level. Gene expression data from microarray or RNA-seq experiments can capture the expression change of genes, however, it is still challenge to reveal the activity change of TFs. Results Here we propose a method, called REACTIN (REgulatory ACTivity INference), which integrates TF binding data with gene expression data to identify TFs with significantly differential activity between disease and normal samples. REACTIN successfully detect differential activity of estrogen receptor (ER) between ER+ and ER- samples in 10 breast cancer datasets. When applied to compare tumor and normal breast samples, it reveals TFs that are critical for carcinogenesis of breast cancer. Moreover, Reaction can be utilized to identify transcriptional programs that are predictive to patient survival time of breast cancer patients. Conclusions REACTIN provides a useful tool to investigate regulatory programs underlying a biological process providing the related case and control gene expression data. Considering the enormous amount of cancer gene expression data and the increasingly accumulating ChIP-seq data, we expect wide application of REACTIN for revealing the regulatory mechanisms of various diseases. PMID:23885756

  11. Activation of transcription factor AP-1 and mitogen-activated protein kinases in aniline-induced splenic toxicity

    SciTech Connect

    Khan, M. Firoze . E-mail:; Kannan, Subburaj; Wang Jianling


    Signaling mechanisms in aniline-induced fibrogenic and/or tumorigenic response in the spleen are not known. Previous studies have shown that aniline exposure leads to iron accumulation and oxidative stress in the spleen, which may cause activation of redox-sensitive transcription factors and regulate the transcription of genes involved in fibrosis and/or tumorigenesis. To test this, male SD rats were treated with 0.5 mmol/kg/day aniline via drinking water for 30 days, and activation of transcription factor AP-1 was determined in the splenocyte nuclear extracts (NEs). AP-1 DNA-binding activity in the NEs of freshly isolated splenocytes from aniline-treated rats increased in comparison to the controls, as determined by electrophoretic mobility shift assay (EMSA). AP-1 binding was also determined in the NEs of cultured splenocytes (2 h and 24 h), which showed even a greater increase in binding activity at 2 h. The specificity of AP-1 binding for relevant DNA motifs was confirmed by competition EMSA and by supershift EMSA using antibodies specific to c-Jun and c-Fos. To further explore the signaling mechanisms in the AP-1 activation, phosphorylation patterns of mitogen-activated protein kinases (MAPKs) were pursued. Aniline exposure induced increases in the phosphorylation of the three classes of MAPKs: extracellular-signal-regulated kinase (ERK 1/2), c-Jun N-terminal kinase (JNK 1/2), and p38 MAPKs. Furthermore, TGF-{beta}1 mRNA expression showed a 3-fold increase in the spleens of aniline-treated rats. These observations suggest a strong association among MAPK phosphorylation, AP-1 activation, and enhanced TGF-{beta}1 gene expression. The observed sequence of events subsequent to aniline exposure could regulate genes that lead to fibrogenic and/or tumorigenic response in the spleen.

  12. The availability of the primer activation signal (PAS) affects the efficiency of HIV-1 reverse transcription initiation

    PubMed Central

    Ooms, Marcel; Cupac, Daniel; Abbink, Truus E. M.; Huthoff, Hendrik; Berkhout, Ben


    Initiation of reverse transcription of a retroviral RNA genome is strictly regulated. The tRNA primer binds to the primer binding site (PBS), and subsequent priming is triggered by the primer activation signal (PAS) that also pairs with the tRNA. We observed that in vitro reverse transcription initiation of the HIV-1 leader RNA varies in efficiency among 3′-end truncated transcripts, despite the presence of both PBS and PAS motifs. As the HIV-1 leader RNA can adopt two different foldings, we investigated if the conformational state of the transcripts did influence the efficiency of reverse transcription initiation. However, mutant transcripts that exclusively fold one or the other structure were similarly active, thereby excluding the possibility of regulation of reverse transcription initiation by the structure riboswitch. We next set out to determine the availability of the PAS element. This sequence motif enhances the efficiency of reverse transcription initiation, but its activity is regulated because the PAS motif is initially base paired within the wild-type template. We measured that the initiation efficiency on different templates correlates directly with accessibility of the PAS motif. Furthermore, changes in PAS are critical to facilitate a primer-switch to a new tRNA species, demonstrating the importance of this enhancer element. PMID:17308346

  13. A WW domain-containing yes-associated protein (YAP) is a novel transcriptional co-activator.

    PubMed Central

    Yagi, R; Chen, L F; Shigesada, K; Murakami, Y; Ito, Y


    A protein module called the WW domain recognizes and binds to a short oligopeptide called the PY motif, PPxY, to mediate protein-protein interactions. The PY motif is present in the transcription activation domains of a wide range of transcription factors including c-Jun, AP-2, NF-E2, C/EBPalpha and PEBP2/CBF, suggesting that it plays an important role in transcriptional activation. We show here that mutation of the PY motif in the subregion of the activation domain of the DNA-binding subunit of PEBP2, PEBP2alpha, abolishes its transactivation function. Using yeast two-hybrid screening, we demonstrate that Yes-associated protein (YAP) binds to the PY motif of PEBP2alpha through its WW domain. The C-terminal region of YAP fused to the DNA-binding domain of GAL4 showed transactivation as strong as that of GAL4-VP16. Exogenously expressed YAP conferred transcription-stimulating activity on the PY motif fused to the GAL4 DNA-binding domain as well as to native PEBP2alpha. The osteocalcin promoter was stimulated by exogenous PEBP2alphaA and a dominant negative form of YAP strongly inhibited this activity, suggesting YAP involvement in this promoter activity in vivo. These results indicate that the PY motif is a novel transcription activation domain that functions by recruiting YAP as a strong transcription activator to target genes. PMID:10228168

  14. BET protein Brd4 activates transcription in neurons and BET inhibitor Jq1 blocks memory in mice

    PubMed Central

    Korb, Erica; Herre, Margo; Zucker-Scharff, Ilana; Darnell, Robert B.; Allis, C. David


    Summary Precise regulation of transcription is crucial for the cellular mechanisms underlying memory formation. However, the link between neuronal stimulation and the proteins that directly interact with histone modifications to activate transcription in neurons remains unclear. Brd4 is a member of the BET protein family, which binds acetylated histones and has a critical role in numerous cell types in regulating transcription, including in the response to external cues. Small molecule BET inhibitors are in clinical trials, yet almost nothing is known about Brd4 function in the brain. Here we show that Brd4 is a key player in neuronal function and mediates the transcriptional regulation underlying learning and memory. The loss of Brd4 function affects critical synaptic proteins, which results in memory deficits in mice but also decreases seizure susceptibility. Thus, Brd4 provides a critical, and previously uncharacterized, link between neuronal activation and the transcriptional responses that occur during memory formation. PMID:26301327

  15. Human general transcription factor TFIIA: characterization of a cDNA encoding the small subunit and requirement for basal and activated transcription.

    PubMed Central

    DeJong, J; Bernstein, R; Roeder, R G


    The human general transcription factor TFIIA is one of several factors involved in specific transcription by RNA polymerase II, possibly by regulating the activity of the TATA-binding subunit (TBP) of TFIID. TFIIA purified from HeLa extracts consists of 35-, 19-, and 12-kDa subunits. Here we describe the isolation of a cDNA clone (hTFIIA gamma) encoding the 12-kDa subunit. Using expression constructs derived from hTFIIA gamma and TFIIA alpha/beta (which encodes a 55-kDa precursor to the alpha and beta subunits of natural TFIIA), we have constructed a synthetic TFIIA with a polypeptide composition similar to that of natural TFIIA. The recombinant complex supports the formation of a DNA-TBP-TFIIA complex and mediates both basal and Gal4-VP16-activated transcription by RNA polymerase II in TFIIA-depleted nuclear extracts. In contrast, TFIIA has no effect on tRNA and 5S RNA transcription by RNA polymerase III in this system. We also present evidence that both the p55 and p12 recombinant subunits interact with TBP and that the basic region of TBP is critical for the TFIIA-dependent function of TBP in nuclear extracts. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 Fig. 6 PMID:7724559

  16. A Trihelix DNA Binding Protein Counterbalances Hypoxia-Responsive Transcriptional Activation in Arabidopsis

    PubMed Central

    Licausi, Francesco; Kosmacz, Monika; Oosumi, Teruko; van Dongen, Joost T.; Bailey-Serres, Julia; Perata, Pierdomenico


    Transcriptional activation in response to hypoxia in plants is orchestrated by ethylene-responsive factor group VII (ERF-VII) transcription factors, which are stable during hypoxia but destabilized during normoxia through their targeting to the N-end rule pathway of selective proteolysis. Whereas the conditionally expressed ERF-VII genes enable effective flooding survival strategies in rice, the constitutive accumulation of N-end-rule–insensitive versions of the Arabidopsis thaliana ERF-VII factor RAP2.12 is maladaptive. This suggests that transcriptional activation under hypoxia that leads to anaerobic metabolism may need to be fine-tuned. However, it is presently unknown whether a counterbalance of RAP2.12 exists. Genome-wide transcriptome analyses identified an uncharacterized trihelix transcription factor gene, which we named HYPOXIA RESPONSE ATTENUATOR1 (HRA1), as highly up-regulated by hypoxia. HRA1 counteracts the induction of core low oxygen-responsive genes and transcriptional activation of hypoxia-responsive promoters by RAP2.12. By yeast-two-hybrid assays and chromatin immunoprecipitation we demonstrated that HRA1 interacts with the RAP2.12 protein but with only a few genomic DNA regions from hypoxia-regulated genes, indicating that HRA1 modulates RAP2.12 through protein–protein interaction. Comparison of the low oxygen response of tissues characterized by different levels of metabolic hypoxia (i.e., the shoot apical zone versus mature rosette leaves) revealed that the antagonistic interplay between RAP2.12 and HRA1 enables a flexible response to fluctuating hypoxia and is of importance to stress survival. In Arabidopsis, an effective low oxygen-sensing response requires RAP2.12 stabilization followed by HRA1 induction to modulate the extent of the anaerobic response by negative feedback regulation of RAP2.12. This mechanism is crucial for plant survival under suboptimal oxygenation conditions. The discovery of the feedback loop regulating the oxygen

  17. A trihelix DNA binding protein counterbalances hypoxia-responsive transcriptional activation in Arabidopsis.


    Giuntoli, Beatrice; Lee, Seung Cho; Licausi, Francesco; Kosmacz, Monika; Oosumi, Teruko; van Dongen, Joost T; Bailey-Serres, Julia; Perata, Pierdomenico


    Transcriptional activation in response to hypoxia in plants is orchestrated by ethylene-responsive factor group VII (ERF-VII) transcription factors, which are stable during hypoxia but destabilized during normoxia through their targeting to the N-end rule pathway of selective proteolysis. Whereas the conditionally expressed ERF-VII genes enable effective flooding survival strategies in rice, the constitutive accumulation of N-end-rule-insensitive versions of the Arabidopsis thaliana ERF-VII factor RAP2.12 is maladaptive. This suggests that transcriptional activation under hypoxia that leads to anaerobic metabolism may need to be fine-tuned. However, it is presently unknown whether a counterbalance of RAP2.12 exists. Genome-wide transcriptome analyses identified an uncharacterized trihelix transcription factor gene, which we named HYPOXIA RESPONSE ATTENUATOR1 (HRA1), as highly up-regulated by hypoxia. HRA1 counteracts the induction of core low oxygen-responsive genes and transcriptional activation of hypoxia-responsive promoters by RAP2.12. By yeast-two-hybrid assays and chromatin immunoprecipitation we demonstrated that HRA1 interacts with the RAP2.12 protein but with only a few genomic DNA regions from hypoxia-regulated genes, indicating that HRA1 modulates RAP2.12 through protein-protein interaction. Comparison of the low oxygen response of tissues characterized by different levels of metabolic hypoxia (i.e., the shoot apical zone versus mature rosette leaves) revealed that the antagonistic interplay between RAP2.12 and HRA1 enables a flexible response to fluctuating hypoxia and is of importance to stress survival. In Arabidopsis, an effective low oxygen-sensing response requires RAP2.12 stabilization followed by HRA1 induction to modulate the extent of the anaerobic response by negative feedback regulation of RAP2.12. This mechanism is crucial for plant survival under suboptimal oxygenation conditions. The discovery of the feedback loop regulating the oxygen

  18. Activating Transcription Factor 4 and X Box Binding Protein 1 of Litopenaeus vannamei Transcriptional Regulated White Spot Syndrome Virus Genes Wsv023 and Wsv083

    PubMed Central

    Li, Xiao-Yun; Pang, Li-Ran; Chen, Yong-Gui; Weng, Shao-Ping; Yue, Hai-Tao; Zhang, Ze-Zhi; Chen, Yi-Hong; He, Jian-Guo


    In response to endoplasmic reticulum (ER) stress, the signaling pathway termed unfolded protein response (UPR) is activated. To investigate the role of UPR in Litopenaeus vannamei immunity, the activating transcription factor 4 (designated as LvATF4) which belonged to a branch of the UPR, the [protein kinase RNA (PKR)-like ER kinase, (PERK)]-[eukaryotic initiation factor 2 subunit alpha (eIF2α)] pathway, was identified and characterized. The full-length cDNA of LvATF4 was 1972 bp long, with an open reading frame of 1299 bp long that encoded a 432 amino acid protein. LvATF4 was highly expressed in gills, intestines and stomach. For the white spot syndrome virus (WSSV) challenge, LvATF4 was upregulated in the gills after 3 hpi and increased by 1.9-fold (96 hpi) compared to the mock-treated group. The LvATF4 knock-down by RNA interference resulted in a lower cumulative mortality of L. vannamei under WSSV infection. Reporter gene assays show that LvATF4 could upregulate the expression of the WSSV gene wsv023 based on the activating transcription factor/cyclic adenosine 3′, 5′-monophosphate response element (ATF/CRE). Another transcription factor of L. vannamei, X box binding protein 1 (designated as LvXBP1), has a significant function in [inositol-requiring enzyme-1(IRE1) – (XBP1)] pathway. This transcription factor upregulated the expression of the WSSV gene wsv083 based on the UPR element (UPRE). These results suggest that in L. vannamei UPR signaling pathway transcription factors are important for WSSV and might facilitate WSSV infection. PMID:23638122

  19. Dual transcriptional activities of SIX proteins define their roles in normal and ectopic eye development.


    Anderson, Abigail M; Weasner, Bonnie M; Weasner, Brandon P; Kumar, Justin P


    The SIX family of homeodomain-containing DNA-binding proteins play crucial roles in both Drosophila and vertebrate retinal specification. In flies, three such family members exist, but only two, Sine oculis (So) and Optix, are expressed and function within the eye. In vertebrates, the homologs of Optix (Six3 and Six6) and probably So (Six1 and Six2) are also required for proper eye formation. Depending upon the individual SIX protein and the specific developmental context, transcription of target genes can either be activated or repressed. These activities are thought to occur through physical interactions with the Eyes absent (Eya) co-activator and the Groucho (Gro) co-repressor, but the relative contribution that each complex makes to overall eye development is not well understood. Here, we attempt to address this issue by investigating the role that each complex plays in the induction of ectopic eyes in Drosophila. We fused the VP16 activation and Engrailed repressor domains to both So and Optix, and attempted to generate ectopic eyes with these chimeric proteins. Surprisingly, we find that So and Optix must initially function as transcriptional repressors to trigger the formation of ectopic eyes. Both factors appear to be required to repress the expression of non-retinal selector genes. We propose that during early phases of eye development, SIX proteins function, in part, to repress the transcription of non-retinal selector genes, thereby allowing induction of the retina to proceed. This model of repression-mediated induction of developmental programs could have implications beyond the eye and might be applicable to other systems. PMID:22318629

  20. The Activating Transcription Factor 3 Protein Suppresses the Oncogenic Function of Mutant p53 Proteins*

    PubMed Central

    Wei, Saisai; Wang, Hongbo; Lu, Chunwan; Malmut, Sarah; Zhang, Jianqiao; Ren, Shumei; Yu, Guohua; Wang, Wei; Tang, Dale D.; Yan, Chunhong


    Mutant p53 proteins (mutp53) often acquire oncogenic activities, conferring drug resistance and/or promoting cancer cell migration and invasion. Although it has been well established that such a gain of function is mainly achieved through interaction with transcriptional regulators, thereby modulating cancer-associated gene expression, how the mutp53 function is regulated remains elusive. Here we report that activating transcription factor 3 (ATF3) bound common mutp53 (e.g. R175H and R273H) and, subsequently, suppressed their oncogenic activities. ATF3 repressed mutp53-induced NFKB2 expression and sensitized R175H-expressing cancer cells to cisplatin and etoposide treatments. Moreover, ATF3 appeared to suppress R175H- and R273H-mediated cancer cell migration and invasion as a consequence of preventing the transcription factor p63 from inactivation by mutp53. Accordingly, ATF3 promoted the expression of the metastasis suppressor SHARP1 in mutp53-expressing cells. An ATF3 mutant devoid of the mutp53-binding domain failed to disrupt the mutp53-p63 binding and, thus, lost the activity to suppress mutp53-mediated migration, suggesting that ATF3 binds to mutp53 to suppress its oncogenic function. In line with these results, we found that down-regulation of ATF3 expression correlated with lymph node metastasis in TP53-mutated human lung cancer. We conclude that ATF3 can suppress mutp53 oncogenic function, thereby contributing to tumor suppression in TP53-mutated cancer. PMID:24554706

  1. Epigenetic mediated transcriptional activation of WNT5A participates in arsenical-associated malignant transformation

    SciTech Connect

    Jensen, Taylor J.; Wozniak, Ryan J.; Eblin, Kylee E.; Wnek, Sean M.; Gandolfi, A. Jay; Futscher, Bernard W.


    Arsenic is a human carcinogen with exposure associated with cancer of the lung, skin, and bladder. Many potential mechanisms have been implicated as playing a role in the process of arsenical-induced malignancy including the perturbation of signaling pathways and aberrant epigenetic regulation. We initiated studies to examine the role of a member of the non-canonical WNT signaling pathway, WNT5A, in UROtsa cells and arsenite [URO-ASSC] and monomethylarsonous acid [URO-MSC] malignantly transformed variants. We present data herein that suggest that WNT5A is transcriptionally activated during arsenical-induced malignant transformation. This WNT5A transcriptional activation is correlated with the enrichment of permissive histone modifications and the reduction of repressive modifications in the WNT5A promoter region. The epigenetic activation of WNT5A expression and acetylation of its promoter remain after the removal of the arsenical, consistent with the maintenance of an anchorage independent growth phenotype in these cells. Additionally, treatment with epigenetic modifying drugs supports a functional role for these epigenetic marks in controlling gene expression. Reduction of WNT5A using lentiviral shRNA greatly attenuated the ability of these cells to grow in an anchorage independent fashion. Extension of our model into human bladder cancer cell lines indicates that each of the cell lines examined also express WNT5A. Taken together, these data suggest that the epigenetic remodeling of the WNT5A promoter is correlated with its transcriptional activation and this upregulation likely participates in arsenical-induced malignant transformation.

  2. Post-translational Control of the Temporal Dynamics of Transcription Factor Activity Regulates Neurogenesis.


    Quan, Xiao-Jiang; Yuan, Liqun; Tiberi, Luca; Claeys, Annelies; De Geest, Natalie; Yan, Jiekun; van der Kant, Rob; Xie, Wei R; Klisch, Tiemo J; Shymkowitz, Joost; Rousseau, Frederic; Bollen, Mathieu; Beullens, Monique; Zoghbi, Huda Y; Vanderhaeghen, Pierre; Hassan, Bassem A


    Neurogenesis is initiated by the transient expression of the highly conserved proneural proteins, bHLH transcriptional regulators. Here, we discover a conserved post-translational switch governing the duration of proneural protein activity that is required for proper neuronal development. Phosphorylation of a single Serine at the same position in Scute and Atonal proneural proteins governs the transition from active to inactive forms by regulating DNA binding. The equivalent Neurogenin2 Threonine also regulates DNA binding and proneural activity in the developing mammalian neocortex. Using genome editing in Drosophila, we show that Atonal outlives its mRNA but is inactivated by phosphorylation. Inhibiting the phosphorylation of the conserved proneural Serine causes quantitative changes in expression dynamics and target gene expression resulting in neuronal number and fate defects. Strikingly, even a subtle change from Serine to Threonine appears to shift the duration of Atonal activity in vivo, resulting in neuronal fate defects. PMID:26824657

  3. Regulation of WRKY46 Transcription Factor Function by Mitogen-Activated Protein Kinases in Arabidopsis thaliana.


    Sheikh, Arsheed H; Eschen-Lippold, Lennart; Pecher, Pascal; Hoehenwarter, Wolfgang; Sinha, Alok K; Scheel, Dierk; Lee, Justin


    Mitogen-activated protein kinase (MAPK) cascades are central signaling pathways activated in plants after sensing internal developmental and external stress cues. Knowledge about the downstream substrate proteins of MAPKs is still limited in plants. We screened Arabidopsis WRKY transcription factors as potential targets downstream of MAPKs, and concentrated on characterizing WRKY46 as a substrate of the MAPK, MPK3. Mass spectrometry revealed in vitro phosphorylation of WRKY46 at amino acid position S168 by MPK3. However, mutagenesis studies showed that a second phosphosite, S250, can also be phosphorylated. Elicitation with pathogen-associated molecular patterns (PAMPs), such as the bacterial flagellin-derived flg22 peptide led to in vivo destabilization of WRKY46 in Arabidopsis protoplasts. Mutation of either phosphorylation site reduced the PAMP-induced degradation of WRKY46. Furthermore, the protein for the double phosphosite mutant is expressed at higher levels compared to wild-type proteins or single phosphosite mutants. In line with its nuclear localization and predicted function as a transcriptional activator, overexpression of WRKY46 in protoplasts raised basal plant defense as reflected by the increase in promoter activity of the PAMP-responsive gene, NHL10, in a MAPK-dependent manner. Thus, MAPK-mediated regulation of WRKY46 is a mechanism to control plant defense. PMID:26870073

  4. Protein kinase C modulates transcriptional activation by the juvenile hormone receptor methoprene-tolerant.


    Ojani, Reyhaneh; Liu, Pengcheng; Fu, Xiaonan; Zhu, Jinsong


    Juvenile hormone (JH) controls many biological events in insects by triggering dramatic changes in gene expression in target cells. The Methoprene-tolerant (MET) protein, an intracellular JH receptor, acts as a transcriptional regulator and binds to the promoters of tissue- and stage-specific JH target genes when JH is present. Our recent study has demonstrated that the transcriptional activation by MET is modulated by a membrane-initiated JH signaling pathway, involving phospholipase C (PLC) and calcium/calmodulin-dependent protein kinase II (CaMKII). Here we report that protein kinase C (PKC) is another essential intermediate of this pathway. PKC was activated by JH and this action was PLC-dependent. Inhibition of the PKC activity substantially weakened the JH-induced gene expression in mosquito cells. RNAi experiments indicated that several PKC isoforms were involved in the JH action during the post-emergence development of adult female mosquitoes. JH treatment considerably increased the binding of MET to the promoters of JH response genes in cultured mosquito abdomens that were collected from newly emerged female adults. The JH-induced DNA binding of MET was hindered when the abdomens were treated with a PKC inhibitor and JH. Therefore, the results suggest that PKC modulates the transactivation activity of MET by enhancing the binding of MET to JH response elements in the JH target genes. This mechanism may allow for variable and stage- and tissue-specific genomic responses to JH. PMID:26689644

  5. Regulation of WRKY46 Transcription Factor Function by Mitogen-Activated Protein Kinases in Arabidopsis thaliana

    PubMed Central

    Sheikh, Arsheed H.; Eschen-Lippold, Lennart; Pecher, Pascal; Hoehenwarter, Wolfgang; Sinha, Alok K.; Scheel, Dierk; Lee, Justin


    Mitogen-activated protein kinase (MAPK) cascades are central signaling pathways activated in plants after sensing internal developmental and external stress cues. Knowledge about the downstream substrate proteins of MAPKs is still limited in plants. We screened Arabidopsis WRKY transcription factors as potential targets downstream of MAPKs, and concentrated on characterizing WRKY46 as a substrate of the MAPK, MPK3. Mass spectrometry revealed in vitro phosphorylation of WRKY46 at amino acid position S168 by MPK3. However, mutagenesis studies showed that a second phosphosite, S250, can also be phosphorylated. Elicitation with pathogen-associated molecular patterns (PAMPs), such as the bacterial flagellin-derived flg22 peptide led to in vivo destabilization of WRKY46 in Arabidopsis protoplasts. Mutation of either phosphorylation site reduced the PAMP-induced degradation of WRKY46. Furthermore, the protein for the double phosphosite mutant is expressed at higher levels compared to wild-type proteins or single phosphosite mutants. In line with its nuclear localization and predicted function as a transcriptional activator, overexpression of WRKY46 in protoplasts raised basal plant defense as reflected by the increase in promoter activity of the PAMP-responsive gene, NHL10, in a MAPK-dependent manner. Thus, MAPK-mediated regulation of WRKY46 is a mechanism to control plant defense. PMID:26870073

  6. Histone modifications defining active genes persist after transcriptional and mitotic inactivation.


    Kouskouti, Antigone; Talianidis, Iannis


    We examined various histone modifications across the promoter and the coding regions of constitutively active hepatic genes in G0/G1-enriched, mitotically arrested and alpha-amanitin-blocked cells. Gene activation correlated with localized histone hyperacetylation, H3-K4 tri- or dimethylation and H3-K79 dimethylation and localized nucleosome remodeling at the promoter and the 5' portion of the coding regions. Nucleosomes at more downstream locations were monomethylated at H3-K4. CBP, PCAF, Brg-1, SNF2H and FACT were recruited to the coding regions in a gene-specific manner, in a similarly restricted promoter-proximal pattern. Elongator, however, associated with the more downstream regions. While all factors were dissociated from the chromatin after transcriptional inactivation by alpha-amanitin, the histone modifications remained stable. In mitotic cells, histone modifications on parental nucleosomes were preserved and were regenerated in a transcription-dependent manner at the newly deposited nucleosomes, as the cells entered the next G1 phase. The findings suggest that histone modifications may function as molecular memory bookmarks for previously active locations of the genome, thus contributing to the maintenance of active chromatin states through cell division. PMID:15616580

  7. Transcriptional profiling in the human prefrontal cortex: evidence for two activational states associated with cocaine abuse.


    Lehrmann, E; Oyler, J; Vawter, M P; Hyde, T M; Kolachana, B; Kleinman, J E; Huestis, M A; Becker, K G; Freed, W J


    CNS-focused cDNA microarrays were used to examine gene expression profiles in dorsolateral prefrontal cortex (dlPFC, Area 46) from seven individual sets of age- and post-mortem interval-matched male cocaine abusers and controls. The presence of cocaine and related metabolites was confirmed by gas chromatography-mass spectrometry. Sixty-five transcripts were differentially expressed, indicating alterations in energy metabolism, mitochondria and oligodendrocyte function, cytoskeleton and related signaling, and neuronal plasticity. There was evidence for two distinct states of transcriptional regulation, with increases in gene expression predominating in subjects testing positive for a metabolite indicative of recent 'crack' cocaine abuse and decreased expression profiles in the remaining cocaine subjects. This pattern was confirmed by quantitative polymerase chain reaction for select transcripts. These data suggest that cocaine abuse targets a distinct subset of genes in the dlPFC, resulting in either a state of acute activation in which increased gene expression predominates, or a relatively destimulated, refractory phase. PMID:12629581

  8. Association of cohesin and Nipped-B with transcriptionally active regions of the Drosophila melanogaster genome

    PubMed Central

    Misulovin, Ziva; Schwartz, Yuri B.; Li, Xiao-Yong; Kahn, Tatyana G.; Gause, Maria; MacArthur, Stewart; Fay, Justin C.; Eisen, Michael B.; Pirrotta, Vincenzo; Biggin, Mark D.


    The cohesin complex is a chromosomal component required for sister chromatid cohesion that is conserved from yeast to man. The similarly conserved Nipped-B protein is needed for cohesin to bind to chromosomes. In higher organisms, Nipped-B and cohesin regulate gene expression and development by unknown mechanisms. Using chromatin immunoprecipitation, we find that Nipped-B and cohesin bind to the same sites throughout the entire non-repetitive Drosophila genome. They preferentially bind transcribed regions and overlap with RNA polymerase II. This contrasts sharply with yeast, where cohesin binds almost exclusively between genes. Differences in cohesin and Nipped-B binding between Drosophila cell lines often correlate with differences in gene expression. For example, cohesin and Nipped-B bind the Abd-B homeobox gene in cells in which it is transcribed, but not in cells in which it is silenced. They bind to the Abd-B transcription unit and downstream regulatory region and thus could regulate both transcriptional elongation and activation. We posit that transcription facilitates cohesin binding, perhaps by unfolding chromatin, and that Nipped-B then regulates gene expression by controlling cohesin dynamics. These mechanisms are likely involved in the etiology of Cornelia de Lange syndrome, in which mutation of one copy of the NIPBL gene encoding the human Nipped-B ortholog causes diverse structural and mental birth defects. PMID:17965872

  9. Dual transcriptional activator and repressor roles of TBX20 regulate adult cardiac structure and function

    PubMed Central

    Sakabe, Noboru J.; Aneas, Ivy; Shen, Tao; Shokri, Leila; Park, Soo-Young; Bulyk, Martha L.; Evans, Sylvia M.; Nobrega, Marcelo A.


    The ongoing requirement in adult heart for transcription factors with key roles in cardiac development is not well understood. We recently demonstrated that TBX20, a transcriptional regulator required for cardiac development, has key roles in the maintenance of functional and structural phenotypes in adult mouse heart. Conditional ablation of Tbx20 in adult cardiomyocytes leads to a rapid onset and progression of heart failure, with prominent conduction and contractility phenotypes that lead to death. Here we describe a more comprehensive molecular characterization of the functions of TBX20 in adult mouse heart. Coupling genome-wide chromatin immunoprecipitation and transcriptome analyses (RNA-Seq), we identified a subset of genes that change expression in Tbx20 adult cardiomyocyte-specific knockout hearts which are direct downstream targets of TBX20. This analysis revealed a dual role for TBX20 as both a transcriptional activator and a repressor, and that each of these functions regulates genes with very specialized and distinct molecular roles. We also show how TBX20 binds to its targets genome-wide in a context-dependent manner, using various cohorts of co-factors to either promote or repress distinct genetic programs within adult heart. Our integrative approach has uncovered several novel aspects of TBX20 and T-box protein function within adult heart. Sequencing data accession number ( GSE30943. PMID:22328084

  10. Stathmin regulates mutant p53 stability and transcriptional activity in ovarian cancer

    PubMed Central

    Sonego, Maura; Schiappacassi, Monica; Lovisa, Sara; Dall'Acqua, Alessandra; Bagnoli, Marina; Lovat, Francesca; Libra, Massimo; D'Andrea, Sara; Canzonieri, Vincenzo; Militello, Loredana; Napoli, Marco; Giorda, Giorgio; Pivetta, Barbara; Mezzanzanica, Delia; Barbareschi, Mattia; Valeri, Barbara; Canevari, Silvana; Colombatti, Alfonso; Belletti, Barbara; Del Sal, Giannino; Baldassarre, Gustavo


    Stathmin is a p53-target gene, frequently overexpressed in late stages of human cancer progression. Type II High Grade Epithelial Ovarian Carcinomas (HG-EOC) represents the only clear exception to this observation. Here, we show that stathmin expression is necessary for the survival of HG-EOC cells carrying a p53 mutant (p53MUT) gene. At molecular level, stathmin favours the binding and the phosphorylation of p53MUT by DNA-PKCS, eventually modulating p53MUT stability and transcriptional activity. Inhibition of stathmin or DNA-PKCS impaired p53MUT–dependent transcription of several M phase regulators, resulting in M phase failure and EOC cell death, both in vitro and in vivo. In primary human EOC a strong correlation exists between stathmin, DNA-PKCS, p53MUT overexpression and its transcriptional targets, further strengthening the relevance of the new pathway here described. Overall our data support the hypothesis that the expression of stathmin and p53 could be useful for the identification of high risk patients that will benefit from a therapy specifically acting on mitotic cancer cells. PMID:23610071

  11. Effects of Indole-3-Acetic Acid on the Transcriptional Activities and Stress Tolerance of Bradyrhizobium japonicum

    PubMed Central

    Donati, Andrew J.; Lee, Hae-In; Leveau, Johan H. J.; Chang, Woo-Suk


    A genome-wide transcriptional profile of Bradyrhizobium japonicum, the nitrogen-fixing endosymbiont of the soybean plant, revealed differential expression of approximately 15% of the genome after a 1 mM treatment with the phytohormone indole-3-acetic acid (IAA). A total of 1,323 genes were differentially expressed (619 up-regulated and 704 down-regulated) at a two-fold cut off with q value ≤ 0.05. General stress response genes were induced, such as those involved in response to heat, cold, oxidative, osmotic, and desiccation stresses and in exopolysaccharide (EPS) biosynthesis. This suggests that IAA is effective in activating a generalized stress response in B. japonicum. The transcriptional data were corroborated by the finding that stress tolerance of B. japonicum in cell viability assays was enhanced when pre-treated with 1 mM IAA compared to controls. The IAA treatment also stimulated biofilm formation and EPS production by B. japonicum, especially acidic sugar components in the total EPS. The IAA pre-treatment did not influence the nodulation ability of B. japonicum. The data provide a comprehensive overview of the potential transcriptional responses of the symbiotic bacterium when exposed to the ubiquitous hormone of its plant host. PMID:24098533

  12. Nuclear Factor 90(NF90) targeted to TAR RNA inhibits transcriptional activation of HIV-1

    PubMed Central

    Agbottah, Emmanuel T; Traviss, Christine; McArdle, James; Karki, Sambhav; St Laurent, Georges C; Kumar, Ajit


    Background Examination of host cell-based inhibitors of HIV-1 transcription may be important for attenuating viral replication. We describe properties of a cellular double-stranded RNA binding protein with intrinsic affinity for HIV-1 TAR RNA that interferes with Tat/TAR interaction and inhibits viral gene expression. Results Utilizing TAR affinity fractionation, North-Western blotting, and mobility-shift assays, we show that the C-terminal variant of nuclear factor 90 (NF90ctv) with strong affinity for the TAR RNA, competes with Tat/TAR interaction in vitro. Analysis of the effect of NF90ctv-TAR RNA interaction in vivo showed significant inhibition of Tat-transactivation of HIV-1 LTR in cells expressing NF90ctv, as well as changes in histone H3 lysine-4 and lysine-9 methylation of HIV chromatin that are consistent with the epigenetic changes in transcriptionally repressed gene. Conclusion Structural integrity of the TAR element is crucial in HIV-1 gene expression. Our results show that perturbation Tat/TAR RNA interaction by the dsRNA binding protein is sufficient to inhibit transcriptional activation of HIV-1. PMID:17565699

  13. LRPPRC mutation suppresses cytochrome oxidase activity by altering mitochondrial RNA transcript stability in a mouse model.


    Xu, Fenghao; Addis, Jane B L; Cameron, Jessie M; Robinson, Brian H


    LRPPRC (leucine-rich pentatricopeptide repeat-containing) has been shown to be essential for the maturation of COX (cytochrome c oxidase), possibly by stabilizing RNA transcripts of COXI, COXII and COXIII genes encoded in mtDNA (mitochondrial DNA). We established a mouse 'gene-trap' model using ES cells (embryonic stem cells) in which the C-terminus of LRPPRC has been replaced with a β-geo construct. Mice homozygous for this modification were found to be subject to embryonic lethality, with death before 12.5 dpc (days post-coitum). Biochemical analysis of MEFs (mouse embryonic fibroblasts) isolated from homozygous mutants showed a major decrease in COX activity, with slight reductions in other respiratory chain complexes with mtDNA encoded components. Constructs of LRPPRC containing different numbers of PPRs (pentatricopeptide repeats) were expressed as recombinant proteins and tested for their ability to bind to the COXI mRNA transcript. Full binding required the first 19 PPR motifs. A specific segment of COXI mRNA was identified as the binding target for LRPPRC, encoded by mouse mtDNA nucleotides 5961-6020. These data strongly suggest that LRPPRC is involved in the maturation of COX, and is involved in stabilizing of mitochondrial mRNAs encoding COX transcripts. PMID:21880015

  14. EGR1 regulates hepatic clock gene amplitude by activating Per1 transcription

    PubMed Central

    Tao, Weiwei; Wu, Jing; Zhang, Qian; Lai, Shan-Shan; Jiang, Shan; Jiang, Chen; Xu, Ying; Xue, Bin; Du, Jie; Li, Chao-Jun


    The mammalian clock system is composed of a master clock and peripheral clocks. At the molecular level, the rhythm-generating mechanism is controlled by a molecular clock composed of positive and negative feedback loops. However, the underlying mechanisms for molecular clock regulation that affect circadian clock function remain unclear. Here, we show that Egr1 (early growth response 1), an early growth response gene, is expressed in mouse liver in a circadian manner. Consistently, Egr1 is transactivated by the CLOCK/BMAL1 heterodimer through a conserved E-box response element. In hepatocytes, EGR1 regulates the transcription of several core clock genes, including Bmal1, Per1, Per2, Rev-erbα and Rev-erbβ, and the rhythm amplitude of their expression is dependent on EGR1’s transcriptional function. Further mechanistic studies indicated that EGR1 binds to the proximal region of the Per1 promoter to activate its transcription directly. When the peripheral clock is altered by light or feeding behavior transposition in Egr1-deficient mice, the expression phase of hepatic clock genes shifts normally, but the amplitude is also altered. Our data reveal a critical role for EGR1 in the regulation of hepatic clock circuitry, which may contribute to the rhythm stability of peripheral clock oscillators. PMID:26471974

  15. Impact of the N-Terminal Domain of STAT3 in STAT3-Dependent Transcriptional Activity.


    Hu, Tiancen; Yeh, Jennifer E; Pinello, Luca; Jacob, Jaison; Chakravarthy, Srinivas; Yuan, Guo-Cheng; Chopra, Rajiv; Frank, David A


    The transcription factor STAT3 is constitutively active in many cancers, where it mediates important biological effects, including cell proliferation, differentiation, survival, and angiogenesis. The N-terminal domain (NTD) of STAT3 performs multiple functions, such as cooperative DNA binding, nuclear translocation, and protein-protein interactions. However, it is unclear which subsets of STAT3 target genes depend on the NTD for transcriptional regulation. To identify such genes, we compared gene expression in STAT3-null mouse embryonic fibroblasts (MEFs) stably expressing wild-type STAT3 or STAT3 from which NTD was deleted. NTD deletion reduced the cytokine-induced expression of specific STAT3 target genes by decreasing STAT3 binding to their regulatory regions. To better understand the potential mechanisms of this effect, we determined the crystal structure of the STAT3 NTD and identified a dimer interface responsible for cooperative DNA binding in vitro. We also observed an Ni(2+)-mediated oligomer with an as yet unknown biological function. Mutations on both dimer and Ni(2+)-mediated interfaces affected the cytokine induction of STAT3 target genes. These studies shed light on the role of the NTD in transcriptional regulation by STAT3 and provide a structural template with which to design STAT3 NTD inhibitors with potential therapeutic value. PMID:26169829

  16. RHON1 Mediates a Rho-Like Activity for Transcription Termination in Plastids of Arabidopsis thaliana[C][W

    PubMed Central

    Chi, Wei; He, Baoye; Manavski, Nikolay; Mao, Juan; Ji, Daili; Lu, Congming; Rochaix, Jean David; Meurer, Jörg; Zhang, Lixin


    Although transcription termination is essential to generate functional RNAs, its underlying molecular mechanisms are still poorly understood in plastids of vascular plants. Here, we show that the RNA binding protein RHON1 participates in transcriptional termination of rbcL (encoding large subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase) in Arabidopsis thaliana. Inactivation of RHON1 leads to enhanced rbcL read-through transcription and to aberrant accD (encoding β-subunit of the acetyl-CoA carboxylase) transcriptional initiation, which may result from inefficient transcription termination of rbcL. RHON1 can bind to the mRNA as well as to single-stranded DNA of rbcL, displays an RNA-dependent ATPase activity, and terminates transcription of rbcL in vitro. These results suggest that RHON1 terminates rbcL transcription using an ATP-driven mechanism similar to that of Rho of Escherichia coli. This RHON1-dependent transcription termination occurs in Arabidopsis but not in rice (Oryza sativa) and appears to reflect a fundamental difference between plastomes of dicotyledonous and monocotyledonous plants. Our results point to the importance and significance of plastid transcription termination and provide insights into its machinery in an evolutionary context. PMID:25480370

  17. Binding of basal transcription factor TFIIH to the acidic activation domains of VP16 and p53.

    PubMed Central

    Xiao, H; Pearson, A; Coulombe, B; Truant, R; Zhang, S; Regier, J L; Triezenberg, S J; Reinberg, D; Flores, O; Ingles, C J


    Acidic transcriptional activation domains function well in both yeast and mammalian cells, and some have been shown to bind the general transcription factors TFIID and TFIIB. We now show that two acidic transactivators, herpes simplex virus VP16 and human p53, directly interact with the multisubunit human general transcription factor TFIIH and its Saccharomyces cerevisiae counterpart, factor b. The VP16- and p53-binding domains in these factors lie in the p62 subunit of TFIIH and in the homologous subunit, TFB1, of factor b. Point mutations in VP16 that reduce its transactivation activity in both yeast and mammalian cells weaken its binding to both yeast and human TFIIH. This suggests that binding of activation domains to TFIIH is an important aspect of transcriptional activation. Images PMID:7935417

  18. Transcriptional activation of the human cytotoxic serine protease gene CSP-B in T lymphocytes.

    PubMed Central

    Hanson, R D; Ley, T J


    The cytotoxic serine protease B (CSP-B) gene is activated during cytotoxic T-lymphocyte maturation. In this report, we demonstrate that the PEER T-cell line (bearing gamma/delta T-cell receptors) accumulates CSP-B mRNA following exposure to 12-O-tetradecanoylphorbol-13-acetate (TPA) and N6-2'-O-dibutyryladenosine 3',5'-cyclic monophosphate (bt2cAMP) because of transcriptional activation of the CSP-B gene. TPA and bt2cAMP act synergistically to induce CSP-B expression, since neither agent alone causes activation of CSP-B transcription or mRNA accumulation. Chromatin upstream from the CSP-B gene is resistant to DNase I digestion in untreated PEER cells, but becomes sensitive following TPA-bt2cAMP treatment. Upon activation of PEER cells, a DNase I-hypersensitive site forms upstream from the CSP-B gene within a region that is highly conserved in the mouse. Transient transfection of CSP-B promoter constructs identified two regulatory regions in the CSP-B 5'-flanking sequence, located at positions -609 to -202 and positions -202 to -80. The region from -615 to -63 is sufficient to activate a heterologous promoter in activated PEER cells, but activation is orientation specific, suggesting that this region behaves as an upstream promoter element rather than a classical enhancer. Consensus AP-1, AP-2, and cAMP response elements are found upstream from the CSP-B gene (as are several T-cell-specific consensus elements), but the roles of these elements in CSP-B gene activation have yet to be determined. Images PMID:2233710

  19. GATA2 Mediates Thyrotropin-Releasing Hormone-Induced Transcriptional Activation of the Thyrotropin β Gene

    PubMed Central

    Ohba, Kenji; Sasaki, Shigekazu; Matsushita, Akio; Iwaki, Hiroyuki; Matsunaga, Hideyuki; Suzuki, Shingo; Ishizuka, Keiko; Misawa, Hiroko; Oki, Yutaka; Nakamura, Hirotoshi


    Thyrotropin-releasing hormone (TRH) activates not only the secretion of thyrotropin (TSH) but also the transcription of TSHβ and α-glycoprotein (αGSU) subunit genes. TSHβ expression is maintained by two transcription factors, Pit1 and GATA2, and is negatively regulated by thyroid hormone (T3). Our prior studies suggest that the main activator of the TSHβ gene is GATA2, not Pit1 or unliganded T3 receptor (TR). In previous studies on the mechanism of TRH-induced activation of the TSHβ gene, the involvements of Pit1 and TR have been investigated, but the role of GATA2 has not been clarified. Using kidney-derived CV1 cells and pituitary-derived GH3 and TαT1 cells, we demonstrate here that TRH signaling enhances GATA2-dependent activation of the TSHβ promoter and that TRH-induced activity is abolished by amino acid substitution in the GATA2-Zn finger domain or mutation of GATA-responsive element in the TSHβ gene. In CV1 cells transfected with TRH receptor expression plasmid, GATA2-dependent transactivation of αGSU and endothelin-1 promoters was enhanced by TRH. In the gel shift assay, TRH signal potentiated the DNA-binding capacity of GATA2. While inhibition by T3 is dominant over TRH-induced activation, unliganded TR or the putative negative T3-responsive element are not required for TRH-induced stimulation. Studies using GH3 cells showed that TRH-induced activity of the TSHβ promoter depends on protein kinase C but not the mitogen-activated protein kinase, suggesting that the signaling pathway is different from that in the prolactin gene. These results indicate that GATA2 is the principal mediator of the TRH signaling pathway in TSHβ expression. PMID:21533184

  20. Direct interaction between nucleosome assembly protein 1 and the papillomavirus E2 proteins involved in activation of transcription.


    Rehtanz, Manuela; Schmidt, Hanns-Martin; Warthorst, Ursula; Steger, Gertrud


    Using a yeast two-hybrid screen, we identified human nucleosome assembly protein 1 (hNAP-1) as a protein interacting with the activation domain of the transcriptional activator encoded by papillomaviruses (PVs), the E2 protein. We show that the interaction between E2 and hNAP-1 is direct and not merely mediated by the transcriptional coactivator p300, which is bound by both proteins. Coexpression of hNAP-1 strongly enhances activation by E2, indicating a functional interaction as well. E2 binds to at least two separate domains within hNAP-1, one within the C terminus and an internal domain. The binding of E2 to hNAP-1 is necessary for cooperativity between the factors. Moreover, the N-terminal 91 amino acids are crucial for the transcript