Science.gov

Sample records for activation cluster csmac

  1. T cell receptor-proximal signals are sustained in peripheral microclusters and terminated in the central supramolecular activation cluster.

    PubMed

    Varma, Rajat; Campi, Gabriele; Yokosuka, Tadashi; Saito, Takashi; Dustin, Michael L

    2006-07-01

    T cell receptor (TCR) signaling is initiated and sustained in microclusters; however, it's not known whether signaling also occurs in the TCR-rich central supramolecular activation cluster (cSMAC). We showed that the cSMAC formed by fusion of microclusters contained more CD45 than microclusters and is a site enriched in lysobisphosphatidic acid, a lipid involved in sorting ubiquitinated membrane proteins for degradation. Calcium signaling via TCR was blocked within 2 min by anti-MHCp treatment and 1 min by latrunculin-A treatment. TCR-MHCp interactions in the cSMAC survived these perturbations for 10 min and hence were not sufficient to sustain signaling. TCR microclusters were also resistant to disruption by anti-MHCp and latrunculin-A treatments. We propose that TCR signaling is sustained by stabilized microclusters and is terminated in the cSMAC, a structure from which TCR are sorted for degradation. Our studies reveal a role for F-actin in TCR signaling beyond microcluster formation. PMID:16860761

  2. The Cluster Active Archive

    NASA Astrophysics Data System (ADS)

    Laakso, H.; Perry, C. H.; Escoubet, C. P.; McCaffrey, S.; Herment, D.; Esson, S.; Bowen, H.; Buggy, O.; Taylor, M. G.

    2008-05-01

    The four-satellite Cluster mission investigates small-scale structures (in three dimensions) of the Earth's plasma environment, such as those involved in the interaction between the solar wind and the magnetospheric plasma, in global magnetotail dynamics, in cross-tail currents, and in the formation and dynamics of the neutral line and of plasmoids. The Cluster Active Archive CAA (http://caa.estec.esa.int/) will contain the entire set of Cluster high resolution data and other allied products in a standard format and with a complete set of metadata in machine readable form. The data archived are (1) publicly accessible, (2) of the best quality achievable with the given resources, and (3) suitable for science use and publication by both the Cluster and broader scientific community. The CAA to provide user friendly services for searching and accessing these data, e.g. users can save and restore their selections speeding up similar requests. The CAA is continuing to extend and improve the online capabilities of the system, e.g., the CAA products can be downloaded either via a web interface or a machine accessible interface.

  3. Cluster Active Archive: Overview

    NASA Astrophysics Data System (ADS)

    Laakso, H.; Perry, C.; McCaffrey, S.; Herment, D.; Allen, A. J.; Harvey, C. C.; Escoubet, C. P.; Gruenberger, C.; Taylor, M. G. G. T.; Turner, R.

    The four-satellite Cluster mission investigates the small-scale structures and physical processes related to interaction between the solar wind and the magnetospheric plasma. The Cluster Active Archive (CAA) (URL: http://caa.estec.esa.int) will contain the entire set of Cluster high-resolution data and other allied products in a standard format and with a complete set of metadata in machine readable format. The total amount of the data files in compressed format is expected to exceed 50 TB. The data archive is publicly accessible and suitable for science use and publication by the world-wide scientific community. The CAA aims to provide user-friendly services for searching and accessing these data and ancillary products. The CAA became operational in February 2006 and as of Summer 2008 has data from most of the Cluster instruments for at least the first 5 years of operations (2001-2005). The coverage and range of products are being continually improved with more than 200 datasets available from each spacecraft, including high-resolution magnetic and electric DC fields and wave spectra; full three-dimensional electron and ion distribution functions from a few eV to hundreds of keV; and various ancillary and browse products to help with spacecraft and event location. The CAA is continuing to extend and improve the online capabilities of the system and the quality of the existing data. It will add new data files for years 2006-2009 and is preparing for the long-term archive with complete coverage after the completion of the Cluster mission.

  4. Active matter clusters at interfaces

    NASA Astrophysics Data System (ADS)

    Copenhagen, Katherine; Gopinathan, Ajay

    Collective and directed motility or swarming is an emergent phenomenon displayed by many self-organized assemblies of active biological matter such as clusters of embryonic cells during tissue development and flocks of birds. Such clusters typically encounter very heterogeneous environments. What happens when a cluster encounters an interface between two different environments has implications for its function and fate. Here we study this problem by using a mathematical model of a cluster that treats it as a single cohesive unit whose movement depends on the nature of the local environment. We find that low speed clusters which exert forces but no active torques, encountering an interface with a moderate difference in properties can lead to refraction or even total internal reflection of the cluster. For large speeds and clusters with active torques, they show more complex behaviors crossing the interface multiple times, becoming trapped at the interface and deviating from the predictable refraction and reflection of the low velocity clusters. Our results show a wide range of behaviors that occur when collectively moving active biological matter moves across interfaces and these insights can be used to control motion by patterning environments.

  5. Active matter clusters at interfaces.

    NASA Astrophysics Data System (ADS)

    Copenhagen, Katherine; Gopinathan, Ajay

    2016-03-01

    Collective and directed motility or swarming is an emergent phenomenon displayed by many self-organized assemblies of active biological matter such as clusters of embryonic cells during tissue development, cancerous cells during tumor formation and metastasis, colonies of bacteria in a biofilm, or even flocks of birds and schools of fish at the macro-scale. Such clusters typically encounter very heterogeneous environments. What happens when a cluster encounters an interface between two different environments has implications for its function and fate. Here we study this problem by using a mathematical model of a cluster that treats it as a single cohesive unit that moves in two dimensions by exerting a force/torque per unit area whose magnitude depends on the nature of the local environment. We find that low speed (overdamped) clusters encountering an interface with a moderate difference in properties can lead to refraction or even total internal reflection of the cluster. For large speeds (underdamped), where inertia dominates, the clusters show more complex behaviors crossing the interface multiple times and deviating from the predictable refraction and reflection for the low velocity clusters. We then present an extreme limit of the model in the absence of rotational damping where clusters can become stuck spiraling along the interface or move in large circular trajectories after leaving the interface. Our results show a wide range of behaviors that occur when collectively moving active biological matter moves across interfaces and these insights can be used to control motion by patterning environments.

  6. Cluster Active Archive: lessons learnt

    NASA Astrophysics Data System (ADS)

    Laakso, H. E.; Perry, C. H.; Taylor, M. G.; Escoubet, C. P.; Masson, A.

    2010-12-01

    The ESA Cluster Active Archive (CAA) was opened to public in February 2006 after an initial three-year development phase. It provides access (both web GUI and command-line tool are available) to the calibrated full-resolution datasets of the four-satellite Cluster mission. The data archive is publicly accessible and suitable for science use and publication by the world-wide scientific community. There are more than 350 datasets from each spacecraft, including high-resolution magnetic and electric DC and AC fields as well as full 3-dimensional electron and ion distribution functions and moments from a few eV to hundreds of keV. The Cluster mission has been in operation since February 2001, and currently although the CAA can provide access to some recent observations, the ingestion of some other datasets can be delayed by a few years due to large and difficult calibration routines of aging detectors. The quality of the datasets is the central matter to the CAA. Having the same instrument on four spacecraft allows the cross-instrument comparisons and provide confidence on some of the instrumental calibration parameters. Furthermore it is highly important that many physical parameters are measured by more than one instrument which allow to perform extensive and continuous cross-calibration analyses. In addition some of the instruments can be regarded as absolute or reference measurements for other instruments. The CAA attempts to avoid as much as possible mission-specific acronyms and concepts and tends to use more generic terms in describing the datasets and their contents in order to ease the usage of the CAA data by “non-Cluster” scientists. Currently the CAA has more 1000 users and every month more than 150 different users log in the CAA for plotting and/or downloading observations. The users download about 1 TeraByte of data every month. The CAA has separated the graphical tool from the download tool because full-resolution datasets can be visualized in many

  7. Nano-clustering of ligands on surrogate antigen presenting cells modulates T cell membrane adhesion and organization.

    PubMed

    Dillard, Pierre; Pi, Fuwei; Lellouch, Annemarie C; Limozin, Laurent; Sengupta, Kheya

    2016-03-14

    We investigate the adhesion and molecular organization of the plasma membrane of T lymphocytes interacting with a surrogate antigen presenting cell comprising glass supported ordered arrays of antibody (α-CD3) nano-dots dispersed in a non-adhesive matrix of polyethylene glycol (PEG). The local membrane adhesion and topography, as well as the distribution of the T cell receptors (TCRs) and the kinase ZAP-70, are influenced by dot-geometry, whereas the cell spreading area is determined by the overall average density of the ligands rather than specific characteristics of the dots. TCR clusters are recruited preferentially to the nano-dots and the TCR cluster size distribution has a weak dot-size dependence. On the patterns, the clusters are larger, more numerous, and more enriched in TCRs, as compared to the homogeneously distributed ligands at comparable concentrations. These observations support the idea that non-ligated TCRs residing in the non-adhered parts of the proximal membrane are able to diffuse and enrich the existing clusters at the ligand dots. However, long distance transport is impaired and cluster centralization in the form of a central supramolecular cluster (cSMAC) is not observed. Time-lapse imaging of early cell-surface contacts indicates that the ZAP-70 microclusters are directly recruited to the site of the antibody dots and this process is concomitant with membrane adhesion. These results together point to a complex interplay of adhesion, molecular organization and activation in response to spatially modulated stimulation. PMID:26887857

  8. Egocentric daily activity recognition via multitask clustering.

    PubMed

    Yan, Yan; Ricci, Elisa; Liu, Gaowen; Sebe, Nicu

    2015-10-01

    Recognizing human activities from videos is a fundamental research problem in computer vision. Recently, there has been a growing interest in analyzing human behavior from data collected with wearable cameras. First-person cameras continuously record several hours of their wearers' life. To cope with this vast amount of unlabeled and heterogeneous data, novel algorithmic solutions are required. In this paper, we propose a multitask clustering framework for activity of daily living analysis from visual data gathered from wearable cameras. Our intuition is that, even if the data are not annotated, it is possible to exploit the fact that the tasks of recognizing everyday activities of multiple individuals are related, since typically people perform the same actions in similar environments, e.g., people working in an office often read and write documents). In our framework, rather than clustering data from different users separately, we propose to look for clustering partitions which are coherent among related tasks. In particular, two novel multitask clustering algorithms, derived from a common optimization problem, are introduced. Our experimental evaluation, conducted both on synthetic data and on publicly available first-person vision data sets, shows that the proposed approach outperforms several single-task and multitask learning methods. PMID:26067371

  9. Reevaluating Active Galactic Nuclei in Rich Clusters

    NASA Astrophysics Data System (ADS)

    Way, M. J.; Flores, R.; Quintana, H.

    1999-06-01

    We have selected 42 candidate Active Galactic Nuclei in 19 Rich Abell Clusters. The candidates were selected using the criteria of Dressler, Thompson & Shectman (1985; DTS) in their analysis of the statistics of 22 AGN in 14 rich cluster fields, which are based on the equivalent width of [OII]3727Å, H β, and [OIII]5007Å emission. These AGN are then separated from HII galaxies in the manner developed by Veilleux & Osterbrock (1987; VO) using the additional information provided by Hα and [NII]6583Å or Hα and [SII]6716 + 6731Å emission, in order to test the reliability of the selection criteria used by DTS. Our sample is very comparable to that of DTS before we discriminate AGN from HII galaxies, and would lead to similar conclusions. However, we find that their method inevitably mixes HII galaxies with AGN. Over the years many authors have attempted to quantify the relative fraction of cluster to field AGN since the study of DTS (Hill & Oegerle 1993; Biviano et al. 1997) and have reached similar conclusions, but using criteria similar to that of DTS to select AGN (or using the [OIII]5007Å/H β flux ratio test that also mixes HII galaxies with AGN).

  10. Spectroscopic Active Galaxies and Clusters Explorer

    NASA Astrophysics Data System (ADS)

    Ferrari, L.; Bagliani, D.; Bardi, A.; Battistelli, E.; Birkinshaw, M.; Colafrancesco, S.; Conte, A.; Debernardis, P.; Degregori, S.; Depetris, M.; de Zotti, G.; Donati, A.; Franceschini, A.; Gatti, F.; Gervasi, M.; Gonzalez-Nuevo, J.; Lamagna, L.; Luzzi, G.; Maiolino, M.; Marchegiani, P.; Mariani, A.; Masi, S.; Massardi, M.; Mauskopf, P.; Nati, L.; Nati, F.; Natoli, P.; Piacentini, F.; Polenta, G.; Porciani, M.; Savini, G.; Schillaci, A.; Spinelli, S.; Tartari, A.; Tavanti, M.; Tortora, A.; Vaccari, M.; Vaccarone, R.; Zannoni, M.

    2009-12-01

    We present a concept for the payload SAGACE, the Spectroscopic Active Galaxies And Cluster Explorer, devoted to study the evolution of Universe structures using different observables, all of them in the mm/submm wavelength. The SAGACE payload is made of a passively cooled 3 m telescope, a cryogenic Fourier Transform Spectrometer (FTS) and detector arrays to be operated at 0.3 K by a 3He fridge. The detectors are Ti/Au Transition Edge Sensor (TES) bolometers with a NEP<10-17 W/Hz12. A phase-A study has been recently completed for this experiment, in the framework of the call for small missions of the Italian Space Agency.

  11. Dynamic Regulation of TCR–Microclusters and the Microsynapse for T Cell Activation

    PubMed Central

    Hashimoto-Tane, Akiko; Saito, Takashi

    2016-01-01

    The interaction between a T cell and an antigen-presenting cell is the initiating event in T cell-mediated adaptive immunity. The Immunological Synapse (IS) is formed at the interface between these two cell types, and is the site where antigen (Ag)-specific recognition and activation are induced through the T cell receptor (TCR). This occurs at the center of the IS, and cell adhesion is supported through integrins in the area surrounding the TCR. Recently, this model has been revised based on data indicating that the initial Ag-specific activation signal is triggered prior to IS formation at TCR–microclusters (MCs), sites where TCR, kinases and adaptors of TCR proximal downstream signaling molecules accumulate as an activation signaling cluster. TCR–MCs then move into the center of the cell–cell interface to generate the cSMAC. This translocation of TCR–MCs is mediated initially by the actin cytoskeleton and then by dynein-induced movement along microtubules. The translocation of TCR–MCs and cSMAC formation is induced upon strong TCR stimulation through the assembly of a TCR–dynein super complex with microtubules. The Ag-specific activation signal is induced at TCR–MCs, but the adhesion signal is now shown to be induced by generating a “microsynapse,” which is composed of a core of TCR–MCs and the surrounding adhesion ring of integrin and focal adhesion molecules. Since the microsynapse is critical for activation, particularly under weak TCR stimulation, this structure supports a weak TCR signal through a cell–cell adhesion signal. The microsynapse has a structure similar to the IS but on a micro-scale and regulates Ag-specific activation as well as cell–cell adhesion. We describe here the dynamic regulation of TCR–MCs, responsible for inducing Ag-specific activation signals, and the microsynapse, responsible for adhesion signals critical for cell–cell interactions, and their interrelationship. PMID:27446085

  12. Directed Self-Assembly Pathways of Active Colloidal Clusters.

    PubMed

    Zhang, Jie; Yan, Jing; Granick, Steve

    2016-04-18

    Despite the mounting interest in synthetic active particles, too little is known about their assembly into higher-order clusters. Here, mixing bare silica particles with Janus particles that are self-propelled in electric fields, we assemble rotating chiral clusters of various sorts, their structures consisting of active particles wrapped around central "hub" particles. These clusters self-assemble from the competition between standard energetic interactions and the need to be stable as the clusters rotate when the energy source is turned on, and fall apart when the energy input is off. This allows one to guide the formation of intended clusters, as the final structure depends notably on the sequence of steps in which the clusters form. PMID:27010594

  13. Active galactic nucleus feedback in clusters of galaxies.

    PubMed

    Blanton, Elizabeth L; Clarke, T E; Sarazin, Craig L; Randall, Scott W; McNamara, Brian R

    2010-04-20

    Observations made during the last ten years with the Chandra X-ray Observatory have shed much light on the cooling gas in the centers of clusters of galaxies and the role of active galactic nucleus (AGN) heating. Cooling of the hot intracluster medium in cluster centers can feed the supermassive black holes found in the nuclei of the dominant cluster galaxies leading to AGN outbursts which can reheat the gas, suppressing cooling and large amounts of star formation. AGN heating can come in the form of shocks, buoyantly rising bubbles that have been inflated by radio lobes, and the dissipation of sound waves. PMID:20351250

  14. Interaction of metallic clusters with biologically active curcumin molecules

    NASA Astrophysics Data System (ADS)

    Gupta, Sanjeev K.; He, Haiying; Liu, Chunhui; Dutta, Ranu; Pandey, Ravindra

    2015-09-01

    We have investigated the interaction of subnano metallic Gd and Au clusters with curcumin, an important biomolecule having pharmacological activity. Gd clusters show different site preference to curcumin and much stronger interaction strength, in support of the successful synthesis of highly stable curcumin-coated Gd nanoparticles as reported recently. It can be attributed to significant charge transfer from the Gd cluster to curcumin together with a relatively strong hybridization of the Gd df-orbitals with curcumin p-orbitals. These results suggest that Gd nanoparticles can effectively be used as delivery carriers for curcumin at the cellular level for therapy and medical imaging applications.

  15. Active galactic nucleus feedback in clusters of galaxies

    PubMed Central

    Blanton, Elizabeth L.; Clarke, T. E.; Sarazin, Craig L.; Randall, Scott W.; McNamara, Brian R.

    2010-01-01

    Observations made during the last ten years with the Chandra X-ray Observatory have shed much light on the cooling gas in the centers of clusters of galaxies and the role of active galactic nucleus (AGN) heating. Cooling of the hot intracluster medium in cluster centers can feed the supermassive black holes found in the nuclei of the dominant cluster galaxies leading to AGN outbursts which can reheat the gas, suppressing cooling and large amounts of star formation. AGN heating can come in the form of shocks, buoyantly rising bubbles that have been inflated by radio lobes, and the dissipation of sound waves. PMID:20351250

  16. Active transport and cluster formation on 2D networks.

    PubMed

    Greulich, P; Santen, L

    2010-06-01

    We introduce a model for active transport on inhomogeneous networks embedded in a diffusive environment which is motivated by vesicular transport on actin filaments. In the presence of a hard-core interaction, particle clusters are observed that exhibit an algebraically decaying distribution in a large parameter regime, indicating the existence of clusters on all scales. The scale-free behavior can be understood by a mechanism promoting preferential attachment of particles to large clusters. The results are compared with a diffusion-limited aggregation model and active transport on a regular network. For both models we observe aggregation of particles to clusters which are characterized by a finite size scale if the relevant time scales and particle densities are considered. PMID:20556462

  17. Membrane-Active Peptides and the Clustering of Anionic Lipids

    PubMed Central

    Wadhwani, P.; Epand, R.F.; Heidenreich, N.; Bürck, J.; Ulrich, A.S.; Epand, R.M.

    2012-01-01

    There is some overlap in the biological activities of cell-penetrating peptides (CPPs) and antimicrobial peptides (AMPs). We compared nine AMPs, seven CPPs, and a fusion peptide with regard to their ability to cluster anionic lipids in a mixture mimicking the cytoplasmic membrane of Gram-negative bacteria, as measured by differential scanning calorimetry. We also studied their bacteriostatic effect on several bacterial strains, and examined their conformational changes upon membrane binding using circular dichroism. A remarkable correlation was found between the net positive charge of the peptides and their capacity to induce anionic lipid clustering, which was independent of their secondary structure. Among the peptides studied, six AMPs and four CPPs were found to have strong anionic lipid clustering activity. These peptides also had bacteriostatic activity against several strains (particularly Gram-negative Escherichia coli) that are sensitive to lipid clustering agents. AMPs and CPPs that did not cluster anionic lipids were not toxic to E. coli. As shown previously for several types of AMPs, anionic lipid clustering likely contributes to the mechanism of antibacterial action of highly cationic CPPs. The same mechanism could explain the escape of CPPs from intracellular endosomes that are enriched with anionic lipids. PMID:22853904

  18. Radio active galactic nuclei in galaxy clusters: Feedback, merger signatures, and cluster tracers

    NASA Astrophysics Data System (ADS)

    Paterno-Mahler, Rachel Beth

    Galaxy clusters, the largest gravitationally-bound structures in the universe, are composed of 50-1000s of galaxies, hot X-ray emitting gas, and dark matter. They grow in size over time through cluster and group mergers. The merger history of a cluster can be imprinted on the hot gas, known as the intracluster medium (ICM). Merger signatures include shocks, cold fronts, and sloshing of the ICM, which can form spiral structures. Some clusters host double-lobed radio sources driven by active galactic nuclei (AGN). First, I will present a study of the galaxy cluster Abell 2029, which is very relaxed on large scales and has one of the largest continuous sloshing spirals yet observed in the X-ray, extending outward approximately 400 kpc. The sloshing gas interacts with the southern lobe of the radio galaxy, causing it to bend. Energy injection from the AGN is insufficient to offset cooling. The sloshing spiral may be an important additional mechanism in preventing large amounts of gas from cooling to very low temperatures. Next, I will present a study of Abell 98, a triple system currently undergoing a merger. I will discuss the merger history, and show that it is causing a shock. The central subcluster hosts a double-lobed AGN, which is evacuating a cavity in the ICM. Understanding the physical processes that affect the ICM is important for determining the mass of clusters, which in turn affects our calculations of cosmological parameters. To further constrain these parameters, as well as models of galaxy evolution, it is important to use a large sample of galaxy clusters over a range of masses and redshifts. Bent, double-lobed radio sources can potentially act as tracers of galaxy clusters over wide ranges of these parameters. I examine how efficient bent radio sources are at tracing high-redshift (z>0.7) clusters. Out of 646 sources in our high-redshift Clusters Occupied by Bent Radio AGN (COBRA) sample, 282 are candidate new, distant clusters of galaxies based on

  19. Sensitivity evaluation of dynamic speckle activity measurements using clustering methods

    SciTech Connect

    Etchepareborda, Pablo; Federico, Alejandro; Kaufmann, Guillermo H.

    2010-07-01

    We evaluate and compare the use of competitive neural networks, self-organizing maps, the expectation-maximization algorithm, K-means, and fuzzy C-means techniques as partitional clustering methods, when the sensitivity of the activity measurement of dynamic speckle images needs to be improved. The temporal history of the acquired intensity generated by each pixel is analyzed in a wavelet decomposition framework, and it is shown that the mean energy of its corresponding wavelet coefficients provides a suited feature space for clustering purposes. The sensitivity obtained by using the evaluated clustering techniques is also compared with the well-known methods of Konishi-Fujii, weighted generalized differences, and wavelet entropy. The performance of the partitional clustering approach is evaluated using simulated dynamic speckle patterns and also experimental data.

  20. Size-dependent catalytic activity of supported metal clusters

    NASA Astrophysics Data System (ADS)

    Xu, Z.; Xiao, F.-S.; Purnell, S. K.; Alexeev, O.; Kawi, S.; Deutsch, S. E.; Gates, B. C.

    1994-11-01

    BECAUSE catalysis by metals is a surface phenomenon, many technological catalysts contain small (typically nanometre-sized) supported metal particles with a large fraction of the atoms exposed1. Many reactions, such as hydrocarbon hydrogenations, are structure-insensitive, proceeding at approximately the same rate on metal particles of various sizes provided that they are larger than about 1 nm and show bulk-like metallic behaviour1. But it is not known whether the catalytic properties of metal particles become size-dependent as the particles become so small that they are no longer metallic in character. Here we investigate the catalytic behaviour of precisely defined clusters of just four and six iridium atoms on solid supports. We find that the Ir4 and Ir6 clusters differ in catalytic activity both from each other and from metallic Ir particles. This raises the possibility of tailoring the catalytic behaviour of metal clusters by controlling the cluster size.

  1. Identifying Clusters of Active Transportation Using Spatial Scan Statistics

    PubMed Central

    Huang, Lan; Stinchcomb, David G.; Pickle, Linda W.; Dill, Jennifer; Berrigan, David

    2009-01-01

    Background There is an intense interest in the possibility that neighborhood characteristics influence active transportation such as walking or biking. The purpose of this paper is to illustrate how a spatial cluster identification method can evaluate the geographic variation of active transportation and identify neighborhoods with unusually high/low levels of active transportation. Methods Self-reported walking/biking prevalence, demographic characteristics, street connectivity variables, and neighborhood socioeconomic data were collected from respondents to the 2001 California Health Interview Survey (CHIS; N=10,688) in Los Angeles County (LAC) and San Diego County (SDC). Spatial scan statistics were used to identify clusters of high or low prevalence (with and without age-adjustment) and the quantity of time spent walking and biking. The data, a subset from the 2001 CHIS, were analyzed in 2007–2008. Results Geographic clusters of significantly high or low prevalence of walking and biking were detected in LAC and SDC. Structural variables such as street connectivity and shorter block lengths are consistently associated with higher levels of active transportation, but associations between active transportation and socioeconomic variables at the individual and neighborhood levels are mixed. Only one cluster with less time spent walking and biking among walkers/bikers was detected in LAC, and this was of borderline significance. Age-adjustment affects the clustering pattern of walking/biking prevalence in LAC, but not in SDC. Conclusions The use of spatial scan statistics to identify significant clustering of health behaviors such as active transportation adds to the more traditional regression analysis that examines associations between behavior and environmental factors by identifying specific geographic areas with unusual levels of the behavior independent of predefined administrative units. PMID:19589451

  2. Multimolecular Analysis of Stable Immunological Synapses Reveals Sustained Recruitment and Sequential Assembly of Signaling Clusters*

    PubMed Central

    Philipsen, Lars; Engels, Thomas; Schilling, Kerstin; Gurbiel, Slavyana; Fischer, Klaus-Dieter; Tedford, Kerry; Schraven, Burkhart; Gunzer, Matthias; Reichardt, Peter

    2013-01-01

    The formation of the immunological synapse between T cells and antigen-presenting cells (APC) begins within minutes of contact and can take hours for full T-cell activation. Although early phases of the synapse have been extensively studied for a select number of proteins, later phases have not yet been examined in detail. We studied the signaling network in stable synapses by measuring the simultaneous localization of 25 signaling and structural molecules over 2 h at the level of individual synapses using multi-epitope ligand cartography (MELC). Signaling proteins including phospho(p)ZAP70, pSLP76, pCD3ζ, and pLAT, along with proteins that influence synapse structure such as F-actin, tubulin, CD45, and ICAM-1, were localized in images of synapses and revealed the multidimensional construction of a mature synapse. The construction of the stable synapse included intense early TCR signaling, a phase of recruitment of structural proteins, and a sustained increase in signaling molecules and colocalization of TCR and pLAT signaling clusters in the center of the synapse. Consolidation of TCR and associated proteins resulted in formation of a small number of discrete synaptic microclusters. Development of synapses and cSMAC composition was greatly affected by the absence of Vav1, with an associated loss in PLCγ1 recruitment, pSLP76, and increased CXCR4. Together, these data demonstrate the use of multi-epitope ligand cartography to quantitatively analyze synapse formation and reveal successive recruitment of structural and signaling proteins and sustained phosphorylation at the mature synapse. PMID:23754785

  3. Obscured Starburst Activity in High-redshift Clusters and Groups

    NASA Astrophysics Data System (ADS)

    Kocevski, Dale D.; Lemaux, Brian C.; Lubin, Lori M.; Gal, Roy; McGrath, Elizabeth J.; Fassnacht, Christopher D.; Squires, Gordon K.; Surace, Jason A.; Lacy, Mark

    2011-07-01

    Using Spitzer-Multiband Imaging Photometer 24 μm imaging and extensive Keck spectroscopy, we examine the nature of the obscured star-forming population in three clusters and three groups at z ~ 0.9. These six systems are the primary components of the Cl1604 supercluster, the largest structure imaged by Spitzer at redshifts approaching unity. We find that the average density of 24 μm detected galaxies within the Cl1604 clusters is nearly twice that of the surrounding field and that this overdensity scales with the cluster's dynamical state. The 24 μm bright members often appear optically unremarkable and exhibit only moderate [O II] line emission due to severe obscuration. Their spatial distribution suggests that they are an infalling population, but an examination of their spectral properties, morphologies, and optical colors indicates that they are not simply analogs of the field population that have yet to be quenched. Using stacked composite spectra, we find that the 24 μm detected cluster and group galaxies exhibit elevated levels of Balmer absorption compared with galaxies undergoing normal, continuous star formation. A similar excess is not observed in field galaxies with equivalent infrared luminosities, indicating a greater fraction of the detected cluster and group members have experienced a burst of star formation in the recent past compared to their counterparts in the field. Our results suggest that gas-rich galaxies at high redshift experience a temporary increase in their star formation activity as they assemble into denser environments. Using Hubble Space Telescope Advanced Camera for Surveys imaging, we find that disturbed morphologies are common among the 24 μm detected cluster and group members and become more prevalent in regions of higher galaxy density. We conclude that mergers are the dominant triggering mechanism responsible for the enhanced star formation found in the Cl1604 groups, while a mix of harassment and mergers are likely

  4. Tight Chk1 Levels Control Replication Cluster Activation in Xenopus

    PubMed Central

    Wiggins, Jennifer M.; Barbosa, Pedro; Libeau, Pierre; Priam, Pierre; Narassimprakash, Hemalatha; Grodzenski, Xenia; Marheineke, Kathrin

    2015-01-01

    DNA replication in higher eukaryotes initiates at thousands of origins according to a spatio-temporal program. The ATR/Chk1 dependent replication checkpoint inhibits the activation of later firing origins. In the Xenopus in vitro system initiations are not sequence dependent and 2-5 origins are grouped in clusters that fire at different times despite a very short S phase. We have shown that the temporal program is stochastic at the level of single origins and replication clusters. It is unclear how the replication checkpoint inhibits late origins but permits origin activation in early clusters. Here, we analyze the role of Chk1 in the replication program in sperm nuclei replicating in Xenopus egg extracts by a combination of experimental and modelling approaches. After Chk1 inhibition or immunodepletion, we observed an increase of the replication extent and fork density in the presence or absence of external stress. However, overexpression of Chk1 in the absence of external replication stress inhibited DNA replication by decreasing fork densities due to lower Cdk2 kinase activity. Thus, Chk1 levels need to be tightly controlled in order to properly regulate the replication program even during normal S phase. DNA combing experiments showed that Chk1 inhibits origins outside, but not inside, already active clusters. Numerical simulations of initiation frequencies in the absence and presence of Chk1 activity are consistent with a global inhibition of origins by Chk1 at the level of clusters but need to be combined with a local repression of Chk1 action close to activated origins to fit our data. PMID:26046346

  5. EDI Data Products in the Cluster Active Archive

    NASA Astrophysics Data System (ADS)

    Georgescu, E.; Puhl-Quinn, P.; Vaith, H.; Chutter, M.; Quinn, J.; Paschmann, G.; Torbert, R.

    The Electron Drift Instrument (EDI) contribution to the Cluster Active Archive (CAA) is described. Presented are descriptions of the EDI instrument, the various CAA/EDI data products, the CAA ingestion schedule and the current EDI status. An example of a science application is given for one of the main EDI data products available in the CAA.

  6. Flexible macrocycles as versatile supports for catalytically active metal clusters.

    PubMed

    Ryan, Jason D; Gagnon, Kevin J; Teat, Simon J; McIntosh, Ruaraidh D

    2016-07-12

    Here we present three structurally diverse clusters stabilised by the same macrocyclic polyphenol; t-butylcalix[8]arene. This work demonstrates the range of conformations the flexible ligand is capable of adopting, highlighting its versatility in metal coordination. In addition, a Ti complex displays activity for the ring-opening polymerisation of lactide. PMID:26892948

  7. Obscured Starburst Activity in High Redshift Clusters and Groups

    NASA Astrophysics Data System (ADS)

    Kocevski, Dale; Lemaux, B.; Lubin, L.; Gal, R.

    2011-01-01

    Using Spitzer MIPS 24um imaging and extensive Keck spectroscopy we have found evidence for environmentally triggered starburst activity within six clusters and groups at z 0.9. I will show that the density of 24um-detected galaxies in the cluster environment is nearly twice that of the surrounding field at this redshift and that this overdensity scales with the cluster's dynamical state. The 24um-bright members often appear optically unremarkable and exhibit only moderate [OII] line emission due to severe obscuration. Although their spatial distribution suggests they are an infalling population, a close examination of their spectral properties, morphologies and optical colors indicate they are not simply analogs of the field population that have yet to be quenched. Using stacked DEIMOS spectra, we find the 24um-detected cluster and group galaxies exhibit elevated levels of Balmer absorption compared to galaxies undergoing normal, continuous star formation. A similar excess is not observed in field galaxies with equivalent infrared luminosities, indicating a greater fraction of the detected cluster and group members have experienced a burst of star formation in the recent past compared to their counterparts in the field. Our results suggest that gas-rich galaxies at high redshift experience a temporary increase in their star formation activity as they assemble into denser environments. Using HST ACS imaging we find that disturbed morphologies are common among the obscured starburst population and become more prevalent in regions of higher galaxy density. We conclude that mergers are the dominant triggering mechanism responsible for the enhanced star formation found in the group galaxies, while a mix of harassment and mergers are likely driving the activity of the cluster galaxies.

  8. Ligand Mobility Modulates Immunological Synapse Formation and T Cell Activation

    PubMed Central

    Hsu, Chih-Jung; Hsieh, Wan-Ting; Waldman, Abraham; Clarke, Fiona; Huseby, Eric S.; Burkhardt, Janis K.; Baumgart, Tobias

    2012-01-01

    T cell receptor (TCR) engagement induces clustering and recruitment to the plasma membrane of many signaling molecules, including the protein tyrosine kinase zeta-chain associated protein of 70 kDa (ZAP70) and the adaptor SH2 domain-containing leukocyte protein of 76 kDa (SLP76). This molecular rearrangement results in formation of the immunological synapse (IS), a dynamic protein array that modulates T cell activation. The current study investigates the effects of apparent long-range ligand mobility on T cell signaling activity and IS formation. We formed stimulatory lipid bilayers on glass surfaces from binary lipid mixtures with varied composition, and characterized these surfaces with respect to diffusion coefficient and fluid connectivity. Stimulatory ligands coupled to these surfaces with similar density and orientation showed differences in their ability to activate T cells. On less mobile membranes, central supramolecular activation cluster (cSMAC) formation was delayed and the overall accumulation of CD3ζ at the IS was reduced. Analysis of signaling microcluster (MC) dynamics showed that ZAP70 MCs exhibited faster track velocity and longer trajectories as a function of increased ligand mobility, whereas movement of SLP76 MCs was relatively insensitive to this parameter. Actin retrograde flow was observed on all surfaces, but cell spreading and subsequent cytoskeletal contraction were more pronounced on mobile membranes. Finally, increased tyrosine phosphorylation and persistent elevation of intracellular Ca2+ were observed in cells stimulated on fluid membranes. These results point to ligand mobility as an important parameter in modulating T cell responses. PMID:22384241

  9. Cluster Active Archive products and multipoint magnetospheric investigations

    NASA Astrophysics Data System (ADS)

    Perry, C.; Laakso, H.; Taylor, M.; Escoubet, P.

    2007-12-01

    The four-satellite Cluster mission investigates the small-scale structures (in three dimensions) of the Earth's plasma environment, such as those involved in the interaction between the solar wind and the magnetospheric plasma, in global magnetotail dynamics, in cross-tail currents, and in the formation and dynamics of the neutral line and of plasmoids. The Cluster Active Archive CAA (http://caa.estec.esa.int/) contains the entire set of Cluster high resolution data and other allied products in a standard format. The CAA currently has data from most of the Cluster instruments for at least the first three years of operations (2001-2003). The coverage and range of products is being continually improved with more than 200 datasets available from each spacecraft including high-resolution magnetic & electric DC fields and wave spectra; full 3D electron & ion distributions from a few eV to hundreds of keV; and various ancillary & browse products to help with spacecraft and event location. The data archived are (1) publicly accessible, (2) of the best quality achievable with the given resources, and (3) suitable for science use and publication by both the Cluster and broader scientific community. The presentation contains examples of user friendly services of the CAA for searching and accessing these data and ancillary products and of online capabilities of the system.

  10. Clustering and phase behaviour of attractive active particles with hydrodynamics.

    PubMed

    Navarro, Ricard Matas; Fielding, Suzanne M

    2015-10-14

    We simulate clustering, phase separation and hexatic ordering in a monolayered suspension of active squirming disks subject to an attractive Lennard-Jones-like pairwise interaction potential, taking hydrodynamic interactions between the particles fully into account. By comparing the hydrodynamic case with counterpart simulations for passive and active Brownian particles, we elucidate the relative roles of self-propulsion, interparticle attraction, and hydrodynamic interactions in determining clustering and phase behaviour. Even in the presence of an attractive potential, we find that hydrodynamic interactions strongly suppress the motility induced phase separation that might a priori have been expected in a highly active suspension. Instead, we find only a weak tendency for the particles to form stringlike clusters in this regime. At lower activities we demonstrate phase behaviour that is broadly equivalent to that of the counterpart passive system at low temperatures, characterized by regimes of gas-liquid, gas-solid and liquid-solid phase coexistence. In this way, we suggest that a dimensionless quantity representing the level of activity relative to the strength of attraction plays the role of something like an effective non-equilibrium temperature, counterpart to the (dimensionless) true thermodynamic temperature in the passive system. However there are also some important differences from the equilibrium case, most notably with regards the degree of hexatic ordering, which we discuss carefully. PMID:26278520

  11. Composition and topology of activity cliff clusters formed by bioactive compounds.

    PubMed

    Stumpfe, Dagmar; Dimova, Dilyana; Bajorath, Jürgen

    2014-02-24

    The assessment of activity cliffs has thus far mostly focused on compound pairs, although the majority of activity cliffs are not formed in isolation but in a coordinated manner involving multiple active compounds and cliffs. However, the composition of coordinated activity cliff configurations and their topologies are unknown. Therefore, we have identified all activity cliff configurations formed by currently available bioactive compounds and analyzed them in network representations where activity cliff configurations occur as clusters. The composition, topology, frequency of occurrence, and target distribution of activity cliff clusters have been determined. A limited number of large cliff clusters with unique topologies were identified that were centers of activity cliff formation. These clusters originated from a small number of target sets. However, most clusters were of small to moderate size. Three basic topologies were sufficient to describe recurrent activity cliff cluster motifs/topologies. For example, frequently occurring clusters with star topology determined the scale-free character of the global activity cliff network and represented a characteristic activity cliff configuration. Large clusters with complex topology were often found to contain different combinations of basic topologies. Our study provides a first view of activity cliff configurations formed by currently available bioactive compounds and of the recurrent topologies of activity cliff clusters. Activity cliff clusters of defined topology can be selected, and from compounds forming the clusters, SAR information can be obtained. The SAR information of activity cliff clusters sharing a/one specific activity and topology can be compared. PMID:24437577

  12. Clues to galaxy activity from rich cluster simulations

    NASA Technical Reports Server (NTRS)

    Evrard, August E.

    1990-01-01

    New simulations of rich cluster evolution are used to evaluate the first infall hypothesis of Gunn and Dressler - the idea that the enhanced fraction of active galaxies seen in high redshift clusters is due to a one-time burst of star formation triggered by the rapid rise in external pressure as a galaxy plows into the hot intracluster medium (ICM). Using three-dimensional simulations which contain both baryonic gas and collisionless dark material, local static pressure histories for test orbits of galaxies are generated and a simple trigger threshold based on dP/dt/P sub ISM is applied to define an active fraction of the population. The results lend qualitative and quantitative support to the first infall interpretation.

  13. Active spacecraft potential control: An ion emitter experiment. [Cluster mission

    NASA Technical Reports Server (NTRS)

    Riedler, W.; Goldstein, R.; Hamelin, M.; Maehlum, B. N.; Troim, J.; Olsen, R. C.; Pedersen, A.; Grard, R. J. L.; Schmidt, R.; Rudenauer, F.

    1988-01-01

    The cluster spacecraft are instrumented with ion emitters for charge neutralization. The emitters produce indium ions at 6 keV. The ion current is adjusted in a feedback loop with instruments measuring the spacecraft potential. The system is based on the evaporation of indium in the apex field of a needle. The design of the active spacecraft potential control instruments, and the ion emitters is presented.

  14. Roles of Cluster Active Archive in heliophysics science research

    NASA Astrophysics Data System (ADS)

    McCaffrey, S.; Laakso, H.; Perry, C.; Taylor, M.; Escoubet, P.; Esson, S.; Herment, D.

    2007-12-01

    The four-satellite Cluster mission investigates small-scale structures (in three dimensions) of the Earth's plasma environment, such as those involved in the interaction between the solar wind and the magnetospheric plasma, in global magnetotail dynamics, in cross-tail currents, and in the formation and dynamics of the neutral line and of plasmoids. The Cluster Active Archive CAA (http://caa.estec.esa.int/) will contain the entire set of Cluster high resolution data and other allied products in a standard format and with a complete set of metadata in machine readable form. The data archived are (1) publicly accessible, (2) of the best quality achievable with the given resources, and (3) suitable for science use and publication by both the Cluster and broader scientific community. The CAA tends to provide user friendly services for searching and accessing these data, e.g., users can save their frequent data requests as profiles speeding up their future similar requests. The CAA is continuing to extend and improve the online capabilities of the system, e.g., the CAA products can be downloaded either via a web interface or a machine accessible interface.

  15. Chandra Finds Surprising Black Hole Activity In Galaxy Cluster

    NASA Astrophysics Data System (ADS)

    2002-09-01

    Scientists at the Carnegie Observatories in Pasadena, California, have uncovered six times the expected number of active, supermassive black holes in a single viewing of a cluster of galaxies, a finding that has profound implications for theories as to how old galaxies fuel the growth of their central black holes. The finding suggests that voracious, central black holes might be as common in old, red galaxies as they are in younger, blue galaxies, a surprise to many astronomers. The team made this discovery with NASA'S Chandra X-ray Observatory. They also used Carnegie's 6.5-meter Walter Baade Telescope at the Las Campanas Observatory in Chile for follow-up optical observations. "This changes our view of galaxy clusters as the retirement homes for old and quiet black holes," said Dr. Paul Martini, lead author on a paper describing the results that appears in the September 10 issue of The Astrophysical Journal Letters. "The question now is, how do these black holes produce bright X-ray sources, similar to what we see from much younger galaxies?" Typical of the black hole phenomenon, the cores of these active galaxies are luminous in X-ray radiation. Yet, they are obscured, and thus essentially undetectable in the radio, infrared and optical wavebands. "X rays can penetrate obscuring gas and dust as easily as they penetrate the soft tissue of the human body to look for broken bones," said co-author Dr. Dan Kelson. "So, with Chandra, we can peer through the dust and we have found that even ancient galaxies with 10-billion-year-old stars can have central black holes still actively pulling in copious amounts of interstellar gas. This activity has simply been hidden from us all this time. This means these galaxies aren't over the hill after all and our theories need to be revised." Scientists say that supermassive black holes -- having the mass of millions to billions of suns squeezed into a region about the size of our Solar System -- are the engines in the cores of

  16. Star Formation Activity in CLASH Brightest Cluster Galaxies

    NASA Astrophysics Data System (ADS)

    Fogarty, Kevin; Postman, Marc; Connor, Thomas; Donahue, Megan; Moustakas, John

    2015-11-01

    The CLASH X-ray selected sample of 20 galaxy clusters contains 10 brightest cluster galaxies (BCGs) that exhibit significant (>5σ) extinction-corrected star formation rates (SFRs). Star formation activity is inferred from photometric estimates of UV and Hα+[N ii] emission in knots and filaments detected in CLASH Hubble Space Telescope ACS and WFC3 observations. UV-derived SFRs in these BCGs span two orders of magnitude, including two with a SFR ≳ 100 M⊙ yr-1. These measurements are supplemented with [O ii], [O iii], and Hβ fluxes measured from spectra obtained with the SOAR telescope. We confirm that photoionization from ongoing star formation powers the line emission nebulae in these BCGs, although in many BCGs there is also evidence of a LINER-like contribution to the line emission. Coupling these data with Chandra X-ray measurements, we infer that the star formation occurs exclusively in low-entropy cluster cores and exhibits a correlation with gas properties related to cooling. We also perform an in-depth study of the starburst history of the BCG in the cluster RXJ1532.9+3021, and create 2D maps of stellar properties on scales down to ˜350 pc. These maps reveal evidence for an ongoing burst occurring in elongated filaments, generally on ˜0.5-1.0 Gyr timescales, although some filaments are consistent with much younger (≲100 Myr) burst timescales and may be correlated with recent activity from the active galactic nucleus. The relationship between BCG SFRs and the surrounding intracluster medium gas properties provide new support for the process of feedback-regulated cooling in galaxy clusters and is consistent with recent theoretical predictions. Based on observations obtained at the Southern Astrophysical Research (SOAR) telescope, which is a joint project of the Ministério da Ciência, Tecnologia, e Inovação (MCTI) da República Federativa do Brasil, the U.S. National Optical Astronomy Observatory (NOAO), the University of North Carolina at Chapel

  17. Statistics of Active Galactic Nuclei in Rich Clusters Revisited

    NASA Astrophysics Data System (ADS)

    Way, M. J.; Flores, R. A.; Quintana, H.

    1998-07-01

    Using the spectrophotometry of a large sample of galaxies in 19 Abell clusters, we have selected 42 candidate active galactic nuclei (AGNs) using the criteria used by Dressler and coworkers in their analysis of the statistics of 22 AGNs in 14 rich cluster fields, which are based on the equivalent width of [O II] 3727 Å, Hβ, and [O III] 5007 Å emission. We have then discriminated AGNs from H II region-like galaxies (hereafter H II galaxies) in the manner developed by Veilleux & Osterbrock using the additional information provided by Hα and [N II] 6583 Å or Hα and [S II] 6716 + 6731 Å emission, in order to test the reliability of the selection criteria used by Dressler and coworkers. We find that before we discriminate AGNs from H II galaxies, our sample is very similar to that of Dressler and coworkers and it leads to similar conclusions. However, we find that their method inevitably mixes H II galaxies with AGNs, even for the most luminous objects in our sample. We estimate a contamination of at least 38% at a formal 90% confidence level. Since the study of Dressler and coworkers, other authors have attempted to quantify the relative fraction of cluster-to-field AGNs and have reached similar conclusions, but they have used criteria similar to Dressler and coworkers to select AGNs (or have used the [O III] 5007 Å/Hβ flux ratio test that also mixes H II galaxies with AGNs). Our sample of true AGNs remains too small to reach statistically meaningful conclusions, therefore a new study with a more time-consuming method that includes the other lines will be required to quantify the true relative fraction of cluster-to-field AGNs.

  18. Postsynaptic Clustering and Activation of Pyk2 by PSD-95

    PubMed Central

    Bartos, Jason A.; Ulrich, Jason D.; Li, Hongbin; Beazely, Michael A.; Chen, Yucui; MacDonald, John F.; Hell, Johannes W.

    2010-01-01

    The tyrosine kinase Pyk2 plays a unique role in intracellular signal transduction by linking Ca2+ influx to tyrosine phosphorylation, but the molecular mechanism of Pyk2 activation is unknown. We report that Pyk2 oligomerization by antibodies in vitro or overexpression of PSD-95 in PC6-3 cells induces trans-autophosphorylation of Tyr402, the first step in Pyk2 activation. In neurons, Ca2+ influx through NMDA-type glutamate receptors (NMDAR) causes postsynaptic clustering and autophosphorylation of endogenous Pyk2 via Ca2+- and calmodulin-stimulated binding to PSD-95. Accordingly, Ca2+ influx promotes oligomerization and thereby autoactivation of Pyk2 by stimulating its interaction with PSD-95. We show that this mechanism of Pyk2 activation is critical for LTP in the hippocampus CA1 region, which is thought to underlie learning and memory. PMID:20071509

  19. A Gamblers Clustering Based on Their Favorite Gambling Activity.

    PubMed

    Challet-Bouju, Gaëlle; Hardouin, Jean-Benoit; Renard, Noëlle; Legauffre, Cindy; Valleur, Marc; Magalon, David; Fatséas, Mélina; Chéreau-Boudet, Isabelle; Gorsane, Mohamed-Ali; Vénisse, Jean-Luc; Grall-Bronnec, Marie

    2015-12-01

    The objective of this study was to identify profiles of gamblers to explain the choice of preferred gambling activity among both problem and non-problem gamblers. 628 non-problem and problem gamblers were assessed with a structured interview including "healthy" (sociodemographic characteristics, gambling habits and personality profile assessed with the Temperament and Character Inventory-125) and "pathological" [diagnosis of pathological gambling, gambling-related cognitions (GRCs) and psychiatric comorbidity] variables. We performed a two-step cluster analysis based solely on "healthy" variables to identify gamblers' profiles which typically reflect the choice of preferred gambling activity. The obtained classes were then described using both "healthy" and "pathological" variables, by comparing each class to the rest of the sample. Clusters were generated. Class 1 (Electronic Gaming Machines gamblers) showed high cooperativeness, a lower level of GRC about strategy and more depressive disorders. Class 2 (games with deferred results gamblers) were high novelty seekers and showed a higher level of GRC about strategy and more addictive disorders. Class 3 (roulette gamblers) were more often high rollers and showed a higher level of GRC about strategy and more manic or hypomanic episodes and more obsessive-compulsive disorders. Class 4 (instant lottery gamblers) showed a lower tendency to suicide attempts. Class 5 (scratch cards gamblers) were high harm avoiders and showed a lower overall level of GRC and more panic attacks and eating disorders. The preference for one particular gambling activity may concern different profiles of gamblers. This study highlights the importance of considering the pair gambler-game rather than one or the other separately, and may provide support for future research on gambling and preventive actions directed toward a particular game. PMID:25192752

  20. Usability and quality of the Cluster Active Archive (Invited)

    NASA Astrophysics Data System (ADS)

    Laakso, H. E.

    2009-12-01

    There is a large number of data archives for magnetospheric physics that, however, usually provide access only to spin-averaged datasets. In addition only limited resources have been used to calibrate the measurements to a level that the users could easily analyze them with no need to worry about the quality of the data. These are the starting points to the ESA Cluster Active Archive (CAA, see URL: http://caa.estec.esa.int) that provides access to the calibrated full-resolution datasets of the four-satellite Cluster mission. The data archive is publicly accessible and suitable for science use and publication by the world-wide scientific community. This presentation will focus on the usability aspects of the overall system and its services and the quality of its datasets. The Cluster mission has collected observations for nine years since 2001 and has now submitted a proposal for further observations during years 2010-12. The CAA will contain the entire set of Cluster high-resolution data and other allied products in a standard format and with a complete set of metadata in machine readable format. The data can be accessed either via web GUI or via command line wget tool. Currently there are more than 200 datasets from each spacecraft, including high-resolution magnetic and electric DC and AC fields; full 3-dimensional electron and ion distribution functions and moments from a few eV to hundreds of keV; and various ancillary and browse products to help with spacecraft and event location. To ensure the high quality of its datasets, the CAA runs a series of cross-calibration workshops that focus on detailed comparisons of the measurements. Currently the observations from years 2001-7 are available for most instruments. The total amount of data files in compressed format is expected to exceed 50 TB. The CAA became operational in February 2006 and now has more than 900 registered users who download about 100-1000 GB of data every month. The CAA provides user

  1. How Environment Affects Star Formation: Tracing Activity in High Redshift Galaxy Clusters

    NASA Astrophysics Data System (ADS)

    Alberts, Stacey; Pope, A.; Brodwin, M.; Atlee, D. W.; Lin, Y.; Chary, R.; Dey, A.; Eisenhardt, P. R.; Gettings, D.; Gonzalez, A. H.; Jannuzi, B.; Mancone, C.; Moustakas, J.; Snyder, G. F.; Stanford, S. A.; Stern, D.; Weiner, B. J.; Zeimann, G.

    2014-01-01

    The emerging picture of the evolution of cluster galaxies indicates that the epoch of z>1 is a crucial period of active star formation and mass assembly in clusters. In this dissertation, I leverage a uniformly-selected cluster sample from the IRAC Shallow Cluster Survey (ISCS) with Herschel imaging to analyse the star formation (SF) activity in cluster galaxies over the past ten billion years. This analysis is two-fold: 1) using 274 clusters across the 9 square degree Bootes field, I perform a stacking analysis of mass-limited samples of cluster and field galaxies using wide-field Herschel observations over a long redshift baseline, z=0.3-1.5. I find that the average SF activity in cluster galaxies is evolving faster than in the field, with field-like SF in the cluster cores and enhanced SF activity in the cluster outskirts at z>1.2. By further breaking down my analysis by galaxy mass and type, I determine which mechanisms are capable of driving this evolution. 2) I use unique, deep Herschel imaging of 11 spectroscopically-confirmed clusters from z=1.1-1.8 to study the properties of individual infrared bright cluster galaxies as a function of redshift and cluster-centric radius. Combined with ancillary data, I determine the star formation, dust, and AGN properties of the most active cluster galaxies and tie the evolution of these properties back to the environment by comparing to field populations. By combining these two approaches, I constrain cluster galaxy properties during a pivotal epoch of dust-obscured star formation activity and mass assembly in some of the most extreme structures in the Universe.

  2. Clustering and Pattern Formation in Chemorepulsive Active Colloids.

    PubMed

    Liebchen, Benno; Marenduzzo, Davide; Pagonabarraga, Ignacio; Cates, Michael E

    2015-12-18

    We demonstrate that migration away from self-produced chemicals (chemorepulsion) generates a generic route to clustering and pattern formation among self-propelled colloids. The clustering instability can be caused either by anisotropic chemical production, or by a delayed orientational response to changes of the chemical environment. In each case, chemorepulsion creates clusters of a self-limiting area which grows linearly with self-propulsion speed. This agrees with recent observations of dynamic clusters in Janus colloids (albeit not yet known to be chemorepulsive). More generally, our results could inform design principles for the self-assembly of chemorepulsive synthetic swimmers and/or bacteria into nonequilibrium patterns. PMID:26722949

  3. Clustering and Pattern Formation in Chemorepulsive Active Colloids

    NASA Astrophysics Data System (ADS)

    Liebchen, Benno; Marenduzzo, Davide; Pagonabarraga, Ignacio; Cates, Michael E.

    2015-12-01

    We demonstrate that migration away from self-produced chemicals (chemorepulsion) generates a generic route to clustering and pattern formation among self-propelled colloids. The clustering instability can be caused either by anisotropic chemical production, or by a delayed orientational response to changes of the chemical environment. In each case, chemorepulsion creates clusters of a self-limiting area which grows linearly with self-propulsion speed. This agrees with recent observations of dynamic clusters in Janus colloids (albeit not yet known to be chemorepulsive). More generally, our results could inform design principles for the self-assembly of chemorepulsive synthetic swimmers and/or bacteria into nonequilibrium patterns.

  4. Adults' Physical Activity Patterns across Life Domains: Cluster Analysis with Replication

    PubMed Central

    Rovniak, Liza S.; Sallis, James F.; Saelens, Brian E.; Frank, Lawrence D.; Marshall, Simon J.; Norman, Gregory J.; Conway, Terry L.; Cain, Kelli L.; Hovell, Melbourne F.

    2010-01-01

    Objective Identifying adults' physical activity patterns across multiple life domains could inform the design of interventions and policies. Design Cluster analysis was conducted with adults in two US regions (Baltimore-Washington DC, n = 702; Seattle-King County, n = 987) to identify different physical activity patterns based on adults' reported physical activity across four life domains: leisure, occupation, transport, and home. Objectively measured physical activity, and psychosocial and built (physical) environment characteristics of activity patterns were examined. Main Outcome Measures Accelerometer-measured activity, reported domain-specific activity, psychosocial characteristics, built environment, body mass index (BMI). Results Three clusters replicated (kappa = .90-.93) across both regions: Low Activity, Active Leisure, and Active Job. The Low Activity and Active Leisure adults were demographically similar, but Active Leisure adults had the highest psychosocial and built environment support for activity, highest accelerometer-measured activity, and lowest BMI. Compared to the other clusters, the Active Job cluster had lower socioeconomic status and intermediate accelerometer-measured activity. Conclusion Adults can be clustered into groups based on their patterns of accumulating physical activity across life domains. Differences in psychosocial and built environment support between the identified clusters suggest that tailored interventions for different subgroups may be beneficial. PMID:20836604

  5. Effect of mitochondrial complex I inhibition on Fe-S cluster protein activity

    SciTech Connect

    Mena, Natalia P.; Bulteau, Anne Laure; Salazar, Julio; Hirsch, Etienne C.; Nunez, Marco T.

    2011-06-03

    Highlights: {yields} Mitochondrial complex I inhibition resulted in decreased activity of Fe-S containing enzymes mitochondrial aconitase and cytoplasmic aconitase and xanthine oxidase. {yields} Complex I inhibition resulted in the loss of Fe-S clusters in cytoplasmic aconitase and of glutamine phosphoribosyl pyrophosphate amidotransferase. {yields} Consistent with loss of cytoplasmic aconitase activity, an increase in iron regulatory protein 1 activity was found. {yields} Complex I inhibition resulted in an increase in the labile cytoplasmic iron pool. -- Abstract: Iron-sulfur (Fe-S) clusters are small inorganic cofactors formed by tetrahedral coordination of iron atoms with sulfur groups. Present in numerous proteins, these clusters are involved in key biological processes such as electron transfer, metabolic and regulatory processes, DNA synthesis and repair and protein structure stabilization. Fe-S clusters are synthesized mainly in the mitochondrion, where they are directly incorporated into mitochondrial Fe-S cluster-containing proteins or exported for cytoplasmic and nuclear cluster-protein assembly. In this study, we tested the hypothesis that inhibition of mitochondrial complex I by rotenone decreases Fe-S cluster synthesis and cluster content and activity of Fe-S cluster-containing enzymes. Inhibition of complex I resulted in decreased activity of three Fe-S cluster-containing enzymes: mitochondrial and cytosolic aconitases and xanthine oxidase. In addition, the Fe-S cluster content of glutamine phosphoribosyl pyrophosphate amidotransferase and mitochondrial aconitase was dramatically decreased. The reduction in cytosolic aconitase activity was associated with an increase in iron regulatory protein (IRP) mRNA binding activity and with an increase in the cytoplasmic labile iron pool. Since IRP activity post-transcriptionally regulates the expression of iron import proteins, Fe-S cluster inhibition may result in a false iron deficiency signal. Given that

  6. Night-time neuronal activation of Cluster N in a day- and night-migrating songbird

    PubMed Central

    Zapka, Manuela; Heyers, Dominik; Liedvogel, Miriam; Jarvis, Erich D; Mouritsen, Henrik

    2010-01-01

    Magnetic compass orientation in a night-migratory songbird requires that Cluster N, a cluster of forebrain regions, is functional. Cluster N, which receives input from the eyes via the thalamofugal pathway, shows high neuronal activity in night-migrants performing magnetic compass-guided behaviour at night, whereas no activation is observed during the day, and covering up the birds’ eyes strongly reduces neuronal activation. These findings suggest that Cluster N processes light-dependent magnetic compass information in night-migrating songbirds. The aim of this study was to test if Cluster N is active during daytime migration. We used behavioural molecular mapping based on ZENK activation to investigate if Cluster N is active in the meadow pipit (Anthus pratensis), a day- and night-migratory species. We found that Cluster N of meadow pipits shows high neuronal activity under dim-light at night, but not under full room-light conditions during the day. These data suggest that, in day- and night-migratory meadow pipits, the light-dependent magnetic compass, which requires an active Cluster N, may only be used during night-time, whereas another magnetosensory mechanism and/or other reference system(s), like the sun or polarized light, may be used as primary orientation cues during the day. PMID:20618826

  7. Removing Cool Cores and Central Metallicity Peaks in Galaxy Clusters with Powerful Active Galactic Nucleus Outbursts

    NASA Astrophysics Data System (ADS)

    Guo, Fulai; Mathews, William G.

    2010-07-01

    Recent X-ray observations of galaxy clusters suggest that cluster populations are bimodally distributed according to central gas entropy and are separated into two distinct classes: cool core (CC) and non-cool core (NCC) clusters. While it is widely accepted that active galactic nucleus (AGN) feedback plays a key role in offsetting radiative losses and maintaining many clusters in the CC state, the origin of NCC clusters is much less clear. At the same time, a handful of extremely powerful AGN outbursts have recently been detected in clusters, with a total energy ~1061-1062 erg. Using two-dimensional hydrodynamic simulations, we show that if a large fraction of this energy is deposited near the centers of CC clusters, which is likely common due to dense cores, these AGN outbursts can completely remove CCs, transforming them to NCC clusters. Our model also has interesting implications for cluster abundance profiles, which usually show a central peak in CC systems. Our calculations indicate that during the CC to NCC transformation, AGN outbursts efficiently mix metals in cluster central regions and may even remove central abundance peaks if they are not broad enough. For CC clusters with broad central abundance peaks, AGN outbursts decrease peak abundances, but cannot effectively destroy the peaks. Our model may simultaneously explain the contradictory (possibly bimodal) results of abundance profiles in NCC clusters, some of which are nearly flat, while others have strong central peaks similar to those in CC clusters. A statistical analysis of the sizes of central abundance peaks and their redshift evolution may shed interesting insights on the origin of both types of NCC clusters and the evolution history of thermodynamics and AGN activity in clusters.

  8. Circadian secretion of cortisol and melatonin in cluster headache during active cluster periods and remission.

    PubMed Central

    Waldenlind, E; Gustafsson, S A; Ekbom, K; Wetterberg, L

    1987-01-01

    The cyclic nature of cluster headache warranted a study of the 24-hour rhythms of serum cortisol and melatonin. They were both altered during cluster periods as compared with periods of remission and healthy controls. The 24-hour mean and maximal cortisol levels were higher and the timing of the cortisol minimum was delayed as compared to the same patients in remission. Although there was no relation between the cortisol and melatonin levels and headaches, the rise of cortisol following many attacks might in part represent an adaptive response to pain. The nocturnal melatonin maximum was lower during cluster periods than in remission. This finding, and the dysautonomic signs during attacks, may reflect a change of the vegetative tone in a hyposympathetic direction. Images PMID:3572435

  9. Reactivity and Catalytic Activity of Hydrogen Atom Chemisorbed Silver Clusters.

    PubMed

    Manzoor, Dar; Pal, Sourav

    2015-06-18

    Metal clusters of silver have attracted recent interest of researchers as a result of their potential in different catalytic applications and low cost. However, due to the completely filled d orbital and very high first ionization potential of the silver atom, the silver-based catalysts interact very weakly with the reacting molecules. In the current work, density functional theory calculations were carried out to investigate the effect of hydrogen atom chemisorption on the reactivity and catalytic properties of inert silver clusters. Our results affirm that the hydrogen atom chemisorption leads to enhancement in the binding energy of the adsorbed O2 molecule on the inert silver clusters. The increase in the binding energy is also characterized by the decrease in the Ag-O and increase in the O-O bond lengths in the case of the AgnH silver clusters. Pertinent to the increase in the O-O bond length, a significant red shift in the O-O stretching frequency is also noted in the case of the AgnH silver clusters. Moreover, the hydrogen atom chemisorbed silver clusters show low reaction barriers and high heat of formation of the final products for the environmentally important CO oxidation reaction as compared to the parent catalytically inactive clusters. The obtained results were compared with those of the corresponding gold and hydrogen atom chemisorbed gold clusters obtained at the same level of theory. It is expected the current computational study will provide key insights for future advances in the design of efficient nanosilver-based catalysts through the adsorption of a small atom or a ligand. PMID:25988294

  10. Career Cluster Activity Book, Intermediate Level. Learn About the Fifteen Career Clusters and Color the Pictures.

    ERIC Educational Resources Information Center

    White Hawk, Sharon, Ed.

    Simple black and white illustrations portray one occupation for each of 15 career clusters. Directed toward the Indian student and showing Indians at work in the occupations depicted, the illustrations are intended to create an awareness, understanding, and motivation for Indian students to become involved in work, both on and off the reservation.…

  11. Activation of Methane Promoted by Adsorption of CO on Mo2 C2 (-) Cluster Anions.

    PubMed

    Liu, Qing-Yu; Ma, Jia-Bi; Li, Zi-Yu; Zhao, Chongyang; Ning, Chuan-Gang; Chen, Hui; He, Sheng-Gui

    2016-05-01

    Atomic clusters are being actively studied for activation of methane, the most stable alkane molecule. While many cluster cations are very reactive with methane, the cluster anions are usually not very reactive, particularly for noble metal free anions. This study reports that the reactivity of molybdenum carbide cluster anions with methane can be much enhanced by adsorption of CO. The Mo2 C2 (-) is inert with CH4 while the CO addition product Mo2 C3 O(-) brings about dehydrogenation of CH4 under thermal collision conditions. The cluster structures and reactions are characterized by mass spectrometry, photoelectron spectroscopy, and quantum chemistry calculations, which demonstrate that the Mo2 C3 O(-) isomer with dissociated CO is reactive but the one with non-dissociated CO is unreactive. The enhancement of cluster reactivity promoted by CO adsorption in this study is compared with those of reported systems of a few carbonyl complexes. PMID:27060286

  12. A cluster expansion model for predicting activation barrier of atomic processes

    SciTech Connect

    Rehman, Tafizur; Jaipal, M.; Chatterjee, Abhijit

    2013-06-15

    We introduce a procedure based on cluster expansion models for predicting the activation barrier of atomic processes encountered while studying the dynamics of a material system using the kinetic Monte Carlo (KMC) method. Starting with an interatomic potential description, a mathematical derivation is presented to show that the local environment dependence of the activation barrier can be captured using cluster interaction models. Next, we develop a systematic procedure for training the cluster interaction model on-the-fly, which involves: (i) obtaining activation barriers for handful local environments using nudged elastic band (NEB) calculations, (ii) identifying the local environment by analyzing the NEB results, and (iii) estimating the cluster interaction model parameters from the activation barrier data. Once a cluster expansion model has been trained, it is used to predict activation barriers without requiring any additional NEB calculations. Numerical studies are performed to validate the cluster expansion model by studying hop processes in Ag/Ag(100). We show that the use of cluster expansion model with KMC enables efficient generation of an accurate process rate catalog.

  13. Deriving Age-Activity Relations in M Dwarf Stars Using Clusters of Known Ages

    NASA Astrophysics Data System (ADS)

    Andersen, J. M.; West, A. A.; Covey, K. R.; McDonald, M.; Veilleux, S.; Seth, A.

    2011-12-01

    We present preliminary results from a study of M dwarf magnetic activity in clusters of known ages with the ultimate goal of constraining the age-activity relation. The age-activity relation provides clues to the mechanisms generating magnetic dynamos, especially in late-type dwarfs where their stellar interiors become fully convective. Broadband griz photometry was obtained for four clusters with ages ranging from ˜110 Myrs to 4 Gyrs. Narrowband images of each cluster were acquired with the Maryland Magellan Tunable Filter, tuned to the frequency of Hα, including a correction for the cluster's radial velocity, and a nearby, similarly sized bandpass sampling the stellar pseudo-continuum. This permits a "photometric" measurement of the Hα emission for each star, and thus a measure of activity. Cluster membership is determined from broadband photometry and comparison to stellar positions from previous studies. We report on our findings for the cluster NGC 2516. Hα measurements are stronger for cluster stars than for field stars of the same magnitude. A clear correlation is seen between our Hα strengths measured by narrowband imaging and previous spectroscopic activity measurements for stars where spectra have been obtained.

  14. X-Ray Activity in the Open Cluster IC 4665

    NASA Technical Reports Server (NTRS)

    Giamapapa, Mark S.; Prosser, Charles F.; Fleming, Thomas A.

    1997-01-01

    We present the results of a joint ROSAT High Resolution Imager (HRI) and optical investigation of the open cluster IC 4665. The ROSAT data contains detections for 28 stellar sources in the field, including 22 cluster members and candidate members spanning the color range -0.18 less than or equal to (B - V(sub o)) less than or equal to +1.63 (approx. B3 - M3). Upper limits are given for the remaining members (or candidate members) in the HRI field. Keck HIRES spectra have been obtained that yield radial and rotational velocity measures, respectively, for faint, low mass candidate members located within the field of the ROSAT HRI observation. In addition, photometry of possible optical counterparts to previously uncatalogued X-ray sources in the HRI field is presented. The trends in X-ray properties with (B - V) color in IC 4665 are found to be quite similar to that for other, more nearby young clusters such as the Pleiades and alpha Persei. In particular, a maximum in normalized X-ray luminosity of log (L(sub x)/L(sub bol)) approx. equal 3 is observed, beginning in the color range of (B - V)(sub o) = 0.7 - 0.8. This is similar to the corresponding color range among Pleiades members, in agreement with the earlier estimate, that the age of IC 4665 is similar to the age of the Pleiades. The correlation of rotation and X-ray emission levels is consistent with that in other young clusters. Among the high mass stars in IC 4665, five B stars are detected as X-ray sources. Of these, one is a spectroscopic binary while the remaining objects are apparently single staxs. The level of intrinsic X-ray emission observed in the rapidly rotating (v sini greater than 200 km/ s), single B stars is consistent with an origin due to shock heating of the ambient medium by radiatively driven, rotationally enhanced winds. On the basis of these observations and the results for other clusters, we argue that observed levels of X-ray emission in high mass stars of log (L(sub x)/L(sub bol

  15. Evolution and Distribution of Magnetic Fields from Active Galactic Nuclei in Galaxy Clusters. II. The Effects of Cluster Size and Dynamical State

    NASA Astrophysics Data System (ADS)

    Xu, Hao; Li, Hui; Collins, David C.; Li, Shengtai; Norman, Michael L.

    2011-10-01

    Theory and simulations suggest that magnetic fields from radio jets and lobes powered by their central super massive black holes can be an important source of magnetic fields in the galaxy clusters. This is Paper II in a series of studies where we present self-consistent high-resolution adaptive mesh refinement cosmological magnetohydrodynamic simulations that simultaneously follow the formation of a galaxy cluster and evolution of magnetic fields ejected by an active galactic nucleus. We studied 12 different galaxy clusters with virial masses ranging from 1 × 1014 to 2 × 1015 M sun. In this work, we examine the effects of the mass and merger history on the final magnetic properties. We find that the evolution of magnetic fields is qualitatively similar to those of previous studies. In most clusters, the injected magnetic fields can be transported throughout the cluster and be further amplified by the intracluster medium (ICM) turbulence during the cluster formation process with hierarchical mergers, while the amplification history and the magnetic field distribution depend on the cluster formation and magnetism history. This can be very different for different clusters. The total magnetic energies in these clusters are between 4 × 1057 and 1061 erg, which is mainly decided by the cluster mass, scaling approximately with the square of the total mass. Dynamically older relaxed clusters usually have more magnetic fields in their ICM. The dynamically very young clusters may be magnetized weakly since there is not enough time for magnetic fields to be amplified.

  16. Coordination and activation of azetidine by a triosmium cluster

    SciTech Connect

    Adams, R.D.; Chen, G. )

    1993-06-01

    The ring opening of nitrogen-containing heterocycles is an integral step in the process of hydrogenitrogenatio. The mechanisms by which this step occurs are poorly understood; thus a considerable amount of research has been devoted to modeling this heterogeneous reaction by using homogeneous catalysts. Although it has considerable ring strain, the four-membered heterocycle, azetidine, is opened thermally only at temperatures in excess of 400[degrees]C. Recently, we have found that thietanes, the saturated four-membered heterocycles containing sulfur, undergo facile ring opening when the molecule is coordinated to osmium cluster complexes. It was shown that a bridging coordination of the sulfur atom promotes this process. Thus, we wondered if it might also be possible to open an azetidine ring in a cluster complex under conditions sufficiently mild that a detailed study of the process might be possible. We have now prepared an osmium cluster complex in which the nitrogen atom of the azetidine ligand bridges two of the metal atoms, and we have found that the azetidine ring is spontaneously opened when the complex is heated to 125[degrees]C. In addition, two other complexes formed by transformation of the azetidine ligand have been isolated and characterized. The results of this study are reported here. 20 refs., 4 figs., 13 tabs.

  17. Thermal Dihydrogen Activation by a Closed-Shell AuCeO2(+) Cluster.

    PubMed

    Meng, Jing-Heng; He, Sheng-Gui

    2014-11-01

    Laser-ablation-generated AuCeO2(+) and CeO2(+) oxide clusters were mass-selected using a quadrupole mass filter and reacted with H2 in an ion trap reactor at ambient conditions. The reactions were characterized by mass spectrometry and density functional theory calculations. The gold-cerium bimetallic oxide cluster AuCeO2(+) is more reactive in H2 activation than the pure cerium oxide cluster CeO2(+). The gold atom is the active adsorption site and facilitates the heterolytic cleavage of H2 in collaboration with the separated O(2-) ion of the CeO2 support. To the best of our knowledge, this is the first example of thermal H2 activation by a closed-shell atomic cluster, which provides molecular-level insights into the single gold atom catalysis over metal oxide supports. PMID:26278765

  18. Communication: CO oxidation by silver and gold cluster cations: Identification of different active oxygen species

    SciTech Connect

    Popolan, Denisia M.; Bernhardt, Thorsten M.

    2011-03-07

    The oxidation of carbon monoxide with nitrous oxide on mass-selected Au{sub 3}{sup +} and Ag{sub 3}{sup +} clusters has been investigated under multicollision conditions in an octopole ion trap experiment. The comparative study reveals that for both gold and silver cations carbon dioxide is formed on the clusters. However, whereas in the case of Au{sub 3}{sup +} the cluster itself acts as reactive species that facilitates the formation of CO{sub 2} from N{sub 2}O and CO, for silver the oxidized clusters Ag{sub 3}O{sub x}{sup +} (n= 1-3) are identified as active in the CO oxidation reaction. Thus, in the case of the silver cluster cations N{sub 2}O is dissociated and one oxygen atom is suggested to directly react with CO, whereas a second kind of oxygen strongly bound to silver is acting as a substrate for the reaction.

  19. The Relationship between Cortisol Activity during Cognitive Task and Posttraumatic Stress Symptom Clusters

    PubMed Central

    Duan, Hongxia; Wang, Li; Zhang, Liang; Liu, Jing; Zhang, Kan; Wu, Jianhui

    2015-01-01

    Background The latest development in the dimensional structure of posttraumatic stress disorder (PTSD) is a novel 6-factor model, which builds on the newly released DSM-5. One notable gap in the literature is that little is known about how distinct symptom clusters of PTSD are related to hypothalamic–pituitary–adrenal (HPA) axis activity when people perform a relatively less stressful cognitive task. The purpose of this study was to investigate the relationship between cortisol activity when individuals perform cognitive tasks in the laboratory and a contemporary phenotypic model of posttraumatic stress symptomatology in earthquake survivors. Methods Salivary cortisol while performing cognitive tasks was collected and analyzed in 89 adult earthquake survivors. The PTSD Checklist for the DSM-5 (PCL-5) was used to assess the severity of total PTSD as well as six distinct symptom clusters. Regression analyses were conducted to examine the associations between the six distinct PTSD symptom clusters and cortisol profiles. Results The results showed that the score of the negative affect symptom cluster, but not anhedonia or other clusters, was positively associated with cortisol levels before and during the cognitive tasks. Conclusion The results showed that higher cortisol levels before and during cognitive tasks might be specifically linked to a distinct symptom cluster of PTSD—negative affect symptomatology. This suggests that a distinction should be made between negative affect and anhedonia symptom clusters, as the 6-factor model proposed. PMID:26630485

  20. Identification of clusters of investors from their real trading activity in a financial market

    NASA Astrophysics Data System (ADS)

    Tumminello, Michele; Lillo, Fabrizio; Piilo, Jyrki; Mantegna, Rosario N.

    2012-01-01

    We use statistically validated networks, a recently introduced method of validating links in a bipartite system, to identify clusters of investors trading in a financial market. Specifically, we investigate a special database allowing us to track the trading activity of individual investors of Nokia stock. We find that many statistically detected clusters of investors show a very high degree of synchronization in time when they decide to trade and in the trading action taken. We investigate the composition of these clusters and find that several of them show an over-expression of specific categories of investors.

  1. Nitric oxide synthases activation and inhibition by metallacarborane cluster-based isoform-specific affectors

    PubMed Central

    Kaplánek, Robert; Martásek, Pavel; Grüner, Bohumír; Panda, Satya; Rak, Jakub; Masters, Bettie Sue Siler; Král, Vladimír; Roman, Linda J.

    2012-01-01

    A small library of boron cluster and metallacarborane cluster-based ligands was designed, prepared and tested for isoform-selective activation or inhibition of the three nitric oxide synthase isoforms. Based on the concept of creating a hydrophobic analog of a natural substrate, a stable and non-toxic basic boron cluster system, previously used for boron neutron capture therapy, was modified by the addition of positively charged moieties to its periphery, providing hydrophobic and non-classical hydrogen bonding interactions with the protein. Several of these compounds show efficacy for inhibition of NO synthesis with differential effects on the various nitric oxide synthase isoforms. PMID:23075390

  2. AWM 4: a sharp look at the core of a poor cluster stirred by AGN activity

    NASA Astrophysics Data System (ADS)

    Vrtilek, Jan

    2007-09-01

    The central regions of galaxy clusters, frequently occupied by massive elliptical galaxies with strong radio sources interacting with dense, X-ray emitting gas, are among the most interesting and physically active regions in the Universe. We here propose a deep observation of AWM 4, a poor cluster of relaxed appearance without a cooling core but with strong evidence of AGN-driven heating and gas mixing. In this unusual object we will examine the interaction between cluster gas and radio source at high resolution, measure the properties of the gas and constrain the energy budget of the radio source, and clarify the nature of the observed abundance irregularities.

  3. Cluster Analysis of the Rat Olfactory Bulb Activity in Response to Different Odorants

    NASA Astrophysics Data System (ADS)

    Falasconi, M.; Gutierrez, A.; Auffarth, B.; Sberveglieri, G.; Marco, S.

    2009-05-01

    With the goal of deepen in the understanding of coding of chemical information in the olfactory system, a large data set consisting of rat's olfactory bulb activity values in response to several different volatile compounds has been analyzed by fuzzy c-means clustering methods. Clustering should help to discover groups of glomeruli that are similary activated according to their response profiles across the odorants. To investigate the significance of the achieved fuzzy partitions we developed and applied a novel validity approach based on cluster stability. Our results show certain level of glomerular clustering in the olfactory bulb and indicate that exist a main chemo-topic subdivision of the glomerular layer in few macro-area which are rather specific to particular functional groups of the volatile molecules.

  4. Star formation and black hole accretion activity in rich local clusters of galaxies

    NASA Astrophysics Data System (ADS)

    Bianconi, Matteo; Marleau, Francine R.; Fadda, Dario

    2016-04-01

    Context. We present a study of star formation and central black hole accretion activity of galaxies that are hosted in the two nearby (z ~ 0.2) rich galaxy clusters Abell 983 and 1731. Aims: We aim to quantify both the obscured and unobscured star formation rates, as well as the presence of active galactic nuclei (AGN) as a function of the environment in which the galaxy is located. Methods: We targeted the clusters with unprecedented deep infrared Spitzer observations (0.2 mJy at 24 micron), near-IR Palomar imaging and optical WIYN spectroscopy. The extent of our observations (~3 virial radii) covers the vast range of possible environments, from the very dense cluster centre to the very rarefied cluster outskirts and accretion regions. Results: The star-forming members of the two clusters present star formation rates that are comparable with those measured in coeval field galaxies. Analysis of the spatial arrangement of the spectroscopically confirmed members reveals an elongated distribution for A1731 with respect to the more uniform distribution of A983. The emerging picture is compatible with A983 being a fully evolved cluster, in contrast with the still actively accreting A1731. Conclusions: Analysis of the specific star formation rate reveals evidence of ongoing galaxy pre-processing along A1731's filament-like structure. Furthermore, the decrease in the number of star-forming galaxies and AGN towards the cluster cores suggests that the cluster environment is accelerating the ageing process of the galaxies and blocking further accretion of the cold gas that fuels both star formation and black hole accretion activity. The catalogue and the reduced images (FITS files) are only available at the CDS via anonymous ftp to http://cdsarc.u-strasbg.fr (ftp://130.79.128.5) or via http://cdsarc.u-strasbg.fr/viz-bin/qcat?J/A+A/588/A105

  5. Cluster of solar active regions and onset of coronal mass ejections

    NASA Astrophysics Data System (ADS)

    Wang, JingXiu; Zhang, YuZong; He, Han; Chen, AnQin; Jin, ChunLan; Zhou, GuiPing

    2015-09-01

    Abstract round-the-clock solar observations with full-disk coverage of vector magnetograms and multi-wavelength images demonstrate that solar active regions (ARs) are ultimately connected with magnetic field. Often two or more ARs are clustered, creating a favorable magnetic environment for the onset of coronal mass ejections (CMEs). In this work, we describe a new type of magnetic complex: cluster of solar ARs. An AR cluster is referred to as the close connection of two or more ARs which are located in nearly the same latitude and a narrow span of longitude. We illustrate three examples of AR clusters, each of which has two ARs connected and formed a common dome of magnetic flux system. They are clusters of NOAA (i.e., National Oceanic and Atmospheric Administration) ARs 11226 & 11227, 11429 & 11430, and 11525 & 11524. In these AR clusters, CME initiations were often tied to the instability of the magnetic structures connecting two partner ARs, in the form of inter-connecting loops and/or channeling filaments between the two ARs. We show the evidence that, at least, some of the flare/CMEs in an AR cluster are not a phenomenon of a single AR, but the result of magnetic interaction in the whole AR cluster. The observations shed new light on understanding the mechanism(s) of solar activity. Instead of the simple bipolar topology as suggested by the so-called standard flare model, a multi-bipolar magnetic topology is more common to host the violent solar activity in solar atmosphere.

  6. Prediction of in vitro and in vivo oestrogen receptor activity using hierarchical clustering

    EPA Science Inventory

    In this study, hierarchical clustering classification models were developed to predict in vitro and in vivo oestrogen receptor (ER) activity. Classification models were developed for binding, agonist, and antagonist in vitro ER activity and for mouse in vivo uterotrophic ER bindi...

  7. Earthquake cluster activity beneath the Tanzawa Mountains region, Japan: Migration of hypocenters and low stress drop

    NASA Astrophysics Data System (ADS)

    Yamada, T.; Yukutake, Y.

    2013-12-01

    An earthquake cluster activity was observed beneath the Tanzawa Mountains region, Japan with a depth of 20 km in the end of January, 2012. Japan Meteorological Agency (JMA) determined hypocenters of 76 earthquakes with M > 2 in the area within 50 hours. Five of them had magnitudes greater than 4 and the largest one was 5.4. Four out of the five earthquakes had the reverse-type focal mechanisms with the P axis in the NW-SE direction. First we relocated hypocenters of the activity following the method of Yukutake et al. (2012). We estimated relative arrival times of P and S waves by calculating the coefficients of the cross correlation and relocated hypocenters with the double-difference relocation method (Waldhauser and Ellsworth, 2000). We found that the cluster activity showed a migration from the first earthquake of the activity. The parabolic migration speed was consistent with the migration speed of the deep tremor sources (Ide et al., 2010) for which the fluid activity would play an important role. We then analyzed stress drops of 17 earthquakes with M > 3.5 that occurred from January, 2000 to June, 2012 in the area of the cluster activity. We calculated empirical Green's functions from waveforms of earthquakes with magnitudes of 3.0 to 3.2 and estimated stress drops of the earthquakes assuming that the source spectra can be expressed as the omega-squared model. We found that earthquakes of the cluster activity had smaller stress drops by an order of magnitude than the values of earthquakes that occurred in the same area before the cluster activity. These results suggest that the fluid played an important role for the earthquake cluster activity. That is, the fluid increased the pore pressure, decreased the effective normal stress and triggered the cluster activity. The difference of the rupture speed and the change of the rigidity might also be candidates that account for our results. They, however, can hardly explain the results quantitatively. Fig

  8. An Extended Membrane System with Active Membranes to Solve Automatic Fuzzy Clustering Problems.

    PubMed

    Peng, Hong; Wang, Jun; Shi, Peng; Pérez-Jiménez, Mario J; Riscos-Núñez, Agustín

    2016-05-01

    This paper focuses on automatic fuzzy clustering problem and proposes a novel automatic fuzzy clustering method that employs an extended membrane system with active membranes that has been designed as its computing framework. The extended membrane system has a dynamic membrane structure; since membranes can evolve, it is particularly suitable for processing the automatic fuzzy clustering problem. A modification of a differential evolution (DE) mechanism was developed as evolution rules for objects according to membrane structure and object communication mechanisms. Under the control of both the object's evolution-communication mechanism and the membrane evolution mechanism, the extended membrane system can effectively determine the most appropriate number of clusters as well as the corresponding optimal cluster centers. The proposed method was evaluated over 13 benchmark problems and was compared with four state-of-the-art automatic clustering methods, two recently developed clustering methods and six classification techniques. The comparison results demonstrate the superiority of the proposed method in terms of effectiveness and robustness. PMID:26790484

  9. Clustering-Based Ensemble Learning for Activity Recognition in Smart Homes

    PubMed Central

    Jurek, Anna; Nugent, Chris; Bi, Yaxin; Wu, Shengli

    2014-01-01

    Application of sensor-based technology within activity monitoring systems is becoming a popular technique within the smart environment paradigm. Nevertheless, the use of such an approach generates complex constructs of data, which subsequently requires the use of intricate activity recognition techniques to automatically infer the underlying activity. This paper explores a cluster-based ensemble method as a new solution for the purposes of activity recognition within smart environments. With this approach activities are modelled as collections of clusters built on different subsets of features. A classification process is performed by assigning a new instance to its closest cluster from each collection. Two different sensor data representations have been investigated, namely numeric and binary. Following the evaluation of the proposed methodology it has been demonstrated that the cluster-based ensemble method can be successfully applied as a viable option for activity recognition. Results following exposure to data collected from a range of activities indicated that the ensemble method had the ability to perform with accuracies of 94.2% and 97.5% for numeric and binary data, respectively. These results outperformed a range of single classifiers considered as benchmarks. PMID:25014095

  10. Clustering-based ensemble learning for activity recognition in smart homes.

    PubMed

    Jurek, Anna; Nugent, Chris; Bi, Yaxin; Wu, Shengli

    2014-01-01

    Application of sensor-based technology within activity monitoring systems is becoming a popular technique within the smart environment paradigm. Nevertheless, the use of such an approach generates complex constructs of data, which subsequently requires the use of intricate activity recognition techniques to automatically infer the underlying activity. This paper explores a cluster-based ensemble method as a new solution for the purposes of activity recognition within smart environments. With this approach activities are modelled as collections of clusters built on different subsets of features. A classification process is performed by assigning a new instance to its closest cluster from each collection. Two different sensor data representations have been investigated, namely numeric and binary. Following the evaluation of the proposed methodology it has been demonstrated that the cluster-based ensemble method can be successfully applied as a viable option for activity recognition. Results following exposure to data collected from a range of activities indicated that the ensemble method had the ability to perform with accuracies of 94.2% and 97.5% for numeric and binary data, respectively. These results outperformed a range of single classifiers considered as benchmarks. PMID:25014095

  11. Influence of support hydroxides on the catalytic activity of oxidized gold clusters

    SciTech Connect

    Veith, Gabriel M; Lupini, Andrew R; Pennycook, Stephen J; Dudney, Nancy J

    2010-01-01

    Gold oxide nanoparticles were prepared on the native surface and a hydroxylated surface of a non-porous TiO2 support (Degussa P25). Scanning transmission electron microscopy results show the formation of similarly sized clusters on both support materials (1.86 and 1.61 nm clusters on the native oxide and the hydroxylated oxide respectively). X-ray absorption near edge spectroscopy and X-ray photoelectron spectroscopy clearly indicate the formation of Au3+ rich oxide nanoparticles. Despite the similar cluster sizes and oxidation states the gold oxide clusters grown on the hydroxylated surface were at least 180 times more catalytically active for the oxidation of carbon monoxide then those grown on the native oxide surface. These hydroxides are conveniently introduced during the solution phase synthesis of gold catalysts and play a dominate, but previously unrecognized, role in the catalytic properties of both oxidized and metallic gold particles.

  12. Human Frataxin Activates Fe–S Cluster Biosynthesis by Facilitating Sulfur Transfer Chemistry

    PubMed Central

    2015-01-01

    Iron–sulfur clusters are ubiquitous protein cofactors with critical cellular functions. The mitochondrial Fe–S assembly complex, which consists of the cysteine desulfurase NFS1 and its accessory protein (ISD11), the Fe–S assembly protein (ISCU2), and frataxin (FXN), converts substrates l-cysteine, ferrous iron, and electrons into Fe–S clusters. The physiological function of FXN has received a tremendous amount of attention since the discovery that its loss is directly linked to the neurodegenerative disease Friedreich’s ataxia. Previous in vitro results revealed a role for human FXN in activating the cysteine desulfurase and Fe–S cluster biosynthesis activities of the Fe–S assembly complex. Here we present radiolabeling experiments that indicate FXN accelerates the accumulation of sulfur on ISCU2 and that the resulting persulfide species is viable in the subsequent synthesis of Fe–S clusters. Additional mutagenesis, enzyme kinetic, UV–visible, and circular dichroism spectroscopic studies suggest conserved ISCU2 residue C104 is critical for FXN activation, whereas C35, C61, and C104 are all essential for Fe–S cluster formation on the assembly complex. These results cannot be fully explained by the hypothesis that FXN functions as an iron donor for Fe–S cluster biosynthesis, and further support an allosteric regulator role for FXN. Together, these results lead to an activation model in which FXN accelerates persulfide formation on NFS1 and favors a helix-to-coil interconversion on ISCU2 that facilitates the transfer of sulfur from NFS1 to ISCU2 as an initial step in Fe–S cluster biosynthesis. PMID:24971490

  13. A Redox Active [2Fe-2S] Cluster on the Hydrogenase Maturase HydF.

    PubMed

    Shepard, Eric M; Byer, Amanda S; Betz, Jeremiah N; Peters, John W; Broderick, Joan B

    2016-06-28

    [FeFe]-hydrogenases are nature's most prolific hydrogen catalysts, excelling at facilely interconverting H2 and protons. The catalytic core common to all [FeFe]-hydrogenases is a complex metallocofactor, referred to as the H-cluster, which is composed of a standard [4Fe-4S] cluster linked through a bridging thiolate to a 2Fe subcluster harboring dithiomethylamine, carbon monoxide, and cyanide ligands. This 2Fe subcluster is synthesized and inserted into [FeFe]-hydrogenase by three maturase enzymes denoted HydE, HydF, and HydG. HydE and HydG are radical S-adenosylmethionine enzymes and synthesize the nonprotein ligands of the H-cluster. HydF is a GTPase that functions as a scaffold or carrier for 2Fe subcluster production. Herein, we utilize UV-visible, circular dichroism, and electron paramagnetic resonance spectroscopic studies to establish the existence of redox active [4Fe-4S] and [2Fe-2S] clusters bound to HydF. We have used spectroelectrochemical titrations to assign iron-sulfur cluster midpoint potentials, have shown that HydF purifies with a reduced [2Fe-2S] cluster in the absence of exogenous reducing agents, and have tracked iron-sulfur cluster spectroscopic changes with quaternary structural perturbations. Our results provide an important foundation for understanding the maturation process by defining the iron-sulfur cluster content of HydF prior to its interaction with HydE and HydG. We speculate that the [2Fe-2S] cluster of HydF either acts as a placeholder for HydG-derived Fe(CO)2CN species or serves as a scaffold for 2Fe subcluster assembly. PMID:27232385

  14. Clustering of diet- and activity-related parenting practices: cross-sectional findings of the INPACT study

    PubMed Central

    2013-01-01

    Background Various diet- and activity-related parenting practices are positive determinants of child dietary and activity behaviour, including home availability, parental modelling and parental policies. There is evidence that parenting practices cluster within the dietary domain and within the activity domain. This study explores whether diet- and activity-related parenting practices cluster across the dietary and activity domain. Also examined is whether the clusters are related to child and parental background characteristics. Finally, to indicate the relevance of the clusters in influencing child dietary and activity behaviour, we examined whether clusters of parenting practices are related to these behaviours. Methods Data were used from 1480 parent–child dyads participating in the Dutch IVO Nutrition and Physical Activity Child cohorT (INPACT). Parents of children aged 8–11 years completed questionnaires at home assessing their diet- and activity-related parenting practices, child and parental background characteristics, and child dietary and activity behaviours. Principal component analysis (PCA) was used to identify clusters of parenting practices. Backward regression analysis was used to examine the relationship between child and parental background characteristics with cluster scores, and partial correlations to examine associations between cluster scores and child dietary and activity behaviours. Results PCA revealed five clusters of parenting practices: 1) high visibility and accessibility of screens and unhealthy food, 2) diet- and activity-related rules, 3) low availability of unhealthy food, 4) diet- and activity-related positive modelling, and 5) positive modelling on sports and fruit. Low parental education was associated with unhealthy cluster 1, while high(er) education was associated with healthy clusters 2, 3 and 5. Separate clusters were related to both child dietary and activity behaviour in the hypothesized directions: healthy clusters

  15. Activity in galactic nuclei of cluster and field galaxies in the local universe

    NASA Astrophysics Data System (ADS)

    Hwang, H. S.; Park, C.; Elbaz, D.; Choi, Y.-Y.

    2012-02-01

    Aims: We study the environmental effects on the activity in galactic nuclei by comparing galaxies in clusters and in the field. Methods: Using a spectroscopic sample of galaxies in Abell clusters from the Sloan Digital Sky Survey Data Release 7, we investigate the dependence of nuclear activity on the physical parameters of clusters as well as the nearest neighbor galaxy. We also compare galaxy properties between active galactic nuclei (AGNs) hosts and non-AGN galaxies. Results: We find that the AGN fraction of early-type galaxies starts to decrease around one virial radius of clusters (r200,cl) as decreasing clustercentric radius, while that of late types starts to decrease close to the cluster center (R ~ 0.1-0.5r200,cl). The AGN fractions of early-type cluster galaxies, on average, are found to be lower than those of early-type field galaxies by a factor ~3. However, the mean AGN fractions of late-type cluster galaxies are similar to those of late-type field galaxies. The AGN fraction of early-type brightest cluster galaxies lies between those of other early-type, cluster and field galaxies with similar luminosities. In the field, the AGN fraction is strongly dependent on the morphology of and the distance to the nearest neighbor galaxy. We find an anti-correlation between the AGN fraction and the velocity dispersion of clusters for all subsamples divided by morphology and luminosity of host galaxies. The AGN power indicated by L [OIII] /MBH is found to depend strongly on the mass of host galaxies rather than the clustercentric radius. The difference in physical parameters such as luminosity, (u - r) colors, star formation rates, and (g - i) color gradients between AGN hosts and non-AGN galaxies is seen for both early and late types at all clustercentric radii, while the difference in structure parameters between the two is significant only for late types. Conclusions: These results support the idea that the activity in galactic nuclei is triggered through

  16. Optical activity of a single MnAs cluster: Birefringence or Kerr effect

    NASA Astrophysics Data System (ADS)

    Leuschner, M.; Klar, P. J.; Heimbrodt, W.; Rühle, W. W.; Hara, S.; Stolz, W.; Volz, K.; Kurz, T.; Loidl, A.; Krug von Nidda, H.-A.

    2006-06-01

    We have grown In 0.54Ga 0.46As:Mn/MnAs granular paramagnetic-ferromagnetic hybrid structures by metal-organic vapor-phase epitaxy. The MnAs clusters have a Curie temperature of about 320 K. We have studied the optical activity of individual ferromagnetic MnAs clusters embedded in the paramagnetic In 0.54Ga 0.46As:Mn matrix at room temperature by far-field depolarization measurements. A scanning near-field optical microscopy set-up in constant height mode ( ≈100 nm above the sample surface) was used to achieve a high spatial resolution. Individual MnAs clusters rotate the linear polarization of the incoming light by almost 2∘ in this reflection geometry. This optical activity was analyzed in terms of birefringence and polar Kerr effect and correlated with the structural and magnetic properties of the MnAs clusters as determined by ferromagnetic resonance measurements. The optical activity of the MnAs clusters turns out to be dominated by linear birefringence caused by the uniaxial symmetry of the hexagonal crystal structure of MnAs. The polar Kerr effect plays a minor role in this experiment.

  17. The role of basic amino acid surface clusters on the collagenase activity of cathepsin K

    PubMed Central

    Nallaseth, Ferez S.; Lecaille, Fabien; Li, Zhenqiang; Brömme, Dieter

    2013-01-01

    Cathepsin K is a highly potent collagenase in osteoclasts and responsible for bone degradation. We have previously demonstrated that its unique collagenolytic activity is modulated by glycosaminoglycans that form high molecular complexes with the protease. However, mutational analysis of a specific glycosaminoglycan-cathepsin K binding site only led to a 60% reduction of the collagenolytic activity suggesting additional glycosaminoglycan binding sites or other determinants controlling this activity. We identified 8 cathepsin K specific arginine/lysine residues that form three positively charged clusters at the bottom part of the protease opposing the active site. These residues are highly conserved among mammalian, avian, and reptilian cathepsin K orthologues and to a lesser degree in amphibian and fish specimens. Mutational analysis of these residues revealed an approximately 50% reduction of the collagenolytic activity when the basic amino acids in cluster 2 (K106, K108, R108, R111) were mutated into alanine residues and resulted in a 100% loss of this activity when the mutations were expanded into cluster 3 (K122, R127). Cluster 1 mutations (K77, R79) had no effect. A partial rescue effect was observed when the hexa-mutant variant was combined with three mutations in the previously identified glycosaminoglycan binding site (N190, K101, L195K) indicating the relevance of at least two independent interaction sites. Amino acid substitutions in all sites had no effect on the catalytic efficacy of the protease variants as reflected in their unaltered peptidolytic and gelatinolytic activities and their overall protein stabilities. This study suggests that the basic amino acid clusters in cathepsin K are either involved in alternative glycoasaminoglycan binding sites, play other roles in the formation of collagenolytically active protease complexes or contribute in a yet unknown manner to the specific binding to collagen. PMID:24088021

  18. Preparation of Aun quantum clusters with catalytic activity in β-cyclodextrin polyurethane nanosponges.

    PubMed

    Vasconcelos, Diego Andrade; Kubota, Tatiana; Santos, Douglas C; Araujo, Marcia V G; Teixeira, Zaine; Gimenez, Iara F

    2016-01-20

    Here we report the use of β-cyclodextrin polyurethane nanosponges cross-linked with 1,6-hexamethylene diisocyanate as a template for the preparation of Aun quantum clusters, by the core-etching of glutathione-capped Au nanoparticles. The study of temporal evolution of the core-etching process using different Au concentrations indicated that formation of Aun clusters embedded in the nanosponge is favored by the use of lower Au concentrations, since it began at shorter times and lead to higher cluster loading. An estimation of the number of Au atoms based on the maximum photoluminescence wavelength suggested that, depending on the Au concentration and the core etching time, clusters with 11-15 atoms were formed. After excluding the possibility of an inclusion complex formation, evaluation of the catalytic activity of nanosponge-loaded Aun clusters toward the reduction of 4-nitrophenol has shown that the reaction is catalyzed by the Aun clusters with no induction time, following the Langmuir-Hinshelwood kinetic model. PMID:26572328

  19. Activation and adsorption of CO{sub 2} on copper surfaces and clusters

    SciTech Connect

    Gautam, Seema; Dharmvir, Keya; Goel, Neetu

    2014-04-24

    The activation and adsorption of CO{sub 2} over Cu{sub n} clusters have been investigated by first principle calculations. Results of these calculations are compared with the previous studies of adsorption of CO{sub 2} on Cu (hkl) surfaces [Wang et al. Surface Science 570 (2004) 205–217]. We find that CO{sub 2} is preferentially adsorbed over the clusters in comparison with Cu (hkl) surfaces. The Cu13 cluster in particular dissociates the CO{sub 2} molecule adsorbed on the one of the caps of the icosahedron into CO and atomic oxygen. This activated configuration can act as a precursor to reactions leading to hydrocarbon fuels from CO{sub 2}.

  20. a Three-Step Spatial-Temporal Clustering Method for Human Activity Pattern Analysis

    NASA Astrophysics Data System (ADS)

    Huang, W.; Li, S.; Xu, S.

    2016-06-01

    How people move in cities and what they do in various locations at different times form human activity patterns. Human activity pattern plays a key role in in urban planning, traffic forecasting, public health and safety, emergency response, friend recommendation, and so on. Therefore, scholars from different fields, such as social science, geography, transportation, physics and computer science, have made great efforts in modelling and analysing human activity patterns or human mobility patterns. One of the essential tasks in such studies is to find the locations or places where individuals stay to perform some kind of activities before further activity pattern analysis. In the era of Big Data, the emerging of social media along with wearable devices enables human activity data to be collected more easily and efficiently. Furthermore, the dimension of the accessible human activity data has been extended from two to three (space or space-time) to four dimensions (space, time and semantics). More specifically, not only a location and time that people stay and spend are collected, but also what people "say" for in a location at a time can be obtained. The characteristics of these datasets shed new light on the analysis of human mobility, where some of new methodologies should be accordingly developed to handle them. Traditional methods such as neural networks, statistics and clustering have been applied to study human activity patterns using geosocial media data. Among them, clustering methods have been widely used to analyse spatiotemporal patterns. However, to our best knowledge, few of clustering algorithms are specifically developed for handling the datasets that contain spatial, temporal and semantic aspects all together. In this work, we propose a three-step human activity clustering method based on space, time and semantics to fill this gap. One-year Twitter data, posted in Toronto, Canada, is used to test the clustering-based method. The results show that the

  1. LUMINOUS X-RAY ACTIVE GALACTIC NUCLEI IN CLUSTERS OF GALAXIES

    SciTech Connect

    Koulouridis, E.; Plionis, M.

    2010-05-10

    We present a study of X-ray active galactic nucleus (AGN) overdensities in 16 Abell clusters, within the redshift range 0.073 < z < 0.279, in order to investigate the effect of the hot inter-cluster environment on the triggering of the AGN phenomenon. The X-ray AGN overdensities, with respect to the field expectations, were estimated for sources with L{sub x} {>=} 10{sup 42} erg s{sup -1} (at the redshift of the clusters) and within an area of 1 h {sup -1} {sub 72} Mpc radius (excluding the core). To investigate the presence or absence of a true enhancement of luminous X-ray AGNs in the cluster area, we also derived the corresponding optical galaxy overdensities, using a suitable range of r-band magnitudes. We always find the latter to be significantly higher (and only in two cases roughly equal) with respect to the corresponding X-ray overdensities. Over the whole cluster sample, the mean X-ray point-source overdensity is a factor of {approx}4 less than that corresponding to bright optical galaxies, a difference which is significant at a >0.995 level, as indicated by an appropriate student's t-test. We conclude that the triggering of luminous X-ray AGNs in rich clusters is strongly suppressed. Furthermore, searching for optical Sloan Digital Sky Survey counterparts of all the X-ray sources, associated with our clusters, we found that about half appear to be background QSOs, while others are background and foreground AGNs or stars. The true overdensity of X-ray point sources, associated with the clusters, is therefore even smaller than what our statistical approach revealed.

  2. User Activity Recognition in Smart Homes Using Pattern Clustering Applied to Temporal ANN Algorithm.

    PubMed

    Bourobou, Serge Thomas Mickala; Yoo, Younghwan

    2015-01-01

    This paper discusses the possibility of recognizing and predicting user activities in the IoT (Internet of Things) based smart environment. The activity recognition is usually done through two steps: activity pattern clustering and activity type decision. Although many related works have been suggested, they had some limited performance because they focused only on one part between the two steps. This paper tries to find the best combination of a pattern clustering method and an activity decision algorithm among various existing works. For the first step, in order to classify so varied and complex user activities, we use a relevant and efficient unsupervised learning method called the K-pattern clustering algorithm. In the second step, the training of smart environment for recognizing and predicting user activities inside his/her personal space is done by utilizing the artificial neural network based on the Allen's temporal relations. The experimental results show that our combined method provides the higher recognition accuracy for various activities, as compared with other data mining classification algorithms. Furthermore, it is more appropriate for a dynamic environment like an IoT based smart home. PMID:26007738

  3. User Activity Recognition in Smart Homes Using Pattern Clustering Applied to Temporal ANN Algorithm

    PubMed Central

    Bourobou, Serge Thomas Mickala; Yoo, Younghwan

    2015-01-01

    This paper discusses the possibility of recognizing and predicting user activities in the IoT (Internet of Things) based smart environment. The activity recognition is usually done through two steps: activity pattern clustering and activity type decision. Although many related works have been suggested, they had some limited performance because they focused only on one part between the two steps. This paper tries to find the best combination of a pattern clustering method and an activity decision algorithm among various existing works. For the first step, in order to classify so varied and complex user activities, we use a relevant and efficient unsupervised learning method called the K-pattern clustering algorithm. In the second step, the training of smart environment for recognizing and predicting user activities inside his/her personal space is done by utilizing the artificial neural network based on the Allen’s temporal relations. The experimental results show that our combined method provides the higher recognition accuracy for various activities, as compared with other data mining classification algorithms. Furthermore, it is more appropriate for a dynamic environment like an IoT based smart home. PMID:26007738

  4. Hemoglobin–Albumin Cluster Incorporating a Pt Nanoparticle: Artificial O2 Carrier with Antioxidant Activities

    PubMed Central

    Hosaka, Hitomi; Haruki, Risa; Yamada, Kana; Böttcher, Christoph; Komatsu, Teruyuki

    2014-01-01

    A covalent core–shell structured protein cluster composed of hemoglobin (Hb) at the center and human serum albumins (HSA) at the periphery, Hb-HSAm, is an artificial O2 carrier that can function as a red blood cell substitute. Here we described the preparation of a novel Hb-HSA3 cluster with antioxidant activities and its O2 complex stable in aqueous H2O2 solution. We used an approach of incorporating a Pt nanoparticle (PtNP) into the exterior HSA unit of the cluster. A citrate reduced PtNP (1.8 nm diameter) was bound tightly within the cleft of free HSA with a binding constant (K) of 1.1×107 M−1, generating a stable HSA-PtNP complex. This platinated protein showed high catalytic activities for dismutations of superoxide radical anions (O2•–) and hydrogen peroxide (H2O2), i.e., superoxide dismutase and catalase activities. Also, Hb-HSA3 captured PtNP into the external albumin unit (K = 1.1×107 M−1), yielding an Hb-HSA3(PtNP) cluster. The association of PtNP caused no alteration of the protein surface net charge and O2 binding affinity. The peripheral HSA-PtNP shell prevents oxidation of the core Hb, which enables the formation of an extremely stable O2 complex, even in H2O2 solution. PMID:25310133

  5. RADIO-LOUD ACTIVE GALACTIC NUCLEUS: IS THERE A LINK BETWEEN LUMINOSITY AND CLUSTER ENVIRONMENT?

    SciTech Connect

    Ineson, J.; Croston, J. H.; Hardcastle, M. J.; Jarvis, M.; Kraft, R. P.; Evans, D. A.

    2013-06-20

    We present here the first results from the Chandra ERA (Environments of Radio-loud AGN) Large Project, characterizing the cluster environments of a sample of 26 radio-loud active galactic nuclei (AGNs) at z {approx} 0.5 that covers three decades of radio luminosity. This is the first systematic X-ray environmental study at a single epoch, and has allowed us to examine the relationship between radio luminosity and cluster environment without the problems of Malmquist bias. We have found a weak correlation between radio luminosity and host cluster X-ray luminosity, as well as tentative evidence that this correlation is driven by the subpopulation of low-excitation radio galaxies, with high-excitation radio galaxies showing no significant correlation. The considerable scatter in the environments may be indicative of complex relationships not currently included in feedback models.

  6. Anaerobic central metabolic pathways active during polyhydroxyalkanoate production in uncultured cluster 1 Defluviicoccus enriched in activated sludge communities.

    PubMed

    Burow, Luke C; Mabbett, Amanda N; Borrás, Luis; Blackall, Linda L

    2009-09-01

    A glycogen nonpolyphosphate-accumulating organism (GAO) enrichment culture dominated by the Alphaproteobacteria cluster 1 Defluviicoccus was investigated to determine the metabolic pathways involved in the anaerobic formation of polyhydroxyalkanoates, carbon storage polymers important for the proliferation of microorganisms in enhanced biological phosphorus removal processes. FISH-microautoradiography and post-FISH fluorescent chemical staining confirmed acetate assimilation as polyhydroxyalkanoates in cluster 1 Defluviicoccus under anaerobic conditions. Chemical inhibition of glycolysis using iodoacetate, and of isocitrate lyase by 3-nitropropionate and itaconate, indicated that carbon is likely to be channelled through both glycolysis and the glyoxylate cycle in cluster 1 Defluviicoccus. The effect of metabolic inhibitors of aconitase (monofluoroacetate) and succinate dehydrogenase (malonate) suggested that aconitase, but not succinate dehydrogenase, was active, providing further support for the role of the glyoxylate cycle in these GAOs. Metabolic inhibition of fumarate reductase using oxantel decreased polyhydroxyalkanoate production. This indicated reduction of fumarate to succinate and the operation of the reductive branch of the tricarboxylic acid cycle, which is possibly important in the production of the polyhydroxyvalerate component of polyhydroxyalkanoates observed in cluster 1 Defluviicoccus enrichment cultures. These findings were integrated with previous metabolic models for GAOs and enabled an anaerobic central metabolic pathway model for polyhydroxyalkanoate formation in cluster 1 Defluviicoccus to be proposed. PMID:19622073

  7. The RACE-OC project: Rotation and Activity Evolution in Open Clusters

    NASA Astrophysics Data System (ADS)

    Messina, S.; Distefano, E.; Parihar, Padmakar; Busà, I.; Cutispoto, G.; Lanza, A. F.; Lanzafame, A.; Pagano, I.; Biazzo, K.; Leto, G.; Hatzidimitriou, D.; Kim, S.-L.; Koo, J.-R.; Kang, Y. B.

    2009-02-01

    The RACE-OC project, standing for Rotation and Activity Evolution in Open Clusters, is a long-term project aimed at studying the evolution of rotation and magnetic activity of late-type members of stellar open clusters. Magnetic fields play a fundamental role in altering the rotational properties of late-type stars. They are responsible, e.g., for angular momentum loss in the wind or its redistribution in the stellar interior. Magnetic fields in late-type stars and their related phenomena, such as photospheric cool spots and bright faculae, chromospheric plages, and X-ray emission, in turn depend on the stellar rotation which controls the efficiency of the hydromagnetic dynamo. Thus, the evolution of angular momentum and magnetic activity offer complementary approaches to understanding the mechanisms by which rotation and magnetic fields influence each other in late-type stars.

  8. Is the cluster environment quenching the Seyfert activity in elliptical and spiral galaxies?

    NASA Astrophysics Data System (ADS)

    de Souza, R. S.; Dantas, M. L. L.; Krone-Martins, A.; Cameron, E.; Coelho, P.; Hattab, M. W.; de Val-Borro, M.; Hilbe, J. M.; Elliott, J.; Hagen, A.; COIN Collaboration

    2016-09-01

    We developed a hierarchical Bayesian model (HBM) to investigate how the presence of Seyfert activity relates to their environment, herein represented by the galaxy cluster mass, M200, and the normalized cluster centric distance, r/r200. We achieved this by constructing an unbiased sample of galaxies from the Sloan Digital Sky Survey, with morphological classifications provided by the Galaxy Zoo Project. A propensity score matching approach is introduced to control the effects of confounding variables: stellar mass, galaxy colour, and star formation rate. The connection between Seyfert-activity and environmental properties in the de-biased sample is modelled within an HBM framework using the so-called logistic regression technique, suitable for the analysis of binary data (e.g. whether or not a galaxy hosts an AGN). Unlike standard ordinary least square fitting methods, our methodology naturally allows modelling the probability of Seyfert-AGN activity in galaxies on their natural scale, i.e. as a binary variable. Furthermore, we demonstrate how an HBM can incorporate information of each particular galaxy morphological type in an unified framework. In elliptical galaxies our analysis indicates a strong correlation of Seyfert-AGN activity with r/r200, and a weaker correlation with the mass of the host cluster. In spiral galaxies these trends do not appear, suggesting that the link between Seyfert activity and the properties of spiral galaxies are independent of the environment.

  9. Lymphokine-activated killer (LAK) cell phenomenon in cluster headache. "In vitro" activation by recombinant interleukin-2.

    PubMed

    Giacovazzo, M; Stirparo, G; DeStefano, L; Martelletti, P; Rinaldi-Garaci, C

    1989-03-01

    Previous studies showed that the Natural Killer (NK) activity of peripheral blood lymphocytes (PBL) from cluster headache (CH) patients is lower than that of controls. This decreased activity seems to be independent of the cluster period. beta-interferon has been shown to be more effective in increasing NK activity when incubated with PBL from CH patients, than with PBL from control donors. Lymphokine-Activated Killer (LAK) cells can be generated by incubation of human PBL in recombinant Interleukin-2 (rIL-2). This phenomenon was studied in 10 CH patients and 8 healthy volunteers. PBL were activated to LAK cells by "in vitro" incubation for 72 hours in Control Medium containing rIL-2 (1000 I.U./ml). A four hour Chromium 51 release was used to measure LAK Cell Killing of K562 target cells. The released radioactivity was measured in a gamma scintillation counter. The CH patients showed a marked increase of LAK generation compared to control subjects. This effect seems to be augmented during the cluster period. PMID:2785095

  10. Membership and Coronal Activity in the NGC 2232 and Cr 140 Open Clusters

    NASA Technical Reports Server (NTRS)

    Patten, Brian M.; Oliversen, Ronald J. (Technical Monitor)

    2001-01-01

    This is the second annual performance report for our grant "Membership and Coronal Activity in the NGC 2232 and Cr 140 Open Clusters." We propose to identify X-ray sources and extract net source counts in 8 archival ROSAT HRI images in the regions of the NGC 2232 and Cr 140 open clusters. These X-ray data will be combined with ground-based photometry and spectroscopy in order to identify G, K, and early-M type cluster members. At present, no members later than approximately F5 are currently known for either cluster. With ages of approximately 25 Myr and at a distance of just 320 - 360 pc, the combined late-type membership of the NGC 2232 and Cr 140 clusters will yield an almost unique sample of solar-type stars in the post-T Tauri/pre-main sequence phase of evolution. These stars will be used to assess the level and dispersion in coronal activity levels, as part of a probe of the importance of magnetic braking and the level of magnetic dynamo activity, for solar-type stars just before they reach the ZAMS. Over the past year we have successfully acquired all of the ground-based data necessary to support the analysis of the archival ROSAT X-ray data in the regions around both of these clusters. By the end of 2001 we expect to have completed the reduction and analysis of the ground-based photometry and spectroscopy and will begin the integration of these data with the ROSAT X-ray data. A certain amount of pressure to complete the work on NGC 2232 is coming from the SIRTF project, as this cluster may be a key component to a circumstellar disk evolution GTO program. We are only too happy to try to help and have worked to speed the analysis as much as possible. The primary activity to be undertaken in the next few months is the integration of the groundbased photometry and spectroscopy with the archival ROSAT X-ray data and then writing the paper summarizing our results. The most time consuming portion of this next phase is, of course, seeing the paper through

  11. Membership and Coronal Activity in the NGC 2232 and Cr 140 Open Clusters

    NASA Technical Reports Server (NTRS)

    Oliversen, Ronald J. (Technical Monitor); Patten, Brian M.

    2004-01-01

    Making use of eight archival ROSAT HRI images in the regions of the NGC 2232 and Cr 140, this project's primary focus is to identify X-ray sources and to extract net source counts for these sources in these two open clusters. These X-ray data would be combined with ground-based photometry and spectroscopy in order to identify G, K, and early-M type cluster members. Such membership data are important because, at present, no members later than spectral type approx. F5 are currently known for either cluster. With ages estimated to be approx. 25 Myr and at distances of just approx. 350 pc, the combined late-type membership of the NGC 2232 and Cr 140 clusters would yield an almost unique sample of solar-type stars in the post-T Tauri/pre-main sequence phase of evolution. These stars could be used to assess the level and dispersion of coronal activity levels, as a part of a probe of the importance of magnetic braking and the level of magnetic dynamo activity, for solar-type stars just before they reach the zero-age main sequence.

  12. Role of hydroxyl groups on the stability and catalytic activity of Au clusters on rutile surface

    SciTech Connect

    Kent, Paul R

    2011-01-01

    Hydroxyls are present as surface terminations of transition metal oxides under ambient conditions and may modify the properties of supported catalysts. We perform first-principles density functional theory calculations to investigate the role of hydroxyls on the catalytic activity of supported gold clusters on TiO{sub 2} (rutile). We find that they have a long-range effect increasing the adhesion of gold clusters on rutile. While hydroxyls make one gold atom more electronegative, a more complex charge-transfer scenario is observed on larger clusters which are important for catalytic applications. This enhances the molecular adsorption and coadsorption energies of CO and O{sub 2}, thereby increasing the catalytic activity of gold clusters for CO oxidation, consistent with reported experiments. Hydroxyls at the interface between gold and rutile surface are most important to this process, even when not directly bound to gold. As such, accurate models of catalytic processes on gold and other catalysts should include the effect of surface hydroxyls.

  13. Constraining AGN triggering mechanisms through the clustering analysis of active black holes

    NASA Astrophysics Data System (ADS)

    Gatti, M.; Shankar, F.; Bouillot, V.; Menci, N.; Lamastra, A.; Hirschmann, M.; Fiore, F.

    2016-02-01

    The triggering mechanisms for active galactic nuclei (AGN) are still debated. Some of the most popular ones include galaxy interactions (IT) and disc instabilities (DIs). Using an advanced semi-analytic model (SAM) of galaxy formation, coupled to accurate halo occupation distribution modelling, we investigate the imprint left by each separate triggering process on the clustering strength of AGN at small and large scales. Our main results are as follows: (i) DIs, irrespective of their exact implementation in the SAM, tend to fall short in triggering AGN activity in galaxies at the centre of haloes with Mh > 1013.5 h-1 M⊙. On the contrary, the IT scenario predicts abundance of active central galaxies that generally agrees well with observations at every halo mass. (ii) The relative number of satellite AGN in DIs at intermediate-to-low luminosities is always significantly higher than in IT models, especially in groups and clusters. The low AGN satellite fraction predicted for the IT scenario might suggest that different feeding modes could simultaneously contribute to the triggering of satellite AGN. (iii) Both scenarios are quite degenerate in matching large-scale clustering measurements, suggesting that the sole average bias might not be an effective observational constraint. (iv) Our analysis suggests the presence of both a mild luminosity and a more consistent redshift dependence in the AGN clustering, with AGN inhabiting progressively less massive dark matter haloes as the redshift increases. We also discuss the impact of different observational selection cuts in measuring AGN clustering, including possible discrepancies between optical and X-ray surveys.

  14. Using Light-at-Night (LAN) Satellite Data for Identifying Clusters of Economic Activities in Europe

    NASA Astrophysics Data System (ADS)

    Rybnikova, N. A.; Portnov, B. A.

    2015-04-01

    Enterprises organized in clusters are often efficient in stimulating urban development, productivity and profit outflows. Identifying clusters of economic activities (EAs) thus becomes an important step in devising regional development policies, aimed at facilitating regional economic development. However, a major problem with cluster identification stems from limited reporting of specific EAs by individual countries and administrative entities. Even Eurostat, which maintains most advances regional databases, provides data for less than 50% of all regional subdivisions of the 3rd tier of the Nomenclature of Territorial Units for Statistics (NUTS3). Such poor reporting impedes identification of EA clusters and economic forces behind them. In this study, we test a possibility that missing data on geographic concentrations of EAs can be reconstructed using Light-at-Night (LAN) satellite measurements, and that such reconstructed data can then be used for the identification of EA clusters. As we hypothesize, LAN, captured by satellite sensors, is characterized by different intensity, depending on its source - production facilities, services, etc., - and this information can be used for EA identification. The study was carried out in three stages. First, using nighttime satellite images, we determined what types of EAs can be identified, with a sufficient degree of accuracy, by LAN they emit. Second, we calculated multivariate statistical models, linking EAs concentrations with LAN intensities and several locational and development attributes of NUTS3 regions in Europe. Next, using the obtained statistical models, we restored missing data on EAs across NUTS3 regions in Europe and identified clusters of EAs, using spatial analysis tools.

  15. Activity-induced clustering in model dumbbell swimmers: the role of hydrodynamic interactions.

    PubMed

    Furukawa, Akira; Marenduzzo, Davide; Cates, Michael E

    2014-08-01

    Using a fluid-particle dynamics approach, we numerically study the effects of hydrodynamic interactions on the collective dynamics of active suspensions within a simple model for bacterial motility: each microorganism is modeled as a stroke-averaged dumbbell swimmer with prescribed dipolar force pairs. Using both simulations and qualitative arguments, we show that, when the separation between swimmers is comparable to their size, the swimmers' motions are strongly affected by activity-induced hydrodynamic forces. To further understand these effects, we investigate semidilute suspensions of swimmers in the presence of thermal fluctuations. A direct comparison between simulations with and without hydrodynamic interactions shows these to enhance the dynamic clustering at a relatively small volume fraction; with our chosen model the key ingredient for this clustering behavior is hydrodynamic trapping of one swimmer by another, induced by the active forces. Furthermore, the density dependence of the motility (of both the translational and rotational motions) exhibits distinctly different behaviors with and without hydrodynamic interactions; we argue that this is linked to the clustering tendency. Our study illustrates the fact that hydrodynamic interactions not only affect kinetic pathways in active suspensions, but also cause major changes in their steady state properties. PMID:25215734

  16. Regional and global variations in the temporal clustering of tectonic tremor activity

    NASA Astrophysics Data System (ADS)

    Idehara, Koki; Yabe, Suguru; Ide, Satoshi

    2014-12-01

    The temporal distribution of tremor activity exhibits a highly non-Poissonian behavior, and its maximum period of non-Poissonian clustering statistically describes the recurrence interval of major tremor bursts. Here, we examine variations in the temporal clustering properties of tremor activity by assessing their characteristic times, which are determined by the maximum period of the non-Poissonian distribution. By applying a two-point correlation integral to some of the world's major tremor zones, including Shikoku, Kii-Tokai, and Kyushu in Japan; Cascadia, Jalisco, and Guerrero in Mexico; southern Chile; Taiwan; and Manawatu in New Zealand, we reveal local spatial variations in the temporal clustering properties in each tremor zone and show global-scale variations in tremor activity. The spatial variation in local tremor activity is characterized by a gradual transition in the along-dip direction and shorter-wavelength heterogeneities in the along-strike direction, possibly associated with a spatial change in frictional conditions at the plate interface and rheological conditions in the surrounding materials. The characteristic time correlates positively with locally measured median tremor duration, implying an inherent correlation between the moment release rate and the recurrence interval of tremors.

  17. Using hierarchical clustering methods to classify motor activities of COPD patients from wearable sensor data

    PubMed Central

    Sherrill, Delsey M; Moy, Marilyn L; Reilly, John J; Bonato, Paolo

    2005-01-01

    Background Advances in miniature sensor technology have led to the development of wearable systems that allow one to monitor motor activities in the field. A variety of classifiers have been proposed in the past, but little has been done toward developing systematic approaches to assess the feasibility of discriminating the motor tasks of interest and to guide the choice of the classifier architecture. Methods A technique is introduced to address this problem according to a hierarchical framework and its use is demonstrated for the application of detecting motor activities in patients with chronic obstructive pulmonary disease (COPD) undergoing pulmonary rehabilitation. Accelerometers were used to collect data for 10 different classes of activity. Features were extracted to capture essential properties of the data set and reduce the dimensionality of the problem at hand. Cluster measures were utilized to find natural groupings in the data set and then construct a hierarchy of the relationships between clusters to guide the process of merging clusters that are too similar to distinguish reliably. It provides a means to assess whether the benefits of merging for performance of a classifier outweigh the loss of resolution incurred through merging. Results Analysis of the COPD data set demonstrated that motor tasks related to ambulation can be reliably discriminated from tasks performed in a seated position with the legs in motion or stationary using two features derived from one accelerometer. Classifying motor tasks within the category of activities related to ambulation requires more advanced techniques. While in certain cases all the tasks could be accurately classified, in others merging clusters associated with different motor tasks was necessary. When merging clusters, it was found that the proposed method could lead to more than 12% improvement in classifier accuracy while retaining resolution of 4 tasks. Conclusion Hierarchical clustering methods are relevant

  18. RELATIONSHIP BETWEEN PARENTS' MOTIVATION FOR PHYSICAL ACTIVITY AND THEIR BELIEFS, AND SUPPORT OF THEIR CHILDREN'S PHYSICAL ACTIVITY: A CLUSTER ANALYSIS.

    PubMed

    Naisseh, Matilda; Martinent, Guillaume; Ferrand, Claude; Hautier, Christophe

    2015-08-01

    Previous studies have neglected the multivariate nature of motivation. The purpose of the current study was to first identify motivational profiles of parents' own physical activity. Second, the study examined if such profiles differ in the way in which parents perceive their children's competence in physical activity and the importance and support given to their children's physical activity. 711 physically active parents (57% mothers; M age = 39.7 yr.; children 6-11 years old) completed the Situational Motivation Scale, the Parents' Perceptions of Physical Activity Importance and their Children's Ability Questionnaire, and the Parental Support for Physical Activity Scale. Cluster analyses indicated four motivational profiles: Highly self-determined, Moderately self-determined, Non-self-determined, and Externally motivated profiles. Parents' beliefs and support toward their children's physical activity significantly differed across these profiles. It is the first study using Self-Determination Theory that provides evidence for the interpersonal outcomes of motivation. PMID:26302295

  19. A multiwavelength photometric census of AGN and star formation activity in the brightest cluster galaxies of X-ray selected clusters

    NASA Astrophysics Data System (ADS)

    Green, T. S.; Edge, A. C.; Stott, J. P.; Ebeling, H.; Burgett, W. S.; Chambers, K. C.; Draper, P. W.; Metcalfe, N.; Kaiser, N.; Wainscoat, R. J.; Waters, C.

    2016-09-01

    Despite their reputation as being `red and dead', the unique environment inhabited by brightest cluster galaxies (BCGs) can often lead to a self-regulated feedback cycle between radiatively cooling intracluster gas and star formation and active galactic nucleus (AGN) activity in the BCG. However the prevalence of `active' BCGs, and details of the feedback involved, are still uncertain. We have performed an optical, UV and mid-IR photometric analysis of the BCGs in 981 clusters at 0.03 < z < 0.5, selected from the ROSAT All Sky Survey. Using Pan-STARRS PS1 3π, GALEX and WISE survey data we look for BCGs with photometric colours which deviate from that of the bulk population of passive BCGs - indicative of AGN and/or star formation activity within the BCG. We find that whilst the majority of BCGs are consistent with being passive, at least 14 per cent of our BCGs show a significant colour offset from passivity in at least one colour index. And, where available, supplementary spectroscopy reveals the majority of these particular BCGs show strong optical emission lines. On comparing BCG `activity' with the X-ray luminosity of the host cluster, we find that BCGs showing a colour offset are preferentially found in the more X-ray luminous clusters, indicative of the connection between BCG `activity' and the intracluster medium.

  20. AGN Activity and IGM Heating in the Fossil Cluster RX J1416.4+2315

    NASA Astrophysics Data System (ADS)

    Miraghaei, H.; Khosroshahi, H. G.; Sengupta, C.; Raychaudhury, S.; Jetha, N. N.; Abbassi, S.

    2015-12-01

    We study active galactic nucleus (AGN) activity in the fossil galaxy cluster RX J1416.4+2315. Radio observations were carried out using the Giant Metrewave Radio Telescope at two frequencies, 1420 and 610 MHz. A weak radio lobe that extends from the central nucleus is detected in the 610 MHz map. Assuming the radio lobe originated from the central AGN, we show that the energy injection into the intergalactic medium is only sufficient to heat up the central 50 kpc within the cluster core, while the cooling radius is larger (∼130 kpc). In the hardness ratio map, three low energy cavities have been identified. No radio emission is detected for these regions. We evaluated the power required to inflate the cavities and showed that the total energy budget is sufficient to offset the radiative cooling. We showed that the initial conditions would change the results remarkably. Furthermore, the efficiency of the Bondi accretion in powering the AGN has been estimated.

  1. Supersaturation and activity-rotation relation in PMS stars: the young cluster h Persei

    NASA Astrophysics Data System (ADS)

    Argiroffi, C.; Caramazza, M.; Micela, G.; Sciortino, S.; Moraux, E.; Bouvier, J.; Flaccomio, E.

    2016-05-01

    Context. Several studies showed that the magnetic activity of late-type main-sequence (MS) stars is characterized by different regimes and that their activity levels are well described by the Rossby number, Ro, defined as the ratio between the rotational period Prot and the convective turnover time. Very young pre-main-sequence (PMS) stars show, similarly to MS stars, intense magnetic activity. However, they do not show clear activity-rotation trends, and it still debated which stellar parameters determine their magnetic activity levels. Aims: To bridge the gap between MS and PMS stars, we studied the activity-rotation relation in the young cluster h Persei, a ~13 Myr old cluster, that contains both fast and slow rotators. The cluster members have ended their accretion phase and have developed a radiative core. It therefore offers us the opportunity of studying the activity level of intermediate-age PMS stars with different rotational velocities, excluding any interactions with the circumstellar environment. Methods: We constrained the magnetic activity levels of h Per members by measuring their X-ray emission from a Chandra observation, while rotational periods were obtained previously in the framework of the MONITOR project. By cross-correlating these data, we collected a final catalog of 414 h Per members with known rotational period, effective temperature, and mass. In 169 of these, X-ray emission has also been detected. Results: We found that h Per members with 1.0 M⊙activity regimes: fast rotators clearly show supersaturation, while slower rotators have activity levels compatible to the non-saturated regime. At 13 Myr, h Per is therefore the youngest cluster showing activity-rotation regimes analogous to those of MS stars, indicating that at this age, magnetic field production is most likely regulated by the αΩ type dynamo. Moreover, we observed that supersaturation is better described by Prot than Ro, and that the

  2. Supersaturation and activity-rotation relation in PMS stars: the young cluster h Persei

    NASA Astrophysics Data System (ADS)

    Argiroffi, C.; Caramazza, M.; Micela, G.; Sciortino, S.; Moraux, E.; Bouvier, J.; Flaccomio, E.

    2016-04-01

    Context. Several studies showed that the magnetic activity of late-type main-sequence (MS) stars is characterized by different regimes and that their activity levels are well described by the Rossby number, Ro, defined as the ratio between the rotational period Prot and the convective turnover time. Very young pre-main-sequence (PMS) stars show, similarly to MS stars, intense magnetic activity. However, they do not show clear activity-rotation trends, and it still debated which stellar parameters determine their magnetic activity levels. Aims: To bridge the gap between MS and PMS stars, we studied the activity-rotation relation in the young cluster h Persei, a ~13 Myr old cluster, that contains both fast and slow rotators. The cluster members have ended their accretion phase and have developed a radiative core. It therefore offers us the opportunity of studying the activity level of intermediate-age PMS stars with different rotational velocities, excluding any interactions with the circumstellar environment. Methods: We constrained the magnetic activity levels of h Per members by measuring their X-ray emission from a Chandra observation, while rotational periods were obtained previously in the framework of the MONITOR project. By cross-correlating these data, we collected a final catalog of 414 h Per members with known rotational period, effective temperature, and mass. In 169 of these, X-ray emission has also been detected. Results: We found that h Per members with 1.0 M⊙activity regimes: fast rotators clearly show supersaturation, while slower rotators have activity levels compatible to the non-saturated regime. At 13 Myr, h Per is therefore the youngest cluster showing activity-rotation regimes analogous to those of MS stars, indicating that at this age, magnetic field production is most likely regulated by the αΩ type dynamo. Moreover, we observed that supersaturation is better described by Prot than Ro, and that the

  3. O(2)And N(2)O Activation By Bi-, Tri-, And Tetranuclear Cu Clusters in Biology

    SciTech Connect

    Solomon, E.I.; Sarangi, R.; Woertink, J.S.

    2009-06-04

    Copper-cluster sites in biology exhibit unique spectroscopic features reflecting exchange coupling between oxidized Cu's and e (-) delocalization in mixed valent sites. These novel electronic structures play critical roles in O 2 binding and activation for electrophilic aromatic attack and H-atom abstraction, the 4e (-)/4H (+) reduction of O 2 to H 2O, and in the 2e (-)/2H (+) reduction of N 2O. These electronic structure/reactivity correlations are summarized.

  4. O2 and N2O activation by Bi-, Tri-, and tetranuclear Cu clusters in biology.

    PubMed

    Solomon, Edward I; Sarangi, Ritimukta; Woertink, Julia S; Augustine, Anthony J; Yoon, Jungjoo; Ghosh, Somdatta

    2007-07-01

    Copper-cluster sites in biology exhibit unique spectroscopic features reflecting exchange coupling between oxidized Cu's and e (-) delocalization in mixed valent sites. These novel electronic structures play critical roles in O 2 binding and activation for electrophilic aromatic attack and H-atom abstraction, the 4e (-)/4H (+) reduction of O 2 to H 2O, and in the 2e (-)/2H (+) reduction of N 2O. These electronic structure/reactivity correlations are summarized below. PMID:17472331

  5. Determining Distance, Age, and Activity in a New Benchmark Cluster: Ruprecht 147

    NASA Astrophysics Data System (ADS)

    Wright, Jason T.

    2009-08-01

    This proposal seeks 0.7 night of time on Hectochelle to observe the F, G, and K dwarfs of Ruprecht 147, recently identified as the closest old stellar cluster. At only ~ 200 pc and at an age of ~ 1-2 Gyr, this will be an important benchmark in stellar astrophysics, providing the only sample of spectroscopically accessible old, late-type stars of determinable age. Hectochelle is the ideal instrument to study this cluster, with a FOV, fiber count, and telescope aperture well matched to the cluster's diameter (~ 1°), richness (~ 100 identified members), and distance modulus (6.5-7 mag., putting the G and K dwarfs at B=11-15). Hectochelle will measure the Ca II line strengths of members to establish, for the first time, the chromospheric activity levels of a statistically significant sample of single, G and K dwarfs of this modest age. Hectochelle will also vet background stars for suitability as astrometric reference stars for a forthcoming HST FGS proposal to robustly measure the cluster's distance.

  6. Role of lattice defects in catalytic activities of graphene clusters for fuel cells.

    PubMed

    Zhang, Lipeng; Xu, Quan; Niu, Jianbing; Xia, Zhenhai

    2015-07-14

    Defects are common but important in graphene, which could significantly tailor the electronic structures and physical and chemical properties. In this study, the density functional theory (DFT) method was applied to study the electronic structure and catalytic properties of graphene clusters containing various point and line defects. The electron transfer processes in oxygen reduction reaction (ORR) on perfect and defective graphene clusters in fuel cells was simulated, and the free energy and reaction energy barrier of the elementary reactions were calculated to determine the reaction pathways. It was found that the graphene cluster with the point defect having pentagon rings at the zigzag edge, or line defects (grain boundaries) consisting of pentagon-pentagon-octagon or pentagon-heptagon chains also at the edges, shows the electrocatalytic capability for ORR. Four-electron and two-electron transfer processes could occur simultaneously on graphene clusters with certain types of defects. The energy barriers of the reactions are comparable to that of platinum(111). The catalytic active sites were determined on the defective graphene. PMID:26033301

  7. A Multi-Wavelength Photometric Census of AGN and Star Formation Activity in the Brightest Cluster Galaxies of X-ray Selected Clusters

    NASA Astrophysics Data System (ADS)

    Green, T. S.; Edge, A. C.; Stott, J. P.; Ebeling, H.; Burgett, W. S.; Chambers, K. C.; Draper, P. W.; Metcalfe, N.; Kaiser, N.; Wainscoat, R. J.; Waters, C.

    2016-06-01

    Despite their reputation as being "red and dead", the unique environment inhabited by Brightest Cluster Galaxies (BCGs) can often lead to a self-regulated feedback cycle between radiatively cooling intracluster gas and star formation and AGN activity in the BCG. However the prevalence of "active" BCGs, and details of the feedback involved, are still uncertain. We have performed an optical, UV and Mid-IR photometric analysis of the BCGs in 981 clusters at 0.03 < z < 0.5, selected from the ROSAT All Sky Survey. Using Pan-STARRS PS1 3π, GALEX and WISE survey data we look for BCGs with photometric colours which deviate from that of the bulk population of passive BCGs - indicative of AGN and/or star formation activity within the BCG. We find that whilst the majority of BCGs are consistent with being passive, at least 14% of our BCGs show a significant colour offset from passivity in at least one colour index. And, where available, supplementary spectroscopy reveals the majority of these particular BCGs show strong optical emission lines. On comparing BCG "activity" with the X-ray luminosity of the host cluster, we find that BCGs showing a colour offset are preferentially found in the more X-ray luminous clusters, indicative of the connection between BCG "activity" and the intracluster medium.

  8. A Cluster-Analytical Approach towards Physical Activity and Eating Habits among 10-Year-Old Children

    ERIC Educational Resources Information Center

    Sabbe, Dieter; De Bourdeaudhuij, I.; Legiest, E.; Maes, L.

    2008-01-01

    The purpose was to investigate whether clusters--based on physical activity (PA) and eating habits--can be found among children, and to explore subgroups' characteristics. A total of 1725 10-year olds completed a self-administered questionnaire. K-means cluster analysis was based on the weekly quantity of vigorous and moderate PA, the excess index…

  9. Role of paramagnetic polyconjugated clusters in lignin antioxidant activity (in vitro)

    NASA Astrophysics Data System (ADS)

    Dizhbite, T.; Ponomarenko, J.; Andersone, A.; Dobele, G.; Lauberts, M.; Krasilnikova, J.; Mironova-Ulmane, N.; Telysheva, G.

    2012-08-01

    Using physico-chemical methods (EPR, SEC, Py-GC/MS and UV/VIS spectroscopy) and wet chemical analysis, the characteristics of 6 hardwood lignins in terms of functionality, molecular weight and composition of lignin substructures were determined and considered together with the results of DPPH•, ABTS•+ and O2•- antioxidant assays with the aim to understand the relationships governing antioxidant properties of lignin. The strong positive linear correlation between lignin antioxidant capacity in the three assays used and the extent of conjugation of paramagnetic polyconjugated clusters in lignin macromolecules was found. The biological activity of the most active alkaline lignins was assessed by in vitro experiment with human blood.

  10. Detection of single unit activity from the rat vagus using cluster analysis of principal components.

    PubMed

    Horn, Charles C; Friedman, Mark I

    2003-01-30

    In vivo recordings from subdiaphragmatic vagal afferent nerves generally lack the resolution to distinguish single unit activity. Several methods for data acquisition and analysis were combined to produce a high degree of reliability in recording electrophysiological signals from gastrointestinal and hepatic afferent fibers in the rat. Recordings with low noise were achieved by paralysis of the respiratory muscles and by pinning the nerve to a recording platform. Single unit activity was isolated using principal component (PC) analysis and cluster cutting of data in multi-dimensional space (1-3 PCs). Cluster assignments were determined by a semi-automated approach using the k-means algorithm. The accuracy of single unit classification was assessed by checking inter-spike intervals (ISIs) to determine the length of the refractory period, and by cross-correlation analysis to assess whether single units were mistakenly split into more than one cluster. These analyses produced up to four isolated single units from each nerve filament (a bundle of nerve fibers), and typically it was possible to further increase yield by recording from several nerve filaments simultaneously using an array of electrodes. PMID:12573473

  11. ANISOTROPIC METAL-ENRICHED OUTFLOWS DRIVEN BY ACTIVE GALACTIC NUCLEI IN CLUSTERS OF GALAXIES

    SciTech Connect

    Kirkpatrick, C. C.; McNamara, B. R.; Cavagnolo, K. W.

    2011-04-20

    We present an analysis of the spatial distribution of metal-rich gas in 10 galaxy clusters using deep observations from the Chandra X-ray Observatory. The brightest cluster galaxies (BCGs) have experienced recent active galactic nucleus activity in the forms of bright radio emission, cavities, and shock fronts embedded in the hot atmospheres. The heavy elements are distributed anisotropically and are aligned with the large-scale radio and cavity axes. They are apparently being transported from the halo of the BCG into the intracluster medium along large-scale outflows driven by the radio jets. The radial ranges of the metal-enriched outflows are found to scale with jet power as R{sub Fe} {proportional_to} P {sup 0.42}{sub jet}, with a scatter of only 0.5 dex. The heavy elements are transported beyond the extent of the inner cavities in all clusters, suggesting that this is a long-lasting effect sustained over multiple generations of outbursts. Black holes in BCGs will likely have difficulty ejecting metal-enriched gas beyond 1 Mpc unless their masses substantially exceed 10{sup 9} M{sub sun}.

  12. Forest soil metagenome gene cluster involved in antifungal activity expression in Escherichia coli.

    PubMed

    Chung, Eu Jin; Lim, He Kyoung; Kim, Jin-Cheol; Choi, Gyung Ja; Park, Eun Jin; Lee, Myung Hwan; Chung, Young Ryun; Lee, Seon-Woo

    2008-02-01

    Using two forest soils, we previously constructed two fosmid libraries containing 113,700 members in total. The libraries were screened to select active antifungal clones using Saccharomyces cerevisiae as a target fungus. One clone from the Yuseong pine tree rhizosphere soil library, pEAF66, showed S. cerevisiae growth inhibition. Despite an intensive effort, active chemicals were not isolated. DNA sequence analysis and transposon mutagenesis of pEAF66 revealed 39 open reading frames (ORFs) and indicated that eight ORFs, probably in one transcriptional unit, might be directly involved in the expression of antifungal activity in Escherichia coli. The deduced amino acid sequences of eight ORFs were similar to those of the core genes encoding type II family polyketide synthases, such as the acyl carrier protein (ACP), ACP synthases, aminotransferase, and ACP reductase. The gene cluster involved in antifungal activity was similar in organization to the putative antibiotic production locus of Pseudomonas putida KT2440, although we could not select a similar active clone from the KT2440 genomic DNA library in E. coli. ORFs encoding ATP binding cassette transporters and membrane proteins were located at both ends of the antifungal gene cluster. Upstream ORFs encoding an IclR family response regulator and a LysR family response regulator were involved in the positive regulation of antifungal gene expression. Our results suggested the metagenomic approach as an alternative to search for novel antifungal antibiotics from unculturable soil bacteria. This is the first report of an antifungal gene cluster obtained from a soil metagenome using S. cerevisiae as a target fungus. PMID:18065615

  13. In Situ Generation of Active Molybdenum Octahedral Clusters for Photocatalytic Hydrogen Production from Water.

    PubMed

    Feliz, Marta; Puche, Marta; Atienzar, Pedro; Concepción, Patricia; Cordier, Stéphane; Molard, Yann

    2016-08-01

    The photocatalytic hydrogen evolution reaction (HER) from water under homogeneous and heterogeneous conditions is explored for the {Mo6 Br(i) 8 }(4+) cluster core based unit starting from (TBA)2 [Mo6 Br(i) 8 F(a) 6 ] (TBA=tetra-n-butylammonium; "i" and "a" refer to the face-capping inner and terminal apical ligand, respectively). The catalytic activity of {Mo6 Br(i) 8 }(4+) is enhanced by the in situ generation of [Mo6 Br(i) 8 F(a) 5 (OH)(a) ](2-) , [Mo6 Br(i) 8 F(a) 3 (OH)(a) 3 ](2-) , and [Mo6 Br(i) 8 (OH)(a) 6 ](2-) , which are identified by ESIMS, luminescence, and NMR techniques. Full substitution of F(-) by OH(-) leads to the formation of (H3 O)2 [Mo6 Br(i) 8 (OH)(a) 6 ]⋅10 H2 O; its structure was determined by single-crystal XRD. The immobilization of the active {Mo6 Br(i) 8 }(4+) onto graphene oxide (GO) surfaces enhances its stability under catalytic conditions. The catalytic activity of the resulting (TBA)2 Mo6 Br(i) 8 @GO material is improved with respect to GO, but is reduced compared to the activity under homogeneous conditions because of changes in the GO semiconducting properties as well as lower activity and/or accessibility of the anchored cluster. PMID:27314221

  14. Simulations of cosmic-ray feedback by active galactic nuclei in galaxy clusters

    NASA Astrophysics Data System (ADS)

    Sijacki, Debora; Pfrommer, Christoph; Springel, Volker; Enßlin, Torsten A.

    2008-07-01

    Feedback processes by active galactic nuclei (AGN) appear to be a key for understanding the nature of the very X-ray luminous cool cores found in many clusters of galaxies. We investigate a numerical model for AGN feedback where for the first time a relativistic particle population in AGN-inflated bubbles is followed within a full cosmological context. In our high-resolution simulations of galaxy cluster formation, we assume that black hole accretion is accompanied by energy feedback that occurs in two different modes, depending on the accretion rate itself. At high accretion rates, a small fraction of the radiated energy is coupled thermally to the gas surrounding the quasar, while in a low-accretion state, mechanically efficient feedback in the form of hot, buoyant bubbles that are inflated by radio activity is considered. Unlike previous work, we inject a non-thermal particle population of relativistic protons into the AGN bubbles, instead of adopting a purely thermal heating. We then follow the subsequent evolution of the cosmic-ray (CR) plasma inside the bubbles, considering both its hydrodynamical interactions and dissipation processes relevant to the CR population. This permits us to analyse the impact of CR bubbles on the surrounding intracluster medium, and in particular, how this contrasts with the purely thermal case. Due to the different buoyancy of relativistic plasma and the comparatively long CR dissipation time-scale, we find substantial changes in the evolution of clusters as a result of CR feedback. In particular, the non-thermal population can provide significant pressure support in central cluster regions at low thermal temperatures, providing a natural explanation for the decreasing temperature profiles found in cool core clusters. At the same time, the morphologies of the bubbles and of the induced X-ray cavities show a striking similarity to observational findings. AGN feedback with CRs also proves efficient in regulating cluster cooling

  15. Cluster spacecraft observations of a ULF wave enhanced by Space Plasma Exploration by Active Radar (SPEAR)

    NASA Astrophysics Data System (ADS)

    Badman, S. V.; Wright, D. M.; Clausen, L. B. N.; Fear, R. C.; Robinson, T. R.; Yeoman, T. K.

    2009-09-01

    Space Plasma Exploration by Active Radar (SPEAR) is a high-latitude ionospheric heating facility capable of exciting ULF waves on local magnetic field lines. We examine an interval from 1 February 2006 when SPEAR was transmitting a 1 Hz modulation signal with a 10 min on-off cycle. Ground magnetometer data indicated that SPEAR modulated currents in the local ionosphere at 1 Hz, and enhanced a natural field line resonance with a 10 min period. During this interval the Cluster spacecraft passed over the heater site. Signatures of the SPEAR-enhanced field line resonance were present in the magnetic field data measured by the magnetometer on-board Cluster-2. These are the first joint ground- and space-based detections of field line tagging by SPEAR.

  16. Phosphorous transient enhanced diffusion suppression and activation enhancement with cluster carbon co-implantation

    SciTech Connect

    Nakashima, Yoshiki; Hamamoto, Nariaki; Nagayama, Tsutomu; Koga, Yuji; Umisedo, Sei; Kawamura, Yasunori; Hashimoto, Masahiro; Onoda, Hiroshi

    2012-11-06

    Carbon co-implantation is well known as an effective method for suppressing boron/phosphorous transient enhanced diffusion (TED). Germanium pre-amorphization implantation (PAI) is usually applied prior to carbon co-implantation for suppressing channeling tail of dopants. In this study, cluster carbon was applied instead of the combination of germanium PAI and monomer carbon co-implantation prior to phosphorous implantation. Dependence of phosphorous activation and TED on amorphous layer thickness, carbon dose, carbon distribution and substrate temperature have been investigated. Cluster carbon implantation enables thick amorphous layer formation and TED suppression at the same time and low temperature implantation enhances the ability of amorphous layer formation so that shallow junction and low Rs can be achieved without Ge implantation.

  17. Role of geometrical symmetry in thermally activated processes in clusters of interacting dipolar moments

    NASA Astrophysics Data System (ADS)

    Hovorka, O.; Barker, J.; Friedman, G.; Chantrell, R. W.

    2014-03-01

    Thermally activated magnetization decay is studied in ensembles of clusters of interacting dipolar moments by applying the master-equation formalism, as a model of thermal relaxation in systems of interacting single-domain ferromagnetic particles. Solving the associated master equation reveals a breakdown of the energy barrier picture depending on the geometrical symmetry of structures. Deviations are most pronounced for reduced symmetry and result in a strong interaction dependence of relaxation rates on the memory of system initialization. A simple two-state system description of an ensemble of clusters is developed, which accounts for the observed anomalies. These results follow from a semianalytical treatment, and are fully supported by kinetic Monte Carlo simulations.

  18. Interplay of cytoskeletal activity and lipid phase stability in dynamic protein recruitment and clustering.

    PubMed

    Gómez-Llobregat, Jordi; Buceta, Javier; Reigada, Ramon

    2013-01-01

    Recent experiments have revealed that some membrane proteins aggregate to form clusters. This type of process has been proven to be dynamic and to be actively maintained by external kinetics. Additionally, this dynamic recruiting is cholesterol- and actin-dependent, suggesting that raft organization and cytoskeleton rearrangement play a crucial role. In the present study, we propose a simple model that provides a general framework to describe the dynamical behavior of lipid-protein assemblies. Our results suggest that lipid-mediated interactions and cytoskeleton-anchored proteins contribute to the modulation of such behavior. In particular, we find a resonant condition between the membrane protein and cytoskeleton dynamics that results in the invariance of the ratio of clustered proteins that is found in in vivo experimental observations. PMID:24018870

  19. Predicting Water Activity for Complex Wastes with Solvation Cluster Equilibria (SCE) - 12042

    SciTech Connect

    Agnew, S.F.; Reynolds, J.G.; Johnston, C.T.

    2012-07-01

    Predicting an electrolyte mixture's water activity, i.e. the ratio of water vapor pressure over a solution with that of pure water, in principle reveals both boiling point and solubilities for that mixture. Better predictions of these properties helps support the ongoing missions to concentrate complex nuclear waste mixtures in order to conserve tank space and improved predictions of water activity will help. A new approach for predicting water activity, the solvation cluster equilibria (SCE) model, uses pure electrolyte water activities to predict water activity for a complex mixture of those electrolytes. An SCE function based on electrolyte hydration free energy and a standard Debye- Hueckel (DH) charge compression fits each pure electrolyte's water activity with three parameters. Given these pure electrolyte water activities, the SCE predicts any mixture water activity over a large range of concentration with an additional parameter for each mixture vector, the multinarity. In contrast to ionic strength, which scales with concentration, multinarity is related to the relative proportion of electrolytes in a mixture and can either increase or decrease the water activity prediction over a broad range of concentration for that mixture. The SCE model predicts water activity for complex electrolyte mixtures based on the water activities of pure electrolytes. Three parameter SCE functions fit the water activities of pure electrolytes and along with a single multinarity parameter for each mixture vector then predict the mixture water activity. Predictions of water activity can in principle predict solution electrolyte activity and this relationship will be explored in the future. Predicting electrolyte activities for complex mixtures provides a means of determining solubilities for each electrolyte. Although there are a number of reports [9, 10, 11] of water activity models for pure and binary mixtures of electrolytes, none of them compare measured versus calculated

  20. A new experimental setup for high-pressure catalytic activity measurements on surface deposited mass-selected Pt clusters

    SciTech Connect

    Watanabe, Yoshihide; Isomura, Noritake

    2009-09-15

    A new experimental setup to study catalytic and electronic properties of size-selected clusters on metal oxide substrates from the viewpoint of cluster-support interaction and to formulate a method for the development of heterogeneous catalysts such as automotive exhaust catalysts has been developed. The apparatus consists of a size-selected cluster source, a photoemission spectrometer, a scanning tunneling microscope (STM), and a high-pressure reaction cell. The high-pressure reaction cell measurements provided information on catalytic properties in conditions close to practical use. The authors investigated size-selected platinum clusters deposited on a TiO{sub 2}(110) surface using a reaction cell and STM. Catalytic activity measurements showed that the catalytic activities have a cluster-size dependency.

  1. C-H Bond Activation by Early Transition Metal Carbide Cluster Anion MoC3 (-).

    PubMed

    Li, Zi-Yu; Hu, Lianrui; Liu, Qing-Yu; Ning, Chuan-Gang; Chen, Hui; He, Sheng-Gui; Yao, Jiannian

    2015-12-01

    Although early transition metal (ETM) carbides can activate CH bonds in condensed-phase systems, the electronic-level mechanism is unclear. Atomic clusters are ideal model systems for understanding the mechanisms of bond activation. For the first time, CH activation of a simple alkane (ethane) by an ETM carbide cluster anion (MoC3 (-) ) under thermal-collision conditions has been identified by using high-resolution mass spectrometry, photoelectron imaging spectroscopy, and high-level quantum chemical calculations. Dehydrogenation and ethene elimination were observed in the reaction of MoC3 (-) with C2 H6 . The CH activation follows a mechanism of oxidative addition that is much more favorable in the carbon-stabilized low-spin ground electronic state than in the high-spin excited state. The reaction efficiency between the MoC3 (-) anion and C2 H6 is low (0.23±0.05) %. A comparison between the anionic and a highly efficient cationic reaction system (Pt(+) +C2 H6 ) was made. It turned out that the potential-energy surfaces for the entrance channels of the anionic and cationic reaction systems can be very different. PMID:26490554

  2. The RACE-OC project: Rotation and ACtivity Evolution in Open Clusters .

    NASA Astrophysics Data System (ADS)

    Messina, S.

    The RACE-OC (Rotation and ACtivity Evolution in Open Clusters) is a project aimed at studying the evolution of rotation and magnetic activity of the late-type members belonging to open clusters with an age in the range from about 1 to 500 Myr. In late-type stars rotation and solar-like magnetic activity are closely inter-related. In fact, presence and level of stellar magnetic activity depend on rotation. On the other hand, magnetic activity influences the evolution of the angular momentum and determines the atmospheric structure from the PMS to Post-MS evolutionary stages (Dorren & Guinan \\cite{Dorren94}; Guinan et al. \\cite{Guinan01}). Studies of the rotation and magnetic activity evolution versus time are particularly relevant to 1) determine the radiative and magnetic properties of the young Sun; 2) study its evolution history to the present; 3) construct irradiance tables to be used to model paleo-planetary atmospheres. Our aim is to describe the evolution versus time of either the stellar angular momentum and magnetic activity, by inferring from observational data accurate empirical relations between global stellar properties, rotation and activity manifestations at different atmospheric levels to be compared to current stellar evolution and hydromagnetic dynamo models. The multiband CCD photometric observations have been so far carried out with the 0.6m REM (Rapid Eye Mount) telescope (La Silla, Chile) of INAF; the 2m HCT (Himalayan Chandra Telescope) of IIA, the 1.3m Cassegrain telescope of Skinakas Observatory (University of Crete) and, finally, the 1.3m RCT (Robotic Controlled Telescope, Arizona) of Villanova University.

  3. Modeling active galactic nucleus feedback in cool-core clusters: The formation of cold clumps

    SciTech Connect

    Li, Yuan; Bryan, Greg L.

    2014-07-10

    We perform high-resolution (15-30 pc) adaptive mesh simulations to study the impact of momentum-driven active galactic nucleus (AGN) feedback in cool-core clusters, focusing in this paper on the formation of cold clumps. The feedback is jet-driven with an energy determined by the amount of cold gas within 500 pc of the super-massive black hole. When the intracluster medium in the core of the cluster becomes marginally stable to radiative cooling, with the thermal instability to the free-fall timescale ratio t{sub TI}/t{sub ff} < 3-10, cold clumps of gas start to form along the propagation direction of the AGN jets. By tracing the particles in the simulations, we find that these cold clumps originate from low entropy (but still hot) gas that is accelerated by the jet to outward radial velocities of a few hundred km s{sup –1}. This gas is out of hydrostatic equilibrium and so can cool. The clumps then grow larger as they decelerate and fall toward the center of the cluster, eventually being accreted onto the super-massive black hole. The general morphology, spatial distribution, and estimated Hα morphology of the clumps are in reasonable agreement with observations, although we do not fully replicate the filamentary morphology of the clumps seen in the observations, probably due to missing physics.

  4. Visible-Light-Induced Olefin Activation Using 3D Aromatic Boron-Rich Cluster Photooxidants.

    PubMed

    Messina, Marco S; Axtell, Jonathan C; Wang, Yiqun; Chong, Paul; Wixtrom, Alex I; Kirlikovali, Kent O; Upton, Brianna M; Hunter, Bryan M; Shafaat, Oliver S; Khan, Saeed I; Winkler, Jay R; Gray, Harry B; Alexandrova, Anastassia N; Maynard, Heather D; Spokoyny, Alexander M

    2016-06-01

    We report a discovery that perfunctionalized icosahedral dodecaborate clusters of the type B12(OCH2Ar)12 (Ar = Ph or C6F5) can undergo photo-excitation with visible light, leading to a new class of metal-free photooxidants. Excitation in these species occurs as a result of the charge transfer between low-lying orbitals located on the benzyl substituents and an unoccupied orbital delocalized throughout the boron cluster core. Here we show how these species, photo-excited with a benchtop blue LED source, can exhibit excited-state reduction potentials as high as 3 V and can participate in electron-transfer processes with a broad range of styrene monomers, initiating their polymerization. Initiation is observed in cases of both electron-rich and electron-deficient styrene monomers at cluster loadings as low as 0.005 mol%. Furthermore, photo-excitation of B12(OCH2C6F5)12 in the presence of a less activated olefin such as isobutylene results in the production of highly branched poly(isobutylene). This work introduces a new class of air-stable, metal-free photo-redox reagents capable of mediating chemical transformations. PMID:27186856

  5. Identification of novel mureidomycin analogues via rational activation of a cryptic gene cluster in Streptomyces roseosporus NRRL 15998

    PubMed Central

    Jiang, Lingjuan; Wang, Lu; Zhang, Jihui; Liu, Hao; Hong, Bin; Tan, Huarong; Niu, Guoqing

    2015-01-01

    Antimicrobial agents are urgently needed to tackle the growing threat of antibiotic-resistant pathogens. An important source of new antimicrobials is the large repertoire of cryptic gene clusters embedded in microbial genomes. Genome mining revealed a napsamycin/mureidomycin biosynthetic gene cluster in the chromosome of Streptomyces roseosporus NRRL 15998. The cryptic gene cluster was activated by constitutive expression of a foreign activator gene ssaA from sansanmycin biosynthetic gene cluster of Streptomyces sp. strain SS. Expression of the gene cluster was verified by RT-PCR analysis of key biosynthetic genes. The activated metabolites demonstrated potent inhibitory activity against the highly refractory pathogen Pseudomonas aeruginosa, and characterization of the metabolites led to the discovery of eight acetylated mureidomycin analogues. To our surprise, constitutive expression of the native activator gene SSGG_02995, a ssaA homologue in S. roseosporus NRRL 15998, has no beneficial effect on mureidomycin stimulation. This study provides a new way to activate cryptic gene cluster for the acquisition of novel antibiotics and will accelerate the exploitation of prodigious natural products in Streptomyces. PMID:26370924

  6. Clustered mutations in hominid genome evolution are consistent with APOBEC3G enzymatic activity.

    PubMed

    Pinto, Yishay; Gabay, Orshay; Arbiza, Leonardo; Sams, Aaron J; Keinan, Alon; Levanon, Erez Y

    2016-05-01

    The gradual accumulation of mutations by any of a number of mutational processes is a major driving force of divergence and evolution. Here, we investigate a potentially novel mutational process that is based on the activity of members of the AID/APOBEC family of deaminases. This gene family has been recently shown to introduce-in multiple types of cancer-enzyme-induced clusters of co-occurring somatic mutations caused by cytosine deamination. Going beyond somatic mutations, we hypothesized that APOBEC3-following its rapid expansion in primates-can introduce unique germline mutation clusters that can play a role in primate evolution. In this study, we tested this hypothesis by performing a comprehensive comparative genomic screen for APOBEC3-induced mutagenesis patterns across different hominids. We detected thousands of mutation clusters introduced along primate evolution which exhibit features that strongly fit the known patterns of APOBEC3G mutagenesis. These results suggest that APOBEC3G-induced mutations have contributed to the evolution of all genomes we studied. This is the first indication of site-directed, enzyme-induced genome evolution, which played a role in the evolution of both modern and archaic humans. This novel mutational mechanism exhibits several unique features, such as its higher tendency to mutate transcribed regions and regulatory elements and its ability to generate clusters of concurrent point mutations that all occur in a single generation. Our discovery demonstrates the exaptation of an anti-viral mechanism as a new source of genomic variation in hominids with a strong potential for functional consequences. PMID:27056836

  7. Clustered mutations in hominid genome evolution are consistent with APOBEC3G enzymatic activity

    PubMed Central

    Pinto, Yishay; Gabay, Orshay; Arbiza, Leonardo; Sams, Aaron J.; Keinan, Alon

    2016-01-01

    The gradual accumulation of mutations by any of a number of mutational processes is a major driving force of divergence and evolution. Here, we investigate a potentially novel mutational process that is based on the activity of members of the AID/APOBEC family of deaminases. This gene family has been recently shown to introduce—in multiple types of cancer—enzyme-induced clusters of co-occurring somatic mutations caused by cytosine deamination. Going beyond somatic mutations, we hypothesized that APOBEC3—following its rapid expansion in primates—can introduce unique germline mutation clusters that can play a role in primate evolution. In this study, we tested this hypothesis by performing a comprehensive comparative genomic screen for APOBEC3-induced mutagenesis patterns across different hominids. We detected thousands of mutation clusters introduced along primate evolution which exhibit features that strongly fit the known patterns of APOBEC3G mutagenesis. These results suggest that APOBEC3G-induced mutations have contributed to the evolution of all genomes we studied. This is the first indication of site-directed, enzyme-induced genome evolution, which played a role in the evolution of both modern and archaic humans. This novel mutational mechanism exhibits several unique features, such as its higher tendency to mutate transcribed regions and regulatory elements and its ability to generate clusters of concurrent point mutations that all occur in a single generation. Our discovery demonstrates the exaptation of an anti-viral mechanism as a new source of genomic variation in hominids with a strong potential for functional consequences. PMID:27056836

  8. Effects of algorithm for diagnosis of active labour: cluster randomised trial

    PubMed Central

    Hundley, Vanora; Dowding, Dawn; Bland, J Martin; McNamee, Paul; Greer, Ian; Styles, Maggie; Barnett, Carol A; Scotland, Graham; Niven, Catherine

    2008-01-01

    Objective To compare the effectiveness of an algorithm for diagnosis of active labour in primiparous women with standard care in terms of maternal and neonatal outcomes. Design Cluster randomised trial. Setting Maternity units in Scotland with at least 800 annual births. Participants 4503 women giving birth for the first time, in 14 maternity units. Seven experimental clusters collected data from a baseline sample of 1029 women and a post-implementation sample of 896 women. The seven control clusters had a baseline sample of 1291 women and a post-implementation sample of 1287 women. Intervention Use of an algorithm by midwives to assist their diagnosis of active labour, compared with standard care. Main outcomes Primary outcome: use of oxytocin for augmentation of labour. Secondary outcomes: medical interventions in labour, admission management, and birth outcome. Results No significant difference was found between groups in percentage use of oxytocin for augmentation of labour (experimental minus control, difference=0.3, 95% confidence interval −9.2 to 9.8; P=0.9) or in the use of medical interventions in labour. Women in the algorithm group were more likely to be discharged from the labour suite after their first labour assessment (difference=−19.2, −29.9 to −8.6; P=0.002) and to have more pre-labour admissions (0.29, 0.04 to 0.55; P=0.03). Conclusions Use of an algorithm to assist midwives with the diagnosis of active labour in primiparous women did not result in a reduction in oxytocin use or in medical intervention in spontaneous labour. Significantly more women in the experimental group were discharged home after their first labour ward assessment. Trial registration Current Controlled Trials ISRCTN00522952. PMID:19064606

  9. On the apparent clustering of clonal albumin production and enzyme activity levels.

    PubMed

    Thaler, H T; Braun, H I

    1984-12-01

    This communication is a critique of a novel, but inappropriate, use of the correlation coefficient to demonstrate the clustering of biological activity levels about a purported geometric progression. The data are re-examined by using a Fourier analysis approach to test for periodicity on a logarithmic scale; this approach follows from the methods of Kendall (1974, Philosophical Transactions of the Royal Society, Series A 276, 231-266) and Fisher (1929, Proceedings of the Royal Statistical Society, Series A 125, 54-59). PMID:6534411

  10. Destruction of giant cluster-like vesicles by an ultrasonically activated device

    NASA Astrophysics Data System (ADS)

    Yahagi, Ryosuke; Yoshida, Kenji; Zhang, Yiting; Ebata, Masahiko; Toyota, Taro; Yamaguchi, Tadashi; Hayashi, Hideki

    2016-07-01

    In this paper, we propose a technically simple method of destroying a tissue marker composed of giant cluster-like vesicles (GCVs) to facilitate laparoscopic surgeries; the method releases various biological tracers contained in GCVs. An ultrasonically activated device (USAD) emitting 55.5 kHz ultrasound was employed for this purpose. Optical microscopy and fluorospectrophotometry revealed the destruction of GCVs after ultrasound irradiation when the blade tip was set 1.0 mm or closer to, but not directly in contact with, a GCV-containing cell. This means that USAD could be safely used for destroying this GCV tissue marker in clinical settings.

  11. Voltage clustering in redox-active ligand complexes: mitigating electronic communication through choice of metal ion.

    PubMed

    Zarkesh, Ryan A; Ichimura, Andrew S; Monson, Todd C; Tomson, Neil C; Anstey, Mitchell R

    2016-06-14

    The redox-active bis(imino)acenapthene (BIAN) ligand was used to synthesize homoleptic aluminum, chromium, and gallium complexes of the general formula (BIAN)3M. The resulting compounds were characterized using X-ray crystallography, NMR, EPR, magnetic susceptibility and cyclic voltammetry measurements and modeled using both DFT and ab initio wavefunction calculations to compare the orbital contributions of main group elements and transition metals in ligand-based redox events. Complexes of this type have the potential to improve the energy density and electrolyte stability of grid-scale energy storage technologies, such as redox flow batteries, through thermodynamically-clustered redox events. PMID:26998892

  12. Voltage clustering in redox-active ligand complexes: mitigating electronic communication through choice of metal ion

    DOE PAGESBeta

    Zarkesh, Ryan A.; Ichimura, Andrew S.; Monson, Todd C.; Tomson, Neil C.; Anstey, Mitchell R.

    2016-02-01

    We used the redox-active bis(imino)acenapthene (BIAN) ligand to synthesize homoleptic aluminum, chromium, and gallium complexes of the general formula (BIAN)3M. The resulting compounds were characterized using X-ray crystallography, NMR, EPR, magnetic susceptibility and cyclic voltammetry measurements and modeled using both DFT and ab initio wavefunction calculations to compare the orbital contributions of main group elements and transition metals in ligand-based redox events. Ultimately, complexes of this type have the potential to improve the energy density and electrolyte stability of grid-scale energy storage technologies, such as redox flow batteries, through thermodynamically-clustered redox events.

  13. [FeFe]-Hydrogenase with Chalcogenide Substitutions at the H-Cluster Maintains Full H2 Evolution Activity.

    PubMed

    Noth, Jens; Esselborn, Julian; Güldenhaupt, Jörn; Brünje, Annika; Sawyer, Anne; Apfel, Ulf-Peter; Gerwert, Klaus; Hofmann, Eckhard; Winkler, Martin; Happe, Thomas

    2016-07-11

    The [FeFe]-hydrogenase HYDA1 from Chlamydomonas reinhardtii is particularly amenable to biochemical and biophysical characterization because the H-cluster in the active site is the only inorganic cofactor present. Herein, we present the complete chemical incorporation of the H-cluster into the HYDA1-apoprotein scaffold and, furthermore, the successful replacement of sulfur in the native [4FeH ] cluster with selenium. The crystal structure of the reconstituted pre-mature HYDA1[4Fe4Se]H protein was determined, and a catalytically intact artificial H-cluster variant was generated upon in vitro maturation. Full hydrogen evolution activity as well as native-like composition and behavior of the redesigned enzyme were verified through kinetic assays, FTIR spectroscopy, and X-ray structure analysis. These findings reveal that even a bioinorganic active site with exceptional complexity can exhibit a surprising level of compositional plasticity. PMID:27214763

  14. NanoCluster Beacons as Reporter Probes in Rolling Circle Enhanced Enzyme Activity Detection†

    PubMed Central

    Juul, Sissel; Obliosca, Judy M.; Liu, Cong; Liu, Yen-Liang; Chen, Yu-An; Imphean, Darren M.; Knudsen, Birgitta R.; Ho, Yi-Ping; Leong, Kam W.; Yeh, Hsin-Chih

    2015-01-01

    As a newly developed assay for the detection of endogenous enzyme activity at the single-catalytic-event level, Rolling Circle Enhanced Enzyme Activity Detection (REEAD) has been used to measure enzyme activity in both single human cells and malaria-causing parasites, Plasmodium sp.. Current REEAD assays rely on organic dye-tagged linear DNA probes to report the rolling circle amplification products (RCPs), the cost of which may hinder the widespread use of REEAD. Here we show that a new class of activatable probes, NanoCluster Beacons (NCBs), can simplify the REEAD assays. Easily prepared without any need for purification and capable of large fluorescence enhancement upon hybridization, NCBs are cost-effective and sensitive. Compared to conventional fluorescent probes, NCBs are also more photostable. As demonstrated in reporting the human topoisomerases I (hTopI) cleavage-ligation reaction, the proposed NCBs suggest a read-out format attractive for future REEAD-based diagnostics. PMID:25901841

  15. Overproduction of Ristomycin A by Activation of a Silent Gene Cluster in Amycolatopsis japonicum MG417-CF17

    PubMed Central

    Spohn, Marius; Kirchner, Norbert; Kulik, Andreas; Jochim, Angelika; Wolf, Felix; Muenzer, Patrick; Borst, Oliver; Gross, Harald; Wohlleben, Wolfgang

    2014-01-01

    The emergence of antibiotic-resistant pathogenic bacteria within the last decades is one reason for the urgent need for new antibacterial agents. A strategy to discover new anti-infective compounds is the evaluation of the genetic capacity of secondary metabolite producers and the activation of cryptic gene clusters (genome mining). One genus known for its potential to synthesize medically important products is Amycolatopsis. However, Amycolatopsis japonicum does not produce an antibiotic under standard laboratory conditions. In contrast to most Amycolatopsis strains, A. japonicum is genetically tractable with different methods. In order to activate a possible silent glycopeptide cluster, we introduced a gene encoding the transcriptional activator of balhimycin biosynthesis, the bbr gene from Amycolatopsis balhimycina (bbrAba), into A. japonicum. This resulted in the production of an antibiotically active compound. Following whole-genome sequencing of A. japonicum, 29 cryptic gene clusters were identified by genome mining. One of these gene clusters is a putative glycopeptide biosynthesis gene cluster. Using bioinformatic tools, ristomycin (syn. ristocetin), a type III glycopeptide, which has antibacterial activity and which is used for the diagnosis of von Willebrand disease and Bernard-Soulier syndrome, was deduced as a possible product of the gene cluster. Chemical analyses by high-performance liquid chromatography and mass spectrometry (HPLC-MS), tandem mass spectrometry (MS/MS), and nuclear magnetic resonance (NMR) spectroscopy confirmed the in silico prediction that the recombinant A. japonicum/pRM4-bbrAba synthesizes ristomycin A. PMID:25114137

  16. Cosmological Studies with Galaxy Clusters, Active Galactic Nuclei, and Strongly Lensed Quasars

    NASA Astrophysics Data System (ADS)

    Rumbaugh, Nicholas Andrew

    The large-scale structure (LSS) of the universe provides scientists with one of the best laboratories for studying Lambda Cold Dark Matter (LambdaCDM) cosmology. Especially at high redshift, we see increased rates of galaxy cluster and galaxy merging in LSS relative to the field, which is useful for studying the hierarchical merging predicted by LambdaCDM. The largest identified bound structures, superclusters, have not yet virialized. Despite the wide range of dynamical states of their constituent galaxies, groups, and clusters, they are all still actively evolving, providing an ideal laboratory in which to study cluster and galaxy evolution. In this dissertation, I present original research on several aspects of LSS and LambdaCDM cosmology. Three separate studies are included, each one focusing on a different aspect. In the first study, we use X-ray and optical observations from nine galaxy clusters at high redshift, some embedded in larger structures and some isolated, to study their evolutionary states. We extract X-ray gas temperatures and luminosities as well as optical velocity dispersions. These cluster properties are compared using low-redshift scaling relations. In addition, we employ several tests of substructure, using velocity histograms, Dressler-Shectman tests, and centroiding offsets. We conclude that two clusters out of our sample are most likely unrelaxed, and find support for deviations from self-similarity in the redshift evolution of the Lx-T relation. Our numerous complementary tests of the evolutionary state of clusters suggest potential under-estimations of systematic error in studies employing only a single such test. In the second study, we use multi-band imaging and spectroscopy to study active galactic nuclei (AGN) in high-redshift LSS. The AGN were identified using X-ray imaging and matched to optical catalogs that contained spectroscopic redshifts to identify members of the structures. AGN host galaxies tended to be associated with the

  17. Changing ionization conditions in SDSS galaxies with active galactic nuclei as a function of environment from pairs to clusters

    SciTech Connect

    Khabiboulline, Emil T.; Steinhardt, Charles L.; Silverman, John D.; Ellison, Sara L.; Mendel, J. Trevor; Patton, David R.

    2014-11-01

    We study how active galactic nucleus (AGN) activity changes across environments from galaxy pairs to clusters using 143,843 galaxies with z < 0.2 from the Sloan Digital Sky Survey. Using a refined technique, we apply a continuous measure of AGN activity, characteristic of the ionization state of the narrow-line emitting gas. Changes in key emission-line ratios ([N II] λ6548/Hα, [O III] λ5007/Hβ) between different samples allow us to disentangle different environmental effects while removing contamination. We confirm that galaxy interactions enhance AGN activity. However, conditions in the central regions of clusters are inhospitable for AGN activity even if galaxies are in pairs. These results can be explained through models of gas dynamics in which pair interactions stimulate the transfer of gas to the nucleus and clusters suppress gas availability for accretion onto the central black hole.

  18. Changing Ionization Conditions in SDSS Galaxies with Active Galactic Nuclei as a Function of Environment from Pairs to Clusters

    NASA Astrophysics Data System (ADS)

    Khabiboulline, Emil T.; Steinhardt, Charles L.; Silverman, John D.; Ellison, Sara L.; Mendel, J. Trevor; Patton, David R.

    2014-11-01

    We study how active galactic nucleus (AGN) activity changes across environments from galaxy pairs to clusters using 143,843 galaxies with z < 0.2 from the Sloan Digital Sky Survey. Using a refined technique, we apply a continuous measure of AGN activity, characteristic of the ionization state of the narrow-line emitting gas. Changes in key emission-line ratios ([N II] λ6548/Hα, [O III] λ5007/Hβ) between different samples allow us to disentangle different environmental effects while removing contamination. We confirm that galaxy interactions enhance AGN activity. However, conditions in the central regions of clusters are inhospitable for AGN activity even if galaxies are in pairs. These results can be explained through models of gas dynamics in which pair interactions stimulate the transfer of gas to the nucleus and clusters suppress gas availability for accretion onto the central black hole.

  19. Inhibition of nitrobenzene adsorption by water cluster formation at acidic oxygen functional groups on activated carbon.

    PubMed

    Kato, Yuichi; Machida, Motoi; Tatsumoto, Hideki

    2008-06-15

    The inhibition effect of nitrobenzene adsorption by water clusters formed at the acidic groups on activated carbon was examined in aqueous and n-hexane solution. The activated carbon was oxidized with nitric acid to introduce CO complexes and then outgassed in helium flow at 1273 K to remove them completely without changing the structural properties of the carbon as a reference adsorbent. The amounts of acidic functional groups were determined by applying Boehm titration. A relative humidity of 95% was used to adsorb water onto the carbon surface. Strong adsorption of water onto the oxidized carbon can be observed by thermogravimetric analysis. The adsorption kinetic rate was estimated to be controlled by diffusion from the kinetic analysis. Significant decline in both capacity and kinetic rate for nitrobenzene adsorption onto the oxidized carbon was also observed in n-hexane solution by preadsorption of water to the carbon surface, whereas it was not detected for the outgassed carbons. These results might reveal that water molecules forming clusters at the CO complexes inhibited the entrance of nitrobenzene into the interparticles of the carbon. PMID:18440013

  20. Microbial communication leading to the activation of silent fungal secondary metabolite gene clusters

    PubMed Central

    Netzker, Tina; Fischer, Juliane; Weber, Jakob; Mattern, Derek J.; König, Claudia C.; Valiante, Vito; Schroeckh, Volker; Brakhage, Axel A.

    2015-01-01

    Microorganisms form diverse multispecies communities in various ecosystems. The high abundance of fungal and bacterial species in these consortia results in specific communication between the microorganisms. A key role in this communication is played by secondary metabolites (SMs), which are also called natural products. Recently, it was shown that interspecies “talk” between microorganisms represents a physiological trigger to activate silent gene clusters leading to the formation of novel SMs by the involved species. This review focuses on mixed microbial cultivation, mainly between bacteria and fungi, with a special emphasis on the induced formation of fungal SMs in co-cultures. In addition, the role of chromatin remodeling in the induction is examined, and methodical perspectives for the analysis of natural products are presented. As an example for an intermicrobial interaction elucidated at the molecular level, we discuss the specific interaction between the filamentous fungi Aspergillus nidulans and Aspergillus fumigatus with the soil bacterium Streptomyces rapamycinicus, which provides an excellent model system to enlighten molecular concepts behind regulatory mechanisms and will pave the way to a novel avenue of drug discovery through targeted activation of silent SM gene clusters through co-cultivations of microorganisms. PMID:25941517

  1. Active-Space Coupled-Cluster Study of Electronic States of Be₃

    SciTech Connect

    Kowalski, Karol; Hirata, So; Wloch, M W.; Piecuch, Piotr; Windus, Theresa L.

    2005-08-15

    An automated implementation of the active-space coupled-cluster (CC) and equation-of-motion (EOM) CC methods with all singles and doubles, and triples defined via active orbitals (CCSDt, EOMCCSDt) employing Tensor Contraction Engine (TCE), is reported. The TCE-generated CCSDt/ codes are parallel and applicable to closed-and open-shell references. The effectiveness of the new code in describing electronic quasi-degeneracies is illustrated by the CCSDt / EOMCCSDt) calculations for the challenging Be₃system, which is characterized by a large number of low-lying excited states dominated by two-electron transitions and significant high order correlation effects in the ground electronic state. Different strategies for defining triple excitation s within the CCSDt / EOMCCSDt) approach are discussed.

  2. Application of space-time scan statistics to describe geographic and temporal clustering of visible drug activity.

    PubMed

    Linton, Sabriya L; Jennings, Jacky M; Latkin, Carl A; Gomez, Marisela B; Mehta, Shruti H

    2014-10-01

    Knowledge of the geographic and temporal clustering of drug activity can inform where health and social services are needed and can provide insight on the potential impact of local policies on drug activity. This ecologic study assessed the spatial and temporal distribution of drug activity in Baltimore, Maryland, prior to and following the implementation of a large urban redevelopment project in East Baltimore, which began in 2003. Drug activity was measured by narcotic calls for service at the neighborhood level. A space-time scan statistic approach was used to identify statistically significant clusters of narcotic calls for service across space and time, using a discrete Poisson model. After adjusting for economic deprivation and housing vacancy, clusters of narcotic calls for service were identified among neighborhoods located in Southeast, Northeast, Northwest, and West Baltimore from 2001 to 2010. Clusters of narcotic calls for service were identified among neighborhoods located in East Baltimore from 2001 to 2003, indicating a decrease in narcotic calls thereafter. A large proportion of clusters occurred among neighborhoods located in North and Northeast Baltimore after 2003, which indicated a potential spike during this time frame. These findings suggest potential displacement of drug activity coinciding with the initiation of urban redevelopment in East Baltimore. Space-time scan statistics should be used in future research to describe the potential implications of local policies on drug activity. PMID:25078036

  3. Clustering Home Activity Distributions for Automatic Detection of Mild Cognitive Impairment in Older Adults1

    PubMed Central

    Akl, Ahmad; Chikhaoui, Belkacem; Mattek, Nora; Kaye, Jeffrey; Austin, Daniel; Mihailidis, Alex

    2016-01-01

    The public health implications of growing numbers of older adults at risk for dementia places pressure on identifying dementia at its earliest stages so as to develop proactive management plans. The prodromal dementia phase commonly identified as mild cognitive impairment is an important target for this early detection of impending dementia amenable to treatment. In this paper, we propose a method for home-based automatic detection of mild cognitive impairment in older adults through continuous monitoring via unobtrusive sensing technologies. Our method is composed of two main stages: a training stage and a test stage. For training, room activity distributions are estimated for each subject using a time frame of ω weeks, and then affinity propagation is employed to cluster the activity distributions and to extract exemplars to represent the different emerging clusters. For testing, room activity distributions belonging to a test subject with unknown cognitive status are compared to the extracted exemplars and get assigned the labels of the exemplars that result in the smallest normalized Kullbak–Leibler divergence. The labels of the activity distributions are then used to determine the cognitive status of the test subject. Using the sensor and clinical data pertaining to 85 homes with single occupants, we were able to automatically detect mild cognitive impairment in older adults with an F0.5 score of 0.856. Also, we were able to detect the non-amnestic sub-type of mild cognitive impairment in older adults with an F0.5 score of 0.958.

  4. Nanoparticle cluster gas sensor: Pt activated SnO2 nanoparticles for NH3 detection with ultrahigh sensitivity.

    PubMed

    Liu, Xu; Chen, Nan; Han, Bingqian; Xiao, Xuechun; Chen, Gang; Djerdj, Igor; Wang, Yude

    2015-09-28

    Pt activated SnO2 nanoparticle clusters were synthesized by a simple solvothermal method. The structure, morphology, chemical state and specific surface area were analyzed by X-ray powder diffraction (XRD), transmission electron microscopy (TEM), X-ray photoelectron spectroscopy (XPS) and N2-sorption studies, respectively. The SnO2 nanoparticle cluster matrix consists of tens of thousands of SnO2 nanoparticles with an ultra-small grain size estimated to be 3.0 nm. And there are abundant random-packed wormhole-like pores, caused by the inter-connection of the SnO2 nanoparticles, throughout each cluster. The platinum element is present in two forms including metal (Pt) and tetravalent metal oxide (PtO2) in the Pt activated SnO2 nanoparticle clusters. The as-synthesized pure and Pt activated SnO2 nanoparticle clusters were used to fabricate gas sensor devices. It was found that the gas response toward 500 ppm of ammonia was improved from 6.48 to 203.44 through the activation by Pt. And the results indicate that the sensor based on Pt activated SnO2 not only has ultrahigh sensitivity but also possesses good response-recovery properties, linear dependence, repeatability, selectivity and long-term stability, demonstrating the potential to use Pt activated SnO2 nanoparticle clusters as ammonia gas sensors. At the same time, the formation mechanisms of the unique nanoparticle clusters and highly enhanced sensitivity are also discussed. PMID:26289622

  5. On the luminosity of black hole cluster model of active galactic nuclei

    NASA Technical Reports Server (NTRS)

    Stoeger, W. R.; Pacholczyk, A. G.; Stepinski, T. F.

    1992-01-01

    The luminosity of a nuclear cluster of accreting black holes and other objects is discussed in terms of two accretion regimes: external supply of gas from outside the cluster and internal supply resulting from tidal disruption and capture of stars within the cluster. The external supply regime results in radiation being emitted from the innermost parts of the cluster while internal supply can efficiently feed the holes in the outer parts of the cluster as long as it is not too compact cluster and is embedded in a distribution of stars with a density larger than 10 exp 7 solar masses/cu pc.

  6. A multi-modal prostate segmentation scheme by combining spectral clustering and active shape models

    NASA Astrophysics Data System (ADS)

    Toth, Robert; Tiwari, Pallavi; Rosen, Mark; Kalyanpur, Arjun; Pungavkar, Sona; Madabhushi, Anant

    2008-03-01

    Segmentation of the prostate boundary on clinical images is useful in a large number of applications including calculating prostate volume during biopsy, tumor estimation, and treatment planning. Manual segmentation of the prostate boundary is, however, time consuming and subject to inter- and intra-reader variability. Magnetic Resonance (MR) imaging (MRI) and MR Spectroscopy (MRS) have recently emerged as promising modalities for detection of prostate cancer in vivo. In this paper we present a novel scheme for accurate and automated prostate segmentation on in vivo 1.5 Tesla multi-modal MRI studies. The segmentation algorithm comprises two steps: (1) A hierarchical unsupervised spectral clustering scheme using MRS data to isolate the region of interest (ROI) corresponding to the prostate, and (2) an Active Shape Model (ASM) segmentation scheme where the ASM is initialized within the ROI obtained in the previous step. The hierarchical MRS clustering scheme in step 1 identifies spectra corresponding to locations within the prostate in an iterative fashion by discriminating between potential prostate and non-prostate spectra in a lower dimensional embedding space. The spatial locations of the prostate spectra so identified are used as the initial ROI for the ASM. The ASM is trained by identifying user-selected landmarks on the prostate boundary on T2 MRI images. Boundary points on the prostate are identified using mutual information (MI) as opposed to the traditional Mahalanobis distance, and the trained ASM is deformed to fit the boundary points so identified. Cross validation on 150 prostate MRI slices yields an average segmentation sensitivity, specificity, overlap, and positive predictive value of 89, 86, 83, and 93% respectively. We demonstrate that the accurate initialization of the ASM via the spectral clustering scheme is necessary for automated boundary extraction. Our method is fully automated, robust to system parameters, and computationally efficient.

  7. Modeling active galactic nucleus feedback in cool-core clusters: The balance between heating and cooling

    SciTech Connect

    Li, Yuan; Bryan, Greg L.

    2014-07-01

    We study the long-term evolution of an idealized cool-core galaxy cluster under the influence of momentum-driven active galactic nucleus (AGN) feedback using three-dimensional high-resolution (60 pc) adaptive mesh refinement simulations. The feedback is modeled with a pair of precessing jets whose power is calculated based on the accretion rate of the cold gas surrounding the supermassive black hole (SMBH). The intracluster medium first cools into clumps along the propagation direction of the jets. As the jet power increases, gas condensation occurs isotropically, forming spatially extended structures that resemble the observed Hα filaments in Perseus and many other cool-core clusters. Jet heating elevates the gas entropy, halting clump formation. The cold gas that is not accreted onto the SMBH settles into a rotating disk of ∼10{sup 11} M {sub ☉}. The hot gas cools directly onto the disk while the SMBH accretes from its innermost region, powering the AGN that maintains a thermally balanced state for a few Gyr. The mass cooling rate averaged over 7 Gyr is ∼30 M {sub ☉} yr{sup –1}, an order of magnitude lower than the classic cooling flow value. Medium resolution simulations produce similar results, while in low resolution runs, the cluster experiences cycles of gas condensation and AGN outbursts. Owing to its self-regulating mechanism, AGN feedback can successfully balance cooling with a wide range of model parameters. Our model also produces cold structures in early stages that are in good agreement with the observations. However, the long-lived massive cold disk is unrealistic, suggesting that additional physical processes are still needed.

  8. The angular clustering of WISE-selected active galactic nuclei: Different halos for obscured and unobscured active galactic nuclei

    SciTech Connect

    Donoso, E.; Yan, Lin; Stern, D.; Assef, R. J.

    2014-07-01

    We calculate the angular correlation function for a sample of ∼170,000 active galactic nuclei (AGNs) extracted from the Wide-field Infrared Survey Explorer (WISE) catalog, selected to have red mid-IR colors (W1 – W2 > 0.8) and 4.6 μm flux densities brighter than 0.14 mJy). The sample is expected to be >90% reliable at identifying AGNs and to have a mean redshift of (z) = 1.1. In total, the angular clustering of WISE AGNs is roughly similar to that of optical AGNs. We cross-match these objects with the photometric Sloan Digital Sky Survey catalog and distinguish obscured sources with r – W2 > 6 from bluer, unobscured AGNs. Obscured sources present a higher clustering signal than unobscured sources. Since the host galaxy morphologies of obscured AGNs are not typical red sequence elliptical galaxies and show disks in many cases, it is unlikely that the increased clustering strength of the obscured population is driven by a host galaxy segregation bias. By using relatively complete redshift distributions from the COSMOS survey, we find that obscured sources at (z) ∼ 0.9 have a bias of b = 2.9 ± 0.6 and are hosted in dark matter halos with a typical mass of log (M/M {sub ☉} h {sup –1}) ∼ 13.5. In contrast, unobscured AGNs at (z) ∼ 1.1 have a bias of b = 1.6 ± 0.6 and inhabit halos of log (M/M {sub ☉} h {sup –1}) ∼ 12.4. These findings suggest that obscured AGNs inhabit denser environments than unobscured AGNs, and they are difficult to reconcile with the simplest AGN unification models, where obscuration is driven solely by orientation.

  9. Testing a workplace physical activity intervention: a cluster randomized controlled trial

    PubMed Central

    2011-01-01

    Background Increased physical activity levels benefit both an individuals' health and productivity at work. The purpose of the current study was to explore the impact and cost-effectiveness of a workplace physical activity intervention designed to increase physical activity levels. Methods A total of 1260 participants from 44 UK worksites (based within 5 organizations) were recruited to a cluster randomized controlled trial with worksites randomly allocated to an intervention or control condition. Measurement of physical activity and other variables occurred at baseline, and at 0 months, 3 months and 9 months post-intervention. Health outcomes were measured during a 30 minute health check conducted in worksites at baseline and 9 months post intervention. The intervention consisted of a 3 month tool-kit of activities targeting components of the Theory of Planned Behavior, delivered in-house by nominated facilitators. Self-reported physical activity (measured using the IPAQ short-form) and health outcomes were assessed. Results and discussion Multilevel modelling found no significant effect of the intervention on MET minutes of activity (from the IPAQ) at any of the follow-up time points controlling for baseline activity. However, the intervention did significantly reduce systolic blood pressure (B = -1.79 mm/Hg) and resting heart rate (B = -2.08 beats) and significantly increased body mass index (B = .18 units) compared to control. The intervention was found not to be cost-effective, however the substantial variability round this estimate suggested that further research is warranted. Conclusions The current study found mixed support for this worksite physical activity intervention. The paper discusses some of the tensions involved in conducting rigorous evaluations of large-scale randomized controlled trials in real-world settings. Trial registration Current controlled trials ISRCTN08807396 PMID:21481265

  10. A conserved activation cluster is required for allosteric communication in HtrA-family proteases.

    PubMed

    de Regt, Anna K; Kim, Seokhee; Sohn, Jungsan; Grant, Robert A; Baker, Tania A; Sauer, Robert T

    2015-03-01

    In E. coli, outer-membrane stress causes a transcriptional response through a signaling cascade initiated by DegS cleavage of a transmembrane antisigma factor. Each subunit of DegS, an HtrA-family protease, contains a protease domain and a PDZ domain. The trimeric protease domain is autoinhibited by the unliganded PDZ domains. Allosteric activation requires binding of unassembled outer-membrane proteins (OMPs) to the PDZ domains and protein substrate binding. Here, we identify a set of DegS residues that cluster together at subunit-subunit interfaces in the trimer, link the active sites and substrate binding sites, and are crucial for stabilizing the active enzyme conformation in response to OMP signaling. These residues are conserved across the HtrA-protease family, including orthologs linked to human disease, supporting a common mechanism of allosteric activation. Indeed, mutation of residues at homologous positions in the DegP quality-control protease also eliminates allosteric activation. PMID:25703375

  11. Eastern region represents a worrying cluster of active hepatitis C in Algeria in 2012.

    PubMed

    Bensalem, Aïcha; Selmani, Karima; Hihi, Narjes; Bencherifa, Nesrine; Mostefaoui, Fatma; Kerioui, Cherif; Pineau, Pascal; Debzi, Nabil; Berkane, Saadi

    2016-08-01

    Algeria is the largest country of Africa, peopled with populations living a range of traditional/rural and modern/urban lifestyles. The variations of prevalence of chronic active hepatitis care poorly known on the Algerian territory. We conducted a retrospective survey on all patients (n = 998) referred to our institution in 2012 and confirmed by us for an active hepatitis C. Half of the hepatitis C virus (HCV) isolates were genotyped. Forty Algerian regions out of the 48 were represented in our study. Three geographical clusters (Aïn-Temouchent/SidiBelAbbes, Algiers, and a large Eastern region) with an excess of active hepatitis C were observed. Patients coming from the Eastern cluster (Batna, Khenchela, Oum el Bouaghi, and Tebessa) were strongly over-represented (49% of cases, OR = 14.5, P < 0.0001). The hallmarks of Eastern region were an excess of women (65% vs. 46% in the remaining population, P < 0.0001) and the almost exclusive presence of HCV genotype 1 (93% vs. 63%, P = 0.0001). The core of the epidemics was apparently located in Khenchela (odds ratio = 24.6, P < 0.0001). This situation is plausibly connected with nosocomial transmission or traditional practices as scarification (Hijama), piercing or tattooing, very lively in this region. Distinct hepatitis C epidemics are currently affecting Algerian population. The most worrying situation is observed in rural regions located east of Algeria. J. Med. Virol. 88:1394-1403, 2016. © 2016 Wiley Periodicals, Inc. PMID:26856380

  12. THE CLUSTERING OF GALAXIES AROUND RADIO-LOUD ACTIVE GALACTIC NUCLEI

    SciTech Connect

    Worpel, Hauke; Brown, Michael J. I.; Jones, D. Heath; Floyd, David J. E.; Beutler, Florian

    2013-07-20

    We examine the hypothesis that mergers and close encounters between galaxies can fuel active galactic nuclei (AGNs) by increasing the rate at which gas accretes toward the central black hole. We compare the clustering of galaxies around radio-loud AGNs with the clustering around a population of radio-quiet galaxies with similar masses, colors, and luminosities. Our catalog contains 2178 elliptical radio galaxies with flux densities greater than 2.8 mJy at 1.4 GHz from the Six Degree Field Galaxy Survey. We find tentative evidence that radio AGNs with more than 200 times the median radio power have, on average, more close (r < 160 kpc) companions than their radio-quiet counterparts, suggesting that mergers play a role in forming the most powerful radio galaxies. For ellipticals of fixed stellar mass, the radio power is neither a function of large-scale environment nor halo mass, consistent with the radio powers of ellipticals varying by orders of magnitude over billions of years.

  13. Using Targeted Active-Learning Exercises and Diagnostic Question Clusters to Improve Students' Understanding of Carbon Cycling in Ecosystems

    ERIC Educational Resources Information Center

    Maskiewicz, April Cordero; Griscom, Heather Peckham; Welch, Nicole Turrill

    2012-01-01

    In this study, we used targeted active-learning activities to help students improve their ways of reasoning about carbon flow in ecosystems. The results of a validated ecology conceptual inventory (diagnostic question clusters [DQCs]) provided us with information about students' understanding of and reasoning about transformation of inorganic and…

  14. NanoCluster Beacons as reporter probes in rolling circle enhanced enzyme activity detection

    NASA Astrophysics Data System (ADS)

    Juul, Sissel; Obliosca, Judy M.; Liu, Cong; Liu, Yen-Liang; Chen, Yu-An; Imphean, Darren M.; Knudsen, Birgitta R.; Ho, Yi-Ping; Leong, Kam W.; Yeh, Hsin-Chih

    2015-04-01

    As a newly developed assay for the detection of endogenous enzyme activity at the single-catalytic-event level, Rolling Circle Enhanced Enzyme Activity Detection (REEAD) has been used to measure enzyme activity in both single human cells and malaria-causing parasites, Plasmodium sp. Current REEAD assays rely on organic dye-tagged linear DNA probes to report the rolling circle amplification products (RCPs), the cost of which may hinder the widespread use of REEAD. Here we show that a new class of activatable probes, NanoCluster Beacons (NCBs), can simplify the REEAD assays. Easily prepared without any need for purification and capable of large fluorescence enhancement upon hybridization, NCBs are cost-effective and sensitive. Compared to conventional fluorescent probes, NCBs are also more photostable. As demonstrated in reporting the human topoisomerases I (hTopI) cleavage-ligation reaction, the proposed NCBs suggest a read-out format attractive for future REEAD-based diagnostics.As a newly developed assay for the detection of endogenous enzyme activity at the single-catalytic-event level, Rolling Circle Enhanced Enzyme Activity Detection (REEAD) has been used to measure enzyme activity in both single human cells and malaria-causing parasites, Plasmodium sp. Current REEAD assays rely on organic dye-tagged linear DNA probes to report the rolling circle amplification products (RCPs), the cost of which may hinder the widespread use of REEAD. Here we show that a new class of activatable probes, NanoCluster Beacons (NCBs), can simplify the REEAD assays. Easily prepared without any need for purification and capable of large fluorescence enhancement upon hybridization, NCBs are cost-effective and sensitive. Compared to conventional fluorescent probes, NCBs are also more photostable. As demonstrated in reporting the human topoisomerases I (hTopI) cleavage-ligation reaction, the proposed NCBs suggest a read-out format attractive for future REEAD-based diagnostics. Electronic

  15. Dynamics of fractal cluster colloidal gels with embedded active Janus particles

    NASA Astrophysics Data System (ADS)

    Solomon, Michael; Szakasits, Megan; Zhang, Wenxuan

    We find that fractal cluster gels of colloids in which platinum-coated Janus particles have been embedded exhibit enhanced mobility when the Janus particles are made active by the addition of hydrogen peroxide. Gelation is induced through addition of a divalent salt, magnesium chloride, to an initially stable suspension of Janus and polystyrene colloids, each of size about 1 micron. After the gels have been created, the embedded Janus colloids are activated by hydrogen peroxide, which is delivered to the system through a porous hydrogel membrane. We vary the ratio of active to passive colloids in the gels from about 1:20 to 1:8. Changes in structure and dynamics are visualized by two channel confocal laser scanning microscopy. By image analysis, we determine the particle positions and compute the mean squared displacement (MSD) of all particles in the gel. We measure the mobility enhancement in the fractal gels as a function of hydrogen peroxide concentration and Janus particle concentration and discuss the results in terms of the force provided by each active particle to the fractal gel network.

  16. Graphdiyne oxides as excellent substrate for electroless deposition of Pd clusters with high catalytic activity.

    PubMed

    Qi, Hetong; Yu, Ping; Wang, Yuexiang; Han, Guangchao; Liu, Huibiao; Yi, Yuanping; Li, Yuliang; Mao, Lanqun

    2015-04-29

    Graphdiyne (GDY), a novel kind of two-dimensional carbon allotrope consisting of sp- and sp(2)-hybridized carbon atoms, is found to be able to serve as the reducing agent and stabilizer for electroless deposition of highly dispersed Pd nanoparticles owing to its low reduction potential and highly conjugated electronic structure. Furthermore, we observe that graphdiyne oxide (GDYO), the oxidation form of GDY, can be used as an even excellent substrate for electroless deposition of ultrafine Pd clusters to form Pd/GDYO nanocomposite that exhibits a high catalytic performance toward the reduction of 4-nitrophenol. The high catalytic performance is considered to benefit from the rational design and electroless deposition of active metal catalysts with GDYO as the support. PMID:25871853

  17. The role of geometrical symmetry on thermally activated processes in clusters of interacting dipolar moments

    NASA Astrophysics Data System (ADS)

    Hovorka, Ondrej; Barker, Joe; Friedman, Gary; Chantrell, Roy

    2014-03-01

    Thermally activated magnetization decay is studied in ensembles of clusters of interacting dipolar moments by applying the master-equation formalism, as a model of thermal relaxation in systems of interacting single-domain ferromagnetic nanoparticles. Solving the associated master-equation reveals a breakdown of the energy barrier picture depending on the geometrical symmetry of structures. Deviations are most pronounced for reduced symmetry and result in a strong interaction dependence of relaxation rates on the memory of initialization of an ensemble. Developed is a simple two-state system description of an ensemble, which accounts for the observed anomalies. These results follow from a semi-analytical treatment, and are fully supported by kinetic Monte-Carlo simulations. OH gratefully acknowledges support from a Marie Curie Intra European Fellowship within the 7th European Community Framework Programme under grant agreement PIEF-GA-2010-273014.

  18. N2O reduction by the mu4-sulfide-bridged tetranuclear CuZ cluster active site.

    PubMed

    Chen, Peng; Gorelsky, Serge I; Ghosh, Somdatta; Solomon, Edward I

    2004-08-13

    Nitrous oxide (N2O) reduction is a chemical challenge both in the selective oxidation of organic substrates by N2O and in the removal of N2O as a green-house gas. The reduction of N2O is thermodynamically favorable but kinetically inert, and requires activating transition-metal centers. In biological systems, N2O reduction is the last step in the denitrification process of the bacterial nitrogen cycle and is accomplished by the enzyme nitrous oxide reductase, whose active site consists of a micro4-sulfide-bridged tetranuclear CuZ cluster which has many unusual spectroscopic features. Recent studies have developed a detailed electronic-structure description of the resting CuZ cluster, determined its catalytically relevant state, and provided insight into the role of this tetranuclear copper cluster in N2O activation and reduction. PMID:15307074

  19. Tuning of silver cluster emission from blue to red using a bio-active peptide in water.

    PubMed

    Roy, Subhasish; Baral, Abhishek; Banerjee, Arindam

    2014-03-26

    Blue, green, and red emitting silver quantum clusters have been prepared through green chemical approach by using a bio-active peptide glutathione (reduced) in a 50 mM phosphate buffer at pH 7.46. This study describes fluorescence emission tuning of the silver clusters by making different sized Ag clusters using slightly different reaction conditions keeping the same stabilizing ligand, reducing agent, solvent system, and silver salt precursor. The preparation procedure of these silver quantum clusters is new and highly reproducible. Each of these clusters shows very interesting fluorescence properties with large stokes shifts, and the quantum yields of blue, green, and red clusters are 2.08%, 0.125%, and 1.39%, respectively. These silver quantum clusters have been characterized by using different techniques including fluorescence spectroscopy, UV-vis spectroscopy, field-emission gun transmission electron microscopic (FEG-TEM) imaging and MALDI-TOF MS analyses. MALDI-TOF MS analyses show that the size of these blue, green and red emitting silver clusters are Ag5 (NC1, nanoclusters 1), Ag8 (NC2, nanoclusters 2) and Ag13 (NC3, nanoclusters 3), respectively, by using 2,5-dihydroxybenzoic acid as a matrix. These clusters are stable in broad ranges of pH. The NC3 (red emitting) has been successfully utilized for selective and sensitive detection of toxic Hg(II) ions in water by using even naked eyes, fluorometric, and calorimetric studies. The lower limit of detection of Hg(II) ions in water has been estimated to be 126 and 245 nM from fluorometric and UV-vis analyses, respectively. Enthalpy change (ΔH) during this Hg(II) sensing process is 2508 KJ mol(-1). PMID:24568193

  20. The Sound of Silence: Activating Silent Biosynthetic Gene Clusters in Marine Microorganisms.

    PubMed

    Reen, F Jerry; Romano, Stefano; Dobson, Alan D W; O'Gara, Fergal

    2015-08-01

    Unlocking the rich harvest of marine microbial ecosystems has the potential to both safeguard the existence of our species for the future, while also presenting significant lifestyle benefits for commercial gain. However, while significant advances have been made in the field of marine biodiscovery, leading to the introduction of new classes of therapeutics for clinical medicine, cosmetics and industrial products, much of what this natural ecosystem has to offer is locked in, and essentially hidden from our screening methods. Releasing this silent potential represents a significant technological challenge, the key to which is a comprehensive understanding of what controls these systems. Heterologous expression systems have been successful in awakening a number of these cryptic marine biosynthetic gene clusters (BGCs). However, this approach is limited by the typically large size of the encoding sequences. More recently, focus has shifted to the regulatory proteins associated with each BGC, many of which are signal responsive raising the possibility of exogenous activation. Abundant among these are the LysR-type family of transcriptional regulators, which are known to control production of microbial aromatic systems. Although the environmental signals that activate these regulatory systems remain unknown, it offers the exciting possibility of evoking mimic molecules and synthetic expression systems to drive production of potentially novel natural products in microorganisms. Success in this field has the potential to provide a quantum leap forward in medical and industrial bio-product development. To achieve these new endpoints, it is clear that the integrated efforts of bioinformaticians and natural product chemists will be required as we strive to uncover new and potentially unique structures from silent or cryptic marine gene clusters. PMID:26264003

  1. The Sound of Silence: Activating Silent Biosynthetic Gene Clusters in Marine Microorganisms

    PubMed Central

    Reen, F. Jerry; Romano, Stefano; Dobson, Alan D.W.; O’Gara, Fergal

    2015-01-01

    Unlocking the rich harvest of marine microbial ecosystems has the potential to both safeguard the existence of our species for the future, while also presenting significant lifestyle benefits for commercial gain. However, while significant advances have been made in the field of marine biodiscovery, leading to the introduction of new classes of therapeutics for clinical medicine, cosmetics and industrial products, much of what this natural ecosystem has to offer is locked in, and essentially hidden from our screening methods. Releasing this silent potential represents a significant technological challenge, the key to which is a comprehensive understanding of what controls these systems. Heterologous expression systems have been successful in awakening a number of these cryptic marine biosynthetic gene clusters (BGCs). However, this approach is limited by the typically large size of the encoding sequences. More recently, focus has shifted to the regulatory proteins associated with each BGC, many of which are signal responsive raising the possibility of exogenous activation. Abundant among these are the LysR-type family of transcriptional regulators, which are known to control production of microbial aromatic systems. Although the environmental signals that activate these regulatory systems remain unknown, it offers the exciting possibility of evoking mimic molecules and synthetic expression systems to drive production of potentially novel natural products in microorganisms. Success in this field has the potential to provide a quantum leap forward in medical and industrial bio-product development. To achieve these new endpoints, it is clear that the integrated efforts of bioinformaticians and natural product chemists will be required as we strive to uncover new and potentially unique structures from silent or cryptic marine gene clusters. PMID:26264003

  2. Cluster Analysis of Tumor Suppressor Genes in Canine Leukocytes Identifies Activation State

    PubMed Central

    Daly, Julie-Anne; Mortlock, Sally-Anne; Taylor, Rosanne M.; Williamson, Peter

    2015-01-01

    Cells of the immune system undergo activation and subsequent proliferation in the normal course of an immune response. Infrequently, the molecular and cellular events that underlie the mechanisms of proliferation are dysregulated and may lead to oncogenesis, leading to tumor formation. The most common forms of immunological cancers are lymphomas, which in dogs account for 8%–20% of all cancers, affecting up to 1.2% of the dog population. Key genes involved in negatively regulating proliferation of lymphocytes include a group classified as tumor suppressor genes (TSGs). These genes are also known to be associated with progression of lymphoma in humans, mice, and dogs and are potential candidates for pathological grading and diagnosis. The aim of the present study was to analyze TSG profiles in stimulated leukocytes from dogs to identify genes that discriminate an activated phenotype. A total of 554 TSGs and three gene set collections were analyzed from microarray data. Cluster analysis of three subsets of genes discriminated between stimulated and unstimulated cells. These included 20 most upregulated and downregulated TSGs, TSG in hallmark gene sets significantly enriched in active cells, and a selection of candidate TSGs, p15 (CDKN2B), p18 (CDKN2C), p19 (CDKN1A), p21 (CDKN2A), p27 (CDKN1B), and p53 (TP53) in the third set. Analysis of two subsets suggested that these genes or a subset of these genes may be used as a specialized PCR set for additional analysis. PMID:27478369

  3. B Cell Super-Enhancers and Regulatory Clusters Recruit AID Tumorigenic Activity

    PubMed Central

    Qian, Jason; Wang, Qiao; Dose, Marei; Pruett, Nathanael; Kieffer-Kwon, Kyong-Rim; Resch, Wolfgang; Liang, Genqing; Tang, Zhonghui; Mathé, Ewy; Benner, Christopher; Dubois, Wendy; Nelson, Steevenson; Vian, Laura; Oliveira, Thiago Y.; Jankovic, Mila; Hakim, Ofir; Gazumyan, Anna; Pavri, Rushad; Awasthi, Parirokh; Song, Bin; Liu, Geng; Chen, Longyun; Zhu, Shida; Feigenbaum, Lionel; Staudt, Louis; Murre, Cornelis; Ruan, Yijun; Robbiani, Davide F.; Pan-Hammarström, Qiang; Nussenzweig, Michel C.; Casellas, Rafael

    2014-01-01

    SUMMARY The antibody gene mutator activation-induced cytidine deaminase (AID) promiscuously damages oncogenes, leading to chromosomal translocations and tumorigenesis. Why nonimmunoglobulin loci are susceptible to AID activity is unknown. Here, we study AID-mediated lesions in the context of nuclear architecture and the B cell regulome. We show that AID targets are not randomly distributed across the genome but are predominantly grouped within super-enhancers and regulatory clusters. Unexpectedly, in these domains, AID deaminates active promoters and eRNA+ enhancers interconnected in some instances over megabases of linear chromatin. Using genome editing, we demonstrate that 3D-linked targets cooperate to recruit AID-mediated breaks. Furthermore, a comparison of hypermutation in mouse B cells, AID-induced kataegis in human lymphomas, and translocations in MEFs reveals that AID damages different genes in different cell types. Yet, in all cases, the targets are predominantly associated with topological complex, highly transcribed super-enhancers, demonstrating that these compartments are key mediators of AID recruitment. PMID:25483777

  4. The N-Terminal Domain of Human DNA Helicase Rtel1 Contains a Redox Active Iron-Sulfur Cluster

    PubMed Central

    Landry, Aaron P.

    2014-01-01

    Human telomere length regulator Rtel1 is a superfamily II DNA helicase and is essential for maintaining proper length of telomeres in chromosomes. Here we report that the N-terminal domain of human Rtel1 (RtelN) expressed in Escherichia coli cells produces a protein that contains a redox active iron-sulfur cluster with the redox midpoint potential of −248 ± 10 mV (pH 8.0). The iron-sulfur cluster in RtelN is sensitive to hydrogen peroxide and nitric oxide, indicating that reactive oxygen/nitrogen species may modulate the DNA helicase activity of Rtel1 via modification of its iron-sulfur cluster. Purified RtelN retains a weak binding affinity for the single-stranded (ss) and double-stranded (ds) DNA in vitro. However, modification of the iron-sulfur cluster by hydrogen peroxide or nitric oxide does not significantly affect the DNA binding activity of RtelN, suggesting that the iron-sulfur cluster is not directly involved in the DNA interaction in the N-terminal domain of Rtel1. PMID:25147792

  5. Search for α-Cluster Structure in Exotic Nuclei with the Prototype Active-Target Time-Projection Chamber

    NASA Astrophysics Data System (ADS)

    Fritsch, A.; Ayyad, Y.; Bazin, D.; Beceiro-Novo, S.; Bradt, J.; Carpenter, L.; Cortesi, M.; Mittig, W.; Suzuki, D.; Ahn, T.; Kolata, J. J.; Becchetti, F. D.; Howard, A. M.

    2016-03-01

    Some exotic nuclei appear to exhibit α-cluster structure. While various theoretical models currently describe such clustering, more experimental data are needed to constrain model predictions. The Prototype Active-Target Time-Projection Chamber (PAT-TPC) has low-energy thresholds for charged-particle decay and a high luminosity due to its thick gaseous active target volume, making it well-suited to search for low-energy α-cluster reactions. Radioactive-ion beams produced by the TwinSol facility at the University of Notre Dame were delivered to the PAT-TPC to study nuclei including 14C and 14O via α-resonant scattering. Differential cross sections and excitation functions were measured. Preliminary results from our recent experiments will be presented. This work is supported by the U.S. National Science Foundation.

  6. A stereoscopic system for viewing the temporal evolution of brain activity clusters in response to linguistic stimuli

    NASA Astrophysics Data System (ADS)

    Forbes, Angus; Villegas, Javier; Almryde, Kyle R.; Plante, Elena

    2014-03-01

    In this paper, we present a novel application, 3D+Time Brain View, for the stereoscopic visualization of functional Magnetic Resonance Imaging (fMRI) data gathered from participants exposed to unfamiliar spoken languages. An analysis technique based on Independent Component Analysis (ICA) is used to identify statistically significant clusters of brain activity and their changes over time during different testing sessions. That is, our system illustrates the temporal evolution of participants' brain activity as they are introduced to a foreign language through displaying these clusters as they change over time. The raw fMRI data is presented as a stereoscopic pair in an immersive environment utilizing passive stereo rendering. The clusters are presented using a ray casting technique for volume rendering. Our system incorporates the temporal information and the results of the ICA into the stereoscopic 3D rendering, making it easier for domain experts to explore and analyze the data.

  7. A stereoscopic system for viewing the temporal evolution of brain activity clusters in response to linguistic stimuli.

    PubMed

    Forbes, Angus; Villegas, Javier; Almryde, Kyle R; Plante, Elena

    2014-03-01

    In this paper, we present a novel application, 3D+Time Brain View, for the stereoscopic visualization of functional Magnetic Resonance Imaging (fMRI) data gathered from participants exposed to unfamiliar spoken languages. An analysis technique based on Independent Component Analysis (ICA) is used to identify statistically significant clusters of brain activity and their changes over time during different testing sessions. That is, our system illustrates the temporal evolution of participants' brain activity as they are introduced to a foreign language through displaying these clusters as they change over time. The raw fMRI data is presented as a stereoscopic pair in an immersive environment utilizing passive stereo rendering. The clusters are presented using a ray casting technique for volume rendering. Our system incorporates the temporal information and the results of the ICA into the stereoscopic 3D rendering, making it easier for domain experts to explore and analyze the data. PMID:25075268

  8. Coronal Mass Ejections from the Same Active Region Cluster: Two Different Perspectives

    NASA Astrophysics Data System (ADS)

    Cremades, H.; Mandrini, C. H.; Schmieder, B.; Crescitelli, A. M.

    2015-06-01

    The cluster formed by active regions (ARs) NOAA 11121 and 11123, approximately located on the solar central meridian on 11 November 2010, is of great scientific interest. This complex was the site of violent flux emergence and the source of a series of Earth-directed events on the same day. The onset of the events was nearly simultaneously observed by the Atmospheric Imaging Assembly (AIA) telescope onboard the Solar Dynamics Observatory (SDO) and the Extreme-Ultraviolet Imagers (EUVI) on the Sun-Earth Connection Coronal and Heliospheric Investigation (SECCHI) suite of telescopes onboard the Solar-Terrestrial Relations Observatory (STEREO) twin spacecraft. The progression of these events in the low corona was tracked by the Large Angle Spectroscopic Coronagraphs (LASCO) onboard the Solar and Heliospheric Observatory (SOHO) and the SECCHI/COR coronagraphs on STEREO. SDO and SOHO imagers provided data from the Earth's perspective, whilst the STEREO twin instruments procured images from the orthogonal directions. This spatial configuration of spacecraft allowed optimum simultaneous observations of the AR cluster and the coronal mass ejections that originated in it. Quadrature coronal observations provided by STEREO revealed many more ejective events than were detected from Earth. Furthermore, joint observations by SDO/AIA and STEREO/SECCHI EUVI of the source region indicate that all events classified by GOES as X-ray flares had an ejective coronal counterpart in quadrature observations. These results directly affect current space weather forecasting because alarms might be missed when there is a lack of solar observations in a view direction perpendicular to the Sun-Earth line.

  9. The Role of Collagen Charge Clusters in the Modulation of Matrix Metalloproteinase Activity*

    PubMed Central

    Lauer, Janelle L.; Bhowmick, Manishabrata; Tokmina-Roszyk, Dorota; Lin, Yan; Van Doren, Steven R.; Fields, Gregg B.

    2014-01-01

    Members of the matrix metalloproteinase (MMP) family selectively cleave collagens in vivo. Several substrate structural features that direct MMP collagenolysis have been identified. The present study evaluated the role of charged residue clusters in the regulation of MMP collagenolysis. A series of 10 triple-helical peptide (THP) substrates were constructed in which either Lys-Gly-Asp or Gly-Asp-Lys motifs replaced Gly-Pro-Hyp (where Hyp is 4-hydroxy-l-proline) repeats. The stabilities of THPs containing the two different motifs were analyzed, and kinetic parameters for substrate hydrolysis by six MMPs were determined. A general trend for virtually all enzymes was that, as Gly-Asp-Lys motifs were moved from the extreme N and C termini to the interior next to the cleavage site sequence, kcat/Km values increased. Additionally, all Gly-Asp-Lys THPs were as good or better substrates than the parent THP in which Gly-Asp-Lys was not present. In turn, the Lys-Gly-Asp THPs were also always better substrates than the parent THP, but the magnitude of the difference was considerably less compared with the Gly-Asp-Lys series. Of the MMPs tested, MMP-2 and MMP-9 most greatly favored the presence of charged residues with preference for the Gly-Asp-Lys series. Lys-Gly-(Asp/Glu) motifs are more commonly found near potential MMP cleavage sites than Gly-(Asp/Glu)-Lys motifs. As Lys-Gly-Asp is not as favored by MMPs as Gly-Asp-Lys, the Lys-Gly-Asp motif appears advantageous over the Gly-Asp-Lys motif by preventing unwanted MMP hydrolysis. More specifically, the lack of Gly-Asp-Lys clusters may diminish potential MMP-2 and MMP-9 collagenolytic activity. The present study indicates that MMPs have interactions spanning the P23–P23′ subsites of collagenous substrates. PMID:24297171

  10. Pair and Cluster Formation in Hybrid Active-Passive Matter Suspensions

    NASA Astrophysics Data System (ADS)

    Krafnick, Ryan; Garcia, Angel

    2015-03-01

    Systems composed of self-propelling entities, dubbed active matter, are ubiquitous in nature, from flocks of birds and schools of fish to swarms of bacteria and catalytic nanomotors. These systems (both biological and industrial) have applications ranging from micron-scale cargo manipulation and directed transport to water remediation and material processing. When added to a solution with passive (non-self-propelling) particles, active matter leads to new and altered system properties. For example, the diffusion of passive particles increases by orders of magnitude in typical systems, leading to a raised effective temperature. Additionally, particles that normally repel each other exhibit effective attractions which can lead to pair formation and clustering. The nature of these effects depends on both the mechanical collisions of swimmers and the hydrodynamic flow fields they propagate. We computationally examine the effect and dependence of various system parameters, such as particle shape and density, on these properties. This work was funded by NIH grant GM086801 and NSF grant MCB-1050966.

  11. Symmetry adapted cluster-configuration interaction calculation of the photoelectron spectra of famous biological active steroids

    NASA Astrophysics Data System (ADS)

    Abyar, Fatemeh; Farrokhpour, Hossein

    2014-11-01

    The photoelectron spectra of some famous steroids, important in biology, were calculated in the gas phase. The selected steroids were 5α-androstane-3,11,17-trione, 4-androstane-3,11,17-trione, cortisol, cortisone, corticosterone, dexamethasone, estradiol and cholesterol. The calculations were performed employing symmetry-adapted cluster/configuration interaction (SAC-CI) method using the 6-311++G(2df,pd) basis set. The population ratios of conformers of each steroid were calculated and used for simulating the photoelectron spectrum of steroid. It was found that more than one conformer contribute to the photoelectron spectra of some steroids. To confirm the calculated photoelectron spectra, they compared with their corresponding experimental spectra. There were no experimental gas phase Hesbnd I photoelectron spectra for some of the steroids of this work in the literature and their calculated spectra can show a part of intrinsic characteristics of this molecules in the gas phase. The canonical molecular orbitals involved in the ionization of each steroid were calculated at the HF/6-311++g(d,p) level of theory. The spectral bands of each steroid were assigned by natural bonding orbital (NBO) calculations. Knowing the electronic structures of steroids helps us to understand their biological activities and find which sites of steroid become active when a modification is performing under a biological pathway.

  12. Joint Spatial-Spectral Feature Space Clustering for Speech Activity Detection from ECoG Signals

    PubMed Central

    Kanas, Vasileios G.; Mporas, Iosif; Benz, Heather L.; Sgarbas, Kyriakos N.; Bezerianos, Anastasios; Crone, Nathan E.

    2014-01-01

    Brain machine interfaces for speech restoration have been extensively studied for more than two decades. The success of such a system will depend in part on selecting the best brain recording sites and signal features corresponding to speech production. The purpose of this study was to detect speech activity automatically from electrocorticographic signals based on joint spatial-frequency clustering of the ECoG feature space. For this study, the ECoG signals were recorded while a subject performed two different syllable repetition tasks. We found that the optimal frequency resolution to detect speech activity from ECoG signals was 8 Hz, achieving 98.8% accuracy by employing support vector machines (SVM) as a classifier. We also defined the cortical areas that held the most information about the discrimination of speech and non-speech time intervals. Additionally, the results shed light on the distinct cortical areas associated with the two syllable repetition tasks and may contribute to the development of portable ECoG-based communication. PMID:24658248

  13. Peroxidase-like activity of apoferritin paired gold clusters for glucose detection.

    PubMed

    Jiang, Xin; Sun, Cuiji; Guo, Yi; Nie, Guangjun; Xu, Li

    2015-02-15

    The discovery and application of noble metal nanoclusters have received considerable attention. In this paper, we reported that apoferritin paired gold clusters (Au-Ft) could efficiently catalyze oxidation of 3.3',5.5'-tetramethylbenzidine (TMB) by H2O2 to produce a blue color reaction. Compared with natural enzyme, Au-Ft exhibited higher activity near acidic pH and could be used over a wide range of temperatures. Apoferritin nanocage enhanced the reaction activity of substrate TMB by H2O2. The reaction catalyzed by Au-Ft was found to follow a typical Michaelis-Menten kinetics. The kinetic parameters exhibited a lower K(m) value (0.097 mM) and a higher K(cat) value (5.8 × 10(4) s(-1)) for TMB than that of horse radish peroxidase (HRP). Base on these findings, Au-Ft, acting as a peroxidase mimetic, performed enzymatic spectrophotometric analysis of glucose. This system exhibited acceptable reproducibility and high selectivity in biosening, suggesting that it could have promising applications in the future. PMID:25218100

  14. The Raman and vibronic activity of intermolecular vibrations in aromatic-containing complexes and clusters

    SciTech Connect

    Maxton, P.M.; Schaeffer, M.W.; Ohline, S.M.; Kim, W.; Venturo, V.A.; Felker, P.M. )

    1994-11-15

    Theoretical and experimental results pertaining to the excitation of intermolecular vibrations in the Raman and vibronic spectra of aromatic-containing, weakly bound complexes and clusters are reported. The theoretical analysis of intermolecular Raman activity is based on the assumption that the polarizability tensor of a weakly bound species is given by the sum of the polarizability tensors of its constituent monomers. The analysis shows that the van der Waals bending fundamentals in aromatic--rare gas complexes may be expected to be strongly Raman active. More generally, it predicts strong Raman activity for intermolecular vibrations that involve the libration or internal rotation of monomer moieties having appreciable permanent polarizability anisotropies. The vibronic activity of intermolecular vibrations in aromatic-rare gas complexes is analyzed under the assumption that every vibronic band gains its strength from an aromatic-localized transition. It is found that intermolecular vibrational excitations can accompany aromatic-localized vibronic excitations by the usual Franck--Condon mechanism or by a mechanism dependent on the librational amplitude of the aromatic moiety during the course of the pertinent intermolecular vibration. The latter mechanism can impart appreciable intensity to bands that are forbidden by rigid-molecule symmetry selection rules. The applicability of such rules is therefore called into question. Finally, experimental spectra of intermolecular transitions, obtained by mass-selective, ionization-detected stimulated Raman spectroscopies, are reported for benzene--X (X=Ar, --Ar[sub 2], N[sub 2], HCl, CO[sub 2], and --fluorene), fluorobenzene--Ar and --Kr, aniline--Ar, and fluorene--Ar and --Ar[sub 2]. The results support the conclusions of the theoretical analyses and provide further evidence for the value of Raman methods in characterizing intermolecular vibrational level structures.

  15. Nanoparticle cluster gas sensor: Pt activated SnO2 nanoparticles for NH3 detection with ultrahigh sensitivity

    NASA Astrophysics Data System (ADS)

    Liu, Xu; Chen, Nan; Han, Bingqian; Xiao, Xuechun; Chen, Gang; Djerdj, Igor; Wang, Yude

    2015-09-01

    Pt activated SnO2 nanoparticle clusters were synthesized by a simple solvothermal method. The structure, morphology, chemical state and specific surface area were analyzed by X-ray powder diffraction (XRD), transmission electron microscopy (TEM), X-ray photoelectron spectroscopy (XPS) and N2-sorption studies, respectively. The SnO2 nanoparticle cluster matrix consists of tens of thousands of SnO2 nanoparticles with an ultra-small grain size estimated to be 3.0 nm. And there are abundant random-packed wormhole-like pores, caused by the inter-connection of the SnO2 nanoparticles, throughout each cluster. The platinum element is present in two forms including metal (Pt) and tetravalent metal oxide (PtO2) in the Pt activated SnO2 nanoparticle clusters. The as-synthesized pure and Pt activated SnO2 nanoparticle clusters were used to fabricate gas sensor devices. It was found that the gas response toward 500 ppm of ammonia was improved from 6.48 to 203.44 through the activation by Pt. And the results indicate that the sensor based on Pt activated SnO2 not only has ultrahigh sensitivity but also possesses good response-recovery properties, linear dependence, repeatability, selectivity and long-term stability, demonstrating the potential to use Pt activated SnO2 nanoparticle clusters as ammonia gas sensors. At the same time, the formation mechanisms of the unique nanoparticle clusters and highly enhanced sensitivity are also discussed.Pt activated SnO2 nanoparticle clusters were synthesized by a simple solvothermal method. The structure, morphology, chemical state and specific surface area were analyzed by X-ray powder diffraction (XRD), transmission electron microscopy (TEM), X-ray photoelectron spectroscopy (XPS) and N2-sorption studies, respectively. The SnO2 nanoparticle cluster matrix consists of tens of thousands of SnO2 nanoparticles with an ultra-small grain size estimated to be 3.0 nm. And there are abundant random-packed wormhole-like pores, caused by the inter

  16. Methane Activation Mediated by a Series of Cerium-Vanadium Bimetallic Oxide Cluster Cations: Tuning Reactivity by Doping.

    PubMed

    Ma, Jia-Bi; Meng, Jing-Heng; He, Sheng-Gui

    2016-04-18

    The reactions of cerium-vanadium cluster cations Cex Vy Oz (+) with CH4 are investigated by time-of-flight mass spectrometry and density functional theory calculations. (CeO2 )m (V2 O5 )n (+) clusters (m=1,2, n=1-5; m=3, n=1-4) with dimensions up to nanosize can abstract one hydrogen atom from CH4 . The theoretical study indicates that there are two types of active species in (CeO2 )m (V2 O5 )n (+) , V[(Ot )2 ](.) and [(Ob )2 CeOt ](.) (Ot and Ob represent terminal and bridging oxygen atoms, respectively); the former is less reactive than the latter. The experimentally observed size-dependent reactivities can be rationalized by considering the different active species and mechanisms. Interestingly, the reactivity of the (CeO2 )m (V2 O5 )n (+) clusters falls between those of (CeO2 )2-4 (+) and (V2 O5 )1-5 (+) in terms of C-H bond activation, thus the nature of the active species and the cluster reactivity can be effectively tuned by doping. PMID:26714587

  17. Assembly of Fe-substituted Dawson-type nanoscale selenotungstate clusters with photocatalytic H2 evolution activity.

    PubMed

    Chen, Wei-Chao; Qin, Chao; Wang, Xin-Long; Li, Yang-Guang; Zang, Hong-Ying; Jiao, Yan-Qing; Huang, Peng; Shao, Kui-Zhan; Su, Zhong-Min; Wang, En-Bo

    2014-11-11

    Two Fe-substituted Dawson-type nanoscale selenotungstate clusters, {Fe6Se6W34} and {Fe10Se8W62} involving {α-Se2W14} and {γ-Se2W14} building blocks, have been isolated, which exhibit photocatalytic H2 evolution activity. Their electrochemical behaviours and magnetic properties were also investigated. PMID:25232933

  18. Metabolic risk profiles created using cluster analysis are differentially associated with physical activity: The ARIC study

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Conditions such as hypertension, dyslipidemia, glucose intolerance, and obesity tend to cluster together and predict cardiovascular disease, type 2 diabetes, and premature mortality. This clustering has led to multiple definitions of the Metabolic Syndrome (MetS). While the definitions agree on the ...

  19. A systematic investigation of acetylene activation and hydracyanation of the activated acetylene on Aun (n = 3-10) clusters via density functional theory.

    PubMed

    Gautam, Seema; Sarkar, Abir De

    2016-05-18

    A systematic investigation of the selective catalytic conversion of poisonous HCN gas through hydracyanation of C2H2 activated on Au clusters, presented here for the first time, is of paramount importance from both scientific and technological perspectives. Hydracyanation of activated acetylene on an Au-cluster based catalyst leads to vinyl isocyanide (H2C[double bond, length as m-dash]CHNC) formation, a versatile chemical intermediate. Using density functional theory, bond activation of acetylene and selective catalytic hydracyanation of activated acetylene on small gold clusters Aun (n = 3-10) have been studied through a detailed analysis of the geometric and electronic structures. Different possible complexes of Aun-CHCH have been studied and two possible modes of adsorption of acetylene over the gold clusters, namely, the π- and di-σ modes, have been observed. The hydracyanation of the acetylene molecule is found to occur via the cleavage of one of acetylene triple bonds at the cost of formation of two Au-C bonds followed by the binding of HCN to the activated C[double bond, length as m-dash]C bond via nitrogen's lone pair. Preferential binding sites for HCN and C2H2 are analyzed through Fukui function calculations, frontier molecular orbital analysis and natural population charge distribution analysis. Based on adsorption energies, odd-sized Aun clusters are found to be significantly more favorable for C2H2 adsorption with the C-C bond stretching up to 1.31 Å with respect to the C-C triple bond length of 1.21 Å in the gas phase. The stretching frequency of adsorbed complexes, C2H2/Aun, (3460 cm(-1)), decreases notably relative to the frequency of the free acetylene molecule (7948 cm(-1)), which is a signature of the bond activation of the acetylene molecule over the Au clusters. The high adsorption energy of HCN on the Au9-C2H2 complex implies the considerable binding strength and activation of C2H2 and HCN on the Au9 clusters. Due to the importance of

  20. Redox Control of the Human Iron-Sulfur Repair Protein MitoNEET Activity via Its Iron-Sulfur Cluster.

    PubMed

    Golinelli-Cohen, Marie-Pierre; Lescop, Ewen; Mons, Cécile; Gonçalves, Sergio; Clémancey, Martin; Santolini, Jérôme; Guittet, Eric; Blondin, Geneviève; Latour, Jean-Marc; Bouton, Cécile

    2016-04-01

    Human mitoNEET (mNT) is the first identified Fe-S protein of the mammalian outer mitochondrial membrane. Recently, mNT has been implicated in cytosolic Fe-S repair of a key regulator of cellular iron homeostasis. Here, we aimed to decipher the mechanism by which mNT triggers its Fe-S repair capacity. By using tightly controlled reactions combined with complementary spectroscopic approaches, we have determined the differential roles played by both the redox state of the mNT cluster and dioxygen in cluster transfer and protein stability. We unambiguously demonstrated that only the oxidized state of the mNT cluster triggers cluster transfer to a generic acceptor protein and that dioxygen is neither required for the cluster transfer reaction nor does it affect the transfer rate. In the absence of apo-acceptors, a large fraction of the oxidized holo-mNT form is converted back to reduced holo-mNT under low oxygen tension. Reduced holo-mNT, which holds a [2Fe-2S](+)with a global protein fold similar to that of the oxidized form is, by contrast, resistant in losing its cluster or in transferring it. Our findings thus demonstrate that mNT uses an iron-based redox switch mechanism to regulate the transfer of its cluster. The oxidized state is the "active state," which reacts promptly to initiate Fe-S transfer independently of dioxygen, whereas the reduced state is a "dormant form." Finally, we propose that the redox-sensing function of mNT is a key component of the cellular adaptive response to help stress-sensitive Fe-S proteins recover from oxidative injury. PMID:26887944

  1. The Activity of Rabies Vaccines against Genetic Clusters of Rabies Virus Circulating at the Territory of Ukraine

    PubMed Central

    Ivanov, Mykola; Polupan, Ivan; Deryabin, Oleg

    2013-01-01

    Objective To identify the presence of genetic clusters of rabies virus at the territory of Ukraine and to determine the degree of activity of rabies vaccines against these genetic clusters. Introduction To develop and implement an effective program of rabies eradication in Ukraine in 2008 was founded the unique collection of samples of pathological materials confirmed as positive in rabies at the regional veterinary laboratories of Ukraine. The collection is constantly updated and to present moment it includes 1389 samples from all regions of Ukraine, selected from 17 animal species and humans. Methods Identification of the rabies virus in samples of pathological material for their further selection was carried out using the test developed by us which based on RT-PCR with primers complementary to the conservative fragments of the 5’-end of nucleoprotein gene of rabies virus. For the study of the street rabies virus isolates from the collection we use RT-PCR with the primers pair (509, 304) flanking the variable 3’-end part of nucleoprotein gene of the reference strain of rabies virus CVS (fragment in 377 bp). Studies of rabies vaccines activity were carried out with modified method of U.S. National Institutes of Health using rabies virus street isolates of both genetic clusters instead of the Challenge Virus Standard (CVS). All isolates of street rabies virus were inoculated in a dose of 5–50 LD50. The criteria for evaluation of protective activity of rabies vaccine was effective dose (− lg ED50). Results In molecular genetic studies with variant-specific primers we established the presence in Ukraine of two clusters of rabies virus. Clusters I circulates on the right bank of the Dnipro river (the largest water barrier that divides the country into eastern and western side), and cluster II – on the left bank of the Dnieper. The relationship of these variants with the epizootic situation was researched. For this purpose epizootological zoning of Ukraine

  2. Screen-based media use clusters are related to other activity behaviours and health indicators in adolescents

    PubMed Central

    2013-01-01

    Background Screen-based media (SBM) occupy a considerable portion of young peoples’ discretionary leisure time. The aim of this paper was to investigate whether distinct clusters of SBM use exist, and if so, to examine the relationship of any identified clusters with other activity/sedentary behaviours and physical and mental health indicators. Methods The data for this study come from 643 adolescents, aged 14 years, who were participating in the longitudinal Western Australian Pregnancy Cohort (Raine) Study through May 2003 to June 2006. Time spent on SBM, phone use and reading was assessed using the Multimedia Activity Recall for Children and Adults. Height, weight, muscle strength were measured at a clinic visit and the adolescents also completed questionnaires on their physical activity and psychosocial health. Latent class analysis (LCA) was used to analyse groupings of SBM use. Results Three clusters of SBM use were found; C1 ‘instrumental computer users’ (high email use, general computer use), C2 ‘multi-modal e-gamers’ (both high console and computer game use) and C3 ‘computer e-gamers’ (high computer game use only). Television viewing was moderately high amongst all the clusters. C2 males took fewer steps than their male peers in C1 and C3 (-13,787/week, 95% CI: -4619 to -22957, p = 0.003 and -14,806, 95% CI: -5,306 to -24,305, p = 0.002) and recorded less MVPA than the C1 males (-3.5 h, 95% CI: -1.0 to -5.9, p = 0.005). There was no difference in activity levels between females in clusters C1 and C3. Conclusion SBM use by adolescents did cluster and these clusters related differently to activity/sedentary behaviours and both physical and psychosocial health indicators. It is clear that SBM use is not a single construct and future research needs to take consideration of this if it intends to understand the impact SBM has on health. PMID:24330626

  3. High interfacial activity of polymers "grafted through" functionalized iron oxide nanoparticle clusters.

    PubMed

    Foster, Lynn M; Worthen, Andrew J; Foster, Edward L; Dong, Jiannan; Roach, Clarissa M; Metaxas, Athena E; Hardy, Clifford D; Larsen, Eric S; Bollinger, Jonathan A; Truskett, Thomas M; Bielawski, Christopher W; Johnston, Keith P

    2014-09-01

    The mechanism by which polymers, when grafted to inorganic nanoparticles, lower the interfacial tension at the oil-water interface is not well understood, despite the great interest in particle stabilized emulsions and foams. A simple and highly versatile free radical "grafting through" technique was used to bond high organic fractions (by weight) of poly(oligo(ethylene oxide) monomethyl ether methacrylate) onto iron oxide clusters, without the need for catalysts. In the resulting ∼1 μm hybrid particles, the inorganic cores and grafting architecture contribute to the high local concentration of grafted polymer chains to the dodecane/water interface to produce low interfacial tensions of only 0.003 w/v % (polymer and particle core). This "critical particle concentration" (CPC) for these hybrid inorganic/polymer amphiphilic particles to lower the interfacial tension by 36 mN/m was over 30-fold lower than the critical micelle concentration of the free polymer (without inorganic cores) to produce nearly the same interfacial tension. The low CPC is favored by the high adsorption energy (∼10(6) kBT) for the large ∼1 μm hybrid particles, the high local polymer concentration on the particles surfaces, and the ability of the deformable hybrid nanocluster cores as well as the polymer chains to conform to the interface. The nanocluster cores also increased the entanglement of the polymer chains in bulk DI water or synthetic seawater, producing a viscosity up to 35,000 cP at 0.01 s(-1), in contrast with only 600 cP for the free polymer. As a consequence of these interfacial and rheological properties, the hybrid particles stabilized oil-in-water emulsions at concentrations as low as 0.01 w/v %, with average drop sizes down to 30 μm. In contrast, the bulk viscosity was low for the free polymer, and it did not stabilize the emulsions. The ability to influence the interfacial activity and rheology of polymers upon grafting them to inorganic particles, including clusters

  4. Star Formation and AGN Activity in Galaxy Clusters from z=1-2: a Multi-Wavelength Analysis Featuring Herschel/PACS

    NASA Astrophysics Data System (ADS)

    Alberts, Stacey; Pope, Alexandra; Brodwin, Mark; Chung, Sun Mi; Cybulski, Ryan; Dey, Arjun; Eisenhardt, Peter R. M.; Galametz, Audrey; Gonzalez, Anthony H.; Jannuzi, Buell T.; Stanford, S. Adam; Snyder, Gregory F.; Stern, Daniel; Zeimann, Gregory R.

    2016-07-01

    We present a detailed, multi-wavelength study of star formation (SF) and active galactic nucleus (AGN) activity in 11 near-infrared (IR) selected, spectroscopically confirmed massive (≳1014 M ⊙) galaxy clusters at 1 < z < 1.75. Using new deep Herschel/PACS imaging, we characterize the optical to far-IR spectral energy distributions (SEDs) for IR-luminous cluster galaxies, finding that they can, on average, be well described by field galaxy templates. Identification and decomposition of AGNs through SED fittings allows us to include the contribution to cluster SF from AGN host galaxies. We quantify the star-forming fraction, dust-obscured SF rates (SFRs) and specific SFRs for cluster galaxies as a function of cluster-centric radius and redshift. In good agreement with previous studies, we find that SF in cluster galaxies at z ≳ 1.4 is largely consistent with field galaxies at similar epochs, indicating an era before significant quenching in the cluster cores (r < 0.5 Mpc). This is followed by a transition to lower SF activity as environmental quenching dominates by z ∼ 1. Enhanced SFRs are found in lower mass (10.1\\lt {log} {M}\\star /{M}ȯ \\lt 10.8) cluster galaxies. We find significant variation in SF from cluster to cluster within our uniformly selected sample, indicating that caution should be taken when evaluating individual clusters. We examine AGNs in clusters from z = 0.5–2, finding an excess AGN fraction at z ≳ 1, suggesting environmental triggering of AGNs during this epoch. We argue that our results—a transition from field-like to quenched SF, enhanced SF in lower mass galaxies in the cluster cores, and excess AGNs—are consistent with a co-evolution between SF and AGNs in clusters and an increased merger rate in massive halos at high redshift.

  5. Hydrogen activation, diffusion, and clustering on CeO₂(111): a DFT+U study.

    PubMed

    Fernández-Torre, Delia; Carrasco, Javier; Ganduglia-Pirovano, M Verónica; Pérez, Rubén

    2014-07-01

    We present a comprehensive density functional theory+U study of the mechanisms underlying the dissociation of molecular hydrogen, and diffusion and clustering of the resulting atomic species on the CeO2(111) surface. Contrary to a widely held view based solely on a previous theoretical prediction, our results show conclusively that H2 dissociation is an activated process with a large energy barrier ~1.0 eV that is not significantly affected by coverage or the presence of surface oxygen vacancies. The reaction proceeds through a local energy minimum--where the molecule is located close to one of the surface oxygen atoms and the H-H bond has been substantially weaken by the interaction with the substrate--, and a transition state where one H atom is attached to a surface O atom and the other H atom sits on-top of a Ce(4+) ion. In addition, we have explored how several factors, including H coverage, the location of Ce(3+) ions as well as the U value, may affect the chemisorption energy and the relative stability of isolated OH groups versus pair and trimer structures. The trimer stability at low H coverages and the larger upward relaxation of the surface O atoms within the OH groups are consistent with the assignment of the frequent experimental observation by non-contact atomic force and scanning tunneling microscopies of bright protrusions on three neighboring surface O atoms to a triple OH group. The diffusion path of isolated H atoms on the surface goes through the adsorption on-top of an oxygen in the third atomic layer with a large energy barrier of ~1.8 eV. Overall, the large energy barriers for both, molecular dissociation and atomic diffusion, are consistent with the high activity and selectivity found recently in the partial hydrogenation of acetylene catalyzed by ceria at high H2/C2H2 ratios. PMID:25005299

  6. Mitochondrial Iron-Sulfur Cluster Activity and Cytosolic Iron Regulate Iron Traffic in Saccharomyces cerevisiae.

    PubMed

    Wofford, Joshua D; Lindahl, Paul A

    2015-11-01

    An ordinary differential equation-based mathematical model was developed to describe trafficking and regulation of iron in growing fermenting budding yeast. Accordingly, environmental iron enters the cytosol and moves into mitochondria and vacuoles. Dilution caused by increasing cell volume is included. Four sites are regulated, including those in which iron is imported into the cytosol, mitochondria, and vacuoles, and the site at which vacuolar Fe(II) is oxidized to Fe(III). The objective of this study was to determine whether cytosolic iron (Fecyt) and/or a putative sulfur-based product of iron-sulfur cluster (ISC) activity was/were being sensed in regulation. The model assumes that the matrix of healthy mitochondria is anaerobic, and that in ISC mutants, O2 diffuses into the matrix where it reacts with nonheme high spin Fe(II) ions, oxidizing them to nanoparticles and generating reactive oxygen species. This reactivity causes a further decline in ISC/heme biosynthesis, which ultimately gives rise to the diseased state. The ordinary differential equations that define this model were numerically integrated, and concentrations of each component were plotted versus the concentration of iron in the growth medium and versus the rate of ISC/heme biosynthesis. Model parameters were optimized by fitting simulations to literature data. The model variant that assumed that both Fecyt and ISC biosynthesis activity were sensed in regulation mimicked observed behavior best. Such "dual sensing" probably arises in real cells because regulation involves assembly of an ISC on a cytosolic protein using Fecyt and a sulfur species generated in mitochondria during ISC biosynthesis and exported into the cytosol. PMID:26306041

  7. Star Formation Activity in a Young Galaxy Cluster at Z = 0.866

    NASA Astrophysics Data System (ADS)

    Laganá, T. F.; Ulmer, M. P.; Martins, L. P.; da Cunha, E.

    2016-07-01

    The galaxy cluster RX J1257+4738 at z = 0.866 is one of the highest redshift clusters with a richness of multi-wavelength data, and is thus a good target to study the star formation–density relation at early epochs. Using a sample of spectroscopically confirmed cluster members, we derive the star-formation rates (SFRs) of our galaxies using two methods: (1) the relation between SFR and total infrared luminosity extrapolated from the observed Spitzer Multiband Imaging Photometer for Spitzer 24 μm imaging data; and (2) spectral energy distribution fitting using the MAGPHYS code, including eight different bands. We show that, for this cluster, the SFR–density relation is very weak and seems to be dominated by the two central galaxies and the SFR presents a mild dependence on stellar mass, with more massive galaxies having higher SFR. However, the specific SFR (SSFR) decreases with stellar mass, meaning that more massive galaxies are forming fewer stars per unit of mass, and thus suggesting that the increase in star-forming members is driven by cluster assembly and infall. If the environment is somehow driving the star formation, one would expect a relation between the SSFR and the cluster centric distance, but that is not the case. A possible scenario to explain this lack of correlation is the contamination by infalling galaxies in the inner part of the cluster, which may be on their initial pass through the cluster center. As these galaxies have higher SFRs for their stellar mass, they enhance the mean SSFR in the center of the cluster.

  8. Asp1 from Schizosaccharomyces pombe binds a [2Fe-2S](2+) cluster which inhibits inositol pyrophosphate 1-phosphatase activity.

    PubMed

    Wang, Huanchen; Nair, Vasudha S; Holland, Ashley A; Capolicchio, Samanta; Jessen, Henning J; Johnson, Michael K; Shears, Stephen B

    2015-10-27

    Iron-sulfur (Fe-S) clusters are widely distributed protein cofactors that are vital to cellular biochemistry and the maintenance of bioenergetic homeostasis, but to our knowledge, they have never been identified in any phosphatase. Here, we describe an iron-sulfur cluster in Asp1, a dual-function kinase/phosphatase that regulates cell morphogenesis in Schizosaccharomyces pombe. Full-length Asp1, and its phosphatase domain (Asp1(371-920)), were each heterologously expressed in Escherichia coli. The phosphatase activity is exquisitely specific: it hydrolyzes the 1-diphosphate from just two members of the inositol pyrophosphate (PP-InsP) signaling family, namely, 1-InsP7 and 1,5-InsP8. We demonstrate that Asp1 does not hydrolyze either InsP6, 2-InsP7, 3-InsP7, 4-InsP7, 5-InsP7, 6-InsP7, or 3,5-InsP8. We also recorded 1-phosphatase activity in a human homologue of Asp1, hPPIP5K1, which was heterologously expressed in Drosophila S3 cells with a biotinylated N-terminal tag, and then isolated from cell lysates with avidin beads. Purified, recombinant Asp1(371-920) contained iron and acid-labile sulfide, but the stoichiometry (0.8 atoms of each per protein molecule) indicates incomplete iron-sulfur cluster assembly. We reconstituted the Fe-S cluster in vitro under anaerobic conditions, which increased the stoichiometry to approximately 2 atoms of iron and acid-labile sulfide per Asp1 molecule. The presence of a [2Fe-2S](2+) cluster in Asp1(371-920) was demonstrated by UV-visible absorption, resonance Raman spectroscopy, and electron paramagnetic resonance spectroscopy. We determined that this [2Fe-2S](2+) cluster is unlikely to participate in redox chemistry, since it rapidly degraded upon reduction by dithionite. Biochemical and mutagenic studies demonstrated that the [2Fe-2S](2+) cluster substantially inhibits the phosphatase activity of Asp1, thereby increasing its net kinase activity. PMID:26422458

  9. High-resolution imaging of the immunological synapse and T-cell receptor microclustering through microfabricated substrates

    PubMed Central

    Biggs, M. J. P.; Milone, M. C.; Santos, L. C.; Gondarenko, A.; Wind, S. J.

    2011-01-01

    T-cell activation via antigen presentation is associated with the formation of a macromolecular membrane assembly termed the immunological synapse (IS). The genesis of the IS and the onset of juxtacrine signalling is characterized by the formation of cell membrane microclusters and the organization of such into segregated microdomains. A central zone rich in T-cell receptor (TCR)–major histocompatibility complex microclusters termed the central supramolecular activation cluster (cSMAC) forms the bullseye of this structure, while the cellular interface surrounding the cSMAC is characterized by regions enriched in adhesion and co-stimulatory molecules. In vitro, the study of dynamic TCR microcluster coalescence and IS genesis in T-cell populations is hampered by cell migration within the culture system and resolution constraints resulting from lateral cell–cell contact. Here, we detail a novel system describing the fabrication of micropit arrays designed to sequester single T-cell–antigen presenting cell (APC) conjugates and promote IS formation in the horizontal imaging plane for high-resolution studies of microcluster dynamics. We subsequently use this system to describe the formation of the cSMAC in T-cell populations and to investigate the morphology of the interfacial APC membrane. PMID:21490003

  10. High reactivity of nanosized niobium oxide cluster cations in methane activation: A comparison with vanadium oxides.

    PubMed

    Ding, Xun-Lei; Wang, Dan; Wu, Xiao-Nan; Li, Zi-Yu; Zhao, Yan-Xia; He, Sheng-Gui

    2015-09-28

    The reactions between methane and niobium oxide cluster cations were studied and compared to those employing vanadium oxides. Hydrogen atom abstraction (HAA) reactions were identified over stoichiometric (Nb2O5)N(+) clusters for N as large as 14 with a time-of-flight mass spectrometer. The reactivity of (Nb2O5)N(+) clusters decreases as the N increases, and it is higher than that of (V 2O5)N(+) for N ≥ 4. Theoretical studies were conducted on (Nb2O5)N(+) (N = 2-6) by density functional calculations. HAA reactions on these clusters are all favorable thermodynamically and kinetically. The difference of the reactivity with respect to the cluster size and metal type (Nb vs V) was attributed to thermodynamics, kinetics, the electron capture ability, and the distribution of the unpaired spin density. Nanosized Nb oxide clusters show higher HAA reactivity than V oxides, indicating that niobia may serve as promising catalysts for practical methane conversion. PMID:26429016

  11. High reactivity of nanosized niobium oxide cluster cations in methane activation: A comparison with vanadium oxides

    SciTech Connect

    Ding, Xun-Lei E-mail: chemzyx@iccas.ac.cn; Wang, Dan; Wu, Xiao-Nan; Li, Zi-Yu; Zhao, Yan-Xia E-mail: chemzyx@iccas.ac.cn; He, Sheng-Gui

    2015-09-28

    The reactions between methane and niobium oxide cluster cations were studied and compared to those employing vanadium oxides. Hydrogen atom abstraction (HAA) reactions were identified over stoichiometric (Nb{sub 2}O{sub 5}){sub N}{sup +} clusters for N as large as 14 with a time-of-flight mass spectrometer. The reactivity of (Nb{sub 2}O{sub 5}){sub N}{sup +} clusters decreases as the N increases, and it is higher than that of (V {sub 2}O{sub 5}){sub N}{sup +} for N ≥ 4. Theoretical studies were conducted on (Nb{sub 2}O{sub 5}){sub N}{sup +} (N = 2–6) by density functional calculations. HAA reactions on these clusters are all favorable thermodynamically and kinetically. The difference of the reactivity with respect to the cluster size and metal type (Nb vs V) was attributed to thermodynamics, kinetics, the electron capture ability, and the distribution of the unpaired spin density. Nanosized Nb oxide clusters show higher HAA reactivity than V oxides, indicating that niobia may serve as promising catalysts for practical methane conversion.

  12. MC2: boosted AGN and star formation activity in CIZA J2242.8+5301, a massive post-merger cluster at z = 0.19

    NASA Astrophysics Data System (ADS)

    Sobral, David; Stroe, Andra; Dawson, William A.; Wittman, David; Jee, M. James; Röttgering, Huub; van Weeren, Reinout J.; Brüggen, Marcus

    2015-06-01

    Cluster mergers may play a fundamental role in the formation and evolution of cluster galaxies. Stroe et al. revealed unexpected overdensities of candidate Hα emitters near the ˜1-Mpc-wide shock fronts of the massive (˜2 × 1015 M⊙) `Sausage' merging cluster, CIZA J2242.8+5301. We used the Keck/Deep Imaging Multi-Object Spectrograph and the William Herschel Telescope/AutoFib2+WYFFOS to confirm 83 Hα emitters in and around the merging cluster. We find that cluster star-forming galaxies in the hottest X-ray gas and/or in the cluster subcores (away from the shock fronts) show high [S II]6716/[S II]6761 and high [S II] 6716/Hα, implying very low electron densities (<30 × lower than all other star-forming galaxies outside the cluster) and/or significant contribution from supernovae, respectively. All cluster star-forming galaxies near the cluster centre show evidence of significant outflows (blueshifted Na D ˜200-300 km s-1), likely driven by supernovae. Strong outflows are also found for the clusteractive galactic nucleus (AGN). Hα star-forming galaxies in the merging cluster follow the z ˜ 0 mass-metallicity relation, showing systematically higher metallicity (˜0.15-0.2 dex) than Hα emitters outside the cluster (projected R > 2.5 Mpc). This suggests that the shock front may have triggered remaining metal-rich gas which galaxies were able to retain into forming stars. Our observations show that the merger of impressively massive (˜1015 M⊙) clusters can provide the conditions for significant star formation and AGN activity, but, as we witness strong feedback by star-forming galaxies and AGN (and given how massive the merging cluster is), such sources will likely quench in a few 100 Myr.

  13. Intervention Effects on Adolescent Physical Activity in the Multicomponent SPACE Study: A Cluster Randomized Controlled Trial

    PubMed Central

    Toftager, Mette; Christiansen, Lars B.; Ersbøll, Annette K.; Kristensen, Peter L.; Due, Pernille; Troelsen, Jens

    2014-01-01

    Background Multicomponent school-based interventions have the potential to reduce the age-related decline in adolescents' physical activity (PA), yet there is not consistent evidence to guide non-curricular and school environment interventions. The aim of this study was to assess the effectiveness of a multicomponent environmental school-based intervention, designed to reduce the age-related decline in PA among adolescents. Methods A cluster randomized controlled trial was conducted with 7 intervention and 7 control schools. Baseline measurements were carried out in spring 2010 with 2 years of follow-up. A total of 1,348 students (11–13 years, in grade 5 and 6) enrolled in the study at baseline. The 14 schools included in the study were located in the Region of Southern Denmark. The intervention consisted of organizational and physical changes in the school environment with a total of 11 intervention components. The primary outcome measure was overall PA (cpm, counts per minute) and was supported by analyses of time spent in MVPA, and time spent sedentary. Furthermore, a secondary outcome measure was PA in school time and during recess. PA was measured using accelerometer (Actigraph GT3X). Results A total of 797 students completed the trial and had valid accelerometer data. No significant difference was found for overall PA with an adjusted difference of −19.1 cpm (95% CI: −93, 53) or for school time activity with an adjusted difference of 6 cpm (95% CI: −73, 85). A sensitivity analysis revealed a positive significant intervention effect of PA in recess with an adjusted difference of 95 cpm. Conclusions No evidence was found of the overall effect of a non-curricular multicomponent school-based intervention on PA among Danish adolescents. The intervention was positively associated with PA during school time and recess, however, with small estimates. Lack of effect on overall PA could be due to both program theory and different degrees of implementation

  14. Serum paraoxonase activity is associated with variants in the PON gene cluster and risk of Alzheimer disease.

    PubMed

    Erlich, Porat M; Lunetta, Kathryn L; Cupples, L Adrienne; Abraham, Carmela R; Green, Robert C; Baldwin, Clinton T; Farrer, Lindsay A

    2012-05-01

    Previous studies have shown association of single nucleotide polymorphisms (SNPs) in 3 contiguous genes (PON1, PON2, and PON3) encoding paraoxonase with risk of Alzheimer disease (AD). We evaluated the association of serum paraoxonase activity measured by phenyl acetate (PA) and thiobutyl butyrolactone (TBBL) with risk of AD and with 26 SNPs spanning the PON gene cluster in 266 AD cases and 306 sibling controls from the MIRAGE study. The odds of AD (adjusted for age, gender, and ethnicity) increased 20% for each standard deviation decrease in PA or TBBL activity. There were association signals with activity in all 3 genes. Haplotypes including SNPs spanning the PON genes were generally more significant than haplotypes comprising SNPs from 1 gene. Significant interactions were observed between SNP pairs located across the PON cluster with either serum activity measure as the outcome, and between several PON SNPs and PA activity with AD status as the outcome. Our results suggest that low serum paraoxonase activity is a risk factor for AD. Furthermore, multiple variants in PON influence serum paraoxonase activity and their effects may be synergistic. PMID:20980077

  15. An Introduction to the New Data Streaming and Data Mining Services Provided by the ESA Cluster Active Archive

    NASA Astrophysics Data System (ADS)

    Perry, C. H.; McCaffrey, S.; Laakso, H. E.; Taylor, M. G.

    2011-12-01

    The Cluster Active Archive has been operating since 2006 and is the principal repository for high quality data from the European Space Agency's cornerstone space physics Cluster mission. The archive holds nearly 10 years of high resolution in-situ plasma, particles and waves data from the 11 instruments on each of the four Cluster spacecraft. The archive has more than 1200 registered users and includes processed science data amounting to tens of terabytes of time series data divided into around 1400 logical datasets. We present an introduction to the capabilities and implementation of two new web based services that have been developed to enhance access to the archive data holdings and to assisting science users in locating intervals of scientific interest. i. The new data streaming service supports requests for arbitrary lengths of time series data from a single dataset and supplements the existing web GUI and machine interfaces. The service is primarily aimed at science tool developers who want a simple REST based mechanism to load Cluster data into their application. ii. The data mining service, which makes use of the streaming interface, allows the construction of complex conditions incorporating multiple datasets to identify lists of time intervals of interest for further analysis. For example searching a year of data for tail crossings (identified by rapid change in the azimuth direction of the magnetic field), when the spacecraft is in Burst Mode involves joining three independent datasets and takes about 30 seconds.

  16. Synthesis and SAR requirements of adamantane-colchicine conjugates with both microtubule depolymerizing and tubulin clustering activities.

    PubMed

    Zefirova, Olga N; Nurieva, Evgeniya V; Shishov, Dmitrii V; Baskin, Igor I; Fuchs, Fabian; Lemcke, Heiko; Schröder, Fabian; Weiss, Dieter G; Zefirov, Nikolay S; Kuznetsov, Sergei A

    2011-09-15

    A series of analogues of conjugate 1, combining an adamantane-based paclitaxel (taxol) mimetic with colchicine was synthesized and tested for cytotoxicity in a cell-based assay with the human lung carcinoma cell line A549. The most active compounds (10 EC(50) 2 ± 1.0 nM, 23 EC(50) 6 ± 1.4 nM, 26 EC(50) 5 ± 1.8 nM, 28 EC(50) 11 ± 1.7 nM, 30 EC(50) 4.8 ± 0.5 nM) were found to interfere with the microtubule dynamics in an interesting manner. Treatment of the cells with these compounds promoted disassembly of microtubules followed by the formation of stable tubulin clusters. Structure-activity relationships for the analogues of 23 revealed the sensitivity of both cytotoxicity and tubulin clustering ability to the linker length. The presence of adamantane (or another bulky hydrophobic and non-aromatic moiety) in 23 was found to play an important role in the formation of tubulin clusters. Structural requirements for optimal activity have been partially explained by molecular modeling. PMID:21873068

  17. Activation and Transformation of Ethane by Au2 VO3(+) Clusters with Closed-Shell Electronic Structures.

    PubMed

    Li, Ya-Ke; Li, Zi-Yu; Zhao, Yan-Xia; Liu, Qing-Yu; Meng, Jing-Heng; He, Sheng-Gui

    2016-01-26

    The study of chemical reactions between gold-containing heteronuclear oxide clusters and small molecules can provide molecular level mechanisms to understand the excellent activity of gold supported by metal oxides. While the promotion role of gold in alkane transformation was identified in the clusters with atomic oxygen radicals (O(-.)), the role of gold in the systems without O(-.) is not clear. By employing mass spectrometry and quantum chemistry calculations, the reactivity of Au2 VO3(+) clusters with closed-shell electronic structures toward ethane was explored. Both the dehydrogenation and ethene elimination channels were identified. It is gold rather than oxygen species initiating the C-H activation. The Au-Au dimer formed during the reactions plays important roles in ethane transformation. The reactivity comparison between Au2 VO3(+) and bare Au2(+) demonstrates that Au2 VO3(+) not only retains the property of bare Au2(+) that transforming ethane to dihydrogen, but also exhibits new functions in converting ethane to ethene, which reveals the importance of the composite system. This study provides a further understanding of the reactivity of metal oxide supported gold in alkane activation and transformation. PMID:26679978

  18. Costimulation with anti-cluster of differentiation 3 and anti-cluster of differentiation 28 reduces the activity of mucin 1-stimulated human mononuclear cells

    PubMed Central

    WRIGHT, STEPHEN E.; REWERS-FELKINS, KATHLEEN A.; QUINLIN, IMELDA; ZOHRA, FATEMA; AHMED, JEWEL

    2016-01-01

    Cytotoxic T-lymphocyte activation and extension of the cell life span is necessary in order to enable immunotherapy to perform effectively against cancer. In the present study, mucin 1 (MUC1)-stimulated human mononuclear cells (M1SHMCs) were costimulated with bead-attached monoclonal antibodies specific for cluster of differentiation (CD)3 and CD28 receptors. The study was undertaken to determine whether costimulation was capable of enhancing the killing of cancer cells in vitro and of protecting non-obese diabetic severe combined immunodeficient mice from tumor development. Lysis of MCF-7 tumor cells by M1SHMCs was reduced following costimulation with anti-CD3 and anti-CD28. Furthermore, costimulation with anti-CD3 and anti-CD28 eliminated the protective effects of M1SHMCs on MCF-7 breast cancer cell growth in the non-obese diabetic severe combined immunodeficient mice. The present study suggested that costimulation with anti-CD3 and anti-CD28 is not advisable following antigen activation of lymphocytes under the conditions used here. Using a lower anti-CD3/CD28 bead to T-cell ratio may prevent immune suppression, however, further studies are required to support this hypothesis. PMID:26870234

  19. Phosphatidylinositol 4,5-bisphosphate triggers activation of focal adhesion kinase by inducing clustering and conformational changes.

    PubMed

    Goñi, Guillermina M; Epifano, Carolina; Boskovic, Jasminka; Camacho-Artacho, Marta; Zhou, Jing; Bronowska, Agnieszka; Martín, M Teresa; Eck, Michael J; Kremer, Leonor; Gräter, Frauke; Gervasio, Francesco Luigi; Perez-Moreno, Mirna; Lietha, Daniel

    2014-08-01

    Focal adhesion kinase (FAK) is a nonreceptor tyrosine kinase (NRTK) with key roles in integrating growth and cell matrix adhesion signals, and FAK is a major driver of invasion and metastasis in cancer. Cell adhesion via integrin receptors is well known to trigger FAK signaling, and many of the players involved are known; however, mechanistically, FAK activation is not understood. Here, using a multidisciplinary approach, including biochemical, biophysical, structural, computational, and cell biology approaches, we provide a detailed view of a multistep activation mechanism of FAK initiated by phosphatidylinositol-4,5-bisphosphate [PI(4,5)P2]. Interestingly, the mechanism differs from canonical NRTK activation and is tailored to the dual catalytic and scaffolding function of FAK. We find PI(4,5)P2 induces clustering of FAK on the lipid bilayer by binding a basic region in the regulatory 4.1, ezrin, radixin, moesin homology (FERM) domain. In these clusters, PI(4,5)P2 induces a partially open FAK conformation where the autophosphorylation site is exposed, facilitating efficient autophosphorylation and subsequent Src recruitment. However, PI(4,5)P2 does not release autoinhibitory interactions; rather, Src phosphorylation of the activation loop in FAK results in release of the FERM/kinase tether and full catalytic activation. We propose that PI(4,5)P2 and its generation in focal adhesions by the enzyme phosphatidylinositol 4-phosphate 5-kinase type Iγ are important in linking integrin signaling to FAK activation. PMID:25049397

  20. Phosphatidylinositol 4,5-bisphosphate triggers activation of focal adhesion kinase by inducing clustering and conformational changes

    PubMed Central

    Goñi, Guillermina M.; Epifano, Carolina; Boskovic, Jasminka; Camacho-Artacho, Marta; Zhou, Jing; Bronowska, Agnieszka; Martín, M. Teresa; Eck, Michael J.; Kremer, Leonor; Gräter, Frauke; Gervasio, Francesco Luigi; Perez-Moreno, Mirna; Lietha, Daniel

    2014-01-01

    Focal adhesion kinase (FAK) is a nonreceptor tyrosine kinase (NRTK) with key roles in integrating growth and cell matrix adhesion signals, and FAK is a major driver of invasion and metastasis in cancer. Cell adhesion via integrin receptors is well known to trigger FAK signaling, and many of the players involved are known; however, mechanistically, FAK activation is not understood. Here, using a multidisciplinary approach, including biochemical, biophysical, structural, computational, and cell biology approaches, we provide a detailed view of a multistep activation mechanism of FAK initiated by phosphatidylinositol-4,5-bisphosphate [PI(4,5)P2]. Interestingly, the mechanism differs from canonical NRTK activation and is tailored to the dual catalytic and scaffolding function of FAK. We find PI(4,5)P2 induces clustering of FAK on the lipid bilayer by binding a basic region in the regulatory 4.1, ezrin, radixin, moesin homology (FERM) domain. In these clusters, PI(4,5)P2 induces a partially open FAK conformation where the autophosphorylation site is exposed, facilitating efficient autophosphorylation and subsequent Src recruitment. However, PI(4,5)P2 does not release autoinhibitory interactions; rather, Src phosphorylation of the activation loop in FAK results in release of the FERM/kinase tether and full catalytic activation. We propose that PI(4,5)P2 and its generation in focal adhesions by the enzyme phosphatidylinositol 4-phosphate 5-kinase type Iγ are important in linking integrin signaling to FAK activation. PMID:25049397

  1. Near infrared emission from molecule-like silver clusters confined in zeolite A assisted by thermal activation

    SciTech Connect

    Lin, Hui Imakita, Kenji; Rong Gui, Sa Chu; Fujii, Minoru

    2014-07-07

    Strong and broad near infrared (NIR) emission peaked at ~855 nm upon optimal excitation at 342 nm has been observed from molecule-like silver clusters (MLSCs) confined in zeolite A assisted by thermal activation. To the best of our knowledge, this is the first observation of NIR emission peaked at longer than 800 nm from MLSCs confined in solid matrices. The decay time of the NIR emission is over 10 μs, which indicates that it is a spin-forbidden transition. The ~855 nm NIR emission shows strong dependence on the silver loading concentration and the thermal activation temperature.

  2. Advancing Water and Water-Energy-Food Cluster Activities within Future Earth

    NASA Astrophysics Data System (ADS)

    Lawford, R. G.; Bhaduri, A.; Pahl-Wostl, C.

    2014-12-01

    In building its emerging program, Future Earth has encouraged former Earth System Science Partnership (ESSP) projects to redefine their objectives, priorities and problem approaches so they are aligned with those of Future Earth. These new projects will be characterized by more integrated applications of natural and social sciences as well as dialogue and science integrated across disciplinary boundaries to address a wide range of environmental and social issues. The Global Water System Project (GWSP) has had a heritage of integrating natural and social sciences, and recently started to also look at issues within the Water-Energy-Food (WEF) cluster using similar integrated approaches. As part of the growth of the scientific elements of this cluster, GWSP has approached Future Earth opportunities by addressing the sustainability for Water, Energy, and Food through integrated water information and improved governance.In this presentation the approaches being considered for promoting integration in both water and the WEF cluster will be discussed. In particular, potential contributions of Future Earth to research related to the use and management of water and to issues and science underpinning the W-E-F nexus deliberations will be identified. In both cases the increasing ability to utilize Earth observations and big data will advance this research agenda. In addition, the better understanding of the implications of governance structures in addressing these issues and the options for harmonizing the use of scientific knowledge and technological advances will be explored. For example, insights gained from water management studies undertaken within the GWSP are helping to focus plans for a "sustainable water futures" project and a WEF cluster within Future Earth. The potential role of the Sustainable Development Goals in bringing together the monitoring and science capabilities, and understanding of governance approaches, will be discussed as a framework for facilitating

  3. MET18 Connects the Cytosolic Iron-Sulfur Cluster Assembly Pathway to Active DNA Demethylation in Arabidopsis

    PubMed Central

    Tang, Kai; Zhang, Huiming; Mangrauthia, Satendra K.; Lei, Mingguang; Hsu, Chuan-Chih; Hou, Yueh-Ju; Wang, Chunguo; Li, Yan; Tao, W. Andy; Zhu, Jian-Kang

    2015-01-01

    DNA demethylation mediated by the DNA glycosylase ROS1 helps determine genomic DNA methylation patterns and protects active genes from being silenced. However, little is known about the mechanism of regulation of ROS1 enzymatic activity. Using a forward genetic screen, we identified an anti-silencing (ASI) factor, ASI3, the dysfunction of which causes transgene promoter hyper-methylation and silencing. Map-based cloning identified ASI3 as MET18, a component of the cytosolic iron-sulfur cluster assembly (CIA) pathway. Mutation in MET18 leads to hyper-methylation at thousands of genomic loci, the majority of which overlap with hypermethylated loci identified in ros1 and ros1dml2dml3 mutants. Affinity purification followed by mass spectrometry indicated that ROS1 physically associates with MET18 and other CIA components. Yeast two-hybrid and split luciferase assays showed that ROS1 can directly interact with MET18 and another CIA component, AE7. Site-directed mutagenesis of ROS1 indicated that the conserved iron-sulfur motif is indispensable for ROS1 enzymatic activity. Our results suggest that ROS1-mediated active DNA demethylation requires MET18-dependent transfer of the iron-sulfur cluster, highlighting an important role of the CIA pathway in epigenetic regulation. PMID:26492035

  4. MET18 Connects the Cytosolic Iron-Sulfur Cluster Assembly Pathway to Active DNA Demethylation in Arabidopsis.

    PubMed

    Duan, Cheng-Guo; Wang, Xingang; Tang, Kai; Zhang, Huiming; Mangrauthia, Satendra K; Lei, Mingguang; Hsu, Chuan-Chih; Hou, Yueh-Ju; Wang, Chunguo; Li, Yan; Tao, W Andy; Zhu, Jian-Kang

    2015-10-01

    DNA demethylation mediated by the DNA glycosylase ROS1 helps determine genomic DNA methylation patterns and protects active genes from being silenced. However, little is known about the mechanism of regulation of ROS1 enzymatic activity. Using a forward genetic screen, we identified an anti-silencing (ASI) factor, ASI3, the dysfunction of which causes transgene promoter hyper-methylation and silencing. Map-based cloning identified ASI3 as MET18, a component of the cytosolic iron-sulfur cluster assembly (CIA) pathway. Mutation in MET18 leads to hyper-methylation at thousands of genomic loci, the majority of which overlap with hypermethylated loci identified in ros1 and ros1dml2dml3 mutants. Affinity purification followed by mass spectrometry indicated that ROS1 physically associates with MET18 and other CIA components. Yeast two-hybrid and split luciferase assays showed that ROS1 can directly interact with MET18 and another CIA component, AE7. Site-directed mutagenesis of ROS1 indicated that the conserved iron-sulfur motif is indispensable for ROS1 enzymatic activity. Our results suggest that ROS1-mediated active DNA demethylation requires MET18-dependent transfer of the iron-sulfur cluster, highlighting an important role of the CIA pathway in epigenetic regulation. PMID:26492035

  5. Clustering Analysis of OFFICER'S Behaviours in London Police Foot Patrol Activities

    NASA Astrophysics Data System (ADS)

    Shen, J.; Cheng, T.

    2015-07-01

    In this small paper we aim at presenting a framework of conceptual representation and clustering analysis of police officers' patrol pattern obtained from mining their raw movement trajectory data. This have been achieved by a model developed to accounts for the spatio-temporal dynamics human movements by incorporating both the behaviour features of the travellers and the semantic meaning of the environment they are moving in. Hence, the similarity metric of traveller behaviours is jointly defined according to the stay time allocation in each Spatio-temporal region of interests (ST-ROI) to support clustering analysis of patrol behaviours. The proposed framework enables the analysis of behaviour and preferences on higher level based on raw moment trajectories. The model is firstly applied to police patrol data provided by the Metropolitan Police and will be tested by other type of dataset afterwards.

  6. Growth of fluorescence gold clusters using photo-chemically activated ligands

    NASA Astrophysics Data System (ADS)

    Mishra, Dinesh; Aldeek, Fadi; Michael, Serge; Palui, Goutam; Mattoussi, Hedi

    2016-03-01

    Ligands made of lipoic acid (LA) appended with a polyethylene glycol (PEG) chain have been used in the aqueous phase growth of luminescent gold clusters with distinct emission from yellow to near-IR, using two different routes. In the first route, the gold-ligand complex was chemically reduced using sodium borohydride in alkaline medium, which gave near- IR luminescent gold clusters with maximum emission around 745 nm. In the second method, LA-PEG ligand was photochemically modified to a mixture of thiols, oligomers and oxygenated species under UV-irradiation, which was then used as both reducing agent and stabilizing ligand. By adjusting the pH, temperature, and time of the reaction, we were able to obtain clusters with two distinct emission properties. Refluxing the gold-ligand complex in alkaline medium in the presence of excess ligand gave yellow emission within the first two hours and the emission shifted to red after overnight reaction. Mass spectrometry and chemical assay were used to understand the photo-chemical transformation of Lipoic Acid (LA). Mass spectroscopic studies showed the photo-irradiated product contains thiols, oligomers (dimers, trimers and tetramers) as well as oxygenated species. The amount of thiol formed under different conditions of irradiation was estimated using Ellman's assay.

  7. The formation of the brightest cluster galaxies in cosmological simulations: the case for active galactic nucleus feedback

    NASA Astrophysics Data System (ADS)

    Martizzi, Davide; Teyssier, Romain; Moore, Ben

    2012-03-01

    We use 500 pc resolution cosmological simulations of a Virgo-like galaxy cluster to study the properties of the brightest cluster galaxy (BCG) that forms at the centre of the halo. We compared two simulations; one incorporating only supernova feedback and a second that also includes prescriptions for black hole growth and the resulting active galactic nucleus (AGN) feedback from gas accretion. As previous work has shown, with supernova feedback alone we are unable to reproduce any of the observed properties of massive cluster ellipticals. The resulting BCG rotates quickly, has a high Sérsic index, a strong mass excess in the centre and a total central density profile falling more steeply than isothermal. Furthermore, it is far too efficient at converting most of the available baryons into stars which is strongly constrained by abundance matching. With a treatment of black hole dynamics and AGN feedback the BCG properties are in good agreement with data: they rotate slowly, have a cored surface density profile, a flat or rising velocity dispersion profile and a low stellar mass fraction. The AGN provides a new mechanism to create cores in luminous elliptical galaxies; the core expands due to the combined effects of heating from dynamical friction of sinking massive black holes and AGN feedback that ejects gaseous material from the central regions.

  8. Two- and four-component relativistic generalized-active-space coupled cluster method: implementation and application to BiH.

    PubMed

    Sørensen, Lasse K; Olsen, Jeppe; Fleig, Timo

    2011-06-01

    A string-based coupled-cluster method of general excitation rank and with optimal scaling which accounts for special relativity within the four-component framework is presented. The method opens the way for the treatment of multi-reference problems through an active-space inspired single-reference based state-selective expansion of the model space. The evaluation of the coupled-cluster vector function is implemented by considering contractions of elementary second-quantized operators without setting up the amplitude equations explicitly. The capabilities of the new method are demonstrated in application to the electronic ground state of the bismuth monohydride molecule. In these calculations simulated multi-reference expansions with both doubles and triples excitations into the external space as well as the regular coupled-cluster hierarchy up to full quadruples excitations are compared. The importance of atomic outer core-correlation for obtaining accurate results is shown. Comparison to the non-relativistic framework is performed throughout to illustrate the additional work of the transition to the four-component relativistic framework both in implementation and application. Furthermore, an evaluation of the highest order scaling for general-order expansions is presented. PMID:21663339

  9. Visible light photocatalytic activity of rutile TiO2 fiber clusters in the degradation of terephthalic acid

    NASA Astrophysics Data System (ADS)

    Yener, H. Banu; Helvacı, Şerife Ş.

    2015-09-01

    Rutile TiO2 nanoparticles, in different structural and morphological properties, were produced by the hydrolysis of titanium tetrachloride in a highly acidic reaction media at moderate temperatures without calcination. Their photocatalytic activities were investigated in the liquid-phase degradation of terephthalic acid under visible light illumination. The parameters, which are the concentration of the titanium tetrachloride solution (0.1-1 M) and reaction temperature (60-95 °C), effective on the properties of the particles, and their photocatalytic performances, were investigated. The XRD patterns indicated a pure rutile crystal structure at moderate temperatures without need of calcination. The FEGSEM images showed the formation of flower-, pinecone-, and sphere-like clusters consisting of interconnected nanofibers. The N2 adsorption-desorption isotherms pointed out the microporous structure of the clusters. Band gap energies were found to be varying between 3.02 and 3.08 eV due to the well-developed rutile crystallite structure. Systematic studies elucidated that the optimum reactant concentration and reaction temperature are 0.5 M TiCl4 and 95 °C, respectively. The rutile clusters synthesized at the optimum reaction conditions exhibited 99 % of the photocatalytic degradation of TPA under visible light illumination at shorter irradiation times compared with commercial P25 TiO2.

  10. A Minimal Nitrogen Fixation Gene Cluster from Paenibacillus sp. WLY78 Enables Expression of Active Nitrogenase in Escherichia coli

    PubMed Central

    Zhao, Dehua; Liu, Xiaomeng; Zhang, Bo; Xie, Jianbo; Hong, Yuanyuan; Li, Pengfei; Chen, Sanfeng; Dixon, Ray; Li, Jilun

    2013-01-01

    Most biological nitrogen fixation is catalyzed by molybdenum-dependent nitrogenase, an enzyme complex comprising two component proteins that contains three different metalloclusters. Diazotrophs contain a common core of nitrogen fixation nif genes that encode the structural subunits of the enzyme and components required to synthesize the metalloclusters. However, the complement of nif genes required to enable diazotrophic growth varies significantly amongst nitrogen fixing bacteria and archaea. In this study, we identified a minimal nif gene cluster consisting of nine nif genes in the genome of Paenibacillus sp. WLY78, a gram-positive, facultative anaerobe isolated from the rhizosphere of bamboo. We demonstrate that the nif genes in this organism are organized as an operon comprising nifB, nifH, nifD, nifK, nifE, nifN, nifX, hesA and nifV and that the nif cluster is under the control of a σ70 (σA)-dependent promoter located upstream of nifB. To investigate genetic requirements for diazotrophy, we transferred the Paenibacillus nif cluster to Escherichia coli. The minimal nif gene cluster enables synthesis of catalytically active nitrogenase in this host, when expressed either from the native nifB promoter or from the T7 promoter. Deletion analysis indicates that in addition to the core nif genes, hesA plays an important role in nitrogen fixation and is responsive to the availability of molybdenum. Whereas nif transcription in Paenibacillus is regulated in response to nitrogen availability and by the external oxygen concentration, transcription from the nifB promoter is constitutive in E. coli, indicating that negative regulation of nif transcription is bypassed in the heterologous host. This study demonstrates the potential for engineering nitrogen fixation in a non-nitrogen fixing organism with a minimum set of nine nif genes. PMID:24146630

  11. A Cluster Of Activities On Coma From The Hubble Space Telescope, StarDate, And McDonald Observatory

    NASA Astrophysics Data System (ADS)

    Hemenway, Mary Kay; Jogee, S.; Fricke, K.; Preston, S.

    2011-01-01

    With a goal of providing a vast audience of students, teachers, the general public, and Spanish-speakers with activities to learn about research on the Coma cluster of galaxies based on the HST ACS Treasury survey of Coma, McDonald Observatory used a many-faceted approach. Since this research offered an unprecedented legacy dataset, part of the challenge was to convey the importance of this project to a diverse audience. The methodology was to create different products for different (overlapping) audiences. Five radio programs were produced in English and Spanish for distribution on over 500 radio stations in the US and Mexico with a listening audience of over 2 million; in addition to the radio listeners, there were over 13,000 downloads of the English scripts and almost 6000 of the Spanish. Images were prepared for use in the StarDate Online Astronomy Picture of the Week, for ViewSpace (used in museums), and for the StarDate/Universo Teacher Guide. A high-school level activity on the Coma Cluster was prepared and distributed both on-line and in an upgraded printed version of the StarDate/Universo Teacher Guide. This guide has been distributed to over 1700 teachers nationally. A YouTube video about careers and research in astronomy using the Coma cluster as an example was produced. Just as the activities were varied, so were the evaluation methods. This material is based upon work supported by the National Aeronautics and Space Administration under Grant/Contract/Agreement No. HST-EO-10861.35-A issued through the Space Telescope Science Institute, which is operated by the Association of Universities for Research in Astronomy, Inc., under NASA contract NAS5-26555.

  12. Large-conductance calcium-activated potassium channels in purkinje cell plasma membranes are clustered at sites of hypolemmal microdomains.

    PubMed

    Kaufmann, Walter A; Ferraguti, Francesco; Fukazawa, Yugo; Kasugai, Yu; Shigemoto, Ryuichi; Laake, Petter; Sexton, Joseph A; Ruth, Peter; Wietzorrek, Georg; Knaus, Hans-Günther; Storm, Johan F; Ottersen, Ole Petter

    2009-07-10

    Calcium-activated potassium channels have been shown to be critically involved in neuronal function, but an elucidation of their detailed roles awaits identification of the microdomains where they are located. This study was undertaken to unravel the precise subcellular distribution of the large-conductance calcium-activated potassium channels (called BK, KCa1.1, or Slo1) in the somatodendritic compartment of cerebellar Purkinje cells by means of postembedding immunogold cytochemistry and SDS-digested freeze-fracture replica labeling (SDS-FRL). We found BK channels to be unevenly distributed over the Purkinje cell plasma membrane. At distal dendritic compartments, BK channels were scattered over the plasma membrane of dendritic shafts and spines but absent from postsynaptic densities. At the soma and proximal dendrites, BK channels formed two distinct pools. One pool was scattered over the plasma membrane, whereas the other pool was clustered in plasma membrane domains overlying subsurface cisterns. The labeling density ratio of clustered to scattered channels was about 60:1, established in SDS-FRL. Subsurface cisterns, also called hypolemmal cisterns, are subcompartments of the endoplasmic reticulum likely representing calciosomes that unload and refill Ca2+ independently. Purkinje cell subsurface cisterns are enriched in inositol 1,4,5-triphosphate receptors that mediate the effects of several neurotransmitters, hormones, and growth factors by releasing Ca2+ into the cytosol, generating local Ca2+ sparks. Such increases in cytosolic [Ca2+] may be sufficient for BK channel activation. Clustered BK channels in the plasma membrane may thus participate in building a functional unit (plasmerosome) with the underlying calciosome that contributes significantly to local signaling in Purkinje cells. PMID:19412945

  13. IUE observations of rapidly rotating low-mass stars in young clusters - The relation between chromospheric activity and rotation

    NASA Technical Reports Server (NTRS)

    Simon, Theodore

    1990-01-01

    If the rapid spindown of low-mass stars immediately following their arrival on the ZAMS results from magnetic braking by coronal winds, an equally sharp decline in their chromospheric emission may be expected. To search for evidence of this effect, the IUE spacecraft was used to observe the chromospheric Mg II emission lines of G-M dwarfs in the nearby IC 2391, Alpha Persei, Pleiades, and Hyades clusters. Similar observations were made of a group of X-ray-selected 'naked' T Tauri stars in Taurus-Auriga. The existence of a decline in activity cannot be confirmed from the resulting data. However, the strength of the chromospheric emission in the Mg II lines of the cluster stars is found to be correlated with rotation rate, being strongest for the stars with the shortest rotation periods and weakest for those with the longest periods. This provides indirect support for such an evolutionary change in activity. Chromospheric activity may thus be only an implicit function of age.

  14. Acoustic Cluster Therapy: In Vitro and Ex Vivo Measurement of Activated Bubble Size Distribution and Temporal Dynamics.

    PubMed

    Healey, Andrew John; Sontum, Per Christian; Kvåle, Svein; Eriksen, Morten; Bendiksen, Ragnar; Tornes, Audun; Østensen, Jonny

    2016-05-01

    Acoustic cluster technology (ACT) is a two-component, microparticle formulation platform being developed for ultrasound-mediated drug delivery. Sonazoid microbubbles, which have a negative surface charge, are mixed with micron-sized perfluoromethylcyclopentane droplets stabilized with a positively charged surface membrane to form microbubble/microdroplet clusters. On exposure to ultrasound, the oil undergoes a phase change to the gaseous state, generating 20- to 40-μm ACT bubbles. An acoustic transmission technique is used to measure absorption and velocity dispersion of the ACT bubbles. An inversion technique computes bubble size population with temporal resolution of seconds. Bubble populations are measured both in vitro and in vivo after activation within the cardiac chambers of a dog model, with catheter-based flow through an extracorporeal measurement flow chamber. Volume-weighted mean diameter in arterial blood after activation in the left ventricle was 22 μm, with no bubbles >44 μm in diameter. After intravenous administration, 24.4% of the oil is activated in the cardiac chambers. PMID:26831341

  15. Analysis of HSC activity and compensatory Hox gene expression profile in Hoxb cluster mutant fetal liver cells.

    PubMed

    Bijl, Janet; Thompson, Alexander; Ramirez-Solis, Ramiro; Krosl, Jana; Grier, David G; Lawrence, H Jeffrey; Sauvageau, Guy

    2006-07-01

    Overexpression of Hoxb4 in bone marrow cells promotes expansion of hematopoietic stem cell (HSC) populations in vivo and in vitro, indicating that this homeoprotein can activate the genetic program that determines self-renewal. However, this function cannot be solely attributed to Hoxb4 because Hoxb4(-/-) mice are viable and have an apparently normal HSC number. Quantitative polymerase chain reaction analysis showed that Hoxb4(-/-) c-Kit+ fetal liver cells expressed moderately higher levels of several Hoxb cluster genes than control cells, raising the possibility that normal HSC activity in Hoxb4(-/-) mice is due to a compensatory up-regulation of other Hoxb genes. In this study, we investigated the competitive repopulation potential of HSCs lacking Hoxb4 alone, or in conjunction with 8 other Hoxb genes. Our results show that Hoxb4(-/-) and Hoxb1-b9 (-/-) fetal liver cells retain full competitive repopulation potential and the ability to regenerate all myeloid and lymphoid lineages. Quantitative Hox gene expression profiling in purified c-Kit+ Hoxb1-b9(-/-) fetal liver cells revealed an interaction between the Hoxa, b, and c clusters with variation in expression levels of Hoxa4,-a11, and -c4.Together, these studies show a complex network of genetic interactions between several Hox genes in primitive hematopoietic cells and demonstrate that HSCs lacking up to 30% of the active Hox genes remain fully competent. PMID:16339407

  16. The cytosolic Fe-S cluster assembly component MET18 is required for the full enzymatic activity of ROS1 in active DNA demethylation

    PubMed Central

    Wang, Xiaokang; Li, Qi; Yuan, Wei; Cao, Zhendong; Qi, Bei; Kumar, Suresh; Li, Yan; Qian, Weiqiang

    2016-01-01

    DNA methylation patterns in plants are dynamically regulated by DNA methylation and active DNA demethylation in response to both environmental changes and development of plant. Beginning with the removal of methylated cytosine by ROS1/DME family of 5-methylcytosine DNA glycosylases, active DNA demethylation in plants occurs through base excision repair. So far, many components involved in active DNA demethylation remain undiscovered. Through a forward genetic screening of Arabidopsis mutants showing DNA hypermethylation at the EPF2 promoter region, we identified the conserved iron-sulfur cluster assembly protein MET18. MET18 dysfunction caused DNA hypermethylation at more than 1000 loci as well as the silencing of reporter genes and some endogenous genes. MET18 can directly interact with ROS1 in vitro and in vivo. ROS1 activity was reduced in the met18 mutant plants and point mutation in the conserved Fe-S cluster binding motif of ROS1 disrupted its biological function. Interestingly, a large number of DNA hypomethylated loci, especially in the CHH context, were identified from the met18 mutants and most of the hypo-DMRs were from TE regions. Our results suggest that MET18 can regulate both active DNA demethylation and DNA methylation pathways in Arabidopsis. PMID:27193999

  17. The cytosolic Fe-S cluster assembly component MET18 is required for the full enzymatic activity of ROS1 in active DNA demethylation.

    PubMed

    Wang, Xiaokang; Li, Qi; Yuan, Wei; Cao, Zhendong; Qi, Bei; Kumar, Suresh; Li, Yan; Qian, Weiqiang

    2016-01-01

    DNA methylation patterns in plants are dynamically regulated by DNA methylation and active DNA demethylation in response to both environmental changes and development of plant. Beginning with the removal of methylated cytosine by ROS1/DME family of 5-methylcytosine DNA glycosylases, active DNA demethylation in plants occurs through base excision repair. So far, many components involved in active DNA demethylation remain undiscovered. Through a forward genetic screening of Arabidopsis mutants showing DNA hypermethylation at the EPF2 promoter region, we identified the conserved iron-sulfur cluster assembly protein MET18. MET18 dysfunction caused DNA hypermethylation at more than 1000 loci as well as the silencing of reporter genes and some endogenous genes. MET18 can directly interact with ROS1 in vitro and in vivo. ROS1 activity was reduced in the met18 mutant plants and point mutation in the conserved Fe-S cluster binding motif of ROS1 disrupted its biological function. Interestingly, a large number of DNA hypomethylated loci, especially in the CHH context, were identified from the met18 mutants and most of the hypo-DMRs were from TE regions. Our results suggest that MET18 can regulate both active DNA demethylation and DNA methylation pathways in Arabidopsis. PMID:27193999

  18. Activation and Products of the Cryptic Secondary Metabolite Biosynthetic Gene Clusters by Rifampin Resistance (rpoB) Mutations in Actinomycetes

    PubMed Central

    Tanaka, Yukinori; Kasahara, Ken; Hirose, Yutaka; Murakami, Kiriko; Kugimiya, Rie

    2013-01-01

    A subset of rifampin resistance (rpoB) mutations result in the overproduction of antibiotics in various actinomycetes, including Streptomyces, Saccharopolyspora, and Amycolatopsis, with H437Y and H437R rpoB mutations effective most frequently. Moreover, the rpoB mutations markedly activate (up to 70-fold at the transcriptional level) the cryptic/silent secondary metabolite biosynthetic gene clusters of these actinomycetes, which are not activated under general stressful conditions, with the exception of treatment with rare earth elements. Analysis of the metabolite profile demonstrated that the rpoB mutants produced many metabolites, which were not detected in the wild-type strains. This approach utilizing rifampin resistance mutations is characterized by its feasibility and potential scalability to high-throughput studies and would be useful to activate and to enhance the yields of metabolites for discovery and biochemical characterization. PMID:23603745

  19. The mechanism of emerging catalytic activity of gold nano-clusters on rutile TiO{sub 2}(110) in CO oxidation reaction

    SciTech Connect

    Mitsuhara, K.; Tagami, M.; Matsuda, T.; Visikovskiy, A.; Kido, Y.; Takizawa, M.

    2012-03-28

    This paper reveals the fact that the O adatoms (O{sub ad}) adsorbed on the 5-fold Ti rows of rutile TiO{sub 2}(110) react with CO to form CO{sub 2} at room temperature and the oxidation reaction is pronouncedly enhanced by Au nano-clusters deposited on the above O-rich TiO{sub 2}(110) surfaces. The optimum activity is obtained for 2D clusters with a lateral size of {approx}1.5 nm and two-atomic layer height corresponding to {approx}50 Au atoms/cluster. This strong activity emerging is attributed to an electronic charge transfer from Au clusters to O-rich TiO{sub 2}(110) supports observed clearly by work function measurement, which results in an interface dipole. The interface dipoles lower the potential barrier for dissociative O{sub 2} adsorption on the surface and also enhance the reaction of CO with the O{sub ad} atoms to form CO{sub 2} owing to the electric field of the interface dipoles, which generate an attractive force upon polar CO molecules and thus prolong the duration time on the Au nano-clusters. This electric field is screened by the valence electrons of Au clusters except near the perimeter interfaces, thereby the activity is diminished for three-dimensional clusters with a larger size.

  20. Does cluster-root activity benefit nutrient uptake and growth of co-existing species?

    PubMed

    Muler, Ana L; Oliveira, Rafael S; Lambers, Hans; Veneklaas, Erik J

    2014-01-01

    Species that inhabit phosphorus- (P) and micronutrient-impoverished soils typically have adaptations to enhance the acquisition of these nutrients, for example cluster roots in Proteaceae. However, there are several species co-occurring in the same environment that do not produce similar specialised roots. This study aims to investigate whether one of these species (Scholtzia involucrata) can benefit from the mobilisation of P or micronutrients by the cluster roots of co-occurring Banksia attenuata, and also to examine the response of B. attenuata to the presence of S. involucrata. We conducted a greenhouse experiment, using a replacement series design, where B. attenuata and S. involucrata shared a pot at proportions of 2:0, 1:2 and 0:4. S. involucrata plants grew more in length, were heavier and had higher manganese (Mn) concentrations in their young leaves when grown next to one individual of B. attenuata and one individual of S. involucrata than when grown with three conspecifics. All S. involucrata individuals were colonised by arbuscular mycorrhizal fungi, and possibly Rhizoctonia. Additionally, P concentration was higher in the young leaves of B. attenuata when grown with another B. attenuata than when grown with two individuals of S. involucrata, despite the smaller size of the S. involucrata individuals. Our results demonstrate that intraspecific competition was stronger than interspecific competition for S. involucrata, but not for B. attenuata. We conclude that cluster roots of B. attenuata facilitate the acquisition of nutrients by neighbouring shrubs by making P and Mn more available for their neighbours. PMID:23934064

  1. Active Tectonics of Southern California Revealed by Cluster Analysis of GPS Velocities

    NASA Astrophysics Data System (ADS)

    Thatcher, W. R.; Savage, J. C.; Simpson, R. W.

    2013-12-01

    We use cluster analysis of the USGS National Seismic Hazard Map GPS velocity field for southern California with standard deviations < 1 mm/yr to determine velocity gradients that locate the most important faults, the elastic strain associated with them, and regions of possible block-like behavior. Seven to ten well resolved clusters are statistically significant and spatially distinct with small overlap. In map view (see figure), the 7 clusters solution shows bands of relatively constant velocity sub-parallel to the San Andreas (SAF) and San Jacinto (SJF) faults and the major faults of the eastern Mojave shear zone (EMSZ). These bands are due both to elastic strain accumulation on the SAF and relative motion across lower slip rate faults in the EMSZ and Los Angeles and Ventura basins. At the largest scale, the 7-cluster map shows two main trends. The blue dots define the SJ and SA faults from northwest of the Salton Sea (SS) to Parkfield (P); the grey/magenta boundary suggests that the defined Eastern California Shear Zone could be extended farther south to the Salton Sea. The short ~80-km-long San Gorgonio Pass-San Bernardino Mountains (SGP) segment of the SAF has a much lower slip rate, ~7 mm/yr of right-lateral oblique convergence. As generally shown by previous GPS studies, right-lateral strike-slip movement rates vary considerably along the SAF. In the Imperial Valley (IV) the rate is ~40 mm/yr; east of the Salton Sea it drops to ~20 mm/yr, with 10-15 mm/yr having been shunted westward to the SJF; north of the Salton Sea ~10-15 mm/yr of strike-slip is transferred to the faults of the eastern Mojave; therefore the east-trending faults of San Gorgonio Pass (SGP) take up only ~5 mm/yr of strike slip and ~equal amounts of north-south shortening; on the Mojave (M) segment of the SAF the slip rate increases to ~15-20 mm/yr in the vicinity of Cajon Pass (CP) because of transfer of SJF slip back onto the San Andreas; northwest of Tejon Pass the rate increases again to

  2. Biorthogonal moment expansions in coupled-cluster theory: Review of key concepts and merging the renormalized and active-space coupled-cluster methods

    NASA Astrophysics Data System (ADS)

    Shen, Jun; Piecuch, Piotr

    2012-06-01

    After reviewing recent progress in the area of the development of coupled-cluster (CC) methods for quasi-degenerate electronic states that are characterized by stronger non-dynamical correlation effects, including new generations of single- and multi-reference approaches that can handle bond breaking and excited states dominated by many-electron transitions, and after discussing the key elements of the left-eigenstate completely renormalized (CR) CC and equation-of-motion (EOM) CC methods, and the underlying biorthogonal method of moments of CC (MMCC) equations [P. Piecuch, M. Włoch, J. Chem. Phys. 123 (2005) 224105; P. Piecuch, M. Włoch, J.R. Gour, A. Kinal, Chem. Phys. Lett. 418 (2006) 467; M. Włoch, M.D. Lodriguito, P. Piecuch, J.R. Gour, Mol. Phys. 104 (2006) 2149], it is argued that it is beneficial to merge the CR-CC/EOMCC and active-space CC/EOMCC [P. Piecuch, Mol. Phys. 108 (2010) 2987, and references therein] theories into a single formalism. In order to accomplish this goal, the biorthogonal MMCC theory, which provides compact many-body expansions for the differences between the full configuration interaction and CC or, in the case of excited states, EOMCC energies, obtained using conventional truncation schemes in the cluster operator T and excitation operator Rμ, is generalized, so that one can correct the CC/EOMCC energies obtained with arbitrary truncations in T and Rμ for the selected many-electron correlation effects of interest. The resulting moment expansions, defining the new, Flexible MMCC (Flex-MMCC) formalism, and the ensuing CC(P; Q) hierarchy, proposed in the present work, enable one to correct energies obtained in the active-space CC and EOMCC calculations, in which one selects higher many-body components of T and Rμ via active orbitals and which recover much of the relevant non-dynamical and some dynamical electron correlation effects in applications involving potential energy surfaces (PESs) along bond breaking coordinates, for the

  3. [Pathophysiology of cluster headache].

    PubMed

    Donnet, Anne

    2015-11-01

    The aetiology of cluster headache is partially unknown. Three areas are involved in the pathogenesis of cluster headache: the trigeminal nociceptive pathways, the autonomic system and the hypothalamus. The cluster headache attack involves activation of the trigeminal autonomic reflex. A dysfunction located in posterior hypothalamic gray matter is probably pivotal in the process. There is a probable association between smoke exposure, a possible genetic predisposition and the development of cluster headache. PMID:26470883

  4. Efficient active waveguiding properties of Mo6 nano-cluster-doped polymer nanotubes

    NASA Astrophysics Data System (ADS)

    Bigeon, J.; Huby, N.; Amela-Cortes, M.; Molard, Y.; Garreau, A.; Cordier, S.; Bêche, B.; Duvail, J.-L.

    2016-06-01

    We investigate 1D nanostructures based on a Mo6@SU8 hybrid nanocomposite in which photoluminescent Mo6 clusters are embedded in the photosensitive SU8 resist. Tens of micrometers long Mo6@SU8-based tubular nanostructures were fabricated by the wetting template method, enabling the control of the inner and outer diameter to about 190 nm and 240 nm respectively, as supported by structural and optical characterizations. The image plane optical study of these nanotubes under optical pumping highlights the efficient waveguiding phenomenon of the red luminescence emitted by the clusters. Moreover, the wave vector distribution in the Fourier plane determined by leakage radiation microscopy gives additional features of the emission and waveguiding. First, the anisotropic red luminescence of the whole system can be attributed to the guided mode along the nanotube. Then, a low-loss propagation behavior is evidenced in the Mo6@SU8-based nanotubes. This result contrasts with the weaker waveguiding signature in the case of UV210-based nanotubes embedding PFO (poly(9,9-di-n-octylfluorenyl-2,7-diyl)). It is attributed to the strong reabsorption phenomenon, owing to overlapping between absorption and emission bands in the semi-conducting conjugated polymer PFO. These results make this Mo6@SU8 original class of nanocomposite a promising candidate as nanosources for submicronic photonic integration.

  5. Efficient active waveguiding properties of Mo6 nano-cluster-doped polymer nanotubes.

    PubMed

    Bigeon, J; Huby, N; Amela-Cortes, M; Molard, Y; Garreau, A; Cordier, S; Bêche, B; Duvail, J-L

    2016-06-24

    We investigate 1D nanostructures based on a Mo6@SU8 hybrid nanocomposite in which photoluminescent Mo6 clusters are embedded in the photosensitive SU8 resist. Tens of micrometers long Mo6@SU8-based tubular nanostructures were fabricated by the wetting template method, enabling the control of the inner and outer diameter to about 190 nm and 240 nm respectively, as supported by structural and optical characterizations. The image plane optical study of these nanotubes under optical pumping highlights the efficient waveguiding phenomenon of the red luminescence emitted by the clusters. Moreover, the wave vector distribution in the Fourier plane determined by leakage radiation microscopy gives additional features of the emission and waveguiding. First, the anisotropic red luminescence of the whole system can be attributed to the guided mode along the nanotube. Then, a low-loss propagation behavior is evidenced in the Mo6@SU8-based nanotubes. This result contrasts with the weaker waveguiding signature in the case of UV210-based nanotubes embedding PFO (poly(9,9-di-n-octylfluorenyl-2,7-diyl)). It is attributed to the strong reabsorption phenomenon, owing to overlapping between absorption and emission bands in the semi-conducting conjugated polymer PFO. These results make this Mo6@SU8 original class of nanocomposite a promising candidate as nanosources for submicronic photonic integration. PMID:27171341

  6. Clustering Finnish Gambler Profiles Based on the Money and Time Consumed in Gambling Activities.

    PubMed

    Heiskanen, Maria; Toikka, Arho

    2016-06-01

    Gambling involves consumption of gamblers' money and time. Gamblers are a heterogeneous group, and in addition to grouping gamblers based on personality factors, it is also important to find different gambler profiles with respect to their gambling behavior. Using the nationally representative survey 'Finnish Gambling 2011' (N = 4484), this article studies the subtypes of Finnish gamblers based on the frequency of gambling and the amounts of money and time used in different gambling forms. Cluster analysis reveals six profiles of gamblers, from infrequent gamblers to omnivorous gamblers. In the further analysis of the clusters, it was found that the highest problem gambling prevalence was in the groups of sport betting + electronic gaming machine gamblers and omnivorous gamblers, which were also both dominated by men. Certain gambling consumption patterns and risk factors for problem gambling are related to both socio-demographic backgrounds of the gamblers as well as the structural and situational characteristics of the games. The results have implications for the prevention of problem gambling, as some consumption patterns may be connected with the probability of developing gambling problems. PMID:26026988

  7. Rhenium Complexes and Clusters Supported on c-Al2O3: Effects of Rhenium Oxidation State and Rhenium Cluster Size on Catalytic Activity for n-butane Hydrogenolysis

    SciTech Connect

    Lobo Lapidus, R.; Gates, B

    2009-01-01

    Supported metals prepared from H{sub 3}Re{sub 3}(CO){sub 12} on {gamma}-Al{sub 2}O{sub 3} were treated under conditions that led to various rhenium structures on the support and were tested as catalysts for n-butane conversion in the presence of H{sub 2} in a flow reactor at 533 K and 1 atm. After use, two samples were characterized by X-ray absorption edge positions of approximately 5.6 eV (relative to rhenium metal), indicating that the rhenium was cationic and essentially in the same average oxidation state in each. But the Re-Re coordination numbers found by extended X-ray absorption fine structure spectroscopy (2.2 and 5.1) show that the clusters in the two samples were significantly different in average nuclearity despite their indistinguishable rhenium oxidation states. Spectra of a third sample after catalysis indicate approximately Re{sub 3} clusters, on average, and an edge position of 4.5 eV. Thus, two samples contained clusters approximated as Re{sub 3} (on the basis of the Re-Re coordination number), on average, with different average rhenium oxidation states. The data allow resolution of the effects of rhenium oxidation state and cluster size, both of which affect the catalytic activity; larger clusters and a greater degree of reduction lead to increased activity.

  8. Intranodular clusters of activated cells with T follicular helper phenotype in nodular lymphocyte predominant Hodgkin lymphoma: a pilot study of 32 cases from Finland.

    PubMed

    Nathwani, Bharat N; Vornanen, Martine; Winkelmann, Ria; Kansal, Rina; Doering, Claudia; Hartmann, Sylvia; Hansmann, Martin L

    2013-09-01

    In nodular lymphocyte predominant Hodgkin lymphoma (NLPHL), little is known about the presence of intranodular clusters of cytologically activated lymphoid cells producing a moth-eaten pattern histologically. This pilot study of 32 NLPHL cases from Finland ascertained (1) the frequency of the intranodular clusters of activated lymphoid cells, (2) the immunophenotype of the activated cells, (3) the size and immunophenotype of the rosetting cells, and (4) the clinical significance of the activated cells. Histologically, intranodular clusters of activated cells produced a moth-eaten pattern in 100% (32 cases; subtle in 62.5%, overt in 37.5%). In immunostains, activated cells in subtle clusters (20 cases) were very difficult to identify. Twelve cases had overt clusters of activated cells, which were positive with CD3, CD4, PD1, CXCL13 (T follicular helper [T(FH)] phenotype), but rarely with Ki-67 and BCL2. Most activated rosetting cells had the same immunophenotype as the nonrosetting cells, except for CXCL13. Clinical presentation for all 32 Finnish patients was distinctive: 97% men, 97% with peripheral lymphadenopathy and 35.5% with stage III/IV disease. Only 22% relapsed; 97% were in remission. There was no significant clinical difference between cases with overt and subtle clusters. Intranodular activated TFH cells in NLPHL appeared to be nonproliferating and not long-living, and they were not associated with any adverse clinical outcome. Although most activated cells were TFH cells, it seemed that they were unable to increase the number of malignant cells. The pathogenetic role of the intranodular activated TFH and the small T cells in NLPHL needs further investigation. PMID:23684509

  9. Active mammalian replication origins are associated with a high-density cluster of mCpG dinucleotides.

    PubMed Central

    Rein, T; Zorbas, H; DePamphilis, M L

    1997-01-01

    ori-beta is a well-characterized origin of bidirectional replication (OBR) located approximately 17 kb downstream of the dihydrofolate reductase gene in hamster cell chromosomes. The approximately 2-kb region of ori-beta that exhibits greatest replication initiation activity also contains 12 potential methylation sites in the form of CpG dinucleotides. To ascertain whether DNA methylation might play a role at mammalian replication origins, the methylation status of these sites was examined with bisulfite to chemically distinguish cytosine (C) from 5-methylcytosine (mC). All of the CpGs were methylated, and nine of them were located within 356 bp flanking the minimal OBR, creating a high-density cluster of mCpGs that was approximately 10 times greater than average for human DNA. However, the previously reported densely methylated island in which all cytosines were methylated regardless of their dinucleotide composition was not detected and appeared to be an experimental artifact. A second OBR, located at the 5' end of the RPS14 gene, exhibited a strikingly similar methylation pattern, and the organization of CpG dinucleotides at other mammalian origins revealed the potential for high-density CpG methylation. Moreover, analysis of bromodeoxyuridine-labeled nascent DNA confirmed that active replication origins were methylated. These results suggest that a high-density cluster of mCpG dinucleotides may play a role in either the establishment or the regulation of mammalian replication origins. PMID:8972222

  10. The Devon Active Villages Evaluation (DAVE) trial of a community-level physical activity intervention in rural south-west England: a stepped wedge cluster randomised controlled trial

    PubMed Central

    2014-01-01

    Background The majority of adults are not meeting the guidelines for physical activity despite activity being linked with numerous improvements to long-term health. In light of this, researchers have called for more community-level interventions. The main objective of the present study was to evaluate whether a community-level physical activity intervention increased the activity levels of rural communities. Methods 128 rural villages (clusters) were randomised to receive the intervention in one of four time periods between April 2011 and December 2012. The Devon Active Villages intervention provided villages with 12 weeks of physical activity opportunities for all age groups, including at least three different types of activities per village. Each village received an individually tailored intervention, incorporating a local needs-led approach. Support was provided for a further 12 months following the intervention. The evaluation study used a stepped wedge cluster randomised controlled trial design. All 128 villages were measured at each of five data collection periods using a postal survey. The primary outcome of interest was the proportion of adults reporting sufficient physical activity to meet internationally recognised guidelines. Minutes spent in moderate-and-vigorous activity per week was analysed as a secondary outcome. To compare between intervention and control modes, random effects linear regression and marginal logistic regression models were implemented for continuous and binary outcomes respectively. Results 10,412 adults (4693 intervention, 5719 control) completed the postal survey (response rate 32.2%). The intervention did not increase the odds of adults meeting the physical activity guideline (adjusted OR 1.02, 95% CI: 0.88 to 1.17; P = 0.80), although there was weak evidence of an increase in minutes of moderate-and-vigorous-intensity activity per week (adjusted mean difference = 171, 95% CI: -16 to 358; P = 0.07). The

  11. Improvements on GPS Location Cluster Analysis for the Prediction of Large Carnivore Feeding Activities: Ground-Truth Detection Probability and Inclusion of Activity Sensor Measures

    PubMed Central

    Blecha, Kevin A.; Alldredge, Mat W.

    2015-01-01

    Animal space use studies using GPS collar technology are increasingly incorporating behavior based analysis of spatio-temporal data in order to expand inferences of resource use. GPS location cluster analysis is one such technique applied to large carnivores to identify the timing and location of feeding events. For logistical and financial reasons, researchers often implement predictive models for identifying these events. We present two separate improvements for predictive models that future practitioners can implement. Thus far, feeding prediction models have incorporated a small range of covariates, usually limited to spatio-temporal characteristics of the GPS data. Using GPS collared cougar (Puma concolor) we include activity sensor data as an additional covariate to increase prediction performance of feeding presence/absence. Integral to the predictive modeling of feeding events is a ground-truthing component, in which GPS location clusters are visited by human observers to confirm the presence or absence of feeding remains. Failing to account for sources of ground-truthing false-absences can bias the number of predicted feeding events to be low. Thus we account for some ground-truthing error sources directly in the model with covariates and when applying model predictions. Accounting for these errors resulted in a 10% increase in the number of clusters predicted to be feeding events. Using a double-observer design, we show that the ground-truthing false-absence rate is relatively low (4%) using a search delay of 2–60 days. Overall, we provide two separate improvements to the GPS cluster analysis techniques that can be expanded upon and implemented in future studies interested in identifying feeding behaviors of large carnivores. PMID:26398546

  12. CO2 Activation and Hydrogenation by PtHn (-) Cluster Anions.

    PubMed

    Zhang, Xinxing; Liu, Gaoxiang; Meiwes-Broer, Karl-Heinz; Ganteför, Gerd; Bowen, Kit

    2016-08-01

    Gas phase reactions between PtHn (-) cluster anions and CO2 were investigated by mass spectrometry, anion photoelectron spectroscopy, and computations. Two major products, PtCO2 H(-) and PtCO2 H3 (-) , were observed. The atomic connectivity in PtCO2 H(-) can be depicted as HPtCO2 (-) , where the platinum atom is bonded to a bent CO2 moiety on one side and a hydrogen atom on the other. The atomic connectivity of PtCO2 H3 (-) can be described as H2 Pt(HCO2 )(-) , where the platinum atom is bound to a formate moiety on one side and two hydrogen atoms on the other. Computational studies of the reaction pathway revealed that the hydrogenation of CO2 by PtH3 (-) is highly energetically favorable. PMID:27363532

  13. Transferability study of CHO cell clustering assays for monitoring of pertussis toxin activity in acellular pertussis vaccines.

    PubMed

    Isbrucker, R; Daas, A; Wagner, L; Costanzo, A

    2016-01-01

    Current regulations for acellular pertussis (aP) vaccines require that they are tested for the presence of residual or reversion-derived pertussis toxin (PTx) activity using the mouse histamine sensitisation test (HIST). Although a CHO cell clustering assay can be used by manufacturers to verify if sufficient inactivation of the substance has occurred in-process, this assay cannot be used at present for the final product due to the presence of aluminium adjuvants which interfere with mammalian cell cultures. Recently, 2 modified CHO cell clustering assays which accommodate for the adjuvant effects have been proposed as alternatives to the HIST. These modified assays eliminate the adjuvant-induced cytotoxicity either through dilution of the vaccine (called the Direct Method) or by introducing a porous barrier between the adjuvant and the cells (the Indirect Method). Transferability and suitability of these methods for testing of products present on the European market were investigated during a collaborative study organised by the European Directorate for the Quality of Medicines & HealthCare (EDQM). Thirteen laboratories participated in this study which included 4 aP-containing vaccines spiked by addition of PTx. This study also assessed the transferability of a standardised CHO cell clustering assay protocol for use with non-adjuvanted PTx preparations. Results showed that the majority of laboratories were able to detect the PTx spike in all 4 vaccines at concentrations of 4 IU/mL or lower using the Indirect Method. This sensitivity is in the range of the theoretical sensitivity of the HIST. The Direct Method however did not show the expected results and would need additional development work. PMID:27506252

  14. Methane activation by cobalt cluster cations, Con+ (n=2-16): Reaction mechanisms and thermochemistry of cluster-CHx (x=0-3) complexes

    NASA Astrophysics Data System (ADS)

    Citir, Murat; Liu, Fuyi; Armentrout, P. B.

    2009-02-01

    The kinetic energy dependences of the reactions of Con+ (n =2-16) with CD4 are studied in a guided ion beam tandem mass spectrometer over the energy range of 0-10 eV. The main products are hydride formation, ConD+, dehydrogenation to form ConCD2+, and double dehydrogenation yielding ConC+. These primary products decompose to form secondary and higher order products, ConCD+, Con-1D+, Con-1C+, Con-1CD+, and Con-1CD2+ at higher energies. Adduct formation of ConCD4+ is also observed for the largest cluster cations, n ≥10. In general, the efficiencies of the single and double dehydrogenation processes increase with cluster size, although the hexamer cation shows a reduced reactivity compared to its neighbors. All reactions exhibit thresholds, and cross sections for the various primary and secondary reactions are analyzed to yield reaction thresholds from which bond energies for cobalt cluster cations to D, C, CD, CD2, and CD3 are determined. The relative magnitudes of these bond energies are consistent with simple bond order considerations. Bond energies for larger clusters rapidly reach relatively constant values, which are used to estimate the chemisorption energies of the C, CD, CD2, and CD3 molecular fragments to cobalt surfaces.

  15. The formation of complex acetylcholine receptor clusters requires MuSK kinase activity and structural information from the MuSK extracellular domain

    PubMed Central

    Mazhar, Sania; Herbst, Ruth

    2012-01-01

    Efficient synaptic transmission at the neuromuscular junction (NMJ) requires the topological maturation of the postsynaptic apparatus from an oval acetylcholine receptor (AChR)-rich plaque into a complex pretzel-shaped array of branches. However, compared to NMJ formation very little is known about the mechanisms that regulate NMJ maturation. Recently the process of in vivo transformation from plaque into pretzel has been reproduced in vitro by culturing myotubes aneurally on laminin-coated substrate. It was proposed that the formation of complex AChR clusters is regulated by a MuSK-dependent muscle intrinsic program. To elucidate the structure–function role of MuSK in the aneural maturation of AChR pretzels, we used muscle cell lines expressing MuSK mutant and chimeric proteins. Here we report, that besides its role during agrin-induced AChR clustering, MuSK kinase activity is also necessary for substrate-dependent cluster formation. Constitutive-active MuSK induces larger AChR clusters, a faster cluster maturation on laminin and increases the anchorage of AChRs to the cytoskeleton compared to MuSK wild-type. In addition, we find that the juxtamembrane region of MuSK, which has previously been shown to regulate agrin-induced AChR clustering, is unable to induce complex AChR clusters on laminin substrate. Most interestingly, MuSK kinase activity is not sufficient for laminin-dependent AChR cluster formation since the MuSK ectodomain is also required suggesting a so far undiscovered instructive role for the extracellular domain of MuSK. PMID:22210232

  16. Mechanisms of the S/CO/Se interchange reactions at FeMo-co, the active site cluster of nitrogenase.

    PubMed

    Dance, Ian

    2016-09-28

    The active site of the N2 fixing enzyme nitrogenase is a C-centred Fe7MoS cluster (FeMo-co) containing a trigonal prism of six Fe atoms connected by a central belt of three doubly-bridging S atoms. The trigonal faces of the prism are capped via triply-bridging S atoms to Fe1 at one end and Mo at the other end. One of the central belt atoms, S2B, considered to be important in the chemical mechanism of the enzyme, has been shown by Spatzal, Rees et al. to undergo substitution by CO, and also substitution by Se in the presence of SeCN(-), under turnover conditions. Further, when turning over under C2H2 or N2/CO there is migration of Se to the other two belt bridging positions. These reactions are extraordinary, and unprecedented in metal chalcogenide cluster chemistry. Using density functional simulations, mechanisms for all of these reactions have been developed, involving the small molecules SCO, SeCO, C2H2S, C2H2Se, SeCN(-), SCN(-) functioning as carriers of S and Se atoms. The possibility that the S2B bridge position is vacant is discounted, because the barrier to formation of a bridge-void intermediate with two contiguous three-coordinate Fe atoms is too large. A bridging ligand is retained throughout the proposed mechanisms. Intermediates with Fe-C(O)-S/Se-Fe cycles and with SCO/SeCO C-bound to Fe are predicted. The energetics of the reaction trajectories show them to be feasible and easily reversible, consistent with experiment. Alternative mechanisms involving intramolecular differential rotatory rearrangements of the cluster to scramble the Se bridges are also examined, and shown to be very unlikely. The implications of these new facets of the reactivity of the FeMo-co cluster are discussed: it is considered that they are unlikely to be part of the mechanism of the physiological reactions of nitrogenase. PMID:27534727

  17. O2 Reactions at the Six-iron Active Site (H-cluster) in [FeFe]-Hydrogenase*

    PubMed Central

    Lambertz, Camilla; Leidel, Nils; Havelius, Kajsa G. V.; Noth, Jens; Chernev, Petko; Winkler, Martin; Happe, Thomas; Haumann, Michael

    2011-01-01

    Irreversible inhibition by molecular oxygen (O2) complicates the use of [FeFe]-hydrogenases (HydA) for biotechnological hydrogen (H2) production. Modification by O2 of the active site six-iron complex denoted as the H-cluster ([4Fe4S]-2FeH) of HydA1 from the green alga Chlamydomonas reinhardtii was characterized by x-ray absorption spectroscopy at the iron K-edge. In a time-resolved approach, HydA1 protein samples were prepared after increasing O2 exposure periods at 0 °C. A kinetic analysis of changes in their x-ray absorption near edge structure and extended X-ray absorption fine structure spectra revealed three phases of O2 reactions. The first phase (τ1 ≤ 4 s) is characterized by the formation of an increased number of Fe–O,C bonds, elongation of the Fe–Fe distance in the binuclear unit (2FeH), and oxidation of one iron ion. The second phase (τ2 ≈ 15 s) causes a ∼50% decrease of the number of ∼2.7-Å Fe–Fe distances in the [4Fe4S] subcluster and the oxidation of one more iron ion. The final phase (τ3 ≤ 1000 s) leads to the disappearance of most Fe–Fe and Fe–S interactions and further iron oxidation. These results favor a reaction sequence, which involves 1) oxygenation at 2FeH+ leading to the formation of a reactive oxygen species-like superoxide (O2−), followed by 2) H-cluster inactivation and destabilization due to ROS attack on the [4Fe4S] cluster to convert it into an apparent [3Fe4S]+ unit, leading to 3) complete O2-induced degradation of the remainders of the H-cluster. This mechanism suggests that blocking of ROS diffusion paths and/or altering the redox potential of the [4Fe4S] cubane by genetic engineering may yield improved O2 tolerance in [FeFe]-hydrogenase. PMID:21930709

  18. Clustered-charge to alanine scanning mutagenesis of the Mal63 MAL-activator C-terminal regulatory domain.

    PubMed

    Danzi, Sara E; Bali, Mehtap; Michels, Corinne A

    2003-12-01

    The MAL-activator genes of Saccharomyces cerevisiae encode regulatory proteins required for the expression of the structural genes encoding maltose permease and maltase. Residues within the C-terminal region of the Mal63 protein required for negative regulation were previously identified. Evidence suggested that the C-terminal domain is also involved in positive regulatory functions, such as inducer responsiveness and transactivation in the context of a full-length protein. Charged-cluster to alanine scanning mutagenesis of the regulatory domain of MAL63 and the constitutive MAL43-C were undertaken to identify distinct regions within Mal63p involved in positive functions and to define their roles in induction. Mutations that affect the ability to activate transcription in the inducible MAL63 but have no effect in the constitutive MAL43-C define regions that function in induction. Those that affect both the inducible and constitutive alleles define regions involved in activation more generally. Mutations in MAL63 fell into three classes, those that have little or no impact on activity, those that decrease activity, and those that enhance function. Mutations from these classes mapped to distinct regions of the protein, identifying a region of approximately 90 residues (residues 331-423) involved in maltose sensing and an approximately 50-residue region at the extreme C-terminus (residues 420-470) required for activation, such as the formation and/or maintenance of an active state. These studies support a model for MAL-activator function which involves complex protein-protein interactions and overlapping negative and positive regulatory regions. PMID:14508602

  19. EVOLUTION AND DISTRIBUTION OF MAGNETIC FIELDS FROM ACTIVE GALACTIC NUCLEI IN GALAXY CLUSTERS. I. THE EFFECT OF INJECTION ENERGY AND REDSHIFT

    SciTech Connect

    Xu Hao; Li Hui; Li Shengtai; Collins, David C.; Norman, Michael L. E-mail: hli@lanl.go E-mail: dcollins@physics.ucsd.ed

    2010-12-20

    We present a series of cosmological magnetohydrodynamic simulations that simultaneously follow the formation of a galaxy cluster and evolution of magnetic fields ejected by an active galactic nucleus (AGN). Specifically, we investigate the influence of both the epoch of the AGN (z {approx} 3-0.5) and the AGN energy ({approx}3 x 10{sup 57}- 2 x 10{sup 60} erg) on the final magnetic field distribution in a relatively massive cluster (M{sub vir} {approx} 10{sup 15} M{sub sun}). We find that as long as the AGN magnetic fields are ejected before the major mergers in the cluster formation history, magnetic fields can be transported throughout the cluster and can be further amplified by the intracluster medium (ICM) turbulence caused by hierarchical mergers during the cluster formation process. The total magnetic energy in the cluster can reach {approx}10{sup 61} erg, with micro Gauss fields distributed over the {approx}Mpc scale. The amplification of the total magnetic energy by the ICM turbulence can be significant, up to {approx}1000 times in some cases. Therefore even weak magnetic fields from AGNs can be used to magnetize the cluster to the observed level. The final magnetic energy in the ICM is determined by the ICM turbulent energy, with a weak dependence on the AGN injection energy. We discuss the properties of magnetic fields throughout the cluster and the synthetic Faraday rotation measure maps they produce. We also show that high spatial resolution over most of the magnetic regions of the cluster is very important to capture the small-scale dynamo process and maintain the magnetic field structure in our simulations.

  20. Evolution and Distribution of Magnetic Fields from Active Galactic Nuclei in Galaxy Clusters. I. The Effect of Injection Energy and Redshift

    NASA Astrophysics Data System (ADS)

    Xu, Hao; Li, Hui; Collins, David C.; Li, Shengtai; Norman, Michael L.

    2010-12-01

    We present a series of cosmological magnetohydrodynamic simulations that simultaneously follow the formation of a galaxy cluster and evolution of magnetic fields ejected by an active galactic nucleus (AGN). Specifically, we investigate the influence of both the epoch of the AGN (z ~ 3-0.5) and the AGN energy (~3 × 1057- 2 × 1060 erg) on the final magnetic field distribution in a relatively massive cluster (M vir ~ 1015 M sun). We find that as long as the AGN magnetic fields are ejected before the major mergers in the cluster formation history, magnetic fields can be transported throughout the cluster and can be further amplified by the intracluster medium (ICM) turbulence caused by hierarchical mergers during the cluster formation process. The total magnetic energy in the cluster can reach ~1061 erg, with micro Gauss fields distributed over the ~Mpc scale. The amplification of the total magnetic energy by the ICM turbulence can be significant, up to ~1000 times in some cases. Therefore even weak magnetic fields from AGNs can be used to magnetize the cluster to the observed level. The final magnetic energy in the ICM is determined by the ICM turbulent energy, with a weak dependence on the AGN injection energy. We discuss the properties of magnetic fields throughout the cluster and the synthetic Faraday rotation measure maps they produce. We also show that high spatial resolution over most of the magnetic regions of the cluster is very important to capture the small-scale dynamo process and maintain the magnetic field structure in our simulations.

  1. Active Currents and Stresses on the cell surface: Clustering, Instabilities and Budding

    NASA Astrophysics Data System (ADS)

    Rao, Madan

    2011-03-01

    We study the contractile dynamics of a collection of active polar filaments, such as actin, on a two dimensional substrate, using a continuum hydrodynamic description in the presence of spatiotemporal noise. The steady states, characterized by a variety of phases generically consisting of a transient collection of inward pointing asters. We next study the dynamics of particles advected along these active filaments. This is relevant to the dynamics and organization of a large class of cell surface molecules. We make several predictions regarding the statistics of fluctuations of these passive advective particles which we confirm using fluorescence based experiments. We then show how such active patterning of filaments can give rise to membrane stresses leading to membrane shape deformations. In collaboration with Kripa Gowrishankar and Satyajit Mayor.

  2. Clustering of mammalian Hox genes with other H3K27me3 targets within an active nuclear domain.

    PubMed

    Vieux-Rochas, Maxence; Fabre, Pierre J; Leleu, Marion; Duboule, Denis; Noordermeer, Daan

    2015-04-14

    Embryogenesis requires the precise activation and repression of many transcriptional regulators. The Polycomb group proteins and the associated H3K27me3 histone mark are essential to maintain the inactive state of many of these genes. Mammalian Hox genes are targets of Polycomb proteins and form local 3D clusters centered on the H3K27me3 mark. More distal contacts have also been described, yet their selectivity, dynamics, and relation to other layers of chromatin organization remained elusive. We report that repressed Hox genes form mutual intra- and interchromosomal interactions with other genes located in strong domains labeled by H3K27me3. These interactions occur in a central and active nuclear environment that consists of the HiC compartment A, away from peripheral lamina-associated domains. Interactions are independent of nearby H3K27me3-marked loci and determined by chromosomal distance and cell-type-specific scaling factors, thus inducing a moderate reorganization during embryogenesis. These results provide a simplified view of nuclear organization whereby Polycomb proteins may have evolved to repress genes located in gene-dense regions whose position is restricted to central, active, nuclear environments. PMID:25825760

  3. UreR, the transcriptional activator of the Proteus mirabilis urease gene cluster, is required for urease activity and virulence in experimental urinary tract infections.

    PubMed

    Dattelbaum, Jonathan D; Lockatell, C Virginia; Johnson, David E; Mobley, Harry L T

    2003-02-01

    Proteus mirabilis, a cause of complicated urinary tract infection, produces urease, an essential virulence factor for this species. UreR, a member of the AraC/XylS family of transcriptional regulators, positively activates expression of the ure gene cluster in the presence of urea. To specifically evaluate the contribution of UreR to urease activity and virulence in the urinary tract, a ureR mutation was introduced into P. mirabilis HI4320 by homologous recombination. The isogenic ureR::aphA mutant, deficient in UreR production, lacked measurable urease activity. Expression was not detected in the UreR-deficient strain by Western blotting with monoclonal antibodies raised against UreD. Urease activity and UreD expression were restored by complementation of the mutant strain with ureR expressed from a low-copy-number plasmid. Virulence was assessed by transurethral cochallenge of CBA mice with wild-type and mutant strains. The isogenic ureR::aphA mutant of HI4320 was outcompeted in the urine (P = 0.004), bladder (P = 0.016), and kidneys (P < or = 0.001) 7 days after inoculation. Thus, UreR is required for basal urease activity in the absence of urea, for induction of urease by urea, and for virulence of P. mirabilis in the urinary tract. PMID:12540589

  4. Plasma Membrane Intrinsic Proteins from Maize Cluster in Two Sequence Subgroups with Differential Aquaporin Activity1

    PubMed Central

    Chaumont, François; Barrieu, François; Jung, Rudolf; Chrispeels, Maarten J.

    2000-01-01

    The transport of water through membranes is regulated in part by aquaporins or water channel proteins. These proteins are members of the larger family of major intrinsic proteins (MIPs). Plant aquaporins are categorized as either tonoplast intrinsic proteins (TIPs) or plasma membrane intrinsic proteins (PIPs). Sequence analysis shows that PIPs form several subclasses. We report on the characterization of three maize (Zea mays) PIPs belonging to the PIP1 and PIP2 subfamilies (ZmPIP1a, ZmPIP1b, and ZmPIP2a). The ZmPIP2a clone has normal aquaporin activity in Xenopus laevis oocytes. ZmPIP1a and ZmPIP1b have no activity, and a review of the literature shows that most PIP1 proteins identified in other plants have no or very low activity in oocytes. Arabidopsis PIP1 proteins are the only exception. Control experiments show that this lack of activity of maize PIP1 proteins is not caused by their failure to arrive at the plasma membrane of the oocytes. ZmPIP1b also does not appear to facilitate the transport of any of the small solutes tried (glycerol, choline, ethanol, urea, and amino acids). These results are discussed in relationship to the function and regulation of the PIP family of aquaporins. PMID:10759498

  5. SPACE for physical activity - a multicomponent intervention study: study design and baseline findings from a cluster randomized controlled trial

    PubMed Central

    2011-01-01

    Background The aim of the School site, Play Spot, Active transport, Club fitness and Environment (SPACE) Study was to develop, document, and assess a comprehensive intervention in local school districts that promote everyday physical activity (PA) among 11-15-year-old adolescents. The study is based on a social ecological framework, and is designed to implement organizational and structural changes in the physical environment. Methods/design The SPACE Study used a cluster randomized controlled study design. Twenty-one eligible schools in the Region of Southern Denmark were matched and randomized in seven pairs according to eight matching variables summarized in an audit tool (crow-fly distance from residence to school for 5-6th graders; area household income; area education level; area ethnicity distribution; school district urbanity; condition and characteristics of school outdoor areas; school health policy; and active transport in the local area). Baseline measurements with accelerometers, questionnaires, diaries, and physical fitness tests were obtained in Spring 2010 in 5-6th grade in 7 intervention and 7 control schools, with follow-up measurements to be taken in Spring 2012 in 7-8th grade. The primary outcome measure is objective average daily physical activity and will be supported by analyses of time spent in moderate to vigorous activity and time spent sedentary. Other secondary outcome measures will be obtained, such as, overweight, physical fitness, active commuting to/from school and physical activity in recess periods. Discussion A total of 1348 adolescents in 5-6th grade in the Region of Southern Denmark participated at baseline (n = 14 schools). The response rate was high in all type of measurements (72.6-97.4%). There were no significant differences between intervention and control groups at baseline according to selected background variables and outcome measures: gender (p = .54), age (p = .17), BMI (p = .59), waist circumference (p = .17

  6. CLUSTER CHEMISTRY

    SciTech Connect

    Muetterties, Earl L.

    1980-05-01

    Metal cluster chemistry is one of the most rapidly developing areas of inorganic and organometallic chemistry. Prior to 1960 only a few metal clusters were well characterized. However, shortly after the early development of boron cluster chemistry, the field of metal cluster chemistry began to grow at a very rapid rate and a structural and a qualitative theoretical understanding of clusters came quickly. Analyzed here is the chemistry and the general significance of clusters with particular emphasis on the cluster research within my group. The importance of coordinately unsaturated, very reactive metal clusters is the major subject of discussion.

  7. PROBING THE EXTREME REALM OF ACTIVE GALACTIC NUCLEUS FEEDBACK IN THE MASSIVE GALAXY CLUSTER, RX J1532.9+3021

    SciTech Connect

    Hlavacek-Larrondo, J.; Allen, S. W.; Canning, R. E. A.; Werner, N.; Ehlert, S.; Von der Linden, A.; Taylor, G. B.; Grimes, C. K.; Fabian, A. C.; Sanders, J. S.

    2013-11-10

    We present a detailed Chandra, XMM-Newton, Very Large Array (VLA) and Hubble Space Telescope analysis of one of the strongest cool core clusters known, RX J1532.9+3021 (z = 0.3613). Using new, deep 90 ks Chandra observations, we confirm the presence of a western X-ray cavity or bubble, and report on a newly discovered eastern X-ray cavity. The total mechanical power associated with these active galactic nucleus (AGN) driven outflows is (22 ± 9) × 10{sup 44} erg s{sup –1}, and is sufficient to offset the cooling, indicating that AGN feedback still provides a viable solution to the cooling flow problem even in the strongest cool core clusters. Based on the distribution of the optical filaments, as well as a jet-like structure seen in the 325 MHz VLA radio map, we suggest that the cluster harbors older outflows along the north to south direction. The jet of the central AGN is therefore either precessing or sloshing-induced motions have caused the outflows to change directions. There are also hints of an X-ray depression to the north aligned with the 325 MHz jet-like structure, which might represent the highest redshift ghost cavity discovered to date. We further find evidence of a cold front (r ≈ 65 kpc) that coincides with the outermost edge of the western X-ray cavity and the edge of the radio mini-halo. The common location of the cold front with the edge of the radio mini-halo supports the idea that the latter originates from electrons being reaccelerated due to sloshing-induced turbulence. Alternatively, its coexistence with the edge of the X-ray cavity may be due to cool gas being dragged out by the outburst. We confirm that the central AGN is highly sub-Eddington and conclude that a >10{sup 10} M{sub ☉} or a rapidly spinning black hole is favored to explain both the radiative-inefficiency of the AGN and the powerful X-ray cavities.

  8. Active tumor-targeting luminescent gold clusters with efficient urinary excretion.

    PubMed

    Wang, Xiaojuan; He, Hua; Wang, Yanan; Wang, Junying; Sun, Xing; Xu, Hai; Nau, Werner M; Zhang, Xiaodong; Huang, Fang

    2016-07-28

    We present novel active targeting luminescent gold nanoclusters (AuNCs), which are prepared through a one-pot procedure by using a pentapeptide (CRGDS) for stabilization and tumor recognition. CRGDS-AuNCs exhibit a high tumor-specific retention with an exceptionally high tumor-to-liver uptake ratio of 9.3. Their small hydrodynamic diameter and zwitterionic surface facilitate urinary excretion, which reaches 82% within 24 h after injection. PMID:27354156

  9. General active space commutator-based coupled cluster theory of general excitation rank for electronically excited states: Implementation and application to ScH

    NASA Astrophysics Data System (ADS)

    Hubert, Mickaël; Olsen, Jeppe; Loras, Jessica; Fleig, Timo

    2013-11-01

    We present a new implementation of general excitation rank coupled cluster theory for electronically excited states based on the single-reference multi-reference formalism. The method may include active-space selected and/or general higher excitations by means of the general active space concept. It may employ molecular integrals over the four-component Lévy-Leblond Hamiltonian or the relativistic spin-orbit-free four-component Hamiltonian of Dyall. In an initial application to ground- and excited states of the scandium monohydride molecule we report spectroscopic constants using basis sets of up to quadruple-zeta quality and up to full iterative triple excitations in the cluster operators. Effects due to spin-orbit interaction are evaluated using two-component multi-reference configuration interaction for assessing the accuracy of the coupled cluster results.

  10. General active space commutator-based coupled cluster theory of general excitation rank for electronically excited states: Implementation and application to ScH

    SciTech Connect

    Hubert, Mickaël; Loras, Jessica; Fleig, Timo; Olsen, Jeppe

    2013-11-21

    We present a new implementation of general excitation rank coupled cluster theory for electronically excited states based on the single-reference multi-reference formalism. The method may include active-space selected and/or general higher excitations by means of the general active space concept. It may employ molecular integrals over the four-component Lévy-Leblond Hamiltonian or the relativistic spin-orbit-free four-component Hamiltonian of Dyall. In an initial application to ground- and excited states of the scandium monohydride molecule we report spectroscopic constants using basis sets of up to quadruple-zeta quality and up to full iterative triple excitations in the cluster operators. Effects due to spin-orbit interaction are evaluated using two-component multi-reference configuration interaction for assessing the accuracy of the coupled cluster results.

  11. Lower physical activity is a risk factor for a clustering of metabolic risk factors in non-obese and obese Japanese subjects: the Takahata study.

    PubMed

    Kaino, Wataru; Daimon, Makoto; Sasaki, Satoshi; Karasawa, Shigeru; Takase, Kaoru; Tada, Kyouko; Wada, Kiriko; Kameda, Wataru; Susa, Shinji; Oizumi, Toshihide; Fukao, Akira; Kubota, Isao; Kayama, Takamasa; Kato, Takeo

    2013-01-01

    In several countries including Japan, people without obesity but with a clustering of metabolic risk factors (MetRFs) were not considered to have the metabolic syndrome (MetS). Here, we examined whether lifestyle characteristics differed between non-obese and obese subjects with or without a clustering of MetRFs. From a population-based cross-sectional study of Japanese subjects aged ≥ 40 years, 1,601 subjects (age: 61.9 ± 10.3 years; 710/891 men/women) were recruited. Physical activity status and daily nutritional intake were estimated using questionnaires. A clustering of MetRFs was defined based on the presence of at least two non-essential risk factors for the diagnosis of the MetS in Japan. Energy intake was not higher in subjects with a clustering of MetRFs compared with those without. Among men, energy expenditure at work was significantly lower in non-obese (9.0 ± 8.2 vs. 11.3 ± 9.3 metabolic equivalents (METs), P = 0.025) and obese (9.0 ± 7.9 vs. 11.6 ± 9.4 METs, P = 0.017) subjects with a clustering of MetRFs than in those without. Multiple logistic regression analysis showed that energy expenditure at work was significantly associated with a clustering of MetRFs after adjusting for possible confounding factors including total energy intake. The ORs (per 1 METs) were 0.970 (95% CI, 0.944-0.997; P = 0.032) in non-obese men and 0.962 (0.926- 0.999; P = 0.043) in obese men. Similar associations were not observed in women. In Japanese males, lower physical activity, but not excessive energy intake, is a risk factor for a clustering of MetRFs independent of their obesity status. PMID:23337516

  12. Active and Repressive Chromatin Are Interspersed without Spreading in an Imprinted Gene Cluster in the Mammalian Genome

    PubMed Central

    Regha, Kakkad; Sloane, Mathew A.; Huang, Ru; Pauler, Florian M.; Warczok, Katarzyna E.; Melikant, Balázs; Radolf, Martin; Martens, Joost H.A.; Schotta, Gunnar; Jenuwein, Thomas; Barlow, Denise P.

    2010-01-01

    SUMMARY The Igf2r imprinted cluster is an epigenetic silencing model in which expression of a ncRNA silences multiple genes in cis. Here, we map a 250 kb region in mouse embryonic fibroblast cells to show that histone modifications associated with expressed and silent genes are mutually exclusive and localized to discrete regions. Expressed genes were modified at promoter regions by H3K4me3 + H3K4me2 + H3K9Ac and on putative regulatory elements flanking active promoters by H3K4me2 + H3K9Ac. Silent genes showed two types of nonoverlapping profile. One type spread over large domains of tissue-specific silent genes and contained H3K27me3 alone. A second type formed localized foci on silent imprinted gene promoters and a nonexpressed pseudogene and contained H3K9me3 + H4K20me3 ± HP1. Thus, mammalian chromosome arms contain active chromatin interspersed with repressive chromatin resembling the type of heterochromatin previously considered a feature of centromeres, telomeres, and the inactive X chromosome. PMID:17679087

  13. Ethylene C-H Bond Activation by Neutral Mn2O5 Clusters under Visible Light Irradiation.

    PubMed

    Yin, Shi; Bernstein, Elliot R

    2016-05-01

    A photo excitation fast flow reactor coupled with a single-photon ionization (118 nm, 10.5 eV) time-of-flight mass spectrometry (TOFMS) instrument is used to investigate reactions of neutral MnmOn clusters with C2H4 under visible (532 nm) light irradiation. Association products Mn2O5(C2H4) and Mn3O6,7(C2H4) are observed without irradiation. Under light irradiation, the Mn2O5(C2H4) TOFMS feature decreases, and a new species, Mn2O5H2, is observed. This light-activated reaction suggests that the visible radiation can induce the chemistry, Mn2O5 + C2H4 + hv(532 nm) → Mn2O5*(C2H4) → Mn2O5H2 + C2H2. High barriers (0.67 and 0.59 eV) are obtained on the ground-state potential energy surface (PES); the reaction is barrierless and thermodynamically favorable on the first excited-state PES, as performed by time-dependent density functional theory calculations. The calculational and experimental results suggest that Mn2O5-like structures on manganese oxide surfaces are the appropriate active catalytic sites for visible light photocatalysis of ethylene dehydrogenation. PMID:27099985

  14. A novel DNA binding motif for yeast zinc cluster proteins: the Leu3p and Pdr3p transcriptional activators recognize everted repeats.

    PubMed Central

    Hellauer, K; Rochon, M H; Turcotte, B

    1996-01-01

    The Gal4, Put3, and Ppr1 yeast zinc cluster proteins bind as homodimers to DNA sequences composed of palindromic CGG triplets. Spacing between the triplets specifies the target site for a given zinc cluster protein. In addition, Hap1p, another zinc cluster protein, also recognizes CGG triplets but only when oriented as a direct repeat. Unexpectedly, our results show that Leu3p, another member of this family, also recognizes CGG triplets but oriented in opposite directions and spaced by 4 nucleotides (an everted repeat or inverted palindrome: CCG-N4-CGG). This constitutes a novel DNA motif for zinc cluster proteins. Moreover, the presence of this motif was shown to be essential for in vivo activation by Leu3p of a minimal reporter containing one copy of a target site for this activator. We also provide evidence that another member of this family, Pdr3p, binds to an everted repeat spaced by 0 nucleotides (CCGCGG). Thus, our results show that three CGG motifs are used by members of the zinc cluster family: palindromes, direct repeats, and everted repeats. PMID:8887639

  15. Hierarchical clustering of brain activity during human nonrapid eye movement sleep

    PubMed Central

    Boly, Mélanie; Perlbarg, Vincent; Marrelec, Guillaume; Schabus, Manuel; Laureys, Steven; Doyon, Julien; Pélégrini-Issac, Mélanie; Maquet, Pierre; Benali, Habib

    2012-01-01

    Consciousness is reduced during nonrapid eye movement (NREM) sleep due to changes in brain function that are still poorly understood. Here, we tested the hypothesis that impaired consciousness during NREM sleep is associated with an increased modularity of brain activity. Cerebral connectivity was quantified in resting-state functional magnetic resonance imaging times series acquired in 13 healthy volunteers during wakefulness and NREM sleep. The analysis revealed a modification of the hierarchical organization of large-scale networks into smaller independent modules during NREM sleep, independently from EEG markers of the slow oscillation. Such modifications in brain connectivity, possibly driven by sleep ultraslow oscillations, could hinder the brain's ability to integrate information and account for decreased consciousness during NREM sleep. PMID:22451917

  16. Determination of the active form of the tetranuclear copper sulfur cluster in nitrous oxide reductase.

    PubMed

    Johnston, Esther M; Dell'Acqua, Simone; Ramos, Susana; Pauleta, Sofia R; Moura, Isabel; Solomon, Edward I

    2014-01-15

    N2OR has been found to have two structural forms of its tetranuclear copper active site, the 4CuS Cu(Z)* form and the 4Cu2S Cu(Z) form. EPR, resonance Raman, and MCD spectroscopies have been used to determine the redox states of these sites under different reductant conditions, showing that the Cu(Z)* site accesses the 1-hole and fully reduced redox states, while the Cu(Z) site accesses the 2-hole and 1-hole redox states. Single-turnover reactions of N2OR for Cu(Z) and Cu(Z)* poised in these redox states and steady-state turnover assays with different proportions of Cu(Z) and Cu(Z)* show that only fully reduced Cu(Z)* is catalytically competent in rapid turnover with N2O. PMID:24364717

  17. Cost-Effectiveness of a Long-Term Internet-Delivered Worksite Health Promotion Programme on Physical Activity and Nutrition: A Cluster Randomized Controlled Trial

    ERIC Educational Resources Information Center

    Robroek, Suzan J. W.; Polinder, Suzanne; Bredt, Folef J.; Burdorf, Alex

    2012-01-01

    This study aims to evaluate the cost-effectiveness of a long-term workplace health promotion programme on physical activity (PA) and nutrition. In total, 924 participants enrolled in a 2-year cluster randomized controlled trial, with departments (n = 74) within companies (n = 6) as the unit of randomization. The intervention was compared with a…

  18. Career Education: Learning with a Purpose. Secondary Guide-Vol. 5. Mathematics and Career Clusters, Mathematics Related Activity Suggestions, Field Trip Sites and Guest Speakers.

    ERIC Educational Resources Information Center

    Atkinson, Marilyn; And Others

    The guide offers a compilation of teacher-developed career education materials which may be integrated with secondary level curriculum in mathematics. Suggested activities and ideas present the following units based on career clusters as they relate to mathematics: construction, communications and media, hospitality and recreation, public service,…

  19. Two-Year Longitudinal Analysis of a Cluster Randomized Trial of Physical Activity Promotion by General Practitioners

    PubMed Central

    Grandes, Gonzalo; Sanchez, Alvaro; Montoya, Imanol; Ortega Sanchez-Pinilla, Ricardo; Torcal, Jesús

    2011-01-01

    Background We evaluate the effectiveness of a physical activity promotion programme carried out by general practitioners with inactive patients in routine care. Methods and Findings Pragmatic, cluster randomised clinical trial conducted in eleven public primary care centres in Spain. Fifty-six general practitioners (GPs) were randomly assigned to intervention (29) or standard care (27) groups. They assessed the physical activity level of a systematic sample of patients in routine practice and recruited 4317 individuals (2248 intervention and 2069 control) who did not meet minimum physical activity recommendations. Intervention GPs provided advice to all patients and a physical activity prescription to the subgroup attending an additional appointment (30%). A third of these prescriptions were opportunistically repeated. Control GPs provided standard care. Primary outcome measure was the change in self-reported physical activity from baseline to six, 12 and 24 months. Secondary outcomes included cardiorespiratory fitness and health-related quality of life. A total of 3691 patients (85%) were included in the longitudinal analysis and overall trends over the whole 24 month follow-up were significantly better in the intervention group (p<0.01). The greatest differences with the control group were observed at six months (adjusted difference 1.7 MET*hr/wk [95% CI, 0.8 to 2.6], 25 min/wk [95% CI, 11.3 to 38.4], and a 5.3% higher percentage of patients meeting minimum recommendations [95% CI: 2.1% to 8.8%] NNT = 19). These differences were not statistically significant at 12 and 24 months. No differences were found in secondary outcomes. A significant difference was maintained until 24 months in the proportion of patients achieving minimum recommendation in the subgroup that received a repeat prescription (adjusted difference 10.2%, 95% CI 1.5% to 19.4%). Conclusions General practitioners are effective at increasing the level of physical activity among their inactive

  20. Rotational Velocities and Chromospheric/Coronal Activity of Low-Mass Stars in the Young Open Clusters IC 2391 and IC 2602

    NASA Astrophysics Data System (ADS)

    Stauffer, John R.; Hartmann, Lee W.; Prosser, Charles F.; Randich, Sofia; Balachandran, Suchitra; Patten, Brian M.; Simon, Theodore; Giampapa, Mark

    1997-04-01

    coronal activity as is found in several other young open clusters. That is, there is a large spread in coronal activity for stars with v sin i < 25 km s-1, where we assume there is an intrinsic link between increasing rotation and increasing activity superimposed upon which are a variety of observational and physical mechanisms that act to smear out this relation; above v sin i ~ 25 km s-1, all of the low-mass stars have log (LX/Lbol) ~ -3.0, the canonical ``saturation'' limit. Our measurements of the Hα equivalent widths are consistent with a similar relationship holding for chromospheric activity. One and possibly two of our spectra for M dwarf members of the IC clusters show broad wings for the Hα profile, which we attribute to a flare event or to microflares. Since spectra of a small sample of late-type M dwarfs in the Pleiades also showed similarly broad Hα wings, this suggests that flare frequencies for very young M dwarfs may be quite high.

  1. A participatory parent-focused intervention promoting physical activity in preschools: design of a cluster-randomized trial

    PubMed Central

    2010-01-01

    Background With rates of childhood obesity increasing, physical activity (PA) promotion especially in young children has assumed greater importance. Given the limited effectiveness of most interventions to date, new approaches are needed. The General Systems theory suggests that involving parents as intervention targets may be effective in fostering healthier life styles in children. We describe the development of a parent-focused participatory intervention and the procedures used to evaluate its effectiveness in increasing daily PA in preschoolers. Methods/Design Thirty-seven South German preschools were identified for this study and agreed to participate. Using a two-armed, controlled cluster-randomized trial design we test a participatory intervention with parents as the primary target group and potential agents of behavioural change. Specifically, the intervention is designed to engage parents in the development, refinement and selection of project ideas to promote PA and in incorporating these ideas into daily routines within the preschool community, consisting of children, teachers and parents. Our study is embedded within an existing state-sponsored programme providing structured gym lessons to preschool children. Thus, child-based PA outcomes from the study arm with the parent-focused intervention and the state-sponsored programme are compared with those from the study arm with the state-sponsored programme alone. The evaluation entails baseline measurements of study outcomes as well as follow-up measurements at 6 and 12 months. Accelerometry measures PA intensity over a period of six days, with the mean over six days used as the primary outcome measure. Secondary outcomes include childrens' BMI, a sum of averaged skin fold thickness measurements across multiple sites, and PA behaviour. Longitudinal multilevel models are used to assess within-subject change and between-group differences in study outcomes, adjusted for covariates at the preschool and

  2. A Survey of Chromospheric Activity in the Solar-Type Stars in the Open Cluster M67

    NASA Astrophysics Data System (ADS)

    Giampapa, Mark S.; Hall, Jeffrey C.; Radick, Richard R.; Baliunas, Sallie L.

    2006-11-01

    We present the results of a spectroscopic survey of the Ca II H and K core strengths in a sample of 60 solar-type stars that are members of the solar-age and solar-metallicity open cluster M67. We adopt the HK index, defined as the summed H+K core strengths in 1 Å bandpasses centered on the H and K lines, respectively, as a measure of the chromospheric activity that is present. We compare the distribution of mean HK index values for the M67 solar-type stars with the variation of this index as measured for the Sun during the contemporary solar cycle. We find that the stellar distribution in our HK index is broader than that for the solar cycle. Approximately 17% of the M67 Sun-like stars exhibit average HK indices that are less than solar minimum. About 7%-12% are characterized by relatively high activity in excess of solar maximum values, while 72%-80% of the solar analogs exhibit Ca II H+K strengths within the range of the modern solar cycle. The ranges given reflect uncertainties in the most representative value of the maximum in the HK index to adopt for the solar cycle variations observed during the period AD 1976-2004. Thus, ~20%-30% of our homogeneous sample of Sun-like stars have mean chromospheric H+K strengths that are outside the range of the contemporary solar cycle. Any cycle-like variability that is present in the M67 solar-type stars appears to be characterized by periods greater than ~6 yr. Finally, we estimate a mean chromospheric age for M67 in the range of 3.8-4.3 Gyr. The results presented herein are based on data obtained at the WIYN telescope and at the McMath-Pierce Solar Telescope. The WIYN Observatory is a joint facility of the University of Wisconsin-Madison, Indiana University, Yale University, and the National Optical Astronomy Observatory. The McMath-Pierce Solar Telescope Facility is operated by the National Solar Observatory for the National Science Foundation. This paper is WIYN Open Cluster Study XXVIII in the series.

  3. PROMOTING GROSS MOTOR SKILLS IN TODDLERS: THE ACTIVE BEGINNINGS PILOT CLUSTER RANDOMIZED TRIAL.

    PubMed

    Veldman, Sanne L C; Okely, Anthony D; Jones, Rachel A

    2015-12-01

    This study examined the feasibility, acceptability, and potential efficacy of a gross motor skill program for toddlers. An 8-wk. skills program in which children practiced three skills was implemented for 10 min. daily in two randomly designated childcare centers. Two other centers served as the control group. Recruitment and retention rates were collected for feasibility. Data on professional development, children's participation, program duration, and appropriateness of the lessons were collected for acceptability, and the Test of Gross Motor Development-2 and Get Skilled, Get Active (total of 28 points) were used to look at the potential efficacy. The participants were 60 toddlers (M age=2.5 yr., SD=0.4; n=29 boys), and the retention rate was 95%. Overall participation was 76%, and educators rated 98% of the lessons as appropriate. Compared with the control group, the intervention group showed significantly greater improvements in motor skills (p<.05, Cohen's d=1.13). This study shows that a brief intervention, which is easy to integrate on a daily basis in childcare settings, can improve motor skills among toddlers. PMID:26682608

  4. Theory-Based Behavioral Intervention Increases Self-Reported Physical Activity in South African Men: A Cluster-Randomized Controlled Trial

    PubMed Central

    Jemmott, John B.; Jemmott, Loretta S.; Ngwane, Zolani; Zhang, Jingwen; Heeren, G. Anita; Icard, Larry D.; O’Leary, Ann; Mtose, Xoliswa; Teitelman, Anne; Carty, Craig

    2014-01-01

    Objective To determine whether a health-promotion intervention increases South African men’s adherence to physical-activity guidelines. Method We utilized a cluster-randomized controlled trial design. Eligible clusters, residential neighborhoods near East London, South Africa, were matched in pairs. Within randomly selected pairs, neighborhoods were randomized to theory-based, culturally congruent health-promotion intervention encouraging physical activity or attention-matched HIV/STI risk-reduction control intervention. Men residing in the neighborhoods and reporting coitus in the previous 3 months were eligible. Primary outcome was self-reported individual-level adherence to physical-activity guidelines averaged over 6-month and 12-month post-intervention assessments. Data were collected in 2007–2010. Data collectors, but not facilitators or participants, were blind to group assignment. Results Primary outcome intention-to-treat analysis included 22 of 22 clusters and 537 of 572 men in the health-promotion intervention and 22 of 22 clusters and 569 of 609 men in the attention-control intervention. Model-estimated probability of meeting physical-activity guidelines was 51.0% in the health-promotion intervention and 44.7% in attention-matched control (OR = 1.34; 95% CI, 1.09–1.63), adjusting for baseline prevalence and clustering from 44 neighborhoods. Conclusion A theory-based culturally congruent intervention increased South African men’s self-reported physical activity, a key contributor to deaths from non-communicable diseases in South Africa. Trial registration ClinicalTrials.gov Identifier: NCT01490359. PMID:24736094

  5. Activation of Methane and Carbon Dioxide Mediated by Transition-Metal Doped Magnesium Oxide Clusters [MMgO](+/0/-) (M=Sc-Zn).

    PubMed

    Li, Jilai; González-Navarrete, Patricio; Schlangen, Maria; Schwarz, Helmut

    2015-05-18

    Mission: impossible? DFT calculations show that the trends in the thermochemistry are very different for the activation of CO2 and CH4 mediated by transition-metal doped magnesium oxide clusters [MMgO](+/0/-) (M=Sc-Zn). Thus, seeking a "simple" reagent to simultaneously mediate activation and coupling of CH4 and CO2 with high efficiency seems extremely daunting, if not impossible. PMID:25867011

  6. Activation of the Ustilagic Acid Biosynthesis Gene Cluster in Ustilago maydis by the C2H2 Zinc Finger Transcription Factor Rua1▿

    PubMed Central

    Teichmann, Beate; Liu, Lidan; Schink, Kay Oliver; Bölker, Michael

    2010-01-01

    The phytopathogenic basidiomycetous fungus Ustilago maydis secretes, under conditions of nitrogen starvation, large amounts of the biosurfactant ustilagic acid (UA). This secreted cellobiose glycolipid is toxic for many microorganisms and confers biocontrol activity to U. maydis. Recently, a large gene cluster that is responsible for UA biosynthesis was identified. Here, we show that expression of all cluster genes depends on Rua1, a nuclear protein of the C2H2 zinc finger family, whose gene is located within the gene cluster. While deletion of rua1 results in complete loss of UA production, overexpression of rua1 promotes increased UA synthesis even in the presence of a good nitrogen source. Bioinformatic analysis allowed us to identify a conserved sequence element that is present in the promoters of all structural genes involved in UA biosynthesis. Deletion analysis of several promoters within the cluster revealed that this DNA element serves as an upstream activating sequence (UAS) and mediates Rua1-dependent expression. We used the yeast one-hybrid system to demonstrate specific recognition of this DNA element by Rua1. Introduction of nucleotide exchanges into the consensus sequence interfered with Rua1-dependent activation, suggesting that this sequence element acts as a direct binding site for Rua1. PMID:20173069

  7. Reactivity of the free and (5,5)-carbon nanotube-supported AuPt bimetallic clusters towards O2 activation: a theoretical study.

    PubMed

    Shojaei, Fazel; Mousavi, Masoumeh; Nazari, Fariba; Illas, Francesc

    2015-02-01

    Density functional theory (DFT)-based calculations were carried out to predict the geometry, energy and electronic structures of the small bimetallic AumPtn (2 ≤m + n≤ 4) clusters deposited on a single-wall (5,5)-carbon nanotube (CNT). The chemical reactivity of these supported bimetallic clusters towards O2 reduction reaction was also considered. The calculations indicate that Au atoms tend to avoid the CNT atoms, whereas the opposite occurs for Pt atoms, a behavior which can be rationalized through analyses of the density of states plots. Compared to isolated clusters, the supported counterparts are found to have significant superiority in catalytic activity towards O2 reduction. The adsorption configuration and identity of the metal (Au or Pt) exposed to the O2 molecule adsorption are the dominant factors in determining the catalytic activity of the supported particles. Most notably, high catalytic activity of the supported clusters is associated with a drastic decrease in adsorption energy of the O2 molecule. PMID:25553579

  8. Activation of the ustilagic acid biosynthesis gene cluster in Ustilago maydis by the C2H2 zinc finger transcription factor Rua1.

    PubMed

    Teichmann, Beate; Liu, Lidan; Schink, Kay Oliver; Bölker, Michael

    2010-04-01

    The phytopathogenic basidiomycetous fungus Ustilago maydis secretes, under conditions of nitrogen starvation, large amounts of the biosurfactant ustilagic acid (UA). This secreted cellobiose glycolipid is toxic for many microorganisms and confers biocontrol activity to U. maydis. Recently, a large gene cluster that is responsible for UA biosynthesis was identified. Here, we show that expression of all cluster genes depends on Rua1, a nuclear protein of the C(2)H(2) zinc finger family, whose gene is located within the gene cluster. While deletion of rua1 results in complete loss of UA production, overexpression of rua1 promotes increased UA synthesis even in the presence of a good nitrogen source. Bioinformatic analysis allowed us to identify a conserved sequence element that is present in the promoters of all structural genes involved in UA biosynthesis. Deletion analysis of several promoters within the cluster revealed that this DNA element serves as an upstream activating sequence (UAS) and mediates Rua1-dependent expression. We used the yeast one-hybrid system to demonstrate specific recognition of this DNA element by Rua1. Introduction of nucleotide exchanges into the consensus sequence interfered with Rua1-dependent activation, suggesting that this sequence element acts as a direct binding site for Rua1. PMID:20173069

  9. Prevention through Activity in Kindergarten Trial (PAKT): A cluster randomised controlled trial to assess the effects of an activity intervention in preschool children

    PubMed Central

    2010-01-01

    Background Physical activity and motor skills acquisition are of high importance for health-related prevention and a normal development in childhood. However, few intervention studies exist in preschool children focussing on an increase in physical activity and motor skills. Proof of positive effects is available but not consistent. Methods/Design The design, curriculum, and evaluation strategy of a cluster randomised intervention study in preschool children are described in this manuscript. In the Prevention through Activity in Kindergarten Trial (PAKT), 41 of 131 kindergartens of Wuerzburg and Kitzingen, Germany, were randomised into an intervention and a control group by a random number table stratified for the location of the kindergarten in an urban (more than 20.000 inhabitants) or rural area. The aims of the intervention were to increase physical activity and motor skills in the participating children, and to reduce health risk factors as well as media use. The intervention was designed to involve children, parents and teachers, and lasted one academic year. It contained daily 30-min sessions of physical education in kindergarten based on a holistic pedagogic approach termed the "early psychomotor education". The sessions were instructed by kindergarten teachers under regular supervision by the research team. Parents were actively involved by physical activity homework cards. The kindergarten teachers were trained in workshops and during the supervision. Assessments were performed at baseline, 3-5 months into the intervention, at the end of the intervention and 2-4 months after the intervention. The primary outcomes of the study are increases in physical activity (accelerometry) and in motor skills performance (composite score of obstacle course, standing long jump, balancing on one foot, jumping sidewise to and fro) between baseline and the two assessments during the intervention. Secondary outcomes include decreases in body adiposity (BMI, skin folds

  10. A Career Guidance Curriculum for Ninth Grade Students. Occupational Cluster Learning Activities. Health-Technical. Part 2 of 2. Ninth Grade Career Guidance Project. Project Duration: July 16, 1979, to June 30, 1980.

    ERIC Educational Resources Information Center

    Cape May County Vocational Schools, NJ.

    This second of two parts presents learning activities for four occupational clusters of a ninth-grade cluster program. It contains theory and hands-on activities that explore the occupational requirements and working environment of these areas to help students make intelligent decisions of possible career choices based on levels of interest and…

  11. A Career Guidance Curriculum for Ninth Grade Students. Occupational Cluster Learning Activities. Business-Environmental. Part 1 of 2. Ninth Grade Guidance Project. Project Duration: July 16, 1979, to June 30, 1980.

    ERIC Educational Resources Information Center

    Cape May County Vocational Schools, NJ.

    This first of two parts presents learning activities for four occupational clusters of a ninth-grade cluster program. It contains theory and hands-on activities that explore the occupational requirements and working environment of these areas to help students make intelligent decisions of possible career choices based on levels of interest and…

  12. Nuclear resonance vibrational spectroscopy reveals the FeS cluster composition and active site vibrational properties of an O2-tolerant NAD+-reducing [NiFe] hydrogenase

    DOE PAGESBeta

    Lauterbach, Lars; Wang, Hongxin; Horch, Marius; Gee, Leland B.; Yoda, Yoshitaka; Tanaka, Yoshihito; Zebger, Ingo; Lenz, Oliver; Cramer, Stephen P.

    2014-10-30

    Hydrogenases are complex metalloenzymes that catalyze the reversible splitting of molecular hydrogen into protons and electrons essentially without overpotential. The NAD+-reducing soluble hydrogenase (SH) from Ralstonia eutropha is capable of H2 conversion even in the presence of usually toxic dioxygen. The molecular details of the underlying reactions are largely unknown, mainly because of limited knowledge of the structure and function of the various metal cofactors present in the enzyme. Here, all iron-containing cofactors of the SH were investigated by 57Fe specific nuclear resonance vibrational spectroscopy (NRVS). Our data provide experimental evidence for one [2Fe2S] center and four [4Fe4S] clusters, whichmore » is consistent with the amino acid sequence composition. Only the [2Fe2S] cluster and one of the four [4Fe4S] clusters were reduced upon incubation of the SH with NADH. This finding explains the discrepancy between the large number of FeS clusters and the small amount of FeS cluster-related signals as detected by electron paramagnetic resonance spectroscopic analysis of several NAD+-reducing hydrogenases. For the first time, Fe–CO and Fe–CN modes derived from the [NiFe] active site could be distinguished by NRVS through selective 13C labeling of the CO ligand. This strategy also revealed the molecular coordinates that dominate the individual Fe–CO modes. The present approach explores the complex vibrational signature of the Fe–S clusters and the hydrogenase active site, thereby showing that NRVS represents a powerful tool for the elucidation of complex biocatalysts containing multiple cofactors.« less

  13. DNA methylation in an enhancer region of the FADS cluster is associated with FADS activity in human liver.

    PubMed

    Howard, Timothy D; Mathias, Rasika A; Seeds, Michael C; Herrington, David M; Hixson, James E; Shimmin, Lawrence C; Hawkins, Greg A; Sellers, Matthew; Ainsworth, Hannah C; Sergeant, Susan; Miller, Leslie R; Chilton, Floyd H

    2014-01-01

    Levels of omega-6 (n-6) and omega-3 (n-3), long chain polyunsaturated fatty acids (LcPUFAs) such as arachidonic acid (AA; 20:4, n-6), eicosapentaenoic acid (EPA; 20:5, n-3) and docosahexaenoic acid (DHA; 22:6, n-3) impact a wide range of biological activities, including immune signaling, inflammation, and brain development and function. Two desaturase steps (Δ6, encoded by FADS2 and Δ5, encoded by FADS1) are rate limiting in the conversion of dietary essential 18 carbon PUFAs (18C-PUFAs) such as LA (18:2, n-6) to AA and α-linolenic acid (ALA, 18:3, n-3) to EPA and DHA. GWAS and candidate gene studies have consistently identified genetic variants within FADS1 and FADS2 as determinants of desaturase efficiencies and levels of LcPUFAs in circulating, cellular and breast milk lipids. Importantly, these same variants are documented determinants of important cardiovascular disease risk factors (total, LDL, and HDL cholesterol, triglycerides, CRP and proinflammatory eicosanoids). FADS1 and FADS2 lie head-to-head (5' to 5') in a cluster configuration on chromosome 11 (11q12.2). There is considerable linkage disequilibrium (LD) in this region, where multiple SNPs display association with LcPUFA levels. For instance, rs174537, located ∼ 15 kb downstream of FADS1, is associated with both FADS1 desaturase activity and with circulating AA levels (p-value for AA levels = 5.95 × 10(-46)) in humans. To determine if DNA methylation variation impacts FADS activities, we performed genome-wide allele-specific methylation (ASM) with rs174537 in 144 human liver samples. This approach identified highly significant ASM with CpG sites between FADS1 and FADS2 in a putative enhancer signature region, leading to the hypothesis that the phenotypic associations of rs174537 are likely due to methylation differences. In support of this hypothesis, methylation levels of the most significant probe were strongly associated with FADS1 and, to a lesser degree, FADS2 activities. PMID:24842322

  14. DNA Methylation in an Enhancer Region of the FADS Cluster Is Associated with FADS Activity in Human Liver

    PubMed Central

    Howard, Timothy D.; Mathias, Rasika A.; Seeds, Michael C.; Herrington, David M.; Hixson, James E.; Shimmin, Lawrence C.; Hawkins, Greg A.; Sellers, Matthew; Ainsworth, Hannah C.; Sergeant, Susan; Miller, Leslie R.; Chilton, Floyd H.

    2014-01-01

    Levels of omega-6 (n-6) and omega-3 (n-3), long chain polyunsaturated fatty acids (LcPUFAs) such as arachidonic acid (AA; 20∶4, n-6), eicosapentaenoic acid (EPA; 20∶5, n-3) and docosahexaenoic acid (DHA; 22∶6, n-3) impact a wide range of biological activities, including immune signaling, inflammation, and brain development and function. Two desaturase steps (Δ6, encoded by FADS2 and Δ5, encoded by FADS1) are rate limiting in the conversion of dietary essential 18 carbon PUFAs (18C-PUFAs) such as LA (18∶2, n-6) to AA and α-linolenic acid (ALA, 18∶3, n-3) to EPA and DHA. GWAS and candidate gene studies have consistently identified genetic variants within FADS1 and FADS2 as determinants of desaturase efficiencies and levels of LcPUFAs in circulating, cellular and breast milk lipids. Importantly, these same variants are documented determinants of important cardiovascular disease risk factors (total, LDL, and HDL cholesterol, triglycerides, CRP and proinflammatory eicosanoids). FADS1 and FADS2 lie head-to-head (5′ to 5′) in a cluster configuration on chromosome 11 (11q12.2). There is considerable linkage disequilibrium (LD) in this region, where multiple SNPs display association with LcPUFA levels. For instance, rs174537, located ∼15 kb downstream of FADS1, is associated with both FADS1 desaturase activity and with circulating AA levels (p-value for AA levels = 5.95×10−46) in humans. To determine if DNA methylation variation impacts FADS activities, we performed genome-wide allele-specific methylation (ASM) with rs174537 in 144 human liver samples. This approach identified highly significant ASM with CpG sites between FADS1 and FADS2 in a putative enhancer signature region, leading to the hypothesis that the phenotypic associations of rs174537 are likely due to methylation differences. In support of this hypothesis, methylation levels of the most significant probe were strongly associated with FADS1 and, to a lesser degree, FADS2 activities

  15. A theoretical study of O2 activation by the Au7-cluster on Mg(OH)2: roles of surface hydroxyls and hydroxyl defects.

    PubMed

    Jia, Chuanyi; Fan, Weiliu

    2015-11-11

    Using density functional theory (DFT) calculations, we investigated O2 activation by the Au7-cluster supported on the perfect and hydroxyl defective Mg(OH)2(0001) surface. It is revealed that hydroxyl groups on the perfect Mg(OH)2(0001) surface can not only enhance the stability of the Au7-cluster, but also help the adsorption of the O2 molecule through hydrogen-bonding interactions with the 2nd-layered interfacial Au sites. Density of states (DOS) analysis shows that the d-band centers of the 2nd-layered interfacial Au atoms are very close to the Fermi level, which thereby reduce the Pauli repulsion and promote the O2 adsorption. These two responses make the 2nd-layered interfacial Au atoms favor O2 activation. Interestingly, the surface hydrogen atoms activated by the 1st-layered Au atoms can facilitate the O2 dissociation process as well. Such a process is dynamically favorable and more inclined to occur at low temperatures compared to the direct dissociation process. Meanwhile, the hydroxyl defects of Mg(OH)2(0001) located right under the Au7-cluster can also up-shift the d-band centers of the surrounding Au atoms toward the Fermi level, enhancing its catalytic activity for O2 dissociation. In contrast, the d-band center of Au atoms surrounding the hydroxyl defect near the Au7-cluster exhibits an effective down-shift to lower energies, and therefore holds low activity. These results unveiled the roles of surface hydroxyls and hydroxyl defects on the Au/Mg(OH)2 catalyst in O2 activation and could provide a theoretical guidance for chemists to efficiently synthesize Au/hydroxide catalysts. PMID:26529519

  16. Gold(III) Mediated Activation and Transformation of Methane on Au1-Doped Vanadium Oxide Cluster Cations AuV2O6(.).

    PubMed

    Li, Zi-Yu; Li, Hai-Fang; Zhao, Yan-Xia; He, Sheng-Gui

    2016-08-01

    Gold in the +III oxidation state (Au(III)) has been proposed as a promising species to mediate challenging chemical reactions. However, it is difficult to characterize the chemistry of individual Au(III) species in condensed-phase systems mainly due to the interference from the Au(I) counterpart. Herein, by doping Au atoms into gas-phase vanadium oxide clusters, we demonstrate that the Au(III) cation in the AuV2O6(+) cluster is active for activation and transformation of methane, the most stable alkane molecule, into formaldehyde under mild conditions. In contrast, the AuV2O6(+) cluster isomers with the Au(I) cation can only absorb CH4. The clusters were generated by laser ablation and mass selected to react with CH4, CD4, or CH2D2 in an ion trap reactor. The reactivity was characterized by mass spectrometry and quantum chemistry calculations. The structures of the reactant and product ions were identified by using collision-induced and 425 nm photo-induced dissociation techniques. PMID:27385079

  17. Clustering of Resting State Networks

    PubMed Central

    Lee, Megan H.; Hacker, Carl D.; Snyder, Abraham Z.; Corbetta, Maurizio; Zhang, Dongyang; Leuthardt, Eric C.; Shimony, Joshua S.

    2012-01-01

    Background The goal of the study was to demonstrate a hierarchical structure of resting state activity in the healthy brain using a data-driven clustering algorithm. Methodology/Principal Findings The fuzzy-c-means clustering algorithm was applied to resting state fMRI data in cortical and subcortical gray matter from two groups acquired separately, one of 17 healthy individuals and the second of 21 healthy individuals. Different numbers of clusters and different starting conditions were used. A cluster dispersion measure determined the optimal numbers of clusters. An inner product metric provided a measure of similarity between different clusters. The two cluster result found the task-negative and task-positive systems. The cluster dispersion measure was minimized with seven and eleven clusters. Each of the clusters in the seven and eleven cluster result was associated with either the task-negative or task-positive system. Applying the algorithm to find seven clusters recovered previously described resting state networks, including the default mode network, frontoparietal control network, ventral and dorsal attention networks, somatomotor, visual, and language networks. The language and ventral attention networks had significant subcortical involvement. This parcellation was consistently found in a large majority of algorithm runs under different conditions and was robust to different methods of initialization. Conclusions/Significance The clustering of resting state activity using different optimal numbers of clusters identified resting state networks comparable to previously obtained results. This work reinforces the observation that resting state networks are hierarchically organized. PMID:22792291

  18. A cluster-randomised, controlled trial to assess the impact of a workplace osteoporosis prevention intervention on the dietary and physical activity behaviours of working women: study protocol

    PubMed Central

    2013-01-01

    Background Osteoporosis is a debilitating disease and its risk can be reduced through adequate calcium consumption and physical activity. This protocol paper describes a workplace-based intervention targeting behaviour change in premenopausal women working in sedentary occupations. Method/Design A cluster-randomised design was used, comparing the efficacy of a tailored intervention to standard care. Workplaces were the clusters and units of randomisation and intervention. Sample size calculations incorporated the cluster design. Final number of clusters was determined to be 16, based on a cluster size of 20 and calcium intake parameters (effect size 250 mg, ICC 0.5 and standard deviation 290 mg) as it required the highest number of clusters. Sixteen workplaces were recruited from a pool of 97 workplaces and randomly assigned to intervention and control arms (eight in each). Women meeting specified inclusion criteria were then recruited to participate. Workplaces in the intervention arm received three participatory workshops and organisation wide educational activities. Workplaces in the control/standard care arm received print resources. Intervention workshops were guided by self-efficacy theory and included participatory activities such as goal setting, problem solving, local food sampling, exercise trials, group discussion and behaviour feedback. Outcomes measures were calcium intake (milligrams/day) and physical activity level (duration: minutes/week), measured at baseline, four weeks and six months post intervention. Discussion This study addresses the current lack of evidence for behaviour change interventions focussing on osteoporosis prevention. It addresses missed opportunities of using workplaces as a platform to target high-risk individuals with sedentary occupations. The intervention was designed to modify behaviour levels to bring about risk reduction. It is the first to address dietary and physical activity components each with unique intervention

  19. Emission of Thermally Activated Electrons from Rare Gas Clusters Irradiated with Intense VUV Light Pulses from a Free Electron Laser

    SciTech Connect

    Laarmann, T.; Rusek, M.; Schulz, J.; Castro, A.R.B. de; Guertler, P.; Laasch, W.; Moeller, T.

    2005-08-05

    The ionization dynamics of Ar and Xe clusters irradiated with intense vacuum ultraviolet light from a free-electron laser is investigated using photoelectron spectroscopy. Clusters comprising between 70 and 900 atoms were irradiated with femtosecond pulses at 95 nm wavelength ({approx}13 eV photon energy) and a peak intensity of {approx}4x10{sup 12} W/cm{sup 2}. A broad thermal distribution of emitted electrons from clusters with a maximum kinetic energy up to 30-40 eV is observed. The observation of relatively low-energy photoelectrons is in good agreement with calculations using a time-dependent Thomas-Fermi model and gives experimental evidence of an outer ionization process of the clusters, due to delayed thermoelectronic emission.

  20. Hierarchical chlorine-doped rutile TiO{sub 2} spherical clusters of nanorods: Large-scale synthesis and high photocatalytic activity

    SciTech Connect

    Xu Hua; Zheng Zhi; Zhang Lizhi Zhang Hailu; Deng Feng

    2008-09-15

    In this study, we report the synthesis of hierarchical chlorine-doped rutile TiO{sub 2} spherical clusters of nanorods photocatalyst on a large scale via a soft interface approach. This catalyst showed much higher photocatalytic activity than the famous commercial titania (Degussa P25) under visible light ({lambda}>420 nm). The resulting sample was characterized by X-ray diffraction (XRD), scanning electron microscopy (SEM), transmission electron microscopy (TEM), high-resolution TEM (HRTEM), nitrogen adsorption, X-ray photoelectron spectroscopy (XPS), UV-vis diffuse reflectance spectroscopy, {sup 1}H solid magic-angle spinning nuclear magnetic resonance (MAS-NMR) and photoluminescence spectroscopy. On the basis of characterization results, we found that the doping of chlorine resulted in red shift of absorption and higher surface acidity as well as crystal defects in the photocatalyst, which were the reasons for high photocatalytic activity of chlorine-doped TiO{sub 2} under visible light ({lambda}>420 nm). These hierarchical chlorine-doped rutile TiO{sub 2} spherical clusters of nanorods are very attractive in the fields of environmental pollutants removal and solar cell because of their easy separation and high activity. - Graphical abstract: Hierarchical chlorine-doped rutile TiO{sub 2} spherical clusters of nanorods photocatalyst were synthesized on a large scale via a soft interface approach. This catalyst showed much higher photocatalytic activity than the famous commercial titania (Degussa P25) under visible light ({lambda}>420 nm)

  1. Meaningful Clusters

    SciTech Connect

    Sanfilippo, Antonio P.; Calapristi, Augustin J.; Crow, Vernon L.; Hetzler, Elizabeth G.; Turner, Alan E.

    2004-05-26

    We present an approach to the disambiguation of cluster labels that capitalizes on the notion of semantic similarity to assign WordNet senses to cluster labels. The approach provides interesting insights on how document clustering can provide the basis for developing a novel approach to word sense disambiguation.

  2. ROLE OF C AND P SITES ON THE CHEMICAL ACTIVITY OF METAL CARBIDE AND PHOSPHIDES: FROM CLUSTERS TO SINGLE-CRYSTAL SURFACES

    SciTech Connect

    RODRIGUEZ,J.A.; VINES, F.; LIU, P.; ILLAS, F.

    2007-07-01

    Transition metal carbides and phosphides have shown tremendous potential as highly active catalysts. At a microscopic level, it is not well understood how these new catalysts work. Their high activity is usually attributed to ligand or/and ensemble effects. Here, we review recent studies that examine the chemical activity of metal carbide and phosphides as a function of size, from clusters to extended surfaces, and metal/carbon or metal/phosphorous ratio. These studies reveal that the C and P sites in these compounds cannot be considered as simple spectators. They moderate the reactivity of the metal centers and provide bonding sites for adsorbates.

  3. The relationship between activity clusters detected by an automatic activity monitor and endocrine changes during the periestrous period in lactating dairy cows.

    PubMed

    Aungier, S P M; Roche, J F; Duffy, P; Scully, S; Crowe, M A

    2015-03-01

    The aim of this study was to determine the relationship between observed estrous-related behavior, activity clusters (AC; detected by automatic activity monitor), endocrine profiles, and ovulation time. Twenty-one cows in estrus (after 2 cloprostenol treatments, 11 d apart) and 12 nonsynchronized cows, to establish Heatime (SCR Engineers Ltd., Netanya, Israel) herd baseline activity, were enrolled. Cows had Heatime monitors applied 3 wk before the trial to establish their own baseline activity level. Cows in standing estrus had ultrasonography and phlebotomy carried out every 4 h to determine dominant follicle size, endocrine profiles, and ovulation time. After ovulation, these procedures were repeated once on d 3 to 6. Heatime alerted estrus in 90% of cows, and incorrectly alerted 17% of AC. The mean±SEM duration for standing estrus was 9±1 and 13±1 h for estrous-related behavior. Estrous-related behavior began after the start of the proestrous estradiol-17β (E2) increase (59±6.5 h). Cows with longer durations of raised proestrous E2 had longer intervals from its onset to the start of standing estrus and AC. The AC duration increased with longer durations of estrous-related behavior. Higher peak E2 occurred with longer standing estrus and estrous-related behavior. As E2 concentration decreased after the peak, 90% of cows still had estrous-related behavior. Duration of estrous-related behavior increased with higher average E2 concentration during the last 8 h before the start of the LH surge. During this surge 90% of cows had all of their standing estrus. As yields increased, so did the magnitude of the preovulatory FSH surges. Higher surges occurred with shorter standing estrus and estrous-related behavior. Cows with shorter LH surges had longer standing estrus. Peak LH preceded the AC peak (6.6±0.8 h). Duration of overlap between the AC start and the LH surge end ranged between 0 and 14 h; 1 cow had none. No association was found between the AC

  4. Production of a Novel Amide-Containing Polyene by Activating a Cryptic Biosynthetic Gene Cluster in Streptomyces sp. MSC090213JE08.

    PubMed

    Du, Danyao; Katsuyama, Yohei; Onaka, Hiroyasu; Fujie, Manabu; Satoh, Noriyuki; Shin-Ya, Kazuo; Ohnishi, Yasuo

    2016-08-01

    Streptomyces sp. MSC090213JE08 seems to have more than 20 cryptic biosynthetic gene clusters for secondary metabolites. We aimed to activate some of them by forced production of Streptomyces antibiotic regulatory protein (SARP) family transcriptional activators. We constructed seven recombinant strains, each of which contained a SARP gene under the control of a constitutive promoter, and subjected them to comparative metabolic profiling analysis. Four of the seven strains produced nine metabolites that were hardly detected in the control strains. We isolated a new metabolite (named ishigamide) from the SARP-7-expressing strain and determined its structure as 3-((2E,4E,6E,8E)-13-hydroxytetradeca-2,4,6,8-tetraenamido)propanoic acid. Genome scanning and gene disruption studies identified the ishigamide biosynthetic gene cluster adjacent to the SARP-7 gene. We think that a new subfamily of type II polyketide synthase is involved in the biosynthesis of the polyene structure of ishigamide. PMID:27311327

  5. Imaging active faulting in a region of distributed deformation from the joint clustering of focal mechanisms and hypocentres: Application to the Azores-western Mediterranean region

    NASA Astrophysics Data System (ADS)

    Custódio, Susana; Lima, Vânia; Vales, Dina; Cesca, Simone; Carrilho, Fernando

    2016-04-01

    The matching between linear trends of hypocentres and fault planes indicated by focal mechanisms (FMs) is frequently used to infer the location and geometry of active faults. This practice works well in regions of fast lithospheric deformation, where earthquake patterns are clear and major structures accommodate the bulk of deformation, but typically fails in regions of slow and distributed deformation. We present a new joint FM and hypocentre cluster algorithm that is able to detect systematically the consistency between hypocentre lineations and FMs, even in regions of distributed deformation. We apply the method to the Azores-western Mediterranean region, with particular emphasis on western Iberia. The analysis relies on a compilation of hypocentres and FMs taken from regional and global earthquake catalogues, academic theses and technical reports, complemented by new FMs for western Iberia. The joint clustering algorithm images both well-known and new seismo-tectonic features. The Azores triple junction is characterised by FMs with vertical pressure (P) axes, in good agreement with the divergent setting, and the Iberian domain is characterised by NW-SE oriented P axes, indicating a response of the lithosphere to the ongoing oblique convergence between Nubia and Eurasia. Several earthquakes remain unclustered in the western Mediterranean domain, which may indicate a response to local stresses. The major regions of consistent faulting that we identify are the mid-Atlantic ridge, the Terceira rift, the Trans-Alboran shear zone and the north coast of Algeria. In addition, other smaller earthquake clusters present a good match between epicentre lineations and FM fault planes. These clusters may signal single active faults or wide zones of distributed but consistent faulting. Mainland Portugal is dominated by strike-slip earthquakes with fault planes coincident with the predominant NNE-SSW and WNW-ESE oriented earthquake lineations. Clusters offshore SW Iberia are

  6. Effect of a Nutrition Supplement and Physical Activity Program on Pneumonia and Walking Capacity in Chilean Older People: A Factorial Cluster Randomized Trial

    PubMed Central

    Dangour, Alan D.; Albala, Cecilia; Allen, Elizabeth; Grundy, Emily; Walker, Damian G.; Aedo, Cristian; Sanchez, Hugo; Fletcher, Olivia; Elbourne, Diana; Uauy, Ricardo

    2011-01-01

    Background Ageing is associated with increased risk of poor health and functional decline. Uncertainties about the health-related benefits of nutrition and physical activity for older people have precluded their widespread implementation. We investigated the effectiveness and cost-effectiveness of a national nutritional supplementation program and/or a physical activity intervention among older people in Chile. Methods and Findings We conducted a cluster randomized factorial trial among low to middle socioeconomic status adults aged 65–67.9 years living in Santiago, Chile. We randomized 28 clusters (health centers) into the study and recruited 2,799 individuals in 2005 (∼100 per cluster). The interventions were a daily micronutrient-rich nutritional supplement, or two 1-hour physical activity classes per week, or both interventions, or neither, for 24 months. The primary outcomes, assessed blind to allocation, were incidence of pneumonia over 24 months, and physical function assessed by walking capacity 24 months after enrolment. Adherence was good for the nutritional supplement (∼75%), and moderate for the physical activity intervention (∼43%). Over 24 months the incidence rate of pneumonia did not differ between intervention and control clusters (32.5 versus 32.6 per 1,000 person years respectively; risk ratio = 1.00; 95% confidence interval 0.61–1.63; p = 0.99). In intention-to-treat analysis, after 24 months there was a significant difference in walking capacity between the intervention and control clusters (mean difference 33.8 meters; 95% confidence interval 13.9–53.8; p = 0.001). The overall cost of the physical activity intervention over 24 months was US$164/participant; equivalent to US$4.84/extra meter walked. The number of falls and fractures was balanced across physical activity intervention arms and no serious adverse events were reported for either intervention. Conclusions Chile's nutritional supplementation program for older

  7. Homologous regulators, CnfR1 and CnfR2, activate expression of two distinct nitrogenase gene clusters in the filamentous cyanobacterium Anabaena variabilis ATCC 29413.

    PubMed

    Pratte, Brenda S; Thiel, Teresa

    2016-06-01

    The cyanobacterium Anabaena variabilis has two Mo-nitrogenases that function under different environmental conditions in different cell types. The heterocyst-specific nitrogenase encoded by the large nif1 gene cluster and the similar nif2 gene cluster that functions under anaerobic conditions in vegetative cells are under the control of the promoter for the first gene of each cluster, nifB1 or nifB2 respectively. Associated with each of these clusters is a putative regulatory gene called cnfR (patB) whose product has a C-terminal HTH domain and an N-terminal ferredoxin-like domain. CnfR1 activates nifB1 expression in heterocysts, while CnfR2 activates nifB2 expression. A cnfR1 mutant was unable to make nitrogenase under aerobic conditions in heterocysts while the cnfR2 mutant was unable to make nitrogenase under anaerobic conditions. Mutations in cnfR1 and cnfR2 reduced transcripts for the nif1 and nif2 genes respectively. The closely related cyanobacterium, Anabaena sp. PCC 7120 has the nif1 system but lacks nif2. Expression of nifB2:lacZ from A. variabilis in anaerobic vegetative cells of Anabaena sp. PCC 7120 depended on the presence of cnfR2. This suggests that CnfR2 is necessary and sufficient for activation of the nifB2 promoter and that the CnfR1/CnfR2 family of proteins are the primary activators of nitrogenase gene expression in cyanobacteria. PMID:26950042

  8. Hydrogen activation, diffusion, and clustering on CeO{sub 2}(111): A DFT+U study

    SciTech Connect

    Fernández-Torre, Delia

    2014-07-07

    We present a comprehensive density functional theory+U study of the mechanisms underlying the dissociation of molecular hydrogen, and diffusion and clustering of the resulting atomic species on the CeO{sub 2}(111) surface. Contrary to a widely held view based solely on a previous theoretical prediction, our results show conclusively that H{sub 2} dissociation is an activated process with a large energy barrier ∼1.0 eV that is not significantly affected by coverage or the presence of surface oxygen vacancies. The reaction proceeds through a local energy minimum – where the molecule is located close to one of the surface oxygen atoms and the H–H bond has been substantially weaken by the interaction with the substrate –, and a transition state where one H atom is attached to a surface O atom and the other H atom sits on-top of a Ce{sup 4+} ion. In addition, we have explored how several factors, including H coverage, the location of Ce{sup 3+} ions as well as the U value, may affect the chemisorption energy and the relative stability of isolated OH groups versus pair and trimer structures. The trimer stability at low H coverages and the larger upward relaxation of the surface O atoms within the OH groups are consistent with the assignment of the frequent experimental observation by non-contact atomic force and scanning tunneling microscopies of bright protrusions on three neighboring surface O atoms to a triple OH group. The diffusion path of isolated H atoms on the surface goes through the adsorption on-top of an oxygen in the third atomic layer with a large energy barrier of ∼1.8 eV. Overall, the large energy barriers for both, molecular dissociation and atomic diffusion, are consistent with the high activity and selectivity found recently in the partial hydrogenation of acetylene catalyzed by ceria at high H{sub 2}/C{sub 2}H{sub 2} ratios.

  9. Selectivity of Chemisorbed Oxygen in C–H Bond Activation and CO Oxidation and Kinetic Consequences for CH₄–O₂ Catalysis on Pt and Rh Clusters

    SciTech Connect

    Chin, Ya-Huei; Buda, Corneliu; Neurock, Matthew; Iglesia, Enrique

    2011-10-06

    Rate measurements, density functional theory (DFT) within the framework of transition state theory, and ensemble-averaging methods are used to probe oxygen selectivities, defined as the reaction probability ratios for O* reactions with CO and CH₄, during CH₄–O₂ catalysis on Pt and Rh clusters. CO₂ and H₂O are the predominant products, but small amounts of CO form as chemisorbed oxygen atoms (O*) are depleted from cluster surfaces. Oxygen selectivities, measured using ¹²CO–¹³CH₄–O₂ reactants, increase with O₂/ CO ratio and O* coverage and are much larger than unity at all conditions on Pt clusters. These results suggest that O* reacts much faster with CO than with CH₄, causing any CO that forms and desorbs from metal cluster surfaces to react along the reactor bed with other O* to produce CO₂ at any residence time required for detectable extents of CH₄ conversion. O* selectivities were also calculated by averaging DFTderived activation barriers for CO and CH₄ oxidation reactions over all distinct surface sites on cubo-octahedral Pt clusters (1.8 nm diameter, 201 Pt atoms) at low O* coverages, which are prevalent at low O₂ pressures during catalysis. CO oxidation involves non-activated molecular CO adsorption as the kinetically relevant step on exposed Pt atoms vicinal of chemisorbed O* atoms (on *–O* site pairs). CH₄ oxidation occurs via kinetically relevant C–H bond activation on *–* site pairs involving oxidative insertion of a Pt atom into one of the C–H bonds in CH₄, forming a three-centered HC₃–Pt–H transition state. C–H bond activation barriers reflect the strength of Pt–CH₃ and Pt–H interactions at the transition state, which correlates, in turn, with the Pt coordination and with CH₃ * binding energies. Ensemble-averaged O* selectivities increase linearly with O₂/CO ratios, which define the O* coverages, via a proportionality constant. The proportionality constant is given by the ratio of rate

  10. Active galactic nuclei. IV - Supplying black hole clusters by tidal disruption and by tidal capture of stars

    NASA Technical Reports Server (NTRS)

    Stoeger, W. R.; Pacholczyk, A. G.; Stepinski, T. F.

    1992-01-01

    The extent to which individual holes in a cluster of black holes with a mass spectrum can liberate and accrete the resulting material by tidally disrupting stars they encounter, or by capturing stars as binary companions is studied. It is found that the smaller black holes in 'the halo' of such clusters can adequately supply themselves to the level M-dot sub h or greater than 0.0001(M-dot sub h) sub crit, and up to 0.05(M-dot sub h)sub crit for the smallest holes, by tidal disruption, as long as the cluster is embedded in a distribution of stars of relatively high density (not less than 0.1M sub cl/cu pc), and as long as the entire cluster of stars is not too compact (not less than 0.5 pc). Consideration is given to modifications this 'internal' mode of supply introduces in the spectrum emitted by such black hole clusters, and to the current status of their viability as models for AGN and QSOs in light of dynamical studies by Quinlan and Shapiro (1987, 1989).

  11. On the mobility of vacancy clusters in reduced activation steels: an atomistic study in the Fe-Cr-W model alloy.

    PubMed

    Bonny, G; Castin, N; Bullens, J; Bakaev, A; Klaver, T C P; Terentyev, D

    2013-08-01

    Reduced activation steels are considered as structural materials for future fusion reactors. Besides iron and the main alloying element chromium, these steels contain other minor alloying elements, typically tungsten, vanadium and tantalum. In this work we study the impact of chromium and tungsten, being major alloying elements of ferritic Fe-Cr-W-based steels, on the stability and mobility of vacancy defects, typically formed under irradiation in collision cascades. For this purpose, we perform ab initio calculations, develop a many-body interatomic potential (EAM formalism) for large-scale calculations, validate the potential and apply it using an atomistic kinetic Monte Carlo method to characterize the lifetime and diffusivity of vacancy clusters. To distinguish the role of Cr and W we perform atomistic kinetic Monte Carlo simulations in Fe-Cr, Fe-W and Fe-Cr-W alloys. Within the limitation of transferability of the potentials it is found that both Cr and W enhance the diffusivity of vacancy clusters, while only W strongly reduces their lifetime. The cluster lifetime reduction increases with W concentration and saturates at about 1-2 at.%. The obtained results imply that W acts as an efficient 'breaker' of small migrating vacancy clusters and therefore the short-term annealing process of cascade debris is modified by the presence of W, even in small concentrations. PMID:23838265

  12. BREAKING THE {sigma}{sub 8}-{Omega} {sub m} DEGENERACY USING THE CLUSTERING OF HIGH-z X-RAY ACTIVE GALACTIC NUCLEI

    SciTech Connect

    Basilakos, Spyros; Plionis, Manolis

    2010-05-10

    The clustering of X-ray selected active galactic nuclei (AGNs) appears to be a valuable tool for extracting cosmological information. Using the recent high-precision angular clustering results of {approx}30,000 XMM-Newton soft (0.5-2 keV) X-ray sources, which have a median redshift of z {approx} 1, and assuming a flat geometry, a constant in comoving coordinates AGN clustering evolution, and the AGN bias evolution model of Basilakos et al., we manage to break the {sigma}{sub 8}-{Omega} {sub m} degeneracy. The resulting cosmological constraints are {Omega} {sub m} = 0.27{sup +0.03} {sub -0.05}, w = -0.90{sup +0.10} {sub -0.16}, and {sigma}{sub 8} = 0.74{sup +0.14} {sub -0.12}, while the dark matter host halo mass, in which the X-ray selected AGNs are presumed to reside, is M = 2.50{sup +0.50} {sub -1.50} x 10{sup 13} h {sup -1} M {sub sun}. For the constant {Lambda} model (w = -1) we find {Omega} {sub m} = 0.24 {+-} 0.06 and {sigma}{sub 8} = 0.83{sup +0.11} {sub -0.16}, in good agreement with recent studies based on cluster abundances, weak lensing, and the cosmic microwave background, but in disagreement with the recent bulk flow analysis.

  13. Actin Depletion Initiates Events Leading to Granule Secretion at the Immunological Synapse

    PubMed Central

    Ritter, Alex T.; Asano, Yukako; Stinchcombe, Jane C.; Dieckmann, N.M.G.; Chen, Bi-Chang; Gawden-Bone, C.; van Engelenburg, Schuyler; Legant, Wesley; Gao, Liang; Davidson, Michael W.; Betzig, Eric; Lippincott-Schwartz, Jennifer; Griffiths, Gillian M.

    2015-01-01

    Summary Cytotoxic T lymphocytes (CTLs) use polarized secretion to rapidly destroy virally infected and tumor cells. To understand the temporal relationships between key events leading to secretion, we used high-resolution 4D imaging. CTLs approached targets with actin-rich projections at the leading edge, creating an initially actin-enriched contact with rearward-flowing actin. Within 1 min, cortical actin reduced across the synapse, T cell receptors (TCRs) clustered centrally to form the central supramolecular activation cluster (cSMAC), and centrosome polarization began. Granules clustered around the moving centrosome within 2.5 min and reached the synapse after 6 min. TCR-bearing intracellular vesicles were delivered to the cSMAC as the centrosome docked. We found that the centrosome and granules were delivered to an area of membrane with reduced cortical actin density and phospholipid PIP2. These data resolve the temporal order of events during synapse maturation in 4D and reveal a critical role for actin depletion in regulating secretion. PMID:25992860

  14. The mitochondrial fission factor dynamin-related protein 1 modulates T-cell receptor signalling at the immune synapse

    PubMed Central

    Baixauli, Francesc; Martín-Cófreces, Noa B; Morlino, Giulia; Carrasco, Yolanda R; Calabia-Linares, Carmen; Veiga, Esteban; Serrador, Juan M; Sánchez-Madrid, Francisco

    2011-01-01

    During antigen-specific T-cell activation, mitochondria mobilize towards the vicinity of the immune synapse. We show here that the mitochondrial fission factor dynamin-related protein 1 (Drp1) docks at mitochondria, regulating their positioning and activity near the actin-rich ring of the peripheral supramolecular activation cluster (pSMAC) of the immune synapse. Mitochondrial redistribution in response to T-cell receptor engagement was abolished by Drp1 silencing, expression of the phosphomimetic mutant Drp1S637D and the Drp1-specific inhibitor mdivi-1. Moreover, Drp1 knockdown enhanced mitochondrial depolarization and T-cell receptor signal strength, but decreased myosin phosphorylation, ATP production and T-cell receptor assembly at the central supramolecular activation cluster (cSMAC). Our results indicate that Drp1-dependent mitochondrial positioning and activity controls T-cell activation by fuelling central supramolecular activation cluster assembly at the immune synapse. PMID:21326213

  15. Activation of human naïve Th cells increases surface expression of GD3 and induces neoexpression of GD2 that colocalize with TCR clusters.

    PubMed

    Villanueva-Cabello, Tania M; Mollicone, Rosella; Cruz-Muñoz, Mario E; López-Guerrero, Delia V; Martínez-Duncker, Iván

    2015-12-01

    CD4+ T helper lymphocytes (Th) orchestrate the immune response after their activation by antigen-presenting cells. Activation of naïve Th cells is reported to generate the reduction in surface epitopes of sialic acid (Sia) in α2,3 and α2,6 linkages. In this work, we report that in spite of this glycophenotype, anti-CD3/anti-CD28-activated purified human naïve Th cells show a significant increase in surface Sia, as assessed by metabolic labeling, compared with resting naïve Th cells, suggesting an increased flux of Sia toward Siaα2,8 glycoconjugates. To understand this increase as a result of ganglioside up-regulation, we observed that very early after activation, human naïve Th cells show an increased expression in surface GD3 and neoexpression of surface GD2 gangliosides, the latter clustering with the T cell receptor (TCR). Also, we report that in contrast to GM2/GD2 synthase null mice, lentiviral vector-mediated silencing of the GM2/GD2 synthase in activated human naïve Th cells reduced efficient TCR clustering and downstream signaling, as assessed by proliferation assays and IL-2 and IL-2R expression, pointing to an important role of this enzyme in activation of human naive Th cells. PMID:26263924

  16. INVESTIGATION OF DUAL ACTIVE NUCLEI, OUTFLOWS, SHOCK-HEATED GAS, AND YOUNG STAR CLUSTERS IN MARKARIAN 266

    SciTech Connect

    Mazzarella, J. M.; Chan, B. H. P.; Iwasawa, K. E-mail: bchan@ipac.caltech.edu; and others

    2012-11-01

    Results of observations with the Spitzer, Hubble, GALEX, Chandra, and XMM-Newton space telescopes are presented for the luminous infrared galaxy (LIRG) merger Markarian 266. The SW (Seyfert 2) and NE (LINER) nuclei reside in galaxies with Hubble types SBb (pec) and S0/a (pec), respectively. Both companions are more luminous than L* galaxies and they are inferred to each contain a Almost-Equal-To 2.5 Multiplication-Sign 10{sup 8} M{sub Sun} black hole. Although the nuclei have an observed hard X-ray flux ratio of f{sub X} (NE)/f{sub X} (SW) = 6.4, Mrk 266 SW is likely the primary source of a bright Fe K{alpha} line detected from the system, consistent with the reflection-dominated X-ray spectrum of a heavily obscured active galactic nucleus (AGN). Optical knots embedded in an arc with aligned radio continuum radiation, combined with luminous H{sub 2} line emission, provide evidence for a radiative bow shock in an AGN-driven outflow surrounding the NE nucleus. A soft X-ray emission feature modeled as shock-heated plasma with T {approx} 10{sup 7} K is cospatial with radio continuum emission between the galaxies. Mid-infrared diagnostics provide mixed results, but overall suggest a composite system with roughly equal contributions of AGN and starburst radiation powering the bolometric luminosity. Approximately 120 star clusters have been detected, with most having estimated ages less than 50 Myr. Detection of 24 {mu}m emission aligned with soft X-rays, radio continuum, and ionized gas emission extending {approx}34'' (20 kpc) north of the galaxies is interpreted as {approx}2 Multiplication-Sign 10{sup 7} M{sub Sun} of dust entrained in an outflowing superwind. At optical wavelengths this Northern Loop region is resolved into a fragmented morphology indicative of Rayleigh-Taylor instabilities in an expanding shell of ionized gas. Mrk 266 demonstrates that the dust 'blow-out' phase can begin in a LIRG well before the galaxies fully coalesce during a subsequent

  17. Summary of Case Studies of Exemplary Shared Programs. Rural Education Component, Activity 1.2: Rural Clusters Study.

    ERIC Educational Resources Information Center

    Mid-Continent Regional Educational Lab., Aurora, CO.

    Four case studies conducted by the Mid-continent Regional Educational Laboratory (McREL) Rural Education Project examined four clusters of rural schools and their efforts to improve schooling by collaborating and sharing resources. The Mid-Missouri Small School Consortium involved five rural school districts in efforts to incorporate…

  18. Violent interaction between the active galactic nucleus and the hot gas in the core of the galaxy cluster Sérsic 159-03

    NASA Astrophysics Data System (ADS)

    Werner, N.; Sun, M.; Bagchi, J.; Allen, S. W.; Taylor, G. B.; Sirothia, S. K.; Simionescu, A.; Million, E. T.; Jacob, J.; Donahue, M.

    2011-08-01

    We present a multiwavelength study of the energetic interaction between the central active galactic nucleus (AGN), the intracluster medium (ICM) and the optical emission-line nebula in the galaxy cluster Sérsic 159-03. We use X-ray data from Chandra, high-resolution X-ray spectra and ultraviolet (UV) images from XMM-Newton, Hα images from the Southern Astrophysics Research Telescope, Hubble Space Telescope optical imaging, and Very Large Array and Giant Metrewave Radio Telescope radio data. The cluster centre displays signs of powerful AGN feedback, which has cleared the central regions (r < 7.5 kpc) of a dense, X-ray-emitting ICM. X-ray spectral maps reveal a high-pressure ring surrounding the central AGN at a radius of r˜ 15 kpc, indicating an AGN-driven weak shock. The cluster harbours a bright, 44 kpc long Hα+[N II] filament extending from the centre of the cD galaxy to the north. Along the filament, we see low-entropy, high-metallicity, cooling X-ray gas. The gas in the filament has most likely been uplifted by 'radio mode' AGN activity and subsequently stripped from the galaxy due to its relative southward motion. Because this X-ray gas has been removed from the direct influence of the AGN jets, part of it cools and forms stars as indicated by the observed dust lanes, molecular and ionized emission-line nebulae and the excess UV emission.

  19. PERK regulated miR-424(322)-503 cluster fine-tunes activation of IRE1 and ATF6 during Unfolded Protein Response

    PubMed Central

    Gupta, Ananya; Hossain, Muhammad Mosaraf; Read, Danielle E.; Hetz, Claudio; Samali, Afshin; Gupta, Sanjeev

    2015-01-01

    The endoplasmic reticulum (ER) responds to changes in intracellular homeostasis through activation of the unfolded protein response (UPR). UPR can facilitate the restoration of cellular homeostasis, via the concerted activation of three ER stress sensors, namely IRE1, PERK and ATF6. Global approaches in several cellular contexts have revealed that UPR regulates the expression of many miRNAs that play an important role in the regulation of life and death decisions during UPR. Here we show that expression of miR-424(322)-503 cluster is downregulated during UPR. IRE1 inhibitor (4 μ8C) and deficiency of XBP1 had no effect on downregulation of miR-424(322)-503 during UPR. Treatment of cells with CCT030312, a selective activator of EIF2AK3/PERK signalling, leads to the downregulation of miR-424(322)-503 expression. The repression of miR-424(322)-503 cluster during conditions of ER stress is compromised in PERK-deficient MEFs. miR-424 regulates the expression of ATF6 via a miR-424 binding site in its 3′ UTR and attenuates the ATF6 transcriptional activity during UPR. Further miR-424 had no effect on IRE1-XBP1 axis but enhanced the regulated IRE1-dependent decay (RIDD). Our results suggest that miR-424 constitutes an obligatory fine-tuning mechanism where PERK-mediated downregulation of miR-424(322)-503 cluster regulates optimal activation of IRE1 and ATF6 during conditions of ER stress. PMID:26674075

  20. Activation and silencing of secondary metabolites in Streptomyces albus and Streptomyces lividans after transformation with cosmids containing the thienamycin gene cluster from Streptomyces cattleya.

    PubMed

    Braña, Alfredo F; Rodríguez, Miriam; Pahari, Pallab; Rohr, Jurgen; García, Luis A; Blanco, Gloria

    2014-05-01

    Activation and silencing of antibiotic production was achieved in Streptomyces albus J1074 and Streptomyces lividans TK21 after introduction of genes within the thienamycin cluster from S. cattleya. Dramatic phenotypic and metabolic changes, involving activation of multiple silent secondary metabolites and silencing of others normally produced, were found in recombinant strains harbouring the thienamycin cluster in comparison to the parental strains. In S. albus, ultra-performance liquid chromatography purification and NMR structural elucidation revealed the identity of four structurally related activated compounds: the antibiotics paulomycins A, B and the paulomenols A and B. Four volatile compounds whose biosynthesis was switched off were identified by gas chromatography-mass spectrometry analyses and databases comparison as pyrazines; including tetramethylpyrazine, a compound with important clinical applications to our knowledge never reported to be produced by Streptomyces. In addition, this work revealed the potential of S. albus to produce many others secondary metabolites normally obtained from plants, including compounds of medical relevance as dihydro-β-agarofuran and of interest in perfume industry as β-patchoulene, suggesting that it might be an alternative model for their industrial production. In S. lividans, actinorhodins production was strongly activated in the recombinant strains whereas undecylprodigiosins were significantly reduced. Activation of cryptic metabolites in Streptomyces species might represent an alternative approach for pharmaceutical drug discovery. PMID:24633227

  1. The Clusters-in-a-Liquid Approach for Solvation: New Insights from the Conformer Specific Gas Phase Spectroscopy and Vibrational Optical Activity Spectroscopy

    PubMed Central

    Perera, Angelo S.; Thomas, Javix; Poopari, Mohammad R.; Xu, Yunjie

    2016-01-01

    Vibrational optical activity spectroscopies, namely vibrational circular dichroism (VCD) and Raman optical activity (ROA), have been emerged in the past decade as powerful spectroscopic tools for stereochemical information of a wide range of chiral compounds in solution directly. More recently, their applications in unveiling solvent effects, especially those associated with water solvent, have been explored. In this review article, we first select a few examples to demonstrate the unique sensitivity of VCD spectral signatures to both bulk solvent effects and explicit hydrogen-bonding interactions in solution. Second, we discuss the induced solvent chirality, or chiral transfer, VCD spectral features observed in the water bending band region in detail. From these chirality transfer spectral data, the related conformer specific gas phase spectroscopic studies of small chiral hydration clusters, and the associated matrix isolation VCD experiments of hydrogen-bonded complexes in cold rare gas matrices, a general picture of solvation in aqueous solution emerges. In such an aqueous solution, some small chiral hydration clusters, rather than the chiral solutes themselves, are the dominant species and are the ones that contribute mainly to the experimentally observed VCD features. We then review a series of VCD studies of amino acids and their derivatives in aqueous solution under different pHs to emphasize the importance of the inclusion of the bulk solvent effects. These experimental data and the associated theoretical analyses are the foundation for the proposed “clusters-in-a-liquid” approach to account for solvent effects effectively. We present several approaches to identify and build such representative chiral hydration clusters. Recent studies which applied molecular dynamics simulations and the subsequent snapshot averaging approach to generate the ROA, VCD, electronic CD, and optical rotatory dispersion spectra are also reviewed. Challenges associated with

  2. The clusters-in-a-liquid approach for solvation: New insights from the conformer specific gas phase spectroscopy and vibrational optical activity spectroscopy

    NASA Astrophysics Data System (ADS)

    Xu, Yunjie; Perera, Angelo; Thomas, Javix; Poopari, Mohammad

    2016-02-01

    Vibrational optical activity spectroscopies, namely vibrational circular dichroism (VCD) and Raman optical activity (ROA), have been emerged in the past decade as a powerful spectroscopic tool for stereochemical information of a wide range of chiral compounds in solution directly. More recently, their applications in unveiling solvent effects, especially those associated with water solvent, have been explored. In this review article, we first select a few examples to demonstrate the unique sensitivity of VCD spectral signatures to both bulk solvent effects and explicit hydrogen-bonding interactions in solution. Second, we discuss the induced solvent chirality, or chiral transfer, VCD spectral features observed at the water bending band region in detail. From these chirality transfer spectral data, the related conformer specific gas phase spectroscopic studies of small chiral hydration clusters, and the associated matrix isolation VCD experiments of hydrogen-bonded complexes in cold rare gas matrices, a general picture of solvation in aqueous solution emerges. In such an aqueous solution, some small chiral hydration clusters, rather than the chiral solutes themselves, are the dominant species and are the ones who contribute mainly to the experimentally observed VCD features. We then review a series of VCD studies of amino acids and their derivatives in aqueous solution under different pHs to emphasize the importance of the inclusion of the bulk solvent effects. These experimental data and the associated theoretical analyses are the foundation for the proposed “clusters-in-a-liquid” approach to account for solvent effects effectively. We present several approaches to identify and build such representative chiral hydration clusters. Recent studies which applied molecular dynamics simulations and the subsequent snapshot averaging approach to generate the ROA, electronic CD, and optical rotatory dispersion spectra are also reviewed. Challenges associated with the

  3. The Clusters-in-a-Liquid Approach for Solvation: New Insights from the Conformer Specific Gas Phase Spectroscopy and Vibrational Optical Activity Spectroscopy.

    PubMed

    Perera, Angelo S; Thomas, Javix; Poopari, Mohammad R; Xu, Yunjie

    2016-01-01

    Vibrational optical activity spectroscopies, namely vibrational circular dichroism (VCD) and Raman optical activity (ROA), have been emerged in the past decade as powerful spectroscopic tools for stereochemical information of a wide range of chiral compounds in solution directly. More recently, their applications in unveiling solvent effects, especially those associated with water solvent, have been explored. In this review article, we first select a few examples to demonstrate the unique sensitivity of VCD spectral signatures to both bulk solvent effects and explicit hydrogen-bonding interactions in solution. Second, we discuss the induced solvent chirality, or chiral transfer, VCD spectral features observed in the water bending band region in detail. From these chirality transfer spectral data, the related conformer specific gas phase spectroscopic studies of small chiral hydration clusters, and the associated matrix isolation VCD experiments of hydrogen-bonded complexes in cold rare gas matrices, a general picture of solvation in aqueous solution emerges. In such an aqueous solution, some small chiral hydration clusters, rather than the chiral solutes themselves, are the dominant species and are the ones that contribute mainly to the experimentally observed VCD features. We then review a series of VCD studies of amino acids and their derivatives in aqueous solution under different pHs to emphasize the importance of the inclusion of the bulk solvent effects. These experimental data and the associated theoretical analyses are the foundation for the proposed "clusters-in-a-liquid" approach to account for solvent effects effectively. We present several approaches to identify and build such representative chiral hydration clusters. Recent studies which applied molecular dynamics simulations and the subsequent snapshot averaging approach to generate the ROA, VCD, electronic CD, and optical rotatory dispersion spectra are also reviewed. Challenges associated with the

  4. Friedreich's Ataxia Variants I154F and W155R Diminish Frataxin-Based Activation of the Iron-Sulfur Cluster Assembly Complex

    SciTech Connect

    Tsai, Chi-Lin; Bridwell-Rabb, Jennifer; Barondeau, David P

    2011-11-07

    Friedreich's ataxia (FRDA) is a progressive neurodegenerative disease that has been linked to defects in the protein frataxin (Fxn). Most FRDA patients have a GAA expansion in the first intron of their Fxn gene that decreases protein expression. Some FRDA patients have a GAA expansion on one allele and a missense mutation on the other allele. Few functional details are known for the ~15 different missense mutations identified in FRDA patients. Here in vitro evidence is presented that indicates the FRDA I154F and W155R variants bind more weakly to the complex of Nfs1, Isd11, and Isu2 and thereby are defective in forming the four-component SDUF complex that constitutes the core of the Fe-S cluster assembly machine. The binding affinities follow the trend Fxn ~ I154F > W155F > W155A ~ W155R. The Fxn variants also have diminished ability to function as part of the SDUF complex to stimulate the cysteine desulfurase reaction and facilitate Fe-S cluster assembly. Four crystal structures, including the first for a FRDA variant, reveal specific rearrangements associated with the loss of function and lead to a model for Fxn-based activation of the Fe-S cluster assembly complex. Importantly, the weaker binding and lower activity for FRDA variants correlate with the severity of disease progression. Together, these results suggest that Fxn facilitates sulfur transfer from Nfs1 to Isu2 and that these in vitro assays are sensitive and appropriate for deciphering functional defects and mechanistic details for human Fe-S cluster biosynthesis.

  5. New insights into the mechanism of nickel insertion into carbon monoxide dehydrogenase: analysis of Rhodospirillum rubrum carbon monoxide dehydrogenase variants with substituted ligands to the [Fe3S4] portion of the active-site C-cluster.

    PubMed

    Jeon, Won Bae; Singer, Steven W; Ludden, Paul W; Rubio, Luis M

    2005-12-01

    Carbon monoxide dehydrogenase (CODH) from Rhodospirillum rubrum catalyzes the oxidation of CO to CO2. A unique [NiFe4S4] cluster, known as the C-cluster, constitutes the active site of the enzyme. When grown in Ni-deficient medium R. rubrum accumulates a Ni-deficient apo form of CODH that is readily activated by Ni. It has been previously shown that activation of apo-CODH by Ni is a two-step process involving the rapid formation of an inactive apo-CODH*Ni complex prior to conversion to the active holo-CODH. We have generated CODH variants with substitutions in cysteine residues involved in the coordination of the [Fe3S4] portion of the C-cluster. Analysis of the variants suggests that the cysteine residues at positions 338, 451, and 481 are important for CO oxidation activity catalyzed by CODH but not for Ni binding to the C-cluster. C451S CODH is the only new variant that retains residual CO oxidation activity. Comparison of the kinetics and pH dependence of Ni activation of the apo forms of wild-type, C451S, and C531A CODH allowed us to develop a model for Ni insertion into the C-cluster of CODH in which Ni reversibly binds to the C-cluster and subsequently coordinates Cys531 in the rate-determining step. PMID:16283394

  6. A cluster region of AP-1 responsive elements is required for transcriptional activity of mouse ODC gene by hepatocyte growth factor.

    PubMed

    Bianchi, Laura; Tacchini, Lorenza; Matteucci, Emanuela; Desiderio, Maria Alfonsina

    2002-05-01

    Ornithine decarboxylase (ODC) activity is regulated by a variety of mechanisms including transcription, translation, and RNA and protein half-life. Since in mouse B16-F1 melanoma cells an early and remarkable (about 6-fold) increase in steady state mRNA levels was observed after hepatocyte growth factor (HGF) treatment, we investigated the transcriptional regulation of mouse ODC promoter. Transient transfection of various ODC-luciferase promoter constructs into the B16-Fl cells in combination with electrophoretic mobility shift assays identified the HGF-responsive element as a cluster of three AP-1 binding sites (-1660 to -1572). Even if each site differs from the canonical TPA responsive element for one nucleotide, only the first two AP-1 consensus sequences seemed to be functional since allowed DNA-binding activity of nuclear proteins after HGF treatment. Comparison of the results of transfection assays with the pOD2.5-luc (2.5 kb gene fragment) and with the construct deprived of the AP-1 cluster pOD-B-luc showed that this 50 bp region was required for ODC transactivating activity in response to HGF. Since in B16-F1 cells HGF increased AP-1 activity and the mRNA expression of various AP-1 subunits, we may conclude that HGF-induced transcription of mouse ODC was largely due to triggering of AP-1 pathway. PMID:12054494

  7. High Catalytic Activity and Chemoselectivity of Sub-nanometric Pd Clusters on Porous Nanorods of CeO2 for Hydrogenation of Nitroarenes.

    PubMed

    Zhang, Sai; Chang, Chun-Ran; Huang, Zheng-Qing; Li, Jing; Wu, Zhemin; Ma, Yuanyuan; Zhang, Zhiyun; Wang, Yong; Qu, Yongquan

    2016-03-01

    Sub-nanometric Pd clusters on porous nanorods of CeO2 (PN-CeO2) with a high Pd dispersion of 73.6% exhibit the highest catalytic activity and best chemoselectivity for hydrogenation of nitroarenes to date. For hydrogenation of 4-nitrophenol, the catalysts yield a TOF of ∼44059 h(-1) and a chemoselectivity to 4-aminophenol of >99.9%. The superior catalytic performance can be attributed to a cooperative effect between the highly dispersed sub-nanometric Pd clusters for hydrogen activation and unique surface sites of PN-CeO2 with a high concentration of oxygen vacancy for an energetically and geometrically preferential adsorption of nitroarenes via nitro group. The high concentration of surface defects of PN-CeO2 and large Pd dispersion contribute to the enhanced catalytic activity for the hydrogenation reactions. The high chemoselectivity is mainly governed by the high Pd dispersion on the support. The catalysts also deliver high catalytic activity and selectivity for nitroaromatics with various reducible substituents into the corresponding aminoarenes. PMID:26828123

  8. Rotational Periods and Starspot Activity of Young Solar-Type Dwarfs in the Open Cluster IC 4665

    NASA Technical Reports Server (NTRS)

    Allain, S.; Bouvier, J.; Prosser, C.; Marschall, L. A.; Laaksonen, B. D.

    1995-01-01

    We present the results of a V-band photometric monitoring survey of 15 late-type dwarfs in the young open cluster IC 4665. Low-amplitude periodic light variations are found for 8 stars and ascribed to the modulation by starspots that cover typically a few percent of the stellar disk. Periods range from 0.6 to 3.7 d, translating to equatorial velocities between 13 and 93 km/s. That no period longer than 4 d was detected suggests a relative paucity of extremely slow rotators (V(sub eq) much less than 10 km/s) among late-type dwarfs in IC 4665. The fractional number of slow rotators in IC 4665 is similar to that of Alpha Per cluster, suggesting that IC 4665 is close in age to Alpha Per (approx. 50 Myr).

  9. Seismic activities of earthquake clusters and small repeating earthquakes in Japan before and after the 2011 off the Pacific coast of Tohoku earthquake

    NASA Astrophysics Data System (ADS)

    Igarashi, T.

    2011-12-01

    The 2011 off the Pacific coast of Tohoku earthquake (M9.0) had a great effect on seismic activities over vast areas. In this study, we investigated spatio-temporal changes of seismic activities of earthquake clusters and small repeating earthquakes before and after the main shock. We have already reported many small repeating earthquakes occur at the upper boundary of the subducting plates in Japan. From these sequences, we can estimate the space-time characteristics of the inter-plate slip. In the 21st century, the resultant slip-rates correspond to relative plate motion in the Ryukyu-arc. In contrast, the shallow part and the southern part of the northeastern Japan arc indicated slip deficits. There were few after-slips following the 2005 off Miyagi earthquake (M7.2), which located near the hypocenter of the 2011 main shock. On the other hand, slip deficits of the southern shallow part were slightly decreased by after-slips following the 2003 and 2008 M7 class earthquakes. We also identified quasi-static slips associated with foreshocks off Miyagi that started from February 2011. After the main shock, we detect many small repeating earthquakes in the aftershocks. The distributions suggest after-slips near the trench of the southeastern part as well as in the deep part of the source region estimated by GPS data analysis. However, some of them are burst-type repeating sequences which occurred only after the main shock. Many continual-type repeating sequences are distributed in the southern part of the source region, and it is difficult to estimate slip-rates in the northern part at present. This uneven distribution may have been caused because observed seismograms are distorted by the multiplicity of the waves to come from various locations, the seismic velocity changes at the propagation path or site, or changes of physical properties at the plate interface. Furthermore, we automatically extracted earthquake clusters by using the unified JMA hypocenter catalogue

  10. Experimental and computational investigation of Au25 clusters and CO2: a unique interaction and enhanced electrocatalytic activity.

    PubMed

    Kauffman, Douglas R; Alfonso, Dominic; Matranga, Christopher; Qian, Huifeng; Jin, Rongchao

    2012-06-20

    Atomically precise, inherently charged Au(25) clusters are an exciting prospect for promoting catalytically challenging reactions, and we have studied the interaction between CO(2) and Au(25). Experimental results indicate a reversible Au(25)-CO(2) interaction that produced spectroscopic and electrochemical changes similar to those seen with cluster oxidation. Density functional theory (DFT) modeling indicates these changes stem from a CO(2)-induced redistribution of charge within the cluster. Identification of this spontaneous coupling led to the application of Au(25) as a catalyst for the electrochemical reduction of CO(2) in aqueous media. Au(25) promoted the CO(2) → CO reaction within 90 mV of the formal potential (thermodynamic limit), representing an approximate 200-300 mV improvement over larger Au nanoparticles and bulk Au. Peak CO(2) conversion occurred at -1 V (vs RHE) with approximately 100% efficiency and a rate 7-700 times higher than that for larger Au catalysts and 10-100 times higher than those for current state-of-the-art processes. PMID:22616945

  11. Cool Cluster Correctly Correlated

    SciTech Connect

    Sergey Aleksandrovich Varganov

    2005-12-17

    Atomic clusters are unique objects, which occupy an intermediate position between atoms and condensed matter systems. For a long time it was thought that physical and chemical properties of atomic dusters monotonically change with increasing size of the cluster from a single atom to a condensed matter system. However, recently it has become clear that many properties of atomic clusters can change drastically with the size of the clusters. Because physical and chemical properties of clusters can be adjusted simply by changing the cluster's size, different applications of atomic clusters were proposed. One example is the catalytic activity of clusters of specific sizes in different chemical reactions. Another example is a potential application of atomic clusters in microelectronics, where their band gaps can be adjusted by simply changing cluster sizes. In recent years significant advances in experimental techniques allow one to synthesize and study atomic clusters of specified sizes. However, the interpretation of the results is often difficult. The theoretical methods are frequently used to help in interpretation of complex experimental data. Most of the theoretical approaches have been based on empirical or semiempirical methods. These methods allow one to study large and small dusters using the same approximations. However, since empirical and semiempirical methods rely on simple models with many parameters, it is often difficult to estimate the quantitative and even qualitative accuracy of the results. On the other hand, because of significant advances in quantum chemical methods and computer capabilities, it is now possible to do high quality ab-initio calculations not only on systems of few atoms but on clusters of practical interest as well. In addition to accurate results for specific clusters, such methods can be used for benchmarking of different empirical and semiempirical approaches. The atomic clusters studied in this work contain from a few atoms to

  12. Replication origins in Xenopus egg extract Are 5-15 kilobases apart and are activated in clusters that fire at different times.

    PubMed

    Blow, J J; Gillespie, P J; Francis, D; Jackson, D A

    2001-01-01

    When Xenopus eggs and egg extracts replicate DNA, replication origins are positioned randomly with respect to DNA sequence. However, a completely random distribution of origins would generate some unacceptably large interorigin distances. We have investigated the distribution of replication origins in Xenopus sperm nuclei replicating in Xenopus egg extract. Replicating DNA was labeled with [(3)H]thymidine or bromodeoxyuridine and the geometry of labeled sites on spread DNA was examined. Most origins were spaced 5-15 kb apart. This regular distribution provides an explanation for how complete chromosome replication can be ensured although origins are positioned randomly with respect to DNA sequence. Origins were grouped into small clusters (typically containing 5-10 replicons) that fired at approximately the same time, with different clusters being activated at different times in S phase. This suggests that a temporal program of origin firing similar to that seen in somatic cells also exists in the Xenopus embryo. When the quantity of origin recognition complexes (ORCs) on the chromatin was restricted, the average interorigin distance increased, and the number of origins in each cluster decreased. This suggests that the binding of ORCs to chromatin determines the regular spacing of origins in this system. PMID:11149917

  13. Functional analysis of ars gene cluster of Pannonibacter indicus strain HT23(T) (DSM 23407(T)) and identification of a proline residue essential for arsenate reductase activity.

    PubMed

    Bandyopadhyay, Saumya; Das, Subrata K

    2016-04-01

    Arsenic is a naturally occurring ubiquitous highly toxic metalloid. In this study, we have identified ars gene cluster in Pannonibacter indicus strain HT23(T) (DSM 23407(T)), responsible for reduction of toxic pentavalent arsenate. The ars gene cluster is comprised of four non-overlapping open reading frames (ORFs) encoding a transcriptional regulator (ArsR), a low molecular weight protein tyrosine phosphatases (LMW-PTPase) with hypothetical function, an arsenite efflux pump (Acr3), and an arsenate reductase (ArsC). Heterologous expression of arsenic inducible ars gene cluster conferred arsenic resistance to Escherichia coli ∆ars mutant strain AW3110. The recombinant ArsC was purified and assayed. Site-directed mutagenesis was employed to ascertain the role of specific amino acids in ArsC catalysis. Pro94X (X = Ala, Arg, Cys, and His) amino acid substitutions led to enzyme inactivation. Circular dichroism spectra analysis suggested Pro94 as an essential amino acid for enzyme catalytic activity as it is indispensable for optimum protein folding in P. indicus Grx-coupled ArsC. PMID:26915994

  14. Gas deficiency in cluster galaxies - A comparison of nine clusters

    NASA Technical Reports Server (NTRS)

    Giovanelli, R.; Haynes, M. P.

    1985-01-01

    The available 21 cm line data in the literature for galaxies in nine clusters is combined with new high-sensitivity observations of 51 galaxies in five of the nine clusters in order to test for discriminating circumstances between those clusters which show H I deficiency among their spiral population and those which do not. An H I deficiency for the complete cluster sample is derived employing a comparison sample of galaxies chosen from the Catalog of Isolated Galaxies. The deficiency and its radial dependence is summarized for each cluster and a composite. A comparison of the environments in different clusters leads to the conclusion that the occurrence of H I deficiency is correlated with the presence of a hot X-ray intracluster medium, and that an ongoing interaction process is active through the cores of X-ray clusters.

  15. Development and evaluation of a structured programme for promoting physical activity among seniors with intellectual disabilities: a study protocol for a cluster randomized trial

    PubMed Central

    2013-01-01

    Background Older people with intellectual disabilities have very low physical activity levels. Well designed, theory-driven and evidence-based health promotion programmes for the target population are lacking. This paper describes the design of a cluster-randomised trial for a systematically developed health promotion programme aimed at improving physical activity and increasing fitness among seniors with intellectual disabilities. Methods and design The Intervention Mapping protocol was used for programme development. After defining the programme’s objectives, the following behavioural techniques were selected to achieve them: Tailoring, Education, Modelling, Mirroring, Feedback, Reinforcement and Grading. With professionals and managers of provider services for people with intellectual disabilities, we translated these strategies into a structured day-activity programme, that consisted of a physical activity and an education programme. The programme will be executed in five day-activity centres in groups of eight to ten seniors during eight months, whereas seniors in five other centres receive care as usual. The physical activity level, as measured in number of steps a day, will be used as primary outcome measurement. Secondary outcome measurements include motor fitness, cardio respiratory fitness, morphological and metabolic fitness, ADL, functional deterioration and depressive symptoms. Differences in the primary and secondary outcome measures between participants and controls will be analysed using generalized estimation equations, correcting for day-activity center as cluster. Discussion This paper provides insight into the development and content of a theory-driven intervention aimed at behavioural change in a population with a low intellectual level. Its evaluation design is described. The programme’s applicability to other populations is discussed. Trial registration Trial number: ISRCTN82341588 PMID:23938154

  16. Organizational-Level Strategies With or Without an Activity Tracker to Reduce Office Workers’ Sitting Time: Rationale and Study Design of a Pilot Cluster-Randomized Trial

    PubMed Central

    Fjeldsoe, Brianna S; Young, Duncan C; Winkler, Elisabeth A H; Dunstan, David W; Straker, Leon M; Brakenridge, Christian J; Healy, Genevieve N

    2016-01-01

    Background The office workplace is a key setting in which to address excessive sitting time and inadequate physical activity. One major influence on workplace sitting is the organizational environment. However, the impact of organizational-level strategies on individual level activity change is unknown. Further, the emergence of sophisticated, consumer-targeted wearable activity trackers that facilitate real-time self-monitoring of activity, may be a useful adjunct to support organizational-level strategies, but to date have received little evaluation in this workplace setting. Objective The aim of this study is to evaluate the feasibility, acceptability, and effectiveness of organizational-level strategies with or without an activity tracker on sitting, standing, and stepping in office workers in the short (3 months, primary aim) and long-term (12 months, secondary aim). Methods This study is a pilot, cluster-randomized trial (with work teams as the unit of clustering) of two interventions in office workers: organizational-level support strategies (eg, visible management support, emails) or organizational-level strategies plus the use of a waist-worn activity tracker (the LUMOback) that enables self-monitoring of sitting, standing, and stepping time and enables users to set sitting and posture alerts. The key intervention message is to ‘Stand Up, Sit Less, and Move More.’ Intervention elements will be implemented from within the organization by the Head of Workplace Wellbeing. Participants will be recruited via email and enrolled face-to-face. Assessments will occur at baseline, 3, and 12 months. Time spent sitting, sitting in prolonged (≥30 minute) bouts, standing, and stepping during work hours and across the day will be measured with activPAL3 activity monitors (7 days, 24 hours/day protocol), with total sitting time and sitting time during work hours the primary outcomes. Web-based questionnaires, LUMOback recorded data, telephone interviews, and focus

  17. Quintuplet Cluster

    NASA Technical Reports Server (NTRS)

    1999-01-01

    Penetrating 25,000 light-years of obscuring dust and myriad stars, NASA's Hubble Space Telescope has provided the clearest view yet of one of the largest young clusters of stars inside our Milky Way galaxy, located less than 100 light-years from the very center of the Galaxy. Having the equivalent mass greater than 10,000 stars like our sun, the monster cluster is ten times larger than typical young star clusters scattered throughout our Milky Way. It is destined to be ripped apart in just a few million years by gravitational tidal forces in the galaxy's core. But in its brief lifetime it shines more brightly than any other star cluster in the Galaxy. Quintuplet Cluster is 4 million years old. It has stars on the verge of blowing up as supernovae. It is the home of the brightest star seen in the galaxy, called the Pistol star. This image was taken in infrared light by Hubble's NICMOS camera in September 1997. The false colors correspond to infrared wavelengths. The galactic center stars are white, the red stars are enshrouded in dust or behind dust, and the blue stars are foreground stars between us and the Milky Way's center. The cluster is hidden from direct view behind black dust clouds in the constellation Sagittarius. If the cluster could be seen from earth it would appear to the naked eye as a 3rd magnitude star, 1/6th of a full moon's diameter apart.

  18. Community-based physical activity and nutrition programme for adults with metabolic syndrome in Vietnam: study protocol for a cluster-randomised controlled trial

    PubMed Central

    Tran, Van Dinh; Lee, Andy H; Jancey, Jonine; James, Anthony P; Howat, Peter; Thi Phuong Mai, Le

    2016-01-01

    Introduction Metabolic syndrome (MetS) is a cluster of risk factors for cardiovascular diseases and type II diabetes. In Vietnam, more than one-quarter of its population aged 50–65 have MetS. This cluster-randomised controlled trial aims to evaluate the effectiveness of interventions to increase levels of physical activity and improve dietary behaviours among Vietnamese adults aged 50–65 years with MetS. Method and analysis This 6-month community-based intervention includes a range of strategies to improve physical activity and nutrition for adults with MetS in Hanam, a province located in northern Vietnam. 600 participants will be recruited from 6 communes with 100 participants per commune. The 6 selected communes will be randomly allocated to either an intervention group (m=3; n=300) or a control group (m=3; n=300). The intervention comprises booklets, education sessions, resistance bands and attending local walking groups that provide information and encourage participants to improve their physical activity and healthy eating behaviours during the 6-month period. The control group participants will receive standard and 1-time advice. Social cognitive theory is the theoretical concept underpinning this study. Measurements will be taken at baseline and postintervention to evaluate programme effectiveness. Ethics and dissemination The research protocol was approved by the Curtin University Human Research Ethics Committee (approval number: HR139/2014). The results of the study will be disseminated through publications, reports and conference presentations. Trial registration number ACTRN12614000811606. PMID:27256094

  19. A Nonparametric Bayesian Model for Nested Clustering.

    PubMed

    Lee, Juhee; Müller, Peter; Zhu, Yitan; Ji, Yuan

    2016-01-01

    We propose a nonparametric Bayesian model for clustering where clusters of experimental units are determined by a shared pattern of clustering another set of experimental units. The proposed model is motivated by the analysis of protein activation data, where we cluster proteins such that all proteins in one cluster give rise to the same clustering of patients. That is, we define clusters of proteins by the way that patients group with respect to the corresponding protein activations. This is in contrast to (almost) all currently available models that use shared parameters in the sampling model to define clusters. This includes in particular model based clustering, Dirichlet process mixtures, product partition models, and more. We show results for two typical biostatistical inference problems that give rise to clustering. PMID:26519174

  20. Galaxy Clusters

    NASA Astrophysics Data System (ADS)

    Miller, Christopher J. Miller

    2012-03-01

    There are many examples of clustering in astronomy. Stars in our own galaxy are often seen as being gravitationally bound into tight globular or open clusters. The Solar System's Trojan asteroids cluster at the gravitational Langrangian in front of Jupiter’s orbit. On the largest of scales, we find gravitationally bound clusters of galaxies, the Virgo cluster (in the constellation of Virgo at a distance of ˜50 million light years) being a prime nearby example. The Virgo cluster subtends an angle of nearly 8◦ on the sky and is known to contain over a thousand member galaxies. Galaxy clusters play an important role in our understanding of theUniverse. Clusters exist at peaks in the three-dimensional large-scale matter density field. Their sky (2D) locations are easy to detect in astronomical imaging data and their mean galaxy redshifts (redshift is related to the third spatial dimension: distance) are often better (spectroscopically) and cheaper (photometrically) when compared with the entire galaxy population in large sky surveys. Photometric redshift (z) [Photometric techniques use the broad band filter magnitudes of a galaxy to estimate the redshift. Spectroscopic techniques use the galaxy spectra and emission/absorption line features to measure the redshift] determinations of galaxies within clusters are accurate to better than delta_z = 0.05 [7] and when studied as a cluster population, the central galaxies form a line in color-magnitude space (called the the E/S0 ridgeline and visible in Figure 16.3) that contains galaxies with similar stellar populations [15]. The shape of this E/S0 ridgeline enables astronomers to measure the cluster redshift to within delta_z = 0.01 [23]. The most accurate cluster redshift determinations come from spectroscopy of the member galaxies, where only a fraction of the members need to be spectroscopically observed [25,42] to get an accurate redshift to the whole system. If light traces mass in the Universe, then the locations

  1. Occupational Clusters.

    ERIC Educational Resources Information Center

    Pottawattamie County School System, Council Bluffs, IA.

    The 15 occupational clusters (transportation, fine arts and humanities, communications and media, personal service occupations, construction, hospitality and recreation, health occupations, marine science occupations, consumer and homemaking-related occupations, agribusiness and natural resources, environment, public service, business and office…

  2. Data Clustering

    NASA Astrophysics Data System (ADS)

    Wagstaff, Kiri L.

    2012-03-01

    On obtaining a new data set, the researcher is immediately faced with the challenge of obtaining a high-level understanding from the observations. What does a typical item look like? What are the dominant trends? How many distinct groups are included in the data set, and how is each one characterized? Which observable values are common, and which rarely occur? Which items stand out as anomalies or outliers from the rest of the data? This challenge is exacerbated by the steady growth in data set size [11] as new instruments push into new frontiers of parameter space, via improvements in temporal, spatial, and spectral resolution, or by the desire to "fuse" observations from different modalities and instruments into a larger-picture understanding of the same underlying phenomenon. Data clustering algorithms provide a variety of solutions for this task. They can generate summaries, locate outliers, compress data, identify dense or sparse regions of feature space, and build data models. It is useful to note up front that "clusters" in this context refer to groups of items within some descriptive feature space, not (necessarily) to "galaxy clusters" which are dense regions in physical space. The goal of this chapter is to survey a variety of data clustering methods, with an eye toward their applicability to astronomical data analysis. In addition to improving the individual researcher’s understanding of a given data set, clustering has led directly to scientific advances, such as the discovery of new subclasses of stars [14] and gamma-ray bursts (GRBs) [38]. All clustering algorithms seek to identify groups within a data set that reflect some observed, quantifiable structure. Clustering is traditionally an unsupervised approach to data analysis, in the sense that it operates without any direct guidance about which items should be assigned to which clusters. There has been a recent trend in the clustering literature toward supporting semisupervised or constrained

  3. Hedgehog Signaling Pathway Is Active in GBM with GLI1 mRNA Expression Showing a Single Continuous Distribution Rather than Discrete High/Low Clusters

    PubMed Central

    Biswas, Nidhan K.; Rote, Sarang; Chatterjee, Uttara; Ghosh, Samarendra N.; Deb, Sumit; Saha, Suniti K.; Chowdhury, Anup K.; Ghosh, Subhashish; Rudin, Charles M.; Mukherjee, Ankur; Basu, Analabha; Dhara, Surajit

    2015-01-01

    Hedgehog (Hh) signaling pathway is a valid therapeutic target in a wide range of malignancies. We focus here on glioblastoma multiforme (GBM), a lethal malignancy of the central nervous system (CNS). By analyzing RNA-sequencing based transcriptomics data on 149 clinical cases of TCGA-GBM database we show here a strong correlation (r = 0.7) between GLI1 and PTCH1 mRNA expression—as a hallmark of the canonical Hh-pathway activity in this malignancy. GLI1 mRNA expression varied in 3 orders of magnitude among the GBM patients of the same cohort showing a single continuous distribution—unlike the discrete high/low-GLI1 mRNA expressing clusters of medulloblastoma (MB). When compared with MB as a reference, the median GLI1 mRNA expression in GBM appeared 14.8 fold lower than that of the “high-Hh” cluster of MB but 5.6 fold higher than that of the “low-Hh” cluster of MB. Next, we demonstrated statistically significant up- and down-regulation of GLI1 mRNA expressions in GBM patient-derived low-passage neurospheres in vitro by sonic hedgehog ligand-enriched conditioned media (shh-CM) and by Hh-inhibitor drug vismodegib respectively. We also showed clinically achievable dose (50 μM) of vismodegib alone to be sufficient to induce apoptosis and cell cycle arrest in these low-passage GBM neurospheres in vitro. Vismodegib showed an effect on the neurospheres, both by down-regulating GLI1 mRNA expression and by inducing apoptosis/cell cycle arrest, irrespective of their relative endogenous levels of GLI1 mRNA expression. We conclude from our study that this single continuous distribution pattern of GLI1 mRNA expression technically puts almost all GBM patients in a single group rather than discrete high- or low-clusters in terms of Hh-pathway activity. That is suggestive of therapies with Hh-pathway inhibitor drugs in this malignancy without a need for further stratification of patients on the basis of relative levels of Hh-pathway activity among them. PMID:25775002

  4. Cluster generator

    DOEpatents

    Donchev, Todor I.; Petrov, Ivan G.

    2011-05-31

    Described herein is an apparatus and a method for producing atom clusters based on a gas discharge within a hollow cathode. The hollow cathode includes one or more walls. The one or more walls define a sputtering chamber within the hollow cathode and include a material to be sputtered. A hollow anode is positioned at an end of the sputtering chamber, and atom clusters are formed when a gas discharge is generated between the hollow anode and the hollow cathode.

  5. A community-wide campaign to promote physical activity in middle-aged and elderly people: a cluster randomized controlled trial

    PubMed Central

    2013-01-01

    Background We aimed to evaluate the effectiveness of a community-wide campaign (CWC) for promoting physical activity in middle-aged and elderly people. Methods A cluster randomized controlled trial (RCT) with a community as the unit of randomization was performed using a population-based random-sampled evaluation by self-administered questionnaires in the city of Unnan, Shimane Prefecture, Japan. The evaluation sample included 6000 residents aged 40 to 79 years. We randomly allocated nine communities to the intervention group and three to the control group. The intervention was a CWC from 2009 to 2010 to promote physical activity, and it comprised information, education, and support delivery. The primary outcome was a change in engaging in regular aerobic, flexibility, and/or muscle-strengthening activities evaluated at the individual level. Results In total, 4414 residents aged 40–79 years responded to a self-administered questionnaire (73.6% response rate). Awareness of the CWC was 79% in the intervention group. Awareness and knowledge were significantly different between the intervention and control groups, although there were no significant differences in belief and intention. The 1-year CWC did not significantly promote the recommended level of physical activity (adjusted odds ratio: 0.97; 95% confidence interval: 0.84–1.14). Conclusions This cluster RCT showed that the CWC did not promote physical activity in 1 year. Significant differences were observed in awareness and knowledge between intervention and control groups as short-term impacts of the campaign. Trial registration UMIN-CTR UMIN000002683 PMID:23570536

  6. A factor that positively regulates cell division by activating transcription of the major cluster of essential cell division genes of Escherichia coli.

    PubMed Central

    Wang, X D; de Boer, P A; Rothfield, L I

    1991-01-01

    Cell division in Escherichia coli requires the products of the ftsQ, ftsA and ftsZ genes. It is not known how the cell regulates the cellular concentrations of these essential elements of the division system. We describe here a factor that activates cell division by specifically increasing transcription from one of the two promoters that lie immediately upstream of the ftsQAZ gene cluster. The trans-acting factor is the product of the sdiA gene, which was isolated on the basis of its ability to suppress the division inhibitory effect of the MinC/MinD division inhibitor. In addition, the sdiA gene product suppressed the action of other chromosomally encoded division inhibitors, induced minicell formation in wild type cells, and restored division activity to an ftsZ temperature-sensitive mutant grown under nonpermissive conditions. All of these properties were explained by the ability of the sdiA gene product specifically to increase transcription of the ftsQAZ gene cluster, resulting in an increase in cellular concentration of the FtsZ protein. The sdiA gene product is the first factor thus far identified that specifically regulates expression of this key group of cell division genes. Images PMID:1915297

  7. The Conserved Lys-95 Charged Residue Cluster Is Critical for the Homodimerization and Enzyme Activity of Human Ribonucleotide Reductase Small Subunit M2*

    PubMed Central

    Chen, Xinhuan; Xu, Zhijian; Zhang, Lingna; Liu, Hongchuan; Liu, Xia; Lou, Meng; Zhu, Lijun; Huang, Bingding; Yang, Cai-Guang; Zhu, Weiliang; Shao, Jimin

    2014-01-01

    Ribonucleotide reductase (RR) catalyzes the reduction of ribonucleotides to deoxyribonucleotides for DNA synthesis. Human RR small subunit M2 exists in a homodimer form. However, the importance of the dimer form to the enzyme and the related mechanism remain unclear. In this study, we tried to identify the interfacial residues that may mediate the assembly of M2 homodimer by computational alanine scanning based on the x-ray crystal structure. Co-immunoprecipitation, size exclusion chromatography, and RR activity assays showed that the K95E mutation in M2 resulted in dimer disassembly and enzyme activity inhibition. In comparison, the charge-exchanging double mutation of K95E and E98K recovered the dimerization and activity. Structural comparisons suggested that a conserved cluster of charged residues, including Lys-95, Glu-98, Glu-105, and Glu-174, at the interface may function as an ionic lock for M2 homodimer. Although the measurements of the radical and iron contents showed that the monomer (the K95E mutant) was capable of generating the diiron and tyrosyl radical cofactor, co-immunoprecipitation and competitive enzyme inhibition assays indicated that the disassembly of M2 dimer reduced its interaction with the large subunit M1. In addition, the immunofluorescent and fusion protein-fluorescent imaging analyses showed that the dissociation of M2 dimer altered its subcellular localization. Finally, the transfection of the wild-type M2 but not the K95E mutant rescued the G1/S phase cell cycle arrest and cell growth inhibition caused by the siRNA knockdown of M2. Thus, the conserved Lys-95 charged residue cluster is critical for human RR M2 homodimerization, which is indispensable to constitute an active holoenzyme and function in cells. PMID:24253041

  8. An active immune defense with a minimal CRISPR (clustered regularly interspaced short palindromic repeats) RNA and without the Cas6 protein.

    PubMed

    Maier, Lisa-Katharina; Stachler, Aris-Edda; Saunders, Sita J; Backofen, Rolf; Marchfelder, Anita

    2015-02-13

    The prokaryotic immune system CRISPR-Cas (clustered regularly interspaced short palindromic repeats-CRISPR-associated) is a defense system that protects prokaryotes against foreign DNA. The short CRISPR RNAs (crRNAs) are central components of this immune system. In CRISPR-Cas systems type I and III, crRNAs are generated by the endonuclease Cas6. We developed a Cas6b-independent crRNA maturation pathway for the Haloferax type I-B system in vivo that expresses a functional crRNA, which we termed independently generated crRNA (icrRNA). The icrRNA is effective in triggering degradation of an invader plasmid carrying the matching protospacer sequence. The Cas6b-independent maturation of the icrRNA allowed mutation of the repeat sequence without interfering with signals important for Cas6b processing. We generated 23 variants of the icrRNA and analyzed them for activity in the interference reaction. icrRNAs with deletions or mutations of the 3' handle are still active in triggering an interference reaction. The complete 3' handle could be removed without loss of activity. However, manipulations of the 5' handle mostly led to loss of interference activity. Furthermore, we could show that in the presence of an icrRNA a strain without Cas6b (Δcas6b) is still active in interference. PMID:25512373

  9. An Active Immune Defense with a Minimal CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) RNA and without the Cas6 Protein*

    PubMed Central

    Maier, Lisa-Katharina; Stachler, Aris-Edda; Saunders, Sita J.; Backofen, Rolf; Marchfelder, Anita

    2015-01-01

    The prokaryotic immune system CRISPR-Cas (clustered regularly interspaced short palindromic repeats-CRISPR-associated) is a defense system that protects prokaryotes against foreign DNA. The short CRISPR RNAs (crRNAs) are central components of this immune system. In CRISPR-Cas systems type I and III, crRNAs are generated by the endonuclease Cas6. We developed a Cas6b-independent crRNA maturation pathway for the Haloferax type I-B system in vivo that expresses a functional crRNA, which we termed independently generated crRNA (icrRNA). The icrRNA is effective in triggering degradation of an invader plasmid carrying the matching protospacer sequence. The Cas6b-independent maturation of the icrRNA allowed mutation of the repeat sequence without interfering with signals important for Cas6b processing. We generated 23 variants of the icrRNA and analyzed them for activity in the interference reaction. icrRNAs with deletions or mutations of the 3′ handle are still active in triggering an interference reaction. The complete 3′ handle could be removed without loss of activity. However, manipulations of the 5′ handle mostly led to loss of interference activity. Furthermore, we could show that in the presence of an icrRNA a strain without Cas6b (Δcas6b) is still active in interference. PMID:25512373

  10. The effect of metal cluster deposition route on structure and photocatalytic activity of mono- and bimetallic nanoparticles supported on TiO2 by radiolytic method

    NASA Astrophysics Data System (ADS)

    Klein, Marek; Nadolna, Joanna; Gołąbiewska, Anna; Mazierski, Paweł; Klimczuk, Tomasz; Remita, Hynd; Zaleska-Medynska, Adriana

    2016-08-01

    TiO2 (P25) was modified with small and relatively monodisperse mono- and bimetallic clusters (Ag, Pd, Pt, Ag/Pd, Ag/Pt and Pd/Pt) induced by radiolysis to improve its photocatalytic activity. The as-prepared samples were characterized by X-ray fluorescence spectrometry (XRF), photoluminescence spectrometry (PL), diffuse reflectance spectroscopy (DRS), X-ray powder diffractometry (XRD), scanning transition electron microscopy (STEM) and BET surface area analysis. The effect of metal type (mono- and bimetallic modification) as well as deposition method (simultaneous or subsequent deposition of two metals) on the photocatalytic activity in toluene removal in gas phase under UV-vis irradiation (light-emitting diodes- LEDs) and phenol degradation in liquid phase under visible light irradiation (λ > 420 nm) were investigated. The highest photoactivity under Vis light was observed for TiO2 co-loaded with platinum (0.1%) and palladium (0.1%) clusters. Simultaneous addition of metal precursors results in formation of larger metal nanoparticles (15-30 nm) on TiO2 surface and enhances the Vis-induced activity of Ag/Pd-TiO2 up to four times, while the subsequent metal ions addition results in formation of metal particle size ranging from 4 to 20 nm. Subsequent addition of metal precursors results in formation of BNPs (bimetallic nanoparticle) composites showing higher stability in four cycles of toluene degradation under UV-vis. Obtained results indicated that direct electron transfer from the BNPs to the conduction band of the semiconductor is responsible for visible light photoactivity, whereas superoxide radicals (such as O2rad- and rad OOH) are responsible for pollutants degradation over metal-TiO2 composites.

  11. Sialic Acid-Mediated Gene Expression in Streptococcus pneumoniae and Role of NanR as a Transcriptional Activator of the nan Gene Cluster

    PubMed Central

    Afzal, Muhammad; Shafeeq, Sulman; Ahmed, Hifza

    2015-01-01

    In this study, we investigated the transcriptomic response of Streptococcus pneumoniae D39 to sialic acid (N-acetylneuraminic acid [Neu5Ac]). Transcriptome comparison of wild-type D39 grown in M17 medium with and without sialic acid revealed the elevated expression of various genes and operons, including the nan gene cluster (nan operon I and nanA gene). Our microarray analysis and promoter-lacZ fusion studies showed that the transcriptional regulator NanR acts as a transcriptional activator of nan operon I and the nanA gene in the presence of sialic acid. The putative regulatory site of NanR in the promoter region of nan operon I is predicted and confirmed by promoter truncation experiments. Furthermore, the role of CcpA in the regulation of the nan gene cluster is demonstrated through microarray analysis and promoter-lacZ fusion studies, suggesting that in the presence of sialic acid and glucose, CcpA represses the expression of nan operon I while the expression of the nanA gene is CcpA independent. PMID:25724955

  12. Snoezelen, structured reminiscence therapy and 10-minutes activation in long term care residents with dementia (WISDE): study protocol of a cluster randomized controlled trial

    PubMed Central

    2010-01-01

    Background People with dementia are often inapproachable due to symptoms of their illness. Therefore nurses should establish relationships with dementia patients via their remaining resources and facilitate communication. In order to achieve this, different targeted non-pharmacological interventions are recommended and practiced. However there is no sufficient evidence about the efficacy of most of these interventions. A number of publications highlight the urgent need for methodological sound studies so that more robust conclusions may be drawn. Methods/Design The trial is designed as a cluster randomized controlled trial with 20 nursing homes in Saxony and Saxony-Anhalt (Germany) as the units of randomization. Nursing homes will be randomly allocated into 4 study groups consisting of 5 clusters and 90 residents: snoezelen, structured reminiscence therapy, 10-minutes activation or unstructured verbal communication (control group). The purpose is to determine whether the interventions are effective to reduce apathy in long-term care residents with dementia (N = 360) as the main outcome measure. Assessments will be done at baseline, 3, 6 and 12 months after beginning of the interventions. Discussion This trial will particularly contribute to the evidence on efficacy of non-pharmacological interventions in dementia care. Trial Registration ClinicalTrials.gov NCT00653731 PMID:20113526

  13. TagSNP analyses of the PON gene cluster: effects on PON1 activity, LDL oxidative susceptibility, and vascular disease.

    PubMed

    Carlson, Christopher S; Heagerty, Patrick J; Hatsukami, Thomas S; Richter, Rebecca J; Ranchalis, Jane; Lewis, Julieann; Bacus, Tamara J; McKinstry, Laura A; Schellenberg, Gerard D; Rieder, Mark; Nickerson, Deborah; Furlong, Clement E; Chait, Alan; Jarvik, Gail P

    2006-05-01

    Paraoxonase 1 (PON1) activity is consistently predictive of vascular disease, although the genotype at four functional PON1 polymorphisms is not. To address this inconsistency, we investigated the role of all common PON1 genetic variability, as measured by tagging single-nucleotide polymorphisms (tagSNPs), in predicting PON1 activity for phenylacetate hydrolysis, LDL susceptibility to oxidation ex vivo, plasma homocysteine (Hcy) levels, and carotid artery disease (CAAD) status. The biological goal was to establish whether additional common genetic variation beyond consideration of the four known functional SNPs improves prediction of these phenotypes. PON2 and PON3 tagSNPs were secondarily evaluated. Expanded analysis of an additional 26 tagSNPs found evidence of previously undescribed common PON1 polymorphisms that affect PON1 activity independently of the four known functional SNPs. PON1 activity was not significantly correlated with LDL oxidative susceptibility, but genotypes at the PON1(-108) promoter polymorphism and several other PON1 SNPs were. Neither PON1 activity nor PON1 genotype was significantly correlated with plasma Hcy levels. This study revealed previously undetected common functional PON1 polymorphisms that explain 4% of PON1 activity and a high rate of recombination in PON1, but the sum of the common PON1 locus variation does not explain the relationship between PON1 activity and CAAD. PMID:16474172

  14. Dealing with chemical reaction pathways and electronic excitations in molecular systems via renormalized and active-space coupled-cluster methods

    SciTech Connect

    Piecuch, Piotr; Li, Wei; Lutz, Jesse J.; Włoch, Marta; Gour, Jeffrey R.

    2015-01-22

    Coupled-cluster (CC) theory has become the de facto standard for high-accuracy molecular calculations, but the widely used CC and equation-of-motion (EOM) CC approaches, such as CCSD(T) and EOMCCSD, have difficulties with capturing stronger electron correlations that characterize multi-reference molecular problems. This presentation demonstrates that many of these difficulties can be addressed by exploiting the completely renormalized (CR) CC and EOMCC approaches, such as CR-CC(2,3), CR-EOMCCSD(T), and CR-EOMCC(2,3), and their local correlation counterparts applicable to systems with hundreds of atoms, and the active-space CC/EOMCC approaches, such as CCSDt and EOMCCSDt, and their extensions to valence systems via the electron-attached and ionized formalisms.

  15. SVM clustering

    PubMed Central

    Winters-Hilt, Stephen; Merat, Sam

    2007-01-01

    Background Support Vector Machines (SVMs) provide a powerful method for classification (supervised learning). Use of SVMs for clustering (unsupervised learning) is now being considered in a number of different ways. Results An SVM-based clustering algorithm is introduced that clusters data with no a priori knowledge of input classes. The algorithm initializes by first running a binary SVM classifier against a data set with each vector in the set randomly labelled, this is repeated until an initial convergence occurs. Once this initialization step is complete, the SVM confidence parameters for classification on each of the training instances can be accessed. The lowest confidence data (e.g., the worst of the mislabelled data) then has its' labels switched to the other class label. The SVM is then re-run on the data set (with partly re-labelled data) and is guaranteed to converge in this situation since it converged previously, and now it has fewer data points to carry with mislabelling penalties. This approach appears to limit exposure to the local minima traps that can occur with other approaches. Thus, the algorithm then improves on its weakly convergent result by SVM re-training after each re-labeling on the worst of the misclassified vectors – i.e., those feature vectors with confidence factor values beyond some threshold. The repetition of the above process improves the accuracy, here a measure of separability, until there are no misclassifications. Variations on this type of clustering approach are shown. Conclusion Non-parametric SVM-based clustering methods may allow for much improved performance over parametric approaches, particularly if they can be designed to inherit the strengths of their supervised SVM counterparts. PMID:18047717

  16. Acute Whiplash Injury Study (AWIS): a protocol for a cluster randomised pilot and feasibility trial of an Active Behavioural Physiotherapy Intervention in an insurance private setting

    PubMed Central

    Wiangkham, Taweewat; Duda, Joan; Haque, M Sayeed; Price, Jonathan; Rushton, Alison

    2016-01-01

    Introduction Whiplash-associated disorder (WAD) causes substantial social and economic burden internationally. Up to 60% of patients with WAD progress to chronicity. Research therefore needs to focus on effective management in the acute stage to prevent the development of chronicity. Approximately 93% of patients are classified as WADII (neck complaint and musculoskeletal sign(s)), and in the UK, most are managed in the private sector. In our recent systematic review, a combination of active and behavioural physiotherapy was identified as potentially effective in the acute stage. An Active Behavioural Physiotherapy Intervention (ABPI) was developed through combining empirical (modified Delphi study) and theoretical (social cognitive theory focusing on self-efficacy) evidence. This pilot and feasibility trial has been designed to inform the design of an adequately powered definitive randomised controlled trial. Methods and analysis Two parallel phases. (1) An external pilot and feasibility cluster randomised double-blind (assessor and participants), parallel two-arm (ABPI vs standard physiotherapy) clinical trial to evaluate procedures and feasibility. Six UK private physiotherapy clinics will be recruited and cluster randomised by a computer-generated randomisation sequence. Sixty participants (30 each arm) will be assessed at recruitment (baseline) and at 3 months postbaseline. The planned primary outcome measure is the neck disability index. (2) An embedded exploratory qualitative study using semistructured indepth interviews (n=3–4 physiotherapists) and a focus group (n=6–8 patients) and entailing the recruitment of purposive samples will explore perceptions of the ABPI. Quantitative data will be analysed descriptively. Qualitative data will be coded and analysed deductively (identify themes) and inductively (identify additional themes). Ethics and dissemination This trial is approved by the University of Birmingham Ethics Committee (ERN_15-0542). Trial

  17. Chaos theory perspective for industry clusters development

    NASA Astrophysics Data System (ADS)

    Yu, Haiying; Jiang, Minghui; Li, Chengzhang

    2016-03-01

    Industry clusters have outperformed in economic development in most developing countries. The contributions of industrial clusters have been recognized as promotion of regional business and the alleviation of economic and social costs. It is no doubt globalization is rendering clusters in accelerating the competitiveness of economic activities. In accordance, many ideas and concepts involve in illustrating evolution tendency, stimulating the clusters development, meanwhile, avoiding industrial clusters recession. The term chaos theory is introduced to explain inherent relationship of features within industry clusters. A preferred life cycle approach is proposed for industrial cluster recessive theory analysis. Lyapunov exponents and Wolf model are presented for chaotic identification and examination. A case study of Tianjin, China has verified the model effectiveness. The investigations indicate that the approaches outperform in explaining chaos properties in industrial clusters, which demonstrates industrial clusters evolution, solves empirical issues and generates corresponding strategies.

  18. Methane activation on nickel oxide clusters with a concerted mechanism: a density functional theory study of the effect of silica support.

    PubMed

    Xi, Yanyan; Chen, Bili; Lin, Xufeng; Wang, Chuangye; Fu, Hui

    2016-04-01

    The support effect is an important issue in heterogeneous catalysis. A systematic density functional theory (DFT) study was performed to investigate the support effect of a silica model on the initial step of methane activation on NixOx (x =2,3) clusters with a concerted mechanism. Four reactions were examined by exploring their potential energy surfaces (PES): CH4 reacting with unsupported Ni2O2, with silica-supported Ni2O2, with unsupported Ni3O3, and with silica-supported Ni3O3. For each reaction, PES with different spin states were explored. For CH4 activation taking place via a concerted mechanism, the reaction barriers in terms of free energy and reaction free energy increased with the involvement of the model silica support. Only one PES made a major contribution to the overall reaction rate of all four reactions examined. No spin transition process was required for the reactions to undergo their most-favorable pathway from their starting reactants. These results provide a deeper insight into the support effect on C-H bond activation of small alkanes in general, and of methane in particular, on supported transition metal catalysts. PMID:26979607

  19. Self-propelled rods exhibit a phase-separated state characterized by the presence of active stresses and the ejection of polar clusters

    NASA Astrophysics Data System (ADS)

    Weitz, Sebastian; Deutsch, Andreas; Peruani, Fernando

    2015-07-01

    We study collections of self-propelled rods (SPR) moving in two dimensions for packing fractions less than or equal to 0.3. We find that in the thermodynamical limit the SPR undergo a phase transition between a disordered gas and a novel phase-separated system state. Interestingly, (global) orientational order patterns—contrary to what has been suggested—vanish in this limit. In the found novel state, the SPR self-organize into a highly dynamical, high-density, compact region—which we call aggregate—which is surrounded by a disordered gas. Active stresses build inside aggregates as a result of the combined effect of local orientational order and active forces. This leads to the most distinctive feature of these aggregates: constant ejection of polar clusters of SPR. This novel phase-separated state represents a novel state of matter characterized by large fluctuations in volume and shape, related to mass ejection, and exhibits positional as well as orientational local order. SPR systems display new physics unseen in other active matter systems.

  20. The SMART CLUSTER METHOD - adaptive earthquake cluster analysis and declustering

    NASA Astrophysics Data System (ADS)

    Schaefer, Andreas; Daniell, James; Wenzel, Friedemann

    2016-04-01

    Earthquake declustering is an essential part of almost any statistical analysis of spatial and temporal properties of seismic activity with usual applications comprising of probabilistic seismic hazard assessments (PSHAs) and earthquake prediction methods. The nature of earthquake clusters and subsequent declustering of earthquake catalogues plays a crucial role in determining the magnitude-dependent earthquake return period and its respective spatial variation. Various methods have been developed to address this issue from other researchers. These have differing ranges of complexity ranging from rather simple statistical window methods to complex epidemic models. This study introduces the smart cluster method (SCM), a new methodology to identify earthquake clusters, which uses an adaptive point process for spatio-temporal identification. Hereby, an adaptive search algorithm for data point clusters is adopted. It uses the earthquake density in the spatio-temporal neighbourhood of each event to adjust the search properties. The identified clusters are subsequently analysed to determine directional anisotropy, focussing on a strong correlation along the rupture plane and adjusts its search space with respect to directional properties. In the case of rapid subsequent ruptures like the 1992 Landers sequence or the 2010/2011 Darfield-Christchurch events, an adaptive classification procedure is applied to disassemble subsequent ruptures which may have been grouped into an individual cluster using near-field searches, support vector machines and temporal splitting. The steering parameters of the search behaviour are linked to local earthquake properties like magnitude of completeness, earthquake density and Gutenberg-Richter parameters. The method is capable of identifying and classifying earthquake clusters in space and time. It is tested and validated using earthquake data from California and New Zealand. As a result of the cluster identification process, each event in

  1. Chemical quantification and antioxidant assay of four active components in Ficus hirta root using UPLC-PAD-MS fingerprinting combined with cluster analysis

    PubMed Central

    2013-01-01

    Background Root of Ficus hirta (RFH) is widely consumed in China as a plant-derived popular food. However, contents of the active constituents of RFH are unknown, and the chemical as well as bioactive properties of RFH may be affected by growing area. In order to ensure the standard efficacy of health products made with RFH, its active constituents should firstly be determined and, secondly, a means of assessing samples for their contents of these constituents is needed. Results Four active components, including two coumarins, namely psoralen and bergapten, and two flavonoids, namely luteolin and apigenin, in twenty RFH samples were quantified using a new ultra performance liquid chromatography coupled with photodiode array detector and mass spectrometry (UPLC-PAD-MS) method, and the content level in descending order was psoralen > bergapten > luteolin > apigenin. Chromatographic fingerprint similarity evaluation and cluster analysis were used to assess geographical origin of RFH, and the results revealed a high level of similarity for the tested RFH samples obtained from Hainan, Guangdong, Guangxi provinces and Hong Kong. 2, 2-Diphenyl-1-picrylhydrazyl (DPPH) radical scavenging assay was conducted to evaluate the antioxidant potencies of the four components, and the results clearly demonstrated that luteolin was most effective; apigenin exhibited a moderate potency, whereas psoralen and bergapten possessed little effect against free radical reactions. Structure-activity relationship of the components was elucidated, and the 3′-hydroxyl group of luteolin was found to be directly responsible for its antioxidant activity. Conclusion The present UPLC-PAD-MS method and DPPH radical scavenging assay performed well for the purpose of constituent quantification and antioxidant assay. Global profiles were highly similar for RFH samples from different origins. Both the coumarins and flavonoids were involved in the health benefit of RFH. PMID:23835498

  2. GALAXY CLUSTERS AROUND RADIO-LOUD ACTIVE GALACTIC NUCLEI AT 1.3 < z < 3.2 AS SEEN BY SPITZER

    SciTech Connect

    Wylezalek, Dominika; Stern, Daniel; Eisenhardt, Peter R. M.; Galametz, Audrey; Vernet, Joeel; De Breuck, Carlos; Seymour, Nick; Brodwin, Mark; Gonzalez, Anthony H.; Hatch, Nina; Jarvis, Matt; Rettura, Alessandro; Stanford, Spencer A.; Stevens, Jason A.

    2013-05-20

    We report the first results from the Clusters Around Radio-Loud AGN program, a Cycle 7 and 8 Spitzer Space Telescope snapshot program to investigate the environments of a large sample of obscured and unobscured luminous radio-loud active galactic nuclei (AGNs) at 1.2 < z < 3.2. These data, obtained for 387 fields, reach 3.6 and 4.5 {mu}m depths of [3.6]{sub AB} = 22.6 and [4.5]{sub AB} = 22.9 at the 95% completeness level, which is two to three times fainter than L* in this redshift range. By using the color cut [3.6] - [4.5] > -0.1 (AB), which efficiently selects high-redshift (z > 1.3) galaxies of all types, we identify galaxy cluster member candidates in the fields of the radio-loud AGN. The local density of these Infrared Array Camera (IRAC)-selected sources is compared to the density of similarly selected sources in blank fields. We find that 92% of the radio-loud AGN reside in environments richer than average. The majority (55%) of the radio-loud AGN fields are found to be overdense at a {>=}2{sigma} level; 10% are overdense at a {>=}5{sigma} level. A clear rise in surface density of IRAC-selected sources toward the position of the radio-loud AGN strongly supports an association of the majority of the IRAC-selected sources with the radio-loud AGN. Our results provide solid statistical evidence that radio-loud AGN are likely beacons for finding high-redshift galaxy (proto-)clusters. We investigate how environment depends on AGN type (unobscured radio-loud quasars versus obscured radio galaxies), radio luminosity and redshift, finding no correlation with either AGN type or radio luminosity. We find a decrease in density with redshift, consistent with galaxy evolution for this uniform, flux-limited survey. These results are consistent with expectations from the orientation-driven AGN unification model, at least for the high radio luminosity regimes considered in this sample.

  3. Would Older Adults with Mild Cognitive Impairment Adhere to and Benefit from a Structured Lifestyle Activity Intervention to Enhance Cognition?: A Cluster Randomized Controlled Trial

    PubMed Central

    Lam, Linda Chiu-wa; Chan, Wai Chi; Leung, Tony; Fung, Ada Wai-tung; Leung, Edward Man-fuk

    2015-01-01

    Background Epidemiologic evidence suggests that cognitive and physical activities are associated with better cognition in late life. The present study was conducted to examine the possible benefits of four structured lifestyle activity interventions and compare their effectiveness in optimizing cognition for older adults with mild cognitive impairment (MCI). Method and Findings This was a 12-month cluster randomized controlled trial. 555 community-dwelling Chinese older adults with MCI (295 with multiple-domain deficits (mdMCI), 260 with single-domain deficit (sdMCI)) were recruited. Participants were randomized into physical exercise (P), cognitive activity (C), integrated cognitive and physical exercise (CP), and social activity (S, active control) groups. Interventions comprised of one-hour structured activities three times per week. Primary outcome was Clinical Dementia Rating sum of boxes (CDR-SOB) scores. Secondary outcomes included Chinese versions of Alzheimer’s Disease Assessment Scale - Cognitive subscale (ADAS-Cog), delayed recall, Mini-Mental State Examination, Category Verbal Fluency Test (CVFT) and Disability Assessment for Dementia – Instrumental Activities of Daily Living (DAD-IADL). Percentage adherence to programs and factors affecting adherence were also examined. At 12th month, 423 (76.2%) completed final assessment. There was no change in CDR-SOB and DAD-IADL scores across time and intervention groups. Multilevel normal model and linear link function showed improvement in ADAS-Cog, delayed recall and CVFT with time (p<0.05). Post-hoc subgroup analyses showed that the CP group, compared with other intervention groups, had more significant improvements of ADAS-Cog, delayed recall and CVFT performance with sdMCI participants (p<0.05). Overall adherence rate was 73.3%. Improvements in ADAS-Cog and delayed recall scores were associated with adherence after controlling for age, education, and intervention groups (univariate analyses). Conclusions

  4. Identification of an Iron-Sulfur Cluster That Modulates the Enzymatic Activity in NarE, a Neisseria meningitidis ADP-ribosyltransferase*

    PubMed Central

    Del Vecchio, Mariangela; Pogni, Rebecca; Baratto, Maria Camilla; Nobbs, Angela; Rappuoli, Rino; Pizza, Mariagrazia; Balducci, Enrico

    2009-01-01

    In prokaryotes, mono-ADP-ribose transfer enzymes represent a family of exotoxins that display activity in a variety of bacterial pathogens responsible for causing disease in plants and animals, including those affecting mankind, such as diphtheria, cholera, and whooping cough. We report here that NarE, a putative ADP-ribosylating toxin previously identified from Neisseria meningitidis, which shares structural homologies with Escherichia coli heat labile enterotoxin and toxin from Vibrio cholerae, possesses an iron-sulfur center. The recombinant protein was expressed in E. coli, and when purified at high concentration, NarE is a distinctive golden brown in color. Evidence from UV-visible spectrophotometry and EPR spectroscopy revealed characteristics consistent of an iron-binding protein. The presence of iron was determined by colorimetric method and by an atomic absorption spectrophotometer. To identify the amino acids involved in binding iron, a combination of site-directed mutagenesis and UV-visible and enzymatic assays were performed. All four cysteine residues were individually replaced by serine. Substitution of Cys67 and Cys128 into serine caused a drastic reduction in the E420/E280 ratio, suggesting that these two residues are essential for the formation of a stable coordination. This modification led to a consistent loss in ADP-ribosyltransferase activity, while decrease in NAD-glycohydrolase activity was less dramatic in these mutants, indicating that the correct assembly of the iron-binding site is essential for transferase but not hydrolase activity. This is the first observation suggesting that a member of the ADP-ribosyltransferase family contains an Fe-S cluster implicated in catalysis. This observation may unravel novel functions exerted by this class of enzymes. PMID:19744927

  5. Identification of an iron-sulfur cluster that modulates the enzymatic activity in NarE, a Neisseria meningitidis ADP-ribosyltransferase.

    PubMed

    Del Vecchio, Mariangela; Pogni, Rebecca; Baratto, Maria Camilla; Nobbs, Angela; Rappuoli, Rino; Pizza, Mariagrazia; Balducci, Enrico

    2009-11-27

    In prokaryotes, mono-ADP-ribose transfer enzymes represent a family of exotoxins that display activity in a variety of bacterial pathogens responsible for causing disease in plants and animals, including those affecting mankind, such as diphtheria, cholera, and whooping cough. We report here that NarE, a putative ADP-ribosylating toxin previously identified from Neisseria meningitidis, which shares structural homologies with Escherichia coli heat labile enterotoxin and toxin from Vibrio cholerae, possesses an iron-sulfur center. The recombinant protein was expressed in E. coli, and when purified at high concentration, NarE is a distinctive golden brown in color. Evidence from UV-visible spectrophotometry and EPR spectroscopy revealed characteristics consistent of an iron-binding protein. The presence of iron was determined by colorimetric method and by an atomic absorption spectrophotometer. To identify the amino acids involved in binding iron, a combination of site-directed mutagenesis and UV-visible and enzymatic assays were performed. All four cysteine residues were individually replaced by serine. Substitution of Cys(67) and Cys(128) into serine caused a drastic reduction in the E(420)/E(280) ratio, suggesting that these two residues are essential for the formation of a stable coordination. This modification led to a consistent loss in ADP-ribosyltransferase activity, while decrease in NAD-glycohydrolase activity was less dramatic in these mutants, indicating that the correct assembly of the iron-binding site is essential for transferase but not hydrolase activity. This is the first observation suggesting that a member of the ADP-ribosyltransferase family contains an Fe-S cluster implicated in catalysis. This observation may unravel novel functions exerted by this class of enzymes. PMID:19744927

  6. The study protocol of a cluster-randomised controlled trial of family-mediated personalised activities for nursing home residents with dementia

    PubMed Central

    2012-01-01

    Background Following admission to a nursing home, the feelings of depression and burden that family carers may experience do not necessarily diminish. Additionally, they may experience feelings of guilt and grief for the loss of a previously close relationship. At the same time, individuals with dementia may develop symptoms of depression and agitation (BPSD) that may be related to changes in family relationships, social interaction and stimulation. Until now, interventions to alleviate carer stress and BPSD have treated carers and relatives separately rather than focusing on maintaining or enhancing their relationships. One-to-one structured activities have been shown to reduce BPSD and also improve the caring experience, but barriers such as a lack of resources impede the implementation of activities in aged care facilities. The current study will investigate the effect of individualised activities based on the Montessori methodology administered by family carers in residential care. Methods/Design We will conduct a cluster-randomised trial to train family carers in conducting personalised one-to-one activities based on the Montessori methodology with their relatives. Montessori activities derive from the principles espoused by Maria Montessori and subsequent educational theorists to promote engagement in learning, namely task breakdown, guided repetition, progression in difficulty from simple to complex, and the careful matching of demands to levels of competence. Persons with dementia living in aged care facilities and frequently visiting family carers will be included in the study. Consented, willing participants will be randomly assigned by facility to a treatment condition using the Montessori approach or a control waiting list condition. We hypothesise that family carers conducting Montessori-based activities will experience improvements in quality of visits and overall relationship with the resident as well as higher self-rated mastery, fewer depressive

  7. Physical activity and academic achievement across the curriculum (A + PAAC): rationale and design of a 3-year, cluster-randomized trial

    PubMed Central

    2013-01-01

    Background Improving academic achievement and reducing the rates of obesity in elementary school students are both of considerable interest. Increased physical activity during academic instruction time during school offers a potential intervention to address both issues. A program titled “Physical Activity Across the Curriculum” (PAAC) was developed in which classroom teachers in 22 elementary schools were trained to deliver academic instruction using physical activity with a primary aim of preventing increased BMI. A secondary analysis of data assessed the impact of PAAC on academic achievement using the Weschler Individual Achievement Test-II and significant improvements were shown for reading, math and spelling in students who participated in PAAC. Based on the results from PAAC, an adequately powered trial will be conducted to assess differences in academic achievement between intervention and control schools called, “Academic Achievement and Physical Activity Across the Curriculum (A + PAAC).” Methods/design Seventeen elementary schools were cluster randomized to A + PAAC or control for a 3-year trial. Classroom teachers were trained to deliver academic instruction through moderate-to-vigorous physical activity with a target of 100+ minutes of A + PAAC activities per week. The primary outcome measure is academic achievement measured by the Weschler Individual Achievement Test-III, which was administered at baseline (Fall 2011) and will be repeated in the spring of each year by assessors blinded to condition. Potential mediators of any association between A + PAAC and academic achievement will be examined on the same schedule and include changes in cognitive function, cardiovascular fitness, daily physical activity, BMI, and attention-to-task. An extensive process analysis will be conducted to document the fidelity of the intervention. School and student recruitment/randomization, teacher training, and baseline testing for A

  8. Effectiveness of a School-Based Physical Activity Intervention on Cognitive Performance in Danish Adolescents: LCoMotion—Learning, Cognition and Motion – A Cluster Randomized Controlled Trial

    PubMed Central

    Domazet, Sidsel Louise; Froberg, Karsten; Hillman, Charles H.; Andersen, Lars Bo; Bugge, Anna

    2016-01-01

    Background Physical activity is associated not only with health-related parameters, but also with cognitive and academic performance. However, no large scale school-based physical activity interventions have investigated effects on cognitive performance in adolescents. The aim of this study was to describe the effectiveness of a school-based physical activity intervention in enhancing cognitive performance in 12–14 years old adolescents. Methods A 20 week cluster randomized controlled trial was conducted including seven intervention and seven control schools. A total of 632 students (mean (SD) age: 12.9 (0.6) years) completed the trial with baseline and follow-up data on primary or secondary outcomes (74% of randomized subjects). The intervention targeted physical activity during academic subjects, recess, school transportation and leisure-time. Cognitive performance was assessed using an executive functions test of inhibition (flanker task) with the primary outcomes being accuracy and reaction time on congruent and incongruent trials. Secondary outcomes included mathematics performance, physical activity levels, body-mass index, waist-circumference and cardiorespiratory fitness. Results No significant difference in change, comparing the intervention group to the control group, was observed on the primary outcomes (p’s>0.05) or mathematics skills (p>0.05). An intervention effect was found for cardiorespiratory fitness in girls (21 meters (95% CI: 4.4–38.6) and body-mass index in boys (-0.22 kg/m2 (95% CI: -0.39–0.05). Contrary to our predictions, a significantly larger change in interference control for reaction time was found in favor of the control group (5.0 milliseconds (95% CI: 0–9). Baseline to mid-intervention changes in physical activity levels did not differ significantly between groups (all p’s>0.05). Conclusions No evidence was found for effectiveness of a 20-week multi-faceted school-based physical activity intervention for enhancing

  9. Interstitial Fluid Flow Intensity Modulates Endothelial Sprouting in Restricted Src-Activated Cell Clusters During Capillary Morphogenesis

    PubMed Central

    Hernández Vera, Rodrigo; Genové, Elsa; Alvarez, Lery; Borrós, Salvador; Kamm, Roger; Lauffenburger, Douglas

    2009-01-01

    Development of tissues in vitro with dimensions larger than 150 to 200 μm requires the presence of a functional vascular network. Therefore, we have studied capillary morphogenesis under controlled biological and biophysical conditions with the aim of promoting vascular structures in tissue constructs. We and others have previously demonstrated that physiological values of interstitial fluid flow normal to an endothelial monolayer in combination with vascular endothelial growth factor play a critical role during capillary morphogenesis by promoting cell sprouting. In the present work, we studied the effect that a range of interstitial flow velocities (0–50 μm/min) has in promoting the amount, length, and branching of developing sprouts during capillary morphogenesis. The number of capillary-like structures developed from human umbilical vein endothelial cell monolayers across the interstitial flow values tested was not significantly affected. Instead, the length and branching degree of the sprouts presented a significant maximum at flow velocities of 10 to 20 μm/min. More-over, at these same flow values, the phosphorylation level of Src also showed its peak. We discovered that capillary morphogenesis is restricted to patches of Src-activated cells (phosphorylated Src (pSrc)) at the monolayer, suggesting that the transduction pathway in charge of sensing the mechanical stimulus induced by flow is promoting predetermined mechanically sensitive areas (pSrc) to undergo capillary morphogenesis. PMID:18636940

  10. Subunits of the Pyruvate Dehydrogenase Cluster of Mycoplasma pneumoniae Are Surface-Displayed Proteins that Bind and Activate Human Plasminogen

    PubMed Central

    Gründel, Anne; Friedrich, Kathleen; Pfeiffer, Melanie; Jacobs, Enno; Dumke, Roger

    2015-01-01

    The dual role of glycolytic enzymes in cytosol-located metabolic processes and in cell surface-mediated functions with an influence on virulence is described for various micro-organisms. Cell wall-less bacteria of the class Mollicutes including the common human pathogen Mycoplasma pneumoniae possess a reduced genome limiting the repertoire of virulence factors and metabolic pathways. After the initial contact of bacteria with cells of the respiratory epithelium via a specialized complex of adhesins and release of cell-damaging factors, surface-displayed glycolytic enzymes may facilitate the further interaction between host and microbe. In this study, we described detection of the four subunits of pyruvate dehydrogenase complex (PDHA-D) among the cytosolic and membrane-associated proteins of M. pneumoniae. Subunits of PDH were cloned, expressed and purified to produce specific polyclonal guinea pig antisera. Using colony blotting, fractionation of total proteins and immunofluorescence experiments, the surface localization of PDHA-C was demonstrated. All recombinant PDH subunits are able to bind to HeLa cells and human plasminogen. These interactions can be specifically blocked by the corresponding polyclonal antisera. In addition, an influence of ionic interactions on PDHC-binding to plasminogen as well as of lysine residues on the association of PDHA-D with plasminogen was confirmed. The PDHB subunit was shown to activate plasminogen and the PDHB-plasminogen complex induces degradation of human fibrinogen. Hence, our data indicate that the surface-associated PDH subunits might play a role in the pathogenesis of M. pneumoniae infections by interaction with human plasminogen. PMID:25978044

  11. FRET analysis using sperm-activating peptides tagged with fluorescent proteins reveals that ligand-binding sites exist as clusters.

    PubMed

    Arcos-Hernández, César; Romero, Francisco; Sánchez-Guevara, Yoloxochitl; Beltrán, Carmen; Nishigaki, Takuya

    2016-02-01

    Long-range cellular communication between the sperm and egg is critical for external fertilization. Sperm-activating peptides (SAPs) are diffusible components of the outer layer of eggs in echinoderms, and function as chemoattractants for spermatozoa. The decapeptide named speract is the best-characterized sea urchin SAP. Biochemical and physiological actions of speract have been studied with purified or chemically synthesized peptides. In this work, we prepared recombinant speract fused to a fluorescent protein (FP; FP-speract) using three color variants: a cyan (eCFP), a yellow (mVenus) and a large Stokes shift yellow (mAmetrine) FP. Although these fluorescence tags are 20 times larger than speract, competitive binding experiments using mAmetrine-speract revealed that this FP-speract has binding affinity to the receptor that is comparable (7.6-fold less) to that of non-labeled speract. Indeed, 10 nmol l(-1) eCFP-speract induces physiological sperm responses such as membrane potential changes and increases in intracellular pH and Ca(2+) concentrations similar to those triggered by 10 nmol l(-1) speract. Furthermore, FP-speract maintains its fluorescence upon binding to its receptor. Using this property, we performed fluorescence resonance energy transfer (FRET) measurements with eCFP-speract and mVenus-speract as probes and obtained a positive FRET signal upon binding to the receptor, which suggests that the speract receptor exists as an oligomer, at least as a dimer, or alternatively that a single speract receptor protein possesses multiple binding sites. This property could partially account for the positive and/or negative cooperative binding of speract to the receptor. PMID:26889001

  12. A cluster randomised trial of a school-based intervention to prevent decline in adolescent physical activity levels: study protocol for the ‘Physical Activity 4 Everyone’ trial

    PubMed Central

    2013-01-01

    Background Adolescence is an established period of physical activity decline. Multi-component school-based interventions have the potential to slow the decline in adolescents’ physical activity; however, few interventions have been conducted in schools located in low-income or disadvantaged communities. This study aims to assess the effectiveness of a multi-component school-based intervention in reducing the decline in physical activity among students attending secondary schools located in disadvantaged communities. Methods/Design The cluster randomised trial will be conducted with 10 secondary schools located in selected regions of New South Wales, Australia. The schools will be selected from areas that have a level of socio-economic status that is below the state average. Five schools will be allocated to receive an intervention based on the Health Promoting Schools framework, and will be supported by a part-time physical activity consultant placed in intervention schools who will implement a range of intervention adoption strategies. Study measures will be taken at baseline when students are in Year 7 (12–13 years) and again after 12- and 24-months. The primary outcome, minutes of moderate- to-vigorous- intensity physical activity per day and percentage of time in moderate- to vigorous-intensity physical activity (MVPA), will be objectively assessed using accelerometers (Actigraph GT3x+). Group allocation and intervention delivery will commence after baseline data collection. The intervention will continue during school terms through to 24-month follow-up. Discussion The study will provide evidence regarding the effectiveness of a multi-component school-based intervention that includes an in-school physical activity consultant targeting the physical activity levels of adolescents in disadvantaged Australian secondary schools. Trial registration Australian New Zealand Clinical Trials Registry ACTRN12612000382875. PMID:23336603

  13. ‘Physical Activity 4 Everyone’ school-based intervention to prevent decline in adolescent physical activity levels: 12 month (mid-intervention) report on a cluster randomised trial

    PubMed Central

    Sutherland, Rachel; Campbell, Elizabeth; Lubans, David R; Morgan, Philip J; Okely, Anthony D; Nathan, Nicole; Wolfenden, Luke; Wiese, Jarrod; Gillham, Karen; Hollis, Jenna; Wiggers, John

    2016-01-01

    Background Adolescence is a recognised period of physical activity decline, particularly among low-income communities. We report the 12-month (midpoint) effects of a 2-year multicomponent physical activity intervention implemented in disadvantaged secondary schools. Methods A cluster randomised trial was undertaken in 10 secondary schools located in disadvantaged areas in New South Wales, Australia. Students in Grade 7 were recruited, with follow-up in Grade 8. The intervention was guided by socioecological theory and included seven physical activity strategies, and six implementation adoption strategies. The primary outcome was mean minutes of moderate-to-vigorous physical activity (MVPA) per day assessed using Actigraph GT3X accelerometers. Outcome data were analysed using repeated measures linear mixed models. Results At baseline, 1150 (93%) students participated in the data collection (mean age 12 years, 48% boys) and 1050 (79%) students participated at 12-month follow-up. By the 12-month follow-up, the six implementation adoption strategies had been used to support schools to deliver four of the seven physical activity elements. There was a significant group-by-time interaction for mean minutes of MVPA per day in favour of the intervention group (adjusted difference between groups at follow-up=3.85 min, 95% CI (0.79 to 6.91), p≤0.01), including significantly more vigorous physical activity (2.45 min, p≤0.01), equating to 27 min more MVPA per week. Summary At 12-month follow-up, the intervention had reduced the decline in physical activity among adolescents from disadvantaged schools. The intervention may assist students to meet physical activity guidelines. PMID:26359346

  14. CARTILAGE CELL CLUSTERS

    PubMed Central

    Lotz, Martin K.; Otsuki, Shuhei; Grogan, Shawn P.; Sah, Robert; Terkeltaub, Robert; D’Lima, Darryl

    2010-01-01

    The formation of new cell clusters is a histological hallmark of arthritic cartilage but the biology of clusters and their role in disease are poorly understood. This is the first comprehensive review of clinical and experimental conditions associated with cluster formation. Genes and proteins that are expressed in cluster cells, the cellular origin of the clusters, mechanisms that lead to cluster formation and the role of cluster cells in pathogenesis are discussed. PMID:20506158

  15. CXCR6-CXCL16 axis promotes prostate cancer by mediating cytoskeleton rearrangement via Ezrin activation and αvβ3 integrin clustering

    PubMed Central

    Singh, Rajesh; Kapur, Neeraj; Mir, Hina; Singh, Nalinaksha; Lillard, James W.; Singh, Shailesh

    2016-01-01

    Cytoskeletal rearrangement is required for migration and invasion, which are the key steps of cancer metastasis. Ezrin and integrin co-ordinate these processes by regulating cellular adhesion and cytoskeletal polymerization-depolymerization. It is also well established that chemokine-chemokine receptor axis plays a crucial role in regulating cancer cell migration and invasion. In this study, we show involvement of CXC chemokine receptor 6 (CXCR6) and its only natural ligand CXCL16 in pathobiology of prostate cancer (PCa). CXCR6 is highly expressed in PCa tissues and cell lines (LNCaP and PC3), relative to normal tissue and cells. CXCR6 expression in PCa tissues correlated with higher Gleason score. Similarly, aggressive PCa cells (PC3) show high CXCR6 compared to less aggressive LNCaP. Besides, PC3 cells show higher MMPs expression compared to LNCaP cells following CXCL16 stimulation. Intriguingly, CXCR6-CXCL16 interaction in PCa cells promotes Ezrin activation, αvβ3 integrin clustering and capping at the leading edge in FAK/PI3K/PKC dependent manner, thereby modifying cellular adhesion as well as motility. Together these results demonstrate that CXCL16 stimulation changes cytoskeletal dynamics resulting in enhanced migration, invasion and adhesion to endothelial cells, ultimately enabling PCa cells to achieve their metastatic goal. PMID:26799186

  16. Analysis of multi-domain hypothetical proteins containing iron-sulphur clusters and fad ligands reveal rieske dioxygenase activity suggesting their plausible roles in bioremediation

    PubMed Central

    Sathyanarayanan, Nitish; Nagendra, Holenarasipur Gundurao

    2012-01-01

    ‘Conserved hypothetical’ proteins pose a challenge not just for functional genomics, but also to biology in general. As long as there are hundreds of conserved proteins with unknown function in model organisms such as Escherichia coli, Bacillus subtilis or Saccharomyces cerevisiae, any discussion towards a ‘complete’ understanding of these biological systems will remain a wishful thinking. Insilico approaches exhibit great promise towards attempts that enable appreciating the plausible roles of these hypothetical proteins. Among the majority of genomic proteins, two-thirds in unicellular organisms and more than 80% in metazoa, are multi-domain proteins, created as a result of gene duplication events. Aromatic ring-hydroxylating dioxygenases, also called Rieske dioxygenases (RDOs), are class of multi-domain proteins that catalyze the initial step in microbial aerobic degradation of many aromatic compounds. Investigations here address the computational characterization of hypothetical proteins containing Ferredoxin and Flavodoxin signatures. Consensus sequence of each class of oxidoreductase was obtained by a phylogenetic analysis, involving clustering methods based on evolutionary relationship. A synthetic sequence was developed by combining the consensus, which was used as the basis to search for their homologs via BLAST. The exercise yielded 129 multidomain hypothetical proteins containing both 2Fe-2S (Ferredoxin) and FNR (Flavodoxin) domains. In the current study, 40 proteins with N-terminus 2Fe-2S domain and C-terminus FNR domain are characterized, through homology modelling and docking exercises which suggest dioxygenase activity indicating their plausible roles in degradation of aromatic moieties. PMID:23275712

  17. Quantum-chemical study of the effect of oxygen on the formation of active sites of silver clusters during the selective adsorption of hydrocarbons

    NASA Astrophysics Data System (ADS)

    Lanin, S. N.; Polynskaya, Yu. G.; Pichugina, D. A.; Nguen, V.; Beletskaya, A. V.; Kuz'menko, N. E.; Shestakov, A. F.

    2013-09-01

    Density functional theory (PBE with a modified Dirac-Coulomb-Breit Hamiltonian) is used to simulate the adsorption of hydrocarbons (C2H2, C2H4, C2H6) on the surface of a sorbent containing Ag0, Agδ+, and AgO sites. The dynamics of change in the structural characteristics of Ag n ( n ≤ 10) is analyzed and the adsorption of oxygen on Ag8 and Ag10 is studied to select the adsorption site model. Studying the interaction of hydrocarbons with Ag8, Ag10, Ag{10/+}, Ag10O, and Ag10O2 clusters reveals that the presence of oxygen leads to an increase in the activation of unsaturated hydrocarbons, and the adsorption energy of C2H2 increases tenfold. It is found that the role of adsorbed oxygen is not only to form adsorption sites of hydrocarbons (Agδ+) but also to bind C2H2 and C2H4 directly to the sorbent's surface.

  18. Activation energies for nucleation and growth and critical cluster size dependence in JMAK analyses of kinetic Monte-Carlo simulations of precipitation

    NASA Astrophysics Data System (ADS)

    Molnar, David; Niedermeier, Christian; Mora, Alejandro; Binkele, Peter; Schmauder, Siegfried

    2012-11-01

    Kinetic Monte-Carlo (KMC) methods are used as an approach to simulate precipitation in Cu-alloyed bcc Fe. In order to characterize the process, transformed fractions, that is, the precipitated atoms, are related to Johnson-Mehl-Avrami-Kolmogorov theory. However, simulated data often deviate from corresponding fit curves and so does the resulting growth exponent when compared to theoretical expectations. Furthermore, some data may suggest the development of a metastable phase. In our study, we show that the characteristics of the transformed fraction and, as a consequence, the derived growth exponents sensitively depend on the number of atoms that are considered to form a particle and hence contribute to the transformed fraction. With a temperature dependence of the critical cluster size and additionally accounting for severe impingement of the particles, we obtain growth exponents which lie close to the expected range between n = 1.5 and n = 2.5 for pre-existing nuclei or continuous nucleation, respectively. From these, we obtain activation energies for nucleation and growth of precipitates. In this way, atomistic KMC simulations yield thermodynamical quantities, which can be valuable input parameters for larger length scale simulation methods, for example, for Phase Field Method simulations.

  19. It's LiFe! Mobile and Web-Based Monitoring and Feedback Tool Embedded in Primary Care Increases Physical Activity: A Cluster Randomized Controlled Trial

    PubMed Central

    Spreeuwenberg, Marieke; Tange, Huibert; van der Weijden, Trudy; de Witte, Luc

    2015-01-01

    Background Physical inactivity is a major public health problem. The It’s LiFe! monitoring and feedback tool embedded in the Self-Management Support Program (SSP) is an attempt to stimulate physical activity in people with chronic obstructive pulmonary disease or type 2 diabetes treated in primary care. Objective Our aim was to evaluate whether the SSP combined with the use of the monitoring and feedback tool leads to more physical activity compared to usual care and to evaluate the additional effect of using this tool on top of the SSP. Methods This was a three-armed cluster randomised controlled trial. Twenty four family practices were randomly assigned to one of three groups in which participants received the tool + SSP (group 1), the SSP (group 2), or care as usual (group 3). The primary outcome measure was minutes of physical activity per day. The secondary outcomes were general and exercise self-efficacy and quality of life. Outcomes were measured at baseline after the intervention (4-6 months), and 3 months thereafter. Results The group that received the entire intervention (tool + SSP) showed more physical activity directly after the intervention than Group 3 (mean difference 11.73, 95% CI 6.21-17.25; P<.001), and Group 2 (mean difference 7.86, 95% CI 2.18-13.54; P=.003). Three months after the intervention, this effect was still present and significant (compared to Group 3: mean difference 10.59, 95% CI 4.94-16.25; P<.001; compared to Group 2: mean difference 9.41, 95% CI 3.70-15.11; P<.001). There was no significant difference in effect between Groups 2 and 3 on both time points. There was no interaction effect for disease type. Conclusions The combination of counseling with the tool proved an effective way to stimulate physical activity. Counseling without the tool was not effective. Future research about the cost-effectiveness and application under more tailored conditions and in other target groups is recommended. Trial Registration Clinical

  20. Clustered randomised controlled trial of two education interventions designed to increase physical activity and well-being of secondary school students: the MOVE Project

    PubMed Central

    Tymms, Peter B; Curtis, Sarah E; Routen, Ash C; Thomson, Katie H; Bolden, David S; Bock, Susan; Dunn, Christine E; Cooper, Ashley R; Elliott, Julian G; Moore, Helen J; Summerbell, Carolyn D; Tiffin, Paul A; Kasim, Adetayo S

    2016-01-01

    Objective To assess the effectiveness of 2 interventions in improving the physical activity and well-being of secondary school children. Design A clustered randomised controlled trial; classes, 1 per school, were assigned to 1 of 3 intervention arms or a control group based on a 2×2 factorial design. The interventions were peer-mentoring and participative learning. Year 7 children (aged 11–12) in the peer-mentoring intervention were paired with year 9 children for 6 weekly mentoring meetings. Year 7 children in the participative learning arm took part in 6 weekly geography lessons using personalised physical activity and Global Positioning System (GPS) data. Year 7 children in the combined intervention received both interventions, with the year 9 children only participating in the mentoring sessions. Participants 1494 year 7 students from 60 schools in the North of England took part in the trial. Of these, 43 students opted out of taking part in the evaluation measurements, 2 moved teaching group and 58 changed school. Valid accelerometry outcome data were collected for 892 students from 53 schools; and well-being outcome data were available for 927 students from 52 schools. Main outcome measures The primary outcomes were mean minutes of accelerometer-measured moderate-to-vigorous intensity physical activity per day, and well-being as evaluated by the KIDSCREEN-27 questionnaire. These data were collected 6 weeks after the intervention; a 12-month follow-up is planned. Results No significant effects (main or interaction) were observed for the outcomes. However, small positive differences were found for both outcomes for the participative learning intervention. Conclusions These findings suggest that the 2 school-based interventions did not modify levels of physical activity or well-being within the period monitored. Change in physical activity may require more comprehensive individual behavioural intervention, and/or more system-based efforts to address wider

  1. Increased masticatory activity and quality of life in elderly persons with dementia-a longitudinal matched cluster randomized single-blind multicenter intervention study

    PubMed Central

    2013-01-01

    Background Worldwide, millions of people are suffering from dementia and this number is rising. An index of quality of life (QoL) can describe the impact a disease or treatment has on a person’s wellbeing. QoL comprises many variables, including physical health and function, and mental health and function. QoL is related to masticatory ability and physical activity. Animal studies show that disruption of mastication due to loss of teeth or a soft diet leads to memory loss and learning problems. Since these are common complaints in dementia, it is hypothesized that improvement of masticatory function and normalization of diet consistency can increase QoL in elderly persons suffering from dementia. Therefore, the goal of the present study is to examine whether an increase in masticatory activity, achieved by increased food consistency and enhancement of masticatory function through improved oral health care has a positive effect on QoL, including cognition, mood, activities of daily living (ADL), and circadian rhythm in elderly persons with dementia. Methods and design The described study is a prospective longitudinal matched cluster randomized single-blind multicenter study. Participants are elderly persons living in the Netherlands, suffering from dementia and receiving psychogeriatric care. An intervention group will receive improved oral health care and a diet of increased consistency. A control group receives care as usual. Participants will be assessed four times; outcome variables besides QoL are cognition, mood, independence, rest-activity rhythm, blood pressure, and masticatory function. Discussion This research protocol investigates the effect of an intervention executed by daily caregivers. The intervention will increase masticatory activity, which is achieved by three different actions, (providing oral health care, increasing food consistency, or a combination of both). There is a certain amount of variety in the nature of the interventions due to local

  2. Nuclear resonance vibrational spectroscopy reveals the FeS cluster composition and active site vibrational properties of an O2-tolerant NAD+-reducing [NiFe] hydrogenase

    SciTech Connect

    Lauterbach, Lars; Wang, Hongxin; Horch, Marius; Gee, Leland B.; Yoda, Yoshitaka; Tanaka, Yoshihito; Zebger, Ingo; Lenz, Oliver; Cramer, Stephen P.

    2014-10-30

    Hydrogenases are complex metalloenzymes that catalyze the reversible splitting of molecular hydrogen into protons and electrons essentially without overpotential. The NAD+-reducing soluble hydrogenase (SH) from Ralstonia eutropha is capable of H2 conversion even in the presence of usually toxic dioxygen. The molecular details of the underlying reactions are largely unknown, mainly because of limited knowledge of the structure and function of the various metal cofactors present in the enzyme. Here, all iron-containing cofactors of the SH were investigated by 57Fe specific nuclear resonance vibrational spectroscopy (NRVS). Our data provide experimental evidence for one [2Fe2S] center and four [4Fe4S] clusters, which is consistent with the amino acid sequence composition. Only the [2Fe2S] cluster and one of the four [4Fe4S] clusters were reduced upon incubation of the SH with NADH. This finding explains the discrepancy between the large number of FeS clusters and the small amount of FeS cluster-related signals as detected by electron paramagnetic resonance spectroscopic analysis of several NAD+-reducing hydrogenases. For the first time, Fe–CO and Fe–CN modes derived from the [NiFe] active site could be distinguished by NRVS through selective 13C labeling of the CO ligand. This strategy also revealed the molecular coordinates that dominate the individual Fe–CO modes. The present approach explores the complex vibrational signature of the Fe–S clusters and the hydrogenase active site, thereby showing that NRVS represents a powerful tool for the elucidation of complex biocatalysts containing multiple cofactors.

  3. Density functional theory calculations on the active site of biotin synthase: mechanism of S transfer from the Fe(2)S(2) cluster and the role of 1st and 2nd sphere residues.

    PubMed

    Rana, Atanu; Dey, Subal; Agrawal, Amita; Dey, Abhishek

    2015-10-01

    Density functional theory (DFT) calculations are performed on the active site of biotin synthase (BS) to investigate the sulfur transfer from the Fe(2)S(2) cluster to dethiobiotin (DTB). The active site is modeled to include both the 1st and 2nd sphere residues. Molecular orbital theory considerations and calculation on smaller models indicate that only an S atom (not S²⁻) transfer from an oxidized Fe(2)S(2) cluster leads to the formation of biotin from the DTB using two adenosyl radicals generated from S-adenosyl-L-methionine. The calculations on larger protein active site model indicate that a 9-monothiobiotin bound reduced cluster should be an intermediate during the S atom insertion from the Fe(2)S(2) cluster consistent with experimental data. The Arg260 bound to Fe1, being a weaker donor than cysteine bound to Fe(2), determines the geometry and the electronic structure of this intermediate. The formation of this intermediate containing the C9-S bond is estimated to have a ΔG(≠) of 17.1 kcal/mol while its decay by the formation of the 2nd C6-S bond is calculated to have a ΔG(≠) of 29.8 kcal/mol, i.e. the 2nd C-S bond formation is calculated to be the rate determining step in the cycle and it leads to the decay of the Fe(2)S(2) cluster. Significant configuration interaction (CI), present in these transition states, helps lower the barrier of these reactions by ~30-25 kcal/mol relative to a hypothetical outer-sphere reaction. The conserved Phe285 residue near the Fe(2)S(2) active site determines the stereo selectivity at the C6 center of this radical coupling reaction. Reaction mechanism of BS investigated using DFT calculations. Strong CI and the Phe285 residue control the kinetic rate and stereochemistry of the product. PMID:26369537

  4. Methane activation by cobalt cluster cations, Co{sub n}{sup +} (n=2-16): Reaction mechanisms and thermochemistry of cluster-CH{sub x} (x=0-3) complexes

    SciTech Connect

    Citir, Murat; Liu Fuyi; Armentrout, P. B.

    2009-02-07

    The kinetic energy dependences of the reactions of Co{sub n}{sup +} (n=2-16) with CD{sub 4} are studied in a guided ion beam tandem mass spectrometer over the energy range of 0-10 eV. The main products are hydride formation, Co{sub n}D{sup +}, dehydrogenation to form Co{sub n}CD{sub 2}{sup +}, and double dehydrogenation yielding Co{sub n}C{sup +}. These primary products decompose to form secondary and higher order products, Co{sub n}CD{sup +}, Co{sub n-1}D{sup +}, Co{sub n-1}C{sup +}, Co{sub n-1}CD{sup +}, and Co{sub n-1}CD{sub 2}{sup +} at higher energies. Adduct formation of Co{sub n}CD{sub 4}{sup +} is also observed for the largest cluster cations, n{>=}10. In general, the efficiencies of the single and double dehydrogenation processes increase with cluster size, although the hexamer cation shows a reduced reactivity compared to its neighbors. All reactions exhibit thresholds, and cross sections for the various primary and secondary reactions are analyzed to yield reaction thresholds from which bond energies for cobalt cluster cations to D, C, CD, CD{sub 2}, and CD{sub 3} are determined. The relative magnitudes of these bond energies are consistent with simple bond order considerations. Bond energies for larger clusters rapidly reach relatively constant values, which are used to estimate the chemisorption energies of the C, CD, CD{sub 2}, and CD{sub 3} molecular fragments to cobalt surfaces.

  5. Family-Based Cluster Randomized Controlled Trial Enhancing Physical Activity and Motor Competence in 4–7-Year-Old Children

    PubMed Central

    Laukkanen, Arto; Pesola, Arto Juhani; Heikkinen, Risto; Sääkslahti, Arja Kaarina; Finni, Taija

    2015-01-01

    Little is known of how to involve families in physical activity (PA) interventions for children. In this cluster randomized controlled trial, we recruited families with four- to seven-year-old children to participate in a year-long study where parents in the intervention group families (n = 46) received tailored counseling to increase children’s PA. Structured PA was not served. Control group families (n = 45) did not receive any counseling. PA in all children (n = 91; mean age 6.16 ± 1.13 years at the baseline) was measured by accelerometers at the baseline and after three, six, nine and 12 months. Motor competence (MC) (n = 89) was measured at the baseline and after six and 12 months by a KTK (KörperkoordinationsTest für Kinder) and throwing and catching a ball (TCB) protocols. The effect of parental counseling on study outcomes was analyzed by a linear mixed-effects model fit by REML and by a Mann-Whitney U test in the case of the TCB. As season was hypothesized to affect counseling effect, an interaction of season on the study outcomes was examined. The results show significant decrease of MVPA in the intervention group when compared to the control group (p < .05). The TCB showed a nearly significant improvement at six months in the intervention group compared to the controls (p = .051), but not at 12 months. The intervention group had a steadier development of the KTK when the interaction of season was taken into account. In conclusion, more knowledge of family constructs associating with the effectiveness of counseling is needed for understanding how to enhance PA in children by parents. However, a hypothesis may be put forward that family-based counseling during an inactive season rather than an active season may provide a more lasting effect on the development of KTK in children. Trial Registration Controlled-Trials.com ISRCTN28668090 PMID:26502183

  6. Lessons learnt from the Bristol Girls Dance Project cluster RCT: implications for designing and implementing after-school physical activity interventions

    PubMed Central

    Edwards, Mark J; May, Thomas; Kesten, Joanna M; Banfield, Kate; Bird, Emma L; Powell, Jane E; Sebire, Simon J; Jago, Russell

    2016-01-01

    Objective To consider implementation issues associated with the delivery of Bristol Girls Dance Project (BGDP) and to identify improvements that may aid the design of after-school physical activity (PA) interventions. Design Two-armed cluster randomised control trial. The BGDP was a 20-week school-based intervention, consisting of two 75 min after-school dance sessions per week, which aimed to support Year 7 girls to be more physically active. Setting 18 secondary schools (nine intervention, nine control) in the Greater Bristol area (as an indication of deprivation, children eligible for the pupil premium in participant schools ranged from 6.9 to 53.3%). Participants 571 Year 7 girls. This article reports on qualitative data collected from 59 girls in the intervention arm of the trial, 10 dance instructors and 9 school contacts involved in the delivering of the BGDP. Methods Data were obtained from nine focus groups with girls (one per intervention school), and interviews with dance instructors and school contacts. Focus groups sought views of girls’ motivation to participate, teaching styles and experiences of the intervention. Interviews explored views on implementation and dissemination. Framework analysis was used to analyse data. Results Qualitative data elicited three themes associated with the delivery of BGDP that affected implementation: project design, session content and project organisation. ‘Project design’ found issues associated with recruitment, timetabling and session quantity to influence the effectiveness of BGDP. ‘Session content’ found that dance instructors delivered a range of content and that girls enjoyed a variety of dance. Themes within ‘project organisation’ suggested an ‘open enrolment’ policy and greater parental involvement may facilitate better attendance. Conclusions After-school PA interventions have potential for increasing PA levels among adolescent girls. There is a need to consider the context in which

  7. Protocol for the ‘Virtual Traveller’ cluster-randomised controlled trial: a behaviour change intervention to increase physical activity in primary-school Maths and English lessons

    PubMed Central

    Norris, E; Dunsmuir, S; Duke-Williams, O; Stamatakis, E; Shelton, N

    2016-01-01

    Introduction Physical activity (PA) has been shown to be an important factor for health and educational outcomes in children. However, a large proportion of children's school day is spent in sedentary lesson-time. There is emerging evidence about the effectiveness of physically active lessons: integrating physical movements and educational content in the classroom. ‘Virtual Traveller’ is a novel 6-week intervention of 10-min sessions performed 3 days per week, using classroom interactive whiteboards to integrate movement into primary-school Maths and English teaching. The primary aim of this project is to evaluate the effect of the Virtual Traveller intervention on children's PA, on-task behaviour and student engagement. Methods and analysis This study will be a cluster-randomised controlled trial with a waiting-list control group. Ten year 4 (aged 8–9 years) classes across 10 primary schools will be randomised by class to either the 6-week Virtual Traveller intervention or the waiting-list control group. Data will be collected 5 times: at baseline, at weeks 2 and 4 of the intervention, and 1 week and 3 months postintervention. At baseline, anthropometric measures, 4-day objective PA monitoring (including 2 weekend days; Actigraph accelerometer), PA and on-task behaviour observations and student engagement questionnaires will be performed. All but anthropometric measures will be repeated at all other data collection points. Changes in overall PA levels and levels during different time-periods (eg, lesson-time) will be examined. Changes in on-task behaviour and student engagement between intervention groups will also be examined. Multilevel regression modelling will be used to analyse the data. Process evaluation will be carried out during the intervention period. Ethics and dissemination The results of this study will be disseminated through peer-review publications and conference presentations. Ethical approval was obtained through the University

  8. SACS: Spitzer Archival Cluster Survey

    NASA Astrophysics Data System (ADS)

    Stern, Daniel

    combined, providing a high-purity, uniform sample. Matching the Spitzer/IRAC-selected clusters with data at similar and longer wavelengths available in the archive (WISE 3- 5μm, Spitzer/MIPS 24μm or Herschel/SPIRE 250μm data) we will be also able to study the dependence on the environment of star formation and AGN activity out to z~2, and to study the effect of star-forming galaxies and AGNs on cosmological results from ongoing Sunyaev-Zel'dovich (SZ) and X-ray cluster surveys. The identified clusters will be valuable for both astrophysics and cosmology. In terms of astrophysics, the redshift probed by the MIR color selection targets a key epoch in cluster development, when star formation is shutting down and the galaxies are becoming passive. Massive clusters also distort space-time around them, creating powerful gravitational telescopes that lens the distant universe. This both allows detailed studies of the lensed objects with otherwise unachievable sensitivity, as well as provides a unique probe of the mass distribution in the lensing cluster. In terms of cosmology, clusters are the most massive structures in the universe, and their space density is sensitive to basic cosmological parameters. Clusters identified by this program will become a lasting legacy of Spitzer, providing exciting targets for Chandra, Hubble, James Webb Space Telescope (JWST), Astro-H, Athena, as well as future 30-m class ground-based telescopes (e.g., GMT, ELT, TMT). The upcoming large-scale, space-based surveys of eROSITA, Euclid, and WFIRST all have distant cluster studies as key scientific goals. Our proposed survey will provide new high redshift targets for those satellites, enabling unique, exciting multi-wavelength studies of the Spitzer-selected sample, as well as a training set to identify additional high-redshift clusters outside of the Spitzer footprint.

  9. Synthesis of the Stereoisomeric Clusters 1,2-Os3(CO)10(trans-dpmn) and 1,2-Os3(CO)10(cis-dpmn) [where dpmn = 2,3-bis(diphenylphosphinomethyl)-5-norbornene]: DFT Evaluation of the Isomeric Clusters 1,2-Os3(CO)10(dpmn) and Isomer-Dependent Diphosphine Ligand Activation

    DOE PAGESBeta

    Yang, Li; Nesterov, Vladimir N.; Wang, Xiaoping; Richmond, Michael G.

    2014-07-23

    The bicyclic diphosphines trans- and cis-2,3-bis(diphenylphosphinomethyl)-5-norbornene (dpmn) react with 1,2-Os3(CO)10(MeCN)2 (1) to furnish the corresponding ligand-bridged clusters Os3(CO)10(trans-dpmn) (2) and Os3(CO)10(cis-dpmn) (3). Both new products have been isolated and the molecular structures established by X-ray diffraction analyses. The dihydroxyl-bridged cluster 1,2-Os3(CO)8(μ-OH)2(cis-dpmn) (4), which accompanied the formation of 3 in one reaction, has been isolated and characterized by mass spectrometry and X-ray crystallography. Whereas cluster 2 is stable in toluene at 373 K, 3 is thermally sensitive under identical conditions and undergoes loss of CO (2 equiv), coupled with the activation of three norbornene C-H bonds and one P-C(phenyl) bond, tomore » furnish the dihydride cluster H2Os3(CO)8[μ3-2-PhPC-3-endo-Ph2PCH2(C7H7)] (5). The solid-state structure of 5 confirms the multiple activation of the cis-dpmn ligand and accompanying formation of the face-capping 2-PhPC-3-endo-Ph2PCH2(C7H7) moiety in the product. DFT calculations on 2 and 3 indicate that the former cluster is the thermodynamically more stable isomer, and the conversion of 3→ 5 + 2CO + benzene is computed to be exergonic by 12.7 kcal/mol and is entropically favored due to the release of the CO and benzene by-products.« less

  10. Partial activation of gene activity and chromatin remodeling of the human 14q32.1 serpin gene cluster by HNF-1 alpha and HNF-4 in fibroblast microcell hybrids.

    PubMed

    Rollini, P; Xu, L; Fournier, R E

    1999-07-01

    The genes encoding alpha 1-antitrypsin (alpha 1AT, gene symbol P I) and corticosteroid-binding globulin (CBG) are part of a cluster of serine protease inhibitor (serpin) genes on human chromosome 14q32.1. Both genes are highly expressed in the liver and in cultured hepatoma cells, and the approximately 100-kb region around these genes contains an extensive array of expression-associated DNase I-hypersensitive sites (DHSs). Activation of human alpha 1AT and CBG transcription occurred when human chromosome 14 was transferred from nonexpressing cells to rat hepatoma cells. This activation event was accompanied by long-range chromatin reorganization of the entire region and the de novo formation of 17 expression-associated DHSs. Both gene activation and chromatin remodeling in hepatic cells required the liver-enriched transactivators hepatocyte nuclear factors-1 alpha and -4 (HNF-1 alpha and HNF-4). In this study, we tested whether ectopic expression of HNF-1 alpha and HNF-4 in nonexpressing cells could activate alpha 1AT and/or CBG transcription, and we monitored the chromatin structure of the locus in stably transfected fibroblasts. We report that both alpha 1AT and CBG mRNAs were expressed in fibroblast transfectants that stably expressed HNF-1 alpha and HNF-4, but expression was only approximately 1-10% of that observed in hepatic cells. Gene activation in these cells was accompanied by partial chromatin remodeling, as 6 of 17 expression-associated DHSs were formed. The potential implications of these results are discussed. PMID:11586788

  11. Collective thermoregulation in bee clusters.

    PubMed

    Ocko, Samuel A; Mahadevan, L

    2014-02-01

    Swarming is an essential part of honeybee behaviour, wherein thousands of bees cling onto each other to form a dense cluster that may be exposed to the environment for several days. This cluster has the ability to maintain its core temperature actively without a central controller. We suggest that the swarm cluster is akin to an active porous structure whose functional requirement is to adjust to outside conditions by varying its porosity to control its core temperature. Using a continuum model that takes the form of a set of advection-diffusion equations for heat transfer in a mobile porous medium, we show that the equalization of an effective 'behavioural pressure', which propagates information about the ambient temperature through variations in density, leads to effective thermoregulation. Our model extends and generalizes previous models by focusing the question of mechanism on the form and role of the behavioural pressure, and allows us to explain the vertical asymmetry of the cluster (as a consequence of buoyancy-driven flows), the ability of the cluster to overpack at low ambient temperatures without breaking up at high ambient temperatures, and the relative insensitivity to large variations in the ambient temperature. Our theory also makes testable hypotheses for the response of the cluster to external temperature inhomogeneities and suggests strategies for biomimetic thermoregulation. PMID:24335563

  12. Collective thermoregulation in bee clusters

    PubMed Central

    Ocko, Samuel A.; Mahadevan, L.

    2014-01-01

    Swarming is an essential part of honeybee behaviour, wherein thousands of bees cling onto each other to form a dense cluster that may be exposed to the environment for several days. This cluster has the ability to maintain its core temperature actively without a central controller. We suggest that the swarm cluster is akin to an active porous structure whose functional requirement is to adjust to outside conditions by varying its porosity to control its core temperature. Using a continuum model that takes the form of a set of advection–diffusion equations for heat transfer in a mobile porous medium, we show that the equalization of an effective ‘behavioural pressure’, which propagates information about the ambient temperature through variations in density, leads to effective thermoregulation. Our model extends and generalizes previous models by focusing the question of mechanism on the form and role of the behavioural pressure, and allows us to explain the vertical asymmetry of the cluster (as a consequence of buoyancy-driven flows), the ability of the cluster to overpack at low ambient temperatures without breaking up at high ambient temperatures, and the relative insensitivity to large variations in the ambient temperature. Our theory also makes testable hypotheses for the response of the cluster to external temperature inhomogeneities and suggests strategies for biomimetic thermoregulation. PMID:24335563

  13. Electronic Origins of the Variable Efficiency of Room-Temperature Methane Activation by Homo- and Heteronuclear Cluster Oxide Cations [XYO2](+) (X, Y = Al, Si, Mg): Competition between Proton-Coupled Electron Transfer and Hydrogen-Atom Transfer.

    PubMed

    Li, Jilai; Zhou, Shaodong; Zhang, Jun; Schlangen, Maria; Weiske, Thomas; Usharani, Dandamudi; Shaik, Sason; Schwarz, Helmut

    2016-06-29

    The reactivity of the homo- and heteronuclear oxide clusters [XYO2](+) (X, Y = Al, Si, Mg) toward methane was studied using Fourier transform ion cyclotron resonance mass spectrometry, in conjunction with high-level quantum mechanical calculations. The most reactive cluster by both experiment and theory is [Al2O2](•+). In its favorable pathway, this cluster abstracts a hydrogen atom by means of proton-coupled electron transfer (PCET) instead of following the conventional hydrogen-atom transfer (HAT) route. This mechanistic choice originates in the strong Lewis acidity of the aluminum site of [Al2O2](•+), which cleaves the C-H bond heterolytically to form an Al-CH3 entity, while the proton is transferred to the bridging oxygen atom of the cluster ion. In addition, a comparison of the reactivity of heteronuclear and homonuclear oxide clusters [XYO2](+) (X, Y = Al, Si, Mg) reveals a striking doping effect by aluminum. Thus, the vacant s-p hybrid orbital on Al acts as an acceptor of the electron pair from methyl anion (CH3(-)) and is therefore eminently important for bringing about thermal methane activation by PCET. For the Al-doped cluster ions, the spin density at an oxygen atom, which is crucial for the HAT mechanism, acts here as a spectator during the course of the PCET mediated C-H bond cleavage. A diagnostic plot of the deformation energy vis-à-vis the barrier shows the different HAT/PCET reactivity map for the entire series. This is a strong connection to the recently discussed mechanism of oxidative coupling of methane on magnesium oxide surfaces proceeding through Grignard-type intermediates. PMID:27241233

  14. Energy Balance in Clusters of Galaxies

    NASA Astrophysics Data System (ADS)

    Motl, P. M.; Burns, J. M.

    2005-04-01

    We review different physical mechanisms that are likely to play a significant role in determining the detailed thermal state of gas in clusters of galaxies. Mergers are the dominant process impacting clusters and these collisions significantly perturb the cluster state. The continual loss of energy from the gas to radiation must also be accounted for and cooling gas can drive several positive feedback mechanisms. From simple energy arguments, AGN are likely to make a significant contribution to balance the energy lost from cluster cores. We also explore additional positive feedback mechanisms including supernovae feedback and thermal conduction. If AGN are the sole feedback mechanism, what are to be made of clusters that lack evidence for AGN activity yet have canonical cool cores? As cluster samples with high-resolution X-ray data grow larger, it is likely to be the properties of relaxed, cool-core clusters that will be the best guides to numerical simulations.

  15. Effects of a Clinician Referral and Exercise Program for Men Who Have Completed Active Treatment for Prostate Cancer: A Multicenter Cluster Randomized Controlled Trial (ENGAGE)

    PubMed Central

    Livingston, Patricia M; Craike, Melinda J; Salmon, Jo; Courneya, Kerry S; Gaskin, Cadeyrn J; Fraser, Steve F; Mohebbi, Mohammadreza; Broadbent, Suzanne; Botti, Mari; Kent, Bridie

    2015-01-01

    BACKGROUND The purpose of this study was to determine the efficacy of a clinician referral and exercise program in improving exercise levels and quality of life for men with prostate cancer. METHODS This was a multicenter cluster randomized controlled trial in Melbourne, Australia comprising 15 clinicians: 8 clinicians were randomized to refer eligible participants (n = 54) to a 12-week exercise program comprising 2 supervised gym sessions and 1 home-based session per week, and 7 clinicians were randomized to follow usual care (n = 93). The primary outcome was self-reported physical activity; the secondary outcomes were quality of life, anxiety, and symptoms of depression. RESULTS A significant intervention effect was observed for vigorous-intensity exercise (effect size: Cohen's d, 0.46; 95% confidence interval [CI], 0.09-0.82; P = .010) but not for combined moderate and vigorous exercise levels (effect size: d, 0.08; 95% CI, −0.28 to 0.45; P = .48). Significant intervention effects were also observed for meeting exercise guidelines (≥150 min/wk; odds ratio, 3.9; 95% CI, 1.9-7.8; P = .002); positive intervention effects were observed in the intervention group for cognitive functioning (effect size: d, 0.34; 95% CI, −0.02 to 0.70; P = .06) and depression symptoms (effect size: d, −0.35; 95% CI, −0.71 to 0.02; P = .06). Eighty percent of participants reported that the clinician's referral influenced their decision to participate in the exercise program. CONCLUSIONS The clinician referral and 12-week exercise program significantly improved vigorous exercise levels and had a positive impact on mental health outcomes for men living with prostate cancer. Further research is needed to determine the sustainability of the exercise program and its generalizability to other cancer populations. Cancer 2015;121:2646–2654. © 2015 American Cancer Society. PMID:25877784

  16. A New Mother-Child Play Activity Program to Decrease Parenting Stress and Improve Child Cognitive Abilities: A Cluster Randomized Controlled Trial

    PubMed Central

    Tachibana, Yoshiyuki; Fukushima, Ai; Saito, Hitomi; Yoneyama, Satoshi; Ushida, Kazuo; Yoneyama, Susumu; Kawashima, Ryuta

    2012-01-01

    Background We propose a new play activity intervention program for mothers and children. Our interdisciplinary program integrates four fields of child-related sciences: neuroscience, preschool pedagogy, developmental psychology, and child and maternal psychiatry. To determine the effect of this intervention on child and mother psychosocial problems related to parenting stress and on the children's cognitive abilities, we performed a cluster randomized controlled trial. Methodology/Principal Findings Participants were 238 pairs of mothers and typically developing preschool children (ages 4–6 years old) from Wakakusa kindergarten in Japan. The pairs were asked to play at home for about 10 min a day, 5 days a week for 3 months. Participants were randomly assigned to the intervention or control group by class unit. The Parenting Stress Index (PSI) (for mothers), the Goodenough Draw-a-Man intelligence test (DAM), and the new S-S intelligence test (NS-SIT) (for children) were administered prior to and 3 months after the intervention period. Pre–post changes in test scores were compared between the groups using a linear mixed-effects model analysis. The primary outcomes were the Total score on the child domain of the PSI (for child psychosocial problems related to parenting stress), Total score on the parent domain of the PSI (for maternal psychosocial problems related to parenting stress), and the score on the DAM (for child cognitive abilities). The results of the PSI suggested that the program may reduce parenting stress. The results of the cognitive tests suggested that the program may improve the children's fluid intelligence, working memory, and processing speed. Conclusions/Significance Our intervention program may ameliorate the children's psychosocial problems related to parenting stress and increase their cognitive abilities. Trial Registration UMIN Clinical Trials Registry UMIN000002265 PMID:22848340

  17. The dance of heating and cooling in galaxy clusters: three-dimensional simulations of self-regulated active galactic nuclei outflows

    NASA Astrophysics Data System (ADS)

    Gaspari, M.; Melioli, C.; Brighenti, F.; D'Ercole, A.

    2011-02-01

    It is now widely accepted that heating processes play a fundamental role in galaxy clusters, struggling in an intricate but fascinating ‘dance' with its antagonist, radiative cooling. Last-generation observations, especially X-ray, are giving us tiny hints about the notes of this endless ballet. Cavities, shocks, turbulence and wide absorption lines indicate that the central active nucleus is injecting a huge amount of energy in the intracluster medium. However, which is the real dominant engine of self-regulated heating? One of the models we propose is massive subrelativistic outflows, probably generated by a wind disc or just the result of the entrainment on kpc scale by the fast radio jet. Using a modified version of the adaptive mesh refinement code FLASH 3.2, we have explored several feedback mechanisms that self-regulate the mechanical power. Two are the best schemes that answer our primary question, that is, quenching cooling flow and at the same time preserving a cool core appearance for a long-term evolution (7 Gyr): one is more explosive (with efficiencies ˜ 5 × 10-3-10-2), triggered by central cooled gas, and the other is gentler, ignited by hot gas Bondi accretion (with ɛ= 0.1). These three-dimensional simulations show that the total energy injected is not the key aspect, but the results strongly depend on how energy is given to the intracluster medium. We follow the dynamics of the best models (temperature, density, surface brightness maps and profiles) and produce many observable predictions: buoyant bubbles, ripples, turbulence, iron abundance maps and hydrostatic equilibrium deviation. We present an in-depth discussion of the merits and flaws of all our models, with a critical eye towards observational concordance.

  18. Cluster headache

    MedlinePlus

    ... may be triggered by: Alcohol and cigarette smoking High altitudes (trekking and air travel) Bright light (including sunlight) Exertion (physical activity) Heat (hot weather or hot baths) Foods high in nitrites (bacon and preserved meats) Certain medicines ...

  19. Astrophysics of galaxy clusters

    NASA Astrophysics Data System (ADS)

    Ettori, Stefano

    2016-07-01

    As the nodes of the cosmic web, clusters of galaxies trace the large-scale distribution of matter in the Universe. They are thus privileged sites in which to investigate the complex physics of structure formation. However, the complete story of how these structures grow, and how they dissipate the gravitational and non-thermal components of their energy budget over cosmic time, is still beyond our grasp. Most of the baryons gravitationally bound to the cluster's halo is in the form of a diffuse, hot, metal-enriched plasma that radiates primarily in the X-ray band. X-ray observations of the evolving cluster population provide a unique opportunity to address such fundamental open questions as: How do hot diffuse baryons accrete and dynamically evolve in dark matter potentials? How and when was the energy that we observe in the ICM generated and distributed? Where and when are heavy elements produced and how are they circulated? We will present the ongoing activities to define the strategy on how an X-ray observatory with large collecting area and an unprecedented combination of high spectral and angular resolution, such as Athena, can address these questions.

  20. Cluster galaxies die hard

    NASA Astrophysics Data System (ADS)

    Weinmann, Simone M.; Kauffmann, Guinevere; von der Linden, Anja; De Lucia, Gabriella

    2010-08-01

    We investigate how the specific star formation rates of galaxies of different masses depend on cluster-centric radius and on the central/satellite dichotomy in both field and cluster environments. Recent data from a variety of sources, including the cluster catalogue of von der Linden et al., are compared to the semi-analytic models of De Lucia & Blaizot. We find that these models predict too many passive satellite galaxies in clusters, too few passive central galaxies with low stellar masses and too many passive central galaxies with high masses. We then outline a series of modifications to the model necessary to solve these problems: (a) instead of instantaneous stripping of the external gas reservoir after a galaxy becomes a satellite, the gas supply is assumed to decrease at the same rate that the surrounding halo loses mass due to tidal stripping and (b) the active galactic nuclei (AGN) feedback efficiency is lowered to bring the fraction of massive passive centrals in better agreement with the data. We also allow for radio mode AGN feedback in satellite galaxies. (c) We assume that satellite galaxies residing in host haloes with masses below 1012h-1Msolar do not undergo any stripping. We highlight the fact that in low-mass galaxies, the external reservoir is composed primarily of gas that has been expelled from the galactic disc by supernovae-driven winds. This gas must remain available as a future reservoir for star formation, even in satellite galaxies. Finally, we present a simple recipe for the stripping of gas and dark matter in satellites that can be used in models where subhalo evolution is not followed in detail.

  1. GSFC Contributions to the NATO X-ray Astronomy Institute, Erice, July 1979. [X-ray spectra of supernova remants, galactic X-ray sources, active galactic nuclei, and clusters of galaxies

    NASA Technical Reports Server (NTRS)

    Holt, S. S.; Mushotzky, R. F.

    1979-01-01

    An overview of X-ray astronomical spectroscopy in general is presented and results obtained by HEAO 1 and 2 as well as earlier spacecraft are examined. Particular emphasis is given to the spectra of supernova remnants; galactic binary X-ray sources, cataclysmic variables, bulges, pulsars, and stars; the active nuclei of Seyfert 1 galaxy, BL Lac, and quasars; the diffuse X-ray background; and galactic clusters.

  2. A cluster-randomized controlled trial to reduce sedentary behavior and promote physical activity and health of 8-9 year olds: The Transform-Us! Study

    PubMed Central

    2011-01-01

    Background Physical activity (PA) is associated with positive cardio-metabolic health and emerging evidence suggests sedentary behavior (SB) may be detrimental to children's health independent of PA. The primary aim of the Transform-Us! study is to determine whether an 18-month, behavioral and environmental intervention in the school and family settings results in higher levels of PA and lower rates of SB among 8-9 year old children compared with usual practice (post-intervention and 12-months follow-up). The secondary aims are to determine the independent and combined effects of PA and SB on children's cardio-metabolic health risk factors; identify the factors that mediate the success of the intervention; and determine whether the intervention is cost-effective. Methods/design A four-arm cluster-randomized controlled trial (RCT) with a 2 × 2 factorial design, with schools as the unit of randomization. Twenty schools will be allocated to one of four intervention groups, sedentary behavior (SB-I), physical activity (PA-I), combined SB and PA (SB+PA-I) or current practice control (C), which will be evaluated among approximately 600 children aged 8-9 years in school year 3 living in Melbourne, Australia. All children in year 3 at intervention schools in 2010 (8-9 years) will receive the intervention over an 18-month period with a maintenance 'booster' delivered in 2012 and children at all schools will be invited to participate in the evaluation assessments. To maximize the sample and to capture new students arriving at intervention and control schools, recruitment will be on-going up to the post-intervention time point. Primary outcomes are time spent sitting and in PA assessed via accelerometers and inclinometers and survey. Discussion To our knowledge, Transform-Us! is the first RCT to examine the effectiveness of intervention strategies for reducing children's overall sedentary time, promoting PA and optimizing health outcomes. The integration of consistent

  3. A novel hexanuclear titanium(iv)-oxo-iminodiacetate cluster with a Ti6O9 core: single-crystal structure and photocatalytic activities.

    PubMed

    Ni, Lubin; Liang, Dashuai; Cai, Yin; Diao, Guowang; Zhou, Zhaohui

    2016-05-01

    A new family of hexanuclear titanium(iv)-oxo-carboxylate cluster K7H[Ti6O9(ida)6]Cl2·13H2O {Ti6O9} has been synthesized via the H2O2-assisted reaction between TiCl4 and iminodiacetate ligands. This cluster was fully characterized by single-crystal X-ray diffraction and a wide range of analytical methods, including FT-IR, UV/vis spectroscopy as well as electrochemistry and thermogravimetric analysis. As a new type of carboxylate substituted Ti-oxo-cluster, the structural motif of the {Ti6O9} cluster consists of one symmetric {Ti6O6} hexagonal prism with two staggered triangular {Ti3O3} subunits linked by three μ2-O bridges. The {Ti6O9} polyanions are linked by K(+) cations to form a novel 3D architecture. The structural information and stability of the {Ti6O9} polyanion in aqueous solution were thoroughly investigated by solid-state/solution NMR, ESI-MS spectroscopy. Moreover, this Ti-oxo cluster exhibits remarkable potential as a visible-light homogeneous photocatalyst for degradation of rhodamine B (RhB). Finally, a proposed peroxotitanium(iv)-mediated photocatalytic pathway involved is illustrated by spectroscopic data. PMID:26857945

  4. Foodservice Occupations Cluster Guide.

    ERIC Educational Resources Information Center

    Oregon State Dept. of Education, Salem.

    Intended to assist vocational teachers in developing and implementing a cluster program in food service occupations, this guide contains sections on cluster organization and implementation and instructional emphasis areas. The cluster organization and implementation section covers goal-based planning and includes a proposed cluster curriculum, a…

  5. Cluster-impact fusion

    SciTech Connect

    Echenique, P.M.; Manson, J.R.; Ritchie, R.H. )

    1990-03-19

    We present a model for the cluster-impact-fusion experiments of Buehler, Friedlander, and Friedman, Calculated fusion rates as a function of bombarding energy for constant cluster size agree well with experiment. The dependence of the fusion rate on cluster size at fixed bombarding energy is explained qualitatively. The role of correlated, coherent collisions in enhanced energy loss by clusters is emphasized.

  6. Identification of Urban Leprosy Clusters

    PubMed Central

    Paschoal, José Antonio Armani; Paschoal, Vania Del'Arco; Nardi, Susilene Maria Tonelli; Rosa, Patrícia Sammarco; Ismael, Manuela Gallo y Sanches; Sichieri, Eduvaldo Paulo

    2013-01-01

    Overpopulation of urban areas results from constant migrations that cause disordered urban growth, constituting clusters defined as sets of people or activities concentrated in relatively small physical spaces that often involve precarious conditions. Aim. Using residential grouping, the aim was to identify possible clusters of individuals in São José do Rio Preto, Sao Paulo, Brazil, who have or have had leprosy. Methods. A population-based, descriptive, ecological study using the MapInfo and CrimeStat techniques, geoprocessing, and space-time analysis evaluated the location of 425 people treated for leprosy between 1998 and 2010. Clusters were defined as concentrations of at least 8 people with leprosy; a distance of up to 300 meters between residences was adopted. Additionally, the year of starting treatment and the clinical forms of the disease were analyzed. Results. Ninety-eight (23.1%) of 425 geocoded cases were located within one of ten clusters identified in this study, and 129 cases (30.3%) were in the region of a second-order cluster, an area considered of high risk for the disease. Conclusion. This study identified ten clusters of leprosy cases in the city and identified an area of high risk for the appearance of new cases of the disease. PMID:24288467

  7. A Hierarchical Clustering Methodology for the Estimation of Toxicity

    EPA Science Inventory

    A Quantitative Structure Activity Relationship (QSAR) methodology based on hierarchical clustering was developed to predict toxicological endpoints. This methodology utilizes Ward's method to divide a training set into a series of structurally similar clusters. The structural sim...

  8. Experiments on clustered neuronal networks

    NASA Astrophysics Data System (ADS)

    Teller, S.; Soriano, J.

    2013-01-01

    Neuronal cultures show a rich repertoire of spontaneous activity. However, the mechanisms that relate a particular network architecture with a specific dynamic behavior are still not well understood. In order to investigate the dependence of neuronal network dynamics on architecture we study spontaneous activity in networks formed by interconnected aggregates of neurons (clustered neuronal networks). In the experiments we monitor the spontaneous activity using calcium fluorescence imaging. Network's firing is characterized by bursts of activity, in which the clusters fire sequentially in a short time window, remaining silent until the next bursting episode. We also investigate perturbations on the connectivity of the network. We mainly focus in physical damage. In some cases we observe important changes in the collective activity of the network, while in other cases some dynamic motifs are preserved, hinting at the existence of dynamic robustness.

  9. Activating GENeral practitioners dialogue with patients on their Agenda (MultiCare AGENDA) study protocol for a cluster randomized controlled trial

    PubMed Central

    2012-01-01

    Background This study investigates the efficacy of a complex multifaceted intervention aiming at increasing the quality of care of GPs for patients with multimorbidity. In its core, the intervention aims at enhancing the doctor-patient-dialogue and identifying the patient’s agenda and needs. Also, a medication check is embedded. Our primary hypothesis is that a more patient-centred communication will reduce the number of active pharmaceuticals taken without impairing the patients’ quality of life. Secondary hypotheses include a better knowledge of GPs about their patients’ medication, a higher patient satisfaction and a more effective and/or efficient health care utilization. Methods/design Multi-center, parallel group, cluster randomized controlled clinical trial in GP surgeries. Inclusion criteria: Patients aged 65–84 years with at least 3 chronic conditions. Intervention: GPs allocated to this group will receive a multifaceted educational intervention on performing a narrative doctor-patient dialogue reflecting treatment targets and priorities of the patient and on performing a narrative patient-centred medication review. During the one year intervention GPs will have a total of three conversations à 30 minutes with the enrolled patients. Control: Care as usual. Follow-up per patient: 14 months after baseline interview. Primary efficacy endpoints: Differences in medication intake and health related quality of life between baseline and follow-up in the intervention compared to the control group. Randomization: Computer-generated by an independent institute. It will be performed successively when patient recruitment in the respective surgery is finished. Blinding: Participants (GPs and patients) will not be blinded to their assignment but will be unaware of the study hypotheses or outcome measures. Discussion There is growing evidence that the phenomenon of polypharmacy and low quality of drug use is substantially due to mis-communication (or non

  10. A multi-wavelength census of star formation activity in the young embedded cluster around Serpens/G3-G6

    NASA Astrophysics Data System (ADS)

    Djupvik, A. A.; André, Ph.; Bontemps, S.; Motte, F.; Olofsson, G.; Gålfalk, M.; Florén, H.-G.

    2006-11-01

    Aims.The aim of this paper is to characterise the star formation activity in the poorly studied embedded cluster Serpens/G3-G6, located ~45 arcmin (3 pc) to the south of the Serpens Cloud Core, and to determine the luminosity and mass functions of its population of Young Stellar Objects (YSOs). Methods: .Multi-wavelength broadband photometry was obtained to sample the near and mid-IR spectral energy distributions to separate YSOs from field stars and classify the YSO evolutionary stage. ISOCAM mapping in the two filters LW2 (5-8.5 μm) and LW3 (12-18 μm) of a 19 arcmin × 16 arcmin field was combined with JHKS data from 2MASS, KS data from Arnica/NOT, and L arcmin data from SIRCA/NOT. Continuum emission at 1.3 mm (IRAM) and 3.6 cm (VLA) was mapped to study the cloud structure and the coldest/youngest sources. Deep narrow band imaging at the 2.12 μm S(1) line of H2 from NOTCam/NOT was obtained to search for signs of bipolar outflows. Results: .We have strong evidence for a stellar population of 31 Class II sources, 5 flat-spectrum sources, 5 Class I sources, and two Class 0 sources. Our method does not sample the Class III sources. The cloud is composed of two main dense clumps aligned along a ridge over ~0.5 pc plus a starless core coinciding with absorption features seen in the ISOCAM maps. We find two S-shaped bipolar collimated flows embedded in the NE clump, and propose the two driving sources to be a Class 0 candidate (MMS3) and a double Class I (MMS2). For the Class II population we find a best age of ~2 Myr and compatibility with recent Initial Mass Functions (IMFs) by comparing the observed Class II luminosity function (LF), which is complete to 0.08 L⊙, to various model LFs with different star formation scenarios and input IMFs.

  11. Synthesis of the First Example of the 12-Vertex-closo/12-Vertex-nido Biscarborane Cluster by a Metal-Free B-H Activation at a Phosphorus(III) Center.

    PubMed

    Wong, Yuen Onn; Smith, Mark D; Peryshkov, Dmitry V

    2016-05-10

    An unusual 12-vertex-closo-C2 B10 /12-vertex-nido-C2 B10 biscarborane cluster was synthesized through an unprecedented regioselective metal-free B-H activation by a sterically hindered P(III) center under mild conditions accompanied by cage-opening rearrangement. A combination of the electron-accepting properties of a carborane cage and steric enforcement of close interatomic contacts represent a new synthetic strategy for the activation of strong B-H bonds in carboranes. PMID:26990216

  12. N-O versus N-N bond activation in reaction of N2O with carbon cluster ions: Experimental and ab initio studies of the effects of geometric and electronic structure

    NASA Astrophysics Data System (ADS)

    Resat, Marianne Sowa; Smolanoff, Jason N.; Goldman, Ilyse B.; Anderson, Scott L.

    1994-06-01

    We report a combined experimental and theoretical study of the reaction of small carbon cluster cations with N2O aimed at understanding the reaction mechanism and how it is affected by the electronic and geometric structure of the C+n reactants. Cross sections for reaction of C+n (n=3-12) with N2O were measured over a collision energy range from 0.1-10 eV, using a guided ion beam tandem mass spectrometer. Ab initio calculations were used to examine the structure and energetics of reactant and product species. Small clusters, which are linear, react with no activation barrier, resulting in either oxide or nitride formation. The branching between oxide and nitride channels shows a strong even-odd alternation, with even clusters preferentially forming nitrides. This appears to be correlated with an even/odd alternation in the ionization potential of the CnN. The larger, monocyclic C+n have activation barriers for reaction, and a completely different product distribution. Secondary reactions of the primary oxide and nitride products were studied at high N2O pressures. Products containing two O or two N atoms are not observed, but it is possible to add one of each. Possible reaction mechanisms are discussed and supported by thermochemistry derived from spin restricted ab initio calculations.

  13. Semantic Clustering of Search Engine Results

    PubMed Central

    Soliman, Sara Saad; El-Sayed, Maged F.; Hassan, Yasser F.

    2015-01-01

    This paper presents a novel approach for search engine results clustering that relies on the semantics of the retrieved documents rather than the terms in those documents. The proposed approach takes into consideration both lexical and semantics similarities among documents and applies activation spreading technique in order to generate semantically meaningful clusters. This approach allows documents that are semantically similar to be clustered together rather than clustering documents based on similar terms. A prototype is implemented and several experiments are conducted to test the prospered solution. The result of the experiment confirmed that the proposed solution achieves remarkable results in terms of precision. PMID:26933673

  14. Stellar Snowflake Cluster

    NASA Technical Reports Server (NTRS)

    2005-01-01

    [figure removed for brevity, see original site] Figure 1 Stellar Snowflake Cluster Combined Image [figure removed for brevity, see original site] Figure 2 Infrared Array CameraFigure 3 Multiband Imaging Photometer

    Newborn stars, hidden behind thick dust, are revealed in this image of a section of the Christmas Tree cluster from NASA's Spitzer Space Telescope, created in joint effort between Spitzer's infrared array camera and multiband imaging photometer instruments.

    The newly revealed infant stars appear as pink and red specks toward the center of the combined image (fig. 1). The stars appear to have formed in regularly spaced intervals along linear structures in a configuration that resembles the spokes of a wheel or the pattern of a snowflake. Hence, astronomers have nicknamed this the 'Snowflake' cluster.

    Star-forming clouds like this one are dynamic and evolving structures. Since the stars trace the straight line pattern of spokes of a wheel, scientists believe that these are newborn stars, or 'protostars.' At a mere 100,000 years old, these infant structures have yet to 'crawl' away from their location of birth. Over time, the natural drifting motions of each star will break this order, and the snowflake design will be no more.

    While most of the visible-light stars that give the Christmas Tree cluster its name and triangular shape do not shine brightly in Spitzer's infrared eyes, all of the stars forming from this dusty cloud are considered part of the cluster.

    Like a dusty cosmic finger pointing up to the newborn clusters, Spitzer also illuminates the optically dark and dense Cone nebula, the tip of which can be seen towards the bottom left corner of each image.

    This combined image shows the presence of organic molecules mixed with dust as wisps of green, which have been illuminated by nearby star formation. The larger yellowish dots neighboring the baby red stars in the Snowflake Cluster are massive stellar infants forming

  15. Survey on granularity clustering.

    PubMed

    Ding, Shifei; Du, Mingjing; Zhu, Hong

    2015-12-01

    With the rapid development of uncertain artificial intelligent and the arrival of big data era, conventional clustering analysis and granular computing fail to satisfy the requirements of intelligent information processing in this new case. There is the essential relationship between granular computing and clustering analysis, so some researchers try to combine granular computing with clustering analysis. In the idea of granularity, the researchers expand the researches in clustering analysis and look for the best clustering results with the help of the basic theories and methods of granular computing. Granularity clustering method which is proposed and studied has attracted more and more attention. This paper firstly summarizes the background of granularity clustering and the intrinsic connection between granular computing and clustering analysis, and then mainly reviews the research status and various methods of granularity clustering. Finally, we analyze existing problem and propose further research. PMID:26557926

  16. Cluster Morphology Analysis

    PubMed Central

    Jacquez, Geoffrey M.

    2009-01-01

    Most disease clustering methods assume specific shapes and do not evaluate statistical power using the applicable geography, at-risk population, and covariates. Cluster Morphology Analysis (CMA) conducts power analyses of alternative techniques assuming clusters of different relative risks and shapes. Results are ranked by statistical power and false positives, under the rationale that surveillance should (1) find true clusters while (2) avoiding false clusters. CMA then synthesizes results of the most powerful methods. CMA was evaluated in simulation studies and applied to pancreatic cancer mortality in Michigan, and finds clusters of flexible shape while routinely evaluating statistical power. PMID:20234799

  17. Universal Cluster Deposition System

    NASA Astrophysics Data System (ADS)

    Qiang, You; Sun, Zhiguang; Sellmyer, David J.

    2001-03-01

    We have developed a universal cluster deposition system (UCDS), which combines a new kind of sputtering-gas-aggregation (SGA) cluster beam source with two atom beams from magnetron sputtering. A highly intense, very stable beam of nanoclusters (like Co, Fe, Ni, Si, CoSm or CoPt) are produced. A quadrupole and/or a new high transmission infinite range mass selector have been designed for the cluster beam. The size distribution (Δd/d) is between 0.05+/-0.10, measured in situ by TOF. A range of mean cluster size is 2 to 10 nm. Usually the deposition rate is about 5 deg/s. The cluster concentration in the film is adjusted through the ratio of cluster and atomic beam deposition rates, as measured in situ with a rotatable quartz microbalance. The UCDS can be used to prepare coated clusters. After exiting from the cluster source, the clusters can be coated first with an atomic or molecular species in an evaporation chamber, and deposited alone or co-deposited with another material. This system is used to deposit simultaneously or alternately mesoscopic thin films or multilayers, and offers the possibility to control independently the incident cluster size and concentration, and thereby the interaction between clusters and cluster-matrix material which is of interest for fundamental research and industry applications. Magnetic properties of Co cluster-assembled materials will be discussed. * Research supported by NSF, DARPA through ARO, and CMRA

  18. Cluster headache management and beyond.

    PubMed

    Martelletti, Paolo

    2015-01-01

    The therapeutic management of cluster headache is based on a very stable triad of drugs. Acute treatment has, in subcutaneous sumatriptan, its gold standard if compared to pure oxygen or indomethacin. Preventative treatment is based on verapamil at high doses (≥ 360 mg) and is a gold standard if compared to lithium carbonate or topiramate. Transitional treatments, based on the short-term use of corticosteroids with either systemic or local administration (GON), can be useful for the suppression of most resistant cluster periods, but with a well-known carry-over phenomenon related to the length of the cluster period itself. The role of invasive or noninvasive neuromodulation approaches must still be determined on a large scale; therefore, its use is not recommended as of yet. Lifestyle changes, including alcohol avoidance during the active phase of the disease, sleep hygiene and use of vasodilation drugs, should be carefully considered and the patients should be fully informed. PMID:26027515

  19. The Two Stem Cell MicroRNA Gene Clusters C19MC and miR-371-3 Are Activated by Specific Chromosomal Rearrangements in a Subgroup of Thyroid Adenomas

    PubMed Central

    Rippe, Volkhard; Dittberner, Lea; Lorenz, Verena N.; Drieschner, Norbert; Nimzyk, Rolf; Sendt, Wolfgang; Junker, Klaus; Belge, Gazanfer; Bullerdiek, Jörn

    2010-01-01

    Thyroid adenomas are common benign human tumors with a high prevalence of about 5% of the adult population even in iodine sufficient areas. Rearrangements of chromosomal band 19q13.4 represent a frequent clonal cytogenetic deviation in these tumors making them the most frequent non-random chromosomal translocations in human epithelial tumors at all. Two microRNA (miRNA) gene clusters i.e. C19MC and miR-371-3 are located in close proximity to the breakpoint region of these chromosomal rearrangements and have been checked for a possible up-regulation due to the genomic alteration. In 4/5 cell lines established from thyroid adenomas with 19q13.4 rearrangements and 5/5 primary adenomas with that type of rearrangement both the C19MC and miR-371-3 cluster were found to be significantly overexpressed compared to controls lacking that particular chromosome abnormality. In the remaining cell line qRT-PCR revealed overexpression of members of the miR-371-3 cluster only which might be due to a deletion accompanying the chromosomal rearrangement in that case. In depth molecular characterization of the breakpoint in a cell line from one adenoma of this type reveals the existence of large Pol-II mRNA fragments as the most likely source of up-regulation of the C19MC cluster. The up-regulation of the clusters is likely to be causally associated with the pathogenesis of the corresponding tumors. Of note, the expression of miRNAs miR-520c and miR-373 is known to characterize stem cells and in terms of molecular oncology has been implicated in invasive growth of epithelial cells in vitro and in vivo thus allowing to delineate a distinct molecular subtype of thyroid adenomas. Besides thyroid adenomas rearrangements of 19q13.4 are frequently found in other human neoplasias as well, suggesting that activation of both clusters might be a more general phenomenon in human neoplasias. PMID:20209130

  20. Weighted voting-based consensus clustering for chemical structure databases.

    PubMed

    Saeed, Faisal; Ahmed, Ali; Shamsir, Mohd Shahir; Salim, Naomie

    2014-06-01

    The cluster-based compound selection is used in the lead identification process of drug discovery and design. Many clustering methods have been used for chemical databases, but there is no clustering method that can obtain the best results under all circumstances. However, little attention has been focused on the use of combination methods for chemical structure clustering, which is known as consensus clustering. Recently, consensus clustering has been used in many areas including bioinformatics, machine learning and information theory. This process can improve the robustness, stability, consistency and novelty of clustering. For chemical databases, different consensus clustering methods have been used including the co-association matrix-based, graph-based, hypergraph-based and voting-based methods. In this paper, a weighted cumulative voting-based aggregation algorithm (W-CVAA) was developed. The MDL Drug Data Report (MDDR) benchmark chemical dataset was used in the experiments and represented by the AlogP and ECPF_4 descriptors. The results from the clustering methods were evaluated by the ability of the clustering to separate biologically active molecules in each cluster from inactive ones using different criteria, and the effectiveness of the consensus clustering was compared to that of Ward's method, which is the current standard clustering method in chemoinformatics. This study indicated that weighted voting-based consensus clustering can overcome the limitations of the existing voting-based methods and improve the effectiveness of combining multiple clusterings of chemical structures. PMID:24830925

  1. EINSTEIN Cluster Alignments Revisited

    NASA Astrophysics Data System (ADS)

    Chambers, S. W.; Melott, A. L.; Miller, C. J.

    2000-12-01

    We have examined whether the major axes of rich galaxy clusters tend to point (in projection) toward their nearest neighboring cluster. We used the data of Ulmer, McMillan and Kowalski, who used x-ray morphology to define position angles. Our cluster samples, with well measured redshifts and updated positions, were taken from the MX Northern Abell Cluster Survey. The usual Kolmogorov-Smirnov test shows no significant alignment signal for nonrandom angles for all separations less than 100 Mpc/h. Refining the null hypothesis, however, with the Wilcoxon rank-sum test, reveals a high confidence signal for alignment. This confidence is highest when we restrict our sample to small nearest neighbor separations. We conclude that we have identified a more powerful tool for testing cluster-cluster alignments. Moreover, there is a strong signal in the data for alignment, consistent with a picture of hierarchical cluster formation in which matter falls into clusters along large scale filamentary structures.

  2. Matlab Cluster Ensemble Toolbox

    SciTech Connect

    Sapio, Vincent De; Kegelmeyer, Philip

    2009-04-27

    This is a Matlab toolbox for investigating the application of cluster ensembles to data classification, with the objective of improving the accuracy and/or speed of clustering. The toolbox divides the cluster ensemble problem into four areas, providing functionality for each. These include, (1) synthetic data generation, (2) clustering to generate individual data partitions and similarity matrices, (3) consensus function generation and final clustering to generate ensemble data partitioning, and (4) implementation of accuracy metrics. With regard to data generation, Gaussian data of arbitrary dimension can be generated. The kcenters algorithm can then be used to generate individual data partitions by either, (a) subsampling the data and clustering each subsample, or by (b) randomly initializing the algorithm and generating a clustering for each initialization. In either case an overall similarity matrix can be computed using a consensus function operating on the individual similarity matrices. A final clustering can be performed and performance metrics are provided for evaluation purposes.

  3. Spectroscopic Studies of Abell Clusters

    NASA Astrophysics Data System (ADS)

    Way, Michael Joseph

    The objectives of this work are to use spectroscopic techniques to accurately categorize galaxies as either HII region star forming galaxies or as Active Galactic Nuclei powered via a black hole, and to use radial velocities and projected positions of galaxies in clusters to obtain the total cluster mass and its distribution. The masses and distributions compare well to X-ray mass measurements. The commonly used Dressler, A., Thompson, I. & Shectman, S. 1985, ApJ, 288, 481 technique for discriminating between Active Galactic Nuclei and HII region galaxies uses the measurement of the equivalent width of the emission lines (OII) 3727 A, H/beta, and (OIII) 5007 A. High quality spectra from 42 galaxies were taken and it is shown that their method is not capable of distinguishing between Active Galactic Nuclei and HII region galaxies. The emission line flux from H/beta, (OIII) 5007 A, (OI) 6300 A, Hα, (NII) 6583 A, and (SII) 6716+6731 A in combination with the method of Veilleux, S. & Osterbrock, D. E. 1987, ApJS, 63, 295 must be used to accurately distinguish between Active Galactic Nuclei and HII region galaxies. Galaxy radial velocities from spectroscopic data and their projected 2-D positions in clusters are used to obtain robust estimates of the total mass and mass distribution in two clusters. The total mass is calculated using the Virial theorem after removing substructure. The mass distribution is estimated via several robust statistical tests for 1-D, 2-D and 3-D structure. It is shown that the derived mass estimates agree well with those found independently from hot X-ray gas emission in clusters.

  4. LacR is a repressor of lacABCD and LacT is an activator of lacTFEG, constituting the lac gene cluster in Streptococcus pneumoniae.

    PubMed

    Afzal, Muhammad; Shafeeq, Sulman; Kuipers, Oscar P

    2014-09-01

    Comparison of the transcriptome of Streptococcus pneumoniae strain D39 grown in the presence of either lactose or galactose with that of the strain grown in the presence of glucose revealed the elevated expression of various genes and operons, including the lac gene cluster, which is organized into two operons, i.e., lac operon I (lacABCD) and lac operon II (lacTFEG). Deletion of the DeoR family transcriptional regulator lacR that is present downstream of the lac gene cluster revealed elevated expression of lac operon I even in the absence of lactose. This suggests a function of LacR as a transcriptional repressor of lac operon I, which encodes enzymes involved in the phosphorylated tagatose pathway in the absence of lactose or galactose. Deletion of lacR did not affect the expression of lac operon II, which encodes a lactose-specific phosphotransferase. This finding was further confirmed by β-galactosidase assays with PlacA-lacZ and PlacT-lacZ in the presence of either lactose or glucose as the sole carbon source in the medium. This suggests the involvement of another transcriptional regulator in the regulation of lac operon II, which is the BglG-family transcriptional antiterminator LacT. We demonstrate the role of LacT as a transcriptional activator of lac operon II in the presence of lactose and CcpA-independent regulation of the lac gene cluster in S. pneumoniae. PMID:24951784

  5. PbaR, an IclR family transcriptional activator for the regulation of the 3-phenoxybenzoate 1',2'-dioxygenase gene cluster in Sphingobium wenxiniae JZ-1T.

    PubMed

    Cheng, Minggen; Chen, Kai; Guo, Suhui; Huang, Xing; He, Jian; Li, Shunpeng; Jiang, Jiandong

    2015-12-01

    The 3-phenoxybenzoate (3-PBA) 1',2'-dioxygenase gene cluster (pbaA1A2B cluster), which is responsible for catalyzing 3-phenoxybenzoate to 3-hydroxybenzoate and catechol, is inducibly expressed in Sphingobium wenxiniae strain JZ-1(T) by its substrate 3-PBA. In this study, we identified a transcriptional activator of the pbaA1A2B cluster, PbaR, using a DNA affinity approach. PbaR is a 253-amino-acid protein with a molecular mass of 28,000 Da. PbaR belongs to the IclR family of transcriptional regulators and shows 99% identity to a putative transcriptional regulator that is located on the carbazole-degrading plasmid pCAR3 in Sphingomonas sp. strain KA1. Gene disruption and complementation showed that PbaR was essential for transcription of the pbaA1A2B cluster in response to 3-PBA in strain JZ-1(T). However, PbaR does not regulate the reductase component gene pbaC. An electrophoretic mobility shift assay and DNase I footprinting showed that PbaR binds specifically to the 29-bp motif AATAGAAAGTCTGCCGTACGGCTATTTTT in the pbaA1A2B promoter area and that the palindromic sequence (GCCGTACGGC) within the motif is essential for PbaR binding. The binding site was located between the -10 box and the ribosome-binding site (downstream of the transcriptional start site), which is distinct from the location of the binding site in previously reported IclR family transcriptional regulators. This study reveals the regulatory mechanism for 3-PBA degradation in strain JZ-1(T), and the identification of PbaR increases the variety of regulatory models in the IclR family of transcriptional regulators. PMID:26386050

  6. PbaR, an IclR Family Transcriptional Activator for the Regulation of the 3-Phenoxybenzoate 1′,2′-Dioxygenase Gene Cluster in Sphingobium wenxiniae JZ-1T

    PubMed Central

    Cheng, Minggen; Chen, Kai; Guo, Suhui; Huang, Xing; He, Jian; Li, Shunpeng

    2015-01-01

    The 3-phenoxybenzoate (3-PBA) 1′,2′-dioxygenase gene cluster (pbaA1A2B cluster), which is responsible for catalyzing 3-phenoxybenzoate to 3-hydroxybenzoate and catechol, is inducibly expressed in Sphingobium wenxiniae strain JZ-1T by its substrate 3-PBA. In this study, we identified a transcriptional activator of the pbaA1A2B cluster, PbaR, using a DNA affinity approach. PbaR is a 253-amino-acid protein with a molecular mass of 28,000 Da. PbaR belongs to the IclR family of transcriptional regulators and shows 99% identity to a putative transcriptional regulator that is located on the carbazole-degrading plasmid pCAR3 in Sphingomonas sp. strain KA1. Gene disruption and complementation showed that PbaR was essential for transcription of the pbaA1A2B cluster in response to 3-PBA in strain JZ-1T. However, PbaR does not regulate the reductase component gene pbaC. An electrophoretic mobility shift assay and DNase I footprinting showed that PbaR binds specifically to the 29-bp motif AATAGAAAGTCTGCCGTACGGCTATTTTT in the pbaA1A2B promoter area and that the palindromic sequence (GCCGTACGGC) within the motif is essential for PbaR binding. The binding site was located between the −10 box and the ribosome-binding site (downstream of the transcriptional start site), which is distinct from the location of the binding site in previously reported IclR family transcriptional regulators. This study reveals the regulatory mechanism for 3-PBA degradation in strain JZ-1T, and the identification of PbaR increases the variety of regulatory models in the IclR family of transcriptional regulators. PMID:26386050

  7. CLUSTERING OF RARE EVENTS

    EPA Science Inventory

    The clustering of cases of a rare disease is considered. The number of events observed for each unit is assumed to have a Poisson distribution, the mean of which depends upon the population size and the cluster membership of that unit. Here a cluster consists of those units that ...

  8. Bismuth(III) benzohydroxamates: powerful anti-bacterial activity against Helicobacter pylori and hydrolysis to a unique Bi34 oxido-cluster [Bi34O22(BHA)22(H-BHA)14(DMSO)6].

    PubMed

    Pathak, Amita; Blair, Victoria L; Ferrero, Richard L; Mehring, Michael; Andrews, Philip C

    2014-12-14

    Reaction of BiPh3 or Bi(O(t)Bu)3 with benzohydroxamic acid (H2-BHA) results in formation of novel mono- and di-anionic hydroxamato complexes; [Bi2(BHA)3]∞ 1, [Bi(H-BHA)3] 2, [Bi(BHA)(H-BHA)] 3, all of which display nM activity against Helicobacter pylori. Subsequent dissolution of [Bi2(BHA)3]∞ in DMSO/toluene results in hydrolysis to the first structurally authenticated {Bi34} oxido-cluster [Bi34O22(BHA)22(H-BHA)14(DMSO)6] 4. PMID:25341969

  9. Ionized cluster beam deposition

    NASA Technical Reports Server (NTRS)

    Kirkpatrick, A. R.

    1983-01-01

    Ionized Cluster Beam (ICB) deposition, a new technique originated by Takagi of Kyoto University in Japan, offers a number of unique capabilities for thin film metallization as well as for deposition of active semiconductor materials. ICB allows average energy per deposited atom to be controlled and involves impact kinetics which result in high diffusion energies of atoms on the growth surface. To a greater degree than in other techniques, ICB involves quantitative process parameters which can be utilized to strongly control the characteristics of films being deposited. In the ICB deposition process, material to be deposited is vaporized into a vacuum chamber from a confinement crucible at high temperature. Crucible nozzle configuration and operating temperature are such that emerging vapor undergoes supercondensation following adiabatic expansion through the nozzle.

  10. Quantum Monte Carlo methods and lithium cluster properties. [Atomic clusters

    SciTech Connect

    Owen, R.K.

    1990-12-01

    Properties of small lithium clusters with sizes ranging from n = 1 to 5 atoms were investigated using quantum Monte Carlo (QMC) methods. Cluster geometries were found from complete active space self consistent field (CASSCF) calculations. A detailed development of the QMC method leading to the variational QMC (V-QMC) and diffusion QMC (D-QMC) methods is shown. The many-body aspect of electron correlation is introduced into the QMC importance sampling electron-electron correlation functions by using density dependent parameters, and are shown to increase the amount of correlation energy obtained in V-QMC calculations. A detailed analysis of D-QMC time-step bias is made and is found to be at least linear with respect to the time-step. The D-QMC calculations determined the lithium cluster ionization potentials to be 0.1982(14) (0.1981), 0.1895(9) (0.1874(4)), 0.1530(34) (0.1599(73)), 0.1664(37) (0.1724(110)), 0.1613(43) (0.1675(110)) Hartrees for lithium clusters n = 1 through 5, respectively; in good agreement with experimental results shown in the brackets. Also, the binding energies per atom was computed to be 0.0177(8) (0.0203(12)), 0.0188(10) (0.0220(21)), 0.0247(8) (0.0310(12)), 0.0253(8) (0.0351(8)) Hartrees for lithium clusters n = 2 through 5, respectively. The lithium cluster one-electron density is shown to have charge concentrations corresponding to nonnuclear attractors. The overall shape of the electronic charge density also bears a remarkable similarity with the anisotropic harmonic oscillator model shape for the given number of valence electrons.

  11. A new clustering strategy

    NASA Astrophysics Data System (ADS)

    Feng, Jian-xin; Tang, Jia-fu; Wang, Guang-xing

    2007-04-01

    On the basis of the analysis of clustering algorithm that had been proposed for MANET, a novel clustering strategy was proposed in this paper. With the trust defined by statistical hypothesis in probability theory and the cluster head selected by node trust and node mobility, this strategy can realize the function of the malicious nodes detection which was neglected by other clustering algorithms and overcome the deficiency of being incapable of implementing the relative mobility metric of corresponding nodes in the MOBIC algorithm caused by the fact that the receiving power of two consecutive HELLO packet cannot be measured. It's an effective solution to cluster MANET securely.

  12. Unconventional methods for clustering

    NASA Astrophysics Data System (ADS)

    Kotyrba, Martin

    2016-06-01

    Cluster analysis or clustering is a task of grouping a set of objects in such a way that objects in the same group (called a cluster) are more similar (in some sense or another) to each other than to those in other groups (clusters). It is the main task of exploratory data mining and a common technique for statistical data analysis used in many fields, including machine learning, pattern recognition, image analysis, information retrieval, and bioinformatics. The topic of this paper is one of the modern methods of clustering namely SOM (Self Organising Map). The paper describes the theory needed to understand the principle of clustering and descriptions of algorithm used with clustering in our experiments.

  13. Integrating Cluster Data into the VO Infrastructure

    NASA Astrophysics Data System (ADS)

    Richards, P. J.; Perry, C. H.

    2007-12-01

    The UK Cluster Data Centre (UKCDC) has provided access to Cluster data products since the launch of the Cluster spacecraft in 2000. In keeping with the aim of providing the widest possible access to the Space Physics community, the UKCDC has participated in several projects to advance the interoperability of their data holdings within the emerging international VO infrastructure. These activities include AstroGrid in the UK, ESA's SpaceGrid and participation in the NASA led Space Physics Archive Search and Extract (SPASE) Consortium. Although, as demonstrated by SpaceGrid, the technology exists to build the VO infrastructure, the main obstacle to progress has been the absence of a metadata standard used by Data Centres and other data providers. The Cluster Active Archive (CAA), which is providing an archive of Cluster high resolution data, has a comprehensive metadata dictionary which is used to describe all Cluster data products. The UKCDC is ingesting into the CAA the summary and primary data products being used during the mission for event monitoring. As part of this activity, the CAA metadata is also being translated into SPASE metadata and the UKCDC is in the process of building a SPASE registry of the data products available at the UKCDC and also data access services developed according to the SPASE standards. The experience gained as the SPASE standard matures will form the basis for building a SPASE registry and services for access to the Cluster archive.

  14. Modeling Clustered Data with Very Few Clusters.

    PubMed

    McNeish, Daniel; Stapleton, Laura M

    2016-01-01

    Small-sample inference with clustered data has received increased attention recently in the methodological literature, with several simulation studies being presented on the small-sample behavior of many methods. However, nearly all previous studies focus on a single class of methods (e.g., only multilevel models, only corrections to sandwich estimators), and the differential performance of various methods that can be implemented to accommodate clustered data with very few clusters is largely unknown, potentially due to the rigid disciplinary preferences. Furthermore, a majority of these studies focus on scenarios with 15 or more clusters and feature unrealistically simple data-generation models with very few predictors. This article, motivated by an applied educational psychology cluster randomized trial, presents a simulation study that simultaneously addresses the extreme small sample and differential performance (estimation bias, Type I error rates, and relative power) of 12 methods to account for clustered data with a model that features a more realistic number of predictors. The motivating data are then modeled with each method, and results are compared. Results show that generalized estimating equations perform poorly; the choice of Bayesian prior distributions affects performance; and fixed effect models perform quite well. Limitations and implications for applications are also discussed. PMID:27269278

  15. ECLAT: The European Cluster Assimilation Technology Project

    NASA Astrophysics Data System (ADS)

    Milan, S. E.; Imber, S. M.; Lester, M.; Nakamura, R.; Boakes, P.; Kauristie, K.; Palmroth, M.; Opgenoorth, H.; Sergeev, V.

    2013-09-01

    The European Cluster Assimilation Technology project is a collaboration funded by the European Commission through the Seventh Framework Programme (FP7). ECLAT will ingest a variety of contextual datasets into the Cluster Active Archive to complement the existing Cluster data. These datasets will include SuperDARN ionospheric convection measurements, auroral observations, MIRACLE measurements of ionospheric currents in the Scandinavian sector, detailed magnetic field modelling and Cluster footprint tracing, detailed Cluster boundary crossings information, and state-of-the-art physics-based modelling of the magnetosphere using the GUMICS code. This poster will provide an overview of the ECLAT project, its datasets, and software tools. ECLAT provides extensive information from key regions for Earth's space-weather sciences, i.e. solar wind, magnetosphere, and ionosphere, suitable for studies of local process as well as large-scale response to solar wind drivers.

  16. ECLAT: The European Cluster Assimilation Technology Project

    NASA Astrophysics Data System (ADS)

    Milan, S. E.; Lester, M.; Nakamura, R.; Kauristie, K.; Palmroth, M.; Opgenoorth, H.; Sergeev, V.

    2012-04-01

    The European Cluster Assimilation Technology project is a collaboration between the University of Leicester, UK, the Institutet för rymdfysik, Sweden, St. Petersberg State University, Russia, the Finnish Meteorological Institute, Finland, and the Oesterreichische Akademie der Wissenschaften, Austria, funded by the European Commission through the Seventh Framework Programme (FP7). ECLAT will ingest a variety of contextual datasets into the Cluster Active Archive to complement the existing Cluster data. These datasets will include SuperDARN ionospheric convection measurements, auroral observations, MIRACLE measurements of ionospheric currents in the Scandinavian sector, detailed magnetic field modelling and Cluster footprint tracing, detailed Cluster boundary-crossings information, and state-of-the-art physics-based modelling of the magnetosphere using the GUMICS code. This poster will provide an overview of the ECLAT project, its datasets, and software tools.

  17. Stoichiometric and catalytic activation of the alpha- and beta-2,3,4-tri-O-acetyl-5-thioxylopyranosyl bromide inside the cavity of the Pd3(dppm)3(CO)2+ cluster.

    PubMed

    Brevet, David; Mugnier, Yves; Lemaître, Frédéric; Lucas, Dominique; Samreth, Soth; Harvey, Pierre D

    2003-08-11

    The title cluster (Pd(3)(2+)) exhibits a pronounced affinity for Br(-) ions to form the very stable Pd(3)(Br)(+) adduct. Upon a 2-electron reduction, a dissociative process occurs generating Pd(3)(0) and eliminating Br(-) according to an ECE mechanism (electrochemical, chemical, electrochemical). At a lower temperature (i.e. -20 degrees C), both ECE and EEC processes operate. This cluster also activates the C-Br bond, and this work deals with the reactivity of Pd(3)(2+) with 2,3,4-tri-O-acetyl-5-thioxylopyranosyl bromide (Xyl-Br), both alpha- and beta-isomers. The observed inorganic product is Pd(3)(Br)(+) again, and it is formed according to an associative mechanism involving Pd(3)(2+).Xyl-Br host-guest assemblies. In an attempt to render the C-Br bond activation catalytic, these species are investigated under reduction conditions at two potentials (-0.9 and -1.25 V vs SCE). In the former case, the major product is Xyl-H, issued from a radical intermediate Xyl(*) abstracting an H atom from the solvent. Evidence for Xyl(*) is provided by the trapping with TEMPO (2,2,6,6-tetramethyl-1-piperidinyloxy) and DMPO (5,5'-dimethylpyrroline-N-oxyde). In the second case, only one product is observed, 3,4-di-O-acetyl-5-thioxylal, which is issued from the Xyl(-)() intermediate anion. PMID:12895115

  18. [Clustering of simple obesity].

    PubMed

    Yoshida, K; Matsuda, H; Kurita, M; Umetada, Y

    1988-05-01

    An attempt was made to classify persons with simple obesity from the viewpoint of health education. Subjects of the study were 1,278 male workers in a financing company who underwent health examination. At the time of health examinations, questionnaire survey concerning their life styles was carried out on all the subjects. The obese group consisted of 127 subjects whose obesity indices were over 15% and the control group consisted of 342 subjects whose obesity indices ranged from -5 to 5%. Subjects in the obese group were classified into four clusters based on cluster analysis using five life-style parameters; that is, frequency of taking breakfast, frequency of taking staple food, drinking habits, smoking habits, and frequency of exercise. The first cluster (N = 10) included inactive persons, the second cluster (N = 46) non smokers, the third cluster (N = 39) smokers and heavy drinkers, and the fourth cluster (N = 32) smokers and non-drinkers. Comparison of the four clusters of obese persons with the control group revealed the following findings: 1) All the four clusters had significantly high frequencies of abnormal values of triglyceride (TG) and fasting blood sugar (FBS). 2) The first cluster had significantly high frequencies of abnormal values of glutamic oxalacetic transaminase (GOT) and glutamic pyruvic transaminase (GPT). 3) The second cluster had significantly high frequencies of abnormal values of systolic and diastolic blood pressure, total cholesterol, TG, FBS, uric acid, GOT, GPT and gamma glutamyl transferase (GGT).(ABSTRACT TRUNCATED AT 250 WORDS) PMID:3172544

  19. Ariane-5 and Cluster update

    NASA Astrophysics Data System (ADS)

    1996-06-01

    The Enquiry Board started work on 13 June and will report by mid-July. The Launch Qualification Committee resumed its activities on 14 June. The ESA Director General and the CNES Chairman will have to rule on the Enquiry Board's recommendations and the Launch Qualification Committee's requirements. The ESA Executive will then be able to determine - with CNES - the technical and programmatic implications for the Ariane-5 development programme. The Enquiry Board's findings and recommendations and their implications will be made known to the press soon afterwards. The Ariane Launcher Programme Board (the ESA delegate body that supervises the programme) will meet on 12 August, when the ESA Executive will present the programmatic implications. On the payload side, the Cluster Science Working Team (SWT) met on 17 and 18 June to assess the situation after the loss of the Cluster mission and to explore ways in which its scientific objectives could be revived. The SWT proposed the following approach: a. integration of the Cluster structural model with flight spare subsystems (the Phoenix project) together with a rebuild of three spacecraft identical to the originals. This scenario offers alternative options: a1. integration and testing of the Cluster spare (Phoenix), storage and launch at a later date together with the three rebuilt satellites, and a2. integration and reflight of Phoenix as soon as possible and production and launch of the three rebuilt satellites at a later date. The SWT stressed that the case for an early launch of Phoenix was largely dependent on whether the follow-on programme was also approved. A further option would call for: b. use of the Cluster spare (Phoenix) as outlined above, augmented by three new "mini" satellites funded and produced by ESA Member States that would carry subsets of the Cluster instrumentation. This mission would thus fly one main spacecraft and three "companion" spacecraft, as described in an early proposal for Cluster. On 21

  20. Understanding the star-forming environment in stellar clusters

    NASA Astrophysics Data System (ADS)

    Wang, Shiya

    The main goal of this thesis is to investigate the physical conditions of the star-forming environment in stellar clusters, especially for the formation of low-mass cluster members. Embedded, young, and intermediate-mass stellar clusters around Herbig Ae/Be stars are sampled. Mid- and near-infrared observations identifying young stars and millimeter interferometric observations probing dense molecular gas and dust continuum are presented. These observations are used to reveal the large-scale young stellar population around the vicinity where the sampled clusters form, probe the physical conditions of dense molecular clumps which are capable of forming individual low-mass cluster members, and examine the influence of the most massive star in the cluster on its siblings and natal cluster-forming cloud. This study shows that stars within the cluster tend to seem younger than those outside the cluster, suggesting a higher and continuous star-forming rate within the cluster than outside, or massive stars are initiated later than low-mass stars within the same cloud. A thorough investigation of young stars and dense gas toward the MWC 1080 cluster further suggests a domination of the most massive star in the cluster on both the natal cloud dispersal and its low-mass cluster members. As active outflows and winds from the Herbig Ae/Be stars increase the non-thermal motion in the cloud, low-mass cluster members are formed within denser and more turbulent cores, than isolated low-mass star-forming cores. In addition, the strong gas dispersal from the Herbig Ae/Be stars also helps the removal of the circumstellar material around nearby low-mass stars. This makes these low-mass cluster members appear older. In summary, this thesis provides the observational evidence showing how the most massive star in the cluster affects the formation and evolution of low-mass cluster members and the physical conditions of star formation in the cluster.

  1. Dying radio galaxies in clusters

    NASA Astrophysics Data System (ADS)

    Murgia, M.; Parma, P.; Mack, K.-H.; de Ruiter, H. R.; Fanti, R.; Govoni, F.; Tarchi, A.; Giacintucci, S.; Markevitch, M.

    2011-02-01

    Aims: We present a study of five "dying" nearby (z ≤ 0.2) radio galaxies belonging to both the WENSS minisurvey and the B2 bright catalogs WNB1734+6407, WNB1829+6911, WNB1851+5707, B2 0120+33, and B2 1610+29. Methods: These sources have been selected on the basis of their extremely steep broad-band radio spectra, which strongly indicates that either these objects belong to the rare class of dying radio galaxies or we are observing "fossil" radio plasma remaining from a previous instance of nuclear activity. We derive the relative duration of the dying phase from the fit of a synchrotron radiative model to the radio spectra of the sources. Results: The modeling of the integrated spectra and the deep spectral index images obtained with the VLA confirmed that in these sources the central engine has ceased to be active for a significant fraction of their lifetime, although their extended lobes have not yet completely faded away. We found that WNB1851+5707 is in reality composed of two distinct dying galaxies, which appear blended together as a single source in the WENSS. In the cases of WNB1829+6911 and B2 0120+33, the fossil radio lobes are seen in conjunction with a currently active core. A very faint core is also detected in a MERLIN image of WNB1851+5707a, one of the two dying sources composing WNB1851+5707. We found that all sources in our sample are located (at least in projection) at the center of an X-ray emitting cluster. Conclusions: Our results suggest that the duration of the dying phase for a radio source in a cluster can be significantly higher than that of a radio galaxy in the field, although no firm conclusions can be drawn because of the small number statistics involved. The simplest interpretation of the tendency for dying galaxies to be found in clusters is that the low-frequency radio emission from the fading radio lobes lasts longer if their expansion is somewhat reduced or even stopped. Another possibility is that the occurrence of dying

  2. Effect of self-propulsion on equilibrium clustering.

    PubMed

    Mani, Ethayaraja; Löwen, Hartmut

    2015-09-01

    In equilibrium, colloidal suspensions governed by short-range attractive and long-range repulsive interactions form thermodynamically stable clusters. Using Brownian dynamics computer simulations, we investigate how this equilibrium clustering is affected when such particles are self-propelled. We find that the clustering process is stable under self-propulsion. For the range of interaction parameters studied and at low particle density, the cluster size increases with the speed of self-propulsion (activity) and for higher activity the cluster size decreases, showing a nonmonotonic variation of cluster size with activity. This clustering behavior is distinct from the pure kinetic (or motility-induced) clustering of self-propelling particles which is observed at significantly higher activities and densities. We present an equilibrium model incorporating the effect of activity as activity-induced attraction and repulsion by imposing that the strength of these interactions depend on activity superlinearly. The model explains the cluster size dependence of activity obtained from simulations semiquantitatively. Our predictions are verifiable in experiments on interacting synthetic colloidal microswimmers. PMID:26465467

  3. Effect of self-propulsion on equilibrium clustering

    NASA Astrophysics Data System (ADS)

    Mani, Ethayaraja; Löwen, Hartmut

    2015-09-01

    In equilibrium, colloidal suspensions governed by short-range attractive and long-range repulsive interactions form thermodynamically stable clusters. Using Brownian dynamics computer simulations, we investigate how this equilibrium clustering is affected when such particles are self-propelled. We find that the clustering process is stable under self-propulsion. For the range of interaction parameters studied and at low particle density, the cluster size increases with the speed of self-propulsion (activity) and for higher activity the cluster size decreases, showing a nonmonotonic variation of cluster size with activity. This clustering behavior is distinct from the pure kinetic (or motility-induced) clustering of self-propelling particles which is observed at significantly higher activities and densities. We present an equilibrium model incorporating the effect of activity as activity-induced attraction and repulsion by imposing that the strength of these interactions depend on activity superlinearly. The model explains the cluster size dependence of activity obtained from simulations semiquantitatively. Our predictions are verifiable in experiments on interacting synthetic colloidal microswimmers.

  4. Searching for the missing baryons in clusters.

    PubMed

    Rasheed, Bilhuda; Bahcall, Neta; Bode, Paul

    2011-03-01

    Observations of clusters of galaxies suggest that they contain fewer baryons (gas plus stars) than the cosmic baryon fraction. This "missing baryon" puzzle is especially surprising for the most massive clusters, which are expected to be representative of the cosmic matter content of the universe (baryons and dark matter). Here we show that the baryons may not actually be missing from clusters, but rather are extended to larger radii than typically observed. The baryon deficiency is typically observed in the central regions of clusters (∼0.5 the virial radius). However, the observed gas-density profile is significantly shallower than the mass-density profile, implying that the gas is more extended than the mass and that the gas fraction increases with radius. We use the observed density profiles of gas and mass in clusters to extrapolate the measured baryon fraction as a function of radius and as a function of cluster mass. We find that the baryon fraction reaches the cosmic value near the virial radius for all groups and clusters above ∼5 x 10(13)h(-1)(72)M. This suggests that the baryons are not missing, they are simply located in cluster outskirts. Heating processes (such as shock-heating of the intracluster gas, supernovae, and Active Galactic Nuclei feedback) likely contribute to this expanded distribution. Upcoming observations should be able to detect these baryons. PMID:21321229

  5. Searching for the missing baryons in clusters

    PubMed Central

    Rasheed, Bilhuda; Bahcall, Neta; Bode, Paul

    2011-01-01

    Observations of clusters of galaxies suggest that they contain fewer baryons (gas plus stars) than the cosmic baryon fraction. This “missing baryon” puzzle is especially surprising for the most massive clusters, which are expected to be representative of the cosmic matter content of the universe (baryons and dark matter). Here we show that the baryons may not actually be missing from clusters, but rather are extended to larger radii than typically observed. The baryon deficiency is typically observed in the central regions of clusters (∼0.5 the virial radius). However, the observed gas-density profile is significantly shallower than the mass-density profile, implying that the gas is more extended than the mass and that the gas fraction increases with radius. We use the observed density profiles of gas and mass in clusters to extrapolate the measured baryon fraction as a function of radius and as a function of cluster mass. We find that the baryon fraction reaches the cosmic value near the virial radius for all groups and clusters above . This suggests that the baryons are not missing, they are simply located in cluster outskirts. Heating processes (such as shock-heating of the intracluster gas, supernovae, and Active Galactic Nuclei feedback) likely contribute to this expanded distribution. Upcoming observations should be able to detect these baryons. PMID:21321229

  6. Health coaching and pedometers to enhance physical activity and prevent falls in community-dwelling people aged 60 years and over: study protocol for the Coaching for Healthy AGEing (CHAnGE) cluster randomised controlled trial

    PubMed Central

    Tiedemann, Anne; Rissel, Chris; Howard, Kirsten; Tong, Allison; Merom, Dafna; Smith, Stuart; Wickham, James; Bauman, Adrian; Lord, Stephen R; Vogler, Constance; Lindley, Richard I; Simpson, Judy M; Allman-Farinelli, Margaret; Sherrington, Catherine

    2016-01-01

    Introduction Prevention of falls and promotion of physical activity are essential for maximising well-being in older age. However, there is evidence that promoting physical activity among older people without providing fall prevention advice may increase fall rates. This trial aims to establish the impact of a physical activity and fall prevention programme compared with a healthy eating programme on physical activity and falls among people aged 60+ years. Methods and analysis This cluster randomised controlled trial will involve 60 groups of community-dwelling people aged 60+ years. Participating groups will be randomised to: (1) a physical activity and fall prevention intervention (30 groups), involving written information, fall risk assessment and prevention advice, a pedometer-based physical activity tracker and telephone-based health coaching; or (2) a healthy eating intervention (30 groups) involving written information and telephone-based dietary coaching. Primary outcomes will be objectively measured physical activity at 12 months post-randomisation and self-reported falls throughout the 12-month trial period. Secondary outcomes include: the proportion of fallers, the proportion of people meeting the Australian physical activity guidelines, body mass index, eating habits, mobility goal attainment, mobility-related confidence, quality of life, fear of falling, risk-taking behaviour, mood, well-being, self-reported physical activity, disability, and health and community service use. The between-group difference in the number of falls per person-year will be analysed using negative binomial regression models. For the continuously scored primary and secondary outcome measures, linear regression adjusted for corresponding baseline scores will assess the effect of group allocation. Analyses will be preplanned, conducted while masked to group allocation, will take into account cluster randomisation, and will use an intention-to-treat approach. Ethics and

  7. Cluster Inter-Spacecraft Communications

    NASA Technical Reports Server (NTRS)

    Cox, Brian

    2008-01-01

    A document describes a radio communication system being developed for exchanging data and sharing data-processing capabilities among spacecraft flying in formation. The system would establish a high-speed, low-latency, deterministic loop communication path connecting all the spacecraft in a cluster. The system would be a wireless version of a ring bus that complies with the Institute of Electrical and Electronics Engineers (IEEE) standard 1393 (which pertains to a spaceborne fiber-optic data bus enhancement to the IEEE standard developed at NASA's Jet Propulsion Laboratory). Every spacecraft in the cluster would be equipped with a ring-bus radio transceiver. The identity of a spacecraft would be established upon connection into the ring bus, and the spacecraft could be at any location in the ring communication sequence. In the event of failure of a spacecraft, the ring bus would reconfigure itself, bypassing a failed spacecraft. Similarly, the ring bus would reconfigure itself to accommodate a spacecraft newly added to the cluster or newly enabled or re-enabled. Thus, the ring bus would be scalable and robust. Reliability could be increased by launching, into the cluster, spare spacecraft to be activated in the event of failure of other spacecraft.

  8. Electron: Cluster interactions

    SciTech Connect

    Scheidemann, A.A.; Kresin, V.V.; Knight, W.D.

    1994-02-01

    Beam depletion spectroscopy has been used to measure absolute total inelastic electron-sodium cluster collision cross sections in the energy range from E {approximately} 0.1 to E {approximately} 6 eV. The investigation focused on the closed shell clusters Na{sub 8}, Na{sub 20}, Na{sub 40}. The measured cross sections show an increase for the lowest collision energies where electron attachment is the primary scattering channel. The electron attachment cross section can be understood in terms of Langevin scattering, connecting this measurement with the polarizability of the cluster. For energies above the dissociation energy the measured electron-cluster cross section is energy independent, thus defining an electron-cluster interaction range. This interaction range increases with the cluster size.

  9. Information-based clustering

    PubMed Central

    Slonim, Noam; Atwal, Gurinder Singh; Tkačik, Gašper; Bialek, William

    2005-01-01

    In an age of increasingly large data sets, investigators in many different disciplines have turned to clustering as a tool for data analysis and exploration. Existing clustering methods, however, typically depend on several nontrivial assumptions about the structure of data. Here, we reformulate the clustering problem from an information theoretic perspective that avoids many of these assumptions. In particular, our formulation obviates the need for defining a cluster “prototype,” does not require an a priori similarity metric, is invariant to changes in the representation of the data, and naturally captures nonlinear relations. We apply this approach to different domains and find that it consistently produces clusters that are more coherent than those extracted by existing algorithms. Finally, our approach provides a way of clustering based on collective notions of similarity rather than the traditional pairwise measures. PMID:16352721

  10. Comparing Cool Cores in the Planck SZ Selected Samples of Clusters of Galaxies with Cool Cores in X-ray Selected Cluster Samples

    NASA Astrophysics Data System (ADS)

    Jones, Christine; Santos, Felipe A.; Forman, William R.; Kraft, Ralph P.; Lovisari, Lorenzo; Arnaud, Monique; Mazzotta, Pasquale; Van Weeren, Reinout J.; Churazov, Eugene; Ferrari, Chiara; Borgani, Stefano; Chandra-Planck Collaboration

    2016-06-01

    The Planck mission provided a representative sample of clusters of galaxies over the entire sky. With completed Chandra observations of 165 Planck ESZ and cosmology sample clusters at z<0.35, we can now characterize each cluster in terms of its X-ray luminosity, gas temperature, gas mass, total mass, gas entropy, gas central cooling time, presence of active AGN, gas cavities, radio emission, and cluster morphology. In this presentation we compare the percentages of cool core and non-cool core clusters in the Planck-selected clusters with the percentages in X-ray selected cluster samples. We find a significantly smaller percentage of cool core clusters in the Planck sample than in X-ray selected cluster samples. We will discuss the primary reasons for this smaller percentage of cool-core clusters in the Planck-selected cluster sample than in X-ray-selected samples.

  11. Characterizing the Small Scale Structure in Clusters of Galaxies

    NASA Technical Reports Server (NTRS)

    Forman, William R.

    2001-01-01

    We studied galaxy clusters Abell 119, Abell 754, and Abell 1750, using data from the ASCA and ROSAT satellites. In addition, we completed the paper "Merging Binary Clusters". In this paper we study three prominent bi-modal X-ray clusters: A3528, A1750 and A3395. Since the sub-clusters in these systems have projected separations of 0.93, 1.00 and 0.67 Mpc respectively, we examine their X-ray and optical observations to investigate the dynamics and possible merging of these sub-clusters. Using data taken with ROSAT and ASCA, we analyze the temperature and surface brightness distributions. We also analyze the velocity distributions of the three clusters using new measurements supplemented with previously published data. We examined both the overall cluster properties as well as the two sub-cluster elements in each. These results were then applied to the determination of the overall cluster masses, that demonstrate excellent consistency between the various methods used. While the characteristic parameters of the sub-clusters are typical of isolated objects, our temperature results for the regions between the two sub-clusters clearly confirm the presence of merger activity that is suggested by the surface brightness distributions. These three clusters represent a progression of equal-sized sub-cluster mergers, starting from initial contact to immediately before first core passage.

  12. Radio Galaxies in Galaxy Clusters: Feedback, Merger Signatures, and Signposts

    NASA Astrophysics Data System (ADS)

    Paterno-Mahler, Rachel; Blanton, Elizabeth L.; Randall, Scott W.; Andrade-Santos, Felipe; Ashby, Matthew; Brodwin, Mark; Bulbul, Esra; Clarke, Tracy E.; Golden-Marx, Emmet; Johnson, Ryan; Jones, Christine; Murray, Stephen S.; Wing, Joshua

    2015-01-01

    Extended, double-lobed radio sources are often located in rich galaxy clusters. I will present results of an optical and X-ray analysis of two nearby clusters with such radio sources - one of the clusters is relaxed (A2029) and one of the clusters is undergoing a merger (A98). Because of their association with clusters, extended radio sources can be used to locate clusters at a wide range of distances. The number of spectroscopically confirmed galaxy clusters with is very low compared to the number of well-studied low-redshift clusters. In the Clusters Occupied by Bent Radio AGN (COBRA) survey, we use bent, double-lobed radio sources as signposts to efficiently locate high-redshift clusters. Using a Spitzer Snapshot Survey of our sample of 653 bent, double-lobed radio sources (selected from the FIRST survey and with galaxy hosts too faint to be detected in the SDSS), we have the potential to identify approximately 400 new clusters and groups with redshifts. I will present results from the Spitzer observations regarding the efficiency of the method for finding new clusters. These newly identified clusters will be used to study galaxy formation and evolution, as well as the effect that feedback from active galactic nuclei (AGN) has on galaxies and their environments.

  13. Mini-clusters

    NASA Technical Reports Server (NTRS)

    Chinellato, J. A.; Dobrigkeit, C.; Bellandifilho, J.; Lattes, C. M. G.; Menon, M. J.; Navia, C. E.; Pamilaju, A.; Sawayanagi, K.; Shibuya, E. H.; Turtelli, A., Jr.

    1985-01-01

    Experimental results of mini-clusters observed in Chacaltaya emulsion chamber no.19 are summarized. The study was made on 54 single core shower upper and 91 shower clusters of E(gamma) 10 TeV from 30 families which are visible energy greater than 80 TeV and penetrate through both upper and lower detectors of the two-story chamber. The association of hadrons in mini-cluster is made clear from their penetrative nature and microscopic observation of shower continuation in lower chamber. Small P sub t (gamma) of hadrons in mini-clusters remained in puzzle.

  14. Management of cluster headache.

    PubMed

    Tfelt-Hansen, Peer C; Jensen, Rigmor H

    2012-07-01

    The prevalence of cluster headache is 0.1% and cluster headache is often not diagnosed or misdiagnosed as migraine or sinusitis. In cluster headache there is often a considerable diagnostic delay - an average of 7 years in a population-based survey. Cluster headache is characterized by very severe or severe orbital or periorbital pain with a duration of 15-180 minutes. The cluster headache attacks are accompanied by characteristic associated unilateral symptoms such as tearing, nasal congestion and/or rhinorrhoea, eyelid oedema, miosis and/or ptosis. In addition, there is a sense of restlessness and agitation. Patients may have up to eight attacks per day. Episodic cluster headache (ECH) occurs in clusters of weeks to months duration, whereas chronic cluster headache (CCH) attacks occur for more than 1 year without remissions. Management of cluster headache is divided into acute attack treatment and prophylactic treatment. In ECH and CCH the attacks can be treated with oxygen (12 L/min) or subcutaneous sumatriptan 6 mg. For both oxygen and sumatriptan there are two randomized, placebo-controlled trials demonstrating efficacy. In both ECH and CCH, verapamil is the prophylactic drug of choice. Verapamil 360 mg/day was found to be superior to placebo in one clinical trial. In clinical practice, daily doses of 480-720 mg are mostly used. Thus, the dose of verapamil used in cluster headache treatment may be double the dose used in cardiology, and with the higher doses the PR interval should be checked with an ECG. At the start of a cluster, transitional preventive treatment such as corticosteroids or greater occipital nerve blockade can be given. In CCH and in long-standing clusters of ECH, lithium, methysergide, topiramate, valproic acid and ergotamine tartrate can be used as add-on prophylactic treatment. In drug-resistant CCH, neuromodulation with either occipital nerve stimulation or deep brain stimulation of the hypothalamus is an alternative treatment strategy

  15. The youngest globular clusters

    NASA Astrophysics Data System (ADS)

    Beck, Sara

    2015-11-01

    It is likely that all stars are born in clusters, but most clusters are not bound and disperse. None of the many protoclusters in our Galaxy are likely to develop into long-lived bound clusters. The super star clusters (SSCs) seen in starburst galaxies are more massive and compact and have better chances of survival. The birth and early development of SSCs takes place deep in molecular clouds, and during this crucial stage the embedded clusters are invisible to optical or UV observations but are studied via the radio-infrared supernebulae (RISN) they excite. We review observations of embedded clusters and identify RISN within 10 Mpc whose exciting clusters have ≈ 106 M⊙ or more in volumes of a few pc3 and which are likely to not only survive as bound clusters, but to evolve into objects as massive and compact as Galactic globulars. These clusters are distinguished by very high star formation efficiency η, at least a factor of 10 higher than the few percent seen in the Galaxy, probably due to the violent disturbances their host galaxies have undergone. We review recent observations of the kinematics of the ionized gas in RISN showing outflows through low-density channels in the ambient molecular cloud; this may protect the cloud from feedback by the embedded H II region.

  16. “Pre-schoolers in the playground” an outdoor physical activity intervention for children aged 18 months to 4 years old: study protocol for a pilot cluster randomised controlled trial

    PubMed Central

    2013-01-01

    Background The pre-school years are considered critical for establishing healthy lifestyle behaviours such as physical activity. Levels of physical activity track through childhood into adulthood, thus establishing habitual physical activity early in life is vital. Time spent outdoors is associated with greater physical activity and playground interventions have been shown to increase physical activity in school aged children. There are few pre-school, playground-based interventions, and evaluations of these have found mixed results. A recent report published by the UK Chief Medical Officer (CMO) highlighted that new interventions to promote movement in the early years (0–5 years old) are needed. The aim of this study is to undertake a pilot cluster randomised controlled trial (RCT) of an outdoor playground-based physical activity intervention for parents and their children aged 18 months to 4 years old (“Pre-schoolers in the Playground”; PiP) and to assess the feasibility of conducting a full scale cluster RCT. The PiP intervention is grounded in behavioural theory (Social Cognitive Theory), and is in accordance with the CMO guidance for physical activity in the early years. It is informed by existing literature and data collected from focus groups with parents. Methods/Design One hundred and fifty pre-school children affiliated to 10 primary schools will be recruited. Schools will be randomised to either the PiP intervention arm or the control arm (usual practice). Children in the intervention arm will be invited to attend three 30 minute outdoor play sessions per week for 30 weeks (3 school terms) at the school. Feasibility will be assessed by examining recruitment rates, attendance, attrition, acceptability of the trial and of the PiP intervention to parents, fidelity of intervention implementation, capability and capacity for schools to deliver the intervention. Health outcomes and the feasibility of outcome measurement tools will be assessed. These

  17. Nonequilibrium clustering of self-propelled rods.

    PubMed

    Peruani, Fernando; Deutsch, Andreas; Bär, Markus

    2006-09-01

    Motivated by aggregation phenomena in gliding bacteria, we study collective motion in a two-dimensional model of active, self-propelled rods interacting through volume exclusion. In simulations with individual particles, we find that particle clustering is facilitated by a sufficiently large packing fraction eta or length-to-width ratio kappa . The transition to clustering in simulations is well captured by a mean-field model for the cluster size distribution, which predicts that the transition values kappac of the aspect ratio for a fixed packing fraction eta are given by kappac=Ceta-1 where C is a constant. PMID:17025586

  18. Clustering versus non-clustering phase synchronizations.

    PubMed

    Liu, Shuai; Zhan, Meng

    2014-03-01

    Clustering phase synchronization (CPS) is a common scenario to the global phase synchronization of coupled dynamical systems. In this work, a novel scenario, the non-clustering phase synchronization (NPS), is reported. It is found that coupled systems do not transit to the global synchronization until a certain sufficiently large coupling is attained, and there is no clustering prior to the global synchronization. To reveal the relationship between CPS and NPS, we further analyze the noise effect on coupled phase oscillators and find that the coupled oscillator system can change from CPS to NPS with the increase of noise intensity or system disorder. These findings are expected to shed light on the mechanism of various intriguing self-organized behaviors in coupled systems. PMID:24697366

  19. Clustering versus non-clustering phase synchronizations

    SciTech Connect

    Liu, Shuai; Zhan, Meng

    2014-03-15

    Clustering phase synchronization (CPS) is a common scenario to the global phase synchronization of coupled dynamical systems. In this work, a novel scenario, the non-clustering phase synchronization (NPS), is reported. It is found that coupled systems do not transit to the global synchronization until a certain sufficiently large coupling is attained, and there is no clustering prior to the global synchronization. To reveal the relationship between CPS and NPS, we further analyze the noise effect on coupled phase oscillators and find that the coupled oscillator system can change from CPS to NPS with the increase of noise intensity or system disorder. These findings are expected to shed light on the mechanism of various intriguing self-organized behaviors in coupled systems.

  20. A nonparametric clustering technique which estimates the number of clusters

    NASA Technical Reports Server (NTRS)

    Ramey, D. B.

    1983-01-01

    In applications of cluster analysis, one usually needs to determine the number of clusters, K, and the assignment of observations to each cluster. A clustering technique based on recursive application of a multivariate test of bimodality which automatically estimates both K and the cluster assignments is presented.

  1. Reactive accelerated cluster erosion (RACE) by ionized cluster beams

    NASA Astrophysics Data System (ADS)

    Gspann, Jürgen

    1996-05-01

    Beams of ionized clusters accelerated up to about 120 keV kinetic energy per cluster are used for cluster impact lithography. Chemical reactions of clusters of CO 2, or of SF 6, respectively, are found to assist the physical erosion by hypervelocity cluster impacts in yielding volatile products. Natural diamond, silicon and Pyrex glass have been microstructured showing very smooth eroded surfaces.

  2. Synthetic Analogues of the Active Site of the A-cluster of Acetyl Coenzyme A Synthase/CO Dehydrogenase: Syntheses, Structures, and Reactions with CO

    PubMed Central

    Harrop, Todd C.; Olmstead, Marilyn M.; Mascharak, Pradip K.

    2016-01-01

    Two metallosynthons, namely (Et4N)2[Ni(NpPepS)] (1) and (Et4N)2[Ni(PhPepS)] (2) containing carboxamido-N and thiolato-S as donors have been used to model the bimetallic Mp-Nid subsite of the A-cluster of the enzyme ACS/CODH. A series of sulfurbridged Ni/Cu dinuclear and trinuclear complexes (3-10) have been synthesized to explore their redox properties and affinity of the metal centers toward CO. The structures of (Et4N)2[Ni(PhPepS)] (2), (Et4N)[Cu(neo)Ni(NpPepS)]•0.5Et2O•0.5H2O (3•0.5Et2O•0.5H2O), (Et4N)[Cu(neo)Ni(PhPepS)]•H2O (4•H2O), (Et4N)2[Ni{Ni(NpPepS)}2]•DMF (5•DMF), (Et4N)2[Ni(DMF)2{Ni(NpPepS)}2]•3DMF (6•3DMF), (Et4N)2[Ni(DMF)2{Ni(PhPepS)}2] (8), and [Ni(dppe)Ni(PhPepS)]•CH2Cl2 (10•CH2Cl2) have been determined by crystallography. The Nid mimics 1 and 2 resist reduction and exhibit no affinity toward CO. In contrast, the sulfur-bridged Ni center (designated NiC) in the trinuclear models 5–8 are amenable to reduction and binds CO in the Ni(I) state. Also, the sulfur-bridged NiC center can be removed from the trimers (5–8) by treatment with 1,10-phenanthroline much like the “labile Ni” from the enzyme. The dinuclear Ni-Ni models 9 and 10 resemble the Nip-Nid subsite of the A-cluster more closely and only the modeled Nip site of the dimers can be reduced. The Ni(I)-Ni(II) species display EPR spectra typical of a Ni(I) center in distorted trigonal bipyramidal and distorted tetrahedral geometries for 9red and 10red, respectively. Both species bind CO and the CO-adducts 9red-CO and 10red-CO display strong νco at 2044 and 1997 cm-1, respectively. The reduction of 10 is reversible. The CO-affinity of 10 in the reduced state and the νco value of 10red-CO closely resemble the CO-bound reduced A-cluster (νco = 1996 cm-1). PMID:16602803

  3. Caveolin-1 Facilitates the Direct Coupling between Large Conductance Ca2+-activated K+ (BKCa) and Cav1.2 Ca2+ Channels and Their Clustering to Regulate Membrane Excitability in Vascular Myocytes*

    PubMed Central

    Suzuki, Yoshiaki; Yamamura, Hisao; Ohya, Susumu; Imaizumi, Yuji

    2013-01-01

    L-type voltage-dependent Ca2+ channels (LVDCC) and large conductance Ca2+-activated K+ channels (BKCa) are the major factors defining membrane excitability in vascular smooth muscle cells (VSMCs). The Ca2+ release from sarcoplasmic reticulum through ryanodine receptor significantly contributes to BKCa activation in VSMCs. In this study direct coupling between LVDCC (Cav1.2) and BKCa and the role of caveoline-1 on their interaction in mouse mesenteric artery SMCs were examined. The direct activation of BKCa by Ca2+ influx through coupling LVDCC was demonstrated by patch clamp recordings in freshly isolated VSMCs. Using total internal reflection fluorescence microscopy, it was found that a large part of yellow fluorescent protein-tagged BKCa co-localized with the cyan fluorescent protein-tagged Cav1.2 expressed in the plasma membrane of primary cultured mouse VSMCs and that the two molecules often exhibited FRET. It is notable that each BKα subunit of a tetramer in BKCa can directly interact with Cav1.2 and promotes Cav1.2 cluster in the molecular complex. Furthermore, caveolin-1 deficiency in knock-out (KO) mice significantly reduced not only the direct coupling between BKCa and Cav1.2 but also the functional coupling between BKCa and ryanodine receptor in VSMCs. The measurement of single cell shortening by 40 mm K+ revealed enhanced contractility in VSMCs from KO mice than wild type. Taken together, caveolin-1 facilitates the accumulation/clustering of BKCa-LVDCC complex in caveolae, which effectively regulates spatiotemporal Ca2+ dynamics including the negative feedback, to control the arterial excitability and contractility. PMID:24202214

  4. A De Novo Deletion in the Regulators of Complement Activation Cluster Producing a Hybrid Complement Factor H/Complement Factor H-Related 3 Gene in Atypical Hemolytic Uremic Syndrome.

    PubMed

    Challis, Rachel C; Araujo, Geisilaine S R; Wong, Edwin K S; Anderson, Holly E; Awan, Atif; Dorman, Anthony M; Waldron, Mary; Wilson, Valerie; Brocklebank, Vicky; Strain, Lisa; Morgan, B Paul; Harris, Claire L; Marchbank, Kevin J; Goodship, Timothy H J; Kavanagh, David

    2016-06-01

    The regulators of complement activation cluster at chromosome 1q32 contains the complement factor H (CFH) and five complement factor H-related (CFHR) genes. This area of the genome arose from several large genomic duplications, and these low-copy repeats can cause genome instability in this region. Genomic disorders affecting these genes have been described in atypical hemolytic uremic syndrome, arising commonly through nonallelic homologous recombination. We describe a novel CFH/CFHR3 hybrid gene secondary to a de novo 6.3-kb deletion that arose through microhomology-mediated end joining rather than nonallelic homologous recombination. We confirmed a transcript from this hybrid gene and showed a secreted protein product that lacks the recognition domain of factor H and exhibits impaired cell surface complement regulation. The fact that the formation of this hybrid gene arose as a de novo event suggests that this cluster is a dynamic area of the genome in which additional genomic disorders may arise. PMID:26490391

  5. Estimating the concrete compressive strength using hard clustering and fuzzy clustering based regression techniques.

    PubMed

    Nagwani, Naresh Kumar; Deo, Shirish V

    2014-01-01

    Understanding of the compressive strength of concrete is important for activities like construction arrangement, prestressing operations, and proportioning new mixtures and for the quality assurance. Regression techniques are most widely used for prediction tasks where relationship between the independent variables and dependent (prediction) variable is identified. The accuracy of the regression techniques for prediction can be improved if clustering can be used along with regression. Clustering along with regression will ensure the more accurate curve fitting between the dependent and independent variables. In this work cluster regression technique is applied for estimating the compressive strength of the concrete and a novel state of the art is proposed for predicting the concrete compressive strength. The objective of this work is to demonstrate that clustering along with regression ensures less prediction errors for estimating the concrete compressive strength. The proposed technique consists of two major stages: in the first stage, clustering is used to group the similar characteristics concrete data and then in the second stage regression techniques are applied over these clusters (groups) to predict the compressive strength from individual clusters. It is found from experiments that clustering along with regression techniques gives minimum errors for predicting compressive strength of concrete; also fuzzy clustering algorithm C-means performs better than K-means algorithm. PMID:25374939

  6. Estimating the Concrete Compressive Strength Using Hard Clustering and Fuzzy Clustering Based Regression Techniques

    PubMed Central

    Nagwani, Naresh Kumar; Deo, Shirish V.

    2014-01-01

    Understanding of the compressive strength of concrete is important for activities like construction arrangement, prestressing operations, and proportioning new mixtures and for the quality assurance. Regression techniques are most widely used for prediction tasks where relationship between the independent variables and dependent (prediction) variable is identified. The accuracy of the regression techniques for prediction can be improved if clustering can be used along with regression. Clustering along with regression will ensure the more accurate curve fitting between the dependent and independent variables. In this work cluster regression technique is applied for estimating the compressive strength of the concrete and a novel state of the art is proposed for predicting the concrete compressive strength. The objective of this work is to demonstrate that clustering along with regression ensures less prediction errors for estimating the concrete compressive strength. The proposed technique consists of two major stages: in the first stage, clustering is used to group the similar characteristics concrete data and then in the second stage regression techniques are applied over these clusters (groups) to predict the compressive strength from individual clusters. It is found from experiments that clustering along with regression techniques gives minimum errors for predicting compressive strength of concrete; also fuzzy clustering algorithm C-means performs better than K-means algorithm. PMID:25374939

  7. “läuft.” - a school-based multi-component program to establish a physically active lifestyle in adolescence: study protocol for a cluster-randomized controlled trial

    PubMed Central

    2013-01-01

    Background Physical activity during childhood and adolescence is associated with substantial health benefits and tracks into adulthood. Nevertheless, only 22.7% of German adolescents are sufficiently physically active. Thus, the promotion of an active lifestyle in youth is an essential issue of public health. This study will evaluate the implementation and efficacy of the “läuft.” program to enhance physical activity in adolescence. “läuft.” is a multicomponent school-based program developed on the basis of effective strategies for health interventions and behavioral change. Methods/design The “läuft.” physical activity program targets four different levels. (a) Each student receives a pedometer and documents his/her steps over 12 weeks using an interactive user account on the “läuft.” homepage. (b) For classes there will be different competitions, with achieving the most steps in selected weeks, the highest increases of steps and developing the most inventive ideas to promote physical activity in school. Besides, the intervention includes four educational lessons. (c) The headmasters and teaching staff of the participating schools will get information material with suggestions and encouragement to enhance physical activity in school. Participating teachers will be invited to an introductory seminar. (d) Parents will be provided with informational material about the program and will be invited to a parent-teacher conference about the benefits of being physically active and how they can support their children in engaging in a physically active lifestyle. To evaluate the efficacy of the “läuft.” physical activity program, a two-arm cluster randomized controlled trial will be conducted in three waves: (1) baseline assessment, January/February 2014, (2) post assessment, June/July 2014 and (3) 12-month follow-up assessment, June/July 2015. Data collection will include physical and medical testing, self-administered questionnaires, group

  8. The Swift AGN and Cluster Survey

    NASA Astrophysics Data System (ADS)

    Danae Griffin, Rhiannon; Dai, Xinyu; Kochanek, Christopher S.; Bregman, Joel N.; Nugent, Jenna

    2016-01-01

    The Swift active galactic nucleus (AGN) and Cluster Survey (SACS) uses 125 deg^2 of Swift X-ray Telescope serendipitous fields with variable depths surrounding X-ray bursts to provide a medium depth (4 × 10^-15 erg cm^-2 s^-1) and area survey filling the gap between deep, narrow Chandra/XMM-Newton surveys and wide, shallow ROSAT surveys. Here, we present the first two papers in a series of publications for SACS. In the first paper, we introduce our method and catalog of 22,563 point sources and 442 extended sources. We examine the number counts of the AGN and galaxy cluster populations. SACS provides excellent constraints on the AGN number counts at the bright end with negligible uncertainties due to cosmic variance, and these constraints are consistent with previous measurements. The depth and areal coverage of SACS is well suited for galaxy cluster surveys outside the local universe, reaching z ˜ 1 for massive clusters. In the second paper, we use Sloan Digital Sky Survey (SDSS) DR8 data to study the 203 extended SACS sources that are located within the SDSS footprint. We search for galaxy over-densities in 3-D space using SDSS galaxies and their photometric redshifts near the Swift galaxy cluster candidates. We find 103 Swift clusters with a > 3σ over-density. The remaining targets are potentially located at higher redshifts and require deeper optical follow-up observations for confirmations as galaxy clusters. We present a series of cluster properties including the redshift, BCG magnitude, BCG-to-X-ray center offset, optical richness, X-ray luminosity and red sequences. We compare the observed redshift distribution of the sample with a theoretical model, and find that our sample is complete for z ≤ 0.3 and 80% complete for z ≤ 0.4, consistent with the survey depth of SDSS. We also match our SDSS confirmed Swift clusters to existing cluster catalogs, and find 42, 2 and 1 matches in optical, X-ray and SZ catalogs, respectively, so the majority of these

  9. Exceptional activity of sub-nm Pt clusters on CdS for photocatalytic hydrogen production: A combined of experimental and first-principles study

    SciTech Connect

    Wu, Qiyuan; Su, Dong; Xiong, Shangmin; Shen, Peichuan; Zhao, Shen; Li, Yan; Orlov, Alexander

    2014-12-24

    In this work we have explored a new concept of substantially increasing photocatalytic activity for H₂ production of conventional semiconductors by modifying them with sub-nm Pt particles. By combining both experimental and theoretical approaches, we have also developed new mechanistic insights into the 17 times increase in photocatalytic activity of Pt modified CdS catalysts.

  10. Formation of a Unique Cluster of G-Quadruplex Structures in the HIV-1 nef Coding Region: Implications for Antiviral Activity

    PubMed Central

    Perrone, Rosalba; Nadai, Matteo; Poe, Jerrod A.; Frasson, Ilaria; Palumbo, Manlio; Palù, Giorgio; Smithgall, Thomas E.; Richter, Sara N.

    2013-01-01

    G-quadruplexes are tetraplex structures of nucleic acids that can form in G-rich sequences. Their presence and functional role have been established in telomeres, oncogene promoters and coding regions of the human chromosome. In particular, they have been proposed to be directly involved in gene regulation at the level of transcription. Because the HIV-1 Nef protein is a fundamental factor for efficient viral replication, infectivity and pathogenesis invitro and invivo, we investigated G-quadruplex formation in the HIV-1 nef gene to assess the potential for viral inhibition through G-quadruplex stabilization. A comprehensive computational analysis of the nef coding region of available strains showed the presence of three conserved sequences that were uniquely clustered. Biophysical testing proved that G-quadruplex conformations were efficiently stabilized or induced by G-quadruplex ligands in all three sequences. Upon incubation with a G-quadruplex ligand, Nef expression was reduced in a reporter gene assay and Nef-dependent enhancement of HIV-1 infectivity was significantly repressed in an antiviral assay. These data constitute the first evidence of the possibility to regulate HIV-1 gene expression and infectivity through G-quadruplex targeting and therefore open a new avenue for viral treatment. PMID:24015290

  11. Thermochemistry of the activation of N2 on iron cluster cations: Guided ion beam studies of the reactions of Fen+ (n=1-19) with N2

    NASA Astrophysics Data System (ADS)

    Tan, Lin; Liu, Fuyi; Armentrout, P. B.

    2006-02-01

    The kinetic energy dependences of the reactions of Fen+ (n=1-19) with N2 are studied in a guided ion beam tandem mass spectrometer over the energy range of 0-15eV. In addition to collision-induced dissociation forming Fem+ ions, which dominate the product spectra, a variety of FemN2+ and FemN+ product ions, where m ⩽n, is observed. All processes are observed to exhibit thresholds. Fem+-N and Fem+-2N bond energies as a function of cluster size are derived from the threshold analysis of the kinetic energy dependences of the endothermic reactions. The trends in this thermochemistry are compared to the isoelectronic D0(Fen+-CH), and to bulk phase values. A fairly uniform barrier of 0.48±0.03eV at 0K is observed for formation of the FenN2+ product ions (n =12, 15-19) and can be related to the rate-limiting step in the Haber process for catalytic ammonia production.

  12. Crystal Structure of Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-associated Csn2 Protein Revealed Ca[superscript 2+]-dependent Double-stranded DNA Binding Activity

    SciTech Connect

    Nam, Ki Hyun; Kurinov, Igor; Ke, Ailong

    2012-05-22

    Clustered regularly interspaced short palindromic repeats (CRISPR) and their associated protein genes (cas genes) are widespread in bacteria and archaea. They form a line of RNA-based immunity to eradicate invading bacteriophages and malicious plasmids. A key molecular event during this process is the acquisition of new spacers into the CRISPR loci to guide the selective degradation of the matching foreign genetic elements. Csn2 is a Nmeni subtype-specific cas gene required for new spacer acquisition. Here we characterize the Enterococcus faecalis Csn2 protein as a double-stranded (ds-) DNA-binding protein and report its 2.7 {angstrom} tetrameric ring structure. The inner circle of the Csn2 tetrameric ring is {approx}26 {angstrom} wide and populated with conserved lysine residues poised for nonspecific interactions with ds-DNA. Each Csn2 protomer contains an {alpha}/{beta} domain and an {alpha}-helical domain; significant hinge motion was observed between these two domains. Ca{sup 2+} was located at strategic positions in the oligomerization interface. We further showed that removal of Ca{sup 2+} ions altered the oligomerization state of Csn2, which in turn severely decreased its affinity for ds-DNA. In summary, our results provided the first insight into the function of the Csn2 protein in CRISPR adaptation by revealing that it is a ds-DNA-binding protein functioning at the quaternary structure level and regulated by Ca{sup 2+} ions.

  13. Active photosynthesis in cyanobacterial mutants with directed modifications in the ligands for two iron-sulfur clusters on the PsaC protein of photosystem I.

    PubMed Central

    Mannan, R M; He, W Z; Metzger, S U; Whitmarsh, J; Malkin, R; Pakrasi, H B

    1996-01-01

    The PsaC protein of the Photosystem I (PSI) complex in thylakoid membranes coordinates two [4Fe-4S] clusters, FA and FB. Although it is known that PsaC participates in electron transfer to ferredoxin, the pathway of electrons through this protein is unknown. To elucidate the roles of FA and FB, we created two site-directed mutant strains of the cyanobacterium Anabaena variabilis ATCC 29413. In one mutant, cysteine 13, a ligand for FB was replaced by an aspartic acid (C13D); in the other mutant, cysteine 50, a ligand for FA was modified similarly (C50D). Low-temperature electron paramagnetic resonance studies demonstrated that the C50D mutant has a normal FB center and a modified FA center. In contrast, the C13D strain has normal FA, but failed to reveal any signal from FB. Room-temperature optical studies showed that C13D has only one functional electron acceptor in PsaC, whereas two such acceptors are functional in the C50D and wild-type strains. Although both mutants grow under photoautotrophic conditions, the rate of PSI-mediated electron transfer in C13D under low light levels is about half that of C50D or wild type. These data show that (i) FB is not essential for the assembly of the PsaC protein in PSI and (ii) FB is not absolutely required for electron transfer from the PSI reaction center to ferredoxin. PMID:8617228

  14. Formation of a unique cluster of G-quadruplex structures in the HIV-1 Nef coding region: implications for antiviral activity.

    PubMed

    Perrone, Rosalba; Nadai, Matteo; Poe, Jerrod A; Frasson, Ilaria; Palumbo, Manlio; Palù, Giorgio; Smithgall, Thomas E; Richter, Sara N

    2013-01-01

    G-quadruplexes are tetraplex structures of nucleic acids that can form in G-rich sequences. Their presence and functional role have been established in telomeres, oncogene promoters and coding regions of the human chromosome. In particular, they have been proposed to be directly involved in gene regulation at the level of transcription. Because the HIV-1 Nef protein is a fundamental factor for efficient viral replication, infectivity and pathogenesis in vitro and in vivo, we investigated G-quadruplex formation in the HIV-1 nef gene to assess the potential for viral inhibition through G-quadruplex stabilization. A comprehensive computational analysis of the nef coding region of available strains showed the presence of three conserved sequences that were uniquely clustered. Biophysical testing proved that G-quadruplex conformations were efficiently stabilized or induced by G-quadruplex ligands in all three sequences. Upon incubation with a G-quadruplex ligand, Nef expression was reduced in a reporter gene assay and Nef-dependent enhancement of HIV-1 infectivity was significantly repressed in an antiviral assay. These data constitute the first evidence of the possibility to regulate HIV-1 gene expression and infectivity through G-quadruplex targeting and therefore open a new avenue for viral treatment. PMID:24015290

  15. The LLNL Cluster Tool

    SciTech Connect

    Hunter, S L

    2007-03-27

    {lg_bullet} The Cluster Tool -is a set of linked vacuum chambers -can deposit multiple layers of metal and metal oxides {lg_bullet} Each layer can be deposited without breaking vacuum {lg_bullet} Shadow masks can give each layer a different pattern {lg_bullet} The Cluster Tool will be operational in April

  16. Cluster Interest Inventory.

    ERIC Educational Resources Information Center

    Herzog, Douglas

    The Cluster Interest Inventory is designed to familiarize students with representative occupations in 13 career clusters: (1) agribusiness and natural resources, (2) business marketing, and office occupations, (3) communications and media, (4) consumer and homemaker, (5) fine arts and humanities, (6) health, (7) manufacturing and processing, (8)…

  17. Coma cluster of galaxies

    NASA Technical Reports Server (NTRS)

    1999-01-01

    Atlas Image mosaic, covering 34' x 34' on the sky, of the Coma cluster, aka Abell 1656. This is a particularly rich cluster of individual galaxies (over 1000 members), most prominently the two giant ellipticals, NGC 4874 (right) and NGC 4889 (left). The remaining members are mostly smaller ellipticals, but spiral galaxies are also evident in the 2MASS image. The cluster is seen toward the constellation Coma Berenices, but is actually at a distance of about 100 Mpc (330 million light years, or a redshift of 0.023) from us. At this distance, the cluster is in what is known as the 'Hubble flow,' or the overall expansion of the Universe. As such, astronomers can measure the Hubble Constant, or the universal expansion rate, based on the distance to this cluster. Large, rich clusters, such as Coma, allow astronomers to measure the 'missing mass,' i.e., the matter in the cluster that we cannot see, since it gravitationally influences the motions of the member galaxies within the cluster. The near-infrared maps the overall luminous mass content of the member galaxies, since the light at these wavelengths is dominated by the more numerous older stellar populations. Galaxies, as seen by 2MASS, look fairly smooth and homogeneous, as can be seen from the Hubble 'tuning fork' diagram of near-infrared galaxy morphology. Image mosaic by S. Van Dyk (IPAC).

  18. Probability and Cancer Clusters

    ERIC Educational Resources Information Center

    Hamilton-Keene, Rachael; Lenard, Christoper T.; Mills, Terry M.

    2009-01-01

    Recently there have been several news items about possible cancer clusters in the Australian media. The term "cancer cluster" is used when an unusually large number of people in one geographic area, often a workplace, are diagnosed with cancer in a short space of time. In this paper the authors explore this important health issue using probability…

  19. Illinois' Career Cluster Model

    ERIC Educational Resources Information Center

    Jankowski, Natasha A.; Kirby, Catherine L.; Bragg, Debra D.; Taylor, Jason L.; Oertle, Kathleen M.

    2009-01-01

    This booklet provides information to multiple stakeholders on the implementation of career clusters in Illinois. The booklet is an extension of the previous edition titled "An Introduction to Illinois CTE Programs of Study" (2008), and provides a resource for partners to understand Illinois' Career Cluster Model as its own adaptation of the…

  20. Matlab Cluster Ensemble Toolbox

    2009-04-27

    This is a Matlab toolbox for investigating the application of cluster ensembles to data classification, with the objective of improving the accuracy and/or speed of clustering. The toolbox divides the cluster ensemble problem into four areas, providing functionality for each. These include, (1) synthetic data generation, (2) clustering to generate individual data partitions and similarity matrices, (3) consensus function generation and final clustering to generate ensemble data partitioning, and (4) implementation of accuracy metrics. Withmore » regard to data generation, Gaussian data of arbitrary dimension can be generated. The kcenters algorithm can then be used to generate individual data partitions by either, (a) subsampling the data and clustering each subsample, or by (b) randomly initializing the algorithm and generating a clustering for each initialization. In either case an overall similarity matrix can be computed using a consensus function operating on the individual similarity matrices. A final clustering can be performed and performance metrics are provided for evaluation purposes.« less

  1. Mixed-Initiative Clustering

    ERIC Educational Resources Information Center

    Huang, Yifen

    2010-01-01

    Mixed-initiative clustering is a task where a user and a machine work collaboratively to analyze a large set of documents. We hypothesize that a user and a machine can both learn better clustering models through enriched communication and interactive learning from each other. The first contribution or this thesis is providing a framework of…

  2. Young Massive Star Clusters

    NASA Astrophysics Data System (ADS)

    Portegies Zwart, Simon F.; McMillan, Stephen L. W.; Gieles, Mark

    2010-09-01

    Young massive clusters (YMCs) are dense aggregates of young stars that form the fundamental building blocks of galaxies. Several examples exist in the Milky Way Galaxy and the Local Group, but they are particularly abundant in starburst and interacting galaxies. The few YMCs that are close enough to resolve are of prime interest for studying the stellar mass function and the ecological interplay between stellar evolution and stellar dynamics. The distant unresolved clusters may be effectively used to study the star-cluster mass function, and they provide excellent constraints on the formation mechanisms of young cluster populations. YMCs are expected to be the nurseries for many unusual objects, including a wide range of exotic stars and binaries. So far only a few such objects have been found in YMCs, although their older cousins, the globular clusters, are unusually rich in stellar exotica. In this review, we focus on star clusters younger than ˜100 Myr, more than a few current crossing times old, and more massive than ˜104M⊙; the size of the cluster and its environment are considered less relevant as distinguishing parameters. We describe the global properties of the currently known young massive star clusters in the Local Group and beyond, and discuss the state of the art in observations and dynamical modeling of these systems. In order to make this review readable by observers, theorists, and computational astrophysicists, we also review the cross-disciplinary terminology.

  3. Blue emitting undecaplatinum clusters

    NASA Astrophysics Data System (ADS)

    Chakraborty, Indranath; Bhuin, Radha Gobinda; Bhat, Shridevi; Pradeep, T.

    2014-07-01

    A blue luminescent 11-atom platinum cluster showing step-like optical features and the absence of plasmon absorption was synthesized. The cluster was purified using high performance liquid chromatography (HPLC). Electrospray ionization (ESI) and matrix assisted laser desorption ionization (MALDI) mass spectrometry (MS) suggest a composition, Pt11(BBS)8, which was confirmed by a range of other experimental tools. The cluster is highly stable and compatible with many organic solvents.A blue luminescent 11-atom platinum cluster showing step-like optical features and the absence of plasmon absorption was synthesized. The cluster was purified using high performance liquid chromatography (HPLC). Electrospray ionization (ESI) and matrix assisted laser desorption ionization (MALDI) mass spectrometry (MS) suggest a composition, Pt11(BBS)8, which was confirmed by a range of other experimental tools. The cluster is highly stable and compatible with many organic solvents. Electronic supplementary information (ESI) available: Details of experimental procedures, instrumentation, chromatogram of the crude cluster; SEM/EDAX, DLS, PXRD, TEM, FT-IR, and XPS of the isolated Pt11 cluster; UV/Vis, MALDI MS and SEM/EDAX of isolated 2 and 3; and 195Pt NMR of the K2PtCl6 standard. See DOI: 10.1039/c4nr02778g

  4. Brightest Cluster Galaxy Identification

    NASA Astrophysics Data System (ADS)

    Leisman, Luke; Haarsma, D. B.; Sebald, D. A.; ACCEPT Team

    2011-01-01

    Brightest cluster galaxies (BCGs) play an important role in several fields of astronomical research. The literature includes many different methods and criteria for identifying the BCG in the cluster, such as choosing the brightest galaxy, the galaxy nearest the X-ray peak, or the galaxy with the most extended profile. Here we examine a sample of 75 clusters from the Archive of Chandra Cluster Entropy Profile Tables (ACCEPT) and the Sloan Digital Sky Survey (SDSS), measuring masked magnitudes and profiles for BCG candidates in each cluster. We first identified galaxies by hand; in 15% of clusters at least one team member selected a different galaxy than the others.We also applied 6 other identification methods to the ACCEPT sample; in 30% of clusters at least one of these methods selected a different galaxy than the other methods. We then developed an algorithm that weighs brightness, profile, and proxi