Science.gov

Sample records for activation cluster csmac

  1. Active matter clusters at interfaces

    NASA Astrophysics Data System (ADS)

    Copenhagen, Katherine; Gopinathan, Ajay

    Collective and directed motility or swarming is an emergent phenomenon displayed by many self-organized assemblies of active biological matter such as clusters of embryonic cells during tissue development and flocks of birds. Such clusters typically encounter very heterogeneous environments. What happens when a cluster encounters an interface between two different environments has implications for its function and fate. Here we study this problem by using a mathematical model of a cluster that treats it as a single cohesive unit whose movement depends on the nature of the local environment. We find that low speed clusters which exert forces but no active torques, encountering an interface with a moderate difference in properties can lead to refraction or even total internal reflection of the cluster. For large speeds and clusters with active torques, they show more complex behaviors crossing the interface multiple times, becoming trapped at the interface and deviating from the predictable refraction and reflection of the low velocity clusters. Our results show a wide range of behaviors that occur when collectively moving active biological matter moves across interfaces and these insights can be used to control motion by patterning environments.

  2. Active matter clusters at interfaces.

    NASA Astrophysics Data System (ADS)

    Copenhagen, Katherine; Gopinathan, Ajay

    2016-03-01

    Collective and directed motility or swarming is an emergent phenomenon displayed by many self-organized assemblies of active biological matter such as clusters of embryonic cells during tissue development, cancerous cells during tumor formation and metastasis, colonies of bacteria in a biofilm, or even flocks of birds and schools of fish at the macro-scale. Such clusters typically encounter very heterogeneous environments. What happens when a cluster encounters an interface between two different environments has implications for its function and fate. Here we study this problem by using a mathematical model of a cluster that treats it as a single cohesive unit that moves in two dimensions by exerting a force/torque per unit area whose magnitude depends on the nature of the local environment. We find that low speed (overdamped) clusters encountering an interface with a moderate difference in properties can lead to refraction or even total internal reflection of the cluster. For large speeds (underdamped), where inertia dominates, the clusters show more complex behaviors crossing the interface multiple times and deviating from the predictable refraction and reflection for the low velocity clusters. We then present an extreme limit of the model in the absence of rotational damping where clusters can become stuck spiraling along the interface or move in large circular trajectories after leaving the interface. Our results show a wide range of behaviors that occur when collectively moving active biological matter moves across interfaces and these insights can be used to control motion by patterning environments.

  3. Active constrained clustering by examining spectral Eigenvectors

    NASA Technical Reports Server (NTRS)

    Wagstaff, Kiri L.; desJardins, Marie; Xu, Qianjun

    2005-01-01

    This work focuses on the active selection of pairwise constraints for spectral clustering. We develop and analyze a technique for Active Constrained Clustering by Examining Spectral eigenvectorS (ACCESS) derived from a similarity matrix.

  4. Nano-clustering of ligands on surrogate antigen presenting cells modulates T cell membrane adhesion and organization.

    PubMed

    Dillard, Pierre; Pi, Fuwei; Lellouch, Annemarie C; Limozin, Laurent; Sengupta, Kheya

    2016-03-14

    We investigate the adhesion and molecular organization of the plasma membrane of T lymphocytes interacting with a surrogate antigen presenting cell comprising glass supported ordered arrays of antibody (α-CD3) nano-dots dispersed in a non-adhesive matrix of polyethylene glycol (PEG). The local membrane adhesion and topography, as well as the distribution of the T cell receptors (TCRs) and the kinase ZAP-70, are influenced by dot-geometry, whereas the cell spreading area is determined by the overall average density of the ligands rather than specific characteristics of the dots. TCR clusters are recruited preferentially to the nano-dots and the TCR cluster size distribution has a weak dot-size dependence. On the patterns, the clusters are larger, more numerous, and more enriched in TCRs, as compared to the homogeneously distributed ligands at comparable concentrations. These observations support the idea that non-ligated TCRs residing in the non-adhered parts of the proximal membrane are able to diffuse and enrich the existing clusters at the ligand dots. However, long distance transport is impaired and cluster centralization in the form of a central supramolecular cluster (cSMAC) is not observed. Time-lapse imaging of early cell-surface contacts indicates that the ZAP-70 microclusters are directly recruited to the site of the antibody dots and this process is concomitant with membrane adhesion. These results together point to a complex interplay of adhesion, molecular organization and activation in response to spatially modulated stimulation.

  5. Cluster Wideband Data Products in the Cluster Active Archive

    NASA Astrophysics Data System (ADS)

    Pickett, J. S.; Seeberger, J. M.; Christopher, I. W.; Santolík, O.; Sigsbee, K. M.

    Cluster Wideband Data (WBD) plasma wave receivers are mounted on all four of the Cluster spacecraft providing approximately 4-7% orbit coverage since mission operations began in February 2001. Data obtained by the WBD instruments are downlinked in real time to various Deep Space Network (DSN) and Panska Ves (PV) ground stations. The strengths of the WBD instruments lie in their high time and frequency resolution data, which allow analysis of the wave fine structure in order to more accurately investigate the linear and nonlinear nature of the waves, and in their use in carrying out Very Long Baseline Interferometry (VLBI) investigations to locate and characterize remote wave sources and their characteristics. The WBD team has already archived at the Cluster Active Archive (CAA) the documentation, software and data plots required for carrying on an independent scientific investigation. A document on interpretation issues has also been archived to help ensure that signals which are not naturally in the plasma are not misinterpreted. The WBD team also plans to archive digital, calibrated data files for the entire mission in cdf format at NASA's CDAWeb and submit these files for conversion to the Cluster standard cef format and archiving at the CAA. In order to ensure that the calibration of the WBD data has been done properly, WBD has taken part in Cluster cross calibration activities with the other wave instruments with regard to wave amplitudes in the time and frequency domains and with the PEACE instruments with regard to low density measurements.

  6. PEACE Data in the Cluster Active Archive

    NASA Astrophysics Data System (ADS)

    Fazakerley, A. N.; Lahiff, A. D.; Wilson, R. J.; Rozum, I.; Anekallu, C.; West, M.; Bacai, H.

    We describe the data products of the Cluster Plasma Electron and Current Experiment (PEACE) instruments which have been produced for the Cluster Active Archive. This article is intended to introduce the PEACE instruments, the measured data and the data products provided through the CAA. We aim to help the researcher to choose the data products most suited to their needs and to avoid inadvertent misuse of the data.

  7. Egocentric daily activity recognition via multitask clustering.

    PubMed

    Yan, Yan; Ricci, Elisa; Liu, Gaowen; Sebe, Nicu

    2015-10-01

    Recognizing human activities from videos is a fundamental research problem in computer vision. Recently, there has been a growing interest in analyzing human behavior from data collected with wearable cameras. First-person cameras continuously record several hours of their wearers' life. To cope with this vast amount of unlabeled and heterogeneous data, novel algorithmic solutions are required. In this paper, we propose a multitask clustering framework for activity of daily living analysis from visual data gathered from wearable cameras. Our intuition is that, even if the data are not annotated, it is possible to exploit the fact that the tasks of recognizing everyday activities of multiple individuals are related, since typically people perform the same actions in similar environments, e.g., people working in an office often read and write documents). In our framework, rather than clustering data from different users separately, we propose to look for clustering partitions which are coherent among related tasks. In particular, two novel multitask clustering algorithms, derived from a common optimization problem, are introduced. Our experimental evaluation, conducted both on synthetic data and on publicly available first-person vision data sets, shows that the proposed approach outperforms several single-task and multitask learning methods. PMID:26067371

  8. Pattern Activity Clustering and Evaluation (PACE)

    NASA Astrophysics Data System (ADS)

    Blasch, Erik; Banas, Christopher; Paul, Michael; Bussjager, Becky; Seetharaman, Guna

    2012-06-01

    With the vast amount of network information available on activities of people (i.e. motions, transportation routes, and site visits) there is a need to explore the salient properties of data that detect and discriminate the behavior of individuals. Recent machine learning approaches include methods of data mining, statistical analysis, clustering, and estimation that support activity-based intelligence. We seek to explore contemporary methods in activity analysis using machine learning techniques that discover and characterize behaviors that enable grouping, anomaly detection, and adversarial intent prediction. To evaluate these methods, we describe the mathematics and potential information theory metrics to characterize behavior. A scenario is presented to demonstrate the concept and metrics that could be useful for layered sensing behavior pattern learning and analysis. We leverage work on group tracking, learning and clustering approaches; as well as utilize information theoretical metrics for classification, behavioral and event pattern recognition, and activity and entity analysis. The performance evaluation of activity analysis supports high-level information fusion of user alerts, data queries and sensor management for data extraction, relations discovery, and situation analysis of existing data.

  9. Scaling of cluster growth for coagulating active particles.

    PubMed

    Cremer, Peet; Löwen, Hartmut

    2014-02-01

    Cluster growth in a coagulating system of active particles (such as microswimmers in a solvent) is studied by theory and simulation. In contrast to passive systems, the net velocity of a cluster can have various scalings dependent on the propulsion mechanism and alignment of individual particles. Additionally, the persistence length of the cluster trajectory typically increases with size. As a consequence, a growing cluster collects neighboring particles in a very efficient way and thus amplifies its growth further. This results in unusual large growth exponents for the scaling of the cluster size with time and, for certain conditions, even leads to "explosive" cluster growth where the cluster becomes macroscopic in a finite amount of time.

  10. Multimolecular Analysis of Stable Immunological Synapses Reveals Sustained Recruitment and Sequential Assembly of Signaling Clusters*

    PubMed Central

    Philipsen, Lars; Engels, Thomas; Schilling, Kerstin; Gurbiel, Slavyana; Fischer, Klaus-Dieter; Tedford, Kerry; Schraven, Burkhart; Gunzer, Matthias; Reichardt, Peter

    2013-01-01

    The formation of the immunological synapse between T cells and antigen-presenting cells (APC) begins within minutes of contact and can take hours for full T-cell activation. Although early phases of the synapse have been extensively studied for a select number of proteins, later phases have not yet been examined in detail. We studied the signaling network in stable synapses by measuring the simultaneous localization of 25 signaling and structural molecules over 2 h at the level of individual synapses using multi-epitope ligand cartography (MELC). Signaling proteins including phospho(p)ZAP70, pSLP76, pCD3ζ, and pLAT, along with proteins that influence synapse structure such as F-actin, tubulin, CD45, and ICAM-1, were localized in images of synapses and revealed the multidimensional construction of a mature synapse. The construction of the stable synapse included intense early TCR signaling, a phase of recruitment of structural proteins, and a sustained increase in signaling molecules and colocalization of TCR and pLAT signaling clusters in the center of the synapse. Consolidation of TCR and associated proteins resulted in formation of a small number of discrete synaptic microclusters. Development of synapses and cSMAC composition was greatly affected by the absence of Vav1, with an associated loss in PLCγ1 recruitment, pSLP76, and increased CXCR4. Together, these data demonstrate the use of multi-epitope ligand cartography to quantitatively analyze synapse formation and reveal successive recruitment of structural and signaling proteins and sustained phosphorylation at the mature synapse. PMID:23754785

  11. Active dipole clusters: From helical motion to fission.

    PubMed

    Kaiser, Andreas; Popowa, Katarina; Löwen, Hartmut

    2015-07-01

    The structure of a finite particle cluster is typically determined by total energy minimization. Here we consider the case where a cluster of soft-sphere dipoles becomes active, i.e., when the individual particles exhibit an additional self-propulsion along their dipole moments. We numerically solve the overdamped equations of motion for soft-sphere dipoles in a solvent. Starting from an initial metastable dipolar cluster, the self-propulsion generates a complex cluster dynamics. The final cluster state has in general a structure widely different to the initial one, the details depend on the model parameters and on the protocol of how the self-propulsion is turned on. The center of mass of the cluster moves on a helical path, the details of which are governed by the initial cluster magnetization. An instantaneous switch to a high self-propulsion leads to fission of the cluster. However, fission does not occur if the self-propulsion is increased slowly to high strengths. Our predictions can be verified through experiments with self-phoretic colloidal Janus particles and for macroscopic self-propelled dipoles in a highly viscous solvent.

  12. Active galactic nucleus feedback in clusters of galaxies

    PubMed Central

    Blanton, Elizabeth L.; Clarke, T. E.; Sarazin, Craig L.; Randall, Scott W.; McNamara, Brian R.

    2010-01-01

    Observations made during the last ten years with the Chandra X-ray Observatory have shed much light on the cooling gas in the centers of clusters of galaxies and the role of active galactic nucleus (AGN) heating. Cooling of the hot intracluster medium in cluster centers can feed the supermassive black holes found in the nuclei of the dominant cluster galaxies leading to AGN outbursts which can reheat the gas, suppressing cooling and large amounts of star formation. AGN heating can come in the form of shocks, buoyantly rising bubbles that have been inflated by radio lobes, and the dissipation of sound waves. PMID:20351250

  13. Interaction of metallic clusters with biologically active curcumin molecules

    NASA Astrophysics Data System (ADS)

    Gupta, Sanjeev K.; He, Haiying; Liu, Chunhui; Dutta, Ranu; Pandey, Ravindra

    2015-09-01

    We have investigated the interaction of subnano metallic Gd and Au clusters with curcumin, an important biomolecule having pharmacological activity. Gd clusters show different site preference to curcumin and much stronger interaction strength, in support of the successful synthesis of highly stable curcumin-coated Gd nanoparticles as reported recently. It can be attributed to significant charge transfer from the Gd cluster to curcumin together with a relatively strong hybridization of the Gd df-orbitals with curcumin p-orbitals. These results suggest that Gd nanoparticles can effectively be used as delivery carriers for curcumin at the cellular level for therapy and medical imaging applications.

  14. Active transport and cluster formation on 2D networks.

    PubMed

    Greulich, P; Santen, L

    2010-06-01

    We introduce a model for active transport on inhomogeneous networks embedded in a diffusive environment which is motivated by vesicular transport on actin filaments. In the presence of a hard-core interaction, particle clusters are observed that exhibit an algebraically decaying distribution in a large parameter regime, indicating the existence of clusters on all scales. The scale-free behavior can be understood by a mechanism promoting preferential attachment of particles to large clusters. The results are compared with a diffusion-limited aggregation model and active transport on a regular network. For both models we observe aggregation of particles to clusters which are characterized by a finite size scale if the relevant time scales and particle densities are considered. PMID:20556462

  15. Radio active galactic nuclei in galaxy clusters: Feedback, merger signatures, and cluster tracers

    NASA Astrophysics Data System (ADS)

    Paterno-Mahler, Rachel Beth

    Galaxy clusters, the largest gravitationally-bound structures in the universe, are composed of 50-1000s of galaxies, hot X-ray emitting gas, and dark matter. They grow in size over time through cluster and group mergers. The merger history of a cluster can be imprinted on the hot gas, known as the intracluster medium (ICM). Merger signatures include shocks, cold fronts, and sloshing of the ICM, which can form spiral structures. Some clusters host double-lobed radio sources driven by active galactic nuclei (AGN). First, I will present a study of the galaxy cluster Abell 2029, which is very relaxed on large scales and has one of the largest continuous sloshing spirals yet observed in the X-ray, extending outward approximately 400 kpc. The sloshing gas interacts with the southern lobe of the radio galaxy, causing it to bend. Energy injection from the AGN is insufficient to offset cooling. The sloshing spiral may be an important additional mechanism in preventing large amounts of gas from cooling to very low temperatures. Next, I will present a study of Abell 98, a triple system currently undergoing a merger. I will discuss the merger history, and show that it is causing a shock. The central subcluster hosts a double-lobed AGN, which is evacuating a cavity in the ICM. Understanding the physical processes that affect the ICM is important for determining the mass of clusters, which in turn affects our calculations of cosmological parameters. To further constrain these parameters, as well as models of galaxy evolution, it is important to use a large sample of galaxy clusters over a range of masses and redshifts. Bent, double-lobed radio sources can potentially act as tracers of galaxy clusters over wide ranges of these parameters. I examine how efficient bent radio sources are at tracing high-redshift (z>0.7) clusters. Out of 646 sources in our high-redshift Clusters Occupied by Bent Radio AGN (COBRA) sample, 282 are candidate new, distant clusters of galaxies based on

  16. Unsupervised active learning based on hierarchical graph-theoretic clustering.

    PubMed

    Hu, Weiming; Hu, Wei; Xie, Nianhua; Maybank, Steve

    2009-10-01

    Most existing active learning approaches are supervised. Supervised active learning has the following problems: inefficiency in dealing with the semantic gap between the distribution of samples in the feature space and their labels, lack of ability in selecting new samples that belong to new categories that have not yet appeared in the training samples, and lack of adaptability to changes in the semantic interpretation of sample categories. To tackle these problems, we propose an unsupervised active learning framework based on hierarchical graph-theoretic clustering. In the framework, two promising graph-theoretic clustering algorithms, namely, dominant-set clustering and spectral clustering, are combined in a hierarchical fashion. Our framework has some advantages, such as ease of implementation, flexibility in architecture, and adaptability to changes in the labeling. Evaluations on data sets for network intrusion detection, image classification, and video classification have demonstrated that our active learning framework can effectively reduce the workload of manual classification while maintaining a high accuracy of automatic classification. It is shown that, overall, our framework outperforms the support-vector-machine-based supervised active learning, particularly in terms of dealing much more efficiently with new samples whose categories have not yet appeared in the training samples. PMID:19336318

  17. Digital Wave Processor Products in the Cluster Active Archive

    NASA Astrophysics Data System (ADS)

    Yearby, K. H.; Alleyne, H. St. C.; Walker, S. N.; Bates, I.; Gough, M. P.; Buckley, A.; Carozzi, T. D.

    The Digital Wave Processor (DWP) is the central control and data processing instrument for the Cluster Wave Experiment Consortium. DWP products in the Cluster Active Archive (CAA) provide a mainly supporting function for the rest of the consortium. This includes a time correction dataset which allows the standard timing accuracy of 2 ms to be improved to around 20 μs, and experiment command and status datasets which show what commands have been sent to the experiments, and the resulting status. DWP also contains a particle correlator experiment that computes the auto-correlation of electron counts received by the PEACE electron experiment via an inter-experiment link.

  18. Multiscale time activity data exploration via temporal clustering visualization spreadsheet.

    PubMed

    Woodring, Jonathan; Shen, Han-Wei

    2009-01-01

    Time-varying data is usually explored by animation or arrays of static images. Neither is particularly effective for classifying data by different temporal activities. Important temporal trends can be missed due to the lack of ability to find them with current visualization methods. In this paper, we propose a method to explore data at different temporal resolutions to discover and highlight data based upon time-varying trends. Using the wavelet transform along the time axis, we transform data points into multi-scale time series curve sets. The time curves are clustered so that data of similar activity are grouped together, at different temporal resolutions. The data are displayed to the user in a global time view spreadsheet where she is able to select temporal clusters of data points, and filter and brush data across temporal scales. With our method, a user can interact with data based on time activities and create expressive visualizations. PMID:19008560

  19. Activity and Rotation in the Young Cluster h Per

    NASA Astrophysics Data System (ADS)

    Argiroffi, C.; Caramazza, M.; Micela, G.; Moraux, E.; Bouvier, J.

    2014-08-01

    We study the rotation-activity relationship for low-mass members of the young cluster h Persei, a ~13 Myr old cluster. h Per, thanks to its age, allows us to link the rotation-activity relation observed for main-sequence stars to the still unexplained activity levels of very young clusters. We constrained the activity levels of h Per members by analyzing a deep Chandra/ACIS-I observation pointed to the central field of h Per. We combined this X-ray catalog with the catalog of h Per members with measured rotational period, presented by Moraux et al. (2013). We obtained a final catalog of 202 h Per members with measured X-ray luminosity and rotational period. We investigate the rotation-activity relation of h Per members considering different mass ranges. We find that stars with 1.3 M⊙ > M 1.4 M⊙ show significant evidence of supersaturation for short periods. This phenomenon is instead not observed for lower mass stars.

  20. STAR FORMATION ACTIVITY IN CLASH BRIGHTEST CLUSTER GALAXIES

    SciTech Connect

    Fogarty, Kevin; Postman, Marc; Connor, Thomas; Donahue, Megan; Moustakas, John

    2015-11-10

    The CLASH X-ray selected sample of 20 galaxy clusters contains 10 brightest cluster galaxies (BCGs) that exhibit significant (>5σ) extinction-corrected star formation rates (SFRs). Star formation activity is inferred from photometric estimates of UV and Hα+[N ii] emission in knots and filaments detected in CLASH Hubble Space Telescope ACS and WFC3 observations. UV-derived SFRs in these BCGs span two orders of magnitude, including two with a SFR ≳ 100 M{sub ⊙} yr{sup −1}. These measurements are supplemented with [O ii], [O iii], and Hβ fluxes measured from spectra obtained with the SOAR telescope. We confirm that photoionization from ongoing star formation powers the line emission nebulae in these BCGs, although in many BCGs there is also evidence of a LINER-like contribution to the line emission. Coupling these data with Chandra X-ray measurements, we infer that the star formation occurs exclusively in low-entropy cluster cores and exhibits a correlation with gas properties related to cooling. We also perform an in-depth study of the starburst history of the BCG in the cluster RXJ1532.9+3021, and create 2D maps of stellar properties on scales down to ∼350 pc. These maps reveal evidence for an ongoing burst occurring in elongated filaments, generally on ∼0.5–1.0 Gyr timescales, although some filaments are consistent with much younger (≲100 Myr) burst timescales and may be correlated with recent activity from the active galactic nucleus. The relationship between BCG SFRs and the surrounding intracluster medium gas properties provide new support for the process of feedback-regulated cooling in galaxy clusters and is consistent with recent theoretical predictions.

  1. Clues to galaxy activity from rich cluster simulations

    NASA Technical Reports Server (NTRS)

    Evrard, August E.

    1990-01-01

    New simulations of rich cluster evolution are used to evaluate the first infall hypothesis of Gunn and Dressler - the idea that the enhanced fraction of active galaxies seen in high redshift clusters is due to a one-time burst of star formation triggered by the rapid rise in external pressure as a galaxy plows into the hot intracluster medium (ICM). Using three-dimensional simulations which contain both baryonic gas and collisionless dark material, local static pressure histories for test orbits of galaxies are generated and a simple trigger threshold based on dP/dt/P sub ISM is applied to define an active fraction of the population. The results lend qualitative and quantitative support to the first infall interpretation.

  2. Spatiotemporal regulation of T cell co-stimulation by TCR-CD28 microclusters through PKCθ translocation

    PubMed Central

    Yokosuka, Tadashi; Kobayashi, Wakana; Sakata-Sogawa, Kumiko; Hashimoto-Tane, Akiko; Dustin, Michel L.; Tokunaga, Makio; Saito, Takashi

    2010-01-01

    Summary T cell activation is mediated by microclusters (MCs) containing TCRs, kinases, and adaptors. Although TCR-MCs translocate to form a central supramolecular activation cluster (c-SMAC) of immunological synapse between T cells and antigen-presenting cells (APCs), the role of MC translocation in T cell signaling remains unclear. Here, we found that the accumulation of MCs in c-SMAC was important for T cell co-stimulation. Using planar bilayer system, co-stimulatory receptor CD28 was initially recruited coordinately with TCR to MCs and its signals was mediated through the assembly with PKCθ. Their co-localization and assembly is correlated withco-stimulatory function. The accumulation of MCs at c-SMAC was accompanied by segregation of CD28 from TCRs and both CD28 and PKCθ translocated to a spatially unique sub-zone of c-SMAC. Thus, co-stimulation is mediated by generating a novel co-stimulatory compartment in c-SMAC via the dynamic regulation of MC translocation. PMID:18848472

  3. Active spacecraft potential control: An ion emitter experiment. [Cluster mission

    NASA Technical Reports Server (NTRS)

    Riedler, W.; Goldstein, R.; Hamelin, M.; Maehlum, B. N.; Troim, J.; Olsen, R. C.; Pedersen, A.; Grard, R. J. L.; Schmidt, R.; Rudenauer, F.

    1988-01-01

    The cluster spacecraft are instrumented with ion emitters for charge neutralization. The emitters produce indium ions at 6 keV. The ion current is adjusted in a feedback loop with instruments measuring the spacecraft potential. The system is based on the evaporation of indium in the apex field of a needle. The design of the active spacecraft potential control instruments, and the ion emitters is presented.

  4. Composition and topology of activity cliff clusters formed by bioactive compounds.

    PubMed

    Stumpfe, Dagmar; Dimova, Dilyana; Bajorath, Jürgen

    2014-02-24

    The assessment of activity cliffs has thus far mostly focused on compound pairs, although the majority of activity cliffs are not formed in isolation but in a coordinated manner involving multiple active compounds and cliffs. However, the composition of coordinated activity cliff configurations and their topologies are unknown. Therefore, we have identified all activity cliff configurations formed by currently available bioactive compounds and analyzed them in network representations where activity cliff configurations occur as clusters. The composition, topology, frequency of occurrence, and target distribution of activity cliff clusters have been determined. A limited number of large cliff clusters with unique topologies were identified that were centers of activity cliff formation. These clusters originated from a small number of target sets. However, most clusters were of small to moderate size. Three basic topologies were sufficient to describe recurrent activity cliff cluster motifs/topologies. For example, frequently occurring clusters with star topology determined the scale-free character of the global activity cliff network and represented a characteristic activity cliff configuration. Large clusters with complex topology were often found to contain different combinations of basic topologies. Our study provides a first view of activity cliff configurations formed by currently available bioactive compounds and of the recurrent topologies of activity cliff clusters. Activity cliff clusters of defined topology can be selected, and from compounds forming the clusters, SAR information can be obtained. The SAR information of activity cliff clusters sharing a/one specific activity and topology can be compared.

  5. Chandra Finds Surprising Black Hole Activity In Galaxy Cluster

    NASA Astrophysics Data System (ADS)

    2002-09-01

    Scientists at the Carnegie Observatories in Pasadena, California, have uncovered six times the expected number of active, supermassive black holes in a single viewing of a cluster of galaxies, a finding that has profound implications for theories as to how old galaxies fuel the growth of their central black holes. The finding suggests that voracious, central black holes might be as common in old, red galaxies as they are in younger, blue galaxies, a surprise to many astronomers. The team made this discovery with NASA'S Chandra X-ray Observatory. They also used Carnegie's 6.5-meter Walter Baade Telescope at the Las Campanas Observatory in Chile for follow-up optical observations. "This changes our view of galaxy clusters as the retirement homes for old and quiet black holes," said Dr. Paul Martini, lead author on a paper describing the results that appears in the September 10 issue of The Astrophysical Journal Letters. "The question now is, how do these black holes produce bright X-ray sources, similar to what we see from much younger galaxies?" Typical of the black hole phenomenon, the cores of these active galaxies are luminous in X-ray radiation. Yet, they are obscured, and thus essentially undetectable in the radio, infrared and optical wavebands. "X rays can penetrate obscuring gas and dust as easily as they penetrate the soft tissue of the human body to look for broken bones," said co-author Dr. Dan Kelson. "So, with Chandra, we can peer through the dust and we have found that even ancient galaxies with 10-billion-year-old stars can have central black holes still actively pulling in copious amounts of interstellar gas. This activity has simply been hidden from us all this time. This means these galaxies aren't over the hill after all and our theories need to be revised." Scientists say that supermassive black holes -- having the mass of millions to billions of suns squeezed into a region about the size of our Solar System -- are the engines in the cores of

  6. Analysis of Cluster spacecraft potential during active control

    NASA Astrophysics Data System (ADS)

    Torkar, K.; Fehringer, M.; Escoubet, C. P.; André, M.; Pedersen, A.; Svenes, K. R.; Décréau, P. M. E.

    The floating potential of a spacecraft is determined by an equilibrium between photo-electron emission from the sunlit spacecraft surfaces and the plasma electron current, while other currents play a secondary role. On the Cluster spacecraft, the presence of the experiment ASPOC to control the potential by an ion beam with currents up to several tens of microamperes and energies of several keV provides an opportunity to study the interaction between the spacecraft and the ambient plasma with the current of the artificial ion beam as an additional parameter. The effect of active control on the Cluster spacecraft potential in the various plasma environments is presented in an overall statistics. Changes of the potential resulting from switching the ion beam current to different levels serve to calibrate the density-potential relationship.

  7. Star Formation Activity in CLASH Brightest Cluster Galaxies

    NASA Astrophysics Data System (ADS)

    Fogarty, Kevin; Postman, Marc; Connor, Thomas; Donahue, Megan; Moustakas, John

    2015-11-01

    The CLASH X-ray selected sample of 20 galaxy clusters contains 10 brightest cluster galaxies (BCGs) that exhibit significant (>5σ) extinction-corrected star formation rates (SFRs). Star formation activity is inferred from photometric estimates of UV and Hα+[N ii] emission in knots and filaments detected in CLASH Hubble Space Telescope ACS and WFC3 observations. UV-derived SFRs in these BCGs span two orders of magnitude, including two with a SFR ≳ 100 M⊙ yr-1. These measurements are supplemented with [O ii], [O iii], and Hβ fluxes measured from spectra obtained with the SOAR telescope. We confirm that photoionization from ongoing star formation powers the line emission nebulae in these BCGs, although in many BCGs there is also evidence of a LINER-like contribution to the line emission. Coupling these data with Chandra X-ray measurements, we infer that the star formation occurs exclusively in low-entropy cluster cores and exhibits a correlation with gas properties related to cooling. We also perform an in-depth study of the starburst history of the BCG in the cluster RXJ1532.9+3021, and create 2D maps of stellar properties on scales down to ˜350 pc. These maps reveal evidence for an ongoing burst occurring in elongated filaments, generally on ˜0.5-1.0 Gyr timescales, although some filaments are consistent with much younger (≲100 Myr) burst timescales and may be correlated with recent activity from the active galactic nucleus. The relationship between BCG SFRs and the surrounding intracluster medium gas properties provide new support for the process of feedback-regulated cooling in galaxy clusters and is consistent with recent theoretical predictions. Based on observations obtained at the Southern Astrophysical Research (SOAR) telescope, which is a joint project of the Ministério da Ciência, Tecnologia, e Inovação (MCTI) da República Federativa do Brasil, the U.S. National Optical Astronomy Observatory (NOAO), the University of North Carolina at Chapel

  8. Analysis of Cluster spacecraft potential during active control

    NASA Astrophysics Data System (ADS)

    Torkar, K.; Fehringer, M.; Escoubet, C.; Andre, M.; Pedersen, A.; Svenes, K.; Décréau, P.

    The floating potential of a spacecraft is determined by an equilibrium between photo-electron emission from the sunlit spacecraft surfaces, plasma electron current, and secondary effects. Without spacecraft potential control, the result largely reflects the density and temperature of the ambient plasma. On the Cluster spacecraft, the presence of the experiment ASPOC to control the potential by an ion beam with currents up to several tens of microamperes and energies of several keV provides an opportunity to study the interaction between the spacecraft and the ambient plasma with the current of the artificial ion beam as an additional parameter. Changes of the potential resulting from switching the ion beam current to different levels serve to calibrate the density-potential relationship. Wave data are used to obtain independent information on plasma density. The measurements onboard Cluster are compared with models and data from other spacecraft. After describing the principle of the interaction and showing some events out of the first 1.5 years of operation, an overall statistic is presented, describing the effect of active control on the Cluster spacecraft potential in the various plasma environments.

  9. A new vampire saga: the molecular mechanism of T cell trogocytosis.

    PubMed

    Dopfer, Elaine Pashupati; Minguet, Susana; Schamel, Wolfgang W A

    2011-08-26

    In the current issue of Immunity, Martínez-Martín et al. (2011) describe the central supramolecular activation cluster (cSMAC) as a site of clathrin-independent T cell receptor (TCR) internalization and trogocytosis. Further, they identify small Rho GTPases TC21 and RhoG as key mediators of these processes.

  10. A Gamblers Clustering Based on Their Favorite Gambling Activity.

    PubMed

    Challet-Bouju, Gaëlle; Hardouin, Jean-Benoit; Renard, Noëlle; Legauffre, Cindy; Valleur, Marc; Magalon, David; Fatséas, Mélina; Chéreau-Boudet, Isabelle; Gorsane, Mohamed-Ali; Vénisse, Jean-Luc; Grall-Bronnec, Marie

    2015-12-01

    The objective of this study was to identify profiles of gamblers to explain the choice of preferred gambling activity among both problem and non-problem gamblers. 628 non-problem and problem gamblers were assessed with a structured interview including "healthy" (sociodemographic characteristics, gambling habits and personality profile assessed with the Temperament and Character Inventory-125) and "pathological" [diagnosis of pathological gambling, gambling-related cognitions (GRCs) and psychiatric comorbidity] variables. We performed a two-step cluster analysis based solely on "healthy" variables to identify gamblers' profiles which typically reflect the choice of preferred gambling activity. The obtained classes were then described using both "healthy" and "pathological" variables, by comparing each class to the rest of the sample. Clusters were generated. Class 1 (Electronic Gaming Machines gamblers) showed high cooperativeness, a lower level of GRC about strategy and more depressive disorders. Class 2 (games with deferred results gamblers) were high novelty seekers and showed a higher level of GRC about strategy and more addictive disorders. Class 3 (roulette gamblers) were more often high rollers and showed a higher level of GRC about strategy and more manic or hypomanic episodes and more obsessive-compulsive disorders. Class 4 (instant lottery gamblers) showed a lower tendency to suicide attempts. Class 5 (scratch cards gamblers) were high harm avoiders and showed a lower overall level of GRC and more panic attacks and eating disorders. The preference for one particular gambling activity may concern different profiles of gamblers. This study highlights the importance of considering the pair gambler-game rather than one or the other separately, and may provide support for future research on gambling and preventive actions directed toward a particular game.

  11. Mapping brain activity at scale with cluster computing.

    PubMed

    Freeman, Jeremy; Vladimirov, Nikita; Kawashima, Takashi; Mu, Yu; Sofroniew, Nicholas J; Bennett, Davis V; Rosen, Joshua; Yang, Chao-Tsung; Looger, Loren L; Ahrens, Misha B

    2014-09-01

    Understanding brain function requires monitoring and interpreting the activity of large networks of neurons during behavior. Advances in recording technology are greatly increasing the size and complexity of neural data. Analyzing such data will pose a fundamental bottleneck for neuroscience. We present a library of analytical tools called Thunder built on the open-source Apache Spark platform for large-scale distributed computing. The library implements a variety of univariate and multivariate analyses with a modular, extendable structure well-suited to interactive exploration and analysis development. We demonstrate how these analyses find structure in large-scale neural data, including whole-brain light-sheet imaging data from fictively behaving larval zebrafish, and two-photon imaging data from behaving mouse. The analyses relate neuronal responses to sensory input and behavior, run in minutes or less and can be used on a private cluster or in the cloud. Our open-source framework thus holds promise for turning brain activity mapping efforts into biological insights.

  12. Clustering and Pattern Formation in Chemorepulsive Active Colloids

    NASA Astrophysics Data System (ADS)

    Liebchen, Benno; Marenduzzo, Davide; Pagonabarraga, Ignacio; Cates, Michael E.

    2015-12-01

    We demonstrate that migration away from self-produced chemicals (chemorepulsion) generates a generic route to clustering and pattern formation among self-propelled colloids. The clustering instability can be caused either by anisotropic chemical production, or by a delayed orientational response to changes of the chemical environment. In each case, chemorepulsion creates clusters of a self-limiting area which grows linearly with self-propulsion speed. This agrees with recent observations of dynamic clusters in Janus colloids (albeit not yet known to be chemorepulsive). More generally, our results could inform design principles for the self-assembly of chemorepulsive synthetic swimmers and/or bacteria into nonequilibrium patterns.

  13. Clustering and Pattern Formation in Chemorepulsive Active Colloids.

    PubMed

    Liebchen, Benno; Marenduzzo, Davide; Pagonabarraga, Ignacio; Cates, Michael E

    2015-12-18

    We demonstrate that migration away from self-produced chemicals (chemorepulsion) generates a generic route to clustering and pattern formation among self-propelled colloids. The clustering instability can be caused either by anisotropic chemical production, or by a delayed orientational response to changes of the chemical environment. In each case, chemorepulsion creates clusters of a self-limiting area which grows linearly with self-propulsion speed. This agrees with recent observations of dynamic clusters in Janus colloids (albeit not yet known to be chemorepulsive). More generally, our results could inform design principles for the self-assembly of chemorepulsive synthetic swimmers and/or bacteria into nonequilibrium patterns.

  14. Clustering and Pattern Formation in Chemorepulsive Active Colloids.

    PubMed

    Liebchen, Benno; Marenduzzo, Davide; Pagonabarraga, Ignacio; Cates, Michael E

    2015-12-18

    We demonstrate that migration away from self-produced chemicals (chemorepulsion) generates a generic route to clustering and pattern formation among self-propelled colloids. The clustering instability can be caused either by anisotropic chemical production, or by a delayed orientational response to changes of the chemical environment. In each case, chemorepulsion creates clusters of a self-limiting area which grows linearly with self-propulsion speed. This agrees with recent observations of dynamic clusters in Janus colloids (albeit not yet known to be chemorepulsive). More generally, our results could inform design principles for the self-assembly of chemorepulsive synthetic swimmers and/or bacteria into nonequilibrium patterns. PMID:26722949

  15. Effect of mitochondrial complex I inhibition on Fe-S cluster protein activity

    SciTech Connect

    Mena, Natalia P.; Bulteau, Anne Laure; Salazar, Julio; Hirsch, Etienne C.; Nunez, Marco T.

    2011-06-03

    Highlights: {yields} Mitochondrial complex I inhibition resulted in decreased activity of Fe-S containing enzymes mitochondrial aconitase and cytoplasmic aconitase and xanthine oxidase. {yields} Complex I inhibition resulted in the loss of Fe-S clusters in cytoplasmic aconitase and of glutamine phosphoribosyl pyrophosphate amidotransferase. {yields} Consistent with loss of cytoplasmic aconitase activity, an increase in iron regulatory protein 1 activity was found. {yields} Complex I inhibition resulted in an increase in the labile cytoplasmic iron pool. -- Abstract: Iron-sulfur (Fe-S) clusters are small inorganic cofactors formed by tetrahedral coordination of iron atoms with sulfur groups. Present in numerous proteins, these clusters are involved in key biological processes such as electron transfer, metabolic and regulatory processes, DNA synthesis and repair and protein structure stabilization. Fe-S clusters are synthesized mainly in the mitochondrion, where they are directly incorporated into mitochondrial Fe-S cluster-containing proteins or exported for cytoplasmic and nuclear cluster-protein assembly. In this study, we tested the hypothesis that inhibition of mitochondrial complex I by rotenone decreases Fe-S cluster synthesis and cluster content and activity of Fe-S cluster-containing enzymes. Inhibition of complex I resulted in decreased activity of three Fe-S cluster-containing enzymes: mitochondrial and cytosolic aconitases and xanthine oxidase. In addition, the Fe-S cluster content of glutamine phosphoribosyl pyrophosphate amidotransferase and mitochondrial aconitase was dramatically decreased. The reduction in cytosolic aconitase activity was associated with an increase in iron regulatory protein (IRP) mRNA binding activity and with an increase in the cytoplasmic labile iron pool. Since IRP activity post-transcriptionally regulates the expression of iron import proteins, Fe-S cluster inhibition may result in a false iron deficiency signal. Given that

  16. Circadian secretion of cortisol and melatonin in cluster headache during active cluster periods and remission.

    PubMed Central

    Waldenlind, E; Gustafsson, S A; Ekbom, K; Wetterberg, L

    1987-01-01

    The cyclic nature of cluster headache warranted a study of the 24-hour rhythms of serum cortisol and melatonin. They were both altered during cluster periods as compared with periods of remission and healthy controls. The 24-hour mean and maximal cortisol levels were higher and the timing of the cortisol minimum was delayed as compared to the same patients in remission. Although there was no relation between the cortisol and melatonin levels and headaches, the rise of cortisol following many attacks might in part represent an adaptive response to pain. The nocturnal melatonin maximum was lower during cluster periods than in remission. This finding, and the dysautonomic signs during attacks, may reflect a change of the vegetative tone in a hyposympathetic direction. Images PMID:3572435

  17. Night-time neuronal activation of Cluster N in a day- and night-migrating songbird

    PubMed Central

    Zapka, Manuela; Heyers, Dominik; Liedvogel, Miriam; Jarvis, Erich D; Mouritsen, Henrik

    2010-01-01

    Magnetic compass orientation in a night-migratory songbird requires that Cluster N, a cluster of forebrain regions, is functional. Cluster N, which receives input from the eyes via the thalamofugal pathway, shows high neuronal activity in night-migrants performing magnetic compass-guided behaviour at night, whereas no activation is observed during the day, and covering up the birds’ eyes strongly reduces neuronal activation. These findings suggest that Cluster N processes light-dependent magnetic compass information in night-migrating songbirds. The aim of this study was to test if Cluster N is active during daytime migration. We used behavioural molecular mapping based on ZENK activation to investigate if Cluster N is active in the meadow pipit (Anthus pratensis), a day- and night-migratory species. We found that Cluster N of meadow pipits shows high neuronal activity under dim-light at night, but not under full room-light conditions during the day. These data suggest that, in day- and night-migratory meadow pipits, the light-dependent magnetic compass, which requires an active Cluster N, may only be used during night-time, whereas another magnetosensory mechanism and/or other reference system(s), like the sun or polarized light, may be used as primary orientation cues during the day. PMID:20618826

  18. Removing Cool Cores and Central Metallicity Peaks in Galaxy Clusters with Powerful Active Galactic Nucleus Outbursts

    NASA Astrophysics Data System (ADS)

    Guo, Fulai; Mathews, William G.

    2010-07-01

    Recent X-ray observations of galaxy clusters suggest that cluster populations are bimodally distributed according to central gas entropy and are separated into two distinct classes: cool core (CC) and non-cool core (NCC) clusters. While it is widely accepted that active galactic nucleus (AGN) feedback plays a key role in offsetting radiative losses and maintaining many clusters in the CC state, the origin of NCC clusters is much less clear. At the same time, a handful of extremely powerful AGN outbursts have recently been detected in clusters, with a total energy ~1061-1062 erg. Using two-dimensional hydrodynamic simulations, we show that if a large fraction of this energy is deposited near the centers of CC clusters, which is likely common due to dense cores, these AGN outbursts can completely remove CCs, transforming them to NCC clusters. Our model also has interesting implications for cluster abundance profiles, which usually show a central peak in CC systems. Our calculations indicate that during the CC to NCC transformation, AGN outbursts efficiently mix metals in cluster central regions and may even remove central abundance peaks if they are not broad enough. For CC clusters with broad central abundance peaks, AGN outbursts decrease peak abundances, but cannot effectively destroy the peaks. Our model may simultaneously explain the contradictory (possibly bimodal) results of abundance profiles in NCC clusters, some of which are nearly flat, while others have strong central peaks similar to those in CC clusters. A statistical analysis of the sizes of central abundance peaks and their redshift evolution may shed interesting insights on the origin of both types of NCC clusters and the evolution history of thermodynamics and AGN activity in clusters.

  19. Extraction of SAR information from activity cliff clusters via matching molecular series.

    PubMed

    Dimova, Dilyana; Bajorath, Jürgen

    2014-11-24

    The vast majority of activity cliffs that occur is sets of bioactive compounds are formed in a coordinated manner. This means that multiple and overlapping cliffs are formed by groups of structural analogs with varying activity. In network representations, coordinated activity cliffs emerge as clusters of varying size and topology. Activity cliff clusters are typically rich in structure-activity relationship (SAR) information but often difficult to analyze from a medicinal chemistry viewpoint. A key question is how to best access SAR information contained in activity cliff clusters without the need to evaluate many different clusters individually. Herein, we introduce a methodology for the systematic extraction of SAR information from activity cliff clusters that utilizes the concept of matching molecular series (MMS). Sequences of activity cliff-forming compounds are isolated from clusters that follow a activity gradient and series spanning large activity differences are preferentially selected. In addition to its systematic nature, an attractive feature of the approach is that SAR information associated with extracted series is readily interpretable. We show that MMS are abundant in activity cliff clusters from the current spectrum of bioactive compounds and that many MMS share compounds. The resulting pairs of connected MMS contain compounds with closely related structural cores and alternative substitution sites that reveal SAR determinants and preferred substituents.

  20. Career Cluster Activity Book, Intermediate Level. Learn About the Fifteen Career Clusters and Color the Pictures.

    ERIC Educational Resources Information Center

    White Hawk, Sharon, Ed.

    Simple black and white illustrations portray one occupation for each of 15 career clusters. Directed toward the Indian student and showing Indians at work in the occupations depicted, the illustrations are intended to create an awareness, understanding, and motivation for Indian students to become involved in work, both on and off the reservation.…

  1. Reactivity and Catalytic Activity of Hydrogen Atom Chemisorbed Silver Clusters.

    PubMed

    Manzoor, Dar; Pal, Sourav

    2015-06-18

    Metal clusters of silver have attracted recent interest of researchers as a result of their potential in different catalytic applications and low cost. However, due to the completely filled d orbital and very high first ionization potential of the silver atom, the silver-based catalysts interact very weakly with the reacting molecules. In the current work, density functional theory calculations were carried out to investigate the effect of hydrogen atom chemisorption on the reactivity and catalytic properties of inert silver clusters. Our results affirm that the hydrogen atom chemisorption leads to enhancement in the binding energy of the adsorbed O2 molecule on the inert silver clusters. The increase in the binding energy is also characterized by the decrease in the Ag-O and increase in the O-O bond lengths in the case of the AgnH silver clusters. Pertinent to the increase in the O-O bond length, a significant red shift in the O-O stretching frequency is also noted in the case of the AgnH silver clusters. Moreover, the hydrogen atom chemisorbed silver clusters show low reaction barriers and high heat of formation of the final products for the environmentally important CO oxidation reaction as compared to the parent catalytically inactive clusters. The obtained results were compared with those of the corresponding gold and hydrogen atom chemisorbed gold clusters obtained at the same level of theory. It is expected the current computational study will provide key insights for future advances in the design of efficient nanosilver-based catalysts through the adsorption of a small atom or a ligand.

  2. Dynamical quorum sensing and clustering dynamics in a population of spatially distributed active rotators

    NASA Astrophysics Data System (ADS)

    Sakaguchi, Hidetsugu; Maeyama, Satomi

    2013-02-01

    A model of clustering dynamics is proposed for a population of spatially distributed active rotators. A transition from excitable to oscillatory dynamics is induced by the increase of the local density of active rotators. It is interpreted as dynamical quorum sensing. In the oscillation regime, phase waves propagate without decay, which generates an effectively long-range interaction in the clustering dynamics. The clustering process becomes facilitated and only one dominant cluster appears rapidly as a result of the dynamical quorum sensing. An exact localized solution is found to a simplified model equation, and the competitive dynamics between two localized states is studied numerically.

  3. Activation of Methane Promoted by Adsorption of CO on Mo2 C2 (-) Cluster Anions.

    PubMed

    Liu, Qing-Yu; Ma, Jia-Bi; Li, Zi-Yu; Zhao, Chongyang; Ning, Chuan-Gang; Chen, Hui; He, Sheng-Gui

    2016-05-01

    Atomic clusters are being actively studied for activation of methane, the most stable alkane molecule. While many cluster cations are very reactive with methane, the cluster anions are usually not very reactive, particularly for noble metal free anions. This study reports that the reactivity of molybdenum carbide cluster anions with methane can be much enhanced by adsorption of CO. The Mo2 C2 (-) is inert with CH4 while the CO addition product Mo2 C3 O(-) brings about dehydrogenation of CH4 under thermal collision conditions. The cluster structures and reactions are characterized by mass spectrometry, photoelectron spectroscopy, and quantum chemistry calculations, which demonstrate that the Mo2 C3 O(-) isomer with dissociated CO is reactive but the one with non-dissociated CO is unreactive. The enhancement of cluster reactivity promoted by CO adsorption in this study is compared with those of reported systems of a few carbonyl complexes. PMID:27060286

  4. Charge separation promoted activation of molecular oxygen by neutral gold clusters.

    PubMed

    Woodham, Alex P; Meijer, Gerard; Fielicke, André

    2013-02-01

    Gold nanoparticles and sub-nanoparticles famously act as highly efficient and selective low-temperature oxidation catalysts with molecular oxygen, in stark contrast to the nobility of the bulk phase. The origins of this activity and the nature of the active species remain open questions. Gas-phase studies of isolated gold clusters hold promise for disentangling these problems. Here we address the interaction of neutral gold clusters (Au(n); 4 ≤ n ≤ 21) with molecular oxygen by probing the highly characteristic O-O vibrational stretch frequencies. This reveals that for selected cluster sizes the oxygen is highly activated with respect to the free moiety. Complementary quantum chemical calculations provide evidence for substantial electron transfer to the O(2) unit and concomitant rearrangement of the parent gold cluster structure upon binding and activation. This gives evidence for a model of the interaction between neutral gold clusters and molecular oxygen.

  5. Spontaneous cluster activity in the inferior olivary nucleus in brainstem slices from postnatal mice.

    PubMed

    Rekling, Jens C; Jensen, Kristian H R; Jahnsen, Henrik

    2012-04-01

    A distinctive property of the cerebellar system is olivocerebellar modules, where synchronized electrical activity in neurons in the inferior olivary nucleus (IO) evokes organized activity in the cerebellar cortex. However, the exact function of these modules, and how they are developed, is still largely unknown. Here we show that the IO in in vitro slices from postnatal mice spontaneously generates clusters of neurons with synchronous Ca(2+) transients. Neurons in the principal olive (PO), and the vestibular-related dorsomedial cell column (dmcc), showed an age-dependent increase in spontaneous calcium transients. The spatiotemporal activity pattern was occasionally organized in clusters of co-active neighbouring neurons,with regular (16 min-1) and irregular (2-3 min(-1)) repeating cluster activity in the dmcc and PO, respectively. IO clusters had a diameter of 100-170 μm, lasted~1 s, and increased in occurrence from postnatal day P5.5 to P12.5, followed by a sharp drop to near zero at P15.5. IO clusters were overlapping, and comprised nearly identical neurons at some time points, and a varied subset of neurons at others. Some neurons had hub-like properties, being co-active with many other neighbours, and some were co-active with separate clusters at different times. The coherence between calcium transients in IO neurons decreased with Euclidean distance between the cells reaching low values at 100-200 μm distances. Intracellular recordings from IO neurons during cluster formation revealed the presence of spikelet-like potentials, suggesting that electrical coupling between neighbouring IO neurons may serve as a synchronizing mechanism. In conclusion, the IO shows spontaneous cluster activity under in vitro conditions, coinciding with a critical postnatal period in olivocerebellar development. We propose that these clusters may be forerunners of the ensembles of IO neurons shown to be co-active in adult animals spontaneously and during motor acts.

  6. Selenate reductase activity in Escherichia coli requires Isc iron-sulfur cluster biosynthesis genes.

    PubMed

    Yee, Nathan; Choi, Jessica; Porter, Abigail W; Carey, Sean; Rauschenbach, Ines; Harel, Arye

    2014-12-01

    The selenate reductase in Escherichia coli is a multi-subunit enzyme predicted to bind Fe-S clusters. In this study, we examined the iron-sulfur cluster biosynthesis genes that are required for selenate reductase activity. Mutants devoid of either the iscU or hscB gene in the Isc iron-sulfur cluster biosynthesis pathway lost the ability to reduce selenate. Genetic complementation by the wild-type sequences restored selenate reductase activity. The results indicate the Isc biosynthetic system plays a key role in selenate reductase Fe-S cofactor assembly and is essential for enzyme activity.

  7. X-Ray Activity in the Open Cluster IC 4665

    NASA Technical Reports Server (NTRS)

    Giamapapa, Mark S.; Prosser, Charles F.; Fleming, Thomas A.

    1997-01-01

    We present the results of a joint ROSAT High Resolution Imager (HRI) and optical investigation of the open cluster IC 4665. The ROSAT data contains detections for 28 stellar sources in the field, including 22 cluster members and candidate members spanning the color range -0.18 less than or equal to (B - V(sub o)) less than or equal to +1.63 (approx. B3 - M3). Upper limits are given for the remaining members (or candidate members) in the HRI field. Keck HIRES spectra have been obtained that yield radial and rotational velocity measures, respectively, for faint, low mass candidate members located within the field of the ROSAT HRI observation. In addition, photometry of possible optical counterparts to previously uncatalogued X-ray sources in the HRI field is presented. The trends in X-ray properties with (B - V) color in IC 4665 are found to be quite similar to that for other, more nearby young clusters such as the Pleiades and alpha Persei. In particular, a maximum in normalized X-ray luminosity of log (L(sub x)/L(sub bol)) approx. equal 3 is observed, beginning in the color range of (B - V)(sub o) = 0.7 - 0.8. This is similar to the corresponding color range among Pleiades members, in agreement with the earlier estimate, that the age of IC 4665 is similar to the age of the Pleiades. The correlation of rotation and X-ray emission levels is consistent with that in other young clusters. Among the high mass stars in IC 4665, five B stars are detected as X-ray sources. Of these, one is a spectroscopic binary while the remaining objects are apparently single staxs. The level of intrinsic X-ray emission observed in the rapidly rotating (v sini greater than 200 km/ s), single B stars is consistent with an origin due to shock heating of the ambient medium by radiatively driven, rotationally enhanced winds. On the basis of these observations and the results for other clusters, we argue that observed levels of X-ray emission in high mass stars of log (L(sub x)/L(sub bol

  8. A cluster expansion model for predicting activation barrier of atomic processes

    SciTech Connect

    Rehman, Tafizur; Jaipal, M.; Chatterjee, Abhijit

    2013-06-15

    We introduce a procedure based on cluster expansion models for predicting the activation barrier of atomic processes encountered while studying the dynamics of a material system using the kinetic Monte Carlo (KMC) method. Starting with an interatomic potential description, a mathematical derivation is presented to show that the local environment dependence of the activation barrier can be captured using cluster interaction models. Next, we develop a systematic procedure for training the cluster interaction model on-the-fly, which involves: (i) obtaining activation barriers for handful local environments using nudged elastic band (NEB) calculations, (ii) identifying the local environment by analyzing the NEB results, and (iii) estimating the cluster interaction model parameters from the activation barrier data. Once a cluster expansion model has been trained, it is used to predict activation barriers without requiring any additional NEB calculations. Numerical studies are performed to validate the cluster expansion model by studying hop processes in Ag/Ag(100). We show that the use of cluster expansion model with KMC enables efficient generation of an accurate process rate catalog.

  9. Activation and Characterization of a Cryptic Polycyclic Tetramate Macrolactam Biosynthetic Gene Cluster

    PubMed Central

    Luo, Yunzi; Huang, Hua; Liang, Jing; Wang, Meng; Lu, Lu; Shao, Zengyi; Cobb, Ryan E.; Zhao, Huimin

    2014-01-01

    Polycyclic tetramate macrolactams (PTMs) are a widely distributed class of natural products with important biological activities. However, many of them have not been characterized. Here we apply a plug and play synthetic biology strategy to activate a cryptic PTM biosynthetic gene cluster SGR810-815 from Streptomyces griseus and discover three potential PTMs. This gene cluster is highly conserved in phylogenetically diverse bacterial strains and contains an unusual hybrid polyketide synthase-nonribosomal peptide synthetase (PKS-NRPS) which resembles iterative PKSs known in fungi. To further characterize this gene cluster, we use the same synthetic biology approach to create a series of gene deletion constructs and elucidate the biosynthetic steps for the formation of the polycyclic system. The strategy we employ bypasses the traditional laborious processes to elicit gene cluster expression and should be generally applicable to many other silent or cryptic gene clusters for discovery and characterization of new natural products. PMID:24305602

  10. Living Clusters and Crystals from Low-Density Suspensions of Active Colloids

    NASA Astrophysics Data System (ADS)

    Mognetti, B. M.; Šarić, A.; Angioletti-Uberti, S.; Cacciuto, A.; Valeriani, C.; Frenkel, D.

    2013-12-01

    Recent studies aimed at investigating artificial analogs of bacterial colonies have shown that low-density suspensions of self-propelled particles confined in two dimensions can assemble into finite aggregates that merge and split, but have a typical size that remains constant (living clusters). In this Letter, we address the problem of the formation of living clusters and crystals of active particles in three dimensions. We study two systems: self-propelled particles interacting via a generic attractive potential and colloids that can move toward each other as a result of active agents (e.g., by molecular motors). In both cases, fluidlike “living” clusters form. We explain this general feature in terms of the balance between active forces and regression to thermodynamic equilibrium. This balance can be quantified in terms of a dimensionless number that allows us to collapse the observed clustering behavior onto a universal curve. We also discuss how active motion affects the kinetics of crystal formation.

  11. Communication: CO oxidation by silver and gold cluster cations: Identification of different active oxygen species

    SciTech Connect

    Popolan, Denisia M.; Bernhardt, Thorsten M.

    2011-03-07

    The oxidation of carbon monoxide with nitrous oxide on mass-selected Au{sub 3}{sup +} and Ag{sub 3}{sup +} clusters has been investigated under multicollision conditions in an octopole ion trap experiment. The comparative study reveals that for both gold and silver cations carbon dioxide is formed on the clusters. However, whereas in the case of Au{sub 3}{sup +} the cluster itself acts as reactive species that facilitates the formation of CO{sub 2} from N{sub 2}O and CO, for silver the oxidized clusters Ag{sub 3}O{sub x}{sup +} (n= 1-3) are identified as active in the CO oxidation reaction. Thus, in the case of the silver cluster cations N{sub 2}O is dissociated and one oxygen atom is suggested to directly react with CO, whereas a second kind of oxygen strongly bound to silver is acting as a substrate for the reaction.

  12. THE EVOLUTION OF ACTIVE GALACTIC NUCLEI IN CLUSTERS OF GALAXIES TO REDSHIFT 1.3

    SciTech Connect

    Martini, Paul; Sivakoff, Gregory R.; Mulchaey, John S.

    2009-08-10

    We have measured the luminous active galactic nucleus (AGN) population in a large sample of clusters of galaxies and find evidence for a substantial increase in the cluster AGN population from z {approx} 0.05 to z {approx} 1.3. The present sample now includes 32 clusters of galaxies, including 15 clusters above z = 0.4, which corresponds to a three-fold increase compared to our previous work at high redshift. At z < 0.4, we have obtained new observations of AGN candidates in six additional clusters and found no new luminous AGN in cluster members. Our total sample of 17 low-redshift clusters contains only two luminous AGNs, while at high redshifts there are 18 such AGNs, or an average of more than one per cluster. We have characterized the evolution of luminous X-ray AGNs as the fraction of galaxies with M{sub R} < M* {sub R}(z) + 1 that host AGNs with rest-frame, hard X-ray [2-10 keV] luminosities L {sub X,H} {>=} 10{sup 43} erg s{sup -1}. The AGN fraction increases from f{sub A} = 0.134{sup +0.18} {sub -0.087}% at a median z = 0.19 to f{sub A} = 1.00{sup +0.29} {sub -0.23}% at a median z = 0.72. Our best estimate of the evolution is a factor of 8 increase to z = 1 and the statistical significance of the increase is 3.8{sigma}. This dramatic evolution is qualitatively similar to the evolution of the star-forming galaxy population in clusters known as the Butcher-Oemler effect. We discuss the implications of this result for the coevolution of black holes and galaxies in clusters, the evolution of AGN feedback, searches for clusters with the Sunyaev-Zel'dovich effect, and the possible detection of environment-dependent downsizing.

  13. The Relationship between Cortisol Activity during Cognitive Task and Posttraumatic Stress Symptom Clusters

    PubMed Central

    Duan, Hongxia; Wang, Li; Zhang, Liang; Liu, Jing; Zhang, Kan; Wu, Jianhui

    2015-01-01

    Background The latest development in the dimensional structure of posttraumatic stress disorder (PTSD) is a novel 6-factor model, which builds on the newly released DSM-5. One notable gap in the literature is that little is known about how distinct symptom clusters of PTSD are related to hypothalamic–pituitary–adrenal (HPA) axis activity when people perform a relatively less stressful cognitive task. The purpose of this study was to investigate the relationship between cortisol activity when individuals perform cognitive tasks in the laboratory and a contemporary phenotypic model of posttraumatic stress symptomatology in earthquake survivors. Methods Salivary cortisol while performing cognitive tasks was collected and analyzed in 89 adult earthquake survivors. The PTSD Checklist for the DSM-5 (PCL-5) was used to assess the severity of total PTSD as well as six distinct symptom clusters. Regression analyses were conducted to examine the associations between the six distinct PTSD symptom clusters and cortisol profiles. Results The results showed that the score of the negative affect symptom cluster, but not anhedonia or other clusters, was positively associated with cortisol levels before and during the cognitive tasks. Conclusion The results showed that higher cortisol levels before and during cognitive tasks might be specifically linked to a distinct symptom cluster of PTSD—negative affect symptomatology. This suggests that a distinction should be made between negative affect and anhedonia symptom clusters, as the 6-factor model proposed. PMID:26630485

  14. AWM 4: a sharp look at the core of a poor cluster stirred by AGN activity

    NASA Astrophysics Data System (ADS)

    Vrtilek, Jan

    2007-09-01

    The central regions of galaxy clusters, frequently occupied by massive elliptical galaxies with strong radio sources interacting with dense, X-ray emitting gas, are among the most interesting and physically active regions in the Universe. We here propose a deep observation of AWM 4, a poor cluster of relaxed appearance without a cooling core but with strong evidence of AGN-driven heating and gas mixing. In this unusual object we will examine the interaction between cluster gas and radio source at high resolution, measure the properties of the gas and constrain the energy budget of the radio source, and clarify the nature of the observed abundance irregularities.

  15. Cluster Analysis of the Rat Olfactory Bulb Activity in Response to Different Odorants

    NASA Astrophysics Data System (ADS)

    Falasconi, M.; Gutierrez, A.; Auffarth, B.; Sberveglieri, G.; Marco, S.

    2009-05-01

    With the goal of deepen in the understanding of coding of chemical information in the olfactory system, a large data set consisting of rat's olfactory bulb activity values in response to several different volatile compounds has been analyzed by fuzzy c-means clustering methods. Clustering should help to discover groups of glomeruli that are similary activated according to their response profiles across the odorants. To investigate the significance of the achieved fuzzy partitions we developed and applied a novel validity approach based on cluster stability. Our results show certain level of glomerular clustering in the olfactory bulb and indicate that exist a main chemo-topic subdivision of the glomerular layer in few macro-area which are rather specific to particular functional groups of the volatile molecules.

  16. Clustering patterns of physical activity, sedentary and dietary behavior among European adolescents: The HELENA study

    PubMed Central

    2011-01-01

    Background Evidence suggests possible synergetic effects of multiple lifestyle behaviors on health risks like obesity and other health outcomes. A better insight in the clustering of those behaviors, could help to identify groups who are at risk in developing chronic diseases. This study examines the prevalence and clustering of physical activity, sedentary and dietary patterns among European adolescents and investigates if the identified clusters could be characterized by socio-demographic factors. Methods The study comprised a total of 2084 adolescents (45.6% male), from eight European cities participating in the HELENA (Healthy Lifestyle in Europe by Nutrition in Adolescence) study. Physical activity and sedentary behavior were measured using self-reported questionnaires and diet quality was assessed based on dietary recall. Based on the results of those three indices, cluster analyses were performed. To identify gender differences and associations with socio-demographic variables, chi-square tests were executed. Results Five stable and meaningful clusters were found. Only 18% of the adolescents showed healthy and 21% unhealthy scores on all three included indices. Males were highly presented in the cluster with high levels of moderate to vigorous physical activity (MVPA) and low quality diets. The clusters with low levels of MVPA and high quality diets comprised more female adolescents. Adolescents with low educated parents had diets of lower quality and spent more time in sedentary activities. In addition, the clusters with high levels of MVPA comprised more adolescents of the younger age category. Conclusion In order to develop effective primary prevention strategies, it would be important to consider multiple health indices when identifying high risk groups. PMID:21586158

  17. Cluster of solar active regions and onset of coronal mass ejections

    NASA Astrophysics Data System (ADS)

    Wang, JingXiu; Zhang, YuZong; He, Han; Chen, AnQin; Jin, ChunLan; Zhou, GuiPing

    2015-09-01

    Abstract round-the-clock solar observations with full-disk coverage of vector magnetograms and multi-wavelength images demonstrate that solar active regions (ARs) are ultimately connected with magnetic field. Often two or more ARs are clustered, creating a favorable magnetic environment for the onset of coronal mass ejections (CMEs). In this work, we describe a new type of magnetic complex: cluster of solar ARs. An AR cluster is referred to as the close connection of two or more ARs which are located in nearly the same latitude and a narrow span of longitude. We illustrate three examples of AR clusters, each of which has two ARs connected and formed a common dome of magnetic flux system. They are clusters of NOAA (i.e., National Oceanic and Atmospheric Administration) ARs 11226 & 11227, 11429 & 11430, and 11525 & 11524. In these AR clusters, CME initiations were often tied to the instability of the magnetic structures connecting two partner ARs, in the form of inter-connecting loops and/or channeling filaments between the two ARs. We show the evidence that, at least, some of the flare/CMEs in an AR cluster are not a phenomenon of a single AR, but the result of magnetic interaction in the whole AR cluster. The observations shed new light on understanding the mechanism(s) of solar activity. Instead of the simple bipolar topology as suggested by the so-called standard flare model, a multi-bipolar magnetic topology is more common to host the violent solar activity in solar atmosphere.

  18. Prediction of in vitro and in vivo oestrogen receptor activity using hierarchical clustering

    EPA Science Inventory

    In this study, hierarchical clustering classification models were developed to predict in vitro and in vivo oestrogen receptor (ER) activity. Classification models were developed for binding, agonist, and antagonist in vitro ER activity and for mouse in vivo uterotrophic ER bindi...

  19. Earthquake cluster activity beneath the Tanzawa Mountains region, Japan: Migration of hypocenters and low stress drop

    NASA Astrophysics Data System (ADS)

    Yamada, T.; Yukutake, Y.

    2013-12-01

    An earthquake cluster activity was observed beneath the Tanzawa Mountains region, Japan with a depth of 20 km in the end of January, 2012. Japan Meteorological Agency (JMA) determined hypocenters of 76 earthquakes with M > 2 in the area within 50 hours. Five of them had magnitudes greater than 4 and the largest one was 5.4. Four out of the five earthquakes had the reverse-type focal mechanisms with the P axis in the NW-SE direction. First we relocated hypocenters of the activity following the method of Yukutake et al. (2012). We estimated relative arrival times of P and S waves by calculating the coefficients of the cross correlation and relocated hypocenters with the double-difference relocation method (Waldhauser and Ellsworth, 2000). We found that the cluster activity showed a migration from the first earthquake of the activity. The parabolic migration speed was consistent with the migration speed of the deep tremor sources (Ide et al., 2010) for which the fluid activity would play an important role. We then analyzed stress drops of 17 earthquakes with M > 3.5 that occurred from January, 2000 to June, 2012 in the area of the cluster activity. We calculated empirical Green's functions from waveforms of earthquakes with magnitudes of 3.0 to 3.2 and estimated stress drops of the earthquakes assuming that the source spectra can be expressed as the omega-squared model. We found that earthquakes of the cluster activity had smaller stress drops by an order of magnitude than the values of earthquakes that occurred in the same area before the cluster activity. These results suggest that the fluid played an important role for the earthquake cluster activity. That is, the fluid increased the pore pressure, decreased the effective normal stress and triggered the cluster activity. The difference of the rupture speed and the change of the rigidity might also be candidates that account for our results. They, however, can hardly explain the results quantitatively. Fig

  20. An Extended Membrane System with Active Membranes to Solve Automatic Fuzzy Clustering Problems.

    PubMed

    Peng, Hong; Wang, Jun; Shi, Peng; Pérez-Jiménez, Mario J; Riscos-Núñez, Agustín

    2016-05-01

    This paper focuses on automatic fuzzy clustering problem and proposes a novel automatic fuzzy clustering method that employs an extended membrane system with active membranes that has been designed as its computing framework. The extended membrane system has a dynamic membrane structure; since membranes can evolve, it is particularly suitable for processing the automatic fuzzy clustering problem. A modification of a differential evolution (DE) mechanism was developed as evolution rules for objects according to membrane structure and object communication mechanisms. Under the control of both the object's evolution-communication mechanism and the membrane evolution mechanism, the extended membrane system can effectively determine the most appropriate number of clusters as well as the corresponding optimal cluster centers. The proposed method was evaluated over 13 benchmark problems and was compared with four state-of-the-art automatic clustering methods, two recently developed clustering methods and six classification techniques. The comparison results demonstrate the superiority of the proposed method in terms of effectiveness and robustness. PMID:26790484

  1. Systematic assessment of coordinated activity cliffs formed by kinase inhibitors and detailed characterization of activity cliff clusters and associated SAR information.

    PubMed

    Dimova, Dilyana; Stumpfe, Dagmar; Bajorath, Jürgen

    2015-01-27

    From currently available kinase inhibitors and their activity data, clusters of coordinated activity cliffs were systematically derived and subjected to cluster index and index map analysis. Type I-like inhibitors with well-defined IC50 measurements were found to provide a large knowledge base of activity cliff clusters for 266 targets from nine kinase groups. On the basis of index map analysis, these clusters were systematically organized according to structural similarity of inhibitors and activity cliff diversity and prioritized for structure-activity relationship (SAR) analysis. From prioritized clusters, interpretable SAR information can be extracted. It is also shown that activity cliff clusters formed by ATP site-directed inhibitors often represent local SAR environments of rather different complexity and interpretability. In addition, activity cliff clusters including promiscuous kinase inhibitors have been determined. Only a small subset of inhibitors was found to change activity cliff roles in different clusters. The activity cliff clusters described herein and their index map organization substantially enrich SAR information associated with kinase inhibitors in compound subsets of limited size. The cluster and index map information is made available upon request to provide opportunities for further SAR exploration. On the basis of our analysis and the data provided, activity cliff clusters and corresponding inhibitor series for kinase targets of interest can be readily selected.

  2. Influence of support hydroxides on the catalytic activity of oxidized gold clusters

    SciTech Connect

    Veith, Gabriel M; Lupini, Andrew R; Pennycook, Stephen J; Dudney, Nancy J

    2010-01-01

    Gold oxide nanoparticles were prepared on the native surface and a hydroxylated surface of a non-porous TiO2 support (Degussa P25). Scanning transmission electron microscopy results show the formation of similarly sized clusters on both support materials (1.86 and 1.61 nm clusters on the native oxide and the hydroxylated oxide respectively). X-ray absorption near edge spectroscopy and X-ray photoelectron spectroscopy clearly indicate the formation of Au3+ rich oxide nanoparticles. Despite the similar cluster sizes and oxidation states the gold oxide clusters grown on the hydroxylated surface were at least 180 times more catalytically active for the oxidation of carbon monoxide then those grown on the native oxide surface. These hydroxides are conveniently introduced during the solution phase synthesis of gold catalysts and play a dominate, but previously unrecognized, role in the catalytic properties of both oxidized and metallic gold particles.

  3. Clustering-based ensemble learning for activity recognition in smart homes.

    PubMed

    Jurek, Anna; Nugent, Chris; Bi, Yaxin; Wu, Shengli

    2014-01-01

    Application of sensor-based technology within activity monitoring systems is becoming a popular technique within the smart environment paradigm. Nevertheless, the use of such an approach generates complex constructs of data, which subsequently requires the use of intricate activity recognition techniques to automatically infer the underlying activity. This paper explores a cluster-based ensemble method as a new solution for the purposes of activity recognition within smart environments. With this approach activities are modelled as collections of clusters built on different subsets of features. A classification process is performed by assigning a new instance to its closest cluster from each collection. Two different sensor data representations have been investigated, namely numeric and binary. Following the evaluation of the proposed methodology it has been demonstrated that the cluster-based ensemble method can be successfully applied as a viable option for activity recognition. Results following exposure to data collected from a range of activities indicated that the ensemble method had the ability to perform with accuracies of 94.2% and 97.5% for numeric and binary data, respectively. These results outperformed a range of single classifiers considered as benchmarks.

  4. A Redox Active [2Fe-2S] Cluster on the Hydrogenase Maturase HydF.

    PubMed

    Shepard, Eric M; Byer, Amanda S; Betz, Jeremiah N; Peters, John W; Broderick, Joan B

    2016-06-28

    [FeFe]-hydrogenases are nature's most prolific hydrogen catalysts, excelling at facilely interconverting H2 and protons. The catalytic core common to all [FeFe]-hydrogenases is a complex metallocofactor, referred to as the H-cluster, which is composed of a standard [4Fe-4S] cluster linked through a bridging thiolate to a 2Fe subcluster harboring dithiomethylamine, carbon monoxide, and cyanide ligands. This 2Fe subcluster is synthesized and inserted into [FeFe]-hydrogenase by three maturase enzymes denoted HydE, HydF, and HydG. HydE and HydG are radical S-adenosylmethionine enzymes and synthesize the nonprotein ligands of the H-cluster. HydF is a GTPase that functions as a scaffold or carrier for 2Fe subcluster production. Herein, we utilize UV-visible, circular dichroism, and electron paramagnetic resonance spectroscopic studies to establish the existence of redox active [4Fe-4S] and [2Fe-2S] clusters bound to HydF. We have used spectroelectrochemical titrations to assign iron-sulfur cluster midpoint potentials, have shown that HydF purifies with a reduced [2Fe-2S] cluster in the absence of exogenous reducing agents, and have tracked iron-sulfur cluster spectroscopic changes with quaternary structural perturbations. Our results provide an important foundation for understanding the maturation process by defining the iron-sulfur cluster content of HydF prior to its interaction with HydE and HydG. We speculate that the [2Fe-2S] cluster of HydF either acts as a placeholder for HydG-derived Fe(CO)2CN species or serves as a scaffold for 2Fe subcluster assembly. PMID:27232385

  5. Clustering of diet- and activity-related parenting practices: cross-sectional findings of the INPACT study

    PubMed Central

    2013-01-01

    Background Various diet- and activity-related parenting practices are positive determinants of child dietary and activity behaviour, including home availability, parental modelling and parental policies. There is evidence that parenting practices cluster within the dietary domain and within the activity domain. This study explores whether diet- and activity-related parenting practices cluster across the dietary and activity domain. Also examined is whether the clusters are related to child and parental background characteristics. Finally, to indicate the relevance of the clusters in influencing child dietary and activity behaviour, we examined whether clusters of parenting practices are related to these behaviours. Methods Data were used from 1480 parent–child dyads participating in the Dutch IVO Nutrition and Physical Activity Child cohorT (INPACT). Parents of children aged 8–11 years completed questionnaires at home assessing their diet- and activity-related parenting practices, child and parental background characteristics, and child dietary and activity behaviours. Principal component analysis (PCA) was used to identify clusters of parenting practices. Backward regression analysis was used to examine the relationship between child and parental background characteristics with cluster scores, and partial correlations to examine associations between cluster scores and child dietary and activity behaviours. Results PCA revealed five clusters of parenting practices: 1) high visibility and accessibility of screens and unhealthy food, 2) diet- and activity-related rules, 3) low availability of unhealthy food, 4) diet- and activity-related positive modelling, and 5) positive modelling on sports and fruit. Low parental education was associated with unhealthy cluster 1, while high(er) education was associated with healthy clusters 2, 3 and 5. Separate clusters were related to both child dietary and activity behaviour in the hypothesized directions: healthy clusters

  6. Raft coalescence and FcγRIIA activation upon sphingomyelin clustering induced by lysenin.

    PubMed

    Kulma, Magdalena; Kwiatkowska, Katarzyna; Sobota, Andrzej

    2012-08-01

    Activation of immunoreceptor FcγRIIA by cross-linking with antibodies is accompanied by coalescence of sphingolipid/cholesterol-rich membrane rafts leading to the formation of signaling platforms of the receptor. In this report we examined whether clustering of the raft lipid sphingomyelin can reciprocally induce partition of FcγRIIA to rafts. To induce sphingomyelin clustering, cells were exposed to non-lytic concentrations of GST-lysenin which specifically recognizes sphingomyelin. The lysenin/sphingomyelin complexes formed microscale assemblies composed of GST-lysenin oligomers engaging sphingomyelin of rafts. Upon sphingomyelin clustering, non-cross-linked FcγRIIA associated with raft-derived detergent-resistant membrane fractions as revealed by density gradient centrifugation. Pretreatment of cells with GST-lysenin also increased the size of detergent-insoluble molecular complexes of activated FcγRIIA. Sphingomyelin clustering triggered tyrosine phosphorylation of the receptor and its accompanying proteins, Cbl and NTAL, in the absence of receptor ligands and enhanced phosphorylation of these proteins in the ligand presence. These data indicate that clustering of plasma membrane sphingomyelin induces coalescence of rafts and triggers signaling events analogous to those caused by FcγRIIA activation.

  7. Identification of seven hydrophobic clusters in GCN4 making redundant contributions to transcriptional activation.

    PubMed Central

    Jackson, B M; Drysdale, C M; Natarajan, K; Hinnebusch, A G

    1996-01-01

    GCN4 is a transcriptional activator in the bZIP family that regulates amino acid biosynthetic genes in the yeast Saccharomyces cerevisiae. The N-terminal 100 amino acids of GCN4 contains a potent activation function that confers high-level transcription in the absence of the centrally located acidic activation domain (CAAD) delineated in previous studies. To identify specific amino acids important for activation by the N-terminal domain, we mutagenized a GCN4 allele lacking the CAAD and screened alleles in vivo for reduced expression of the HIS3 gene. We found four pairs of closely spaced phenylalanines and a leucine residue distributed throughout the N-terminal 100 residues of GCN4 that are required for high-level activation in the absence of the CAAD. Trp, Leu, and Tyr were highly functional substitutions for the Phe residue at position 45. Combined with our previous findings, these results indicate that GCN4 contains seven clusters of aromatic or bulky hydrophobic residues which make important contributions to transcriptional activation at HIS3. None of the seven hydrophobic clusters is essential for activation by full-length GCN4, and the critical residues in two or three clusters must be mutated simultaneously to observe a substantial reduction in GCN4 function. Numerous combinations of four or five intact clusters conferred high-level transcription of HIS3. We propose that many of the hydrophobic clusters in GCN4 act independently of one another to provide redundant means of stimulating transcription and that the functional contributions of these different segments are cumulative at the HIS3 promoter. On the basis of the primacy of bulky hydrophobic residues throughout the activation domain, we suggest that GCN4 contains multiple sites that mediate hydrophobic contacts with one or more components of the transcription initiation machinery. PMID:8816468

  8. Preparation of Aun quantum clusters with catalytic activity in β-cyclodextrin polyurethane nanosponges.

    PubMed

    Vasconcelos, Diego Andrade; Kubota, Tatiana; Santos, Douglas C; Araujo, Marcia V G; Teixeira, Zaine; Gimenez, Iara F

    2016-01-20

    Here we report the use of β-cyclodextrin polyurethane nanosponges cross-linked with 1,6-hexamethylene diisocyanate as a template for the preparation of Aun quantum clusters, by the core-etching of glutathione-capped Au nanoparticles. The study of temporal evolution of the core-etching process using different Au concentrations indicated that formation of Aun clusters embedded in the nanosponge is favored by the use of lower Au concentrations, since it began at shorter times and lead to higher cluster loading. An estimation of the number of Au atoms based on the maximum photoluminescence wavelength suggested that, depending on the Au concentration and the core etching time, clusters with 11-15 atoms were formed. After excluding the possibility of an inclusion complex formation, evaluation of the catalytic activity of nanosponge-loaded Aun clusters toward the reduction of 4-nitrophenol has shown that the reaction is catalyzed by the Aun clusters with no induction time, following the Langmuir-Hinshelwood kinetic model.

  9. Preparation of Aun quantum clusters with catalytic activity in β-cyclodextrin polyurethane nanosponges.

    PubMed

    Vasconcelos, Diego Andrade; Kubota, Tatiana; Santos, Douglas C; Araujo, Marcia V G; Teixeira, Zaine; Gimenez, Iara F

    2016-01-20

    Here we report the use of β-cyclodextrin polyurethane nanosponges cross-linked with 1,6-hexamethylene diisocyanate as a template for the preparation of Aun quantum clusters, by the core-etching of glutathione-capped Au nanoparticles. The study of temporal evolution of the core-etching process using different Au concentrations indicated that formation of Aun clusters embedded in the nanosponge is favored by the use of lower Au concentrations, since it began at shorter times and lead to higher cluster loading. An estimation of the number of Au atoms based on the maximum photoluminescence wavelength suggested that, depending on the Au concentration and the core etching time, clusters with 11-15 atoms were formed. After excluding the possibility of an inclusion complex formation, evaluation of the catalytic activity of nanosponge-loaded Aun clusters toward the reduction of 4-nitrophenol has shown that the reaction is catalyzed by the Aun clusters with no induction time, following the Langmuir-Hinshelwood kinetic model. PMID:26572328

  10. Clustering and rule-based classifications of chemical structures evaluated in the biological activity space.

    PubMed

    Schuffenhauer, Ansgar; Brown, Nathan; Ertl, Peter; Jenkins, Jeremy L; Selzer, Paul; Hamon, Jacques

    2007-01-01

    Classification methods for data sets of molecules according to their chemical structure were evaluated for their biological relevance, including rule-based, scaffold-oriented classification methods and clustering based on molecular descriptors. Three data sets resulting from uniformly determined in vitro biological profiling experiments were classified according to their chemical structures, and the results were compared in a Pareto analysis with the number of classes and their average spread in the profile space as two concurrent objectives which were to be minimized. It has been found that no classification method is overall superior to all other studied methods, but there is a general trend that rule-based, scaffold-oriented methods are the better choice if classes with homogeneous biological activity are required, but a large number of clusters can be tolerated. On the other hand, clustering based on chemical fingerprints is superior if fewer and larger classes are required, and some loss of homogeneity in biological activity can be accepted.

  11. a Three-Step Spatial-Temporal Clustering Method for Human Activity Pattern Analysis

    NASA Astrophysics Data System (ADS)

    Huang, W.; Li, S.; Xu, S.

    2016-06-01

    How people move in cities and what they do in various locations at different times form human activity patterns. Human activity pattern plays a key role in in urban planning, traffic forecasting, public health and safety, emergency response, friend recommendation, and so on. Therefore, scholars from different fields, such as social science, geography, transportation, physics and computer science, have made great efforts in modelling and analysing human activity patterns or human mobility patterns. One of the essential tasks in such studies is to find the locations or places where individuals stay to perform some kind of activities before further activity pattern analysis. In the era of Big Data, the emerging of social media along with wearable devices enables human activity data to be collected more easily and efficiently. Furthermore, the dimension of the accessible human activity data has been extended from two to three (space or space-time) to four dimensions (space, time and semantics). More specifically, not only a location and time that people stay and spend are collected, but also what people "say" for in a location at a time can be obtained. The characteristics of these datasets shed new light on the analysis of human mobility, where some of new methodologies should be accordingly developed to handle them. Traditional methods such as neural networks, statistics and clustering have been applied to study human activity patterns using geosocial media data. Among them, clustering methods have been widely used to analyse spatiotemporal patterns. However, to our best knowledge, few of clustering algorithms are specifically developed for handling the datasets that contain spatial, temporal and semantic aspects all together. In this work, we propose a three-step human activity clustering method based on space, time and semantics to fill this gap. One-year Twitter data, posted in Toronto, Canada, is used to test the clustering-based method. The results show that the

  12. ISOTROPIC HEATING OF GALAXY CLUSTER CORES VIA RAPIDLY REORIENTING ACTIVE GALACTIC NUCLEUS JETS

    SciTech Connect

    Babul, Arif; Sharma, Prateek; Reynolds, Christopher S.

    2013-05-01

    Active galactic nucleus (AGN) jets carry more than sufficient energy to stave off catastrophic cooling of the intracluster medium (ICM) in the cores of cool-core clusters. However, in order to prevent catastrophic cooling, the ICM must be heated in a near-isotropic fashion and narrow bipolar jets with P{sub jet} = 10{sup 44-45} erg s{sup -1}, typical of radio AGNs at cluster centers, are inefficient in heating the gas in the transverse direction to the jets. We argue that due to existent conditions in cluster cores, the supermassive black holes (SMBHs) will, in addition to accreting gas via radiatively inefficient flows, experience short stochastic episodes of enhanced accretion via thin disks. In general, the orientation of these accretion disks will be misaligned with the spin axis of the black holes (BHs) and the ensuing torques will cause the BH's spin axis (and therefore the jet axis) to slew and rapidly change direction. This model not only explains recent observations showing successive generations of jet-lobes-bubbles in individual cool-core clusters that are offset from each other in the angular direction with respect to the cluster center, but also shows that AGN jets can heat the cluster core nearly isotropically on the gas cooling timescale. Our model does require that the SMBHs at the centers of cool-core clusters be spinning relatively slowly. Torques from individual misaligned disks are ineffective at tilting rapidly spinning BHs by more than a few degrees. Additionally, since SMBHs that host thin accretion disks will manifest as quasars, we predict that roughly 1-2 rich clusters within z < 0.5 should have quasars at their centers.

  13. User Activity Recognition in Smart Homes Using Pattern Clustering Applied to Temporal ANN Algorithm.

    PubMed

    Bourobou, Serge Thomas Mickala; Yoo, Younghwan

    2015-01-01

    This paper discusses the possibility of recognizing and predicting user activities in the IoT (Internet of Things) based smart environment. The activity recognition is usually done through two steps: activity pattern clustering and activity type decision. Although many related works have been suggested, they had some limited performance because they focused only on one part between the two steps. This paper tries to find the best combination of a pattern clustering method and an activity decision algorithm among various existing works. For the first step, in order to classify so varied and complex user activities, we use a relevant and efficient unsupervised learning method called the K-pattern clustering algorithm. In the second step, the training of smart environment for recognizing and predicting user activities inside his/her personal space is done by utilizing the artificial neural network based on the Allen's temporal relations. The experimental results show that our combined method provides the higher recognition accuracy for various activities, as compared with other data mining classification algorithms. Furthermore, it is more appropriate for a dynamic environment like an IoT based smart home. PMID:26007738

  14. User Activity Recognition in Smart Homes Using Pattern Clustering Applied to Temporal ANN Algorithm.

    PubMed

    Bourobou, Serge Thomas Mickala; Yoo, Younghwan

    2015-01-01

    This paper discusses the possibility of recognizing and predicting user activities in the IoT (Internet of Things) based smart environment. The activity recognition is usually done through two steps: activity pattern clustering and activity type decision. Although many related works have been suggested, they had some limited performance because they focused only on one part between the two steps. This paper tries to find the best combination of a pattern clustering method and an activity decision algorithm among various existing works. For the first step, in order to classify so varied and complex user activities, we use a relevant and efficient unsupervised learning method called the K-pattern clustering algorithm. In the second step, the training of smart environment for recognizing and predicting user activities inside his/her personal space is done by utilizing the artificial neural network based on the Allen's temporal relations. The experimental results show that our combined method provides the higher recognition accuracy for various activities, as compared with other data mining classification algorithms. Furthermore, it is more appropriate for a dynamic environment like an IoT based smart home.

  15. Activation Energies and Potentials of Mean Force for Water Cluster Evaporation

    SciTech Connect

    Kathmann, Shawn M.; Palmer, Bruce J.; Schenter, Gregory K.; Garrett, Bruce C.

    2008-02-11

    Activation energies for water cluster evaporation are of interest in many areas of chemical physics. We present the first computation of activation energies for small waters clusters using the formalism of Dynamical Nucleation Theory (DNT). To this end, individual evaporation rate constants are computed for water clusters (H2O)i, where i = 2 to 10 for temperatures ranging from 243 to 333K. These calculations employ a parallel sampling technique utilizing the Global Arrays Toolkit developed at PNNL. The resulting evaporation rate constants for each cluster are then fit to Arrhenius equations to obtain activation energies. We discuss DNT evaporation rate constants and their relation to potentials of mean force, activation energies, and how to account for non-separability of the reaction coordinate in the reactant state partition function. This work was supported by the PNNL Computational Science and Engineering LDRD Program and the Chemical and Material Sciences Division, Office of Basic Energy Sciences, Department of Energy. The Pacific Northwest National Laboratory is operated by Battelle for the US Department of Energy.

  16. Yeast homologous recombination-based promoter engineering for the activation of silent natural product biosynthetic gene clusters.

    PubMed

    Montiel, Daniel; Kang, Hahk-Soo; Chang, Fang-Yuan; Charlop-Powers, Zachary; Brady, Sean F

    2015-07-21

    Large-scale sequencing of prokaryotic (meta)genomic DNA suggests that most bacterial natural product gene clusters are not expressed under common laboratory culture conditions. Silent gene clusters represent a promising resource for natural product discovery and the development of a new generation of therapeutics. Unfortunately, the characterization of molecules encoded by these clusters is hampered owing to our inability to express these gene clusters in the laboratory. To address this bottleneck, we have developed a promoter-engineering platform to transcriptionally activate silent gene clusters in a model heterologous host. Our approach uses yeast homologous recombination, an auxotrophy complementation-based yeast selection system and sequence orthogonal promoter cassettes to exchange all native promoters in silent gene clusters with constitutively active promoters. As part of this platform, we constructed and validated a set of bidirectional promoter cassettes consisting of orthogonal promoter sequences, Streptomyces ribosome binding sites, and yeast selectable marker genes. Using these tools we demonstrate the ability to simultaneously insert multiple promoter cassettes into a gene cluster, thereby expediting the reengineering process. We apply this method to model active and silent gene clusters (rebeccamycin and tetarimycin) and to the silent, cryptic pseudogene-containing, environmental DNA-derived Lzr gene cluster. Complete promoter refactoring and targeted gene exchange in this "dead" cluster led to the discovery of potent indolotryptoline antiproliferative agents, lazarimides A and B. This potentially scalable and cost-effective promoter reengineering platform should streamline the discovery of natural products from silent natural product biosynthetic gene clusters. PMID:26150486

  17. Yeast homologous recombination-based promoter engineering for the activation of silent natural product biosynthetic gene clusters.

    PubMed

    Montiel, Daniel; Kang, Hahk-Soo; Chang, Fang-Yuan; Charlop-Powers, Zachary; Brady, Sean F

    2015-07-21

    Large-scale sequencing of prokaryotic (meta)genomic DNA suggests that most bacterial natural product gene clusters are not expressed under common laboratory culture conditions. Silent gene clusters represent a promising resource for natural product discovery and the development of a new generation of therapeutics. Unfortunately, the characterization of molecules encoded by these clusters is hampered owing to our inability to express these gene clusters in the laboratory. To address this bottleneck, we have developed a promoter-engineering platform to transcriptionally activate silent gene clusters in a model heterologous host. Our approach uses yeast homologous recombination, an auxotrophy complementation-based yeast selection system and sequence orthogonal promoter cassettes to exchange all native promoters in silent gene clusters with constitutively active promoters. As part of this platform, we constructed and validated a set of bidirectional promoter cassettes consisting of orthogonal promoter sequences, Streptomyces ribosome binding sites, and yeast selectable marker genes. Using these tools we demonstrate the ability to simultaneously insert multiple promoter cassettes into a gene cluster, thereby expediting the reengineering process. We apply this method to model active and silent gene clusters (rebeccamycin and tetarimycin) and to the silent, cryptic pseudogene-containing, environmental DNA-derived Lzr gene cluster. Complete promoter refactoring and targeted gene exchange in this "dead" cluster led to the discovery of potent indolotryptoline antiproliferative agents, lazarimides A and B. This potentially scalable and cost-effective promoter reengineering platform should streamline the discovery of natural products from silent natural product biosynthetic gene clusters.

  18. Yeast homologous recombination-based promoter engineering for the activation of silent natural product biosynthetic gene clusters

    PubMed Central

    Montiel, Daniel; Kang, Hahk-Soo; Chang, Fang-Yuan; Charlop-Powers, Zachary; Brady, Sean F.

    2015-01-01

    Large-scale sequencing of prokaryotic (meta)genomic DNA suggests that most bacterial natural product gene clusters are not expressed under common laboratory culture conditions. Silent gene clusters represent a promising resource for natural product discovery and the development of a new generation of therapeutics. Unfortunately, the characterization of molecules encoded by these clusters is hampered owing to our inability to express these gene clusters in the laboratory. To address this bottleneck, we have developed a promoter-engineering platform to transcriptionally activate silent gene clusters in a model heterologous host. Our approach uses yeast homologous recombination, an auxotrophy complementation-based yeast selection system and sequence orthogonal promoter cassettes to exchange all native promoters in silent gene clusters with constitutively active promoters. As part of this platform, we constructed and validated a set of bidirectional promoter cassettes consisting of orthogonal promoter sequences, Streptomyces ribosome binding sites, and yeast selectable marker genes. Using these tools we demonstrate the ability to simultaneously insert multiple promoter cassettes into a gene cluster, thereby expediting the reengineering process. We apply this method to model active and silent gene clusters (rebeccamycin and tetarimycin) and to the silent, cryptic pseudogene-containing, environmental DNA-derived Lzr gene cluster. Complete promoter refactoring and targeted gene exchange in this “dead” cluster led to the discovery of potent indolotryptoline antiproliferative agents, lazarimides A and B. This potentially scalable and cost-effective promoter reengineering platform should streamline the discovery of natural products from silent natural product biosynthetic gene clusters. PMID:26150486

  19. Magnetic Field-Induced T Cell Receptor Clustering by Nanoparticles Enhances T Cell Activation and Stimulates Antitumor Activity

    PubMed Central

    2015-01-01

    Iron–dextran nanoparticles functionalized with T cell activating proteins have been used to study T cell receptor (TCR) signaling. However, nanoparticle triggering of membrane receptors is poorly understood and may be sensitive to physiologically regulated changes in TCR clustering that occur after T cell activation. Nano-aAPC bound 2-fold more TCR on activated T cells, which have clustered TCR, than on naive T cells, resulting in a lower threshold for activation. To enhance T cell activation, a magnetic field was used to drive aggregation of paramagnetic nano-aAPC, resulting in a doubling of TCR cluster size and increased T cell expansion in vitro and after adoptive transfer in vivo. T cells activated by nano-aAPC in a magnetic field inhibited growth of B16 melanoma, showing that this novel approach, using magnetic field-enhanced nano-aAPC stimulation, can generate large numbers of activated antigen-specific T cells and has clinically relevant applications for adoptive immunotherapy. PMID:24564881

  20. Submillimetre observations of galaxy clusters with the BLAST: the star formation activity in Abell 3112

    NASA Astrophysics Data System (ADS)

    Braglia, Filiberto G.; Ade, Peter A. R.; Bock, James J.; Chapin, Edward L.; Devlin, Mark J.; Edge, Alastair; Griffin, Matthew; Gundersen, Joshua O.; Halpern, Mark; Hargrave, Peter C.; Hughes, David H.; Klein, Jeff; Marsden, Gaelen; Mauskopf, Philip; Moncelsi, Lorenzo; Netterfield, Calvin B.; Ngo, Henry; Olmi, Luca; Pascale, Enzo; Patanchon, Guillaume; Pimbblet, Kevin A.; Rex, Marie; Scott, Douglas; Semisch, Christopher; Thomas, Nicholas; Truch, Matthew D. P.; Tucker, Carole; Tucker, Gregory S.; Valiante, Elisabetta; Viero, Marco P.; Wiebe, Donald V.

    2011-04-01

    We present observations at 250, 350 and 500 μm of the nearby galaxy cluster Abell 3112 (z= 0.075) carried out with the Balloon-borne Large Aperture Submillimeter Telescope. Five cluster members are individually detected as bright submillimetre (submm) sources. Their far-infrared spectral energy distributions and optical colours identify them as normal star-forming galaxies of high mass, with globally evolved stellar populations. They all have (B-R) colours of 1.38 ± 0.08, transitional between the blue, active population and the red, evolved galaxies that dominate the cluster core. We stack to estimate the mean submm emission from all cluster members, which is determined to be 16.6 ± 2.5, 6.1 ± 1.9 and 1.5 ± 1.3 mJy at 250, 350 and 500 μm, respectively. Stacking analyses of the submm emission of cluster members reveal trends in the mean far-infrared luminosity with respect to clustercentric radius and KS-band magnitude. We find that a large fraction of submm emission comes from the boundary of the inner, virialized region of the cluster, at clustercentric distances around R500. Stacking also shows that the bulk of the submm emission arises in intermediate-mass galaxies with KS magnitude ˜1 mag fainter than the characteristic magnitude ?. The results and constraints obtained in this work will provide a useful reference for the forthcoming surveys to be conducted on galaxy clusters by Herschel.

  1. Hemoglobin–Albumin Cluster Incorporating a Pt Nanoparticle: Artificial O2 Carrier with Antioxidant Activities

    PubMed Central

    Hosaka, Hitomi; Haruki, Risa; Yamada, Kana; Böttcher, Christoph; Komatsu, Teruyuki

    2014-01-01

    A covalent core–shell structured protein cluster composed of hemoglobin (Hb) at the center and human serum albumins (HSA) at the periphery, Hb-HSAm, is an artificial O2 carrier that can function as a red blood cell substitute. Here we described the preparation of a novel Hb-HSA3 cluster with antioxidant activities and its O2 complex stable in aqueous H2O2 solution. We used an approach of incorporating a Pt nanoparticle (PtNP) into the exterior HSA unit of the cluster. A citrate reduced PtNP (1.8 nm diameter) was bound tightly within the cleft of free HSA with a binding constant (K) of 1.1×107 M−1, generating a stable HSA-PtNP complex. This platinated protein showed high catalytic activities for dismutations of superoxide radical anions (O2•–) and hydrogen peroxide (H2O2), i.e., superoxide dismutase and catalase activities. Also, Hb-HSA3 captured PtNP into the external albumin unit (K = 1.1×107 M−1), yielding an Hb-HSA3(PtNP) cluster. The association of PtNP caused no alteration of the protein surface net charge and O2 binding affinity. The peripheral HSA-PtNP shell prevents oxidation of the core Hb, which enables the formation of an extremely stable O2 complex, even in H2O2 solution. PMID:25310133

  2. Cluster B personality disorders are associated with allelic variation of monoamine oxidase A activity.

    PubMed

    Jacob, Christian P; Müller, Johannes; Schmidt, Michael; Hohenberger, Katrin; Gutknecht, Lise; Reif, Andreas; Schmidtke, Armin; Mössner, Rainald; Lesch, Klaus Peter

    2005-09-01

    Genetic variants of the monoamine oxidase A (MAOA) have been associated with aggression-, anxiety-, and addiction-related behavior in several nonclinical and clinical populations. Here, we investigated the influence of allelic variation of MAOA activity on aggression-related personality traits and disease risk in patients with personality disorders. Personality disorders were diagnosed with the Structured Clinical Interview of DSM-IV and were allocated to cluster A, B, and C. Personality features were assessed by the revised NEO Personality Inventory and the Tridimensional Personality Questionnaire. The genotype of the MAOA gene-linked polymorphic region (MAOA-LPR) was determined in 566 patients with personality disorders and in 281 healthy controls. MAOA genotype was significantly associated with cluster B personality disorders (chi2=7.77, p=0.005, df=1) but not with cluster C personality disorders. In total, 26.0% of cluster B patients were hemi- or homozygous for the low-activity variant of the MAOA genotype, compared to 16.4% in the control group. Associations between MAOA variants and personality domains related to impulsivity and aggressiveness were inconsistent. Our findings further support the notion that allelic variation of MAOA activity contributes modestly to the balance of hyper- (impulsive-aggressive) and hyporeactive (anxious-depressive) traits.

  3. RADIO-LOUD ACTIVE GALACTIC NUCLEUS: IS THERE A LINK BETWEEN LUMINOSITY AND CLUSTER ENVIRONMENT?

    SciTech Connect

    Ineson, J.; Croston, J. H.; Hardcastle, M. J.; Jarvis, M.; Kraft, R. P.; Evans, D. A.

    2013-06-20

    We present here the first results from the Chandra ERA (Environments of Radio-loud AGN) Large Project, characterizing the cluster environments of a sample of 26 radio-loud active galactic nuclei (AGNs) at z {approx} 0.5 that covers three decades of radio luminosity. This is the first systematic X-ray environmental study at a single epoch, and has allowed us to examine the relationship between radio luminosity and cluster environment without the problems of Malmquist bias. We have found a weak correlation between radio luminosity and host cluster X-ray luminosity, as well as tentative evidence that this correlation is driven by the subpopulation of low-excitation radio galaxies, with high-excitation radio galaxies showing no significant correlation. The considerable scatter in the environments may be indicative of complex relationships not currently included in feedback models.

  4. Active learning for semi-supervised clustering based on locally linear propagation reconstruction.

    PubMed

    Chang, Chin-Chun; Lin, Po-Yi

    2015-03-01

    The success of semi-supervised clustering relies on the effectiveness of side information. To get effective side information, a new active learner learning pairwise constraints known as must-link and cannot-link constraints is proposed in this paper. Three novel techniques are developed for learning effective pairwise constraints. The first technique is used to identify samples less important to cluster structures. This technique makes use of a kernel version of locally linear embedding for manifold learning. Samples neither important to locally linear propagation reconstructions of other samples nor on flat patches in the learned manifold are regarded as unimportant samples. The second is a novel criterion for query selection. This criterion considers not only the importance of a sample to expanding the space coverage of the learned samples but also the expected number of queries needed to learn the sample. To facilitate semi-supervised clustering, the third technique yields inferred must-links for passing information about flat patches in the learned manifold to semi-supervised clustering algorithms. Experimental results have shown that the learned pairwise constraints can capture the underlying cluster structures and proven the feasibility of the proposed approach.

  5. Relaxed active space: Fixing tailored-CC with high order coupled cluster. II

    SciTech Connect

    Melnichuk, Ann Bartlett, Rodney J.

    2014-02-14

    Due to the steep increase in computational cost with the inclusion of higher-connected cluster operators in coupled-cluster applications, it is usually not practical to use such methods for larger systems or basis sets without an active space partitioning. This study generates an active space subject to unambiguous statistical criteria to define a space whose size permits treatment at the CCSDT level. The automated scheme makes it unnecessary for the user to judge whether a chosen active space is sufficient to correctly solve the problem. Two demanding applications are presented: twisted ethylene and the transition states for the bicyclo[1,1,0]butane isomerization. As bi-radicals both systems require at least a CCSDT level of theory for quantitative results, for the geometries and energies.

  6. Is the cluster environment quenching the Seyfert activity in elliptical and spiral galaxies?

    NASA Astrophysics Data System (ADS)

    de Souza, R. S.; Dantas, M. L. L.; Krone-Martins, A.; Cameron, E.; Coelho, P.; Hattab, M. W.; de Val-Borro, M.; Hilbe, J. M.; Elliott, J.; Hagen, A.; COIN Collaboration

    2016-09-01

    We developed a hierarchical Bayesian model (HBM) to investigate how the presence of Seyfert activity relates to their environment, herein represented by the galaxy cluster mass, M200, and the normalized cluster centric distance, r/r200. We achieved this by constructing an unbiased sample of galaxies from the Sloan Digital Sky Survey, with morphological classifications provided by the Galaxy Zoo Project. A propensity score matching approach is introduced to control the effects of confounding variables: stellar mass, galaxy colour, and star formation rate. The connection between Seyfert-activity and environmental properties in the de-biased sample is modelled within an HBM framework using the so-called logistic regression technique, suitable for the analysis of binary data (e.g. whether or not a galaxy hosts an AGN). Unlike standard ordinary least square fitting methods, our methodology naturally allows modelling the probability of Seyfert-AGN activity in galaxies on their natural scale, i.e. as a binary variable. Furthermore, we demonstrate how an HBM can incorporate information of each particular galaxy morphological type in an unified framework. In elliptical galaxies our analysis indicates a strong correlation of Seyfert-AGN activity with r/r200, and a weaker correlation with the mass of the host cluster. In spiral galaxies these trends do not appear, suggesting that the link between Seyfert activity and the properties of spiral galaxies are independent of the environment.

  7. Membership and Coronal Activity in the NGC 2232 and Cr 140 Open Clusters

    NASA Technical Reports Server (NTRS)

    Patten, Brian M.; Oliversen, Ronald J. (Technical Monitor)

    2001-01-01

    This is the second annual performance report for our grant "Membership and Coronal Activity in the NGC 2232 and Cr 140 Open Clusters." We propose to identify X-ray sources and extract net source counts in 8 archival ROSAT HRI images in the regions of the NGC 2232 and Cr 140 open clusters. These X-ray data will be combined with ground-based photometry and spectroscopy in order to identify G, K, and early-M type cluster members. At present, no members later than approximately F5 are currently known for either cluster. With ages of approximately 25 Myr and at a distance of just 320 - 360 pc, the combined late-type membership of the NGC 2232 and Cr 140 clusters will yield an almost unique sample of solar-type stars in the post-T Tauri/pre-main sequence phase of evolution. These stars will be used to assess the level and dispersion in coronal activity levels, as part of a probe of the importance of magnetic braking and the level of magnetic dynamo activity, for solar-type stars just before they reach the ZAMS. Over the past year we have successfully acquired all of the ground-based data necessary to support the analysis of the archival ROSAT X-ray data in the regions around both of these clusters. By the end of 2001 we expect to have completed the reduction and analysis of the ground-based photometry and spectroscopy and will begin the integration of these data with the ROSAT X-ray data. A certain amount of pressure to complete the work on NGC 2232 is coming from the SIRTF project, as this cluster may be a key component to a circumstellar disk evolution GTO program. We are only too happy to try to help and have worked to speed the analysis as much as possible. The primary activity to be undertaken in the next few months is the integration of the groundbased photometry and spectroscopy with the archival ROSAT X-ray data and then writing the paper summarizing our results. The most time consuming portion of this next phase is, of course, seeing the paper through

  8. Membership and Coronal Activity in the NGC 2232 and Cr 140 Open Clusters

    NASA Technical Reports Server (NTRS)

    Oliversen, Ronald J. (Technical Monitor); Patten, Brian M.

    2004-01-01

    Making use of eight archival ROSAT HRI images in the regions of the NGC 2232 and Cr 140, this project's primary focus is to identify X-ray sources and to extract net source counts for these sources in these two open clusters. These X-ray data would be combined with ground-based photometry and spectroscopy in order to identify G, K, and early-M type cluster members. Such membership data are important because, at present, no members later than spectral type approx. F5 are currently known for either cluster. With ages estimated to be approx. 25 Myr and at distances of just approx. 350 pc, the combined late-type membership of the NGC 2232 and Cr 140 clusters would yield an almost unique sample of solar-type stars in the post-T Tauri/pre-main sequence phase of evolution. These stars could be used to assess the level and dispersion of coronal activity levels, as a part of a probe of the importance of magnetic braking and the level of magnetic dynamo activity, for solar-type stars just before they reach the zero-age main sequence.

  9. Role of hydroxyl groups on the stability and catalytic activity of Au clusters on rutile surface

    SciTech Connect

    Kent, Paul R

    2011-01-01

    Hydroxyls are present as surface terminations of transition metal oxides under ambient conditions and may modify the properties of supported catalysts. We perform first-principles density functional theory calculations to investigate the role of hydroxyls on the catalytic activity of supported gold clusters on TiO{sub 2} (rutile). We find that they have a long-range effect increasing the adhesion of gold clusters on rutile. While hydroxyls make one gold atom more electronegative, a more complex charge-transfer scenario is observed on larger clusters which are important for catalytic applications. This enhances the molecular adsorption and coadsorption energies of CO and O{sub 2}, thereby increasing the catalytic activity of gold clusters for CO oxidation, consistent with reported experiments. Hydroxyls at the interface between gold and rutile surface are most important to this process, even when not directly bound to gold. As such, accurate models of catalytic processes on gold and other catalysts should include the effect of surface hydroxyls.

  10. Using Light-at-Night (LAN) Satellite Data for Identifying Clusters of Economic Activities in Europe

    NASA Astrophysics Data System (ADS)

    Rybnikova, N. A.; Portnov, B. A.

    2015-04-01

    Enterprises organized in clusters are often efficient in stimulating urban development, productivity and profit outflows. Identifying clusters of economic activities (EAs) thus becomes an important step in devising regional development policies, aimed at facilitating regional economic development. However, a major problem with cluster identification stems from limited reporting of specific EAs by individual countries and administrative entities. Even Eurostat, which maintains most advances regional databases, provides data for less than 50% of all regional subdivisions of the 3rd tier of the Nomenclature of Territorial Units for Statistics (NUTS3). Such poor reporting impedes identification of EA clusters and economic forces behind them. In this study, we test a possibility that missing data on geographic concentrations of EAs can be reconstructed using Light-at-Night (LAN) satellite measurements, and that such reconstructed data can then be used for the identification of EA clusters. As we hypothesize, LAN, captured by satellite sensors, is characterized by different intensity, depending on its source - production facilities, services, etc., - and this information can be used for EA identification. The study was carried out in three stages. First, using nighttime satellite images, we determined what types of EAs can be identified, with a sufficient degree of accuracy, by LAN they emit. Second, we calculated multivariate statistical models, linking EAs concentrations with LAN intensities and several locational and development attributes of NUTS3 regions in Europe. Next, using the obtained statistical models, we restored missing data on EAs across NUTS3 regions in Europe and identified clusters of EAs, using spatial analysis tools.

  11. A multiwavelength photometric census of AGN and star formation activity in the brightest cluster galaxies of X-ray selected clusters

    NASA Astrophysics Data System (ADS)

    Green, T. S.; Edge, A. C.; Stott, J. P.; Ebeling, H.; Burgett, W. S.; Chambers, K. C.; Draper, P. W.; Metcalfe, N.; Kaiser, N.; Wainscoat, R. J.; Waters, C.

    2016-09-01

    Despite their reputation as being `red and dead', the unique environment inhabited by brightest cluster galaxies (BCGs) can often lead to a self-regulated feedback cycle between radiatively cooling intracluster gas and star formation and active galactic nucleus (AGN) activity in the BCG. However the prevalence of `active' BCGs, and details of the feedback involved, are still uncertain. We have performed an optical, UV and mid-IR photometric analysis of the BCGs in 981 clusters at 0.03 < z < 0.5, selected from the ROSAT All Sky Survey. Using Pan-STARRS PS1 3π, GALEX and WISE survey data we look for BCGs with photometric colours which deviate from that of the bulk population of passive BCGs - indicative of AGN and/or star formation activity within the BCG. We find that whilst the majority of BCGs are consistent with being passive, at least 14 per cent of our BCGs show a significant colour offset from passivity in at least one colour index. And, where available, supplementary spectroscopy reveals the majority of these particular BCGs show strong optical emission lines. On comparing BCG `activity' with the X-ray luminosity of the host cluster, we find that BCGs showing a colour offset are preferentially found in the more X-ray luminous clusters, indicative of the connection between BCG `activity' and the intracluster medium.

  12. RELATIONSHIP BETWEEN PARENTS' MOTIVATION FOR PHYSICAL ACTIVITY AND THEIR BELIEFS, AND SUPPORT OF THEIR CHILDREN'S PHYSICAL ACTIVITY: A CLUSTER ANALYSIS.

    PubMed

    Naisseh, Matilda; Martinent, Guillaume; Ferrand, Claude; Hautier, Christophe

    2015-08-01

    Previous studies have neglected the multivariate nature of motivation. The purpose of the current study was to first identify motivational profiles of parents' own physical activity. Second, the study examined if such profiles differ in the way in which parents perceive their children's competence in physical activity and the importance and support given to their children's physical activity. 711 physically active parents (57% mothers; M age = 39.7 yr.; children 6-11 years old) completed the Situational Motivation Scale, the Parents' Perceptions of Physical Activity Importance and their Children's Ability Questionnaire, and the Parental Support for Physical Activity Scale. Cluster analyses indicated four motivational profiles: Highly self-determined, Moderately self-determined, Non-self-determined, and Externally motivated profiles. Parents' beliefs and support toward their children's physical activity significantly differed across these profiles. It is the first study using Self-Determination Theory that provides evidence for the interpersonal outcomes of motivation.

  13. AGN ACTIVITY AND IGM HEATING IN THE FOSSIL CLUSTER RX J1416.4+2315

    SciTech Connect

    Miraghaei, H.; Khosroshahi, H. G.; Abbassi, S.; Sengupta, C.; Raychaudhury, S.

    2015-12-15

    We study active galactic nucleus (AGN) activity in the fossil galaxy cluster RX J1416.4+2315. Radio observations were carried out using the Giant Metrewave Radio Telescope at two frequencies, 1420 and 610 MHz. A weak radio lobe that extends from the central nucleus is detected in the 610 MHz map. Assuming the radio lobe originated from the central AGN, we show that the energy injection into the intergalactic medium is only sufficient to heat up the central 50 kpc within the cluster core, while the cooling radius is larger (∼130 kpc). In the hardness ratio map, three low energy cavities have been identified. No radio emission is detected for these regions. We evaluated the power required to inflate the cavities and showed that the total energy budget is sufficient to offset the radiative cooling. We showed that the initial conditions would change the results remarkably. Furthermore, the efficiency of the Bondi accretion in powering the AGN has been estimated.

  14. Supersaturation and activity-rotation relation in PMS stars: the young cluster h Persei

    NASA Astrophysics Data System (ADS)

    Argiroffi, C.; Caramazza, M.; Micela, G.; Sciortino, S.; Moraux, E.; Bouvier, J.; Flaccomio, E.

    2016-05-01

    Context. Several studies showed that the magnetic activity of late-type main-sequence (MS) stars is characterized by different regimes and that their activity levels are well described by the Rossby number, Ro, defined as the ratio between the rotational period Prot and the convective turnover time. Very young pre-main-sequence (PMS) stars show, similarly to MS stars, intense magnetic activity. However, they do not show clear activity-rotation trends, and it still debated which stellar parameters determine their magnetic activity levels. Aims: To bridge the gap between MS and PMS stars, we studied the activity-rotation relation in the young cluster h Persei, a ~13 Myr old cluster, that contains both fast and slow rotators. The cluster members have ended their accretion phase and have developed a radiative core. It therefore offers us the opportunity of studying the activity level of intermediate-age PMS stars with different rotational velocities, excluding any interactions with the circumstellar environment. Methods: We constrained the magnetic activity levels of h Per members by measuring their X-ray emission from a Chandra observation, while rotational periods were obtained previously in the framework of the MONITOR project. By cross-correlating these data, we collected a final catalog of 414 h Per members with known rotational period, effective temperature, and mass. In 169 of these, X-ray emission has also been detected. Results: We found that h Per members with 1.0 M⊙activity regimes: fast rotators clearly show supersaturation, while slower rotators have activity levels compatible to the non-saturated regime. At 13 Myr, h Per is therefore the youngest cluster showing activity-rotation regimes analogous to those of MS stars, indicating that at this age, magnetic field production is most likely regulated by the αΩ type dynamo. Moreover, we observed that supersaturation is better described by Prot than Ro, and that the

  15. Cooperativity between Integrin Activation and Mechanical Stress Leads to Integrin Clustering

    PubMed Central

    Ali, O.; Guillou, H.; Destaing, O.; Albigès-Rizo, C.; Block, M.R.; Fourcade, B.

    2011-01-01

    Integrins are transmembrane receptors involved in crucial cellular biological functions such as migration, adhesion, and spreading. Upon the modulation of integrin affinity toward their extracellular ligands by cytoplasmic proteins (inside-out signaling) these receptors bind to their ligands and cluster into nascent adhesions. This clustering results in the increase in the mechanical linkage among the cell and substratum, cytoskeleton rearrangements, and further outside-in signaling. Based on experimental observations of the distribution of focal adhesions in cells attached to micropatterned surfaces, we introduce a physical model relying on experimental numerical constants determined in the literature. In this model, allosteric integrin activation works in synergy with the stress build by adhesion and the membrane rigidity to allow the clustering to nascent adhesions independently of actin but dependent on the integrin diffusion onto adhesive surfaces. The initial clustering could provide a template to the mature adhesive structures. Predictions of our model for the organization of focal adhesions are discussed in comparison with experiments using adhesive protein microarrays. PMID:21641304

  16. Determining Distance, Age, and Activity in a New Benchmark Cluster: Ruprecht 147

    NASA Astrophysics Data System (ADS)

    Wright, Jason T.

    2009-08-01

    This proposal seeks 0.7 night of time on Hectochelle to observe the F, G, and K dwarfs of Ruprecht 147, recently identified as the closest old stellar cluster. At only ~ 200 pc and at an age of ~ 1-2 Gyr, this will be an important benchmark in stellar astrophysics, providing the only sample of spectroscopically accessible old, late-type stars of determinable age. Hectochelle is the ideal instrument to study this cluster, with a FOV, fiber count, and telescope aperture well matched to the cluster's diameter (~ 1°), richness (~ 100 identified members), and distance modulus (6.5-7 mag., putting the G and K dwarfs at B=11-15). Hectochelle will measure the Ca II line strengths of members to establish, for the first time, the chromospheric activity levels of a statistically significant sample of single, G and K dwarfs of this modest age. Hectochelle will also vet background stars for suitability as astrometric reference stars for a forthcoming HST FGS proposal to robustly measure the cluster's distance.

  17. Role of lattice defects in catalytic activities of graphene clusters for fuel cells.

    PubMed

    Zhang, Lipeng; Xu, Quan; Niu, Jianbing; Xia, Zhenhai

    2015-07-14

    Defects are common but important in graphene, which could significantly tailor the electronic structures and physical and chemical properties. In this study, the density functional theory (DFT) method was applied to study the electronic structure and catalytic properties of graphene clusters containing various point and line defects. The electron transfer processes in oxygen reduction reaction (ORR) on perfect and defective graphene clusters in fuel cells was simulated, and the free energy and reaction energy barrier of the elementary reactions were calculated to determine the reaction pathways. It was found that the graphene cluster with the point defect having pentagon rings at the zigzag edge, or line defects (grain boundaries) consisting of pentagon-pentagon-octagon or pentagon-heptagon chains also at the edges, shows the electrocatalytic capability for ORR. Four-electron and two-electron transfer processes could occur simultaneously on graphene clusters with certain types of defects. The energy barriers of the reactions are comparable to that of platinum(111). The catalytic active sites were determined on the defective graphene. PMID:26033301

  18. Iron binding activity is essential for the function of IscA in iron-sulphur cluster biogenesis.

    PubMed

    Landry, Aaron P; Cheng, Zishuo; Ding, Huangen

    2013-03-01

    Iron-sulphur cluster biogenesis requires coordinated delivery of iron and sulphur to scaffold proteins, followed by transfer of the assembled clusters from scaffold proteins to target proteins. This complex process is accomplished by a group of dedicated iron-sulphur cluster assembly proteins that are conserved from bacteria to humans. While sulphur in iron-sulphur clusters is provided by L-cysteine via cysteine desulfurase, the iron donor(s) for iron-sulphur cluster assembly remains largely elusive. Here we report that among the primary iron-sulphur cluster assembly proteins, IscA has a unique and strong binding activity for mononuclear iron in vitro and in vivo. Furthermore, the ferric iron centre tightly bound in IscA can be readily extruded by l-cysteine, followed by reduction to ferrous iron for iron-sulphur cluster biogenesis. Substitution of the highly conserved residue tyrosine 40 with phenylalanine (Y40F) in IscA results in a mutant protein that has a diminished iron binding affinity but retains the iron-sulphur cluster binding activity. Genetic complementation studies show that the IscA Y40F mutant is inactive in vivo, suggesting that the iron binding activity is essential for the function of IscA in iron-sulphur cluster biogenesis.

  19. Spi-1/PU.1 activates transcription through clustered DNA occupancy in erythroleukemia.

    PubMed

    Ridinger-Saison, Maya; Boeva, Valentina; Rimmelé, Pauline; Kulakovskiy, Ivan; Gallais, Isabelle; Levavasseur, Benjamin; Paccard, Caroline; Legoix-Né, Patricia; Morlé, François; Nicolas, Alain; Hupé, Philippe; Barillot, Emmanuel; Moreau-Gachelin, Françoise; Guillouf, Christel

    2012-10-01

    Acute leukemias are characterized by deregulation of transcriptional networks that control the lineage specificity of gene expression. The aberrant overexpression of the Spi-1/PU.1 transcription factor leads to erythroleukemia. To determine how Spi-1 mechanistically influences the transcriptional program, we combined a ChIP-seq analysis with transcriptional profiling in cells from an erythroleukemic mouse model. We show that Spi-1 displays a selective DNA-binding that does not often cause transcriptional modulation. We report that Spi-1 controls transcriptional activation and repression partially through distinct Spi-1 recruitment to chromatin. We revealed several parameters impacting on Spi-1-mediated transcriptional activation. Gene activation is facilitated by Spi-1 occupancy close to transcriptional starting site of genes devoid of CGIs. Moreover, in those regions Spi-1 acts by binding to multiple motifs tightly clustered and with similar orientation. Finally, in contrast to the myeloid and lymphoid B cells in which Spi-1 exerts a physiological activity, in the erythroleukemic cells, lineage-specific cooperating factors do not play a prevalent role in Spi-1-mediated transcriptional activation. Thus, our work describes a new mechanism of gene activation through clustered site occupancy of Spi-1 particularly relevant in regard to the strong expression of Spi-1 in the erythroleukemic cells.

  20. A Cluster-Analytical Approach towards Physical Activity and Eating Habits among 10-Year-Old Children

    ERIC Educational Resources Information Center

    Sabbe, Dieter; De Bourdeaudhuij, I.; Legiest, E.; Maes, L.

    2008-01-01

    The purpose was to investigate whether clusters--based on physical activity (PA) and eating habits--can be found among children, and to explore subgroups' characteristics. A total of 1725 10-year olds completed a self-administered questionnaire. K-means cluster analysis was based on the weekly quantity of vigorous and moderate PA, the excess index…

  1. ANISOTROPIC METAL-ENRICHED OUTFLOWS DRIVEN BY ACTIVE GALACTIC NUCLEI IN CLUSTERS OF GALAXIES

    SciTech Connect

    Kirkpatrick, C. C.; McNamara, B. R.; Cavagnolo, K. W.

    2011-04-20

    We present an analysis of the spatial distribution of metal-rich gas in 10 galaxy clusters using deep observations from the Chandra X-ray Observatory. The brightest cluster galaxies (BCGs) have experienced recent active galactic nucleus activity in the forms of bright radio emission, cavities, and shock fronts embedded in the hot atmospheres. The heavy elements are distributed anisotropically and are aligned with the large-scale radio and cavity axes. They are apparently being transported from the halo of the BCG into the intracluster medium along large-scale outflows driven by the radio jets. The radial ranges of the metal-enriched outflows are found to scale with jet power as R{sub Fe} {proportional_to} P {sup 0.42}{sub jet}, with a scatter of only 0.5 dex. The heavy elements are transported beyond the extent of the inner cavities in all clusters, suggesting that this is a long-lasting effect sustained over multiple generations of outbursts. Black holes in BCGs will likely have difficulty ejecting metal-enriched gas beyond 1 Mpc unless their masses substantially exceed 10{sup 9} M{sub sun}.

  2. MHD SIMULATIONS OF ACTIVE GALACTIC NUCLEUS JETS IN A DYNAMIC GALAXY CLUSTER MEDIUM

    SciTech Connect

    Mendygral, P. J.; Jones, T. W.; Dolag, K.

    2012-05-10

    We present a pair of three-dimensional magnetohydrodynamical simulations of intermittent jets from a central active galactic nucleus (AGN) in a galaxy cluster extracted from a high-resolution cosmological simulation. The selected cluster was chosen as an apparently relatively relaxed system, not having undergone a major merger in almost 7 Gyr. Despite this characterization and history, the intracluster medium (ICM) contains quite active 'weather'. We explore the effects of this ICM weather on the morphological evolution of the AGN jets and lobes. The orientation of the jets is different in the two simulations so that they probe different aspects of the ICM structure and dynamics. We find that even for this cluster, which can be characterized as relaxed by an observational standard, the large-scale, bulk ICM motions can significantly distort the jets and lobes. Synthetic X-ray observations of the simulations show that the jets produce complex cavity systems, while synthetic radio observations reveal bending of the jets and lobes similar to wide-angle tail radio sources. The jets are cycled on and off with a 26 Myr period using a 50% duty cycle. This leads to morphological features similar to those in 'double-double' radio galaxies. While the jet and ICM magnetic fields are generally too weak in the simulations to play a major role in the dynamics, Maxwell stresses can still become locally significant.

  3. Phosphorous transient enhanced diffusion suppression and activation enhancement with cluster carbon co-implantation

    NASA Astrophysics Data System (ADS)

    Nakashima, Yoshiki; Hamamoto, Nariaki; Nagayama, Tsutomu; Koga, Yuji; Umisedo, Sei; Kawamura, Yasunori; Hashimoto, Masahiro; Onoda, Hiroshi

    2012-11-01

    Carbon co-implantation is well known as an effective method for suppressing boron/phosphorous transient enhanced diffusion (TED). Germanium pre-amorphization implantation (PAI) is usually applied prior to carbon co-implantation for suppressing channeling tail of dopants. In this study, cluster carbon was applied instead of the combination of germanium PAI and monomer carbon co-implantation prior to phosphorous implantation. Dependence of phosphorous activation and TED on amorphous layer thickness, carbon dose, carbon distribution and substrate temperature have been investigated. Cluster carbon implantation enables thick amorphous layer formation and TED suppression at the same time and low temperature implantation enhances the ability of amorphous layer formation so that shallow junction and low Rs can be achieved without Ge implantation.

  4. Phosphorous transient enhanced diffusion suppression and activation enhancement with cluster carbon co-implantation

    SciTech Connect

    Nakashima, Yoshiki; Hamamoto, Nariaki; Nagayama, Tsutomu; Koga, Yuji; Umisedo, Sei; Kawamura, Yasunori; Hashimoto, Masahiro; Onoda, Hiroshi

    2012-11-06

    Carbon co-implantation is well known as an effective method for suppressing boron/phosphorous transient enhanced diffusion (TED). Germanium pre-amorphization implantation (PAI) is usually applied prior to carbon co-implantation for suppressing channeling tail of dopants. In this study, cluster carbon was applied instead of the combination of germanium PAI and monomer carbon co-implantation prior to phosphorous implantation. Dependence of phosphorous activation and TED on amorphous layer thickness, carbon dose, carbon distribution and substrate temperature have been investigated. Cluster carbon implantation enables thick amorphous layer formation and TED suppression at the same time and low temperature implantation enhances the ability of amorphous layer formation so that shallow junction and low Rs can be achieved without Ge implantation.

  5. Interplay of cytoskeletal activity and lipid phase stability in dynamic protein recruitment and clustering

    PubMed Central

    Gómez-Llobregat, Jordi; Buceta, Javier; Reigada, Ramon

    2013-01-01

    Recent experiments have revealed that some membrane proteins aggregate to form clusters. This type of process has been proven to be dynamic and to be actively maintained by external kinetics. Additionally, this dynamic recruiting is cholesterol- and actin-dependent, suggesting that raft organization and cytoskeleton rearrangement play a crucial role. In the present study, we propose a simple model that provides a general framework to describe the dynamical behavior of lipid-protein assemblies. Our results suggest that lipid-mediated interactions and cytoskeleton-anchored proteins contribute to the modulation of such behavior. In particular, we find a resonant condition between the membrane protein and cytoskeleton dynamics that results in the invariance of the ratio of clustered proteins that is found in in vivo experimental observations. PMID:24018870

  6. In Situ Generation of Active Molybdenum Octahedral Clusters for Photocatalytic Hydrogen Production from Water.

    PubMed

    Feliz, Marta; Puche, Marta; Atienzar, Pedro; Concepción, Patricia; Cordier, Stéphane; Molard, Yann

    2016-08-01

    The photocatalytic hydrogen evolution reaction (HER) from water under homogeneous and heterogeneous conditions is explored for the {Mo6 Br(i) 8 }(4+) cluster core based unit starting from (TBA)2 [Mo6 Br(i) 8 F(a) 6 ] (TBA=tetra-n-butylammonium; "i" and "a" refer to the face-capping inner and terminal apical ligand, respectively). The catalytic activity of {Mo6 Br(i) 8 }(4+) is enhanced by the in situ generation of [Mo6 Br(i) 8 F(a) 5 (OH)(a) ](2-) , [Mo6 Br(i) 8 F(a) 3 (OH)(a) 3 ](2-) , and [Mo6 Br(i) 8 (OH)(a) 6 ](2-) , which are identified by ESIMS, luminescence, and NMR techniques. Full substitution of F(-) by OH(-) leads to the formation of (H3 O)2 [Mo6 Br(i) 8 (OH)(a) 6 ]⋅10 H2 O; its structure was determined by single-crystal XRD. The immobilization of the active {Mo6 Br(i) 8 }(4+) onto graphene oxide (GO) surfaces enhances its stability under catalytic conditions. The catalytic activity of the resulting (TBA)2 Mo6 Br(i) 8 @GO material is improved with respect to GO, but is reduced compared to the activity under homogeneous conditions because of changes in the GO semiconducting properties as well as lower activity and/or accessibility of the anchored cluster. PMID:27314221

  7. Multi-wavelength study of X-ray luminous clusters at z ~ 0.3. I. Star-formation activity of cluster galaxies

    NASA Astrophysics Data System (ADS)

    Braglia, F. G.; Pierini, D.; Biviano, A.; Böhringer, H.

    2009-06-01

    Context: The current paradigm of cosmic formation and evolution of galaxy clusters foresees growth mostly through merging. Galaxies in the infall region or in the core of a cluster undergo transformations owing to different environmental stresses. Aims: For two X-ray luminous clusters at redshift z 0.3 with opposite X-ray morphologies (i.e., dynamical states), RXCJ 0014.3-3022 and RXCJ 2308.3-0211, we assess differences in galaxy populations as a function of cluster topography. This is a pilot study for the joint X-ray and optical analysis of the REFLEX-DXL cluster sample. Methods: Cluster large-scale structure and substructure are determined from the combined photometry in the B, V, and R bands, and from multi-object optical spectroscopy at low resolution. Photometric redshifts and broad-band optical colours are determined. A spectral index analysis is performed, based on the [O II](λλ3726, 3728 Å) and Hδ(λ4102 Å) features, and the D4000 break, which are available for more than 100 member galaxies per cluster. Additional far-ultraviolet (FUV) photometry is retrieved from the GALEX archive. Combination of spectral indices and FUV-optical colours provides a picture of the star-formation history in galaxies. Results: In spite of the potential presence of a small fraction of galaxies with obscured star-formation activity, the average star-formation history of cluster members is found to depend on clustercentric distance and, more interestingly, on cluster substructure. The core regions of both clusters mainly host galaxies dominated by old, passively evolving stellar populations, which define the same red sequence in a (B-R) colour-R magnitude diagram. However, a sharp increase in star-formation activity is found along two clearly evident filamentary structures of the merging cluster RXCJ 0014.3-3022, out to its virial radius and beyond. It is produced by luminous (i.e., LR ≥ LRstar) and sub-Lstar galaxies. In contrast, the regular cool-core cluster RXCJ 2308

  8. Predicting Water Activity for Complex Wastes with Solvation Cluster Equilibria (SCE) - 12042

    SciTech Connect

    Agnew, S.F.; Reynolds, J.G.; Johnston, C.T.

    2012-07-01

    Predicting an electrolyte mixture's water activity, i.e. the ratio of water vapor pressure over a solution with that of pure water, in principle reveals both boiling point and solubilities for that mixture. Better predictions of these properties helps support the ongoing missions to concentrate complex nuclear waste mixtures in order to conserve tank space and improved predictions of water activity will help. A new approach for predicting water activity, the solvation cluster equilibria (SCE) model, uses pure electrolyte water activities to predict water activity for a complex mixture of those electrolytes. An SCE function based on electrolyte hydration free energy and a standard Debye- Hueckel (DH) charge compression fits each pure electrolyte's water activity with three parameters. Given these pure electrolyte water activities, the SCE predicts any mixture water activity over a large range of concentration with an additional parameter for each mixture vector, the multinarity. In contrast to ionic strength, which scales with concentration, multinarity is related to the relative proportion of electrolytes in a mixture and can either increase or decrease the water activity prediction over a broad range of concentration for that mixture. The SCE model predicts water activity for complex electrolyte mixtures based on the water activities of pure electrolytes. Three parameter SCE functions fit the water activities of pure electrolytes and along with a single multinarity parameter for each mixture vector then predict the mixture water activity. Predictions of water activity can in principle predict solution electrolyte activity and this relationship will be explored in the future. Predicting electrolyte activities for complex mixtures provides a means of determining solubilities for each electrolyte. Although there are a number of reports [9, 10, 11] of water activity models for pure and binary mixtures of electrolytes, none of them compare measured versus calculated

  9. Activation of conventional kinesin motors in clusters by Shaw voltage-gated K+ channels

    PubMed Central

    Barry, Joshua; Xu, Mingxuan; Gu, Yuanzheng; Dangel, Andrew W.; Jukkola, Peter; Shrestha, Chandra; Gu, Chen

    2013-01-01

    Summary The conventional kinesin motor transports many different cargos to specific locations in neurons. How cargos regulate motor function remains unclear. Here we focus on KIF5, the heavy chain of conventional kinesin, and report that the Kv3 (Shaw) voltage-gated K+ channel, the only known tetrameric KIF5-binding protein, clusters and activates KIF5 motors during axonal transport. Endogenous KIF5 often forms clusters along axons, suggesting a potential role of KIF5-binding proteins. Our biochemical assays reveal that the high-affinity multimeric binding between the Kv3.1 T1 domain and KIF5B requires three basic residues in the KIF5B tail. Kv3.1 T1 competes with the motor domain and microtubules, but not with kinesin light chain 1 (KLC1), for binding to the KIF5B tail. Live-cell imaging assays show that four KIF5-binding proteins, Kv3.1, KLC1 and two synaptic proteins SNAP25 and VAMP2, differ in how they regulate KIF5B distribution. Only Kv3.1 markedly increases the frequency and number of KIF5B-YFP anterograde puncta. Deletion of Kv3.1 channels reduces KIF5 clusters in mouse cerebellar neurons. Therefore, clustering and activation of KIF5 motors by Kv3 regulate the motor number in carrier vesicles containing the channel proteins, contributing not only to the specificity of Kv3 channel transport, but also to the cargo-mediated regulation of motor function. PMID:23487040

  10. C-H Bond Activation by Early Transition Metal Carbide Cluster Anion MoC3 (-).

    PubMed

    Li, Zi-Yu; Hu, Lianrui; Liu, Qing-Yu; Ning, Chuan-Gang; Chen, Hui; He, Sheng-Gui; Yao, Jiannian

    2015-12-01

    Although early transition metal (ETM) carbides can activate CH bonds in condensed-phase systems, the electronic-level mechanism is unclear. Atomic clusters are ideal model systems for understanding the mechanisms of bond activation. For the first time, CH activation of a simple alkane (ethane) by an ETM carbide cluster anion (MoC3 (-) ) under thermal-collision conditions has been identified by using high-resolution mass spectrometry, photoelectron imaging spectroscopy, and high-level quantum chemical calculations. Dehydrogenation and ethene elimination were observed in the reaction of MoC3 (-) with C2 H6 . The CH activation follows a mechanism of oxidative addition that is much more favorable in the carbon-stabilized low-spin ground electronic state than in the high-spin excited state. The reaction efficiency between the MoC3 (-) anion and C2 H6 is low (0.23±0.05) %. A comparison between the anionic and a highly efficient cationic reaction system (Pt(+) +C2 H6 ) was made. It turned out that the potential-energy surfaces for the entrance channels of the anionic and cationic reaction systems can be very different. PMID:26490554

  11. Subnanometer platinum clusters highly active and selective catalysts for the oxidative dehydrogenation of propane.

    SciTech Connect

    Vajda, S; Pellin, M. J.; Greeley, J. P.; Marshall, C. L.; Curtiss, L. A.; Ballentine, G. A.; Elam, J. W.; Catillon-Mucherie, S.; Redfern, P. C.; Mehmood, F.; Zapol, P.; Yale Univ.

    2009-03-01

    Small clusters are known to possess reactivity not observed in their bulk analogues, which can make them attractive for catalysis. Their distinct catalytic properties are often hypothesized to result from the large fraction of under-coordinated surface atoms. Here, we show that size-preselected Pt{sub 8-10} clusters stabilized on high-surface-area supports are 40-100 times more active for the oxidative dehydrogenation of propane than previously studied platinum and vanadia catalysts, while at the same time maintaining high selectivity towards formation of propylene over by-products. Quantum chemical calculations indicate that under-coordination of the Pt atoms in the clusters is responsible for the surprisingly high reactivity compared with extended surfaces. We anticipate that these results will form the basis for development of a new class of catalysts by providing a route to bond-specific chemistry, ranging from energy-efficient and environmentally friendly synthesis strategies to the replacement of petrochemical feedstocks by abundant small alkanes.

  12. Visible-Light-Induced Olefin Activation Using 3D Aromatic Boron-Rich Cluster Photooxidants.

    PubMed

    Messina, Marco S; Axtell, Jonathan C; Wang, Yiqun; Chong, Paul; Wixtrom, Alex I; Kirlikovali, Kent O; Upton, Brianna M; Hunter, Bryan M; Shafaat, Oliver S; Khan, Saeed I; Winkler, Jay R; Gray, Harry B; Alexandrova, Anastassia N; Maynard, Heather D; Spokoyny, Alexander M

    2016-06-01

    We report a discovery that perfunctionalized icosahedral dodecaborate clusters of the type B12(OCH2Ar)12 (Ar = Ph or C6F5) can undergo photo-excitation with visible light, leading to a new class of metal-free photooxidants. Excitation in these species occurs as a result of the charge transfer between low-lying orbitals located on the benzyl substituents and an unoccupied orbital delocalized throughout the boron cluster core. Here we show how these species, photo-excited with a benchtop blue LED source, can exhibit excited-state reduction potentials as high as 3 V and can participate in electron-transfer processes with a broad range of styrene monomers, initiating their polymerization. Initiation is observed in cases of both electron-rich and electron-deficient styrene monomers at cluster loadings as low as 0.005 mol%. Furthermore, photo-excitation of B12(OCH2C6F5)12 in the presence of a less activated olefin such as isobutylene results in the production of highly branched poly(isobutylene). This work introduces a new class of air-stable, metal-free photo-redox reagents capable of mediating chemical transformations. PMID:27186856

  13. Modeling active galactic nucleus feedback in cool-core clusters: The formation of cold clumps

    SciTech Connect

    Li, Yuan; Bryan, Greg L.

    2014-07-10

    We perform high-resolution (15-30 pc) adaptive mesh simulations to study the impact of momentum-driven active galactic nucleus (AGN) feedback in cool-core clusters, focusing in this paper on the formation of cold clumps. The feedback is jet-driven with an energy determined by the amount of cold gas within 500 pc of the super-massive black hole. When the intracluster medium in the core of the cluster becomes marginally stable to radiative cooling, with the thermal instability to the free-fall timescale ratio t{sub TI}/t{sub ff} < 3-10, cold clumps of gas start to form along the propagation direction of the AGN jets. By tracing the particles in the simulations, we find that these cold clumps originate from low entropy (but still hot) gas that is accelerated by the jet to outward radial velocities of a few hundred km s{sup –1}. This gas is out of hydrostatic equilibrium and so can cool. The clumps then grow larger as they decelerate and fall toward the center of the cluster, eventually being accreted onto the super-massive black hole. The general morphology, spatial distribution, and estimated Hα morphology of the clumps are in reasonable agreement with observations, although we do not fully replicate the filamentary morphology of the clumps seen in the observations, probably due to missing physics.

  14. Modeling Active Galactic Nucleus Feedback in Cool-core Clusters: The Formation of Cold Clumps

    NASA Astrophysics Data System (ADS)

    Li, Yuan; Bryan, Greg L.

    2014-07-01

    We perform high-resolution (15-30 pc) adaptive mesh simulations to study the impact of momentum-driven active galactic nucleus (AGN) feedback in cool-core clusters, focusing in this paper on the formation of cold clumps. The feedback is jet-driven with an energy determined by the amount of cold gas within 500 pc of the super-massive black hole. When the intracluster medium in the core of the cluster becomes marginally stable to radiative cooling, with the thermal instability to the free-fall timescale ratio t TI/t ff < 3-10, cold clumps of gas start to form along the propagation direction of the AGN jets. By tracing the particles in the simulations, we find that these cold clumps originate from low entropy (but still hot) gas that is accelerated by the jet to outward radial velocities of a few hundred km s-1. This gas is out of hydrostatic equilibrium and so can cool. The clumps then grow larger as they decelerate and fall toward the center of the cluster, eventually being accreted onto the super-massive black hole. The general morphology, spatial distribution, and estimated Hα morphology of the clumps are in reasonable agreement with observations, although we do not fully replicate the filamentary morphology of the clumps seen in the observations, probably due to missing physics.

  15. ACTIVE GALACTIC NUCLEUS FEEDBACK AND ENTROPY INJECTION IN GALAXY CLUSTER CORES

    SciTech Connect

    Chaudhuri, Anya; Majumdar, Subhabrata; Nath, Biman B. E-mail: subha@tifr.res.in

    2013-10-20

    We make the first estimate of non-gravitational energy profiles in galaxy cluster cores (and beyond) based on observational data. Comparing the observed entropy profiles within r{sub 500}, from the Representative XMM-Newton Cluster Structure Survey to simulated base entropy profiles without feedback from both adaptive mesh refinement (AMR) and smoothed particle hydrodynamic (SPH) non-radiative simulations, we estimate the amount of additional non-gravitational energy, E{sub ICM}, contained in the intracluster medium (ICM), as well as the total energy feedback, E{sub Feedback}, from active galactic nuclei (AGNs; the central AGNs in most cases) into the clusters. The total feedback energy scales with the mean spectroscopic temperature as E{sub Feedback}∝T{sub sp}{sup 2.52±0.08} and E{sub Feedback}∝T{sub sp}{sup 2.17±0.11} for the SPH and AMR baseline profiles. The mean non-gravitational energy per particle within r{sub 500} remaining in the ICM after energy lost during cooling is ε{sub ICM} = 2.8 ± 0.8 keV for the SPH theoretical relation and ε{sub ICM} = 1.7 ± 0.9 keV for the AMR theoretical relation. We use the NRAO/VLA Sky Survey source catalog to determine the radio luminosity, L{sub R} , at 1.4 GHz of the central source(s) of our sample. For T{sub sp} > 3 keV, the E{sub Feedback} correlates with L{sub R} , although with different normalization for cool-core and non-cool-core clusters. We show that AGNs could provide a significant portion of the feedback.

  16. Clustered mutations in hominid genome evolution are consistent with APOBEC3G enzymatic activity

    PubMed Central

    Pinto, Yishay; Gabay, Orshay; Arbiza, Leonardo; Sams, Aaron J.; Keinan, Alon

    2016-01-01

    The gradual accumulation of mutations by any of a number of mutational processes is a major driving force of divergence and evolution. Here, we investigate a potentially novel mutational process that is based on the activity of members of the AID/APOBEC family of deaminases. This gene family has been recently shown to introduce—in multiple types of cancer—enzyme-induced clusters of co-occurring somatic mutations caused by cytosine deamination. Going beyond somatic mutations, we hypothesized that APOBEC3—following its rapid expansion in primates—can introduce unique germline mutation clusters that can play a role in primate evolution. In this study, we tested this hypothesis by performing a comprehensive comparative genomic screen for APOBEC3-induced mutagenesis patterns across different hominids. We detected thousands of mutation clusters introduced along primate evolution which exhibit features that strongly fit the known patterns of APOBEC3G mutagenesis. These results suggest that APOBEC3G-induced mutations have contributed to the evolution of all genomes we studied. This is the first indication of site-directed, enzyme-induced genome evolution, which played a role in the evolution of both modern and archaic humans. This novel mutational mechanism exhibits several unique features, such as its higher tendency to mutate transcribed regions and regulatory elements and its ability to generate clusters of concurrent point mutations that all occur in a single generation. Our discovery demonstrates the exaptation of an anti-viral mechanism as a new source of genomic variation in hominids with a strong potential for functional consequences. PMID:27056836

  17. ULF wave activity during the 2003 Halloween superstorm: multipoint observations from CHAMP, Cluster and Geotail missions

    NASA Astrophysics Data System (ADS)

    Balasis, G.; Daglis, I. A.; Zesta, E.; Papadimitriou, C.; Georgiou, M.; Haagmans, R.; Tsinganos, K.

    2012-12-01

    We examine data from a topside ionosphere and two magnetospheric missions (CHAMP, Cluster and Geotail) for signatures of ultra low frequency (ULF) waves during the exceptional 2003 Halloween geospace magnetic storm, when Dst reached ~-380 nT. We use a suite of wavelet-based algorithms, which are a subset of a tool that is being developed for the analysis of multi-instrument multi-satellite and ground-based observations to identify ULF waves and investigate their properties. Starting from the region of topside ionosphere, we first present three clear and strong signatures of Pc3 ULF wave activity (frequency 15-100 mHz) in CHAMP tracks. We then expand these three time intervals for purposes of comparison between CHAMP, Cluster and Geotail Pc3 observations but also to be able to search for Pc4-5 wave signatures (frequency 1-10 mHz) into Cluster and Geotail measurements in order to have a more complete picture of the ULF wave occurrence during the storm. Due to the fast motion through field lines in a low Earth orbit (LEO) we are able to reliably detect Pc3 (but not Pc4-5) waves from CHAMP. This is the first time, to our knowledge, that ULF wave observations from a topside ionosphere mission are compared to ULF wave observations from magnetospheric missions. Our study provides evidence for the occurrence of a number of prominent ULF wave events in the Pc3 and Pc4-5 bands during the storm and offers a platform to study the wave evolution from high altitudes to LEO. The ULF wave analysis methods presented here can be applied to observations from the upcoming Swarm multi-satellite mission of ESA, which is anticipated to enable joint studies with the Cluster mission.

  18. Identification of novel mureidomycin analogues via rational activation of a cryptic gene cluster in Streptomyces roseosporus NRRL 15998

    PubMed Central

    Jiang, Lingjuan; Wang, Lu; Zhang, Jihui; Liu, Hao; Hong, Bin; Tan, Huarong; Niu, Guoqing

    2015-01-01

    Antimicrobial agents are urgently needed to tackle the growing threat of antibiotic-resistant pathogens. An important source of new antimicrobials is the large repertoire of cryptic gene clusters embedded in microbial genomes. Genome mining revealed a napsamycin/mureidomycin biosynthetic gene cluster in the chromosome of Streptomyces roseosporus NRRL 15998. The cryptic gene cluster was activated by constitutive expression of a foreign activator gene ssaA from sansanmycin biosynthetic gene cluster of Streptomyces sp. strain SS. Expression of the gene cluster was verified by RT-PCR analysis of key biosynthetic genes. The activated metabolites demonstrated potent inhibitory activity against the highly refractory pathogen Pseudomonas aeruginosa, and characterization of the metabolites led to the discovery of eight acetylated mureidomycin analogues. To our surprise, constitutive expression of the native activator gene SSGG_02995, a ssaA homologue in S. roseosporus NRRL 15998, has no beneficial effect on mureidomycin stimulation. This study provides a new way to activate cryptic gene cluster for the acquisition of novel antibiotics and will accelerate the exploitation of prodigious natural products in Streptomyces. PMID:26370924

  19. Voltage clustering in redox-active ligand complexes: mitigating electronic communication through choice of metal ion

    DOE PAGES

    Zarkesh, Ryan A.; Ichimura, Andrew S.; Monson, Todd C.; Tomson, Neil C.; Anstey, Mitchell R.

    2016-02-01

    We used the redox-active bis(imino)acenapthene (BIAN) ligand to synthesize homoleptic aluminum, chromium, and gallium complexes of the general formula (BIAN)3M. The resulting compounds were characterized using X-ray crystallography, NMR, EPR, magnetic susceptibility and cyclic voltammetry measurements and modeled using both DFT and ab initio wavefunction calculations to compare the orbital contributions of main group elements and transition metals in ligand-based redox events. Ultimately, complexes of this type have the potential to improve the energy density and electrolyte stability of grid-scale energy storage technologies, such as redox flow batteries, through thermodynamically-clustered redox events.

  20. Voltage clustering in redox-active ligand complexes: mitigating electronic communication through choice of metal ion.

    PubMed

    Zarkesh, Ryan A; Ichimura, Andrew S; Monson, Todd C; Tomson, Neil C; Anstey, Mitchell R

    2016-06-14

    The redox-active bis(imino)acenapthene (BIAN) ligand was used to synthesize homoleptic aluminum, chromium, and gallium complexes of the general formula (BIAN)3M. The resulting compounds were characterized using X-ray crystallography, NMR, EPR, magnetic susceptibility and cyclic voltammetry measurements and modeled using both DFT and ab initio wavefunction calculations to compare the orbital contributions of main group elements and transition metals in ligand-based redox events. Complexes of this type have the potential to improve the energy density and electrolyte stability of grid-scale energy storage technologies, such as redox flow batteries, through thermodynamically-clustered redox events. PMID:26998892

  1. NanoCluster Beacons as Reporter Probes in Rolling Circle Enhanced Enzyme Activity Detection†

    PubMed Central

    Juul, Sissel; Obliosca, Judy M.; Liu, Cong; Liu, Yen-Liang; Chen, Yu-An; Imphean, Darren M.; Knudsen, Birgitta R.; Ho, Yi-Ping; Leong, Kam W.; Yeh, Hsin-Chih

    2015-01-01

    As a newly developed assay for the detection of endogenous enzyme activity at the single-catalytic-event level, Rolling Circle Enhanced Enzyme Activity Detection (REEAD) has been used to measure enzyme activity in both single human cells and malaria-causing parasites, Plasmodium sp.. Current REEAD assays rely on organic dye-tagged linear DNA probes to report the rolling circle amplification products (RCPs), the cost of which may hinder the widespread use of REEAD. Here we show that a new class of activatable probes, NanoCluster Beacons (NCBs), can simplify the REEAD assays. Easily prepared without any need for purification and capable of large fluorescence enhancement upon hybridization, NCBs are cost-effective and sensitive. Compared to conventional fluorescent probes, NCBs are also more photostable. As demonstrated in reporting the human topoisomerases I (hTopI) cleavage-ligation reaction, the proposed NCBs suggest a read-out format attractive for future REEAD-based diagnostics. PMID:25901841

  2. [FeFe]-Hydrogenase with Chalcogenide Substitutions at the H-Cluster Maintains Full H2 Evolution Activity.

    PubMed

    Noth, Jens; Esselborn, Julian; Güldenhaupt, Jörn; Brünje, Annika; Sawyer, Anne; Apfel, Ulf-Peter; Gerwert, Klaus; Hofmann, Eckhard; Winkler, Martin; Happe, Thomas

    2016-07-11

    The [FeFe]-hydrogenase HYDA1 from Chlamydomonas reinhardtii is particularly amenable to biochemical and biophysical characterization because the H-cluster in the active site is the only inorganic cofactor present. Herein, we present the complete chemical incorporation of the H-cluster into the HYDA1-apoprotein scaffold and, furthermore, the successful replacement of sulfur in the native [4FeH ] cluster with selenium. The crystal structure of the reconstituted pre-mature HYDA1[4Fe4Se]H protein was determined, and a catalytically intact artificial H-cluster variant was generated upon in vitro maturation. Full hydrogen evolution activity as well as native-like composition and behavior of the redesigned enzyme were verified through kinetic assays, FTIR spectroscopy, and X-ray structure analysis. These findings reveal that even a bioinorganic active site with exceptional complexity can exhibit a surprising level of compositional plasticity. PMID:27214763

  3. [FeFe]-Hydrogenase with Chalcogenide Substitutions at the H-Cluster Maintains Full H2 Evolution Activity.

    PubMed

    Noth, Jens; Esselborn, Julian; Güldenhaupt, Jörn; Brünje, Annika; Sawyer, Anne; Apfel, Ulf-Peter; Gerwert, Klaus; Hofmann, Eckhard; Winkler, Martin; Happe, Thomas

    2016-07-11

    The [FeFe]-hydrogenase HYDA1 from Chlamydomonas reinhardtii is particularly amenable to biochemical and biophysical characterization because the H-cluster in the active site is the only inorganic cofactor present. Herein, we present the complete chemical incorporation of the H-cluster into the HYDA1-apoprotein scaffold and, furthermore, the successful replacement of sulfur in the native [4FeH ] cluster with selenium. The crystal structure of the reconstituted pre-mature HYDA1[4Fe4Se]H protein was determined, and a catalytically intact artificial H-cluster variant was generated upon in vitro maturation. Full hydrogen evolution activity as well as native-like composition and behavior of the redesigned enzyme were verified through kinetic assays, FTIR spectroscopy, and X-ray structure analysis. These findings reveal that even a bioinorganic active site with exceptional complexity can exhibit a surprising level of compositional plasticity.

  4. Overproduction of Ristomycin A by Activation of a Silent Gene Cluster in Amycolatopsis japonicum MG417-CF17

    PubMed Central

    Spohn, Marius; Kirchner, Norbert; Kulik, Andreas; Jochim, Angelika; Wolf, Felix; Muenzer, Patrick; Borst, Oliver; Gross, Harald; Wohlleben, Wolfgang

    2014-01-01

    The emergence of antibiotic-resistant pathogenic bacteria within the last decades is one reason for the urgent need for new antibacterial agents. A strategy to discover new anti-infective compounds is the evaluation of the genetic capacity of secondary metabolite producers and the activation of cryptic gene clusters (genome mining). One genus known for its potential to synthesize medically important products is Amycolatopsis. However, Amycolatopsis japonicum does not produce an antibiotic under standard laboratory conditions. In contrast to most Amycolatopsis strains, A. japonicum is genetically tractable with different methods. In order to activate a possible silent glycopeptide cluster, we introduced a gene encoding the transcriptional activator of balhimycin biosynthesis, the bbr gene from Amycolatopsis balhimycina (bbrAba), into A. japonicum. This resulted in the production of an antibiotically active compound. Following whole-genome sequencing of A. japonicum, 29 cryptic gene clusters were identified by genome mining. One of these gene clusters is a putative glycopeptide biosynthesis gene cluster. Using bioinformatic tools, ristomycin (syn. ristocetin), a type III glycopeptide, which has antibacterial activity and which is used for the diagnosis of von Willebrand disease and Bernard-Soulier syndrome, was deduced as a possible product of the gene cluster. Chemical analyses by high-performance liquid chromatography and mass spectrometry (HPLC-MS), tandem mass spectrometry (MS/MS), and nuclear magnetic resonance (NMR) spectroscopy confirmed the in silico prediction that the recombinant A. japonicum/pRM4-bbrAba synthesizes ristomycin A. PMID:25114137

  5. Regulatory elements required for the activation and repression of the protocadherin-alpha gene cluster.

    PubMed

    Kehayova, Polina; Monahan, Kevin; Chen, Weisheng; Maniatis, Tom

    2011-10-11

    The mouse protocadherin (Pcdh) -α, -β, and -γ gene clusters encode more than 50 protein isoforms, the combinatorial expression of which generates vast single-cell diversity in the brain. At present, the mechanisms by which this diversity is expressed are not understood. Here we show that two transcriptional enhancer elements, HS5-1 and HS7, play a critical role in Pcdhα gene expression in mice. We show that the HS5-1 element functions as an enhancer in neurons and a silencer in nonneuronal cells. The enhancer activity correlates with the binding of zinc finger DNA binding protein CTCF to the target promoters, and the silencer activity requires the binding of the REST/NRSF repressor complex in nonneuronal cells. Thus, the HS5-1 element functions as a neuron-specific enhancer and nonneuronal cell repressor. In contrast, the HS7 element functions as a Pcdhα cluster-wide transcription enhancer element. These studies reveal a complex organization of regulatory elements required for generating single cell Pcdh diversity. PMID:21949399

  6. Microbial communication leading to the activation of silent fungal secondary metabolite gene clusters

    PubMed Central

    Netzker, Tina; Fischer, Juliane; Weber, Jakob; Mattern, Derek J.; König, Claudia C.; Valiante, Vito; Schroeckh, Volker; Brakhage, Axel A.

    2015-01-01

    Microorganisms form diverse multispecies communities in various ecosystems. The high abundance of fungal and bacterial species in these consortia results in specific communication between the microorganisms. A key role in this communication is played by secondary metabolites (SMs), which are also called natural products. Recently, it was shown that interspecies “talk” between microorganisms represents a physiological trigger to activate silent gene clusters leading to the formation of novel SMs by the involved species. This review focuses on mixed microbial cultivation, mainly between bacteria and fungi, with a special emphasis on the induced formation of fungal SMs in co-cultures. In addition, the role of chromatin remodeling in the induction is examined, and methodical perspectives for the analysis of natural products are presented. As an example for an intermicrobial interaction elucidated at the molecular level, we discuss the specific interaction between the filamentous fungi Aspergillus nidulans and Aspergillus fumigatus with the soil bacterium Streptomyces rapamycinicus, which provides an excellent model system to enlighten molecular concepts behind regulatory mechanisms and will pave the way to a novel avenue of drug discovery through targeted activation of silent SM gene clusters through co-cultivations of microorganisms. PMID:25941517

  7. Changing Ionization Conditions in SDSS Galaxies with Active Galactic Nuclei as a Function of Environment from Pairs to Clusters

    NASA Astrophysics Data System (ADS)

    Khabiboulline, Emil T.; Steinhardt, Charles L.; Silverman, John D.; Ellison, Sara L.; Mendel, J. Trevor; Patton, David R.

    2014-11-01

    We study how active galactic nucleus (AGN) activity changes across environments from galaxy pairs to clusters using 143,843 galaxies with z < 0.2 from the Sloan Digital Sky Survey. Using a refined technique, we apply a continuous measure of AGN activity, characteristic of the ionization state of the narrow-line emitting gas. Changes in key emission-line ratios ([N II] λ6548/Hα, [O III] λ5007/Hβ) between different samples allow us to disentangle different environmental effects while removing contamination. We confirm that galaxy interactions enhance AGN activity. However, conditions in the central regions of clusters are inhospitable for AGN activity even if galaxies are in pairs. These results can be explained through models of gas dynamics in which pair interactions stimulate the transfer of gas to the nucleus and clusters suppress gas availability for accretion onto the central black hole.

  8. Changing ionization conditions in SDSS galaxies with active galactic nuclei as a function of environment from pairs to clusters

    SciTech Connect

    Khabiboulline, Emil T.; Steinhardt, Charles L.; Silverman, John D.; Ellison, Sara L.; Mendel, J. Trevor; Patton, David R.

    2014-11-01

    We study how active galactic nucleus (AGN) activity changes across environments from galaxy pairs to clusters using 143,843 galaxies with z < 0.2 from the Sloan Digital Sky Survey. Using a refined technique, we apply a continuous measure of AGN activity, characteristic of the ionization state of the narrow-line emitting gas. Changes in key emission-line ratios ([N II] λ6548/Hα, [O III] λ5007/Hβ) between different samples allow us to disentangle different environmental effects while removing contamination. We confirm that galaxy interactions enhance AGN activity. However, conditions in the central regions of clusters are inhospitable for AGN activity even if galaxies are in pairs. These results can be explained through models of gas dynamics in which pair interactions stimulate the transfer of gas to the nucleus and clusters suppress gas availability for accretion onto the central black hole.

  9. Methane Activation by Iron-Carbide Cluster Anions FeC6(-).

    PubMed

    Li, Hai-Fang; Li, Zi-Yu; Liu, Qing-Yu; Li, Xiao-Na; Zhao, Yan-Xia; He, Sheng-Gui

    2015-06-18

    Laser-ablation-generated and mass-selected iron-carbide cluster anions FeC6(-) were reacted with CH4 in a linear ion trap reactor under thermal collision conditions. The reactions were characterized by mass spectrometry and density functional theory calculations. Adsorption product of FeC6CH4(-) was observed in the experiments. The identified large kinetic isotope effect suggests that CH4 can be activated by FeC6(-) anions with a dissociative adsorption manner, which is further supported by the reaction mechanism calculations. The large dipole moment of FeC6(-) (19.21 D) can induce a polarization of CH4 and can facilitate the cleavage of C-H bond. This study reports the CH4 activation by transition-metal carbide anions, which provides insights into mechanistic understanding of iron-carbon centers that are important for condensed-phase catalysis.

  10. Clustering Home Activity Distributions for Automatic Detection of Mild Cognitive Impairment in Older Adults1

    PubMed Central

    Akl, Ahmad; Chikhaoui, Belkacem; Mattek, Nora; Kaye, Jeffrey; Austin, Daniel; Mihailidis, Alex

    2016-01-01

    The public health implications of growing numbers of older adults at risk for dementia places pressure on identifying dementia at its earliest stages so as to develop proactive management plans. The prodromal dementia phase commonly identified as mild cognitive impairment is an important target for this early detection of impending dementia amenable to treatment. In this paper, we propose a method for home-based automatic detection of mild cognitive impairment in older adults through continuous monitoring via unobtrusive sensing technologies. Our method is composed of two main stages: a training stage and a test stage. For training, room activity distributions are estimated for each subject using a time frame of ω weeks, and then affinity propagation is employed to cluster the activity distributions and to extract exemplars to represent the different emerging clusters. For testing, room activity distributions belonging to a test subject with unknown cognitive status are compared to the extracted exemplars and get assigned the labels of the exemplars that result in the smallest normalized Kullbak–Leibler divergence. The labels of the activity distributions are then used to determine the cognitive status of the test subject. Using the sensor and clinical data pertaining to 85 homes with single occupants, we were able to automatically detect mild cognitive impairment in older adults with an F0.5 score of 0.856. Also, we were able to detect the non-amnestic sub-type of mild cognitive impairment in older adults with an F0.5 score of 0.958. PMID:27617044

  11. Clustering Home Activity Distributions for Automatic Detection of Mild Cognitive Impairment in Older Adults1

    PubMed Central

    Akl, Ahmad; Chikhaoui, Belkacem; Mattek, Nora; Kaye, Jeffrey; Austin, Daniel; Mihailidis, Alex

    2016-01-01

    The public health implications of growing numbers of older adults at risk for dementia places pressure on identifying dementia at its earliest stages so as to develop proactive management plans. The prodromal dementia phase commonly identified as mild cognitive impairment is an important target for this early detection of impending dementia amenable to treatment. In this paper, we propose a method for home-based automatic detection of mild cognitive impairment in older adults through continuous monitoring via unobtrusive sensing technologies. Our method is composed of two main stages: a training stage and a test stage. For training, room activity distributions are estimated for each subject using a time frame of ω weeks, and then affinity propagation is employed to cluster the activity distributions and to extract exemplars to represent the different emerging clusters. For testing, room activity distributions belonging to a test subject with unknown cognitive status are compared to the extracted exemplars and get assigned the labels of the exemplars that result in the smallest normalized Kullbak–Leibler divergence. The labels of the activity distributions are then used to determine the cognitive status of the test subject. Using the sensor and clinical data pertaining to 85 homes with single occupants, we were able to automatically detect mild cognitive impairment in older adults with an F0.5 score of 0.856. Also, we were able to detect the non-amnestic sub-type of mild cognitive impairment in older adults with an F0.5 score of 0.958.

  12. Application of space-time scan statistics to describe geographic and temporal clustering of visible drug activity.

    PubMed

    Linton, Sabriya L; Jennings, Jacky M; Latkin, Carl A; Gomez, Marisela B; Mehta, Shruti H

    2014-10-01

    Knowledge of the geographic and temporal clustering of drug activity can inform where health and social services are needed and can provide insight on the potential impact of local policies on drug activity. This ecologic study assessed the spatial and temporal distribution of drug activity in Baltimore, Maryland, prior to and following the implementation of a large urban redevelopment project in East Baltimore, which began in 2003. Drug activity was measured by narcotic calls for service at the neighborhood level. A space-time scan statistic approach was used to identify statistically significant clusters of narcotic calls for service across space and time, using a discrete Poisson model. After adjusting for economic deprivation and housing vacancy, clusters of narcotic calls for service were identified among neighborhoods located in Southeast, Northeast, Northwest, and West Baltimore from 2001 to 2010. Clusters of narcotic calls for service were identified among neighborhoods located in East Baltimore from 2001 to 2003, indicating a decrease in narcotic calls thereafter. A large proportion of clusters occurred among neighborhoods located in North and Northeast Baltimore after 2003, which indicated a potential spike during this time frame. These findings suggest potential displacement of drug activity coinciding with the initiation of urban redevelopment in East Baltimore. Space-time scan statistics should be used in future research to describe the potential implications of local policies on drug activity.

  13. Modeling active galactic nucleus feedback in cool-core clusters: The balance between heating and cooling

    SciTech Connect

    Li, Yuan; Bryan, Greg L.

    2014-07-01

    We study the long-term evolution of an idealized cool-core galaxy cluster under the influence of momentum-driven active galactic nucleus (AGN) feedback using three-dimensional high-resolution (60 pc) adaptive mesh refinement simulations. The feedback is modeled with a pair of precessing jets whose power is calculated based on the accretion rate of the cold gas surrounding the supermassive black hole (SMBH). The intracluster medium first cools into clumps along the propagation direction of the jets. As the jet power increases, gas condensation occurs isotropically, forming spatially extended structures that resemble the observed Hα filaments in Perseus and many other cool-core clusters. Jet heating elevates the gas entropy, halting clump formation. The cold gas that is not accreted onto the SMBH settles into a rotating disk of ∼10{sup 11} M {sub ☉}. The hot gas cools directly onto the disk while the SMBH accretes from its innermost region, powering the AGN that maintains a thermally balanced state for a few Gyr. The mass cooling rate averaged over 7 Gyr is ∼30 M {sub ☉} yr{sup –1}, an order of magnitude lower than the classic cooling flow value. Medium resolution simulations produce similar results, while in low resolution runs, the cluster experiences cycles of gas condensation and AGN outbursts. Owing to its self-regulating mechanism, AGN feedback can successfully balance cooling with a wide range of model parameters. Our model also produces cold structures in early stages that are in good agreement with the observations. However, the long-lived massive cold disk is unrealistic, suggesting that additional physical processes are still needed.

  14. Nanoparticle cluster gas sensor: Pt activated SnO2 nanoparticles for NH3 detection with ultrahigh sensitivity.

    PubMed

    Liu, Xu; Chen, Nan; Han, Bingqian; Xiao, Xuechun; Chen, Gang; Djerdj, Igor; Wang, Yude

    2015-09-28

    Pt activated SnO2 nanoparticle clusters were synthesized by a simple solvothermal method. The structure, morphology, chemical state and specific surface area were analyzed by X-ray powder diffraction (XRD), transmission electron microscopy (TEM), X-ray photoelectron spectroscopy (XPS) and N2-sorption studies, respectively. The SnO2 nanoparticle cluster matrix consists of tens of thousands of SnO2 nanoparticles with an ultra-small grain size estimated to be 3.0 nm. And there are abundant random-packed wormhole-like pores, caused by the inter-connection of the SnO2 nanoparticles, throughout each cluster. The platinum element is present in two forms including metal (Pt) and tetravalent metal oxide (PtO2) in the Pt activated SnO2 nanoparticle clusters. The as-synthesized pure and Pt activated SnO2 nanoparticle clusters were used to fabricate gas sensor devices. It was found that the gas response toward 500 ppm of ammonia was improved from 6.48 to 203.44 through the activation by Pt. And the results indicate that the sensor based on Pt activated SnO2 not only has ultrahigh sensitivity but also possesses good response-recovery properties, linear dependence, repeatability, selectivity and long-term stability, demonstrating the potential to use Pt activated SnO2 nanoparticle clusters as ammonia gas sensors. At the same time, the formation mechanisms of the unique nanoparticle clusters and highly enhanced sensitivity are also discussed. PMID:26289622

  15. Nanoparticle cluster gas sensor: Pt activated SnO2 nanoparticles for NH3 detection with ultrahigh sensitivity.

    PubMed

    Liu, Xu; Chen, Nan; Han, Bingqian; Xiao, Xuechun; Chen, Gang; Djerdj, Igor; Wang, Yude

    2015-09-28

    Pt activated SnO2 nanoparticle clusters were synthesized by a simple solvothermal method. The structure, morphology, chemical state and specific surface area were analyzed by X-ray powder diffraction (XRD), transmission electron microscopy (TEM), X-ray photoelectron spectroscopy (XPS) and N2-sorption studies, respectively. The SnO2 nanoparticle cluster matrix consists of tens of thousands of SnO2 nanoparticles with an ultra-small grain size estimated to be 3.0 nm. And there are abundant random-packed wormhole-like pores, caused by the inter-connection of the SnO2 nanoparticles, throughout each cluster. The platinum element is present in two forms including metal (Pt) and tetravalent metal oxide (PtO2) in the Pt activated SnO2 nanoparticle clusters. The as-synthesized pure and Pt activated SnO2 nanoparticle clusters were used to fabricate gas sensor devices. It was found that the gas response toward 500 ppm of ammonia was improved from 6.48 to 203.44 through the activation by Pt. And the results indicate that the sensor based on Pt activated SnO2 not only has ultrahigh sensitivity but also possesses good response-recovery properties, linear dependence, repeatability, selectivity and long-term stability, demonstrating the potential to use Pt activated SnO2 nanoparticle clusters as ammonia gas sensors. At the same time, the formation mechanisms of the unique nanoparticle clusters and highly enhanced sensitivity are also discussed.

  16. RADIO ACTIVE GALAXY NUCLEI IN GALAXY CLUSTERS: HEATING HOT ATMOSPHERES AND DRIVING SUPERMASSIVE BLACK HOLE GROWTH OVER COSMIC TIME

    SciTech Connect

    Ma, C.-J.; McNamara, B. R.; Nulsen, P. E. J.

    2013-01-20

    We estimate the average radio active galactic nucleus (AGN, mechanical) power deposited into the hot atmospheres of galaxy clusters over more than three quarters of the age of the Universe. Our sample was drawn from eight major X-ray cluster surveys and includes 685 clusters in the redshift range 0.1 < z < 0.6 that overlap the area covered by the NRAO VLA Sky Survey (NVSS). The radio-AGN mechanical power was estimated from the radio luminosity of central NVSS sources, using the relation of Cavagnolo et al. that is based on mechanical powers determined from the enthalpies of X-ray cavities. We find only a weak correlation between radio luminosity and cluster X-ray luminosity, although the most powerful radio sources reside in luminous clusters. The average AGN mechanical power of 3 Multiplication-Sign 10{sup 44} erg s{sup -1} exceeds the X-ray luminosity of 44% of the clusters, indicating that the accumulation of radio-AGN energy is significant in these clusters. Integrating the AGN mechanical power to redshift z = 2.0, using simple models for its evolution and disregarding the hierarchical growth of clusters, we find that the AGN energy accumulated per particle in low luminosity X-ray clusters exceeds 1 keV per particle. This result represents a conservative lower limit to the accumulated thermal energy. The estimate is comparable to the level of energy needed to 'preheat' clusters, indicating that continual outbursts from radio-AGN are a significant source of gas energy in hot atmospheres. Assuming an average mass conversion efficiency of {eta} = 0.1, our result implies that the supermassive black holes that released this energy did so by accreting an average of {approx}10{sup 9} M {sub Sun} over time, which is comparable to the level of growth expected during the quasar era.

  17. A conserved activation cluster is required for allosteric communication in HtrA-family proteases

    PubMed Central

    de Regt, Anna; Kim, Seokhee; Sohn, Jungsan; Grant, Robert A.; Baker, Tania A.; Sauer, Robert T.

    2015-01-01

    Summary In E. coli, outer-membrane stress causes a transcriptional response through a signaling cascade initiated by DegS cleavage of a transmembrane anti-sigma factor. Each subunit of DegS, an HtrA-family protease, contains a protease domain and a PDZ domain. The trimeric protease domain is autoinhibited by the unliganded PDZ domains. Allosteric activation requires binding of unassembled outer-membrane proteins (OMPs) to the PDZ domains and protein-substrate binding. Here, we identify a set of DegS residues that cluster together at subunit-subunit interfaces in the trimer, link the active sites and substrate-binding sites, and are crucial for stabilizing the active enzyme conformation in response to OMP signaling. These residues are conserved across the HtrA-protease family, including orthologs linked to human disease, supporting a common mechanism of allosteric activation. Indeed, mutation of residues at homologous positions in the DegP quality-control protease also eliminates allosteric activation. PMID:25703375

  18. The angular clustering of WISE-selected active galactic nuclei: Different halos for obscured and unobscured active galactic nuclei

    SciTech Connect

    Donoso, E.; Yan, Lin; Stern, D.; Assef, R. J.

    2014-07-01

    We calculate the angular correlation function for a sample of ∼170,000 active galactic nuclei (AGNs) extracted from the Wide-field Infrared Survey Explorer (WISE) catalog, selected to have red mid-IR colors (W1 – W2 > 0.8) and 4.6 μm flux densities brighter than 0.14 mJy). The sample is expected to be >90% reliable at identifying AGNs and to have a mean redshift of (z) = 1.1. In total, the angular clustering of WISE AGNs is roughly similar to that of optical AGNs. We cross-match these objects with the photometric Sloan Digital Sky Survey catalog and distinguish obscured sources with r – W2 > 6 from bluer, unobscured AGNs. Obscured sources present a higher clustering signal than unobscured sources. Since the host galaxy morphologies of obscured AGNs are not typical red sequence elliptical galaxies and show disks in many cases, it is unlikely that the increased clustering strength of the obscured population is driven by a host galaxy segregation bias. By using relatively complete redshift distributions from the COSMOS survey, we find that obscured sources at (z) ∼ 0.9 have a bias of b = 2.9 ± 0.6 and are hosted in dark matter halos with a typical mass of log (M/M {sub ☉} h {sup –1}) ∼ 13.5. In contrast, unobscured AGNs at (z) ∼ 1.1 have a bias of b = 1.6 ± 0.6 and inhabit halos of log (M/M {sub ☉} h {sup –1}) ∼ 12.4. These findings suggest that obscured AGNs inhabit denser environments than unobscured AGNs, and they are difficult to reconcile with the simplest AGN unification models, where obscuration is driven solely by orientation.

  19. Electron density estimation in cold magnetospheric plasmas with the Cluster Active Archive

    NASA Astrophysics Data System (ADS)

    Masson, A.; Pedersen, A.; Taylor, M. G.; Escoubet, C. P.; Laakso, H. E.

    2009-12-01

    Electron density is a key physical quantity to characterize any plasma medium. Its measurement is thus essential to understand the various physical processes occurring in the environment of a magnetized planet. However, any magnetosphere of the solar system is far from being an homogeneous medium with a constant electron density and temperature. For instance, the Earth’s magnetosphere is composed of a variety of regions with densities and temperatures spanning over at least 6 decades of magnitude. For this reason, different types of scientific instruments are usually carried onboard a magnetospheric spacecraft to estimate in situ the electron density of the various plasma regions crossed by different means. In the case of the European Space Agency Cluster mission, five different instruments on each of its four identical spacecraft can be used to estimate it: two particle instruments, a DC electric field instrument, a relaxation sounder and a high-time resolution passive wave receiver. Each of these instruments has its pros and cons depending on the plasma conditions. The focus of this study is the accurate estimation of the electron density in cold plasma regions of the magnetosphere including the magnetotail lobes (Ne ≤ 0.01 e-/cc, Te ~ 100 eV) and the plasmasphere (Ne> 10 e-/cc, Te <10 eV). In these regions, particle instruments can be blind to low energy ions outflowing from the ionosphere or measuring only a portion of the energy range of the particles due to photoelectrons. This often results in an under estimation of the bulk density. Measurements from a relaxation sounder enables accurate estimation of the bulk electron density above a fraction of 1 e-/cc but requires careful calibration of the resonances and/or the cutoffs detected. On Cluster, active soundings enable to derive precise density estimates between 0.2 and 80 e-/cc every minute or two. Spacecraft-to-probe difference potential measurements from a double probe electric field experiment can be

  20. Eastern region represents a worrying cluster of active hepatitis C in Algeria in 2012.

    PubMed

    Bensalem, Aïcha; Selmani, Karima; Hihi, Narjes; Bencherifa, Nesrine; Mostefaoui, Fatma; Kerioui, Cherif; Pineau, Pascal; Debzi, Nabil; Berkane, Saadi

    2016-08-01

    Algeria is the largest country of Africa, peopled with populations living a range of traditional/rural and modern/urban lifestyles. The variations of prevalence of chronic active hepatitis care poorly known on the Algerian territory. We conducted a retrospective survey on all patients (n = 998) referred to our institution in 2012 and confirmed by us for an active hepatitis C. Half of the hepatitis C virus (HCV) isolates were genotyped. Forty Algerian regions out of the 48 were represented in our study. Three geographical clusters (Aïn-Temouchent/SidiBelAbbes, Algiers, and a large Eastern region) with an excess of active hepatitis C were observed. Patients coming from the Eastern cluster (Batna, Khenchela, Oum el Bouaghi, and Tebessa) were strongly over-represented (49% of cases, OR = 14.5, P < 0.0001). The hallmarks of Eastern region were an excess of women (65% vs. 46% in the remaining population, P < 0.0001) and the almost exclusive presence of HCV genotype 1 (93% vs. 63%, P = 0.0001). The core of the epidemics was apparently located in Khenchela (odds ratio = 24.6, P < 0.0001). This situation is plausibly connected with nosocomial transmission or traditional practices as scarification (Hijama), piercing or tattooing, very lively in this region. Distinct hepatitis C epidemics are currently affecting Algerian population. The most worrying situation is observed in rural regions located east of Algeria. J. Med. Virol. 88:1394-1403, 2016. © 2016 Wiley Periodicals, Inc. PMID:26856380

  1. THE CLUSTERING OF GALAXIES AROUND RADIO-LOUD ACTIVE GALACTIC NUCLEI

    SciTech Connect

    Worpel, Hauke; Brown, Michael J. I.; Jones, D. Heath; Floyd, David J. E.; Beutler, Florian

    2013-07-20

    We examine the hypothesis that mergers and close encounters between galaxies can fuel active galactic nuclei (AGNs) by increasing the rate at which gas accretes toward the central black hole. We compare the clustering of galaxies around radio-loud AGNs with the clustering around a population of radio-quiet galaxies with similar masses, colors, and luminosities. Our catalog contains 2178 elliptical radio galaxies with flux densities greater than 2.8 mJy at 1.4 GHz from the Six Degree Field Galaxy Survey. We find tentative evidence that radio AGNs with more than 200 times the median radio power have, on average, more close (r < 160 kpc) companions than their radio-quiet counterparts, suggesting that mergers play a role in forming the most powerful radio galaxies. For ellipticals of fixed stellar mass, the radio power is neither a function of large-scale environment nor halo mass, consistent with the radio powers of ellipticals varying by orders of magnitude over billions of years.

  2. Ribulose bisphosphate carboxylase activity and a Calvin cycle gene cluster in Sulfobacillus species.

    PubMed

    Caldwell, Paul E; MacLean, Martin R; Norris, Paul R

    2007-07-01

    The Calvin-Benson-Bassham (CBB) cycle has been extensively studied in proteobacteria, cyanobacteria, algae and plants, but hardly at all in Gram-positive bacteria. Some characteristics of ribulose bisphosphate carboxylase/oxygenase (RuBisCO) and a cluster of potential CBB cycle genes in a Gram-positive bacterium are described in this study with two species of Sulfobacillus (Gram-positive, facultatively autotrophic, mineral sulfide-oxidizing acidophiles). In contrast to the Gram-negative, iron-oxidizing acidophile Acidithiobacillus ferrooxidans, Sulfobacillus thermosulfidooxidans grew poorly autotrophically unless the CO(2) concentration was enhanced over that in air. However, the RuBisCO of each organism showed similar affinities for CO(2) and for ribulose 1,5-bisphosphate, and similar apparent derepression of activity under CO(2) limitation. The red-type, form I RuBisCO of Sulfobacillus acidophilus was confirmed as closely related to that of the anoxygenic phototroph Oscillochloris trichoides. Eight genes potentially involved in the CBB cycle in S. acidophilus were clustered in the order cbbA, cbbP, cbbE, cbbL, cbbS, cbbX, cbbG and cbbT.

  3. Coupled-cluster with active space selected higher amplitudes: performance of seminatural orbitals for ground and excited state calculations.

    PubMed

    Köhn, Andreas; Olsen, Jeppe

    2006-11-01

    The active space approach for coupled-cluster models is generalized using the general active space concept and implemented in a string-based general coupled-cluster code. Particular attention is devoted to the choice of orbitals on which the subspace division is based. Seminatural orbitals are proposed for that purpose. These orbitals are obtained by diagonalizing only the hole-hole and particle-particle block of the one-electron density of a lower-order method. The seminatural orbitals are shown to be a good replacement for complete active space self-consistent field orbitals and avoid the ambiguities with respect to the reference determinant introduced by the latter orbitals. The seminatural orbitals also perform well in excited state calculations, including excited states with strong double excitation contributions, which usually are difficult to describe with standard coupled-cluster methods. A set of vertical excitation energies is obtained and benchmarked against full configuration interaction calculations, and alternative hierarchies of active space coupled-cluster models are proposed. As a simple application the spectroscopic constants of the C(2) B (1)Delta(g) and B(') (1)Sigma(g) (+) states are calculated using active space coupled-cluster methods and basis sets up to quadruple-zeta quality in connection with extrapolation and additivity schemes. PMID:17100432

  4. Coupled-cluster with active space selected higher amplitudes: Performance of seminatural orbitals for ground and excited state calculations

    NASA Astrophysics Data System (ADS)

    Köhn, Andreas; Olsen, Jeppe

    2006-11-01

    The active space approach for coupled-cluster models is generalized using the general active space concept and implemented in a string-based general coupled-cluster code. Particular attention is devoted to the choice of orbitals on which the subspace division is based. Seminatural orbitals are proposed for that purpose. These orbitals are obtained by diagonalizing only the hole-hole and particle-particle block of the one-electron density of a lower-order method. The seminatural orbitals are shown to be a good replacement for complete active space self-consistent field orbitals and avoid the ambiguities with respect to the reference determinant introduced by the latter orbitals. The seminatural orbitals also perform well in excited state calculations, including excited states with strong double excitation contributions, which usually are difficult to describe with standard coupled-cluster methods. A set of vertical excitation energies is obtained and benchmarked against full configuration interaction calculations, and alternative hierarchies of active space coupled-cluster models are proposed. As a simple application the spectroscopic constants of the C2 BΔg1 and B'Σg+1 states are calculated using active space coupled-cluster methods and basis sets up to quadruple-zeta quality in connection with extrapolation and additivity schemes.

  5. Using Targeted Active-Learning Exercises and Diagnostic Question Clusters to Improve Students' Understanding of Carbon Cycling in Ecosystems

    ERIC Educational Resources Information Center

    Maskiewicz, April Cordero; Griscom, Heather Peckham; Welch, Nicole Turrill

    2012-01-01

    In this study, we used targeted active-learning activities to help students improve their ways of reasoning about carbon flow in ecosystems. The results of a validated ecology conceptual inventory (diagnostic question clusters [DQCs]) provided us with information about students' understanding of and reasoning about transformation of inorganic and…

  6. AVERAGE HEATING RATE OF HOT ATMOSPHERES IN DISTANT CLUSTERS BY RADIO ACTIVE GALACTIC NUCLEUS: EVIDENCE FOR CONTINUOUS ACTIVE GALACTIC NUCLEUS HEATING

    SciTech Connect

    Ma, C.-J.; McNamara, B. R.; Schaffer, R.; Nulsen, P. E. J.; Vikhlinin, A.

    2011-10-20

    We examine atmospheric heating by radio active galactic nuclei (AGNs) in distant X-ray clusters by cross correlating clusters selected from the 400 Square Degree (400SD) X-ray Cluster survey with radio sources in the NRAO VLA Sky Survey. Roughly 30% of the clusters show radio emission above a flux threshold of 3 mJy within a projected radius of 250 kpc. The radio emission is presumably associated with the brightest cluster galaxy. The mechanical jet power for each radio source was determined using scaling relations between radio power and cavity (mechanical) power determined for nearby clusters, groups, and galaxies with hot atmospheres containing X-ray cavities. The average jet power of central radio AGNs is approximately 2 x 10{sup 44} erg s{sup -1}. We find no significant correlation between radio power, and hence mechanical jet power, and the X-ray luminosities of clusters in the redshift range 0.1-0.6. This implies that the mechanical heating rate per particle is higher in lower mass, lower X-ray luminosity clusters. The jet power averaged over the sample corresponds to an atmospheric heating of approximately 0.2 keV per particle within R{sub 500}. Assuming the current AGN heating rate does not evolve but remains constant to redshifts of 2, the heating rate per particle would rise by a factor of two. We find that the energy injected from radio AGNs contribute substantially to the excess entropy in hot atmospheres needed to break self-similarity in cluster scaling relations. The detection frequency of radio AGNs is inconsistent with the presence of strong cooling flows in 400SD clusters, but does not exclude weak cooling flows. It is unclear whether central AGNs in 400SD clusters are maintained by feedback at the base of a cooling flow. Atmospheric heating by radio AGNs may retard the development of strong cooling flows at early epochs.

  7. NanoCluster Beacons as reporter probes in rolling circle enhanced enzyme activity detection

    NASA Astrophysics Data System (ADS)

    Juul, Sissel; Obliosca, Judy M.; Liu, Cong; Liu, Yen-Liang; Chen, Yu-An; Imphean, Darren M.; Knudsen, Birgitta R.; Ho, Yi-Ping; Leong, Kam W.; Yeh, Hsin-Chih

    2015-04-01

    As a newly developed assay for the detection of endogenous enzyme activity at the single-catalytic-event level, Rolling Circle Enhanced Enzyme Activity Detection (REEAD) has been used to measure enzyme activity in both single human cells and malaria-causing parasites, Plasmodium sp. Current REEAD assays rely on organic dye-tagged linear DNA probes to report the rolling circle amplification products (RCPs), the cost of which may hinder the widespread use of REEAD. Here we show that a new class of activatable probes, NanoCluster Beacons (NCBs), can simplify the REEAD assays. Easily prepared without any need for purification and capable of large fluorescence enhancement upon hybridization, NCBs are cost-effective and sensitive. Compared to conventional fluorescent probes, NCBs are also more photostable. As demonstrated in reporting the human topoisomerases I (hTopI) cleavage-ligation reaction, the proposed NCBs suggest a read-out format attractive for future REEAD-based diagnostics.As a newly developed assay for the detection of endogenous enzyme activity at the single-catalytic-event level, Rolling Circle Enhanced Enzyme Activity Detection (REEAD) has been used to measure enzyme activity in both single human cells and malaria-causing parasites, Plasmodium sp. Current REEAD assays rely on organic dye-tagged linear DNA probes to report the rolling circle amplification products (RCPs), the cost of which may hinder the widespread use of REEAD. Here we show that a new class of activatable probes, NanoCluster Beacons (NCBs), can simplify the REEAD assays. Easily prepared without any need for purification and capable of large fluorescence enhancement upon hybridization, NCBs are cost-effective and sensitive. Compared to conventional fluorescent probes, NCBs are also more photostable. As demonstrated in reporting the human topoisomerases I (hTopI) cleavage-ligation reaction, the proposed NCBs suggest a read-out format attractive for future REEAD-based diagnostics. Electronic

  8. A cluster of noncoding RNAs activates the ESR1 locus during breast cancer adaptation

    PubMed Central

    Tomita, Saori; Abdalla, Mohamed Osama Ali; Fujiwara, Saori; Matsumori, Haruka; Maehara, Kazumitsu; Ohkawa, Yasuyuki; Iwase, Hirotaka; Saitoh, Noriko; Nakao, Mitsuyoshi

    2015-01-01

    Estrogen receptor-α (ER)-positive breast cancer cells undergo hormone-independent proliferation after deprivation of oestrogen, leading to endocrine therapy resistance. Up-regulation of the ER gene (ESR1) is critical for this process, but the underlying mechanisms remain unclear. Here we show that the combination of transcriptome and fluorescence in situ hybridization analyses revealed that oestrogen deprivation induced a cluster of noncoding RNAs that defined a large chromatin domain containing the ESR1 locus. We termed these RNAs as Eleanors (ESR1 locus enhancing and activating noncoding RNAs). Eleanors were present in ER-positive breast cancer tissues and localized at the transcriptionally active ESR1 locus to form RNA foci. Depletion of one Eleanor, upstream (u)-Eleanor, impaired cell growth and transcription of intragenic Eleanors and ESR1 mRNA, indicating that Eleanors cis-activate the ESR1 gene. Eleanor-mediated gene activation represents a new type of locus control mechanism and plays an essential role in the adaptation of breast cancer cells. PMID:25923108

  9. Robust x-ray image segmentation by spectral clustering and active shape model.

    PubMed

    Wu, Jing; Mahfouz, Mohamed R

    2016-07-01

    Extraction of bone contours from x-ray radiographs plays an important role in joint space width assessment, preoperative planning, and kinematics analysis. We present a robust segmentation method to accurately extract the distal femur and proximal tibia in knee radiographs of varying image quality. A spectral clustering method based on the eigensolution of an affinity matrix is utilized for x-ray image denoising. An active shape model-based segmentation method is employed for robust and accurate segmentation of the denoised x-ray images. The performance of the proposed method is evaluated with x-ray images from the public-use dataset(s), the osteoarthritis initiative, achieving a root mean square error of [Formula: see text] for femur and [Formula: see text] for tibia. The results demonstrate that this method outperforms previous segmentation methods in capturing anatomical shape variations, accounting for image quality differences and guiding accurate segmentation. PMID:27660806

  10. The Sound of Silence: Activating Silent Biosynthetic Gene Clusters in Marine Microorganisms

    PubMed Central

    Reen, F. Jerry; Romano, Stefano; Dobson, Alan D.W.; O’Gara, Fergal

    2015-01-01

    Unlocking the rich harvest of marine microbial ecosystems has the potential to both safeguard the existence of our species for the future, while also presenting significant lifestyle benefits for commercial gain. However, while significant advances have been made in the field of marine biodiscovery, leading to the introduction of new classes of therapeutics for clinical medicine, cosmetics and industrial products, much of what this natural ecosystem has to offer is locked in, and essentially hidden from our screening methods. Releasing this silent potential represents a significant technological challenge, the key to which is a comprehensive understanding of what controls these systems. Heterologous expression systems have been successful in awakening a number of these cryptic marine biosynthetic gene clusters (BGCs). However, this approach is limited by the typically large size of the encoding sequences. More recently, focus has shifted to the regulatory proteins associated with each BGC, many of which are signal responsive raising the possibility of exogenous activation. Abundant among these are the LysR-type family of transcriptional regulators, which are known to control production of microbial aromatic systems. Although the environmental signals that activate these regulatory systems remain unknown, it offers the exciting possibility of evoking mimic molecules and synthetic expression systems to drive production of potentially novel natural products in microorganisms. Success in this field has the potential to provide a quantum leap forward in medical and industrial bio-product development. To achieve these new endpoints, it is clear that the integrated efforts of bioinformaticians and natural product chemists will be required as we strive to uncover new and potentially unique structures from silent or cryptic marine gene clusters. PMID:26264003

  11. N2O reduction by the mu4-sulfide-bridged tetranuclear CuZ cluster active site.

    PubMed

    Chen, Peng; Gorelsky, Serge I; Ghosh, Somdatta; Solomon, Edward I

    2004-08-13

    Nitrous oxide (N2O) reduction is a chemical challenge both in the selective oxidation of organic substrates by N2O and in the removal of N2O as a green-house gas. The reduction of N2O is thermodynamically favorable but kinetically inert, and requires activating transition-metal centers. In biological systems, N2O reduction is the last step in the denitrification process of the bacterial nitrogen cycle and is accomplished by the enzyme nitrous oxide reductase, whose active site consists of a micro4-sulfide-bridged tetranuclear CuZ cluster which has many unusual spectroscopic features. Recent studies have developed a detailed electronic-structure description of the resting CuZ cluster, determined its catalytically relevant state, and provided insight into the role of this tetranuclear copper cluster in N2O activation and reduction.

  12. Anti-tumor and immunomodulatory activity of iron hepta-tungsten phosphate oxygen clusters complex.

    PubMed

    Zhang, Bisong; Qiu, Jianping; Wu, Changsheng; Li, Yunxia; Liu, Zhenxiang

    2015-12-01

    Polyoxometalates (POMs) have attracted a considerable attention due to their unique structural characteristics, physicochemical properties and biological activities. In this study, iron hepta-tungsten phosphate oxygen clusters complex Na12H[Fe(HPW7O28)2]·44H2O (IHTPO) was synthesized and evaluated for in vitro cytotoxic activities on human hepatoma HepG2, leukemia K562, lung carcinoma A549, and large cell lung cancer NCI-H460 cells, therapeutic efficacies on mice transplantable tumor, and immunomodulatory potentials on the immune response in tumor-bearing mice. IHTPO exhibited lower in vitro cytotoxic activities against four human tumor cell lines, with the IC50 values being higher than 62.5μM (ca. 300μg/ml). IHTPO, however, significantly inhibited the growth of S180 sarcoma transplanted in mice. It was further showed that IHTPO could not only significantly promote splenocytes proliferation, NK cell and CTL activity from splenocytes, but remarkably enhance serum antigen-specific IgG, IgG2a and IgG2b antibody levels in S180-bearing mice. IHTPO also significantly promoted Th1 cytokines IFN-γ and IL-2 production, and up-regulated the mRNA expression levels of IFN-γ, IL-2 and Th1 transcription factors T-bet and STAT-4 in splenocytes from the S180-bearing mice. These results suggested that IHTPO significantly inhibited the growth of mice transplantable tumor, and that its in vivo antitumor activity might be achieved by improving Th1 protective cell-mediated immunity. IHTPO could act as antitumor agent with immunomodulatory activity.

  13. Cluster Analysis of Tumor Suppressor Genes in Canine Leukocytes Identifies Activation State

    PubMed Central

    Daly, Julie-Anne; Mortlock, Sally-Anne; Taylor, Rosanne M.; Williamson, Peter

    2015-01-01

    Cells of the immune system undergo activation and subsequent proliferation in the normal course of an immune response. Infrequently, the molecular and cellular events that underlie the mechanisms of proliferation are dysregulated and may lead to oncogenesis, leading to tumor formation. The most common forms of immunological cancers are lymphomas, which in dogs account for 8%–20% of all cancers, affecting up to 1.2% of the dog population. Key genes involved in negatively regulating proliferation of lymphocytes include a group classified as tumor suppressor genes (TSGs). These genes are also known to be associated with progression of lymphoma in humans, mice, and dogs and are potential candidates for pathological grading and diagnosis. The aim of the present study was to analyze TSG profiles in stimulated leukocytes from dogs to identify genes that discriminate an activated phenotype. A total of 554 TSGs and three gene set collections were analyzed from microarray data. Cluster analysis of three subsets of genes discriminated between stimulated and unstimulated cells. These included 20 most upregulated and downregulated TSGs, TSG in hallmark gene sets significantly enriched in active cells, and a selection of candidate TSGs, p15 (CDKN2B), p18 (CDKN2C), p19 (CDKN1A), p21 (CDKN2A), p27 (CDKN1B), and p53 (TP53) in the third set. Analysis of two subsets suggested that these genes or a subset of these genes may be used as a specialized PCR set for additional analysis. PMID:27478369

  14. Transition state stabilization by six arginines clustered in the active site of creatine kinase.

    PubMed

    Jourden, Michael J; Geiss, Paul R; Thomenius, Michael J; Horst, Lindsay A; Barty, Melissa M; Brym, Melissa J; Mulligan, Guy B; Almeida, Ryan M; Kersteen, Betsy A; Myers, Nichole R; Snider, Mark J; Borders, Charles L; Edmiston, Paul L

    2005-08-10

    Six fully conserved arginine residues (R129, R131, R235, R291, R319, and R340) closely grouped in the nucleotide binding site of rabbit muscle creatine kinase (rmCK) were mutated; four to alanine and all six to lysine. Kinetic analyses in the direction of phosphocreatine formation showed that all four alanine mutants led to substantial losses of activity with three (R129A, R131A, and R235A) having no detectable activity. All six lysine mutants retained variable degrees of reduced enzymatic activity. Static quenching of intrinsic tryptophan fluorescence was used to measure the binding constants for MgADP and MgATP. Nucleotide binding was at most only modestly affected by mutation of the arginine residues. Thus, the cluster of arginines seem to be primarily responsible for transition state stabilization which is further supported by the observation that none of the inactive mutants demonstrated the ability to form a transition analogue complex of MgADP.nitrate.creatine as determined by fluorescence quenching assays. As a whole, the results suggest that the most important role these residues play is to properly align the substrates for stabilization of the phosphoryl transfer reaction.

  15. Coronal Mass Ejections from the Same Active Region Cluster: Two Different Perspectives

    NASA Astrophysics Data System (ADS)

    Cremades, H.; Mandrini, C. H.; Schmieder, B.; Crescitelli, A. M.

    2015-06-01

    The cluster formed by active regions (ARs) NOAA 11121 and 11123, approximately located on the solar central meridian on 11 November 2010, is of great scientific interest. This complex was the site of violent flux emergence and the source of a series of Earth-directed events on the same day. The onset of the events was nearly simultaneously observed by the Atmospheric Imaging Assembly (AIA) telescope onboard the Solar Dynamics Observatory (SDO) and the Extreme-Ultraviolet Imagers (EUVI) on the Sun-Earth Connection Coronal and Heliospheric Investigation (SECCHI) suite of telescopes onboard the Solar-Terrestrial Relations Observatory (STEREO) twin spacecraft. The progression of these events in the low corona was tracked by the Large Angle Spectroscopic Coronagraphs (LASCO) onboard the Solar and Heliospheric Observatory (SOHO) and the SECCHI/COR coronagraphs on STEREO. SDO and SOHO imagers provided data from the Earth's perspective, whilst the STEREO twin instruments procured images from the orthogonal directions. This spatial configuration of spacecraft allowed optimum simultaneous observations of the AR cluster and the coronal mass ejections that originated in it. Quadrature coronal observations provided by STEREO revealed many more ejective events than were detected from Earth. Furthermore, joint observations by SDO/AIA and STEREO/SECCHI EUVI of the source region indicate that all events classified by GOES as X-ray flares had an ejective coronal counterpart in quadrature observations. These results directly affect current space weather forecasting because alarms might be missed when there is a lack of solar observations in a view direction perpendicular to the Sun-Earth line.

  16. High reactivity of nanosized niobium oxide cluster cations in methane activation: A comparison with vanadium oxides.

    PubMed

    Ding, Xun-Lei; Wang, Dan; Wu, Xiao-Nan; Li, Zi-Yu; Zhao, Yan-Xia; He, Sheng-Gui

    2015-09-28

    The reactions between methane and niobium oxide cluster cations were studied and compared to those employing vanadium oxides. Hydrogen atom abstraction (HAA) reactions were identified over stoichiometric (Nb2O5)N(+) clusters for N as large as 14 with a time-of-flight mass spectrometer. The reactivity of (Nb2O5)N(+) clusters decreases as the N increases, and it is higher than that of (V 2O5)N(+) for N ≥ 4. Theoretical studies were conducted on (Nb2O5)N(+) (N = 2-6) by density functional calculations. HAA reactions on these clusters are all favorable thermodynamically and kinetically. The difference of the reactivity with respect to the cluster size and metal type (Nb vs V) was attributed to thermodynamics, kinetics, the electron capture ability, and the distribution of the unpaired spin density. Nanosized Nb oxide clusters show higher HAA reactivity than V oxides, indicating that niobia may serve as promising catalysts for practical methane conversion.

  17. A stereoscopic system for viewing the temporal evolution of brain activity clusters in response to linguistic stimuli.

    PubMed

    Forbes, Angus; Villegas, Javier; Almryde, Kyle R; Plante, Elena

    2014-03-01

    In this paper, we present a novel application, 3D+Time Brain View, for the stereoscopic visualization of functional Magnetic Resonance Imaging (fMRI) data gathered from participants exposed to unfamiliar spoken languages. An analysis technique based on Independent Component Analysis (ICA) is used to identify statistically significant clusters of brain activity and their changes over time during different testing sessions. That is, our system illustrates the temporal evolution of participants' brain activity as they are introduced to a foreign language through displaying these clusters as they change over time. The raw fMRI data is presented as a stereoscopic pair in an immersive environment utilizing passive stereo rendering. The clusters are presented using a ray casting technique for volume rendering. Our system incorporates the temporal information and the results of the ICA into the stereoscopic 3D rendering, making it easier for domain experts to explore and analyze the data.

  18. Detection of Hg2+ based on the selective inhibition of peroxidase mimetic activity of BSA-Au clusters.

    PubMed

    Zhu, Rui; Zhou, Yan; Wang, Xi-Liang; Liang, Li-Ping; Long, Yi-Juan; Wang, Qin-Long; Zhang, Hai-Jie; Huang, Xiao-Xiao; Zheng, Hu-Zhi

    2013-12-15

    It was found that Hg(2+) can inhibit the peroxidase mimetic activity of bovine serum albumin (BSA) protected Au clusters (BSA-Au) due to the specific interaction between Hg(2+) and Au(+) existed onto the surface of BSA-Au clusters. By coupling with 3, 3', 5, 5'-tetramethylbenzidine (TMB)-H2O2 chromogenic reaction, a novel method for Hg(2+) detection was developed based on the inhibiting effect of Hg(2+) on BSA-Au clusters peroxidase-like activity. This method exhibited high selectivity and sensitivity. As low as 3 nM (0.6 ppb, 3σ) Hg(2+) could be detected with a linear range from 10 nM (2 ppb) to 10 µM (2 ppm) and this method was successfully applied for the determination of total mercury content in skin lightening products.

  19. Search for α-Cluster Structure in Exotic Nuclei with the Prototype Active-Target Time-Projection Chamber

    NASA Astrophysics Data System (ADS)

    Fritsch, A.; Ayyad, Y.; Bazin, D.; Beceiro-Novo, S.; Bradt, J.; Carpenter, L.; Cortesi, M.; Mittig, W.; Suzuki, D.; Ahn, T.; Kolata, J. J.; Becchetti, F. D.; Howard, A. M.

    2016-03-01

    Some exotic nuclei appear to exhibit α-cluster structure. While various theoretical models currently describe such clustering, more experimental data are needed to constrain model predictions. The Prototype Active-Target Time-Projection Chamber (PAT-TPC) has low-energy thresholds for charged-particle decay and a high luminosity due to its thick gaseous active target volume, making it well-suited to search for low-energy α-cluster reactions. Radioactive-ion beams produced by the TwinSol facility at the University of Notre Dame were delivered to the PAT-TPC to study nuclei including 14C and 14O via α-resonant scattering. Differential cross sections and excitation functions were measured. Preliminary results from our recent experiments will be presented. This work is supported by the U.S. National Science Foundation.

  20. A stereoscopic system for viewing the temporal evolution of brain activity clusters in response to linguistic stimuli

    NASA Astrophysics Data System (ADS)

    Forbes, Angus; Villegas, Javier; Almryde, Kyle R.; Plante, Elena

    2014-03-01

    In this paper, we present a novel application, 3D+Time Brain View, for the stereoscopic visualization of functional Magnetic Resonance Imaging (fMRI) data gathered from participants exposed to unfamiliar spoken languages. An analysis technique based on Independent Component Analysis (ICA) is used to identify statistically significant clusters of brain activity and their changes over time during different testing sessions. That is, our system illustrates the temporal evolution of participants' brain activity as they are introduced to a foreign language through displaying these clusters as they change over time. The raw fMRI data is presented as a stereoscopic pair in an immersive environment utilizing passive stereo rendering. The clusters are presented using a ray casting technique for volume rendering. Our system incorporates the temporal information and the results of the ICA into the stereoscopic 3D rendering, making it easier for domain experts to explore and analyze the data.

  1. Pair and Cluster Formation in Hybrid Active-Passive Matter Suspensions

    NASA Astrophysics Data System (ADS)

    Krafnick, Ryan; Garcia, Angel

    2015-03-01

    Systems composed of self-propelling entities, dubbed active matter, are ubiquitous in nature, from flocks of birds and schools of fish to swarms of bacteria and catalytic nanomotors. These systems (both biological and industrial) have applications ranging from micron-scale cargo manipulation and directed transport to water remediation and material processing. When added to a solution with passive (non-self-propelling) particles, active matter leads to new and altered system properties. For example, the diffusion of passive particles increases by orders of magnitude in typical systems, leading to a raised effective temperature. Additionally, particles that normally repel each other exhibit effective attractions which can lead to pair formation and clustering. The nature of these effects depends on both the mechanical collisions of swimmers and the hydrodynamic flow fields they propagate. We computationally examine the effect and dependence of various system parameters, such as particle shape and density, on these properties. This work was funded by NIH grant GM086801 and NSF grant MCB-1050966.

  2. Joint spatial-spectral feature space clustering for speech activity detection from ECoG signals.

    PubMed

    Kanas, Vasileios G; Mporas, Iosif; Benz, Heather L; Sgarbas, Kyriakos N; Bezerianos, Anastasios; Crone, Nathan E

    2014-04-01

    Brain-machine interfaces for speech restoration have been extensively studied for more than two decades. The success of such a system will depend in part on selecting the best brain recording sites and signal features corresponding to speech production. The purpose of this study was to detect speech activity automatically from electrocorticographic signals based on joint spatial-frequency clustering of the ECoG feature space. For this study, the ECoG signals were recorded while a subject performed two different syllable repetition tasks. We found that the optimal frequency resolution to detect speech activity from ECoG signals was 8 Hz, achieving 98.8% accuracy by employing support vector machines as a classifier. We also defined the cortical areas that held the most information about the discrimination of speech and nonspeech time intervals. Additionally, the results shed light on the distinct cortical areas associated with the two syllables repetition tasks and may contribute to the development of portable ECoG-based communication.

  3. Peroxidase-like activity of apoferritin paired gold clusters for glucose detection.

    PubMed

    Jiang, Xin; Sun, Cuiji; Guo, Yi; Nie, Guangjun; Xu, Li

    2015-02-15

    The discovery and application of noble metal nanoclusters have received considerable attention. In this paper, we reported that apoferritin paired gold clusters (Au-Ft) could efficiently catalyze oxidation of 3.3',5.5'-tetramethylbenzidine (TMB) by H2O2 to produce a blue color reaction. Compared with natural enzyme, Au-Ft exhibited higher activity near acidic pH and could be used over a wide range of temperatures. Apoferritin nanocage enhanced the reaction activity of substrate TMB by H2O2. The reaction catalyzed by Au-Ft was found to follow a typical Michaelis-Menten kinetics. The kinetic parameters exhibited a lower K(m) value (0.097 mM) and a higher K(cat) value (5.8 × 10(4) s(-1)) for TMB than that of horse radish peroxidase (HRP). Base on these findings, Au-Ft, acting as a peroxidase mimetic, performed enzymatic spectrophotometric analysis of glucose. This system exhibited acceptable reproducibility and high selectivity in biosening, suggesting that it could have promising applications in the future. PMID:25218100

  4. Symmetry adapted cluster-configuration interaction calculation of the photoelectron spectra of famous biological active steroids

    NASA Astrophysics Data System (ADS)

    Abyar, Fatemeh; Farrokhpour, Hossein

    2014-11-01

    The photoelectron spectra of some famous steroids, important in biology, were calculated in the gas phase. The selected steroids were 5α-androstane-3,11,17-trione, 4-androstane-3,11,17-trione, cortisol, cortisone, corticosterone, dexamethasone, estradiol and cholesterol. The calculations were performed employing symmetry-adapted cluster/configuration interaction (SAC-CI) method using the 6-311++G(2df,pd) basis set. The population ratios of conformers of each steroid were calculated and used for simulating the photoelectron spectrum of steroid. It was found that more than one conformer contribute to the photoelectron spectra of some steroids. To confirm the calculated photoelectron spectra, they compared with their corresponding experimental spectra. There were no experimental gas phase Hesbnd I photoelectron spectra for some of the steroids of this work in the literature and their calculated spectra can show a part of intrinsic characteristics of this molecules in the gas phase. The canonical molecular orbitals involved in the ionization of each steroid were calculated at the HF/6-311++g(d,p) level of theory. The spectral bands of each steroid were assigned by natural bonding orbital (NBO) calculations. Knowing the electronic structures of steroids helps us to understand their biological activities and find which sites of steroid become active when a modification is performing under a biological pathway.

  5. Nanoparticle cluster gas sensor: Pt activated SnO2 nanoparticles for NH3 detection with ultrahigh sensitivity

    NASA Astrophysics Data System (ADS)

    Liu, Xu; Chen, Nan; Han, Bingqian; Xiao, Xuechun; Chen, Gang; Djerdj, Igor; Wang, Yude

    2015-09-01

    Pt activated SnO2 nanoparticle clusters were synthesized by a simple solvothermal method. The structure, morphology, chemical state and specific surface area were analyzed by X-ray powder diffraction (XRD), transmission electron microscopy (TEM), X-ray photoelectron spectroscopy (XPS) and N2-sorption studies, respectively. The SnO2 nanoparticle cluster matrix consists of tens of thousands of SnO2 nanoparticles with an ultra-small grain size estimated to be 3.0 nm. And there are abundant random-packed wormhole-like pores, caused by the inter-connection of the SnO2 nanoparticles, throughout each cluster. The platinum element is present in two forms including metal (Pt) and tetravalent metal oxide (PtO2) in the Pt activated SnO2 nanoparticle clusters. The as-synthesized pure and Pt activated SnO2 nanoparticle clusters were used to fabricate gas sensor devices. It was found that the gas response toward 500 ppm of ammonia was improved from 6.48 to 203.44 through the activation by Pt. And the results indicate that the sensor based on Pt activated SnO2 not only has ultrahigh sensitivity but also possesses good response-recovery properties, linear dependence, repeatability, selectivity and long-term stability, demonstrating the potential to use Pt activated SnO2 nanoparticle clusters as ammonia gas sensors. At the same time, the formation mechanisms of the unique nanoparticle clusters and highly enhanced sensitivity are also discussed.Pt activated SnO2 nanoparticle clusters were synthesized by a simple solvothermal method. The structure, morphology, chemical state and specific surface area were analyzed by X-ray powder diffraction (XRD), transmission electron microscopy (TEM), X-ray photoelectron spectroscopy (XPS) and N2-sorption studies, respectively. The SnO2 nanoparticle cluster matrix consists of tens of thousands of SnO2 nanoparticles with an ultra-small grain size estimated to be 3.0 nm. And there are abundant random-packed wormhole-like pores, caused by the inter

  6. Methane Activation Mediated by a Series of Cerium-Vanadium Bimetallic Oxide Cluster Cations: Tuning Reactivity by Doping.

    PubMed

    Ma, Jia-Bi; Meng, Jing-Heng; He, Sheng-Gui

    2016-04-18

    The reactions of cerium-vanadium cluster cations Cex Vy Oz (+) with CH4 are investigated by time-of-flight mass spectrometry and density functional theory calculations. (CeO2 )m (V2 O5 )n (+) clusters (m=1,2, n=1-5; m=3, n=1-4) with dimensions up to nanosize can abstract one hydrogen atom from CH4 . The theoretical study indicates that there are two types of active species in (CeO2 )m (V2 O5 )n (+) , V[(Ot )2 ](.) and [(Ob )2 CeOt ](.) (Ot and Ob represent terminal and bridging oxygen atoms, respectively); the former is less reactive than the latter. The experimentally observed size-dependent reactivities can be rationalized by considering the different active species and mechanisms. Interestingly, the reactivity of the (CeO2 )m (V2 O5 )n (+) clusters falls between those of (CeO2 )2-4 (+) and (V2 O5 )1-5 (+) in terms of C-H bond activation, thus the nature of the active species and the cluster reactivity can be effectively tuned by doping.

  7. Methane Activation Mediated by a Series of Cerium-Vanadium Bimetallic Oxide Cluster Cations: Tuning Reactivity by Doping.

    PubMed

    Ma, Jia-Bi; Meng, Jing-Heng; He, Sheng-Gui

    2016-04-18

    The reactions of cerium-vanadium cluster cations Cex Vy Oz (+) with CH4 are investigated by time-of-flight mass spectrometry and density functional theory calculations. (CeO2 )m (V2 O5 )n (+) clusters (m=1,2, n=1-5; m=3, n=1-4) with dimensions up to nanosize can abstract one hydrogen atom from CH4 . The theoretical study indicates that there are two types of active species in (CeO2 )m (V2 O5 )n (+) , V[(Ot )2 ](.) and [(Ob )2 CeOt ](.) (Ot and Ob represent terminal and bridging oxygen atoms, respectively); the former is less reactive than the latter. The experimentally observed size-dependent reactivities can be rationalized by considering the different active species and mechanisms. Interestingly, the reactivity of the (CeO2 )m (V2 O5 )n (+) clusters falls between those of (CeO2 )2-4 (+) and (V2 O5 )1-5 (+) in terms of C-H bond activation, thus the nature of the active species and the cluster reactivity can be effectively tuned by doping. PMID:26714587

  8. Assembly of Fe-substituted Dawson-type nanoscale selenotungstate clusters with photocatalytic H2 evolution activity.

    PubMed

    Chen, Wei-Chao; Qin, Chao; Wang, Xin-Long; Li, Yang-Guang; Zang, Hong-Ying; Jiao, Yan-Qing; Huang, Peng; Shao, Kui-Zhan; Su, Zhong-Min; Wang, En-Bo

    2014-11-11

    Two Fe-substituted Dawson-type nanoscale selenotungstate clusters, {Fe6Se6W34} and {Fe10Se8W62} involving {α-Se2W14} and {γ-Se2W14} building blocks, have been isolated, which exhibit photocatalytic H2 evolution activity. Their electrochemical behaviours and magnetic properties were also investigated.

  9. Physical activity levels and supportive care needs for physical activity among breast cancer survivors with different psychosocial profiles: a cluster-analytical approach.

    PubMed

    Charlier, C; Pauwels, E; Lechner, L; Spittaels, H; Bourgois, J; DE Bourdeaudhuij, I; VAN Hoof, E

    2012-11-01

    The transition from breast cancer patient to survivor is associated with many treatment-related and psychosocial factors, which can influence health behaviour and associated needs. First, this study aimed to identify clusters of treatment-related and psychosocial factors among breast cancer survivors. Second, clusters' physical activity levels and care needs for physical activity were evaluated. Breast cancer survivors (n= 440; 52 ± 8 years) (3 weeks to 6 months post treatment) completed self-reports on physical and psychological symptoms; illness representations; social support and coping; physical activity and care needs for physical activity. Analyses identified four clusters: (1) a low distress-active approach group; (2) a low distress-resigned approach group; (3) a high distress-active approach group; and (4) a high distress-emotional approach group. Physical activity levels were higher in the low distress groups than in the high distress-emotional approach group. However, women with low distress and an active approach reported equal care needs for physical activity than women with high distress and an emotional approach. These findings suggest that care needs for physical activity are unrelated to distress and actual physical activity levels. The results emphasise the importance of screening for needs and provide a framework supporting the referral of breast cancer survivors to tailored interventions.

  10. Metabolic risk profiles created using cluster analysis are differentially associated with physical activity: The ARIC study

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Conditions such as hypertension, dyslipidemia, glucose intolerance, and obesity tend to cluster together and predict cardiovascular disease, type 2 diabetes, and premature mortality. This clustering has led to multiple definitions of the Metabolic Syndrome (MetS). While the definitions agree on the ...

  11. Collisional activation of N2O decomposition and CO oxidation reactions on isolated rhodium clusters.

    PubMed

    Parry, Imogen S; Kartouzian, Aras; Hamilton, Suzanne M; Balaj, O Petru; Beyer, Martin K; Mackenzie, Stuart R

    2013-09-12

    The reactions of nitrous oxide decorated rhodium clusters, RhnN2O(+) (n = 5, 6), have been studied by Fourier transform ion cyclotron resonance mass spectrometry. Collision induced dissociation with Ar is shown to lead to one of two processes; desorption of the intact N2O moiety (indicating molecular adsorption in the parent cluster) or N2O decomposition liberating molecular nitrogen with the latter becoming increasingly dominant at higher collision energies. Consistent with the results of earlier studies, which employed infrared excitation [Hermes, A. C.; et al. J. Phys. Chem. Lett. 2011, 2, 3053], Rh5ON2O(+) is observed to behave qualitatively differently to Rh5N2O(+) with decomposition of the nitrous oxide dominating the chemistry of the former. In other experiments, the reactivity of RhnN2O(+) clusters with CO has been studied. Chemisorption of (13)CO is calculated to deposit ca. 2 eV into the parent cluster, initiating a range of chemical processes on the cluster surface, which are fit to a simple reaction mechanism. Clear differences are again observed in the reaction branching ratios for Rh5N2O(+) and Rh6N2O(+) parent cluster ions. For the n = 5 cluster, the combined N2O reduction/CO oxidation is the most significant reaction channel, while the n = 6 cluster preferentially is oxidized to Rh6O(+) with loss of N2 and CO. Even larger differences are observed in the reactions of the N2O decorated cluster oxides, RhnON2O(+), for which more reaction possibilities arise. The results of all studies are discussed in relation to infrared driven processes on the same parent cluster species [Hamilton, S. M.; et al. J. Am. Chem. Soc. 2010, 132, 1448; J. Phys. Chem. A, 2011, 115, 2489].

  12. Redox Control of the Human Iron-Sulfur Repair Protein MitoNEET Activity via Its Iron-Sulfur Cluster.

    PubMed

    Golinelli-Cohen, Marie-Pierre; Lescop, Ewen; Mons, Cécile; Gonçalves, Sergio; Clémancey, Martin; Santolini, Jérôme; Guittet, Eric; Blondin, Geneviève; Latour, Jean-Marc; Bouton, Cécile

    2016-04-01

    Human mitoNEET (mNT) is the first identified Fe-S protein of the mammalian outer mitochondrial membrane. Recently, mNT has been implicated in cytosolic Fe-S repair of a key regulator of cellular iron homeostasis. Here, we aimed to decipher the mechanism by which mNT triggers its Fe-S repair capacity. By using tightly controlled reactions combined with complementary spectroscopic approaches, we have determined the differential roles played by both the redox state of the mNT cluster and dioxygen in cluster transfer and protein stability. We unambiguously demonstrated that only the oxidized state of the mNT cluster triggers cluster transfer to a generic acceptor protein and that dioxygen is neither required for the cluster transfer reaction nor does it affect the transfer rate. In the absence of apo-acceptors, a large fraction of the oxidized holo-mNT form is converted back to reduced holo-mNT under low oxygen tension. Reduced holo-mNT, which holds a [2Fe-2S](+)with a global protein fold similar to that of the oxidized form is, by contrast, resistant in losing its cluster or in transferring it. Our findings thus demonstrate that mNT uses an iron-based redox switch mechanism to regulate the transfer of its cluster. The oxidized state is the "active state," which reacts promptly to initiate Fe-S transfer independently of dioxygen, whereas the reduced state is a "dormant form." Finally, we propose that the redox-sensing function of mNT is a key component of the cellular adaptive response to help stress-sensitive Fe-S proteins recover from oxidative injury.

  13. The Activity of Rabies Vaccines against Genetic Clusters of Rabies Virus Circulating at the Territory of Ukraine

    PubMed Central

    Ivanov, Mykola; Polupan, Ivan; Deryabin, Oleg

    2013-01-01

    Objective To identify the presence of genetic clusters of rabies virus at the territory of Ukraine and to determine the degree of activity of rabies vaccines against these genetic clusters. Introduction To develop and implement an effective program of rabies eradication in Ukraine in 2008 was founded the unique collection of samples of pathological materials confirmed as positive in rabies at the regional veterinary laboratories of Ukraine. The collection is constantly updated and to present moment it includes 1389 samples from all regions of Ukraine, selected from 17 animal species and humans. Methods Identification of the rabies virus in samples of pathological material for their further selection was carried out using the test developed by us which based on RT-PCR with primers complementary to the conservative fragments of the 5’-end of nucleoprotein gene of rabies virus. For the study of the street rabies virus isolates from the collection we use RT-PCR with the primers pair (509, 304) flanking the variable 3’-end part of nucleoprotein gene of the reference strain of rabies virus CVS (fragment in 377 bp). Studies of rabies vaccines activity were carried out with modified method of U.S. National Institutes of Health using rabies virus street isolates of both genetic clusters instead of the Challenge Virus Standard (CVS). All isolates of street rabies virus were inoculated in a dose of 5–50 LD50. The criteria for evaluation of protective activity of rabies vaccine was effective dose (− lg ED50). Results In molecular genetic studies with variant-specific primers we established the presence in Ukraine of two clusters of rabies virus. Clusters I circulates on the right bank of the Dnipro river (the largest water barrier that divides the country into eastern and western side), and cluster II – on the left bank of the Dnieper. The relationship of these variants with the epizootic situation was researched. For this purpose epizootological zoning of Ukraine

  14. High interfacial activity of polymers "grafted through" functionalized iron oxide nanoparticle clusters.

    PubMed

    Foster, Lynn M; Worthen, Andrew J; Foster, Edward L; Dong, Jiannan; Roach, Clarissa M; Metaxas, Athena E; Hardy, Clifford D; Larsen, Eric S; Bollinger, Jonathan A; Truskett, Thomas M; Bielawski, Christopher W; Johnston, Keith P

    2014-09-01

    The mechanism by which polymers, when grafted to inorganic nanoparticles, lower the interfacial tension at the oil-water interface is not well understood, despite the great interest in particle stabilized emulsions and foams. A simple and highly versatile free radical "grafting through" technique was used to bond high organic fractions (by weight) of poly(oligo(ethylene oxide) monomethyl ether methacrylate) onto iron oxide clusters, without the need for catalysts. In the resulting ∼1 μm hybrid particles, the inorganic cores and grafting architecture contribute to the high local concentration of grafted polymer chains to the dodecane/water interface to produce low interfacial tensions of only 0.003 w/v % (polymer and particle core). This "critical particle concentration" (CPC) for these hybrid inorganic/polymer amphiphilic particles to lower the interfacial tension by 36 mN/m was over 30-fold lower than the critical micelle concentration of the free polymer (without inorganic cores) to produce nearly the same interfacial tension. The low CPC is favored by the high adsorption energy (∼10(6) kBT) for the large ∼1 μm hybrid particles, the high local polymer concentration on the particles surfaces, and the ability of the deformable hybrid nanocluster cores as well as the polymer chains to conform to the interface. The nanocluster cores also increased the entanglement of the polymer chains in bulk DI water or synthetic seawater, producing a viscosity up to 35,000 cP at 0.01 s(-1), in contrast with only 600 cP for the free polymer. As a consequence of these interfacial and rheological properties, the hybrid particles stabilized oil-in-water emulsions at concentrations as low as 0.01 w/v %, with average drop sizes down to 30 μm. In contrast, the bulk viscosity was low for the free polymer, and it did not stabilize the emulsions. The ability to influence the interfacial activity and rheology of polymers upon grafting them to inorganic particles, including clusters

  15. High interfacial activity of polymers "grafted through" functionalized iron oxide nanoparticle clusters.

    PubMed

    Foster, Lynn M; Worthen, Andrew J; Foster, Edward L; Dong, Jiannan; Roach, Clarissa M; Metaxas, Athena E; Hardy, Clifford D; Larsen, Eric S; Bollinger, Jonathan A; Truskett, Thomas M; Bielawski, Christopher W; Johnston, Keith P

    2014-09-01

    The mechanism by which polymers, when grafted to inorganic nanoparticles, lower the interfacial tension at the oil-water interface is not well understood, despite the great interest in particle stabilized emulsions and foams. A simple and highly versatile free radical "grafting through" technique was used to bond high organic fractions (by weight) of poly(oligo(ethylene oxide) monomethyl ether methacrylate) onto iron oxide clusters, without the need for catalysts. In the resulting ∼1 μm hybrid particles, the inorganic cores and grafting architecture contribute to the high local concentration of grafted polymer chains to the dodecane/water interface to produce low interfacial tensions of only 0.003 w/v % (polymer and particle core). This "critical particle concentration" (CPC) for these hybrid inorganic/polymer amphiphilic particles to lower the interfacial tension by 36 mN/m was over 30-fold lower than the critical micelle concentration of the free polymer (without inorganic cores) to produce nearly the same interfacial tension. The low CPC is favored by the high adsorption energy (∼10(6) kBT) for the large ∼1 μm hybrid particles, the high local polymer concentration on the particles surfaces, and the ability of the deformable hybrid nanocluster cores as well as the polymer chains to conform to the interface. The nanocluster cores also increased the entanglement of the polymer chains in bulk DI water or synthetic seawater, producing a viscosity up to 35,000 cP at 0.01 s(-1), in contrast with only 600 cP for the free polymer. As a consequence of these interfacial and rheological properties, the hybrid particles stabilized oil-in-water emulsions at concentrations as low as 0.01 w/v %, with average drop sizes down to 30 μm. In contrast, the bulk viscosity was low for the free polymer, and it did not stabilize the emulsions. The ability to influence the interfacial activity and rheology of polymers upon grafting them to inorganic particles, including clusters

  16. CAUGHT IN THE ACT: STRONG, ACTIVE RAM PRESSURE STRIPPING IN VIRGO CLUSTER SPIRAL NGC 4330

    SciTech Connect

    Abramson, Anne; Kenney, Jeffrey D. P.; Crowl, Hugh H.; Van Gorkom, J. H.; Schiminovich, David; Chung, Aeree; Vollmer, Bernd E-mail: jeff.kenney@yale.edu E-mail: jvangork@astro.columbia.edu E-mail: achung@yonsei.ac.kr

    2011-05-15

    We present a multi-wavelength study of NGC 4330, a highly inclined spiral galaxy in the Virgo Cluster which is a clear example of strong, ongoing intracluster medium-interstellar medium (ICM-ISM) ram pressure stripping. The H I has been removed from well within the undisturbed old stellar disk, to 50%-65% of R{sub 25}. Multi-wavelength data (WIYN BVR-H{alpha}, Very Large Array 21 cm H I and radio continuum, and Galaxy Evolution Explorer NUV and FUV) reveal several one-sided extraplanar features likely caused by ram pressure at an intermediate disk-wind angle. At the leading edge of the interaction, the H{alpha} and dust extinction curve sharply out of the disk in a remarkable and distinctive 'upturn' feature that may be generally useful as a diagnostic indicator of active ram pressure. On the trailing side, the ISM is stretched out in a long tail which contains 10% of the galaxy's total H I emission, 6%-9% of its NUV-FUV emission, but only 2% of the H{alpha}. The centroid of the H I tail is downwind of the UV/H{alpha} tail, suggesting that the ICM wind has shifted most of the ISM downwind over the course of the past 10-300 Myr. Along the major axis, the disk is highly asymmetric in the UV, but more symmetric in H{alpha} and H I, also implying recent changes in the distributions of gas and star formation. The UV-optical colors indicate very different star formation histories for the leading and trailing sides of the galaxy. On the leading side, a strong gradient in the UV-optical colors of the gas-stripped disk suggests that it has taken 200-400 Myr to strip the gas from a radius of >8 to 5 kpc, but on the trailing side there is no age gradient. All our data suggest a scenario in which NGC 4330 is falling into the cluster center for the first time and has experienced a significant increase in ram pressure over the last 200-400 Myr. Many of the UV-bright stars that form outside the thin disk due to ram pressure will ultimately produce stellar thick disk and halo

  17. The m-chlorophenylpiperazine test in cluster headache: a study on central serotoninergic activity.

    PubMed

    Leone, M; Attanasio, A; Croci, D; Libro, G; Grazzi, L; D'Amico, D; Nespolo, A; Bussone, G

    1997-10-01

    The central serotoninergic agonist m-chlorophenylpiperazine (m-CPP) stimulates several 5HT receptor subtypes. It induces the release of both cortisol and prolactin (PRL). In this study we investigated central serotoninergic responsiveness in cluster headache by monitoring cortisol and PRL responses to m-CPP administration. Twenty-three patients with episodic cluster headache and 17 sex-matched and age-matched healthy subjects were studied. The cluster headache patients were tested during a cluster period, and none were receiving prophylaxis. A single oral dose of m-CPP, 0.5 mg/kg, was given at time 0. Blood samples were drawn at -30, 0, 30, 60, 90, 120, 150 and 180 min. PRL and cortisol levels were assayed in the samples. PRL and cortisol delta maxima (delta maximum = maximum response - baseline level at time 0/baseline level at time 0) were evaluated in each patient and mean values compared. Serum levels of m-CPP were detected by HPLC and correlated to hormonal responses. Reduced cortisol (p < 0.02) and increased PRL (p < 0.05) delta maxima were observed in cluster headache patients. Increased basal cortisol plasma levels (p < 0.05) and reduced basal PRL plasma levels (p = 0.06) also characterized cluster headache patients. This is the first study evaluating central serotoninergic responsiveness to m-CPP in cluster headache and these data suggest impaired central serotoninergic function in this pathology. PMID:9350388

  18. The m-chlorophenylpiperazine test in cluster headache: a study on central serotoninergic activity.

    PubMed

    Leone, M; Attanasio, A; Croci, D; Libro, G; Grazzi, L; D'Amico, D; Nespolo, A; Bussone, G

    1997-10-01

    The central serotoninergic agonist m-chlorophenylpiperazine (m-CPP) stimulates several 5HT receptor subtypes. It induces the release of both cortisol and prolactin (PRL). In this study we investigated central serotoninergic responsiveness in cluster headache by monitoring cortisol and PRL responses to m-CPP administration. Twenty-three patients with episodic cluster headache and 17 sex-matched and age-matched healthy subjects were studied. The cluster headache patients were tested during a cluster period, and none were receiving prophylaxis. A single oral dose of m-CPP, 0.5 mg/kg, was given at time 0. Blood samples were drawn at -30, 0, 30, 60, 90, 120, 150 and 180 min. PRL and cortisol levels were assayed in the samples. PRL and cortisol delta maxima (delta maximum = maximum response - baseline level at time 0/baseline level at time 0) were evaluated in each patient and mean values compared. Serum levels of m-CPP were detected by HPLC and correlated to hormonal responses. Reduced cortisol (p < 0.02) and increased PRL (p < 0.05) delta maxima were observed in cluster headache patients. Increased basal cortisol plasma levels (p < 0.05) and reduced basal PRL plasma levels (p = 0.06) also characterized cluster headache patients. This is the first study evaluating central serotoninergic responsiveness to m-CPP in cluster headache and these data suggest impaired central serotoninergic function in this pathology.

  19. Unique DC-SIGN clustering activity of a small glycomimetic: A lesson for ligand design.

    PubMed

    Sutkeviciute, Ieva; Thépaut, Michel; Sattin, Sara; Berzi, Angela; McGeagh, John; Grudinin, Sergei; Weiser, Jörg; Le Roy, Aline; Reina, Jose J; Rojo, Javier; Clerici, Mario; Bernardi, Anna; Ebel, Christine; Fieschi, Franck

    2014-06-20

    DC-SIGN is a dendritic cell-specific C-type lectin receptor that recognizes highly glycosylated ligands expressed on the surface of various pathogens. This receptor plays an important role in the early stages of many viral infections, including HIV, which makes it an interesting therapeutic target. Glycomimetic compounds are good drug candidates for DC-SIGN inhibition due to their high solubility, resistance to glycosidases, and nontoxicity. We studied the structural properties of the interaction of the tetrameric DC-SIGN extracellular domain (ECD), with two glycomimetic antagonists, a pseudomannobioside (1) and a linear pseudomannotrioside (2). Though the inhibitory potency of 2, as measured by SPR competition experiments, was 1 order of magnitude higher than that of 1, crystal structures of the complexes within the DC-SIGN carbohydrate recognition domain showed the same binding mode for both compounds. Moreover, when conjugated to multivalent scaffolds, the inhibitory potencies of these compounds became uniform. Combining isothermal titration microcalorimetry, analytical ultracentrifugation, and dynamic light scattering techniques to study DC-SIGN ECD interaction with these glycomimetics revealed that 2 is able, without any multivalent presentation, to cluster DC-SIGN tetramers leading to an artificially overestimated inhibitory potency. The use of multivalent scaffolds presenting 1 or 2 in HIV trans-infection inhibition assay confirms the loss of potency of 2 upon conjugation and the equal efficacy of chemically simpler compound 1. This study documents a unique case where, among two active compounds chemically derived, the compound with the lower apparent activity is the optimal lead for further drug development.

  20. Hydrogen activation, diffusion, and clustering on CeO₂(111): a DFT+U study.

    PubMed

    Fernández-Torre, Delia; Carrasco, Javier; Ganduglia-Pirovano, M Verónica; Pérez, Rubén

    2014-07-01

    We present a comprehensive density functional theory+U study of the mechanisms underlying the dissociation of molecular hydrogen, and diffusion and clustering of the resulting atomic species on the CeO2(111) surface. Contrary to a widely held view based solely on a previous theoretical prediction, our results show conclusively that H2 dissociation is an activated process with a large energy barrier ~1.0 eV that is not significantly affected by coverage or the presence of surface oxygen vacancies. The reaction proceeds through a local energy minimum--where the molecule is located close to one of the surface oxygen atoms and the H-H bond has been substantially weaken by the interaction with the substrate--, and a transition state where one H atom is attached to a surface O atom and the other H atom sits on-top of a Ce(4+) ion. In addition, we have explored how several factors, including H coverage, the location of Ce(3+) ions as well as the U value, may affect the chemisorption energy and the relative stability of isolated OH groups versus pair and trimer structures. The trimer stability at low H coverages and the larger upward relaxation of the surface O atoms within the OH groups are consistent with the assignment of the frequent experimental observation by non-contact atomic force and scanning tunneling microscopies of bright protrusions on three neighboring surface O atoms to a triple OH group. The diffusion path of isolated H atoms on the surface goes through the adsorption on-top of an oxygen in the third atomic layer with a large energy barrier of ~1.8 eV. Overall, the large energy barriers for both, molecular dissociation and atomic diffusion, are consistent with the high activity and selectivity found recently in the partial hydrogenation of acetylene catalyzed by ceria at high H2/C2H2 ratios.

  1. Hydrogen activation, diffusion, and clustering on CeO₂(111): a DFT+U study.

    PubMed

    Fernández-Torre, Delia; Carrasco, Javier; Ganduglia-Pirovano, M Verónica; Pérez, Rubén

    2014-07-01

    We present a comprehensive density functional theory+U study of the mechanisms underlying the dissociation of molecular hydrogen, and diffusion and clustering of the resulting atomic species on the CeO2(111) surface. Contrary to a widely held view based solely on a previous theoretical prediction, our results show conclusively that H2 dissociation is an activated process with a large energy barrier ~1.0 eV that is not significantly affected by coverage or the presence of surface oxygen vacancies. The reaction proceeds through a local energy minimum--where the molecule is located close to one of the surface oxygen atoms and the H-H bond has been substantially weaken by the interaction with the substrate--, and a transition state where one H atom is attached to a surface O atom and the other H atom sits on-top of a Ce(4+) ion. In addition, we have explored how several factors, including H coverage, the location of Ce(3+) ions as well as the U value, may affect the chemisorption energy and the relative stability of isolated OH groups versus pair and trimer structures. The trimer stability at low H coverages and the larger upward relaxation of the surface O atoms within the OH groups are consistent with the assignment of the frequent experimental observation by non-contact atomic force and scanning tunneling microscopies of bright protrusions on three neighboring surface O atoms to a triple OH group. The diffusion path of isolated H atoms on the surface goes through the adsorption on-top of an oxygen in the third atomic layer with a large energy barrier of ~1.8 eV. Overall, the large energy barriers for both, molecular dissociation and atomic diffusion, are consistent with the high activity and selectivity found recently in the partial hydrogenation of acetylene catalyzed by ceria at high H2/C2H2 ratios. PMID:25005299

  2. Mitochondrial Iron-Sulfur Cluster Activity and Cytosolic Iron Regulate Iron Traffic in Saccharomyces cerevisiae.

    PubMed

    Wofford, Joshua D; Lindahl, Paul A

    2015-11-01

    An ordinary differential equation-based mathematical model was developed to describe trafficking and regulation of iron in growing fermenting budding yeast. Accordingly, environmental iron enters the cytosol and moves into mitochondria and vacuoles. Dilution caused by increasing cell volume is included. Four sites are regulated, including those in which iron is imported into the cytosol, mitochondria, and vacuoles, and the site at which vacuolar Fe(II) is oxidized to Fe(III). The objective of this study was to determine whether cytosolic iron (Fecyt) and/or a putative sulfur-based product of iron-sulfur cluster (ISC) activity was/were being sensed in regulation. The model assumes that the matrix of healthy mitochondria is anaerobic, and that in ISC mutants, O2 diffuses into the matrix where it reacts with nonheme high spin Fe(II) ions, oxidizing them to nanoparticles and generating reactive oxygen species. This reactivity causes a further decline in ISC/heme biosynthesis, which ultimately gives rise to the diseased state. The ordinary differential equations that define this model were numerically integrated, and concentrations of each component were plotted versus the concentration of iron in the growth medium and versus the rate of ISC/heme biosynthesis. Model parameters were optimized by fitting simulations to literature data. The model variant that assumed that both Fecyt and ISC biosynthesis activity were sensed in regulation mimicked observed behavior best. Such "dual sensing" probably arises in real cells because regulation involves assembly of an ISC on a cytosolic protein using Fecyt and a sulfur species generated in mitochondria during ISC biosynthesis and exported into the cytosol.

  3. The effects of baryon physics, black holes and active galactic nucleus feedback on the mass distribution in clusters of galaxies

    NASA Astrophysics Data System (ADS)

    Martizzi, Davide; Teyssier, Romain; Moore, Ben; Wentz, Tina

    2012-06-01

    The spatial distribution of matter in clusters of galaxies is mainly determined by the dominant dark matter component; however, physical processes involving baryonic matter are able to modify it significantly. We analyse a set of 500 pc resolution cosmological simulations of a cluster of galaxies with mass comparable to Virgo, performed with the AMR code RAMSES. We compare the mass density profiles of the dark, stellar and gaseous matter components of the cluster that result from different assumptions for the subgrid baryonic physics and galaxy formation processes. First, the prediction of a gravity-only N-body simulation is compared to that of a hydrodynamical simulation with standard galaxy formation recipes, and then all results are compared to a hydrodynamical simulation which includes thermal active galactic nucleus (AGN) feedback from supermassive black holes (SMBHs). We find the usual effects of overcooling and adiabatic contraction in the run with standard galaxy formation physics, but very different results are found when implementing SMBHs and AGN feedback. Star formation is strongly quenched, producing lower stellar densities throughout the cluster, and much less cold gas is available for star formation at low redshifts. At redshift z= 0 we find a flat density core of radius 10 kpc in both the dark and stellar matter density profiles. We speculate on the possible formation mechanisms able to produce such cores and we conclude that they can be produced through the coupling of different processes: (I) dynamical friction from the decay of black hole orbits during galaxy mergers; (II) AGN-driven gas outflows producing fluctuations of the gravitational potential causing the removal of collisionless matter from the central region of the cluster; (III) adiabatic expansion in response to the slow expulsion of gas from the central region of the cluster during the quiescent mode of AGN activity.

  4. Screen-based media use clusters are related to other activity behaviours and health indicators in adolescents

    PubMed Central

    2013-01-01

    Background Screen-based media (SBM) occupy a considerable portion of young peoples’ discretionary leisure time. The aim of this paper was to investigate whether distinct clusters of SBM use exist, and if so, to examine the relationship of any identified clusters with other activity/sedentary behaviours and physical and mental health indicators. Methods The data for this study come from 643 adolescents, aged 14 years, who were participating in the longitudinal Western Australian Pregnancy Cohort (Raine) Study through May 2003 to June 2006. Time spent on SBM, phone use and reading was assessed using the Multimedia Activity Recall for Children and Adults. Height, weight, muscle strength were measured at a clinic visit and the adolescents also completed questionnaires on their physical activity and psychosocial health. Latent class analysis (LCA) was used to analyse groupings of SBM use. Results Three clusters of SBM use were found; C1 ‘instrumental computer users’ (high email use, general computer use), C2 ‘multi-modal e-gamers’ (both high console and computer game use) and C3 ‘computer e-gamers’ (high computer game use only). Television viewing was moderately high amongst all the clusters. C2 males took fewer steps than their male peers in C1 and C3 (-13,787/week, 95% CI: -4619 to -22957, p = 0.003 and -14,806, 95% CI: -5,306 to -24,305, p = 0.002) and recorded less MVPA than the C1 males (-3.5 h, 95% CI: -1.0 to -5.9, p = 0.005). There was no difference in activity levels between females in clusters C1 and C3. Conclusion SBM use by adolescents did cluster and these clusters related differently to activity/sedentary behaviours and both physical and psychosocial health indicators. It is clear that SBM use is not a single construct and future research needs to take consideration of this if it intends to understand the impact SBM has on health. PMID:24330626

  5. Star Formation Activity in a Young Galaxy Cluster at Z = 0.866

    NASA Astrophysics Data System (ADS)

    Laganá, T. F.; Ulmer, M. P.; Martins, L. P.; da Cunha, E.

    2016-07-01

    The galaxy cluster RX J1257+4738 at z = 0.866 is one of the highest redshift clusters with a richness of multi-wavelength data, and is thus a good target to study the star formation-density relation at early epochs. Using a sample of spectroscopically confirmed cluster members, we derive the star-formation rates (SFRs) of our galaxies using two methods: (1) the relation between SFR and total infrared luminosity extrapolated from the observed Spitzer Multiband Imaging Photometer for Spitzer 24 μm imaging data; and (2) spectral energy distribution fitting using the MAGPHYS code, including eight different bands. We show that, for this cluster, the SFR-density relation is very weak and seems to be dominated by the two central galaxies and the SFR presents a mild dependence on stellar mass, with more massive galaxies having higher SFR. However, the specific SFR (SSFR) decreases with stellar mass, meaning that more massive galaxies are forming fewer stars per unit of mass, and thus suggesting that the increase in star-forming members is driven by cluster assembly and infall. If the environment is somehow driving the star formation, one would expect a relation between the SSFR and the cluster centric distance, but that is not the case. A possible scenario to explain this lack of correlation is the contamination by infalling galaxies in the inner part of the cluster, which may be on their initial pass through the cluster center. As these galaxies have higher SFRs for their stellar mass, they enhance the mean SSFR in the center of the cluster.

  6. Asp1 from Schizosaccharomyces pombe binds a [2Fe-2S](2+) cluster which inhibits inositol pyrophosphate 1-phosphatase activity.

    PubMed

    Wang, Huanchen; Nair, Vasudha S; Holland, Ashley A; Capolicchio, Samanta; Jessen, Henning J; Johnson, Michael K; Shears, Stephen B

    2015-10-27

    Iron-sulfur (Fe-S) clusters are widely distributed protein cofactors that are vital to cellular biochemistry and the maintenance of bioenergetic homeostasis, but to our knowledge, they have never been identified in any phosphatase. Here, we describe an iron-sulfur cluster in Asp1, a dual-function kinase/phosphatase that regulates cell morphogenesis in Schizosaccharomyces pombe. Full-length Asp1, and its phosphatase domain (Asp1(371-920)), were each heterologously expressed in Escherichia coli. The phosphatase activity is exquisitely specific: it hydrolyzes the 1-diphosphate from just two members of the inositol pyrophosphate (PP-InsP) signaling family, namely, 1-InsP7 and 1,5-InsP8. We demonstrate that Asp1 does not hydrolyze either InsP6, 2-InsP7, 3-InsP7, 4-InsP7, 5-InsP7, 6-InsP7, or 3,5-InsP8. We also recorded 1-phosphatase activity in a human homologue of Asp1, hPPIP5K1, which was heterologously expressed in Drosophila S3 cells with a biotinylated N-terminal tag, and then isolated from cell lysates with avidin beads. Purified, recombinant Asp1(371-920) contained iron and acid-labile sulfide, but the stoichiometry (0.8 atoms of each per protein molecule) indicates incomplete iron-sulfur cluster assembly. We reconstituted the Fe-S cluster in vitro under anaerobic conditions, which increased the stoichiometry to approximately 2 atoms of iron and acid-labile sulfide per Asp1 molecule. The presence of a [2Fe-2S](2+) cluster in Asp1(371-920) was demonstrated by UV-visible absorption, resonance Raman spectroscopy, and electron paramagnetic resonance spectroscopy. We determined that this [2Fe-2S](2+) cluster is unlikely to participate in redox chemistry, since it rapidly degraded upon reduction by dithionite. Biochemical and mutagenic studies demonstrated that the [2Fe-2S](2+) cluster substantially inhibits the phosphatase activity of Asp1, thereby increasing its net kinase activity.

  7. Highly Active Gold(I)-Silver(I) Oxo Cluster Activating sp³ C-H Bonds of Methyl Ketones under Mild Conditions.

    PubMed

    Pei, Xiao-Li; Yang, Yang; Lei, Zhen; Chang, Shan-Shan; Guan, Zong-Jie; Wan, Xian-Kai; Wen, Ting-Bin; Wang, Quan-Ming

    2015-04-29

    The activation of C(sp(3))-H bonds is challenging, due to their high bond dissociation energy, low proton acidity, and highly nonpolar character. Herein we report a unique gold(I)-silver(I) oxo cluster protected by hemilabile phosphine ligands [OAu3Ag3(PPhpy2)3](BF4)4 (1), which can activate C(sp(3))-H bonds under mild conditions for a broad scope of methyl ketones (RCOCH3, R = methyl, phenyl, 2-methylphenyl, 2-aminophenyl, 2-hydroxylphenyl, 2-pyridyl, 2-thiazolyl, tert-butyl, ethyl, isopropyl). Activation happens via triple deprotonation of the methyl group, leading to formation of heterometallic Au(I)-Ag(I) clusters with formula RCOCAu4Ag4(PPhpy2)4(BF4)5 (PPhpy2 = bis(2-pyridyl)phenylphosphine). Cluster 1 can be generated in situ via the reaction of [OAu3Ag(PPhpy2)3](BF4)2 with 2 equiv of AgBF4. The oxo ion and the metal centers are found to be essential in the cleavage of sp(3) C-H bonds of methyl ketones. Interestingly, cluster 1 selectively activates the C-H bonds in -CH3 rather than the N-H bonds in -NH2 or the O-H bond in -OH which is traditionally thought to be more reactive than C-H bonds. Control experiments with butanone, 3-methylbutanone, and cyclopentanone as substrates show that the auration of the C-H bond of the terminal methyl group is preferred over secondary or tertiary sp(3) C-H bonds; in other words, the C-H bond activation is influenced by steric effect. This work highlights the powerful reactivity of metal clusters toward C-H activation and sheds new light on gold(I)-mediated catalysis.

  8. A multiwavelength strong lensing analysis of baryons and dark matter in the dynamically active cluster AC 114

    NASA Astrophysics Data System (ADS)

    Sereno, M.; Lubini, M.; Jetzer, Ph.

    2010-07-01

    Context. Strong lensing studies can provide detailed mass maps of the inner regions even in dynamically active galaxy clusters. Aims: We illustrate the important role of a proper modelling of the intracluster medium, i.e., the main baryonic component. We demonstrate that the addition of a new contribution accounting for the gas can increase the statistical significance of the lensing model. Methods: We propose a parametric method for strong lensing analyses that exploits multiwavelength observations. The mass model accounts for cluster-sized dark matter halos, galaxies (whose stellar mass can be obtained from optical analyses), and the intracluster medium. The gas distribution is fitted to lensing data exploiting prior knowledge from X-ray observations. This gives an unbiased insight into each matter component and allows us to study the dynamical status of a cluster. The method was applied to AC 114, an irregular X-ray cluster. Results: We find positive evidence of dynamical activity, the dark matter distribution being shifted and rotated with respect to the gas. On the other hand, the dark matter follows the galaxy density in terms of both shape and orientation, illustrating the collisionless nature of dark matter. The inner region (≲250 kpc) is underluminous in optical bands, whereas the gas fraction (~20 ± 5%) slightly exceeds typical values. Evidence of lensing and X-ray suggests that the cluster develops in the plane of the sky and is not affected by the lensing over-concentration bias. Despite the dynamical activity, the matter distribution seems to agree with predictions of N-body simulations. An universal cusped profile provides a good description of either the overall or the dark matter distribution, whereas theoretical scaling relations seem to be accurately fitted.

  9. High reactivity of nanosized niobium oxide cluster cations in methane activation: A comparison with vanadium oxides

    SciTech Connect

    Ding, Xun-Lei E-mail: chemzyx@iccas.ac.cn; Wang, Dan; Wu, Xiao-Nan; Li, Zi-Yu; Zhao, Yan-Xia E-mail: chemzyx@iccas.ac.cn; He, Sheng-Gui

    2015-09-28

    The reactions between methane and niobium oxide cluster cations were studied and compared to those employing vanadium oxides. Hydrogen atom abstraction (HAA) reactions were identified over stoichiometric (Nb{sub 2}O{sub 5}){sub N}{sup +} clusters for N as large as 14 with a time-of-flight mass spectrometer. The reactivity of (Nb{sub 2}O{sub 5}){sub N}{sup +} clusters decreases as the N increases, and it is higher than that of (V {sub 2}O{sub 5}){sub N}{sup +} for N ≥ 4. Theoretical studies were conducted on (Nb{sub 2}O{sub 5}){sub N}{sup +} (N = 2–6) by density functional calculations. HAA reactions on these clusters are all favorable thermodynamically and kinetically. The difference of the reactivity with respect to the cluster size and metal type (Nb vs V) was attributed to thermodynamics, kinetics, the electron capture ability, and the distribution of the unpaired spin density. Nanosized Nb oxide clusters show higher HAA reactivity than V oxides, indicating that niobia may serve as promising catalysts for practical methane conversion.

  10. High reactivity of nanosized niobium oxide cluster cations in methane activation: A comparison with vanadium oxides.

    PubMed

    Ding, Xun-Lei; Wang, Dan; Wu, Xiao-Nan; Li, Zi-Yu; Zhao, Yan-Xia; He, Sheng-Gui

    2015-09-28

    The reactions between methane and niobium oxide cluster cations were studied and compared to those employing vanadium oxides. Hydrogen atom abstraction (HAA) reactions were identified over stoichiometric (Nb2O5)N(+) clusters for N as large as 14 with a time-of-flight mass spectrometer. The reactivity of (Nb2O5)N(+) clusters decreases as the N increases, and it is higher than that of (V 2O5)N(+) for N ≥ 4. Theoretical studies were conducted on (Nb2O5)N(+) (N = 2-6) by density functional calculations. HAA reactions on these clusters are all favorable thermodynamically and kinetically. The difference of the reactivity with respect to the cluster size and metal type (Nb vs V) was attributed to thermodynamics, kinetics, the electron capture ability, and the distribution of the unpaired spin density. Nanosized Nb oxide clusters show higher HAA reactivity than V oxides, indicating that niobia may serve as promising catalysts for practical methane conversion. PMID:26429016

  11. Effect of Co doping on catalytic activity of small Pt clusters

    NASA Astrophysics Data System (ADS)

    Dhilip Kumar, T. J.; Zhou, Chenggang; Cheng, Hansong; Forrey, Robert C.; Balakrishnan, N.

    2008-03-01

    Platinum is the most widely used catalyst in fuel cell electrodes. Designing improved catalysts with low or no platinum content is one of the grand challenges in fuel cell research. Here, we investigate electronic structures of Pt4 and Pt3Co clusters and report a comparative study of adsorption of H2, O2, and CO molecules on the two clusters using density functional theory. The adsorption studies show that H2 undergoes dissociative chemisorption on the tetrahedral clusters in head on and side on approaches at Pt centers. O2 dissociation occurs primarily in three and four center coordinations and CO prefers to adsorb on Pt or Co atop atoms. The adsorption energy of O2 is found to be higher for the Co doped cluster. For CO, the Pt atop orientation is preferred for both Pt4 and Pt3Co tetrahedral clusters. Adsorption of CO molecule on tetrahedral Pt3Co in side on approach leads to isomerization to planar rhombus geometry. An analysis of Hirshfeld charge distribution shows that the clusters become more polarized after adsorption of the molecules.

  12. Effect of Co doping on catalytic activity of small Pt clusters.

    PubMed

    Dhilip Kumar, T J; Zhou, Chenggang; Cheng, Hansong; Forrey, Robert C; Balakrishnan, N

    2008-03-28

    Platinum is the most widely used catalyst in fuel cell electrodes. Designing improved catalysts with low or no platinum content is one of the grand challenges in fuel cell research. Here, we investigate electronic structures of Pt(4) and Pt(3)Co clusters and report a comparative study of adsorption of H(2), O(2), and CO molecules on the two clusters using density functional theory. The adsorption studies show that H(2) undergoes dissociative chemisorption on the tetrahedral clusters in head on and side on approaches at Pt centers. O(2) dissociation occurs primarily in three and four center coordinations and CO prefers to adsorb on Pt or Co atop atoms. The adsorption energy of O(2) is found to be higher for the Co doped cluster. For CO, the Pt atop orientation is preferred for both Pt(4) and Pt(3)Co tetrahedral clusters. Adsorption of CO molecule on tetrahedral Pt(3)Co in side on approach leads to isomerization to planar rhombus geometry. An analysis of Hirshfeld charge distribution shows that the clusters become more polarized after adsorption of the molecules. PMID:18376957

  13. Sejong Open Cluster Survey (SOS) - V. The Active Star Forming Region SH 2-255-257

    NASA Astrophysics Data System (ADS)

    Lim, Beomdu; Sung, Hwankyung; Hur, Hyeonoh; Lee, Byeong-Cheol; Bessell, Michael S.; Kim, Jinyoung S.; Lee, Kang Hwan; Park, Byeong-Gon; Jeong, Gwanghui

    2015-12-01

    There is much observational evidence that active star formation is taking place in the H II regions Sh 2-255-257. We present a photometric study of this star forming region (SFR) using imaging data obtained in passbands from the optical to the mid-infrared, in order to study the star formation process. A total of 218 members were identified using various selection criteria based on their observational properties. The SFR is reddened by at least E(B-V) = 0.8 mag, and the reddening law toward the region is normal (R_V = 3.1). From the zero-age main sequence fitting method it is confirmed that the SFR is 2.1 ± 0.3 kpc from the Sun. The median age of the identified members is estimated to be about 1.3 Myr from a comparison of the Hertzsprung-Russell diagram (HRD) with stellar evolutionary models. The initial mass function (IMF) is derived from the HRD and the near-infrared (J, J-H) color-magnitude diagram. The slope of the IMF is about Γ = -1.6 ± 0.1, which is slightly steeper than that of the Salpeter/Kroupa IMF. It implies that low-mass star formation is dominant in the SFR. The sum of the masses of all the identified members provides the lower limit of the cluster mass (169 M_{⊙}). We also analyzed the spectral energy distribution (SED) of pre-main sequence stars using the SED fitting tool of Robitaille et al., and confirm that there is a significant discrepancy between stellar mass and age obtained from two different methods based on the SED fitting tool and the HRD.

  14. Imaging active faults in a region of distributed deformation from joint focal mechanism and hypocenter clustering: Application to western Iberia

    NASA Astrophysics Data System (ADS)

    Custodio, S.; Lima, V.; Vales, D.; Carrilho, F.; Cesca, S.

    2015-12-01

    Mainland Portugal, on the SW edge of the European continent, is located directly north of the boundary between the Eurasian and Nubian plates. It lies in a region of slow lithospheric deformation, which has generated some of the largest earthquakes in Europe, both intraplate (mainland) and interplate (offshore). The seismicity of mainland Portugal and its adjacent offshore has been repeatedly classified as diffuse. We analyse the instrumental earthquake catalog for western Iberia, enriched with data from recent dense broadband deployments. We show that although the plate boundary south of Portugal is diffuse, in that deformation is accommodated along several distributed faults rather than along one long linear plate boundary, the seismicity itself is not diffuse. Rather, when located using high quality data, earthquakes collapse into well-defined clusters and lineations. We then present a new joint focal mechanism and hypocenter cluster algorithm that is able to extract coherent information between hypocenter locations and focal mechanisms. We apply the method to the Azores-western Mediterranean region, with emphasis on western Iberia. In addition to identifying well-known seismo-tectonic features, the joint clustering algorithm identifies eight new clusters of earthquakes with a good match between the directions of epicentre lineations and focal mechanism fault planes. These clusters may signal single active faults or wider fault zones accommodating a consistent type of faulting. Mainland Portugal is dominated by strike-slip faulting, consistent with the NNE-SSW and WNW-ESE oriented lineations. The region offshore SW Iberia displays clusters that are either predominantly strike-slip or reverse, indicating slip partitioning. This work shows that the study of low-magnitude earthquakes using dense seismic deployments is a powerful tool to study lithospheric deformation in slowly deforming regions, where high-magnitude earthquakes occur with long recurrence intervals.

  15. MC2: boosted AGN and star formation activity in CIZA J2242.8+5301, a massive post-merger cluster at z = 0.19

    NASA Astrophysics Data System (ADS)

    Sobral, David; Stroe, Andra; Dawson, William A.; Wittman, David; Jee, M. James; Röttgering, Huub; van Weeren, Reinout J.; Brüggen, Marcus

    2015-06-01

    Cluster mergers may play a fundamental role in the formation and evolution of cluster galaxies. Stroe et al. revealed unexpected overdensities of candidate Hα emitters near the ˜1-Mpc-wide shock fronts of the massive (˜2 × 1015 M⊙) `Sausage' merging cluster, CIZA J2242.8+5301. We used the Keck/Deep Imaging Multi-Object Spectrograph and the William Herschel Telescope/AutoFib2+WYFFOS to confirm 83 Hα emitters in and around the merging cluster. We find that cluster star-forming galaxies in the hottest X-ray gas and/or in the cluster subcores (away from the shock fronts) show high [S II]6716/[S II]6761 and high [S II] 6716/Hα, implying very low electron densities (<30 × lower than all other star-forming galaxies outside the cluster) and/or significant contribution from supernovae, respectively. All cluster star-forming galaxies near the cluster centre show evidence of significant outflows (blueshifted Na D ˜200-300 km s-1), likely driven by supernovae. Strong outflows are also found for the clusteractive galactic nucleus (AGN). Hα star-forming galaxies in the merging cluster follow the z ˜ 0 mass-metallicity relation, showing systematically higher metallicity (˜0.15-0.2 dex) than Hα emitters outside the cluster (projected R > 2.5 Mpc). This suggests that the shock front may have triggered remaining metal-rich gas which galaxies were able to retain into forming stars. Our observations show that the merger of impressively massive (˜1015 M⊙) clusters can provide the conditions for significant star formation and AGN activity, but, as we witness strong feedback by star-forming galaxies and AGN (and given how massive the merging cluster is), such sources will likely quench in a few 100 Myr.

  16. Alpha6beta4 integrin crosslinking induces EGFR clustering and promotes EGF-mediated Rho activation in breast cancer

    PubMed Central

    Gilcrease, Michael Z; Zhou, Xiao; Lu, Xiaolin; Woodward, Wendy A; Hall, Brian E; Morrissey, Phillip J

    2009-01-01

    Background The α6β4 integrin is overexpressed in the basal subtype of breast cancer and plays an important role in tumor cell motility and invasion. EGFR is also overexpressed in the basal subtype of breast cancer, and crosstalk between α6β4 integrin and EGFR appears to be important in tumor progression. Methods We evaluated the effects of α6β4 crosslinking on the distribution and function of EGFR in breast carcinoma cell line MDA-MB-231. Receptor distribution was evaluated by fluorescence microscopy and multispectral imaging flow cytometry, and ligand-mediated EGFR signaling was evaluated using Western blots and a Rho pull-down assay. Results Antibody-mediated crosslinking of α6β4 integrin was sufficient to induce cell-surface clustering of not only α6β4 but also EGFR in nonadherent cells. The induced clustering of EGFR was observed minimally after 5 min of integrin crosslinking but was more prominent after 15 min. EGFR clustering had minimal effect on the phosphorylation of Akt or Erk1,2 in response to EGF in suspended cells or in response to HB-EGF in adherent cells. However, EGFR clustering induced by crosslinking α6β4 had a marked effect on Rho activation in response to EGF. Conclusion Crosslinking α6β4 integrin in breast carcinoma cells induces EGFR clustering and preferentially promotes Rho activation in response to EGF. We hypothesize that this integrin-EGFR crosstalk may facilitate tumor cell cytoskeletal rearrangements important for tumor progression. PMID:19470173

  17. Intervention Effects on Adolescent Physical Activity in the Multicomponent SPACE Study: A Cluster Randomized Controlled Trial

    PubMed Central

    Toftager, Mette; Christiansen, Lars B.; Ersbøll, Annette K.; Kristensen, Peter L.; Due, Pernille; Troelsen, Jens

    2014-01-01

    Background Multicomponent school-based interventions have the potential to reduce the age-related decline in adolescents' physical activity (PA), yet there is not consistent evidence to guide non-curricular and school environment interventions. The aim of this study was to assess the effectiveness of a multicomponent environmental school-based intervention, designed to reduce the age-related decline in PA among adolescents. Methods A cluster randomized controlled trial was conducted with 7 intervention and 7 control schools. Baseline measurements were carried out in spring 2010 with 2 years of follow-up. A total of 1,348 students (11–13 years, in grade 5 and 6) enrolled in the study at baseline. The 14 schools included in the study were located in the Region of Southern Denmark. The intervention consisted of organizational and physical changes in the school environment with a total of 11 intervention components. The primary outcome measure was overall PA (cpm, counts per minute) and was supported by analyses of time spent in MVPA, and time spent sedentary. Furthermore, a secondary outcome measure was PA in school time and during recess. PA was measured using accelerometer (Actigraph GT3X). Results A total of 797 students completed the trial and had valid accelerometer data. No significant difference was found for overall PA with an adjusted difference of −19.1 cpm (95% CI: −93, 53) or for school time activity with an adjusted difference of 6 cpm (95% CI: −73, 85). A sensitivity analysis revealed a positive significant intervention effect of PA in recess with an adjusted difference of 95 cpm. Conclusions No evidence was found of the overall effect of a non-curricular multicomponent school-based intervention on PA among Danish adolescents. The intervention was positively associated with PA during school time and recess, however, with small estimates. Lack of effect on overall PA could be due to both program theory and different degrees of implementation

  18. The efficacy of trivalent cyclic hexapeptides to induce lipid clustering in PG/PE membranes correlates with their antimicrobial activity.

    PubMed

    Finger, Sebastian; Kerth, Andreas; Dathe, Margitta; Blume, Alfred

    2015-11-01

    Various models have been proposed for the sequence of events occurring after binding of specific antimicrobial peptides to lipid membranes. The lipid clustering model arose by the finding that antimicrobial peptides can induce a segregation of certain negatively charged lipids in lipid model membranes. Anionic lipid segregation by cationic peptides is initially an effect of charge interaction where the ratio of peptide and lipid charges is thought to be the decisive parameter in the peptide induced lipid demixing. However, the sequence of events following this initial lipid clustering is more complex and can lead to deactivation of membrane proteins involved in cell division or perturbation of lipid reorganization essential for cell division. In this study we used DSC and ITC techniques to investigate the effect of binding different cyclic hexapeptides with varying antimicrobial efficacy, to phosphatidylglycerol (PG)/phosphatidylethanolamine (PE) lipid membranes and their ability to induce lipid segregation in these mixtures. We found that these cyclic hexapeptides consisting of three charged and three aromatic amino acids showed indeed different abilities to induce lipid demixing depending on their amino acid composition and their sequence. The results clearly showed that the cationic amino acids are essential for electrostatic binding but that the three hydrophobic amino acids in the peptides and their position in the sequence also contribute to binding affinity and to the extent of induction of lipid clustering. The efficacy of these different hexapeptides to induce PG clusters in PG/PE membranes was found to be correlated with their antimicrobial activity.

  19. Activation and Transformation of Ethane by Au2 VO3(+) Clusters with Closed-Shell Electronic Structures.

    PubMed

    Li, Ya-Ke; Li, Zi-Yu; Zhao, Yan-Xia; Liu, Qing-Yu; Meng, Jing-Heng; He, Sheng-Gui

    2016-01-26

    The study of chemical reactions between gold-containing heteronuclear oxide clusters and small molecules can provide molecular level mechanisms to understand the excellent activity of gold supported by metal oxides. While the promotion role of gold in alkane transformation was identified in the clusters with atomic oxygen radicals (O(-.)), the role of gold in the systems without O(-.) is not clear. By employing mass spectrometry and quantum chemistry calculations, the reactivity of Au2 VO3(+) clusters with closed-shell electronic structures toward ethane was explored. Both the dehydrogenation and ethene elimination channels were identified. It is gold rather than oxygen species initiating the C-H activation. The Au-Au dimer formed during the reactions plays important roles in ethane transformation. The reactivity comparison between Au2 VO3(+) and bare Au2(+) demonstrates that Au2 VO3(+) not only retains the property of bare Au2(+) that transforming ethane to dihydrogen, but also exhibits new functions in converting ethane to ethene, which reveals the importance of the composite system. This study provides a further understanding of the reactivity of metal oxide supported gold in alkane activation and transformation. PMID:26679978

  20. Synthesis and SAR requirements of adamantane-colchicine conjugates with both microtubule depolymerizing and tubulin clustering activities.

    PubMed

    Zefirova, Olga N; Nurieva, Evgeniya V; Shishov, Dmitrii V; Baskin, Igor I; Fuchs, Fabian; Lemcke, Heiko; Schröder, Fabian; Weiss, Dieter G; Zefirov, Nikolay S; Kuznetsov, Sergei A

    2011-09-15

    A series of analogues of conjugate 1, combining an adamantane-based paclitaxel (taxol) mimetic with colchicine was synthesized and tested for cytotoxicity in a cell-based assay with the human lung carcinoma cell line A549. The most active compounds (10 EC(50) 2 ± 1.0 nM, 23 EC(50) 6 ± 1.4 nM, 26 EC(50) 5 ± 1.8 nM, 28 EC(50) 11 ± 1.7 nM, 30 EC(50) 4.8 ± 0.5 nM) were found to interfere with the microtubule dynamics in an interesting manner. Treatment of the cells with these compounds promoted disassembly of microtubules followed by the formation of stable tubulin clusters. Structure-activity relationships for the analogues of 23 revealed the sensitivity of both cytotoxicity and tubulin clustering ability to the linker length. The presence of adamantane (or another bulky hydrophobic and non-aromatic moiety) in 23 was found to play an important role in the formation of tubulin clusters. Structural requirements for optimal activity have been partially explained by molecular modeling. PMID:21873068

  1. Costimulation with anti-cluster of differentiation 3 and anti-cluster of differentiation 28 reduces the activity of mucin 1-stimulated human mononuclear cells

    PubMed Central

    WRIGHT, STEPHEN E.; REWERS-FELKINS, KATHLEEN A.; QUINLIN, IMELDA; ZOHRA, FATEMA; AHMED, JEWEL

    2016-01-01

    Cytotoxic T-lymphocyte activation and extension of the cell life span is necessary in order to enable immunotherapy to perform effectively against cancer. In the present study, mucin 1 (MUC1)-stimulated human mononuclear cells (M1SHMCs) were costimulated with bead-attached monoclonal antibodies specific for cluster of differentiation (CD)3 and CD28 receptors. The study was undertaken to determine whether costimulation was capable of enhancing the killing of cancer cells in vitro and of protecting non-obese diabetic severe combined immunodeficient mice from tumor development. Lysis of MCF-7 tumor cells by M1SHMCs was reduced following costimulation with anti-CD3 and anti-CD28. Furthermore, costimulation with anti-CD3 and anti-CD28 eliminated the protective effects of M1SHMCs on MCF-7 breast cancer cell growth in the non-obese diabetic severe combined immunodeficient mice. The present study suggested that costimulation with anti-CD3 and anti-CD28 is not advisable following antigen activation of lymphocytes under the conditions used here. Using a lower anti-CD3/CD28 bead to T-cell ratio may prevent immune suppression, however, further studies are required to support this hypothesis. PMID:26870234

  2. Activity-dependent regulation of the K/Cl transporter KCC2 membrane diffusion, clustering, and function in hippocampal neurons.

    PubMed

    Chamma, Ingrid; Heubl, Martin; Chevy, Quentin; Renner, Marianne; Moutkine, Imane; Eugène, Emmanuel; Poncer, Jean Christophe; Lévi, Sabine

    2013-09-25

    The neuronal K/Cl transporter KCC2 exports chloride ions and thereby influences the efficacy and polarity of GABA signaling in the brain. KCC2 is also critical for dendritic spine morphogenesis and the maintenance of glutamatergic transmission in cortical neurons. Because KCC2 plays a pivotal role in the function of central synapses, it is of particular importance to understand the cellular and molecular mechanisms underlying its regulation. Here, we studied the impact of membrane diffusion and clustering on KCC2 function. KCC2 forms clusters in the vicinity of both excitatory and inhibitory synapses. Using quantum-dot-based single-particle tracking on rat primary hippocampal neurons, we show that KCC2 is slowed down and confined at excitatory and inhibitory synapses compared with extrasynaptic regions. However, KCC2 escapes inhibitory synapses faster than excitatory synapses, reflecting stronger molecular constraints at the latter. Interfering with KCC2-actin interactions or inhibiting F-actin polymerization releases diffusion constraints on KCC2 at excitatory but not inhibitory synapses. Thus, F-actin constrains KCC2 diffusion at excitatory synapses, whereas KCC2 is confined at inhibitory synapses by a distinct mechanism. Finally, increased neuronal activity rapidly increases the diffusion coefficient and decreases the dwell time of KCC2 at excitatory synapses. This effect involves NMDAR activation, Ca(2+) influx, KCC2 S940 dephosphorylation and calpain protease cleavage of KCC2 and is accompanied by reduced KCC2 clustering and ion transport function. Thus, activity-dependent regulation of KCC2 lateral diffusion and clustering allows for a rapid regulation of chloride homeostasis in neurons.

  3. Phosphatidylinositol 4,5-bisphosphate triggers activation of focal adhesion kinase by inducing clustering and conformational changes

    PubMed Central

    Goñi, Guillermina M.; Epifano, Carolina; Boskovic, Jasminka; Camacho-Artacho, Marta; Zhou, Jing; Bronowska, Agnieszka; Martín, M. Teresa; Eck, Michael J.; Kremer, Leonor; Gräter, Frauke; Gervasio, Francesco Luigi; Perez-Moreno, Mirna; Lietha, Daniel

    2014-01-01

    Focal adhesion kinase (FAK) is a nonreceptor tyrosine kinase (NRTK) with key roles in integrating growth and cell matrix adhesion signals, and FAK is a major driver of invasion and metastasis in cancer. Cell adhesion via integrin receptors is well known to trigger FAK signaling, and many of the players involved are known; however, mechanistically, FAK activation is not understood. Here, using a multidisciplinary approach, including biochemical, biophysical, structural, computational, and cell biology approaches, we provide a detailed view of a multistep activation mechanism of FAK initiated by phosphatidylinositol-4,5-bisphosphate [PI(4,5)P2]. Interestingly, the mechanism differs from canonical NRTK activation and is tailored to the dual catalytic and scaffolding function of FAK. We find PI(4,5)P2 induces clustering of FAK on the lipid bilayer by binding a basic region in the regulatory 4.1, ezrin, radixin, moesin homology (FERM) domain. In these clusters, PI(4,5)P2 induces a partially open FAK conformation where the autophosphorylation site is exposed, facilitating efficient autophosphorylation and subsequent Src recruitment. However, PI(4,5)P2 does not release autoinhibitory interactions; rather, Src phosphorylation of the activation loop in FAK results in release of the FERM/kinase tether and full catalytic activation. We propose that PI(4,5)P2 and its generation in focal adhesions by the enzyme phosphatidylinositol 4-phosphate 5-kinase type Iγ are important in linking integrin signaling to FAK activation. PMID:25049397

  4. Modeling clustered activity increase in amyloid-beta positron emission tomographic images with statistical descriptors

    PubMed Central

    Shokouhi, Sepideh; Rogers, Baxter P; Kang, Hakmook; Ding, Zhaohua; Claassen, Daniel O; Mckay, John W; Riddle, William R

    2015-01-01

    Background Amyloid-beta (Aβ) imaging with positron emission tomography (PET) holds promise for detecting the presence of Aβ plaques in the cortical gray matter. Many image analyses focus on regional average measurements of tracer activity distribution; however, considerable additional information is available in the images. Metrics that describe the statistical properties of images, such as the two-point correlation function (S2), have found wide applications in astronomy and materials science. S2 provides a detailed characterization of spatial patterns in images typically referred to as clustering or flocculence. The objective of this study was to translate the two-point correlation method into Aβ-PET of the human brain using 11C-Pittsburgh compound B (11C-PiB) to characterize longitudinal changes in the tracer distribution that may reflect changes in Aβ plaque accumulation. Methods We modified the conventional S2 metric, which is primarily used for binary images and formulated a weighted two-point correlation function (wS2) to describe nonbinary, real-valued PET images with a single statistical function. Using serial 11C-PiB scans, we calculated wS2 functions from two-dimensional PET images of different cortical regions as well as three-dimensional data from the whole brain. The area under the wS2 functions was calculated and compared with the mean/median of the standardized uptake value ratio (SUVR). For three-dimensional data, we compared the area under the wS2 curves with the subjects’ cerebrospinal fluid measures. Results Overall, the longitudinal changes in wS2 correlated with the increase in mean SUVR but showed lower variance. The whole brain results showed a higher inverse correlation between the cerebrospinal Aβ and wS2 than between the cerebrospinal Aβ and SUVR mean/median. We did not observe any confounding of wS2 by region size or injected dose. Conclusion The wS2 detects subtle changes and provides additional information about the binding

  5. Near infrared emission from molecule-like silver clusters confined in zeolite A assisted by thermal activation

    SciTech Connect

    Lin, Hui Imakita, Kenji; Rong Gui, Sa Chu; Fujii, Minoru

    2014-07-07

    Strong and broad near infrared (NIR) emission peaked at ~855 nm upon optimal excitation at 342 nm has been observed from molecule-like silver clusters (MLSCs) confined in zeolite A assisted by thermal activation. To the best of our knowledge, this is the first observation of NIR emission peaked at longer than 800 nm from MLSCs confined in solid matrices. The decay time of the NIR emission is over 10 μs, which indicates that it is a spin-forbidden transition. The ~855 nm NIR emission shows strong dependence on the silver loading concentration and the thermal activation temperature.

  6. Advancing Water and Water-Energy-Food Cluster Activities within Future Earth

    NASA Astrophysics Data System (ADS)

    Lawford, R. G.; Bhaduri, A.; Pahl-Wostl, C.

    2014-12-01

    In building its emerging program, Future Earth has encouraged former Earth System Science Partnership (ESSP) projects to redefine their objectives, priorities and problem approaches so they are aligned with those of Future Earth. These new projects will be characterized by more integrated applications of natural and social sciences as well as dialogue and science integrated across disciplinary boundaries to address a wide range of environmental and social issues. The Global Water System Project (GWSP) has had a heritage of integrating natural and social sciences, and recently started to also look at issues within the Water-Energy-Food (WEF) cluster using similar integrated approaches. As part of the growth of the scientific elements of this cluster, GWSP has approached Future Earth opportunities by addressing the sustainability for Water, Energy, and Food through integrated water information and improved governance.In this presentation the approaches being considered for promoting integration in both water and the WEF cluster will be discussed. In particular, potential contributions of Future Earth to research related to the use and management of water and to issues and science underpinning the W-E-F nexus deliberations will be identified. In both cases the increasing ability to utilize Earth observations and big data will advance this research agenda. In addition, the better understanding of the implications of governance structures in addressing these issues and the options for harmonizing the use of scientific knowledge and technological advances will be explored. For example, insights gained from water management studies undertaken within the GWSP are helping to focus plans for a "sustainable water futures" project and a WEF cluster within Future Earth. The potential role of the Sustainable Development Goals in bringing together the monitoring and science capabilities, and understanding of governance approaches, will be discussed as a framework for facilitating

  7. Large-scale clustering of broad-line Active Galactic Nuclei at low redshifts

    NASA Astrophysics Data System (ADS)

    Krumpe, Mirko; Miyaji, Takamitsu; Coil, Alison; Husemann, Bernd; Fanidakis, Nikolaos; Aceves, Hector

    2015-08-01

    In the last decade, large area surveys (e.g., SDSS, 2dF, XMM-COSMOS) significantly improved AGN clustering measurements, which now provide tight constraints on the mass of the hosting dark matter halos (as a function of AGN luminosity, type, and redshift), the environment in which super massive black hole accretion takes place, and the co-evolution of galaxies and AGN.I will report on a series of papers in which we study the large-scale clustering of broad-line optical and X-ray AGN through cross-correlation measurements with SDSS galaxies. With three independent measurements, we cover a redshift range of z=0.07-0.50. We find an X-ray luminosity dependence in the clustering amplitude of X-ray selected broad-line AGN. X-ray and optically selected broad-line AGN do not show significant differences in the clustering strengths at low redshifts. We apply Halo Occupation Distribution modeling and determined constraints on the distribution of AGN among dark matter halos as a function of their mass. At z~0.3, the AGN fraction decreases with increasing DMH mass. I will also present our newest results on the origin of the X-ray luminosity dependence of broad-line AGN clustering. The mass of supermassive black holes drives the dependence, while no dependence on L/L_EDD is found. Thus, more massive black holes reside in more massive dark matter halos. We also compare our results to state-of-the-art cosmological simulations and find good agreement.

  8. GRB2 Nucleates T Cell Receptor-Mediated LAT Clusters That Control PLC-γ1 Activation and Cytokine Production.

    PubMed

    Bilal, Mahmood Yousif; Houtman, Jon C D

    2015-01-01

    GRB2 is a ubiquitously expressed adaptor protein required for signaling downstream of multiple receptors. To address the role of GRB2 in receptor-mediated signaling, the expression of GRB2 was suppressed in human CD4+ T cells and its role downstream of the T cell receptor (TCR) was examined. Interestingly, GRB2 deficient T cells had enhanced signaling from complexes containing the TCR. However, GRB2 deficient T cells had substantially reduced production of IL-2 and IFN-γ. This defect was attributed to diminished formation of linker for activation of T cells (LAT) signaling clusters, which resulted in reduced MAP kinase activation, calcium flux, and PLC-γ1 recruitment to LAT signaling clusters. Add back of wild-type GRB2, but not a novel N-terminal SH3 domain mutant, rescued LAT microcluster formation, calcium mobilization, and cytokine release, providing the first direct evidence that GRB2, and its ability to bind to SH3 domain ligands, is required for establishing LAT microclusters. Our data demonstrate that the ability of GRB2 to facilitate protein clusters is equally important in regulating TCR-mediated functions as its capacity to recruit effector proteins. This highlights that GRB2 regulates signaling downstream of adaptors and receptors by both recruiting effector proteins and regulating the formation of signaling complexes.

  9. Role of the lysine-rich cluster of the C2 domain in the phosphatidylserine-dependent activation of PKCalpha.

    PubMed

    Rodríguez-Alfaro, Jose A; Gomez-Fernandez, Juan C; Corbalan-Garcia, Senena

    2004-01-23

    The C2 domain of PKCalpha is a Ca(2+)-dependent membrane-targeting module involved in the plasma membrane localization of the enzyme. Recent findings have shown an additional area located in the beta3-beta4 strands, named the lysine-rich cluster, which has been demonstrated to be involved in the PtdIns(4,5)P(2)-dependent activation of the enzyme. Nevertheless, whether other anionic phospholipids can bind to this region and contribute to the regulation of the enzyme's function is not clear. To study other possible roles for this cluster, we generated double and triple mutants that substituted the lysine by alanine residues, and studied their binding and activation properties in a Ca(2+)/phosphatidylserine-dependent manner and compared them with the wild-type protein. It was found that some of the mutants exerted a constitutive activation independently of membrane binding. Furthermore, the constructs were fused to green fluorescent protein and were expressed in fibroblast cells. It was shown that none of the mutants was able to translocate to the plasma membrane, even in saturating conditions of Ca(2+) and diacylglycerol, suggesting that the interactions performed by this lysine-rich cluster are a key event in the subcellular localization of PKCalpha. Taken together, the results obtained showed that these lysine residues might be involved in two functions: one to establish an intramolecular interaction that keeps the enzyme in an inactive conformation; and the second, once the enzyme has been partially activated, to establish further interactions with diacylglycerol and/or acidic phospholipids, leading to the full activation of PKCalpha.

  10. Simultaneous blind separation and clustering of coactivated EEG/MEG sources for analyzing spontaneous brain activity.

    PubMed

    Hirayama, Jun-ichiro; Ogawa, Takeshi; Hyvärinen, Aapo

    2014-01-01

    Analysis of the dynamics (non-stationarity) of functional connectivity patterns has recently received a lot of attention in the neuroimaging community. Most analysis has been using functional magnetic resonance imaging (fMRI), partly due to the inherent technical complexity of the electro- or magnetoencephalography (EEG/MEG) signals, but EEG/MEG holds great promise in analyzing fast changes in connectivity. Here, we propose a method for dynamic connectivity analysis of EEG/MEG, combining blind source separation with dynamic connectivity analysis in a single probabilistic model. Blind source separation is extremely useful for interpretation of the connectivity changes, and also enables rejection of artifacts. Dynamic connectivity analysis is performed by clustering the coactivation patterns of separated sources by modeling their variances. Experiments on resting-state EEG show that the obtained clusters correlate with physiologically meaningful quantities. PMID:25571098

  11. Clustering Analysis of OFFICER'S Behaviours in London Police Foot Patrol Activities

    NASA Astrophysics Data System (ADS)

    Shen, J.; Cheng, T.

    2015-07-01

    In this small paper we aim at presenting a framework of conceptual representation and clustering analysis of police officers' patrol pattern obtained from mining their raw movement trajectory data. This have been achieved by a model developed to accounts for the spatio-temporal dynamics human movements by incorporating both the behaviour features of the travellers and the semantic meaning of the environment they are moving in. Hence, the similarity metric of traveller behaviours is jointly defined according to the stay time allocation in each Spatio-temporal region of interests (ST-ROI) to support clustering analysis of patrol behaviours. The proposed framework enables the analysis of behaviour and preferences on higher level based on raw moment trajectories. The model is firstly applied to police patrol data provided by the Metropolitan Police and will be tested by other type of dataset afterwards.

  12. ALMA and HST Observations of the Molecular Environment, Star formation Activity and Cluster Dissolution In NGC 1097

    NASA Astrophysics Data System (ADS)

    Sheth, Kartik; Regan, Michael W.; Ngcebetsha, Buntu; Kohno, Kotaro; Teuben, Peter J.; Vogel, Stuart N.; Villard, Eric; Wiklind, Tommy; Lundgren, Andreas

    2015-01-01

    Barred spiral galaxies, such as NGC 1097, are an ideal laboratory for studying the interplay between the molecular gas environment and recent star formation activity because there are several dynamically distinct environs (the circumnuclear ring, the bar dust lanes and spurs, the bar end, the inner ring and spiral arms) where the SF activity varies by over three orders of magnitude. We present new ALMA Cycle 1 data showing the CO(1-0), HCN, HCO+, CS, 13CO, C18O emission across the entire disk of NGC 1097 at a resolution of 75 pc (1'). We map the distribution and kinematics of the molecular ISM and quantify the free fall time and shear to constrain what initiates (or inhibits) the star formation activity. By combining the 12m primary array, ACA-7m and total power data we show the most complete maps of NGC 1097. We use the high resolution data to measure the gas inflow rate and accretion onto the circumnuclear ring and constrain the feeding of the central AGN. The 13CO / 12CO ratio across the different environments is used to measure and quantify the diffuse versus dense phases of the molecular ISM across the disk of the galaxy. Finally we compare the ALMA data to new HST UV & optical data to measure the ages and locations of young star clusters. By comparing the cluster age and morphology to the ALMA data we constrain the cluster dissolution time scales as a function of the molecular ISM. Finally we show new JVLA C, X and Ka band continuum data to distinguish between old and young star formation activity.

  13. Growth of fluorescence gold clusters using photo-chemically activated ligands

    NASA Astrophysics Data System (ADS)

    Mishra, Dinesh; Aldeek, Fadi; Michael, Serge; Palui, Goutam; Mattoussi, Hedi

    2016-03-01

    Ligands made of lipoic acid (LA) appended with a polyethylene glycol (PEG) chain have been used in the aqueous phase growth of luminescent gold clusters with distinct emission from yellow to near-IR, using two different routes. In the first route, the gold-ligand complex was chemically reduced using sodium borohydride in alkaline medium, which gave near- IR luminescent gold clusters with maximum emission around 745 nm. In the second method, LA-PEG ligand was photochemically modified to a mixture of thiols, oligomers and oxygenated species under UV-irradiation, which was then used as both reducing agent and stabilizing ligand. By adjusting the pH, temperature, and time of the reaction, we were able to obtain clusters with two distinct emission properties. Refluxing the gold-ligand complex in alkaline medium in the presence of excess ligand gave yellow emission within the first two hours and the emission shifted to red after overnight reaction. Mass spectrometry and chemical assay were used to understand the photo-chemical transformation of Lipoic Acid (LA). Mass spectroscopic studies showed the photo-irradiated product contains thiols, oligomers (dimers, trimers and tetramers) as well as oxygenated species. The amount of thiol formed under different conditions of irradiation was estimated using Ellman's assay.

  14. MET18 Connects the Cytosolic Iron-Sulfur Cluster Assembly Pathway to Active DNA Demethylation in Arabidopsis

    PubMed Central

    Tang, Kai; Zhang, Huiming; Mangrauthia, Satendra K.; Lei, Mingguang; Hsu, Chuan-Chih; Hou, Yueh-Ju; Wang, Chunguo; Li, Yan; Tao, W. Andy; Zhu, Jian-Kang

    2015-01-01

    DNA demethylation mediated by the DNA glycosylase ROS1 helps determine genomic DNA methylation patterns and protects active genes from being silenced. However, little is known about the mechanism of regulation of ROS1 enzymatic activity. Using a forward genetic screen, we identified an anti-silencing (ASI) factor, ASI3, the dysfunction of which causes transgene promoter hyper-methylation and silencing. Map-based cloning identified ASI3 as MET18, a component of the cytosolic iron-sulfur cluster assembly (CIA) pathway. Mutation in MET18 leads to hyper-methylation at thousands of genomic loci, the majority of which overlap with hypermethylated loci identified in ros1 and ros1dml2dml3 mutants. Affinity purification followed by mass spectrometry indicated that ROS1 physically associates with MET18 and other CIA components. Yeast two-hybrid and split luciferase assays showed that ROS1 can directly interact with MET18 and another CIA component, AE7. Site-directed mutagenesis of ROS1 indicated that the conserved iron-sulfur motif is indispensable for ROS1 enzymatic activity. Our results suggest that ROS1-mediated active DNA demethylation requires MET18-dependent transfer of the iron-sulfur cluster, highlighting an important role of the CIA pathway in epigenetic regulation. PMID:26492035

  15. MET18 Connects the Cytosolic Iron-Sulfur Cluster Assembly Pathway to Active DNA Demethylation in Arabidopsis.

    PubMed

    Duan, Cheng-Guo; Wang, Xingang; Tang, Kai; Zhang, Huiming; Mangrauthia, Satendra K; Lei, Mingguang; Hsu, Chuan-Chih; Hou, Yueh-Ju; Wang, Chunguo; Li, Yan; Tao, W Andy; Zhu, Jian-Kang

    2015-10-01

    DNA demethylation mediated by the DNA glycosylase ROS1 helps determine genomic DNA methylation patterns and protects active genes from being silenced. However, little is known about the mechanism of regulation of ROS1 enzymatic activity. Using a forward genetic screen, we identified an anti-silencing (ASI) factor, ASI3, the dysfunction of which causes transgene promoter hyper-methylation and silencing. Map-based cloning identified ASI3 as MET18, a component of the cytosolic iron-sulfur cluster assembly (CIA) pathway. Mutation in MET18 leads to hyper-methylation at thousands of genomic loci, the majority of which overlap with hypermethylated loci identified in ros1 and ros1dml2dml3 mutants. Affinity purification followed by mass spectrometry indicated that ROS1 physically associates with MET18 and other CIA components. Yeast two-hybrid and split luciferase assays showed that ROS1 can directly interact with MET18 and another CIA component, AE7. Site-directed mutagenesis of ROS1 indicated that the conserved iron-sulfur motif is indispensable for ROS1 enzymatic activity. Our results suggest that ROS1-mediated active DNA demethylation requires MET18-dependent transfer of the iron-sulfur cluster, highlighting an important role of the CIA pathway in epigenetic regulation.

  16. Two- and four-component relativistic generalized-active-space coupled cluster method: implementation and application to BiH.

    PubMed

    Sørensen, Lasse K; Olsen, Jeppe; Fleig, Timo

    2011-06-01

    A string-based coupled-cluster method of general excitation rank and with optimal scaling which accounts for special relativity within the four-component framework is presented. The method opens the way for the treatment of multi-reference problems through an active-space inspired single-reference based state-selective expansion of the model space. The evaluation of the coupled-cluster vector function is implemented by considering contractions of elementary second-quantized operators without setting up the amplitude equations explicitly. The capabilities of the new method are demonstrated in application to the electronic ground state of the bismuth monohydride molecule. In these calculations simulated multi-reference expansions with both doubles and triples excitations into the external space as well as the regular coupled-cluster hierarchy up to full quadruples excitations are compared. The importance of atomic outer core-correlation for obtaining accurate results is shown. Comparison to the non-relativistic framework is performed throughout to illustrate the additional work of the transition to the four-component relativistic framework both in implementation and application. Furthermore, an evaluation of the highest order scaling for general-order expansions is presented. PMID:21663339

  17. Two- and four-component relativistic generalized-active-space coupled cluster method: implementation and application to BiH.

    PubMed

    Sørensen, Lasse K; Olsen, Jeppe; Fleig, Timo

    2011-06-01

    A string-based coupled-cluster method of general excitation rank and with optimal scaling which accounts for special relativity within the four-component framework is presented. The method opens the way for the treatment of multi-reference problems through an active-space inspired single-reference based state-selective expansion of the model space. The evaluation of the coupled-cluster vector function is implemented by considering contractions of elementary second-quantized operators without setting up the amplitude equations explicitly. The capabilities of the new method are demonstrated in application to the electronic ground state of the bismuth monohydride molecule. In these calculations simulated multi-reference expansions with both doubles and triples excitations into the external space as well as the regular coupled-cluster hierarchy up to full quadruples excitations are compared. The importance of atomic outer core-correlation for obtaining accurate results is shown. Comparison to the non-relativistic framework is performed throughout to illustrate the additional work of the transition to the four-component relativistic framework both in implementation and application. Furthermore, an evaluation of the highest order scaling for general-order expansions is presented.

  18. A minimal nitrogen fixation gene cluster from Paenibacillus sp. WLY78 enables expression of active nitrogenase in Escherichia coli.

    PubMed

    Wang, Liying; Zhang, Lihong; Liu, Zhanzhi; Liu, Zhangzhi; Zhao, Dehua; Liu, Xiaomeng; Zhang, Bo; Xie, Jianbo; Hong, Yuanyuan; Li, Pengfei; Chen, Sanfeng; Dixon, Ray; Li, Jilun

    2013-01-01

    Most biological nitrogen fixation is catalyzed by molybdenum-dependent nitrogenase, an enzyme complex comprising two component proteins that contains three different metalloclusters. Diazotrophs contain a common core of nitrogen fixation nif genes that encode the structural subunits of the enzyme and components required to synthesize the metalloclusters. However, the complement of nif genes required to enable diazotrophic growth varies significantly amongst nitrogen fixing bacteria and archaea. In this study, we identified a minimal nif gene cluster consisting of nine nif genes in the genome of Paenibacillus sp. WLY78, a gram-positive, facultative anaerobe isolated from the rhizosphere of bamboo. We demonstrate that the nif genes in this organism are organized as an operon comprising nifB, nifH, nifD, nifK, nifE, nifN, nifX, hesA and nifV and that the nif cluster is under the control of a σ(70) (σ(A))-dependent promoter located upstream of nifB. To investigate genetic requirements for diazotrophy, we transferred the Paenibacillus nif cluster to Escherichia coli. The minimal nif gene cluster enables synthesis of catalytically active nitrogenase in this host, when expressed either from the native nifB promoter or from the T7 promoter. Deletion analysis indicates that in addition to the core nif genes, hesA plays an important role in nitrogen fixation and is responsive to the availability of molybdenum. Whereas nif transcription in Paenibacillus is regulated in response to nitrogen availability and by the external oxygen concentration, transcription from the nifB promoter is constitutive in E. coli, indicating that negative regulation of nif transcription is bypassed in the heterologous host. This study demonstrates the potential for engineering nitrogen fixation in a non-nitrogen fixing organism with a minimum set of nine nif genes.

  19. A Minimal Nitrogen Fixation Gene Cluster from Paenibacillus sp. WLY78 Enables Expression of Active Nitrogenase in Escherichia coli

    PubMed Central

    Zhao, Dehua; Liu, Xiaomeng; Zhang, Bo; Xie, Jianbo; Hong, Yuanyuan; Li, Pengfei; Chen, Sanfeng; Dixon, Ray; Li, Jilun

    2013-01-01

    Most biological nitrogen fixation is catalyzed by molybdenum-dependent nitrogenase, an enzyme complex comprising two component proteins that contains three different metalloclusters. Diazotrophs contain a common core of nitrogen fixation nif genes that encode the structural subunits of the enzyme and components required to synthesize the metalloclusters. However, the complement of nif genes required to enable diazotrophic growth varies significantly amongst nitrogen fixing bacteria and archaea. In this study, we identified a minimal nif gene cluster consisting of nine nif genes in the genome of Paenibacillus sp. WLY78, a gram-positive, facultative anaerobe isolated from the rhizosphere of bamboo. We demonstrate that the nif genes in this organism are organized as an operon comprising nifB, nifH, nifD, nifK, nifE, nifN, nifX, hesA and nifV and that the nif cluster is under the control of a σ70 (σA)-dependent promoter located upstream of nifB. To investigate genetic requirements for diazotrophy, we transferred the Paenibacillus nif cluster to Escherichia coli. The minimal nif gene cluster enables synthesis of catalytically active nitrogenase in this host, when expressed either from the native nifB promoter or from the T7 promoter. Deletion analysis indicates that in addition to the core nif genes, hesA plays an important role in nitrogen fixation and is responsive to the availability of molybdenum. Whereas nif transcription in Paenibacillus is regulated in response to nitrogen availability and by the external oxygen concentration, transcription from the nifB promoter is constitutive in E. coli, indicating that negative regulation of nif transcription is bypassed in the heterologous host. This study demonstrates the potential for engineering nitrogen fixation in a non-nitrogen fixing organism with a minimum set of nine nif genes. PMID:24146630

  20. A Cluster Of Activities On Coma From The Hubble Space Telescope, StarDate, And McDonald Observatory

    NASA Astrophysics Data System (ADS)

    Hemenway, Mary Kay; Jogee, S.; Fricke, K.; Preston, S.

    2011-01-01

    With a goal of providing a vast audience of students, teachers, the general public, and Spanish-speakers with activities to learn about research on the Coma cluster of galaxies based on the HST ACS Treasury survey of Coma, McDonald Observatory used a many-faceted approach. Since this research offered an unprecedented legacy dataset, part of the challenge was to convey the importance of this project to a diverse audience. The methodology was to create different products for different (overlapping) audiences. Five radio programs were produced in English and Spanish for distribution on over 500 radio stations in the US and Mexico with a listening audience of over 2 million; in addition to the radio listeners, there were over 13,000 downloads of the English scripts and almost 6000 of the Spanish. Images were prepared for use in the StarDate Online Astronomy Picture of the Week, for ViewSpace (used in museums), and for the StarDate/Universo Teacher Guide. A high-school level activity on the Coma Cluster was prepared and distributed both on-line and in an upgraded printed version of the StarDate/Universo Teacher Guide. This guide has been distributed to over 1700 teachers nationally. A YouTube video about careers and research in astronomy using the Coma cluster as an example was produced. Just as the activities were varied, so were the evaluation methods. This material is based upon work supported by the National Aeronautics and Space Administration under Grant/Contract/Agreement No. HST-EO-10861.35-A issued through the Space Telescope Science Institute, which is operated by the Association of Universities for Research in Astronomy, Inc., under NASA contract NAS5-26555.

  1. Physical activity and health-related quality of life during pregnancy: a secondary analysis of a cluster-randomised trial.

    PubMed

    Kolu, Päivi; Raitanen, Jani; Luoto, Riitta

    2014-11-01

    The aim of the study was to evaluate the role of physical activity before and during pregnancy on health-related quality of life (HRQoL). Data from the cluster-randomised gestational diabetes mellitus primary prevention trial conducted in maternity clinics were utilised in a secondary analysis. The cases considered were pregnant women who reported engaging in at least 150 min of moderate-intensity leisure-time physical activity per week (active women) (N = 80), and the controls were women below these recommendations (less active) (N = 258). All participants had at least one risk factor for gestational diabetes mellitus. Their HRQoL was evaluated via the validated generic instrument 15D, with HRQoL at the end of pregnancy examined in relation to changes in physical activity during pregnancy. Logistic regression models addressed age, parity, education, and pre-pregnancy body mass index. At the end of pregnancy, the expected HRQoL was higher (tobit regression coefficient 0.022, 95 % CI 0.003-0.042) among active women than less active women. Active women also had greater mobility (OR 1.98, 95 % CI 1.04-3.78), ability to handle their usual activities (OR 2.22, 95 % CI 1.29-3.81), and vitality (OR 2.08, 95 % CI 1.22-3.54) than did less active women. Active women reported higher-quality sleep (OR 2.11, 95 % CI 1.03-4.30) throughout pregnancy as compared to less active women. Meeting of the physical activity guidelines before pregnancy was associated with better overall HRQoL and components thereof related to physical activity.

  2. Acoustic Cluster Therapy: In Vitro and Ex Vivo Measurement of Activated Bubble Size Distribution and Temporal Dynamics.

    PubMed

    Healey, Andrew John; Sontum, Per Christian; Kvåle, Svein; Eriksen, Morten; Bendiksen, Ragnar; Tornes, Audun; Østensen, Jonny

    2016-05-01

    Acoustic cluster technology (ACT) is a two-component, microparticle formulation platform being developed for ultrasound-mediated drug delivery. Sonazoid microbubbles, which have a negative surface charge, are mixed with micron-sized perfluoromethylcyclopentane droplets stabilized with a positively charged surface membrane to form microbubble/microdroplet clusters. On exposure to ultrasound, the oil undergoes a phase change to the gaseous state, generating 20- to 40-μm ACT bubbles. An acoustic transmission technique is used to measure absorption and velocity dispersion of the ACT bubbles. An inversion technique computes bubble size population with temporal resolution of seconds. Bubble populations are measured both in vitro and in vivo after activation within the cardiac chambers of a dog model, with catheter-based flow through an extracorporeal measurement flow chamber. Volume-weighted mean diameter in arterial blood after activation in the left ventricle was 22 μm, with no bubbles >44 μm in diameter. After intravenous administration, 24.4% of the oil is activated in the cardiac chambers. PMID:26831341

  3. IUE observations of rapidly rotating low-mass stars in young clusters - The relation between chromospheric activity and rotation

    NASA Technical Reports Server (NTRS)

    Simon, Theodore

    1990-01-01

    If the rapid spindown of low-mass stars immediately following their arrival on the ZAMS results from magnetic braking by coronal winds, an equally sharp decline in their chromospheric emission may be expected. To search for evidence of this effect, the IUE spacecraft was used to observe the chromospheric Mg II emission lines of G-M dwarfs in the nearby IC 2391, Alpha Persei, Pleiades, and Hyades clusters. Similar observations were made of a group of X-ray-selected 'naked' T Tauri stars in Taurus-Auriga. The existence of a decline in activity cannot be confirmed from the resulting data. However, the strength of the chromospheric emission in the Mg II lines of the cluster stars is found to be correlated with rotation rate, being strongest for the stars with the shortest rotation periods and weakest for those with the longest periods. This provides indirect support for such an evolutionary change in activity. Chromospheric activity may thus be only an implicit function of age.

  4. Acoustic Cluster Therapy: In Vitro and Ex Vivo Measurement of Activated Bubble Size Distribution and Temporal Dynamics.

    PubMed

    Healey, Andrew John; Sontum, Per Christian; Kvåle, Svein; Eriksen, Morten; Bendiksen, Ragnar; Tornes, Audun; Østensen, Jonny

    2016-05-01

    Acoustic cluster technology (ACT) is a two-component, microparticle formulation platform being developed for ultrasound-mediated drug delivery. Sonazoid microbubbles, which have a negative surface charge, are mixed with micron-sized perfluoromethylcyclopentane droplets stabilized with a positively charged surface membrane to form microbubble/microdroplet clusters. On exposure to ultrasound, the oil undergoes a phase change to the gaseous state, generating 20- to 40-μm ACT bubbles. An acoustic transmission technique is used to measure absorption and velocity dispersion of the ACT bubbles. An inversion technique computes bubble size population with temporal resolution of seconds. Bubble populations are measured both in vitro and in vivo after activation within the cardiac chambers of a dog model, with catheter-based flow through an extracorporeal measurement flow chamber. Volume-weighted mean diameter in arterial blood after activation in the left ventricle was 22 μm, with no bubbles >44 μm in diameter. After intravenous administration, 24.4% of the oil is activated in the cardiac chambers.

  5. Timing and duration of hydrothermal activity at the Los Bronces porphyry cluster: an update

    NASA Astrophysics Data System (ADS)

    Deckart, K.; Silva, W.; Spröhnle, C.; Vela, I.

    2014-06-01

    New geochronological data from the Los Bronces cluster of the Río Blanco-Los Bronces mega-porphyry Cu-Mo district establish a wide range of magmatism, hydrothermal alteration, and mineralization ages, both in terms of areal extent and time. The northern El Plomo and southernmost Los Piches exploration areas contain the oldest barren porphyritic intrusions with U-Pb ages of 10.8 ± 0.1 Ma and 13.4 ± 0.1 Ma, respectively. A hypabyssal barren intrusion adjacent northwesterly to the main pit area yields a slightly younger age of 10.2 ± 0.3 Ma (San Manuel sector, U-Pb), whereas in the Los Bronces (LB) open-pit area, the present day mineral extraction zone, porphyries range from 8.49 to 6.02 Ma (U-Pb). Hydrothermal biotite and sericite ages are up to 0.5 Ma younger but consistent with the cooling of the corresponding intrusion events of each area. Two quartz-molybdenite B-type veins from the LB open pit have Re-Os molybdenite ages of 5.65 ± 0.03 Ma and 5.35 ± 0.03 Ma consistent with published data for the contiguous Río Blanco cluster. The San Manuel exploration area within the Los Bronces cluster, located about 1.5-2 km southeast of the open-pit extraction zone, shows both the oldest hydrothermal biotite (7.70 ± 0.07 Ma; 40Ar/39Ar) and breccia cement molybdenite ages (8.36 ± 0.06 Ma; Re-Os) registered in the entire Río Blanco-Los Bronces district. These are also older than those reported from the El Teniente porphyry Cu(-Mo) deposit, suggesting that mineralization in the late Miocene to early Pliocene porphyry belt of Central Chile commenced 2 Ma before the previously accepted age of 6.3 Ma.

  6. Active Tectonics of Southern California Revealed by Cluster Analysis of GPS Velocities

    NASA Astrophysics Data System (ADS)

    Thatcher, W. R.; Savage, J. C.; Simpson, R. W.

    2013-12-01

    We use cluster analysis of the USGS National Seismic Hazard Map GPS velocity field for southern California with standard deviations < 1 mm/yr to determine velocity gradients that locate the most important faults, the elastic strain associated with them, and regions of possible block-like behavior. Seven to ten well resolved clusters are statistically significant and spatially distinct with small overlap. In map view (see figure), the 7 clusters solution shows bands of relatively constant velocity sub-parallel to the San Andreas (SAF) and San Jacinto (SJF) faults and the major faults of the eastern Mojave shear zone (EMSZ). These bands are due both to elastic strain accumulation on the SAF and relative motion across lower slip rate faults in the EMSZ and Los Angeles and Ventura basins. At the largest scale, the 7-cluster map shows two main trends. The blue dots define the SJ and SA faults from northwest of the Salton Sea (SS) to Parkfield (P); the grey/magenta boundary suggests that the defined Eastern California Shear Zone could be extended farther south to the Salton Sea. The short ~80-km-long San Gorgonio Pass-San Bernardino Mountains (SGP) segment of the SAF has a much lower slip rate, ~7 mm/yr of right-lateral oblique convergence. As generally shown by previous GPS studies, right-lateral strike-slip movement rates vary considerably along the SAF. In the Imperial Valley (IV) the rate is ~40 mm/yr; east of the Salton Sea it drops to ~20 mm/yr, with 10-15 mm/yr having been shunted westward to the SJF; north of the Salton Sea ~10-15 mm/yr of strike-slip is transferred to the faults of the eastern Mojave; therefore the east-trending faults of San Gorgonio Pass (SGP) take up only ~5 mm/yr of strike slip and ~equal amounts of north-south shortening; on the Mojave (M) segment of the SAF the slip rate increases to ~15-20 mm/yr in the vicinity of Cajon Pass (CP) because of transfer of SJF slip back onto the San Andreas; northwest of Tejon Pass the rate increases again to

  7. The cytosolic Fe-S cluster assembly component MET18 is required for the full enzymatic activity of ROS1 in active DNA demethylation

    PubMed Central

    Wang, Xiaokang; Li, Qi; Yuan, Wei; Cao, Zhendong; Qi, Bei; Kumar, Suresh; Li, Yan; Qian, Weiqiang

    2016-01-01

    DNA methylation patterns in plants are dynamically regulated by DNA methylation and active DNA demethylation in response to both environmental changes and development of plant. Beginning with the removal of methylated cytosine by ROS1/DME family of 5-methylcytosine DNA glycosylases, active DNA demethylation in plants occurs through base excision repair. So far, many components involved in active DNA demethylation remain undiscovered. Through a forward genetic screening of Arabidopsis mutants showing DNA hypermethylation at the EPF2 promoter region, we identified the conserved iron-sulfur cluster assembly protein MET18. MET18 dysfunction caused DNA hypermethylation at more than 1000 loci as well as the silencing of reporter genes and some endogenous genes. MET18 can directly interact with ROS1 in vitro and in vivo. ROS1 activity was reduced in the met18 mutant plants and point mutation in the conserved Fe-S cluster binding motif of ROS1 disrupted its biological function. Interestingly, a large number of DNA hypomethylated loci, especially in the CHH context, were identified from the met18 mutants and most of the hypo-DMRs were from TE regions. Our results suggest that MET18 can regulate both active DNA demethylation and DNA methylation pathways in Arabidopsis. PMID:27193999

  8. The mechanism of emerging catalytic activity of gold nano-clusters on rutile TiO{sub 2}(110) in CO oxidation reaction

    SciTech Connect

    Mitsuhara, K.; Tagami, M.; Matsuda, T.; Visikovskiy, A.; Kido, Y.; Takizawa, M.

    2012-03-28

    This paper reveals the fact that the O adatoms (O{sub ad}) adsorbed on the 5-fold Ti rows of rutile TiO{sub 2}(110) react with CO to form CO{sub 2} at room temperature and the oxidation reaction is pronouncedly enhanced by Au nano-clusters deposited on the above O-rich TiO{sub 2}(110) surfaces. The optimum activity is obtained for 2D clusters with a lateral size of {approx}1.5 nm and two-atomic layer height corresponding to {approx}50 Au atoms/cluster. This strong activity emerging is attributed to an electronic charge transfer from Au clusters to O-rich TiO{sub 2}(110) supports observed clearly by work function measurement, which results in an interface dipole. The interface dipoles lower the potential barrier for dissociative O{sub 2} adsorption on the surface and also enhance the reaction of CO with the O{sub ad} atoms to form CO{sub 2} owing to the electric field of the interface dipoles, which generate an attractive force upon polar CO molecules and thus prolong the duration time on the Au nano-clusters. This electric field is screened by the valence electrons of Au clusters except near the perimeter interfaces, thereby the activity is diminished for three-dimensional clusters with a larger size.

  9. Efficient active waveguiding properties of Mo6 nano-cluster-doped polymer nanotubes

    NASA Astrophysics Data System (ADS)

    Bigeon, J.; Huby, N.; Amela-Cortes, M.; Molard, Y.; Garreau, A.; Cordier, S.; Bêche, B.; Duvail, J.-L.

    2016-06-01

    We investigate 1D nanostructures based on a Mo6@SU8 hybrid nanocomposite in which photoluminescent Mo6 clusters are embedded in the photosensitive SU8 resist. Tens of micrometers long Mo6@SU8-based tubular nanostructures were fabricated by the wetting template method, enabling the control of the inner and outer diameter to about 190 nm and 240 nm respectively, as supported by structural and optical characterizations. The image plane optical study of these nanotubes under optical pumping highlights the efficient waveguiding phenomenon of the red luminescence emitted by the clusters. Moreover, the wave vector distribution in the Fourier plane determined by leakage radiation microscopy gives additional features of the emission and waveguiding. First, the anisotropic red luminescence of the whole system can be attributed to the guided mode along the nanotube. Then, a low-loss propagation behavior is evidenced in the Mo6@SU8-based nanotubes. This result contrasts with the weaker waveguiding signature in the case of UV210-based nanotubes embedding PFO (poly(9,9-di-n-octylfluorenyl-2,7-diyl)). It is attributed to the strong reabsorption phenomenon, owing to overlapping between absorption and emission bands in the semi-conducting conjugated polymer PFO. These results make this Mo6@SU8 original class of nanocomposite a promising candidate as nanosources for submicronic photonic integration.

  10. Clustering Finnish Gambler Profiles Based on the Money and Time Consumed in Gambling Activities.

    PubMed

    Heiskanen, Maria; Toikka, Arho

    2016-06-01

    Gambling involves consumption of gamblers' money and time. Gamblers are a heterogeneous group, and in addition to grouping gamblers based on personality factors, it is also important to find different gambler profiles with respect to their gambling behavior. Using the nationally representative survey 'Finnish Gambling 2011' (N = 4484), this article studies the subtypes of Finnish gamblers based on the frequency of gambling and the amounts of money and time used in different gambling forms. Cluster analysis reveals six profiles of gamblers, from infrequent gamblers to omnivorous gamblers. In the further analysis of the clusters, it was found that the highest problem gambling prevalence was in the groups of sport betting + electronic gaming machine gamblers and omnivorous gamblers, which were also both dominated by men. Certain gambling consumption patterns and risk factors for problem gambling are related to both socio-demographic backgrounds of the gamblers as well as the structural and situational characteristics of the games. The results have implications for the prevention of problem gambling, as some consumption patterns may be connected with the probability of developing gambling problems.

  11. Symbolic clustering

    SciTech Connect

    Reinke, R.E.

    1991-01-01

    Clustering is the problem of finding a good organization for data. Because there are many kinds of clustering problems, and because there are many possible clusterings for any data set, clustering programs use knowledge and assumptions about individual problems to make clustering tractable. Cluster-analysis techniques allow knowledge to be expressed in the choice of a pairwise distance measure and in the choice of clustering algorithm. Conceptual clustering adds knowledge and preferences about cluster descriptions. In this study the author describes symbolic clustering, which adds representation choice to the set of ways a data analyst can use problem-specific knowledge. He develops an informal model for symbolic clustering, and uses it to suggest where and how knowledge can be expressed in clustering. A language for creating symbolic clusters, based on the model, was developed and tested on three real clustering problems. The study concludes with a discussion of the implications of the model and the results for clustering in general.

  12. Rhenium Complexes and Clusters Supported on c-Al2O3: Effects of Rhenium Oxidation State and Rhenium Cluster Size on Catalytic Activity for n-butane Hydrogenolysis

    SciTech Connect

    Lobo Lapidus, R.; Gates, B

    2009-01-01

    Supported metals prepared from H{sub 3}Re{sub 3}(CO){sub 12} on {gamma}-Al{sub 2}O{sub 3} were treated under conditions that led to various rhenium structures on the support and were tested as catalysts for n-butane conversion in the presence of H{sub 2} in a flow reactor at 533 K and 1 atm. After use, two samples were characterized by X-ray absorption edge positions of approximately 5.6 eV (relative to rhenium metal), indicating that the rhenium was cationic and essentially in the same average oxidation state in each. But the Re-Re coordination numbers found by extended X-ray absorption fine structure spectroscopy (2.2 and 5.1) show that the clusters in the two samples were significantly different in average nuclearity despite their indistinguishable rhenium oxidation states. Spectra of a third sample after catalysis indicate approximately Re{sub 3} clusters, on average, and an edge position of 4.5 eV. Thus, two samples contained clusters approximated as Re{sub 3} (on the basis of the Re-Re coordination number), on average, with different average rhenium oxidation states. The data allow resolution of the effects of rhenium oxidation state and cluster size, both of which affect the catalytic activity; larger clusters and a greater degree of reduction lead to increased activity.

  13. Using Targeted Active-Learning Exercises and Diagnostic Question Clusters to Improve Students' Understanding of Carbon Cycling in Ecosystems

    PubMed Central

    Maskiewicz, April Cordero; Griscom, Heather Peckham; Welch, Nicole Turrill

    2012-01-01

    In this study, we used targeted active-learning activities to help students improve their ways of reasoning about carbon flow in ecosystems. The results of a validated ecology conceptual inventory (diagnostic question clusters [DQCs]) provided us with information about students' understanding of and reasoning about transformation of inorganic and organic carbon-containing compounds in biological systems. These results helped us identify specific active-learning exercises that would be responsive to students' existing knowledge. The effects of the active-learning interventions were then examined through analysis of students' pre- and postinstruction responses on the DQCs. The biology and non–biology majors participating in this study attended a range of institutions and the instructors varied in their use of active learning; one lecture-only comparison class was included. Changes in pre- to postinstruction scores on the DQCs showed that an instructor's teaching method had a highly significant effect on student reasoning following course instruction, especially for questions pertaining to cellular-level, carbon-transforming processes. We conclude that using targeted in-class activities had a beneficial effect on student learning regardless of major or class size, and argue that using diagnostic questions to identify effective learning activities is a valuable strategy for promoting learning, as gains from lecture-only classes were minimal. PMID:22383618

  14. Highly active Ag clusters stabilized on TiO2 nanocrystals for catalytic reduction of p-nitrophenol

    NASA Astrophysics Data System (ADS)

    Wang, Xin; Zhao, Zhe; Ou, Dingrong; Tu, Baofeng; Cui, Daan; Wei, Xuming; Cheng, Mojie

    2016-11-01

    Ag/TiO2 nanocomposites comprising of Ag clusters on TiO2 nanocrystal surfaces are of great significance in catalysts and advanced functional materials. Herein a novel method to synthesize Ag/TiO2 nanocomposites with Ag clusters under 2 nm on TiO2 nanocrystal surfaces have been developed. The success of this method relies on a silver mirror reaction in toluene, which refers to the reduction of silver-dodecylamine complexes by acetaldehyde in the presence of mono-dispersed TiO2 nanocrystals. The prepared Ag/TiO2 nanocomposites have been characterized by FT-IR spectra, UV-vis absorption spectra, X-ray diffraction (XRD) analysis, ultra high resolution scanning electron microscope (Ultra-HRSEM), high resolution transmission electron microscope (HRTEM) and X-ray photoelectron spectra (XPS). Catalytic activity of Ag/TiO2 nanocomposites is evaluated for the reduction of p-nitrophenol (4-NP) into p-aminophenol (4-AP) by NaBH4. Results demonstrate that Ag/TiO2 nanocomposites have shown an outstanding catalytic activity as well as a good stability in successive reduction of 4-NP. Noticeably, TOF of Ag/TiO2-0.75 nanocomposites obtained in this work is the highest among Ag based catalysts previously reported.

  15. Active mammalian replication origins are associated with a high-density cluster of mCpG dinucleotides.

    PubMed Central

    Rein, T; Zorbas, H; DePamphilis, M L

    1997-01-01

    ori-beta is a well-characterized origin of bidirectional replication (OBR) located approximately 17 kb downstream of the dihydrofolate reductase gene in hamster cell chromosomes. The approximately 2-kb region of ori-beta that exhibits greatest replication initiation activity also contains 12 potential methylation sites in the form of CpG dinucleotides. To ascertain whether DNA methylation might play a role at mammalian replication origins, the methylation status of these sites was examined with bisulfite to chemically distinguish cytosine (C) from 5-methylcytosine (mC). All of the CpGs were methylated, and nine of them were located within 356 bp flanking the minimal OBR, creating a high-density cluster of mCpGs that was approximately 10 times greater than average for human DNA. However, the previously reported densely methylated island in which all cytosines were methylated regardless of their dinucleotide composition was not detected and appeared to be an experimental artifact. A second OBR, located at the 5' end of the RPS14 gene, exhibited a strikingly similar methylation pattern, and the organization of CpG dinucleotides at other mammalian origins revealed the potential for high-density CpG methylation. Moreover, analysis of bromodeoxyuridine-labeled nascent DNA confirmed that active replication origins were methylated. These results suggest that a high-density cluster of mCpG dinucleotides may play a role in either the establishment or the regulation of mammalian replication origins. PMID:8972222

  16. SufD and SufC ATPase activity are required for iron acquisition during in vivo Fe-S cluster formation on SufB

    PubMed Central

    Saini, Avneesh; Mapolelo, Daphne T.; Chahal, Harsimranjit K.; Johnson, Michael K.; Outten, F. Wayne

    2010-01-01

    In vivo biogenesis of Fe-S cluster cofactors requires complex biosynthetic machinery to limit release of iron and sulfide, to protect the Fe-S cluster from oxidation, and to target the Fe-S cluster to the correct apo-enzyme. The SufABCDSE pathway for Fe-S cluster assembly in E. coli accomplishes these tasks under iron starvation and oxidative stress conditions that disrupt Fe-S cluster metabolism. Although SufB, SufC, and SufD are all required for in vivo Suf function, their exact roles are unclear. Here we show that SufB, SufC, and SufD, co-expressed with the SufS-SufE sulfur transfer pair, purify as two distinct complexes (SufBC2D and SufB2C2) that contain Fe-S clusters and FADH2. These studies also show that SufC and SufD are required for in vivo Fe-S cluster formation on SufB. Furthermore, while SufD is dispensable for in vivo sulfur transfer, it is absolutely required for in vivo iron acquisition. Finally, we demonstrate for the first time that the ATPase activity of SufC is necessary for in vivo iron acquisition during Fe-S cluster assembly. PMID:20857974

  17. Efficient anchorage of Pt clusters on N-doped carbon nanotubes and their catalytic activity

    NASA Astrophysics Data System (ADS)

    Lepró, Xavier; Terrés, Eduardo; Vega-Cantú, Yadira; Rodríguez-Macías, Fernando J.; Muramatsu, Hiroyuki; Kim, Yoon Ahm; Hayahsi, Takuya; Endo, Morinobu; Torres R., Miguel; Terrones, Mauricio

    2008-09-01

    We report an efficient method for anchoring Pt clusters (e.g., 6 nm in size) on the surfaces of N-doped multi-walled carbon nanotubes (MWNTs-CN x) using a relatively simple method consisting of a hydrothermal treatment of Na 2[PtCl 6] · 6H 2O and N-doped nanotubes dispersed in acetic acid. The catalytic properties of this material were evaluated finding that the conversion of cinnamaldehyde using Pt-coated MWNTs-CN x could increase up to 6 times with respect to that obtained for uncoated MWNTs-CN x and pure carbon CNTs. Therefore, we envisage this material could be either used as an efficient catalyst or as a sensor.

  18. The Devon Active Villages Evaluation (DAVE) trial of a community-level physical activity intervention in rural south-west England: a stepped wedge cluster randomised controlled trial

    PubMed Central

    2014-01-01

    Background The majority of adults are not meeting the guidelines for physical activity despite activity being linked with numerous improvements to long-term health. In light of this, researchers have called for more community-level interventions. The main objective of the present study was to evaluate whether a community-level physical activity intervention increased the activity levels of rural communities. Methods 128 rural villages (clusters) were randomised to receive the intervention in one of four time periods between April 2011 and December 2012. The Devon Active Villages intervention provided villages with 12 weeks of physical activity opportunities for all age groups, including at least three different types of activities per village. Each village received an individually tailored intervention, incorporating a local needs-led approach. Support was provided for a further 12 months following the intervention. The evaluation study used a stepped wedge cluster randomised controlled trial design. All 128 villages were measured at each of five data collection periods using a postal survey. The primary outcome of interest was the proportion of adults reporting sufficient physical activity to meet internationally recognised guidelines. Minutes spent in moderate-and-vigorous activity per week was analysed as a secondary outcome. To compare between intervention and control modes, random effects linear regression and marginal logistic regression models were implemented for continuous and binary outcomes respectively. Results 10,412 adults (4693 intervention, 5719 control) completed the postal survey (response rate 32.2%). The intervention did not increase the odds of adults meeting the physical activity guideline (adjusted OR 1.02, 95% CI: 0.88 to 1.17; P = 0.80), although there was weak evidence of an increase in minutes of moderate-and-vigorous-intensity activity per week (adjusted mean difference = 171, 95% CI: -16 to 358; P = 0.07). The

  19. Improvements on GPS Location Cluster Analysis for the Prediction of Large Carnivore Feeding Activities: Ground-Truth Detection Probability and Inclusion of Activity Sensor Measures.

    PubMed

    Blecha, Kevin A; Alldredge, Mat W

    2015-01-01

    Animal space use studies using GPS collar technology are increasingly incorporating behavior based analysis of spatio-temporal data in order to expand inferences of resource use. GPS location cluster analysis is one such technique applied to large carnivores to identify the timing and location of feeding events. For logistical and financial reasons, researchers often implement predictive models for identifying these events. We present two separate improvements for predictive models that future practitioners can implement. Thus far, feeding prediction models have incorporated a small range of covariates, usually limited to spatio-temporal characteristics of the GPS data. Using GPS collared cougar (Puma concolor) we include activity sensor data as an additional covariate to increase prediction performance of feeding presence/absence. Integral to the predictive modeling of feeding events is a ground-truthing component, in which GPS location clusters are visited by human observers to confirm the presence or absence of feeding remains. Failing to account for sources of ground-truthing false-absences can bias the number of predicted feeding events to be low. Thus we account for some ground-truthing error sources directly in the model with covariates and when applying model predictions. Accounting for these errors resulted in a 10% increase in the number of clusters predicted to be feeding events. Using a double-observer design, we show that the ground-truthing false-absence rate is relatively low (4%) using a search delay of 2-60 days. Overall, we provide two separate improvements to the GPS cluster analysis techniques that can be expanded upon and implemented in future studies interested in identifying feeding behaviors of large carnivores.

  20. Improvements on GPS Location Cluster Analysis for the Prediction of Large Carnivore Feeding Activities: Ground-Truth Detection Probability and Inclusion of Activity Sensor Measures

    PubMed Central

    Blecha, Kevin A.; Alldredge, Mat W.

    2015-01-01

    Animal space use studies using GPS collar technology are increasingly incorporating behavior based analysis of spatio-temporal data in order to expand inferences of resource use. GPS location cluster analysis is one such technique applied to large carnivores to identify the timing and location of feeding events. For logistical and financial reasons, researchers often implement predictive models for identifying these events. We present two separate improvements for predictive models that future practitioners can implement. Thus far, feeding prediction models have incorporated a small range of covariates, usually limited to spatio-temporal characteristics of the GPS data. Using GPS collared cougar (Puma concolor) we include activity sensor data as an additional covariate to increase prediction performance of feeding presence/absence. Integral to the predictive modeling of feeding events is a ground-truthing component, in which GPS location clusters are visited by human observers to confirm the presence or absence of feeding remains. Failing to account for sources of ground-truthing false-absences can bias the number of predicted feeding events to be low. Thus we account for some ground-truthing error sources directly in the model with covariates and when applying model predictions. Accounting for these errors resulted in a 10% increase in the number of clusters predicted to be feeding events. Using a double-observer design, we show that the ground-truthing false-absence rate is relatively low (4%) using a search delay of 2–60 days. Overall, we provide two separate improvements to the GPS cluster analysis techniques that can be expanded upon and implemented in future studies interested in identifying feeding behaviors of large carnivores. PMID:26398546

  1. Transferability study of CHO cell clustering assays for monitoring of pertussis toxin activity in acellular pertussis vaccines.

    PubMed

    Isbrucker, R; Daas, A; Wagner, L; Costanzo, A

    2016-01-01

    Current regulations for acellular pertussis (aP) vaccines require that they are tested for the presence of residual or reversion-derived pertussis toxin (PTx) activity using the mouse histamine sensitisation test (HIST). Although a CHO cell clustering assay can be used by manufacturers to verify if sufficient inactivation of the substance has occurred in-process, this assay cannot be used at present for the final product due to the presence of aluminium adjuvants which interfere with mammalian cell cultures. Recently, 2 modified CHO cell clustering assays which accommodate for the adjuvant effects have been proposed as alternatives to the HIST. These modified assays eliminate the adjuvant-induced cytotoxicity either through dilution of the vaccine (called the Direct Method) or by introducing a porous barrier between the adjuvant and the cells (the Indirect Method). Transferability and suitability of these methods for testing of products present on the European market were investigated during a collaborative study organised by the European Directorate for the Quality of Medicines & HealthCare (EDQM). Thirteen laboratories participated in this study which included 4 aP-containing vaccines spiked by addition of PTx. This study also assessed the transferability of a standardised CHO cell clustering assay protocol for use with non-adjuvanted PTx preparations. Results showed that the majority of laboratories were able to detect the PTx spike in all 4 vaccines at concentrations of 4 IU/mL or lower using the Indirect Method. This sensitivity is in the range of the theoretical sensitivity of the HIST. The Direct Method however did not show the expected results and would need additional development work. PMID:27506252

  2. Transferability study of CHO cell clustering assays for monitoring of pertussis toxin activity in acellular pertussis vaccines.

    PubMed

    Isbrucker, R; Daas, A; Wagner, L; Costanzo, A

    2016-01-01

    Current regulations for acellular pertussis (aP) vaccines require that they are tested for the presence of residual or reversion-derived pertussis toxin (PTx) activity using the mouse histamine sensitisation test (HIST). Although a CHO cell clustering assay can be used by manufacturers to verify if sufficient inactivation of the substance has occurred in-process, this assay cannot be used at present for the final product due to the presence of aluminium adjuvants which interfere with mammalian cell cultures. Recently, 2 modified CHO cell clustering assays which accommodate for the adjuvant effects have been proposed as alternatives to the HIST. These modified assays eliminate the adjuvant-induced cytotoxicity either through dilution of the vaccine (called the Direct Method) or by introducing a porous barrier between the adjuvant and the cells (the Indirect Method). Transferability and suitability of these methods for testing of products present on the European market were investigated during a collaborative study organised by the European Directorate for the Quality of Medicines & HealthCare (EDQM). Thirteen laboratories participated in this study which included 4 aP-containing vaccines spiked by addition of PTx. This study also assessed the transferability of a standardised CHO cell clustering assay protocol for use with non-adjuvanted PTx preparations. Results showed that the majority of laboratories were able to detect the PTx spike in all 4 vaccines at concentrations of 4 IU/mL or lower using the Indirect Method. This sensitivity is in the range of the theoretical sensitivity of the HIST. The Direct Method however did not show the expected results and would need additional development work.

  3. Methane activation by cobalt cluster cations, Con+ (n=2-16): Reaction mechanisms and thermochemistry of cluster-CHx (x=0-3) complexes

    NASA Astrophysics Data System (ADS)

    Citir, Murat; Liu, Fuyi; Armentrout, P. B.

    2009-02-01

    The kinetic energy dependences of the reactions of Con+ (n =2-16) with CD4 are studied in a guided ion beam tandem mass spectrometer over the energy range of 0-10 eV. The main products are hydride formation, ConD+, dehydrogenation to form ConCD2+, and double dehydrogenation yielding ConC+. These primary products decompose to form secondary and higher order products, ConCD+, Con-1D+, Con-1C+, Con-1CD+, and Con-1CD2+ at higher energies. Adduct formation of ConCD4+ is also observed for the largest cluster cations, n ≥10. In general, the efficiencies of the single and double dehydrogenation processes increase with cluster size, although the hexamer cation shows a reduced reactivity compared to its neighbors. All reactions exhibit thresholds, and cross sections for the various primary and secondary reactions are analyzed to yield reaction thresholds from which bond energies for cobalt cluster cations to D, C, CD, CD2, and CD3 are determined. The relative magnitudes of these bond energies are consistent with simple bond order considerations. Bond energies for larger clusters rapidly reach relatively constant values, which are used to estimate the chemisorption energies of the C, CD, CD2, and CD3 molecular fragments to cobalt surfaces.

  4. A cluster-randomised controlled trial of a physical activity and nutrition programme in retirement villages: a study protocol

    PubMed Central

    Holt, Anne-Marie; Jancey, Jonine; Lee, Andy H; Kerr, Deborah A; Hills, Andrew P; Anderson, Annie S; Howat, Peter A

    2014-01-01

    Introduction Physical activity levels of Australia's ageing population are declining and coincidentally rates of overweight and obesity are increasing. Adequate levels of physical activity and a healthy diet are recognised as important lifestyle factors for the maintenance of a healthy weight and prevention of chronic diseases. Retirement village (RV) residents rarely engage in physical activity and nutrition programmes offered, with poor attendance and low use of existing facilities such as on-site fitness centres and classes and nutrition seminars. The RV provides a unique setting to access and engage with this older target group, to test the effectiveness of strategies to increase levels of physical activity, improve nutrition and maintain a healthy weight. Method and analysis This cluster-randomised controlled trial will evaluate a physical activity, nutrition and healthy weight management intervention for insufficiently active (‘not achieving 150 min of moderate-intensity physical activity per week’) adults aged 60–75 residing in RV's. A total of 400 participants will be recruited from 20 randomly selected RV's in Perth, Western Australia. Villages will be assigned to either the intervention group (n=10) or the control group (n=10) each containing 200 participants. The Retirement Village Physical Activity and Nutrition for Seniors (RVPANS) programme is a home-based physical activity and nutrition programme that includes educational resources, along with facilitators who will motivate and guide the participants during the 6-month intervention. Descriptive statistics and mixed regression models will be performed to assess the intervention effects. This trial will evaluate an intervention for the modification of health risk factors in the RV setting. Such research conducted in RV's has been limited. Ethics and dissemination Curtin University Human Research Ethics Committee (approval number: HR128/2012). Dissemination of the study results will occur

  5. ADAP–SLP-76 Binding Differentially Regulates Supramolecular Activation Cluster (SMAC) Formation Relative to T Cell–APC Conjugation

    PubMed Central

    Wang, Hongyan; McCann, Fiona E.; Gordan, John D.; Wu, Xiang; Raab, Monika; Malik, Talat H.; Davis, Daniel M.; Rudd, Christopher E.

    2004-01-01

    T cell–APC conjugation as mediated by leukocyte function-associated antigen-1 (LFA-1)–intercellular adhesion molecule (ICAM)-1 binding is followed by formation of the supramolecular activation cluster (SMAC) at the immunological synapse. The intracellular processes that regulate SMAC formation and its influence on T cell function are important questions to be addressed. Here, using a mutational approach, we demonstrate that binding of adaptor adhesion and degranulation promoting adaptor protein (ADAP) to SLP-76 differentially regulates peripheral SMAC (pSMAC) formation relative to conjugation. Although mutation of the YDDV sites (termed M12) disrupted SLP-76 SH2 domain binding and prevented the ability of ADAP to increase conjugation and LFA-1 clustering, M12 acted selectively as a dominant negative (DN) inhibitor of pSMAC formation, an effect that was paralleled by a DN effect on interleukin-2 production. ADAP also colocalized with LFA-1 at the immunological synapse. Our findings identify ADAP–SLP-76 binding as a signaling event that differentially regulates SMAC formation, and support a role for SMAC formation in T cell cytokine production. PMID:15477347

  6. Mechanisms of the S/CO/Se interchange reactions at FeMo-co, the active site cluster of nitrogenase.

    PubMed

    Dance, Ian

    2016-09-28

    The active site of the N2 fixing enzyme nitrogenase is a C-centred Fe7MoS cluster (FeMo-co) containing a trigonal prism of six Fe atoms connected by a central belt of three doubly-bridging S atoms. The trigonal faces of the prism are capped via triply-bridging S atoms to Fe1 at one end and Mo at the other end. One of the central belt atoms, S2B, considered to be important in the chemical mechanism of the enzyme, has been shown by Spatzal, Rees et al. to undergo substitution by CO, and also substitution by Se in the presence of SeCN(-), under turnover conditions. Further, when turning over under C2H2 or N2/CO there is migration of Se to the other two belt bridging positions. These reactions are extraordinary, and unprecedented in metal chalcogenide cluster chemistry. Using density functional simulations, mechanisms for all of these reactions have been developed, involving the small molecules SCO, SeCO, C2H2S, C2H2Se, SeCN(-), SCN(-) functioning as carriers of S and Se atoms. The possibility that the S2B bridge position is vacant is discounted, because the barrier to formation of a bridge-void intermediate with two contiguous three-coordinate Fe atoms is too large. A bridging ligand is retained throughout the proposed mechanisms. Intermediates with Fe-C(O)-S/Se-Fe cycles and with SCO/SeCO C-bound to Fe are predicted. The energetics of the reaction trajectories show them to be feasible and easily reversible, consistent with experiment. Alternative mechanisms involving intramolecular differential rotatory rearrangements of the cluster to scramble the Se bridges are also examined, and shown to be very unlikely. The implications of these new facets of the reactivity of the FeMo-co cluster are discussed: it is considered that they are unlikely to be part of the mechanism of the physiological reactions of nitrogenase. PMID:27534727

  7. The formation of complex acetylcholine receptor clusters requires MuSK kinase activity and structural information from the MuSK extracellular domain

    PubMed Central

    Mazhar, Sania; Herbst, Ruth

    2012-01-01

    Efficient synaptic transmission at the neuromuscular junction (NMJ) requires the topological maturation of the postsynaptic apparatus from an oval acetylcholine receptor (AChR)-rich plaque into a complex pretzel-shaped array of branches. However, compared to NMJ formation very little is known about the mechanisms that regulate NMJ maturation. Recently the process of in vivo transformation from plaque into pretzel has been reproduced in vitro by culturing myotubes aneurally on laminin-coated substrate. It was proposed that the formation of complex AChR clusters is regulated by a MuSK-dependent muscle intrinsic program. To elucidate the structure–function role of MuSK in the aneural maturation of AChR pretzels, we used muscle cell lines expressing MuSK mutant and chimeric proteins. Here we report, that besides its role during agrin-induced AChR clustering, MuSK kinase activity is also necessary for substrate-dependent cluster formation. Constitutive-active MuSK induces larger AChR clusters, a faster cluster maturation on laminin and increases the anchorage of AChRs to the cytoskeleton compared to MuSK wild-type. In addition, we find that the juxtamembrane region of MuSK, which has previously been shown to regulate agrin-induced AChR clustering, is unable to induce complex AChR clusters on laminin substrate. Most interestingly, MuSK kinase activity is not sufficient for laminin-dependent AChR cluster formation since the MuSK ectodomain is also required suggesting a so far undiscovered instructive role for the extracellular domain of MuSK. PMID:22210232

  8. Conserved structure and adjacent location of the thrombin receptor and protease-activated receptor 2 genes define a protease-activated receptor gene cluster.

    PubMed Central

    Kahn, M.; Ishii, K.; Kuo, W. L.; Piper, M.; Connolly, A.; Shi, Y. P.; Wu, R.; Lin, C. C.; Coughlin, S. R.

    1996-01-01

    BACKGROUND: Thrombin is a serine protease that elicits a variety of cellular responses. Molecular cloning of a thrombin receptor revealed a G protein-coupled receptor that is activated by a novel proteolytic mechanism. Recently, a second protease-activated receptor was discovered and dubbed PAR2. PAR2 is highly related to the thrombin receptor by sequence and, like the thrombin receptor, is activated by cleavage of its amino terminal exodomain. Also like the thrombin receptor, PAR2 can be activated by the hexapeptide corresponding to its tethered ligand sequence independent of receptor cleavage. Thus, functionally, the thrombin receptor and PAR2 constitute a fledgling receptor family that shares a novel proteolytic activation mechanism. To further explore the relatedness of the two known protease-activated receptors and to examine the possibility that a protease-activated gene cluster might exist, we have compared the structure and chromosomal locations of the thrombin receptor and PAR2 genes. MATERIALS AND METHODS: The genomic structures of the two protease-activated receptor genes were determined by analysis of lambda phage, P1 bacteriophage, and bacterial artificial chromosome (BAC) genomic clones. Chromosomal location was determined with fluorescent in situ hybridization (FISH) on metaphase chromosomes, and the relative distance separating the two genes was evaluated both by means of two-color FISH and analysis of YACs and BACs containing both genes. RESULTS: Analysis of genomic clones revealed that the two protease-activated receptor genes share a two-exon genomic structure in which the first exon encodes 5'-untranslated sequence and signal peptide, and the second exon encodes the mature receptor protein and 3'-untranslated sequence. The two receptor genes also share a common locus with the two human genes located at 5q13 and the two mouse genes at 13D2, a syntenic region of the mouse genome. These techniques also suggest that the physical distance separating

  9. Clustered Conserved Cysteines in Hyaluronan Synthase Mediate Cooperative Activation by Mg(2+) Ions and Severe Inhibitory Effects of Divalent Cations.

    PubMed

    Tlapak-Simmons, Valarie L; Medina, Andria P; Baggenstoss, Bruce A; Nguyen, Long; Baron, Christina A; Weigel, Paul H

    2011-11-15

    Hyaluronan synthase (HAS) uses UDP-GlcUA and UDP-GlcNAc to make hyaluronan (HA). Streptococcus equisimilis HAS (SeHAS) contains four conserved cysteines clustered near the membrane, and requires phospholipids and Mg(2+) for activity. Activity of membrane-bound or purified enzyme displayed a sigmoidal saturation profile for Mg(2+) with a Hill coefficient of 2. To assess if Cys residues are important for cooperativity we examined the Mg(2+) dependence of mutants with various combinations of Cys-to-Ala mutations. All Cys-mutants lost the cooperative response to Mg(2+). In the presence of Mg(2+), other divalent cations inhibited SeHAS with different potencies (Cu(2+)~Zn(2+) >Co(2+) >Ni(2+) >Mn(2+) >Ba(2+) Sr(2+) Ca(2+)). Some divalent metal ions likely inhibit by displacement of Mg(2+)-UDP-Sugar complexes (e.g. Ca(2+), Sr(2+) and Ba(2+) had apparent Ki values of 2-5 mM). In contrast, Zn(2+) and Cu(2+) inhibited more potently (apparent Ki ≤ 0.2 mM). Inhibition of Cys-null SeHAS by Cu(2+), but not Zn(2+), was greatly attenuated compared to wildtype. Double and triple Cys-mutants showed differing sensitivities to Zn(2+) or Cu(2+). Wildtype SeHAS allowed to make HA prior to exposure to Zn(2+) or Cu(2+) was protected from inhibition, indicating that access of metal ions to sensitive functional groups was hindered in processively acting HA•HAS complexes. We conclude that clustered Cys residues mediate cooperative interactions with Mg(2+) and that transition metal ions inhibit SeHAS very potently by interacting with one or more of these -SH groups.

  10. Clustering of T cell ligands on artificial APC membranes influences T cell activation and protein kinase C theta translocation to the T cell plasma membrane.

    PubMed

    Giannoni, Francesca; Barnett, Joellen; Bi, Kun; Samodal, Rodrigo; Lanza, Paola; Marchese, Patrizia; Billetta, Rosario; Vita, Randi; Klein, Mark R; Prakken, Berent; Kwok, William W; Sercarz, Eli; Altman, Amnon; Albani, Salvatore

    2005-03-15

    T cell activation is associated with active clustering of relevant molecules in membrane microdomains defined as the supramolecular activation cluster. The contact area between these regions on the surface of T cells and APC is defined as the immunological synapse. It has been recently shown that preclustering of MHC-peptide complexes in membrane microdomains on the APC surface affects the efficiency of immune synapse formation and the related T cell activation. Disruption of such clusters may reduce the efficiency of stimulation. We describe here an entirely artificial system for Ag-specific, ex vivo stimulation of human polyclonal T cells (artificial APC (aAPC)). aAPC are based on artificial membrane bilayers containing discrete membrane microdomains encompassing T cell ligands (i.e., appropriate MHC-peptide complexes in association with costimulatory molecules). We show here that preclustering of T cell ligands triggered a degree of T cell activation significantly higher than the one achieved when we used either soluble tetramers or aAPC in which MHC-peptide complexes were uniformly distributed within artificial bilayer membranes. This increased efficiency in stimulation was mirrored by increased translocation from the cytoplasm to the membrane of protein kinase theta, a T cell signaling molecule that colocalizes with the TCR within the supramolecular activation cluster, thus indicating efficient engagement of T cell activation pathways. Engineered aAPC may have immediate application for basic and clinical immunology studies pertaining to modulation of T cells ex vivo.

  11. EVOLUTION AND DISTRIBUTION OF MAGNETIC FIELDS FROM ACTIVE GALACTIC NUCLEI IN GALAXY CLUSTERS. I. THE EFFECT OF INJECTION ENERGY AND REDSHIFT

    SciTech Connect

    Xu Hao; Li Hui; Li Shengtai; Collins, David C.; Norman, Michael L. E-mail: hli@lanl.go E-mail: dcollins@physics.ucsd.ed

    2010-12-20

    We present a series of cosmological magnetohydrodynamic simulations that simultaneously follow the formation of a galaxy cluster and evolution of magnetic fields ejected by an active galactic nucleus (AGN). Specifically, we investigate the influence of both the epoch of the AGN (z {approx} 3-0.5) and the AGN energy ({approx}3 x 10{sup 57}- 2 x 10{sup 60} erg) on the final magnetic field distribution in a relatively massive cluster (M{sub vir} {approx} 10{sup 15} M{sub sun}). We find that as long as the AGN magnetic fields are ejected before the major mergers in the cluster formation history, magnetic fields can be transported throughout the cluster and can be further amplified by the intracluster medium (ICM) turbulence caused by hierarchical mergers during the cluster formation process. The total magnetic energy in the cluster can reach {approx}10{sup 61} erg, with micro Gauss fields distributed over the {approx}Mpc scale. The amplification of the total magnetic energy by the ICM turbulence can be significant, up to {approx}1000 times in some cases. Therefore even weak magnetic fields from AGNs can be used to magnetize the cluster to the observed level. The final magnetic energy in the ICM is determined by the ICM turbulent energy, with a weak dependence on the AGN injection energy. We discuss the properties of magnetic fields throughout the cluster and the synthetic Faraday rotation measure maps they produce. We also show that high spatial resolution over most of the magnetic regions of the cluster is very important to capture the small-scale dynamo process and maintain the magnetic field structure in our simulations.

  12. CLUSTER CHEMISTRY

    SciTech Connect

    Muetterties, Earl L.

    1980-05-01

    Metal cluster chemistry is one of the most rapidly developing areas of inorganic and organometallic chemistry. Prior to 1960 only a few metal clusters were well characterized. However, shortly after the early development of boron cluster chemistry, the field of metal cluster chemistry began to grow at a very rapid rate and a structural and a qualitative theoretical understanding of clusters came quickly. Analyzed here is the chemistry and the general significance of clusters with particular emphasis on the cluster research within my group. The importance of coordinately unsaturated, very reactive metal clusters is the major subject of discussion.

  13. Active Currents and Stresses on the cell surface: Clustering, Instabilities and Budding

    NASA Astrophysics Data System (ADS)

    Rao, Madan

    2011-03-01

    We study the contractile dynamics of a collection of active polar filaments, such as actin, on a two dimensional substrate, using a continuum hydrodynamic description in the presence of spatiotemporal noise. The steady states, characterized by a variety of phases generically consisting of a transient collection of inward pointing asters. We next study the dynamics of particles advected along these active filaments. This is relevant to the dynamics and organization of a large class of cell surface molecules. We make several predictions regarding the statistics of fluctuations of these passive advective particles which we confirm using fluorescence based experiments. We then show how such active patterning of filaments can give rise to membrane stresses leading to membrane shape deformations. In collaboration with Kripa Gowrishankar and Satyajit Mayor.

  14. Cyclotide Structure–Activity Relationships: Qualitative and Quantitative Approaches Linking Cytotoxic and Anthelmintic Activity to the Clustering of Physicochemical Forces

    PubMed Central

    Park, Sungkyu; Strömstedt, Adam A.; Göransson, Ulf

    2014-01-01

    Cyclotides are a family of plant-derived proteins that are characterized by a cyclic backbone and a knotted disulfide topology. Their cyclic cystine knot (CCK) motif makes them exceptionally resistant to thermal, chemical, and enzymatic degradation. Cyclotides exert much of their biological activity via interactions with cell membranes. In this work, we qualitatively and quantitatively analyze the cytotoxic and anthelmintic membrane activities of cyclotides. The qualitative and quantitative models describe the potency of cyclotides using four simple physicochemical terms relevant to membrane contact. Specifically, surface areas of the cyclotides representing lipophilic and hydrogen bond donating properties were quantified and their distribution across the molecular surface was determined. The resulting quantitative structure-activity relation (QSAR) models suggest that the activity of the cyclotides is proportional to their lipophilic and positively charged surface areas, provided that the distribution of these surfaces is asymmetric. In addition, we qualitatively analyzed the physicochemical differences between the various cyclotide subfamilies and their effects on the cyclotides' orientation on the membrane and membrane activity. PMID:24682019

  15. Plasma Membrane Intrinsic Proteins from Maize Cluster in Two Sequence Subgroups with Differential Aquaporin Activity1

    PubMed Central

    Chaumont, François; Barrieu, François; Jung, Rudolf; Chrispeels, Maarten J.

    2000-01-01

    The transport of water through membranes is regulated in part by aquaporins or water channel proteins. These proteins are members of the larger family of major intrinsic proteins (MIPs). Plant aquaporins are categorized as either tonoplast intrinsic proteins (TIPs) or plasma membrane intrinsic proteins (PIPs). Sequence analysis shows that PIPs form several subclasses. We report on the characterization of three maize (Zea mays) PIPs belonging to the PIP1 and PIP2 subfamilies (ZmPIP1a, ZmPIP1b, and ZmPIP2a). The ZmPIP2a clone has normal aquaporin activity in Xenopus laevis oocytes. ZmPIP1a and ZmPIP1b have no activity, and a review of the literature shows that most PIP1 proteins identified in other plants have no or very low activity in oocytes. Arabidopsis PIP1 proteins are the only exception. Control experiments show that this lack of activity of maize PIP1 proteins is not caused by their failure to arrive at the plasma membrane of the oocytes. ZmPIP1b also does not appear to facilitate the transport of any of the small solutes tried (glycerol, choline, ethanol, urea, and amino acids). These results are discussed in relationship to the function and regulation of the PIP family of aquaporins. PMID:10759498

  16. Clustering of mammalian Hox genes with other H3K27me3 targets within an active nuclear domain.

    PubMed

    Vieux-Rochas, Maxence; Fabre, Pierre J; Leleu, Marion; Duboule, Denis; Noordermeer, Daan

    2015-04-14

    Embryogenesis requires the precise activation and repression of many transcriptional regulators. The Polycomb group proteins and the associated H3K27me3 histone mark are essential to maintain the inactive state of many of these genes. Mammalian Hox genes are targets of Polycomb proteins and form local 3D clusters centered on the H3K27me3 mark. More distal contacts have also been described, yet their selectivity, dynamics, and relation to other layers of chromatin organization remained elusive. We report that repressed Hox genes form mutual intra- and interchromosomal interactions with other genes located in strong domains labeled by H3K27me3. These interactions occur in a central and active nuclear environment that consists of the HiC compartment A, away from peripheral lamina-associated domains. Interactions are independent of nearby H3K27me3-marked loci and determined by chromosomal distance and cell-type-specific scaling factors, thus inducing a moderate reorganization during embryogenesis. These results provide a simplified view of nuclear organization whereby Polycomb proteins may have evolved to repress genes located in gene-dense regions whose position is restricted to central, active, nuclear environments.

  17. Clustering of mammalian Hox genes with other H3K27me3 targets within an active nuclear domain

    PubMed Central

    Vieux-Rochas, Maxence; Fabre, Pierre J.; Leleu, Marion; Duboule, Denis; Noordermeer, Daan

    2015-01-01

    Embryogenesis requires the precise activation and repression of many transcriptional regulators. The Polycomb group proteins and the associated H3K27me3 histone mark are essential to maintain the inactive state of many of these genes. Mammalian Hox genes are targets of Polycomb proteins and form local 3D clusters centered on the H3K27me3 mark. More distal contacts have also been described, yet their selectivity, dynamics, and relation to other layers of chromatin organization remained elusive. We report that repressed Hox genes form mutual intra- and interchromosomal interactions with other genes located in strong domains labeled by H3K27me3. These interactions occur in a central and active nuclear environment that consists of the HiC compartment A, away from peripheral lamina-associated domains. Interactions are independent of nearby H3K27me3-marked loci and determined by chromosomal distance and cell-type–specific scaling factors, thus inducing a moderate reorganization during embryogenesis. These results provide a simplified view of nuclear organization whereby Polycomb proteins may have evolved to repress genes located in gene-dense regions whose position is restricted to central, active, nuclear environments. PMID:25825760

  18. PROBING THE EXTREME REALM OF ACTIVE GALACTIC NUCLEUS FEEDBACK IN THE MASSIVE GALAXY CLUSTER, RX J1532.9+3021

    SciTech Connect

    Hlavacek-Larrondo, J.; Allen, S. W.; Canning, R. E. A.; Werner, N.; Ehlert, S.; Von der Linden, A.; Taylor, G. B.; Grimes, C. K.; Fabian, A. C.; Sanders, J. S.

    2013-11-10

    We present a detailed Chandra, XMM-Newton, Very Large Array (VLA) and Hubble Space Telescope analysis of one of the strongest cool core clusters known, RX J1532.9+3021 (z = 0.3613). Using new, deep 90 ks Chandra observations, we confirm the presence of a western X-ray cavity or bubble, and report on a newly discovered eastern X-ray cavity. The total mechanical power associated with these active galactic nucleus (AGN) driven outflows is (22 ± 9) × 10{sup 44} erg s{sup –1}, and is sufficient to offset the cooling, indicating that AGN feedback still provides a viable solution to the cooling flow problem even in the strongest cool core clusters. Based on the distribution of the optical filaments, as well as a jet-like structure seen in the 325 MHz VLA radio map, we suggest that the cluster harbors older outflows along the north to south direction. The jet of the central AGN is therefore either precessing or sloshing-induced motions have caused the outflows to change directions. There are also hints of an X-ray depression to the north aligned with the 325 MHz jet-like structure, which might represent the highest redshift ghost cavity discovered to date. We further find evidence of a cold front (r ≈ 65 kpc) that coincides with the outermost edge of the western X-ray cavity and the edge of the radio mini-halo. The common location of the cold front with the edge of the radio mini-halo supports the idea that the latter originates from electrons being reaccelerated due to sloshing-induced turbulence. Alternatively, its coexistence with the edge of the X-ray cavity may be due to cool gas being dragged out by the outburst. We confirm that the central AGN is highly sub-Eddington and conclude that a >10{sup 10} M{sub ☉} or a rapidly spinning black hole is favored to explain both the radiative-inefficiency of the AGN and the powerful X-ray cavities.

  19. Silver clusters onto nanosized colloidal silica as novel surface-enhanced Raman scattering active substrates.

    PubMed

    Muniz-Miranda, Maurizio

    2003-06-01

    A new method is proposed for obtaining surface-enhanced Raman scattering (SERS)-active substrates by photochemical reduction of silver nitrate onto colloidal silica. Transmission electron microscopy (TEM) and UV-visible absorption spectroscopy are employed to investigate the nanoscale structure of the materials. High quality SERS spectra are obtained from different organic ligands to check the efficiency of these substrates. A marked stability of the colloidal suspension is ensured by the scarce tendency of the Ag-doped silica particles to aggregate by either aging or adsorption of ligand.

  20. General active space commutator-based coupled cluster theory of general excitation rank for electronically excited states: Implementation and application to ScH

    SciTech Connect

    Hubert, Mickaël; Loras, Jessica; Fleig, Timo; Olsen, Jeppe

    2013-11-21

    We present a new implementation of general excitation rank coupled cluster theory for electronically excited states based on the single-reference multi-reference formalism. The method may include active-space selected and/or general higher excitations by means of the general active space concept. It may employ molecular integrals over the four-component Lévy-Leblond Hamiltonian or the relativistic spin-orbit-free four-component Hamiltonian of Dyall. In an initial application to ground- and excited states of the scandium monohydride molecule we report spectroscopic constants using basis sets of up to quadruple-zeta quality and up to full iterative triple excitations in the cluster operators. Effects due to spin-orbit interaction are evaluated using two-component multi-reference configuration interaction for assessing the accuracy of the coupled cluster results.

  1. Actin Depletion Initiates Events Leading to Granule Secretion at the Immunological Synapse

    PubMed Central

    Ritter, Alex T.; Asano, Yukako; Stinchcombe, Jane C.; Dieckmann, N.M.G.; Chen, Bi-Chang; Gawden-Bone, C.; van Engelenburg, Schuyler; Legant, Wesley; Gao, Liang; Davidson, Michael W.; Betzig, Eric; Lippincott-Schwartz, Jennifer; Griffiths, Gillian M.

    2015-01-01

    Summary Cytotoxic T lymphocytes (CTLs) use polarized secretion to rapidly destroy virally infected and tumor cells. To understand the temporal relationships between key events leading to secretion, we used high-resolution 4D imaging. CTLs approached targets with actin-rich projections at the leading edge, creating an initially actin-enriched contact with rearward-flowing actin. Within 1 min, cortical actin reduced across the synapse, T cell receptors (TCRs) clustered centrally to form the central supramolecular activation cluster (cSMAC), and centrosome polarization began. Granules clustered around the moving centrosome within 2.5 min and reached the synapse after 6 min. TCR-bearing intracellular vesicles were delivered to the cSMAC as the centrosome docked. We found that the centrosome and granules were delivered to an area of membrane with reduced cortical actin density and phospholipid PIP2. These data resolve the temporal order of events during synapse maturation in 4D and reveal a critical role for actin depletion in regulating secretion. PMID:25992860

  2. Double-stranded endonuclease activity in Bacillus halodurans clustered regularly interspaced short palindromic repeats (CRISPR)-associated Cas2 protein.

    PubMed

    Nam, Ki Hyun; Ding, Fran; Haitjema, Charles; Huang, Qingqiu; DeLisa, Matthew P; Ke, Ailong

    2012-10-19

    The CRISPR (clustered regularly interspaced short palindromic repeats) system is a prokaryotic RNA-based adaptive immune system against extrachromosomal genetic elements. Cas2 is a universally conserved core CRISPR-associated protein required for the acquisition of new spacers for CRISPR adaptation. It was previously characterized as an endoribonuclease with preference for single-stranded (ss)RNA. Here, we show using crystallography, mutagenesis, and isothermal titration calorimetry that the Bacillus halodurans Cas2 (Bha_Cas2) from the subtype I-C/Dvulg CRISPR instead possesses metal-dependent endonuclease activity against double-stranded (ds)DNA. This activity is consistent with its putative function in producing new spacers for insertion into the 5'-end of the CRISPR locus. Mutagenesis and isothermal titration calorimetry studies revealed that a single divalent metal ion (Mg(2+) or Mn(2+)), coordinated by a symmetric Asp pair in the Bha_Cas2 dimer, is involved in the catalysis. We envision that a pH-dependent conformational change switches Cas2 into a metal-binding competent conformation for catalysis. We further propose that the distinct substrate preferences among Cas2 proteins may be determined by the sequence and structure in the β1-α1 loop.

  3. Lower physical activity is a risk factor for a clustering of metabolic risk factors in non-obese and obese Japanese subjects: the Takahata study.

    PubMed

    Kaino, Wataru; Daimon, Makoto; Sasaki, Satoshi; Karasawa, Shigeru; Takase, Kaoru; Tada, Kyouko; Wada, Kiriko; Kameda, Wataru; Susa, Shinji; Oizumi, Toshihide; Fukao, Akira; Kubota, Isao; Kayama, Takamasa; Kato, Takeo

    2013-01-01

    In several countries including Japan, people without obesity but with a clustering of metabolic risk factors (MetRFs) were not considered to have the metabolic syndrome (MetS). Here, we examined whether lifestyle characteristics differed between non-obese and obese subjects with or without a clustering of MetRFs. From a population-based cross-sectional study of Japanese subjects aged ≥ 40 years, 1,601 subjects (age: 61.9 ± 10.3 years; 710/891 men/women) were recruited. Physical activity status and daily nutritional intake were estimated using questionnaires. A clustering of MetRFs was defined based on the presence of at least two non-essential risk factors for the diagnosis of the MetS in Japan. Energy intake was not higher in subjects with a clustering of MetRFs compared with those without. Among men, energy expenditure at work was significantly lower in non-obese (9.0 ± 8.2 vs. 11.3 ± 9.3 metabolic equivalents (METs), P = 0.025) and obese (9.0 ± 7.9 vs. 11.6 ± 9.4 METs, P = 0.017) subjects with a clustering of MetRFs than in those without. Multiple logistic regression analysis showed that energy expenditure at work was significantly associated with a clustering of MetRFs after adjusting for possible confounding factors including total energy intake. The ORs (per 1 METs) were 0.970 (95% CI, 0.944-0.997; P = 0.032) in non-obese men and 0.962 (0.926- 0.999; P = 0.043) in obese men. Similar associations were not observed in women. In Japanese males, lower physical activity, but not excessive energy intake, is a risk factor for a clustering of MetRFs independent of their obesity status.

  4. Two-Year Longitudinal Analysis of a Cluster Randomized Trial of Physical Activity Promotion by General Practitioners

    PubMed Central

    Grandes, Gonzalo; Sanchez, Alvaro; Montoya, Imanol; Ortega Sanchez-Pinilla, Ricardo; Torcal, Jesús

    2011-01-01

    Background We evaluate the effectiveness of a physical activity promotion programme carried out by general practitioners with inactive patients in routine care. Methods and Findings Pragmatic, cluster randomised clinical trial conducted in eleven public primary care centres in Spain. Fifty-six general practitioners (GPs) were randomly assigned to intervention (29) or standard care (27) groups. They assessed the physical activity level of a systematic sample of patients in routine practice and recruited 4317 individuals (2248 intervention and 2069 control) who did not meet minimum physical activity recommendations. Intervention GPs provided advice to all patients and a physical activity prescription to the subgroup attending an additional appointment (30%). A third of these prescriptions were opportunistically repeated. Control GPs provided standard care. Primary outcome measure was the change in self-reported physical activity from baseline to six, 12 and 24 months. Secondary outcomes included cardiorespiratory fitness and health-related quality of life. A total of 3691 patients (85%) were included in the longitudinal analysis and overall trends over the whole 24 month follow-up were significantly better in the intervention group (p<0.01). The greatest differences with the control group were observed at six months (adjusted difference 1.7 MET*hr/wk [95% CI, 0.8 to 2.6], 25 min/wk [95% CI, 11.3 to 38.4], and a 5.3% higher percentage of patients meeting minimum recommendations [95% CI: 2.1% to 8.8%] NNT = 19). These differences were not statistically significant at 12 and 24 months. No differences were found in secondary outcomes. A significant difference was maintained until 24 months in the proportion of patients achieving minimum recommendation in the subgroup that received a repeat prescription (adjusted difference 10.2%, 95% CI 1.5% to 19.4%). Conclusions General practitioners are effective at increasing the level of physical activity among their inactive

  5. Cluster Randomized Trial of a Church-Based Peer Counselor and Tailored Newsletter Intervention to Promote Colorectal Cancer Screening and Physical Activity among Older African Americans

    ERIC Educational Resources Information Center

    Leone, Lucia A.; Allicock, Marlyn; Pignone, Michael P.; Walsh, Joan F.; Johnson, La-Shell; Armstrong-Brown, Janelle; Carr, Carol C.; Langford, Aisha; Ni, Andy; Resnicow, Ken; Campbell, Marci K.

    2016-01-01

    Action Through Churches in Time to Save Lives (ACTS) of Wellness was a cluster randomized controlled trial developed to promote colorectal cancer screening and physical activity (PA) within urban African American churches. Churches were recruited from North Carolina (n = 12) and Michigan (n = 7) and were randomized to intervention (n = 10) or…

  6. Cost-Effectiveness of a Long-Term Internet-Delivered Worksite Health Promotion Programme on Physical Activity and Nutrition: A Cluster Randomized Controlled Trial

    ERIC Educational Resources Information Center

    Robroek, Suzan J. W.; Polinder, Suzanne; Bredt, Folef J.; Burdorf, Alex

    2012-01-01

    This study aims to evaluate the cost-effectiveness of a long-term workplace health promotion programme on physical activity (PA) and nutrition. In total, 924 participants enrolled in a 2-year cluster randomized controlled trial, with departments (n = 74) within companies (n = 6) as the unit of randomization. The intervention was compared with a…

  7. A participatory parent-focused intervention promoting physical activity in preschools: design of a cluster-randomized trial

    PubMed Central

    2010-01-01

    Background With rates of childhood obesity increasing, physical activity (PA) promotion especially in young children has assumed greater importance. Given the limited effectiveness of most interventions to date, new approaches are needed. The General Systems theory suggests that involving parents as intervention targets may be effective in fostering healthier life styles in children. We describe the development of a parent-focused participatory intervention and the procedures used to evaluate its effectiveness in increasing daily PA in preschoolers. Methods/Design Thirty-seven South German preschools were identified for this study and agreed to participate. Using a two-armed, controlled cluster-randomized trial design we test a participatory intervention with parents as the primary target group and potential agents of behavioural change. Specifically, the intervention is designed to engage parents in the development, refinement and selection of project ideas to promote PA and in incorporating these ideas into daily routines within the preschool community, consisting of children, teachers and parents. Our study is embedded within an existing state-sponsored programme providing structured gym lessons to preschool children. Thus, child-based PA outcomes from the study arm with the parent-focused intervention and the state-sponsored programme are compared with those from the study arm with the state-sponsored programme alone. The evaluation entails baseline measurements of study outcomes as well as follow-up measurements at 6 and 12 months. Accelerometry measures PA intensity over a period of six days, with the mean over six days used as the primary outcome measure. Secondary outcomes include childrens' BMI, a sum of averaged skin fold thickness measurements across multiple sites, and PA behaviour. Longitudinal multilevel models are used to assess within-subject change and between-group differences in study outcomes, adjusted for covariates at the preschool and

  8. The mitochondrial fission factor dynamin-related protein 1 modulates T-cell receptor signalling at the immune synapse

    PubMed Central

    Baixauli, Francesc; Martín-Cófreces, Noa B; Morlino, Giulia; Carrasco, Yolanda R; Calabia-Linares, Carmen; Veiga, Esteban; Serrador, Juan M; Sánchez-Madrid, Francisco

    2011-01-01

    During antigen-specific T-cell activation, mitochondria mobilize towards the vicinity of the immune synapse. We show here that the mitochondrial fission factor dynamin-related protein 1 (Drp1) docks at mitochondria, regulating their positioning and activity near the actin-rich ring of the peripheral supramolecular activation cluster (pSMAC) of the immune synapse. Mitochondrial redistribution in response to T-cell receptor engagement was abolished by Drp1 silencing, expression of the phosphomimetic mutant Drp1S637D and the Drp1-specific inhibitor mdivi-1. Moreover, Drp1 knockdown enhanced mitochondrial depolarization and T-cell receptor signal strength, but decreased myosin phosphorylation, ATP production and T-cell receptor assembly at the central supramolecular activation cluster (cSMAC). Our results indicate that Drp1-dependent mitochondrial positioning and activity controls T-cell activation by fuelling central supramolecular activation cluster assembly at the immune synapse. PMID:21326213

  9. Activation of Methane and Carbon Dioxide Mediated by Transition-Metal Doped Magnesium Oxide Clusters [MMgO](+/0/-) (M=Sc-Zn).

    PubMed

    Li, Jilai; González-Navarrete, Patricio; Schlangen, Maria; Schwarz, Helmut

    2015-05-18

    Mission: impossible? DFT calculations show that the trends in the thermochemistry are very different for the activation of CO2 and CH4 mediated by transition-metal doped magnesium oxide clusters [MMgO](+/0/-) (M=Sc-Zn). Thus, seeking a "simple" reagent to simultaneously mediate activation and coupling of CH4 and CO2 with high efficiency seems extremely daunting, if not impossible. PMID:25867011

  10. Reducing long term sickness absence by an activating intervention in adjustment disorders: a cluster randomised controlled design

    PubMed Central

    van der Klink, J J L; Blonk, R; Schene, A; van Dijk, F J H

    2003-01-01

    Aims: To compare an innovative activating intervention with "care as usual" (control group) for the guidance of employees on sickness leave because of an adjustment disorder. It was hypothesised that the intervention would be more effective than care as usual in lowering the intensity of symptoms, increasing psychological resources, and decreasing sickness leave duration. Methods: A prospective, cluster randomised controlled trial was carried out with 192 patients on first sickness leave for an adjustment disorder. Symptom intensity, sickness duration, and return to work rates were measured at 3 months and 12 months. Analyses were performed on an intention to treat basis. Results: At 3 months, significantly more patients in the intervention group had returned to work compared with the control group. At 12 months all patients had returned to work, but sickness leave was shorter in the intervention group than in the control group. The recurrence rate was lower in the intervention group. There were no differences between the two study groups with regard to the decrease of symptoms. At baseline, symptom intensity was higher in the patients than in a normal reference population, but decreased over time in a similar manner in both groups to approximately normal levels. Conclusion: The experimental intervention for adjustment disorders was successful in shortening sick leave duration, mainly by decreasing long term absenteeism. PMID:12771395

  11. Activation of the Ustilagic Acid Biosynthesis Gene Cluster in Ustilago maydis by the C2H2 Zinc Finger Transcription Factor Rua1▿

    PubMed Central

    Teichmann, Beate; Liu, Lidan; Schink, Kay Oliver; Bölker, Michael

    2010-01-01

    The phytopathogenic basidiomycetous fungus Ustilago maydis secretes, under conditions of nitrogen starvation, large amounts of the biosurfactant ustilagic acid (UA). This secreted cellobiose glycolipid is toxic for many microorganisms and confers biocontrol activity to U. maydis. Recently, a large gene cluster that is responsible for UA biosynthesis was identified. Here, we show that expression of all cluster genes depends on Rua1, a nuclear protein of the C2H2 zinc finger family, whose gene is located within the gene cluster. While deletion of rua1 results in complete loss of UA production, overexpression of rua1 promotes increased UA synthesis even in the presence of a good nitrogen source. Bioinformatic analysis allowed us to identify a conserved sequence element that is present in the promoters of all structural genes involved in UA biosynthesis. Deletion analysis of several promoters within the cluster revealed that this DNA element serves as an upstream activating sequence (UAS) and mediates Rua1-dependent expression. We used the yeast one-hybrid system to demonstrate specific recognition of this DNA element by Rua1. Introduction of nucleotide exchanges into the consensus sequence interfered with Rua1-dependent activation, suggesting that this sequence element acts as a direct binding site for Rua1. PMID:20173069

  12. Activation of the ustilagic acid biosynthesis gene cluster in Ustilago maydis by the C2H2 zinc finger transcription factor Rua1.

    PubMed

    Teichmann, Beate; Liu, Lidan; Schink, Kay Oliver; Bölker, Michael

    2010-04-01

    The phytopathogenic basidiomycetous fungus Ustilago maydis secretes, under conditions of nitrogen starvation, large amounts of the biosurfactant ustilagic acid (UA). This secreted cellobiose glycolipid is toxic for many microorganisms and confers biocontrol activity to U. maydis. Recently, a large gene cluster that is responsible for UA biosynthesis was identified. Here, we show that expression of all cluster genes depends on Rua1, a nuclear protein of the C(2)H(2) zinc finger family, whose gene is located within the gene cluster. While deletion of rua1 results in complete loss of UA production, overexpression of rua1 promotes increased UA synthesis even in the presence of a good nitrogen source. Bioinformatic analysis allowed us to identify a conserved sequence element that is present in the promoters of all structural genes involved in UA biosynthesis. Deletion analysis of several promoters within the cluster revealed that this DNA element serves as an upstream activating sequence (UAS) and mediates Rua1-dependent expression. We used the yeast one-hybrid system to demonstrate specific recognition of this DNA element by Rua1. Introduction of nucleotide exchanges into the consensus sequence interfered with Rua1-dependent activation, suggesting that this sequence element acts as a direct binding site for Rua1. PMID:20173069

  13. Cocaine users with comorbid Cluster B personality disorders show dysfunctional brain activation and connectivity in the emotional regulation networks during negative emotion maintenance and reappraisal.

    PubMed

    Albein-Urios, Natalia; Verdejo-Román, Juan; Soriano-Mas, Carles; Asensio, Samuel; Martínez-González, José Miguel; Verdejo-García, Antonio

    2013-12-01

    Cocaine dependence often co-occurs with Cluster B personality disorders. Since both disorders are characterized by emotion regulation deficits, we predicted that cocaine comorbid patients would exhibit dysfunctional patterns of brain activation and connectivity during reappraisal of negative emotions. We recruited 18 cocaine users with comorbid Cluster B personality disorders, 17 cocaine users without comorbidities and 21 controls to be scanned using functional magnetic resonance imaging (fMRI) during performance on a reappraisal task in which they had to maintain or suppress the emotions induced by negative affective stimuli. We followed region of interest (ROI) and whole-brain approaches to investigate brain activations and connectivity associated with negative emotion experience and reappraisal. Results showed that cocaine users with comorbid personality disorders had reduced activation of the subgenual anterior cingulate cortex during negative emotion maintenance and increased activation of the lateral orbitofrontal cortex and the amygdala during reappraisal. Amygdala activation correlated with impulsivity and antisocial beliefs in the comorbid group. Connectivity analyses showed that in the cocaine comorbid group the subgenual cingulate was less efficiently connected with the amygdala and the fusiform gyri and more efficiently connected with the anterior insula during maintenance, whereas during reappraisal the left orbitofrontal cortex was more efficiently connected with the amygdala and the right orbitofrontal cortex was less efficiently connected with the dorsal striatum. We conclude that cocaine users with comorbid Cluster B personality disorders have distinctive patterns of brain activation and connectivity during maintenance and reappraisal of negative emotions, which correlate with impulsivity and dysfunctional beliefs.

  14. Hydrogen activation, diffusion, and clustering on CeO2(111): A DFT+U study

    NASA Astrophysics Data System (ADS)

    Fernández-Torre, Delia; Carrasco, Javier; Ganduglia-Pirovano, M. Verónica; Pérez, Rubén

    2014-07-01

    We present a comprehensive density functional theory+U study of the mechanisms underlying the dissociation of molecular hydrogen, and diffusion and clustering of the resulting atomic species on the CeO2(111) surface. Contrary to a widely held view based solely on a previous theoretical prediction, our results show conclusively that H2 dissociation is an activated process with a large energy barrier ˜1.0 eV that is not significantly affected by coverage or the presence of surface oxygen vacancies. The reaction proceeds through a local energy minimum - where the molecule is located close to one of the surface oxygen atoms and the H-H bond has been substantially weaken by the interaction with the substrate -, and a transition state where one H atom is attached to a surface O atom and the other H atom sits on-top of a Ce4+ ion. In addition, we have explored how several factors, including H coverage, the location of Ce3+ ions as well as the U value, may affect the chemisorption energy and the relative stability of isolated OH groups versus pair and trimer structures. The trimer stability at low H coverages and the larger upward relaxation of the surface O atoms within the OH groups are consistent with the assignment of the frequent experimental observation by non-contact atomic force and scanning tunneling microscopies of bright protrusions on three neighboring surface O atoms to a triple OH group. The diffusion path of isolated H atoms on the surface goes through the adsorption on-top of an oxygen in the third atomic layer with a large energy barrier of ˜1.8 eV. Overall, the large energy barriers for both, molecular dissociation and atomic diffusion, are consistent with the high activity and selectivity found recently in the partial hydrogenation of acetylene catalyzed by ceria at high H2/C2H2 ratios.

  15. Nuclear resonance vibrational spectroscopy reveals the FeS cluster composition and active site vibrational properties of an O2-tolerant NAD+-reducing [NiFe] hydrogenase

    DOE PAGES

    Lauterbach, Lars; Wang, Hongxin; Horch, Marius; Gee, Leland B.; Yoda, Yoshitaka; Tanaka, Yoshihito; Zebger, Ingo; Lenz, Oliver; Cramer, Stephen P.

    2014-10-30

    Hydrogenases are complex metalloenzymes that catalyze the reversible splitting of molecular hydrogen into protons and electrons essentially without overpotential. The NAD+-reducing soluble hydrogenase (SH) from Ralstonia eutropha is capable of H2 conversion even in the presence of usually toxic dioxygen. The molecular details of the underlying reactions are largely unknown, mainly because of limited knowledge of the structure and function of the various metal cofactors present in the enzyme. Here, all iron-containing cofactors of the SH were investigated by 57Fe specific nuclear resonance vibrational spectroscopy (NRVS). Our data provide experimental evidence for one [2Fe2S] center and four [4Fe4S] clusters, whichmore » is consistent with the amino acid sequence composition. Only the [2Fe2S] cluster and one of the four [4Fe4S] clusters were reduced upon incubation of the SH with NADH. This finding explains the discrepancy between the large number of FeS clusters and the small amount of FeS cluster-related signals as detected by electron paramagnetic resonance spectroscopic analysis of several NAD+-reducing hydrogenases. For the first time, Fe–CO and Fe–CN modes derived from the [NiFe] active site could be distinguished by NRVS through selective 13C labeling of the CO ligand. This strategy also revealed the molecular coordinates that dominate the individual Fe–CO modes. The present approach explores the complex vibrational signature of the Fe–S clusters and the hydrogenase active site, thereby showing that NRVS represents a powerful tool for the elucidation of complex biocatalysts containing multiple cofactors.« less

  16. Cluster headache

    MedlinePlus

    Histamine headache; Headache - histamine; Migrainous neuralgia; Headache - cluster; Horton's headache; Vascular headache - cluster ... be related to the body's sudden release of histamine (chemical in the body released during an allergic ...

  17. A Career Guidance Curriculum for Ninth Grade Students. Occupational Cluster Learning Activities. Business-Environmental. Part 1 of 2. Ninth Grade Guidance Project. Project Duration: July 16, 1979, to June 30, 1980.

    ERIC Educational Resources Information Center

    Cape May County Vocational Schools, NJ.

    This first of two parts presents learning activities for four occupational clusters of a ninth-grade cluster program. It contains theory and hands-on activities that explore the occupational requirements and working environment of these areas to help students make intelligent decisions of possible career choices based on levels of interest and…

  18. A Career Guidance Curriculum for Ninth Grade Students. Occupational Cluster Learning Activities. Health-Technical. Part 2 of 2. Ninth Grade Career Guidance Project. Project Duration: July 16, 1979, to June 30, 1980.

    ERIC Educational Resources Information Center

    Cape May County Vocational Schools, NJ.

    This second of two parts presents learning activities for four occupational clusters of a ninth-grade cluster program. It contains theory and hands-on activities that explore the occupational requirements and working environment of these areas to help students make intelligent decisions of possible career choices based on levels of interest and…

  19. The Infant Feeding Activity and Nutrition Trial (INFANT) an early intervention to prevent childhood obesity: Cluster-randomised controlled trial

    PubMed Central

    Campbell, Karen; Hesketh, Kylie; Crawford, David; Salmon, Jo; Ball, Kylie; McCallum, Zoë

    2008-01-01

    Background Multiple factors combine to support a compelling case for interventions that target the development of obesity-promoting behaviours (poor diet, low physical activity and high sedentary behaviour) from their inception. These factors include the rapidly increasing prevalence of fatness throughout childhood, the instigation of obesity-promoting behaviours in infancy, and the tracking of these behaviours from childhood through to adolescence and adulthood. The Infant Feeding Activity and Nutrition Trial (INFANT) aims to determine the effectiveness of an early childhood obesity prevention intervention delivered to first-time parents. The intervention, conducted with parents over the infant's first 18 months of life, will use existing social networks (first-time parent's groups) and an anticipatory guidance framework focusing on parenting skills which support the development of positive diet and physical activity behaviours, and reduced sedentary behaviours in infancy. Methods/Design This cluster-randomised controlled trial, with first-time parent groups as the unit of randomisation, will be conducted with a sample of 600 first-time parents and their newborn children who attend the first-time parents' group at Maternal and Child Health Centres. Using a two-stage sampling process, local government areas in Victoria, Australia will be randomly selected at the first stage. At the second stage, a proportional sample of first-time parent groups within selected local government areas will be randomly selected and invited to participate. Informed consent will be obtained and groups will then be randomly allocated to the intervention or control group. Discussion The early years hold promise as a time in which obesity prevention may be most effective. To our knowledge this will be the first randomised trial internationally to demonstrate whether an early health promotion program delivered to first-time parents in their existing social groups promotes healthy eating

  20. Cluster B personality symptoms in persons at genetic risk for schizophrenia are associated with social competence and activation of the right temporo-parietal junction during emotion processing.

    PubMed

    Goldschmidt, Micaela Giuliana; Villarreal, Mirta Fabiana; de Achával, Delfina; Drucaroff, Lucas Javier; Costanzo, Elsa Yolanda; Castro, Mariana Nair; Pahissa, Jaime; Camprodon, Joan; Nemeroff, Charles; Guinjoan, Salvador Martín

    2014-01-30

    Personality disorders are common in nonpsychotic siblings of patients with schizophrenia, and some personality traits in this group may be associated with an increased risk for full-blown psychosis. We sought to establish if faulty right-hemisphere activation induced by social cognitive tasks, as previously described in patients with schizophrenia, is associated with specific personality symptoms in their unaffected siblings. We observed that cluster B personality symptoms in this group were inversely related to activation in the right temporo parietal junction (rTPJ, a structure critical in social cognitive processing) in response to a basic emotion processing task and also to social competence, whereas in contrast to our initial hypothesis, cluster A traits were not associated with right hemisphere activation during emotion processing or with social competence. These findings suggest the existence of clinical traits in at-risk individuals which share a common neurobiological substrate with schizophrenia, in regards to social performance.

  1. Meaningful Clusters

    SciTech Connect

    Sanfilippo, Antonio P.; Calapristi, Augustin J.; Crow, Vernon L.; Hetzler, Elizabeth G.; Turner, Alan E.

    2004-05-26

    We present an approach to the disambiguation of cluster labels that capitalizes on the notion of semantic similarity to assign WordNet senses to cluster labels. The approach provides interesting insights on how document clustering can provide the basis for developing a novel approach to word sense disambiguation.

  2. Abell Clusters

    NASA Astrophysics Data System (ADS)

    Katgert, P.; Murdin, P.

    2000-11-01

    Abell clusters are the most conspicuous groupings of galaxies identified by George Abell on the plates of the first photographic survey made with the SCHMIDT TELESCOPE at Mount Palomar in the 1950s. Sometimes, the term Abell clusters is used as a synonym of nearby, optically selected galaxy clusters....

  3. A theoretical study of O2 activation by the Au7-cluster on Mg(OH)2: roles of surface hydroxyls and hydroxyl defects.

    PubMed

    Jia, Chuanyi; Fan, Weiliu

    2015-11-11

    Using density functional theory (DFT) calculations, we investigated O2 activation by the Au7-cluster supported on the perfect and hydroxyl defective Mg(OH)2(0001) surface. It is revealed that hydroxyl groups on the perfect Mg(OH)2(0001) surface can not only enhance the stability of the Au7-cluster, but also help the adsorption of the O2 molecule through hydrogen-bonding interactions with the 2nd-layered interfacial Au sites. Density of states (DOS) analysis shows that the d-band centers of the 2nd-layered interfacial Au atoms are very close to the Fermi level, which thereby reduce the Pauli repulsion and promote the O2 adsorption. These two responses make the 2nd-layered interfacial Au atoms favor O2 activation. Interestingly, the surface hydrogen atoms activated by the 1st-layered Au atoms can facilitate the O2 dissociation process as well. Such a process is dynamically favorable and more inclined to occur at low temperatures compared to the direct dissociation process. Meanwhile, the hydroxyl defects of Mg(OH)2(0001) located right under the Au7-cluster can also up-shift the d-band centers of the surrounding Au atoms toward the Fermi level, enhancing its catalytic activity for O2 dissociation. In contrast, the d-band center of Au atoms surrounding the hydroxyl defect near the Au7-cluster exhibits an effective down-shift to lower energies, and therefore holds low activity. These results unveiled the roles of surface hydroxyls and hydroxyl defects on the Au/Mg(OH)2 catalyst in O2 activation and could provide a theoretical guidance for chemists to efficiently synthesize Au/hydroxide catalysts. PMID:26529519

  4. Gold(III) Mediated Activation and Transformation of Methane on Au1-Doped Vanadium Oxide Cluster Cations AuV2O6(.).

    PubMed

    Li, Zi-Yu; Li, Hai-Fang; Zhao, Yan-Xia; He, Sheng-Gui

    2016-08-01

    Gold in the +III oxidation state (Au(III)) has been proposed as a promising species to mediate challenging chemical reactions. However, it is difficult to characterize the chemistry of individual Au(III) species in condensed-phase systems mainly due to the interference from the Au(I) counterpart. Herein, by doping Au atoms into gas-phase vanadium oxide clusters, we demonstrate that the Au(III) cation in the AuV2O6(+) cluster is active for activation and transformation of methane, the most stable alkane molecule, into formaldehyde under mild conditions. In contrast, the AuV2O6(+) cluster isomers with the Au(I) cation can only absorb CH4. The clusters were generated by laser ablation and mass selected to react with CH4, CD4, or CH2D2 in an ion trap reactor. The reactivity was characterized by mass spectrometry and quantum chemistry calculations. The structures of the reactant and product ions were identified by using collision-induced and 425 nm photo-induced dissociation techniques.

  5. Gold(III) Mediated Activation and Transformation of Methane on Au1-Doped Vanadium Oxide Cluster Cations AuV2O6(.).

    PubMed

    Li, Zi-Yu; Li, Hai-Fang; Zhao, Yan-Xia; He, Sheng-Gui

    2016-08-01

    Gold in the +III oxidation state (Au(III)) has been proposed as a promising species to mediate challenging chemical reactions. However, it is difficult to characterize the chemistry of individual Au(III) species in condensed-phase systems mainly due to the interference from the Au(I) counterpart. Herein, by doping Au atoms into gas-phase vanadium oxide clusters, we demonstrate that the Au(III) cation in the AuV2O6(+) cluster is active for activation and transformation of methane, the most stable alkane molecule, into formaldehyde under mild conditions. In contrast, the AuV2O6(+) cluster isomers with the Au(I) cation can only absorb CH4. The clusters were generated by laser ablation and mass selected to react with CH4, CD4, or CH2D2 in an ion trap reactor. The reactivity was characterized by mass spectrometry and quantum chemistry calculations. The structures of the reactant and product ions were identified by using collision-induced and 425 nm photo-induced dissociation techniques. PMID:27385079

  6. A cluster-randomised, controlled trial to assess the impact of a workplace osteoporosis prevention intervention on the dietary and physical activity behaviours of working women: study protocol

    PubMed Central

    2013-01-01

    Background Osteoporosis is a debilitating disease and its risk can be reduced through adequate calcium consumption and physical activity. This protocol paper describes a workplace-based intervention targeting behaviour change in premenopausal women working in sedentary occupations. Method/Design A cluster-randomised design was used, comparing the efficacy of a tailored intervention to standard care. Workplaces were the clusters and units of randomisation and intervention. Sample size calculations incorporated the cluster design. Final number of clusters was determined to be 16, based on a cluster size of 20 and calcium intake parameters (effect size 250 mg, ICC 0.5 and standard deviation 290 mg) as it required the highest number of clusters. Sixteen workplaces were recruited from a pool of 97 workplaces and randomly assigned to intervention and control arms (eight in each). Women meeting specified inclusion criteria were then recruited to participate. Workplaces in the intervention arm received three participatory workshops and organisation wide educational activities. Workplaces in the control/standard care arm received print resources. Intervention workshops were guided by self-efficacy theory and included participatory activities such as goal setting, problem solving, local food sampling, exercise trials, group discussion and behaviour feedback. Outcomes measures were calcium intake (milligrams/day) and physical activity level (duration: minutes/week), measured at baseline, four weeks and six months post intervention. Discussion This study addresses the current lack of evidence for behaviour change interventions focussing on osteoporosis prevention. It addresses missed opportunities of using workplaces as a platform to target high-risk individuals with sedentary occupations. The intervention was designed to modify behaviour levels to bring about risk reduction. It is the first to address dietary and physical activity components each with unique intervention

  7. Clustering, Cosmology and a New Era of Black Hole Demographics - I. The Conditional Luminosity Function of Active Galactic Nuclei

    NASA Astrophysics Data System (ADS)

    Ballantyne, D. R.

    2016-09-01

    Deep X-ray surveys have provided a comprehensive and largely unbiased view of active galactic nuclei (AGN) evolution stretching back to z ˜ 5. However, it has been challenging to use the survey results to connect this evolution to the cosmological environment that AGNs inhabit. Exploring this connection will be crucial to understanding the triggering mechanisms of AGNs and how these processes manifest in observations at all wavelengths. In anticipation of upcoming wide-field X-ray surveys that will allow quantitative analysis of AGN environments, this paper presents a method to observationally constrain the Conditional Luminosity Function (CLF) of AGNs at a specific z. Once measured, the CLF allows the calculation of the AGN bias, mean dark matter halo mass, AGN lifetime, halo occupation number, and AGN correlation function - all as a function of luminosity. The CLF can be constrained using a measurement of the X-ray luminosity function and the correlation length at different luminosities. The method is illustrated at z ≈ 0 and 0.9 using the limited data that is currently available, and a clear luminosity dependence in the AGN bias and mean halo mass is predicted at both z, supporting the idea that there are at least two different modes of AGN triggering. In addition, the CLF predicts that z ≈ 0.9 quasars may be commonly hosted by haloes with Mh ˜ 1014 M⊙. These `young cluster' environments may provide the necessary interactions between gas-rich galaxies to fuel luminous accretion. The results derived from this method will be useful to populate AGNs of different luminosities in cosmological simulations.

  8. Tuning the redox activity of encapsulated metal clusters via the metallic and semiconducting character of carbon nanotubes

    PubMed Central

    Zhang, Fan; Pan, Xiulian; Hu, Yongfeng; Yu, Liang; Chen, Xiaoqi; Jiang, Peng; Zhang, Hongbo; Deng, Shibin; Zhang, Jin; Bolin, Trudy B.; Zhang, Shuo; Huang, Yuying; Bao, Xinhe

    2013-01-01

    We demonstrate that reactions confined within single-walled carbon nanotube (SWCNT) channels are modulated by the metallic and semiconducting character of the hosts. In situ Raman and X-ray absorption near-edge structure spectroscopies provide complementary information about the electronic state of carbon nanotubes and the encapsulated rhenium species, which reveal electronic interactions between encapsulated species and nanotubes. More electrons are transferred from metallic tubes (m-SWCNTs) to oxidic rhenium clusters, leading to a lower valence state rhenium oxide than that in semiconducting tubes (s-SWCNTs). Reduction in 3.5% (vol/vol) H2/Ar leads to weakened host–guest electronic interaction. The high valence state Re within s-SWCNTs is more readily reduced when raising the temperature, whereas only a sluggish change is observed for Re within m-SWCNTs. Only at 400 °C does Re reach a similar electronic state (mixture of Re0 and Re4+) in both types of tubes. Subsequent oxidation in 1% O2/Ar does not show changes for Re in s-SWCNTs up to 200 °C. In comparison, m-SWCNTs facilitate the oxidation of reduced rhenium (160 °C). This can be exploited for rational design of active catalysts with stable species as a desired valence state can be obtained by selecting specific-type SWCNTs and a controlled thermal treatment. These results also provide a chemical approach to modulate reversibly the electronic structure of SWCNTs without damaging the sidewalls of SWCNTs. PMID:23980145

  9. FTIR studies of metal ligands, networks of hydrogen bonds, and water molecules near the active site Mn₄CaO₅ cluster in Photosystem II.

    PubMed

    Debus, Richard J

    2015-01-01

    The photosynthetic conversion of water to molecular oxygen is catalyzed by the Mn₄CaO₅ cluster in Photosystem II and provides nearly our entire supply of atmospheric oxygen. The Mn₄CaO₅ cluster accumulates oxidizing equivalents in response to light-driven photochemical events within Photosystem II and then oxidizes two molecules of water to oxygen. The Mn₄CaO₅ cluster converts water to oxygen much more efficiently than any synthetic catalyst because its protein environment carefully controls the cluster's reactivity at each step in its catalytic cycle. This control is achieved by precise choreography of the proton and electron transfer reactions associated with water oxidation and by careful management of substrate (water) access and proton egress. This review describes the FTIR studies undertaken over the past two decades to identify the amino acid residues that are responsible for this control and to determine the role of each. In particular, this review describes the FTIR studies undertaken to characterize the influence of the cluster's metal ligands on its activity, to delineate the proton egress pathways that link the Mn₄CaO₅ cluster with the thylakoid lumen, and to characterize the influence of specific residues on the water molecules that serve as substrate or as participants in the networks of hydrogen bonds that make up the water access and proton egress pathways. This information will improve our understanding of water oxidation by the Mn₄CaO₅ catalyst in Photosystem II and will provide insight into the design of new generations of synthetic catalysts that convert sunlight into useful forms of storable energy. This article is part of a Special Issue entitled: Vibrational spectroscopies and bioenergetic systems. PMID:25038513

  10. Hierarchical chlorine-doped rutile TiO{sub 2} spherical clusters of nanorods: Large-scale synthesis and high photocatalytic activity

    SciTech Connect

    Xu Hua; Zheng Zhi; Zhang Lizhi Zhang Hailu; Deng Feng

    2008-09-15

    In this study, we report the synthesis of hierarchical chlorine-doped rutile TiO{sub 2} spherical clusters of nanorods photocatalyst on a large scale via a soft interface approach. This catalyst showed much higher photocatalytic activity than the famous commercial titania (Degussa P25) under visible light ({lambda}>420 nm). The resulting sample was characterized by X-ray diffraction (XRD), scanning electron microscopy (SEM), transmission electron microscopy (TEM), high-resolution TEM (HRTEM), nitrogen adsorption, X-ray photoelectron spectroscopy (XPS), UV-vis diffuse reflectance spectroscopy, {sup 1}H solid magic-angle spinning nuclear magnetic resonance (MAS-NMR) and photoluminescence spectroscopy. On the basis of characterization results, we found that the doping of chlorine resulted in red shift of absorption and higher surface acidity as well as crystal defects in the photocatalyst, which were the reasons for high photocatalytic activity of chlorine-doped TiO{sub 2} under visible light ({lambda}>420 nm). These hierarchical chlorine-doped rutile TiO{sub 2} spherical clusters of nanorods are very attractive in the fields of environmental pollutants removal and solar cell because of their easy separation and high activity. - Graphical abstract: Hierarchical chlorine-doped rutile TiO{sub 2} spherical clusters of nanorods photocatalyst were synthesized on a large scale via a soft interface approach. This catalyst showed much higher photocatalytic activity than the famous commercial titania (Degussa P25) under visible light ({lambda}>420 nm)

  11. ROLE OF C AND P SITES ON THE CHEMICAL ACTIVITY OF METAL CARBIDE AND PHOSPHIDES: FROM CLUSTERS TO SINGLE-CRYSTAL SURFACES

    SciTech Connect

    RODRIGUEZ,J.A.; VINES, F.; LIU, P.; ILLAS, F.

    2007-07-01

    Transition metal carbides and phosphides have shown tremendous potential as highly active catalysts. At a microscopic level, it is not well understood how these new catalysts work. Their high activity is usually attributed to ligand or/and ensemble effects. Here, we review recent studies that examine the chemical activity of metal carbide and phosphides as a function of size, from clusters to extended surfaces, and metal/carbon or metal/phosphorous ratio. These studies reveal that the C and P sites in these compounds cannot be considered as simple spectators. They moderate the reactivity of the metal centers and provide bonding sites for adsorbates.

  12. Imaging active faulting in a region of distributed deformation from the joint clustering of focal mechanisms and hypocentres: Application to the Azores-western Mediterranean region

    NASA Astrophysics Data System (ADS)

    Custódio, Susana; Lima, Vânia; Vales, Dina; Cesca, Simone; Carrilho, Fernando

    2016-04-01

    The matching between linear trends of hypocentres and fault planes indicated by focal mechanisms (FMs) is frequently used to infer the location and geometry of active faults. This practice works well in regions of fast lithospheric deformation, where earthquake patterns are clear and major structures accommodate the bulk of deformation, but typically fails in regions of slow and distributed deformation. We present a new joint FM and hypocentre cluster algorithm that is able to detect systematically the consistency between hypocentre lineations and FMs, even in regions of distributed deformation. We apply the method to the Azores-western Mediterranean region, with particular emphasis on western Iberia. The analysis relies on a compilation of hypocentres and FMs taken from regional and global earthquake catalogues, academic theses and technical reports, complemented by new FMs for western Iberia. The joint clustering algorithm images both well-known and new seismo-tectonic features. The Azores triple junction is characterised by FMs with vertical pressure (P) axes, in good agreement with the divergent setting, and the Iberian domain is characterised by NW-SE oriented P axes, indicating a response of the lithosphere to the ongoing oblique convergence between Nubia and Eurasia. Several earthquakes remain unclustered in the western Mediterranean domain, which may indicate a response to local stresses. The major regions of consistent faulting that we identify are the mid-Atlantic ridge, the Terceira rift, the Trans-Alboran shear zone and the north coast of Algeria. In addition, other smaller earthquake clusters present a good match between epicentre lineations and FM fault planes. These clusters may signal single active faults or wide zones of distributed but consistent faulting. Mainland Portugal is dominated by strike-slip earthquakes with fault planes coincident with the predominant NNE-SSW and WNW-ESE oriented earthquake lineations. Clusters offshore SW Iberia are

  13. Hydrogen activation, diffusion, and clustering on CeO{sub 2}(111): A DFT+U study

    SciTech Connect

    Fernández-Torre, Delia

    2014-07-07

    We present a comprehensive density functional theory+U study of the mechanisms underlying the dissociation of molecular hydrogen, and diffusion and clustering of the resulting atomic species on the CeO{sub 2}(111) surface. Contrary to a widely held view based solely on a previous theoretical prediction, our results show conclusively that H{sub 2} dissociation is an activated process with a large energy barrier ∼1.0 eV that is not significantly affected by coverage or the presence of surface oxygen vacancies. The reaction proceeds through a local energy minimum – where the molecule is located close to one of the surface oxygen atoms and the H–H bond has been substantially weaken by the interaction with the substrate –, and a transition state where one H atom is attached to a surface O atom and the other H atom sits on-top of a Ce{sup 4+} ion. In addition, we have explored how several factors, including H coverage, the location of Ce{sup 3+} ions as well as the U value, may affect the chemisorption energy and the relative stability of isolated OH groups versus pair and trimer structures. The trimer stability at low H coverages and the larger upward relaxation of the surface O atoms within the OH groups are consistent with the assignment of the frequent experimental observation by non-contact atomic force and scanning tunneling microscopies of bright protrusions on three neighboring surface O atoms to a triple OH group. The diffusion path of isolated H atoms on the surface goes through the adsorption on-top of an oxygen in the third atomic layer with a large energy barrier of ∼1.8 eV. Overall, the large energy barriers for both, molecular dissociation and atomic diffusion, are consistent with the high activity and selectivity found recently in the partial hydrogenation of acetylene catalyzed by ceria at high H{sub 2}/C{sub 2}H{sub 2} ratios.

  14. Active galactic nuclei. IV - Supplying black hole clusters by tidal disruption and by tidal capture of stars

    NASA Technical Reports Server (NTRS)

    Stoeger, W. R.; Pacholczyk, A. G.; Stepinski, T. F.

    1992-01-01

    The extent to which individual holes in a cluster of black holes with a mass spectrum can liberate and accrete the resulting material by tidally disrupting stars they encounter, or by capturing stars as binary companions is studied. It is found that the smaller black holes in 'the halo' of such clusters can adequately supply themselves to the level M-dot sub h or greater than 0.0001(M-dot sub h) sub crit, and up to 0.05(M-dot sub h)sub crit for the smallest holes, by tidal disruption, as long as the cluster is embedded in a distribution of stars of relatively high density (not less than 0.1M sub cl/cu pc), and as long as the entire cluster of stars is not too compact (not less than 0.5 pc). Consideration is given to modifications this 'internal' mode of supply introduces in the spectrum emitted by such black hole clusters, and to the current status of their viability as models for AGN and QSOs in light of dynamical studies by Quinlan and Shapiro (1987, 1989).

  15. Effect of a Nutrition Supplement and Physical Activity Program on Pneumonia and Walking Capacity in Chilean Older People: A Factorial Cluster Randomized Trial

    PubMed Central

    Dangour, Alan D.; Albala, Cecilia; Allen, Elizabeth; Grundy, Emily; Walker, Damian G.; Aedo, Cristian; Sanchez, Hugo; Fletcher, Olivia; Elbourne, Diana; Uauy, Ricardo

    2011-01-01

    Background Ageing is associated with increased risk of poor health and functional decline. Uncertainties about the health-related benefits of nutrition and physical activity for older people have precluded their widespread implementation. We investigated the effectiveness and cost-effectiveness of a national nutritional supplementation program and/or a physical activity intervention among older people in Chile. Methods and Findings We conducted a cluster randomized factorial trial among low to middle socioeconomic status adults aged 65–67.9 years living in Santiago, Chile. We randomized 28 clusters (health centers) into the study and recruited 2,799 individuals in 2005 (∼100 per cluster). The interventions were a daily micronutrient-rich nutritional supplement, or two 1-hour physical activity classes per week, or both interventions, or neither, for 24 months. The primary outcomes, assessed blind to allocation, were incidence of pneumonia over 24 months, and physical function assessed by walking capacity 24 months after enrolment. Adherence was good for the nutritional supplement (∼75%), and moderate for the physical activity intervention (∼43%). Over 24 months the incidence rate of pneumonia did not differ between intervention and control clusters (32.5 versus 32.6 per 1,000 person years respectively; risk ratio = 1.00; 95% confidence interval 0.61–1.63; p = 0.99). In intention-to-treat analysis, after 24 months there was a significant difference in walking capacity between the intervention and control clusters (mean difference 33.8 meters; 95% confidence interval 13.9–53.8; p = 0.001). The overall cost of the physical activity intervention over 24 months was US$164/participant; equivalent to US$4.84/extra meter walked. The number of falls and fractures was balanced across physical activity intervention arms and no serious adverse events were reported for either intervention. Conclusions Chile's nutritional supplementation program for older

  16. Homologous regulators, CnfR1 and CnfR2, activate expression of two distinct nitrogenase gene clusters in the filamentous cyanobacterium Anabaena variabilis ATCC 29413.

    PubMed

    Pratte, Brenda S; Thiel, Teresa

    2016-06-01

    The cyanobacterium Anabaena variabilis has two Mo-nitrogenases that function under different environmental conditions in different cell types. The heterocyst-specific nitrogenase encoded by the large nif1 gene cluster and the similar nif2 gene cluster that functions under anaerobic conditions in vegetative cells are under the control of the promoter for the first gene of each cluster, nifB1 or nifB2 respectively. Associated with each of these clusters is a putative regulatory gene called cnfR (patB) whose product has a C-terminal HTH domain and an N-terminal ferredoxin-like domain. CnfR1 activates nifB1 expression in heterocysts, while CnfR2 activates nifB2 expression. A cnfR1 mutant was unable to make nitrogenase under aerobic conditions in heterocysts while the cnfR2 mutant was unable to make nitrogenase under anaerobic conditions. Mutations in cnfR1 and cnfR2 reduced transcripts for the nif1 and nif2 genes respectively. The closely related cyanobacterium, Anabaena sp. PCC 7120 has the nif1 system but lacks nif2. Expression of nifB2:lacZ from A. variabilis in anaerobic vegetative cells of Anabaena sp. PCC 7120 depended on the presence of cnfR2. This suggests that CnfR2 is necessary and sufficient for activation of the nifB2 promoter and that the CnfR1/CnfR2 family of proteins are the primary activators of nitrogenase gene expression in cyanobacteria. PMID:26950042

  17. Reciprocal control of RNA-binding and aconitase activity in the regulation of the iron-responsive element binding protein: role of the iron-sulfur cluster.

    PubMed

    Haile, D J; Rouault, T A; Tang, C K; Chin, J; Harford, J B; Klausner, R D

    1992-08-15

    Several mechanisms of posttranscriptional gene regulation are involved in regulation of the expression of essential proteins of iron metabolism. Coordinate regulation of ferritin and transferrin receptor expression is produced by binding of a cytosolic protein, the iron-responsive element binding protein (IRE-BP) to specific stem-loop structures present in target RNAs. The affinity of this protein for its cognate RNA is regulated by the cell in response to changes in iron availability. The IRE-BP demonstrates a striking level of amino acid sequence identity to the iron-sulfur (Fe-S) protein mitochondrial aconitase. Moreover, the recombinant IRE-BP has aconitase function. The lability of the Fe-S cluster in mitochondrial aconitase has led us to propose that the mechanism by which iron levels are sensed by the IRE-BP involves changes in an Fe-S cluster in the IRE-BP. In this study, we demonstrate that procedures aimed at altering the IRE-BP Fe-S cluster in vitro reciprocally alter the RNA binding and aconitase activity of the IRE-BP. The changes in the RNA binding of the protein produced in vitro appear to match the previously described alterations of the protein in response to iron availability in the cell. Furthermore, iron manipulation of cells correlates with the activation or inactivation of the IRE-BP aconitase activity. The results are consistent with a model for the posttranslational regulation of the IRE-BP in which the Fe-S cluster is altered in response to the availability of intracellular iron and this, in turn, regulates the RNA-binding activity. PMID:1502165

  18. Selectivity of Chemisorbed Oxygen in C–H Bond Activation and CO Oxidation and Kinetic Consequences for CH₄–O₂ Catalysis on Pt and Rh Clusters

    SciTech Connect

    Chin, Ya-Huei; Buda, Corneliu; Neurock, Matthew; Iglesia, Enrique

    2011-10-06

    Rate measurements, density functional theory (DFT) within the framework of transition state theory, and ensemble-averaging methods are used to probe oxygen selectivities, defined as the reaction probability ratios for O* reactions with CO and CH₄, during CH₄–O₂ catalysis on Pt and Rh clusters. CO₂ and H₂O are the predominant products, but small amounts of CO form as chemisorbed oxygen atoms (O*) are depleted from cluster surfaces. Oxygen selectivities, measured using ¹²CO–¹³CH₄–O₂ reactants, increase with O₂/ CO ratio and O* coverage and are much larger than unity at all conditions on Pt clusters. These results suggest that O* reacts much faster with CO than with CH₄, causing any CO that forms and desorbs from metal cluster surfaces to react along the reactor bed with other O* to produce CO₂ at any residence time required for detectable extents of CH₄ conversion. O* selectivities were also calculated by averaging DFTderived activation barriers for CO and CH₄ oxidation reactions over all distinct surface sites on cubo-octahedral Pt clusters (1.8 nm diameter, 201 Pt atoms) at low O* coverages, which are prevalent at low O₂ pressures during catalysis. CO oxidation involves non-activated molecular CO adsorption as the kinetically relevant step on exposed Pt atoms vicinal of chemisorbed O* atoms (on *–O* site pairs). CH₄ oxidation occurs via kinetically relevant C–H bond activation on *–* site pairs involving oxidative insertion of a Pt atom into one of the C–H bonds in CH₄, forming a three-centered HC₃–Pt–H transition state. C–H bond activation barriers reflect the strength of Pt–CH₃ and Pt–H interactions at the transition state, which correlates, in turn, with the Pt coordination and with CH₃ * binding energies. Ensemble-averaged O* selectivities increase linearly with O₂/CO ratios, which define the O* coverages, via a proportionality constant. The proportionality constant is given by the ratio of rate

  19. VEGF-Induced Expression of miR-17–92 Cluster in Endothelial Cells Is Mediated by ERK/ELK1 Activation and Regulates Angiogenesis

    PubMed Central

    Chamorro-Jorganes, Aránzazu; Lee, Monica Y.; Araldi, Elisa; Landskroner-Eiger, Shira; Fernández-Fuertes, Marta; Sahraei, Mahnaz; Quiles del Rey, Maria; van Solingen, Coen; Yu, Jun; Fernández-Hernando, Carlos; Sessa, William C.

    2016-01-01

    Rationale: Several lines of evidence indicate that the regulation of microRNA (miRNA) levels by different stimuli may contribute to the modulation of stimulus-induced responses. The miR-17–92 cluster has been linked to tumor development and angiogenesis, but its role in vascular endothelial growth factor–induced endothelial cell (EC) functions is unclear and its regulation is unknown. Objective: The purpose of this study was to elucidate the mechanism by which VEGF regulates the expression of miR-17–92 cluster in ECs and determine its contribution to the regulation of endothelial angiogenic functions, both in vitro and in vivo. This was done by analyzing the effect of postnatal inactivation of miR-17–92 cluster in the endothelium (miR-17–92 iEC-KO mice) on developmental retinal angiogenesis, VEGF-induced ear angiogenesis, and tumor angiogenesis. Methods and Results: Here, we show that Erk/Elk1 activation on VEGF stimulation of ECs is responsible for Elk-1-mediated transcription activation (chromatin immunoprecipitation analysis) of the miR-17–92 cluster. Furthermore, we demonstrate that VEGF-mediated upregulation of the miR-17–92 cluster in vitro is necessary for EC proliferation and angiogenic sprouting. Finally, we provide genetic evidence that miR-17–92 iEC-KO mice have blunted physiological retinal angiogenesis during development and diminished VEGF-induced ear angiogenesis and tumor angiogenesis. Computational analysis and rescue experiments show that PTEN (phosphatase and tensin homolog) is a target of the miR-17–92 cluster and is a crucial mediator of miR-17-92–induced EC proliferation. However, the angiogenic transcriptional program is reduced when miR-17–92 is inhibited. Conclusions: Taken together, our results indicate that VEGF-induced miR-17–92 cluster expression contributes to the angiogenic switch of ECs and participates in the regulation of angiogenesis. PMID:26472816

  20. Data Clustering

    NASA Astrophysics Data System (ADS)

    Wagstaff, Kiri L.

    2012-03-01

    On obtaining a new data set, the researcher is immediately faced with the challenge of obtaining a high-level understanding from the observations. What does a typical item look like? What are the dominant trends? How many distinct groups are included in the data set, and how is each one characterized? Which observable values are common, and which rarely occur? Which items stand out as anomalies or outliers from the rest of the data? This challenge is exacerbated by the steady growth in data set size [11] as new instruments push into new frontiers of parameter space, via improvements in temporal, spatial, and spectral resolution, or by the desire to "fuse" observations from different modalities and instruments into a larger-picture understanding of the same underlying phenomenon. Data clustering algorithms provide a variety of solutions for this task. They can generate summaries, locate outliers, compress data, identify dense or sparse regions of feature space, and build data models. It is useful to note up front that "clusters" in this context refer to groups of items within some descriptive feature space, not (necessarily) to "galaxy clusters" which are dense regions in physical space. The goal of this chapter is to survey a variety of data clustering methods, with an eye toward their applicability to astronomical data analysis. In addition to improving the individual researcher’s understanding of a given data set, clustering has led directly to scientific advances, such as the discovery of new subclasses of stars [14] and gamma-ray bursts (GRBs) [38]. All clustering algorithms seek to identify groups within a data set that reflect some observed, quantifiable structure. Clustering is traditionally an unsupervised approach to data analysis, in the sense that it operates without any direct guidance about which items should be assigned to which clusters. There has been a recent trend in the clustering literature toward supporting semisupervised or constrained

  1. A Pt-cluster-based heterogeneous catalyst for homogeneous catalytic reactions: X-ray absorption spectroscopy and reaction kinetic studies of their activity and stability against leaching.

    PubMed

    Li, Yimin; Liu, Jack Hung-Chang; Witham, Cole A; Huang, Wenyu; Marcus, Matthew A; Fakra, Sirine C; Alayoglu, Pinar; Zhu, Zhongwei; Thompson, Christopher M; Arjun, Arpana; Lee, Kihong; Gross, Elad; Toste, F Dean; Somorjai, Gabor A

    2011-08-31

    The design and development of metal-cluster-based heterogeneous catalysts with high activity, selectivity, and stability under solution-phase reaction conditions will enable their applications as recyclable catalysts in large-scale fine chemicals production. To achieve these required catalytic properties, a heterogeneous catalyst must contain specific catalytically active species in high concentration, and the active species must be stabilized on a solid catalyst support under solution-phase reaction conditions. These requirements pose a great challenge for catalysis research to design metal-cluster-based catalysts for solution-phase catalytic processes. Here, we focus on a silica-supported, polymer-encapsulated Pt catalyst for an electrophilic hydroalkoxylation reaction in toluene, which exhibits superior selectivity and stability against leaching under mild reaction conditions. We unveil the key factors leading to the observed superior catalytic performance by combining X-ray absorption spectroscopy (XAS) and reaction kinetic studies. On the basis of the mechanistic understandings obtained in this work, we also provide useful guidelines for designing metal-cluster-based catalyst for a broader range of reactions in the solution phase. PMID:21721543

  2. The origin of the selectivity and activity of ruthenium-cluster catalysts for fuel-cell feed-gas purification: a gas-phase approach.

    PubMed

    Lang, Sandra M; Bernhardt, Thorsten M; Krstić, Marjan; Bonačić-Koutecký, Vlasta

    2014-05-19

    Gas-phase ruthenium clusters Ru(n)(+) (n=2-6) are employed as model systems to discover the origin of the outstanding performance of supported sub-nanometer ruthenium particles in the catalytic CO methanation reaction with relevance to the hydrogen feed-gas purification for advanced fuel-cell applications. Using ion-trap mass spectrometry in conjunction with first-principles density functional theory calculations three fundamental properties of these clusters are identified which determine the selectivity and catalytic activity: high reactivity toward CO in contrast to inertness in the reaction with CO2; promotion of cooperatively enhanced H2 coadsorption and dissociation on pre-formed ruthenium carbonyl clusters, that is, no CO poisoning occurs; and the presence of Ru-atom sites with a low number of metal-metal bonds, which are particularly active for H2 coadsorption and activation. Furthermore, comprehensive theoretical investigations provide mechanistic insight into the CO methanation reaction and discover a reaction route involving the formation of a formyl-type intermediate. PMID:24803209

  3. Role of the [4Fe-4S] cluster in reductive activation of the cobalt center of the corrinoid iron-sulfur protein from Clostridium thermoaceticum during acetate biosynthesis.

    PubMed

    Menon, S; Ragsdale, S W

    1998-04-21

    The corrinoid iron-sulfur protein (CFeSP) from Clostridium thermoaceticum functions as a methyl carrier in the Wood-Ljungdahl pathway of acetyl-CoA synthesis. The small subunit (33 kDa) contains cobalt in a corrinoid cofactor, and the large subunit (55 kDa) contains a [4Fe-4S] cluster. The cobalt center is methylated by methyltetrahydrofolate (CH3-H4folate) to form a methylcobalt intermediate and, subsequently, is demethylated by carbon monoxide dehydrogenase/acetyl-CoA synthase (CODH/ACS). The work described here demonstrates that the [4Fe-4S] cluster is required to facilitate the reactivation of oxidatively inactivated Cob(II)amide to the active Co(I) state. Site-directed mutagenesis of the large subunit gene was used to change residue 20 from cysteine to alanine, which resulted in formation of a cluster with EPR and redox properties consistent with those of [3Fe-4S] clusters. The midpoint potential of the cluster in the C20A variant was approximately 500 mV more positive than that of the [4Fe-4S] cluster in the native enzyme. Accordingly, it was found that the Co center in the C20A mutant protein could be reduced artificially but was severely crippled in its ability to be reduced by physiological electron donors. This is probably because the reduced cluster of the C20A protein cannot provide the driving force needed to reduce Co(II) to Co(I), since the Co(II/I) midpoint potential is -504 mV. The C20A variant also was unable to catalyze the steady-state synthesis of acetyl-CoA when CH3-H4folate or methyl iodide were provided as methyl donors and CO and CODH/ACS as reductants. Addition of chemical reductants rescued the catalytically crippled variant form in both of these reactions. On the other hand, in single-turnover reactions, the methyl-Co state of the altered protein was fully active in methylating H4folate and in synthesizing acetyl-CoA in the presence of CO and CoA. The combined results strongly indicate that the FeS cluster of the CFeSP is necessary for

  4. INVESTIGATION OF DUAL ACTIVE NUCLEI, OUTFLOWS, SHOCK-HEATED GAS, AND YOUNG STAR CLUSTERS IN MARKARIAN 266

    SciTech Connect

    Mazzarella, J. M.; Chan, B. H. P.; Iwasawa, K. E-mail: bchan@ipac.caltech.edu; and others

    2012-11-01

    Results of observations with the Spitzer, Hubble, GALEX, Chandra, and XMM-Newton space telescopes are presented for the luminous infrared galaxy (LIRG) merger Markarian 266. The SW (Seyfert 2) and NE (LINER) nuclei reside in galaxies with Hubble types SBb (pec) and S0/a (pec), respectively. Both companions are more luminous than L* galaxies and they are inferred to each contain a Almost-Equal-To 2.5 Multiplication-Sign 10{sup 8} M{sub Sun} black hole. Although the nuclei have an observed hard X-ray flux ratio of f{sub X} (NE)/f{sub X} (SW) = 6.4, Mrk 266 SW is likely the primary source of a bright Fe K{alpha} line detected from the system, consistent with the reflection-dominated X-ray spectrum of a heavily obscured active galactic nucleus (AGN). Optical knots embedded in an arc with aligned radio continuum radiation, combined with luminous H{sub 2} line emission, provide evidence for a radiative bow shock in an AGN-driven outflow surrounding the NE nucleus. A soft X-ray emission feature modeled as shock-heated plasma with T {approx} 10{sup 7} K is cospatial with radio continuum emission between the galaxies. Mid-infrared diagnostics provide mixed results, but overall suggest a composite system with roughly equal contributions of AGN and starburst radiation powering the bolometric luminosity. Approximately 120 star clusters have been detected, with most having estimated ages less than 50 Myr. Detection of 24 {mu}m emission aligned with soft X-rays, radio continuum, and ionized gas emission extending {approx}34'' (20 kpc) north of the galaxies is interpreted as {approx}2 Multiplication-Sign 10{sup 7} M{sub Sun} of dust entrained in an outflowing superwind. At optical wavelengths this Northern Loop region is resolved into a fragmented morphology indicative of Rayleigh-Taylor instabilities in an expanding shell of ionized gas. Mrk 266 demonstrates that the dust 'blow-out' phase can begin in a LIRG well before the galaxies fully coalesce during a subsequent

  5. Cocaine users with comorbid Cluster B personality disorders show dysfunctional brain activation and connectivity in the emotional regulation networks during negative emotion maintenance and reappraisal.

    PubMed

    Albein-Urios, Natalia; Verdejo-Román, Juan; Soriano-Mas, Carles; Asensio, Samuel; Martínez-González, José Miguel; Verdejo-García, Antonio

    2013-12-01

    Cocaine dependence often co-occurs with Cluster B personality disorders. Since both disorders are characterized by emotion regulation deficits, we predicted that cocaine comorbid patients would exhibit dysfunctional patterns of brain activation and connectivity during reappraisal of negative emotions. We recruited 18 cocaine users with comorbid Cluster B personality disorders, 17 cocaine users without comorbidities and 21 controls to be scanned using functional magnetic resonance imaging (fMRI) during performance on a reappraisal task in which they had to maintain or suppress the emotions induced by negative affective stimuli. We followed region of interest (ROI) and whole-brain approaches to investigate brain activations and connectivity associated with negative emotion experience and reappraisal. Results showed that cocaine users with comorbid personality disorders had reduced activation of the subgenual anterior cingulate cortex during negative emotion maintenance and increased activation of the lateral orbitofrontal cortex and the amygdala during reappraisal. Amygdala activation correlated with impulsivity and antisocial beliefs in the comorbid group. Connectivity analyses showed that in the cocaine comorbid group the subgenual cingulate was less efficiently connected with the amygdala and the fusiform gyri and more efficiently connected with the anterior insula during maintenance, whereas during reappraisal the left orbitofrontal cortex was more efficiently connected with the amygdala and the right orbitofrontal cortex was less efficiently connected with the dorsal striatum. We conclude that cocaine users with comorbid Cluster B personality disorders have distinctive patterns of brain activation and connectivity during maintenance and reappraisal of negative emotions, which correlate with impulsivity and dysfunctional beliefs. PMID:23712090

  6. The age-mass-metallicity-activity relation for solar-type stars: comparisons with asteroseismology and the NGC 188 open cluster

    NASA Astrophysics Data System (ADS)

    Lorenzo-Oliveira, D.; Porto de Mello, G. F.; Schiavon, R. P.

    2016-10-01

    Context. The Mount Wilson Ca ii index log(R'_HK) is the accepted standard metric of calibration for the chromospheric activity versus age relation for FGK stars. Recent results claim its inability to discern activity levels, and thus ages, for stars older than ~2 Gyr, which would severely hamper its application to date disk stars older than the Sun. Aims: We present a new activity-age calibration of the Mt. Wilson index that explicitly takes mass and [Fe/H] biases into account; these biases are implicit in samples of stars selected to have precise ages, which have so far not been appreciated. Methods: We show that these selection biases tend to blur the activity-age relation for large age ranges. We calibrate the Mt. Wilson index for a sample of field FGK stars with precise ages, covering a wide range of mass and [Fe/H] , augmented with data from the Pleiades, Hyades, M 67 clusters, and the Ursa Major moving group. Results: We further test the calibration with extensive new Gemini/GMOS log ()R'HK) data of the old, solar [Fe/H] clusters, M 67 and NGC 188. The observed NGC 188 activity level is clearly lower than M 67. We correctly recover the isochronal age of both clusters and establish the viability of deriving usable chromospheric ages for solar-type stars up to at least ~6 Gyr, where average errors are ~0.14 dex provided that we explicitly account for the mass and [Fe/H] dimensions. We test our calibration against asteroseismological ages, finding excellent correlation (ρ = + 0.89). We show that our calibration improves the chromospheric age determination for a wide range of ages, masses, and metallicities in comparison to previous age-activity relations.

  7. Disruption of Transcriptional Coactivator Sub1 Leads to Genome-Wide Re-distribution of Clustered Mutations Induced by APOBEC in Active Yeast Genes.

    PubMed

    Lada, Artem G; Kliver, Sergei F; Dhar, Alok; Polev, Dmitrii E; Masharsky, Alexey E; Rogozin, Igor B; Pavlov, Youri I

    2015-05-01

    Mutations in genomes of species are frequently distributed non-randomly, resulting in mutation clusters, including recently discovered kataegis in tumors. DNA editing deaminases play the prominent role in the etiology of these mutations. To gain insight into the enigmatic mechanisms of localized hypermutagenesis that lead to cluster formation, we analyzed the mutational single nucleotide variations (SNV) data obtained by whole-genome sequencing of drug-resistant mutants induced in yeast diploids by AID/APOBEC deaminase and base analog 6-HAP. Deaminase from sea lamprey, PmCDA1, induced robust clusters, while 6-HAP induced a few weak ones. We found that PmCDA1, AID, and APOBEC1 deaminases preferentially mutate the beginning of the actively transcribed genes. Inactivation of transcription initiation factor Sub1 strongly reduced deaminase-induced can1 mutation frequency, but, surprisingly, did not decrease the total SNV load in genomes. However, the SNVs in the genomes of the sub1 clones were re-distributed, and the effect of mutation clustering in the regions of transcription initiation was even more pronounced. At the same time, the mutation density in the protein-coding regions was reduced, resulting in the decrease of phenotypically detected mutants. We propose that the induction of clustered mutations by deaminases involves: a) the exposure of ssDNA strands during transcription and loss of protection of ssDNA due to the depletion of ssDNA-binding proteins, such as Sub1, and b) attainment of conditions favorable for APOBEC action in subpopulation of cells, leading to enzymatic deamination within the currently expressed genes. This model is applicable to both the initial and the later stages of oncogenic transformation and explains variations in the distribution of mutations and kataegis events in different tumor cells. PMID:25941824

  8. IscS from Archaeoglobus fulgidus has no desulfurase activity but may provide a cysteine ligand for [Fe2S2] cluster assembly.

    PubMed

    Pagnier, Adrien; Nicolet, Yvain; Fontecilla-Camps, Juan C

    2015-06-01

    Iron sulfur ([Fe-S]) clusters are essential prosthetic groups involved in fundamental cell processes such as gene expression regulation, electron transfer and Lewis acid base chemistry. Central components of their biogenesis are pyridoxal-5'-phosphate (PLP) dependent l-cysteine desulfurases, which provide the necessary S atoms for [Fe-S] cluster assembly. The archaeon Archaeoglobus fulgidus (Af) has two ORFs, which although annotated as l-cysteine desulfurases of the ISC type (IscS), lack the essential Lys residue (K199 in Af) that forms a Schiff base with PLP. We have previously determined the structure of an Af(IscU-D35A-IscS)2 complex heterologously expressed in Escherichia coli and found it to contain a [Fe2S2] cluster. In order to understand the origin of sulfide in that structure we have performed a series of functional tests using wild type and mutated forms of AfIscS. In addition, we have determined the crystal structure of an AfIscS-D199K mutant. From these studies we conclude that: i) AfIscS has no desulfurase activity; ii) in our in vitro [Fe2S2] cluster assembly experiments, sulfide ions are non-enzymatically generated by a mixture of iron, l-cysteine and PLP and iii) the physiological role of AfIscS may be to provide a cysteine ligand to the nascent cluster as observed in the [Fe2S2]-Af(IscU-D35A-IscS)2 complex. This article is part of a Special Issue entitled: Fe/S proteins: Analysis, structure, function, biogenesis and diseases.

  9. Disruption of Transcriptional Coactivator Sub1 Leads to Genome-Wide Re-distribution of Clustered Mutations Induced by APOBEC in Active Yeast Genes.

    PubMed

    Lada, Artem G; Kliver, Sergei F; Dhar, Alok; Polev, Dmitrii E; Masharsky, Alexey E; Rogozin, Igor B; Pavlov, Youri I

    2015-05-01

    Mutations in genomes of species are frequently distributed non-randomly, resulting in mutation clusters, including recently discovered kataegis in tumors. DNA editing deaminases play the prominent role in the etiology of these mutations. To gain insight into the enigmatic mechanisms of localized hypermutagenesis that lead to cluster formation, we analyzed the mutational single nucleotide variations (SNV) data obtained by whole-genome sequencing of drug-resistant mutants induced in yeast diploids by AID/APOBEC deaminase and base analog 6-HAP. Deaminase from sea lamprey, PmCDA1, induced robust clusters, while 6-HAP induced a few weak ones. We found that PmCDA1, AID, and APOBEC1 deaminases preferentially mutate the beginning of the actively transcribed genes. Inactivation of transcription initiation factor Sub1 strongly reduced deaminase-induced can1 mutation frequency, but, surprisingly, did not decrease the total SNV load in genomes. However, the SNVs in the genomes of the sub1 clones were re-distributed, and the effect of mutation clustering in the regions of transcription initiation was even more pronounced. At the same time, the mutation density in the protein-coding regions was reduced, resulting in the decrease of phenotypically detected mutants. We propose that the induction of clustered mutations by deaminases involves: a) the exposure of ssDNA strands during transcription and loss of protection of ssDNA due to the depletion of ssDNA-binding proteins, such as Sub1, and b) attainment of conditions favorable for APOBEC action in subpopulation of cells, leading to enzymatic deamination within the currently expressed genes. This model is applicable to both the initial and the later stages of oncogenic transformation and explains variations in the distribution of mutations and kataegis events in different tumor cells.

  10. Violent interaction between the active galactic nucleus and the hot gas in the core of the galaxy cluster Sérsic 159-03

    NASA Astrophysics Data System (ADS)

    Werner, N.; Sun, M.; Bagchi, J.; Allen, S. W.; Taylor, G. B.; Sirothia, S. K.; Simionescu, A.; Million, E. T.; Jacob, J.; Donahue, M.

    2011-08-01

    We present a multiwavelength study of the energetic interaction between the central active galactic nucleus (AGN), the intracluster medium (ICM) and the optical emission-line nebula in the galaxy cluster Sérsic 159-03. We use X-ray data from Chandra, high-resolution X-ray spectra and ultraviolet (UV) images from XMM-Newton, Hα images from the Southern Astrophysics Research Telescope, Hubble Space Telescope optical imaging, and Very Large Array and Giant Metrewave Radio Telescope radio data. The cluster centre displays signs of powerful AGN feedback, which has cleared the central regions (r < 7.5 kpc) of a dense, X-ray-emitting ICM. X-ray spectral maps reveal a high-pressure ring surrounding the central AGN at a radius of r˜ 15 kpc, indicating an AGN-driven weak shock. The cluster harbours a bright, 44 kpc long Hα+[N II] filament extending from the centre of the cD galaxy to the north. Along the filament, we see low-entropy, high-metallicity, cooling X-ray gas. The gas in the filament has most likely been uplifted by 'radio mode' AGN activity and subsequently stripped from the galaxy due to its relative southward motion. Because this X-ray gas has been removed from the direct influence of the AGN jets, part of it cools and forms stars as indicated by the observed dust lanes, molecular and ionized emission-line nebulae and the excess UV emission.

  11. The Clusters-in-a-Liquid Approach for Solvation: New Insights from the Conformer Specific Gas Phase Spectroscopy and Vibrational Optical Activity Spectroscopy

    PubMed Central

    Perera, Angelo S.; Thomas, Javix; Poopari, Mohammad R.; Xu, Yunjie

    2016-01-01

    Vibrational optical activity spectroscopies, namely vibrational circular dichroism (VCD) and Raman optical activity (ROA), have been emerged in the past decade as powerful spectroscopic tools for stereochemical information of a wide range of chiral compounds in solution directly. More recently, their applications in unveiling solvent effects, especially those associated with water solvent, have been explored. In this review article, we first select a few examples to demonstrate the unique sensitivity of VCD spectral signatures to both bulk solvent effects and explicit hydrogen-bonding interactions in solution. Second, we discuss the induced solvent chirality, or chiral transfer, VCD spectral features observed in the water bending band region in detail. From these chirality transfer spectral data, the related conformer specific gas phase spectroscopic studies of small chiral hydration clusters, and the associated matrix isolation VCD experiments of hydrogen-bonded complexes in cold rare gas matrices, a general picture of solvation in aqueous solution emerges. In such an aqueous solution, some small chiral hydration clusters, rather than the chiral solutes themselves, are the dominant species and are the ones that contribute mainly to the experimentally observed VCD features. We then review a series of VCD studies of amino acids and their derivatives in aqueous solution under different pHs to emphasize the importance of the inclusion of the bulk solvent effects. These experimental data and the associated theoretical analyses are the foundation for the proposed “clusters-in-a-liquid” approach to account for solvent effects effectively. We present several approaches to identify and build such representative chiral hydration clusters. Recent studies which applied molecular dynamics simulations and the subsequent snapshot averaging approach to generate the ROA, VCD, electronic CD, and optical rotatory dispersion spectra are also reviewed. Challenges associated with

  12. The clusters-in-a-liquid approach for solvation: New insights from the conformer specific gas phase spectroscopy and vibrational optical activity spectroscopy

    NASA Astrophysics Data System (ADS)

    Xu, Yunjie; Perera, Angelo; Thomas, Javix; Poopari, Mohammad

    2016-02-01

    Vibrational optical activity spectroscopies, namely vibrational circular dichroism (VCD) and Raman optical activity (ROA), have been emerged in the past decade as a powerful spectroscopic tool for stereochemical information of a wide range of chiral compounds in solution directly. More recently, their applications in unveiling solvent effects, especially those associated with water solvent, have been explored. In this review article, we first select a few examples to demonstrate the unique sensitivity of VCD spectral signatures to both bulk solvent effects and explicit hydrogen-bonding interactions in solution. Second, we discuss the induced solvent chirality, or chiral transfer, VCD spectral features observed at the water bending band region in detail. From these chirality transfer spectral data, the related conformer specific gas phase spectroscopic studies of small chiral hydration clusters, and the associated matrix isolation VCD experiments of hydrogen-bonded complexes in cold rare gas matrices, a general picture of solvation in aqueous solution emerges. In such an aqueous solution, some small chiral hydration clusters, rather than the chiral solutes themselves, are the dominant species and are the ones who contribute mainly to the experimentally observed VCD features. We then review a series of VCD studies of amino acids and their derivatives in aqueous solution under different pHs to emphasize the importance of the inclusion of the bulk solvent effects. These experimental data and the associated theoretical analyses are the foundation for the proposed “clusters-in-a-liquid” approach to account for solvent effects effectively. We present several approaches to identify and build such representative chiral hydration clusters. Recent studies which applied molecular dynamics simulations and the subsequent snapshot averaging approach to generate the ROA, electronic CD, and optical rotatory dispersion spectra are also reviewed. Challenges associated with the

  13. PERK regulated miR-424(322)-503 cluster fine-tunes activation of IRE1 and ATF6 during Unfolded Protein Response

    PubMed Central

    Gupta, Ananya; Hossain, Muhammad Mosaraf; Read, Danielle E.; Hetz, Claudio; Samali, Afshin; Gupta, Sanjeev

    2015-01-01

    The endoplasmic reticulum (ER) responds to changes in intracellular homeostasis through activation of the unfolded protein response (UPR). UPR can facilitate the restoration of cellular homeostasis, via the concerted activation of three ER stress sensors, namely IRE1, PERK and ATF6. Global approaches in several cellular contexts have revealed that UPR regulates the expression of many miRNAs that play an important role in the regulation of life and death decisions during UPR. Here we show that expression of miR-424(322)-503 cluster is downregulated during UPR. IRE1 inhibitor (4 μ8C) and deficiency of XBP1 had no effect on downregulation of miR-424(322)-503 during UPR. Treatment of cells with CCT030312, a selective activator of EIF2AK3/PERK signalling, leads to the downregulation of miR-424(322)-503 expression. The repression of miR-424(322)-503 cluster during conditions of ER stress is compromised in PERK-deficient MEFs. miR-424 regulates the expression of ATF6 via a miR-424 binding site in its 3′ UTR and attenuates the ATF6 transcriptional activity during UPR. Further miR-424 had no effect on IRE1-XBP1 axis but enhanced the regulated IRE1-dependent decay (RIDD). Our results suggest that miR-424 constitutes an obligatory fine-tuning mechanism where PERK-mediated downregulation of miR-424(322)-503 cluster regulates optimal activation of IRE1 and ATF6 during conditions of ER stress. PMID:26674075

  14. Activation and silencing of secondary metabolites in Streptomyces albus and Streptomyces lividans after transformation with cosmids containing the thienamycin gene cluster from Streptomyces cattleya.

    PubMed

    Braña, Alfredo F; Rodríguez, Miriam; Pahari, Pallab; Rohr, Jurgen; García, Luis A; Blanco, Gloria

    2014-05-01

    Activation and silencing of antibiotic production was achieved in Streptomyces albus J1074 and Streptomyces lividans TK21 after introduction of genes within the thienamycin cluster from S. cattleya. Dramatic phenotypic and metabolic changes, involving activation of multiple silent secondary metabolites and silencing of others normally produced, were found in recombinant strains harbouring the thienamycin cluster in comparison to the parental strains. In S. albus, ultra-performance liquid chromatography purification and NMR structural elucidation revealed the identity of four structurally related activated compounds: the antibiotics paulomycins A, B and the paulomenols A and B. Four volatile compounds whose biosynthesis was switched off were identified by gas chromatography-mass spectrometry analyses and databases comparison as pyrazines; including tetramethylpyrazine, a compound with important clinical applications to our knowledge never reported to be produced by Streptomyces. In addition, this work revealed the potential of S. albus to produce many others secondary metabolites normally obtained from plants, including compounds of medical relevance as dihydro-β-agarofuran and of interest in perfume industry as β-patchoulene, suggesting that it might be an alternative model for their industrial production. In S. lividans, actinorhodins production was strongly activated in the recombinant strains whereas undecylprodigiosins were significantly reduced. Activation of cryptic metabolites in Streptomyces species might represent an alternative approach for pharmaceutical drug discovery.

  15. Friedreich's Ataxia Variants I154F and W155R Diminish Frataxin-Based Activation of the Iron-Sulfur Cluster Assembly Complex

    SciTech Connect

    Tsai, Chi-Lin; Bridwell-Rabb, Jennifer; Barondeau, David P

    2011-11-07

    Friedreich's ataxia (FRDA) is a progressive neurodegenerative disease that has been linked to defects in the protein frataxin (Fxn). Most FRDA patients have a GAA expansion in the first intron of their Fxn gene that decreases protein expression. Some FRDA patients have a GAA expansion on one allele and a missense mutation on the other allele. Few functional details are known for the ~15 different missense mutations identified in FRDA patients. Here in vitro evidence is presented that indicates the FRDA I154F and W155R variants bind more weakly to the complex of Nfs1, Isd11, and Isu2 and thereby are defective in forming the four-component SDUF complex that constitutes the core of the Fe-S cluster assembly machine. The binding affinities follow the trend Fxn ~ I154F > W155F > W155A ~ W155R. The Fxn variants also have diminished ability to function as part of the SDUF complex to stimulate the cysteine desulfurase reaction and facilitate Fe-S cluster assembly. Four crystal structures, including the first for a FRDA variant, reveal specific rearrangements associated with the loss of function and lead to a model for Fxn-based activation of the Fe-S cluster assembly complex. Importantly, the weaker binding and lower activity for FRDA variants correlate with the severity of disease progression. Together, these results suggest that Fxn facilitates sulfur transfer from Nfs1 to Isu2 and that these in vitro assays are sensitive and appropriate for deciphering functional defects and mechanistic details for human Fe-S cluster biosynthesis.

  16. Yeast zinc cluster proteins Dal81 and Uga3 cooperate by targeting common coactivators for transcriptional activation of γ-aminobutyrate responsive genes.

    PubMed

    Sylvain, Marc-André; Liang, Xiao Bei; Hellauer, Karen; Turcotte, Bernard

    2011-07-01

    In Saccharomyces cerevisiae, optimal utilization of various compounds as a nitrogen source is mediated by a complex transcriptional network. The zinc cluster protein Dal81 is a general activator of nitrogen metabolic genes, including those for γ-aminobutyrate (GABA). In contrast, Uga3 (another zinc cluster protein) is an activator restricted to the control of genes involved in utilization of GABA. Uga3 binds to DNA elements found in the promoters of target genes and increases their expression in the presence of GABA. Dal81 appears to act as a coactivator since the DNA-binding activity of this factor is dispensable but its mode of action is not known. In this study, we have mapped a regulatory, as well as an activating, region for Uga3. A LexA-Uga3 chimeric protein activates a lexA reporter in a GABA- and Dal81-dependent manner. Activation by Uga3 requires the SAGA complex as well as Gal11, a component of mediator. ChIP analysis revealed that Uga3 is weakly bound to target promoters. The presence of GABA enhances binding of Uga3 and allows recruitment of Dal81 and Gal11 to target genes. Recruitment of Gal11 is prevented in the absence of Dal81. Importantly, Dal81 by itself is a potent activator when tethered to DNA and its activity depends on SAGA and Gal11 but not Uga3. Overexpression of Uga3 bypasses the requirement for Dal81 but not for SAGA or Gal11. Thus, under artificial conditions, both Dal81 and Uga3 can activate transcription independently of each other. However, under physiological conditions, both factors cooperate by targeting common coactivators.

  17. Rotational Periods and Starspot Activity of Young Solar-Type Dwarfs in the Open Cluster IC 4665

    NASA Technical Reports Server (NTRS)

    Allain, S.; Bouvier, J.; Prosser, C.; Marschall, L. A.; Laaksonen, B. D.

    1995-01-01

    We present the results of a V-band photometric monitoring survey of 15 late-type dwarfs in the young open cluster IC 4665. Low-amplitude periodic light variations are found for 8 stars and ascribed to the modulation by starspots that cover typically a few percent of the stellar disk. Periods range from 0.6 to 3.7 d, translating to equatorial velocities between 13 and 93 km/s. That no period longer than 4 d was detected suggests a relative paucity of extremely slow rotators (V(sub eq) much less than 10 km/s) among late-type dwarfs in IC 4665. The fractional number of slow rotators in IC 4665 is similar to that of Alpha Per cluster, suggesting that IC 4665 is close in age to Alpha Per (approx. 50 Myr).

  18. MASS OUTFLOW AND CHROMOSPHERIC ACTIVITY OF RED GIANT STARS IN GLOBULAR CLUSTERS. II. M13 AND M92

    SciTech Connect

    Meszaros, Sz.; Dupree, A. K.; Szalai, T. E-mail: dupree@cfa.harvard.edu

    2009-05-15

    High-resolution spectra of 123 red giant stars in the globular cluster M13 and 64 red giant stars in M92 were obtained with Hectochelle at the MMT telescope. Emission and line asymmetries in H{alpha} and Ca II K are identified, characterizing motions in the extended atmospheres and seeking differences attributable to metallicity in these clusters and M15. On the red giant branch, emission in H{alpha} generally appears in stars with T {sub eff} {approx}< 4500 K and log L/L {sub sun}{approx}> 2.75. Fainter stars showing emission are asymptotic giant branch (AGB) stars or perhaps binary stars. The line-bisector for H{alpha} reveals the onset of chromospheric expansion in stars more luminous than log (L/L {sub sun}) {approx} 2.5 in all clusters, and this outflow velocity increases with stellar luminosity. However, the coolest giants in the metal-rich M13 show greatly reduced outflow in H{alpha} most probably due to decreased T {sub eff} and changing atmospheric structure. The Ca II K{sub 3} outflow velocities are larger than shown by H{alpha} at the same luminosity and signal accelerating outflows in the chromospheres. Stars clearly on the AGB show faster chromospheric outflows in H{alpha} than RGB objects. While the H{alpha} velocities on the RGB are similar for all metallicities, the AGB stars in the metal-poor M15 and M92 have higher outflow velocities than in the metal-rich M13. Comparison of these chromospheric line profiles in the paired metal-poor clusters, M15 and M92, shows remarkable similarities in the presence of emission and dynamical signatures, and does not reveal a source of the 'second-parameter' effect.

  19. Cool Cluster Correctly Correlated

    SciTech Connect

    Varganov, Sergey Aleksandrovich

    2005-01-01

    Atomic clusters are unique objects, which occupy an intermediate position between atoms and condensed matter systems. For a long time it was thought that physical and chemical properties of atomic dusters monotonically change with increasing size of the cluster from a single atom to a condensed matter system. However, recently it has become clear that many properties of atomic clusters can change drastically with the size of the clusters. Because physical and chemical properties of clusters can be adjusted simply by changing the cluster's size, different applications of atomic clusters were proposed. One example is the catalytic activity of clusters of specific sizes in different chemical reactions. Another example is a potential application of atomic clusters in microelectronics, where their band gaps can be adjusted by simply changing cluster sizes. In recent years significant advances in experimental techniques allow one to synthesize and study atomic clusters of specified sizes. However, the interpretation of the results is often difficult. The theoretical methods are frequently used to help in interpretation of complex experimental data. Most of the theoretical approaches have been based on empirical or semiempirical methods. These methods allow one to study large and small dusters using the same approximations. However, since empirical and semiempirical methods rely on simple models with many parameters, it is often difficult to estimate the quantitative and even qualitative accuracy of the results. On the other hand, because of significant advances in quantum chemical methods and computer capabilities, it is now possible to do high quality ab-initio calculations not only on systems of few atoms but on clusters of practical interest as well. In addition to accurate results for specific clusters, such methods can be used for benchmarking of different empirical and semiempirical approaches. The atomic clusters studied in this work contain from a few atoms to

  20. Quintuplet Cluster

    NASA Technical Reports Server (NTRS)

    1999-01-01

    Penetrating 25,000 light-years of obscuring dust and myriad stars, NASA's Hubble Space Telescope has provided the clearest view yet of one of the largest young clusters of stars inside our Milky Way galaxy, located less than 100 light-years from the very center of the Galaxy. Having the equivalent mass greater than 10,000 stars like our sun, the monster cluster is ten times larger than typical young star clusters scattered throughout our Milky Way. It is destined to be ripped apart in just a few million years by gravitational tidal forces in the galaxy's core. But in its brief lifetime it shines more brightly than any other star cluster in the Galaxy. Quintuplet Cluster is 4 million years old. It has stars on the verge of blowing up as supernovae. It is the home of the brightest star seen in the galaxy, called the Pistol star. This image was taken in infrared light by Hubble's NICMOS camera in September 1997. The false colors correspond to infrared wavelengths. The galactic center stars are white, the red stars are enshrouded in dust or behind dust, and the blue stars are foreground stars between us and the Milky Way's center. The cluster is hidden from direct view behind black dust clouds in the constellation Sagittarius. If the cluster could be seen from earth it would appear to the naked eye as a 3rd magnitude star, 1/6th of a full moon's diameter apart.

  1. High Catalytic Activity and Chemoselectivity of Sub-nanometric Pd Clusters on Porous Nanorods of CeO2 for Hydrogenation of Nitroarenes.

    PubMed

    Zhang, Sai; Chang, Chun-Ran; Huang, Zheng-Qing; Li, Jing; Wu, Zhemin; Ma, Yuanyuan; Zhang, Zhiyun; Wang, Yong; Qu, Yongquan

    2016-03-01

    Sub-nanometric Pd clusters on porous nanorods of CeO2 (PN-CeO2) with a high Pd dispersion of 73.6% exhibit the highest catalytic activity and best chemoselectivity for hydrogenation of nitroarenes to date. For hydrogenation of 4-nitrophenol, the catalysts yield a TOF of ∼44059 h(-1) and a chemoselectivity to 4-aminophenol of >99.9%. The superior catalytic performance can be attributed to a cooperative effect between the highly dispersed sub-nanometric Pd clusters for hydrogen activation and unique surface sites of PN-CeO2 with a high concentration of oxygen vacancy for an energetically and geometrically preferential adsorption of nitroarenes via nitro group. The high concentration of surface defects of PN-CeO2 and large Pd dispersion contribute to the enhanced catalytic activity for the hydrogenation reactions. The high chemoselectivity is mainly governed by the high Pd dispersion on the support. The catalysts also deliver high catalytic activity and selectivity for nitroaromatics with various reducible substituents into the corresponding aminoarenes.

  2. A cluster region of AP-1 responsive elements is required for transcriptional activity of mouse ODC gene by hepatocyte growth factor.

    PubMed

    Bianchi, Laura; Tacchini, Lorenza; Matteucci, Emanuela; Desiderio, Maria Alfonsina

    2002-05-01

    Ornithine decarboxylase (ODC) activity is regulated by a variety of mechanisms including transcription, translation, and RNA and protein half-life. Since in mouse B16-F1 melanoma cells an early and remarkable (about 6-fold) increase in steady state mRNA levels was observed after hepatocyte growth factor (HGF) treatment, we investigated the transcriptional regulation of mouse ODC promoter. Transient transfection of various ODC-luciferase promoter constructs into the B16-Fl cells in combination with electrophoretic mobility shift assays identified the HGF-responsive element as a cluster of three AP-1 binding sites (-1660 to -1572). Even if each site differs from the canonical TPA responsive element for one nucleotide, only the first two AP-1 consensus sequences seemed to be functional since allowed DNA-binding activity of nuclear proteins after HGF treatment. Comparison of the results of transfection assays with the pOD2.5-luc (2.5 kb gene fragment) and with the construct deprived of the AP-1 cluster pOD-B-luc showed that this 50 bp region was required for ODC transactivating activity in response to HGF. Since in B16-F1 cells HGF increased AP-1 activity and the mRNA expression of various AP-1 subunits, we may conclude that HGF-induced transcription of mouse ODC was largely due to triggering of AP-1 pathway. PMID:12054494

  3. Seismic activities of earthquake clusters and small repeating earthquakes in Japan before and after the 2011 off the Pacific coast of Tohoku earthquake

    NASA Astrophysics Data System (ADS)

    Igarashi, T.

    2011-12-01

    The 2011 off the Pacific coast of Tohoku earthquake (M9.0) had a great effect on seismic activities over vast areas. In this study, we investigated spatio-temporal changes of seismic activities of earthquake clusters and small repeating earthquakes before and after the main shock. We have already reported many small repeating earthquakes occur at the upper boundary of the subducting plates in Japan. From these sequences, we can estimate the space-time characteristics of the inter-plate slip. In the 21st century, the resultant slip-rates correspond to relative plate motion in the Ryukyu-arc. In contrast, the shallow part and the southern part of the northeastern Japan arc indicated slip deficits. There were few after-slips following the 2005 off Miyagi earthquake (M7.2), which located near the hypocenter of the 2011 main shock. On the other hand, slip deficits of the southern shallow part were slightly decreased by after-slips following the 2003 and 2008 M7 class earthquakes. We also identified quasi-static slips associated with foreshocks off Miyagi that started from February 2011. After the main shock, we detect many small repeating earthquakes in the aftershocks. The distributions suggest after-slips near the trench of the southeastern part as well as in the deep part of the source region estimated by GPS data analysis. However, some of them are burst-type repeating sequences which occurred only after the main shock. Many continual-type repeating sequences are distributed in the southern part of the source region, and it is difficult to estimate slip-rates in the northern part at present. This uneven distribution may have been caused because observed seismograms are distorted by the multiplicity of the waves to come from various locations, the seismic velocity changes at the propagation path or site, or changes of physical properties at the plate interface. Furthermore, we automatically extracted earthquake clusters by using the unified JMA hypocenter catalogue

  4. Galaxy Clusters

    NASA Astrophysics Data System (ADS)

    Miller, Christopher J. Miller

    2012-03-01

    There are many examples of clustering in astronomy. Stars in our own galaxy are often seen as being gravitationally bound into tight globular or open clusters. The Solar System's Trojan asteroids cluster at the gravitational Langrangian in front of Jupiter’s orbit. On the largest of scales, we find gravitationally bound clusters of galaxies, the Virgo cluster (in the constellation of Virgo at a distance of ˜50 million light years) being a prime nearby example. The Virgo cluster subtends an angle of nearly 8◦ on the sky and is known to contain over a thousand member galaxies. Galaxy clusters play an important role in our understanding of theUniverse. Clusters exist at peaks in the three-dimensional large-scale matter density field. Their sky (2D) locations are easy to detect in astronomical imaging data and their mean galaxy redshifts (redshift is related to the third spatial dimension: distance) are often better (spectroscopically) and cheaper (photometrically) when compared with the entire galaxy population in large sky surveys. Photometric redshift (z) [Photometric techniques use the broad band filter magnitudes of a galaxy to estimate the redshift. Spectroscopic techniques use the galaxy spectra and emission/absorption line features to measure the redshift] determinations of galaxies within clusters are accurate to better than delta_z = 0.05 [7] and when studied as a cluster population, the central galaxies form a line in color-magnitude space (called the the E/S0 ridgeline and visible in Figure 16.3) that contains galaxies with similar stellar populations [15]. The shape of this E/S0 ridgeline enables astronomers to measure the cluster redshift to within delta_z = 0.01 [23]. The most accurate cluster redshift determinations come from spectroscopy of the member galaxies, where only a fraction of the members need to be spectroscopically observed [25,42] to get an accurate redshift to the whole system. If light traces mass in the Universe, then the locations

  5. Organizational-Level Strategies With or Without an Activity Tracker to Reduce Office Workers’ Sitting Time: Rationale and Study Design of a Pilot Cluster-Randomized Trial

    PubMed Central

    Fjeldsoe, Brianna S; Young, Duncan C; Winkler, Elisabeth A H; Dunstan, David W; Straker, Leon M; Brakenridge, Christian J; Healy, Genevieve N

    2016-01-01

    Background The office workplace is a key setting in which to address excessive sitting time and inadequate physical activity. One major influence on workplace sitting is the organizational environment. However, the impact of organizational-level strategies on individual level activity change is unknown. Further, the emergence of sophisticated, consumer-targeted wearable activity trackers that facilitate real-time self-monitoring of activity, may be a useful adjunct to support organizational-level strategies, but to date have received little evaluation in this workplace setting. Objective The aim of this study is to evaluate the feasibility, acceptability, and effectiveness of organizational-level strategies with or without an activity tracker on sitting, standing, and stepping in office workers in the short (3 months, primary aim) and long-term (12 months, secondary aim). Methods This study is a pilot, cluster-randomized trial (with work teams as the unit of clustering) of two interventions in office workers: organizational-level support strategies (eg, visible management support, emails) or organizational-level strategies plus the use of a waist-worn activity tracker (the LUMOback) that enables self-monitoring of sitting, standing, and stepping time and enables users to set sitting and posture alerts. The key intervention message is to ‘Stand Up, Sit Less, and Move More.’ Intervention elements will be implemented from within the organization by the Head of Workplace Wellbeing. Participants will be recruited via email and enrolled face-to-face. Assessments will occur at baseline, 3, and 12 months. Time spent sitting, sitting in prolonged (≥30 minute) bouts, standing, and stepping during work hours and across the day will be measured with activPAL3 activity monitors (7 days, 24 hours/day protocol), with total sitting time and sitting time during work hours the primary outcomes. Web-based questionnaires, LUMOback recorded data, telephone interviews, and focus

  6. Occupational Clusters.

    ERIC Educational Resources Information Center

    Pottawattamie County School System, Council Bluffs, IA.

    The 15 occupational clusters (transportation, fine arts and humanities, communications and media, personal service occupations, construction, hospitality and recreation, health occupations, marine science occupations, consumer and homemaking-related occupations, agribusiness and natural resources, environment, public service, business and office…

  7. Cluster generator

    DOEpatents

    Donchev, Todor I.; Petrov, Ivan G.

    2011-05-31

    Described herein is an apparatus and a method for producing atom clusters based on a gas discharge within a hollow cathode. The hollow cathode includes one or more walls. The one or more walls define a sputtering chamber within the hollow cathode and include a material to be sputtered. A hollow anode is positioned at an end of the sputtering chamber, and atom clusters are formed when a gas discharge is generated between the hollow anode and the hollow cathode.

  8. Gene targeting technologies in rats: zinc finger nucleases, transcription activator-like effector nucleases, and clustered regularly interspaced short palindromic repeats.

    PubMed

    Mashimo, Tomoji

    2014-01-01

    The laboratory rat has been widely used as an animal model in biomedical science for more than 150 years. Applying zinc-finger nucleases or transcription activator-like effector nucleases to rat embryos via microinjection is an efficient genome editing tool for generating targeted knockout rats. Recently, clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated endonucleases have been used as an effective tool for precise and multiplex genome editing in mice and rats. In this review, the advantages and disadvantages of these site-specific nuclease technologies for genetic analysis and manipulation in rats are discussed.

  9. Community-based physical activity and nutrition programme for adults with metabolic syndrome in Vietnam: study protocol for a cluster-randomised controlled trial

    PubMed Central

    Tran, Van Dinh; Lee, Andy H; Jancey, Jonine; James, Anthony P; Howat, Peter; Thi Phuong Mai, Le

    2016-01-01

    Introduction Metabolic syndrome (MetS) is a cluster of risk factors for cardiovascular diseases and type II diabetes. In Vietnam, more than one-quarter of its population aged 50–65 have MetS. This cluster-randomised controlled trial aims to evaluate the effectiveness of interventions to increase levels of physical activity and improve dietary behaviours among Vietnamese adults aged 50–65 years with MetS. Method and analysis This 6-month community-based intervention includes a range of strategies to improve physical activity and nutrition for adults with MetS in Hanam, a province located in northern Vietnam. 600 participants will be recruited from 6 communes with 100 participants per commune. The 6 selected communes will be randomly allocated to either an intervention group (m=3; n=300) or a control group (m=3; n=300). The intervention comprises booklets, education sessions, resistance bands and attending local walking groups that provide information and encourage participants to improve their physical activity and healthy eating behaviours during the 6-month period. The control group participants will receive standard and 1-time advice. Social cognitive theory is the theoretical concept underpinning this study. Measurements will be taken at baseline and postintervention to evaluate programme effectiveness. Ethics and dissemination The research protocol was approved by the Curtin University Human Research Ethics Committee (approval number: HR139/2014). The results of the study will be disseminated through publications, reports and conference presentations. Trial registration number ACTRN12614000811606. PMID:27256094

  10. A Nonparametric Bayesian Model for Nested Clustering.

    PubMed

    Lee, Juhee; Müller, Peter; Zhu, Yitan; Ji, Yuan

    2016-01-01

    We propose a nonparametric Bayesian model for clustering where clusters of experimental units are determined by a shared pattern of clustering another set of experimental units. The proposed model is motivated by the analysis of protein activation data, where we cluster proteins such that all proteins in one cluster give rise to the same clustering of patients. That is, we define clusters of proteins by the way that patients group with respect to the corresponding protein activations. This is in contrast to (almost) all currently available models that use shared parameters in the sampling model to define clusters. This includes in particular model based clustering, Dirichlet process mixtures, product partition models, and more. We show results for two typical biostatistical inference problems that give rise to clustering. PMID:26519174

  11. Combining active-space coupled-cluster methods with moment energy corrections via the CC(P;Q) methodology, with benchmark calculations for biradical transition states.

    PubMed

    Shen, Jun; Piecuch, Piotr

    2012-04-14

    We have recently suggested the CC(P;Q) methodology that can correct energies obtained in the active-space coupled-cluster (CC) or equation-of-motion (EOM) CC calculations, which recover much of the nondynamical and some dynamical electron correlation effects, for the higher-order, mostly dynamical, correlations missing in the active-space CC/EOMCC considerations. It is shown that one can greatly improve the description of biradical transition states, both in terms of the resulting energy barriers and total energies, by combining the CC approach with singles, doubles, and active-space triples, termed CCSDt, with the CC(P;Q)-style correction due to missing triple excitations defining the CC(t;3) approximation.

  12. Hedgehog signaling pathway is active in GBM with GLI1 mRNA expression showing a single continuous distribution rather than discrete high/low clusters.

    PubMed

    Chandra, Vikas; Das, Tapojyoti; Gulati, Puneet; Biswas, Nidhan K; Rote, Sarang; Chatterjee, Uttara; Ghosh, Samarendra N; Deb, Sumit; Saha, Suniti K; Chowdhury, Anup K; Ghosh, Subhashish; Rudin, Charles M; Mukherjee, Ankur; Basu, Analabha; Dhara, Surajit

    2015-01-01

    Hedgehog (Hh) signaling pathway is a valid therapeutic target in a wide range of malignancies. We focus here on glioblastoma multiforme (GBM), a lethal malignancy of the central nervous system (CNS). By analyzing RNA-sequencing based transcriptomics data on 149 clinical cases of TCGA-GBM database we show here a strong correlation (r = 0.7) between GLI1 and PTCH1 mRNA expression--as a hallmark of the canonical Hh-pathway activity in this malignancy. GLI1 mRNA expression varied in 3 orders of magnitude among the GBM patients of the same cohort showing a single continuous distribution-unlike the discrete high/low-GLI1 mRNA expressing clusters of medulloblastoma (MB). When compared with MB as a reference, the median GLI1 mRNA expression in GBM appeared 14.8 fold lower than that of the "high-Hh" cluster of MB but 5.6 fold higher than that of the "low-Hh" cluster of MB. Next, we demonstrated statistically significant up- and down-regulation of GLI1 mRNA expressions in GBM patient-derived low-passage neurospheres in vitro by sonic hedgehog ligand-enriched conditioned media (shh-CM) and by Hh-inhibitor drug vismodegib respectively. We also showed clinically achievable dose (50 μM) of vismodegib alone to be sufficient to induce apoptosis and cell cycle arrest in these low-passage GBM neurospheres in vitro. Vismodegib showed an effect on the neurospheres, both by down-regulating GLI1 mRNA expression and by inducing apoptosis/cell cycle arrest, irrespective of their relative endogenous levels of GLI1 mRNA expression. We conclude from our study that this single continuous distribution pattern of GLI1 mRNA expression technically puts almost all GBM patients in a single group rather than discrete high- or low-clusters in terms of Hh-pathway activity. That is suggestive of therapies with Hh-pathway inhibitor drugs in this malignancy without a need for further stratification of patients on the basis of relative levels of Hh-pathway activity among them. PMID:25775002

  13. A community-wide campaign to promote physical activity in middle-aged and elderly people: a cluster randomized controlled trial

    PubMed Central

    2013-01-01

    Background We aimed to evaluate the effectiveness of a community-wide campaign (CWC) for promoting physical activity in middle-aged and elderly people. Methods A cluster randomized controlled trial (RCT) with a community as the unit of randomization was performed using a population-based random-sampled evaluation by self-administered questionnaires in the city of Unnan, Shimane Prefecture, Japan. The evaluation sample included 6000 residents aged 40 to 79 years. We randomly allocated nine communities to the intervention group and three to the control group. The intervention was a CWC from 2009 to 2010 to promote physical activity, and it comprised information, education, and support delivery. The primary outcome was a change in engaging in regular aerobic, flexibility, and/or muscle-strengthening activities evaluated at the individual level. Results In total, 4414 residents aged 40–79 years responded to a self-administered questionnaire (73.6% response rate). Awareness of the CWC was 79% in the intervention group. Awareness and knowledge were significantly different between the intervention and control groups, although there were no significant differences in belief and intention. The 1-year CWC did not significantly promote the recommended level of physical activity (adjusted odds ratio: 0.97; 95% confidence interval: 0.84–1.14). Conclusions This cluster RCT showed that the CWC did not promote physical activity in 1 year. Significant differences were observed in awareness and knowledge between intervention and control groups as short-term impacts of the campaign. Trial registration UMIN-CTR UMIN000002683 PMID:23570536

  14. Transcriptional activation is a conserved feature of the early embryonic factor Zelda that requires a cluster of four zinc fingers for DNA binding and a low-complexity activation domain.

    PubMed

    Hamm, Danielle C; Bondra, Eliana R; Harrison, Melissa M

    2015-02-01

    Delayed transcriptional activation of the zygotic genome is a nearly universal phenomenon in metazoans. Immediately following fertilization, development is controlled by maternally deposited products, and it is not until later stages that widespread activation of the zygotic genome occurs. Although the mechanisms driving this genome activation are currently unknown, the transcriptional activator Zelda (ZLD) has been shown to be instrumental in driving this process in Drosophila melanogaster. Here we define functional domains of ZLD required for both DNA binding and transcriptional activation. We show that the C-terminal cluster of four zinc fingers mediates binding to TAGteam DNA elements in the promoters of early expressed genes. All four zinc fingers are required for this activity, and splice isoforms lacking three of the four zinc fingers fail to activate transcription. These truncated splice isoforms dominantly suppress activation by the full-length, embryonically expressed isoform. We map the transcriptional activation domain of ZLD to a central region characterized by low complexity. Despite relatively little sequence conservation within this domain, ZLD orthologs from Drosophila virilis, Anopheles gambiae, and Nasonia vitripennis activate transcription in D. melanogaster cells. Transcriptional activation by these ZLD orthologs suggests that ZLD functions through conserved interactions with a protein cofactor(s). We have identified distinct DNA-binding and activation domains within the critical transcription factor ZLD that controls the initial activation of the zygotic genome.

  15. Efficient Room-Temperature Methane Activation by the Closed-Shell, Metal-Free Cluster [OSiOH](+) : A Novel Mechanistic Variant.

    PubMed

    Sun, Xiaoyan; Zhou, Shaodong; Schlangen, Maria; Schwarz, Helmut

    2016-09-26

    The closed-shell cluster ion [OSiOH](+) is generated in the gas phase and its reactivity towards the thermal activation of CH4 has been examined using Fourier transform-ion cyclotron resonance (FT-ICR) mass spectrometry in conjunction with state-of-the-art quantum chemical calculations. Quite unexpectedly at room temperature, [OSiOH](+) efficiently mediates C-H bond activation, giving rise to [SiOH](+) and [SiOCH3 ](+) with the concomitant formation of methanol and water, respectively. Mechanistic aspects for this unprecedented reactivity pattern are presented, and the properties of the [OSiOH](+) /CH4 couple are compared with those of the closed-shell systems [OCOH](+) /CH4 and [MgOH](+) /CH4 ; the last two couples exhibit an entirely different reactivity scenario. PMID:27515768

  16. Two novel monothiol glutaredoxins from Saccharomyces cerevisiae provide further insight into iron-sulfur cluster binding, oligomerization, and enzymatic activity of glutaredoxins.

    PubMed

    Mesecke, Nikola; Mittler, Sarah; Eckers, Elisabeth; Herrmann, Johannes M; Deponte, Marcel

    2008-02-01

    Two novel monothiol glutaredoxins from yeast (ScGrx6 and ScGrx7) were identified and analyzed in vitro. Both proteins are highly suited to study structure-function relationships of glutaredoxin subclasses because they differ from all monothiol glutaredoxins investigated so far and share features with dithiol glutaredoxins. ScGrx6 and ScGrx7 are, for example, the first monothiol glutaredoxins showing an activity in the standard glutaredoxin transhydrogenase assay with glutathione and bis-(2-hydroxyethyl)-disulfide. Steady-state kinetics of ScGrx7 with glutathione and cysteine-glutathione disulfide are similar to dithiol glutaredoxins and are consistent with a ping-pong mechanism. In contrast to most other glutaredoxins, ScGrx7 and ScGrx6 are able to dimerize noncovalently. Furthermore, ScGrx6 is the first monothiol glutaredoxin shown to directly bind an iron-sulfur cluster. The cluster can be stabilized by reduced glutathione, and its loss results in the conversion of tetramers to dimers. ScGrx7 does not bind metal ions but can be covalently modified in Escherichia coli leading to a mass shift of 1090 +/- 14 Da. What might be the structural requirements that cause the different properties? We hypothesize that a G(S/T)x3 insertion between a highly conserved lysine residue and the active site cysteine residue could be responsible for the abrogated transhydrogenase activity of many monothiol glutaredoxins. In addition, we suggest an active site motif without proline residues that could lead to the identification of further metal binding glutaredoxins. Such different properties presumably reflect diverse functions in vivo and might therefore explain why there are at least seven glutaredoxins in yeast. PMID:18171082

  17. Infrared Coronet Cluster

    NASA Technical Reports Server (NTRS)

    2007-01-01

    While perhaps not quite as well known as its star formation cousin of Orion, the Corona Australis region (containing, at its heart, the Coronet cluster) is one of the nearest and most active regions of ongoing star formation. The Spitzer image shows young stars plus diffuse emission from dust.

  18. An Active Immune Defense with a Minimal CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) RNA and without the Cas6 Protein*

    PubMed Central

    Maier, Lisa-Katharina; Stachler, Aris-Edda; Saunders, Sita J.; Backofen, Rolf; Marchfelder, Anita

    2015-01-01

    The prokaryotic immune system CRISPR-Cas (clustered regularly interspaced short palindromic repeats-CRISPR-associated) is a defense system that protects prokaryotes against foreign DNA. The short CRISPR RNAs (crRNAs) are central components of this immune system. In CRISPR-Cas systems type I and III, crRNAs are generated by the endonuclease Cas6. We developed a Cas6b-independent crRNA maturation pathway for the Haloferax type I-B system in vivo that expresses a functional crRNA, which we termed independently generated crRNA (icrRNA). The icrRNA is effective in triggering degradation of an invader plasmid carrying the matching protospacer sequence. The Cas6b-independent maturation of the icrRNA allowed mutation of the repeat sequence without interfering with signals important for Cas6b processing. We generated 23 variants of the icrRNA and analyzed them for activity in the interference reaction. icrRNAs with deletions or mutations of the 3′ handle are still active in triggering an interference reaction. The complete 3′ handle could be removed without loss of activity. However, manipulations of the 5′ handle mostly led to loss of interference activity. Furthermore, we could show that in the presence of an icrRNA a strain without Cas6b (Δcas6b) is still active in interference. PMID:25512373

  19. An active immune defense with a minimal CRISPR (clustered regularly interspaced short palindromic repeats) RNA and without the Cas6 protein.

    PubMed

    Maier, Lisa-Katharina; Stachler, Aris-Edda; Saunders, Sita J; Backofen, Rolf; Marchfelder, Anita

    2015-02-13

    The prokaryotic immune system CRISPR-Cas (clustered regularly interspaced short palindromic repeats-CRISPR-associated) is a defense system that protects prokaryotes against foreign DNA. The short CRISPR RNAs (crRNAs) are central components of this immune system. In CRISPR-Cas systems type I and III, crRNAs are generated by the endonuclease Cas6. We developed a Cas6b-independent crRNA maturation pathway for the Haloferax type I-B system in vivo that expresses a functional crRNA, which we termed independently generated crRNA (icrRNA). The icrRNA is effective in triggering degradation of an invader plasmid carrying the matching protospacer sequence. The Cas6b-independent maturation of the icrRNA allowed mutation of the repeat sequence without interfering with signals important for Cas6b processing. We generated 23 variants of the icrRNA and analyzed them for activity in the interference reaction. icrRNAs with deletions or mutations of the 3' handle are still active in triggering an interference reaction. The complete 3' handle could be removed without loss of activity. However, manipulations of the 5' handle mostly led to loss of interference activity. Furthermore, we could show that in the presence of an icrRNA a strain without Cas6b (Δcas6b) is still active in interference.

  20. An active immune defense with a minimal CRISPR (clustered regularly interspaced short palindromic repeats) RNA and without the Cas6 protein.

    PubMed

    Maier, Lisa-Katharina; Stachler, Aris-Edda; Saunders, Sita J; Backofen, Rolf; Marchfelder, Anita

    2015-02-13

    The prokaryotic immune system CRISPR-Cas (clustered regularly interspaced short palindromic repeats-CRISPR-associated) is a defense system that protects prokaryotes against foreign DNA. The short CRISPR RNAs (crRNAs) are central components of this immune system. In CRISPR-Cas systems type I and III, crRNAs are generated by the endonuclease Cas6. We developed a Cas6b-independent crRNA maturation pathway for the Haloferax type I-B system in vivo that expresses a functional crRNA, which we termed independently generated crRNA (icrRNA). The icrRNA is effective in triggering degradation of an invader plasmid carrying the matching protospacer sequence. The Cas6b-independent maturation of the icrRNA allowed mutation of the repeat sequence without interfering with signals important for Cas6b processing. We generated 23 variants of the icrRNA and analyzed them for activity in the interference reaction. icrRNAs with deletions or mutations of the 3' handle are still active in triggering an interference reaction. The complete 3' handle could be removed without loss of activity. However, manipulations of the 5' handle mostly led to loss of interference activity. Furthermore, we could show that in the presence of an icrRNA a strain without Cas6b (Δcas6b) is still active in interference. PMID:25512373

  1. The effect of metal cluster deposition route on structure and photocatalytic activity of mono- and bimetallic nanoparticles supported on TiO2 by radiolytic method

    NASA Astrophysics Data System (ADS)

    Klein, Marek; Nadolna, Joanna; Gołąbiewska, Anna; Mazierski, Paweł; Klimczuk, Tomasz; Remita, Hynd; Zaleska-Medynska, Adriana

    2016-08-01

    TiO2 (P25) was modified with small and relatively monodisperse mono- and bimetallic clusters (Ag, Pd, Pt, Ag/Pd, Ag/Pt and Pd/Pt) induced by radiolysis to improve its photocatalytic activity. The as-prepared samples were characterized by X-ray fluorescence spectrometry (XRF), photoluminescence spectrometry (PL), diffuse reflectance spectroscopy (DRS), X-ray powder diffractometry (XRD), scanning transition electron microscopy (STEM) and BET surface area analysis. The effect of metal type (mono- and bimetallic modification) as well as deposition method (simultaneous or subsequent deposition of two metals) on the photocatalytic activity in toluene removal in gas phase under UV-vis irradiation (light-emitting diodes- LEDs) and phenol degradation in liquid phase under visible light irradiation (λ > 420 nm) were investigated. The highest photoactivity under Vis light was observed for TiO2 co-loaded with platinum (0.1%) and palladium (0.1%) clusters. Simultaneous addition of metal precursors results in formation of larger metal nanoparticles (15-30 nm) on TiO2 surface and enhances the Vis-induced activity of Ag/Pd-TiO2 up to four times, while the subsequent metal ions addition results in formation of metal particle size ranging from 4 to 20 nm. Subsequent addition of metal precursors results in formation of BNPs (bimetallic nanoparticle) composites showing higher stability in four cycles of toluene degradation under UV-vis. Obtained results indicated that direct electron transfer from the BNPs to the conduction band of the semiconductor is responsible for visible light photoactivity, whereas superoxide radicals (such as O2rad- and rad OOH) are responsible for pollutants degradation over metal-TiO2 composites.

  2. Merging Active-Space and Renormalized Coupled-Cluster Methods via the CC(P;Q) Formalism, with Benchmark Calculations for Singlet-Triplet Gaps in Biradical Systems.

    PubMed

    Shen, Jun; Piecuch, Piotr

    2012-12-11

    We have recently developed a flexible form of the method of moments of coupled-cluster (CC) equations and the CC(P;Q) hierarchy, which enable one to correct the CC and equation-of-motion CC energies obtained with unconventional truncations in the cluster and excitation operators [Shen, J.; Piecuch, P. Chem. Phys.2012, 401, 180; J. Chem. Phys.2012, 136, 144104]. One of the CC(P;Q) methods is a novel hybrid scheme, abbreviated as CC(t;3), in which the results of CC calculations with singles, doubles, and active-space triples, termed CCSDt, are corrected for the triple excitations missing in CCSDt using the expressions that are reminiscent of the completely renormalized (CR) CC approach known as CR-CC(2,3). We demonstrate that the total electronic energies of the lowest singlet and triplet states, and the singlet-triplet gaps in biradical systems, including methylene, (HFH)(-), and trimethylenemethane, resulting from the CC(t;3) calculations agree with those obtained with the full CC approach with singles, doubles, and triples to within fractions of a millihartree, improving the results of the noniterative triples CCSD(T), CCSD(2)T, and CR-CC(2,3) and hybrid CCSD(T)-h calculations, and competing with the best multireference CC data.

  3. Zwitterion L-cysteine adsorbed on the Au₂₀ cluster: enhancement of infrared active normal modes.

    PubMed

    Tlahuice-Flores, Alfredo

    2013-04-01

    The study reported herein addressed the structure, adsorption energy and normal modes of zwitterion L-cysteine (Z-cys) adsorbed on the Au₂₀ cluster by using density functional theory (DFT). It was found that four Z-cys are bound to the Au₂₀ apexes preferentially through S atoms. Regarding normal modes, after adsorption of four Z-cys molecules, a more intense infrared (IR) peak is maintained around 1,631.4 cm(-1) corresponding with a C=O stretching mode, but its intensity is enhanced approximately six times. The enhancement in the intensity of modes between 0 to 300 cm(-1) is around 4.5 to 5.0 times for normal modes that involve O-C=O and C-S bending modes. Other two normal modes in the range from 300 to 3,500 cm(-1) show enhancements of 6.0 and 7.4 times. In general, four peaks show major intensities and they are related with normal modes of carboxyl and NH₃ groups of Z-cys.

  4. Double C-H bond activation of hydrocarbons by a gas phase neutral oxide cluster: the importance of spin state.

    PubMed

    Wang, Zhe-Chen; Yin, Shi; Bernstein, Elliot R

    2013-03-21

    The neutral cluster V2O5 is generated and detected in the gas phase. Its reactivity toward butane is studied both experimentally and theoretically. Experimental results show clearly that neutral V2O5 can react with n-butane (C4H10) to generate V2O5H2, indicating double hydrogen atom transfer from C4H10 to V2O5 to produce C4H8. Further experimental evidence indicates that V2O5 is only partially reacted even at very high concentrations of C4H10. Density functional theory (DFT) studies show that the lowest energy triplet state of V2O5 is reactive toward C4H10, whereas the ground state singlet V2O5 is inert. Calculated results are in agreement with experimental findings, and a detailed reaction mechanism is provided. Reactions of V2O5H2 with several oxidants are also studied theoretically to find a path to regenerate V2O5. Neutral (3)V2O5 can also react with C2H6 to form V2O5H2 and C2H4, but only as a minor reaction channel; the major product is the adsorption product V2O5(C2H6). PMID:23441829

  5. Mediating effects of resistance training skill competency on health-related fitness and physical activity: the ATLAS cluster randomised controlled trial.

    PubMed

    Smith, Jordan J; Morgan, Philip J; Plotnikoff, Ronald C; Stodden, David F; Lubans, David R

    2016-01-01

    The purpose of this study was to examine the mediating effect of resistance training skill competency on percentage of body fat, muscular fitness and physical activity among a sample of adolescent boys participating in a school-based obesity prevention intervention. Participants were 361 adolescent boys taking part in the Active Teen Leaders Avoiding Screen-time (ATLAS) cluster randomised controlled trial: a school-based program targeting the health behaviours of economically disadvantaged adolescent males considered "at-risk" of obesity. Body fat percentage (bioelectrical impedance), muscular fitness (hand grip dynamometry and push-ups), physical activity (accelerometry) and resistance training skill competency were assessed at baseline and post-intervention (i.e., 8 months). Three separate multi-level mediation models were analysed to investigate the potential mediating effects of resistance training skill competency on each of the study outcomes using a product-of-coefficients test. Analyses followed the intention-to-treat principle. The intervention had a significant impact on the resistance training skill competency of the boys, and improvements in skill competency significantly mediated the effect of the intervention on percentage of body fat and the combined muscular fitness score. No significant mediated effects were found for physical activity. Improving resistance training skill competency may be an effective strategy for achieving improvements in body composition and muscular fitness in adolescent boys.

  6. Dealing with chemical reaction pathways and electronic excitations in molecular systems via renormalized and active-space coupled-cluster methods

    SciTech Connect

    Piecuch, Piotr; Li, Wei; Lutz, Jesse J.; Włoch, Marta; Gour, Jeffrey R.

    2015-01-22

    Coupled-cluster (CC) theory has become the de facto standard for high-accuracy molecular calculations, but the widely used CC and equation-of-motion (EOM) CC approaches, such as CCSD(T) and EOMCCSD, have difficulties with capturing stronger electron correlations that characterize multi-reference molecular problems. This presentation demonstrates that many of these difficulties can be addressed by exploiting the completely renormalized (CR) CC and EOMCC approaches, such as CR-CC(2,3), CR-EOMCCSD(T), and CR-EOMCC(2,3), and their local correlation counterparts applicable to systems with hundreds of atoms, and the active-space CC/EOMCC approaches, such as CCSDt and EOMCCSDt, and their extensions to valence systems via the electron-attached and ionized formalisms.

  7. Acute Whiplash Injury Study (AWIS): a protocol for a cluster randomised pilot and feasibility trial of an Active Behavioural Physiotherapy Intervention in an insurance private setting

    PubMed Central

    Wiangkham, Taweewat; Duda, Joan; Haque, M Sayeed; Price, Jonathan; Rushton, Alison

    2016-01-01

    Introduction Whiplash-associated disorder (WAD) causes substantial social and economic burden internationally. Up to 60% of patients with WAD progress to chronicity. Research therefore needs to focus on effective management in the acute stage to prevent the development of chronicity. Approximately 93% of patients are classified as WADII (neck complaint and musculoskeletal sign(s)), and in the UK, most are managed in the private sector. In our recent systematic review, a combination of active and behavioural physiotherapy was identified as potentially effective in the acute stage. An Active Behavioural Physiotherapy Intervention (ABPI) was developed through combining empirical (modified Delphi study) and theoretical (social cognitive theory focusing on self-efficacy) evidence. This pilot and feasibility trial has been designed to inform the design of an adequately powered definitive randomised controlled trial. Methods and analysis Two parallel phases. (1) An external pilot and feasibility cluster randomised double-blind (assessor and participants), parallel two-arm (ABPI vs standard physiotherapy) clinical trial to evaluate procedures and feasibility. Six UK private physiotherapy clinics will be recruited and cluster randomised by a computer-generated randomisation sequence. Sixty participants (30 each arm) will be assessed at recruitment (baseline) and at 3 months postbaseline. The planned primary outcome measure is the neck disability index. (2) An embedded exploratory qualitative study using semistructured indepth interviews (n=3–4 physiotherapists) and a focus group (n=6–8 patients) and entailing the recruitment of purposive samples will explore perceptions of the ABPI. Quantitative data will be analysed descriptively. Qualitative data will be coded and analysed deductively (identify themes) and inductively (identify additional themes). Ethics and dissemination This trial is approved by the University of Birmingham Ethics Committee (ERN_15-0542). Trial

  8. Impact of the iron-sulfur cluster proximal to the active site on the catalytic function of an O2-tolerant NAD(+)-reducing [NiFe]-hydrogenase.

    PubMed

    Karstens, Katja; Wahlefeld, Stefan; Horch, Marius; Grunzel, Miriam; Lauterbach, Lars; Lendzian, Friedhelm; Zebger, Ingo; Lenz, Oliver

    2015-01-20

    The soluble NAD(+)-reducing hydrogenase (SH) from Ralstonia eutropha H16 belongs to the O2-tolerant subtype of pyridine nucleotide-dependent [NiFe]-hydrogenases. To identify molecular determinants for the O2 tolerance of this enzyme, we introduced single amino acids exchanges in the SH small hydrogenase subunit. The resulting mutant strains and proteins were investigated with respect to their physiological, biochemical, and spectroscopic properties. Replacement of the four invariant conserved cysteine residues, Cys41, Cys44, Cys113, and Cys179, led to unstable protein, strongly supporting their involvement in the coordination of the iron-sulfur cluster proximal to the catalytic [NiFe] center. The Cys41Ser exchange, however, resulted in an SH variant that displayed up to 10% of wild-type activity, suggesting that the coordinating role of Cys41 might be partly substituted by the nearby Cys39 residue, which is present only in O2-tolerant pyridine nucleotide-dependent [NiFe]-hydrogenases. Indeed, SH variants carrying glycine, alanine, or serine in place of Cys39 showed increased O2 sensitivity compared to that of the wild-type enzyme. Substitution of further amino acids typical for O2-tolerant SH representatives did not greatly affect the H2-oxidizing activity in the presence of O2. Remarkably, all mutant enzymes investigated by electron paramagnetic resonance spectroscopy did not reveal significant spectral changes in relation to wild-type SH, showing that the proximal iron-sulfur cluster does not contribute to the wild-type spectrum. Interestingly, exchange of Trp42 by serine resulted in a completely redox-inactive [NiFe] site, as revealed by infrared spectroscopy and H2/D(+) exchange experiments. The possible role of this residue in electron and/or proton transfer is discussed.

  9. Chaos theory perspective for industry clusters development

    NASA Astrophysics Data System (ADS)

    Yu, Haiying; Jiang, Minghui; Li, Chengzhang

    2016-03-01

    Industry clusters have outperformed in economic development in most developing countries. The contributions of industrial clusters have been recognized as promotion of regional business and the alleviation of economic and social costs. It is no doubt globalization is rendering clusters in accelerating the competitiveness of economic activities. In accordance, many ideas and concepts involve in illustrating evolution tendency, stimulating the clusters development, meanwhile, avoiding industrial clusters recession. The term chaos theory is introduced to explain inherent relationship of features within industry clusters. A preferred life cycle approach is proposed for industrial cluster recessive theory analysis. Lyapunov exponents and Wolf model are presented for chaotic identification and examination. A case study of Tianjin, China has verified the model effectiveness. The investigations indicate that the approaches outperform in explaining chaos properties in industrial clusters, which demonstrates industrial clusters evolution, solves empirical issues and generates corresponding strategies.

  10. The SMART CLUSTER METHOD - adaptive earthquake cluster analysis and declustering

    NASA Astrophysics Data System (ADS)

    Schaefer, Andreas; Daniell, James; Wenzel, Friedemann

    2016-04-01

    Earthquake declustering is an essential part of almost any statistical analysis of spatial and temporal properties of seismic activity with usual applications comprising of probabilistic seismic hazard assessments (PSHAs) and earthquake prediction methods. The nature of earthquake clusters and subsequent declustering of earthquake catalogues plays a crucial role in determining the magnitude-dependent earthquake return period and its respective spatial variation. Various methods have been developed to address this issue from other researchers. These have differing ranges of complexity ranging from rather simple statistical window methods to complex epidemic models. This study introduces the smart cluster method (SCM), a new methodology to identify earthquake clusters, which uses an adaptive point process for spatio-temporal identification. Hereby, an adaptive search algorithm for data point clusters is adopted. It uses the earthquake density in the spatio-temporal neighbourhood of each event to adjust the search properties. The identified clusters are subsequently analysed to determine directional anisotropy, focussing on a strong correlation along the rupture plane and adjusts its search space with respect to directional properties. In the case of rapid subsequent ruptures like the 1992 Landers sequence or the 2010/2011 Darfield-Christchurch events, an adaptive classification procedure is applied to disassemble subsequent ruptures which may have been grouped into an individual cluster using near-field searches, support vector machines and temporal splitting. The steering parameters of the search behaviour are linked to local earthquake properties like magnitude of completeness, earthquake density and Gutenberg-Richter parameters. The method is capable of identifying and classifying earthquake clusters in space and time. It is tested and validated using earthquake data from California and New Zealand. As a result of the cluster identification process, each event in

  11. High-temperature protein G is essential for activity of the Escherichia coli clustered regularly interspaced short palindromic repeats (CRISPR)/Cas system.

    PubMed

    Yosef, Ido; Goren, Moran G; Kiro, Ruth; Edgar, Rotem; Qimron, Udi

    2011-12-13

    Prokaryotic DNA arrays arranged as clustered regularly interspaced short palindromic repeats (CRISPR), along with their associated proteins, provide prokaryotes with adaptive immunity by RNA-mediated targeting of alien DNA or RNA matching the sequences between the repeats. Here, we present a thorough screening system for the identification of bacterial proteins participating in immunity conferred by the Escherichia coli CRISPR system. We describe the identification of one such protein, high-temperature protein G (HtpG), a homolog of the eukaryotic chaperone heat-shock protein 90. We demonstrate that in the absence of htpG, the E. coli CRISPR system loses its suicidal activity against λ prophage and its ability to provide immunity from lysogenization. Transcomplementation of htpG restores CRISPR activity. We further show that inactivity of the CRISPR system attributable to htpG deficiency can be suppressed by expression of Cas3, a protein that is essential for its activity. Accordingly, we also find that the steady-state level of overexpressed Cas3 is significantly enhanced following HtpG expression. We conclude that HtpG is a newly identified positive modulator of the CRISPR system that is essential for maintaining functional levels of Cas3.

  12. c-erbB activation in avian leukosis virus-induced erythroblastosis: clustered integration sites and the arrangement of provirus in the c-erbB alleles.

    PubMed Central

    Raines, M A; Lewis, W G; Crittenden, L B; Kung, H J

    1985-01-01

    There is considerable evidence that links the activation of cellular genes to oncogenesis. We previously reported that structural rearrangements in the cellular oncogene c-erbB correlate with the development of erythroblastosis induced by avian leukosis virus (ALV). c-erbB recently has been shown to be related to the gene encoding epidermal growth factor receptor. We now have characterized the detailed mechanisms of c-erbB activation by ALV proviruses. We report here that the ALV proviral integration sites are clustered 5' to the region where homology to v-erbB starts, suggesting that interruption in this region of c-erbB is important for its activation. The proviruses are oriented in the same transcriptional direction as c-erbB and usually are full-size. The latter finding is in contrast to the frequent deletions observed within the c-myc-linked proviruses in B-cell lymphomas. We have also identified a second c-erbB allele, which differs from the previously known allele primarily by a deletion in an intron region. This allele is also oncogenic upon mutation by an ALV provirus. Images PMID:2986110

  13. Total Plasma Density Determination In The Earth's Space Environment From The Active and Passive Measurements of The Cluster/whisper Experiment

    NASA Astrophysics Data System (ADS)

    Trotignon, J. G.; Canu, P.; Dandouras, I.; Darrouzet, F.; Décréau, P. M. E.; Hitier, R.; Le Guirriec, E.; Lemaire, J.; Rauch, J. L.; Rème, H.

    The WHISPER experiment that is onboard the four CLUSTER satellites is a classical relaxation sounder. It therefore sends short pulses (0.5 ms or 1 ms) at given frequen- cies in the surrounding medium. The answer from the probed plasma is subsequently received and analysed onboard. A fast Fourier transform is applied to the received sig- nal and the calculated frequency spectrum transmitted to the ground. The frequency at which the pulse is transmitted varies step by step, 1 kHz or 2 kHz in width, from 2 kHz to 80 kHz, i.e., in a frequency range that includes the plasma frequency expected in the Earth's space environment from the plasmapause to the solar wind. In active (sounding) mode, plasma resonances are thus triggered by WHISPER at characteris- tic frequencies from which the total plasma density and, possibly, the magnetic field modulus are derived. Whenever the transmitter is switched off, the WHISPER behaves like a simple wave receiver. The electric field component of natural waves are then recorded, its frequency spectrum determined onboard and fed into the telemetry. The objective of the presentation is to show how the total plasma density is derived from the active and passive measurements of the WHISPER. Different types of plasma res- onances are actually excited depending on the nature of the encountered plasma. Once the resonances are identified, their frequency locations are used for plasma density determinations. The characteristic frequencies of the plasma being known from the active measurements, natural waves (passive measurements) may be identified more easily. Their characteristics, such as cut-off or maximum-intensity frequencies, may be used for plasma density measurement purposes, which allows the gaps between active sequences to be filled in. Some examples in the solar wind, the magnetosheath, and the plasmapause are shown. A particular attention is paid to the latter. The hot to cold electron density ratio may indeed be estimated, and

  14. The HNF-4/HNF-1α transactivation cascade regulates gene activity and chromatin structure of the human serine protease inhibitor gene cluster at 14q32.1

    PubMed Central

    Rollini, Pierre; Fournier, R. E. K.

    1999-01-01

    Hepatocyte-specific expression of the α1-antitrypsin (α1AT) gene requires the activities of two liver-enriched transactivators, hepatocyte nuclear factors 1α and 4 (HNF-1α and HNF-4). The α1AT gene maps to a region of human chromosome 14q32.1 that includes a related serine protease inhibitor (serpin) gene encoding corticosteroid-binding globulin (CBG), and the chromatin organization of this ≈130-kb region, as defined by DNase I-hypersensitive sites, has been described. Microcell transfer of human chromosome 14 from fibroblasts to rat hepatoma cells results in activation of α1AT and CBG transcription and chromatin reorganization of the entire locus. To assess the roles of HNF-1α and HNF-4 in gene activation and chromatin remodeling, we transferred human chromosome 14 from fibroblasts to rat hepatoma cell variants that are deficient in expression of HNF-1α and HNF-4. The variant cells failed to activate either α1AT or CBG transcription, and chromatin remodeling failed to occur. However, α1AT and CBG transcription could be rescued by transfecting the cells with expression plasmids encoding HNF-1α or HNF-4. In these transfectants, the chromatin structure of the entire α1AT/CBG locus was reorganized to an expressing cell-typical state. Thus, HNF-1α and HNF-4 control both chromatin structure and gene activity of two cell-specific genes within the serpin gene cluster at 14q32.1. PMID:10468604

  15. Circadian rhythm transcription factor CLOCK regulates the transcriptional activity of the glucocorticoid receptor by acetylating its hinge region lysine cluster: potential physiological implications

    PubMed Central

    Nader, Nancy; Chrousos, George P.; Kino, Tomoshige

    2009-01-01

    Glucocorticoids, end products of the hypothalamic-pituitary-adrenal axis, influence functions of virtually all organs and tissues through the glucocorticoid receptor (GR). Circulating levels of glucocorticoids fluctuate naturally in a circadian fashion and regulate the transcriptional activity of GR in target tissues. The basic helix-loop-helix protein CLOCK, a histone acetyltransferase (HAT), and its heterodimer partner BMAL1 are self-oscillating transcription factors that generate circadian rhythms in both the central nervous system and periphery. We found that CLOCK/BMAL1 repressed GR-induced transcriptional activity in a HAT-activity- dependent fashion. In serum-shock-synchronized cells, transactivational activity of GR, accessed by mRNA expression of an endogenous-responsive gene, fluctuated spontaneously in a circadian fashion in reverse phase with CLOCK/BMAL1 mRNA expression. CLOCK and GR interacted with each other physically, and CLOCK suppressed binding of GR to its DNA recognition sequences by acetylating multiple lysine residues located in its hinge region. These findings indicate that CLOCK/BMAL1 functions as a reverse-phase negative regulator of glucocorticoid action in target tissues, possibly by antagonizing biological actions of diurnally fluctuating circulating glucocorticoids. Further, these results suggest that a peripheral target tissue circadian rhythm indirectly influences the functions of every organ and tissue inside the body through modulation of the ubiquitous and diverse actions of glucocorticoids.—Nader, N., Chrousos, G. P., Kino, T. Circadian rhythm transcription factor CLOCK regulates the transcriptional activity of the glucocorticoid receptor by acetylating its hinge region lysine cluster: potential physiological implications. PMID:19141540

  16. Effect of a governmentally-led physical activity program on motor skills in young children attending child care centers: a cluster randomized controlled trial

    PubMed Central

    2013-01-01

    Objective To assess the effect of a governmentally-led center based child care physical activity program (Youp’là Bouge) on child motor skills. Patients and methods We conducted a single blinded cluster randomized controlled trial in 58 Swiss child care centers. Centers were randomly selected and 1:1 assigned to a control or intervention group. The intervention lasted from September 2009 to June 2010 and included training of the educators, adaptation of the child care built environment, parental involvement and daily physical activity. Motor skill was the primary outcome and body mass index (BMI), physical activity and quality of life secondary outcomes. The intervention implementation was also assessed. Results At baseline, 648 children present on the motor test day were included (age 3.3 ± 0.6, BMI 16.3 ± 1.3 kg/m2, 13.2% overweight, 49% girls) and 313 received the intervention. Relative to children in the control group (n = 201), children in the intervention group (n = 187) showed no significant increase in motor skills (delta of mean change (95% confidence interval: -0.2 (−0.8 to 0.3), p = 0.43) or in any of the secondary outcomes. Not all child care centers implemented all the intervention components. Within the intervention group, several predictors were positively associated with trial outcomes: 1) free-access to a movement space and parental information session for motor skills 2) highly motivated and trained educators for BMI 3) free-access to a movement space and purchase of mobile equipment for physical activity (all p < 0.05). Conclusion This “real-life” physical activity program in child care centers confirms the complexity of implementing an intervention outside a study setting and identified potentially relevant predictors that could improve future programs. Trial registration Clinical trials.gov NCT00967460 PMID:23835207

  17. Chemical quantification and antioxidant assay of four active components in Ficus hirta root using UPLC-PAD-MS fingerprinting combined with cluster analysis

    PubMed Central

    2013-01-01

    Background Root of Ficus hirta (RFH) is widely consumed in China as a plant-derived popular food. However, contents of the active constituents of RFH are unknown, and the chemical as well as bioactive properties of RFH may be affected by growing area. In order to ensure the standard efficacy of health products made with RFH, its active constituents should firstly be determined and, secondly, a means of assessing samples for their contents of these constituents is needed. Results Four active components, including two coumarins, namely psoralen and bergapten, and two flavonoids, namely luteolin and apigenin, in twenty RFH samples were quantified using a new ultra performance liquid chromatography coupled with photodiode array detector and mass spectrometry (UPLC-PAD-MS) method, and the content level in descending order was psoralen > bergapten > luteolin > apigenin. Chromatographic fingerprint similarity evaluation and cluster analysis were used to assess geographical origin of RFH, and the results revealed a high level of similarity for the tested RFH samples obtained from Hainan, Guangdong, Guangxi provinces and Hong Kong. 2, 2-Diphenyl-1-picrylhydrazyl (DPPH) radical scavenging assay was conducted to evaluate the antioxidant potencies of the four components, and the results clearly demonstrated that luteolin was most effective; apigenin exhibited a moderate potency, whereas psoralen and bergapten possessed little effect against free radical reactions. Structure-activity relationship of the components was elucidated, and the 3′-hydroxyl group of luteolin was found to be directly responsible for its antioxidant activity. Conclusion The present UPLC-PAD-MS method and DPPH radical scavenging assay performed well for the purpose of constituent quantification and antioxidant assay. Global profiles were highly similar for RFH samples from different origins. Both the coumarins and flavonoids were involved in the health benefit of RFH. PMID:23835498

  18. OBSERVED SCALING RELATIONS FOR STRONG LENSING CLUSTERS: CONSEQUENCES FOR COSMOLOGY AND CLUSTER ASSEMBLY

    SciTech Connect

    Comerford, Julia M.; Moustakas, Leonidas A.; Natarajan, Priyamvada

    2010-05-20

    Scaling relations of observed galaxy cluster properties are useful tools for constraining cosmological parameters as well as cluster formation histories. One of the key cosmological parameters, {sigma}{sub 8}, is constrained using observed clusters of galaxies, although current estimates of {sigma}{sub 8} from the scaling relations of dynamically relaxed galaxy clusters are limited by the large scatter in the observed cluster mass-temperature (M-T) relation. With a sample of eight strong lensing clusters at 0.3 < z < 0.8, we find that the observed cluster concentration-mass relation can be used to reduce the M-T scatter by a factor of 6. Typically only relaxed clusters are used to estimate {sigma}{sub 8}, but combining the cluster concentration-mass relation with the M-T relation enables the inclusion of unrelaxed clusters as well. Thus, the resultant gains in the accuracy of {sigma}{sub 8} measurements from clusters are twofold: the errors on {sigma}{sub 8} are reduced and the cluster sample size is increased. Therefore, the statistics on {sigma}{sub 8} determination from clusters are greatly improved by the inclusion of unrelaxed clusters. Exploring cluster scaling relations further, we find that the correlation between brightest cluster galaxy (BCG) luminosity and cluster mass offers insight into the assembly histories of clusters. We find preliminary evidence for a steeper BCG luminosity-cluster mass relation for strong lensing clusters than the general cluster population, hinting that strong lensing clusters may have had more active merging histories.

  19. GALAXY CLUSTERS AROUND RADIO-LOUD ACTIVE GALACTIC NUCLEI AT 1.3 < z < 3.2 AS SEEN BY SPITZER

    SciTech Connect

    Wylezalek, Dominika; Stern, Daniel; Eisenhardt, Peter R. M.; Galametz, Audrey; Vernet, Joeel; De Breuck, Carlos; Seymour, Nick; Brodwin, Mark; Gonzalez, Anthony H.; Hatch, Nina; Jarvis, Matt; Rettura, Alessandro; Stanford, Spencer A.; Stevens, Jason A.

    2013-05-20

    We report the first results from the Clusters Around Radio-Loud AGN program, a Cycle 7 and 8 Spitzer Space Telescope snapshot program to investigate the environments of a large sample of obscured and unobscured luminous radio-loud active galactic nuclei (AGNs) at 1.2 < z < 3.2. These data, obtained for 387 fields, reach 3.6 and 4.5 {mu}m depths of [3.6]{sub AB} = 22.6 and [4.5]{sub AB} = 22.9 at the 95% completeness level, which is two to three times fainter than L* in this redshift range. By using the color cut [3.6] - [4.5] > -0.1 (AB), which efficiently selects high-redshift (z > 1.3) galaxies of all types, we identify galaxy cluster member candidates in the fields of the radio-loud AGN. The local density of these Infrared Array Camera (IRAC)-selected sources is compared to the density of similarly selected sources in blank fields. We find that 92% of the radio-loud AGN reside in environments richer than average. The majority (55%) of the radio-loud AGN fields are found to be overdense at a {>=}2{sigma} level; 10% are overdense at a {>=}5{sigma} level. A clear rise in surface density of IRAC-selected sources toward the position of the radio-loud AGN strongly supports an association of the majority of the IRAC-selected sources with the radio-loud AGN. Our results provide solid statistical evidence that radio-loud AGN are likely beacons for finding high-redshift galaxy (proto-)clusters. We investigate how environment depends on AGN type (unobscured radio-loud quasars versus obscured radio galaxies), radio luminosity and redshift, finding no correlation with either AGN type or radio luminosity. We find a decrease in density with redshift, consistent with galaxy evolution for this uniform, flux-limited survey. These results are consistent with expectations from the orientation-driven AGN unification model, at least for the high radio luminosity regimes considered in this sample.

  20. Cluster headache

    PubMed Central

    2010-01-01

    Introduction The revised International Headache Society (IHS) criteria for cluster headache are: attacks of severe or very severe, strictly unilateral pain, which is orbital, supraorbital, or temporal pain, lasting 15 to 180 minutes and occurring from once every other day to eight times daily. Methods and outcomes We conducted a systematic review and aimed to answer the following clinical questions: What are the effects of interventions to abort cluster headache? What are the effects of interventions to prevent cluster headache? We searched: Medline, Embase, The Cochrane Library, and other important databases up to June 2009 (Clinical Evidence reviews are updated periodically; please check our website for the most up-to-date version of this review). We included harms alerts from relevant organisations, such as the US Food and Drug Administration (FDA) and the UK Medicines and Healthcare products Regulatory Agency (MHRA). Results We found 23 systematic reviews, RCTs, or observational studies that met our inclusion criteria. We performed a GRADE evaluation of the quality of evidence for interventions. Conclusions In this systematic review, we present information relating to the effectiveness and safety of the following interventions: baclofen (oral); botulinum toxin (intramuscular); capsaicin (intranasal); chlorpromazine; civamide (intranasal); clonidine (transdermal); corticosteroids; ergotamine and dihydroergotamine (oral or intranasal); gabapentin (oral); greater occipital nerve injections (betamethasone plus xylocaine); high-dose and high-flow-rate oxygen; hyperbaric oxygen; leuprolide; lidocaine (intranasal); lithium (oral); melatonin; methysergide (oral); octreotide (subcutaneous); pizotifen (oral); sodium valproate (oral); sumatriptan (oral, subcutaneous, and intranasal); topiramate (oral); tricyclic antidepressants (TCAs); verapamil; and zolmitriptan (oral and intranasal). PMID:21718584

  1. The 60-μm extragalactic background radiation intensity, dust-enshrouded active galactic nuclei and the assembly of groups and clusters of galaxies

    NASA Astrophysics Data System (ADS)

    Blain, A. W.; Phillips, T. G.

    2002-06-01

    Submillimetre- (submm-) wave observations have revealed a cosmologically significant population of high-redshift dust-enshrouded galaxies. The form of evolution inferred for this population can be reconciled easily with COBE FIRAS and DIRBE measurements of the cosmic background radiation (CBR) intensity at wavelengths longer than ~100μm. At shorter wavelengths, however, the 60-μm CBR intensity reported by Finkbeiner, Davis & Schlegel is less easily accounted for. Lagache et al. have proposed that this excess CBR emission is a warm Galactic component, and the detection of the highest-energy γ-rays from blazars limits the CBR intensity at these wavelengths, but here we investigate possible sources of this excess CBR emission, assuming that it has a genuine extragalactic origin. We propose and test three explanations, each involving additional populations of luminous, evolving galaxies not readily detected in existing submm-wave surveys. First, an additional population of dust-enshrouded galaxies with hot dust temperatures, perhaps dust-enshrouded, Compton-thick active galactic nuclei (AGN) as suggested by recent deep Chandra surveys. Secondly, a population of dusty galaxies with temperatures more typical of the existing submm-selected galaxies, but at relatively low redshifts. These could plausibly be associated with the assembly of groups and clusters of galaxies. Thirdly, a population of low-luminosity, cool, quiescent spiral galaxies. Hot AGN sources and the assembly of galaxy groups can account for the excess 60-μm background. There are significant problems with the cluster assembly scenario, in which too many bright 60-μm IRAS sources are predicted. Spiral galaxies have the wrong spectral energy distributions to account for the excess. Future wide-field far-infrared (IR) surveys at wavelengths of 70 and 250μm using the SIRTF and Herschel space missions will sample representative volumes of the distant Universe, allowing any hot population of dusty AGNs and

  2. Cluster Randomized Trial of a Church-Based Peer Counselor and Tailored Newsletter Intervention to Promote Colorectal Cancer Screening and Physical Activity Among Older African Americans.

    PubMed

    Leone, Lucia A; Allicock, Marlyn; Pignone, Michael P; Walsh, Joan F; Johnson, La-Shell; Armstrong-Brown, Janelle; Carr, Carol C; Langford, Aisha; Ni, Andy; Resnicow, Ken; Campbell, Marci K

    2016-10-01

    Action Through Churches in Time to Save Lives (ACTS) of Wellness was a cluster randomized controlled trial developed to promote colorectal cancer screening and physical activity (PA) within urban African American churches. Churches were recruited from North Carolina (n = 12) and Michigan (n = 7) and were randomized to intervention (n = 10) or comparison (n = 9). Intervention participants received three mailed tailored newsletters addressing colorectal cancer screening and PA behaviors over approximately 6 months. Individuals who were not up-to-date for screening at baseline could also receive motivational calls from a peer counselor. The main outcomes were up-to-date colorectal cancer screening and Metabolic Equivalency Task (MET)-hours/week of moderate-vigorous PA. Multivariate analyses examined changes in the main outcomes controlling for church cluster, gender, marital status, weight, and baseline values. Baseline screening was high in both intervention (75.9%, n = 374) and comparison groups (73.7%, n = 338). Screening increased at follow-up: +6.4 and +4.7 percentage points for intervention and comparison, respectively (p = .25). Baseline MET-hours/week of PA was 7.8 (95% confidence interval [6.8, 8.7]) for intervention and 8.7 (95% confidence interval [7.6, 9.8]) for the comparison group. There were no significant changes (p = .15) in PA for intervention (-0.30 MET-hours/week) compared with the comparison (-0.05 MET-hours/week). Among intervention participants, PA increased more for those who participated in church exercise programs, and screening improved more for those who spoke with a peer counselor or recalled the newsletters. Overall, the intervention did not improve PA or screening in an urban church population. These findings support previous research indicating that structured PA opportunities are necessary to promote change in PA and churches need more support to initiate effective peer counselor programs. PMID:26515276

  3. The zinc binuclear cluster activator AlcR is able to bind to single sites but requires multiple repeated sites for synergistic activation of the alcA gene in Aspergillus nidulans.

    PubMed

    Panozzo, C; Capuano, V; Fillinger, S; Felenbok, B

    1997-09-01

    The alcA gene which is part of the recently identified ethanol regulon, is one of the most strongly inducible genes in Aspergillus nidulans. Its transcriptional activation is mediated by the AlcR transactivator which contains a DNA-binding domain belonging to the C6 zinc binuclear cluster family. AlcR differs from the other members of this family by several features, the most striking characteristic being its binding to both symmetric and asymmetric DNA sites with the same apparent affinity. However, AlcR is also able to bind to a single site with high affinity, suggesting that unlike the other C6 proteins, AlcR binds as a monomer. In this report, we show that AlcR targets, to be functional in vivo, have to be organized as inverted or direct repeats. In addition, we show a strong synergistic activation of alcA transcription in which the number and the position of the AlcR-binding sites are crucial. The fact that the AlcR unit for in vitro binding is a single site whereas the in vivo functional unit is a repeat opens the question of the mechanism of the strong alcA transactivation. These results show that AlcR displays both in vitro and in vivo a new range of binding specificity and provides a novel example in the C6 zinc cluster protein family.

  4. Would Older Adults with Mild Cognitive Impairment Adhere to and Benefit from a Structured Lifestyle Activity Intervention to Enhance Cognition?: A Cluster Randomized Controlled Trial

    PubMed Central

    Lam, Linda Chiu-wa; Chan, Wai Chi; Leung, Tony; Fung, Ada Wai-tung; Leung, Edward Man-fuk

    2015-01-01

    Background Epidemiologic evidence suggests that cognitive and physical activities are associated with better cognition in late life. The present study was conducted to examine the possible benefits of four structured lifestyle activity interventions and compare their effectiveness in optimizing cognition for older adults with mild cognitive impairment (MCI). Method and Findings This was a 12-month cluster randomized controlled trial. 555 community-dwelling Chinese older adults with MCI (295 with multiple-domain deficits (mdMCI), 260 with single-domain deficit (sdMCI)) were recruited. Participants were randomized into physical exercise (P), cognitive activity (C), integrated cognitive and physical exercise (CP), and social activity (S, active control) groups. Interventions comprised of one-hour structured activities three times per week. Primary outcome was Clinical Dementia Rating sum of boxes (CDR-SOB) scores. Secondary outcomes included Chinese versions of Alzheimer’s Disease Assessment Scale - Cognitive subscale (ADAS-Cog), delayed recall, Mini-Mental State Examination, Category Verbal Fluency Test (CVFT) and Disability Assessment for Dementia – Instrumental Activities of Daily Living (DAD-IADL). Percentage adherence to programs and factors affecting adherence were also examined. At 12th month, 423 (76.2%) completed final assessment. There was no change in CDR-SOB and DAD-IADL scores across time and intervention groups. Multilevel normal model and linear link function showed improvement in ADAS-Cog, delayed recall and CVFT with time (p<0.05). Post-hoc subgroup analyses showed that the CP group, compared with other intervention groups, had more significant improvements of ADAS-Cog, delayed recall and CVFT performance with sdMCI participants (p<0.05). Overall adherence rate was 73.3%. Improvements in ADAS-Cog and delayed recall scores were associated with adherence after controlling for age, education, and intervention groups (univariate analyses). Conclusions

  5. Cognitive-behavioural health-promotion intervention increases fruit and vegetable consumption and physical activity among South African adolescents: a cluster-randomised controlled trial.

    PubMed

    Jemmott, John B; Jemmott, Loretta S; O'Leary, Ann; Ngwane, Zolani; Icard, Larry; Bellamy, Scarlett; Jones, Shasta; Landis, J Richard; Heeren, G Anita; Tyler, Joanne C; Makiwane, Monde B

    2011-02-01

    Rates of chronic diseases are high among Black South Africans but few studies have tested cognitive-behavioural health-promotion interventions to reduce this problem. We tested the efficacy of such an intervention among adolescents in a cluster-randomised controlled trial. We randomly selected 9 of 17 matched pairs of schools and randomised one school in each pair to the cognitive-behavioural health-promotion intervention designed to encourage health-related behaviours and the other to a human immunodeficiency virus (HIV)/sexually transmitted disease (STD) risk-reduction intervention that served as the control. Interventions were based on social cognitive theory, the theory of planned behaviour and qualitative data from the target population. Data collectors, blind to participants' intervention, administered confidential assessments at baseline and 3, 6 and 12 months post-intervention. Primary outcomes were fruit and vegetable consumption and physical activity. Participants were 1057 grade 6 learners (mean age = 12.4 years), with 96.7% retained at 12-month follow-up. Generalised estimating equations revealed that averaged over the follow-ups, a greater percentage of health-promotion intervention participants than HIV/STD control participants met 5-a-Day fruit and vegetable and physical activity guidelines. The intervention also increased health-promotion knowledge, attitude and intention, but did not decrease substance use or substance-use attitude and intention. The findings suggest that theory based and contextually appropriate interventions may increase health behaviours among young adolescents in sub-Saharan Africa.

  6. Activation of p70s6k is associated with phosphorylation of four clustered sites displaying Ser/Thr-Pro motifs.

    PubMed

    Ferrari, S; Bannwarth, W; Morley, S J; Totty, N F; Thomas, G

    1992-08-01

    Partial amino acid sequences were obtained from 22 internal tryptic peptides of rat liver p70s6k (M(r) 70,000 ribosomal protein S6 kinase), 3 of which were found to contain phosphorylated residues. To determine whether these sites were associated with p70s6k activation, the kinase was labeled to high specific activity with 32P(i) in Swiss mouse 3T3 cells. By sequential cleavage with CNBr and endoproteinase Lys-C followed by two-dimensional tryptic peptide analysis, it could be shown that all of the sites were located in a small endoproteinase Lys-C peptide of M(r) 2400. Analysis of the p70s6k protein sequence revealed a single candidate that could represent this peptide. Three tryptic peptides derived from the endoproteinase Lys-C fragment were chosen by a newly described computer program as the most likely candidates to contain the in vivo sites of phosphorylation. Synthetic peptides based on these sequences were phosphorylated either chemically or enzymatically and found to comigrate by two-dimensional thin-layer electrophoresis/chromatography with the four major in vivo labeled tryptic phosphopeptides. Three of the phosphorylation sites in these peptides were equivalent to those sequenced in the rat liver p70s6k. In addition, all four sites display the motif Ser/Thr-Pro, typical of cell cycle-regulated sites, and are clustered in a putative autoinhibitory domain of the enzyme.

  7. A multi-component universal intervention to improve diet and physical activity among adults with intellectual disabilities in community residences: a cluster randomised controlled trial.

    PubMed

    Bergström, Helena; Hagströmer, Maria; Hagberg, Jan; Elinder, Liselotte Schäfer

    2013-11-01

    People with ID have an increased risk for unhealthy diets, physical inactivity and weight disturbances. The aim of the current study was to investigate the effectiveness of a novel and complex intervention to improve diet and physical activity, targeting both caregivers and residents, in community residences for people with ID. A three component intervention based on Social Cognitive Theory was developed, including: (1) appointment of a health ambassador in each community residence attending network meetings, (2) a study circle for caregivers, and (3) a health course for the residents. The intervention lasted for 12-16 months and allowed for some local tailoring. A cluster randomised controlled trial, randomised at residence level, was conducted to evaluate the effects of the intervention. Thirty community residences for people with mild or moderate ID in Stockholm County, Sweden, were included. A total of 130 participants, 74 women and 56 men aged 20-66 years, entered, and 129 participants completed the study. The primary outcome was physical activity, measured by pedometry. Secondary outcomes were BMI, waist circumference, dietary quality measured by digital photography, satisfaction with life assessed with a scale, and work routines assessed with a questionnaire. Outcomes were related to intervention fidelity. A positive intervention effect was found on physical activity, with an average increase of 1608 steps/day among participants in the intervention group (P=0.045). The effect size was 0.29 (Cohen's d). The type of residence was found to be an effect moderator. A positive intervention effect was found as well on work routines, with an average increase of 7.1 percentage points on a self-assessment scale among residences in the intervention group (P=0.016). No significant effects were found on BMI, waist circumference, dietary quality, or satisfaction with life. In conclusion, this innovative intervention was effective in improving physical activity and work

  8. Steroid hormones in cluster headaches.

    PubMed

    Stillman, Mark

    2006-04-01

    For decades, glucocorticoid therapy has been a well-recognized abortive treatment for cluster headaches. However, the role of steroid hormones, including both glucocorticoids and sex steroids, in the pathophysiology and therapy of cluster headaches has been a topic of much debate and speculation. Current research now points to the importance of cortisol and testosterone in the pathogenesis of cluster headaches, and they appear to be linked mechanistically to another hormone, melatonin. Melatonin, unlike cortisol or testosterone, is not a product of the hypothalamic pituitary axis but of the retinohypothalamic pineal axis, and is the major biomarker of circadian rhythms. The regulation of steroids and melatonin in the pathogenesis of cluster headaches in turn depends on the sympathetic nervous system. Accumulated evidence suggests sympathetic dysfunction--embodied in the Horner sign so commonly seen in the cluster headache--as a necessary ingredient in the inception of the cluster headache. Sympathetic dysfunction now is thought to be associated with the hypercortisolism, hypotestosteronism, and lower-than-normal melatonin levels in the active cluster patient. Future research may hold the key to a fuller explanation of the complex interaction of hormonal systems in the cluster headache.

  9. Effectiveness of a School-Based Physical Activity Intervention on Cognitive Performance in Danish Adolescents: LCoMotion—Learning, Cognition and Motion – A Cluster Randomized Controlled Trial

    PubMed Central

    Domazet, Sidsel Louise; Froberg, Karsten; Hillman, Charles H.; Andersen, Lars Bo; Bugge, Anna

    2016-01-01

    Background Physical activity is associated not only with health-related parameters, but also with cognitive and academic performance. However, no large scale school-based physical activity interventions have investigated effects on cognitive performance in adolescents. The aim of this study was to describe the effectiveness of a school-based physical activity intervention in enhancing cognitive performance in 12–14 years old adolescents. Methods A 20 week cluster randomized controlled trial was conducted including seven intervention and seven control schools. A total of 632 students (mean (SD) age: 12.9 (0.6) years) completed the trial with baseline and follow-up data on primary or secondary outcomes (74% of randomized subjects). The intervention targeted physical activity during academic subjects, recess, school transportation and leisure-time. Cognitive performance was assessed using an executive functions test of inhibition (flanker task) with the primary outcomes being accuracy and reaction time on congruent and incongruent trials. Secondary outcomes included mathematics performance, physical activity levels, body-mass index, waist-circumference and cardiorespiratory fitness. Results No significant difference in change, comparing the intervention group to the control group, was observed on the primary outcomes (p’s>0.05) or mathematics skills (p>0.05). An intervention effect was found for cardiorespiratory fitness in girls (21 meters (95% CI: 4.4–38.6) and body-mass index in boys (-0.22 kg/m2 (95% CI: -0.39–0.05). Contrary to our predictions, a significantly larger change in interference control for reaction time was found in favor of the control group (5.0 milliseconds (95% CI: 0–9). Baseline to mid-intervention changes in physical activity levels did not differ significantly between groups (all p’s>0.05). Conclusions No evidence was found for effectiveness of a 20-week multi-faceted school-based physical activity intervention for enhancing

  10. Mid-Holocene cluster of large-scale landslides revealed in the Southwestern Alps by 36Cl dating. Insight on an Alpine-scale landslide activity

    NASA Astrophysics Data System (ADS)

    Zerathe, Swann; Lebourg, Thomas; Braucher, Régis; Bourlès, Didier

    2014-04-01

    Although it is generally assumed that the internal structure of a slope (e.g. lithology and rock mass properties, inherited faults and heterogeneities, etc.) is preponderant for the progressive development of large-scale landslides, the ability to identify triggering factors responsible for final slope failures such as glacial debuttressing, seismic activities or climatic changes, especially when considering landslide cluster at an orogen-scale, is still debated. Highlighting in this study the spatial and temporal concordant clustering of deep-seated slope failures in the external Southwestern Alps, we discuss and review the possible causes for such wide-spread slope instabilities at both local and larger (Alpine) scale. High resolution field mapping coupled with electrical resistivity tomography first allows establishing an inventory of large landslides in the Southwestern Alps, determining their structural model, precising their depth limit (100-200 m) as well as the involved rock volumes (>107 m3). We show that they developed in the same geostructural context of thick mudstone layers overlain by faulted limestone and followed a block-spread model of deformation that could evolve in rock-collapse events. Cosmic ray exposure dating (CRE), using both 36Cl and 10Be in coexisting limestone and chert, respectively, has been carried out from the main scarps of six Deep Seated Landslides (DSL) and leads to landslide-failure CRE ages ranging from 3.7 to 4.7 ka. They highlighted: (i) mainly single and fast ruptures and (ii) a possible concomitant initiation with a main peak of activity between 3.3 and 5.1 ka, centered at ca 4.2 ka. Because this region was not affected by historical glaciations events, landslide triggering by glacial unloading can be excluded. The presented data combined with field observations preferentially suggest that these failures were climatically driven and were most likely controlled by high pressure changes in the karstic medium. In effect, the

  11. FRET analysis using sperm-activating peptides tagged with fluorescent proteins reveals that ligand-binding sites exist as clusters.

    PubMed

    Arcos-Hernández, César; Romero, Francisco; Sánchez-Guevara, Yoloxochitl; Beltrán, Carmen; Nishigaki, Takuya

    2016-02-01

    Long-range cellular communication between the sperm and egg is critical for external fertilization. Sperm-activating peptides (SAPs) are diffusible components of the outer layer of eggs in echinoderms, and function as chemoattractants for spermatozoa. The decapeptide named speract is the best-characterized sea urchin SAP. Biochemical and physiological actions of speract have been studied with purified or chemically synthesized peptides. In this work, we prepared recombinant speract fused to a fluorescent protein (FP; FP-speract) using three color variants: a cyan (eCFP), a yellow (mVenus) and a large Stokes shift yellow (mAmetrine) FP. Although these fluorescence tags are 20 times larger than speract, competitive binding experiments using mAmetrine-speract revealed that this FP-speract has binding affinity to the receptor that is comparable (7.6-fold less) to that of non-labeled speract. Indeed, 10 nmol l(-1) eCFP-speract induces physiological sperm responses such as membrane potential changes and increases in intracellular pH and Ca(2+) concentrations similar to those triggered by 10 nmol l(-1) speract. Furthermore, FP-speract maintains its fluorescence upon binding to its receptor. Using this property, we performed fluorescence resonance energy transfer (FRET) measurements with eCFP-speract and mVenus-speract as probes and obtained a positive FRET signal upon binding to the receptor, which suggests that the speract receptor exists as an oligomer, at least as a dimer, or alternatively that a single speract receptor protein possesses multiple binding sites. This property could partially account for the positive and/or negative cooperative binding of speract to the receptor.

  12. Spatial clustering with Density-Ordered tree

    NASA Astrophysics Data System (ADS)

    Cheng, Qing; Lu, Xin; Liu, Zhong; Huang, Jincai; Cheng, Guangquan

    2016-10-01

    Clustering has emerged as an active research direction for knowledge discovery in spatial databases. Most spatial clustering methods become ineffective when inappropriate parameters are given or when datasets of diverse shapes and densities are provided. To address this issue, we propose a novel clustering method, called SCDOT (Spatial Clustering with Density-Ordered Tree). By projecting a dataset to a Density-Ordered Tree, SCDOT partitions the data into several relatively small sub-clusters with a box-plot method. A heuristic method is proposed to find the genuine clusters by repeatedly merging sub-clusters and an iteration strategy is utilized to automatically determine input parameters. Moreover, we also provide an innovative way to identify cluster center and noise. Extensive experiments on both synthetic and real-world datasets demonstrate the superior performance of SCDOT over the baseline methods.

  13. A healthy school start - Parental support to promote healthy dietary habits and physical activity in children: Design and evaluation of a cluster-randomised intervention

    PubMed Central

    2011-01-01

    Background Childhood obesity is multi-factorial and determined to a large extent by dietary habits, physical activity and sedentary behaviours. Previous research has shown that school-based programmes are effective but that their effectiveness can be improved by including a parental component. At present, there is a lack of effective parental support programmes for improvement of diet and physical activity and prevention of obesity in children. Methods/Design This paper describes the rationale and design of a parental support programme to promote healthy dietary habits and physical activity in six-year-old children starting school. The study is performed in close collaboration with the school health care and is designed as a cluster-randomised controlled trial with a mixed methods approach. In total, 14 pre-school classes are included from a municipality in Stockholm county where there is large variation in socio-economic status between the families. The school classes are randomised to intervention (n = 7) and control (n = 7) groups including a total of 242 children. The intervention is based on social cognitive theory and consists of three main components: 1) a health information brochure; 2) two motivational interviewing sessions with the parents; and 3) teacher-led classroom activities with the children. The primary outcomes are physical activity in the children measured objectively by accelerometry, children's dietary and physical activity habits measured with a parent-proxy questionnaire and parents' self-efficacy measured by a questionnaire. Secondary outcomes are height, weight and waist circumference in the children. The duration of the intervention is six months and includes baseline, post intervention and six months follow-up measurements. Linear and logistic regression models will be used to analyse differences between intervention and control groups in the outcome variables. Mediator and moderator analysis will be performed. Participants will be

  14. ‘Physical Activity 4 Everyone’ school-based intervention to prevent decline in adolescent physical activity levels: 12 month (mid-intervention) report on a cluster randomised trial

    PubMed Central

    Sutherland, Rachel; Campbell, Elizabeth; Lubans, David R; Morgan, Philip J; Okely, Anthony D; Nathan, Nicole; Wolfenden, Luke; Wiese, Jarrod; Gillham, Karen; Hollis, Jenna; Wiggers, John

    2016-01-01

    Background Adolescence is a recognised period of physical activity decline, particularly among low-income communities. We report the 12-month (midpoint) effects of a 2-year multicomponent physical activity intervention implemented in disadvantaged secondary schools. Methods A cluster randomised trial was undertaken in 10 secondary schools located in disadvantaged areas in New South Wales, Australia. Students in Grade 7 were recruited, with follow-up in Grade 8. The intervention was guided by socioecological theory and included seven physical activity strategies, and six implementation adoption strategies. The primary outcome was mean minutes of moderate-to-vigorous physical activity (MVPA) per day assessed using Actigraph GT3X accelerometers. Outcome data were analysed using repeated measures linear mixed models. Results At baseline, 1150 (93%) students participated in the data collection (mean age 12 years, 48% boys) and 1050 (79%) students participated at 12-month follow-up. By the 12-month follow-up, the six implementation adoption strategies had been used to support schools to deliver four of the seven physical activity elements. There was a significant group-by-time interaction for mean minutes of MVPA per day in favour of the intervention group (adjusted difference between groups at follow-up=3.85 min, 95% CI (0.79 to 6.91), p≤0.01), including significantly more vigorous physical activity (2.45 min, p≤0.01), equating to 27 min more MVPA per week. Summary At 12-month follow-up, the intervention had reduced the decline in physical activity among adolescents from disadvantaged schools. The intervention may assist students to meet physical activity guidelines. PMID:26359346

  15. Analysis of multi-domain hypothetical proteins containing iron-sulphur clusters and fad ligands reveal rieske dioxygenase activity suggesting their plausible roles in bioremediation

    PubMed Central

    Sathyanarayanan, Nitish; Nagendra, Holenarasipur Gundurao

    2012-01-01

    ‘Conserved hypothetical’ proteins pose a challenge not just for functional genomics, but also to biology in general. As long as there are hundreds of conserved proteins with unknown function in model organisms such as Escherichia coli, Bacillus subtilis or Saccharomyces cerevisiae, any discussion towards a ‘complete’ understanding of these biological systems will remain a wishful thinking. Insilico approaches exhibit great promise towards attempts that enable appreciating the plausible roles of these hypothetical proteins. Among the majority of genomic proteins, two-thirds in unicellular organisms and more than 80% in metazoa, are multi-domain proteins, created as a result of gene duplication events. Aromatic ring-hydroxylating dioxygenases, also called Rieske dioxygenases (RDOs), are class of multi-domain proteins that catalyze the initial step in microbial aerobic degradation of many aromatic compounds. Investigations here address the computational characterization of hypothetical proteins containing Ferredoxin and Flavodoxin signatures. Consensus sequence of each class of oxidoreductase was obtained by a phylogenetic analysis, involving clustering methods based on evolutionary relationship. A synthetic sequence was developed by combining the consensus, which was used as the basis to search for their homologs via BLAST. The exercise yielded 129 multidomain hypothetical proteins containing both 2Fe-2S (Ferredoxin) and FNR (Flavodoxin) domains. In the current study, 40 proteins with N-terminus 2Fe-2S domain and C-terminus FNR domain are characterized, through homology modelling and docking exercises which suggest dioxygenase activity indicating their plausible roles in degradation of aromatic moieties. PMID:23275712

  16. Quantum-chemical study of the effect of oxygen on the formation of active sites of silver clusters during the selective adsorption of hydrocarbons

    NASA Astrophysics Data System (ADS)

    Lanin, S. N.; Polynskaya, Yu. G.; Pichugina, D. A.; Nguen, V.; Beletskaya, A. V.; Kuz'menko, N. E.; Shestakov, A. F.

    2013-09-01

    Density functional theory (PBE with a modified Dirac-Coulomb-Breit Hamiltonian) is used to simulate the adsorption of hydrocarbons (C2H2, C2H4, C2H6) on the surface of a sorbent containing Ag0, Agδ+, and AgO sites. The dynamics of change in the structural characteristics of Ag n ( n ≤ 10) is analyzed and the adsorption of oxygen on Ag8 and Ag10 is studied to select the adsorption site model. Studying the interaction of hydrocarbons with Ag8, Ag10, Ag{10/+}, Ag10O, and Ag10O2 clusters reveals that the presence of oxygen leads to an increase in the activation of unsaturated hydrocarbons, and the adsorption energy of C2H2 increases tenfold. It is found that the role of adsorbed oxygen is not only to form adsorption sites of hydrocarbons (Agδ+) but also to bind C2H2 and C2H4 directly to the sorbent's surface.

  17. CXCR6-CXCL16 axis promotes prostate cancer by mediating cytoskeleton rearrangement via Ezrin activation and αvβ3 integrin clustering

    PubMed Central

    Singh, Rajesh; Kapur, Neeraj; Mir, Hina; Singh, Nalinaksha; Lillard, James W.; Singh, Shailesh

    2016-01-01

    Cytoskeletal rearrangement is required for migration and invasion, which are the key steps of cancer metastasis. Ezrin and integrin co-ordinate these processes by regulating cellular adhesion and cytoskeletal polymerization-depolymerization. It is also well established that chemokine-chemokine receptor axis plays a crucial role in regulating cancer cell migration and invasion. In this study, we show involvement of CXC chemokine receptor 6 (CXCR6) and its only natural ligand CXCL16 in pathobiology of prostate cancer (PCa). CXCR6 is highly expressed in PCa tissues and cell lines (LNCaP and PC3), relative to normal tissue and cells. CXCR6 expression in PCa tissues correlated with higher Gleason score. Similarly, aggressive PCa cells (PC3) show high CXCR6 compared to less aggressive LNCaP. Besides, PC3 cells show higher MMPs expression compared to LNCaP cells following CXCL16 stimulation. Intriguingly, CXCR6-CXCL16 interaction in PCa cells promotes Ezrin activation, αvβ3 integrin clustering and capping at the leading edge in FAK/PI3K/PKC dependent manner, thereby modifying cellular adhesion as well as motility. Together these results demonstrate that CXCL16 stimulation changes cytoskeletal dynamics resulting in enhanced migration, invasion and adhesion to endothelial cells, ultimately enabling PCa cells to achieve their metastatic goal. PMID:26799186

  18. Reducing tobacco use among low socio-economic status youth in Delhi, India: outcomes from project ACTIVITY, a cluster randomized trial.

    PubMed

    Harrell, Melissa B; Arora, Monika; Bassi, Shalini; Gupta, Vinay K; Perry, Cheryl L; Srinath Reddy, K

    2016-10-01

    To test the efficacy of an intervention to reduce tobacco use among youth (10-19 years old) in slum communities in Delhi, India. This community-based cluster-randomized trial included 14 slums composed of purposely built resettlement colonies and adjacent inhabitant-built Jhuggi Jhopris. Youth in the intervention received a 2 year multiple-component intervention: (a) youth and adult leader training; (b) peer-led interactive activities and outreach; (c) tobacco cessation camps; and (d) enforcement of India's Tobacco Control Law (smoke-free environments and youth access). Overall, no differences between the intervention and control conditions were observed over time; self-reported tobacco use declined in both groups. However, when stratified by type of residence, a significant decrease was observed among youth in the resettlement colonies in the intervention group for overall tobacco use (slope = -0.69) and cigarette and bidi smoking (slope = -0.66), compared to an increase in the control group (slope = 0.24 and 0.12, respectively) (P < 0.001). No differences in smokeless tobacco (SLT) use were observed for either group. Comprehensive community-based interventions that engage youth can be effective in reducing smoking among disadvantaged youth in India. More intensive interventions, like tax increases or large-scale media campaigns, appear warranted for the most marginalized in this context and for SLT products. PMID:27540182

  19. Methane activation by cobalt cluster cations, Co{sub n}{sup +} (n=2-16): Reaction mechanisms and thermochemistry of cluster-CH{sub x} (x=0-3) complexes

    SciTech Connect

    Citir, Murat; Liu Fuyi; Armentrout, P. B.

    2009-02-07

    The kinetic energy dependences of the reactions of Co{sub n}{sup +} (n=2-16) with CD{sub 4} are studied in a guided ion beam tandem mass spectrometer over the energy range of 0-10 eV. The main products are hydride formation, Co{sub n}D{sup +}, dehydrogenation to form Co{sub n}CD{sub 2}{sup +}, and double dehydrogenation yielding Co{sub n}C{sup +}. These primary products decompose to form secondary and higher order products, Co{sub n}CD{sup +}, Co{sub n-1}D{sup +}, Co{sub n-1}C{sup +}, Co{sub n-1}CD{sup +}, and Co{sub n-1}CD{sub 2}{sup +} at higher energies. Adduct formation of Co{sub n}CD{sub 4}{sup +} is also observed for the largest cluster cations, n{>=}10. In general, the efficiencies of the single and double dehydrogenation processes increase with cluster size, although the hexamer cation shows a reduced reactivity compared to its neighbors. All reactions exhibit thresholds, and cross sections for the various primary and secondary reactions are analyzed to yield reaction thresholds from which bond energies for cobalt cluster cations to D, C, CD, CD{sub 2}, and CD{sub 3} are determined. The relative magnitudes of these bond energies are consistent with simple bond order considerations. Bond energies for larger clusters rapidly reach relatively constant values, which are used to estimate the chemisorption energies of the C, CD, CD{sub 2}, and CD{sub 3} molecular fragments to cobalt surfaces.

  20. Clustered randomised controlled trial of two education interventions designed to increase physical activity and well-being of secondary school students: the MOVE Project

    PubMed Central

    Tymms, Peter B; Curtis, Sarah E; Routen, Ash C; Thomson, Katie H; Bolden, David S; Bock, Susan; Dunn, Christine E; Cooper, Ashley R; Elliott, Julian G; Moore, Helen J; Summerbell, Carolyn D; Tiffin, Paul A; Kasim, Adetayo S

    2016-01-01

    Objective To assess the effectiveness of 2 interventions in improving the physical activity and well-being of secondary school children. Design A clustered randomised controlled trial; classes, 1 per school, were assigned to 1 of 3 intervention arms or a control group based on a 2×2 factorial design. The interventions were peer-mentoring and participative learning. Year 7 children (aged 11–12) in the peer-mentoring intervention were paired with year 9 children for 6 weekly mentoring meetings. Year 7 children in the participative learning arm took part in 6 weekly geography lessons using personalised physical activity and Global Positioning System (GPS) data. Year 7 children in the combined intervention received both interventions, with the year 9 children only participating in the mentoring sessions. Participants 1494 year 7 students from 60 schools in the North of England took part in the trial. Of these, 43 students opted out of taking part in the evaluation measurements, 2 moved teaching group and 58 changed school. Valid accelerometry outcome data were collected for 892 students from 53 schools; and well-being outcome data were available for 927 students from 52 schools. Main outcome measures The primary outcomes were mean minutes of accelerometer-measured moderate-to-vigorous intensity physical activity per day, and well-being as evaluated by the KIDSCREEN-27 questionnaire. These data were collected 6 weeks after the intervention; a 12-month follow-up is planned. Results No significant effects (main or interaction) were observed for the outcomes. However, small positive differences were found for both outcomes for the participative learning intervention. Conclusions These findings suggest that the 2 school-based interventions did not modify levels of physical activity or well-being within the period monitored. Change in physical activity may require more comprehensive individual behavioural intervention, and/or more system-based efforts to address wider

  1. It's LiFe! Mobile and Web-Based Monitoring and Feedback Tool Embedded in Primary Care Increases Physical Activity: A Cluster Randomized Controlled Trial

    PubMed Central

    Spreeuwenberg, Marieke; Tange, Huibert; van der Weijden, Trudy; de Witte, Luc

    2015-01-01

    Background Physical inactivity is a major public health problem. The It’s LiFe! monitoring and feedback tool embedded in the Self-Management Support Program (SSP) is an attempt to stimulate physical activity in people with chronic obstructive pulmonary disease or type 2 diabetes treated in primary care. Objective Our aim was to evaluate whether the SSP combined with the use of the monitoring and feedback tool leads to more physical activity compared to usual care and to evaluate the additional effect of using this tool on top of the SSP. Methods This was a three-armed cluster randomised controlled trial. Twenty four family practices were randomly assigned to one of three groups in which participants received the tool + SSP (group 1), the SSP (group 2), or care as usual (group 3). The primary outcome measure was minutes of physical activity per day. The secondary outcomes were general and exercise self-efficacy and quality of life. Outcomes were measured at baseline after the intervention (4-6 months), and 3 months thereafter. Results The group that received the entire intervention (tool + SSP) showed more physical activity directly after the intervention than Group 3 (mean difference 11.73, 95% CI 6.21-17.25; P<.001), and Group 2 (mean difference 7.86, 95% CI 2.18-13.54; P=.003). Three months after the intervention, this effect was still present and significant (compared to Group 3: mean difference 10.59, 95% CI 4.94-16.25; P<.001; compared to Group 2: mean difference 9.41, 95% CI 3.70-15.11; P<.001). There was no significant difference in effect between Groups 2 and 3 on both time points. There was no interaction effect for disease type. Conclusions The combination of counseling with the tool proved an effective way to stimulate physical activity. Counseling without the tool was not effective. Future research about the cost-effectiveness and application under more tailored conditions and in other target groups is recommended. Trial Registration Clinical

  2. Protocol for the ‘Virtual Traveller’ cluster-randomised controlled trial: a behaviour change intervention to increase physical activity in primary-school Maths and English lessons

    PubMed Central

    Norris, E; Dunsmuir, S; Duke-Williams, O; Stamatakis, E; Shelton, N

    2016-01-01

    Introduction Physical activity (PA) has been shown to be an important factor for health and educational outcomes in children. However, a large proportion of children's school day is spent in sedentary lesson-time. There is emerging evidence about the effectiveness of physically active lessons: integrating physical movements and educational content in the classroom. ‘Virtual Traveller’ is a novel 6-week intervention of 10-min sessions performed 3 days per week, using classroom interactive whiteboards to integrate movement into primary-school Maths and English teaching. The primary aim of this project is to evaluate the effect of the Virtual Traveller intervention on children's PA, on-task behaviour and student engagement. Methods and analysis This study will be a cluster-randomised controlled trial with a waiting-list control group. Ten year 4 (aged 8–9 years) classes across 10 primary schools will be randomised by class to either the 6-week Virtual Traveller intervention or the waiting-list control group. Data will be collected 5 times: at baseline, at weeks 2 and 4 of the intervention, and 1 week and 3 months postintervention. At baseline, anthropometric measures, 4-day objective PA monitoring (including 2 weekend days; Actigraph accelerometer), PA and on-task behaviour observations and student engagement questionnaires will be performed. All but anthropometric measures will be repeated at all other data collection points. Changes in overall PA levels and levels during different time-periods (eg, lesson-time) will be examined. Changes in on-task behaviour and student engagement between intervention groups will also be examined. Multilevel regression modelling will be used to analyse the data. Process evaluation will be carried out during the intervention period. Ethics and dissemination The results of this study will be disseminated through peer-review publications and conference presentations. Ethical approval was obtained through the University

  3. Assessment of the impact of anthropogenic activities on the groundwater hydrology and chemistry in Tarsus coastal plain (Mersin, SE Turkey) using fuzzy clustering, multivariate statistics and GIS techniques

    NASA Astrophysics Data System (ADS)

    Güler, Cüneyt; Kurt, Mehmet Ali; Alpaslan, Musa; Akbulut, Can

    2012-01-01

    SummaryTarsus coastal plain (TCP) is an economically and ecologically important area situated in between the fertile fluvio-deltaic plains of two rivers, Deliçay and Tarsus (Mersin, SE Turkey), where anthropogenic activities (agricultural, industrial, and domestic) are very intense. Twenty-four water quality parameters were surveyed at 193 groundwater and 10 surface water sites during August 2008. The objective was to characterize the physico-chemical properties of groundwaters in TCP, assess the impact of anthropogenic activities on the groundwater hydrology and chemistry, and identify the major hydrogeochemical processes occurring in the area. Groundwater samples were grouped into hydrochemically distinct and spatially continuous four water classes (i.e., C1, C2, C3, and C4) using the fuzzy c-means (FCM) clustering method, where membership values were interpolated using the ordinary kriging technique. Principal components analysis (PCA) was used to decipher various underlying natural and anthropogenic processes creating these distinct water classes. Four principal components (PCs) were extracted in PCA which explained more than 73% of the total variance in water quality. Major factors responsible for the variations in chemistries of water classes are identified as: (1) water-rock interaction and nitrate contamination; (2) salinization by seawater intrusion and evaporite dissolution; (3) geogenic/anthropogenic Cr, Fe, and Mn; and (4) anthropogenic Zn pollution. Overexploitation of the aquifer is clearly evident, especially at settlements located near the coastal zone, where the water table is lowered 2-5 m below the sea level. Salinization is well known in the area and is attributed not only to seawater intrusion, but also to dissolution of evaporitic series from the Handere formation. Hydrochemical evidence also suggest that in the area subsurface paleo-river channels and the deposits infilling the ancient lagoon area within Quaternary-Recent alluvial deposits

  4. Lessons learnt from the Bristol Girls Dance Project cluster RCT: implications for designing and implementing after-school physical activity interventions

    PubMed Central

    Edwards, Mark J; May, Thomas; Kesten, Joanna M; Banfield, Kate; Bird, Emma L; Powell, Jane E; Sebire, Simon J; Jago, Russell

    2016-01-01

    Objective To consider implementation issues associated with the delivery of Bristol Girls Dance Project (BGDP) and to identify improvements that may aid the design of after-school physical activity (PA) interventions. Design Two-armed cluster randomised control trial. The BGDP was a 20-week school-based intervention, consisting of two 75 min after-school dance sessions per week, which aimed to support Year 7 girls to be more physically active. Setting 18 secondary schools (nine intervention, nine control) in the Greater Bristol area (as an indication of deprivation, children eligible for the pupil premium in participant schools ranged from 6.9 to 53.3%). Participants 571 Year 7 girls. This article reports on qualitative data collected from 59 girls in the intervention arm of the trial, 10 dance instructors and 9 school contacts involved in the delivering of the BGDP. Methods Data were obtained from nine focus groups with girls (one per intervention school), and interviews with dance instructors and school contacts. Focus groups sought views of girls’ motivation to participate, teaching styles and experiences of the intervention. Interviews explored views on implementation and dissemination. Framework analysis was used to analyse data. Results Qualitative data elicited three themes associated with the delivery of BGDP that affected implementation: project design, session content and project organisation. ‘Project design’ found issues associated with recruitment, timetabling and session quantity to influence the effectiveness of BGDP. ‘Session content’ found that dance instructors delivered a range of content and that girls enjoyed a variety of dance. Themes within ‘project organisation’ suggested an ‘open enrolment’ policy and greater parental involvement may facilitate better attendance. Conclusions After-school PA interventions have potential for increasing PA levels among adolescent girls. There is a need to consider the context in which

  5. Family-Based Cluster Randomized Controlled Trial Enhancing Physical Activity and Motor Competence in 4–7-Year-Old Children

    PubMed Central

    Laukkanen, Arto; Pesola, Arto Juhani; Heikkinen, Risto; Sääkslahti, Arja Kaarina; Finni, Taija

    2015-01-01

    Little is known of how to involve families in physical activity (PA) interventions for children. In this cluster randomized controlled trial, we recruited families with four- to seven-year-old children to participate in a year-long study where parents in the intervention group families (n = 46) received tailored counseling to increase children’s PA. Structured PA was not served. Control group families (n = 45) did not receive any counseling. PA in all children (n = 91; mean age 6.16 ± 1.13 years at the baseline) was measured by accelerometers at the baseline and after three, six, nine and 12 months. Motor competence (MC) (n = 89) was measured at the baseline and after six and 12 months by a KTK (KörperkoordinationsTest für Kinder) and throwing and catching a ball (TCB) protocols. The effect of parental counseling on study outcomes was analyzed by a linear mixed-effects model fit by REML and by a Mann-Whitney U test in the case of the TCB. As season was hypothesized to affect counseling effect, an interaction of season on the study outcomes was examined. The results show significant decrease of MVPA in the intervention group when compared to the control group (p < .05). The TCB showed a nearly significant improvement at six months in the intervention group compared to the controls (p = .051), but not at 12 months. The intervention group had a steadier development of the KTK when the interaction of season was taken into account. In conclusion, more knowledge of family constructs associating with the effectiveness of counseling is needed for understanding how to enhance PA in children by parents. However, a hypothesis may be put forward that family-based counseling during an inactive season rather than an active season may provide a more lasting effect on the development of KTK in children. Trial Registration Controlled-Trials.com ISRCTN28668090 PMID:26502183

  6. The BLISS cluster randomised controlled trial of the effect of 'active dissemination of information' on standards of care for premature babies in England (BEADI) study protocol [ISRCTN89683698

    PubMed Central

    Acolet, Dominique; Jelphs, Kim; Davidson, Deborah; Peck, Edward; Clemens, Felicity; Houston, Rosie; Weindling, Michael; Lavis, John; Elbourne, Diana

    2007-01-01

    Background Gaps between research knowledge and practice have been consistently reported. Traditional ways of communicating information have limited impact on practice changes. Strategies to disseminate information need to be more interactive and based on techniques reported in systematic reviews of implementation of changes. There is a need for clarification as to which dissemination strategies work best to translate evidence into practice in neonatal units across England. The objective of this trial is to assess whether an innovative active strategy for the dissemination of neonatal research findings, recommendations, and national neonatal guidelines is more likely to lead to changes in policy and practice than the traditional (more passive) forms of dissemination in England. Methods/design Cluster randomised controlled trial of all neonatal units in England (randomised by hospital, n = 182 and stratified by neonatal regional networks and neonatal units level of care) to assess the relative effectiveness of active dissemination strategies on changes in local policies and practices. Participants will be mainly consultant lead clinicians in each unit. The intervention will be multifaceted using: audit and feedback; educational meetings for local staff (evidence-based lectures on selected topics, interactive workshop to examine current practice and draw up plans for change); and quality improvement and organisational changes methods. Policies and practice outcomes for the babies involved will be collected before and after the intervention. Outcomes will assess all premature babies born in England during a three month period for timing of surfactant administration at birth, temperature control at birth, and resuscitation team (qualification and numbers) present at birth. Trial registration Current controlled trials ISRCTN89683698 PMID:17922901

  7. Nuclear resonance vibrational spectroscopy reveals the FeS cluster composition and active site vibrational properties of an O2-tolerant NAD+-reducing [NiFe] hydrogenase

    SciTech Connect

    Lauterbach, Lars; Wang, Hongxin; Horch, Marius; Gee, Leland B.; Yoda, Yoshitaka; Tanaka, Yoshihito; Zebger, Ingo; Lenz, Oliver; Cramer, Stephen P.

    2014-10-30

    Hydrogenases are complex metalloenzymes that catalyze the reversible splitting of molecular hydrogen into protons and electrons essentially without overpotential. The NAD+-reducing soluble hydrogenase (SH) from Ralstonia eutropha is capable of H2 conversion even in the presence of usually toxic dioxygen. The molecular details of the underlying reactions are largely unknown, mainly because of limited knowledge of the structure and function of the various metal cofactors present in the enzyme. Here, all iron-containing cofactors of the SH were investigated by 57Fe specific nuclear resonance vibrational spectroscopy (NRVS). Our data provide experimental evidence for one [2Fe2S] center and four [4Fe4S] clusters, which is consistent with the amino acid sequence composition. Only the [2Fe2S] cluster and one of the four [4Fe4S] clusters were reduced upon incubation of the SH with NADH. This finding explains the discrepancy between the large number of FeS clusters and the small amount of FeS cluster-related signals as detected by electron paramagnetic resonance spectroscopic analysis of several NAD+-reducing hydrogenases. For the first time, Fe–CO and Fe–CN modes derived from the [NiFe] active site could be distinguished by NRVS through selective 13C labeling of the CO ligand. This strategy also revealed the molecular coordinates that dominate the individual Fe–CO modes. The present approach explores the complex vibrational signature of the Fe–S clusters and the hydrogenase active site, thereby showing that NRVS represents a powerful tool for the elucidation of complex biocatalysts containing multiple cofactors.

  8. SACS: Spitzer Archival Cluster Survey

    NASA Astrophysics Data System (ADS)

    Stern, Daniel

    combined, providing a high-purity, uniform sample. Matching the Spitzer/IRAC-selected clusters with data at similar and longer wavelengths available in the archive (WISE 3- 5μm, Spitzer/MIPS 24μm or Herschel/SPIRE 250μm data) we will be also able to study the dependence on the environment of star formation and AGN activity out to z~2, and to study the effect of star-forming galaxies and AGNs on cosmological results from ongoing Sunyaev-Zel'dovich (SZ) and X-ray cluster surveys. The identified clusters will be valuable for both astrophysics and cosmology. In terms of astrophysics, the redshift probed by the MIR color selection targets a key epoch in cluster development, when star formation is shutting down and the galaxies are becoming passive. Massive clusters also distort space-time around them, creating powerful gravitational telescopes that lens the distant universe. This both allows detailed studies of the lensed objects with otherwise unachievable sensitivity, as well as provides a unique probe of the mass distribution in the lensing cluster. In terms of cosmology, clusters are the most massive structures in the universe, and their space density is sensitive to basic cosmological parameters. Clusters identified by this program will become a lasting legacy of Spitzer, providing exciting targets for Chandra, Hubble, James Webb Space Telescope (JWST), Astro-H, Athena, as well as future 30-m class ground-based telescopes (e.g., GMT, ELT, TMT). The upcoming large-scale, space-based surveys of eROSITA, Euclid, and WFIRST all have distant cluster studies as key scientific goals. Our proposed survey will provide new high redshift targets for those satellites, enabling unique, exciting multi-wavelength studies of the Spitzer-selected sample, as well as a training set to identify additional high-redshift clusters outside of the Spitzer footprint.

  9. Promoting a healthy diet and physical activity in adults with intellectual disabilities living in community residences: Design and evaluation of a cluster-randomized intervention

    PubMed Central

    2010-01-01

    Background Many adults with intellectual disabilities have poor dietary habits, low physical activity and weight disturbances. This study protocol describes the design and evaluation of a health intervention aiming to improve diet and physical activity in this target group. In Sweden, adults with intellectual disabilities often live in community residences where the staff has insufficient education regarding the special health needs of residents. No published lifestyle interventions have simultaneously targeted both residents and staff. Methods/Design The intervention is designed to suit the ordinary work routines of community residences. It is based on social cognitive theory and takes 12-15 months to complete. The intervention includes three components: 1) Ten health education sessions for residents in their homes; 2) the appointment of a health ambassador among the staff in each residence and formation of a network; and 3) a study circle for staff in each residence. The intervention is implemented by consultation with managers, training of health educators, and coaching of health ambassadors. Fidelity is assessed based on the participation of residents and staff in the intervention activities. The study design is a cluster-randomised trial with physical activity as primary outcome objectively assessed by pedometry. Secondary outcomes are dietary quality assessed by digital photography, measured weight, height and waist circumference, and quality of life assessed by a quality of life scale. Intermediate outcomes are changes in work routines in the residences assessed by a questionnaire to managers. Adults with mild to moderate intellectual disabilities living in community residences in Stockholm County are eligible for inclusion. Multilevel analysis is used to evaluate effects on primary and secondary outcomes. The impact of the intervention on work routines in community residences is analysed by ordinal regression analysis. Barriers and facilitators of

  10. Synthesis of the Stereoisomeric Clusters 1,2-Os3(CO)10(trans-dpmn) and 1,2-Os3(CO)10(cis-dpmn) [where dpmn = 2,3-bis(diphenylphosphinomethyl)-5-norbornene]: DFT Evaluation of the Isomeric Clusters 1,2-Os3(CO)10(dpmn) and Isomer-Dependent Diphosphine Ligand Activation

    DOE PAGES

    Yang, Li; Nesterov, Vladimir N.; Wang, Xiaoping; Richmond, Michael G.

    2014-07-23

    The bicyclic diphosphines trans- and cis-2,3-bis(diphenylphosphinomethyl)-5-norbornene (dpmn) react with 1,2-Os3(CO)10(MeCN)2 (1) to furnish the corresponding ligand-bridged clusters Os3(CO)10(trans-dpmn) (2) and Os3(CO)10(cis-dpmn) (3). Both new products have been isolated and the molecular structures established by X-ray diffraction analyses. The dihydroxyl-bridged cluster 1,2-Os3(CO)8(μ-OH)2(cis-dpmn) (4), which accompanied the formation of 3 in one reaction, has been isolated and characterized by mass spectrometry and X-ray crystallography. Whereas cluster 2 is stable in toluene at 373 K, 3 is thermally sensitive under identical conditions and undergoes loss of CO (2 equiv), coupled with the activation of three norbornene C-H bonds and one P-C(phenyl) bond, tomore » furnish the dihydride cluster H2Os3(CO)8[μ3-2-PhPC-3-endo-Ph2PCH2(C7H7)] (5). The solid-state structure of 5 confirms the multiple activation of the cis-dpmn ligand and accompanying formation of the face-capping 2-PhPC-3-endo-Ph2PCH2(C7H7) moiety in the product. DFT calculations on 2 and 3 indicate that the former cluster is the thermodynamically more stable isomer, and the conversion of 3→ 5 + 2CO + benzene is computed to be exergonic by 12.7 kcal/mol and is entropically favored due to the release of the CO and benzene by-products.« less

  11. Collective thermoregulation in bee clusters.

    PubMed

    Ocko, Samuel A; Mahadevan, L

    2014-02-01

    Swarming is an essential part of honeybee behaviour, wherein thousands of bees cling onto each other to form a dense cluster that may be exposed to the environment for several days. This cluster has the ability to maintain its core temperature actively without a central controller. We suggest that the swarm cluster is akin to an active porous structure whose functional requirement is to adjust to outside conditions by varying its porosity to control its core temperature. Using a continuum model that takes the form of a set of advection-diffusion equations for heat transfer in a mobile porous medium, we show that the equalization of an effective 'behavioural pressure', which propagates information about the ambient temperature through variations in density, leads to effective thermoregulation. Our model extends and generalizes previous models by focusing the question of mechanism on the form and role of the behavioural pressure, and allows us to explain the vertical asymmetry of the cluster (as a consequence of buoyancy-driven flows), the ability of the cluster to overpack at low ambient temperatures without breaking up at high ambient temperatures, and the relative insensitivity to large variations in the ambient temperature. Our theory also makes testable hypotheses for the response of the cluster to external temperature inhomogeneities and suggests strategies for biomimetic thermoregulation. PMID:24335563

  12. Collective thermoregulation in bee clusters.

    PubMed

    Ocko, Samuel A; Mahadevan, L

    2014-02-01

    Swarming is an essential part of honeybee behaviour, wherein thousands of bees cling onto each other to form a dense cluster that may be exposed to the environment for several days. This cluster has the ability to maintain its core temperature actively without a central controller. We suggest that the swarm cluster is akin to an active porous structure whose functional requirement is to adjust to outside conditions by varying its porosity to control its core temperature. Using a continuum model that takes the form of a set of advection-diffusion equations for heat transfer in a mobile porous medium, we show that the equalization of an effective 'behavioural pressure', which propagates information about the ambient temperature through variations in density, leads to effective thermoregulation. Our model extends and generalizes previous models by focusing the question of mechanism on the form and role of the behavioural pressure, and allows us to explain the vertical asymmetry of the cluster (as a consequence of buoyancy-driven flows), the ability of the cluster to overpack at low ambient temperatures without breaking up at high ambient temperatures, and the relative insensitivity to large variations in the ambient temperature. Our theory also makes testable hypotheses for the response of the cluster to external temperature inhomogeneities and suggests strategies for biomimetic thermoregulation.

  13. Collective thermoregulation in bee clusters

    PubMed Central

    Ocko, Samuel A.; Mahadevan, L.

    2014-01-01

    Swarming is an essential part of honeybee behaviour, wherein thousands of bees cling onto each other to form a dense cluster that may be exposed to the environment for several days. This cluster has the ability to maintain its core temperature actively without a central controller. We suggest that the swarm cluster is akin to an active porous structure whose functional requirement is to adjust to outside conditions by varying its porosity to control its core temperature. Using a continuum model that takes the form of a set of advection–diffusion equations for heat transfer in a mobile porous medium, we show that the equalization of an effective ‘behavioural pressure’, which propagates information about the ambient temperature through variations in density, leads to effective thermoregulation. Our model extends and generalizes previous models by focusing the question of mechanism on the form and role of the behavioural pressure, and allows us to explain the vertical asymmetry of the cluster (as a consequence of buoyancy-driven flows), the ability of the cluster to overpack at low ambient temperatures without breaking up at high ambient temperatures, and the relative insensitivity to large variations in the ambient temperature. Our theory also makes testable hypotheses for the response of the cluster to external temperature inhomogeneities and suggests strategies for biomimetic thermoregulation. PMID:24335563

  14. Astrophysics of galaxy clusters

    NASA Astrophysics Data System (ADS)

    Ettori, Stefano

    2016-07-01

    As the nodes of the cosmic web, clusters of galaxies trace the large-scale distribution of matter in the Universe. They are thus privileged sites in which to investigate the complex physics of structure formation. However, the complete story of how these structures grow, and how they dissipate the gravitational and non-thermal components of their energy budget over cosmic time, is still beyond our grasp. Most of the baryons gravitationally bound to the cluster's halo is in the form of a diffuse, hot, metal-enriched plasma that radiates primarily in the X-ray band. X-ray observations of the evolving cluster population provide a unique opportunity to address such fundamental open questions as: How do hot diffuse baryons accrete and dynamically evolve in dark matter potentials? How and when was the energy that we observe in the ICM generated and distributed? Where and when are heavy elements produced and how are they circulated? We will present the ongoing activities to define the strategy on how an X-ray observatory with large collecting area and an unprecedented combination of high spectral and angular resolution, such as Athena, can address these questions.

  15. Clustering, Cosmology and a New Era of Black Hole Demographics - II. The Conditional Luminosity Functions of Type 2 and Type 1 Active Galactic Nuclei

    NASA Astrophysics Data System (ADS)

    Ballantyne, D. R.

    2016-09-01

    The orientation-based unification model of active galactic nuclei (AGNs) posits that the principle difference between obscured (Type 2) and unobscured (Type 1) AGNs is the line-of-sight into the central engine. If this model is correct than there should be no difference in many of the properties of AGN host galaxies (e.g., the mass of the surrounding dark matter haloes). However, recent clustering analyses of Type 1 and Type 2 AGNs have provided some evidence for a difference in the halo mass, in conflict with the orientation-based unified model. In this work, a method to compute the Conditional Luminosity Function (CLF) of Type 2 and Type 1 AGNs is presented. The CLF allows many fundamental halo properties to be computed as a function of AGN luminosity, which we apply to the question of the host halo masses of Type 1 and 2 AGNs. By making use of the total AGN CLF, the Type 1 X-ray luminosity function, and the luminosity-dependent Type 2 AGN fraction, the CLFs of Type 1 and 2 AGNs are calculated at z ≈ 0 and 0.9. At both z, there is no statistically significant difference in the mean halo mass of Type 2 and 1 AGNs at any luminosity. There is marginal evidence that Type 1 AGNs may have larger halo masses than Type 2s, which would be consistent with an evolutionary picture where quasars are initially obscured and then subsequently reveal themselves as Type 1s. As the Type 1 lifetime is longer, the host halo will increase somewhat in mass during the Type 1 phase. The CLF technique will be a powerful way to study the properties of many AGNs subsets (e.g., radio-loud, Compton-thick) as future wide-area X-ray and optical surveys substantially increase our ability to place AGNs in their cosmological context.

  16. Electronic Origins of the Variable Efficiency of Room-Temperature Methane Activation by Homo- and Heteronuclear Cluster Oxide Cations [XYO2](+) (X, Y = Al, Si, Mg): Competition between Proton-Coupled Electron Transfer and Hydrogen-Atom Transfer.

    PubMed

    Li, Jilai; Zhou, Shaodong; Zhang, Jun; Schlangen, Maria; Weiske, Thomas; Usharani, Dandamudi; Shaik, Sason; Schwarz, Helmut

    2016-06-29

    The reactivity of the homo- and heteronuclear oxide clusters [XYO2](+) (X, Y = Al, Si, Mg) toward methane was studied using Fourier transform ion cyclotron resonance mass spectrometry, in conjunction with high-level quantum mechanical calculations. The most reactive cluster by both experiment and theory is [Al2O2](•+). In its favorable pathway, this cluster abstracts a hydrogen atom by means of proton-coupled electron transfer (PCET) instead of following the conventional hydrogen-atom transfer (HAT) route. This mechanistic choice originates in the strong Lewis acidity of the aluminum site of [Al2O2](•+), which cleaves the C-H bond heterolytically to form an Al-CH3 entity, while the proton is transferred to the bridging oxygen atom of the cluster ion. In addition, a comparison of the reactivity of heteronuclear and homonuclear oxide clusters [XYO2](+) (X, Y = Al, Si, Mg) reveals a striking doping effect by aluminum. Thus, the vacant s-p hybrid orbital on Al acts as an acceptor of the electron pair from methyl anion (CH3(-)) and is therefore eminently important for bringing about thermal methane activation by PCET. For the Al-doped cluster ions, the spin density at an oxygen atom, which is crucial for the HAT mechanism, acts here as a spectator during the course of the PCET mediated C-H bond cleavage. A diagnostic plot of the deformation energy vis-à-vis the barrier shows the different HAT/PCET reactivity map for the entire series. This is a strong connection to the recently discussed mechanism of oxidative coupling of methane on magnesium oxide surfaces proceeding through Grignard-type intermediates. PMID:27241233

  17. Electronic Origins of the Variable Efficiency of Room-Temperature Methane Activation by Homo- and Heteronuclear Cluster Oxide Cations [XYO2](+) (X, Y = Al, Si, Mg): Competition between Proton-Coupled Electron Transfer and Hydrogen-Atom Transfer.

    PubMed

    Li, Jilai; Zhou, Shaodong; Zhang, Jun; Schlangen, Maria; Weiske, Thomas; Usharani, Dandamudi; Shaik, Sason; Schwarz, Helmut

    2016-06-29

    The reactivity of the homo- and heteronuclear oxide clusters [XYO2](+) (X, Y = Al, Si, Mg) toward methane was studied using Fourier transform ion cyclotron resonance mass spectrometry, in conjunction with high-level quantum mechanical calculations. The most reactive cluster by both experiment and theory is [Al2O2](•+). In its favorable pathway, this cluster abstracts a hydrogen atom by means of proton-coupled electron transfer (PCET) instead of following the conventional hydrogen-atom transfer (HAT) route. This mechanistic choice originates in the strong Lewis acidity of the aluminum site of [Al2O2](•+), which cleaves the C-H bond heterolytically to form an Al-CH3 entity, while the proton is transferred to the bridging oxygen atom of the cluster ion. In addition, a comparison of the reactivity of heteronuclear and homonuclear oxide clusters [XYO2](+) (X, Y = Al, Si, Mg) reveals a striking doping effect by aluminum. Thus, the vacant s-p hybrid orbital on Al acts as an acceptor of the electron pair from methyl anion (CH3(-)) and is therefore eminently important for bringing about thermal methane activation by PCET. For the Al-doped cluster ions, the spin density at an oxygen atom, which is crucial for the HAT mechanism, acts here as a spectator during the course of the PCET mediated C-H bond cleavage. A diagnostic plot of the deformation energy vis-à-vis the barrier shows the different HAT/PCET reactivity map for the entire series. This is a strong connection to the recently discussed mechanism of oxidative coupling of methane on magnesium oxide surfaces proceeding through Grignard-type intermediates.

  18. A cluster-randomized controlled trial to reduce sedentary behavior and promote physical activity and health of 8-9 year olds: The Transform-Us! Study

    PubMed Central

    2011-01-01

    Background Physical activity (PA) is associated with positive cardio-metabolic health and emerging evidence suggests sedentary behavior (SB) may be detrimental to children's health independent of PA. The primary aim of the Transform-Us! study is to determine whether an 18-month, behavioral and environmental intervention in the school and family settings results in higher levels of PA and lower rates of SB among 8-9 year old children compared with usual practice (post-intervention and 12-months follow-up). The secondary aims are to determine the independent and combined effects of PA and SB on children's cardio-metabolic health risk factors; identify the factors that mediate the success of the intervention; and determine whether the intervention is cost-effective. Methods/design A four-arm cluster-randomized controlled trial (RCT) with a 2 × 2 factorial design, with schools as the unit of randomization. Twenty schools will be allocated to one of four intervention groups, sedentary behavior (SB-I), physical activity (PA-I), combined SB and PA (SB+PA-I) or current practice control (C), which will be evaluated among approximately 600 children aged 8-9 years in school year 3 living in Melbourne, Australia. All children in year 3 at intervention schools in 2010 (8-9 years) will receive the intervention over an 18-month period with a maintenance 'booster' delivered in 2012 and children at all schools will be invited to participate in the evaluation assessments. To maximize the sample and to capture new students arriving at intervention and control schools, recruitment will be on-going up to the post-intervention time point. Primary outcomes are time spent sitting and in PA assessed via accelerometers and inclinometers and survey. Discussion To our knowledge, Transform-Us! is the first RCT to examine the effectiveness of intervention strategies for reducing children's overall sedentary time, promoting PA and optimizing health outcomes. The integration of consistent

  19. A novel hexanuclear titanium(iv)-oxo-iminodiacetate cluster with a Ti6O9 core: single-crystal structure and photocatalytic activities.

    PubMed

    Ni, Lubin; Liang, Dashuai; Cai, Yin; Diao, Guowang; Zhou, Zhaohui

    2016-05-01

    A new family of hexanuclear titanium(iv)-oxo-carboxylate cluster K7H[Ti6O9(ida)6]Cl2·13H2O {Ti6O9} has been synthesized via the H2O2-assisted reaction between TiCl4 and iminodiacetate ligands. This cluster was fully characterized by single-crystal X-ray diffraction and a wide range of analytical methods, including FT-IR, UV/vis spectroscopy as well as electrochemistry and thermogravimetric analysis. As a new type of carboxylate substituted Ti-oxo-cluster, the structural motif of the {Ti6O9} cluster consists of one symmetric {Ti6O6} hexagonal prism with two staggered triangular {Ti3O3} subunits linked by three μ2-O bridges. The {Ti6O9} polyanions are linked by K(+) cations to form a novel 3D architecture. The structural information and stability of the {Ti6O9} polyanion in aqueous solution were thoroughly investigated by solid-state/solution NMR, ESI-MS spectroscopy. Moreover, this Ti-oxo cluster exhibits remarkable potential as a visible-light homogeneous photocatalyst for degradation of rhodamine B (RhB). Finally, a proposed peroxotitanium(iv)-mediated photocatalytic pathway involved is illustrated by spectroscopic data.

  20. GSFC Contributions to the NATO X-ray Astronomy Institute, Erice, July 1979. [X-ray spectra of supernova remants, galactic X-ray sources, active galactic nuclei, and clusters of galaxies

    NASA Technical Reports Server (NTRS)

    Holt, S. S.; Mushotzky, R. F.

    1979-01-01

    An overview of X-ray astronomical spectroscopy in general is presented and results obtained by HEAO 1 and 2 as well as earlier spacecraft are examined. Particular emphasis is given to the spectra of supernova remnants; galactic binary X-ray sources, cataclysmic variables, bulges, pulsars, and stars; the active nuclei of Seyfert 1 galaxy, BL Lac, and quasars; the diffuse X-ray background; and galactic clusters.

  1. Identification of Urban Leprosy Clusters

    PubMed Central

    Paschoal, José Antonio Armani; Paschoal, Vania Del'Arco; Nardi, Susilene Maria Tonelli; Rosa, Patrícia Sammarco; Ismael, Manuela Gallo y Sanches; Sichieri, Eduvaldo Paulo

    2013-01-01

    Overpopulation of urban areas results from constant migrations that cause disordered urban growth, constituting clusters defined as sets of people or activities concentrated in relatively small physical spaces that often involve precarious conditions. Aim. Using residential grouping, the aim was to identify possible clusters of individuals in São José do Rio Preto, Sao Paulo, Brazil, who have or have had leprosy. Methods. A population-based, descriptive, ecological study using the MapInfo and CrimeStat techniques, geoprocessing, and space-time analysis evaluated the location of 425 people treated for leprosy between 1998 and 2010. Clusters were defined as concentrations of at least 8 people with leprosy; a distance of up to 300 meters between residences was adopted. Additionally, the year of starting treatment and the clinical forms of the disease were analyzed. Results. Ninety-eight (23.1%) of 425 geocoded cases were located within one of ten clusters identified in this study, and 129 cases (30.3%) were in the region of a second-order cluster, an area considered of high risk for the disease. Conclusion. This study identified ten clusters of leprosy cases in the city and identified an area of high risk for the appearance of new cases of the disease. PMID:24288467

  2. Identification of urban leprosy clusters.

    PubMed

    Paschoal, José Antonio Armani; Paschoal, Vania Del'Arco; Nardi, Susilene Maria Tonelli; Rosa, Patrícia Sammarco; Ismael, Manuela Gallo y Sanches; Sichieri, Eduvaldo Paulo

    2013-01-01

    Overpopulation of urban areas results from constant migrations that cause disordered urban growth, constituting clusters defined as sets of people or activities concentrated in relatively small physical spaces that often involve precarious conditions. Aim. Using residential grouping, the aim was to identify possible clusters of individuals in São José do Rio Preto, Sao Paulo, Brazil, who have or have had leprosy. Methods. A population-based, descriptive, ecological study using the MapInfo and CrimeStat techniques, geoprocessing, and space-time analysis evaluated the location of 425 people treated for leprosy between 1998 and 2010. Clusters were defined as concentrations of at least 8 people with leprosy; a distance of up to 300 meters between residences was adopted. Additionally, the year of starting treatment and the clinical forms of the disease were analyzed. Results. Ninety-eight (23.1%) of 425 geocoded cases were located within one of ten clusters identified in this study, and 129 cases (30.3%) were in the region of a second-order cluster, an area considered of high risk for the disease. Conclusion. This study identified ten clusters of leprosy cases in the city and identified an area of high risk for the appearance of new cases of the disease.

  3. PREFACE: Nuclear Cluster Conference; Cluster'07

    NASA Astrophysics Data System (ADS)

    Freer, Martin

    2008-05-01

    The Cluster Conference is a long-running conference series dating back to the 1960's, the first being initiated by Wildermuth in Bochum, Germany, in 1969. The most recent meeting was held in Nara, Japan, in 2003, and in 2007 the 9th Cluster Conference was held in Stratford-upon-Avon, UK. As the name suggests the town of Stratford lies upon the River Avon, and shortly before the conference, due to unprecedented rainfall in the area (approximately 10 cm within half a day), lay in the River Avon! Stratford is the birthplace of the `Bard of Avon' William Shakespeare, and this formed an intriguing conference backdrop. The meeting was attended by some 90 delegates and the programme contained 65 70 oral presentations, and was opened by a historical perspective presented by Professor Brink (Oxford) and closed by Professor Horiuchi (RCNP) with an overview of the conference and future perspectives. In between, the conference covered aspects of clustering in exotic nuclei (both neutron and proton-rich), molecular structures in which valence neutrons are exchanged between cluster cores, condensates in nuclei, neutron-clusters, superheavy nuclei, clusters in nuclear astrophysical processes and exotic cluster decays such as 2p and ternary cluster decay. The field of nuclear clustering has become strongly influenced by the physics of radioactive beam facilities (reflected in the programme), and by the excitement that clustering may have an important impact on the structure of nuclei at the neutron drip-line. It was clear that since Nara the field had progressed substantially and that new themes had emerged and others had crystallized. Two particular topics resonated strongly condensates and nuclear molecules. These topics are thus likely to be central in the next cluster conference which will be held in 2011 in the Hungarian city of Debrechen. Martin Freer Participants and Cluster'07

  4. A Hierarchical Clustering Methodology for the Estimation of Toxicity

    EPA Science Inventory

    A Quantitative Structure Activity Relationship (QSAR) methodology based on hierarchical clustering was developed to predict toxicological endpoints. This methodology utilizes Ward's method to divide a training set into a series of structurally similar clusters. The structural sim...

  5. Activating GENeral practitioners dialogue with patients on their Agenda (MultiCare AGENDA) study protocol for a cluster randomized controlled trial

    PubMed Central

    2012-01-01

    Background This study investigates the efficacy of a complex multifaceted intervention aiming at increasing the quality of care of GPs for patients with multimorbidity. In its core, the intervention aims at enhancing the doctor-patient-dialogue and identifying the patient’s agenda and needs. Also, a medication check is embedded. Our primary hypothesis is that a more patient-centred communication will reduce the number of active pharmaceuticals taken without impairing the patients’ quality of life. Secondary hypotheses include a better knowledge of GPs about their patients’ medication, a higher patient satisfaction and a more effective and/or efficient health care utilization. Methods/design Multi-center, parallel group, cluster randomized controlled clinical trial in GP surgeries. Inclusion criteria: Patients aged 65–84 years with at least 3 chronic conditions. Intervention: GPs allocated to this group will receive a multifaceted educational intervention on performing a narrative doctor-patient dialogue reflecting treatment targets and priorities of the patient and on performing a narrative patient-centred medication review. During the one year intervention GPs will have a total of three conversations à 30 minutes with the enrolled patients. Control: Care as usual. Follow-up per patient: 14 months after baseline interview. Primary efficacy endpoints: Differences in medication intake and health related quality of life between baseline and follow-up in the intervention compared to the control group. Randomization: Computer-generated by an independent institute. It will be performed successively when patient recruitment in the respective surgery is finished. Blinding: Participants (GPs and patients) will not be blinded to their assignment but will be unaware of the study hypotheses or outcome measures. Discussion There is growing evidence that the phenomenon of polypharmacy and low quality of drug use is substantially due to mis-communication (or non

  6. Solution NMR Structure of the Iron-Sulfur Cluster Assembly Protein U (IscU) with Zinc Bound at the Active Site

    SciTech Connect

    Ramelot, Theresa A.; Cort, John R.; Goldsmith-Fischman, Sharon; Kornhaber, Greg J.; Xiao, Rong; Shastry, Ritu; Acton, Thomas; Honig, Barry; Montelione, Gaetano; Kennedy, Michael A.

    2004-11-19

    IscU is a highly conserved protein that serves as the scaffold for IscS-mediated assembly of iron-sulfur ([Fe-S]) clusters. We report the NMR solution structure of monomeric Haemophilus influenzae IscU with zinc bound at the [Fe-S] cluster assembly site. The compact core of the globular structure has an {alpha}-{beta} sandwich architecture with a three-stranded antiparallel {beta}-sheet and four {alpha}-helices. A nascent helix is located N-terminal to the core structure. The zinc is ligated by three cysteines and one histidine that are located in and near conformationally dynamic loops at one end of the IscU structure. Removal of the zinc metal by chelation results in widespread loss of structure in the apo form. The zinc-bound IscU may be a good model for iron-loaded IscU and may demonstrate structural features found in the iron-sulfur cluster bound form. Structural and functional similarities, genomic context in operons containing other homologous genes, and distributions of conserved surface residues support the hypothesis that IscU protein domains are homologous (i.e. derived from a common ancestor) with the SufE/YgdK family of iron sulfur cluster assembly proteins.

  7. Stellar Snowflake Cluster

    NASA Technical Reports Server (NTRS)

    2005-01-01

    [figure removed for brevity, see original site] Figure 1 Stellar Snowflake Cluster Combined Image [figure removed for brevity, see original site] Figure 2 Infrared Array CameraFigure 3 Multiband Imaging Photometer

    Newborn stars, hidden behind thick dust, are revealed in this image of a section of the Christmas Tree cluster from NASA's Spitzer Space Telescope, created in joint effort between Spitzer's infrared array camera and multiband imaging photometer instruments.

    The newly revealed infant stars appear as pink and red specks toward the center of the combined image (fig. 1). The stars appear to have formed in regularly spaced intervals along linear structures in a configuration that resembles the spokes of a wheel or the pattern of a snowflake. Hence, astronomers have nicknamed this the 'Snowflake' cluster.

    Star-forming clouds like this one are dynamic and evolving structures. Since the stars trace the straight line pattern of spokes of a wheel, scientists believe that these are newborn stars, or 'protostars.' At a mere 100,000 years old, these infant structures have yet to 'crawl' away from their location of birth. Over time, the natural drifting motions of each star will break this order, and the snowflake design will be no more.

    While most of the visible-light stars that give the Christmas Tree cluster its name and triangular shape do not shine brightly in Spitzer's infrared eyes, all of the stars forming from this dusty cloud are considered part of the cluster.

    Like a dusty cosmic finger pointing up to the newborn clusters, Spitzer also illuminates the optically dark and dense Cone nebula, the tip of which can be seen towards the bottom left corner of each image.

    This combined image shows the presence of organic molecules mixed with dust as wisps of green, which have been illuminated by nearby star formation. The larger yellowish dots neighboring the baby red stars in the Snowflake Cluster are massive stellar infants forming

  8. Survey on granularity clustering.

    PubMed

    Ding, Shifei; Du, Mingjing; Zhu, Hong

    2015-12-01

    With the rapid development of uncertain artificial intelligent and the arrival of big data era, conventional clustering analysis and granular computing fail to satisfy the requirements of intelligent information processing in this new case. There is the essential relationship between granular computing and clustering analysis, so some researchers try to combine granular computing with clustering analysis. In the idea of granularity, the researchers expand the researches in clustering analysis and look for the best clustering results with the help of the basic theories and methods of granular computing. Granularity clustering method which is proposed and studied has attracted more and more attention. This paper firstly summarizes the background of granularity clustering and the intrinsic connection between granular computing and clustering analysis, and then mainly reviews the research status and various methods of granularity clustering. Finally, we analyze existing problem and propose further research.

  9. Cluster automorphism groups of cluster algebras with coefficients

    NASA Astrophysics Data System (ADS)

    Chang, Wen; Zhu, Bin

    2016-10-01

    We study the cluster automorphism group of a skew-symmetric cluster algebra with geometric coefficients. For this, we introduce the notion of gluing free cluster algebra, and show that under a weak condition the cluster automorphism group of a gluing free cluster algebra is a subgroup of the cluster automorphism group of its principal part cluster algebra (i.e. the corresponding cluster algebra without coefficients). We show that several classes of cluster algebras with coefficients are gluing free, for example, cluster algebras with principal coefficients, cluster algebras with universal geometric coefficients, and cluster algebras from surfaces (except a 4-gon) with coefficients from boundaries. Moreover, except four kinds of surfaces, the cluster automorphism group of a cluster algebra from a surface with coefficients from boundaries is isomorphic to the cluster automorphism group of its principal part cluster algebra; for a cluster algebra with principal coefficients, its cluster automorphism group is isomorphic to the automorphism group of its initial quiver.

  10. Semantic Clustering of Search Engine Results.

    PubMed

    Soliman, Sara Saad; El-Sayed, Maged F; Hassan, Yasser F

    2015-01-01

    This paper presents a novel approach for search engine results clustering that relies on the semantics of the retrieved documents rather than the terms in those documents. The proposed approach takes into consideration both lexical and semantics similarities among documents and applies activation spreading technique in order to generate semantically meaningful clusters. This approach allows documents that are semantically similar to be clustered together rather than clustering documents based on similar terms. A prototype is implemented and several experiments are conducted to test the prospered solution. The result of the experiment confirmed that the proposed solution achieves remarkable results in terms of precision.

  11. Semantic Clustering of Search Engine Results

    PubMed Central

    Soliman, Sara Saad; El-Sayed, Maged F.; Hassan, Yasser F.

    2015-01-01

    This paper presents a novel approach for search engine results clustering that relies on the semantics of the retrieved documents rather than the terms in those documents. The proposed approach takes into consideration both lexical and semantics similarities among documents and applies activation spreading technique in order to generate semantically meaningful clusters. This approach allows documents that are semantically similar to be clustered together rather than clustering documents based on similar terms. A prototype is implemented and several experiments are conducted to test the prospered solution. The result of the experiment confirmed that the proposed solution achieves remarkable results in terms of precision. PMID:26933673

  12. Benzo[1,2-c]1,2,5-oxadiazole N-oxide derivatives as potential antitrypanosomal drugs. Part 3: Substituents-clustering methodology in the search for new active compounds.

    PubMed

    Aguirre, Gabriela; Boiani, Lucía; Cerecetto, Hugo; Di Maio, Rossanna; González, Mercedes; Porcal, Williams; Denicola, Ana; Möller, Matías; Thomson, Leonor; Tórtora, Verónica

    2005-12-01

    The results of a study on the use of Hansch's series design, cluster methodology, for the generation of new benzo[1,2-c]1,2,5-oxadiazole N-oxide derivatives as antitrypanosomal compounds are described. In vitro activity of these compounds was tested against Tulahuen 2 strain of Trypanosoma cruzi. Clearly, the Hansch methodology allowed identifying two cluster-substituents suitable for further structural modifications. The most effective drugs, derivatives 11, 18, and 21, with 50% inhibitory concentration (IC(50)) of the same order as that of the reference drug, represent an excellent structural point of chemical modifications for the design of future drugs. Preliminary results from the study of the mechanism of action of these benzofuroxans point to perturbation of the mitochondrial electron chain, inhibiting parasite respiration.

  13. The environments of poor clusters of galaxies

    NASA Astrophysics Data System (ADS)

    Bliton, Mark Alan

    Poor clusters of galaxies are fundamental cosmological structures, but have received relatively little attention compared to rich, Abell clusters. In order to fully understand galaxy clustering, we must examine galaxy associations of all masses and richness levels. We have therefore undertaken an X-ray, optical, and radio investigation of the environments of poor clusters, in order to understand how their galaxies, radio sources, and intracluster media influence and interact with one another. To examine the global properties of poor clusters as observed in these three wavelength regimes, we have utilized three major sky surveys: the ROSAT All-Sky Survey, the Digitized Sky Survey, and the NRAO VLA Sky Survey. For the purposes of this study, we construct a complete, volume-limited sample of 306 poor clusters in the redshift range 0.01--0.03. We compute the X-ray luminosity function (XLF) of poor clusters and compare to XLFs of nearby, rich, Abell clusters. We also compute the bivariate radio luminosity function (BRLF), which is the fraction of radio-loud galaxies of a given optical magnitude. Higher richness clusters produce increased AGN activity in M* galaxies. We find that only clusters with an elliptical as their dominant galaxy possess an ICM. This implies that the presence of a dominant elliptical at the center of a poor cluster is more closely linked to the presence of an ICM than the overall morphological mix of the cluster galaxies. We also find a strong anti-correlation between richness and the fraction of starburst radio galaxies in poor clusters. There may be two factors which contribute to this anti-correlation. For richer clusters, the ICM density may be sufficiently strong that it can strip gas from starforming galaxies, thereby reducing the level of star formation in richer systems. Conversely, the poorest clusters contain higher galaxy compactness, which results in smaller nearest-neighbor distances between galaxies. These smaller galaxy separations

  14. Matlab Cluster Ensemble Toolbox

    SciTech Connect

    Sapio, Vincent De; Kegelmeyer, Philip

    2009-04-27

    This is a Matlab toolbox for investigating the application of cluster ensembles to data classification, with the objective of improving the accuracy and/or speed of clustering. The toolbox divides the cluster ensemble problem into four areas, providing functionality for each. These include, (1) synthetic data generation, (2) clustering to generate individual data partitions and similarity matrices, (3) consensus function generation and final clustering to generate ensemble data partitioning, and (4) implementation of accuracy metrics. With regard to data generation, Gaussian data of arbitrary dimension can be generated. The kcenters algorithm can then be used to generate individual data partitions by either, (a) subsampling the data and clustering each subsample, or by (b) randomly initializing the algorithm and generating a clustering for each initialization. In either case an overall similarity matrix can be computed using a consensus function operating on the individual similarity matrices. A final clustering can be performed and performance metrics are provided for evaluation purposes.

  15. Adaptive cluster detection

    NASA Astrophysics Data System (ADS)

    Friedenberg, David

    2010-10-01

    the rate of falsely detected active regions. Additionally we examine the more general field of clustering and develop a framework for clustering algorithms based around diffusion maps. Diffusion maps can be used to project high-dimensional data into a lower dimensional space while preserving much of the structure in the data. We demonstrate how diffusion maps can be used to solve clustering problems and examine the influence of tuning parameters on the results. We introduce two novel methods, the self-tuning diffusion map which replaces the global scaling parameter in the typical diffusion map framework with a local scaling parameter and an algorithm for automatically selecting tuning parameters based on a cross-validation style score called prediction strength. The methods are tested on several example datasets.

  16. Adapting interrelated two-way clustering method for quantitative structure-activity relationship (QSAR) modeling of mutagenicity/non- mutagenicity of a diverse set of chemicals.

    PubMed

    Majumdar, Subhabrata; Basak, Subhash C; Grunwald, Gregory D

    2013-12-01

    Interrelated Two-way Clustering (ITC) is an unsupervised clustering method developed to divide samples into two groups in gene expression data obtained through microarrays, selecting important genes simultaneously in the process. This has been found to be a better approach than conventional clustering methods like K-means or selforganizing map for the scenarios when number of samples is much smaller than number of variables (n«p). In this paper we used the ITC approach for classification of a diverse set of 508 chemicals regarding mutagenicity. A large number of topological indices (TIs), 3-dimensional, and quantum chemical descriptors, as well as atom pairs (APs) has been used as explanatory variables. In this paper, ITC has been used only for predictor selection, after which ridge regression is employed to build the final predictive model. The proper leave-one-out (LOO) method of cross-validation in this scenario is to take as holdout each of the 508 compounds before predictor thinning and compare the predicted values with the experimental data. ITC based results obtained here are comparable to those developed earlier.

  17. The two stem cell microRNA gene clusters C19MC and miR-371-3 are activated by specific chromosomal rearrangements in a subgroup of thyroid adenomas.

    PubMed

    Rippe, Volkhard; Dittberner, Lea; Lorenz, Verena N; Drieschner, Norbert; Nimzyk, Rolf; Sendt, Wolfgang; Junker, Klaus; Belge, Gazanfer; Bullerdiek, Jörn

    2010-03-03

    Thyroid adenomas are common benign human tumors with a high prevalence of about 5% of the adult population even in iodine sufficient areas. Rearrangements of chromosomal band 19q13.4 represent a frequent clonal cytogenetic deviation in these tumors making them the most frequent non-random chromosomal translocations in human epithelial tumors at all. Two microRNA (miRNA) gene clusters i.e. C19MC and miR-371-3 are located in close proximity to the breakpoint region of these chromosomal rearrangements and have been checked for a possible up-regulation due to the genomic alteration. In 4/5 cell lines established from thyroid adenomas with 19q13.4 rearrangements and 5/5 primary adenomas with that type of rearrangement both the C19MC and miR-371-3 cluster were found to be significantly overexpressed compared to controls lacking that particular chromosome abnormality. In the remaining cell line qRT-PCR revealed overexpression of members of the miR-371-3 cluster only which might be due to a deletion accompanying the chromosomal rearrangement in that case. In depth molecular characterization of the breakpoint in a cell line from one adenoma of this type reveals the existence of large Pol-II mRNA fragments as the most likely source of up-regulation of the C19MC cluster. The up-regulation of the clusters is likely to be causally associated with the pathogenesis of the corresponding tumors. Of note, the expression of miRNAs miR-520c and miR-373 is known to characterize stem cells and in terms of molecular oncology has been implicated in invasive growth of epithelial cells in vitro and in vivo thus allowing to delineate a distinct molecular subtype of thyroid adenomas. Besides thyroid adenomas rearrangements of 19q13.4 are frequently found in other human neoplasias as well, suggesting that activation of both clusters might be a more general phenomenon in human neoplasias.

  18. Effect of intervention aimed at increasing physical activity, reducing sedentary behaviour, and increasing fruit and vegetable consumption in children: Active for Life Year 5 (AFLY5) school based cluster randomised controlled trial

    PubMed Central

    Kipping, Ruth R; Howe, Laura D; Jago, Russell; Campbell, Rona; Wells, Sian; Chittleborough, Catherine R; Mytton, Julie; Noble, Sian M; Peters, Tim J

    2014-01-01

    Objective To investigate the effectiveness of a school based intervention to increase physical activity, reduce sedentary behaviour, and increase fruit and vegetable consumption in children. Design Cluster randomised controlled trial. Setting 60 primary schools in the south west of England. Participants Primary school children who were in school year 4 (age 8-9 years) at recruitment and baseline assessment, in year 5 during the intervention, and at the end of year 5 (age 9-10) at follow-up assessment. Intervention The Active for Life Year 5 (AFLY5) intervention consisted of teacher training, provision of lesson and child-parent interactive homework plans, all materials required for lessons and homework, and written materials for school newsletters and parents. The intervention was delivered when children were in school year 5 (age 9-10 years). Schools allocated to control received standard teaching. Main outcome measures The pre-specified primary outcomes were accelerometer assessed minutes of moderate to vigorous physical activity per day, accelerometer assessed minutes of sedentary behaviour per day, and reported daily consumption of servings of fruit and vegetables. Results 60 schools with more than 2221 children were recruited; valid data were available for fruit and vegetable consumption for 2121 children, for accelerometer assessed physical activity and sedentary behaviour for 1252 children, and for secondary outcomes for between 1825 and 2212 children for the main analyses. None of the three primary outcomes differed between children in schools allocated to the AFLY5 intervention and those allocated to the control group. The difference in means comparing the intervention group with the control group was –1.35 (95% confidence interval –5.29 to 2.59) minutes per day for moderate to vigorous physical activity, –0.11 (–9.71 to 9.49) minutes per day for sedentary behaviour, and 0.08 (–0.12 to 0.28) servings per day for fruit and vegetable consumption

  19. Weighted voting-based consensus clustering for chemical structure databases.

    PubMed

    Saeed, Faisal; Ahmed, Ali; Shamsir, Mohd Shahir; Salim, Naomie

    2014-06-01

    The cluster-based compound selection is used in the lead identification process of drug discovery and design. Many clustering methods have been used for chemical databases, but there is no clustering method that can obtain the best results under all circumstances. However, little attention has been focused on the use of combination methods for chemical structure clustering, which is known as consensus clustering. Recently, consensus clustering has been used in many areas including bioinformatics, machine learning and information theory. This process can improve the robustness, stability, consistency and novelty of clustering. For chemical databases, different consensus clustering methods have been used including the co-association matrix-based, graph-based, hypergraph-based and voting-based methods. In this paper, a weighted cumulative voting-based aggregation algorithm (W-CVAA) was developed. The MDL Drug Data Report (MDDR) benchmark chemical dataset was used in the experiments and represented by the AlogP and ECPF_4 descriptors. The results from the clustering methods were evaluated by the ability of the clustering to separate biologically active molecules in each cluster from inactive ones using different criteria, and the effectiveness of the consensus clustering was compared to that of Ward's method, which is the current standard clustering method in chemoinformatics. This study indicated that weighted voting-based consensus clustering can overcome the limitations of the existing voting-based methods and improve the effectiveness of combining multiple clusterings of chemical structures. PMID:24830925

  20. LacR is a repressor of lacABCD and LacT is an activator of lacTFEG, constituting the lac gene cluster in Streptococcus pneumoniae.

    PubMed

    Afzal, Muhammad; Shafeeq, Sulman; Kuipers, Oscar P

    2014-09-01

    Comparison of the transcriptome of Streptococcus pneumoniae strain D39 grown in the presence of either lactose or galactose with that of the strain grown in the presence of glucose revealed the elevated expression of various genes and operons, including the lac gene cluster, which is organized into two operons, i.e., lac operon I (lacABCD) and lac operon II (lacTFEG). Deletion of the DeoR family transcriptional regulator lacR that is present downstream of the lac gene cluster revealed elevated expression of lac operon I even in the absence of lactose. This suggests a function of LacR as a transcriptional repressor of lac operon I, which encodes enzymes involved in the phosphorylated tagatose pathway in the absence of lactose or galactose. Deletion of lacR did not affect the expression of lac operon II, which encodes a lactose-specific phosphotransferase. This finding was further confirmed by β-galactosidase assays with PlacA-lacZ and PlacT-lacZ in the presence of either lactose or glucose as the sole carbon source in the medium. This suggests the involvement of another transcriptional regulator in the regulation of lac operon II, which is the BglG-family transcriptional antiterminator LacT. We demonstrate the role of LacT as a transcriptional activator of lac operon II in the presence of lactose and CcpA-independent regulation of the lac gene cluster in S. pneumoniae. PMID:24951784

  1. LacR Is a Repressor of lacABCD and LacT Is an Activator of lacTFEG, Constituting the lac Gene Cluster in Streptococcus pneumoniae

    PubMed Central

    Afzal, Muhammad; Shafeeq, Sulman

    2014-01-01

    Comparison of the transcriptome of Streptococcus pneumoniae strain D39 grown in the presence of either lactose or galactose with that of the strain grown in the presence of glucose revealed the elevated expression of various genes and operons, including the lac gene cluster, which is organized into two operons, i.e., lac operon I (lacABCD) and lac operon II (lacTFEG). Deletion of the DeoR family transcriptional regulator lacR that is present downstream of the lac gene cluster revealed elevated expression of lac operon I even in the absence of lactose. This suggests a function of LacR as a transcriptional repressor of lac operon I, which encodes enzymes involved in the phosphorylated tagatose pathway in the absence of lactose or galactose. Deletion of lacR did not affect the expression of lac operon II, which encodes a lactose-specific phosphotransferase. This finding was further confirmed by β-galactosidase assays with PlacA-lacZ and PlacT-lacZ in the presence of either lactose or glucose as the sole carbon source in the medium. This suggests the involvement of another transcriptional regulator in the regulation of lac operon II, which is the BglG-family transcriptional antiterminator LacT. We demonstrate the role of LacT as a transcriptional activator of lac operon II in the presence of lactose and CcpA-independent regulation of the lac gene cluster in S. pneumoniae. PMID:24951784

  2. Ionized cluster beam deposition

    NASA Astrophysics Data System (ADS)

    Kirkpatrick, A. R.

    1983-11-01

    Ionized Cluster Beam (ICB) deposition, a new technique originated by Takagi of Kyoto University in Japan, offers a number of unique capabilities for thin film metallization as well as for deposition of active semiconductor materials. ICB allows average energy per deposited atom to be controlled and involves impact kinetics which result in high diffusion energies of atoms on the growth surface. To a greater degree than in other techniques, ICB involves quantitative process parameters which can be utilized to strongly control the characteristics of films being deposited. In the ICB deposition process, material to be deposited is vaporized into a vacuum chamber from a confinement crucible at high temperature. Crucible nozzle configuration and operating temperature are such that emerging vapor undergoes supercondensation following adiabatic expansion through the nozzle.

  3. Ionized cluster beam deposition

    NASA Technical Reports Server (NTRS)

    Kirkpatrick, A. R.

    1983-01-01

    Ionized Cluster Beam (ICB) deposition, a new technique originated by Takagi of Kyoto University in Japan, offers a number of unique capabilities for thin film metallization as well as for deposition of active semiconductor materials. ICB allows average energy per deposited atom to be controlled and involves impact kinetics which result in high diffusion energies of atoms on the growth surface. To a greater degree than in other techniques, ICB involves quantitative process parameters which can be utilized to strongly control the characteristics of films being deposited. In the ICB deposition process, material to be deposited is vaporized into a vacuum chamber from a confinement crucible at high temperature. Crucible nozzle configuration and operating temperature are such that emerging vapor undergoes supercondensation following adiabatic expansion through the nozzle.

  4. Star cluster dynamics.

    PubMed

    Vesperini, Enrico

    2010-02-28

    Dynamical evolution plays a key role in shaping the current properties of star clusters and star cluster systems. A detailed understanding of the effects of evolutionary processes is essential to be able to disentangle the properties that result from dynamical evolution from those imprinted at the time of cluster formation. In this review, I focus my attention on globular clusters, and review the main physical ingredients driving their early and long-term evolution, describe the possible evolutionary routes and show how cluster structure and stellar content are affected by dynamical evolution.

  5. A new clustering strategy

    NASA Astrophysics Data System (ADS)

    Feng, Jian-xin; Tang, Jia-fu; Wang, Guang-xing

    2007-04-01

    On the basis of the analysis of clustering algorithm that had been proposed for MANET, a novel clustering strategy was proposed in this paper. With the trust defined by statistical hypothesis in probability theory and the cluster head selected by node trust and node mobility, this strategy can realize the function of the malicious nodes detection which was neglected by other clustering algorithms and overcome the deficiency of being incapable of implementing the relative mobility metric of corresponding nodes in the MOBIC algorithm caused by the fact that the receiving power of two consecutive HELLO packet cannot be measured. It's an effective solution to cluster MANET securely.

  6. Quantum Monte Carlo methods and lithium cluster properties. [Atomic clusters

    SciTech Connect

    Owen, R.K.

    1990-12-01

    Properties of small lithium clusters with sizes ranging from n = 1 to 5 atoms were investigated using quantum Monte Carlo (QMC) methods. Cluster geometries were found from complete active space self consistent field (CASSCF) calculations. A detailed development of the QMC method leading to the variational QMC (V-QMC) and diffusion QMC (D-QMC) methods is shown. The many-body aspect of electron correlation is introduced into the QMC importance sampling electron-electron correlation functions by using density dependent parameters, and are shown to increase the amount of correlation energy obtained in V-QMC calculations. A detailed analysis of D-QMC time-step bias is made and is found to be at least linear with respect to the time-step. The D-QMC calculations determined the lithium cluster ionization potentials to be 0.1982(14) (0.1981), 0.1895(9) (0.1874(4)), 0.1530(34) (0.1599(73)), 0.1664(37) (0.1724(110)), 0.1613(43) (0.1675(110)) Hartrees for lithium clusters n = 1 through 5, respectively; in good agreement with experimental results shown in the brackets. Also, the binding energies per atom was computed to be 0.0177(8) (0.0203(12)), 0.0188(10) (0.0220(21)), 0.0247(8) (0.0310(12)), 0.0253(8) (0.0351(8)) Hartrees for lithium clusters n = 2 through 5, respectively. The lithium cluster one-electron density is shown to have charge concentrations corresponding to nonnuclear attractors. The overall shape of the electronic charge density also bears a remarkable similarity with the anisotropic harmonic oscillator model shape for the given number of valence electrons.

  7. Complementary ensemble clustering of biomedical data.

    PubMed

    Fodeh, Samah Jamal; Brandt, Cynthia; Luong, Thai Binh; Haddad, Ali; Schultz, Martin; Murphy, Terrence; Krauthammer, Michael

    2013-06-01

    The rapidly growing availability of electronic biomedical data has increased the need for innovative data mining methods. Clustering in particular has been an active area of research in many different application areas, with existing clustering algorithms mostly focusing on one modality or representation of the data. Complementary ensemble clustering (CEC) is a recently introduced framework in which Kmeans is applied to a weighted, linear combination of the coassociation matrices obtained from separate ensemble clustering of different data modalities. The strength of CEC is its extraction of information from multiple aspects of the data when forming the final clusters. This study assesses the utility of CEC in biomedical data, which often have multiple data modalities, e.g., text and images, by applying CEC to two distinct biomedical datasets (PubMed images and radiology reports) that each have two modalities. Referent to five different clustering approaches based on the Kmeans algorithm, CEC exhibited equal or better performance in the metrics of micro-averaged precision and Normalized Mutual Information across both datasets. The reference methods included clustering of single modalities as well as ensemble clustering of separate and merged data modalities. Our experimental results suggest that CEC is equivalent or more efficient than comparable Kmeans based clustering methods using either single or merged data modalities.

  8. PbaR, an IclR family transcriptional activator for the regulation of the 3-phenoxybenzoate 1',2'-dioxygenase gene cluster in Sphingobium wenxiniae JZ-1T.

    PubMed

    Cheng, Minggen; Chen, Kai; Guo, Suhui; Huang, Xing; He, Jian; Li, Shunpeng; Jiang, Jiandong

    2015-12-01

    The 3-phenoxybenzoate (3-PBA) 1',2'-dioxygenase gene cluster (pbaA1A2B cluster), which is responsible for catalyzing 3-phenoxybenzoate to 3-hydroxybenzoate and catechol, is inducibly expressed in Sphingobium wenxiniae strain JZ-1(T) by its substrate 3-PBA. In this study, we identified a transcriptional activator of the pbaA1A2B cluster, PbaR, using a DNA affinity approach. PbaR is a 253-amino-acid protein with a molecular mass of 28,000 Da. PbaR belongs to the IclR family of transcriptional regulators and shows 99% identity to a putative transcriptional regulator that is located on the carbazole-degrading plasmid pCAR3 in Sphingomonas sp. strain KA1. Gene disruption and complementation showed that PbaR was essential for transcription of the pbaA1A2B cluster in response to 3-PBA in strain JZ-1(T). However, PbaR does not regulate the reductase component gene pbaC. An electrophoretic mobility shift assay and DNase I footprinting showed that PbaR binds specifically to the 29-bp motif AATAGAAAGTCTGCCGTACGGCTATTTTT in the pbaA1A2B promoter area and that the palindromic sequence (GCCGTACGGC) within the motif is essential for PbaR binding. The binding site was located between the -10 box and the ribosome-binding site (downstream of the transcriptional start site), which is distinct from the location of the binding site in previously reported IclR family transcriptional regulators. This study reveals the regulatory mechanism for 3-PBA degradation in strain JZ-1(T), and the identification of PbaR increases the variety of regulatory models in the IclR family of transcriptional regulators. PMID:26386050

  9. PbaR, an IclR Family Transcriptional Activator for the Regulation of the 3-Phenoxybenzoate 1′,2′-Dioxygenase Gene Cluster in Sphingobium wenxiniae JZ-1T

    PubMed Central

    Cheng, Minggen; Chen, Kai; Guo, Suhui; Huang, Xing; He, Jian; Li, Shunpeng

    2015-01-01

    The 3-phenoxybenzoate (3-PBA) 1′,2′-dioxygenase gene cluster (pbaA1A2B cluster), which is responsible for catalyzing 3-phenoxybenzoate to 3-hydroxybenzoate and catechol, is inducibly expressed in Sphingobium wenxiniae strain JZ-1T by its substrate 3-PBA. In this study, we identified a transcriptional activator of the pbaA1A2B cluster, PbaR, using a DNA affinity approach. PbaR is a 253-amino-acid protein with a molecular mass of 28,000 Da. PbaR belongs to the IclR family of transcriptional regulators and shows 99% identity to a putative transcriptional regulator that is located on the carbazole-degrading plasmid pCAR3 in Sphingomonas sp. strain KA1. Gene disruption and complementation showed that PbaR was essential for transcription of the pbaA1A2B cluster in response to 3-PBA in strain JZ-1T. However, PbaR does not regulate the reductase component gene pbaC. An electrophoretic mobility shift assay and DNase I footprinting showed that PbaR binds specifically to the 29-bp motif AATAGAAAGTCTGCCGTACGGCTATTTTT in the pbaA1A2B promoter area and that the palindromic sequence (GCCGTACGGC) within the motif is essential for PbaR binding. The binding site was located between the −10 box and the ribosome-binding site (downstream of the transcriptional start site), which is distinct from the location of the binding site in previously reported IclR family transcriptional regulators. This study reveals the regulatory mechanism for 3-PBA degradation in strain JZ-1T, and the identification of PbaR increases the variety of regulatory models in the IclR family of transcriptional regulators. PMID:26386050

  10. Unconventional methods for clustering

    NASA Astrophysics Data System (ADS)

    Kotyrba, Martin

    2016-06-01

    Cluster analysis or clustering is a task of grouping a set of objects in such a way that objects in the same group (called a cluster) are more similar (in some sense or another) to each other than to those in other groups (clusters). It is the main task of exploratory data mining and a common technique for statistical data analysis used in many fields, including machine learning, pattern recognition, image analysis, information retrieval, and bioinformatics. The topic of this paper is one of the modern methods of clustering namely SOM (Self Organising Map). The paper describes the theory needed to understand the principle of clustering and descriptions of algorithm used with clustering in our experiments.

  11. Comparison of two active case-finding strategies for community-based diagnosis of symptomatic smear-positive tuberculosis and control of infectious tuberculosis in Harare, Zimbabwe (DETECTB): a cluster-randomised trial

    PubMed Central

    Corbett, Elizabeth L; Bandason, Tsitsi; Duong, Trinh; Dauya, Ethel; Makamure, Beauty; Churchyard, Gavin J; Williams, Brian G; Munyati, Shungu S; Butterworth, Anthony E; Mason, Peter R; Mungofa, Stanley; Hayes, Richard J

    2010-01-01

    Summary Background Control of tuberculosis in settings with high HIV prevalence is a pressing public health priority. We tested two active case-finding strategies to target long periods of infectiousness before diagnosis, which is typical of HIV-negative tuberculosis and is a key driver of transmission. Methods Clusters of neighbourhoods in the high-density residential suburbs of Harare, Zimbabwe, were randomised to receive six rounds of active case finding at 6-monthly intervals by either mobile van or door-to-door visits. Randomisation was done by selection of discs of two colours from an opaque bag, with one disc to represent every cluster, and one colour allocated to each intervention group before selection began. In both groups, adult (≥16 years) residents volunteering chronic cough (≥2 weeks) had two sputum specimens collected for fluorescence microscopy. Community health workers and cluster residents were not masked to intervention allocation, but investigators and laboratory staff were masked to allocation until final analysis. The primary outcome was the cumulative yield of smear-positive tuberculosis per 1000 adult residents, compared between intervention groups; analysis was by intention to treat. The secondary outcome was change in prevalence of culture-positive tuberculosis from before intervention to before round six of intervention in 12% of randomly selected households from the two intervention groups combined; analysis was based on participants who provided sputum in the two prevalence surveys. This trial is registered, number ISRCTN84352452. Findings 46 study clusters were identified and randomly allocated equally between intervention groups, with 55 741 adults in the mobile van group and 54 691 in the door-to-door group at baseline. HIV prevalence was 21% (1916/9060) and in the 6 months before intervention the smear-positive case notification rate was 2·8 per 1000 adults per year. The trial was completed as planned with no adverse events

  12. Ariane-5 and Cluster update

    NASA Astrophysics Data System (ADS)

    1996-06-01

    The Enquiry Board started work on 13 June and will report by mid-July. The Launch Qualification Committee resumed its activities on 14 June. The ESA Director General and the CNES Chairman will have to rule on the Enquiry Board's recommendations and the Launch Qualification Committee's requirements. The ESA Executive will then be able to determine - with CNES - the technical and programmatic implications for the Ariane-5 development programme. The Enquiry Board's findings and recommendations and their implications will be made known to the press soon afterwards. The Ariane Launcher Programme Board (the ESA delegate body that supervises the programme) will meet on 12 August, when the ESA Executive will present the programmatic implications. On the payload side, the Cluster Science Working Team (SWT) met on 17 and 18 June to assess the situation after the loss of the Cluster mission and to explore ways in which its scientific objectives could be revived. The SWT proposed the following approach: a. integration of the Cluster structural model with flight spare subsystems (the Phoenix project) together with a rebuild of three spacecraft identical to the originals. This scenario offers alternative options: a1. integration and testing of the Cluster spare (Phoenix), storage and launch at a later date together with the three rebuilt satellites, and a2. integration and reflight of Phoenix as soon as possible and production and launch of the three rebuilt satellites at a later date. The SWT stressed that the case for an early launch of Phoenix was largely dependent on whether the follow-on programme was also approved. A further option would call for: b. use of the Cluster spare (Phoenix) as outlined above, augmented by three new "mini" satellites funded and produced by ESA Member States that would carry subsets of the Cluster instrumentation. This mission would thus fly one main spacecraft and three "companion" spacecraft, as described in an early proposal for Cluster. On 21

  13. Information-based clustering

    PubMed Central

    Slonim, Noam; Atwal, Gurinder Singh; Tkačik, Gašper; Bialek, William

    2005-01-01

    In an age of increasingly large data sets, investigators in many different disciplines have turned to clustering as a tool for data analysis and exploration. Existing clustering methods, however, typically depend on several nontrivial assumptions about the structure of data. Here, we reformulate the clustering problem from an information theoretic perspective that avoids many of these assumptions. In particular, our formulation obviates the need for defining a cluster “prototype,” does not require an a priori similarity metric, is invariant to changes in the representation of the data, and naturally captures nonlinear relations. We apply this approach to different domains and find that it consistently produces clusters that are more coherent than those extracted by existing algorithms. Finally, our approach provides a way of clustering based on collective notions of similarity rather than the traditional pairwise measures. PMID:16352721

  14. Convex Discriminative Multitask Clustering.

    PubMed

    Zhang, Xiao-Lei

    2015-01-01

    Multitask clustering tries to improve the clustering performance of multiple tasks simultaneously by taking their relationship into account. Most existing multitask clustering algorithms fall into the type of generative clustering, and none are formulated as convex optimization problems. In this paper, we propose two convex Discriminative Multitask Clustering (DMTC) objectives to address the problems. The first one aims to learn a shared feature representation, which can be seen as a technical combination of the convex multitask feature learning and the convex Multiclass Maximum Margin Clustering (M3C). The second one aims to learn the task relationship, which can be seen as a combination of the convex multitask relationship learning and M3C. The objectives of the two algorithms are solved in a uniform procedure by the efficient cutting-plane algorithm and further unified in the Bayesian framework. Experimental results on a toy problem and two benchmark data sets demonstrate the effectiveness of the proposed algorithms. PMID:26353206

  15. Clusters of galaxies

    NASA Astrophysics Data System (ADS)

    Vikhlinin, A. A.; Kravtsov, A. V.; Markevich, M. L.; Sunyaev, R. A.; Churazov, E. M.

    2014-04-01

    Galaxy clusters are formed via nonlinear growth of primordial density fluctuations and are the most massive gravitationally bound objects in the present Universe. Their number density at different epochs and their properties depend strongly on the properties of dark matter and dark energy, making clusters a powerful tool for observational cosmology. Observations of the hot gas filling the gravitational potential well of a cluster allows studying gasdynamic and plasma effects and the effect of supermassive black holes on the heating and cooling of gas on cluster scales. The work of Yakov Borisovich Zeldovich has had a profound impact on virtually all cosmological and astrophysical studies of galaxy clusters, introducing concepts such as the Harrison-Zeldovich spectrum, the Zeldovich approximation, baryon acoustic peaks, and the Sunyaev-Zeldovich effect. Here, we review the most basic properties of clusters and their role in modern astrophysics and cosmology.

  16. Modeling the active site of [NiFe] hydrogenases and the [NiFeu] subsite of the C-cluster of carbon monoxide dehydrogenases: low-spin iron(II) versus high-spin iron(II).

    PubMed

    Weber, Katharina; Erdem, Özlen F; Bill, Eckhard; Weyhermüller, Thomas; Lubitz, Wolfgang

    2014-06-16

    A series of four [S2Ni(μ-S)2FeCp*Cl] compounds with different tetradentate thiolate/thioether ligands bound to the Ni(II) ion is reported (Cp* = C5Me5). The {S2Ni(μ-S)2Fe} core of these compounds resembles structural features of the active site of [NiFe] hydrogenases. Detailed analyses of the electronic structures of these compounds by Mössbauer and electron paramagnetic resonance spectroscopy, magnetic measurements, and density functional theory calculations reveal the oxidation states Ni(II) low spin and Fe(II) high spin for the metal ions. The same electronic configurations have been suggested for the Cred1 state of the C-cluster [NiFeu] subsite in carbon monoxide dehydrogenases (CODH). The Ni-Fe distance of ∼3 Å excludes a metal-metal bond between nickel and iron, which is in agreement with the computational results. Electrochemical experiments show that iron is the redox active site in these complexes, performing a reversible one-electron oxidation. The four complexes are discussed with regard to their similarities and differences both to the [NiFe] hydrogenases and the C-cluster of Ni-containing CODH.

  17. Cluster Inter-Spacecraft Communications

    NASA Technical Reports Server (NTRS)

    Cox, Brian

    2008-01-01

    A document describes a radio communication system being developed for exchanging data and sharing data-processing capabilities among spacecraft flying in formation. The system would establish a high-speed, low-latency, deterministic loop communication path connecting all the spacecraft in a cluster. The system would be a wireless version of a ring bus that complies with the Institute of Electrical and Electronics Engineers (IEEE) standard 1393 (which pertains to a spaceborne fiber-optic data bus enhancement to the IEEE standard developed at NASA's Jet Propulsion Laboratory). Every spacecraft in the cluster would be equipped with a ring-bus radio transceiver. The identity of a spacecraft would be established upon connection into the ring bus, and the spacecraft could be at any location in the ring communication sequence. In the event of failure of a spacecraft, the ring bus would reconfigure itself, bypassing a failed spacecraft. Similarly, the ring bus would reconfigure itself to accommodate a spacecraft newly added to the cluster or newly enabled or re-enabled. Thus, the ring bus would be scalable and robust. Reliability could be increased by launching, into the cluster, spare spacecraft to be activated in the event of failure of other spacecraft.

  18. Searching for the missing baryons in clusters

    PubMed Central

    Rasheed, Bilhuda; Bahcall, Neta; Bode, Paul

    2011-01-01

    Observations of clusters of galaxies suggest that they contain fewer baryons (gas plus stars) than the cosmic baryon fraction. This “missing baryon” puzzle is especially surprising for the most massive clusters, which are expected to be representative of the cosmic matter content of the universe (baryons and dark matter). Here we show that the baryons may not actually be missing from clusters, but rather are extended to larger radii than typically observed. The baryon deficiency is typically observed in the central regions of clusters (∼0.5 the virial radius). However, the observed gas-density profile is significantly shallower than the mass-density profile, implying that the gas is more extended than the mass and that the gas fraction increases with radius. We use the observed density profiles of gas and mass in clusters to extrapolate the measured baryon fraction as a function of radius and as a function of cluster mass. We find that the baryon fraction reaches the cosmic value near the virial radius for all groups and clusters above . This suggests that the baryons are not missing, they are simply located in cluster outskirts. Heating processes (such as shock-heating of the intracluster gas, supernovae, and Active Galactic Nuclei feedback) likely contribute to this expanded distribution. Upcoming observations should be able to detect these baryons. PMID:21321229

  19. Mini-clusters

    NASA Technical Reports Server (NTRS)

    Chinellato, J. A.; Dobrigkeit, C.; Bellandifilho, J.; Lattes, C. M. G.; Menon, M. J.; Navia, C. E.; Pamilaju, A.; Sawayanagi, K.; Shibuya, E. H.; Turtelli, A., Jr.

    1985-01-01

    Experimental results of mini-clusters observed in Chacaltaya emulsion chamber no.19 are summarized. The study was made on 54 single core shower upper and 91 shower clusters of E(gamma) 10 TeV from 30 families which are visible energy greater than 80 TeV and penetrate through both upper and lower detectors of the two-story chamber. The association of hadrons in mini-cluster is made clear from their penetrative nature and microscopic observation of shower continuation in lower chamber. Small P sub t (gamma) of hadrons in mini-clusters remained in puzzle.

  20. Reactions of intermetallic clusters

    NASA Astrophysics Data System (ADS)

    Farley, R. W.; Castleman, A. W., Jr.

    1990-02-01

    Reaction of bismuth-alkali clusters with closed-shell HX acids provides insight into the structures, formation, and stabilities of these intermetallic species. HC1 and HI are observed to quantitatively strip BixNay and BixKy, respectively, of their alkali component, leaving bare bismuth clusters as the only bismuth-containing species detected. Product bismuth clusters exhibit the same distribution observed when pure bismuth is evaporated in the source. Though evaporated simultaneously from the same crucible, this suggests alkali atoms condense onto existing bismuth clusters and have negligible effect on their formation and consequent distribution. The indistinguishibility of reacted and pure bismuth cluster distributions further argues against the simple replacement of alkali atoms with hydrogen in these reactions. This is considered further evidence that the alkali atoms are external to the stable bismuth Zintl anionic structures. Reactivities of BixNay clusters with HC1 are estimated to lie between 3×10-13 for Bi4Na, to greater than 4×10-11 for clusters possessing large numbers of alkali atoms. Bare bismuth clusters are observed in separate experiments to react significantly more slowly with rates of 1-9×10-14 and exhibit little variation of reactivity with size. The bismuth clusters may thus be considered a relatively inert substrate upon which the alkali overlayer reacts.

  1. Management of cluster headache.

    PubMed

    Tfelt-Hansen, Peer C; Jensen, Rigmor H

    2012-07-01

    The prevalence of cluster headache is 0.1% and cluster headache is often not diagnosed or misdiagnosed as migraine or sinusitis. In cluster headache there is often a considerable diagnostic delay - an average of 7 years in a population-based survey. Cluster headache is characterized by very severe or severe orbital or periorbital pain with a duration of 15-180 minutes. The cluster headache attacks are accompanied by characteristic associated unilateral symptoms such as tearing, nasal congestion and/or rhinorrhoea, eyelid oedema, miosis and/or ptosis. In addition, there is a sense of restlessness and agitation. Patients may have up to eight attacks per day. Episodic cluster headache (ECH) occurs in clusters of weeks to months duration, whereas chronic cluster headache (CCH) attacks occur for more than 1 year without remissions. Management of cluster headache is divided into acute attack treatment and prophylactic treatment. In ECH and CCH the attacks can be treated with oxygen (12 L/min) or subcutaneous sumatriptan 6 mg. For both oxygen and sumatriptan there are two randomized, placebo-controlled trials demonstrating efficacy. In both ECH and CCH, verapamil is the prophylactic drug of choice. Verapamil 360 mg/day was found to be superior to placebo in one clinical trial. In clinical practice, daily doses of 480-720 mg are mostly used. Thus, the dose of verapamil used in cluster headache treatment may be double the dose used in cardiology, and with the higher doses the PR interval should be checked with an ECG. At the start of a cluster, transitional preventive treatment such as corticosteroids or greater occipital nerve blockade can be given. In CCH and in long-standing clusters of ECH, lithium, methysergide, topiramate, valproic acid and ergotamine tartrate can be used as add-on prophylactic treatment. In drug-resistant CCH, neuromodulation with either occipital nerve stimulation or deep brain stimulation of the hypothalamus is an alternative treatment strategy

  2. The youngest globular clusters

    NASA Astrophysics Data System (ADS)

    Beck, Sara

    2015-11-01

    It is likely that all stars are born in clusters, but most clusters are not bound and disperse. None of the many protoclusters in our Galaxy are likely to develop into long-lived bound clusters. The super star clusters (SSCs) seen in starburst galaxies are more massive and compact and have better chances of survival. The birth and early development of SSCs takes place deep in molecular clouds, and during this crucial stage the embedded clusters are invisible to optical or UV observations but are studied via the radio-infrared supernebulae (RISN) they excite. We review observations of embedded clusters and identify RISN within 10 Mpc whose exciting clusters have ≈ 106 M⊙ or more in volumes of a few pc3 and which are likely to not only survive as bound clusters, but to evolve into objects as massive and compact as Galactic globulars. These clusters are distinguished by very high star formation efficiency η, at least a factor of 10 higher than the few percent seen in the Galaxy, probably due to the violent disturbances their host galaxies have undergone. We review recent observations of the kinematics of the ionized gas in RISN showing outflows through low-density channels in the ambient molecular cloud; this may protect the cloud from feedback by the embedded H II region.

  3. Clustering versus non-clustering phase synchronizations

    SciTech Connect

    Liu, Shuai; Zhan, Meng

    2014-03-15

    Clustering phase synchronization (CPS) is a common scenario to the global phase synchronization of coupled dynamical systems. In this work, a novel scenario, the non-clustering phase synchronization (NPS), is reported. It is found that coupled systems do not transit to the global synchronization until a certain sufficiently large coupling is attained, and there is no clustering prior to the global synchronization. To reveal the relationship between CPS and NPS, we further analyze the noise effect on coupled phase oscillators and find that the coupled oscillator system can change from CPS to NPS with the increase of noise intensity or system disorder. These findings are expected to shed light on the mechanism of various intriguing self-organized behaviors in coupled systems.

  4. Effect of self-propulsion on equilibrium clustering.

    PubMed

    Mani, Ethayaraja; Löwen, Hartmut

    2015-09-01

    In equilibrium, colloidal suspensions governed by short-range attractive and long-range repulsive interactions form thermodynamically stable clusters. Using Brownian dynamics computer simulations, we investigate how this equilibrium clustering is affected when such particles are self-propelled. We find that the clustering process is stable under self-propulsion. For the range of interaction parameters studied and at low particle density, the cluster size increases with the speed of self-propulsion (activity) and for higher activity the cluster size decreases, showing a nonmonotonic variation of cluster size with activity. This clustering behavior is distinct from the pure kinetic (or motility-induced) clustering of self-propelling particles which is observed at significantly higher activities and densities. We present an equilibrium model incorporating the effect of activity as activity-induced attraction and repulsion by imposing that the strength of these interactions depend on activity superlinearly. The model explains the cluster size dependence of activity obtained from simulations semiquantitatively. Our predictions are verifiable in experiments on interacting synthetic colloidal microswimmers.

  5. Effect of self-propulsion on equilibrium clustering.

    PubMed

    Mani, Ethayaraja; Löwen, Hartmut

    2015-09-01

    In equilibrium, colloidal suspensions governed by short-range attractive and long-range repulsive interactions form thermodynamically stable clusters. Using Brownian dynamics computer simulations, we investigate how this equilibrium clustering is affected when such particles are self-propelled. We find that the clustering process is stable under self-propulsion. For the range of interaction parameters studied and at low particle density, the cluster size increases with the speed of self-propulsion (activity) and for higher activity the cluster size decreases, showing a nonmonotonic variation of cluster size with activity. This clustering behavior is distinct from the pure kinetic (or motility-induced) clustering of self-propelling particles which is observed at significantly higher activities and densities. We present an equilibrium model incorporating the effect of activity as activity-induced attraction and repulsion by imposing that the strength of these interactions depend on activity superlinearly. The model explains the cluster size dependence of activity obtained from simulations semiquantitatively. Our predictions are verifiable in experiments on interacting synthetic colloidal microswimmers. PMID:26465467

  6. Effect of self-propulsion on equilibrium clustering

    NASA Astrophysics Data System (ADS)

    Mani, Ethayaraja; Löwen, Hartmut

    2015-09-01

    In equilibrium, colloidal suspensions governed by short-range attractive and long-range repulsive interactions form thermodynamically stable clusters. Using Brownian dynamics computer simulations, we investigate how this equilibrium clustering is affected when such particles are self-propelled. We find that the clustering process is stable under self-propulsion. For the range of interaction parameters studied and at low particle density, the cluster size increases with the speed of self-propulsion (activity) and for higher activity the cluster size decreases, showing a nonmonotonic variation of cluster size with activity. This clustering behavior is distinct from the pure kinetic (or motility-induced) clustering of self-propelling particles which is observed at significantly higher activities and densities. We present an equilibrium model incorporating the effect of activity as activity-induced attraction and repulsion by imposing that the strength of these interactions depend on activity superlinearly. The model explains the cluster size dependence of activity obtained from simulations semiquantitatively. Our predictions are verifiable in experiments on interacting synthetic colloidal microswimmers.

  7. Health coaching and pedometers to enhance physical activity and prevent falls in community-dwelling people aged 60 years and over: study protocol for the Coaching for Healthy AGEing (CHAnGE) cluster randomised controlled trial

    PubMed Central

    Tiedemann, Anne; Rissel, Chris; Howard, Kirsten; Tong, Allison; Merom, Dafna; Smith, Stuart; Wickham, James; Bauman, Adrian; Lord, Stephen R; Vogler, Constance; Lindley, Richard I; Simpson, Judy M; Allman-Farinelli, Margaret; Sherrington, Catherine

    2016-01-01

    Introduction Prevention of falls and promotion of physical activity are essential for maximising well-being in older age. However, there is evidence that promoting physical activity among older people without providing fall prevention advice may increase fall rates. This trial aims to establish the impact of a physical activity and fall prevention programme compared with a healthy eating programme on physical activity and falls among people aged 60+ years. Methods and analysis This cluster randomised controlled trial will involve 60 groups of community-dwelling people aged 60+ years. Participating groups will be randomised to: (1) a physical activity and fall prevention intervention (30 groups), involving written information, fall risk assessment and prevention advice, a pedometer-based physical activity tracker and telephone-based health coaching; or (2) a healthy eating intervention (30 groups) involving written information and telephone-based dietary coaching. Primary outcomes will be objectively measured physical activity at 12 months post-randomisation and self-reported falls throughout the 12-month trial period. Secondary outcomes include: the proportion of fallers, the proportion of people meeting the Australian physical activity guidelines, body mass index, eating habits, mobility goal attainment, mobility-related confidence, quality of life, fear of falling, risk-taking behaviour, mood, well-being, self-reported physical activity, disability, and health and community service use. The between-group difference in the number of falls per person-year will be analysed using negative binomial regression models. For the continuously scored primary and secondary outcome measures, linear regression adjusted for corresponding baseline scores will assess the effect of group allocation. Analyses will be preplanned, conducted while masked to group allocation, will take into account cluster randomisation, and will use an intention-to-treat approach. Ethics and

  8. A nonparametric clustering technique which estimates the number of clusters

    NASA Technical Reports Server (NTRS)

    Ramey, D. B.

    1983-01-01

    In applications of cluster analysis, one usually needs to determine the number of clusters, K, and the assignment of observations to each cluster. A clustering technique based on recursive application of a multivariate test of bimodality which automatically estimates both K and the cluster assignments is presented.

  9. “Pre-schoolers in the playground” an outdoor physical activity intervention for children aged 18 months to 4 years old: study protocol for a pilot cluster randomised controlled trial

    PubMed Central

    2013-01-01

    Background The pre-school years are considered critical for establishing healthy lifestyle behaviours such as physical activity. Levels of physical activity track through childhood into adulthood, thus establishing habitual physical activity early in life is vital. Time spent outdoors is associated with greater physical activity and playground interventions have been shown to increase physical activity in school aged children. There are few pre-school, playground-based interventions, and evaluations of these have found mixed results. A recent report published by the UK Chief Medical Officer (CMO) highlighted that new interventions to promote movement in the early years (0–5 years old) are needed. The aim of this study is to undertake a pilot cluster randomised controlled trial (RCT) of an outdoor playground-based physical activity intervention for parents and their children aged 18 months to 4 years old (“Pre-schoolers in the Playground”; PiP) and to assess the feasibility of conducting a full scale cluster RCT. The PiP intervention is grounded in behavioural theory (Social Cognitive Theory), and is in accordance with the CMO guidance for physical activity in the early years. It is informed by existing literature and data collected from focus groups with parents. Methods/Design One hundred and fifty pre-school children affiliated to 10 primary schools will be recruited. Schools will be randomised to either the PiP intervention arm or the control arm (usual practice). Children in the intervention arm will be invited to attend three 30 minute outdoor play sessions per week for 30 weeks (3 school terms) at the school. Feasibility will be assessed by examining recruitment rates, attendance, attrition, acceptability of the trial and of the PiP intervention to parents, fidelity of intervention implementation, capability and capacity for schools to deliver the intervention. Health outcomes and the feasibility of outcome measurement tools will be assessed. These

  10. Mixed-Initiative Clustering

    ERIC Educational Resources Information Center

    Huang, Yifen

    2010-01-01

    Mixed-initiative clustering is a task where a user and a machine work collaboratively to analyze a large set of documents. We hypothesize that a user and a machine can both learn better clustering models through enriched communication and interactive learning from each other. The first contribution or this thesis is providing a framework of…

  11. Cluster Interest Inventory.

    ERIC Educational Resources Information Center

    Herzog, Douglas

    The Cluster Interest Inventory is designed to familiarize students with representative occupations in 13 career clusters: (1) agribusiness and natural resources, (2) business marketing, and office occupations, (3) communications and media, (4) consumer and homemaker, (5) fine arts and humanities, (6) health, (7) manufacturing and processing, (8)…

  12. Matlab Cluster Ensemble Toolbox

    2009-04-27

    This is a Matlab toolbox for investigating the application of cluster ensembles to data classification, with the objective of improving the accuracy and/or speed of clustering. The toolbox divides the cluster ensemble problem into four areas, providing functionality for each. These include, (1) synthetic data generation, (2) clustering to generate individual data partitions and similarity matrices, (3) consensus function generation and final clustering to generate ensemble data partitioning, and (4) implementation of accuracy metrics. Withmore » regard to data generation, Gaussian data of arbitrary dimension can be generated. The kcenters algorithm can then be used to generate individual data partitions by either, (a) subsampling the data and clustering each subsample, or by (b) randomly initializing the algorithm and generating a clustering for each initialization. In either case an overall similarity matrix can be computed using a consensus function operating on the individual similarity matrices. A final clustering can be performed and performance metrics are provided for evaluation purposes.« less

  13. [Cluster headache differential diagnosis].

    PubMed

    Guégan-Massardier, Evelyne; Laubier, Cécile

    2015-11-01

    Cluster headache is characterized by disabling stereotyped headache. Early diagnosis allows appropriate treatment, unfortunately diagnostic errors are frequent. The main differential diagnoses are other primary or essential headaches. Migraine, more frequent and whose diagnosis is carried by excess, trigeminal neuralgia or other trigemino-autonomic cephalgia. Vascular or tumoral underlying condition can mimic cluster headache, neck and brain imaging is recommended, ideally MRI.

  14. Blue emitting undecaplatinum clusters

    NASA Astrophysics Data System (ADS)

    Chakraborty, Indranath; Bhuin, Radha Gobinda; Bhat, Shridevi; Pradeep, T.

    2014-07-01

    A blue luminescent 11-atom platinum cluster showing step-like optical features and the absence of plasmon absorption was synthesized. The cluster was purified using high performance liquid chromatography (HPLC). Electrospray ionization (ESI) and matrix assisted laser desorption ionization (MALDI) mass spectrometry (MS) suggest a composition, Pt11(BBS)8, which was confirmed by a range of other experimental tools. The cluster is highly stable and compatible with many organic solvents.A blue luminescent 11-atom platinum cluster showing step-like optical features and the absence of plasmon absorption was synthesized. The cluster was purified using high performance liquid chromatography (HPLC). Electrospray ionization (ESI) and matrix assisted laser desorption ionization (MALDI) mass spectrometry (MS) suggest a composition, Pt11(BBS)8, which was confirmed by a range of other experimental tools. The cluster is highly stable and compatible with many organic solvents. Electronic supplementary information (ESI) available: Details of experimental procedures, instrumentation, chromatogram of the crude cluster; SEM/EDAX, DLS, PXRD, TEM, FT-IR, and XPS of the isolated Pt11 cluster; UV/Vis, MALDI MS and SEM/EDAX of isolated 2 and 3; and 195Pt NMR of the K2PtCl6 standard. See DOI: 10.1039/c4nr02778g

  15. Muster: Massively Scalable Clustering

    2010-05-20

    Muster is a framework for scalable cluster analysis. It includes implementations of classic K-Medoids partitioning algorithms, as well as infrastructure for making these algorithms run scalably on very large systems. In particular, Muster contains algorithms such as CAPEK (described in reference 1) that are capable of clustering highly distributed data sets in-place on a hundred thousand or more processes.

  16. Illinois' Career Cluster Model

    ERIC Educational Resources Information Center

    Jankowski, Natasha A.; Kirby, Catherine L.; Bragg, Debra D.; Taylor, Jason L.; Oertle, Kathleen M.

    2009-01-01

    This booklet provides information to multiple stakeholders on the implementation of career clusters in Illinois. The booklet is an extension of the previous edition titled "An Introduction to Illinois CTE Programs of Study" (2008), and provides a resource for partners to understand Illinois' Career Cluster Model as its own adaptation of the…

  17. Brightest Cluster Galaxy Identification

    NASA Astrophysics Data System (ADS)

    Leisman, Luke; Haarsma, D. B.; Sebald, D. A.; ACCEPT Team

    2011-01-01

    Brightest cluster galaxies (BCGs) play an important role in several fields of astronomical research. The literature includes many different methods and criteria for identifying the BCG in the cluster, such as choosing the brightest galaxy, the galaxy nearest the X-ray peak, or the galaxy with the most extended profile. Here we examine a sample of 75 clusters from the Archive of Chandra Cluster Entropy Profile Tables (ACCEPT) and the Sloan Digital Sky Survey (SDSS), measuring masked magnitudes and profiles for BCG candidates in each cluster. We first identified galaxies by hand; in 15% of clusters at least one team member selected a different galaxy than the others.We also applied 6 other identification methods to the ACCEPT sample; in 30% of clusters at least one of these methods selected a different galaxy than the other methods. We then developed an algorithm that weighs brightness, profile, and proximity to the X-ray peak and centroid. This algorithm incorporates the advantages of by-hand identification (weighing multiple properties) and automated selection (repeatable and consistent). The BCG population chosen by the algorithm is more uniform in its properties than populations selected by other methods, particularly in the relation between absolute magnitude (a proxy for galaxy mass) and average gas temperature (a proxy for cluster mass). This work supported by a Barry M. Goldwater Scholarship and a Sid Jansma Summer Research Fellowship.

  18. Marketing Occupations. Cluster Guide.

    ERIC Educational Resources Information Center

    Oregon State Dept. of Education, Salem.

    This cluster guide, which is designed to show teachers what specific knowledge and skills qualify high school students for entry-level employment (or postsecondary training) in marketing occupations, is organized into three sections: (1) cluster organization and implementation, (2) instructional emphasis areas, and (3) assessment. The first…

  19. Probability and Cancer Clusters

    ERIC Educational Resources Information Center

    Hamilton-Keene, Rachael; Lenard, Christoper T.; Mills, Terry M.

    2009-01-01

    Recently there have been several news items about possible cancer clusters in the Australian media. The term "cancer cluster" is used when an unusually large number of people in one geographic area, often a workplace, are diagnosed with cancer in a short space of time. In this paper the authors explore this important health issue using probability…

  20. SUPERMODEL ANALYSIS OF GALAXY CLUSTERS

    SciTech Connect

    Fusco-Femiano, R.; Cavaliere, A.; Lapi, A.

    2009-11-01

    We present the analysis of the X-ray brightness and temperature profiles for six clusters belonging to both the Cool Core (CC) and Non Cool Core (NCC) classes, in terms of the Supermodel (SM) developed by Cavaliere et al. Based on the gravitational wells set by the dark matter (DM) halos, the SM straightforwardly expresses the equilibrium of the intracluster plasma (ICP) modulated by the entropy deposited at the boundary by standing shocks from gravitational accretion, and injected at the center by outgoing blast waves from mergers or from outbursts of active galactic nuclei. The cluster set analyzed here highlights not only how simply the SM represents the main dichotomy CC versus NCC clusters in terms of a few ICP parameters governing the radial entropy run, but also how accurately it fits even complex brightness and temperature profiles. For CC clusters like A2199 and A2597, the SM with a low level of central entropy straightforwardly yields the characteristic peaked profile of the temperature marked by a decline toward the center, without requiring currently strong radiative cooling and high mass deposition rates. NCC clusters like A1656 require instead a central entropy floor of a substantial level, and some like A2256 and even more A644 feature structured temperature profiles that also call for a definite floor extension; in such conditions the SM accurately fits the observations, and suggests that in these clusters the ICP has been just remolded by a merger event, in the way of a remnant cool core. The SM also predicts that DM halos with high concentration should correlate with flatter entropy profiles and steeper brightness in the outskirts; this is indeed the case with A1689, for which from X-rays we find concentration values c approx 10, the hallmark of an early halo formation. Thus, we show the SM to constitute a fast tool not only to provide wide libraries of accurate fits to X-ray temperature and density profiles, but also to retrieve from the ICP

  1. Early Hemostatic Responses to Trauma Identified Using Hierarchical Clustering Analysis

    PubMed Central

    White, N.J.; Contaifer, D.; Martin, E.J.; Newton, J.C.; Mohammed, B.M.; Bostic, J.L.; Br